text
stringlengths 0
7.84M
| meta
dict |
|---|---|
Pyramiding resistance-conferring gene sequences in crops.
Plant viruses can cause devastating diseases in many crops around the world. Genetic resistance and the adoption of resistant crop cultivars is the most desirable strategy to manage viruses. Single or multiple sources of resistance derived from host and/or virus gene sequences are used to develop resistant crop plants. Pyramiding sources of resistance is essential for achieving broad-spectrum and durable resistance and for protecting crops from commonly occurring mixed virus infections. Stacking resistance-conferring gene sequences into single crop cultivars is achieved by first, conventional breeding and the use of dominant and recessive host genes; second, genetic engineering and the deployment of virus-derived gene sequences or modified small plant RNAs for antiviral RNA interference defense, or of programmable nucleases to target viral gene sequences or to alter host factors that are critical to complete the virus infection cycle; and third, a combination of conventional breeding and genetic engineering. These strategies are successfully used to mitigate the effect of viruses. It is anticipated that the development of virus resistant crops carrying multiple resistance-conferring gene sequences will be further facilitated by progress at unraveling underpinnings of virus-host interactions, and at determining the sequence of more crop genomes.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Morbidity and mortality conference
Morbidity and mortality (M&M) conferences are traditional, recurring conferences held by medical services at academic medical centers, most large private medical and surgical practices, and other medical centers. Their use in psychiatric medicine is less evident. Death, deterioration and complications may be unavoidable in some patients due to underlying disease processes. However they may also be associated with errors or omissions in patient care. M&M conferences involve the analysis of adverse outcomes in patient care, through peer review. The objectives of a well-run M&M conference are to identify adverse outcomes associated with medical error, to modify behavior and judgment based on previous experiences, and to prevent repetition of errors leading to complications. Conferences are non-punitive and focus on the goal of improved patient care. The proceedings are generally kept confidential by law. M&M conferences occur with regular frequency, often weekly, biweekly or monthly, and highlight recent cases and identify areas of improvement for clinicians involved in the case. They are particularly important for identifying systems issues (e.g., outdated policies, changes in patient identification procedures, arithmetic errors, etc.) which affect patient care.
The results of a survey that endeavored to study the relevance and traits of morbidity and mortality conferences (M&MCs) in the spring of 1998 indicate that 90% of U.S. internal medicine training programs hold M&MCs. The majority of these conferences occur on a monthly basis, where an assigned leader reviews certain select cases that had unpredicted consequences or a suspected medical error. It was also reported that two-thirds of the hospitals use the M&MCs as a means to fulfill their administrative requirements for quality assurance.
History
Morbidity and Mortality conferences have long been part of the practice of medicine, having originated in the early 1900s with Ernest Codman at Massachusetts General Hospital in Boston. He lost his staff privileges there after suggesting the evaluating of surgeon competence. Codman's ideas contributed to the standardization of hospital practices — including a case report system that ascribed responsibility for adverse outcomes — by the American College of Surgeons in 1916. As the medical profession evolved, physicians grew accustomed to discussing their errors at mortality conferences, where autopsy findings were presented, and in published case reports. By 1983, the ACGME began requiring that accredited residency programs conduct a weekly review of all complications and deaths.
Methods
A Mortality Review Task Force reviews and selects cases to be presented at each M&MC conference. Cases selected include all deaths, significant patient injuries, and near-death situations. A core team of senior quality consultants prepares the selected cases for presentation, gathering and reviewing information that may have caused the case. Hospital physicians, residents, and staff are encouraged to attend the MM&I. During the MM&I meetings the leader reminds the participants of MM&I's confidentiality. Resident leaders present the cases and literature relating to the cases. Then the participants discuss and identify issues that may have led to the undesirable outcome. At the end of the conference, the leader reminds the participants of the MM&I's confidentiality once again and evaluates the conference.
References
External links
Carter, Laura Stephenson. Puzzling over medical mysteries
Category:Medical conferences
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Angular combining Http Get response with conditional http post
I am implementing a private message system in an app that uses angular 4. When a user clicks on a unread message in their inbox (that may make up one of multiple messages in a thread that also may be unread) all the messages should be returned in the thread but I also want to check to see if any of the messages are unread, and mark them as read as part of this method.
The call to get the messages looks as follows:
getMessageThread(id: number, recipientId: number) {
return this.authHttp.get(this.baseUrl + 'users/' + id + '/messages/' + recipientId)
.map(response => response.json())
.catch(this.handleError);
}
and in the component:
loadMessageThread() {
const currentUserId = +this.authService.decodedToken.nameid;
this.userService.getMessageThread(currentUserId, this.userId).subscribe(messages => {
this.messages = messages;
}, error => {
this.alertify.error(error);
});
}
I also have the following method in the service which should be called conditionally if any of the returned messages in the thread are marked as unread:
markAsRead(userId: number, messageId: number) {
return this.authHttp.post(this.baseUrl + 'users/' + userId + '/messages/' + messageId, {}).subscribe();
}
So far I have tried a few different options. If I try and call the user service from within the subscribe I get an error stating the user service is undefined:
loadMessageThread() {
const currentUserId = +this.authService.decodedToken.nameid;
this.userService.getMessageThread(currentUserId, this.userId)
.subscribe(messages => {
this.messages = messages;
_.each(this.messages, function(message) {
if (message.read === false && message.recipientId === currentUserId) {
console.log(message) // works
this.userService.markAsRead(currentUserId, message.id); // fails
}
});
}, error => {
this.alertify.error(error);
});
}
If I try using a 'do' method prior to the subscribe this also fails to call the method in the service and goes straight to the error condition without hitting the subscribe method:
loadMessageThread() {
const currentUserId = +this.authService.decodedToken.nameid;
this.userService.getMessageThread(currentUserId, this.userId)
.do(messages => {
_.each(messages, function (message: IMessage) {
if (message.read === false && message.recipientId === currentUserId) {
console.log(message) // works
this.userService.markAsRead(currentUserId, message.id); // fails
}
});
})
.subscribe(messages => {
this.messages = messages;
}, error => {
this.alertify.error(error);
});
}
I'm not sure if I am overthinking this and am missing a more obvious approach to this. Any help or suggestions would be appreciated.
Thanks, Neil
A:
_.each(this.messages, function (message) {
should be
_.each(this.messages, (message) => {
otherwise this will not refer to the component.
|
{
"pile_set_name": "StackExchange"
}
|
It is known that, in automotive applications, the rolling bearings, in particular those present in wheel hubs, and more in particular those forming the hub bearing unit of the aforesaid type, are continuously exposed, in use, to the contact with high quantities of contaminants: therefore, in such applications, the sealing assemblies used to protect the bearings (incorporated in the bearings themselves or, more frequently, belonging to the hub-bearing unit) in addition to the purpose of withholding the lubricant oil or grease within the bearing, above all have the purpose of preventing external contaminants from entering inside the wheel hub and/or the bearing.
Unfortunately, contaminants such as dust and mud, also if blocked by the sealing assembly, tend to blend with the grease lubricating the sealing lips and wear the latter off until they lose their entire sealing capacity. To overcome such drawback, the sealing assemblies known for the described applications present a main radial sealing lip and, more outwards, a dust lip for preserving the main lip from the contact with contaminants.
However, to avoid a rapid wear thereof, the anti-dust lips are usually designed so as to fit with the sealing surface on which the main lip cooperates by interference, with very low interference or even with minor clearance. In this way, however, the lubricant grease possibly placed between the two lips is easily lost outwards and the external contaminants, also if in minimum amount, may come into contact with the main sealing lip and cause consequent wear of the same.
A solution of the problem consists in shaping the anti-dust lip so as to “pump” the contaminants outwards. However, such solution is no longer satisfying in view of the longer life required by the members.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
With the Penny Arcade Expo's habit of selling out far in advance, fans eager to attend next year's PAX East should probably register as soon as humanly possible.
PAX East moves into its new digs at the Boston Convention & Exhibition Center this March, which means more room for fans to hobnob with games and their creators. The extra added space doesn't mean you should hold off on getting your registration filed now that it has officially opened. Judging by the overwhelming response to last year's PAX East, I'd daresay you'll want to put your $55 down immediately, if not sooner.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Python Selenium WebDriver how to add timeout to get(url) function
I am running a simple piece of code that downloads a website through proxy, however sometimes the proxy can be slow and this can cause the WebDriver .get(url) request to block indefinitely.
Is there a simple piece of Python code for WebDriver that will set a timeout for this function? Through searching I've only found techniques that work for java.
driver.get(url)
A:
For all the web cretents out there what I used to solve this problem was this. Selenium uses the socket library so I set a timeout on the socket module, this throws an error which we can use to send the escape key to the browser (which stops the page loading):
socket.setdefaulttimeout(2)
try:
driver.get(pageLink)
except socket.timeout:
#send ESCAPE key to browser
A:
Found this in the docs
selenium.webdriver.remote.webdriver.set_script_timeout(time_to_wait)
Set the amount of time that the script should wait before throwing an error.
time_to_wait: The amount of time to wait
Usage:
driver.set_script_timeout(30)
|
{
"pile_set_name": "StackExchange"
}
|
D
ACROSS THE BOARD OF
THREE OPTIONS THAT
REMAIN GET HOME ON A
VALUE PAY FOR
EIGHTEEN DOLLARS AND
THIRTY ONE CENT ITEM
NUMBER 6 8 2 4 3 4.
NOW THIS WATCH IS
OVER 50 PERCENT GONE
.IT'S MY HOST PICK
BECAUSE OF THAT
ABALONE DIAL. THE
DESIGN ON THIS WATCH
IS PHENOMENAL AND
THEN YOU GET CHOICES
.IT'S AN INVADER
RESERVE 56 WAR TEES
YOU'RE GETTING THE
SWISS COURTS AN
ABSOLUTELY DIAL AND
AN INTERCHANGEABLE
GENUINE LEATHER STRAP
THAT YOU CAN CHANGE
OUT WITHIN SECONDS 70
TWO PERCENT OFF
YOU'RE SAVING OVER
ALMOST FIVE HUNDRED
AND SIXTY DOLLARS ON
THE 40S NOW THIS IS
BEAUTIFUL. LET ME
SHOW YOU YOUR OPTIONS
YOU HAVE IT AVAILABLE
IN THE BLACK LOOK AT
THE COLORS IN THAT
ABALONE DIAL IT LOOKS
LIKE IT'S PLUGGED IN
THAT ABALONE DIAL
LOOKS ELECTRIC IN THE
BLACK AND THEN IF YOU
LIKE IT IN THAT
SILVER TONE YOU'RE
GONNA GET A LITTLE
BIT MORE SHINE BUT
HEADS UP THE SILVER
TONE IS MORE LIMITED
.THIS IS THE STRAP
GEN YOU IN LEATHER
STRAP THAT YOU CAN
CHANGE AND RIGHT IS
GONNA SHOW US HOW TO
DO THAT. IT IS YOURS
FOR 2 0 9. FORTY FOUR
IS NUMBER 6 7 9 4 8 9
IS THE ITEM NUMBER
THIRTY FOUR NINETY
ONE WE'LL GET IT HOME
ON A VALUE. HEY RYAN
TELL ME ABOUT THE 40S
SO THE 40S IS ONE OF
OUR COLLECTIONS THAT
WE JUST REALLY
HAVEN'T HAD MUCH OF
IT UP UNTIL WE CAME
OUT WITH THIS DESIGN
HERE NOT TOO LONG AGO
AND JUST HAD ONE
PRESENTATION THAT'S A
PART OF IT. SO IT'S
THIS IT'S A BIT OF
THIS WHAT WE'VE
FRITSCH IS THAT TO NO
SHAPE IT'S A LITTLE
BIT MORE AGGRESSIVE
OF HOW IT BOWS OUT AT
THE 9 AND ALSO THE
THREE O'CLOCK
POSITION FOR THE TIME
PIECE. BUT HERE'S THE
THING THIS IS THIS IS
WHAT'S JUST MARVELOUS
.I MEAN I LOVE ALSO
IS JUST MENTIONED THE
ABALONE SHELL THIS
NATURAL ORGANIC
MATERIAL THAT'S
DERIVED FROM THE SEA
MOLLUSK YOU'LL BE
ABLE TO SEE THE
CURVED CRYSTAL THAT'S
A PART OF THIS WATCH
TOO. SO IT IS THAT
CURVED FLAME FUSION
CRYSTALS THAT'S VERY
EXPENSIVE FOR US TO
BE ABLE TO CREATE AND
THEN LOOK AT WHAT
HAPPENS. SO I CAN
CHANGE OUT FROM THIS
BRACELET WHERE IT HAS
A POLYURETHANE CENTER
LINKS BY PRESSING TWO
BUTTONS ON EACH SIDE
ON THE OUTSIDE OF THE
LUG SYSTEM. SO WHEN I
PRESSED THIS
SIMULTANEOUSLY IT
WILL THEN JUST SIMPLY
REMOVE PUSH THAT THAT
THE PIN IN AND
RELEASE EVERYTHING.
NOW THERE IS A
GUIDING SYSTEM.
THERE'S A LITTLE
CHANNEL SYSTEM WHERE
I CAN THEN TAKE THE
GENUINE LEATHER STRAP
.I'M JUST TRYING TO
DO THIS FOR SAKE VIA
TELEVISION HERE AND
JUST GET EVERYTHING
LINED UP. I MIGHT BE
ABLE I MIGHT HAVE TO
JUST TAKE IT OUT OF
THE SHOT AND DO IT
BUT AND THEN
EVERYTHING WILL THERE
GOES JUST LINES IN
AND IT LOOKS IT
CLICKS IN JUST
PERFECTLY THERE. AND
LOOK AT THIS ONE
OTHER THING IS IN THE
BACK IT'S GENUINE
CALF LEATHER SO
THAT'S A BIG UPGRADE
IN OF ITSELF GENUINE
ITALIAN GENUINE CALF
LEATHER IS WHAT YOU
RECEIVE THAT'S GOING
TO WRAP AROUND THE
WRIST THIS WATCH. SO
THE BEAUTY YOU GET
THE BEAUTY OF THE
CASE BUT THEN YOU
HAVE THE DESIGN AND
THE DIFFERENT FEEL
AND THE DIFFERENT
LOOK OF INTERCHANGING
OUT FROM THE GENUINE
LEATHER STRAP TO THE
BRACELET FOR THIS
PIECE AND THAT
LEATHER STRAP.
CROCKER BOSS THERE'S
CONTRAST STITCHING
GENUINE CALF LEATHER
CHANGES THE LOOK. SO
YOU'RE GETTING ALMOST
ONE WATCH BUT THE
LOOK OF TWO MUST BUY
IT 2 0 9 FORTY FOUR
THAT'S SEVENTY TWO
PERCENT OVER 50
PERCENT SOLD THROUGH
.SO IF YOU'RE LOVING
WHAT YOU'RE SEEING
AND I HAVE TO TELL
YOU I'M LOOKING AT
THAT ABALONE DIAL THE
WAY THAT IT CATCHES
THE LIGHT I SEE RED
PURPLE, BLUE, YELLOW
,THE GREENS IT'S
ABSOLUTELY
MESMERIZING WHEN YOU
LOOK AT THAT ABALONE
DIAL UP CLOSE AND
PERSONAL, THE SHAPE
OF THIS WATCH IS
EXCEPTIONAL. IT'S
ALMOST A 707 DOLLAR
WATCH THAT YOU CAN
GET HOME AND THE LOOK
OF TWO DIFFERENT
WATCHES FOR UNDER
THIRTY FIVE DOLLARS
SCOOP IT UP ON A
VALUE PAY, GET IT
HOME, TRY IT OUT,
CHANGE OUT THE STRAPS
.OH YOU LOVE IT IF
FOR SOME REASON
YOU'RE NOT IN LOVE.
WE HAVE A 30 DAY
MONEY BACK GUARANTEE
THE VALUE PAY ON THIS
IS PHENOMENAL UNDER
THIRTY FIVE DOLLARS.
HERE'S THAT NUMBER 6
7 9 4 8 9 YOU'RE
GOING TO SEE THIS
ABALONE IN THE
SUNLIGHT. WHA
|
{
"pile_set_name": "YoutubeSubtitles"
}
|
If NASA faked the moon landings, does the agency have any credibility at all? Was the Space Shuttle program also a hoax? Is the International Space Station another one? Do not dismiss these hypotheses offhand. Check out our wider NASA research and make up your own mind about it all.
There used to be a fellow poster on another forum who was always writing these fantastic threads about NASA fakery.
In particular, about how the satellites that NASA claims to launch, are as fake as the shuttle missions.A couple things to consider, one the ones that NASA claims are placed in the exosphere via missiles are subject to an array of various solar radiations that would interrupt and interfere with transmission of signals to the point of negating their being useful at all. Not to mention they never bother to explain how or where the fuel is stored for decades to do the necessary almost constant corrections to keep up with the Earth's transit around the Sun. They are not attached in any meaningful way according to NASA to Earth's gravitational field.
Then the one's that would be supposedly geosynchronous at 300 to 500 miles up, have the same problem of needing constant corrections to keep it from merely falling to Earth because of having to fight the gravitational forces.
In essence, we are still using old-fashioned ground radio waves to send and receive signals off the ionosphere. I tested this myself by calling a tech support group for a national cable system and asking them some pointed questions, which after passing me around to several guys, never could give me answers to my questions. Basically, I was asking if 'rabbit ears' and antennae still work, and if so why? I said, on the one hand you are telling me your signal has to travel out to a relay satellite a thousand miles up. How does the signal "know" that it doesn't have to just bounce off the ionosphere anymore? Or how does it know that some of it needs to bounce off the ionosphere and part of it still needs to hit a relay a thousand miles out? They were stumped.
I finally got one to admit what the box is REALLY for. It has a broader frequency band so that it can hit 300 points on the range instead of 13 that comes standard with your TV. The satellite is a scam. If you will notice almost nobody's "dish" is pointing up into space but outward to receive a slanted signal at a much lower altitude.
Unleashed wrote:The satellite is a scam. If you will notice almost nobody's "dish" is pointing up into space but outward to receive a slanted signal at a much lower altitude.
The slant of the dish should change according to latitude. Two italian cities like Milan and Rome, for example, that are at different latitudes but roughly the same longitude, should have dishes pointing roughly in the same direction, but in Rome they should point slightly upward (assuming the satellites travel around the equator).
Assuming the dish has to be pointed right at the general area where the signal comes from (the satellite orbit around the equator, for example, or an antenna on the ground, like you seem to imply) : for low that a dish can be slanted, there is no way it is pointing at anything else but the sky. Even the slightest pointing up would require an incredibly high tower to emit the signal just a few kilometers away, no? Where are these high towers? Have you ever seen any? Also: How can satellites phones work, say in the middle of oceans? How come satellite TV can be watched on cruise ships, or in the middle of deserted, faraway areas? etc.
Unleashed wrote:The satellite is a scam. If you will notice almost nobody's "dish" is pointing up into space but outward to receive a slanted signal at a much lower altitude.
If we still can rely on basic knowledge such as the earth is a sphere and has gravity which will get weaker the farther you go away from it - satellites are indeed quite possible Some pictures here cause doubts though.
TV satellites are almost exclusively in geostationary orbit (i.e. above the eqator).Thats one reason they are more difficult to receive the more north or south you go - far north or south comparativly larger dishes are needed to get a good enough signal.Dishes in coutries not close to the equator are offset designs - they seem not to point directly at the satelite, but they do (parabolic shape, reflection, focal point).Some advantages are: easier to mount, less space used, dish will not be filled with water or snow or dirt.
Unleashed wrote:The satellite is a scam. If you will notice almost nobody's "dish" is pointing up into space but outward to receive a slanted signal at a much lower altitude.
The slant of the dish should change according to latitude. Two italian cities like Milan and Rome, for example, that are at different latitudes but roughly the same longitude, should have dishes pointing roughly in the same direction, but in Rome they should point slightly upward (assuming the satellites travel around the equator).
Assuming the dish has to be pointed right at the general area where the signal comes from (the satellite orbit around the equator, for example, or an antenna on the ground, like you seem to imply) : for low that a dish can be slanted, there is no way it is pointing at anything else but the sky. Even the slightest pointing up would require an incredibly high tower to emit the signal just a few kilometers away, no? Where are these high towers? Have you ever seen any? Also: How can satellites phones work, say in the middle of oceans? How come satellite TV can be watched on cruise ships, or in the middle of deserted, faraway areas? etc.
I asked about that, too. He told me there would have to be an uplink/downlink satellite somewhere in my area that is 300 ft. wide. I started laughing.
Nobody has improved on Marconi. Have you read "Thunderstruck" by Erik Larson? That work involved detailing Marconi's efforts to link ships to radio. If TV had been invented then, you could have watched TV in your stateroom as early as the mid-1900's. The story of Dr. Crippen would have been the first murder mystery real time show on the small screen!
The signal for phones is still bouncing off the ionosphere. The great improvement seems to be that research has shown that parabolic antennas receive and send radio waves more efficiently. The difference in the cellphone towers is that Marconi's research showed that according to the height of an antenna has everything to do with the angle at which the signal strikes the ionosphere. That way the two do not interfere with each other. Neither modern invention requires satellites.
If you notice, the first thing Jim Cantore tells you is that they are still sending planes up to take pictures and measure the eye. So the photos seen today are pretty much just like the ones our parents saw in the 1960's onward. They aren't coming from a satellite orbiting the Earth.
After thinking about this I have tried to see if it bears out in other scenarios. There was a professor who was relating the floating mass of garbage bigger than the size of Texas in the Pacific ocean.It seems that he is frustrated because their funding does not cover the cost of planes to fly over it at a required altitude in order to photograph the Pacific Garbage Patch fully. So he ends up taking pictures from the edges in a boat and "guesstimating" it's size. I said aloud to myself. Wow, too bad we don't have things like satellites to photograph them!
Unleashed wrote:The satellite is a scam. If you will notice almost nobody's "dish" is pointing up into space but outward to receive a slanted signal at a much lower altitude.
If we still can rely on basic knowledge such as the earth is a sphere and has gravity which will get weaker the farther you go away from it - satellites are indeed quite possible Some pictures here cause doubts though.
TV satellites are almost exclusively in geostationary orbit (i.e. above the eqator).Thats one reason they are more difficult to receive the more north or south you go - far north or south comparativly larger dishes are needed to get a good enough signal.Dishes in coutries not close to the equator are offset designs - they seem not to point directly at the satelite, but they do (parabolic shape, reflection, focal point).Some advantages are: easier to mount, less space used, dish will not be filled with water or snow or dirt.
According to NASA who is enamoured with the number 17,000, that is how many satellites they tell us are in orbit now. Nevermind that there is nowhere close to that number of shuttle missions or launches by US rockets and other countries claim to have sent!However weak the gravitational field is suspected to be there is still a set amount of decay rate that causes a satellite to "fall" around the Earth with each rotation. This must be overcome. Where are the engines and fuel tanks on a satellite that correct these movements to keep them aloft for a decade or more? The vomit comet can not remain aloft for days on end for training. Just a short trip. Then it must land under it's own power even though it is at the breach of weightlessness, it can't sustain it.
Conversely, if a satellite has achieved "weightlessness", then it is tasked with keeping up under it's own power the trek of the Earth's forward rotation around the Sun.
Well in space these speeds are no problem. There's nothing that could stop you from gaining speed, except gravity from other objects (e.g planets) or some small particles cruising around there, but you can ignore these
GPS and weather forcecasting by the way wouldn't work if there were no satelites staying on the exact same place
However weak the gravitational field is suspected to be there is still a set amount of decay rate that causes a satellite to "fall" around the Earth with each rotation. This must be overcome.
That's wrong. How then could the moon circulate around the earth without "falling"? There is some certain rate of speed, due to the lack of my scientific english skills I dont know it's name, that keeps you in the exact same position when circulating around a given object.
Where are the engines and fuel tanks on a satellite that correct these movements to keep them aloft for a decade or more?
i don't know how to build a satelite but a plausible reason why there are no engines at the satelites is, that they cut it of as soon as the satelite is in position.
Well in space these speeds are no problem. There's nothing that could stop you from gaining speed, except gravity from other objects (e.g planets) or some small particles cruising around there, but you can ignore these
GPS and weather forcecasting by the way wouldn't work if there were no satelites staying on the exact same place
They have doppler radar which is the predominant weather forecasting tool.Just like everything else, your GPS is emiting a signal that bounces off the ionosphere. It is tracking your "position" in the same way that subs are tracked. By the ping.
However weak the gravitational field is suspected to be there is still a set amount of decay rate that causes a satellite to "fall" around the Earth with each rotation. This must be overcome.
If it is below the point of "weightlessness" or the gravitation field exertion. Once it is farther out, then you have keep it tethered by means of reaching speed to "keep up". Do you follow?
That's wrong. How then could the moon circulate around the earth without "falling"? There is some certain rate of speed, due to the lack of my scientific english skills I dont know it's name, that keeps you in the exact same position when circulating around a given object.
Geostationary? Centrifugal Force? The Moon exerts it's own gravitational field so strong it can affect tides on the Earth. Satellites do not. The Moon does not circulate around the Earth. The Earth spins on it's axis.
Where are the engines and fuel tanks on a satellite that correct these movements to keep them aloft for a decade or more?
i don't know how to build a satelite but a plausible reason why there are no engines at the satelites is, that they cut it of as soon as the satelite is in position.
And yet NASA claims that these booster rockets are necessary to correct the decay rate if within our atmosphere. Or are lost due to drift when outside it. Just like a satellite will be lost due to drift immediately unless it has it's own power to keep up.
Last edited by Unleashed on August 27th, 2011, 12:18 pm, edited 1 time in total.
anon1911 wrote:Well in space these speeds are no problem. There's nothing that could stop you from gaining speed, except gravity from other objects (e.g planets) or some small particles cruising around there, but you can ignore these
GPS and weather forcecasting by the way wouldn't work if there were no satelites staying on the exact same place
...that keeps you in the exact same position when circulating around a given object.
i don't know how to build a satelite but a plausible reason why there are no engines at the satelites is, that they cut it of as soon as the satelite is in position.
ok, heres the rocket-science what keeps this 'Irene-tracking' sat in constant fixed position ?how does it stay 'fixed', what regulates its relative & higher spin speed ?what optimises its gravity/anti-gravity equilibrium?
Funny or should I say sadly, NASA never bothered to take a photo of this weather satellite, and the NWS doesn't have a picture of it hanging on the wall of their headquarters either. Even though they claim they are so dependent on it for vital info. You have to satisfy yourself that it looks like the cartoon imagery featured here, no doubt.
Look at the antenna that they claim is receiving the radio signal from the satellite! Wow, it looks remarkably like your old aerial antenna you watched TV with!And someone had the presence of mind to take a photograph of it. Hahahahaha.hmmmm.
@UnleashedNot trying to argue or to convince you of the correctness of my education.
It just so happens that I have not yet found reason to throw away everything I learnt about physics - to the contrary, I can and do verify it every day.
The 3 Newtonian laws - one of which is also known as the conservation of momentum - explain to me without a doubt that a body such as a satellite will not slow down when it does not meet resistance.Since there is almost no resistance because of almost no air up there, it is only a matter of the right speed and hight.Earths gravity pulls the satellite down - the satellites speed provides for the opposite outward force.The net result of forces is: the satellite does not fall.(well, it does: that is the centripetal forcethe equal but opposite centrifugal force comes from its angular speed)
Geosync and geostationary orbits are special cases - the distance from earth and speed making those satellites appear to stay at a fixed point (geostationary) or to move along a meridian appearing to go up and down periodically.
Since there is always a little resistance causing the satellites to slow down gradually over time, some propulsion is needed.One means is e.g. ion-trusters - they are small and also do not look like the rockets used to shoot the whole thing up from earth.They do not provide huge forces, but such are not needed - ony small attitude corrections and compensation for the very small drag. In turn they do not use much fuel (mostly xenon).Large force applied a short time and small force applied a long time will achieve the same result. No fuel burning rockets needed.
As for GPS: this is passiveEach satellite sends out its position and the exact time.The device just receives the signal from a few satellites and computes its location.
The moon not circulating around earth:Earth spins and the moon circulates - both, not one or the other.We have the phases of the moon because of it circulating the earth.Its rising and setting becaus earth spins.The name month comes from how long it takes the moon to do one full circle.
But that is just my reality - you may have yours.Communication is rather difficult with such diverging viewpoints
There are indeed some interesting theories which amount to the earth in center of universe and everything else revolving around it on some number of shells.Basically variants of the old view before Newton and Galileo.The sun on one shell, the moon on another, the planets each on its own, dito for the stars.No gravitation needed.But even in these, satellites are possible - such theories have the advantage that indeed no fuel would be needed once a satellite is up
Jonathan wrote:@UnleashedNot trying to argue or to convince you of the correctness of my education.
It just so happens that I have not yet found reason to throw away everything I learnt about physics - to the contrary, I can and do verify it every day.
The 3 Newtonian laws - one of which is also known as the conservation of momentum - explain to me without a doubt that a body such as a satellite will not slow down when it does not meet resistance.Since there is almost no resistance because of almost no air up there, it is only a matter of the right speed and hight.Earths gravity pulls the satellite down - the satellites speed provides for the opposite outward force.The net result of forces is: the satellite does not fall.(well, it does: that is the centripetal forcethe equal but opposite centrifugal force comes from its angular speed)
Geosync and geostationary orbits are special cases - the distance from earth and speed making those satellites appear to stay at a fixed point (geostationary) or to move along a meridian appearing to go up and down periodically.
Since there is always a little resistance causing the satellites to slow down gradually over time, some propulsion is needed.One means is e.g. ion-trusters - they are small and also do not look like the rockets used to shoot the whole thing up from earth.They do not provide huge forces, but such are not needed - ony small attitude corrections and compensation for the very small drag. In turn they do not use much fuel (mostly xenon).Large force applied a short time and small force applied a long time will achieve the same result. No fuel burning rockets needed.
As for GPS: this is passiveEach satellite sends out its position and the exact time.The device just receives the signal from a few satellites and computes its location.
The moon not circulating around earth:Earth spins and the moon circulates - both, not one or the other.We have the phases of the moon because of it circulating the earth.Its rising and setting becaus earth spins.The name month comes from how long it takes the moon to do one full circle.
But that is just my reality - you may have yours.Communication is rather difficult with such diverging viewpoints
There are indeed some interesting theories which amount to the earth in center of universe and everything else revolving around it on some number of shells.Basically variants of the old view before Newton and Galileo.The sun on one shell, the moon on another, the planets each on its own, dito for the stars.No gravitation needed.But even in these, satellites are possible - such theories have the advantage that indeed no fuel would be needed once a satellite is up
Thank you for your interest in my post.You know it always looks so good on paper!
Now here is what I'd like for you to do. Let's suppose that NASA wanted to launch a rocket with a satellite as payload. And further suppose they want it parked in 23,000 mile geostationary orbit.
Please tell the class how the satellites unfold and launch from the payload bay in the nosecone of the rocket. What happens to the rocket afterward? A nice photo of the satellite on the ground.How they get around gamma and solar radiation interference of the signal to and from 23,000 miles up? And what advantages this system holds over simply bouncing the radio transmission off the ionosphere ^^^^^^^ in this relay manner? Thanks just awfully much.
Unleashed wrote:Thank you for your interest in my post.You know it always looks so good on paper!
Now here is what I'd like for you to do. Let's suppose that NASA wanted to launch a rocket with a satellite as payload. And further suppose they want it parked in 23,000 mile geostationary orbit.
Please tell the class how the satellites unfold and launch from the payload bay in the nosecone of the rocket. What happens to the rocket afterward? A nice photo of the satellite on the ground.How they get around gamma and solar radiation interference of the signal to and from 23,000 miles up? And what advantages this system holds over simply bouncing the radio transmission off the ionosphere ^^^^^^^ in this relay manner? Thanks just awfully much.
Unleashed
You presented your view, I presented mine - and some reasons along with it.
It appears that I have stepped on your toes - sorry about that!
Caveat: I'm not sure I understood all of what you said the way you intended (e.g. the part with the photo) - I'm pretty good at english but sometimes not that good.
How would it help if I reiterated something I read about how satellites are deployed, as I have never engineered such things obviously.It sounds reasonable that "the rocket" has some fuel to do a de-orbiting deceleration after deployment of the payload. Does not need to be much - it will slowly but steadyly fall and eventually...you know.But I also read another reasonable sounding thing about a graveyard orbit a little lower than i.e. GEO because just letting the waste drop down will present danger to other lower satellites.
On the radiation:I don't know - do you?I think even the far out GEO is within the magnetosphere enough to be protected by it.
A travel to the moon is a different thing.
Advantages?e.g. positioning of an highly directional antenna such as a dish - with reflection at the ionosphere the dishes would need to be constantly adjusted because the point of reflection (height) changes during a day.They would not need to point exactly to a point located 36.000 km above the equator.Also the frequencies with which this bouncing off is possible are in the short wave band only(?).Also possible with the much higher frequencies actually used for TV for example?
I have no interest in disproving you as I said above.
There is a nice "app" for any smartphone and the data are available via internet too.Its called Iridium Flares - and it predicts where and when you can see such a thing.That would only work if it is really there, no?
Unleashed wrote:Thank you for your interest in my post.You know it always looks so good on paper!
Now here is what I'd like for you to do. Let's suppose that NASA wanted to launch a rocket with a satellite as payload. And further suppose they want it parked in 23,000 mile geostationary orbit.
Please tell the class how the satellites unfold and launch from the payload bay in the nosecone of the rocket. What happens to the rocket afterward? A nice photo of the satellite on the ground.How they get around gamma and solar radiation interference of the signal to and from 23,000 miles up? And what advantages this system holds over simply bouncing the radio transmission off the ionosphere ^^^^^^^ in this relay manner? Thanks just awfully much.
Unleashed
You presented your view, I presented mine - and some reasons along with it.
It appears that I have stepped on your toes - sorry about that!
Caveat: I'm not sure I understood all of what you said the way you intended (e.g. the part with the photo) - I'm pretty good at english but sometimes not that good.
How would it help if I reiterated something I read about how satellites are deployed, as I have never engineered such things obviously.It sounds reasonable that "the rocket" has some fuel to do a de-orbiting deceleration after deployment of the payload. Does not need to be much - it will slowly but steadyly fall and eventually...you know.But I also read another reasonable sounding thing about a graveyard orbit a little lower than i.e. GEO because just letting the waste drop down will present danger to other lower satellites.
On the radiation:I don't know - do you?I think even the far out GEO is within the magnetosphere enough to be protected by it.
A travel to the moon is a different thing.
Advantages?e.g. positioning of an highly directional antenna such as a dish - with reflection at the ionosphere the dishes would need to be constantly adjusted because the point of reflection (height) changes during a day.They would not need to point exactly to a point located 36.000 km above the equator.Also the frequencies with which this bouncing off is possible are in the short wave band only(?).Also possible with the much higher frequencies actually used for TV for example?
I have no interest in disproving you as I said above.
There is a nice "app" for any smartphone and the data are available via internet too.Its called Iridium Flares - and it predicts where and when you can see such a thing.That would only work if it is really there, no?
All the best!
Yes, people actually watched television without the use of a satellite. Just with antenna like is shown and supposedly receives weather data from a satellite. Did you see the link a couple pages ago?
I am disappointed you didn't find any pics of satellites you cared to share. They are rare, when NASA mostly favors animated drawings. Oh well.
So there are 17,000 sats and 10-12,000 more, who knows, decelerating rockets, in NEO? I found this website detailing 'photos' of iridium flares. Interesting. I confess to have never seen any of these flares. Though some did not seem to comport with being 33,000 miles up. While others....?http://www.astroverde.org/iridium_flares.htm
But, to be honest, I would just like to see photos of all the de-orbiting rockets!
Here are some related websites I found interesting. No, of course they don't include a photo of a satellite, except Sputnik. :/ And mentions that Earth's rotational speed is 894 mph (at Kennedy).
I couldn't match the photo here with their explanation of how excellerating with booster rockets after launching the sat occurs and if it did, why it wouldn't just barrel over the satellite.
I already related a conversation I had with a "tech support" guys who had no knowledge of any satellites, but did allow as how what you are paying for is the rental on a receiver for a converter box that allows for 300 channels vs. standard 13.
To say you were not trying to disprove me is a tad disingenuous. But, be that as it may, we will just have to agree to disagree.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
parseFloat to display with comma
Is there a way to use the below JavaScript code to use comma's? For example the var num = 1924.00 Is there way to get it to display as 1,924.00?
var num = parseFloat(totalAmount).toFixed(2);
A:
You could use a specific regex like this one in the function below:
function format_currency( value ) {
return value.toString().replace(/\B(?=(\d{3})+(?!\d))/g, ",");
}
If you want to use it in conjuction with the .toFixed(), just do like this:
format_currency( 1245.3.toFixed(2) );
Hope it helps.
|
{
"pile_set_name": "StackExchange"
}
|
/*
* MPC823 and PXA LCD Controller
*
* Modeled after video interface by Paolo Scaffardi
*
*
* (C) Copyright 2001
* Wolfgang Denk, DENX Software Engineering, [email protected].
*
* SPDX-License-Identifier: GPL-2.0+
*/
#ifndef _LCD_H_
#define _LCD_H_
extern char lcd_is_enabled;
extern int lcd_line_length;
extern struct vidinfo panel_info;
void lcd_ctrl_init(void *lcdbase);
void lcd_enable(void);
/* setcolreg used in 8bpp/16bpp; initcolregs used in monochrome */
void lcd_setcolreg(ushort regno, ushort red, ushort green, ushort blue);
void lcd_initcolregs(void);
int lcd_getfgcolor(void);
/* gunzip_bmp used if CONFIG_VIDEO_BMP_GZIP */
struct bmp_image *gunzip_bmp(unsigned long addr, unsigned long *lenp,
void **alloc_addr);
int bmp_display(ulong addr, int x, int y);
/**
* Set whether we need to flush the dcache when changing the LCD image. This
* defaults to off.
*
* @param flush non-zero to flush cache after update, 0 to skip
*/
void lcd_set_flush_dcache(int flush);
#if defined CONFIG_MPC823
/*
* LCD controller stucture for MPC823 CPU
*/
typedef struct vidinfo {
ushort vl_col; /* Number of columns (i.e. 640) */
ushort vl_row; /* Number of rows (i.e. 480) */
ushort vl_width; /* Width of display area in millimeters */
ushort vl_height; /* Height of display area in millimeters */
/* LCD configuration register */
u_char vl_clkp; /* Clock polarity */
u_char vl_oep; /* Output Enable polarity */
u_char vl_hsp; /* Horizontal Sync polarity */
u_char vl_vsp; /* Vertical Sync polarity */
u_char vl_dp; /* Data polarity */
u_char vl_bpix; /* Bits per pixel, 0 = 1, 1 = 2, 2 = 4, 3 = 8 */
u_char vl_lbw; /* LCD Bus width, 0 = 4, 1 = 8 */
u_char vl_splt; /* Split display, 0 = single-scan, 1 = dual-scan */
u_char vl_clor; /* Color, 0 = mono, 1 = color */
u_char vl_tft; /* 0 = passive, 1 = TFT */
/* Horizontal control register. Timing from data sheet */
ushort vl_wbl; /* Wait between lines */
/* Vertical control register */
u_char vl_vpw; /* Vertical sync pulse width */
u_char vl_lcdac; /* LCD AC timing */
u_char vl_wbf; /* Wait between frames */
} vidinfo_t;
#elif defined(CONFIG_CPU_PXA25X) || defined(CONFIG_CPU_PXA27X) || \
defined CONFIG_CPU_MONAHANS
/*
* PXA LCD DMA descriptor
*/
struct pxafb_dma_descriptor {
u_long fdadr; /* Frame descriptor address register */
u_long fsadr; /* Frame source address register */
u_long fidr; /* Frame ID register */
u_long ldcmd; /* Command register */
};
/*
* PXA LCD info
*/
struct pxafb_info {
/* Misc registers */
u_long reg_lccr3;
u_long reg_lccr2;
u_long reg_lccr1;
u_long reg_lccr0;
u_long fdadr0;
u_long fdadr1;
/* DMA descriptors */
struct pxafb_dma_descriptor * dmadesc_fblow;
struct pxafb_dma_descriptor * dmadesc_fbhigh;
struct pxafb_dma_descriptor * dmadesc_palette;
u_long screen; /* physical address of frame buffer */
u_long palette; /* physical address of palette memory */
u_int palette_size;
};
/*
* LCD controller stucture for PXA CPU
*/
typedef struct vidinfo {
ushort vl_col; /* Number of columns (i.e. 640) */
ushort vl_row; /* Number of rows (i.e. 480) */
ushort vl_width; /* Width of display area in millimeters */
ushort vl_height; /* Height of display area in millimeters */
/* LCD configuration register */
u_char vl_clkp; /* Clock polarity */
u_char vl_oep; /* Output Enable polarity */
u_char vl_hsp; /* Horizontal Sync polarity */
u_char vl_vsp; /* Vertical Sync polarity */
u_char vl_dp; /* Data polarity */
u_char vl_bpix; /* Bits per pixel, 0 = 1, 1 = 2, 2 = 4, 3 = 8, 4 = 16 */
u_char vl_lbw; /* LCD Bus width, 0 = 4, 1 = 8 */
u_char vl_splt; /* Split display, 0 = single-scan, 1 = dual-scan */
u_char vl_clor; /* Color, 0 = mono, 1 = color */
u_char vl_tft; /* 0 = passive, 1 = TFT */
/* Horizontal control register. Timing from data sheet */
ushort vl_hpw; /* Horz sync pulse width */
u_char vl_blw; /* Wait before of line */
u_char vl_elw; /* Wait end of line */
/* Vertical control register. */
u_char vl_vpw; /* Vertical sync pulse width */
u_char vl_bfw; /* Wait before of frame */
u_char vl_efw; /* Wait end of frame */
/* PXA LCD controller params */
struct pxafb_info pxa;
} vidinfo_t;
#elif defined(CONFIG_ATMEL_LCD) || defined(CONFIG_ATMEL_HLCD)
typedef struct vidinfo {
ushort vl_col; /* Number of columns (i.e. 640) */
ushort vl_row; /* Number of rows (i.e. 480) */
u_long vl_clk; /* pixel clock in ps */
/* LCD configuration register */
u_long vl_sync; /* Horizontal / vertical sync */
u_long vl_bpix; /* Bits per pixel, 0 = 1, 1 = 2, 2 = 4, 3 = 8, 4 = 16 */
u_long vl_tft; /* 0 = passive, 1 = TFT */
u_long vl_cont_pol_low; /* contrast polarity is low */
u_long vl_clk_pol; /* clock polarity */
/* Horizontal control register. */
u_long vl_hsync_len; /* Length of horizontal sync */
u_long vl_left_margin; /* Time from sync to picture */
u_long vl_right_margin; /* Time from picture to sync */
/* Vertical control register. */
u_long vl_vsync_len; /* Length of vertical sync */
u_long vl_upper_margin; /* Time from sync to picture */
u_long vl_lower_margin; /* Time from picture to sync */
u_long mmio; /* Memory mapped registers */
} vidinfo_t;
#elif defined(CONFIG_EXYNOS_FB)
enum {
FIMD_RGB_INTERFACE = 1,
FIMD_CPU_INTERFACE = 2,
};
enum exynos_fb_rgb_mode_t {
MODE_RGB_P = 0,
MODE_BGR_P = 1,
MODE_RGB_S = 2,
MODE_BGR_S = 3,
};
typedef struct vidinfo {
ushort vl_col; /* Number of columns (i.e. 640) */
ushort vl_row; /* Number of rows (i.e. 480) */
ushort vl_width; /* Width of display area in millimeters */
ushort vl_height; /* Height of display area in millimeters */
/* LCD configuration register */
u_char vl_freq; /* Frequency */
u_char vl_clkp; /* Clock polarity */
u_char vl_oep; /* Output Enable polarity */
u_char vl_hsp; /* Horizontal Sync polarity */
u_char vl_vsp; /* Vertical Sync polarity */
u_char vl_dp; /* Data polarity */
u_char vl_bpix; /* Bits per pixel */
/* Horizontal control register. Timing from data sheet */
u_char vl_hspw; /* Horz sync pulse width */
u_char vl_hfpd; /* Wait before of line */
u_char vl_hbpd; /* Wait end of line */
/* Vertical control register. */
u_char vl_vspw; /* Vertical sync pulse width */
u_char vl_vfpd; /* Wait before of frame */
u_char vl_vbpd; /* Wait end of frame */
u_char vl_cmd_allow_len; /* Wait end of frame */
unsigned int win_id;
unsigned int init_delay;
unsigned int power_on_delay;
unsigned int reset_delay;
unsigned int interface_mode;
unsigned int mipi_enabled;
unsigned int dp_enabled;
unsigned int cs_setup;
unsigned int wr_setup;
unsigned int wr_act;
unsigned int wr_hold;
unsigned int logo_on;
unsigned int logo_width;
unsigned int logo_height;
int logo_x_offset;
int logo_y_offset;
unsigned long logo_addr;
unsigned int rgb_mode;
unsigned int resolution;
/* parent clock name(MPLL, EPLL or VPLL) */
unsigned int pclk_name;
/* ratio value for source clock from parent clock. */
unsigned int sclk_div;
unsigned int dual_lcd_enabled;
} vidinfo_t;
void init_panel_info(vidinfo_t *vid);
#else
typedef struct vidinfo {
ushort vl_col; /* Number of columns (i.e. 160) */
ushort vl_row; /* Number of rows (i.e. 100) */
u_char vl_bpix; /* Bits per pixel, 0 = 1 */
ushort *cmap; /* Pointer to the colormap */
void *priv; /* Pointer to driver-specific data */
} vidinfo_t;
#endif /* CONFIG_MPC823, CONFIG_CPU_PXA25X, CONFIG_MCC200, CONFIG_ATMEL_LCD */
extern vidinfo_t panel_info;
/* Video functions */
#if defined(CONFIG_RBC823)
void lcd_disable(void);
#endif
void lcd_putc(const char c);
void lcd_puts(const char *s);
void lcd_printf(const char *fmt, ...);
void lcd_clear(void);
int lcd_display_bitmap(ulong bmp_image, int x, int y);
/**
* Get the width of the LCD in pixels
*
* @return width of LCD in pixels
*/
int lcd_get_pixel_width(void);
/**
* Get the height of the LCD in pixels
*
* @return height of LCD in pixels
*/
int lcd_get_pixel_height(void);
/**
* Get the number of text lines/rows on the LCD
*
* @return number of rows
*/
int lcd_get_screen_rows(void);
/**
* Get the number of text columns on the LCD
*
* @return number of columns
*/
int lcd_get_screen_columns(void);
/**
* Set the position of the text cursor
*
* @param col Column to place cursor (0 = left side)
* @param row Row to place cursor (0 = top line)
*/
void lcd_position_cursor(unsigned col, unsigned row);
/* Allow boards to customize the information displayed */
void lcd_show_board_info(void);
/* Return the size of the LCD frame buffer, and the line length */
int lcd_get_size(int *line_length);
int lcd_dt_simplefb_add_node(void *blob);
int lcd_dt_simplefb_enable_existing_node(void *blob);
/* Update the LCD / flush the cache */
void lcd_sync(void);
/************************************************************************/
/* ** BITMAP DISPLAY SUPPORT */
/************************************************************************/
#if defined(CONFIG_CMD_BMP) || defined(CONFIG_SPLASH_SCREEN)
# include <bmp_layout.h>
# include <asm/byteorder.h>
#endif
/*
* Information about displays we are using. This is for configuring
* the LCD controller and memory allocation. Someone has to know what
* is connected, as we can't autodetect anything.
*/
#define CONFIG_SYS_HIGH 0 /* Pins are active high */
#define CONFIG_SYS_LOW 1 /* Pins are active low */
#define LCD_MONOCHROME 0
#define LCD_COLOR2 1
#define LCD_COLOR4 2
#define LCD_COLOR8 3
#define LCD_COLOR16 4
/*----------------------------------------------------------------------*/
#if defined(CONFIG_LCD_INFO_BELOW_LOGO)
# define LCD_INFO_X 0
# define LCD_INFO_Y (BMP_LOGO_HEIGHT + VIDEO_FONT_HEIGHT)
#elif defined(CONFIG_LCD_LOGO)
# define LCD_INFO_X (BMP_LOGO_WIDTH + 4 * VIDEO_FONT_WIDTH)
# define LCD_INFO_Y VIDEO_FONT_HEIGHT
#else
# define LCD_INFO_X VIDEO_FONT_WIDTH
# define LCD_INFO_Y VIDEO_FONT_HEIGHT
#endif
/* Default to 8bpp if bit depth not specified */
#ifndef LCD_BPP
# define LCD_BPP LCD_COLOR8
#endif
#ifndef LCD_DF
# define LCD_DF 1
#endif
/* Calculate nr. of bits per pixel and nr. of colors */
#define NBITS(bit_code) (1 << (bit_code))
#define NCOLORS(bit_code) (1 << NBITS(bit_code))
/************************************************************************/
/* ** CONSOLE CONSTANTS */
/************************************************************************/
#if LCD_BPP == LCD_MONOCHROME
/*
* Simple black/white definitions
*/
# define CONSOLE_COLOR_BLACK 0
# define CONSOLE_COLOR_WHITE 1 /* Must remain last / highest */
#elif LCD_BPP == LCD_COLOR8
/*
* 8bpp color definitions
*/
# define CONSOLE_COLOR_BLACK 0
# define CONSOLE_COLOR_RED 1
# define CONSOLE_COLOR_GREEN 2
# define CONSOLE_COLOR_YELLOW 3
# define CONSOLE_COLOR_BLUE 4
# define CONSOLE_COLOR_MAGENTA 5
# define CONSOLE_COLOR_CYAN 6
# define CONSOLE_COLOR_GREY 14
# define CONSOLE_COLOR_WHITE 15 /* Must remain last / highest */
#else
/*
* 16bpp color definitions
*/
# define CONSOLE_COLOR_BLACK 0x0000
# define CONSOLE_COLOR_WHITE 0xffff /* Must remain last / highest */
#endif /* color definitions */
/************************************************************************/
#ifndef PAGE_SIZE
# define PAGE_SIZE 4096
#endif
/************************************************************************/
#endif /* _LCD_H_ */
|
{
"pile_set_name": "Github"
}
|
FIG. 5 is a perspective view showing a prior art infrared imaging device. In FIG. 5, reference numeral 1 designates a two-dimensional photodiode array, for example, 128.times.128 array of pixels, which converts lights to electricity to generate signal charges. The photodiode array 1 is mounted on and electrically connected to a silicon CCD 2 for transferring signal charges, via indium bumps 3. Infrared light 4 is incident on the photodiode array 1.
FIG. 6 is a cross-sectional view of the infrared imaging device shown in FIG. 5. In FIG. 6, the same reference numerals as in FIG. 5 designate the same or corresponding parts. A p type HgCdTe layer 12 is disposed on a CdTe substrate 11. A plurality of n type impurity regions 13 are disposed at the surface of the p type HgCdTe layer 12. Each n type impurity region 13 is part of a pixel of the two-dimensional photodiode array 1. A p side electrode 5, which is common to all pixels of the photodiode array, is disposed on the p type HgCdTe layer 12 where the n type impurity regions 13 are not present. An insulating film 101 covers the HgCdTe layer 12 and the p side electrode 5 and apertures corresponding to the n type impurity regions 13 penetrate the insulating film 101. N side electrodes 6 for the pixels are formed in the apertures. N type regions 22 are disposed at the surface of the p type silicon substrate 21 of the silicon CCD 2 and opposed to the pixel regions 13 of the photodiode array 1. The n type regions 22 serve as a signal input stage of the CCD 2. An insulating film 102 having apertures corresponding to the n type regions 22 covers the silicon substrate 21 and electrodes 7 are disposed in the apertures. The n side electrode 6 of each pixel of the photodiode array 1 is connected to the opposite electrode 7 at the input stage of the CCD 2 via a corresponding indium bump 3. The p side electrode 5 is connected to the p type region of the CCD 2 via the indium bumps 3 and a substrate voltage (GND) of the CCD 2 is applied to the p side electrode 5 through the bonding pad 103 and the aluminum wiring 104.
FIG. 7 is a schematic diagram showing a two-dimensional photodiode array. A 3.times.3 pixel array is employed for simplifying the description. In FIG. 7, the p side electrode 5 is common to all pixels and an n side electrode 6 is provided corresponding to each pixel of the photodiode array 1.
FIG. 8 is a schematic diagram showing a structure of the CCD 2 from the input stage to the CCD channel and the potentials at respective regions. This CCD is a charge storage type CCD having a charge storage region at the input stage. The n side electrode of the photodiode 1 is connected to the n type region 22 of the CCD. An input stage region 25 includes the n type region 22, and an input gate region 26 is adjacent to the input stage region 25. A charge storage region 27 is adjacent to the input gate region 26. A transfer gate region 28 is adjacent to the charge storage region 27. A CCD channel region 29 is adjacent to the transfer gate region 28. An input gate electrode 17 is disposed on the input gate region 26. The potential barrier of the input gate region 26 depends on a DC voltage V.sub.G applied to the input gate electrode 17, whereby the quantity of charge transferred from the input stage region 25 to the storage region 27 is controlled. An electrode 18 forms the potential well, i.e., storage region 27 and a prescribed voltage V.sub. T is applied to the electrode 18. A transfer gate electrode 19 is disposed on the transfer gate region 28. The potential of the transfer gate region 28 is varied by applying a signal .phi..sub.T to the transfer gate electrode 19 with a prescribed timing, whereby the charges stored in the storage region 27 are transferred to the CCD channel region 29. A transfer electrode 20 is disposed on the CCD channel region 29 and a signal .phi..sub.CCD is applied to the transfer electrode 20 with a prescribed timing, whereby the charges in the CCD channel region 29 are transferred over CCD channels successively.
FIG. 9 is an electric circuit diagram of the photodiode array 1 shown in FIG. 5. In FIG. 9, reference numeral 9 designates a pixel disposed in the center of the photodiode array 1 and reference numeral 8 designates pixels surrounding the pixel 9. Reference numeral 10 designates substrate resistances (r, R) between those pixels. FIG. 10 shows I - V characteristics of the pixels.
A description is given of the operation. The p side electrode 5, which is common to all pixels, is provided around the pixels and electrically connected to the substrate voltage (GND) of the silicon CCD 2 while the n side electrodes 6 are electrically connected to the silicon CCD 2 via the In bumps 3. The infrared light 4 incident on the photodiode array 1 is converted into signal charges and the signal charges are transferred to the silicon CCD 2 through the indium bumps 3. Thereafter, the signal charges are output as time sequence signals, resulting in picture signals.
By applying a low DC voltage V.sub.G to the input gate electrode 17 of the silicon CCD as shown in FIG. 8, the quantity of charges transferred through the indium bumps can be controlled. Furthermore, a reverse bias voltage V.sub.bb is applied to each pixel of the photodiode array 1 according to the DC voltage V.sub.G. FIG. 9 shows an electric circuit diagram for explaining the voltage applied to the pixels of the photodiode array 1. In FIG. 9, the distance from the common p side electrode 5 to the peripheral pixel 8 is different from that to the central pixel 9, so that differences arise in the substrate resistances 10, resulting in differences in the reverse bias voltages V.sub.bb applied to the pixels. More concretely, when the reverse bias voltages applied to the peripheral pixel 8 and the central pixel 9 are V.sub.a and V.sub.b, respectively, and the photoelectric currents flowing through the peripheral pixel 8 and the central pixel 9 are i.sub.a and i.sub.b, respectively, the following equations are obtained. ##EQU1## As seen from above equations, the reverse bias voltage V.sub.b applied to the central pixel 9 is less than the reverse bias voltage V.sub.a applied to the peripheral pixel 8. When this result is applied to FIG. 10, the operating bias point of the peripheral pixel 8 is different from that of the central pixel 9, resulting in a difference in the output photoelectric current between the peripheral pixel 8 and the central pixel 9. More concretely, less photoelectric current is output from the central pixel 9 than from the peripheral pixel 8.
In the prior art infrared imaging device constituted as described above, there is a non-uniformity in the photoelectric current output from the peripheral pixels and the photoelectric current output from the central pixel. This problem may be solved by forming the p side electrode close to each pixel, but that solution is technically difficult. In addition, since the operating point of the device is its reverse-biased point, the device is easily affected by leakage current.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Microbial Evaluation of Vegetable Ingredients in Salad Bars †.
Vegetable salad ingredients (lettuce, tomatoes, broccoli, and cauliflower) purchased from three grocery-store deli operations were analyzed for total plate count, coliforms, yeasts, and molds. The temperature of the vegetable ingredients was measured at the time of purchase and the pH was measured on all samples within one-half hour after purchase. In the second phase, fresh broccoli was processed into florets, inoculated with E. coli ATCC 23742, and subjected to three washing treatments. The temperature of the salad ingredients ranged from 5.1°C to 18.9°C. The pH ranges for the vegetables were broccoli, 5.46 to 6.39; cauliflower, 5.82 to 6.65; lettuce, 4.92 to 6.38; and tomatoes, 3.30 to 4.47. The total aerobic count for the vegetables ranged from 5.51 to 6.63 log CFU/g. Coliforms on the vegetables ranged from 4.89 to 6.30 log CFU/g. Yeasts and molds were found on all vegetables. The results of the study indicate that the temperature conditions and pH ranges for the broccoli, cauliflower, and lettuce could support microbial growth. The pH range of the tomatoes was below 4.6, but if contaminated and added to low acid foods, the tomatoes may also act as a vehicle for microbial contamination. When a chlorine wash solution was used, it slightly reduced the aerobic microbial load on previously inoculated broccoli and reduced the coliform population of the broccoli by approximately one log unit.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
2011-12 Cross Over Resolution
01.01.12 … marks an equally important post in DeXXy.Net. Have you set your resolutions for year 2012? Good presentation of your resolutions will make things more achievable. Don’t you agree?
3 Jan 2012 | Happy New Year 01.01.12
A man’s vision can be concisely put in such easy way, notably career, family, health, financial and entertainment. To attain those, my resolutions must have a strong degree of relationship between them.
A greater shall look upon myself to get something done better than last year even though something must be loosen up a bit to get others go through.
An immensely important year in my life. The turning point where I shall put myself in greater height of the year. Thanks to my past resolutions to keep me on track and become a guideline for me to look with greater outcome. The year is finally come.
Wise is better … the wiser the better
As I mentioned, a man’s vision can be put in very simple way.
Career Status
Health Maintenance
Family Building
Progressive Vacation
Career Status
It’s not beyond my expectation when comes to career. I’ve chosen a right career in a right time. I’ve never lose grip on opportunities where brings me to this stage. Really thanks to my lucky star. Time will be proven my worth and value.
Health Maintenance
Life is meaningful without health. It does bring all the joy and meaningful in my life. Treasuring a good life is a must in resolution every year. No doubt.
Family Building
Bells ringing when times is up to certain stage. No one could be exception unless plan otherwise. The relationship that I ripped all the years has come to ripen. You could figure out if you’re wise.
Progressive Vacation
Many can stand without it. It has been with my life for so long until I’ve been associated strongly to it. The key elements of Time, Money & Energy are well explain enough to justify it. Even though challenging was ahead me, I believe wise can solve the things out.
Let’s have a deep thought. What would be my life without this? I would be a dull-man, perhaps.
Y2k11 … looking back
In year 2011 …
– A sociable person and a person to be learn by others when comes to experiences and presentable when needed.
– Trustfulness person to lead and manage the group, be a social group or close associate group.
– Achieve the balance of nature exploring, be a mountain, hill, waterfall and beach.
– Put a halt on MBA course due to new undertaking task on hand. Foresee myself as a e-business entrepreneur with great compassion for innovative touring around the world.
– Innovative touring was a fruitful method where I’ve seen the world more than ever.
– Getting myself a powerful smartphone, to become an e-business entrepreneur on the walk.
– Readiness to settle down for a necessity of our life. My instinct told me it’s the right time.
– Fall in love with number versus time as ventured into investment money-making instrument.
– Having a tough moment to bring down my credit line. Even though, it brings prosperous which turn to be a good thing.
– Optimistic with great life definition even though sources are limited.
– Invested a basic shelter where the basic requirement counts.
Major Achievements … year 2011
— [January] —
New Year hike @ Gunung GAP and Ulu Semangkok
Visit Dino Alive @ Science Centre with MyKhaki
Hike Gunung Angsi (first time)
CNY Hiking @ Bukit Ketumbar (first time)
— [February] —
VIsit FGS 2011 on CNY
Explore Greenish Waterfall @ Puchong
Join Paintball Challenge 2011 by Ambank
New Tabur series – Tabur Extreme
Hike Bukit Kutu (revisit)
— [March] —
Hike Gunung Nuang (revisit)
First time white water rafting @ Kampar
Visit Kellie Castle
Hike Bukit Apeh via Cheras Hatamas (first time)
— [April] —
Explore Jeram Perlus Waterfall
Explore Lata Nyur Waterfall
Joined Ambank Treasure Hunt @ Pulai Spring Resort
Hike Tabur East (revisit)
Run Energizer Night Race 2011 (first time)
Oversea trip @ Mt Bromo, Indonesia with MyKhaki
— [May] —
Hike 3-in-1 mountain @ Cameron Highlands
— [June] —
Go-Live project in Ambank
Resigned from Ambank
Visit Endau-Rompin Selai @ Johor
3rd Anniversary Trip @ Danga Bay with MyLove
A’Famosa Melaka Water Park (revisit)
— [July] —
Participate Feel-Good Fun Run 2011
Hike Bukit Apeh @ Cheras Awana (first time)
Organize durian trip @ Raub and yamchar @ Fraser Hill with MyKhaki
— [August] —
Oversea trip @ Bangkok with MyKhaki
Attempted Bukit Puchong (leisure & training)
— [September] —
Hike Gunung Datuk on Malaysia Day (revisit)
Hike Bukit Tabur West (leisure & training)
Participate on Siemens Run 2011
Pre-Honeymoon trip @ Krabi, Thailand with MyLove
— [October] —
Hike Bukit Saga + Bukit Apeh (leisure & training)
Hike Gunung Angsi (leisure & training)
Melaka Makan-Makan Trip 2011 (Lite version)
— [November] —
Hike Bukit Puchong (leisure & training)
Explore Pulau Intan Beach Trek @ Tanjung Tuan Port Dickson
— [December] —
BBQ at Sungai Nuang
Completed Annual Gathering 2011 (3rd edition) @ Bagan Lalang
Ipoh Ho-Jiak Trip 2011 during Christmas
Melaka New Year Countdown 2012
Together with my associates and alliances, let’s make year 2012 another greater year to achieve.
|
{
"pile_set_name": "Pile-CC"
}
|
With their first new album in 22 years on the way, Slowdive will be hitting the road as well and the band have announced a short string of North American dates with Japanese Breakfast this spring. The tour concludes in NYC with a show at the soon-to-open Brooklyn Steel on May 8. Tickets for that show go on sale Friday, January 27 at noon with an AmEx presale starting Wednesday, January 25 at noon.
All dates are listed, along with a stream of new song "Star Roving," below
Slowdive - 2017 Tour Dates
05-02 St. Paul, MN - Palace Theater *
05-03 Chicago, IL - Vic Theater *
05-05 Toronto, Ontario - Danforth Music Hall *
05-07 Washington, DC - 9:30 Club *
05-08 Brooklyn, NY - Brooklyn Steel *
06-03 London, England - Field Day 2017 @ Victoria Park
* with Japanese Breakfast
|
{
"pile_set_name": "OpenWebText2"
}
|
23-Jähriger gesteht Messerattacken
Der nach zwei Messerattacken am Mittwochabend in der Leopoldstadt gefasste 23-jährige Mann hat beide Taten gestanden. Er nannte „schlechte aggressive Stimmung“ und seine „Drogensucht“ als Motiv.
Für die erste Tat nahe dem Nestroyplatz, bei der er eine dreiköpfige Familie angegriffen hatte, nannte er „schlechte, aggressive Stimmung sowie Wut auf seine gesamte Lebenssituation“ als Motiv, berichtete Polizeisprecher Patrick Maierhofer am Donnerstag.
Dieses Element ist nicht mehr verfügbar
Polizeisprecher Patrick Maierhofer zum Geständnis des Mannes
Rund eine halbe Stunde später hatte der Afghane auf dem Praterstern einen Landsmann attackiert. Bei diesem handelte es sich um einen Bekannten, sagte er in seiner Einvernahme. „Er war böse auf ihn und hat ihn für seine Drogensucht verantwortlich gemacht“, zitierte Maierhofer aus der Befragung. Mittlerweile sei er eigenen Angaben zufolge aber clean, auch Alkohol habe er vor den Attacken nicht konsumiert, sagte der Afghane. Die Frage, ob die Tat auch politisch motiviert war, verneinte der 23-Jährige eindeutig.
zurück von weiter
Tatzeuge konnte sich in Lokal retten
Die erste Attacke wurde um 19.45 Uhr vor einem japanischen Restaurant am Nestroyplatz beim Aufgang der U1 verübt. Die dreiköpfige Familie - der 67-jährige Vater, die 56-jährige Mutter und die 17-jährige Tochter - dürfte gerade aus dem Lokal gekommen sein, als sie der Täter mit einem Klappmesser attackierte - mehr dazu in Messerattacke auf Familie in Wien.
Der Vater, ein Mediziner, musste reanimiert werden. Ein Tatzeuge flüchtete nach dem Angriff in ein Lokal. „Dem wollte der Beschuldigte nachgehen, nachdem die Tür von innen versperrt wurde, hat er mit dem Messer in der Hand gegen die Scheibe geschlagen und sich dabei an der Hand verletzt“, berichtete Polizeisprecher Maierhofer.
Ein Opfer weiter in Lebensgefahr
Rund eine halbe Stunde später hatte der Asylwerber am Praterstern beim Ausgang zum Riesenrad den Landsmann attackiert. Der 20-Jährige war am Donnerstag außer Lebensgefahr. Der Familienvater schwebte allerdings weiterhin in Lebensgefahr, der Zustand von Mutter und Tochter war stabil.
Der 23-jährige Verdächtige war noch am Mittwochabend bei einer Sofortfahndung nach der zweiten Attacke festgenommen worden. Er hatte zwei Messer bei sich, diese wurden von der Polizei sichergestellt. „Er hat angegeben, dass er die Messer untertags um circa zehn Euro gekauft hat“, sagte Maierhofer. Der Afghane befand sich am Donnerstag noch in Polizeigewahrsam und soll nach den Vernehmungen in die Justizanstalt Josefstadt gebracht werden.
Die Tatortgruppe des Landeskriminalamtes entdeckte am Donnerstag unweit des ersten Tatorts am Nestroyplatz eine Blutspur. Diese führte zum Treppelweg am Donaukanal und dürfte vom 23-Jährigen stammen. Im Einsatz waren auch Spürhunde der Polizei.
* Anlässlich des Weltfrauentags hat sich wien.ORF.at entschlossen, auf unserer Nachrichtenseite ein sprachliches Experiment durchzuführen. Wir werden heute die Berichte und Meldungen in weiblicher Form publizieren. Es geht nicht um klassisches Gendern, sondern darum, etwa Mehrzahlwörter, die Frauen einschließen, rein weiblich zu bilden. Das heißt: Bei der Formulierung „die Bürgerinnen“ werden Männer an diesem Tag eingeschlossen sein.
|
{
"pile_set_name": "OpenWebText2"
}
|
Snakes: Evolution of Mystery in Nature
We have erected a descriptive website on Professor Harry Greene's
new book with the above title, issued by the University of
California. It includes TOC and a narrative description of this
new book which may be nominated fora Pulitzer in Science Literature.
http://www.xmission.com/~gastown/herpmed/mystery.htm
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
strtok de tabulador con 4 espacios C
Estoy tratando de parsear un documento, en el cual cada línea tiene strings separados por tabs (cada tab son 4 espacios en blanco), pero a la hora de realizar un strtok no estoy siendo capaz de reconocer esos espacios en blanco.
Este es el fragmento de código en cuestión:
if((toks[0] != '\r') && (toks[0] != '\n') && (toks[0] != '\000')){
while ((toks = strtok(NULL, " ")) != NULL){
if ((strcmp(toks, "\r\n") != 0) && (strcmp(toks, "\r") != 0) && (strcmp(toks, "\n") != 0)){
i++;
inputs = realloc(inputs,i*sizeof(char*));
inputs[i-1] = toks;
numArgs++;
}
}
}
No soy capaz de hacer el strtok del while para que me reconozca los 4 espacios, un ejemplo de línea que debería de poder parsear es:
hola----¿----que----tal----?\000\000
Donde cada '-' representa un caracter ' '
Muchas gracias de antemano.
A:
No te funciona porque strtok( ) no se usa así:
char* strtok( char* str, const char* delim );
Parameters:
str - pointer to the null-terminated byte string to tokenize
delim - pointer to the null-terminated byte string identifying delimiters
En delim pasas un puntero a una lista de caracteres; puedes pasarle, por ejemplo, "abc", y te separará por cualquiera de ellos, a, b o c. Pero no te buscara abc.
Para buscar un conjunto de caracteres repetido, una posible opción es usar strstr( ), que te buscará una cadena dentro de otra, que es lo que en realidad quieres hacer. Usándola, recorrer una cadena buscando las separaciones es muy simple:
char *ptr = "una cadena de texto";
while( ptr = (strstr( ptr, " " ) ) ) {
ptr += 4; // Nos saltamos los 4 espacios iniciales.
// Hacemos lo que queramos hacer ...
}
Puesto que no es equivalente a strtok( ), para poder trocear una cadena hay que hacer algunos cambios en nuestro método:
#include <stdio.h>
#include <string.h>
int main( void ) {
const char buff[] = " Esto no es mas que una simple cadena de prueba ";
const char *start = strstr( buff, " " );
if( start == buff ) start += 2; // Tamaño de los espacios.
while( 1 ) {
const char *end = strstr( start, " " );
if( !end ) break;
printf( "%.*s\n", (int)( end - start ), start );
start = end + 2; // Tamaño de los espacios
}
if( *start ) printf( "%s\n", start );
return 0;
}
|
{
"pile_set_name": "StackExchange"
}
|
Subjective alcohol effects and drinking behavior: the relative influence of early response and acquired tolerance.
(1) To establish the reliability and validity of a modified version of the Self-Rating of Alcohol (SRE) form. (2) To differentiate early subjective alcohol response (SR) from acquired tolerance in the prediction of drinking outcomes. 353 undergraduates completed an online survey. SR was assessed using the SRE form and a modified SRE including items assessing global stimulant and sedative effects. The Daily Drinking Questionnaire-Revised (DDQ-R), and the Rutgers Alcohol Problems Index (RAPI) assessed alcohol use and problems, respectively. The revised version of the SRE showed good internal consistency and incremental validity. Early SR assessed by the modified SRE was consistently associated with use and problems. Acquired tolerance was significantly related to use and problems above and beyond early SR. The modified SRE incorporating stimulant and sedative responses demonstrated good psychometric properties and the potential to capture unique variability in drinking outcomes. Differentiating early SR from tolerance showed that each contributes uniquely to drinking behavior and problems. Thus, future studies would benefit from examining the unique contribution of each aspect of SR.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Kenneth Robinson (cricketer)
Kenneth Mark Lefebre Robinson (16 February 1897 – 9 January 1963) was an English first-class cricketer and Royal Navy officer.
Robinson was born in Hampshire at South Stoneham in February 1897. He served in the Royal Navy in the First World War, during which he was promoted from the rank of midshipman to sub-lieutenant in December 1916. In the closing stages of the war, he was promoted from the rank of acting lieutenant to lieutenant in June 1918. He was later promoted to the rank of lieutenant commander in January 1926. The following year he made a single appearance in first-class cricket for the Royal Navy against the touring New Zealanders at Portsmouth in 1927. Batting twice in the match, he was dismissed for 13 runs in the Royal Navy first-innings by Bill Cunningham, while in their second-innings he was dismissed for a single run by Ernest Bernau. Robinson was promoted to the rank of commander in December 1931, before being loaned to the Royal Australian Navy from 1932–34. Returning to the Royal Navy, he served aboard as its acting captain from December 1944 to mid–1945. He retired from active service in March 1947. Robinson died in January 1963 at Alverstoke, Hampshire.
References
External links
Category:1897 births
Category:1963 deaths
Category:People from the Borough of Eastleigh
Category:Royal Navy officers
Category:Royal Navy personnel of World War I
Category:English cricketers
Category:Royal Navy cricketers
Category:Royal Navy personnel of World War II
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Using Mata in .ado files - syntax error
This question is in continuation of this, but since it can be answered without knowledge of my previous question, I thought posting a new question was the way to do it (I'm sorry if this is not the case). In the previous question I was told that putting Mata code at the end of my .ado-file would make the local var2 usable within the Stata code. A minimal example is the following:
program define hello
args var1
local sum_var=`var1'+`var2'
disp `sum_var'
end
mata
void cens_func(todo, x, y, g, H)
{
y = (x-1)^2
}
S = optimize_init()
optimize_init_evaluator(S, &cens_func())
optimize_init_which(S, "min")
optimize_init_params(S, 2)
temp=optimize(S)
st_local("var2",strofreal(temp))
end
which unfortunately does not run. I am getting an invalid syntax error. Running this in a .do-file with the Mata code first, causes no errors. What am I missing here? Thanks in advance.
A:
I will refer back to my answer yesterday. Mata will create a new local, or change an existing local, but you can't use a local before it has been created. Nothing to do with Mata changes that.
On calling Mata from Stata, see help m1_ado.
Thus in your code, you would need a Mata call before you tried to use var2 as your Mata function creates var2.
|
{
"pile_set_name": "StackExchange"
}
|
And his stunned family and friends lament the fact that Mr. Lawrence will be remembered more for the lies he told than the things he did.
''Though there is much that I still do not understand about recent events, I and those who knew my husband remember a life that, although not perfect, was indelibly marked by kindness, compassion and love for his community and country,'' his widow, Shelia Davis Lawrence, wrote to Mr. Clinton this week.
Maurice Larry Lawrence grew up poor and got rich as a real estate developer, amassing a $300 million fortune at his death. He gave generously to Jewish charities and to Democratic candidates, lending his ocean-front Tudor mansion in Coronado, across the bay from San Diego, to celebrities, politicians and even President Clinton. He held Gatsby-style parties, with carnival rides and fireworks displays over the Pacific.
Yet as friends and relatives tell it, Mr. Lawrence may have made good but never felt good enough. So he reinvented pieces of his past. In hunting for a motive, some neighbors wondered whether he had harbored a need to measure up to the many genuine war heroes around the San Diego Navy base.
''We have so many Purple Hearts here and on every corner we have real, real heroes,'' said Carol Cahill, a 70-year-old Coronado resident who had known Mr. Lawrence for 30 years. ''Maybe he just figured -- merchant marine, you can't trace it, no one will ever know.''
The Myth
Making A War Record Is Created
For years, Mr. Lawrence struggled to fit in in the heavily military, heavily Republican world of San Diego. He loved to tell friends that he had ''three strikes'' against him: he was ''a liberal, a Jew, a Democrat.''
The military both appealed to him and infuriated him.
''This town is full of narrow-minded admirals,'' a former colleague quoted Mr. Lawrence as saying often, particularly when his requests for building permits were blocked.
|
{
"pile_set_name": "OpenWebText2"
}
|
Sunday, January 20
I wish I could say this was a tree in my garden. They are lovely. In someone else's lovely neat garden, & looking so healthy too.
Here are the little cups that form once the flower is spent. I remember playing with them as a child, & pretending they were little cups in a teaset.
These are the buds on the other little tree.
I used a little camera we got at a garage sale for $5, which we have given to our Granddaughter. She is not very interested in photography really, but has taken some nice photos of people with it.
I happened to have it in my bag yesterday, so whipped it out to take these pics. I think the neighbours wondered what I was doing. They surrepticiously came out & pretended to potter about on their front lawns, watching me. It was a little cul-de-sac, & I suppose any stranger would be noticed.
The rain has stopped for the time being. Steam is rising from the ground. Sitting in front of the fan is the only way I can keep sane.
Hi Meggie, One of my favorite natives the flowering Gum/The flowers remind me of the Gumnut babies..Its very warm here also had aircon on constantly.I live in Northern Victoria were it gets Bloody hot Melbourne had 23c the other day we had 35c . .phewwwwwwww
|
{
"pile_set_name": "Pile-CC"
}
|
Axial engine
Axial engines (sometimes known as barrel or Z-crank engines) are a type of reciprocating engine with pistons arranged around an output shaft with their axes parallel to the shaft. Barrel refers to the cylindrical shape of the cylinder group (result of the pistons being spaced evenly around the central crankshaft and aligned parallel to the crankshaft axis) whilst the Z-crank alludes to the shape of the crankshaft.
The key advantage of the axial design is that the cylinders are arranged in parallel around the output/crank shaft in contrast to radial and inline engines, both types having cylinders at right angles to the shaft. As a result, it is a very compact, cylindrical engine, allowing variation in compression ratio of the engine while running. In a swashplate engine the piston rods stay parallel with the shaft, and piston side-forces that cause excessive wear can be eliminated almost completely. The small-end bearing of a traditional connecting rod, one of the most problematic bearings in a traditional engine, is eliminated.
An alternate design, the Rand cam engine, replaces the plate with one or more Sinusoidal cam surfaces. Vanes mounted parallel to a shaft mounted inside a cylindrical 'barrel' that are free to sliding up and down ride the sinuous cam, the segments formed by rotor, stator walls and vanes constituting combustion chambers. In effect these spaces serving the same purpose as the cylinders of an axial engine, and the sinuous cam surface acts as the face of the pistons. In other respect this form follows the normal cycles of internal combustion but with burning gas directly imparting a force on the cam surface, translated into a rotational force by timing one or more detonations. This design eliminates the multiple reciprocal pistons, ball joints and swash plate of a conventional 'barrel' engine but crucially depends on effective sealing provided by sliding and rotating surfaces.
In either form the axial or 'barrel' engine can be derived as a cam engine or swashplate or wobble plate engine.
(A wobble-plate is similar to a swash plate, in that the pistons press down on the plate in sequence, imparting a lateral moment that is translated into rotary motion. This motion can be simulated by placing a Compact Disc on a ball bearing at its centre and pressing down at progressive places around its circumference. The difference is that while a wobble plate nutates, a swash-plate rotates.)
While axial engines are challenging to make practicable at typical engine operating speeds some cam engines have been tested that offer extremely compact size (approximating to a six-inch (150mm) cube) yet producing approximately forty horsepower at c 7000 rpm, useful for light aerial applications. The attraction of lightweight and mechanically simple (far fewer major moving parts, in the form of a rotor plus twelve axial vanes forming twenty-four combustion chambers) engines, even with a finite working life, have obvious application for small unmanned aircraft. (Such a design having allegedly been tested at NAVAIR PSEF in 2003.)
History
Macomber
In 1911 the Macomber Rotary Engine Company of Los Angeles marketed one of the first axial internal-combustion engines, manufactured by the Avis Engine Company of Allston, Massachusetts. A four-stroke, air-cooled unit, it had seven cylinders and a variable compression ratio, altered by changing the wobble-plate angle and hence the length of piston stroke. It was called a "rotary engine", because the entire engine rotated apart from the end casings.
Ignition was supplied by a Bosch magneto directly driven from the cam gears. The high voltage current was then taken to a fixed electrode on the front bearing case, from which the sparks would jump to the spark plugs in the cylinder heads as they passed within 1/16 inch (1.5 mm) from it. According to Macomber's literature, it was "guaranteed not to overheat".
The engine was claimed to be able to run at 150 to 1,500 rpm. At the normal speed of 1,000 rpm, it reportedly developed 50 hp. It weighed and it was long by in diameter.
Pioneer aviator Charles Francis Walsh flew an aircraft powered by a Macomber engine in May 1911, the "Walsh Silver Dart".
Statax
In 1913 Statax-Motor of Zürich, Switzerland introduced a swashplate engine design. Only a single prototype was produced, which is currently held in the Science Museum, London. In 1914 the company moved to London to become the Statax Engine Company and planned on introducing a series of rotary engines; a 3-cylinder of 10 hp, a 5-cylinder of 40 hp, a 7-cylinder of 80 hp, and a 10-cylinder of 100 hp.
It appears only the 40 hp design was ever produced, which was installed in a Caudron G.II for the British 1914 Aerial Derby but was withdrawn before the flight. Hansen introduced an all-aluminum version of this design in 1922, but it is not clear if they produced it in any quantity. Much improved versions were introduced by Statax's German division in 1929, producing 42 hp in a new sleeve valve version known as the 29B. Greenwood and Raymond of San Francisco acquired the patent rights for the US, Canada, and Japan, and planned a 5-cylinder of 100 hp and a 9-cylinder of 350 hp.
John O. Almen
Experimental barrel engines for aircraft use were built and tested by American John O. Almen of Seattle, Washington in the early 1920s, and by the mid-1920s the water-cooled Almen A-4 (18 cylinders, two groups of nine each horizontally-opposed) had passed its United States Army Air Corps acceptance tests. However, it never entered production, reportedly due to limited funds and the Air Corps' growing emphasis on air-cooled radial engines. The A-4 had much smaller frontal area than water-cooled engines of comparable power output, and thereby offered better streamlining possibilities. It was rated at 425 horsepower (317 kW), and weighed only 749 pounds (340 kg), thus giving a power/weight ratio of better than 1:2, a considerable design achievement at the time.
Heraclio Alfaro
Heraclio Alfaro Fournier was a Spanish aviator who was knighted at the age of 18 by King Alfonso XIII of Spain for designing, building, and flying Spain's first airplane. He developed a barrel engine for aircraft use which was later produced by the Indian Motocycle Manufacturing Company as the Alfaro. It was a perfect example of the "put in everything" design, as it included a sleeve valve system based on a rotating cylinder head, a design that never entered production on any engine. It was later developed further for use in the Doman helicopter by Stephen duPont, son of the president of the Indian Motorcycle Company, who had been one of Alfaro's students at Massachusetts Institute of Technology.
Wooler
Perhaps the most refined of the designs was the British Wooler wobble-plate engine of 1947. This 6-cylinder engine was designed by John Wooler, better known as a motorcycle engine designer, for aircraft use. It was similar to the Bristol axial engine but had two wobble-plates, driven by 12 opposed pistons in 6 cylinders. The engine is often incorrectly referred to as a swashplate engine. A single example is preserved in the Aeroplane Gallery of the Science Museum, London.
H.L.F. Trebert
Some small barrel engines were produced by the H.L.F. Trebert Engine Works of Rochester, New York for marine usage.
Present day
Dyna-Cam
The Dyna-Cam engine originally came from a design by the Blazer brothers, two American engineers in the brass era automotive industry who worked for Studebaker in 1916. They sold the rights to Karl Herrmann, Studebaker's head of engineering, who developed the concept over many years, eventually taking out US patent 2237989 in 1941. It has 6 double-ended pistons working in 6 cylinders, and its 12 combustion chambers are fired every revolution of the drive shaft. The pistons drive a sine-shaped cam, as opposed to a swashplate or wobble-plate, hence its name.
In 1961, at the age of 80, Herrmann sold the rights to one of his employees, Edward Palmer, who set up the Dyna-Cam Engine Corp. along with son Dennis. Edward's son Dennis and daughter Pat then helped get the engine installed in a Piper Arrow airplane. The engine was flown for about 700 hours from 1987 through 1991. Their longest-life engine ran for nearly 4000 hours before overhaul. Dyna-Cam opened a research and development facility about 1993 and won many various awards from NASA, the United States Navy, the United States Marine Corps, California Energy Commission, Air Quality Management District, and Los Angeles Regional Technology Alliance for different variations of the same Dyna-Cam engine. About 40 prototype engines were built by the Herrmann Group and another 25 built by the Dyna-Cam Group since they acquired the engine and opened their shop. A new patent was granted to Dennis Palmer and Edward Palmer, first in 1985 and then several more around 2000 to Dennis Palmer. In 2003 the assets of the Dyna-Cam Engine Corporation were acquired by Aero-Marine Corporation, who changed their name to Axial Vector Engine Corporation. Axial Vector then totally re-designed the cam engine. Axial Vector's new engine, like many of the others on this list, suffers from the "put in everything" problem, including piezoelectric valves and ignition, ceramic cylinder liners with no piston rings, and a variety of other advanced features. It has little similarity to the original Herrmann and Dyna-Cam engines, since the Dyna-Cam engine used conventional valves, piston rings, accessories, had no unproven ceramic materials and actually flew in an aircraft and also powered a "Eliminator" ski boat for over four years.
FairDiesel
United Kingdom company FairDiesel Limited is designing two-stroke Diesel opposed piston barrel engines that use non-sinusoidal cams, for industrial applications and aviation use. Their engine designs range from a 2-cylinder, 80 mm bore to 32-cylinder, 160 mm bore.
Duke Engines
New Zealand company Duke Engines started in 1993 has created several different engines and installed one in a car in 1999. The engine runs a 5-cylinder, 3 litre, 4-stroke internal combustion engine platform with its unique axial arrangement, which is in its third generation. Due to a valveless design, Duke engine loses less energy between the power strokes. Current prototypes of Duke's engines claim to match characteristics of conventional internal combustion engines but with fewer parts and 30% lighter. This goes in the direction of developing a more efficient engine. It is being stated that this design for engines could be ideal for motorcycles in future. During development the Duke has been tested at MAHLE Powertrain in the United Kingdom and in the United States; test results are available with it also having multi-fuel capabilities.
Cylindrical Energy Module
The Cylindrical Energy Module (CEM) is a sine-wave swashplate engine that can also be used as a standalone pump, powered by an external source. The rotating swashplate rotor assembly is moved back and forth with the help of piston drive pins, which follow a stationary sinusoidal cam track that encircles the rotor assembly.
Applications
The most well-known application is in torpedoes, where the cylindrical shape is desirable. The modern Mark 48 torpedo is powered by a 500 hp swashplate engine geared to a pump-jet propulsor. It is fueled by Otto fuel II, a monopropellant that requires no oxygen supply and can propel the torpedo at up to (74.56 mph).
Other applications include pneumatic and hydraulic motors, hydrostatic transmissions such as Honda's Hondamatic CVT, and air conditioner pumps. Also, some Stirling engines use a swashplate arrangement, e.g., Stirling Thermal Motors' STM 4-120 engine.
See also
Axial piston pump
Notes
References
External links
Barrel Engine - Part 2 Flight December 1941
Category:Engine technology
Category:Piston engines
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
Why mi jasmine spec fails TypeError: undefined is not a constructor (evaluating 'this.sortLayout.$('.toggle').removeProp('disabled')')?
When I testing this part of the code jasmine send me this error TypeError: undefined is not a constructor (evaluating 'this.sortLayout.$('.toggle').removeProp('disabled')')
onResponsive: function() {
var selectedServers,
spanDetails,
span;
this.sortLayout.$('.toggle').removeProp('disabled');
this.contractYear.$('.toggle').removeProp('disabled');
selectedServers = parseInt(this.sortLayout.$('.toggle').find('span').text().match(/\d+/)[0], 10);
span = $('div.wrapper').find('span');
spanDetails = $('div#divider').find('span');
span.empty();
spanDetails.empty();
if(selectedServers === 1){
span.append('Selected '+selectedServers);
}else{
spanDetails.append('Selected'+selectedServers);
}
}
Spec
describe('#onResponsive', function() {
it('enables sort filter menu', function() {
this.view.onShow();
spyOn($.fn, 'removeProp');
spyOn($.fn, 'find').and.returnValue('4');
this.view.onVizResponsive();
//var result = $('.dropdown-toggle').find();
//expect(result).toEqual('4');
expect($.fn.removeProp).toHaveBeenCalledWith('disabled');
expect($.fn.removeProp).toHaveBeenCalledWith('span');
});
});
Why I get this failure when this jQuery function don't return anything.
A:
I needed append toggle to the DOM.
describe('#onResponsive', function() {
it('enables the sort filter menu', function() {
this.view.onShow();
spyOn($.fn, 'removeProp');
this.view.sortLayout.$el.append('<button class="toggle" disabled><span>Toggle option 1</span></button>');
this.view.onVizResponsive();
this.view.sortLayout.$el.find('.toggle').remove();
this.view.sortLayout.$el.append('<button class="toggle" disabled><span>Toggle option 2</span></button>');
this.view.onVizResponsive();
expect($.fn.removeProp).toHaveBeenCalledWith('disabled');
});
});
|
{
"pile_set_name": "StackExchange"
}
|
Как на самом деле IKEA будет работать в Украине 13 сентября 2018, 16:03 Цей матеріал також доступний українською
Почему IKEA открывает в Украине city-store, а не привычный большой гипермаркет? Моя версия
IKEA заходит в Украину не благодаря, а вопреки. Никто из существующих чиновников к этому отношения не имеет. Все они привычно присосались к анонсу, как любят это делать по любому поводу. Воду на Марсе нашли – Слава Украине! Смерть ворогам. Более продвинутые рассказывают о новой концепции сети – стать next-door store, быть ближе к своему потребителю. Мол, они в Лондоне такую концепцию запустили, скоро и в Киеве будет, чем мы хуже.
В реальности же IKEA заходит к нам с концепцией небольшого магазина, чтобы в случае чего было не больно его закрыть. Проверяет рынок, но не на покупательский спрос, а на наличие в магазине пожарников и санэпидстанции через сутки после открытия. Если придут пожарники, а потом санэпидстанция, а потом и представитель налоговой – посидеть на корточках и поплевать в пол – то будет не так страшно терять магазин, потому что он небольшой. Риски есть, но они оправданы.
IKEA заходит в Украину не благодаря, а вопреки
Тем более покупательский спрос есть, что ярко демонстрирует россыпь псевдо-икей в каждом районе, по всей стране, торгующих по каталогам и ввозящих мебель из Польши в мешках.
К тому же, IKEA несколько лет искала участок под Киевом в 20-30 га, но так и не нашла. Удивительно почему. Наверное, потому что под Киевом вся земля уже давно распилена и распродана, а частники, владеющие участками, каждый раз, слыша имя того, кто им хочет сделать предложение, впадали в экстаз от жадности, тут же повышая цену за сотку в пять раз. А это никому не интересно, даже IKEA.
А в остальном мы почти Лондон.
Текст опубликован с разрешения автора
Оригинал
Присоединяйтесь к нашему телеграм-каналу Мнения Нового Времени
|
{
"pile_set_name": "OpenWebText2"
}
|
New River (Chattahoochee River tributary)
The New River is a tributary of the Chattahoochee River in Coweta and Heard counties in the U.S. state of Georgia. Rising south of the city of Newnan, the New River flows generally southwest, reaching the Chattahoochee at West Point Lake approximately west of Hogansville.
See also
List of rivers of Georgia
References
USGS Hydrologic Unit Map - State of Georgia (1974)
Category:Rivers of Georgia (U.S. state)
Category:Bodies of water of Coweta County, Georgia
Category:Bodies of water of Heard County, Georgia
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Sir,
Congenital diaphragmatic hernia (CDH) is a developmental defect of the diaphragm that allows abdominal viscera to herniate into the thorax resulting in pulmonary hypoplasia.\[[@ref1]\] CDH occurs in one of 2000--3000 births.\[[@ref2]\] About 97% of CDH are unilateral, 1% bilateral, and 2% are central hernias.\[[@ref2]\] Bilateral CDH is challenging to diagnose prenatally because the mediastinal shift is minimal, and the right-sided herniated liver is of similar echogenicity as the lung.\[[@ref2]\] Bilateral CDH accounts for five in 1,000,000 births, and bilateral anterior CDH occurs in six of 10,000,000 births.\[[@ref3]\] We describe a rare case of a CDH where the anterior half of the diaphragm is deficient bilaterally and centrally, leading to bilateral anterior herniation of the liver and small loop of bowel, as well as secondary complications of narrow intimal tear of the aorta at the level of the right carotid artery.
Bilateral CDH carries significant mortality, with a mortality rate of 65%--74% versus 20%--35% for unilateral CDHs.\[[@ref1][@ref2]\] Prenatal diagnosis is extremely important as it can improve delivery planning, postnatal care, and evaluation for chromosomal and congenital anomalies.\[[@ref4][@ref5]\]
This patient is a male born at 39.1 weeks by planned cesarean section to a G3P2 mother. The infant was suspected to have a CDH on the antenatal ultrasound. The CDH was confirmed by fetal magnetic resonance imaging (MRI) as an anterior CDH with the liver and a small portion of bowel herniating superiorly through the defect \[[Figure 1](#F1){ref-type="fig"}\].
{#F1}
The boy was born with acute respiratory distress syndrome and needed extensive cardiorespiratory support including extracorporeal membrane oxygenation (ECMO). Once the patient was relatively stable in the early postnatal period, computed tomography imaging was performed to better visualize the CDH \[[Figure 2](#F2){ref-type="fig"}\]. This imaging showed a bilateral anterior diaphragmatic defect with an intact posterior diaphragm, a hernia containing a large portion of the liver and a bowel loop posterior to it, bilateral hypoplastic lungs, and a superiorly displaced heart.
{#F2}
An echocardiogram demonstrated endothelial disruption of the aorta at the level of the right carotid artery possibly due to the previous ECMO cannula position. The tissue flap was blocking blood flow and created an aortic arch gradient and systemic hypertension that was controlled with esmolol. Consultations between pediatric surgery and pediatric cardiology determined the patient was stable to repair the diaphragmatic hernia and the aortic arch. A bilateral anterior CDH repair was performed successfully, and notable findings during this procedure included multiple blebs and surface irregularity on the right lung, confluent pericardial and diaphragmatic tissue, hypoplastic left lung, and diaphragmatic remnants. Seventeen days later, the infant underwent an uncomplicated aortic arch reconstruction of the intimal flap dissection of the transverse arch.
In our case, although bilateral CDH was suspected based on sonographic evidence, the definitive prenatal diagnosis was based on further evidence from fetal MRI, which demonstrated liver and small bowel herniation into the pleural cavity. There was also evidence of bilateral lung hypoplasia and superior displacement of the heart.
Patients who are diagnosed prenatally are more likely to have severe defects that are easily visualized on fetal ultrasound and carry a worse prognosis.\[[@ref2]\] As such, surgical repair for CDH continues to be a challenge requiring a multidisciplinary approach with collaboration between surgery, neonatology, cardiology, and radiology teams. Presurgical management and optimal timing of surgery remain variable; to date, studies evaluating the survival outcomes of early versus delayed surgical repair demonstrate inconclusive evidence.\[[@ref2]\] The prognosis of bilateral CDH remains poor, with the severity of pulmonary hypertension and pulmonary hypoplasia being the important prognostic risk factors.\[[@ref1][@ref2][@ref5]\]
Bilateral CDH is an extremely rare type of CDH, and our case is novel interest because it presents an even rarer variation-a bilateral anterior CDH of an infant who was diagnosed prenatally and presented at birth with heart dysfunction requiring ECMO. Literature/case reports on bilateral anterior CDH are extensively limited. Our case demonstrates how integrative use of different imaging modalities can guide prenatal diagnosis, surgical planning, and neonatal management in hopes of improving survival outcomes of CDH patients.
Financial support and sponsorship {#sec2-1}
=================================
Nil.
Conflicts of interest {#sec2-2}
=====================
There are no conflicts of interest.
|
{
"pile_set_name": "PubMed Central"
}
|
Role of nitric oxide in cerebellar development and function: focus on granule neurons.
More than 20 years of research have firmly established important roles of the diffusible messenger molecule, nitric oxide (NO), in cerebellar development and function. Granule neurons are main players in every NO-related mechanism involving cerebellar function and dysfunction. Granule neurons are endowed with remarkable amounts of the Ca(2+)-dependent neuronal isoform of nitric oxide synthase and can directly respond to endogenously produced NO or induce responses in neighboring cells taking advantage of the high diffusibility of the molecule. Nitric oxide acts as a negative regulator of granule cell precursor proliferation and promotes survival and differentiation of these neurons. Nitric oxide is neuroprotective towards granule neurons challenged with toxic insults. Nitric oxide is a main regulator of bidirectional plasticity at parallel fiber-Purkinje neuron synapses, inducing long-term depression (LTD) or long-term potentiation (LTP) depending on postsynaptic Ca(2+) levels, thus playing a central role in cerebellar learning related to motor control. Granule neurons cooperate with glial cells, in particular with microglia, in the regulation of NO production through the respective forms of NOS present in the two cellular types. Aim of the present paper is to review the state of the art and the improvement of our understanding of NO functions in cerebellar granule neurons obtained during the last two decades and to outline possible future development of the research.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Tetrahydrobiopterin (BH4) is an essential cofactor of endothelial nitric oxide synthase (eNOS). Diminished NO formation and subsequent impaired relaxation have been proposed to be due to reduced endothelial BH4 levels, which enhances superoxide formation from eNOS. This idea gained support from electron paramagnetic resonance spin trapping studies showing that fully reduced BH4 inhibits superoxide release form eNOS while oxidized BH4 has no effect. In addition, these studies demonstrated that saturation of BH4- binding site is critical for inhibiting superoxide and that displacement of the cofactor from eNOS by oxidized BH4 analogs such as sepiapterin and 7,8-dihydrobiopterin elevates superoxide production. Based on these findings we hypothesized that the ratio between fully reduced and oxidized BH4 regulates superoxide generation from endothelial nitric oxide synthase. Previous studies used L-arginine and L-arginine analogs to implicate eNOS as a source of superoxide. However, spin trapping studies showed that these compounds have little effect on superoxide release from purified eNOS. This paradox indicates that identification of eNOS as a superoxide producer remains elusive. Here, the role of eNOS in superoxide formation from BH4- depleted human coronary artery endothelial cells will be examined by pharmacological approaches using 1,14-bis-isothiourea, 7-nitroindazole or caveolin-1 scaffolding peptide. These agents specifically inhibit oxygen activation by either impeding enzyme activation and/or blocking heme group. In addition, superoxide formation in COS-7 transfected with wild type eNOS and C99A mutant that has a low affinity off BH4 will be examined. These experiments will reveal the interplay between eNOS/BH4 in superoxide formation. In addition, it will be examined the mechanisms by which BH4 is depleted and regenerated in endothelial cells. To this end, the effect of oxidative stress on GTP cyclohydrolase-I activity and GTP feedback regulatory peptide will be examined. Parallel experiments will examine the role of GFRP in the regulation of BH4. Finally, it will be examined whether nitrosative/oxidative stress changes BH4-binding to eNOS to generate an enzyme that produces superoxide by a BH4-insensitive mechanism. This information is likely to contribute in the identification of risk factors and in the design of new therapeutic interventions to ameliorate vascular function in conditions such as hypertension, atherosclerosis and diabetes.
|
{
"pile_set_name": "NIH ExPorter"
}
|
Q:
in R Return a logical if my function plots a graph
Hi I have a function called basic_plot(), which will generate a plot if the variable plot_function = TRUE else it return a NULL. it is as follows
plot_function = TRUE;
basic_plot = function() {
if(plot_function) {
par(mfrow = c(1,3))
plot(1:10,1:10,type = "o")
plot(10:1,1:10,type = "o")
plot(1:10,rep(5,10),type = "o")
} else {
NULL;
}
}
basic_plot();
should generate a plot with tree panels populated with some lines. This function along with the variable it depends on is embedded with in some other code. What I would like to know is how I can tell an if() statement if the plot has been drawn? for example
if(is.null(basic_plot())) {
print("I haven't drawn the plot yet")
} else {
print("I have drawn the plot and want to do more stuff.")
}
The problem with the above is if a function plots a graph it is considered a null. so this will never know when I draw the plot e.g
plot_function = TRUE;
is.null(basic_plot())
[1] TRUE
plot_function = FALSE;
is.null(basic_plot())
[1] TRUE
The true application for this is with in a shiny app but actually thought this could be a generic R query. I cannot return anything other than generate the plot in the basic_plot() function (avoiding the obvious return something after the plot is drawn). I am hoping for an alternative function to is.null() such as has this function does something or not?
Cheers,
C
A:
In your function basic_plot the plot(1:10,rep(5,10),type = "o") command does not assign anything to the function, so it is still NULL
For example below will assign TRUE to your function.
plot_function = TRUE;
basic_plot = function() {
if(plot_function) {
par(mfrow = c(1,3))
plot(1:10,1:10,type = "o")
plot(10:1,1:10,type = "o")
plot(1:10,rep(5,10),type = "o")
TRUE
} else {
NULL;
}
}
basic_plot();
For storing plots as an object, recordPlot() is used:
myplot<-recordPlot()
|
{
"pile_set_name": "StackExchange"
}
|
Files:
tests/test-openat.c
tests/test-open.h
tests/signature.h
tests/macros.h
Depends-on:
fcntl
symlink
configure.ac:
Makefile.am:
TESTS += test-openat
check_PROGRAMS += test-openat
test_openat_LDADD = $(LDADD) @LIBINTL@
|
{
"pile_set_name": "Github"
}
|
INTRODUCTION {#s1}
============
Age patterns of survival and fertility vary widely across species \[[@R1]\]. During evolution, natural selection has shaped these age patterns, referred to as life histories, so to optimise the fitness of each species by maximising reproduction \[[@R2]\]. Reproduction is increased if survival or fertility are enhanced or if a decline in survival or fertility with age is resisted. The diversity in life history across species indicates that it has a strong genetic basis. Several genetic pathways have been found in animals that regulate survival and fertility, including the signalling cascade of growth hormone (GH), insulin-like growth factor 1 (IGF1), and insulin, signalling by target of rapamycin (TOR), DNA repair mechanisms, immune regulation, and telomere maintenance \[[@R3], [@R4]\]. These pathways have been discovered mostly in studies on mutant animal models, but likely contribute to variation in survival and fertility in wild-type animals as well \[[@R5], [@R6]\]. Genetic variation in these pathways is thought to likewise determine the age patterns of survival and fertility in humans \[[@R7]\], but it remains disappointingly inconclusive as an explanation of observed variation in human survival and fertility. Candidate-gene studies, linkage studies, and genome-wide association studies have yielded consistent evidence for only a handful of genetic variants to determine variation in human survival to old age, of which most notably *APOE* \[[@R8]--[@R11]\]. Genetic variants have been described as determinants of human infertility \[[@R12], [@R13]\], but have rarely been studied for variation in human fertility \[[@R14]\].
Research on the genetic determinants of human life history has almost exclusively been conducted in populations living in modern affluent environments. These modern affluent environments, however, are radically different from the environments in which over many generations humans have been subjected to evolutionary pressures. During most of human history, survival and fertility were compromised by infectious diseases \[[@R15], [@R16]\], malnutrition \[[@R17], [@R18]\], climatic hardships, predation, and violence \[[@R19]\]. Fitness, which includes survival and fertility, has long been shaped by natural selection enforced through these environmental stressors. It is, therefore, likely that natural selection has enhanced survival and fertility by promoting genetic variants that shape inflammatory processes to improve resistance against infections, metabolic processes to facilitate consumption and storage of nutrients, and psychological strategies to cope with environmental stressors. In modern affluent environments, however, where survival and fertility depend less on these adverse environmental stressors, such genetic variants are of less influence on life history.
If we aim to identify the genetic determinants of life history that have enhanced fitness in adverse environments, we should search for them in such environments. In this study, we investigate genetic variants that determine life history through variation in survival and fertility in a traditional rural African population that lives in such an adverse environment. Compared with modern affluent environments, this population\'s mortality rates and fertility rates are high, various infectious diseases are endemic, periodic food shortage and malnutrition are common, and a sedentary lifestyle is absent \[[@R20]--[@R29]\].
RESULTS {#s2}
=======
Table [1](#T1){ref-type="table"} shows the general characteristics of the Ghanaian study population. Genetic variants as determinants of variation in survival were investigated in men and women together, grouped as newborns, middle-aged adults of fertile ages from 20 through 44 years, and old individuals aged 60 years or over. Genetic variants as determinants of variation in fertility were investigated in women only. Observed fertility was registered in middle-aged women of fertile ages from 20 through 44 years during follow-up. Reported fertility was registered in postmenopausal women aged 45 years or over at the beginning of follow-up.
###### General characteristics of the Ghanaian study population
Men and women Women
-------------------- --------------- ------------- ------------- ------------- -------------
Individuals, *n* 1482 1589 1144 732 708
Females, *n* (%) 695 (46.9) 1394 (87.7) 608 (53.1) 732 (100.0) 708 (100.0)
Age, years 0 (0--0) 33 (26--40) 70 (65--77) 33 (27--37) 63 (56--71)
Tribe, *n* (%)
Bimoba 1017 (68.6) 1124 (70.7) 696 (60.8) 549 (75.0) 446 (63.0)
Kusasi 367 (24.8) 365 (23.0) 357 (31.2) 142 (19.4) 205 (29.0)
Other 98 (6.6) 100 (6.3) 91 (8.0) 41 (5.6) 57 (8.1)
Observed fertility NA NA NA 1 (1--2) NA
Reported fertility NA NA NA NA 8 (6--9)
Data are given as numbers with percentages or as medians with interquartile ranges. Observed fertility is expressed as the number of children that a woman gave birth to during the period of follow-up. Reported fertility is expressed as the number of children that a woman had given birth to during life. NA: not applicable.
As shown in Figure [1](#F1){ref-type="fig"}, after the quality control 4052 SNPs, encompassing 148 genes, were included in the analyses. The median (interquartile range) number of kb between SNPs included in the analyses was 2.3 kb (1.8-3.4 kb). An overview of the included genes is given in [Supplementary Table 1](#SD1){ref-type="supplementary-material"}.
{#F1}
Figure [2](#F2){ref-type="fig"} reports on the investigation of the genetic variants as determinants of variation in survival. We assessed the association of each SNP with the chance of being an old individual as compared with a newborn, a middle-aged adult as compared with a newborn, and an old individual as compared with a middle-aged adult, reflecting the survival between each pair of age groups. None of the SNPs were statistically significantly associated with survival between these three age groups.
{#F2}
Although each was non-significant, we list the ten SNPs with the lowest *p* values for the association with survival between each pair of age groups in [Supplementary Tables 2, 3, and 4](#SD1){ref-type="supplementary-material"}. SNPs in many different genes appeared in these lists, among which two neutrally selected control SNPs in the list comparing newborns and old individuals. None of these SNPs appeared in more than one of these lists, except for rs2026816 in the insulin receptor substrate 2 gene (*IRS2*) and rs2069842 in the interleukin 6 gene (*IL6*), both of which were in the lists comparing newborns and old individuals and comparing newborns and middle-aged adults.
Figure [3](#F3){ref-type="fig"} reports on the investigation of the genetic variants as determinants of variation in fertility. We assessed the associations of each SNP with observed fertility in middle-aged women and with reported fertility in postmenopausal women. None of the SNPs were statistically significantly associated with either observed or reported fertility.
{#F3}
Although each was non-significant, we list the ten SNPs with the lowest *p* values for the associations with observed and reported fertility in [Supplementary Tables 5 and 6](#SD1){ref-type="supplementary-material"}. SNPs in many different genes appeared in these lists. Among them was a neutrally selected control SNP in the list for the association with observed fertility in middle-aged women. None of the SNPs appeared in both lists.
DISCUSSION {#s3}
==========
The aim of this study was to identify the genetic variants that determine life history through variation in survival and fertility in a traditional rural African population that lives in an adverse environment without a western lifestyle. We conducted a large-scale candidate gene study using a high density of SNPs. We found no statistically significant association of any genetic variant with either survival or fertility.
Studies on the genetic determinants of variation in human survival and fertility in adverse environments have never been executed with numbers of individuals and SNPs comparable to this study. Due to a lack of previous genetic studies in this region, we could not rely on standard genome-wide association analyses given the higher degree of population stratification and the lesser degree of linkage disequilibrium in African populations \[[@R30]\]. Instead, we used a custom-made array for geno-typing a high density of SNPs in the genes of interest. A relatively large proportion of SNPs failed genotyping or had an insufficient minor allele frequency. The exceptional circumstances that are inherent to adverse environments -- such as an inadequate infrastructure, a missing civil registry, and language and culture barriers -- compromised the study\'s execution. The proportion of individuals with failed genotyping was comparable with studies in western affluent environments, but we rigidly excluded a relatively large proportion that appeared to have a mismatch between their genetic and registered sexes or to be unintentionally duplicated. To enlarge the contrast in the analysis of the SNPs\' associations with survival the selection of old individuals could have been restricted to higher ages, but this would have diminished the number of included old individuals and the power of the analysis. A post hoc calculation of the present study\'s power, based on the numbers of individuals and SNPs included in the analyses after the quality control using an additive logistic regression model, reveals that we could find statistically significant associations with an odds ratio of at least 1.4 with a power of 80% and a minimal minor allele frequency ranging from 0.08 to 0.29 ([Supplementary Figure 1](#SD1){ref-type="supplementary-material"}). As we did not find such statistically significant associations, the associations are possibly present, but less strong.
Population stratification was unlikely to explain our results. As a result of the polygynous and patrilocal culture in the research area, men preferentially marry women from outside the region. Previous analyses of this study population have confirmed that the female-mediated gene flow is nearly fully random and prevents population stratification of autosomal genes \[[@R31]\]. To account for possible population stratification in this study, we rigidly excluded individuals that had a different allele at less than 10% of the loci indicated by an IBS1 below 10% and SNPs that were not in Hardy-Weinberg equilibrium. In addition, we adjusted our analyses for tribe, which represents a mainly cultural population stratification, and for the main dimensions of the multidimensional scaling (MDS) analysis, which represents a mainly genetic population stratification. The MDS analysis did not reveal any population stratification. The adjustments did not affect our results.
Here we did not find genetic variants that were statistically significantly associated with variation in survival or fertility. This finding corresponds with the difficulty to identify such variants in modern affluent environments. In such environments, variation in human lifespan is genetically determined for only less than 30%. Many and various studies have yielded consistent evidence for only a handful of genetic variants to determine variation in survival, most notably *APOE*, and most of their associations with survival are not strong \[[@R8]--[@R10]\]. Genetic variants that determine infertility have been identified, but genetic variants that determine variation in fertility have rarely been reported \[[@R14]\]. These disappointing results have been explained by the proposition that survival and fertility are determined by rare genetic variants with a strong effect or by a complex of interacting genetic variants with small effects. Both remain undetected in genome-wide or large-scale candidate gene association studies, such as our study \[[@R10], [@R11]\].
Contrary to many studies in affluent populations, the present study did not identify *APOE* as a determinant of variation in survival. Three SNPs in *APOE* were included in the present analyses: rs1081101, rs877973, and rs769450. The *p* values for their associations with survival ranged between 0.36 and 1.00. In West Africans, only the latter of these SNPs is in linkage disequilibrium (*r*^2^=0.21) with rs429358, the SNP that constitutes the *APOEε4* allele and most consistently determines variation in survival in modern affluent populations, but contrary to rs429358, it does not influence blood lipid levels. The other two SNPs are not in linkage disequilibrium with rs429358 and influence blood triglyceride, but not cholesterol levels \[[@R32]\].
Our finding that genetic variants known to influence survival in modern affluent populations, such as *APOE*, did not influence survival in adverse environments may likely be explained, apart from chance, by gene-environment interaction. The effects of genes vary depending on environmental conditions, which thus determine the effects of genes on survival and fertility \[[@R33]\]. Our study was conducted in an environment characterised by endemic infectious diseases, shortages of food, necessary physical activity, and a scarcity of cardiovascular disease and diabetes up to high ages \[[@R20]--[@R29]\]. These characteristics differ radically from those of modern affluent environments. Variants of *APOE* affect blood lipid levels, the risk of cardiovascular disease, and survival in affluent populations \[[@R34]\]. In this study population, lipid levels as well as the risk of cardiovascular disease are far lower than in affluent populations \[[@R25]--[@R28]\], which may explain why *APOE* does not affect survival here. The higher levels of physical activity may provide an additional explanation for the absence of such an effect \[[@R35]\]. Likewise, we have previously shown that variants of *IL10*, associated with the inflammatory strength of the immune response, enhance survival in those exposed to contaminated drinking water, but diminish survival in those exposed to clean drinking water \[[@R36]\]. These examples of different effects of genetic variants in different environments indicate that such effects can only be identified if, firstly, a specific hypothesis is formulated, secondly, the environmental conditions are measured with the same rigour as the genetic variants, and, thirdly, corresponding appropriate statistical methods are applied.
Life histories have evolved as natural selection has optimised fitness by increasing the frequencies of genetic variants that enhance survival and fertility, while decreasing the frequencies of genetic variants that diminish survival and fertility. The effects of genetic variants on survival and fertility, and thereby the evolution of life history, are largely dependent on environmental factors \[[@R2]\]. The diversity in life history across species indicates that it has a genetic basis, but the diversity in the genetic variants that determine variation in survival and fertility across populations and environ-ments within species indicates that these genetic variants differ across species, populations, and environments.
Evolutionary theory predicts that most of the genetic variants that enhance survival diminish fertility or vice versa, because a trade-off exists between investments in survival and investments in fertility \[[@R37], [@R38]\]. Indeed, genetic variants have been described that influence both survival and fertility \[[@R39], [@R40]\]. The close relation between survival and fertility during evolution has encouraged us to study them jointly. Furthermore, several evolutionary theories explain why survival and fertility decline with age in humans and many other species. According to one theory, random damage accumulates in the genetic determinants of survival and fertility as natural selection loses its strength \[[@R37], [@R38]\]. Such genetic damage as determinants of life history that differ across individuals cannot be identified by a study like the present. According to another theory, some genetic determinants that enhance survival and fertility at early ages have an antagonistic pleiotropic effects that diminish survival and fertility at later ages \[[@R37], [@R38]\]. The present study would have been able to identify such genetic determinants.
It is critical to acknowledge that natural selection works to maximize fitness as a phenotype rather than a genotype, with survival and fertility being the most important components of this phenotype. The genotype only matters to natural selection as a determinant of the phenotype that is under selection. Meanwhile, the phenotype may be the result of a complex interaction between various genetic variants. Natural selection exists by virtue of such variation in the genetic determinants. Genetic variation is conserved, since genes are prone to mutations and new genetic variants are introduced by sexual reproduction. The resulting genetic heterogeneity of populations may explain why so few unique genetic variants have been found to determine variation in the complex phenotypes of survival and fertility. If different genetic variants determine a similar phenotype, each of these genetic variants is shared by only a proportion of the individuals and a patchwork of shared and unshared variants is established throughout the population. Moreover, if different genetic variants interact with each other to express a phenotype, the penetrance of one of these genetic variants relative to another may vary throughout the population. When studied in a population as a whole, these patterns lead to annulation of the effect of a single genetic variant. As an example of genetic heterogeneity underlying a single phenotype, the ability to digest milk after childhood due to lactase persistence has independently evolved multiple times in similar environments of animal domestication. Across populations, various SNPs at different positions in the lactase gene bring about this trait. Still, these specific variants are insufficient to explain differences in the frequencies of lactase persistence across populations \[[@R41], [@R42]\]. Methods to analyse multiple interacting genetic variants are possible, but beyond the aim of this study. More fundamentally, the complexity of the genotype to give rise to a phenotype suggests that, next to explaining genetic variation in survival and fertility, it may be more worthwhile to search for the causal biological mechanisms that determine survival and fertility.
In conclusion, we aimed to identify the genetic variants that determine life history through variation in survival and fertility in an adverse environment in rural Africa, which resembles the environments during most of recent human evolution. In this large-scale candidate gene study, we did not find statistically significant associations of genetic variants with survival or fertility. Apart from a lack of power, we hypothesise that genetic heterogeneity of complex phenotypes and gene-environment interaction prevent the identification of such unique genetic variants that humans have been selected for.
METHODS {#s4}
=======
Study population {#s4_1}
----------------
This study was conducted in the Garu-Tempane District in the Upper East Region in Ghana. The region is rural, remote, and one of the least developed in the country. The vast majority of the inhabitants are involved in subsistence agriculture performed by manual labour without proper means of transportation or mechanized farming. The mean annual per capita income and expenditure in the region are one third of those in Ghana nationally and one fifth of those in the capital Accra \[[@R43]\]. Of the adult inhabitants, 31% has attended school as compared with 69% in Ghana nationally and 89% in the capital Accra \[[@R43]\]. Hospital care is absent. Various infectious diseases -- including malaria, measles, meningitis, tuberculosis, typhoid fever, trachoma, and intestinal helminths -- are highly endemic and constitute the main causes of death both in childhood and adulthood, although the prevalence of human immunodeficiency virus (HIV) is low (\<4%) compared with other African regions \[[@R44]\].
From 2002 through 2011, we kept a demographic registry of the population in a research area of 375 km^2^ comprising 32 villages. During annual visits we registered the name, age, sex, tribe, and location of living of each inhabitant. If an inhabitant\'s age was unknown, it was estimated by oral methods, as described previously \[[@R20], [@R21]\]. Households were occupied by extended families with 48% of the married men having multiple wives \[[@R45]\]. Annual migration relative to the study population\'s size was 2% into and 1% out of the research area. The average property of the households included small numbers of cattle and bicycles with a value of circa 1,000 US\$ and 15% of the households had access to electricity \[[@R22], [@R45]\]. Drinking water was drawn from boreholes, open wells, and rivers \[[@R36]\]. Of apparently healthy adults, 86% were infected by the malaria species *Plasmodium falciparum*, 44% by the protozoan *Giardia lamblia*, and 31% by the helminth *Necator americanus* \[[@R24]\]. During the nine years of follow-up, 46 to 53% of the population was aged less than 15 years and 6 to 7% of the population was aged 60 years and more \[[@R28]\].
Ethical approval was given by the Committee Medical Ethics of the Leiden University Medical Center, the Ethical Review Committee of Ghana Health Services, and the local chiefs and elders. Because of illiteracy, informed consent was obtained orally from the participants after explanation of the purpose and conduction of this research project. The data were analysed anonymously. This study was conducted in accordance with the Declaration of Helsinki.
Survival and fertility {#s4_2}
----------------------
Survival of all inhabitants was registered during the annual follow-up from 2002 through 2011 \[[@R28]\]. Fertility of women was measured through their reproduction in two manners. Firstly, observed fertility was registered prospectively for women of all ages during the annual follow-up from 2002 through 2011. Observed fertility was expressed as the number of children that a woman gave birth to during the period of follow-up \[[@R28], [@R46]\]. Secondly, reported fertility was retrospectively determined in 2003 by interviewing women who were available and willing to participate. Data on reported fertility was restricted to women aged 45 years and older, who were considered to be postmenopausal and for whom reported fertility represented lifelong reproduction. Reported fertility was expressed as the number of children that a woman had given birth to during life \[[@R21], [@R47]\].
DNA collection, isolation, processing, and genotyping {#s4_3}
-----------------------------------------------------
To identify genetic variants associated with survival, we aimed to contrast the genotypes of newborns, of middle-aged individuals, and of individuals who had survived to old age. To identify genetic variants associated with fertility, we aimed to associate the genotypes of middle-aged and postmenopausal women with their reported or observed fertility. Since 2003, we took buccal samples from all newborns who were present during our visits, older than one week, and born in the same year. We took buccal samples from men and women of the fertile ages from 20 through 44 years, from women aged 45 years and older, and from men and women aged 60 years and older. The buccal samples of middle-aged and older individuals were collected together with measurements of phenotypic characteristics, including fertility \[[@R21], [@R47]\], infectious diseases \[[@R24]\], inflammatory and metabolic markers in blood \[[@R23], [@R25], [@R26], [@R36]\], cardiovascular health \[[@R25]--[@R27]\], muscle strength \[[@R29], [@R48]\]. These characteristics had been measured in randomly selected individuals. In addition, we collected buccal samples in 2010 from individuals randomly selected from our demographic registry to obtain balanced numbers in the three age groups. With an eye to the analyses of fertility, we oversampled middle-aged women over men.
The buccal samples were stored in 2.5 ml STE buffer (100 mM NaCl, 10 mM Tris/HCl, 10 mM EDTA, pH 8.0) with 0.05 mg/ml proteinase K, 0.1 mg/ml pronase, and 0.5% sodium dodecylsulphate. DNA was isolated and processed from samples collected in 2002 through 2006 by BaseClear (Leiden, the Netherlands) using a Chemagic bead-extraction method, from samples collected in 2006 through 2008 by the Department of Molecular Epidemiology of Leiden University Medical Center (Leiden, the Netherlands) using Qiagen silica spin-columns, and from samples collected in 2007 through 2011 by LGC Genomics, formerly KBioscience (Middlesex, UK), using a proprietary silica column method. DNA was genotyped using a custom-made Illumina Infinium iSelect High-Density Custom Genotyping BeadChip (Illumina, San Diego, CA) at the Department of Human Genetics of Leiden University Medical Center following the manufacturer\'s instructions.
Candidate gene selection {#s4_4}
------------------------
For the genotyping and analyses, we selected 153 candidate genes that were considered relevant for regulation of life history based on literature, discussion with experts, and general inference. These candidate genes included genes associated with survival or fertility in genome-wide association studies in humans or model organisms \[[@R49]\], human genes that have been under positive or balancing selection pressure during the last 100,000 years and that are associated with survival or fertility \[[@R15], [@R50], [@R51]\], and homologues of genes associated with survival in model organisms \[[@R52]\].
SNP selection {#s4_5}
-------------
We aimed for a dense coverage of SNPs in the candidate genes. We selected SNPs that are known to be causally associated with survival or fertility in humans, had a minor allele frequency equal to or higher than 1% and a correlation equal to or higher than 0.8 in the Yoruba population \[[@R53]\], and/or had a genotype score higher than 0.8 according to the Illumina Design Tool (Illumina, San Diego, CA). If necessary, we chose tag SNPs using Tagger \[[@R54]\] and/or OpenHelix Genome Variation Server \[[@R55]\] based on the Yoruba population \[[@R53]\]. We additionally selected 170 control SNPs that are presumed to be selectively neutral for analysis of population stratification \[[@R56], [@R57]\]. The median (interquartile range) number of 1000 base pairs (kb) between genotyped SNPs was 0.8 kb (0.8-1.0 kb).
Quality control {#s4_6}
---------------
After genotyping, buccal samples and SNPs were subjected to a stringent quality control protocol. Of the 6104 individuals from whom buccal samples had been taken, we excluded 370 (6.1%) because of genotyping failure. Furthermore, we excluded 98 (1.6%) individuals with a call rate below 90%, 542 (8.9%) individuals with a sex mismatch, 3 (\< 0.1%) individuals with an excess of heterozygosity indicated by an inbreeding coefficient below −0.3 or above 0.3, and 492 (8.1%) individuals with a different allele at less than 10% of the loci indicated by an IBS1 below 10%, which included unintentional duplicates. Of the 4599 individuals eligible for analysis, 212 (4.6%) individuals outside the designated sex and age groups were excluded. Of the 9509 genotyped SNPs, we excluded 1162 (12.2%) because of genotyping failure. Furthermore, we excluded 581 (6.1%) SNPs with a call rate below 90%, 3646 (38.3%) SNPs with a minor allele frequency below 1%, and 68 (0.7%) SNPs that were not in Hardy-Weinberg equilibrium. As a result, 4387 individuals and 4052 SNPs were included in the analyses. Of these SNPs, 98 (2.4%) were evolutionarily neutrally selected controls. The exclusions and inclusions are described in Figure [1](#F1){ref-type="fig"}.
As previously reported for this study population, population stratification is unlikely to influence any associations with genetic variation in autosomal genes. As a result of the polygynous and patrilocal culture in the research area, the female-mediated gene flow is nearly fully random \[[@R31]\]. Multidimensional scaling (MDS) analysis did not reveal any population stratification. Potential residual population stratification was addressed in the analyses.
Analyses {#s4_7}
--------
For the investigation of the genetic determinants of survival, we assessed the association of each SNP with the chance of being in one of three age groups: newborns, middle-aged adults of fertile ages from 20 through 44 years, and old individuals aged 60 years or over. We compared the chances between pairs of these groups using an additive logistic regression model adjusted for sex. For the investigation of the genetic determinants of fertility, we assessed the associations of each SNP with observed fertility in middle-aged women of fertile ages from 20 through 44 years and with reported fertility in postmenopausal women aged 45 years and older. We assessed the association with reported fertility using an additive linear regression model. We assessed the association with observed fertility using an Andersen-Gill model, which is an extension to the Cox regression model for analysis of recurrent events \[[@R58]\]. The model was adjusted for calendar year in order to account for the decline in fertility observed during the period of follow-up \[[@R28]\]. To avoid convergence of this model it was necessary to exclude 954 SNPs with a minor allele frequency below 5% from this assessment. All models were repeated with additional adjustment for tribe as a categorical covariate, with additional adjustment for the first two dimensions of the MDS analysis, with additional clustering per household, or with a combination of these in order to account for potential population stratification. These additional adjustments did not alter the results. After a Bonferroni correction for the number of SNPs included in the analyses the threshold for significant results was set at 1.23 × 10^−5^ for the logistic and linear regression models and at 1.61 × 10^−5^ for the Andersen-Gill model. The analyses were performed using R (R Foundation, Vienna, Austria).
SUPPLEMENTARY DATA TABLES AND FIGURES {#s5}
=====================================
The authors are grateful for the dedicated assistance in the fieldwork of a local team and for the valuable advice on the analyses and the manuscript of dr. R. Noordam and dr. I. Postmus.
**Funding**
This study was supported by the Netherlands Foundation for the Advancements of Tropical Research (WOTRO 93-467), the Netherlands Organization for Scientific Research (NWO 051-14-050), the European Union-funded Network of Excellence LifeSpan (FP6 036894), a grant of the Board of Leiden University Medical Center, and Stichting Dioraphte. The funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
**Author contributions**
Conception and design of the study: PdK and RGJW. Collection of the data: JJEK, JP, UKE, and HSF. Analysis of the data: JJEK, JP, and SB. Interpretation of the results: all authors. Drafting of the manuscript: JJEK and JP. All authors provided intellectual contributions and read and approved the manuscript.
**Conflicts of interest statement**
The authors have no conflict of interests to declare.
|
{
"pile_set_name": "PubMed Central"
}
|
PSX Extreme
Site Stats
New Monster Hunter Breaks Records In Japan
As we all know, certain games are just made for the Japanese market, while the rest of the world is on the outside looking in. Perhaps we just don't understand the fascination, but for whatever reason, games likes Monster Hunter are simply huge in Japan, but barely recognized in the U.S. and Europe. The latest in that long-running series, Monster Hunter Portable 2nd for the PSP, has officially sold 700,000 units in its first week of availability in Japan.
And of course, considering how much more popular the Nintendo DS is than the PSP in Japan, this makes the game the fastest-selling PSP title...ever. With the fast start, there is a possibility Monster Hunter Portable 2nd could eventually become the best selling PSP title in the handheld's short history in Japan.
As one final note, the same source that unveiled this information today - Japanese gaming site Mainichi Interactive - reports that PSP hardware sales have done well over the past week. Sony has even released a gold-colored PSP to commemorate the big game's release, but the most popular colors remain blue and silver. 2006 was a solid year for Sony's handheld, and slowly but surely, it's starting to make up ground with each passing month.
|
{
"pile_set_name": "Pile-CC"
}
|
1. Introduction {#s0005}
===============
In December 2019, Corona Virus Disease 2019 (COVID-19) epidemic emerged in Wuhan, China, causing global attentions ([@b0185]). The virus is known as especially severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). It was recently documented that, in addition to systemic and respiratory symptoms, 36.4% (78/214) of patients with COVID-19 develop neurological symptoms, including headache, disturbed consciousness, and paresthesia. Severely affected patients are more likely to develop neurological symptoms than patients who have mild or moderate disease ([@b0115]). Additionally, autopsy reports have revealed brain tissue edema and partial neuronal degeneration in deceased patients ([@b0250]). Furthermore, on March 4, 2020, Beijing Ditan Hospital reported for the first time a case of viral encephalitis caused by a novel coronavirus (CoV) attacking the central nervous system (CNS). The researchers confirmed the presence of SARS-CoV-2 in the cerebrospinal fluid by genome sequencing. It illustrated that COVID-19 has potential to cause nervous system damage ([@b0245]). With the now ongoing COVID-19 pandemic, it is particularly necessary to make clinicians aware of the impact of various CoV infections on the CNS. This article reviews the epidemiology, possible mechanisms of neuroinvasion, and management strategies pertaining to CoV infections with potential nervous system involvement.
2. CoV infections affecting the CNS {#s0010}
===================================
Many viral infections can cause serious damage to the structure and function of the nervous system, including severe encephalitis due to viral infections in the CNS, toxic encephalopathy caused by severe systemic viral infections, and severe acute demyelinating lesions developing after viral infections. ([@b0125], [@b0230]). Some viruses are neurotropic and can invade nervous tissues and cause infections of immune-functioning macrophages, microglia, or astrocytes in the CNS ([@b0010], [@b0170]).
CoV have an average diameter of 100 nm, and they are spherical or oval. There are large spikes of viral membrane glycoproteins on the surface, and, when observed by electron microscopy, these negatively stained virus particles show a typical crown-like shape. CoV is a positive-sense single-stranded RNA virus, which harbors the largest genome among currently known RNA viruses, with a genome length of about 26--32 kb ([@b0165]). The pathogen of the now ongoing novel pneumonia outbreak is the novel CoV 2019 (SARS-CoV-2), which is the seventh known CoV that can infect humans; the remaining six are HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, SARS-CoV, and MERS-CoV ([@b0035]). The most common and important types of CoV infections with potential nervous system damage are described below.
2.1. SARS-CoV {#s0015}
-------------
Severe acute respiratory syndrome (SARS) is a zoonotic respiratory disease caused by SARS-CoV that started in Asia and spread throughout the world in 2003. It has the characteristics of acute onset and strong infectivity, and is a great threat to human health. The main clinical manifestations of SARS are fever, chills, dry cough, and difficulty breathing. In severe cases, respiratory failure and death may occur ([@b0100]). In addition, SARS-CoV could induce neurological diseases such as polyneuropathy, encephalitis, and aortic ischemic stroke ([@b0190]). Autopsy studies demonstrated that signs of cerebral edema and meningeal vasodilation could be detected in most cases of SARS. Furthermore, infiltration of monocytes and lymphocytes in the vessel wall, ischemic changes of neurons, demyelinationn of nerve fibers, as well as SARS-CoV virus particles and genome sequences could be detected in the brain ([@b0070], [@b0270]).
2.2. MERS-CoV {#s0020}
-------------
Middle East Respiratory Syndrome (MERS), caused by MERS-CoV, originates from bats, and the intermediate host is camel. Patients with MERS-CoV infection usually present with pneumonia-related symptoms, such as fever, myalgia, cough, and dyspnea. Severe cases can lead to acute respiratory distress syndrome (ARDS), septic shock, multiple organ failure, and death ([@b0220]). MERS-CoV is known to be potentially neuroinvasive, and that a retrospective study found that 25.7% of patients with MERS can develop insanity and 8.6% of patients have seizures ([@b0160]). Kim et al. also reported that almost 1/5 of patients with MERS-CoV infection show neurological symptoms during the infection process, including but not limited to disturbance of consciousness, paralysis, ischemic stroke, Guillain-Barre syndrome and other poisoning or infectious neuropathy. Interestingly, their neurological complications are not accompanied by respiratory symptoms, but delayed by 2--3 weeks ([@b0085]).
2.3. SARS-CoV-2 {#s0025}
---------------
The genetic similarity between SARS-CoV-2 and SARS-CoV is 79.5%, and its similarity to bat coronavirus is as high as 96% ([@b0235]). Patients infected with SARS-CoV-2 have symptoms of varying degrees, ranging from fever or a mild cough to pneumonia and extensive involvement of multiple organ functions with a mortality rate of 2% to 4%. At present, clinical data have revealed that some patients with COVID-19 have symptoms similar to intracranial infections such as headache, epilepsy, and disturbed consciousness. Moreover, a growing number of COVID-19 patients report a sudden loss of smell or taste. It is therefore likely that anosmia and dysgeusia might be observed in patients with COVID-19 ([@b0065], [@b0155], [@b0080]). In fact, some even develop COVID-19-related symptoms only after showing neurologic symptoms ([@b0115]). Recently, Beijing Ditan Hospital reported for the first time a case of viral encephalitis caused by the novel CoV attacking the CNS. The researchers confirmed the presence of SARS-CoV-2 in cerebrospinal fluid by genome sequencing, adding support to the theory this new pneumonia virus can also cause nervous system damage ([@b0245]). It is therefore likely that other pathogenic bacteria, such as bacteria, may destroy the blood--brain barrier, and secondary intracranial infections may cause headaches, projectile vomiting, visual loss, and limb convulsions in patients with severe COVID-19 symptoms.
3. Nervous system diseases related to CoV infections {#s0030}
====================================================
3.1. Viral encephalitis {#s0035}
-----------------------
Encephalitis refers to inflammatory lesions in the brain parenchyma caused by pathogens, including neuronal damage and nerve tissue lesions. It is characterized by acute onset, and common symptoms include headache, fever (mainly high fever), vomiting, convulsions, and consciousness disorders ([@b0055]). Early diagnosis of viral encephalitis is critical. In the ongoing pneumonia epidemic, the treatment team of Beijing Ditan Hospital confirmed the presence of SARS-CoV-2 in the cerebrospinal fluid of patients with COVID-19 by genome sequencing, thereby clinically verifying viral encephalitis ([@b0245]). This provided a solid basis for CoV causing the encephalitis.
3.2. Infectious toxic encephalopathy {#s0040}
------------------------------------
Infectious toxic encephalopathy, also known as acute toxic encephalitis, refers to a type of reversible brain dysfunction syndrome caused by factors such as systemic toxemia, metabolic disorders, and hypoxia during the process of acute infection ([@b0135], [@b0180], [@b0265]). The basic pathological changes in this disease include cerebral edema, with no evidence of inflammation on cerebrospinal fluid analysis. Its clinical symptoms are complex and diverse. Patients with a mild course of the disease may develop headache, dysphoria, mental disorder, and delirium. Seriously affected patients may experience disorientation, loss of consciousness, coma, and paralysis ([@b0045], [@b0135]). Acute viral infection is also an important cause of this disease, exemplified by a respiratory infection caused by CoV. Patients with COVID-19 often suffer from severe hypoxia and viremia ([@b0075]), which has the potential to cause toxic encephalopathy. Moreover, almost 40% of patients with COVID-19 develop headache, disturbed consciousness, and other brain dysfunction symptoms ([@b0115]), and that an autopsy study reported that edema has been detected in brain tissue of COVID-19 patients ([@b0250]). Collectively, these findings provide the evidence that COVID-19 could cause infectious toxic encephalopathy, although detailed studies are greatly required.
3.3. Acute cerebrovascular disease {#s0045}
----------------------------------
A considerable amount of evidence indicates that especially respiratory-related infection is an independent risk factor for acute cerebrovascular disease ([@b0050], [@b0215]). Data from the use of experimental mouse models suggests that influenza virus can aggravate ischemic brain injury by triggering a cytokine cascade and increase the risk of cerebral hemorrhage after treatment with tissue-type plasminogen activator ([@b0145]). The infection of CoV, especially SARS-CoV-2, has been widely reported to cause cytokine storm syndromes, which may be one of the factors that CoV cause acute cerebrobasilar disease ([@b0120], [@b0030]). In addition, critically ill patients with severe SARS-CoV-2 infections often show elevated levels of D-dimer and severe platelet reduction, which may render these patients prone to acute cerebrovascular events ([@b0210]). It is therefore likely that during CoV infections, patients at risk of developing cerebrovascular disease should be alerted with regard to the occurrence of acute cerebrovascular events.
4. Mechanisms of CoV infections on the nervous system damage {#s0050}
============================================================
4.1. Direct infection injury {#s0055}
----------------------------
The genetic material and even proteins of various viruses can often be detected in nervous system tissue samples (such as cerebrospinal fluid or brain), suggesting that viruses can directly invade the nervous system and cause nerve damage ([@b0095], [@b0105]).
### 4.1.1. Blood circulation pathway {#s0060}
A typical virus entering the CNS through the blood circulation is the JE virus, which multiplies in the vascular cells of the skin area affected by the mosquito bite. It is subsequently released into the blood to reproduce in mononuclear macrophages throughout the body. The secondary release into the blood may increase the permeability of the blood--brain barrier through the produced cytokines, thereby promoting the virus to enter the brain and causing viral encephalitis ([@b0200]). Although there is rare evidence that CoV, especially SARS-CoV-2, invade the nervous system via the blood circulation pathway ([@b0095], [@b0040]), subsequent studies are expected.
### 4.1.2. Neuronal pathway {#s0065}
Neuronal pathway is important vehicles for neurotropic viruses to enter the CNS. Viruses can migrate by infecting sensory or motor nerve endings, achieving retrograde or anterograde neuronal transport through the motor proteins, dynein and kinesins ([@b0175]). An example of a neuronal pathway is that of olfactory neuron transport. The unique anatomical organization of olfactory nerves and the olfactory bulb in the nasal cavity and forebrain effectively makes it a channel between the nasal epithelium and the CNS ([@b0095]). As a consequence, CoV can enter the brain through the olfactory tract in the early stages of infection or nasal vaccination ([@b0040], [@b0140]). For example, after CoV infects nasal cells, it can reach the entire brain and cerebrospinal fluid through the olfactory nerve and olfactory bulb within 7 days and cause inflammation and demyelinating reaction. However, removal of the olfactory bulb in the mice, resulted in a restricted invasion of CoV into the CNS ([@b0025]). Gu et al. also detected SARS virus particles and genome sequences in brain neurons ([@b0070]). The observations mentioned here indicate that CoV can invade the CNS from the periphery through neural pathways.
4.2. Hypoxia injury {#s0070}
-------------------
When a virus proliferates in lung tissue cells, it causes diffuse alveolar and interstitial inflammatory exudation, edema, and the formation of transparent membranes. This, in turn, leads to alveolar gas exchange disorders causing hypoxia in the CNS, increasing anaerobic metabolism in the mitochondria of brain cells ([@b0005]). The accumulation of acid can cause cerebral vasodilation, swelling of brain cells, interstitial edema, obstruction of cerebral blood flow, and even headache due to ischemia and congestion ([@b0005]). If the hypoxia continues unabated, cerebral edema and the cerebral circulation disorder may worsen sharply. With intracranial hypertension, the brain function gradually deteriorates, and drowsiness, bulbar conjunctival edema, and even coma can be observed ([@b0005]). In addition, for patients at particular risk of developing cerebrovascular disease, hypoxia may also induce the occurrence of acute cerebrovascular disease such as acute ischemic stroke. Owing to the fact that the patients with COVID-19 often suffer from severe hypoxia ([@b0075]), hypoxia injury may cause subsequent nervous system damage.
4.3. Immune injury {#s0075}
------------------
Nervous system damage caused by viral infection may be mediated by the immune system ([@b0090]). The pathology of severe viral infections is closely linked to the development of a systemic inflammatory response syndrome (SIRS). SIRS could be abnormally initiated in severe pneumonia caused by CoV infection, while early anti-inflammatory intervention effectively prevent immune damage and reduce the risk of injury in the nervous system ([@b0120], [@b0060]). Furthermore, SARS and COVID-19 have resulted in a large number of fatalities, most of which have been due to multiple organs failure (MOF) caused by virus-induced SIRS or SIRS-like immune disorders ([@b0260], [@b0030]). The persistence of CoV infections and its ability to infect macrophages, microglia, and astrocytes in the CNS are particularly important. A neurotropic virus can activate glial cells and induce a pro-inflammatory state ([@b0110]). interleukin (IL)-6, an important member of the cytokine storm, is positively correlated with the severity of COVID-2019 symptoms ([@b0205]). Additionally, experiments have confirmed that primary glial cells cultured *in vitro* secrete a large amount of inflammatory factors such as IL-6, IL-12, IL-15, and TNF-α after being infected with CoV ([@b0025]). Furthermore, activation of immune cells in the brain will cause chronic inflammation and brain damage.
4.4. Angiotensin-converting enzyme 2 {#s0080}
------------------------------------
Angiotensin-converting enzyme 2 (ACE2) is a cardio-cerebral vascular protection factor existing in a variety of organs, including the nervous system and skeletal muscles, playing a major role in regulating blood pressure and anti-atherosclerosis mechanisms ([@b0130]). Meanwhile, ACE2 is also an important target for various CoV and influenza viruses ([@b0195], [@b0225], [@b0255]). Binding to ACE2 receptors, the above-mentioned viruses may cause abnormally elevated blood pressure and increase the risk of cerebral hemorrhage. In addition, given that SARS-CoV-2 spike protein could interact with ACE2 expressed in the capillary endothelium, the virus may also damage the blood--brain barrier and enter the CNS by attacking the vascular system ([@b0020]).
4.5. Others {#s0085}
-----------
The biological properties of the CNS may facilitate exacerbation of the neurological damage caused by CoV infections. The CNS has a dense parenchymal structure and the usual lack of permeability of its blood vessels is a barrier to virus invasion. However, if a virus gains access to the CNS, it is difficult to remove ([@b0150]). Due to the lack of major histocompatibility complex antigens in nerve cells, the elimination of viruses in nerve cells depends solely on the role of cytotoxic T cells; however, the apoptosis of mature neurons after virus infection also has a relatively protective effect ([@b0240]). Furthermore, the homeostasis characteristics of the cells in the CNS also contribute to the continued existence of the virus ([@b0150]) ([Fig. 1](#f0005){ref-type="fig"} ; [Fig. 2](#f0010){ref-type="fig"} ).Fig. 1The mechanisms of coronaviruses infections and neurological damage caused by coronaviruses. The coronaviruses can cause nerve damage through direct infection pathways (blood circulation pathways and neuronal pathways), hypoxia, immune injury, ACE2, and other mechanisms. Meanwhile, the coronaviruses have detrimental effects to attack the lung tissue, and causes a series of lung lesions such as hypoxia. Furthermore, the coronaviruses can enter the nervous system directly through the olfactory nerve, and also enter the nervous system through blood circulation and neuronal pathways, resulting in neurological disorders. Ab: antibody; ACE2: angiotensin-converting enzyme 2; CSF: cerebrospinal fluid; ER: endoplasmic reticulum; TNF: tumor necrosis factor.Fig. 2Pathogenesis of nervous system injury caused by coronaviruses. ACE2: angiotensin-converting enzyme 2; BBB: blood brain barrier; IL: interleukin; MHC: major histocompatibility complexes; SIRS: systemic inflammatory response syndrome.
5. Conclusion {#s0090}
=============
CoV infections can affect the nervous system, and it is currently believed that CoV in concert with host immune mechanisms may turn these infections into persistent infections that may lead to neurological diseases. Therefore, patients with CoV infections should be evaluated early for neurological symptoms, including headache, consciousness disorder, paresthesia, and other pathological signs. Timely analysis of cerebrospinal fluid and awareness and management of infection-related neurological complications are key to improving the prognosis of critically ill patients.
This study was supported by the 10.13039/501100001809National Natural Science Foundation of China (No. 81703482 and 81974171 to C.Y.) and the Science and Technology Support (Social Development) Project of Bureau of Science and Technology of Changzhou (No. CE20195044 to L.Y.).
[^1]: These authors contributed equally to this work.
|
{
"pile_set_name": "PubMed Central"
}
|
When someone goes into cardiac arrest, "the chance of survival decreases about 10 percent with each minute," said Adele Peters at Fast Company. Time is of the essence. Recognizing that the patient has actually entered cardiac arrest — the first step in treatment — is difficult, particularly if the symptoms are being "relayed by a panicked friend or relative." In Denmark, emergency dispatchers "now have help from AI."
(Courtesy image)
When someone calls for an ambulance, an AI assistant called Corti transcribes the conversation, using machine learning "to analyze the words and other clues in the background," like someone gasping for breath, that point to a heart attack diagnosis. "The dispatcher gets alerts from the bot in real time." The technology, soon available in the U.S., "is an example of how artificial intelligence can supplement, not replace, humans."
|
{
"pile_set_name": "Pile-CC"
}
|
Blair Strang
Blair Strang (born 15 March 1972) is a New Zealand Maori actor. He is most noted for playing ambulance driver Rangi Heremaia on New Zealand's longest-running soap opera, Shortland Street, between 1995 and 2001 and Brian King on Nothing Trivial from 2011 to 2014.
Early life
Born to a Pākehā father and a Māori mother, he attended Saint Kentigern College, Pakuranga, where he was Head Prefect.
Filmography
Falling Inn Love – Anaaki
Nothing Trivial – Brian King
Kaitangata Twitch – Sebastian Cardwell
Shortland Street – Rangi Heremaia
Go Girls – Joseph
Doves of War – Joe Matich
Orange Roughies – D.S. Sean Parkes
So You Wanna Be a Popstar? – a singer
Power Rangers S.P.D. – Bork (voice)
Maiden Voyage: Ocean Hijack – Enrique
Deceit – Karl
Mataku – Uncle Eru (Season 1 Episode 3: Going to War)
Best Bits – Himself
Happy Birthday 2 You – Paramedic Rangi Heremia
Look Who's Famous Now – Himself
Interrogation
Homeland
Career
As well as Shortland Street, Strang has appeared in television dramas Doves of War (for TV3), Orange Roughies (TV 1), Interrogation (Prime TV), Go Girls and Nothing Trivial. He also made an appearance on So You Wanna be a Popstar?, hosted by Oliver Driver, and starring Katrina Hobbs, and regularly appears in a variety of roles as a guest star or extra.
He completed filming Māori Television's new family drama, Kaitangata Twitch, which is an adaption of the children's book by author, Margaret Mahy. He has also completed a successful New Zealand tour of the theatre piece, Whero's New Net and co starred in the TV drama Nothing Trivial and Homeland.
Personal life
He has an LLB from the University of Auckland, majoring in entertainment law, and is a practising family lawyer in Albany at North Shore Legal Chambers.
He married his former Shortland Street co-star Katrina Devine on 10 November 2001; the couple later divorced.
Awards
In 2008 he won Metro magazine's "Outstanding Performance of the Year" award in a theatre piece with Massive Theatre Company called Whero's New Net.
External links
References
Category:1972 births
Category:Living people
Category:New Zealand Māori people
Category:New Zealand male television actors
Category:New Zealand male soap opera actorsCategory:University of Auckland alumni
Category:New Zealand male Māori actors
Category:People educated at Saint Kentigern College
Category:20th-century New Zealand male actors
Category:21st-century New Zealand male actors
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Q:
SqlConnection Error for EXE stored on network drive
Execution of .Net Console EXE always fails with below error, this happens only when EXE placed on network drive, from local system it works without any connection error.
A network-related or instance-specific error occurred while establishing a connection to SQL Server. The server was not found or was not accessible. Verify that the instance name is correct and that SQL Server is configured to allow remote
connections. (provider: SQL Network Interfaces, error: 26 - Error Locating Server/Instance Specified).
Any assistance will be appreciated.
A:
The issue found with “missing permission at top directories in path hierarchy”.
After providing appropriate permission to top directories, EXE was able to connect SqlServer.
It appears that in absence of such permission security policy restricts application to access network resources.
|
{
"pile_set_name": "StackExchange"
}
|
Anne Bourdon
Anne Bourdon (August 29, 1644 – November 4, 1711) was a nun in New France. She was the first Canadian-born superior of the Ursuline order in New France. She was also known as Mère de Sainte-Agnès.
The daughter of Jean Bourdon, attorney general for the colony, and Jacqueline Potel, she was born in Quebec City. All of her three sisters joined religious orders. She became a novice in the order of the Ursulines of Quebec at the age of 14, and took her vows two years later, taking the name of Anne de Sainte-Agnès. She learned the languages of the native peoples from Marie of the Incarnation. She served as depositary, secretary of the chapter, assistant superior and mistress of novices. When the archives of the community were destroyed by fire in 1686, she reconstructed the archives from memory. In June 1700, she was elected superior for the congregation.
She died at Quebec City at the age of 67 of pleurisy.
References
Category:1644 births
Category:1711 deaths
Category:People of New France
Category:Ursulines
Category:Canadian Roman Catholic religious sisters and nuns
Category:People from Quebec City
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Summary: The Left finds a new cause justifying political violence — climate change. Let’s examine their justifications for violence and the reasons they find it necessary. This story reveals much about 21st century America, and why our political system is in serious trouble.
The Left has (again) brought violence to America’s colleges — suppressing conservatives’ speech by means ranging from sheep-like chanting to riots (throwing bottles, spraying mace, etc.). Now they have taken a small step to expanding their violence by attacking America’s infrastructure to “fight climate change.” The Right started this cycle of political violence, and the Left are accelerating it.
The Guardian gives space to Emily Johnston, an eco-terrorist (violence used for political purposes). She is a “poet and co-founder of 350Seattle.org.”
“Normal methods of political action and protest are simply not working. If we don’t reduce emissions boldly and fast, that’s genocide. …As recent months have made clear, climate change is not only an imminent threat; it is an existing catastrophe. …if we don’t reduce emissions boldly and fast; business as usual is now genocidal. …I have little doubt that the awful weather events of the last couple of months played some role in this — it’s not just scientists seeing the truth anymore: the building is indeed burning, and all the world’s babies are in it. “
She makes no attempt to justify her claims. As for recent weather, many climate scientists have said that it was business as usual (e.g., see the hurricane data). But the useful idiots on the Left applaud anyway!
By “Gaius Publius” at Down with Tyranny.
As evidence Publius cites the latest iteration of the “Antarctica will flood the world” story that has circulated for decades, based on Eric Holthaus’ one-sided alarmist screed about it at Grist. The Left regards alarmist propaganda as gospel, and circulated it widely. But Holthaus’ version was so extreme that even The Guardian debunked it. See more about this issue here.
Why Leftists fear a certain planetary apocalypse?
America has been bombarded for thirty years by predictions of certain doom from climate change. These were at best weakly supported by the reports of the IPCC. Over time the Left’s opinion of the IPCC went from “gold standard of climate science” to “too conservative” (e.g., see Inside Climate News, The Daily Climate, and Yale’s Environment 360). But their campaign failed to terrify Americans into supporting the Left’s agenda.
With the creation of new scenarios of climate change for the IPCC’s AR5 (Representative Concentration Pathways), activists hit the jackpot. The worst case scenario was described in “RCP 8.5: A scenario of comparatively high greenhouse gas emissions” by Keywan Riahi et al. in Climate Change, November 2011. It included this misrepresentation: “Compared to the scenario literature RCP8.5 depicts thus a relatively conservative business as usual case with low income, high population and high energy demand due to only modest improvements in energy intensity.”
This became the Left’s vision of our future, and the basis of one of the major research programs of our time. Scores of papers described the consequences of this worst case future. All were horrific, as they should be for a worst-case scenario (see a sample of them here).
It was a phenomenal waste of resources, which continues even today. It’s an extended proof that “pouring more water on a rock does not make it wetter.”
Many of these studies generated lurid news coverage, describing this apocalyptic future as our destiny — unless we make radical changes to our economy, our government, and our society. It is the climate change version of “if it bleeds, it leads”. See examples here. More recent, and more bizarre, examples are
“The Uninhabitable Earth” By David Wallace-Wells in New York Magazine — “Famine, economic collapse, a sun that cooks us: What climate change could wreak — sooner than you think.”
“Are we headed for near-term human extinction?” by Zach Ruiter at Toronto NOW — “Recent studies suggest it is irresponsible to rule out the possibility …”
“Are we doomed?” by Sammy Roth, writer of USA Today’s “Climate Matters” newsletter.
These stories greatly exaggerate the science, and are based on worst case scenario which is the opposite of “business as usual”. RCP8.5 assumes large changes in long-standing trends. Most importantly, it assumes fertility in the Africa will not crash — as it has done everywhere else — and that technological progress stalls (in the real world, it is accelerating). See details here.
The Left’s leaders have borrowed a page from the fascist textbook: exaggerate a threat into an existential danger. Use fear to justify extreme measures and unify your followers. There were two major reactions to this campaign. The Left believes, and has grown increasingly terrified. The Right remembered the Left’s many previous fear campaigns since the 1960s — all of which have proved false (see a few of their classics). They became skeptics. Some became outright deniers of climate science (e.g., believing there is no “greenhouse effect”).
Conclusions
Left and Right each see a different future for the world. Neither pays much attention to the IPCC. Both cherry-pick individual papers that support their biases and declare them to be Truth (the extreme version of this is what Andy Revkin calls “single-study syndrome“). People on both political extremes in America tend to be immune to logic and facts,
This makes resolution of the political debate almost impossible in the foreseeable future. There are ways to break the gridlock (such as testing the models), but that won’t happen under current conditions. This sets the stage for terrified Leftists to resort to violence, applauded by the larger population of Leftists.
Of course, the Left will scream “unjust” when the Right responds with violence on those issues they consider existential threats (as they will). If so, we will have started another cycle of violence.
This is all very Weimar. This kind of slide to political violence didn’t end well for post-WWI Germany. Political violence won’t end well for us. But this is unnecessary. We need not be led like sheep by our political extremists, both sides of which work against us.
For More Information
Recommended: To better understand the state of knowledge — and the massive uncertainties — in climate science today, I recommend reading about the “Climate Change Statement Review Workshop” Climate held by the American Physical Society (APS) in NYC on 8 January 2014. a a panel of distinguished physicists questioned three climate scientists who support the climate change consensus and three climate scientists who do not. See this summary by Rupert Darwall and the full transcript.
If you liked this post, like us on Facebook and follow us on Twitter. For more information about this vital issue see the keys to understanding climate change, all posts about political violence, about extreme weather, and especially these …
Two interesting books about climate change.
To learn more about the state of climate change see The Rightful Place of Science: Disasters and Climate Change
by Roger Pielke Jr. (Prof of Environmental Studies at U of CO-Boulder).
Polar bears provide a test of climate forecasts. Their story is well-documented in Dr. Susan Crockford’s powerful 2017 book Polar Bears: Outstanding Survivors of Climate Change
Like this: Like Loading...
. It’s a classic example of telling the rest of the story about “doomed polar bears.” She describes the remarkable resilience of polar bears — top predators in one of Earth’s harshest environments — to climate change.
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
"Learn a Parametrization of a Manifold" Demo not working
I'm trying to go through the Mathmetica online sample here:
Learn a Parameterization of a Manifold
However, for some reason, when I get to this step
{{xmin, xmax}, {ymin, ymax}} = CoordinateBounds[manifold, .2];
Show[plot, StreamPlot[ trained[{x, y}] - {x, y}, {x, xmin, xmax}, {y, ymin, ymax}]]
it doesn't plot the stream lines. I tried on both my local copy of Mathematica as well as the cloud version.
Using StreamPlot with any other function does work, but doing it with the trained data set just gives an empty/blank image.
A:
Usually it throws a message about non numeric result for given arguments but it is silent now, nevertheless the same fix works:
f[x_?NumericQ, y_?NumericQ] := trained[{x, y}] - {x, y};
Show[plot, StreamPlot[f[x, y], {x, xmin, xmax}, {y, ymin, ymax}]]
I'm not entirely sure why and don't have time to investigate but I decided that you will be more interested in answer than explanation.
|
{
"pile_set_name": "StackExchange"
}
|
The present invention relates generally to a system and method for the loading and unloading of dynamic grammars and section-based language models in a speech recognition system.
For most speech recognition applications, training speakers to dictate in an organized fashion is essential to increasing the efficiency of the system. A speaker trained to dictate certain language necessary for domain-based diagnosis, reporting, and billing documents can greatly increase the accuracy and efficiency of report generation. In addition, a speaker trained to dictate certain section-specific information in an organized and orderly fashion will further increase the accuracy and efficiency of the speech recognition system. However, even the best trained speaker can improve the accuracy and efficiency of an overall speech recognition system by only so much.
Speech recognition systems have for many years been designed with language models specific to certain domains. For example, a speech recognition system with a language model in the radiology domain will improve efficiency of the speech recognition engine when compared to such a system implemented with a general domain language model. The domain-specific language model is typically created using documents from the intended discipline of the speaker.
Specific domain language models are advantageous over general domain language models because the data within the specific domain language model is uniquely tailored to the intended speakers in that particular domain. The data within the specific domain language model is narrower when compared to the general domain language model, hence any speech recognition engine will be able to work more accurately and efficiently with a narrower domain.
Notwithstanding the advancements in speech recognition over the last few years, further advancement is still possible. For example, it is well known that different medical disciplines require certain documents and reports. It is also well known that documents can be further broken down into sections and sub-sections. In the medical field, virtually every medical document consists of headings and subheadings where information related to these headings and subheadings is often quite distinct in structure and content from other sections of the document. For example, a discharge summary report will likely have a section that deals with the patient's history and physical examination, typically a narrative section. There may be another section that concerns the principle diagnosis, which is typically a list of disease names. Another section to may include medications which themselves have an organization and content quite distinct from everything else in the document. This relationship between document structure and content is pervasive in medical reports and also common in other disciplines. Although some sections are more narrative and some are more structured in very specific ways, these structures tend to be fairly limited and repetitive within a given section. Narrative sections can be also highly repetitive utilizing a limited number of lexical and structural patterns. It is possible to exploit these repetitive patterns to improve accuracy and efficiency in report generation through automatic speech recognition.
Distinct section organization of reports and repetitive structural and lexical characteristics of sections is not limited to the medical domain; it is also found in other domains, such as public safety, insurance, and many others.
Most automatic speech recognition applications accommodate for the particular domain by developing domain-specific language models that relate to the discipline itself rather than to any kind of structural and organizational regularity in reports in the specific domain. Hence, in the medical domain, there typically exists either a general medical language model or more likely a language model that is very specific to the discipline or sub-discipline. For example, language models might be developed which are very specific to the documents and the language that are used by physicians in general in oncology, pediatrics, or other particular sub-disciplines.
In the event a physician practices across several medical domains, the physician may switch dictation domains from general domain dictation to specific domain dictation; or from one specific domain to another specific domain. The physician may dictate a letter that has general medical content which is quite different from a technical report such as a cardiac operative note. In this example, the speech recognition system needs to be nimble enough to switch from a general language model to a more specific language model.
It has been found that a speech recognition system having the ability to change domains within the context of a single document is desirable. Complicating this situation is the fact that there are no standards for the structure and organization of medical reports. Therefore, there exists a need for a speech recognition system having the ability to change domains within the context of a single document in any arbitrary way.
There have been attempts to improve speech recognition by using a language model that changes domains within the document context. Such a system is described in published U.S. patent application 20040254791 entitled “Method and Apparatus for Improving the Transcription Accuracy of Speech Recognition Software” with listed inventors Coifman, et al. Coifman et al. use standard and already existing automatic speech recognition technologies to perform contextual and adaptive ASR by domain, document type, and speaker. Coifman, et al., teach the use of sub-databases having high-likelihood text strings that are created and prioritized such that those text strings are made available within definable portions of computer-transcribed dictations as a first-pass vocabulary for text matches. If there is no match within the first-pass vocabulary, Coifman, et al. teach a second pass where the voice recognition software attempts to match the speech input to text strings within a more general vocabulary. This system as taught by Coifman, et al. is known as a two-pass system. A drawback exists in the two-pass system in that it requires an assumption that there exists well-defined structured data, most likely input field type data. Such a system is not applicable in any environment existing off-line, such as a traditional telephony dictation system, without structure because there is no mechanism to identify structural units, their respective contents, and how the units will interact with the system. Unlike a freeform dictation approach, the two-pass system requires defined and clearly delimited data fields within the speaker dictates.
In addition, the two-pass system requires the use of a fixed set of word combinations or “text strings” for each data field which limits the repertoire of text strings to those that have been observed to have been dictated or are allowed in certain sections or fields.
Further, the two-pass system requires the use of a general vocabulary recognition system if no match is made to this repertoire of text strings, and as opposed to a speech recognition system that has vocabulary and grammatical constraints provided by knowledge of the text strings that have been observed to have been dictated in certain sections or fields.
Heretofore, there has been no system or method for loading and unloading of dynamic grammars and section-based language models in an automatic speech recognition system.
There exists a need for such a system and method that can operate with clearly defined data fields, but does not require the use of data fields within which the speaker dictates.
There also exists a need for such a system and method that is constrained by knowledge of the text strings that have been observed to have been dictated in certain sections or fields.
There also exists a need for such a system and method that is not limited by vocabulary and grammatical constraints provided by knowledge of the text strings that have been observed to have been dictated in certain sections or fields.
There also exists a need for such a system and method that dynamically identifies the larger context in which words are being used, with or without the presence of headings or key words, and applies section language models or grammars when there is evidence in the dictation that it could be used.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
1. Field of the Invention
The invention is related generally to pistons for internal combustion engines, and more particularly to pistons having internal cooling chambers for cooling the pistons during operation.
2. Description of the Related Art
It is desirable for engine manufacturers to increase the temperature of the combustion of the air/fuel mixture in the combustion chamber of the cylinder in order to increase the fuel efficiency of the engine and decrease emissions. Therefore, there remains a significant and continuing need for improved pistons with cooling systems capable of allowing the piston to withstand increased temperatures.
However, with increased heat of combustion, there is a corresponding need to design pistons that can operate in such an environment. One approach has been to cool the upper region of the piston that is exposed to the heat of combustion by forming an open or a closed cooling chamber in the piston and directing a stream of cooling oil from below into the chamber to help extract some of the heat of combustion from the affected regions of the piston. Such a cooling approach, however, has its limits and may not be adequate or most efficient under all conditions. Another alternative approach has been to encapsulate a cooling medium, such as sodium, within a sealed chamber in the upper portion of the piston as the principle means to extract the heat of combustion from the piston. This too has its limits and cannot always adequately cool the piston with ever-increasing combustion temperatures.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Recording devices of the type employing magnetic tape cartridges for storage and subsequent transmission of data have long been known. In general, such cartridge receiving devices comprise a multiplicity of mechanical components designed to function in an interrelated manner to receive and hold a magnetic tape cartridge during the recording and transcription of information thereon. An example of such prior art devices is embodied in the DGD-1 Data Cartridge Drive manufactured and distributed by the 3M Company. Because of the plurality of components which go to form the mechanical combinations comprising the prior art type cartridge receiving and locking mechanism, substantial costs are incurred in the construction, assembly, and maintenance of such devices. In addition to the added component and construction costs entailed in the prior art type configurations additional factors to be considered before a commitment is made to use such prior art structures include the probable replacement factor and the maintenance costs both of which may be relatively high due to the substantial number of individual components used in the construction.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Wednesday, February 11, 2015
When Mona Finds Winnie! ((And a Special Giveaway!))
This Give-Away is CLOSED! Congrats to our Lucky Winner, Robyn in Texas!
This is going to be a long post. So just grab a cuppa, settle in, put your feet up and hang out for a while..because it’s worth it!
When Mona and I ran around Winston Salem, antique mall hopping while her hubby was sitting in some VA office somewhere filling out piles of paperwork, I told her to be on the look out for a featherweight box. They show up in the most unusual places and you will almost miss them if you don’t know what you are looking for.
She had my featherweight and the case she knew what a black box featherweight case looks like…we just never thought we’d find TWO!
Yes. TWO!
We rounded a corner, I pointed my finger excitedly and exclaimed “Black Box! Black Box!” It was all I could get out of my mouth.
We checked it, a featherweight indeed ---only when we plugged it in, it proved to be a dud. The light turned on, the foot pedal didn’t work. She ran out to the car to get the foot pedal from mine so we could try it to eliminate whether it was a foot pedal issue or worse.
It ran –intermittently. And it struggled. A lot. It’s not a foot pedal issue, it could be electrical – it could be the motor. At any rate THAT one was not worth the taking because on top of the asking price, we’d have to pay to have it fixed, and it had issues of unkown origin.
So we left. And went to the next mall….and wouldn't you believe it we almost didn’t see this one in the glass case below our knees? We’d walked past it twice!
Now this little sweetie has had a hard life. Or a good life of lots of sewing, depending on how you look at it.
Chrome hand wheel, scroll face plate– early model!
Her decals are about worn off. Her clear coat is nearly gone in spots.
She PURRS. She HUMS. She is full of verve and vigor and just begging to be adopted.
And she came home for Mona!
Yeah, it was love at first sight!
SO excited. Because of the condition the seller came down to $225.00 which was very reasonable. The case is loaded. There is an attachment box with EVERYTHING including the manual. There are several bobbins. The bobbin case was there ---she just hadn't been cleaned up in a LONG LONG TIME.
It was decided that WINNIE ((So named because we found her in Winston Salem!)) would come home with me so I could give her the once over.
Ready for a clean up job on my table.
Serial number date her to 1937!
Check out the remains of that rubber foot --- that grey mess! I have 4 new rubber feet to go on her, but I’m going to let Rick chisel the old concrete rubber away and get the screw out – that’s quite a job, the old ones really did solidify like cement!
Bobbin area…GUNKY!!!
Behind the face plate…oh boy!
Around the feed dogs under the needle plate…ewwww!
I use a soft bristled paint brush to get all of the lint and gunk out. Where a brush won’t reach I’ll use a cotton swab. It takes time to get all the goobers out – at this point I’m wondering when she was last sewn on!
The manual will tell you every place you need to oil. I oiled liberally. I also used a special concoction for her gears and motor:
Nova Montgomery’s Motor Lubricant!
Nova had sent me a tube to try, and this was the perfect time to do it! I followed Nova’s instructions in her video:
It really was easy!
You can find more info on Nova’s website HERE. She also carries lots of goodies for featherweight machines, so bookmark her as a resource.
Giving Winnie a test run!
New needle, cleaned and oiled and lubed and threaded and ready to roll.
Great tension!
I am so happy for Mona. Winnie will be going up to the Mountain to her cabin this weekend while I’m gone. She’s found a new forever home with a new quilter who will love her greatly.
The feather-mate tables are made by the Greer family right here in the USA. I bought one a couple of years ago, and last week I ordered this second one because I kept forgetting to either take it to the cabin from home, or forgot to bring it back home and left it at the cabin and I decided I really needed two.
The best thing about the Feather-mate table as well as all of the other models of sewingmates tables? They fit MORE THAN ONE MACHINE! I can use this table with ANY of my vintage machines because of these:
Hand lathed adjustable aluminum legs!
These legs are turned on a vintage lathe by the Greer’s son. It’s a family business, and everyone is involved. These legs will give you double the options that you see here, because you can turn them upside down for a greater range of height increments.
If it doesn’t say GREER it’s not a Sewing Mate!
The screws are counter sunk and the table top is smooth smooth smooth! Unlike inexpensive black tubular legs that other makes have, these will not pop off half way to retreat leaving you to prop your lopsided table on a phone book to get it level. Yes, I’ve had that happen in the past. This is sturdy hardware!
It works with my featherweight, it works with my 301, it works with ANY vintage machine I have!
The unique L shape is PERFECT for traveling. A flat bed machine doesn’t need a full surround like a free arm machine would. And did you see the easy carry handle?
If you have a Featherweight, you are going to WANT a Feather-Mate!
So guess what we are going to do? GIVE AWAY A FEATHER-MATE!
The Greers have offered up a prize for one lucky winner residing within the USA! ((Please understand, this is a heavy item, and it already has an $89.00 value so we can’t ship overseas for this giveaway.))
Simply leave me a comment in the comments section below to be entered to win. One entry per person. Please leave your name and email address if you are signing in as anonymous. If you are logged in with a blogger or google+ account, please check that your email address is visible in your profile. We MUST be able to reach you by email if you are drawn. If we can’t reach you by email, we will have to draw again.
When in doubt, just leave your email!
No, you can’t email your comment in, you can’t comment in the guest book, you can’t comment on Facebook or instagram…it has to be HERE. On this post. So I can use the random number generator to choose our lucky winner. It’s only fair that way!
If you are reading us on an iphone or ipad after clicking a link in facebook you must open this page in a new browser or safari window before you can comment. Your device still thinks you are in facebook even though you do not think you are. If you still see the blue bar at the top of your screen…trust me. You are still in facebook!
Same goes for Blog-lovin. Get OUT of blog-lovin and view our page directly. You can’t always comment while reading in a blog reader service. Make sure our address starts with http://quiltville.blogspot.com No bloglovin in the address!
1,757 comments:
Would love to win in your giveaway. Recently found your webpage and usually fall asleep watching archives after a long exhausting day at work. Have to watch them a couple of times to catch everything. Love [email protected]
I'm glad that Mona has found a good machine to start with. I love my feather weight that I found on Craigslist and 'Louise" is just great. She hadn't been used in almost 15 years according to the owners grand-daughter. I would love to have this to go with her...maybe bring her to class the next time you're here playing with us...lol
OOh! Ooh! Pick me!! (Image-a little kid jumping up and down, waving her arms franticallly :) )I have a 1935 Featherweight. Her name is Floye (who was the previous owner), I purchased Floye at an antique mall here in Swannanoa. You really need to make a trip to Asheville area to browse the antique malls here. Anyway, this would be a perfect addition for her.
I am sooooo happy for Mona! The look on her face clutching her new baby is wonderful. I got my FW "Lilly" for Christmas last year and do love her too. I would be delighted to have the little table for her too. I'll definitely have to check out their website...just in case.Thank you Greers and Bonnie.
I have a sewing mate table for my other machines. They even had directions to reverse one of the pieces to fit my Bernina 750 written on the invoice. So it fits my Pfaff, my Jenome and my Bernina. I don't have one for my feather weight and would love one!
What a fun day!! Sew happy for Mona! Love the feather mate, would love to have one! Thanks for the give away!My featherweight is named Betty. Found her on Craig's list, I texted about it, someone was coming to look at her, so I gave up on her, who would pass up on it? Well, next day got an text, the person never showed up! What! Couldn't believe it! Yes, I want her! She is named after the owner, barely used, everything there.
Oh Mona is going to LOVE LOVE LOVE sewing with Winnie!! What a get treasure! Would love to win this great table!! thanks for the opportunity!! AND THANKS for all that you do for us. You are such a caring and giving gal!
Wow, this would be a wonderful prize! I own a FW too. Annie was a gift from a wonderful friend of mine. Just this year I found a case for her too, for $25. I have a desk that belonged to my Dad and if I had this table it would be a wonderful accessory to pair with my Annie!Thank you Bonnie, for all you do for us quilters! :)(just in case, my email address is sewangelic at sbcglobal dot net )
[email protected] would love to have a table. I went to one of Nova's Featherweight maintenance classes and highly recommend it to anyone who owns a FW. P.s. I'm almost through piecing my Grand Illusions on my FW named Peanut.
I'd love a chance to win this. I wasn't aware extensions were made for vintage machines and I have several. My machines would be so much easier to use with one of these. Thanks for the opportunity to win one.
How fun! This is literally the FIRST time I've been to your blog via "Quilt Hollow". Was told to check you out since we are heading to NC in roughly 6 weeks to look for our "forever after" home. Used to blog heavy but now focus mainly on IG (as "sewcindy" and I already follow you there). This sweet gem of a table would be GREAT to travel with!! Look forward to following you regularly, learning about "Bonnie Hunter" and ABSOLUTELY enjoying NC! Thank you. (Cindy) [email protected]
This was just the most awesome post! Great story about finding Mona's Featherweight, great video about lubricating our machines, and great information about the Feathermate. I never knew about them. Thanks for all the wonderful tips and info you pass on to us, and thanks too, for offering the giveaway!
I love to bring old Singer sewing machines back to life. You are very lucky to live in a place where you can find old sewing machines. It is amazing what a little love can do for a machine. Keep rescuing sewing machines!!!!
Holy moly! Could not believe your blog this morning. I have just started getting into VSM's and have 10 already. I would love to have one to use with my 301A! Still looking for a FW. Maybe someday at the auction or at an estate sale. [email protected]
Thank you Bonnie for all the wonderful info you share with us . This awesome table would go great with my little featherweight. Thank you Greer family for making a great product and for your [email protected]
I love, love, love my featherweight. It's the machine I use when we travel in our RV. Ladies with their Berninas and whatever's see my little black machine and ask me, "is that a toy?" When I tell them about all the Bonnie blocks and leader/Enders I've sewn on her that ends the discussion and off they go to find their own. Bonnie, thanks for all you do and for the inspiration. I'd love to be the winner this time. That table is awesome.
Oooooooh! What a wonderful giveaway ! Thanks so much for the chance to win. Either my featherweight Dorothy or my 301 Lucy would love to dress up with this cute little skirt! They are both such hard workers they deserve it! Thanks for a chance to win. [email protected]
What a great idea for a giveaway. I would love to have one of these to fit my Secretariat! Yes, because she is the best thoroughbred in the stable!! She will be coming with me to Quilt Camp in Maine in October to see Bonnie!! Thanks for this opportunity, Bonnie and Greer! [email protected]
I am going to my first retreat in March and I am taking Louise, my featherweight. She is named after my grandmother, who would let me sew on her treadle when I visited in the summer. I would love to win this table. Thank you for the chance. Ann in Michigan. [email protected]
I've just bought my first Featherweight and I'm waiting (not too patiently) for the needed/missing parts to make her run like a top! I would LOVE to have a table to complete my newest addition! Lynne FraasMy email is: [email protected]
I totally understand love at first sight when finding a Featherweight. So happy for Mona and Winnie. She will be well loved. Mona is lucky to have a friend like you to guide her. Thanks for the chance to win the sewing table. Would be great to take to retreats with my girl, Sewphie! Love reading about all your adventures on your blog. [email protected]
So Happy for Mona's find. Perfect gift for Valentine's Day. Been meaning to get one or two of these tables. Lets give it a try for a win. If no win, I will surely need to make the purchase. Bonnie thanks for all your help, instructions, patterns and sharing. Happy Valentine's day.
I would love to have one of these tables for my Featherweight that I take to retreats . Have the one I use at home in it's own table. What great people to make these things for us quilters. Must check out their website. Thanks, Bonnie
Would love a Greer featherweight table. I have one for my bernina and it's awesome. I'm still on the hunt for me first featherweight. I just wish I had you shopping with me so I wouldn't make aid take!!!
Oh Yes!! throw my name in! My hubby made a wooden extension for my kenmore--good job but clunky and heavy. The feathermate would be lovely to have when I use my featherweight.Anita [email protected]
what a generous giveaway! I have several vintage machines that could use a wonderful extension like this. Currently working on a singer 306 K and AM ready to find a way to use it without having another cabinet in the sewing room! Perfect solution thanks for the opportunity to win to both the company that donated and you [email protected]
|
{
"pile_set_name": "Pile-CC"
}
|
Share Email 45 Shares
RUTLAND — An initiative to change the city’s charter to make it gender-neutral led to a debate over whether it’s something the city can afford to spend time on.
The Board of Aldermen at a meeting Monday night approved moving forward with the proposal, but not without one board member voicing his dissent.
Get all of VTDigger's daily news. You'll never miss a story with our daily headlines in your inbox.
Alderman Tom DePoy said that while he could support such a proposal in the future, now was not the time. He said City Attorney Matt Bloomer already has a lot on his plate, and the city is seeking an outside legal firm to help him. Adding something else for the city attorney to do right now, the alderman said, would create an “undue burden.”
“It’s silly. It’s a waste of time,” DePoy said.
Alderman Ed Larson, who proposed in April that the city review its charter to make it gender-neutral, disagreed.
He said having the city attorney review proposed changes won’t take much time, and it doesn’t have to be done immediately. It would not go before voters, Larson added, until Town Meeting Day in March.
“It’s very simplistic. It’s something our city attorney can go through in five minutes,” he said. “This is not a difficult, expensive situation.”
In several places, Larson said when he first proposed the review, the charter contains the word “he” when referring to positions, such as the police chief.
VTDigger is underwritten by:
Alderman William Notte said Larson has already reviewed the charter and suggested where changes can be made.
“Having the city attorney look at this is just a matter of dotting the i’s, crossing the t’s,” Notte said. “If you want a city government that everyone participates in, it has to appear to be open to all. These are very simple changes that show how inclusive Rutland CIty government already is.”
Notte added that such changes are long overdue.
“The charter is a creature of our times. These are much more inclusive times,” he said. “It’s very much a document of the ’20s and ’30s.”
The board’s Charter and Ordinance Committee met earlier this month and agreed to move forward with the proposed changes.
Larson proposed about seven places in the charter that would need to be changed from “he” to either “they” or “he/she,” according to the minutes of that committee meeting.
The full Board of Aldermen on Monday night voted to send those proposed changes to the city attorney for review. DePoy cast the lone vote in opposition.
Any changes to the charter, the city’s governing document, will ultimately require approval of city voters and the Legislature.
|
{
"pile_set_name": "OpenWebText2"
}
|
Q:
create array which is filtered from array of dictionary with the array as a input
I have one dictionary and one array as shown below
Dictionary :
{
"value": [
{
"ctgid": "1",
"catename": "tow"
},
{
"ctgid": "2",
"catename": "towrequest"
},
{
"ctgid": "3",
"catename": "electrical"
},
{
"ctgid": "5",
"catename": "plumber"
},
{
"ctgid": "6",
"catename": "maintenance"
},
{
"ctgid": "7",
"catename": "home"
},
{
"ctgid": "8",
"catename": "computer"
},
{
"ctgid": "9",
"catename": "1q2w"
}
]
}
Array of catename:
(
tow,
towrequest,
plumber
)
There is a list of catename in Array.From above dictionary I want to create the array of ctgid related to catename in above array.
So my final output should be :
Array of catgid :
(
1,
2,
5
)
Note : I can do it with loop , but I don't want to use any loop.
A:
//Json data
NSString *jsonString = @"{\"value\":[{\"ctgid\":\"1\",\"catename\":\"tow\"},{\"ctgid\":\"2\",\"catename\":\"towrequest\"},{\"ctgid\":\"3\",\"catename\":\"electrical\"},{\"ctgid\":\"5\",\"catename\":\"plumber\"},{\"ctgid\":\"6\",\"catename\":\"maintenance\"},{\"ctgid\":\"7\",\"catename\":\"home\"},{\"ctgid\":\"8\",\"catename\":\"computer\"},{\"ctgid\":\"9\",\"catename\":\"1q2w\"}]}";
NSData *data = [jsonString dataUsingEncoding:NSUTF8StringEncoding];
//Converting the data into NSDictionary
NSDictionary *json = [NSJSONSerialization JSONObjectWithData:data options:0 error:nil];
//Get the array of objects
NSArray *array = [NSArray arrayWithArray:[json objectForKey:@"value" ]];
//Category filter names
NSArray *filteCatename = [NSArray arrayWithObjects:@"tow",@"towrequest",@"plumber",nil];
//NSPreicate to filter the array using "in" constrain
NSArray *filtered = [array filteredArrayUsingPredicate:[NSPredicate predicateWithFormat:@"(catename in %@)", filteCatename]];
You can use NSPredicate to filter the NSArray directly without loop.
A:
I haven't tested , but hopefully this is it .
NSMutableArray *arrCatID = [NSmutableArray alloc]init];
for (NSDictionary *instance in myDictionary){ // myDictionary is the values of "Value"
NSString *content = [instance objectForKey:@"catename"];
for (NSString *catName in stringArray) { // stringArray --> has already the CatNAmes with you
if (catName == content) {
[arrCatID addObject:[instance objectForKey:@"ctgid"];
break;
}
}
}
|
{
"pile_set_name": "StackExchange"
}
|
Q:
Switching between different workbooks without using .activate
I want to reference different workbooks in my code and I have used this code:
Dim Basicwb As Excel.Workbook
Dim Basic As Excel.Application
Set Basic = New Excel.Application
Set Basicwb = Basic.Workbooks.Open("X:\Job\Masroori\3-042-PMS.xlsx")
but the problem is how can I refrence it if I dont want to open it each time. I used this code (without .Open) but I get this Error! : "Subscript out of range"
Set Basicwb = Basic.Workbooks("X:\Job\Masroori\3-042-PMS.xlsx")
Also, I dont want to activate the workbook each time, Is there any way?
A:
Taken from the msdn site for the Workbooks property:
"Returns a Workbooks collection that represents all the open workbooks. Read-only."
hence the last line of your code gives you an error since the file is not open. AFAIK, you cannot reference objects within a workbook if that workbook is not open. You can access whatever a workbook has without activating it (so without using .Activate), but it has to be open. Maybe this SO question is of help to you:
Open Excel file for reading with VBA without display
If your workbook is open, you can do the following:
Dim wBook as Excel.Workbook, rngTemp as range
Set wBook = workbooks("wbName.xls")
With wBook
' Do stuff, no need to activate. Example:
set rngTemp=.sheets(1).usedRange
End With
I hope this helps?
|
{
"pile_set_name": "StackExchange"
}
|
INTRODUCTION
============
Patients with IRIDA (iron-refractory iron-deficiency anaemia) absorb insufficient amounts of iron from the diet and respond inadequately to oral ferrous sulfate therapy and intramuscular iron dextran injection \[[@B1]\]. As a consequence of this iron deficiency, anaemia develops that is characterized by hypochromic microcytic erythrocytes and low transferrin saturation. IRIDA is usually diagnosed by routine haematological screening during childhood. Frequently, the affected subjects do not show the typical clinical symptoms of iron deficiency; pallor, dry skin or lesions at the corners of the mouth have been reported in only a few cases \[[@B2]--[@B4]\]. IRIDA is a rare autosomal-recessive disorder \[[@B5]\] mapped to chromosome 22 (22q12.3--13.2) \[[@B2]\], which contains *TMPRSS6* (transmembrane protease serine 6, also known as matriptase-2) the gene responsible for IRIDA \[[@B6]\]. *Tmprss6* was initially characterized in the *mask* mouse, in which chemically induced mutations resulted in the loss of the Tmprss6 protease domain. Similar to IRIDA patients and *Tmprss6*^−/−^ mice \[[@B7]\], the mouse model is hallmarked by microcytic anaemia due to ineffective dietary iron absorption \[[@B8]\].
TMPRSS6 is a member of the TTSP (type II transmembrane serine protease) family and is mainly expressed in the liver \[[@B9]\]. Similar to other TTSP members, TMPRSS6 consists of a short N-terminal intracytoplasmic tail, a type II transmembrane domain, a stem region composed of two extracellular CUB \[complement factor C1s/C1r, urchin embryonic growth factor and BMP (bone morphogenetic protein)\] domains and three LDLR (low-density-lipoprotein receptor class A) domains and a C-terminal trypsin-like serine protease domain \[[@B9]\]. Between the transmembrane domain and the stem region there is a low homology SEA (sea urchin sperm protein, enteropeptidase and agrin) domain \[[@B10]\]. TMPRSS6 is rich in post-translational modifications. Consensus sites for N-glycosylation are located within the SEA domain, the second CUB domain and within the second LDLR domain \[[@B11]\]. A total of 37 evolutionarily conserved extracellular cysteine residues located within the CUB, the LDLR and the protease domains are at least partially involved in the formation of disulfide bridges \[[@B11]\]. *In silico* analysis of human TMPRSS6 revealed a possible phosphorylation site within the intracytoplasmic tail, which was hypothesized to be involved in signal transduction \[[@B9]\]. TMPRSS6 is produced as a zymogen, a single chain inactive proenzyme, which auto-activates itself by cleavage at an arginine residue at the consensus site RIVGG between the prodomain and the catalytic domain. The activated catalytic domain remains attached to the rest of the protein at the cell surface via a single disulfide bridge \[[@B9]\].
Functionally, TMPRSS6 has been linked to the hepatic iron sensing pathway by the observation that hepcidin levels are strongly increased in IRIDA patients and *Tmprss6* mutant mice \[[@B2],[@B6],[@B8]\]. Hepcidin is a small peptide hormone produced by the liver in response to iron levels, inflammatory signals, hypoxia and the erythropoietic drive. Hepcidin controls systemic iron fluxes by binding to the iron exporter ferroportin, inducing its internalization and degradation \[[@B12]\]. Thus high hepcidin levels, as observed in IRIDA, inhibit intestinal iron absorption and macrophage iron release.
Under physiological conditions, TMPRSS6 down-regulates hepcidin levels by binding and proteolytically degrading the hepcidin activator and BMP co-receptor HJV (haemojuvelin), a protein mutated in hereditary haemochromatosis type 2 \[[@B13]\]. *TMPRSS6* mutations that decrease its proteolytic activity and prevent HJV cleavage cause increased hepcidin levels that impair iron release from the duodenal enterocytes and macrophages \[[@B13]\]. *TMPRSS6* mutations linked to IRIDA are detected throughout the *TMPRSS6* gene. These include missense, nonsense, frameshift and splice junction mutations \[[@B14]\]. Missense mutations are predominantly located in the CUB (G442R), LDLR (D521N, E522K) and protease (L674F and R774C) domains. Only a single mutation so far has been reported in the SEA domain (A118D) \[[@B15]\].
In the present paper, we report a novel homozygous missense mutation (c.422A\>G) in exon 4 of *TMPRSS6* that replaces a tyrosine residue with a cysteine residue at amino acid 141. Interestingly, this mutation, located in the SEA domain, abolishes TMPRSS6 autocatalytic activation, causing an increase in hepcidin levels and the characteristic IRIDA phenotype. Together with a previous report \[[@B15]\], our finding suggests that the SEA domain plays an essential role in TMPRSS6 maturation and yields new insights into the proteolytic activation mechanism of this TTSP family member.
MATERIALS AND METHODS
=====================
Urinary hepcidin analysis
-------------------------
Hepcidin analysis was performed essentially as described previously \[[@B16]\]. Briefly, morning urine from the patient and from four age-and sex-matched healthy volunteers was centrifuged for 5 min at 3000 ***g***. After centrifugation, 7 μl of supernatant and 3 μl of 0.1M ammonium acetate buffer (pH 6) were mixed, incubated for 5 min at room temperature (22 °C) and directly applied to a pre-activated CM10 ProteinChip. Following 30 min of incubation in a humid chamber, the CM10 strip was washed three times with 30 mM ammonium acetate (pH 6) and air-dried. A total of 1 μl of SPA (sinapic acid) was added on to each spot, air-dried and reapplied. ProteinChips were read using a PBS IIc SELDI--TOF (surface-enhanced laser-desorption ionization--time-of-flight) mass spectrometer (BioRad Laboratories) pre-calibrated with a standard reference including synthetic hepcidin. Data acquisition parameters were set up to the following: high mass 50000 Da, mass optimization from 1500 to 10000 Da, laser intensity 180, detector sensitivity 9, mass deflector 1500 Da, two warming shots at an intensity of 185 (without warming shot collection), and acquisition of 50 shots every five positions from 27 to 87.
Data analysis was performed using the Ciphergen ProteinChip® Software version 3.2. Hepcidin levels, measured as arbitrary intensity units, were normalized against creatinine values obtained from the same samples (Analysezentrum, University Clinic of Heidelberg, Heidelberg, Germany). All samples were spotted and analysed in triplicate.
Patient clinical analysis
-------------------------
Informed consent was obtained from the parents of the patient and the healthy volunteers according to German law. Haematological parameters were measured at the Zentrum für Kinder und Jugendmedizin, St. Annastift, Ludwigshafen, Germany. The iron-related values (ferritin, transferrin, transferrin saturation, serum transferrin receptor, free serum iron, iron-binding capacity, zinc protoporphyrin, haptoglobin and erythropoietin) were measured at the Professor Seelig Laboratories, Karlsruhe, Germany. Patient DNA was extracted from peripheral blood by using the Qiagen DNeasy blood and tissue kit. Exons 1--18 of the *TMPRSS6* gene were amplified by PCR using Platinum Taq DNA Polymerase (Invitrogen) and primer pairs published previously \[[@B6]\]. Sequencing was performed by GATC Biotech. Chromatograms were visualized with FinchTV (Geospiza) and were analysed with SeqMan (DNAstar). *ALAS2* (aminolevulinate δ synthase 2; exons 1--10), *SLC25A28* (solute carrier family 25, member 28; exons 1--4), and *SLC11A2* (solute carrier family 11, member 2; exons 2--16) were PCR-amplified and sequenced at the Professor Seelig Laboratories, Karlsruhe, Germany.
Plasmids
--------
The vector pcDNA3.1-TMPRSS6, expressing the wild-type *TMPRSS6* ORF (open reading frame) fused to the FLAG epitope at the C-terminus and the vector pcDNA3.1-mycHJV expressing human *HJV* cDNA in fusion with the Myc epitope were kindly provided by Dr Clara Camaschella (Division of Genetics and Cell Biology, San Raffaele Scientific Institute, Milan, Italy) \[[@B13]\].
The vector pcDNA3-HJV was created by cloning the PCR-amplified *HJV* ORF into the HindIII/EcoRI sites of the pcDNA3 vector. The *HJV* cDNA was PCR-amplified from HUH-7 cell-derived template cDNA by using the following primers: HJV-F: CCC**AAGCTT**ATGGGGGAGCCAGGCCA; and HJV-R: CCC**GAATTC**TTACTGAATGCAAAGCCACAGAAC (the recognition site of the restriction enzyme used to clone the PCR product is in bold).
The vector pcDNA3.1-TMPRSS6(Y141C), expressing the Y141C-mutated TMPRSS6 protein fused to the FLAG epitope at the C-terminus, was obtained using the Gene Tailor Site-Directed Mutagenesis System (Invitrogen) with the pcDNA3.1-TMPRSS6 as the template and the primers: Y141C-F: CTACAACTCCAGCTCCGTCTGTTCCTTTGGGGA; and Y141C-R: AGACGGAGCTGGAGTTGTAGTAAGTTCCCA.
The vector for the minigene system was generated by PCR amplification of 100 ng of patient genomic DNA using primers spanning from exons 3 to 5 within the *TMPRSS6* gene and Pfu Ultra DNA polymerase (Stratagene): ex3-F: AAA**GAATTC**GGTACAAGGCGGAGGTGATG; and ex5-R: AAA**CTCGAG**CCAGGATCACTAGGCCCTCG (the recognition site of the restriction enzyme used to clone the PCR product is in bold).
The PCR fragment was restriction-digested and cloned into the EcoRI/XhoI sites of the pcDNA3 vector (Invitrogen). The pEGFP-TMPRSS6 and pEGFP-TMPRSS6(Y141C) vectors were obtained by subcloning the coding sequence of *TMPRSS6* from the pcDNA3.1-TMPRSS6 and pcDNA3.1-TMPRSS6(Y141C) to pEGFP-n1 using the HindIII restriction sites.
All of the vectors were controlled via automatic sequencing performed by GATC Biotech.
Cell culture
------------
The human hepatoma HuH-7 cell line and the human fibroblast HeLa cell line were cultured in high glucose DMEM (Dulbecco\'s modified Eagle\'s medium) with GlutaMAX (Invitrogen) supplemented with 10% (v/v) heat-inactivated FBS (fetal bovine serum) (Invitrogen), 100 units/ml penicillin, 100 μg/ml streptomycin and 1 mM sodium pyruvate. The human hepatoma Hep3B cell line was cultured in EMEM (Eagle\'s minimum essential medium) supplemented with 10% (v/v) FBS, 1 mM sodium pyruvate, 1 mM glutamine, 100 units/ml penicillin and 100 μg/ml streptomycin. Cells were maintained in a 5% CO~2~ atmosphere at 37 °C. Cell transfections were performed by using the TransIT-LT1 Transfection Reagent (Mirus Bio), according to manufacturer\'s guidelines.
Microscopy
----------
To analyse intracellular TMPRSS6 protein expression, 1.5×10^5^ HeLa cells were plated on 420 mm^2^ Lab-Tek chambered coverglass slides (Nunc) and transfected with pEGFP-TMPRSS6 or pEGFP-TMPRSS6(Y141C). After 48 h, the medium was replaced with DMEM complete medium without Phenol Red and the cells were analysed by live microscopy.
To analyse surface TMPRSS6 protein expression, 1.5×10^5^ HeLa cells were plated on to a glass coverslip and transfected with pcDNA3.1-TMPRSS6 or pcDNA3.1-TMPRSS6(Y141C). After 48 h, the samples were fixed in 3% PFA (paraformaldehyde), blocked with 1% (w/v) BSA/0.3 M glycine in PBS, incubated overnight at 4 °C with an anti-FLAG (1:200 dilution; Sigma F3165) primary antibody and subsequently for 1 h with a FITC-conjugated anti-(mouse IgG) antibody (1:250 dilution; Sigma F5262). Cells were mounted on slides with Mowiol and analysed by microscopy. In both cases, samples were visualized using a PerkinElmer Improvision Ultraview VoX Spinning disc confocal microscope and were analysed with Improvision Volocity 5.3.1 and ImageJ 1.42q.
RNA isolation and qRT-PCR (quantitative real-time PCR)
------------------------------------------------------
Total RNA was isolated using the Qiagen RNAeasy kit according to the manufacturer\'s instruction. Total RNA (1 μg) was reverse-transcribed in a 25 μl reaction mixture using MMLV (Moloney-murine-leukaemia virus) reverse transcriptase (Fermentas) and random oligomers as primers. SYBR green real-time PCR was performed using the ABI StepONE Plus real-time PCR system (Applied Biosystems) using the following primers: hs_GAPDH-F, CATGAGAAGTATGACAACAGCCT; hs_GAPDH-R, AGTCCTTCCACGATACCAAAGT; hs_HAMP-F, CTCTGTTTTCCCACAACAGAC; and hs_HAMP-R, TAGGGGAAGTGGGTGTCTC.
Relative hepcidin mRNA expression was normalized to *GAPDH* (glyceraldehyde-3-phosphate dehydrogenase) mRNA. Results were calculated using the Pfaffl method \[[@B17]\].
Luciferase assay
----------------
Hep3B cells (9.5×10^5^ cells/well) were plated on to a 12-well plate. After 24 h, the cells were transfected with 200 ng of pGL3-hepcidin(WT_2.7Kb) reporter vector containing 2.7 kb of the 5′-flanking genomic region of the human hepcidin gene plus its 5′-UTR (untranslated region), 10 ng of a control plasmid containing the *Renilla* gene under the control of the CMV (cytomegalovirus) promoter, 400 ng of pcDNA3-HJV vector and 200 ng of pcDNA3.1-TMPRSS6 or pcDNA3.1-TMPRSS6(Y141C). The next day, cells were lysed in passive lysis buffer (Promega), and cellular extracts were analysed for luciferase activity using the Dual Luciferase Reporter assay system (Promega) and a Centro LB 960 luminometer (Berthold Technologies).
Immunoprecipitation assay
-------------------------
HeLa cells (2×10^6^) were transfected with 7.5 μg of pcDNA3.1mycHJV and with 7.5 μg of pcDNA3.1-FLAG (mock), 7.5 μg of pcDNA3.1-TMPRSS6 or 7.5 μg of pcDNA3.1-TMPRSS6(Y141C). After 24 h, cells were lysed in NET buffer \[50 mM Tris/HCl (pH 7.4), 150 mM NaCl, 5 mM EDTA, 1% (v/v) Triton X-100\] supplemented with sodium fluoride, PIC (phosphoinositidase C), PSMF and sodium orthovanadate. The lysate was incubated with 40 μl of pre-equilibrated anti-FLAG M2 affinity gel (Sigma A2220) for 4 h. After three washing steps in NET buffer, samples were eluted in Laemmli loading buffer \[62.5 mM Tris/HCl (pH 6.8), 2% (w/v) SDS, 10% (v/v) glycerol, 0.1% 2-mercaptoethanol and 0.0005% Bromophenol Blue\] and the eluted proteins were separated by SDS/PAGE (10% gel) for Western blotting. Immunorecognition was performed by using an anti-FLAG (Sigma F7425) or an anti-c-Myc (Sigma C3956) polyclonal antibody.
Analysis of TMPRSS6 autocatalytic cleavage
------------------------------------------
HeLa cells (2.2×10^6^) were seeded on to a 10-cm-diameter dish and transfected with 15 μg of pcDNA3.1-TMPRSS6, 15 μg of pcDNA3.1-TMPRSS6(Y141C) or 15 μg of pcDNA3.1-FLAG (mock) using the TransIT-LT1 Transfection Reagent (Mirus Bio) in DMEM complete medium. The next day, cells were washed with PBS and the medium was exchanged with serum-free OPTImem (Gibco) with or without 0.1 mM 2-mercaptoethanol to create a reduced environment. After 12 h, the supernatant was collected and concentrated using an Amicon Ultra 3K centrifugal filter (Millipore) (90 min at 4 °C at 4000 **g**). The cells were lysed in NET buffer supplemented with sodium fluoride, PIC, PSMF and sodium orthovanadate.
Protein concentrations were determined using the BCA (bicinchoninic acid) assay (Pierce). A portion (50 μg) of total protein extract or concentrated supernatant was separated by SDS/PAGE (10% gel) and transferred on to a Protran BA83 nitrocellulose membrane. Monoclonal anti-tubulin (Sigma T5168), anti-FLAG (Sigma F7425), peroxidase-conjugated anti-(mouse IgG) (Sigma A9044) and peroxidase-conjugated anti-(rabbit IgG) (Sigma A0545) antibodies were used for immunorecognition.
Bioinformatic analysis
----------------------
Sequence alignment of the SEA domain was performed by ClustalW (EBI; <http://www.ebi.ac.uk/clustalw/>). The sequences were retrieved from the GenBank® database using the following accession numbers: *Pan troglodites*, XR_024662; from the NCBI (National Center for Biotechnology Information) protein database using the following accession numbers: *Homo sapiens*, NP_705837; *Rattus norvegicus*, NP_001124028; *Mus musculus*, NP_082178; *Canis familiaris*, XP_531743; *Macaca mulatta*, XP_001085319 and *Monodelphis domestica*, XP_001376304; and from the ENSEMBL database with the following accession numbers: *Pongo pygmaeus*, ENSPPYP00000013149; *Cavia porcellus*, ENSCPOP00000004089; and *Ornithorhynchus anatinus*, ENSOANP00000021472.
The ribbon structure was obtained by using the crystal structure of the SEA domain of transmembrane protease from *M. Musculus* (PDB ID 2E7V) as the structural template and was readapted using the Swiss-Prot DeepView program version 4.0.1.
RESULTS
=======
Patient clinical synopsis
-------------------------
Our patient is the second son of healthy non-consanguineous parents from Lebanon. Haematological disorders have not been reported in his family. In his second year of age, microcytic hypochromic anaemia was diagnosed. Subsequent iron supplementation did not improve his haematological parameters. As a 10-year-old boy, his family moved to Germany and he was referred to our Pediatric Haematology Department because of chronic weakness, occasional bone pain and extensive sleeping. His physical strength and fitness were normal, and he attended a regular school. He ate normal varied food and had normal appetite and stools. He had not suffered from infection or fever in recent months. Body weight was in the normal range between the tenth and 25th percentile, but his height had fallen to just below the third percentile. The laboratory parameters showed a persistent decrease in haemoglobin (7.9--9.4 g/dl), erythrocyte number \[(4.82--5.5)×10^6^/μl\], mean corpuscolar volume (59.8--62.5 fl), and mean corpuscolar haemoglobin (16.4--17.7 pg). Reticulocytes and other blood cell counts were within the normal range, with the exception of thrombocytes which sometimes were increased with a maximum of 5.48×10^5^/μl. We found normal serum liver and renal parameters, including normal total protein and albumin. Analysis of iron metabolism parameters showed normal values for serum ferritin, transferrin and iron-binding capacity. By contrast, transferrin saturation (3.3--4.8%) and serum iron levels (12--18 μg/dl) were pathologically low, whereas serum transferrin receptor levels (4.77--5.03 μg/dl) and zinc protoporphyrin in erythrocytes (332--378 μmol/mol of haemoglobulin; normal \<40) were significantly increased. Bone marrow cytology showed normal blast numbers, erythropoiesis and megakaryopoiesis, both with discrete dysplastic features, and granulopoiesis. Iron staining discovered a clear lack of iron in macrophages. The bone marrow cytogenetic findings were normal. Pathologically low ^59^Fe incorporation was observed from a scintigraphic examination, and this finding corresponded with the clinical observation of non-effective iron supplementation.
The haematological data collected from the proband are summarized in [Table 1](#T1){ref-type="table"}.
###### Haematological parameters
An asterisk indicates pathological values. MCH, mean corpuscular haemoglobin content; MCV, mean corpuscular volume.
Parameter Patient value Normal range
---------------------------------------- --------------- --------------
Ferritin (ng/ml) 86 17--105
Transferrin (mg/dl) 262 210--315
Iron (μg/dl)\* 12--18 92--184
Transferrin saturation (%) 3.3--4.8\* 15--45
Soluble transferrin receptor (μg/dl) 4.77--5.03\* 0.83--1.76
MCV (fl)\* 59.8--62.5\* 83--97
MCH (pg)\* 16.4--17.7\* 28--34
Haemoglobin (g/dl)\* 7.9--9.4\* 14--18
Zinc protoporphyrin (mmol/mol of haem) 378.2\* \<40
Urinary hepcidin levels are elevated in the IRIDA patient
---------------------------------------------------------
Hypochromic microcytic anaemia with low transferrin saturation that cannot be treated by iron supplementation is a strong indication for IRIDA. Since this disorder is hallmarked by increased hepcidin expression, we analysed urinary hepcidin levels in the patient compared with four age-matched healthy male donors. The amount of the 25-amino-acid mature hepcidin peptide (Hamp-25) was analysed using SELDI--TOF MS and CM10 ProteinChip-arrays \[[@B16]\]. Hepcidin levels were normalized against creatinine ([Figure 1](#F1){ref-type="fig"}). The data show severely increased (15-fold) hepcidin levels in the patient\'s urine, supporting the diagnosis of IRIDA.
{#F1}
c.442A\>G, a novel mutation in exon 4 of *TMPRSS6*
--------------------------------------------------
To PCR-amplify all 18 *TMPRSS6* exons and exon/intron boundaries, PCR primers were designed within intronic sequences. Sequence analysis of the PCR products failed to detect any *TMPRSS6* mutation associated previously with IRIDA. Instead, we identified a homozygous nucleotide exchange (c.442A\>G) within exon 4 which, together with exons 3 and 5, constitutes the SEA domain. To exclude hemizygosity of the allele, we also sequenced exon 4 of *TMPRSS6* of both parents. As shown in [Figure 2](#F2){ref-type="fig"}, a heterozygous c.442A\>G base substitution was detected in both parents, clearly indicating that the mutation was homozygous in the patient.
{#F2}
Mutations in *ALAS2*, *SLC25A28* (*MFRN2*) and *SLC11A2* (*DMT1*) were excluded in previous analyses. Within the *SLC11A2* gene, a heterozygous SNP (single nucleotide polymorphism) in intron 5 (IVS5+60 C\>T) was detected. Genetic haemoglobin analysis discovered a heterozygote α^3.7^-globin gene deletion which resulted in an α^+^-thalassaemia trait.
*TMPRSS6* c.422A\>G does not affect splicing of exon 4
------------------------------------------------------
The novel c.442A\>G mutation within exon 4 of the *TMPRSS6* gene is located ten nucleotides from the 3′-end of the exon and replaces the codon triplet TAT by TGT. This raises the possibility that the newly formed GT sequence could act as an aberrant 'splice donor' that may trigger incorrect splicing between the exons 4 and 5, leading to a premature termination of the TMPRSS6 protein.
Because TMPRSS6 expression is restricted to liver tissue \[[@B9]\], a splicing defect cannot be investigated by mRNA analysis of the patient\'s blood cells. We therefore designed a minigene that spans exons 3 to 5 (including introns 3 and 4) of the *TMPRSS6* gene containing the c.442A\>G mutation to transfect HeLa cells. As shown in [Figure 3](#F3){ref-type="fig"}, this minigene construct is correctly spliced, suggesting that the c.442A\>G mutation is unlikely to cause aberrant splicing.
{#F3}
TMPRSS6(Y141C) impairs TMPRSS6 maturation
-----------------------------------------
The c.442A\>G base substitution exchanges a tyrosine residue with a cysteine residue at amino acid 141 within the SEA domain of TMPRSS6. Phylogenetic sequence analysis of the TMPRSS6 protein indicates that amino acid residue 141 is highly conserved, suggesting that this tyrosine residue may be important for TMPRSS6 function ([Figure 4](#F4){ref-type="fig"}A). Introduction of an additional cysteine residue within the second β-sheet of the SEA domain ([Figure 4](#F4){ref-type="fig"}B) may interfere with secondary structure formation of TMPRSS6, a protein that already contains 37 cysteine residues. We therefore next assessed whether the TMPRSS6(Y141C) mutation causes protein mislocalization. TMPRSS6(Y141C) or TMPRSS6 protein fused to EGFP (enhanced green fluorescent protein) was expressed in HeLa cells and the fluorescent signal was analysed by confocal microscopy. As shown in [Figure 5](#F5){ref-type="fig"}(A), both the overexpressed wild-type and mutant TMPRSS6 proteins localize predominantly in intracellular compartments (e.g. the endoplasmic reticulum). To assess membrane localization of TMPRSS6, HeLa cells were transfected with TMPRSS6 or TMPRSS6(Y141C), both C-terminally fused with a FLAG epitope that is predicted to be located in the extracellular space. The cells were analysed by immunocytochemistry using primary anti-FLAG and secondary FITC-conjugated antibodies on fixed non-permeabilized cells. As shown in [Figure 5](#F5){ref-type="fig"}(B), both the TMPRSS6 and TMPRSS6(Y141C) proteins localize to the cell surface, suggesting that faulty processing and localization of the TMPRSS6 mutant protein does not explain IRIDA in the patient.
{#F4}
{#F5}
TMPRSS6 was shown to control hepcidin mRNA expression by binding and proteolytically cleaving HJV \[[@B18]\]. To assess whether amino acid residue 141 of TMPRSS6 is critical for binding HJV we next transfected HeLa cells with a Myc-tagged HJV fusion construct alone or together with plasmids coding for TMPRSS6 or TMPRSS6(Y141C) proteins both tagged with a FLAG epitope. Immunoprecipitation of TMPRSS6 or TMPRSS6(Y141C) using anti-FLAG antibodies both detects HJV protein at the expected molecular mass of 55 kDa ([Figure 6](#F6){ref-type="fig"}A, lanes 2 and 3). No signal was detected in the sample transfected with HJV and a control vector ([Figure 6](#F6){ref-type="fig"}A, lane 1). This experiment demonstrates that the Y141C mutation does not affect binding to HJV.
{#F6}
TMPRSS6, like other serine proteases, is auto-activated by proteolytic cleavage within a RIVGG motif at its pro-domain/catalytic domain junction site. Once cleaved, the 30 kDa catalytic domain remains attached to the rest of the protein via a disulfide bridge. HeLa cells were transfected with a control plasmid or with plasmids coding for TMPRSS6 or TMPRSS6(Y141C). Subsequently, both the cell lysates as well as the concentrated medium supernatant were analysed for TMPRSS6 expression by Western blotting. Interestingly, only conditioned medium from cells transfected with the TMPRSS6 plasmid revealed a TMPRSS6 protein fragment of approx. 30 kDa, which corresponds to the expected mass of cdTMPRSS6 (catalytic domain of TMPRSS6) ([Figure 6](#F6){ref-type="fig"}B, lane 2). A similar fragment failed to be detected in cells transfected with the TMPRSS6(Y141C) ([Figure 6](#F6){ref-type="fig"}B, lane 3) or control vectors ([Figure 6](#F6){ref-type="fig"}B, lane 1), despite efficient expression of the TMPRSS6(Y141C) protein as detected in the cell lysate ([Figure 6](#F6){ref-type="fig"}B, middle panel). Analysis of equal protein amounts was assured by detection of tubulin ([Figure 6](#F6){ref-type="fig"}B, lower panel).
A lack of cdTMPRSS6 in the conditioned medium of TMPRSS6(Y141C)-transfected cells may either indicate a lack of proteolytic auto-activation of the mutated protein or increased binding stability of the catalytic domain to the rest of the protein, due to the formation of an extra disulfide bond in the Y141C-mutated protein.
In an attempt to distinguish between these two possibilities, we repeated the experiment but added the reducing agent 2-mercaptoethanol (0.1 mM) to the cell culture medium. As shown in [Figure 6](#F6){ref-type="fig"}(C) (upper panel, lanes 3 and 4), HeLa cells transfected with TMPRSS6(Y141C) failed to release cdTMPRSS6 into the medium, both under normal and reducing conditions. By contrast, cdTMPRSS6 was readily detected under both conditions in cells transfected with the wild-type construct ([Figure 6](#F6){ref-type="fig"}C). Efficient protein expression of TMPRSS6 and the mutant form were found in the cell lysate ([Figure 6](#F6){ref-type="fig"}C, lower panel).
Taken together these data support the interpretation that TMPRSS6(Y141C) fails to be auto-activated by proteolytic cleavage.
TMPRSS6(Y141C) overexpression increases hepcidin mRNA expression
----------------------------------------------------------------
TMPRSS6(Y141C) overexpression leads to the synthesis of an inactive form of TMPRSS6. To assess whether this defect affects hepcidin mRNA expression, we next transfected the human hepatoma cell line Hep3B with a firefly luciferase reporter vector under the control of the full-length hepcidin promoter, together with expression vectors coding for HJV and TMPRSS6 or TMPRSS6(Y141C) proteins. Firefly luciferase activity was normalized with *Renilla* luciferase under the control of a constitutive CMV promoter.
As expected, transfection of the HJV expression vector resulted in a 3.5-fold increase in luciferase activity. Co-transfection with TMPRSS6 completely abolished this effect. Importantly, co-transfection of TMPRSS6(Y141C) only slightly attenuated the HJV-controlled hepcidin response, resulting in a 2-fold activation of the hepcidin promoter ([Figure 7](#F7){ref-type="fig"}A). Similar findings were obtained analysing endogeneous hepcidin mRNA levels ([Figure 7](#F7){ref-type="fig"}B), suggesting that the amino acid substitution at position 141 is sufficient to inhibit HJV-controlled hepcidin activation and, thus, probably explains the IRIDA phenotype.
{#F7}
DISCUSSION
==========
In the present paper, we report the clinical case of a 10-year-old boy with IRIDA hallmarked by microcytic hypochromic anaemia that could not be resolved by iron administration. Iron treatment was probably ineffective as a consequence of high hepcidin levels in the blood, reflected by increased urinary hepcidin excretion ([Figure 1](#F1){ref-type="fig"}), which blocks duodenal iron uptake and macrophage iron release \[[@B19]\]. Sequence analysis detected a homozygous mutation (c.422A\>G) within exon 4 of the *TMPRSS6* gene ([Figure 2](#F2){ref-type="fig"}). We initially hypothesized that replacing the codon triplet TAT with TGT may generate an additional 'splice donor' sequence. However, a transfected minigene containing the mutation was accurately spliced between exon 4 and 5 ([Figure 3](#F3){ref-type="fig"}), suggesting that an amino acid replacement of a tyrosine residue by a cysteine residue at amino acid 141 may affect TMPRSS6 function. The mutation is located within the SEA domain of TMPRSS6, which is predicted to be localized within the extracellular part of the TMPRSS6 protein. An SEA domain is also present in enteropeptidase, another TTSP family member, in all of the HAT/DESC (human airway trypsin-like protease/differentially expressed in squamous cell carcinoma) subfamily proteins and in the closely related matriptase and matriptase-3 \[[@B20]\]. The biological role of this domain remains to be determined. In some proteins, the SEA domain is subject to autoproteolysis causing the production of a soluble form of the protein that is released from the cell surface. Such an autoproteolytic event can be accelerated by conformational stress within the SEA domain itself \[[@B21]\]. Cleavage occurs between the glycine and serine residues within a conserved GSVVV (mucin), GSVIV (enteropeptidase) or GSVIA (matriptase) motif \[[@B21]--[@B23]\]. It is not yet clear whether the SEA domain of the human TMPRSS6 is also subject to autoproteolysis. Analysis of the primary amino acid sequence failed to detect a common cleavage motif identifying only a putative GSLRV motif.
The TMPRSS6(Y141C) protein localizes to similar subcellular regions as the wild-type TMPRSS6 protein ([Figure 5](#F5){ref-type="fig"}), suggesting that selective retention of TMPRSS6(Y141C) protein within the cytoplasm does not occur. Immunoblotting of medium supernatant of TMPRSS6(Y141C)- and TMPRSS6-transfected cells failed to detect the entire extracellular domain of the TMPRSS6 protein as a consequence of cleavage within the SEA domain, in contrast with findings by Ramsay and co-workers \[[@B10]\], who detected fragments of the appropriate size in both wild-type and mutant TMPRSS6 proteins.
So far, it is not clear which protein domain of TMPRSS6 binds to HJV and *vice versa*. In the present report, we show that the TMPRSS6(Y141C) mutation does not affect co-immunoprecipitation with HJV, suggesting that the interaction domain may be localized within other domains of TMPRSS6.
Finally, we show that the Y141C amino acid substitution affects the maturation of the TMPRSS6 protein. TMPRSS6 is initially synthesized as an inactive proenzyme that, upon auto-activation, cleaves the C-terminal catalytic domain within the RIVGG consensus sequence. The cleaved domain remains attached to the rest of the protein via a disulfide bond. Western blot analysis (under reducing conditions) of tissue culture medium from cells transfected with TMPRSS6 revealed a 30 kDa fragment that corresponds in size to the activated cdTMPRSS6 protein. In addition, we detected a minor 60 kDa fragment that has been proposed previously to represent a dimeric form of cdTMPRSS6 \[[@B18]\]. Interestingly, both the 30 and 60 kDa fragments were undetectable in TMPRSS6(Y141C)-transfected cells. It is unlikely that the additional cysteine residue in TMPRSS6(Y141C) may have stabilized the interaction between cdTMPRSS6 and the rest of the protein, because the addition of 2-mercaptoethanol to the cell culture medium did not result in the detection of cdTMPRSS6 upon expression of TMPRSS6(Y141C) ([Figure 6](#F6){ref-type="fig"}C). Our present data thus suggest that the tyrosine residue at amino acid 141 is probably required for TMPRSS6 autocatalytic cleavage. TMPRSS6 auto-activation is critical for protein function because transfection of TMPRSS6(Y141C) fails to attenuate hepcidin promoter activity ([Figure 7](#F7){ref-type="fig"}). As a consequence, hepcidin levels will be increased ([Figure 1](#F1){ref-type="fig"}) and IRIDA will develop.
Interestingly, an additional mutation in the SEA domain (A118D) was recently shown to be critical for TMPRSS6 auto-activation \[[@B15]\]. It is thus intriguing to speculate that the SEA domain could act as a scaffold structure that maintains TMPRSS6 folding in order for auto-activation to occur. Replacement of a tyrosine residue with an additional cysteine residue within the second β-sheet of the SEA domain ([Figure 4](#F4){ref-type="fig"}B) may interfere with the formation of disulfide bridges within TMPRSS6, a protein that already contains 37 cysteine residues. Alternatively, the mutation could affect N-linked glycosylation of the SEA domain that may affect protein stability.
Together with other findings, our present results suggest that unprocessed TMPRSS6(Y141C) still reaches the cell surface and interacts with HJV, but fails to cleave HJV. As a consequence, the BMP/SMAD4 signalling pathway is hyperactive resulting in excess hepcidin transcription. Functional characterization of the TMPRSS6(Y141C) thus gives novel insight into understanding TMPRSS6 function and the pathogenesis of IRIDA.
AUTHOR CONTRIBUTION
===================
Sandro Altamura performed and analysed the experiments, and wrote the first draft of the paper. Flavia D\'Alessio performed the luciferase and qRT-PCR experiments. Barbara Selle followed the patient, performed the diagnosis and provided the clinical data. Martina Muckenthaler supervised the research and wrote the manuscript.
ACKNOWLEDGEMENTS
================
We thank M. Hentze for helpful discussions.
FUNDING
=======
This study is supported by eRARE-BMBF (HMA-IRON) to M.U.M. S.A. is funded by the Medical Faculty of Heidelberg.
[^1]: ^1^These authors contributed equally to this work.
|
{
"pile_set_name": "PubMed Central"
}
|
Intrasexual interactions among female golden hamsters (Mesocricetus auratus) over the estrous cycle.
Social interactions of cycling female golden hamsters paired with ovariectomized animals in large enclosures were primarily agonistic over the 4-day estrous cycle. These aggressive interactions were intense as indicated by frequent occurrences of chase and flight behavior. Dominant and subordinate social ranks were established in the majority of pairs (96%) tested, and even females in sexual heat were capable of attacking and dominating their rivals. Furthermore, cycling females exhibited significantly more aggressive acts than ovariectomized opponents 1 day prior to sexual receptivity. No differences in fighting patterns were found between animals on the other 3 days of the estrous cycle. Additional analyses revealed clear differences in agonistic elements, including flank marking, between dominant and subordinate females regardless of whether they were gonadectomized or intact. These analyses also showed that dominant individuals frequently chased and bit opponents during encounters within their nesting area. The data are examined for implications on the adaptive organization of female hamster agonistic behavior and the neuroendocrine regulation of species-typical behavior over the estrous cycle.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
1981 general strike in Bielsko-Biała
The 1981 general strike in Bielsko-Biała took place between January 27 and February 6, 1981, in the southern Polish city of Bielsko-Biała, It was the first strike action during the final decade of Communist Poland which was "purely political" in the sense of aiming directly at Communist Party officials without economic demands, such as calls higher wages. It resulted in the removal of several corrupt officials of the local administration.
Background
On January 27, 1981, a general strike began in Bielsko-Biała, and other locations in the area. All major enterprises, including mass transit, factories and most shops, stopped working. Local leaders of Solidarity demanded what was considered impossible at the time - removal of corrupt local officials, including governor of Bielsko-Biała Voivodeship, mayor of the city of Bielsko-Biała, and First Secretary of Bielsko-Biała's office of the Communist Party. Patrycjusz Kosmowski, the local Solidarity leader, who organized the protest, said thirty years after the strike: "Everybody knew that the government was stealing and defrauding. Everybody talked about it, but nobody did anything. We managed to change it!"
The protest in Bielsko-Biała was unique in the fact that it was purely political. Workers did not demand any pay raises; they demanded change in local government and the removal of Communist elite, whose members had been universally regarded as “the untouchables”. As Kosmowski said, at that time ordinary people did not trust the authorities. Instead, local residents would come to the local office of Solidarity, bringing information about corruption among civil servants, party officials and Communist police officers. Some information, including documentation, was brought to Kosmowski and his people by a female employee of the governor’s office, who supported Solidarity.
First protests
The accusations were publicly expressed as early as November 20, 1980, during a weekly meeting of Solidarity leaders of the Bielsko-Biała Podbeskidzie region of Solidarity. Union officials issued a statement, in which they demanded removal of local authorities, due to “a loss of social capital”. Next day, a delegation of Solidarity met with a delegation of the government. Talks were unsuccessful, and the union planned immediate sit-in of the governor’s office. Instead, Solidarity declared readiness to strike, demanding that central government officials come from Warsaw for negotiations. A few days later, in late November 1980, Minister of Administration Józef Kępa came to Bielsko-Biała. He met with Solidarity leaders, promising to open a special committee, which would investigate allegations of corruption. Among members of the committee, there were four Solidarity activists.
The committee completed its work on January 13, 1981. Most charges turned out to be valid, and several new cases of corruption were uncovered. The 150-page report described frauds committed by city and provincial authorities, as well as Party leaders. Most cases referred to selling real estate properties at reduced prices to chosen buyers (for example, a tenement house at Cieszyńska Street in Bielsko-Biała, in which a kindergarten had been planned, ended up in the hands of a Party official), as well as defrauding 34 million zlotys, which had been collected by local inhabitants to build Okrąglak - a multipurpose arena complex. The money disappeared and nobody knew where it was. Also, there were cases of tax evasion, bribery and partisan distribution of ration stamps to purchase passenger vehicles (stamps to purchase the coveted Fiat 126, manufactured at Bielsko-Biała’s Fabryka Samochodów Małolitrażowych, almost exclusively were handed to Party officials.
Józef Łabudek, the governor of Bielsko-Biała Voivodeship did not accept the findings of the committee, and Solidarity leaders realized that he simply tried to play for time. On January 18, 1981, local Interfactory Founding Committee (MKZ) of Solidarity, which represented 350 enterprises of the province, demanded that central government officials return to Bielsko-Biała, to further look into the charges, and to remove corrupt officials. Warsaw, however, did not respond, so strike warning was issued.
The strike
On Monday, January 26, a one-hour warning strike took place in selected enterprises of Bielsko-Biala and the region (Skoczów, Zywiec, Kęty, Andrychów, Sucha Beskidzka). On the same day, the Interfactory Founding Committee changed its name to Interfactory Strike Committee (MKS), with 107 members of 54 enterprises of the province. The MKS had its main office at the club-room of Cotton Plant Bewelana in Bielsko-Biała, which had previously been the location of weekly meetings of regional Solidarity leaders. In that club-room, some 400 people stayed for ten days.
The strike started on Tuesday, January 27, and most enterprises of the Voivodeship took part in it. In Bielsko-Biała itself, the only businesses that did not participate in it were hospitals, railroads, delivery services, and telecommunications companies. In the course of the time, additional enterprises joined the protest, and activists of Rural Solidarity brought food to the workers, who occupied their factories. Crews of striking enterprises were very determined, and what they needed most were news updates. Every few hours, several times a day, strike bulletins were copied and distributed to thousands of people. Negotiations at Bewelana were broadcast live to most local factories, due to the efforts of Solidarity telecommunications experts, who created a network, which connected all radio stations of the enterprises.
Local government was helpless, and the Interfactory Strike Committee became the center of power in the region, with 200,000 people actively participating in the protest. Negotiations, which took place in early February, failed, and soon afterwards, Solidarity leaders Lech Wałęsa, Andrzej Gwiazda and Stanisław Wądołowski came to Bielsko-Biała, together with their advisers Tadeusz Mazowiecki and Bronisław Geremek. Wałęsa and his people at first opposed the strike, for two reasons. Firstly, Bielsko-Biała's Solidarity activists organized it without consultation the union’s national leadership body. Secondly, at that time national negotiations were taking place in Warsaw, and local protests did not help Solidarity. Therefore, Wałęsa came to Bielsko-Biała to end the strike, but after finding out about the situation in the region, and seeing the determination of the people, he changed his mind and supported the protest. Furthermore, he warned the government that a national strike would take place, if force was used against workers in Bielsko-Biała. As time went by, the situation became dramatic. All talks were broken, and people talked among themselves that the authorities were considering the use of force.
Agreement
The situation changed during the night of February 5/6, 1981, when a delegation of the Polish Episcopal Conference arrived at Bielsko-Biała. It was sent there by Primate Stefan Wyszyński, and it consisted of Bishops Bronisław Dąbrowski, Janusz Zimniak, and Czesław Domin. Soon afterwards, the delegation of the government entered the club-room of Bewelana, headed by Minister of Administration Józef Kępa, and his deputy Czesław Kotela.
The negotiations lasted the whole night, ending at 5am on February 6, 1981. An agreement was signed, acceding to the protesting workers' demands. In accord with the agreement, provincial governor Józef Łabudek and his two deputies (Antoni Kobiela and Antoni Urbaniec) resigned on that day, and the new governor, Stanisław Łuczkiewicz, was obliged to punish those guilty of corruption. Other officials who were removed from their posts were local leaders of the Party, mayor of Bielsko-Biała Marian Kałoń (replaced by little known Jacek Krywułt), his deputy Franciszek Holeksa, chief of police, Colonel Ryszard Witek, as well as a number of civil servants.
References
See also
Lublin 1980 strikes
Jastrzębie-Zdrój 1980 strikes
Summer 1981 hunger demonstrations in Poland
1981 warning strike in Poland
1988 Polish strikes
External links
Category:1981 in Poland
Category:1981 labor disputes and strikes
Category:Labor disputes in Poland
Category:Solidarity (Polish trade union)
Category:Protests in Poland
Category:Bielsko-Biała
Category:Anti-communism in Poland
Category:Polish People's Republic
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Introduction
============
A series of studies have demonstrated that quality of life and psychological health improve after lung transplantation \[[@R1]\], \[[@R2]\], \[[@R3]\]. However, patients may still face health strains due to pulmonary infections, side effects of immunosuppression, or allograft rejection. In many chronic diseases, such as chronic pain \[[@R4]\], and rheumatoid arthritis \[[@R5]\], patient\'s perception of illness may influence both the susceptibility to complaints and the psychosocial state of health \[[@R6]\]. Illness perceptions may also be influenced by the patient\'s personality traits \[[@R7]\], \[[@R8]\]. In contrast to kidney transplantation \[[@R9]\], illness perceptions have not been investigated in patients after lung transplantation. On the other hand, patients\' personality is a well-known psychosocial factor in the transplantation process. There are some indications for a relationship between personality and an allograft rejection \[[@R10]\]. Personality traits may affect health behaviour, e.g. compliance. In this way, there could be a relationship between personality and surviving time after an organ transplantation \[[@R11]\].
We therefore studied 50 lung transplant recipients with regard to personality traits, illness perception and the current lung function (FEV~1~). In our theoretical framework personality provides affective as well as cognitive styles; there may be an association between these individual styles and illness perceptions. Our hypotheses were, that there is a relationship between personality factors and illness perceptions, and that personality factors are more relevant to illness perceptions than the current health status (e.g. lung function).
The aims of the study were 1. to investigate personality factors in lung transplant recipients and to compare them with a representative sample of the general population, 2. to search for potential correlations between personality factors and illness perceptions, and 3. to investigate whether illness perceptions and the current lung function (FEV~1~) were correlated.
Methods
=======
Sample and procedure
--------------------
Between 1992 and 2002 125 patients underwent lung transplantation at the University Hospital Zurich. The study inclusion criteria required that transplantation was performed at least one year before the assessment, and that the participants had sufficient knowledge of German. These criteria were fulfilled in 53 patients. Forty-five of the 125 patients had died, 18 patients were one year or less after transplantation, five had incomplete medical data and four were only French speaking. The study aims were explained to the patients during a patient teaching session. The study was approved by the local ethical committee according to the ethical guidelines of the Swiss Academy of Medical Sciences \[[@R12]\]. The questionnaire was sent by mail, informed consent was obtained. The physicians in the Lung Transplant Program were asked to fill out a medical questionnaire providing the medical data from a computerized database.
Instruments
-----------
The **Patient\'s Questionnaire**recorded general socio-demographic information i.e. age, gender, partnership status, children, employment. Additionally, the questionnaire contained the following standardized measuring instruments: The **NEO Five-Factor Inventory (NEO-FFI)**measures the five fundamental dimensions of personality: 1. \"neuroticism\" (annoyed, embarrassed, having unrealistic ideas and little control over needs); 2. \"extraversion\" (active, assertive, talkative, energetic, optimistic); 3. \"openness to experience\" (inquisitive, possessing independent judgment, interested, placing value on new experiences); 4. \"agreeableness\" (altruistic, sympathetic, understanding, benevolent, accommodating); and 5. \"conscientiousness\" (persevering, precise, dependable, determined, systematic) \[[@R13]\]. The German version \[[@R14]\] of the NEO Five-Factor Inventory (NEO-FFI) by Costa and McCrae \[[@R15]\] was used. This version contains 60 items recorded on a 5-point Likert scale.
The **Illness Perception Questionnaire (IPQ)**records the five components of illness perception \"consequences\", \"control\", \"cause\", \"identity\", and \"time-line\" of an illness \[[@R16]\]. According to the self-regulation model of Leventhal, these perceptions reflect the cognitive response of a patient to an illness or its symptoms \[[@R17]\]. For the present study, the IPQ-scales \"control\" and \"consequences\" were investigated. The dimension \"control\" indicates patients\' ideas about what they themselves or providers of medical care can do to bring about recovery or to exert influence on the course of illness. The dimension \"consequences\" reflects the short-term and long-term effects of the illness, e.g. the perceived physical, social, economic and emotional consequences of the illness \[[@R6]\]. Both scales are unidimensional. Because the state of health after lung transplantation is more relevant than the previous lung disease, only the IPQ-subscales \"control\" and \"consequences\" are suitable to record transplantation-related illness perceptions. This design regarding illness perceptions is usual, because most studies that investigated illness perceptions have been restricted on one ore two dimensions, normally \"perceived control\" \[[@R18]\]. According to the importance of the current physical state of health, in the individual items the term \"illness\" was replaced by \"state of health\". Typical items of the \"control\" scale are: \"There is a lot which I can do to control my symptoms\"; \"Recovery of my status of health is largely dependent on chance or fate\"; \"What I can do determines whether my state of health gets better or worse.\" Typical items of the \"consequences\" scale are: \"My status of health has major consequences on my life\"; \"My status of health has to become easier to live with\", or \"My status of health has strongly affected the way others see me.\"
In the **Medical Questionnaire**the diagnosis of the underlying lung disease that led to the lung transplant and the current FEV~1~ ~predicted~ were recorded. FEV~1\ predicted~ is defined as the \"forced expiratory volume in one second\" in percent of the norm values of the general population. **Spirometry** was performed with a mass flow meter (66200 Autobox®, Sensor Medics, Yorba Linda, CA). Criteria for acceptability, reproducibility, and predicted normal values were used according to the European Community of Coal and Steel (ECCS) \[[@R19]\].
Statistical analysis
--------------------
The statistical evaluation was carried out with the **SPSS 11.0**program. In the descriptive statistics the data were expressed as absolute numbers, percent, mean and SD. Comparisons between study sample and representative sample were conducted with t-tests, Cohen\'s d was calculated for effect size. The correlations between variables were calculated by Pearson Correlation.
Results
=======
Demographic and medical data
----------------------------
Fifty of the 53 patients who were asked participated in this survey. The response rate was 94%. The sample comprised 23 women (46%) and 27 men (54%) with a mean age of 42.9 years (SD = 13.6). Forty-one patients (82%) lived with a partner, 24 (48%) had one or more children. All patients lived in Switzerland. At the time of the survey, two patients (4%) were working full-time, three patients (6%) more than 50%-time, 15 patients (30%) less than 50%-time, 15 patients (30%) were undergoing training or working in the household; 15 (30%) patients were unable to work.
Forty-nine patients (98%) had undergone a bilateral lung transplant, and one patient (2%) had received a unilateral lung transplant. On average, the lung transplantation had been performed 4.2 years ago (SD = 2.2 years, minimum 1.6, maximum 9.1). Lung transplantation had been performed for the following diagnoses: cystic fibrosis (N=15, 30%), COPD (N=11, 22%), pulmonary fibrosis (N=9, 18%), and pulmonary hypertension (N=8, 16%), as well as other lung diseases (N=7, 14%) such as lymphangioleiomyomatosis, post-viral bronchiolitis obliterans, histiocytosis X, and bronchiectasis.
The current mean FEV~1~ was 93% (SD 24.9) predicted; the range was between 25% and 148%.
Personality factors and illness perceptions
-------------------------------------------
Table 1 [(Tab. 1)](#T1){ref-type="fig"} shows the mean values for the five personality factors (NEO-FFI) and the illness perceptions \"control\" and \"consequences\" (IPQ), additionally showing the NEO-FFI mean values of a representative sample \[[@R20]\].
The mean values of the personality factors \"extraversion\", \"openness to experiences\", \"agreeableness\", and \"conscientiousness\" in our sample were significantly higher than the mean values in a representative sample of the general population \[[@R20]\].
Table 2 [(Tab. 2)](#T2){ref-type="fig"} shows the correlations between the five personality factors (NEO-FFI), the illness perceptions \"control\" and \"consequences\" (IPQ), and lung function (FEV~1~).
As Table 2 [(Tab. 2)](#T2){ref-type="fig"} indicates, there is a significantly positive correlation between \"control\" and the personality factor \"openness to experiences\". In contrast, the correlation between \"control\" and \"neuroticism\" is significantly negative. There are, however, no significant correlations between \"control\" and the personality factors \"conscientiousness\" and \"agreeableness\". Moreover, there is no significant correlation between \"control\" and the current lung function (FEV~1~). There are no significant correlations between \"consequences\" and the five personality factors as well as the current lung function (FEV~1~).
Discussion
==========
To our knowledge, the present study is the first to record personality traits and illness perceptions concerning lung transplant recipients, and to investigate the relationship between personality as well as somatic features and illness perceptions. The results show the largely ignored importance of personality factors and illness perceptions in transplantation medicine. Due to the high participation rate of 94%, selection effects are almost non-existent. The limitation of the study, however, lies in the cross-sectional design of the investigation and the adaption of the Illness perception Questionnaire IPQ (changing the term \"illness\" to \"health status\"). In addition, the mean values of lung function (FEV~1~ in percent predicted) of our patient group are favourable. Nevertheless the range of values is wide, and a substantial number of patients had pathologic lung function values.
The first interesting result of our study is, that lung transplantation recipients show significantly higher mean values of the personality factors \"extraversion\", \"openness to experiences\", \"agreeableness\", and \"conscientiousness\" compared to a representative sample of the general population \[[@R20]\]. In contrast to \"neuroticism\", these personality factors are more connected with social and personal skills.
To our knowledge, there are no data with regard to the five personality factors before a lung or other organ transplantation. Because of the current state of research we are not able to say, if the NEO-FFI values of transplantation candidates differ from the normal population. An explanation for this result could be that there is a kind of involuntary selection of lung transplantation candidates regarding their personality. In general, lung transplantation candidates show a lower incidence of psychiatric disorders in comparison to other transplantation candidates \[[@R21]\]. In our opinion, a possible selection could take place during the pre-transplant evaluation or in connection with the referring doctor\'s first decision to recommend transplantation. Additionally, there could be local selection criteria, regarding transplantation candidates that differ from center to center. In this sense, lung transplantation patients might be an especially selected patient group that show higher values of socially well accepted personality factors.
An alternative explanation of this result, however, could be that there is a certain change of personality under the longstanding impression of the transplantation experiences. Despite the normally stable trait quality of personality factors, there is some evidence, that a personality change following strong psychological stress situations may occur \[[@R22]\]. A broad literature shows that positive personal and psychological changes are possible in connection with traumatic stress situations like severe diseases \[[@R23]\]. The significantly higher values of \"extraversion\", \"openness to experiences\", \"agreeableness\", and \"conscientiousness\", but not of \"neuroticism\" may indicate such a \"personal growth\" after lung transplantation.
These explanations, however, could be proved only by a prospective study that investigates the personality before and after transplantation in different transplantation centers.
The mean values for the illness perceptions \"control\" and \"consequences\" represent a similar range compared to clinical comparison studies \[[@R14]\]. Since we are dealing with an adapted version of the two IPQ subscales (replacing the term \"illness\" by \"state of health\"), a direct comparison of the samples is of limited significance. However, there is a significant positive correlation between the perception \"control\" and \"openness to experience\" as well as a significant negative correlation between \"control\" and \"neuroticism\": Patients who value new experiences (\"openness to experiences\") tend to trust in the controllability of their state of physical health. On the other hand, patients who express aggressive feelings or unrealistic notions (\"neuroticism\"), are more likely to develop the idea that their state of health could not be controlled (by themselves or the medical staff). Thus, whether a patient believes that her or his current state of health is controllable may be far less in connection with the current lung function than with personality features.
Conclusions
===========
Because of the significantly negative correlation between \"control\" and \"neuroticism\", clinical consequences of the study results may be that patients with high values of neuroticism - because of their feeling of uncertainty - require more intensive medical and psychosocial care. In contrast, the personality factor \"openness to experiences\" could be understood as an individual resource for lung transplant recipients. In any case, this result indicates that certain patients can still feel uncertain even though their physical health is stable.
In our opinion, the differentiated, standardized assessment of personality aspects and illness perceptions after lung transplantation is an important psychosocial research area for the future. Illness perceptions may influence both the proneness to complaints and the psychosocial well-being after transplantation; and they also may have an effect on health behavior \[[@R8]\]. Personality tests could be used to assess the predictive values of individual personality factors (as a personal resource or risk factor) for the psychosocial outcome after lung transplantation. These results could contribute to early identification of patients with psychosocial risks, and to the introduction of appropriate psychosocial treatment.
Acknowledgements
================
This work is supported by a grant of the Swiss National Science Foundation (Project number 4046-05661).
![Mean values, Cronbach\'s alpha and standard deviations for the five personality factors and the illness perceptions \"control\" and \"consequences\" (n=50), additionally showing the NEO-FFI mean values of a representative sample (n=1908) of the general population \[18\]](PSM-02-06-t-001){#T1}
{#T2}
|
{
"pile_set_name": "PubMed Central"
}
|
Summaries of health policy coverage from major news organizations
Many Believe Uninsured Should Serve as Top U.S. Priority
About 42% of U.S. adults believe the federal government should make the issue of the uninsured a top health care priority over the next two years, according to a new WSJ.com/Harris Interactive poll, the Wall Street Journal reports. The poll, conducted between Oct. 8 and Oct. 10, included responses from a nationally representative sample of 2,384 adults.
According to the poll, 42% of respondents cited "reducing the percentage of Americans without health insurance" as one of the top two health care issues, followed by Medicare reform (28%) and efforts to reduce out-of-pocket health care costs (26%). Most respondents said that, although health care issues will have some effect on their votes in the November elections, other issues are more important, the poll found.
In addition, a plurality of respondents believes between two and three to one margins that Democrats would address various health care issues more effectively than Republicans, according to the poll. The poll found that 37% of respondents believe Democrats would more effectively address the issue of the uninsured, compared with 11% who believe Republicans would address the issue more effectively.
However, one-third of respondents believe neither party would more effectively address the issue of the uninsured, and 22% are uncertain, the poll found (Bright, Wall Street Journal, 10/24).
This is part of the California Healthline Daily Edition, a summary of health policy coverage from major news organizations. Sign up for an email subscription.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
Make a HTTP header request with Curb
With curl I can perform a HTTP header request like so:
curl -I 'http://www.google.com'
How can I perform this procedure with Curb? I don't want to retrieve the body as this would take too much time.
A:
The -I/--head option performs a HEAD request. With libcurl C API you need to set the CURLOPT_NOBODY option.
With curb, you can set this option on your handle as follow:
h = Curl::Easy.new("http://www.google.com")
h.set :nobody, true
h.perform
puts h.header_str
# HTTP/1.1 302 Found
# Location: http://www.google.fr/
# Cache-Control: private
# Content-Type: text/html; charset=UTF-8
# ...
As an alternative, you can use one of the convenient shortcut like:
h = Curl::Easy.new("http://www.google.com")
# This sets the option behind the scenes, and call `perform`
h.http_head
puts h.header_str
# ...
Or like this one, using the class method:
h = Curl::Easy.http_head("http://www.google.com")
puts h.header_str
# ...
Note: the ultimate shortcut is Curl.head("http://www.google.com"). That being said wait until the next curb release before using it, since it's NOT working at the time of writing, and has just been patched: see this pull request.
|
{
"pile_set_name": "StackExchange"
}
|
1. Introduction {#sec1-sensors-19-04872}
===============
Porous silicon (PSi) is a type of nanosilicon material with a large specific surface area, good biocompatibility, luminescence at room temperature, and an adjustable refractive index \[[@B1-sensors-19-04872]\]. Porous silicon can be fabricated into various optical devices by electrochemical etching and photolithography technology, which can be used to fabricate high-sensitivity optical biosensors. At present, porous silicon optical biosensors with a single layer \[[@B2-sensors-19-04872]\], double layer \[[@B3-sensors-19-04872]\], Bragg reflector \[[@B4-sensors-19-04872]\], microcavity \[[@B5-sensors-19-04872],[@B6-sensors-19-04872]\], and surface grating \[[@B7-sensors-19-04872],[@B8-sensors-19-04872]\] have been reported. Among these porous silicon sensors, a porous silicon microcavity (PSM) sensor is a one-dimensional photonic crystal containing defect states, and their reflection spectra have excellent optical properties such as high transmittance at defect peaks and narrow half-width \[[@B9-sensors-19-04872],[@B10-sensors-19-04872]\], which results in high detection sensitivity. X. Lv et al. successfully prepared PSM devices and immobilized antibodies on PSM devices. A specific antigen‒antibody reaction was successfully detected, and the results show that the redshift of the PSM biosensor reflectance spectrum increases with increasing antigen concentration \[[@B11-sensors-19-04872]\]. Zhang et al. prepared a PSM with a wavelength of 1555 nm on an SOI silicon wafer by double-cell electrochemical etching. The hybridization reactions of 19 base pairs of DNA were detected, and a detection limit of 43.9 nM was obtained \[[@B12-sensors-19-04872]\].
When porous silicon is used as a biosensor for detection, the detection sensitivity usually depends on the sensitivity of the spectrometer. Therefore, it is important to select a highly sensitive detection method for the detection of low concentrations of biomolecules. According to the relationship between the defective wavelength of the PSM structure and the incident angle of incident light on the surface, the angular spectrum detection method proposed by P. Li et al. is highly sensitive \[[@B13-sensors-19-04872]\]. By changing the incident angle of the incident light source, the change in the incident angle theta corresponding to the weakest reflected light intensity of the PSM device before and after the biological reaction is measured, and the change in the refractive index *n* caused by a biological reaction in the biosensor is obtained, thus accomplishing biological detection.
Quantum dots (QDs) have many advantages, such as good optical stability, a long fluorescence lifetime, and controllable surface properties. Surface-modified QDs have good biocompatibility and are commonly used markers for preparing high-sensitivity biosensors \[[@B14-sensors-19-04872],[@B15-sensors-19-04872]\]. Dihydrolipoic acid (DHLA) can be used to modify the surface properties of QDs to make them water-soluble and biocompatible \[[@B16-sensors-19-04872]\]. Modified QDs can be covalently linked with biological molecules to maintain their biological activity and detection ability \[[@B17-sensors-19-04872]\]. QDs' use as markers can be divided into two categories. The first is to use the fluorescence characteristics of QDs to achieve fluorescence enhancement. Dovzhenkoab et al. successfully embedded CdSe/ZnS QDs and poly(phenylenediamine) derivative (MDMO-PPV and BEHP-co-MEH-PPV) fluorescent molecules into a PSM to modulate fluorescence enhancement and bandwidth compression \[[@B18-sensors-19-04872]\]. Y. Li et al. added QD-labeled biotin, phosphate buffer solution (PBS), and unlabeled biotin to a streptavidin-modified PSI, which proves the feasibility of porous silicon optical biosensors based on QD fluorescence labeling, and then detected SA with different concentrations; the detection limit was 100 pM \[[@B19-sensors-19-04872]\]. The second category uses the highly refractive index characteristics of QDs to achieve refractive index amplification. Gaur et al. successfully labeled and detected small QD biotin molecules by using the shift of the single-layer reflectance spectra of porous silicon, which increased the sensitivity of QD labeling by 6-fold \[[@B2-sensors-19-04872]\]. C. Lv et al. used QDs to couple complementary DNA to achieve refractive index amplification, and used reflection spectroscopy to detect the hybridization reactions between complementary DNA labeled with QDs and to probe the DNA. The results showed that the sensitivity of DNA detection could be increased by more than 5-fold by using QD-labeled complementary DNA \[[@B20-sensors-19-04872]\].
In this paper, the refractive index of the reactant is amplified using QD-labeled complementary DNA of different concentrations, and the angle change before and after the hybridization reaction between probe DNA and QD-labeled complementary DNA of different concentrations in PSM devices is detected by angular spectrum detection. After the probe DNA is fixed on the PSM device, the incident light with the same wavelength as the PSM device is obliquely incident on the surface of the PSM device after collimating beam expansion, and the weakest reflected light intensity is obtained at a certain angle θ~1~. After the hybridization reaction between QD-labeled complementary DNA and probe DNA in the device, the position of the weakest reflected light intensity can be found again at angle θ~2~. The angle change caused by the biological reaction is Δθ = θ~2~ − θ~1~. This method has higher detection sensitivity than the angular spectrum method without QD labeling.
2. Detection Method {#sec2-sensors-19-04872}
===================
The PSM device is composed of a Bragg mirror alternately arranged with a high and low refractive index in the upper and lower periods and a high-porosity cavity layer in the middle. Its wavelength is determined by the position of the central transmission resonance peak. The cavity layer in the middle of the PSM device is equivalent to a defect layer with high transmittance and a narrow half-width peak. If there are 25 layers of PSM devices, the central wavelength of the microcavity is 633 nm. [Figure 1](#sensors-19-04872-f001){ref-type="fig"}a shows the structure of the PSM device.
The high refractive index of the Bragg reflector is *n~H~* = 1.52, the low refractive index is *n~L~* = 1.21, and the refractive index of the intermediate cavity is *n~C~* = 1.21. The optical thickness *d~H~*, *d~L~*, and *d~C~* of the high and low refractive index and middle microcavity layer satisfy the following equations:$$n_{H}d_{H}{= n}_{L}d_{L} = \lambda_{C}/4$$ $$n_{C}d_{C} = \lambda_{C}/2$$ where *n~H~*, *n~L~*, and *n~C~* represent the refractive indices of the high refractive index layer, low refractive index layer, and intermediate defect layer, respectively, and *d~H~*, *d~L~*, and *d~C~* represent the thicknesses of the high refractive index layer, low refractive index layer, and intermediate defect layer, respectively.
If the effective refractive index n of the PSM device changes, then the position of the central wavelength *λ* will also change. However, when the incident angle of the incident light source is changed to obliquely incident, the reflection spectrum of the PSM device will shift accordingly. Based on the above principle, an angular spectrum detection method is proposed. When a laser with the same wavelength as the central wavelength of the PSM is incident perpendicularly on the surface of the PSM, the reflected light intensity is the weakest. After a series of functionalization steps, the position of the central wavelength of the PSM is changed, and the weakest reflected light intensity can be obtained by deflecting the incident light at a certain angle. At this time, the angle is recorded as θ~1~. When the organism reacts in the porous silicon hole, the effective refractive index of the porous silicon device will change, deflect a certain angle θ~2~, and obtain the weakest light intensity. According to the angle change (Δθ = θ~2~ − θ~1~), the refractive index change *n* caused by a biological reaction in PSM devices can be obtained, thus realizing biological detection. [Figure 1](#sensors-19-04872-f001){ref-type="fig"}b shows the experimental device diagram.
As shown in [Figure 1](#sensors-19-04872-f001){ref-type="fig"}b, a part of the reflected light and a part of the transmitted light are obtained after the light is emitted by a semiconductor laser through a transparent glass sheet G. Detector D~1~ is used to detect the reflected light intensity and correct the influence caused by factors such as the power instability of the output light. The light passing through the glass plate is collimated and expanded by polarizer P, two thin lenses L~1~ and L~2~, and the aperture. The obtained beam is irradiated to the surface of the PSM device after passing through aperture A, and the reflected light intensity is received by detector D~2~. In this experiment, a He‒Ne laser with a divergence angle of 0.79 mrad and a wavelength of 633 nm was used as the laser source. Its wavelength is the same as the central wavelength of the PSM device.
Porous silicon can be regarded as a homogeneous mixture of silicon and air without adding any material, and its porosity is:$$\rho = \left( {m_{1} - m_{2}} \right)/\left( {m_{1}{- m}_{3}} \right)$$ where *m*~1~ is the mass before etching, *m*~2~ is the mass after etching, and *m*~3~ is the residual mass after soaking with NaOH. According to Bruggeman's theory \[[@B21-sensors-19-04872]\], the effective refractive index of porous silicon can be obtained via Equation (4):$$\left( {1 - \rho} \right)\frac{n_{si}{}^{2}{- n}^{2}}{n_{si}{}^{2} + {2n}^{2}} + \rho\frac{1 - n^{2}}{1 + 2n^{2}} = 0$$
If something enters the hole, the equation can be transformed as follows:$$\left( {1 - \rho} \right)\frac{n_{si}{}^{2}{- n}_{0}{}^{2}}{n_{si}{}^{2} + 2n_{0}{}^{2}} + \left( {\rho - v} \right)\frac{1{- n}_{0}{}^{2}}{1 + 2n_{0}{}^{2}} + v\frac{n_{1}{}^{2}{- n}_{0}{}^{2}}{n_{1}{}^{2} + 2n_{0}{}^{2}} = 0$$ where *n*~1~ denotes the refractive index of the added material, *v* denotes the volume fraction of the material entering the hole, and *n*~0~ denotes the refractive index of the PSM device after adding the material.
When calculating the refractive index of PSM devices using QD-labeled complementary DNA and without using QD-labeled complementary DNA, the refractive index of Si is *n~si~* = 3.87, the refractive index of QD is 2.70 \[[@B22-sensors-19-04872]\]. The QDs used in the experiments are all carboxyl water-soluble CdSe/ZnS QDs purchased from Jiayuan Quantum Dot Company (Wuhan, China). The size of QD is about 10 nm and its fluorescence peak is 625 nm, its half-width peak is within 30 nm. The structure of QDs is a CdSe core inside, which is surrounded by a ZnS shell and has a surface modified with a carboxyl group (‒COOH). [Figure 2](#sensors-19-04872-f002){ref-type="fig"} shows an SEM image of QDs.
The volume of a single QD is calculated as a sphere. DNA molecules are biological molecules with a refractive index of 1.33 \[[@B23-sensors-19-04872],[@B24-sensors-19-04872],[@B25-sensors-19-04872]\]. When the probe DNA reacts with the complementary DNA, it becomes a double-helix structure with a diameter of 2 nm and a distance of 0.34 nm between adjacent base pairs. The set central wavelength of the PSM is 633 nm, and the thickness of the high refractive index layer and the low refractive index layer of the PSM device can be calculated by using Equation (1) at approximately 104 nm and 130 nm, respectively. Assuming that the first layer of the PSM device is a high refractive index layer with a porosity of 60%, each QD in the QD solution with a concentration of 15 μM can be successfully connected to a complementary DNA molecule and evenly enter the hole to connect to a probe DNA molecule. Under these conditions, the effective refractive index of PSM devices is 1.18 when the probe DNA and complementary DNA are added to PSM devices and 1.36 when the probe DNA and QD-modified complementary DNA are added; the effective refractive index of PSM devices increases by 0.18. If the layer of the PSM device is assumed to be a low refractive index layer under the same conditions and the porosity is 80%, the average number of QDs per hole is 1.2. Under these conditions, the effective refractive index of PSM devices is 1.29 when the probe DNA and complementary DNA are added to PSM devices and 1.51 when the probe DNA and QD-labeled complementary DNA are added; the refractive index of PSM devices increases by 0.22. The results show that, if the first layer is a high refractive index layer, then the refractive index of the PSM biosensor marked with QDs is 1.15 times that of the PSM biosensor without QDs. If the first layer is a low refractive index layer, the refractive index of the PSM biosensor marked with QDs is 1.17 times that of the PSM biosensor without QDs. Thus, the refractive index can be amplified by QD-labeled biomolecules participating in biological reactions. Using the above parameters, the refractive index changes are calculated by the transfer matrix method, and the calculation results are shown in [Figure 3](#sensors-19-04872-f003){ref-type="fig"}. In fact, only some of the QDs can enter porous silicon. The remaining unconnected QDs and complementary DNA will be cleaned out during subsequent processing. Therefore, due to various factors, the actual refractive index change will be smaller than the theoretical value.
As shown in [Figure 3](#sensors-19-04872-f003){ref-type="fig"}, the relationship between Δθ and Δn of PSM devices with 60% and 80% porosity and the change of angle, respectively. The refractive index of PSM devices labeled with QDs changes more when the angle changes are the same.
According to the plane wave expansion method, when the incident angle of the TE mode light wave changes, the forbidden band of PSM also changes. When the incident angle is less than 67° (θ \< 67°), the incident wavelength is measurable in the forbidden band of PSM; when the incident angle continues to increase (θ \> 67°), it will exceed the forbidden band \[[@B13-sensors-19-04872]\]. Therefore, the experiment should be carried out in a small angle range.
3. Experiments {#sec3-sensors-19-04872}
==============
3.1. Preparation of Porous Silicon Microcavity {#sec3dot1-sensors-19-04872}
----------------------------------------------
P-type boron-doped single crystal silicon (crystal orientation \<100\>, resistivity 0.03--0.06 Ω·cm, thickness 400 ± 10 μm) was used to fabricate PSM devices by single-channel anode electrochemical corrosion. Before the start of the experiment, the silicon wafer was cut into a square with a width of 2 cm and then cleaned with acetone, anhydrous ethanol, and deionized water in an ultrasonic cleaner for 10 min to remove impurities such as dust and grease from the surface and minimize the impact of impurities on corrosion. The cleaned silicon wafer was placed in the etching tank made of polytetrafluoroethylene. An etching solution of 40% HF solution and anhydrous ethanol (concentration ratio of 1:1) was poured into the fixed silicon wafer etching tank. According to the Labview8.0 program (National Instruments company, Austin, TX, USA), the current densities of layers with high and low refractive indices were 40 mA/cm^2^ and 90 mA/cm^2^, respectively. The etching times were 2 s and 1.7 s, respectively; the corrosion current density of the middle microcavity layer was 90 mA/cm^2^, and the control corrosion time was 3.4 s. During the corrosion process, porous silicon was formed at intervals of 3 s to ensure sufficient fluoride and corrosion uniformity. This process should be completed in a ventilated environment. The corroded porous silicon was washed with deionized water and dried in nitrogen. The reflectance spectra of the PSM devices were measured by an ultraviolet-visible spectrophotometer (Hitachi U-4100, Hitachi Ltd., Tokyo, Japan) with a resolution of 0.1 nm and compared with those calculated by the transfer matrix method, as shown in [Figure 4](#sensors-19-04872-f004){ref-type="fig"}.
In the theoretical simulation, it is generally considered that the PSM device is an ideal device without absorption and dispersion, and each dielectric interface is smooth. In the experiment, the refractive index dispersion of PSM devices will narrow the band gap of the reflection spectrum, and the absorption of light will reduce the reflectivity and increase the half-width of the defect state. In practical experiments, there will be interface fluctuations in PSM devices, rather than ideal smooth interfaces, which will reduce the reflectivity of the reflection spectrum in the forbidden band, and increase the reflectivity at the defect state and the half-width of defect state. The above factors lead to some differences between the experimental results and the theoretical simulation \[[@B26-sensors-19-04872]\].
[Figure 5](#sensors-19-04872-f005){ref-type="fig"} shows a surface and cross-sectional view of a PSM device. The pore size of the prepared PSM device is approximately 30 nm, which ensures that the 16 base pairs of DNA modified by QDs (approximately 14 nm) can enter smoothly and be detected biologically. The cross section shows that the thickness of the porous silicon layer is 3.1 μm, which is consistent with the thickness of the PSM devices. The defects in each layer of the Bragg reflector and the middle layer of the PSM devices can be observed clearly.
3.2. Functionalization and Detection of PSM {#sec3dot2-sensors-19-04872}
-------------------------------------------
Because of the existence of Si‒H bonds on the surface of the newly prepared porous silicon, the silicon is easily oxidized in the air. Thus, it needs to be placed in 30% hydrogen peroxide solution and oxidized for 3 h at 60 °C so that a layer of SiO~2~ forms on the surface. The porous silicon was washed with deionized water and anhydrous ethanol and then cooled at room temperature. Then, the PSM device was modified with an amino group in 5% 3-aminopropyl triethoxysilane for 1 h, washed with deionized water, dried at room temperature, and then dried in a vacuum drying chamber at 100 °C for 10 min. To add the DNA molecule successfully, the silanized sample was immersed in a 2.5% glutaraldehyde solution for 1 h and then washed repeatedly with PBS and deionized water. Each step of the functionalization of PSM devices was tested by the reflection angular spectrum. [Figure 6](#sensors-19-04872-f006){ref-type="fig"} shows a comparison of the PSM functionalization angular spectrum. The obvious angle change in the figure shows that every step of functionalization was successful.
[Figure 6](#sensors-19-04872-f006){ref-type="fig"} clearly shows the change in angular spectrum due to the functionalization of PSM. As can be seen from the figure, the red, black and blue curves represent the PSM angle spectrum after oxidation, silanization and glutaraldehyde, respectively. The PSM angle spectrum after silanization and glutaraldehyde is red-shifted by 12.45° and 24.37°, respectively, compared with the angle spectrum after oxidation.
3.3. Preparation of Probe DNA and QDs-Labeled Complementary DNA {#sec3dot3-sensors-19-04872}
---------------------------------------------------------------
Probe DNA, with a volume of 30 μL and a concentration of 10 μM, was dripped onto the surface of the PSM. The probe DNA was placed in a constant-temperature box at 37 °C for 2 h. After being blown dry, the probe DNA was washed repeatedly with PBS and deionized water and then blown dry. The dried silicon wafer was immersed in 3-M ethanolamine hydrochloride and placed in a constant-temperature box at 37 °C for 1 h. After being blown dry, the silicon wafer was washed repeatedly with PBS and deionized water to ensure the full entry of probe DNA molecules into the pore. Carboxylic water-soluble CdSe/ZnS QDs with a volume of 30 μL and a concentration of 8 μM were diluted to 1 μM. Then, the carboxyl groups were activated by adding EDC and NHS at a concentration of 0.01 M and a volume of 30 μL, respectively \[[@B27-sensors-19-04872]\]. After 30 min of the reaction at room temperature, 30 μL of complementary DNA was added at the desired concentration, light was allowed to avoid oscillation for 10 h to ensure that the QDs were fully linked with the complementary DNA, and then the sample was centrifuged for 15 min at 10,000 r/min. Complementary DNA labeled by QDs was dripped onto the PSM device with fixed probe DNA by a pipette. The device was immersed in PBS and deionized water for 2 h at 37 °C and, after extraction, it was immersed in PBS and deionized water for 15 min to remove the QDs that had not successfully connected and the complementary DNA labeled by QDs that failed to enter the hole. The preparation process of the biosensor is shown in [Figure 7](#sensors-19-04872-f007){ref-type="fig"}.
4. Results and Discussion {#sec4-sensors-19-04872}
=========================
The probe DNA and complementary DNA sequences of 16 base pairs were purchased from Invitrogen Biotechnology Company (Shanghai, China); their base pair sequences are as follows:5′-CAACGTTGCAGTGTAC-3′-NH2;5′-GTTGCAACGTCACATG-3′-NH2.
A Fluorolog-3-21-TCSPC fluorescence spectrometer (wavelength resolution 0.2 nm) was used to detect the fluorescence peaks of QDs before and after DNA coupling. The excitation wavelength is 375 nm, the excitation voltage is 700 V, and the slot width is 5 nm. The results are shown in [Figure 8](#sensors-19-04872-f008){ref-type="fig"}. The fluorescence peak of the QDs without the complementary DNA is at 623 nm, as shown in the black curve. After the QDs are coupled with complementary DNA at a concentration of 50 μM, the position of the fluorescent luminescence peak becomes 628 nm, as shown in the red curve, and the redshift is 5 nm, indicating that the QDs are successfully coupled with the complementary DNA.
The central wavelength of PSM devices fabricated experimentally will change after the functionalization and addition of biological molecules, resulting in the inconsistency of the wavelength of the incident light. Using the oblique incidence method, the central wavelength of the PSM device can be consistent with that of the incident light source. After adding probe DNA and complementary DNA and the hybridizing reaction, the angles of the weakest reflected light intensity of PSM devices before and after the biological reaction were found by the oblique incidence method and recorded as θ~1~ and θ~2~, respectively. The angle change before and after the hybridization reaction is Δθ = θ~2~ − θ~1~. To accurately locate the position of the weakest light intensity, the intensity of each change of 1' in the angle near the position of the weakest light intensity is recorded. The result is shown in [Figure 9](#sensors-19-04872-f009){ref-type="fig"}.
From the above figure, we can see that the position of the angular spectrum changed obviously after adding QD-labeled complementary DNA to the PSM device fixed with probe DNA. Thus, a hybridization reaction between DNA and QD-labeled complementary DNA has taken place, which enlarges the effective refractive index of the microcavity device.
In order to detect whether there are QDs in the holes of PSM devices that have not been washed out, a Hitachi F4600 (Hitachi Ltd., Tokyo, Japan) fluorescence spectrometer (wavelength resolution is 0.1 nm) was used to detect the fluorescence peaks. The residual QDs in PSM result from two scenarios: on the one hand, QDs were not successfully coupled to the complementary DNA. On the other hand, QDs were successfully coupled with complementary DNA but failed to hybridize with the probe DNA. These QDs cannot be connected with the hole wall of porous silicon, because porous silicon is sealed by functional treatment such as oxidation, silanization, and glutaraldehyde. The result is shown in [Figure 10](#sensors-19-04872-f010){ref-type="fig"}. The excitation wavelength is 375 nm, the excitation voltage is 700 V, and the slot width is 5 nm. The fluorescence spectra of QDs dripped into fully functionalized PSM devices are shown. The absence of obvious fluorescence peaks indicates that QDs will not enter the porous silicon voids if they are not successfully linked to complementary DNA, and this will not affect the experimental results.
Complementary DNA with concentrations of 0.05 nM, 0.10 nM, 0.50 nM, and 1.00 nM was labeled with QDs and hybridized with probe DNA; the measurable angle changes Δθ were 0.27°, 0.33°, 0.87° and 1.87°, respectively. [Figure 11](#sensors-19-04872-f011){ref-type="fig"} shows the relationship between the angular variation and the concentration. The red line is the fitting result, where X denotes the concentration of complementary DNA labeled by QDs (nM), Y denotes the angular redshift Δθ before and after hybridization, with a slope of 1.67, and the linear correlation coefficient is *R^2^* = 0.98.
Because the surface of the PSM device fluctuates, it will cause random errors in measurement; therefore, the 3σ rule is used to calculate the experimental results. Using the same PSM blank sample, the position of the weakest reflected light intensity is measured 10 times. The standard deviation σ is calculated by Equation (6):$$\sigma = \sqrt{\frac{\sum_{i = 1}^{n}\left( {Xi - \overline{X}} \right)^{2}}{\left( {n - 1} \right)}}$$ where σ denotes the standard deviation of the position of the weakest reflected light intensity for 10 consecutive measurements, n denotes the number of measurements, and X denotes the position of the weakest reflected light intensity. The experimental results show that σ = 0.067°, and the detection limit is the concentration of complementary DNA at an angle change of 3σ, which is approximately 35.9 pM according to the linear equation.
The stability sensors and reproducibility of sensing assay are key components for monitoring of targets. Ten pieces of same functionalized porous silicon sensors have been prepared, and target DNA with concentration of 1nM has been detected for reproducibility investigation. All 10 sensors are detected by our method, and the relative standard deviation of the detection results is 4.4%. Five identical functionalized porous silicon sensors are used for sensing stability examine at five-day intervals, The DNA concentration was 1 nM and measured by proposed detection method, and the relative standard deviation of the detection results is 4.9%.
In addition, the complementary DNA of 20 nM, 30 nM, 40 nM, and 50 nM without QD labeling are hybridized with probe DNA at a concentration of 10 μM and detected by angular spectrum detection. The results are shown in [Figure 12](#sensors-19-04872-f012){ref-type="fig"}. The results show that the detection limit of the angular spectrum detection method for DNA molecules without QD labeling is approximately 11.1 nM.
Low detection limit can be achieved by using QDs to label biological molecules for biological detection. Y. Li et al. used QDs as markers and porous silicon biosensors to detect SA with different concentrations, and obtained a detection limit of 100 pM \[[@B19-sensors-19-04872]\]. However, the detection limit of DNA using porous silicon biosensors without fluorescent markers is generally in the order of nM. Researchers such as Liu and Rong-xia et al. used a single-photon quantum well (pqw) structure to detect 16-base-pair DNA oligonucleotides. The experimental results showed that the detection sensitivity is 3.04 nm/muM and the detection limit is 32 nM \[[@B28-sensors-19-04872]\]. Vilensky introduced a new type of microfluidic device that achieved a detection limit of 1 × 10^−9^ M without affecting the specificity \[[@B29-sensors-19-04872]\].
5. Conclusions {#sec5-sensors-19-04872}
==============
Based on a p-type boron-doped PSM device, 16 base pairs of complementary DNA are successfully labeled with CdSe/ZnS water-soluble QDs to amplify the refractive index of the reactant. The hybridization reaction between probe DNA and QD-labeled complementary DNA at different concentrations is detected by angular spectrum detection using a spectrometer-free device. The results show that the angle change before and after the biological reaction is linear with the concentration of complementary DNA labeled by QDs. The detection limit of 36 pM is obtained by the angular spectrum detection method using QD labels. Compared with the angular spectrum detection method without QD labeling, the detection limit is reduced from nM to pM. The detection sensitivity of the angular spectrum detection method is improved, and the detection limit is reduced.
Conceptualization, Z.J.; methodology, Z.J. and R.Z.; software, X.H.; validation, Z.J., R.Z. and X.H.; formal analysis, R.Z.; investigation, R.Z.; data curation, R.Z.; writing---original draft preparation, R.Z.; writing---review and editing, Z.J. and X.L.; visualization, R.Z., X.L. and X.H.; supervision, Z.J.; project administration, X.L.; funding acquisition, Z.J.
This work was supported by the National Science Foundation of China (grant nos. 61665012 and 61575168).
The authors declare no conflicts of interest.
{#sensors-19-04872-f001}
{#sensors-19-04872-f002}
{#sensors-19-04872-f003}
{#sensors-19-04872-f004}
{#sensors-19-04872-f005}
{#sensors-19-04872-f006}
{#sensors-19-04872-f007}
{#sensors-19-04872-f008}
{#sensors-19-04872-f009}
{#sensors-19-04872-f010}
{#sensors-19-04872-f011}
{#sensors-19-04872-f012}
|
{
"pile_set_name": "PubMed Central"
}
|
In recent years, in addition to a chemical synthesis method, synthesis of a substance using an organism or an enzyme has been started to be conducted in an industrial level. Synthesis of a substance by an organism or an enzyme enables reduction of energy in synthesis compared to a chemical synthesis method, and also enables synthesis specialized in a specific structure of a compound having an optical isomer. Meanwhile, improvement of the productivity is one of important issues in industrial production of a useful substance by a microorganism. Conventionally, breeding of a production microbe through genetic approaches such as mutation have been conducted as an approach to improve the substance productivity of a microorganism. In particular, recently, more efficient microbiological production of a useful substance using a recombinant technique etc. has been drawing attention due to the development of microbial genetics and biotechnology.
So far, Rhizopus, a filamentous fungus, has been disclosed as a microorganism which can be used in the production of lactic acid (Patent Documents 1 to 3). However, in a fungus of Rhizopus, examples of the study on recombinant techniques etc. are few because genetic background was not clear, introduction of a molecular genetic approach was late, and isolation and maintenance of a monoclonal strain is expected to be difficult since a fungus of Rhizopus has multinucleated cells. Though a 1dhA promoter (Patent Literature 1, Non Patent Literature 1), a pgk1 promoter (Patent Literature 2, Non Patent Literature 2), a pgk2 promoter (Patent Literature 3), pdcA and amyA promoters (Non Patent Literature 2), tef and 18Sr RNA promoters (Patent Literature 4) etc. are reported as promoters necessary for the transcription of a gene in a fungus of Rhizopus, the intensity of expression of these promoters has not necessarily been examined comprehensively and promoters and microorganisms which achieve even higher productivity are required to reduce the production cost in industrial production. [Patent Document 1] U.S. Pat. No. 6,268,189 [Patent Document 2] International Publication No. WO 2001/73083 [Patent Document 3] International Publication No. WO 2001/72967 [Patent Document 4] U.S. Unexamined Patent Application Publication No. 2010/112651 [Non Patent Document 1] Applied Microbiology and Biotechnology (2004) vol. 64:237-242 [Non Patent Document 2] Archives of Microbiology (2006) vol. 186:41-50
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Unsere Stars Datenbank über Palina Rojinski
Palina Rojinski (russisch Палина Рожински/Palina Roschinski) ist eine deutsche Moderatorin und Schauspielern mit russischer Herkunft. Sie wurde am 21. April 1085 in Leningrad in Russland geboren. Bekannt wurde Palina Rojinski durch ihre nackt Auftritte in der Fernsehshow MTV Home. In der Sendung spielte sie neben Joachim „Joko“ Winterscheidt und Klaas Heufer-Umlauf einen sexy Sitekick. Auch bei Circus HalliGalli hat Palina Rojinski immer wieder Auftritte. Mit ihrer prallen Oberweite und ihren sexy Outfits mit tiefem Ausschnitt wurde sie schnell zum Traum aller Männer.
Neben diesen Rollen hat Palina Rojinski aber auch eigene Shows welche sie moderiert, zum Beispiel die ProSieben Show "Was wäre Wenn". Darüber hinaus hat sie über die Jahre auch in zahlreichen Filmen ihr schauspielerisches Talent zur Show gespielt, es gibt sogar Szenen in denen sie nackt zu sehen ist. Oft trägt Palina Rojinski keinen BH und zeigt sich sehr freizügig. Im Jahr 2014 schossen Paparazzi zahlreiche oben ohne Fotos von ihr. Außerdem hat sie in dem Film Männerherzen an der Seite von Elyas M’Barek eine Nackt Szene von der es zahlreiche Nacktfotos zu bewundern gibt.
Über das Privatlebe von Palina Rojinski ist nicht viel bekannt. Sie zog im März 1991 mit ihren Eltern nach Berlin und war bis Februar 2013 mit dem deutschen Hip-Hopper Jean-Christoph Ritter in einer Beziehung. Es gibt immer wieder Gerüchte, dass Palina Rojinski eine heiße Kandidatin für ein nackt Playboy Shooting ist.
|
{
"pile_set_name": "OpenWebText2"
}
|
Yardeni NAV
Tuesday, March 26, 2013
Don’t worry, there will always be something to worry about. Yesterday, I reflected on how well the bull market has weathered numerous Apocalypse Now crises over the past four years. Many of them actually seem to be abating, forcing apocalyptic market pundits to postpone the predicted end of their endgame scenarios. Most recently, I anticipated that the Cyprus Moment wouldn’t turn into Europe’s Lehman Moment. Sure enough, the Cyprus problem was resolved over the weekend.
But it didn’t take very many moments yesterday for the initial rally in stock prices to be reversed by really stupid comments from a top European official. Jeroen Dijsselbloem, who heads the Eurogroup of euro zone finance ministers, told Reuters and the Financial Times that when failing banks need to be bailed out, euro zone officials would force the bank's shareholders, bondholders, and uninsured depositors to contribute to their recapitalization. He also said that Cyprus was a template for handling the region's other debt-challenged countries. Financial shares were among yesterday’s losers, especially in France and Italy.
Mr. Dijsselbloem, who is also the Dutch finance minister, said, “Taking away the risk from the financial sector and taking it on to the public shoulders is not the right approach.” That makes a great deal of sense, in theory. In practice, his reckless comments could easily upset the relative market calm that he said allowed his group to force private investors and depositors to pay for the bailout of two large Cypriot banks.
ECB President Mario Draghi deserves all of the credit for calming Europe’s markets with his pledge to do whatever it takes to defend the euro at the end of July last year. He did it again just yesterday when the ECB gave Cypriot banks access to its Emergency Liquidity Assistance (ELA) facility. By Monday afternoon, Dijsselbloem attempted to retract his earlier remarks as he issued a statement: “Macro-economic adjustment programmes are tailor-made to the situation of the country concerned and no models or templates are used.”
Wednesday, March 20, 2013
There has been a certain tendency for a spring slump that we have seen a few times. One possible explanation for that, besides some freaky things, some weather events and so on, one possible explanation is seasonality. Because of the severity of the recession in 2007 to 2009, the seasonals got distorted, and they may have led--and I say ‘may’ because the statistical experts, many of them, deny it--but it is possible they led job creation and GDP to be exaggerated to some extent earlier in the year. Our assessment is though, at this point, that we are far enough away from the recession that those seasonal factors ought to be pretty much washing out by now.
As Mr. Bernanke noted, many statistical experts deny that there has been a distortion at all. For example, two economists at the Bureau of Labor Statistics analyzed the problem in an article appearing in the October 2012 issue of Monthly Labor Review. After a careful and thorough analysis of the data, they concluded: “Removing the declines due to the 2007-2009 recession prior to seasonal adjustment in a number of experimental data series reveals that the recession did not create any bias causing a pattern of stronger increases in employment in the winter months of the fourth through the first quarter versus weaker increases from the second to the third quarter.”
Tuesday, March 19, 2013
Cyprus has been a safe haven for money-laundering operations. Russians have large deposits in the island's banking system. The tiny nation, which is one of the 17 members of the euro zone, has only 860,000 people, but the banks have €68.4 billion in deposits. The Germans are in no mood to bail out Russian depositors in Cyprus, which is why the initial bailout plan required a 9.9% wealth tax on large uninsured deposits. Small depositors were also hit with a levy.
Undoubtedly, the final deal will be amended to cushion the blow to small depositors. However, the latest mess in the Euro Mess is a reminder that Mario Draghi's pledge to do whatever it takes to defend the euro won't clean up the mess. The pledge bought time, which must not be wasted or the Euro Mess will last for years to come. The “Cyprus Moment” is yet another waste of time.
For now, the euro zone is falling deeper into recession, as evidenced by the region's weak production numbers during January (Fig. 1). The UK is heading in the same direction (Fig. 2). The question is how long will the Cyprus Moment last, and will it morph into Europe's Lehman Moment? I doubt it. So far, government bond yields for both Italy and Spain remain subdued (Fig. 3). I don't expect that TARGET2 payments will show outflows from these two debt-challenged nations to Germany as a safe haven (Fig. 4).
Monday, March 18, 2013
This past weekend, euro zone finance ministers agreed on a shocking bailout plan for Cyprus. It requires bank accounts with balances above €100,000 to be taxed at 9.9%, while those with less will be taxed at a 6.75%, to raise €5.8 billion for the near-bankrupt nation. This marks the first time in the euro zone crisis that depositors in the bloc's banks will lose money. This unprecedented move to make depositors contribute to a bailout is stoking fears of deposit runs hitting all fragile euro zone banks.
I don’t expect this “Cyprus Moment” will turn into a Lehman Moment for the euro zone. However, the plan could shatter the calm in the euro zone following the pledge at the end of last July by ECB President Mario Draghi to do whatever it takes to defend the euro. The only upside is that we won’t have to worry about irrational exuberance until this latest mess in the Euro Mess is cleaned up.
Monday, March 4, 2013
Japan’s new Prime Minister Shinzo Abe has chosen Haruhiko Kuroda to be the next governor of the Bank of Japan (BOJ). Once he is approved by the Diet, the new governor is expected to push for unlimited QE to start immediately rather than in 2014. The goal is to reflate the economy with a target of 2% for the inflation rate (Fig. 1). The BOJ’s Policy Board is scheduled to hold its first meeting under the new leadership on April 3 and 4.
The question is: Will Abe’s new fiscal and monetary stimulus programs be any different than the same old tired Kabuki of the past two decades? The fact is that we’ve seen this play several times before with the same unhappy ending. Numerous Japanese governments have resorted to such measures to boost growth rather than implement much-needed economic reforms. Nominal GDP has been virtually flat (up only 0.6%) since Q1-2009, with real GDP up 7.3% (over the entire period!) and the GDP deflator down 6.7% (Fig. 2). The Nikkei is up 34% since November 13, 2012, and the yen is down 15.2% over the same period (Fig. 3and Fig. 4). However, swings of this magnitude have occurred in the past since 1990 without any significant improvement in the performance of the economy.
Search
Translate
About: This blog tracks the latest developments in the Federal Reserve System and the other major central banks. It aims to inform the public about global monetary policy. This blog is a companion to The Fed Center website, which provides an extensive updated library and archive of related resources.
|
{
"pile_set_name": "Pile-CC"
}
|
Category Archives: Etiquette of a Writer
It is commonly said in order to promote and market your work, “Presence is key.” Does this mean you have to bombard people with posts saying, “Buy my book!”? Or does it mean you can constantly tell people, “Read my stuff! Look at me! Check this out!”? No. That is not what it means when it is said ‘presence is key’. So what exactly does it mean?
First off, the saying is very true. In order to promote, market, and sell your work, your presence must be out there—notice, I said your presence, not the presence of your books or work or anything like that but rather you. You must become a face and a name familiar to people because if people know you, they’ll be more likely to consider whatever you’re selling, and they may start spreading the word. So, how do you do this?
Don’t make it about you. If you’re on Facebook, Twitter, or any social media site, don’t make all your posts about you. Instead, reach out to others, encourage them, answer their questions if you can, and promote their work. Then, when the time is right, market your own work, but don’t spam your followers with posts saying anything along the lines of, “This is worth reading! Worth purchasing!” Your work should speak for itself. Your readers should speak for you. If you have to boast about it, that gives the exact opposite message you want to portray—it tells me your work isn’t exceptional.
Is there a place for you to specifically promote your work without being a nag? Yes, but you need to create that space. For instance, having a Facebook Page or Facebook Group specifically for your work is a good place to post anything regarding what your work. Your followers there expect that, so it’s fine. However, don’t private message anyone or go to someone else’s page and tell them they need to buy your book. That is distasteful etiquette, and as I said, it has the opposite effect than what you want. The only time this is acceptable is when someone inquires of something along the same lines as to whatever you have to offer. That’s a good time to suggest whatever your work. Notice, I said suggest—not tell or order the person to purchase whatever you’re offering because when someone commands us to do something, we’re more inclined to do the opposite just because we like to be rebellious like that.
So, how should you approach marketing yourself? Don’t be afraid of social media or of criticism. Be watchful of what you say, and be considerate of others—remember, they’re human beings as well. Determine your strengths and be willing to share your resources with others without expecting anything in return. Yes, in an ideal world, if you promote someone’s work, they will in turn promote yours, and some people are really good like that, but others…they just forget or don’t think about it, and that’s okay. That is simply who they are, and you shouldn’t take offense to it, and you’re not obligated to share their work either unless you truly think it is worth sharing. At the same time identify your weaknesses and be on the lookout for those people who might be able to help you strengthen those areas. Someone else might have the same weakness and ask the question you didn’t want to ever ask, so you can follow the conversation and learn as well.
Also, when you are giving others feedback on their work, don’t settle for, “That was good!” While the writer appreciates the fact that you think their story is worthy of some praise, this kind of feedback is shallow and hollow. Instead, look into whatever you’re reading and try to pick out one unique thing that stands out for you and bring that out. That will show the author that you really did pay attention. However, if you see errors or anything that needs correcting, be courteous and contact them privately informing them of the problem. Why do it privately? Well, one day it may be your work out there being critiqued, and would you rather someone publicly correct you or privately? If you’ve shown respect to others, they are more prone to show you the same respect.
In other words, be human. Whatever you have that you’re promoting, seek opportunities to surprise your followers and do random acts of kindness for them. Offer unique opportunities that would get your readers excited about interacting with you.
Is this all you need to do to successfully sell your work? No. Each social media site has its tricks here and there and little secrets that’ll help you. However, knowing who you are and being comfortable and confident that your work can speak for itself is a major realization, and this carries over to all social media sites.
In the end, be real, promote your work from time-to-time, but be yourself.
Book covers are important. They are the image by which your book will be judged. Everyone says, “Don’t judge a book by its cover,” but honestly, if the cover doesn’t catch our attention, it’s unlikely we will read it. When you sign up with a traditional publisher, they have their own graphic artists who they will assign to your book, and you will work with them. They have their own process. What I want to focus on though is when an indie author is working with a graphic artist to create the perfect book cover for their self-published book. However, when working with another creative mind, there is an etiquette that must be considered for the best results. Here are a few things to keep in mind:
Make sure the artist and you work well together.
Come prepared with an idea for the cover.
Don’t settle for less. Follow your gut. Be honest but respectful.
Give the artist creative license.
Make sure the artist and you work well together. As exciting as it is to be at the stage where you need a cover for your book, remember you might not get along with the first artist you encounter. So, before assigning her the task to design your cover, communicate with the artist. How well do you communicate? Are there any misunderstandings? Do you just have a bad feeling about it? Can you be honest with the person? If anything raises a red flag in your mind, do not follow through. It’s better to delay the design of the cover and find the right artist than to force cooperation between the two of you when there is no chemistry. Trust your gut.
Come prepared with an idea for the cover. When I had my first book cover designed, I had no idea what I wanted, so I told the artist the basic idea of the story. When he came back to me with a proof of the cover, I wanted to cry in horror. It looked like a boring textbook—gray and lifeless. But of course the artist didn’t know better. He never read the book. How could he create a proper representation of a story he’s never read? Armed with this knowledge, I sat down and imagined what the book would look like on the shelf of the bookstore—what did the cover look like? From there, I sketched out a very rough idea of the cover and sent it on to him. With that, he was able to work his magic. The lesson learned? It is better to have a vague idea of what you imagine the cover to look like than no idea at all. However, keep in mind, the end result will likely be nothing like you imagine—it should be better than you imagined.
Don’t settle for less. Follow your gut. Be honest but respectful. There will be countless of versions of the cover. With each one, if something doesn’t feel right about the cover, express to the artist what you think the problem might be and ask her if she could change it. The artist won’t see the cover like you do because she is working so closely with it, so you need to point out when something doesn’t feel right about the cover. Neither you nor the artist should get irritated with one another when you’re nitpicking. Both of you should be patient and working with one another. If the problem doesn’t seem to be resolving, take a break. Get away from it in order to look back at it with new eyes. When you come back, you might not see the problem at all—or you might have a better way of explaining what exactly the problem is to the artist.
Give the artist creative license. If you can create your own cover, then do it, but if you can’t, then let the artist do her job. You may present an abstract idea for a cover, but it’s her job to put it into the concrete. Unless the cover is completely illustrated by the artist, most artists will use stock photos for the pictures of the cover, and unfortunately those may not be exactly the look you wanted for this character or that one. The artist should be able to manipulate it to look closer to what you want, but it will be slightly different than what you imagined.
As an author, you may have googled images that you would like to see on your cover, but do not expect those pictures to be used unless they are stock photos. It is okay to find pictures you like and even actors you imagine for your characters, but in the end, accept the fact that none of those pictures will likely be on the cover at all. Otherwise, there is potential of getting in trouble with copyright laws and such. You don’t want that headache. The graphic artist will try to find pictures that are extremely close to the ones you chose, but they will not be identical, and this is good—it makes it unique to your own work.
Now, if you do want to choose pictures that you can use, look up stock photos. Here are a few sites:
And there are many, many more! Find the pictures you like, but don’t purchase anything yet because the picture might not fit perfectly into the cover that’s being created, and an alternative photo will have to be chosen. Show the artist the pictures you’re thinking about, and let them create a mock cover. Once you’re satisfied with the cover, the artist will tell you which stock photos you need to purchase. Is it your responsibility to purchase the stock photos? Yes—unless the artist and you came to some kind of agreement beforehand. This is something you will need to discuss with them just to make sure you’re both on the same page.
When you are working with a graphic artist, the two of you are on the same team. You want the same thing—the perfect cover. Both of you should be patient and professional about it.
Also, authors, if you’re looking for covers and you don’t want to go through the stress of working with an actual artist, you can find pre-made covers for a reasonable price here: www.selfpubbookcovers.com.
Now artists, you may work with an author who is very insecure and doesn’t feel comfortable asking you to make changes. If you sense that is the kind of person you’re working with, be patient with them and reassure them that you want the perfect cover for their book. When you finally think you’ve arrived at the perfect cover, then here are some questions you can ask such an author:
“Is the background exactly the way you want? Should any of the background elements be changed or altered in any way?”
“Do the elements in the foreground meet your approval? Does anything stand out that shouldn’t? Or is there something that should stand out but doesn’t?”
“Do you approve of the color of the cover? How is the lighting/shadows?”
“Are your name and the title positioned where and how you want them? Do you approve of the font?”
If the author approves of everything but you still get the feeling he’s not being completely honest (with himself if not you), you can recommend he think about it for a day, and if he’s still content with the cover, then your work is complete.
If you’re the artist, the last thing you want is for the author to come back to you further down the road and finally confess, “I really don’t like this element of the cover. Could you change it?” When this happens, you have to consider how much you’re going to charge for revisions after the job has already been completed and such. That is stress no one wants to deal with.
If you’re the author, the last thing you want is to be stuck with a cover you secretly don’t like. It’s very hard to promote your work and be excited about your book if you dread the cover. If you’re not excited about it, no one else will be excited about it, and your sales won’t get off the ground. The cover does affect your confidence, so it’s better to be open and honest with the artist during the process rather than regret it later.
However, artists, there will likely be authors who are perfectionists and constantly asking you to change their cover over and over and over again even though it’s really good. There will come a point where you will simply have to put your foot down and calmly but professionally inform them that you can only do a certain number of revisions and after that any additional revisions will be an added cost.
Authors, don’t freak out when I say that to artists. Most artists won’t tack on any additional cost because they really want to work with you and have the best cover for you. Nevertheless, if you push them too hard and are unreasonable, they will stand their ground.
Once you find an artist you work with splendidly and their fees aren’t unreasonable, don’t let him or her go. You can have a wonderful working relationship that could last through book series, and this also allows for consistency of the book covers.
Remember, both of you are creative individuals coming together to create the finished product of a book. Give each other space and respect. Be professional, be honest, but also be considerate.
Last week we identified and discussed the role of Casual Readers. Now we’re going to focus on the more popular role of a Beta Readers.
While Casual Readers tend not to be writers, Beta Readers are usually on the path to becoming editors and are writers themselves. First thing to recognize about Beta Readers is there is not a one size fits all. You may not agree with someone’s method of critiquing because they’re looking at it all wrong, and they’re always negative, and you just can’t seem to do anything right. If this is the case, try getting another Beta Reader, but always do a trial run with them first. Send a sample of your writing, see how they critique. If you two seem to get along, then work from there.
With Beta Readers, it is up to them whether or not you send your work as a complete manuscript at one time or chapter by chapter. This is something the two of you must discuss. Simply be aware, the more you send, the longer it will take to get anything back to you. It is also important to remember that you should have revised and edited your work at least once before sending it to a Beta Reader.
With a Beta Reader, it is important to understand one thing: their job is to tear your work to shreds. Yes, this is difficult. It’s hard. It’s painful. However, it is important. This is also preparing you for when your work must go before an editor. It’s helping you understand your work better and develop thick skin.
Now, on this topic, there is something very important to realize. If you have people read your work, and they stop at a certain point and can’t read further, you must investigate—not only where they stopped but from the beginning all the to that specific point. Look at description, dialogue, character development, scene setting, plot development, writing style. Are the characters cliché? Are they too perfect? Are they relatable? Is there a moral issue in the story that’s causing the problem?
Most people won’t tell you why they didn’t like the story because they don’t know. Some might know, but if you’re stubborn and stuck in your way when it comes to writing, they’re not going to be very honest with you because it takes a lot of time and energy to explain to you the problem.
I don’t volunteer to read anyone’s writing anymore. If I can’t finish a story, I find out exactly why that is, and it’s usually more than one issue, but this one issue brings up this other issue which breeds another one and so on and so forth, and the writer is left thinking, “I can’t write!” And I’m respond, “No, you can! You’re very good at it, and you wrote an entire story which is an awesome accomplishment!” but then I’m lost at how to encourage them to step back, have faith, and tackle things one at a time.
If you’re confident in your writing ability and believe the story you wrote is important for the world to know, then nothing can tear you down. Yes, there are people out there who want nothing more than to completely rip writers to shreds. It doesn’t matter how much effort you put into something or the importance of certain elements and specific scenes, they don’t care. I don’t understand those people, but when I encounter those people, I don’t bother to justify my writing or explain myself. They have a right to their own opinion, and no matter how many times I revise my work, it won’t make them happy, so I just nod and tell them, “Thank you. I will take it into consideration,” but then I’ll go back to my story and set the criticism before the characters and listen to them protest loudly, “Why would I do that?! What would my motives be? That makes absolutely no sense. No, no, and no!” And they cross their arms, threatening me with Writer’s Block if I even attempt to revise in the suggested manner.
This is why you must know why you wrote everything in the story, why it’s important to see how the pieces connect.
However, there are some unofficial guidelines we can all use.
WRITERS, if you give your work to a Beta Reader to critique, expect them to do several things:
They will read your story from beginning to end in a timely manner.
They will make notes on everything that jumps out at them.
They will ask questions.
They will point out errors.
They will not correct or change anything for you.
They are not your brainstorming buddies (unless agreed upon otherwise).
If a Beta Reader cannot complete your novel for lack of time or simply disinterest in the story, you should not be offended but find another Beta Reader.
You must remain professional.
Honesty is key.
BETA READERS, if you volunteer to read someone’s work to critique it, there are a few things you must recognize:
You are obligated to read their entire work and critique it in a timely fashion.
If you cannot complete their work, you must inform the writer of this and explain why.
Do not volunteer to read someone’s work out of pity especially when you’re disinterested in their story.
Look for positive aspects of the story as well as the negative.
You must remain professional.
Honesty is key.
Now notice, I said Writer and Beta Reader should ‘remain professional’ and that ‘honesty is key’. WRITERS, your story may be your baby, but when you’ve reached this stage of your story, you must distance yourself from it and become professional about it. This makes any negativity toward your writing easier to accept and to view objectively rather than subjectively. BETA READERS, being professional while you work allows you to do your work properly without fear of the author lashing out at you and blaming you for your criticism. Even if that were to happen, you can take everything in stride and carry on.
Honesty is the most important element in this process. Writers must be straightforward and honest with their Beta Readers of what they expect from them and when they need the story’s critique completed and returned to them—set a deadline. Beta Readers need to be able to say ‘no’ when they have too much on their plate or when they feel their style of critiquing will not work well with a specific author. Beta Readers should be able to express their opinion without too much concern of how the writer will react since the writer should react responsibly.
Are these hard and fast rules? No. They’re completely unofficial, but they could help to eliminate stress and frustration on everyone’s part. You may approach this subject any way you want.
To summarize: while you are writing or in the middle of revising and editing but need encouragement, find a Casual Reader (or several) to be your cheerleader. Once you’ve revised several times and are now ready for the next step, find a Beta Reader and understand everything is about to get serious, so be professional, and keep honesty between the two of you. This will help you face the harsh realities of publishing.
First, to clarify the title. The ‘readers’ implied are not the readers who pick your books up off the shelf and read. The readers I mean are those who work closely with you prior to publication. They are friends and family you let read your book in the process of writing it and revising and editing it, and they are those who will critique your work prior to you sending it to any publisher or editor. So I am not directing this to anyone picking up a book to read it for the first time. Everything I’m talking about is before the book is even published. Now, with that clear, let’s move on.
For writers, it is unnerving when our VERY first readers read our books before it’s even published. We might have written the entire story without telling a soul what it was about, or we might have told everyone we encountered about our story, but now is the time of reckoning—the time to see what someone truly thinks of it. Now it is time for the story to stand up and speak for itself—be the brilliant story you claimed it to be. Like you letting go of your child’s bike as they attempt to ride without the training wheels, you have faith they’ll find their balance and their freedom in being independent, but at the same time, you’re worried they might falter and fall and scrape their knee. Even if they do fall, you know you can’t rush to them and cuddle them and carry them into the house. They have to grow used to the pain of falling down, and they have to learn to get back up again. It’s part of growing up. The same thing applies to our writing.
Once we’ve written the story, we trust it’s ready for anything, but at the same time we’re terrified of being told that the ideas in our head are not entertaining, enlightening, inspiring, or original. We hate being informed our writing is cliché or boring or that people just don’t ‘get it’, so what are we supposed to do?
Let’s define some terms and then go into detail.
First up, we have the Casual Reader. This would be what I described in my previous post when you let a friend or family member read your story while you’re working on it (especially doing the revision/editing process). Their primary purpose is to be a cheerleader but also to wave a red flag when they’re confused at a point. You can let a Casual Reader read your work as soon as you finished the first draft or while you’re revising and editing your work.
Beta Reader: This is the individual you give your work to when you are ready for some real critiquing. You should have already done a revision or two or three and edited it as best you can. These are the people who are looking for inconsistencies, grammar errors, plot holes, and they will challenge your decision to have this scene unfold that way or that character to do that and not this. A lot of Beta Readers have the inclination of becoming editors, so they’re using this time as practice.
So let’s go into more detail about each kind of reader. Let’s start with the Casual Reader. Why let people read your work before it’s even completed and absolutely polished? One of the most irritating things I’ve discovered as a published author is working hard on a book, get it published, and the only response I get are vague like, “Oh it was a good story.” Now, to be fair, some are more definite in their responses, but still it’s easier to say “It was great,” rather than go into details as to why you absolutely loved all 600 pages of the book. Meanwhile, I labored hard to work that twist in Chapter 5, to kill that character in Chapter 10, to show the emotional and fundamental but silent moment in Chapter 26—doesn’t anyone appreciate it? I almost killed your favorite character, and all I get is, “Oh, that was nice.”?
Your Casual Reader will give you feedback you need to motivate you along the way. They will be your fans. You might not be famous with thousands of followers on Twitter and Facebook, but these few devoted readers will make you feel like the best writer in the world—not because they’re trying to make you feel good, but because they really enjoy the story and can’t contain themselves.
When you let Casual Readers read your work, don’t overwhelm them by sending in the entire story at one time but rather a chapter at a time. Letting someone read the story as a whole is like watching a movie. There’s a beginning, a middle, and an end, and it’s all wrapped up nicely where it may or may not have a sequel. However, allowing people to read it only a chapter at a time is almost treating it like a TV show rather than a movie—you drag it out. They get really attached to the characters, and that’s exactly what you want.
Casual Readers will give you feedback such as this (taken from a Casual Reader of mine who has given me permission to share):
“Oh my gosh that is so AWESOME!!!!!!!!!! I LOVE IT I LOVE IT I LOVE IT I LOVE IT!!!!! 😀 I especially love the part when Vixen asked the guardian to hold her glove thing and she knocked him out. I cracked up laughing on that one.”
“Don’t make me cry you cannot make me cry I cannot cry STOP MAKING ME WANT TO CRRRRRYYYY!!!!!” :'(:'(:'(:'(:'(:'(:'(:'(:'(
“Hahahahaha!!! This was hilarious! And surprising. You made me think that Ardden was going to be okay but who knows (except you) what’ll happen? I thought it awkward then hilarious when Lorrek found out Vixen and she disappeared so suddenly. And I so love it that everyone loves everyone yet they hate them so much.”
“Finally I read it. I was so busy. I Love iiiiittttt!!!!! 😀 it kind of looks like Verddra is going to the good side, but you left a quote in there that Honroth said. Something about enemies. Anyway, it left me thinking that Verddra is acting good yet she isn’t.”
As you can observe, this kind of feedback is the best. It tells me in real time what my readers think and feel about characters, things they experience, and decisions they make. So if you want some responses from your readers, try sending it to them a chapter at a time and tell them in order to get the next chapter, they need to tell you what they think in detail of the chapter they read. This might not work for some readers because of time restraints, but communicate with them and see what works best.
Now, sometimes the Casual Reader will have questions, and that’s a good thing. Do not take offense or be discouraged when you get this kind of feedback. Remember, you’re letting the Reader read while you’re likely revising and editing, so you can always and honestly say, “It’s the rough draft.” In this context, errors to expected and forgiven. The Casual Reader is more like highlighting the AWESOME parts while tagging the vague parts. They are not the Beta Reader, so don’t expect them to give you too much detail as to what is wrong.
This is what you can expect from a Casual Reader. So, what kind of people are good Casual Readers? Not writers. I have about five Casual Readers, but only one is a writer of any kind. All others just enjoy reading. So find friends or family members who have the time to read, and ask if they’d be willing to read your story a chapter at a time.
I had fully intended for this to be one post discussing the Casual Reader and the Beta Reader, but as I wrote it, I realized it was getting long, so I’ve decided to split the two. Next week we will discuss the Etiquette for Beta Readers.
|
{
"pile_set_name": "Pile-CC"
}
|
----- Forwarded by Steven J Kean/NA/Enron on 10/30/2000 07:22 AM -----
Calvin Eakins
10/27/2000 05:02 PM
To: Kenneth Lay/Corp/Enron@ENRON, Jeff Skilling/Corp/Enron@ENRON, Joseph W
Sutton/ENRON_DEVELOPMENT@ENRON_DEVELOPMENT, [email protected], Cliff
Baxter/HOU/ECT@ECT, Sanjay Bhatnagar/ENRON_DEVELOPMENT@ENRON_DEVELOPMENT,
Rick Buy/HOU/ECT@ECT, Richard Causey/Corp/Enron@ENRON, Diomedes
Christodoulou/SA/Enron@Enron, Stephanie Harris@ENRON, Andrew S
Fastow/HOU/ECT@ECT, Calvin Eakins/Corp/Enron@ENRON, Mark
Frevert/NA/Enron@Enron, Kevin Hannon/Enron Communications@Enron
Communications, David W Delainey/HOU/ECT@ECT, David
Haug/ENRON_DEVELOPMENT@ENRON_DEVELOPMENT, Stanley Horton/Corp/Enron@Enron,
Larry L Izzo/ENRON_DEVELOPMENT@ENRON_DEVELOPMENT, Steven J
Kean/NA/Enron@Enron, Mike McConnell/HOU/ECT@ECT, Rebecca
McDonald/ENRON_DEVELOPMENT@ENRON_DEVELOPMENT, Jeffrey McMahon/HOU/ECT@ECT,
Cindy Olson/Corp/Enron@ENRON, Karen S Owens@ees, Ken Rice/Enron
Communications@Enron Communications, Jeffrey Sherrick/Corp/Enron@ENRON, John
Sherriff/LON/ECT@ECT, Elizabeth Tilney/HOU/EES@EES, Greg Whalley/HOU/ECT@ECT,
Thomas E White/HOU/EES@EES, John
Garrison/ENRON_DEVELOPMENT@ENRON_DEVELOPMENT, J Mark Metts/NA/Enron@Enron,
Daniel Brown/NA/Enron@Enron, Dana Lee/HOU/EES@EES, George
Wasaff/NA/Enron@Enron
cc:
Subject: Expenditures with Minority/Women Owned Business Enterprises through
September 30, 2000
Ladies and Gentlemen:
Set forth below for your information and review are the expenditures with
Minority/Women Owned Business Enterprises through September 30, 2000.
Should you have any questions, please contact me at x69500.
Calvin Eakins
Director, Minority & Women Business Development
Enron Global Strategic Sourcing
[email protected]
713/646-9500
|
{
"pile_set_name": "Enron Emails"
}
|
Death of LOW
Stratics VeteranStratics Legend
You have had a couple of faction items on my Yew vendor for more than a week. If they arent picked up this week I will be pulling them down. I will probably be taking a little summer break from uo, so I am unsure if/when they would be put back up.
Stratics is the oldest continually running MMORPG Fansite on the Internet. Founded in 1997 Stratics has served the Ultima Online Community for 18 years. We strive to provide the most complete social experience for Ultima Online players.
|
{
"pile_set_name": "Pile-CC"
}
|
[Suicide among the elderly in Norway].
We wanted to generate more knowledge about elderly people who commit suicide in Norway, especially in relation to demographic conditions, somatic and psychiatric disease, suicide methods and suicidal communication. The material consists of 287 cases of suicide in people aged 65 years or more who were examined at the Department of Forensic Medicine of the University of Oslo during the 1992-2000 period. Sources of information were the forensic autopsy records and police reports. In a majority of the cases the deceased had suffered from psychiatric disease (62%), mostly depression (41%). Somatic disease was less often a prominent factor (22%). A majority had an established contact with the health services at the time of suicide. Suicidal thoughts had been expressed by 29%; previous suicide attempts had been reported by 15%. Health personnel must pay attention to elderly people with symptoms of depression, especially those who express suicidal feelings and have made previous attempts.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
<section>
<h1 class="blue" data-id="#files/css"><i class="ace-icon fa fa-file-o grey"></i> CSS/LESS Files</h1>
<hr />
<!-- #section:files/css -->
<div class="help-content">
<h3 class="info-title smaller" data-id="#files/css.bootstrap">1. Bootstrap</h3>
<!-- #section:files/css.bootstrap -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
Bootstrap's LESS files are not included in the package except for the following:
<br />
<code><span class="brief-show">assets/css/less/bootstrap/</span>variables.less</code>
<code><span class="brief-show">assets/css/less/bootstrap/</span>mixins.less</code>
</li>
<li>
I have modified Bootstrap's CSS file slightly so it's different
from original files you download from official site.
</li>
<li>
But you can use original Bootstrap CSS file without problem.
<br />
Just remember to replace Ace's version of Bootstrap variables file located at
<code>assets/css/less/bootstrap/variables.less</code>
with original Bootstrap variables that you download,
and re-compile Ace's LESS files into CSS again.
</li>
<li>
Specifically, I have changed <code>@gutterWidth</code> from <b>30</b> to <b>24</b>
and changed <code>@grid-float-breakpoint-max</code> from <b>@screen-sm-min</b><i>(768px)</i> to <b>@screen-md-min</b><i>(992px)</i>.
</li>
<li>
The result is that with default Bootstrap, mobile menu will be visible when window width is less than <code>768px</code>
but now it's been modified to <code>992px</code>.
<br />
And it's fine as most desktop browsers are wider than <code>1000px</code>.
</li>
<!--
<li>
<div class="space-8"></div>
I have also modified <code>mixins.less</code> to reduce the number of floating point digits.
<br />
So for example:
<pre data-language="css">
.col-xs-10 {
width: 83.33333333%;
}</pre>
has been changed to:
<pre data-language="css">
.col-xs-10 {
width: 83.3333%;
}</pre>
</li>
-->
</ul>
</div>
<!-- /section:files/css.bootstrap -->
<h3 class="info-title smaller" data-id="#files/css.third">2. Third party</h3>
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
Third party plugin CSS files are inside
<code>assets/css/</code> folder.
</li>
<li>
Minified version is find inside <code>dist/css/</code> folder.
</li>
</ul>
</div>
<h3 class="info-title smaller" data-id="#files/css.less">3. Ace LESS</h3>
<!-- #section:files/css.less -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
Ace's main CSS file (<code>ace.css</code> or <code>ace.min.css</code>) is generated by compiling LESS files.
</li>
<li>
You can find LESS files here <code>assets/css/less</code>
and compile them into CSS using <b>Node.js</b> and <b>LESS</b> compiler using the following command:
<br />
<code>lessc <span class="green">ace.less</span> ../ace.css</code>
<br />
or
<br />
<code>lessc <span class="green">ace.less</span> <b class="blue">--clean-css</b> ../ace<b class="blue">.min</b>.css</code>
</li>
<li>
Main less file is:
<br />
<code data-open-file="css" class="open-file"><span class="brief-show">assets/css/less/</span>ace.less</code>
</li>
<li>
Variable files are:
<br />
<code data-open-file="css" class="open-file"><span class="brief-show">assets/css/less/</span>variables.less</code>
<br />
<code data-open-file="css" class="open-file"><span class="brief-show">assets/css/less/</span>fonts.less</code>
<br />
and
<br />
<code data-open-file="css" class="open-file"><span class="brief-show">assets/css/less/</span>ace-features.less</code>
<br />
which enables feature selection.
</li>
<li>
<div class="alert alert-info">
If you don't have Node.js installed, you can download it here:
<a href="http://nodejs.org/download/">http://nodejs.org/download/</a>
<br />
Then you should install less compiler using the following command:
<br />
<code>npm install -g less</code>
</div>
</li>
</ul>
</div>
<!-- /section:files/css.less -->
<h3 class="info-title smaller" data-id="#files/css.css">4. Ace CSS</h3>
<!-- #section:files/css.css -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
Ace's main CSS file is generated by compiling LESS files into CSS:
<br />
<code>lessc ace.less ../ace.css</code>
<br />
</li>
<li>
But there is also:
<ul class="list-unstyled info-list">
<li>
<code>ace-ie.css</code> which has some rules for IE9 and below and should be included for IE only using conditional comments:
<pre class="light-green">
<!--[if lte IE <span class="light-red bolder">9</span>>
<link rel="stylesheet" href="<span class="purple bolder">path/to/assets/<span class="light-blue">ace-ie.css</span></span>" />
<![endif]-->
</pre>
</li>
<li>
<code>ace-part2.css</code> which is used when main CSS file (ace.css) is too large for IE9 and below (the 4096 selector limit).
<pre class="light-green">
<!--[if lte IE <span class="light-red bolder">9</span>>
<link rel="stylesheet" href="<span class="purple bolder">path/to/assets/<span class="light-blue">ace-part2.css</span></span>" />
<![endif]-->
</pre>
See the following links for more info about this IE limitation:
<br />
<a href="http://support.microsoft.com/kb/262161">Link 1</a>
&
<a href="http://blogs.msdn.com/b/ieinternals/archive/2011/05/14/10164546.aspx">Link 2</a>
</li>
<li>
<code>ace-rtl.css</code> file which is used for RTL (right to left) direction suitable for languages such as Arabic, Hebrew and Persian.
<br />
For more info about using RTL, please see <a href="#settings.rtl">RTL section</a>
</li>
<li>
<code>ace-fonts.css</code> which is the font definition file.
<br />
Used only when you want to serve local fonts rather using fonts directly from google.
<br />
You can also put content of <code>ace-fonts.css</code>
on top of your main CSS file to reduce number of files.
</li>
</ol>
</li>
</ul>
</div>
<!-- /section:files/css.css -->
<h3 class="info-title smaller" data-id="#files/css.skins">5. Ace Skins</h3>
<!-- #section:files/css.skins -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
<code>ace-skins.css</code> file is generated by compiling
<br />
<code>assets/css/less/skins/skins.less</code>
<br />
using the following command:
<br />
<code>lessc <span class="green">skins/skins.less</span> ../ace-skins.css</code>
<br />
or
<br />
<code>lessc <span class="green">skins/skins.less</span> <b class="blue">--clean-css</b> ../ace-skins<b class="blue">.min</b>.css</code>
</li>
<li>
If you don't want to use a separate skin file,
you can compile <code>ace.less</code> using your skin of choice.
<br />
To do that, edit
<br />
<code>assets/css/less/sidebar.less</code>
<br />
and replace
<br />
<code>@import "skins/no-skin.less"</code>
<br />
with
<br />
<code>@import "skins/skin-1.less</code>
<br />
or any other skin.
</li>
<li>
For more info about skins you may want to see <a href="#settings.skins">skins section</a> as well.
</li>
</ul>
</div>
<!-- /section:files/css.skins -->
<h3 class="info-title smaller" data-id="#files/css.order">6. CSS file order</h3>
<!-- #section:files/css.order -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
The correct order of including CSS files is as follows:
<ol>
<li>
<b>bootstrap.css</b>
</li>
<li>
<b>fontawesome.css</b> if you want to use Fontawesome icons.
</li>
<li>
<b>ace-fonts.css</b>
<br />
You may want to serve fonts from your own server or hosted by Google.
<br />
View this file for an example:
<br />
<code data-open-file="html" class="open-file"><span class="brief-show">mustache/app/views/layouts/partials/_shared/_template/</span>fonts.mustache</code>
</li>
<li>
Third party css files such as <b>chosen.css</b> or <b>ui.jqgrid.css</b>
</li>
<li>
<b>ace.css</b>. Ace's main CSS file.
</li>
<li>
<b>ace-part2.css</b>. IE 9 and below have a 4096 selector limit.
<br />
See the following links for more info about this IE limitation:
<br />
<a href="http://support.microsoft.com/kb/262161">Link 1</a>
&
<a href="http://blogs.msdn.com/b/ieinternals/archive/2011/05/14/10164546.aspx">Link 2</a>
<div class="space-4"></div>
I recommend building a custom, smaller CSS file according to your needs, using <a href="../build/css.html">CSS builder</a> and you may not need a second CSS file for IE.
</li>
<li>
<b>ace-skins.css</b>.
Ace skin CSS file, if you want to use a skin other that default one.
<br />
You can also compile default Ace styles (ace.css) using a different skin.
Please refer to the above "Ace Skins" section for more info.
</li>
<li>
<b>ace-rtl.css</b>. Ace's RTL direction CSS file, if you want to use Arabic, Hebrew or Persian.
</li>
<li>
<b>ace-ie.css</b> which is used by IE9 and below.
</li>
<li>
Inline styles which is not recommend and you should always try to separate your CSS from your HTML and application code.
</li>
</ol>
</li>
<li>
<pre data-language="html">
<link href="path/to/bootstrap.min.css" rel="stylesheet" />
<link href="path/to/fontawesome.min.css" rel="stylesheet" /><!-- only if needed -->
<link href="path/to/ace-fonts.css" rel="stylesheet" /><!-- you can also use google hosted fonts -->
<link href="path/to/ace.min.css" rel="stylesheet" class="ace-main-stylesheet" />
<!--[if lte IE 9]>
<link href="path/to/ace-part2.min.css" rel="stylesheet" class="ace-main-stylesheet" />
<![endif]-->
<link href="path/to/ace-skins.min.css" rel="stylesheet" /><!-- only if needed -->
<link href="path/to/ace-rtl.min.css" rel="stylesheet" /><!-- only if needed -->
<!--[if lte IE 9]>
<link href="path/to/ace-ie.min.css" rel="stylesheet" />
<![endif]-->
<style>
/* not recommended to define new CSS rules inside your HTML page */
.some-selector {
color: red;
}
</style>
</pre>
</li>
</ul>
</div>
<!-- #section:files/css.order -->
<h3 class="info-title smaller" data-id="#files/css.fonts">7. Fonts</h3>
<!-- #section:files/css.fonts -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
Ace uses "Open Sans" font from Google as its a popular font with good character support.
<br />
Only "normal" and "light" font weights are included to make the page load faster:
<code>http://fonts.googleapis.com/css?family=Open+Sans:<u>400</u>,<u>300</u></code>
<br />
See this for more info: <a href="http://www.google.com/fonts#UsePlace:use/Collection:Open+Sans">Google Open Sans</a>
<div class="space-6"></div>
You can use google hosted fonts:
<pre data-language="html">
<!-- serve fonts from google -->
<link rel="stylesheet" href="//fonts.googleapis.com/css?family=Open+Sans:400,300" /></pre>
Or serve from your own server: (especially good during development, so that your pages load faster)
<pre data-language="html">
<link rel="stylesheet" href="path/to/ace-fonts.css" /></pre>
You can also embed the contents of "ace-fonts.css" files in your main CSS file to reduce number of files:
<pre data-language="css">
@font-face {
font-family: 'Open Sans';
font-style: normal;
font-weight: 300;
src: local('Open Sans Light'), local('OpenSans-Light'), url(path/to/font/DXI1ORHCpsQm3Vp6mXoaTXhCUOGz7vYGh680lGh-uXM.woff) format('woff');
}
@font-face {
font-family: 'Open Sans';
font-style: normal;
font-weight: 400;
src: local('Open Sans'), local('OpenSans'), url(path/to/font/cJZKeOuBrn4kERxqtaUH3T8E0i7KZn-EPnyo3HZu7kw.woff) format('woff');
}</pre>
Font files are located inside: <code>assets/font</code>
</li>
<li>
For icons you can use Fontawesome, Glyphicons or any other font library.
<br />
Icon font files are located inside: <code>assets/fonts</code>
and you can also serve CDN hosted fonts, for example:
<pre data-language="html">
<link rel="stylesheet" href="//netdna.bootstrapcdn.com/font-awesome/4.2.0/css/font-awesome.min.css" /></pre>
<div class="space-4"></div>
Please also see <a href="#elements.icon" class="help-more">Icons section</a> for more info.
</li>
</ul>
</div>
<!-- /section:files/css.fonts -->
<h3 class="info-title smaller" data-id="#files/css.build">8. CSS Builder</h3>
<!-- #section:files/css.build -->
<div class="info-section">
<ul class="info-list list-unstyled">
<li>
There is also the in-browser CSS builder you can use to build a custom CSS output, using only the parts you need.
</li>
<li>
You can find it here: <a href="../build/css.html">path/to/ace/build/css.html</a>
</li>
</ul>
</div>
<!-- /section:files/css.build -->
</div>
<!-- /section:files/css -->
</section>
|
{
"pile_set_name": "Github"
}
|
Introduction {#h0.0}
============
*Streptococcus pneumoniae*, commonly referred to as pneumococcus, is a major human pathogen contributing greatly to morbidity and mortality worldwide, especially in children and the elderly. Pneumococcal infections cause approximately as many deaths as tuberculosis and include diseases ranging from milder respiratory tract infections to more severe diseases such as pneumonia, meningitis, and septicemia. Although colonization of the nasopharynx precedes disease, pneumococci are frequently found colonizing the nasopharynges of healthy preschool children. The underlying mechanisms explaining how pneumococci, from a local site, pass mucosal barriers to cause systemic disease remains to be further elucidated.
*S. pneumoniae* strain T4 (TIGR4) expresses a pilus-like structure, encoded by the *rlrA* pilus islet 1, and shown to contribute to virulence in animal models ([@B1]). The *rlrA* pilus islet 1 is present in approximately 30% of all pneumococcal isolates ([@B2], [@B3]), depending on the clonal type, and consists of genes encoding three different pilus subunit proteins, RrgA, RrgB, and RrgC, which are covalently linked by three pilus-specific sortases. RrgB is the major stalk protein of the pilus, and in the absence of a pilus shaft, monomeric RrgA is located on the surface and is sortase-linked to the cell wall. However, clinical isolates producing RrgA in the absence of pili have not yet been reported. The pneumococcal pilus and specifically the RrgA protein promote adhesion to lung epithelial cells *in vitro* and virulence *in vivo* in murine models ([@B1], [@B4]). The crystal structure of RrgA was recently solved ([@B5]). It was demonstrated that the 893-residue-long adhesin formed an elongated structure composed of four domains of which the major domain, the D3 domain, adopts an integrin I collagen recognition domain suggested to interact with extracellular matrix (ECM) proteins. Indeed, purified RrgA has been shown to bind fibronectin, laminin, and collagen I, but not to vitronectin ([@B6]).
The innate immune system involves effectors and immune cells and constitutes the first line of defense against invading pathogens. In the lungs, phagocytosis mediated by resident macrophages plays a central role in clearance of pneumococci early in infection, and bacterium-induced Toll-like receptor 9 (TLR9)-NF-κB signaling has been suggested to enhance the phagocytic capacity of alveolar macrophages (AMs) ([@B7], [@B8]). It has also been reported that influenza virus sensitization to pneumococcal infection might operate via an interferon-induced inhibition of bacterial clearance, mediated by AMs in the lungs ([@B9]).
Numerous surface receptors and associated signal transduction pathways are involved in the phagocytic machinery, leading to bacterial killing and later to the induction of an adaptive immune response. The complement system acts as a part of the innate immune response by opsonizing microbes in a specific manner. Complement receptors (CRs) on the surfaces of phagocytes recognize and internalize the opsonized pathogens. Opsonization of bacteria by immunoglobulins leads to similar enhanced uptake of pathogens by Fcγ receptors. Also, opsonin-independent phagocytosis, where ligands on the surfaces of the microorganisms are directly recognized by receptors on the plasma membranes of phagocytes, has been reported. Scavenger receptors, like macrophage receptor with a collagenous structure (MARCO), promote phagocytosis of bacteria nonopsonically and have been shown to protect against pneumococcal infections ([@B10]--[@B12]). There are also receptors that can be involved in either pathway, such as complement receptor 3 (CR3, CD11b/CD18, Mac-1) ([@B13]). CR3 is expressed on polymorphonuclear leukocytes, monocytes/macrophages, and activated lymphocytes and mediates both opsonin-dependent and -independent phagocytosis. It recognizes multiple microbial adhesins by direct protein-protein interactions ([@B14], [@B15]). CR3 binds to a variety of molecules in the host, such as intercellular adhesion molecule 1 (ICAM-1) ([@B16]), fibrinogen ([@B17]), and heparin ([@B18]). Binding of CR3 induces different functions such as leukocyte extravasation and migration. Activation of CR3 also upregulates other key adhesion and defense receptors on leukocytes ([@B19], [@B20]).
Here, we sought to determine whether an interaction can be found between pneumococcal pili and phagocytes, whether the pilus-associated adhesin RrgA is required for this process, and if such an interaction translates into *in vivo* effects using mouse infection models.
RESULTS {#h1}
=======
RrgA on pneumococcal pilus 1 promotes nonopsonic complement receptor 3 (CR3)-dependent uptake of *S*. *pneumoniae* by murine and human macrophages. {#h1.1}
---------------------------------------------------------------------------------------------------------------------------------------------------
To examine whether expression of RrgA affects phagocytosis, pneumococcal strain T4 (TIGR4) expressing RrgA containing pili and mutant derivatives of T4 were incubated on monolayers of murine bone marrow-derived macrophages (BMDMs). T4 is an encapsulated and piliated serotype 4 pneumococcal strain originally isolated from a patient with invasive disease. Its isogenic mutant, the T4Δ*rrgA* strain, lacks RrgA but expresses a RrgB- and RrgC-positive pilus ([@B4]). We also created a complemented mutant of T4Δ*rrgA*, T4Δ*rrgA*∇(*lacE*::*rrgA*) in which *rrgA* was reinserted into the pneumococcal chromosome *in trans*.
After 1 h of phagocytosis, the strains expressing pilus-associated RrgA \[T4 and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains\] were internalized to a significantly higher degree than the *rrgA* deficient mutant, the T4Δ*rrgA* strain ([Fig. 1A](#fig1){ref-type="fig"}) (*P* = 0.0005). For a control, we used cytochalasin D to block actin cytoskeleton rearrangement in cells. With cytochalasin D treatment, the uptake of pneumococci was almost completely abolished, and there was no difference in adherence of the three pneumococcal strains to the cells (data not shown).
{#fig1}
To identify a putative receptor on BMDMs, we considered CR3, also named integrin CD11b/CD18 or Mac-1. Pretreatment of BMDMs with anti-CD11b antibodies decreased the uptake of pneumococcal strain T4 and the T4Δ*rrgA*∇(*lacE*::*rrgA*) strain to the level of uptake of the T4Δ*rrgA* mutant (*P* \< 0.001) ([Fig. 1A](#fig1){ref-type="fig"}). Antibody treatment had no effect on the uptake of the T4Δ*rrgA* mutant. We also treated murine BMDMs with anti-CD11c antibodies and found that they did not influence uptake of T4, thereby confirming the antibody specificity in inhibition ([Fig. 1A](#fig1){ref-type="fig"}).
To further confirm a role for CR3 in pneumococcal phagocytosis, we performed phagocytosis assays with BMDMs from CD11b^−/−^ mice, which lack functional CR3. These macrophages showed a 40% reduction in the uptake of strain T4 expressing pili with RrgA ([Fig. 1B](#fig1){ref-type="fig"}) (*P* \< 0.0012), which is similar to the level of uptake of the RrgA-deficient bacteria by wild-type macrophages. When comparing uptake of the different pneumococcal strains in CD11b^−/−^ macrophages, no statistically significant differences were observed ([Fig. 1B](#fig1){ref-type="fig"}). Targeting CD11b by antibodies or its complete absence only partially inhibited BMDM phagocytosis, testifying to the role of other phagocytic receptors in pneumococcal uptake by macrophages.
Next we used human macrophages (THP-1 cells) in phagocytosis assays of the T4, T4Δ*rrgA*, and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains ([Fig. 1C](#fig1){ref-type="fig"}). A moderate but significant decrease of T4Δ*rrgA* phagocytosis compared to the wild type and the RrgA-complemented mutant was found. A monoclonal antibody specific for human CD11b decreased THP-1 phagocytosis only for strain T4 expressing wild-type pili but had no effect on the uptake of the T4Δ*rrgA* mutant ([Fig. 1C](#fig1){ref-type="fig"}).
Recombinant RrgA, but not RrgC, promotes CR3-mediated phagocytosis of coated beads by murine and human macrophages. {#h1.2}
-------------------------------------------------------------------------------------------------------------------
To directly demonstrate a role for the RrgA adhesin in phagocytosis, we conjugated full-length recombinant RrgA (rRrgA) to fluorescent microspheres and monitored uptake by murine BMDMs and by human THP-1 cells ([Fig. 2A](#fig2){ref-type="fig"}). For a relevant control, we made use of rRrgC, an ancillary pilus 1 component believed to anchor the completed pilus to the peptidoglycan cell wall. In both BMDMs and THP-1 cells, phagocytosis was three and four times higher for beads coated with rRrgA than for beads coated with rRrgC and bovine serum albumin (BSA), respectively. Antibodies specific to murine and human CD11b completely inhibited phagocytosis of rRrgA-coated beads by murine BMDMs and human THP-1 cells, respectively ([Fig. 2B](#fig2){ref-type="fig"}).
{#fig2}
Purified CR3 binds directly to pneumococcal cells expressing pilus-associated RrgA and to recombinant RrgA. {#h1.3}
-----------------------------------------------------------------------------------------------------------
The RrgA adhesin has been demonstrated to bind to a number of extracellular matrix proteins, including collagen I, fibronectin, and laminin in contrast to the other two pilus 1 constituents, RrgB and RrgC ([@B6]). To find evidence for a direct interaction between RrgA-expressing pneumococci and CR3, we performed flow cytometry analyses of purified human CR3 (CD11b/CD18) binding to *S. pneumoniae* T4, T4Δ*rrgA*, and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains, making use of anti-CD11b monoclonal antibody (MAb) (peridinin chlorophyll protein \[PerCp\]-Cy5.5 labeled). CR3 bound efficiently to the two RrgA-expressing strains, whereas there was no binding to the T4Δ*rrgA* strain ([Fig. 3A](#fig3){ref-type="fig"}). The addition of extracellular matrix proteins (collagen I, fibronectin, laminin, or vitronectin) did not inhibit or enhance CR3 binding to pneumococcal cells expressing RrgA (see [Fig. S1](#figS1){ref-type="supplementary-material"} in the supplemental material), suggesting a direct interaction between CR3 and RrgA.
{#fig3}
Next we studied the interaction between purified CR3 and rRrgA using a far-Western dot blotting technique in which purified human CR3 was blotted onto nitrocellulose membranes in concentrations of 0.5, 1, 5, and 10 µg ([Fig. 3B](#fig3){ref-type="fig"}). Since most known interactions between CR3 and its ligands occur via the CD11b integrin domain, purified CD11b-I was also used at equivalent concentrations. Five micrograms of BSA was used as a negative control. For a probe, we used 2 µg of full-length recombinant RrgA and monitored binding with a specific rabbit antibody against RrgA (anti-RrgA). rRrgA was found to bind in a dose-dependent manner to both CR3 and CD11b-I ([Fig. 3B](#fig3){ref-type="fig"}). Furthermore, binding to purified CR3 and CD11b-1 decreased when a specific antibody against CD18 and CD11b was used in an ELISA ([Fig. 3C and D](#fig3){ref-type="fig"}). Also, rRrgA binding to CR3 and CD11b-I was dependent on the concentration of the RrgA adhesin (see [Fig. S2A and S2B](#figS2 figS2){ref-type="supplementary-material"} in the supplemental material).
Absence of RrgA and/or murine expression of CR3 decreased the number of bacteria in the bloodstream early after intranasal and intraperitoneal challenge. {#h1.4}
---------------------------------------------------------------------------------------------------------------------------------------------------------
We next investigated whether pneumococcal expression of RrgA and host expression of CR3 affects virulence and dissemination of pneumococci from a local site to the bloodstream. As intranasal (i.n.) inoculation of pneumococci in mice mimics the natural route of infection in humans, we first investigated whether RrgA and CR3 influence disease kinetics in an infection model of pneumococcal pneumonia. We inoculated 5 × 10^6^ CFU i.n. into C57BL/6 mice and monitored the animals up to 72 h postinfection ([Fig. 4A to C](#fig4){ref-type="fig"}). Wild-type mice infected with the T4 or T4Δ*rrgA*∇(*lacE*::*rrgA*) strain showed increased mortality compared to wild-type mice infected with the T4Δ*rrgA* strain ([Fig. 4A](#fig4){ref-type="fig"}) (*P* = 0.0187 in the survival analysis with the Kaplan-Meier log rank test). Furthermore, the two strains expressing RrgA could be detected in blood samples from wild-type mice as early as 12 h postinfection, whereas no T4Δ*rrgA* bacteria were recovered from blood samples from any mice at this early time point ([Fig. 4B](#fig4){ref-type="fig"}). CD11b^−/−^ mice inoculated i.n. with the T4 strain succumbed later to infection than wild-type mice challenged with the same strain ([Fig. 4A](#fig4){ref-type="fig"}), and CR3-deficient mice also exhibited a delay in the onset of bacteremia ([Fig. 4B and C](#fig4){ref-type="fig"}).
{#fig4}
When we challenged C57BL/6 mice intraperitoneally (i.p.) with the T4 strain and the different isogenic mutants, we observed that mice infected with the T4Δ*rrgA* mutant lacking RrgA survived significantly longer than mice infected with either the T4 or T4Δ*rrgA*∇(*lacE*::*rrgA*) strain both expressing RrgA ([Fig. 5A](#fig5){ref-type="fig"}) (*P* = 0.0025 in the survival analysis with the Kaplan-Meier log rank test) ([@B4]). The prolonged survival of mice infected i.p. with the T4Δ*rrgA* mutant was accompanied by lower levels of bacteria in the bloodstream ([Fig. 5B](#fig5){ref-type="fig"}).
{#fig5}
To rule out the possibility that the prolonged survival of mice infected with the T4Δ*rrgA* mutant either i.n. or i.p. was due to slower growth of the bacteria in blood, we infected mice intravenously (i.v.) with the T4 strain and the T4Δ*rrgA* mutant. Using the i.v. infection route, there were no differences in the survival rate or bacterial growth in blood samples from mice infected with the two strains ([Fig. 5C and D](#fig5){ref-type="fig"}).
Finally, we investigated whether a lack of CR3 expression affected the survival of mice after i.p. inoculation with the T4 or T4Δ*rrgA* strain. When we performed i.p. experiments, we observed that there was a delay in the onset of symptoms and a significantly longer overall survival time of CR3-deficient (CD11b^−/−^) mice compared to wild-type mice (*P* = 0.0051 in the survival analysis with the Kaplan-Meier log rank test) ([Fig. 5E](#fig5){ref-type="fig"}). CD11b^−/−^ mice had lower numbers of CFUs in blood when infected with both T4 and T4Δ*rrgA* strains compared to wild-type mice infected with T4, arguing that the dissemination of RrgA-expressing pneumococci is impaired in CD11b^−/−^ mice ([Fig. 5F](#fig5){ref-type="fig"}).
Bacterial expression of the pilus-associated RrgA adhesin results in higher numbers of intracellular survivors at late time points after phagocytosis. {#h1.5}
------------------------------------------------------------------------------------------------------------------------------------------------------
The results presented so far suggest that the RrgA adhesin, an ancillary protein of the pneumococcal 1 pilus, enhances phagocytosis through a direct interaction with the CR3 receptor expressed on murine and human macrophages. We expected that enhanced phagocytosis *in vitro* would translate into decreased virulence *in vivo*. In contrast, expression of RrgA in the bacteria together with CR3 in the host promoted bacterial virulence in mice and an early appearance of bacteria in the bloodstream after local infection.
To begin explaining these results, we first monitored the fate of RrgA-expressing and non-RrgA-expressing pneumococci after phagocytosis. The uptake of bacteria by macrophages leads to formation of phagosomes, where bacteria confront intracellular killing mechanisms. We monitored intracellular survival by performing gentamicin protection assays where T4, T4Δ*rrgA*, and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains were incubated with macrophages (BMDMs). After antibiotic killing of extracellular bacteria, the number of internalized viable pneumococci was determined by quantitative plating at various time points. There were significantly fewer CFUs of the T4Δ*rrgA* mutant inside the macrophages at the beginning of the experiment ([Fig. 6](#fig6){ref-type="fig"}) (*P* = 0.0011), which further supported the differences in uptake observed in the fluorescence-activated cell sorting (FACS)-based phagocytosis assay ([Fig. 1](#fig1){ref-type="fig"}). The rate of bacterial killing was similar for all pneumococcal strains ([Fig. 6](#fig6){ref-type="fig"}). Interestingly, the increased uptake of RrgA-expressing bacteria and the unaffected intracellular killing rate resulted in significantly higher numbers of survivors for the T4 and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains compared to the T4Δ*rrgA* strain even 10 h after infection (*P* \< 0.05).
{#fig6}
The interaction between RrgA and CR3 leads to increased motility and migratory behavior of murine BMDMs and human THP-1 cells. {#h1.6}
------------------------------------------------------------------------------------------------------------------------------
CR3 is a highly versatile pattern recognition receptor that when ligated activates leukocytes via signaling complexes and actin reorganization. This activation not only mediates phagocytosis but also promotes leukocyte transmigration. The motility/migration of immune cells affects infection, inflammation, and wound healing, and pathogens may utilize this cellular function in order to disseminate within the host ([@B21]--[@B24]). Therefore, we investigated whether the identified interaction between RrgA and CR3 affected the motility/migration of murine BMDMs ([Fig. 7A](#fig7){ref-type="fig"}) and human THP-1 cells ([Fig. 7B](#fig7){ref-type="fig"}). Motility/migration assays were performed using a Transwell system, in which we determined that strain T4 expressing RrgA increased the motility of BMDMs and THP-1 cells approximately twofold compared to untreated control cells ([Fig. 7A](#fig7){ref-type="fig"}, P \< 0.01, and [Fig. 7B](#fig7){ref-type="fig"}, P \< 0.05). Interestingly, the T4Δ*rrgA* strain, lacking RrgA, did not induce the motility/migration of macrophages, while induction of motility/migration was restored in the complemented strain, T4Δ*rrgA*∇(*lacE*::*rrgA*) strain. Both CR3-expressing and CR3-deficient (CD11b^−/−^) macrophages migrated across the Transwell chamber when macrophage chemoattractant 1 (MCP-1) was present in the bottom chamber. However, the two RrgA-expressing strains failed to induce motility/migration in CR3-deficient (CD11b^−/−^) BMDMs ([Fig. 7A](#fig7){ref-type="fig"}), supporting the role for this receptor in macrophage motility/migration upon interaction with pneumococcal RrgA. Finally, when BMDMs were preincubated with antibodies against CD11b, there were no differences in motility/migration between untreated control cells and cells challenged with RrgA^+^ or RrgA^−^ bacteria (data not shown).
{#fig7}
To further confirm that the motile/migratory behavior of BMDMs is induced by RrgA and CR3, we performed additional motility assays using time-lapse video microscopy. Single-cell tracking revealed that the motility/migration of BMDMs was induced by pneumococci expressing RrgA \[T4 and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains\], but not by the T4Δ*rrgA* strain (*P* \< 0.001 \[[Fig. 7C and D](#fig7){ref-type="fig"}\]). CR3-deficient BMDMs were not affected by the addition of any of the pneumococcal strains; their motility/migration remained at control levels ([Fig. 7C and D](#fig7){ref-type="fig"}). Also, the velocity of the cells was measured using this method, which revealed that cells infected with T4 and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains moved faster than uninfected control cells ([Fig. 7D](#fig7){ref-type="fig"}) (*P* = 0.00015). In contrast, BMDMs infected with the T4Δ*rrgA* mutant did not move faster than the control cells. The velocity of the CR3-deficient BMDMs did not increase after bacterial challenge and remained at control levels throughout the experiment.
DISCUSSION {#h2}
==========
We show for the first time that expression of pili on the pneumococcal surface leads to enhanced phagocytosis by murine BMDMs and human macrophages (THP-1 cells). Furthermore, we provide evidence that the pilus-associated adhesin RrgA, rather than the pilus-forming RrgB or pilus-associated RrgC subunits, promotes phagocytosis ([@B25]). Moreover, we show that a specific antibody against murine CD11b decreased phagocytosis by BMDMs and THP-1 cells of pneumococci expressing RrgA to a similar level of phagocytosis as that of RrgA^−^ bacteria, suggesting that RrgA promotes phagocytosis via CR3. Finally, interaction between RrgA and CR3 appears to be direct and mediated by the CD11b integrin domain of CR3, thereby representing the first identified cellular receptor for a Gram-positive pilus. Even though RrgA has been shown to interact with a number of extracellular matrix proteins, purified CR3 binding to RrgA-expressing pneumococci was not affected by the addition of extracellular matrix proteins, like collagen 1, known to interact with either of these two proteins ([@B6]).
Our data demonstrate that internalization of RrgA^+^ and RrgA^−^ bacteria follows a similar route, leading to phagosome formation and intracellular killing. However, pneumococci expressing RrgA were phagocytosed to a greater extent and BMDMs harbored higher numbers of viable RrgA^+^ than RrgA^−^ bacteria over a longer time period (at least 10 h). Pneumococci produce several components toxic to macrophages, such as pneumolysin and H~2~O~2~, and therefore, prolonged intracellular survival time might lead to death of infected macrophages prior to the complete eradication of ingested bacteria.
When pneumococci expressing RrgA were injected intranasally and intraperitoneally into wild-type mice, they reached the bloodstream faster and in higher numbers compared to RrgA^−^ bacteria which, irrespective of infection route, also resulted in an earlier onset of severe disease. In contrast, RrgA-expressing or non-RrgA-expressing pneumococci did not differ in growth after i.v. challenge, and the time to onset of severe disease was also not affected by RrgA. This suggests that RrgA does not promote resistance to clearing mechanisms in the bloodstream.
Expression of RrgA and CR3 was required for rapid appearance of bacteria in the bloodstream when mice were challenged intranasally or intraperitoneally. This supports a role for an interaction between these proteins *in vivo* for pneumococcal dissemination.
It has been demonstrated that CR3 is upregulated on AMs in the lungs after infection with *S. pneumoniae* ([@B26]). AMs are central to the normal surveillance of pneumococci. They may, however, have a dual function in host defense, as it was recently demonstrated that AMs migrate from the lungs to the lung-draining lymph nodes early after infection with an *S. pneumoniae* 6B isolate ([@B27]). Also, the migration of activated macrophages from the peritoneal cavity to the lymph nodes and blood has been shown to depend on CR3 ([@B28]). Thus, activated macrophages carrying pneumococci might migrate in a CR3-dependent manner to regional lymph nodes, and from there, infected phagocytic cells or liberated live bacteria are thought to reach the bloodstream, thereby contributing to systemic spread from local sites. However, further *in vivo* studies are needed to demonstrate that pneumococci can be translocated into the bloodstream via infected immune cells. Also, it is important to stress that other pneumococcal virulence properties, such as PspC, might mediate a direct translocation of bacteria across biological barriers.
For a commensal pathogen like *Streptococcus pneumoniae*, where healthy carriage vastly dominates over disease, each interaction between microbe and host may have dual effects, sometimes favoring the host and other times the microbe. Here we demonstrate that the pilus-associated adhesin RrgA promotes phagocytosis by BMDMs in a process requiring CR3. This process is likely to enhance bacterial clearance. However, the simultaneous activation of motility and migratory behavior of macrophages may tilt the balance in favor of the ingested microbe. The bistability of pilus expression in a pneumococcal population ([@B29], [@B30]) and the fact that only a subset of pneumococcal strains harbor the pilus 1 islet are additional arguments for the dual role of pneumococcal pili in its interaction with the host.
MATERIALS AND METHODS {#h3}
=====================
Bacterial strains and construction of mutants. {#h3.1}
----------------------------------------------
*S. pneumoniae* T4 (TIGR4) of serotype 4 belongs to a clone (ST205) with high invasive disease potential in Sweden ([@B31]--[@B33]). The insertion-deletion mutagenesis used for creating the *rrgA* mutant strain T4Δ*rrgA*, is described elsewhere ([@B1], [@B34]). Complementation *in trans* was achieved by inserting a second, intact copy of *rrgA* into the *lacE* lactose utilization operon, creating the T4Δ*rrgA*∇(*lacE*::*rrgA*) strain ([@B4], [@B35]). Mutants were checked by PCR, sequencing, and immunogenicity using antibodies to pilin subunits.
Murine BMDMs and human macrophage-like THP-1 cells. {#h3.2}
---------------------------------------------------
Murine BMDMs were extracted ([@B7], [@B36]), and cells were plated in 24-well plates (1 × 10^6^ cells per well) and incubated for 7 days at 37°C and 5% CO~2~. Human monocytic leukemia THP-1 cells (American Type Culture Collection \[ATCC\], Manassas, VA) were cultured in RPMI 1640 (Invitrogen) supplemented with 10% heat-inactivated fetal calf serum (FCSi), 2 mM [l]{.smallcaps}-glutamine, and 10 mM HEPES. To induce differentiation, THP-1 cells (5 × 10^5^ cells per well) were seeded onto a 24-well plate with 100 ng/ml of phorbol myristate acetate (PMA) (Sigma) for 30 h at 37°C and 5% CO~2~. Before use, cells were washed to remove nonadherent cells. Each condition was performed in triplicate, and the experiments were repeated at least three times.
Mouse challenge. {#h3.3}
----------------
The mice were 6 to 10 weeks old and were matched by age and sex. The mice were inoculated intranasally, intraperitoneally, or intravenously with ca. 5 × 10^6^ CFU per mouse. Bacterial growth in blood was monitored by taking blood samples from the tail at various time points and plating the samples in serial dilutions on blood agar plates. The health status of the mice was carefully monitored, and clinical scores were given.
*In vitro* phagocytosis assays. {#h3.4}
-------------------------------
Bacteria were resuspended in a solution containing 2.5 mg fluorescein isothiocyanate (FITC) (isomer I; Sigma), 1 ml dimethyl sulfoxide (DMSO) (Sigma), and 9 ml FITC buffer (0.05 M Na~2~CO~3~ \[Merck, Darmstadt, Germany\] and 0.1 M NaCl \[Merck\] in double-distilled water) and incubated on ice for 1 h. After the bacteria were washed 3 times, macrophages were challenged with FITC-labeled pneumococci at a multiplicity of infection (MOI) of about 60 bacteria per cell, spun down at 1,500 rpm for 5 min, and incubated for 60 min at 37°C and 5% CO~2~. Serum-free RPMI 1640 (Gibco/Invitrogen) supplemented with 2 mM glutamine and 10 mM HEPES was used as assay medium. Following bacterial challenge, the cells were washed 3 times with cold phosphate-buffered saline (PBS). The cells were detached by 15- to 30-min incubation on ice with PBS supplemented with 5 mM EDTA at pH 8.0 and 4.0 mg ml^−1^ lidocaine (Sigma). The cells were transferred to 96-well V-bottom plates, washed in PBS, and resuspended in 2% paraformaldehyde (Sigma). Before data acquisition by FACS, extracellular fluorescence was quenched by adding trypan blue (Sigma) at pH 5.5. To inhibit phagocytosis, 10 µg ml^−1^ of cytochalasin D (Sigma) was added 15 min prior to bacterial challenge. For antibody blocking experiments, the following affinity-purified antibodies were used: anti-mouse CD11c (N418), anti-mouse CD11b (M1/70) (eBioscience Inc., San Diego, CA) and anti-human CD11b (VIM12) (Invitrogen). BMDMs were pretreated with selected anti-mouse antibody and THP-1 cells were pretreated with selected anti-human antibody at a concentration of 20 µg µl^−1^ for 30 min at 37°C and 5% CO~2~ prior to bacterial challenge. During FACS acquisition, 1 × 10^4^ cells were counted in each sample. Each condition was added in triplicate, and the experiments were repeated at least three times. The phagocytic index for each sample was calculated by multiplying the percentage of FITC-positive cells with the mean fluorescence intensity (MFI), and dividing this by the mean MFI for the wild-type (T4) samples multiplied with the percentage of FITC-positive cells.
For the microbead phagocytosis assays, we used full-length wild-type rRrgA (amino acid \[aa\] 39 to aa 862) ([@B1], [@B4], [@B37]), full-length wild-type rRrgC ([@B1], [@B4]), and BSA conjugated to carboxylate-modified yellow-green fluorescent microsphere (fluorosphere carboxylate from Molecular Probes, Invitrogen) according to the manufacturer's protocol. THP-1 and BMDM cells, differentiated onto chamber slides (Nunc, Rochester, NY), were treated with 10 µg ml^−1^ of latex beads alone or beads covered with rRrgA, rRrgC, or BSA and incubated for 3 h at 37°C and 5% CO~2~. The inhibition assay was performed as previously described using anti-mouse (M1/70) and anti-human (VIM12) anti-CD11b antibodies. Each treatment was repeated in duplicate. Each preparation was examined at ×100 magnification under oil immersion. At least 10 visual fields for each sample containing at least 10 or more cells were selected in a random fashion, and the number of internalized beads was counted manually, taking care to exclude beads that were only adherent to the cell surface. Differences in the number of beads were tested with the nonparametric Mann-Whitney U test.
Purification of CR3 (CD11b/CD18). {#h3.5}
---------------------------------
Human CD11b/CD18 integrin was purified from human blood buffy coat cell lysates by affinity chromatography on MEM170 monoclonal antibody-Sepharose and eluted at pH 11.5 in the presence of 2 mM MgCl~2~ and 1% octyl glucoside. Human blood buffy coats were from Finnish Red Cross Blood Transfusion Service, Helsinki, Finland. Integrin purity was checked by polyacrylamide gel electrophoresis in the presence of SDS (see [Fig. S3](#figS3){ref-type="supplementary-material"} in the supplemental material).
Flow cytometry analysis of CR3 binding to pneumococci. {#h3.6}
------------------------------------------------------
FACS analysis was performed to quantify the binding of CR3 to RrgA-expressing pneumococci. Bacteria were grown overnight on solid medium and then harvested into PBS. Bacteria (10^8^ CFU) were incubated with 10 µg/ml of purified CR3 (CD11b/CD18) or with PBS as a negative control for 30 min at 37°C. After the bacteria were washed twice in PBS containing 0.1% BSA \[PBS-BSA (0.1%)\], binding was detected following incubation with an anti-CD11b MAb labeled with PerCp-Cy5.5 (BD BioScience) at a final concentration of 10 µg ml^−1^ for 1 h on ice. The cells were washed twice in PBS-BSA (0.1%) and once in PBS and then fixed in 2% paraformaldehyde for 20 min at room temperature. Finally, the bacteria were washed, and the fluorescence intensity was analyzed by a flow cytometer (CyAn ADP; Beckman Coulter). Bacteria were detected using log forward and log side scatter dot plots, and a gating region was set to exclude debris and larger aggregates of bacteria. A total of 1 × 10^4^ bacteria (events) were analyzed for fluorescence using log scale amplifications. Comparison between the fluorescence intensity of the bacteria incubated with purified CR3 with that of bacteria incubated with PBS alone were illustrated by two-dimensional overlaid histograms representing fluorescence intensities calculated with voltage adjustment at FL4 linear channel. FACS results were also expressed as the change in the mean fluorescence intensity (ΔMFI), where ΔMFI was calculated by subtracting the mean fluorescence intensity of the bacteria incubated with purified CR3 from that of bacteria incubated with PBS alone.
Far-Western blots. {#h3.7}
------------------
Human CR3 (CD11b/CD18) or CD11b-I domain-GST was blotted onto nitrocellulose membranes using the Manifold system in concentrations of 0.5, 1, 5, and 10 µg; 5 µg of BSA and 5 µg of glutathione *S*-transferase (GST) were used as negative controls. The membranes were blocked with PBS with 0.01% Tween 20 \[PBS-Tween (0.01%)\] and 5% milk for 30 min at room temperature. The membranes were washed briefly and incubated with 2 µg of rRrgA in the presence of PBS-Tween (0.01%) and 1% milk overnight at 4°C. The membranes were washed, primary antibody (Rb−anti-RrgA \[1:1,000\]) was added, and the membranes were incubated for 3 h at room temperature on a rocking platform. Finally, the membranes were incubated with secondary antibody (anti-Rb peroxidase \[1:2,000\]; Sigma) for 1 h. Experiments were repeated three times, and representative experiments are shown.
ELISA. {#h3.8}
------
To assess direct binding of CR3 (CD11b/CD18) and CD11b I domain-GST to the rRrgA protein, microtiter plates were coated overnight at 4°C with 10 µg/ml of purified CR3 (or CD11b I domain-GST). Subsequent steps were conducted at room temperature (RT) for 1 h each. Nonspecific binding sites were blocked with PBS-BSA (3%), followed by the addition of rRrgA (different concentrations from 0 to 200 ng per well) in PBS-Tween (0.01%) (PBST). Bound rRrgA was detected with a specific antibody against rRrgA (Rb−anti-RrgA) and anti-rabbit serum conjugated to horseradish peroxidase (Sigma), both diluted 1:5,000 in PBST. Sigmafast-OPD (*o*-phenylenediamine dihydrochloride) (Sigma) was used for detection, and absorbance was measured at 492 nm. In inhibition assays, CR3 and CD11b I domain-GST were pretreated with 25 µg/ml of anti-CD18 7E4 MAb and anti-CD11b MEM170 MAb, respectively, for 30 min at RT.
*In vitro* gentamicin protection assay. {#h3.9}
---------------------------------------
The gentamicin protection assay was performed as described elsewhere ([@B7]).
*In vitro* motility assays. {#h3.10}
---------------------------
Differentiated BMDM cells were seeded in serum-free medium (RPMI 1640 supplemented with 2 mM glutamine and 10 mM HEPES) in small petri dishes (35 by 10 mm) at a density of 1 × 10^6^ cells per dish. The cells were either left untreated (control) or challenged with pneumococci at an MOI of ca. 60 bacteria per cell, or recombinant mouse MCP-1 (10 ng ml^−1^; Invitrogen) was added to the bottom chamber ([@B38]). After 1.5 h, gentamicin was added to the medium (400 µg ml^−1^). After an additional 1.5 h, the cells were gently scraped off, counted (input), and transferred to Transwell inserts containing RPMI 1640, and supplemented with 2 mM glutamine, 10 mM HEPES, 100 µg ml^−1^ gentamicin, and 10% FCS (time point zero). Additionally, samples were taken from the medium to ensure that the extracellular bacteria were killed. The cells were incubated for 15 h before the inserts were removed, and the cells in the lower wells were scraped off and counted (output). The percentage of migrated cells was calculated by dividing the output by the input. Each condition was added in triplicate, and the experiments were repeated at least three times.
Time-lapse video microscopy. {#h3.11}
----------------------------
Time-lapse video microscopy was performed by the method of Behnsen et al. ([@B39]).
Statistical analysis. {#h3.12}
---------------------
*In vitro* assays were analyzed using one-way analysis of variance (ANOVA) with Bonferroni's posttest (mean fluorescence intensity, CFU numbers, and motile cells), unless otherwise stated. *In vivo* assays were analyzed using Kaplan-Meier log rank test (survival), Kruskal-Wallis test with Dunn's posttest (CFU numbers), or chi-square test and Fisher's exact test (proportion of bacteremic mice). Graph Pad Prism 4.0 software was used (Graph Pad Software, Inc.), and a *P* value of \<0.05 was considered statistically significant.
SUPPLEMENTAL MATERIAL {#h4}
=====================
######
CR3 binding to pneumococci expressing RrgA is not affected by the presence of extracellular matrix proteins (collagen I, fibronectin, laminin, or vitronectin). Flow cytometry analysis of CR3 binding to RrgA protein associated with the *S. pneumoniae* cell surface in the presence of extracellular matrix proteins (EMPs) was performed. The T4 strain and its mutants (10^8^ live bacteria) were incubated with 10 µg/ml of the indicated EMP with 10 mg/ml of purified CR3 (histograms outlined by thick black lines) or without purified CR3 (light gray filled histograms). CR3 binding was detected with an anti-CD11b MAb (PerCp-Cy5.5 labeled) at a final concentration of 10 µg/ml and is observed by a shift to the right in the population of bacteria incubated with the purified CR3 protein and expressing RrgA on their surface, i.e., the T4 and T4Δ*rrgA*∇(*lacE*::*rrgA*) strains, compared with cells incubated with PBS (control) (filled gray) or with CR3 but not expressing RrgA, i.e., the T4Δ*rrgA* strain. Binding was calculated by subtracting the mean fluorescence intensity of bacteria incubated with purified CR3 protein plus the indicated EMP from that of the bacteria incubated with the same indicated EMP and PBS (ΔMFI). The average ΔMFI values from three independent experiments are shown as numbers in the box in the top right-hand corner of each graph. The addition of EMPs (collagen I, fibronectin, laminin, or vitronectin) did not inhibit or enhance CR3 binding to pneumococcal cells expressing RrgA. Download
######
Figure S1, PDF file, 0.2 MB
######
The recombinant RrgA protein binds to purified human CR3 and to CD11b-I domain-GST in a concentration-dependent manner. (A and B) In ELISA experiments, increasing amounts of recombinant RrgA were incubated with coated CR3 (A) or CD11b-I domain-GST (B). Binding was detected by using a specific antibody against rRrgA (Rb−anti-RrgA) and an anti-rabbit IgG antibody conjugated to horseradish peroxidase (HRP). The binding of rRrgA to CD11b (A) and to the CD11b-I domain-GST (B) is dependent on the concentration of rRrgA. Download
######
Figure S2, PDF file, 0.2 MB
######
Polyacrylamide gel of purified CR3 (CD11b/CD18 integrin). Purified CR3 was run on a 8% polyacrylamide gel in the presence of SDS and stained with Coomassie blue. The positions of the molecular mass markers are indicated to the left of the gel, and the positions of CD11b and CD18 chains are indicated by arrows to the right of the gel. Download
######
Figure S3, PDF file, 0.1 MB
**Citation** Orrskog S, et al. 2012. Pilus adhesin RrgA interacts with complement receptor 3, thereby affecting macrophage function and systemic pneumococcal disease. mBio **4**(1)**:**e00535-12. doi:10.1128/mBio.00535-12.
This work was supported by grants from the Torsten and Ragnar Söderbergs foundation, the Swedish Research Council, the Swedish Royal Academy of Sciences, the Swedish foundation for Strategic Research, ALF grant from Stockholm County Council, EU commission (EIMID-IAPP and EIMID-ITN projects), IRTG Germany funded by DFG, Knut and Alice Wallenberg Foundation, the Academy of Finland, and the Finnish Medical Foundation.
We also thank Martin Rottenberg from the Karolinska Institutet, MTC, for providing rat anti-mouse F4/80 antibodies and Monica Moschioni at Novartis Vaccine for help and provision of sera and proteins.
[^1]: S.O., S.R. and T.S. contributed equally to this article.
[^2]: **Editor** Arturo Zychlinsky, Max Planck Institute for Infection Biology
|
{
"pile_set_name": "PubMed Central"
}
|
Q:
Reducing base64 image memory size using Javascript
I am using canvas.toDataURL() and getting the image in base64 format. But before uploading it to the server can I reduce the image's memory size say to 10KB? How can I do this using JavaScript or jquery?Code I am using is:
var context = canvas.getContext("2d");
context.drawImage(imageObj, c.x, c.y, c.w, c.h, 0, 0, canvas.width, canvas.height);
var vData = canvas.toDataURL();
A:
If you want to compress the string you could attempt one of the compression algorithms mentioned here, but the DataURL is already fairly compressed, so this shouldn't make much of a difference.
Another option is to use the second parameter of the toDataURL specifying the quality of the JPG which can often be safely decreased without a visible effect on the image quality.
If the requested type is image/jpeg or image/webp, then the second argument, if it is between 0.0 and 1.0, is treated as indicating image quality; if the second argument is anything else, the default value for image quality is used. Other arguments are ignored.
|
{
"pile_set_name": "StackExchange"
}
|
/*
Copyright 2014 The Kubernetes Authors.
Licensed under the Apache License, Version 2.0 (the "License");
you may not use this file except in compliance with the License.
You may obtain a copy of the License at
http://www.apache.org/licenses/LICENSE-2.0
Unless required by applicable law or agreed to in writing, software
distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
*/
package runtime
import (
"fmt"
"net/url"
"reflect"
"strings"
"k8s.io/apimachinery/pkg/conversion"
"k8s.io/apimachinery/pkg/runtime/schema"
"k8s.io/apimachinery/pkg/util/naming"
utilruntime "k8s.io/apimachinery/pkg/util/runtime"
"k8s.io/apimachinery/pkg/util/sets"
)
// Scheme defines methods for serializing and deserializing API objects, a type
// registry for converting group, version, and kind information to and from Go
// schemas, and mappings between Go schemas of different versions. A scheme is the
// foundation for a versioned API and versioned configuration over time.
//
// In a Scheme, a Type is a particular Go struct, a Version is a point-in-time
// identifier for a particular representation of that Type (typically backwards
// compatible), a Kind is the unique name for that Type within the Version, and a
// Group identifies a set of Versions, Kinds, and Types that evolve over time. An
// Unversioned Type is one that is not yet formally bound to a type and is promised
// to be backwards compatible (effectively a "v1" of a Type that does not expect
// to break in the future).
//
// Schemes are not expected to change at runtime and are only threadsafe after
// registration is complete.
type Scheme struct {
// versionMap allows one to figure out the go type of an object with
// the given version and name.
gvkToType map[schema.GroupVersionKind]reflect.Type
// typeToGroupVersion allows one to find metadata for a given go object.
// The reflect.Type we index by should *not* be a pointer.
typeToGVK map[reflect.Type][]schema.GroupVersionKind
// unversionedTypes are transformed without conversion in ConvertToVersion.
unversionedTypes map[reflect.Type]schema.GroupVersionKind
// unversionedKinds are the names of kinds that can be created in the context of any group
// or version
// TODO: resolve the status of unversioned types.
unversionedKinds map[string]reflect.Type
// Map from version and resource to the corresponding func to convert
// resource field labels in that version to internal version.
fieldLabelConversionFuncs map[schema.GroupVersionKind]FieldLabelConversionFunc
// defaulterFuncs is an array of interfaces to be called with an object to provide defaulting
// the provided object must be a pointer.
defaulterFuncs map[reflect.Type]func(interface{})
// converter stores all registered conversion functions. It also has
// default converting behavior.
converter *conversion.Converter
// versionPriority is a map of groups to ordered lists of versions for those groups indicating the
// default priorities of these versions as registered in the scheme
versionPriority map[string][]string
// observedVersions keeps track of the order we've seen versions during type registration
observedVersions []schema.GroupVersion
// schemeName is the name of this scheme. If you don't specify a name, the stack of the NewScheme caller will be used.
// This is useful for error reporting to indicate the origin of the scheme.
schemeName string
}
// FieldLabelConversionFunc converts a field selector to internal representation.
type FieldLabelConversionFunc func(label, value string) (internalLabel, internalValue string, err error)
// NewScheme creates a new Scheme. This scheme is pluggable by default.
func NewScheme() *Scheme {
s := &Scheme{
gvkToType: map[schema.GroupVersionKind]reflect.Type{},
typeToGVK: map[reflect.Type][]schema.GroupVersionKind{},
unversionedTypes: map[reflect.Type]schema.GroupVersionKind{},
unversionedKinds: map[string]reflect.Type{},
fieldLabelConversionFuncs: map[schema.GroupVersionKind]FieldLabelConversionFunc{},
defaulterFuncs: map[reflect.Type]func(interface{}){},
versionPriority: map[string][]string{},
schemeName: naming.GetNameFromCallsite(internalPackages...),
}
s.converter = conversion.NewConverter(s.nameFunc)
utilruntime.Must(s.AddConversionFuncs(DefaultEmbeddedConversions()...))
// Enable map[string][]string conversions by default
utilruntime.Must(s.AddConversionFuncs(DefaultStringConversions...))
utilruntime.Must(s.RegisterInputDefaults(&map[string][]string{}, JSONKeyMapper, conversion.AllowDifferentFieldTypeNames|conversion.IgnoreMissingFields))
utilruntime.Must(s.RegisterInputDefaults(&url.Values{}, JSONKeyMapper, conversion.AllowDifferentFieldTypeNames|conversion.IgnoreMissingFields))
return s
}
// nameFunc returns the name of the type that we wish to use to determine when two types attempt
// a conversion. Defaults to the go name of the type if the type is not registered.
func (s *Scheme) nameFunc(t reflect.Type) string {
// find the preferred names for this type
gvks, ok := s.typeToGVK[t]
if !ok {
return t.Name()
}
for _, gvk := range gvks {
internalGV := gvk.GroupVersion()
internalGV.Version = APIVersionInternal // this is hacky and maybe should be passed in
internalGVK := internalGV.WithKind(gvk.Kind)
if internalType, exists := s.gvkToType[internalGVK]; exists {
return s.typeToGVK[internalType][0].Kind
}
}
return gvks[0].Kind
}
// fromScope gets the input version, desired output version, and desired Scheme
// from a conversion.Scope.
func (s *Scheme) fromScope(scope conversion.Scope) *Scheme {
return s
}
// Converter allows access to the converter for the scheme
func (s *Scheme) Converter() *conversion.Converter {
return s.converter
}
// AddUnversionedTypes registers the provided types as "unversioned", which means that they follow special rules.
// Whenever an object of this type is serialized, it is serialized with the provided group version and is not
// converted. Thus unversioned objects are expected to remain backwards compatible forever, as if they were in an
// API group and version that would never be updated.
//
// TODO: there is discussion about removing unversioned and replacing it with objects that are manifest into
// every version with particular schemas. Resolve this method at that point.
func (s *Scheme) AddUnversionedTypes(version schema.GroupVersion, types ...Object) {
s.addObservedVersion(version)
s.AddKnownTypes(version, types...)
for _, obj := range types {
t := reflect.TypeOf(obj).Elem()
gvk := version.WithKind(t.Name())
s.unversionedTypes[t] = gvk
if old, ok := s.unversionedKinds[gvk.Kind]; ok && t != old {
panic(fmt.Sprintf("%v.%v has already been registered as unversioned kind %q - kind name must be unique in scheme %q", old.PkgPath(), old.Name(), gvk, s.schemeName))
}
s.unversionedKinds[gvk.Kind] = t
}
}
// AddKnownTypes registers all types passed in 'types' as being members of version 'version'.
// All objects passed to types should be pointers to structs. The name that go reports for
// the struct becomes the "kind" field when encoding. Version may not be empty - use the
// APIVersionInternal constant if you have a type that does not have a formal version.
func (s *Scheme) AddKnownTypes(gv schema.GroupVersion, types ...Object) {
s.addObservedVersion(gv)
for _, obj := range types {
t := reflect.TypeOf(obj)
if t.Kind() != reflect.Ptr {
panic("All types must be pointers to structs.")
}
t = t.Elem()
s.AddKnownTypeWithName(gv.WithKind(t.Name()), obj)
}
}
// AddKnownTypeWithName is like AddKnownTypes, but it lets you specify what this type should
// be encoded as. Useful for testing when you don't want to make multiple packages to define
// your structs. Version may not be empty - use the APIVersionInternal constant if you have a
// type that does not have a formal version.
func (s *Scheme) AddKnownTypeWithName(gvk schema.GroupVersionKind, obj Object) {
s.addObservedVersion(gvk.GroupVersion())
t := reflect.TypeOf(obj)
if len(gvk.Version) == 0 {
panic(fmt.Sprintf("version is required on all types: %s %v", gvk, t))
}
if t.Kind() != reflect.Ptr {
panic("All types must be pointers to structs.")
}
t = t.Elem()
if t.Kind() != reflect.Struct {
panic("All types must be pointers to structs.")
}
if oldT, found := s.gvkToType[gvk]; found && oldT != t {
panic(fmt.Sprintf("Double registration of different types for %v: old=%v.%v, new=%v.%v in scheme %q", gvk, oldT.PkgPath(), oldT.Name(), t.PkgPath(), t.Name(), s.schemeName))
}
s.gvkToType[gvk] = t
for _, existingGvk := range s.typeToGVK[t] {
if existingGvk == gvk {
return
}
}
s.typeToGVK[t] = append(s.typeToGVK[t], gvk)
}
// KnownTypes returns the types known for the given version.
func (s *Scheme) KnownTypes(gv schema.GroupVersion) map[string]reflect.Type {
types := make(map[string]reflect.Type)
for gvk, t := range s.gvkToType {
if gv != gvk.GroupVersion() {
continue
}
types[gvk.Kind] = t
}
return types
}
// AllKnownTypes returns the all known types.
func (s *Scheme) AllKnownTypes() map[schema.GroupVersionKind]reflect.Type {
return s.gvkToType
}
// ObjectKinds returns all possible group,version,kind of the go object, true if the
// object is considered unversioned, or an error if it's not a pointer or is unregistered.
func (s *Scheme) ObjectKinds(obj Object) ([]schema.GroupVersionKind, bool, error) {
// Unstructured objects are always considered to have their declared GVK
if _, ok := obj.(Unstructured); ok {
// we require that the GVK be populated in order to recognize the object
gvk := obj.GetObjectKind().GroupVersionKind()
if len(gvk.Kind) == 0 {
return nil, false, NewMissingKindErr("unstructured object has no kind")
}
if len(gvk.Version) == 0 {
return nil, false, NewMissingVersionErr("unstructured object has no version")
}
return []schema.GroupVersionKind{gvk}, false, nil
}
v, err := conversion.EnforcePtr(obj)
if err != nil {
return nil, false, err
}
t := v.Type()
gvks, ok := s.typeToGVK[t]
if !ok {
return nil, false, NewNotRegisteredErrForType(s.schemeName, t)
}
_, unversionedType := s.unversionedTypes[t]
return gvks, unversionedType, nil
}
// Recognizes returns true if the scheme is able to handle the provided group,version,kind
// of an object.
func (s *Scheme) Recognizes(gvk schema.GroupVersionKind) bool {
_, exists := s.gvkToType[gvk]
return exists
}
func (s *Scheme) IsUnversioned(obj Object) (bool, bool) {
v, err := conversion.EnforcePtr(obj)
if err != nil {
return false, false
}
t := v.Type()
if _, ok := s.typeToGVK[t]; !ok {
return false, false
}
_, ok := s.unversionedTypes[t]
return ok, true
}
// New returns a new API object of the given version and name, or an error if it hasn't
// been registered. The version and kind fields must be specified.
func (s *Scheme) New(kind schema.GroupVersionKind) (Object, error) {
if t, exists := s.gvkToType[kind]; exists {
return reflect.New(t).Interface().(Object), nil
}
if t, exists := s.unversionedKinds[kind.Kind]; exists {
return reflect.New(t).Interface().(Object), nil
}
return nil, NewNotRegisteredErrForKind(s.schemeName, kind)
}
// Log sets a logger on the scheme. For test purposes only
func (s *Scheme) Log(l conversion.DebugLogger) {
s.converter.Debug = l
}
// AddIgnoredConversionType identifies a pair of types that should be skipped by
// conversion (because the data inside them is explicitly dropped during
// conversion).
func (s *Scheme) AddIgnoredConversionType(from, to interface{}) error {
return s.converter.RegisterIgnoredConversion(from, to)
}
// AddConversionFuncs adds functions to the list of conversion functions. The given
// functions should know how to convert between two of your API objects, or their
// sub-objects. We deduce how to call these functions from the types of their two
// parameters; see the comment for Converter.Register.
//
// Note that, if you need to copy sub-objects that didn't change, you can use the
// conversion.Scope object that will be passed to your conversion function.
// Additionally, all conversions started by Scheme will set the SrcVersion and
// DestVersion fields on the Meta object. Example:
//
// s.AddConversionFuncs(
// func(in *InternalObject, out *ExternalObject, scope conversion.Scope) error {
// // You can depend on Meta() being non-nil, and this being set to
// // the source version, e.g., ""
// s.Meta().SrcVersion
// // You can depend on this being set to the destination version,
// // e.g., "v1".
// s.Meta().DestVersion
// // Call scope.Convert to copy sub-fields.
// s.Convert(&in.SubFieldThatMoved, &out.NewLocation.NewName, 0)
// return nil
// },
// )
//
// (For more detail about conversion functions, see Converter.Register's comment.)
//
// Also note that the default behavior, if you don't add a conversion function, is to
// sanely copy fields that have the same names and same type names. It's OK if the
// destination type has extra fields, but it must not remove any. So you only need to
// add conversion functions for things with changed/removed fields.
func (s *Scheme) AddConversionFuncs(conversionFuncs ...interface{}) error {
for _, f := range conversionFuncs {
if err := s.converter.RegisterConversionFunc(f); err != nil {
return err
}
}
return nil
}
// AddConversionFunc registers a function that converts between a and b by passing objects of those
// types to the provided function. The function *must* accept objects of a and b - this machinery will not enforce
// any other guarantee.
func (s *Scheme) AddConversionFunc(a, b interface{}, fn conversion.ConversionFunc) error {
return s.converter.RegisterUntypedConversionFunc(a, b, fn)
}
// AddGeneratedConversionFunc registers a function that converts between a and b by passing objects of those
// types to the provided function. The function *must* accept objects of a and b - this machinery will not enforce
// any other guarantee.
func (s *Scheme) AddGeneratedConversionFunc(a, b interface{}, fn conversion.ConversionFunc) error {
return s.converter.RegisterGeneratedUntypedConversionFunc(a, b, fn)
}
// AddFieldLabelConversionFunc adds a conversion function to convert field selectors
// of the given kind from the given version to internal version representation.
func (s *Scheme) AddFieldLabelConversionFunc(gvk schema.GroupVersionKind, conversionFunc FieldLabelConversionFunc) error {
s.fieldLabelConversionFuncs[gvk] = conversionFunc
return nil
}
// RegisterInputDefaults sets the provided field mapping function and field matching
// as the defaults for the provided input type. The fn may be nil, in which case no
// mapping will happen by default. Use this method to register a mechanism for handling
// a specific input type in conversion, such as a map[string]string to structs.
func (s *Scheme) RegisterInputDefaults(in interface{}, fn conversion.FieldMappingFunc, defaultFlags conversion.FieldMatchingFlags) error {
return s.converter.RegisterInputDefaults(in, fn, defaultFlags)
}
// AddTypeDefaultingFunc registers a function that is passed a pointer to an
// object and can default fields on the object. These functions will be invoked
// when Default() is called. The function will never be called unless the
// defaulted object matches srcType. If this function is invoked twice with the
// same srcType, the fn passed to the later call will be used instead.
func (s *Scheme) AddTypeDefaultingFunc(srcType Object, fn func(interface{})) {
s.defaulterFuncs[reflect.TypeOf(srcType)] = fn
}
// Default sets defaults on the provided Object.
func (s *Scheme) Default(src Object) {
if fn, ok := s.defaulterFuncs[reflect.TypeOf(src)]; ok {
fn(src)
}
}
// Convert will attempt to convert in into out. Both must be pointers. For easy
// testing of conversion functions. Returns an error if the conversion isn't
// possible. You can call this with types that haven't been registered (for example,
// a to test conversion of types that are nested within registered types). The
// context interface is passed to the convertor. Convert also supports Unstructured
// types and will convert them intelligently.
func (s *Scheme) Convert(in, out interface{}, context interface{}) error {
unstructuredIn, okIn := in.(Unstructured)
unstructuredOut, okOut := out.(Unstructured)
switch {
case okIn && okOut:
// converting unstructured input to an unstructured output is a straight copy - unstructured
// is a "smart holder" and the contents are passed by reference between the two objects
unstructuredOut.SetUnstructuredContent(unstructuredIn.UnstructuredContent())
return nil
case okOut:
// if the output is an unstructured object, use the standard Go type to unstructured
// conversion. The object must not be internal.
obj, ok := in.(Object)
if !ok {
return fmt.Errorf("unable to convert object type %T to Unstructured, must be a runtime.Object", in)
}
gvks, unversioned, err := s.ObjectKinds(obj)
if err != nil {
return err
}
gvk := gvks[0]
// if no conversion is necessary, convert immediately
if unversioned || gvk.Version != APIVersionInternal {
content, err := DefaultUnstructuredConverter.ToUnstructured(in)
if err != nil {
return err
}
unstructuredOut.SetUnstructuredContent(content)
unstructuredOut.GetObjectKind().SetGroupVersionKind(gvk)
return nil
}
// attempt to convert the object to an external version first.
target, ok := context.(GroupVersioner)
if !ok {
return fmt.Errorf("unable to convert the internal object type %T to Unstructured without providing a preferred version to convert to", in)
}
// Convert is implicitly unsafe, so we don't need to perform a safe conversion
versioned, err := s.UnsafeConvertToVersion(obj, target)
if err != nil {
return err
}
content, err := DefaultUnstructuredConverter.ToUnstructured(versioned)
if err != nil {
return err
}
unstructuredOut.SetUnstructuredContent(content)
return nil
case okIn:
// converting an unstructured object to any type is modeled by first converting
// the input to a versioned type, then running standard conversions
typed, err := s.unstructuredToTyped(unstructuredIn)
if err != nil {
return err
}
in = typed
}
flags, meta := s.generateConvertMeta(in)
meta.Context = context
if flags == 0 {
flags = conversion.AllowDifferentFieldTypeNames
}
return s.converter.Convert(in, out, flags, meta)
}
// ConvertFieldLabel alters the given field label and value for an kind field selector from
// versioned representation to an unversioned one or returns an error.
func (s *Scheme) ConvertFieldLabel(gvk schema.GroupVersionKind, label, value string) (string, string, error) {
conversionFunc, ok := s.fieldLabelConversionFuncs[gvk]
if !ok {
return DefaultMetaV1FieldSelectorConversion(label, value)
}
return conversionFunc(label, value)
}
// ConvertToVersion attempts to convert an input object to its matching Kind in another
// version within this scheme. Will return an error if the provided version does not
// contain the inKind (or a mapping by name defined with AddKnownTypeWithName). Will also
// return an error if the conversion does not result in a valid Object being
// returned. Passes target down to the conversion methods as the Context on the scope.
func (s *Scheme) ConvertToVersion(in Object, target GroupVersioner) (Object, error) {
return s.convertToVersion(true, in, target)
}
// UnsafeConvertToVersion will convert in to the provided target if such a conversion is possible,
// but does not guarantee the output object does not share fields with the input object. It attempts to be as
// efficient as possible when doing conversion.
func (s *Scheme) UnsafeConvertToVersion(in Object, target GroupVersioner) (Object, error) {
return s.convertToVersion(false, in, target)
}
// convertToVersion handles conversion with an optional copy.
func (s *Scheme) convertToVersion(copy bool, in Object, target GroupVersioner) (Object, error) {
var t reflect.Type
if u, ok := in.(Unstructured); ok {
typed, err := s.unstructuredToTyped(u)
if err != nil {
return nil, err
}
in = typed
// unstructuredToTyped returns an Object, which must be a pointer to a struct.
t = reflect.TypeOf(in).Elem()
} else {
// determine the incoming kinds with as few allocations as possible.
t = reflect.TypeOf(in)
if t.Kind() != reflect.Ptr {
return nil, fmt.Errorf("only pointer types may be converted: %v", t)
}
t = t.Elem()
if t.Kind() != reflect.Struct {
return nil, fmt.Errorf("only pointers to struct types may be converted: %v", t)
}
}
kinds, ok := s.typeToGVK[t]
if !ok || len(kinds) == 0 {
return nil, NewNotRegisteredErrForType(s.schemeName, t)
}
gvk, ok := target.KindForGroupVersionKinds(kinds)
if !ok {
// try to see if this type is listed as unversioned (for legacy support)
// TODO: when we move to server API versions, we should completely remove the unversioned concept
if unversionedKind, ok := s.unversionedTypes[t]; ok {
if gvk, ok := target.KindForGroupVersionKinds([]schema.GroupVersionKind{unversionedKind}); ok {
return copyAndSetTargetKind(copy, in, gvk)
}
return copyAndSetTargetKind(copy, in, unversionedKind)
}
return nil, NewNotRegisteredErrForTarget(s.schemeName, t, target)
}
// target wants to use the existing type, set kind and return (no conversion necessary)
for _, kind := range kinds {
if gvk == kind {
return copyAndSetTargetKind(copy, in, gvk)
}
}
// type is unversioned, no conversion necessary
if unversionedKind, ok := s.unversionedTypes[t]; ok {
if gvk, ok := target.KindForGroupVersionKinds([]schema.GroupVersionKind{unversionedKind}); ok {
return copyAndSetTargetKind(copy, in, gvk)
}
return copyAndSetTargetKind(copy, in, unversionedKind)
}
out, err := s.New(gvk)
if err != nil {
return nil, err
}
if copy {
in = in.DeepCopyObject()
}
flags, meta := s.generateConvertMeta(in)
meta.Context = target
if err := s.converter.Convert(in, out, flags, meta); err != nil {
return nil, err
}
setTargetKind(out, gvk)
return out, nil
}
// unstructuredToTyped attempts to transform an unstructured object to a typed
// object if possible. It will return an error if conversion is not possible, or the versioned
// Go form of the object. Note that this conversion will lose fields.
func (s *Scheme) unstructuredToTyped(in Unstructured) (Object, error) {
// the type must be something we recognize
gvks, _, err := s.ObjectKinds(in)
if err != nil {
return nil, err
}
typed, err := s.New(gvks[0])
if err != nil {
return nil, err
}
if err := DefaultUnstructuredConverter.FromUnstructured(in.UnstructuredContent(), typed); err != nil {
return nil, fmt.Errorf("unable to convert unstructured object to %v: %v", gvks[0], err)
}
return typed, nil
}
// generateConvertMeta constructs the meta value we pass to Convert.
func (s *Scheme) generateConvertMeta(in interface{}) (conversion.FieldMatchingFlags, *conversion.Meta) {
return s.converter.DefaultMeta(reflect.TypeOf(in))
}
// copyAndSetTargetKind performs a conditional copy before returning the object, or an error if copy was not successful.
func copyAndSetTargetKind(copy bool, obj Object, kind schema.GroupVersionKind) (Object, error) {
if copy {
obj = obj.DeepCopyObject()
}
setTargetKind(obj, kind)
return obj, nil
}
// setTargetKind sets the kind on an object, taking into account whether the target kind is the internal version.
func setTargetKind(obj Object, kind schema.GroupVersionKind) {
if kind.Version == APIVersionInternal {
// internal is a special case
// TODO: look at removing the need to special case this
obj.GetObjectKind().SetGroupVersionKind(schema.GroupVersionKind{})
return
}
obj.GetObjectKind().SetGroupVersionKind(kind)
}
// SetVersionPriority allows specifying a precise order of priority. All specified versions must be in the same group,
// and the specified order overwrites any previously specified order for this group
func (s *Scheme) SetVersionPriority(versions ...schema.GroupVersion) error {
groups := sets.String{}
order := []string{}
for _, version := range versions {
if len(version.Version) == 0 || version.Version == APIVersionInternal {
return fmt.Errorf("internal versions cannot be prioritized: %v", version)
}
groups.Insert(version.Group)
order = append(order, version.Version)
}
if len(groups) != 1 {
return fmt.Errorf("must register versions for exactly one group: %v", strings.Join(groups.List(), ", "))
}
s.versionPriority[groups.List()[0]] = order
return nil
}
// PrioritizedVersionsForGroup returns versions for a single group in priority order
func (s *Scheme) PrioritizedVersionsForGroup(group string) []schema.GroupVersion {
ret := []schema.GroupVersion{}
for _, version := range s.versionPriority[group] {
ret = append(ret, schema.GroupVersion{Group: group, Version: version})
}
for _, observedVersion := range s.observedVersions {
if observedVersion.Group != group {
continue
}
found := false
for _, existing := range ret {
if existing == observedVersion {
found = true
break
}
}
if !found {
ret = append(ret, observedVersion)
}
}
return ret
}
// PrioritizedVersionsAllGroups returns all known versions in their priority order. Groups are random, but
// versions for a single group are prioritized
func (s *Scheme) PrioritizedVersionsAllGroups() []schema.GroupVersion {
ret := []schema.GroupVersion{}
for group, versions := range s.versionPriority {
for _, version := range versions {
ret = append(ret, schema.GroupVersion{Group: group, Version: version})
}
}
for _, observedVersion := range s.observedVersions {
found := false
for _, existing := range ret {
if existing == observedVersion {
found = true
break
}
}
if !found {
ret = append(ret, observedVersion)
}
}
return ret
}
// PreferredVersionAllGroups returns the most preferred version for every group.
// group ordering is random.
func (s *Scheme) PreferredVersionAllGroups() []schema.GroupVersion {
ret := []schema.GroupVersion{}
for group, versions := range s.versionPriority {
for _, version := range versions {
ret = append(ret, schema.GroupVersion{Group: group, Version: version})
break
}
}
for _, observedVersion := range s.observedVersions {
found := false
for _, existing := range ret {
if existing.Group == observedVersion.Group {
found = true
break
}
}
if !found {
ret = append(ret, observedVersion)
}
}
return ret
}
// IsGroupRegistered returns true if types for the group have been registered with the scheme
func (s *Scheme) IsGroupRegistered(group string) bool {
for _, observedVersion := range s.observedVersions {
if observedVersion.Group == group {
return true
}
}
return false
}
// IsVersionRegistered returns true if types for the version have been registered with the scheme
func (s *Scheme) IsVersionRegistered(version schema.GroupVersion) bool {
for _, observedVersion := range s.observedVersions {
if observedVersion == version {
return true
}
}
return false
}
func (s *Scheme) addObservedVersion(version schema.GroupVersion) {
if len(version.Version) == 0 || version.Version == APIVersionInternal {
return
}
for _, observedVersion := range s.observedVersions {
if observedVersion == version {
return
}
}
s.observedVersions = append(s.observedVersions, version)
}
func (s *Scheme) Name() string {
return s.schemeName
}
// internalPackages are packages that ignored when creating a default reflector name. These packages are in the common
// call chains to NewReflector, so they'd be low entropy names for reflectors
var internalPackages = []string{"k8s.io/apimachinery/pkg/runtime/scheme.go"}
|
{
"pile_set_name": "Github"
}
|
About Us
About Bambú Clinic
Originally founded in Brighton, MA, Bambú Clinic in Portland arose out of a collaboration between Dr. Rebecca (Asmar) Krisko and Drs. Kaufmann, Senders and Thom. After graduating from the National College of Natural Medicine in 2003, Dr. (Asmar) Krisko began practicing in a small naturopathic clinic in Vancouver, WA.
Simultaneously, though, she dreamed of opening a clinic of her own where her philosophy of health optimization could come to life with other like-minded physicians. In the spirit of this ideal, she left her infant practice in June 2005 to take a residency position with Dr. Dickson Thom, her mentor and colleague.
Through the years, their working relationship grew into a mutual exchange of ideas and a shared dedication to developing the principles of naturopathic medicine by precept, lecture, and clinical practice.
By August 2007, Dr. (Asmar) Krisko had decided to fulfill her dream of ownership and to open the clinic that would embody these life-changing principles and the dynamic collaboration she enjoyed during her residency.
Dr. (Asmar) Krisko believes that wellness and prosperity can be simultaneously defined as “a creative approach to life, the sustainable application of resources, a strong connection to community, and a high degree of fulfillment.”
These basic principles influenced every aspect of Bambú Clinic including the choice of the name, the associates, the staff, and the basic systems by which the clinic operates.
As the owner, Dr. (Asmar) Krisko recognizes the importance of gathering a team of doctors, staff, and patients willing to co-create a space in which true healing on all levels can occur within the context of a supportive network.
Although Dr. (Asmar) Krisko now owns Bambú Clinic at its Portland location, she recognizes the rich history of this clinic starting with its roots in Boston, MA. She is exceptionally grateful to have benefited from the foundational contributions and creativity of Drs. Senders and Kaufmann in this undertaking.
As the clinic has grown throughout the years, she has continued to seek out outstanding physicians who share a common dedication to the operating principles of this health center and who offer the highest level of patient care by promoting sustainable lifestyle choices and a deep understanding of the true causes of illness.
Bambú Clinic is a naturopathic and traditional Chinese medicine clinic that provides comprehensive medical care to patients of all ages and with all health concerns.
Our practitioners bring their unique sets of strengths and talents and work whole-heartedly with patients to clear the path for healing. Thru this working relationship, our patients grow in health and happiness by enjoying more of what is serving them and discarding what isn’t.
We offer the highest quality diagnoses, healthcare management, and treatment.
The practitioners at Bambú Clinic have undergone rigorous medical training and are board certified and licensed in the state of Oregon.
They are committed to continually furthering their medical knowledge, and they have done so thru residencies, specialized trainings, independent research, and their collaborative professional networks. They are recognized for expertise in their fields, and now educate and mentor other fledgling practitioners.
We partner with you to identify the cause of your illness and restore balance
We are committed to uncovering the underlying causes of imbalance that lead to dysfunction, and we work with to correct these imbalances.
We offer coaching to help you embrace daily dietary and lifestyle habits that promote optimal wellness while using gentle, effective medicines to restore normal physiology, including hydrotherapy, botanicals, homeopathics, herbal preparations, acupuncture, and LED light therapy.
We also work to nurture your mental, emotional and spiritual health to achieve holistic wellness.
We create sustained health thru education
The only way to sustain improved health is to become your own health care activist. We would love for you to achieve a level of wellness where you no longer need regular appointments with your provider. In order to help you get there, we will
provide you with copies of your labs
teach you how to manage acute illness by yourself at home, and
instruct you on the origins of your condition so you can take proactive health measures.
Our patients often begin educate others about what they’ve learned and become ambassadors of health in their families and communities.
We collaborate with other providers for improved health outcomes
We work in consultation with any other providers you may be seeing. We believe that each health care profession brings something valuable and unique to the treatment process, and that by working together we can all provide the best quality of care possible.
The practitioners at Bambú Clinic also participate in a collaborative environment that fosters the growth of a health paradigm based on wellness and prevention to further the clinic goals.
We practice what we preach
We are committed to cultivating our own physical, mental and spiritual health so that we can offer a medical relationship based on a grounded presence of mind and spirit.
At Bambú, we often look to nature to understand the patterns that shape the journey to wellness. When it came to naming our clinic, we applied the same guiding principle.
The clinic’s original owner was of Latin heritage, and “Bambú” is Spanish for bamboo. The bamboo plant represents a “perfect model of healthy growth in nature.” It is the fastest-growing plant on Earth – it surges upward as fast as 4-5 feet in a single 24-hour period, and for brief periods of time, can reach a maximal growth rate exceeding 3 feet per hour.
In Chinese philosophy, our life’s purpose, like the rapid directional growth of the bamboo plant, is represented by skyward growth towards the sun ultimately revealing the heart’s true desire.
Strength and flexibility are two crucial characteristics of the bamboo plant and for a patient’s journey to optimal health. The plant’s hollow stem endows bamboo with the qualities of durability and grace—it bends readily in response to external events, but does not break easily.
We have chosen the beautiful imagery of the bamboo plant to inspire our patients’ paths to true health; the body, mind and spirit’s ability to maintain movement, and flexibility in the face of challenges. As we work together to keep you aligned with your path, we will ultimately move you toward your goal of optimal health.
Originally founded in Brighton, MA, Bambú Clinic in Portland arose out of a collaboration between Dr. Rebecca (Asmar) Krisko and Drs. Kaufmann, Senders and Thom. After graduating from the National College of Natural Medicine in 2003, Dr. (Asmar) Krisko began practicing in a small naturopathic clinic in Vancouver, WA.
Simultaneously, though, she dreamed of opening a clinic of her own where her philosophy of health optimization could come to life with other like-minded physicians. In the spirit of this ideal, she left her infant practice in June 2005 to take a residency position with Dr. Dickson Thom, her mentor and colleague.
Through the years, their working relationship grew into a mutual exchange of ideas and a shared dedication to developing the principles of naturopathic medicine by precept, lecture, and clinical practice.
By August 2007, Dr. (Asmar) Krisko had decided to fulfill her dream of ownership and to open the clinic that would embody these life-changing principles and the dynamic collaboration she enjoyed during her residency.
Dr. (Asmar) Krisko believes that wellness and prosperity can be simultaneously defined as “a creative approach to life, the sustainable application of resources, a strong connection to community, and a high degree of fulfillment.”
These basic principles influenced every aspect of Bambú Clinic including the choice of the name, the associates, the staff, and the basic systems by which the clinic operates.
As the owner, Dr. (Asmar) Krisko recognizes the importance of gathering a team of doctors, staff, and patients willing to co-create a space in which true healing on all levels can occur within the context of a supportive network.
Although Dr. (Asmar) Krisko now owns Bambú Clinic at its Portland location, she recognizes the rich history of this clinic starting with its roots in Boston, MA. She is exceptionally grateful to have benefited from the foundational contributions and creativity of Drs. Senders and Kaufmann in this undertaking.
As the clinic has grown throughout the years, she has continued to seek out outstanding physicians who share a common dedication to the operating principles of this health center and who offer the highest level of patient care by promoting sustainable lifestyle choices and a deep understanding of the true causes of illness.
Bambú Clinic is a naturopathic and traditional Chinese medicine clinic that provides comprehensive medical care to patients of all ages and with all health concerns.
Our practitioners bring their unique sets of strengths and talents and work whole-heartedly with patients to clear the path for healing. Thru this working relationship, our patients grow in health and happiness by enjoying more of what is serving them and discarding what isn’t.
We offer the highest quality diagnoses, healthcare management, and treatment.
The practitioners at Bambú Clinic have undergone rigorous medical training and are board certified and licensed in the state of Oregon.
They are committed to continually furthering their medical knowledge, and they have done so thru residencies, specialized trainings, independent research, and their collaborative professional networks. They are recognized for expertise in their fields, and now educate and mentor other fledgling practitioners.
We partner with you to identify the cause of your illness and restore balance
We are committed to uncovering the underlying causes of imbalance that lead to dysfunction, and we work with to correct these imbalances.
We offer coaching to help you embrace daily dietary and lifestyle habits that promote optimal wellness while using gentle, effective medicines to restore normal physiology, including hydrotherapy, botanicals, homeopathics, herbal preparations, acupuncture, and LED light therapy.
We also work to nurture your mental, emotional and spiritual health to achieve holistic wellness.
We create sustained health thru education
The only way to sustain improved health is to become your own health care activist. We would love for you to achieve a level of wellness where you no longer need regular appointments with your provider. In order to help you get there, we will
provide you with copies of your labs
teach you how to manage acute illness by yourself at home, and
instruct you on the origins of your condition so you can take proactive health measures.
Our patients often begin educate others about what they’ve learned and become ambassadors of health in their families and communities.
We collaborate with other providers for improved health outcomes
We work in consultation with any other providers you may be seeing. We believe that each health care profession brings something valuable and unique to the treatment process, and that by working together we can all provide the best quality of care possible.
The practitioners at Bambú Clinic also participate in a collaborative environment that fosters the growth of a health paradigm based on wellness and prevention to further the clinic goals.
We practice what we preach
We are committed to cultivating our own physical, mental and spiritual health so that we can offer a medical relationship based on a grounded presence of mind and spirit.
At Bambú, we often look to nature to understand the patterns that shape the journey to wellness. When it came to naming our clinic, we applied the same guiding principle.
The clinic’s original owner was of Latin heritage, and “Bambú” is Spanish for bamboo. The bamboo plant represents a “perfect model of healthy growth in nature.” It is the fastest-growing plant on Earth – it surges upward as fast as 4-5 feet in a single 24-hour period, and for brief periods of time, can reach a maximal growth rate exceeding 3 feet per hour.
In Chinese philosophy, our life’s purpose, like the rapid directional growth of the bamboo plant, is represented by skyward growth towards the sun ultimately revealing the heart’s true desire.
Strength and flexibility are two crucial characteristics of the bamboo plant and for a patient’s journey to optimal health. The plant’s hollow stem endows bamboo with the qualities of durability and grace—it bends readily in response to external events, but does not break easily.
We have chosen the beautiful imagery of the bamboo plant to inspire our patients’ paths to true health; the body, mind and spirit’s ability to maintain movement, and flexibility in the face of challenges. As we work together to keep you aligned with your path, we will ultimately move you toward your goal of optimal health.
|
{
"pile_set_name": "Pile-CC"
}
|
Hydrodeoxygenation
Hydrodeoxygenation (HDO) is a hydrogenolysis process for removing oxygen from oxygen containing compounds. Typical HDO catalysts commonly are sulfided nickel-molybdenum or cobalt-molybdenum on gamma alumina. An idealized reaction is:
R2O + 2 H2 → H2O + 2 RH
The first review on HDO was published in 1983. HDO is of interest in producing biofuels, which are derived from oxygen-rich precursors like sugars or lipids. An example of a biomass refining process employing hydrodeoxygenation is the NEXBTL process.
HDO of biomass fast pyrolysis vapors under low hydrogen pressures have recently attracted a lot of attention. Bulk molybdenum trioxide (MoO3) was used as catalyst and found to completely deoxygenate cellulose, corn stover, and lignin pyrolysis vapors and produce a stream of hydrocarbons including aromatics, alkenes, and alkanes. From an economic viewpoint, only aromatics and alkenes should ideally be produced to enable product incorporation into the existing infrastructure.
References
Category:Chemical processes
Category:Petroleum technology
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Peter Patterson (footballer)
Peter Patterson (born 3 October 1945) is a former Australian rules footballer who played with Collingwood in the Victorian Football League (VFL).
Patterson started his career in the Wimmera Football League, where he played with Nhill. A wingman, he made his debut for Collingwood in 1965 and the following year played in the side which lost the grand final by a single point. He missed just one game in 1967 but would only add another 20 games in the next three seasons.
He was later the playing coach of Hampden Football League club South Warrnambool.
References
Category:1945 births
Category:Australian rules footballers from Victoria (Australia)
Category:Collingwood Football Club players
Category:Nhill Football Club players
Category:South Warrnambool Football Club players
Category:South Warrnambool Football Club coaches
Category:Living people
|
{
"pile_set_name": "Wikipedia (en)"
}
|
Melvin Sokolsky
After seeing Heironymous Bosch’s ‘The Garden of delights, Sokolsky started to have a recurring dream in which he saw himself floating in a bubble across wild and wonderful landscapes. Feeling inspirired he decided to emulate his dreams into a series for the Harper’s Bazaar Spring Collection.
Inspired by the Faberge Egg, the Bubble itself was crafted in 10 days out of aircraft aliminium and plexi glass and swiftly taken to Paris which was so be the setting for his dream-like shoot.
“With the awareness that I was prone to live in my own head much of the time, and inclined to severe self-criticism, I began to have doubts whether I could create images on film that reflected the images in my mind’s eye.”
Shooting the Bubble series proved to be both an adventure and technically and logistically very challenging! The Bubble had to be elevated by a large crane and suspended by a thick wire, he has to ensure that his model was safe and could breath and then the bubble would float upwards about the rooftops, through the streets and even down the River Seine.
“There were times when this choreographed dance turned into a Laurel and Hardy comedy. The morning we shot on the Seine, the Bubble was lowered overzealously into the water, flooding it up to Simone’s ankles, and in turn ruining an important pair of designer shoes.”
The resulting series became one of Sokolsky’s most celebrated and recognizable and he was praised across the industry for his unconventional, innovative and triumphant work
HEIST IS A FORWARD THINKING CONTEMPORARY PHOTOGRAPHY COLLECTIVE THAT ENCOURAGES ENGAGEMENT BETWEEN COLLECTORS AND ARTISTS FROM AROUND THE WORLD, PROVIDING ACCESSIBILITY AND INFORMATIVE UNDERSTANDING INTO THE MEDIUM OF FINE-ART PHOTOGRAPHY.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
How to write dynamic sql in Oracle Stored procedure?
Basically in my update sql query column names going to be dynamic like
update bi_employee set <this_is_dynamic_column> where emp_id = 12
Below is the stored procedure that I have written so far.
CREATE OR replace PROCEDURE Sp_run_employee_updates
IS
CURSOR c_emp IS
SELECT *
FROM BI_EMPLOYEE_UPDATE
WHERE EFFECTIVE_DATE = To_date('30-Apr-2012', 'dd-mm-yy');
BEGIN
FOR employee_update IN c_emp LOOP
declare update_sql varchar2(225);
update_sql := 'UPDATE BI_EMPLOYEE SET '
|| employee_update.column_name
|| '= employee_update.new_value WHERE emp_id = '
|| employee_update.employee_id;
END LOOP;
END;
Its giving me foloowing errors
Error(17,13): PLS-00103: Encountered the symbol "=" when expecting one of the following: constant exception table long double ref char time timestamp interval date binary national character nchar The symbol "" was substituted for "=" to continue.
Error(22,5): PLS-00103: Encountered the symbol "UPDATE" when expecting one of the following: begin function pragma procedure subtype type current cursor delete exists prior The symbol "begin" was substituted for "UPDATE" to continue.
Error(31,6): PLS-00103: Encountered the symbol ";" when expecting one of the following: loop
A:
a- This should be like this:
to_date('30-Apr-2012','dd-mon-yyyy');
b- You can do it like this:
CREATE OR REPLACE
PROCEDURE SP_RUN_EMPLOYEE_UPDATES IS
update_sql varchar2(225);
CURSOR c_emp IS
SELECT *
FROM BI_EMPLOYEE_UPDATE
WHERE EFFECTIVE_DATE = to_date('30-Apr-2012','dd-mon-yyyy');
BEGIN
FOR employee_update in c_emp LOOP
update_sql := 'UPDATE BI_EMPLOYEE SET ' || employee_update.column_name ||
'= :1 WHERE emp_id = :2' ;
execute immediate update_sql using employee_update.new_value, employee_update.employee_id;
END LOOP;
END SP_RUN_EMPLOYEE_UPDATES;
|
{
"pile_set_name": "StackExchange"
}
|
Since I founded the Everyday Sexism Project, I have been writing about the abuses that women face: from catcalling to violence. With almost comforting regularity, the same criticisms appear below-the-line each time. So to save time, if nothing else, here is my reply • The best comebacks to sexist comments
Journalist Helen Lewis wisely wrote in 2012 that “the comments on any article about feminism justify feminism”. In my experience, she was right. But it’s not just the outrageous threats, misogynistic abuse and so on that emphasise the importance of the movement. It’s also the more subtle responses; the denials and challenges, often repeated over and over, that prove the points that feminist writers are making. In the interest of satisfying some of these heroically persistent critics, here are the answers to the 10 most common “below-the-line” responses I’ve received.
‘This is not specific to any gender’
I like to think of these commenters as sweetly naive rather than deliberately obtuse. Because, of course, were they to look at just a smidgen of the statistical evidence (often cited in the articles beneath which they are commenting) they would realise that these issues – harassment, sexual abuse, workplace discrimination – are very gendered indeed.
‘Well done. You have identified a problem that had been identified a million times. Now what is your solution?’
I feel awful for foisting another article about sexism on this poor beleaguered reader. As tough as it is for him to keep reading about it though, he might want to stop to consider what it’s like to live with it day-in, day-out. Sure, articles highlighting a problem aren’t necessarily a solution in themselves. But when I first started Everyday Sexism, I met the same response again and again: “sexism doesn’t exist any more”. It’s impossible to begin to tackle something without first raising awareness that the problem exists.
‘Why are you whining about this when there are more important things in the world?’
It’s amazing how this criticism is so rarely levelled at football writers, say, or people writing lighthearted pieces about DIY or dogwalking. Curiously, in fact, it’s almost exclusively women who are policed with the shouts of “it’s worse elsewhere so think yourself lucky”. The existence of rape and other forms of sexual violence don’t invalidate the experiences of those who are discriminated against in the workplace or harassed in the street; nobody tells the police to stop investigating fraud until they’ve solved every murder. The presumption that women in the UK have nothing to complain about is simply false: 85,000 women are raped in the UK every year and over 400,000 sexually assaulted. An average of more than two women are killed by a current or former partner every week. And perhaps most importantly of all, this argument fails to see the links between these different forms of oppression and violence. If we aren’t allowed to challenge the more “minor” forms of harassment and discrimination, we set a precedent for the treatment of women as second-class citizens that has a direct impact on the more serious crimes.
‘I don’t know if these people can ever be changed’
It’s probably true that people who are sexist or commit acts of abuse are unlikely to be swayed by a Guardian blogpost. Revelatory. But I’ve heard from a lot of men who say reading these articles has made them rethink sexist behaviour that they had previously considered to be harmless. And it’s my belief that there’s a critical mass of people out there who wouldn’t dream of carrying out such abuse, but also aren’t aware that it’s going on. If we can engage them, and open their eyes to the problem, they will be more likely to take action and become part of the solution. Maybe a dad will read one of these articles and be alerted to the importance of talking to his sons about respect for women. Maybe a woman who has been groped will read one and realise that she has the right to report the incident to the police.
‘If any man tries to grope me, they’ll get a foot slammed somewhere they really don’t want it to be’
I understand the impulse to comment on an article about harassment or groping with suggested reactions, I really do. It’s frustrating to read about people experiencing abuse and it’s a natural human response to offer advice. But these comments utterly fail to recognise the emotional and physical impact of being accosted or assaulted. Time and again, victims report feeling paralysed by shock or fear. By suggesting how women should react, you are (however unintentionally) implicating them in their own assault. More importantly still, focusing on responses fails to put the blame squarely where it really belongs – with the perpetrator.
‘We can all say “men should not do that in the first place” but this is the same as me leaving my car door open with keys in it and saying “people should not rob”’
No, it’s not. First, there is no good way to avoid assault – 90% of rapists are known to their victims, so those old chestnuts about not wearing short skirts, or going out late at night are nonsense. Second, we have to tackle perpetrators, not tell victims how to behave. Third, it’s incredibly insulting to the vast majority of men to suggest that they are inherently savage and will always attack women given an opportunity. Why should we let perpetrators off the hook “because biology”?
‘What about cleaning adverts portraying men as clueless idiots?’… ‘Does Laura Bates really believe no man has ever been propositioned or felt up at work?’
Nope. In fact, the Everyday Sexism Project accepts and publishes entries from men. Yes, there are isolated examples of adverts and media that make negative and sweeping generalisations about men. But most of the articles I write are about women and their experiences of gender inequality. Why? Women experience gender inequality vastly more frequently than men. The inequality women experience tends to be much more severe than that faced by men. And because of the structural, ingrained inequality in the society we live in (economically, professionally, socially), incidents of sexism experienced by women tend to have a much more far reaching impact on their daily lives.
‘I don’t know anyone in my office who behaves that way’ … ‘I just can’t believe that happens regularly’ … ‘I’ve never worked anywhere where these attitudes would be tolerated’
It’s not hugely surprising that many male commenters may not have witnessed sexism or discrimination firsthand. Harassers and abusers often take advantage of moments of isolation, whether in a deserted tube carriage or an empty office. The silencing of victims means that many never tell anybody about their experiences. This is a problem that disproportionately affects women, so of course men are less likely to have seen it happening, but that doesn’t mean it doesn’t exist. You can keep trying to suggest the problem isn’t really there because you haven’t seen it, but there’s a pesky amount of evidence to the contrary. Wouldn’t it be easier just to believe us?
‘I don’t think demonising all men is going to help’
It’s amazing how quick some men (yes, #notALLmen, don’t panic) can be to jump to the conclusion that any article describing the actions of a minority must somehow be attacking them. It’s not. But by jumping in to shout that not all men are like those described, you are becoming part of the problem. It’s this kind of defensive response that makes it so hard to speak out about sexism. One great way to make the point that “not all men” are sexist is to get involved in taking a stand – you can start by not derailing articles about the problem.
‘This is just another example of the feminist conspiracy at the Guardian’
Busted.
|
{
"pile_set_name": "OpenWebText2"
}
|
Польша не намерена больше принимать беженцев по квотам Евросоюза, причиной стали масштабные теракты в Париже. Об этом заявил польский министр по делам ЕС Конрад Шиманский, передает Independent.
Он пояснил, что у Восточной Европы нет «каких-либо политических возможностей» для приема мигрантов из Сирии и Ирака. «Решения Совета Европы, которые мы критиковали, о переселении беженцев и иммигрантов во все страны ЕС являются частью европейского права…но после трагических событий в Париже мы не видим политической возможности их соблюдения», — сказал министр.
В ночь на 14 ноября боевики террористической группировки «Исламское государство» (ее деятельность в России запрещена) совершили серию нападений на публичные места в Париже. Атакам подверглись стадион, концертный зал и кафе. В результате погибли как минимум 128 человек.
В конце сентября главы МВД стран Евросоюза большинством голосов приняли план введения квот на размещение мигрантов в Европе. Беженцев планируется разместить по всем странам Евросоюза. Некоторые страны Восточной Европы выступили категорически против системы квот. Главными противниками нововведения стали Чехия и Словакия.
|
{
"pile_set_name": "OpenWebText2"
}
|
Introduction {#S0001}
============
Le mésentère commun résulte d\'une anomalie de rotation du tube digestif. Il est caractérisé par la persistance d\'une disposition anatomique embryonnaire secondaire à une anomalie de rotation de l\'anse ombilicale primitive, constituant ainsi un méso commun à toute l\'anse intestinale et une racine du mésentère extrêmement courte \[[@CIT0001]\]. Cette insuffisance de rotation est le plus souvent associée à un défaut d\'accolement. Ces anomalies de rotation intestinale peuvent aboutir à des complications redoutables parfois mortelles, qui surviennent généralement au cours de la période néonatale où à l'âge pédiatrique. Le fait que cette pathologie soit exceptionnelle à l'âge adulte et que sa symptomatologie soit assez variée est source de beaucoup d\'erreurs et de retard diagnostique et thérapeutique au point que la majorité des cas sont diagnostiquer en post-mortem. Les causes de sa révélation tardive sont encore inconnues. La complication la plus redoutable est le volvulus total du grêle, elle survient lorsque le type de l\'anomalie de rotation est le mésentère commun incomplet à 180° \[[@CIT0002]\].
Patient et observation {#S0002}
======================
Nous rapportons l\'observation d\'un adolescent de 18 ans sans antécédent pathologique connu admis dans notre formation dans un tableau de syndrome occlusif, la symptomatologie évoluait depuis plus de 24 heures avant son admission et était faite de douleur abdominale d\'intensité rapidement progressive avec des vomissements initialement alimentaire puis bilieux, le tout évoluant dans un contexte d\'apyrexie et d\'altération de l'état général. L\'examen à son admission trouvait un patient en état de choc: pression artérielle à 80mmHg/30mmHg; une fréquence cardiaque à 135 battements/min; polypneique à 35 cycles/minutes; hypotherme à 36°c; somnolence avec un GCS à 12. Par ailleurs l\'examen abdominal trouvait un abdomen distendu, tympanique avec contracture généralisée. Après mis en condition en déchoquage (Monitorage, oxygénothérapie au masque à haute concentration, prise d\'une voie veineuse centrale fémorale droite, mis en place d\'une sonde gastrique et vésicale)à noter qu\'il était anurique et avait une stase gastrique importante;il a bénéficié d\'un remplissage vasculaire par du sérum salé physiologique 20cc/kg en 30 minutes et devant la non réponse au remplissage vasculaire, mis sous Noradrénaline à 0.3mcg/kg/min et réalisation en parallèle d\'un bilan biologique et radiologique. Le bilan Biologique trouvait une Hyperleucocytose à 24 000 éléments/mm3 à prédominance PNN avec une fonction rénale correcte, la CRP était à 135 mg/l. L'échographie abdominale était non concluante à part un écran gazeux énorme qui gênait l\'examen d\'où la réalisation d\'une TDM abdominale C- /C+ qui trouvait une image en tourbillon intéressant la première anse jéjunal, l\'artère mésentérique supérieure et la veine mésentérique superieure,avec le coecum accolé en sous hépatique et les anses grélique à droite ([Figure 1](#F0001){ref-type="fig"}, [Figure 2](#F0002){ref-type="fig"}, [Figure 3](#F0003){ref-type="fig"}) le diagnostic d\'occlusion sur mésentère commun incomplet était posé et le patient fut admis d\'urgence au bloc Opératoire sous couverture antibiotique à base de ceftriaxone et de métronidazole. L\'exploration trouvait tout le grêle ainsi que le colon ascendant et transverse souffrant ([Figure 4](#F0004){ref-type="fig"}, [Figure 5](#F0005){ref-type="fig"}) le geste a consisté à une devolvulation (recoloration partielle du grêle), cure de l\'anomalie de rotation selon la procédure de LADD et réalisation d\'une colectomie subtotale droite emportant le grêle nécrosé ([Figure 6](#F0006){ref-type="fig"}) et confection de stomies (bout distal grélique à droite et bout colique à gauche). Le résultat per-opératoire était satisfaisant (recoloration partielle des anses ([Figure 7](#F0007){ref-type="fig"}). Le patient a été extubé en réanimation après stabilité hémodynamique. L'évolution était favorable (stomies normo colorées et viables), sevré de la Noradrénaline et transféré au service de chirurgie viscérale après 3 jours d\'hospitalisation en réanimation.
{#F0001}
{#F0002}
{#F0003}
{#F0004}
{#F0005}
{#F0006}
{#F0007}
Discussion {#S0003}
==========
On estime que la prévalence de ces malformations congénitales à l'âge adulte est de l\'ordre de 0,2% à 0,5% \[[@CIT0003], [@CIT0004]\], âge auquel elles demeurent très souvent asymptomatiques et donc non diagnostiquées. Chez ces patients asymptomatiques, le diagnostic peut être révélé au cours de crises d\'appendicite ectopique \[[@CIT0005]\] ou de manière fortuite au cours d\'un examen radiologique. Les complications des anomalies de rotation intestinales peuvent être aigues ou chroniques chez l\'adulte, les complications évolutives aigues comprennent les occlusions duodénales par bride ainsi que le volvulus total du grêle qui reste exceptionnel chez l\'adulte et dont le pronostic est redoutable. Les complications chroniques résultent des sténoses duodénales incomplètes ou de volvulus chroniques du grêle avec insuffisance artérielle mésentérique. Le diagnostic de volvulus total du grêle peut se faire dans des circonstances très variées:en urgence devant un tableau d\'occlusion intestinale aiguë, voire un état de choc \[[@CIT0006]\] pouvant conduire au décès, devant un tableau de douleurs abdominales répétées plus ou moins associées à des troubles du transit; plus rarement, au décours d\'une chirurgie laparoscopique, comme cela a été décrit après une cholécystectomie \[[@CIT0007]--[@CIT0011]\], une appendicectomie \[[@CIT0012], [@CIT0013]\] ou une chirurgie de l\'obésité.
L\'abdomen sans préparation (ASP) peut être extrêmement variable et ne montre aucun signe spécifique, cependant il est rarement normal et généralement interpréter comme « inhabituel » ou discordant. L'échographie doppler est souvent gênée par les gaz et n\'est pas toujours contributive au diagnostic, cependant sa sensibilité serait de 86,5%, sa spécificité de 74,7%, sa valeur prédictive positive de 42,1% et sa valeur prédictive négative de 96,3% \[[@CIT0014]\]. Enfin, selon certains auteurs \[[@CIT0015]\], l'échographie serait l\'examen de référence pour éliminer une AR, lorsque celle-ci montre la présence du troisième duodénum en arrière de l\'artère mésentérique supérieure. L\'examen de référence pour le diagnostic du volvulus total du grêle sur anomalie de rotation intestinale chez l\'adulte est la tomodensitométrie abdomino-pelvienne avec injection de produit de contraste \[[@CIT0016]--[@CIT0019]\], décrit par Fischer \[[@CIT0020]\] en 1981 sous le nom de whirl-like pattern, le signe du « tourbillon » semble être pathognomonique pour la majorité des auteurs. Il correspond à la vrille du mésentère visible en position médiane, en avant de l\'aorte et au niveau de l\'artère mésentérique supérieure, autour de laquelle viennent « s\'enrouler » la veine mésentérique supérieure et le jéjunum proximal. Le traitement du volvulus aigu du grêle sur malrotation intestinale est une urgence chirurgicale. La procédure de Ladd reste la référence \[[@CIT0002]\], aussi bien chez l\'adulte que chez l\'enfant. Elle consiste en une laparotomie médiane suivie d\'une réduction du volvulus par détorsion (dans un sens antihoraire le plus souvent), d\'une section des brides responsables du raccourcissement de la racine mésentérique, d\'une fixation de l\'intestin en mésentère commun complet pour éviter toute récidive et enfin d\'une appendicectomie de principe. L'évolution est alors généralement favorable, à condition que le diagnostic et la prise en charge thérapeutique aient été effectués rapidement.
Conclusion {#S0004}
==========
Complication redoutable et exceptionnelle à l'âge adulte. La lourde mortalité du au retard diagnostique impose la connaissance de ces anomalies de rotations ainsi que les complications qu\'elles peuvent engendrées à chaque praticien. La symptomatologie clinique étant non spécifique, la réalisation d\'examen radiologique ne doit accusée d\'aucun retard. Le pronostic du volvulus total du grêle est celui du syndrome occlusif, de la pullulation microbienne qu\'il occasionne et dépend fortement du délai de prise en charge et du terrain.
Conflits d\'intérêts {#S0005}
====================
Les auteurs ne déclarent aucun conflit d''intérêts.
Contributions des auteurs {#S0006}
=========================
Tous les auteurs ont lu et approuvé la version finale de ce manuscrit.
|
{
"pile_set_name": "PubMed Central"
}
|
DE 10 2004 030 115 A1 describes a transmission for a motor vehicle, in which multiple planetary gear sets are provided between an input shaft and an output shaft, each of which is composed of one sun gear, one ring gear, and one planet spider. Furthermore, multiple shift elements are provided, via the selective actuation of which the planetary gear sets can be coupled to each other in order to define different gears between the input shaft and the output shaft. In all, seven forward gears can be selected between the input shaft and the output shaft in this case.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Infection Prevention Practices in Japan, Thailand, and the United States: Results From National Surveys.
Numerous evidence-based practices for preventing device-associated infections are available, yet the extent to which these practices are regularly used in acute care hospitals across different countries has not been compared, to our knowledge. Data from hospital surveys conducted in Japan, the United States, and Thailand in 2012, 2013, and 2014, respectively, were evaluated to determine the use of recommended practices to prevent central line-associated bloodstream infection (CLABSI), ventilator-associated pneumonia (VAP), and catheter-associated urinary tract infection (CAUTI). The outcomes were the percentage of hospitals reporting regular use (a score of 4 or 5 on a scale from 1 [never use] to 5 [always use]) of each practice across countries and identified hospital characteristics associated with the use of selected practices in each country. Survey response rates were 71% in Japan and the United States and 87% in Thailand. A majority of hospitals in Japan (76.6%), Thailand (63.2%), and the United States (97.8%) used maximum barrier precautions for preventing CLABSI and semirecumbent positioning to prevent VAP (66.2% for Japan, 86.7% for Thailand, and 98.7% for the United States). Nearly all hospitals (>90%) in Thailand and the United States reported monitoring CLABSI, VAP, and CAUTI rates, whereas in Japan only CLABSI rates were monitored by a majority of hospitals. Regular use of CAUTI prevention practices was variable across the 3 countries, with only a few practices adopted by >50% of hospitals. A majority of hospitals in Japan, Thailand, and the United States have adopted certain practices to prevent CLABSI and VAP. Opportunities for targeting prevention activities and reducing device-associated infection risk in hospitals exist across all 3 countries.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Write a Review
My Firefly Friend
They only come out at night, those dancing, flitting pinpoints of light. And there are children all over the world, glass jar in one hand, lid with holes in the other, leaping and jumping as they try to capture these lights for their very own. What are they – fairies? Nope, they’re fireflies!
What child hasn’t tried to catch a jarful of fireflies to light up her room? That warm yellow glow attracts our attention as they dip and sway under trees and around bushes, and some even seem to be attracted back to us as they hover near our heads, seeming to say, "Here I am, catch me if you can!"
In My Firefly Friend, one little girl has a special firefly who visits her every night, glowing just outside her window as she is tucked into her bed ready to sleep. Although she wants very much to catch him with her jar, she also appreciates his beauty as he flits freely through the night, returning to visit when he knows she is waiting for him.
About the Author: A teacher in San Antonio, Texas, Ms. Lott makes her home with her husband, Wendell, and three daughters, Charmaine, Courtney, and Kia. (
|
{
"pile_set_name": "Pile-CC"
}
|
Produced by Adrian Mastronardi, tallforasmurf and the
Online Distributed Proofreading Team at http://www.pgdp.net
(This file was produced from images generously made
available by The Internet Archive/American Libraries.)
TRANSCRIBER'S NOTE
In this etext, the oe ligature is shown as [oe].
While proofing and formatting this document the Project Gutenberg team
noted and corrected 23 typographical errors, for example "Beauieu" for
"Beaulieu". All were deemed trivial and their correction had no effect
on the sense of the text.
ILLUSTRATIONS
OF
UNIVERSAL PROGRESS;
A Series of Discussions.
BY
HERBERT SPENCER,
AUTHOR OF
"THE PRINCIPLES OF PSYCHOLOGY," "SOCIAL STATICS,"
"ESSAYS, MORAL, POLITICAL AND AESTHETIC," "EDUCATION,"
"FIRST PRINCIPLES," ETC., ETC., ETC.
WITH
_A NOTICE OF SPENCER'S "NEW SYSTEM OF PHILOSOPHY."_
NEW YORK:
D. APPLETON AND COMPANY,
443 & 445 BROADWAY.
1865.
WORKS BY THE SAME AUTHOR.
PUBLISHED BY D. APPLETON & CO.
_EDUCATION--INTELLECTUAL, MORAL, AND PHYSICAL._ 1 vol., 12mo. Cloth,
$1.25.
_A NEW SYSTEM OF PHILOSOPHY._ Vol. I. _FIRST PRINCIPLES._ Large 12mo.
503 pages. Cloth $2.00.
_PRINCIPLES OF BIOLOGY._ In Quarterly Parts, by Subscription. $2.00
per year.
NOW IN PRESS:
_ESSAYS--MORAL, POLITICAL, AND AESTHETIC._ 1 vol., large 12mo. Cloth.
_Copies sent by mail, postpaid, on receipt of price._
ENTERED, according to Act of Congress, in the year 1864, by
D. APPLETON AND COMPANY,
In the Clerk's Office of the District Court of the United States for the
Southern District of New York.
AMERICAN NOTICE
OF A
NEW SYSTEM OF PHILOSOPHY.
BY
HERBERT SPENCER.
The author of the following work, Mr. Herbert Spencer, of England, has
entered upon the publication of a new philosophical system, so original and
comprehensive as to deserve the attention of all earnest inquirers. He
proposes nothing less than to unfold such a complete philosophy of Nature,
physical, organic, mental and social, as Science has now for the first time
made possible, and which, if successfully executed, will constitute a
momentous step in the progress of thought.
His system is designed to embrace five works; each a distinct treatise, but
all closely connected in plan, and treating of the following subjects in
the order presented: 1st, First Principles; 2d, Principles of Biology; 3d,
Principles of Psychology; 4th, Principles of Sociology; 5th, Principles of
Morality. The opening work of the series--_First Principles_--though
somewhat of an introductory character, is an independent and completed
argument. It consists of two parts: first, "The Unknowable," and second,
"The Laws of the Knowable." Unattractive as these titles may seem, they
indicate a discussion of great originality and transcendent interest.
When public consideration is invited to a system of philosophy so extended
as to comprehend the entire scheme of nature and humanity, and so bold as
to deal with them in the ripest spirit of science, it is natural that many
should ask at the outset how the author stands related to the problem of
Religion. Mr. Spencer finds this the preliminary question of his
philosophy, and engages with it at the threshold of his undertaking. Before
attempting to work out a philosophical scheme, he sees that it is at first
necessary to find how far Philosophy can go and where she must stop--the
necessary limits of human knowledge, or the circle which bounds all
rational and legitimate investigation; and this opens at once the profound
and imminent question of the spheres and relation of Religion and Science.
Mr. Spencer is a leading representative of that school of thinkers which
holds that, as man is finite, he can grasp and know only the finite;--that
by the inexorable conditions of thought all real knowledge is relative and
phenomenal, and hence that we cannot go behind phenomena to find the
ultimate causes and solve the ultimate mystery of being. In such assertions
as that "God cannot by any searching be found out;" that "a God understood
would be no God at all;" and that "to think God _is_ as we think Him to be
is blasphemy," we see the recognition of this idea of the inscrutableness
of the Absolute Cause. The doctrine itself is neither new nor limited to a
few exceptional thinkers. It is widely affirmed by enlightened science, and
pervades nearly all the cultivated theology of the present day. Sir William
Hamilton and Dr. Mansel are among its recent and ablest expounders. "With
the exception," says Sir William Hamilton, "of a few late absolutist
theorizers in Germany, this is perhaps the truth of all others most
harmoniously reechoed by every philosopher of every school;" and among
these he names Protagoras, Aristotle, St. Augustine, Melanchthon, Scaliger,
Bacon, Spinoza, Newton, and Kant.
But though Mr. Spencer accepts this doctrine, he has not left it where he
found it. The world is indebted to him for having advanced the argument to
a higher and grander conclusion--a conclusion which changes the
philosophical aspect of the whole question, and involves the profoundest
consequences. Hamilton and Mansel bring us, by their inexorable logic, to
the result that we can neither know nor conceive the Infinite, and that
every attempt to do so involves us in contradiction and absurdity; but
having reached this vast negation, their logic and philosophy break down.
Accepting their conclusions as far as they go, Mr. Spencer maintains the
utter incompleteness of their reasoning, and, pushing the inquiry still
farther, he demonstrates that though we cannot grasp the Infinite in
_thought_, we can realize it in _consciousness_. He shows that though by
the laws of thinking we are rigorously prevented from forming a
_conception_ of that Incomprehensible, Omnipotent Power by which we are
acted upon in all phenomena, yet we are, by the laws of thought, equally
prevented from ridding ourselves of the _consciousness_ of this Power. He
proves that this consciousness of a Supreme Cause is not _negative_, but
_positive_--that it is indestructible, and has a higher certainty than any
other belief whatever. The Unknowable, then, in the view of Mr. Spencer, is
not a mere term of negation, nor a word employed only to express our
ignorance, but it means that Infinite Reality, that Supreme but Inscrutable
Cause, of which the universe is but a manifestation, and which has an
ever-present disclosure in human consciousness.
Having thus found an indestructible basis in human nature for the religious
sentiment, Mr. Spencer next shows that all religions rest upon this
foundation, and contain a fundamental verity--a soul of truth, which
remains when their conflicting doctrines and discordant peculiarities are
mutually cancelled. In the lower and grosser forms of religion this truth
is but dimly discerned, but becomes ever clearer the more highly the
religion is developed, surviving every change, and remaining untouched by
the severest criticism.
Mr. Spencer then proceeds to demonstrate that all science tends to
precisely the same great conclusion;--in all directions investigation leads
to insoluble mystery. Alike in the external and the internal worlds, the
man of science sees himself in the midst of perpetual changes of which he
can discover neither the beginning nor the end. If he looks inward, he
perceives that both ends of the thread of consciousness are beyond his
grasp. If he resolve the appearances, properties, and movements of
surrounding things into manifestations of Force in Space and Time, he still
finds that Force, Space, and Time pass all understanding. Thus do all lines
of argument converge to the same conclusion. Whether we scrutinize internal
consciousness or external phenomena, or trace to their root the faiths of
mankind, we reach that common ground where all antagonisms disappear--that
highest and most abstract of all truths, which is affirmed with equal
certainty by both religion and science, and in which may be found their
full and final reconciliation.
It is perhaps hardly just to Mr. Spencer to state his position upon this
grave subject without giving also the accompanying reasoning; but so
compressed and symmetrical is his argument that it cannot be put into
narrower compass without mutilation. To those interested in the advance of
thought in this direction, we may say that the discussion will be found
unsurpassed in nobleness of aim, eloquence of statement, philosophic
breadth, and depth and power of reasoning.
This portion of the work embraces five chapters, as follows: I. Religion
and Science; II. Ultimate Religious Ideas; III. Ultimate Scientific Ideas;
IV. The Relativity of all Knowledge; V. The Reconciliation.
The second and larger portion of _First Principles_ Mr. Spencer designates
"The Laws of the Knowable." By these he understands those fundamental and
universal principles reached by scientific investigation, which underlie
all phenomena, and are necessary to their explanation. Certain great laws
have been established which are found equally true in all departments of
nature, and these are made the foundation of his philosophy. The sublime
idea of the Unity of the Universe, to which science has long been tending,
Mr. Spencer has made peculiarly his own. Through the vast diversities of
nature he discerns a oneness of order and method, which necessitates but
one philosophy of being; the same principles being found to regulate the
course of celestial movement, terrestrial changes, and the phenomena of
life, mind, and society. These may all be comprehended in a single
philosophical scheme, so that each shall throw light upon the other, and
the mastery of one help to the comprehension of all.
To Mr. Spencer the one conception which spans the universe and solves the
widest range of its problems--which reaches outward through boundless space
and back through illimitable time, resolving the deepest questions of life,
mind, society, history, and civilization, which predicts the glorious
possibilities of the future, and reveals the august method by which the
Divine Power works evermore,--this one, all-elucidating conception, is
expressed by the term EVOLUTION. To this great subject he has devoted his
remarkable powers of thought for many years, and stands toward it not only
in the relation of an expositor, but also in that of a discoverer.
The fact that all living beings are developed from a minute structureless
germ has long been known, while the law which governs their evolution--that
the change is ever from the homogeneous to the heterogeneous--has been
arrived at within a generation. But this fact of growth is by no means
limited to the physical history of plants and animals--it is exemplified
upon a far more extended scale. Astronomers hold that the solar system has
gone through such a process, and Geologists teach that the earth has had
its career of evolution. Animals have a mental as well as a physical
development, and there is also a progress of knowledge, of religion, of the
arts and sciences, of institutions, manners, governments, and civilization
itself. Mr. Spencer has the honour of having first established the
universality of the principle by which all these changes are governed. The
law of evolution, which has been hitherto limited to plants and animals, he
demonstrates to be the law of _all_ evolution. This doctrine is unfolded in
the first Essay of the present volume, and is more or less fully
illustrated in the others; but it will be found elaborately worked out in
the second part of _First Principles_.
The course of the discussion in this part of the work will be best shown by
enumerating the titles to the chapters, which are as follows: I. Laws in
General; II. The Law of Evolution; III. The Same continued; IV. The Causes
of Evolution; V. Space, Time, Matter, Motion, and Force; VI. The
Indestructibility of Matter; VII. The Continuity of Motion; VIII. The
Persistence of Force; IX. The Correlation and Equivalence of Forces; X. The
Direction of Motion; XI. The Rhythm of Motion; XII. The Conditions
Essential to Evolution; XIII. The Instability of the Homogeneous; XIV. The
Multiplication of Effects; XV. Differentiation and Integration; XVI.
Equilibration; XVII. Summary and Conclusion.
A most interesting and fruitful field of thought, it will be seen, is here
traversed by our author, and the latest and highest questions of science
are discussed under novel aspects and in new relations. Not only do the
pages abound with acute suggestions and fresh views, but the entire
argument, in its leading demonstrations, and the full breadth of its
philosophic scope, is stamped with a high originality.
* * * * *
Having thus determined the sphere of philosophy and ascertained those
fundamental principles governing all orders of phenomena which are to be
subsequently used for guidance and verification, the author proceeds to the
second work of the series, which is devoted to Biology, or the Science of
Life. He regards life not as a foreign and unintelligible something, thrust
into the scheme of nature, of which we can know nothing save its mystery,
but as an essential part of the universal plan. The harmonies of life are
regarded as but phases of the universal harmony, and Biology is studied by
the same methods as other departments of science. The great truths of
Physics and Chemistry are applied to its elucidation; its facts are
collected, its inductions established, and constantly verified by the first
principles laid down at the outset. Apart from its connections with the
philosophical system, of which it forms a part, this work will have great
intrinsic interest. Nothing was more needed than a compact and
well-digested statement of those general principles of life to which
science has arrived, and Mr. Spencer's presentation is proving to be just
what is required. Some idea of his mode of treating the subject may be
formed by glancing over a few of his first chapter-headings. PART FIRST: I.
Organic Matter; II. The Actions of Forces on Organic Matter; III. The
Reactions of Organic Matter on Forces; IV. Proximate Definition of Life; V.
The Correspondence between Life and its Circumstances; VI. The Degree of
Life Varies with the Degree of Correspondence; VII. Inductions of Biology.
PART SECOND: I. Growth; II. Development; III. Function; IV. Waste and
Repair; V. Adaptation; VI. Individuality; VII. Genesis; VIII. Heredity; IX.
Variation; X. Genesis, Heredity and Variation; XI. Classification; XII.
Distribution.
* * * * *
In the scheme of nature Mind is ever associated with Life. The third
division of this philosophical system will therefore be Psychology, or the
Science of Mind. This great subject will be considered, not by the narrow
methods usual with metaphysicians, but in its broadest aspects as a phase
of nature's order--to be studied by observation and induction through the
whole range of psychical manifestation in animated beings. The subject of
mind will be regarded in the light of the great truths of Biology
previously established; the connections of mind and life will be traced;
the progress of mentality as exhibited in the animal grades, and the
evolution of the intellectual faculties in man will be delineated and the
cooperation of mind and nature in the production of ideas and intelligence
unfolded. We have no work upon mind of this comprehensive and thoroughly
scientific character: the materials are abundant, and the necessity of
their organization is widely recognized. That Mr. Spencer is eminently the
man to perform this great task is proved by the fact that he is already the
author of the most profound and able contribution to the advancement of
psychological science that has appeared for many years.
* * * * *
In the true philosophic order, Biology and Psychology prepare the way for
the study of social science, and hence the fourth part of Mr. Spencer's
system will treat of Sociology, or the natural laws of society. As a
knowledge of individuals must precede an understanding of their mutual
relations, so an exposition of the laws of life and mind, which constitute
the science of human nature, must precede the successful study of social
phenomena. In this part will be considered the development of society, or
that intellectual and moral progress which depends upon the growth of human
ideas and feelings in their necessary order. The evolution of political,
ecclesiastical, and industrial organizations will be traced, and a
statement made of those principles underlying all social progress, without
which there can be no successful regulation of the affairs of society. Mr.
Spencer's mind has long been occupied with these important questions, as
the reader will find by referring to his able work upon "Social Statics,"
published several years ago.
* * * * *
Lastly, in Part Fifth, Mr. Spencer proposes to consider the _Principles of
Morality_, bringing to bear the truths furnished by Biology, Psychology,
and Sociology, to determine the true theory of right living. He will show
that the true moral ideal and limit of progress is the attainment of an
equilibrium between constitution and conditions of existence, and trace
those principles of private conduct, physical, intellectual, moral, and
religious that follow from the conditions to complete individual life.
Those rules of human action which all civilized nations have registered as
essential laws--the inductions of morality--will be delineated, and also
those mutual limitations of men's actions necessitated by their coexistence
as units of society, which constitute the foundation of justice.
* * * * *
It cannot be doubted that the order here indicated, as it corresponds to
the method of nature, is the one which Philosophy must pursue in the
future. It combines the precision of science with the harmony and unity of
universal truth. The time is past when Biology can be considered with no
reference to the laws of Physics; Mind with no reference to the science of
Life, and Sociology, without having previously mastered the foregoing
subjects. The progress of knowledge is now toward more definite,
systematic, and comprehensive views, while it is the highest function of
intellect to coordinate and bind together its isolated and fragmentary
parts. In carrying out his great plan, therefore, Mr. Spencer is but
embodying the large philosophical tendencies of the age.
If it is urged that his scheme is too vast for any one man to accomplish,
it may be replied: 1st. That it is not intended to treat the various
subjects exhaustively, but only to state general principles with just
sufficient details for their clear illustration. 2d. A considerable portion
of the work is already issued, and much more is ready for publication,
while the author is still in the prime of life. 3d. It must be remembered
that intellects occasionally appear, endowed with that comprehensive grasp
and high organizing power which fits them for vast undertakings. The reader
will find at the close of the volume Mr. Spencer's Prospectus of his
system. That he who has so clearly mapped out his work is the proper one to
execute it, we think will be fully apparent to all who peruse the present
volume.
An impression prevails with many that Mr. Spencer belongs to the positive
school of M. Auguste Comte. This is an entire misapprehension; but the
position having been assumed by several of his reviewers, he repels the
charge in the following letter, which appeared in the _New Englander_ for
January, 1864.
_To the Editor of the New Englander_:
SIR:--While recognizing the appreciative tone and general candour of
the article in your last number, entitled "Herbert Spencer on Ultimate
Religious Ideas," allow me to point out one error which pervades it.
The writer correctly represents the leading positions of my argument,
but he inadvertently conveys a wrong impression respecting my
tendencies and sympathies. He says of me, "the spirit of his philosophy
is evidently that of the so-called positive method which has now many
partial disciples, as well as many zealous adherents among the thinkers
of England." Further on I am tacitly classed with "the English admirers
and disciples of the great Positivist;" and it is presently added that
"in Mr. Spencer we have an example of a positivist, who does not treat
the subject of religion with supercilious neglect." Here and
throughout, the implication is that I am a follower of Comte. This is a
mistake. That M. Comte has given a general exposition of the doctrine
and method elaborated by science, and has applied to it a name which
has obtained a certain currency, is true. But it is not true that the
holders of this doctrine and followers of this method are disciples of
M. Comte. Neither their modes of inquiry nor their views concerning
human knowledge in its nature and limits are appreciably different from
what they were before. If they are Positivists it is in the sense that
all men of science have been more or less consistently Positivists; and
the applicability of M. Comte's title to them no more makes them his
disciples than does its applicability to the men of science who lived
and died before M. Comte wrote, make them his disciples.
My own attitude toward M. Comte and his partial adherents has been all
along that of antagonism. In an essay on the "Genesis of Science,"
published in 1854, and republished with other essays in 1857, I have
endeavoured to show that his theory of the logical dependence and
historical development of the sciences is untrue. I have still among my
papers the memoranda of a second review (for which I failed to obtain a
place), the purpose of which was to show the untenableness of his
theory of intellectual progress. The only doctrine of importance in
which I agree with him--the relativity of all knowledge--is one common
to him and sundry other thinkers of earlier date; and even this I hold
in a different sense from that in which he held it. But on all points
that are distinctive of his philosophy, I differ from him. I deny his
Hierarchy of the Sciences. I regard his division of intellectual
progress into the three phases, theological, metaphysical, and
positive, as superficial. I reject utterly his Religion of Humanity.
And his ideal of society I hold in detestation. Some of his minor views
I accept; some of his incidental remarks seem to me to be profound, but
from everything which distinguishes Comteism as a system, I dissent
entirely. The only influence on my own course of thought which I can
trace to M. Comte's writings, is the influence that results from
meeting with antagonistic opinions definitely expressed.
Such being my position, you will, I think, see that by classing me as a
Positivist, and tacitly including me among the English admirers and
disciples of Comte, your reviewer unintentionally misrepresents me. I
am quite ready to bear the odium attaching to opinions which I do hold;
but I object to have added the odium attaching to opinions which I _do
not_ hold. If, by publishing this letter in your forthcoming number,
you will allow me to set myself right with the American public on this
matter, you will greatly oblige me. I am, Sir, your obedient servant,
HERBERT SPENCER.
We take the liberty of making an extract from a private letter of Mr.
Spencer, which contains some further observations in the same connection:
"There appears to have got abroad in the United States, a very
erroneous impression respecting the influence of Comte's writings in
England. I suppose that the currency obtained by the words 'Positivism'
and 'Positivist,' is to blame for this. Comte having designated by the
term Positive Philosophy all that body of definitely-established
knowledge which men of science have been gradually organizing into a
coherent body of doctrine, and having habitually placed this in
opposition to the incoherent body of doctrine defended by theologians,
it has become the habit of the theological party to think of the
antagonist scientific party under this title of Positivists applied to
them by Comte. And thus, from the habit of calling them Positivists
there has grown up the assumption that they call themselves
Positivists, and that they are the disciples of Comte. The truth is
that Comte and his doctrines receive here scarcely any attention. I
know something of the scientific world in England, and I cannot name a
single man of science who acknowledges himself a follower of Comte, or
accepts the title of Positivist. Lest, however, there should be some
such who were unknown to me, I have recently made inquiries into the
matter. To Professor Tyndall I put the question whether Comte had
exerted any appreciable influence on his own course of thought: and he
replied, 'So far as I know, my own course of thought would have been
exactly the same had Comte never existed.' I then asked, 'Do you know
any men of science whose views have been affected by Comte's writings?'
and his answer was: 'His influence on scientific thought in England is
absolutely _nil_.' To the same questions Prof. Huxley returned, in
other words, the same answers. Professors Huxley and Tyndall, being
leaders in their respective departments, and being also men of general
culture and philosophic insight, I think that, joining their
impressions with my own, I am justified in saying that the scientific
world of England is wholly uninfluenced by Comte. Such small influence
as he has had here has been on some literary men and historians--men
who were attracted by the grand achievements of science, who were
charmed by the plausible system of scientific generalizations put forth
by Comte, with the usual French regard for symmetry and disregard for
fact, and who were, from their want of scientific training, unable to
detect the essential fallaciousness of his system. Of these the most
notable example was the late Mr. Buckle. Besides him, I can name but
seven men who have been in any appreciable degree influenced by Comte;
and of these, four, if not five, are scarcely known to the public."
Mr. Spencer's philosophical series is published by D. Appleton & Co., New
York, in quarterly parts (80 to 100 pages each), by subscription, at two
dollars a year. "_First Principles_" is issued in one volume, and four
parts of Biology have appeared. We subjoin some notices of his philosophy
from American and English reviews.
_From the National Quarterly Review_ (American.)
Comte thus founded social science, and opened a path for future
discoverers; but he did not perceive, any more than previous inquirers,
the fundamental law of human evolution. It was reserved for Herbert
Spencer to discover this all-comprehensive law which is found to
explain alike all the phenomena of man's history and all those of
external nature. This sublime discovery, that the universe is in a
continuous process of evolution from the homogeneous to the
heterogeneous, with which only Newton's law of gravitation is at all
worthy to be compared, underlies not only physics, but also history. It
reveals the law to which social changes conform.
_From the Christian Examiner._
Reverent and bold--reverent for truth, though not for the forms of
truth, and not for much that we hold true--bold in the destruction of
error, though without that joy in destruction which often claims the
name of boldness;--these works are interesting in themselves and in
their relation to the current thought of the time. They seem at first
sight to form the turning point in the positive philosophy, but closer
examination shows us that it is only a new and marked stage in a
regular growth. It is the positive philosophy reaching the higher
relations of our being, and establishing what before it ignored because
it had not reached, and by ignoring seemed to deny. This system
formerly excluded theology and psychology. In the works of Herbert
Spencer we have the rudiments of a positive theology and an immense
step toward the perfection of the science of psychology.... Such is a
brief and meagre sketch of a discussion which we would commend to be
followed in detail by every mind interested in theological studies.
Herbert Spencer comes in good faith from what has been so long a
hostile camp, bringing a flag of truce and presenting terms of
agreement meant to be honourable to both parties: let us give him a
candid hearing.... In conclusion, we would remark that the work of
Herbert Spencer referred to (First Principles) is not mainly
theological, but will present the latest and broadest generalizations
of science, and we would commend to our readers this author, too little
known among us, as at once one of the clearest of teachers and one of
the wisest and most honourable of opponents.
_From the New Englander._
Though we find here some unwarranted assumptions, as well as some grave
omissions, yet this part (Laws of the Knowable) may be considered, upon
the whole, as a fine specimen of scientific reasoning. Considerable
space is devoted to the "Law of Evolution" the discovery of which is
the author's chief claim to originality, and certainly evinces great
power of generalization. To quote the abstract definition without a
full statement of the inductions from which it is derived would convey
no fair impression of the breadth and strength of the thought which it
epitomizes. Of Mr. Spencer's general characteristics as a writer, we
may observe that his style is marked by great purity, clearness, and
force; though it is somewhat diffuse, and the abstract nature of some
of his topics occasionally renders his thought difficult of
apprehension. His treatment of his subjects is generally thorough and
sometimes exhaustive; his arguments are always ingenious if not always
convincing; his illustrations are drawn from almost every accessible
field of human knowledge, and his method of "putting things" is such as
to make the most of his materials. He is undoubtedly entitled to a high
rank among the speculative and philosophic writers of the present
day....
In Mr. Spencer we have the example of a positivist, who does not treat
the subject of religion with supercilious neglect, and who illustrates
by his own method of reasoning upon the highest objects of human
thought, the value of those metaphysical studies which it is so much
the fashion of his school to decry. For both these reasons the volume,
which we now propose to examine, deserves the careful attention of the
theologian who desires to know what one of the strongest thinkers of
his school, commonly thought atheistic in its tendencies, can say in
behalf of our ultimate religious ideas. For if we mistake not, in spite
of the very negative character of his own results, he has furnished
some strong arguments for the doctrine of a positive Christian
theology. We shall be mistaken if we expect to find him carelessly
passing these matters by (religious faith and theological science) as
in all respects beyond knowledge and of no practical concern. On the
contrary, he gives them profound attention, and arrives at conclusions
in regard to them which even the Christian theologian must allow to
contain a large measure of truth. While showing the _unsearchable
nature_ of the ultimate facts on which religion depends, he
demonstrates their _real existence_ and their great importance.... In
answering these questions Mr. Spencer has, we think, arrived nearer to
a true philosophy than either Hamilton or Mansel. At least he has
indicated in a more satisfactory manner than they have done, the
positive datum of consciousness that the unconditioned, though
inscrutable, _exists_. It may be said that Mr. Spencer is not
chargeable with excluding God from the universe, or denying all
revelation of Him in His works, since he earnestly defends the truth
that an inscrutable power is shown to _exist_. We certainly would not
charge him with theoretical atheism, holding as he does this ultimate
religious idea.
_From the North American Review._
The law of organic development announced in the early part of the
present century, by Goethe, Schelling, and Von Baer, and vaguely
expressed in the formula, that "evolution is always from the homogenous
to the heterogeneous, and from the simple to the complex," has recently
been extended by Herbert Spencer so as to include all phenomena
whatsoever. He has shown that this law of evolution is the law of _all_
evolution. Whether it be in the development of the earth or of life
upon its surface, in the development of Society, of government, of
manufactures, of commerce, of language, literature, science and art,
this same advance from the simple to the complex, through successive
differentiations, holds uniformly. The stupendous induction from all
classes of phenomena by which Mr. Spencer proceeds to establish and
illustrate his theorem cannot be given here.
_From the Christian Spectator_ (_English_).
Mr. Spencer claims for his view that it is not only a religious
position, but preeminently _the_ religious position; and we are most
thoroughly disposed to agree with him, though we think he does not
appreciate the force of his own argument, nor fully understand his own
words. For let us now attempt to realize the meaning of this fact, of
which Mr. Spencer and his compeers have put us in possession; let us
endeavour to see whether its bearings are really favorable or adverse
to religion. They are put forward indeed avowedly as adverse to any
other religion than a mere reverential acquiescence in ignorance
concerning all that truly exists; but it appears to us that this
supposed opposition to religion arises from the fact that the doctrine
itself is so profoundly, so intensely, so overwhelmingly religious,
nay, so utterly and entirely CHRISTIAN, that its true meaning could not
be seen for very glory. Like Moses, when he came down from the Mount,
this positive philosophy comes with a veil over its face, that its too
divine radiance may be hidden for a time. This is Science that has been
conversing with GOD, and brings in her hand His law written on tables
of stone.
_From the Reader._
To answer the question of the likelihood of the permanence of Mr.
Mill's philosophic reign, ... we should have to take account, among
other things, of the differences from Mr. Mill already shown by the
extraordinarily able and peculiarly original thinker whose name we have
associated with Mr. Mill's at the head of this article. We may take
occasion, at another time, to call attention to these speculations of
Mr. Herbert Spencer, whose works in the meantime, and especially that
new one whose title we have cited, we recommend to all those select
readers whose appreciation of masterly exposition, and great reach and
boldness of generalization, does not depend on their mere disposition
to agree with the doctrines propounded.
_From the British Quarterly Review._
Complete in itself, it is at the same time but a part of a whole,
which, if it should be constructed in proportion, will be ten times as
great. For these First Principles are merely the foundation of a system
of philosophy, bolder, more elaborate and comprehensive, perhaps, than
any other which has been hitherto designed in England.... Widely as it
will be seen we differ from the author on some points, we very
sincerely hope he may succeed in accomplishing the bold and magnificent
project he has mapped out.
_From the Cornhill Magazine._
Our "Survey," superficial as it is, must include at least the mention
of a work so lofty in aim, and so remarkable in execution as the system
of Philosophy which Mr. Herbert Spencer is issuing to subscribers....
In spite of all dissidence respecting the conclusions, the serious
reader will applaud the profound earnestness and thoroughness with
which these conclusions are advocated; the universal scientific
knowledge brought to bear on them by way of illustration, and the acute
and subtle thinking displayed in every chapter.
_From the Parthenon._
By these books he has wedged his way into fame in a manner distinctly
original, and curiously marked.... There is a peculiar charm in this
author's style, in that it sacrifices to no common taste, while at the
same time it makes the most abstruse questions intelligible.... The
book, if it is to be noticed with the slightest degree of fairness,
requires to be read and re-read, to be studied apart from itself and
with itself. For whatever may be its ultimate fate--although as the
ages go on it shall become but as the lispings of a little child, a
little more educated than other lisping children of the same time--this
is certain, that, as a book addressed to the present, it lifts the mind
far above the ordinary range of thought, suggests new associations,
arranges chaotic pictures, strikes often a broad harmony, and even
moves the heart by an intellectual struggle as passionless as fate, but
as irresistible as time.
_From the Critic._
Mr. Spencer is the foremost mind of the only philosophical school in
England which has arrived at a consistent scheme... Beyond this school
we encounter an indolent chaotic eclecticism. Mr. Spencer claims the
respect due to distinct and daring individuality; others are echoes or
slaves. Mr. Spencer may be a usurper, but he has the voice and gesture
of a king.
_From the Medico-Chirurgical Review._
Mr. Spencer is equally remarkable for his search after first
principles; for his acute attempts to decompose mental phenomena into
their primary elements; and for his broad generalizations of mental
activity, viewed in connection with nature, instinct, and all the
analogies presented by _life_ in its universal aspects.
EDITOR'S PREFACE.
The essays contained in the present volume were first published in the
English periodicals--chiefly the Quarterly Reviews. They contain ideas of
permanent interest, and display an amount of thought and labor evidently
much greater than is usually bestowed on review articles. They were written
with a view to ultimate republication in an enduring form, and were issued
in London with several other papers, under the title of "Essays;
Scientific, Political, and Speculative," first and second series;--the
former appearing in 1857, and the latter in 1863.
The interest created in Mr. Spencer's writings by the publication in this
country of his valuable work on "Education," and by criticisms of his other
works, has created a demand for these discussions which can only be
supplied by their republication. They are now, however, issued in a new
form, and are more suited to develop the author's purpose in their
preparation; for while each of these essays has its intrinsic and
independent claims upon the reader's attention, they are all at the same
time but parts of a connected and comprehensive argument. Nearly all of Mr.
Spencer's essays have relations more or less direct to the general doctrine
of Evolution--a doctrine which he has probably done more to unfold and
illustrate than any other thinker. The papers comprised in the present
volume are those which deal with the subject in its most obvious and
prominent aspects.
Although the argument contained in the first essay on "Progress; its Law
and Cause," has been published in an amplified form in the author's "First
Principles," it has been thought best to prefix it to the present
collection as a key to the full interpretation of the other essays.
To those who read this volume its commendation will be superfluous; we will
only say that those who become interested in his course of thought will
find it completely elaborated in his new System of Philosophy, now in
course of publication.
The remaining articles of Mr. Spencer's first and second series will be
shortly published, in a volume entitled "Essays; Moral, Political, and
AEsthetic."
NEW YORK, _March_, 1864.
CONTENTS.
PAGE
I. Progress: Its Law and Cause, 1
II. Manners and Fashion, 61
III. The Genesis of Science, 116
IV. The Physiology of Laughter, 194
V. The Origin and Function of Music, 210
VI. The Nebular Hypothesis, 239
VII. Bain on the Emotions and the Will, 300
VIII. Illogical Geology, 325
IX. The Development Hypothesis, 377
X. The Social Organism, 384
XI. Use and Beauty, 429
XII. The Sources of Architectural Types, 434
XIII. The Use of Anthropomorphism, 440
I. PROGRESS: ITS LAW AND CAUSE.
The current conception of Progress is somewhat shifting and indefinite.
Sometimes it comprehends little more than simple growth--as of a nation in
the number of its members and the extent of territory over which it has
spread. Sometimes it has reference to quantity of material products--as
when the advance of agriculture and manufactures is the topic. Sometimes
the superior quality of these products is contemplated: and sometimes the
new or improved appliances by which they are produced. When, again, we
speak of moral or intellectual progress, we refer to the state of the
individual or people exhibiting it; while, when the progress of Knowledge,
of Science, of Art, is commented upon, we have in view certain abstract
results of human thought and action. Not only, however, is the current
conception of Progress more or less vague, but it is in great measure
erroneous. It takes in not so much the reality of Progress as its
accompaniments--not so much the substance as the shadow. That progress in
intelligence seen during the growth of the child into the man, or the
savage into the philosopher, is commonly regarded as consisting in the
greater number of facts known and laws understood: whereas the actual
progress consists in those internal modifications of which this increased
knowledge is the expression. Social progress is supposed to consist in the
produce of a greater quantity and variety of the articles required for
satisfying men's wants; in the increasing security of person and property;
in widening freedom of action: whereas, rightly understood, social progress
consists in those changes of structure in the social organism which have
entailed these consequences. The current conception is a teleological one.
The phenomena are contemplated solely as bearing on human happiness. Only
those changes are held to constitute progress which directly or indirectly
tend to heighten human happiness. And they are thought to constitute
progress simply _because_ they tend to heighten human happiness. But
rightly to understand progress, we must inquire what is the nature of these
changes, considered apart from our interests. Ceasing, for example, to
regard the successive geological modifications that have taken place in the
Earth, as modifications that have gradually fitted it for the habitation of
Man, and as _therefore_ a geological progress, we must seek to determine
the character common to these modifications--the law to which they all
conform. And similarly in every other case. Leaving out of sight
concomitants and beneficial consequences, let us ask what Progress is in
itself.
In respect to that progress which individual organisms display in the
course of their evolution, this question has been answered by the Germans.
The investigations of Wolff, Goethe, and Von Baer, have established the
truth that the series of changes gone through during the development of a
seed into a tree, or an ovum into an animal, constitute an advance from
homogeneity of structure to heterogeneity of structure. In its primary
stage, every germ consists of a substance that is uniform throughout, both
in texture and chemical composition. The first step is the appearance of a
difference between two parts of this substance; or, as the phenomenon is
called in physiological language, a differentiation. Each of these
differentiated divisions presently begins itself to exhibit some contrast
of parts; and by and by these secondary differentiations become as definite
as the original one. This process is continuously repeated--is
simultaneously going on in all parts of the growing embryo; and by endless
such differentiations there is finally produced that complex combination of
tissues and organs constituting the adult animal or plant. This is the
history of all organisms whatever. It is settled beyond dispute that
organic progress consists in a change from the homogeneous to the
heterogeneous.
Now, we propose in the first place to show, that this law of organic
progress is the law of all progress. Whether it be in the development of
the Earth, in the development of Life upon its surface, in the development
of Society, of Government, of Manufactures, of Commerce, of Language,
Literature, Science, Art, this same evolution of the simple into the
complex, through successive differentiations, holds throughout. From the
earliest traceable cosmical changes down to the latest results of
civilization, we shall find that the transformation of the homogeneous into
the heterogeneous, is that in which Progress essentially consists.
With the view of showing that _if_ the Nebular Hypothesis be true, the
genesis of the solar system supplies one illustration of this law, let us
assume that the matter of which the sun and planets consist was once in a
diffused form; and that from the gravitation of its atoms there resulted a
gradual concentration. By the hypothesis, the solar system in its nascent
state existed as an indefinitely extended and nearly homogeneous medium--a
medium almost homogeneous in density, in temperature, and in other physical
attributes. The first advance towards consolidation resulted in a
differentiation between the occupied space which the nebulous mass still
filled, and the unoccupied space which it previously filled. There
simultaneously resulted a contrast in density and a contrast in
temperature, between the interior and the exterior of this mass. And at the
same time there arose throughout it rotatory movements, whose velocities
varied according to their distances from its centre. These differentiations
increased in number and degree until there was evolved the organized group
of sun, planets, and satellites, which we now know--a group which presents
numerous contrasts of structure and action among its members. There are the
immense contrasts between the sun and planets, in bulk and in weight; as
well as the subordinate contrasts between one planet and another, and
between the planets and their satellites. There is the similarly marked
contrast between the sun as almost stationary, and the planets as moving
round him with great velocity; while there are the secondary contrasts
between the velocities and periods of the several planets, and between
their simple revolutions and the double ones of their satellites, which
have to move round their primaries while moving round the sun. There is the
yet further strong contrast between the sun and the planets in respect of
temperature; and there is reason to suppose that the planets and satellites
differ from each other in their proper heat, as well as in the heat they
receive from the sun.
When we bear in mind that, in addition to these various contrasts, the
planets and satellites also differ in respect to their distances from each
other and their primary; in respect to the inclinations of their orbits,
the inclinations of their axes, their times of rotation on their axes,
their specific gravities, and their physical constitutions; we see what a
high degree of heterogeneity the solar system exhibits, when compared with
the almost complete homogeneity of the nebulous mass out of which it is
supposed to have originated.
Passing from this hypothetical illustration, which must be taken for what
it is worth, without prejudice to the general argument, let us descend to a
more certain order of evidence. It is now generally agreed among geologists
that the Earth was at first a mass of molten matter; and that it is still
fluid and incandescent at the distance of a few miles beneath its surface.
Originally, then, it was homogeneous in consistence, and, in virtue of the
circulation that takes place in heated fluids, must have been comparatively
homogeneous in temperature; and it must have been surrounded by an
atmosphere consisting partly of the elements of air and water, and partly
of those various other elements which assume a gaseous form at high
temperatures. That slow cooling by radiation which is still going on at an
inappreciable rate, and which, though originally far more rapid than now,
necessarily required an immense time to produce any decided change, must
ultimately have resulted in the solidification of the portion most able to
part with its heat--namely, the surface. In the thin crust thus formed we
have the first marked differentiation. A still further cooling, a
consequent thickening of this crust, and an accompanying deposition of all
solidifiable elements contained in the atmosphere, must finally have been
followed by the condensation of the water previously existing as vapour. A
second marked differentiation must thus have arisen: and as the
condensation must have taken place on the coolest parts of the
surface--namely, about the poles--there must thus have resulted the first
geographical distinction of parts. To these illustrations of growing
heterogeneity, which, though deduced from the known laws of matter, may be
regarded as more or less hypothetical, Geology adds an extensive series
that have been inductively established. Its investigations show that the
Earth has been continually becoming more heterogeneous in virtue of the
multiplication of the strata which form its crust; further, that it has
been becoming more heterogeneous in respect of the composition of these
strata, the latter of which, being made from the detritus of the older
ones, are many of them rendered highly complex by the mixture of materials
they contain; and that this heterogeneity has been vastly increased by the
action of the Earth's still molten nucleus upon its envelope, whence have
resulted not only a great variety of igneous rocks, but the tilting up of
sedimentary strata at all angles, the formation of faults and metallic
veins, the production of endless dislocations and irregularities. Yet
again, geologists teach us that the Earth's surface has been growing more
varied in elevation--that the most ancient mountain systems are the
smallest, and the Andes and Himalayas the most modern; while in all
probability there have been corresponding changes in the bed of the ocean.
As a consequence of these ceaseless differentiations, we now find that no
considerable portion of the Earth's exposed surface is like any other
portion, either in contour, in geologic structure, or in chemical
composition; and that in most parts it changes from mile to mile in all
these characteristics.
Moreover, it must not be forgotten that there has been simultaneously going
on a gradual differentiation of climates. As fast as the Earth cooled and
its crust solidified, there arose appreciable differences in temperature
between those parts of its surface most exposed to the sun and those less
exposed. Gradually, as the cooling progressed, these differences became
more pronounced; until there finally resulted those marked contrasts
between regions of perpetual ice and snow, regions where winter and summer
alternately reign for periods varying according to the latitude, and
regions where summer follows summer with scarcely an appreciable variation.
At the same time the successive elevations and subsidences of different
portions of the Earth's crust, tending as they have done to the present
irregular distribution of land and sea, have entailed various modifications
of climate beyond those dependent on latitude; while a yet further series
of such modifications have been produced by increasing differences of
elevation in the land, which have in sundry places brought arctic,
temperate, and tropical climates to within a few miles of each other. And
the general result of these changes is, that not only has every extensive
region its own meteorologic conditions, but that every locality in each
region differs more or less from others in those conditions, as in its
structure, its contour, its soil. Thus, between our existing Earth, the
phenomena of whose varied crust neither geographers, geologists,
mineralogists, nor meteorologists have yet enumerated, and the molten globe
out of which it was evolved, the contrast in heterogeneity is sufficiently
striking.
When from the Earth itself we turn to the plants and animals that have
lived, or still live, upon its surface, we find ourselves in some
difficulty from lack of facts. That every existing organism has been
developed out of the simple into the complex, is indeed the first
established truth of all; and that every organism that has existed was
similarly developed, is an inference which no physiologist will hesitate to
draw. But when we pass from individual forms of life to Life in general,
and inquire whether the same law is seen in the _ensemble_ of its
manifestations,--whether modern plants and animals are of more
heterogeneous structure than ancient ones, and whether the Earth's present
Flora and Fauna are more heterogeneous than the Flora and Fauna of the
past,--we find the evidence so fragmentary, that every conclusion is open
to dispute. Two-thirds of the Earth's surface being covered by water; a
great part of the exposed land being inaccessible to, or untravelled by,
the geologist; the greater part of the remainder having been scarcely more
than glanced at; and even the most familiar portions, as England, having
been so imperfectly explored that a new series of strata has been added
within these four years,--it is manifestly impossible for us to say with
any certainty what creatures have, and what have not, existed at any
particular period. Considering the perishable nature of many of the lower
organic forms, the metamorphosis of many sedimentary strata, and the gaps
that occur among the rest, we shall see further reason for distrusting our
deductions. On the one hand, the repeated discovery of vertebrate remains
in strata previously supposed to contain none,--of reptiles where only fish
were thought to exist,--of mammals where it was believed there were no
creatures higher than reptiles,--renders it daily more manifest how small
is the value of negative evidence.
On the other hand, the worthlessness of the assumption that we have
discovered the earliest, or anything like the earliest, organic remains, is
becoming equally clear. That the oldest known sedimentary rocks have been
greatly changed by igneous action, and that still older ones have been
totally transformed by it, is becoming undeniable. And the fact that
sedimentary strata earlier than any we know, have been melted up, being
admitted, it must also be admitted that we cannot say how far back in time
this destruction of sedimentary strata has been going on. Thus it is
manifest that the title, _Palaeozoic_, as applied to the earliest known
fossiliferous strata, involves a _petitio principii_; and that, for aught
we know to the contrary, only the last few chapters of the Earth's
biological history may have come down to us. On neither side, therefore, is
the evidence conclusive. Nevertheless we cannot but think that, scanty as
they are, the facts, taken altogether, tend to show both that the more
heterogeneous organisms have been evolved in the later geologic periods,
and that Life in general has been more heterogeneously manifested as time
has advanced. Let us cite, in illustration, the one case of the
_vertebrata_. The earliest known vertebrate remains are those of Fishes;
and Fishes are the most homogeneous of the vertebrata. Later and more
heterogeneous are Reptiles. Later still, and more heterogeneous still, are
Mammals and Birds. If it be said, as it may fairly be said, that the
Palaeozoic deposits, not being estuary deposits, are not likely to contain
the remains of terrestrial vertebrata, which may nevertheless have existed
at that era, we reply that we are merely pointing to the leading facts,
_such as they are_.
But to avoid any such criticism, let us take the mammalian subdivision
only. The earliest known remains of mammals are those of small marsupials,
which are the lowest of the mammalian type; while, conversely, the highest
of the mammalian type--Man--is the most recent. The evidence that the
vertebrate fauna, as a whole, has become more heterogeneous, is
considerably stronger. To the argument that the vertebrate fauna of the
Palaeozoic period, consisting, so far as we know, entirely of Fishes, was
less heterogeneous than the modern vertebrate fauna, which includes
Reptiles, Birds, and Mammals, of multitudinous genera, it may be replied,
as before, that estuary deposits of the Palaeozoic period, could we find
them, might contain other orders of vertebrata. But no such reply can be
made to the argument that whereas the marine vertebrata of the Palaeozoic
period consisted entirely of cartilaginous fishes, the marine vertebrata of
later periods include numerous genera of osseous fishes; and that,
therefore, the later marine vertebrate faunas are more heterogeneous than
the oldest known one. Nor, again, can any such reply be made to the fact
that there are far more numerous orders and genera of mammalian remains in
the tertiary formations than in the secondary formations. Did we wish
merely to make out the best case, we might dwell upon the opinion of Dr.
Carpenter, who says that "the general facts of Palaeontology appear to
sanction the belief, that _the same plan_ may be traced out in what may be
called _the general life of the globe_, as in _the individual life_ of
every one of the forms of organized being which now people it." Or we might
quote, as decisive, the judgment of Professor Owen, who holds that the
earlier examples of each group of creatures severally departed less widely
from archetypal generality than the later ones--were severally less unlike
the fundamental form common to the group as a whole; that is to
say--constituted a less heterogeneous group of creatures; and who further
upholds the doctrine of a biological progression. But in deference to an
authority for whom we have the highest respect, who considers that the
evidence at present obtained does not justify a verdict either way, we are
content to leave the question open.
Whether an advance from the homogeneous to the heterogeneous is or is not
displayed in the biological history of the globe, it is clearly enough
displayed in the progress of the latest and most heterogeneous
creature--Man. It is alike true that, during the period in which the Earth
has been peopled, the human organism has grown more heterogeneous among the
civilized divisions of the species; and that the species, as a whole, has
been growing more heterogeneous in virtue of the multiplication of races
and the differentiation of these races from each other.
In proof of the first of these positions, we may cite the fact that, in the
relative development of the limbs, the civilized man departs more widely
from the general type of the placental mammalia than do the lower human
races. While often possessing well-developed body and arms, the Papuan has
extremely small legs: thus reminding us of the quadrumana, in which there
is no great contrast in size between the hind and fore limbs. But in the
European, the greater length and massiveness of the legs has become very
marked--the fore and hind limbs are relatively more heterogeneous. Again,
the greater ratio which the cranial bones bear to the facial bones
illustrates the same truth. Among the vertebrata in general, progress is
marked by an increasing heterogeneity in the vertebral column, and more
especially in the vertebrae constituting the skull: the higher forms being
distinguished by the relatively larger size of the bones which cover the
brain, and the relatively smaller size of those which form the jaw, &c.
Now, this characteristic, which is stronger in Man than in any other
creature, is stronger in the European than in the savage. Moreover, judging
from the greater extent and variety of faculty he exhibits, we may infer
that the civilized man has also a more complex or heterogeneous nervous
system than the uncivilized man: and indeed the fact is in part visible in
the increased ratio which his cerebrum bears to the subjacent ganglia.
If further elucidation be needed, we may find it in every nursery. The
infant European has sundry marked points of resemblance to the lower human
races; as in the flatness of the alae of the nose, the depression of its
bridge, the divergence and forward opening of the nostrils, the form of the
lips, the absence of a frontal sinus, the width between the eyes, the
smallness of the legs. Now, as the developmental process by which these
traits are turned into those of the adult European, is a continuation of
that change from the homogeneous to the heterogeneous displayed during the
previous evolution of the embryo, which every physiologist will admit; it
follows that the parallel developmental process by which the like traits of
the barbarous races have been turned into those of the civilized races, has
also been a continuation of the change from the homogeneous to the
heterogeneous. The truth of the second position--that Mankind, as a whole,
have become more heterogeneous--is so obvious as scarcely to need
illustration. Every work on Ethnology, by its divisions and subdivisions of
races, bears testimony to it. Even were we to admit the hypothesis that
Mankind originated from several separate stocks, it would still remain
true, that as, from each of these stocks, there have sprung many now widely
different tribes, which are proved by philological evidence to have had a
common origin, the race as a whole is far less homogeneous than it once
was. Add to which, that we have, in the Anglo-Americans, an example of a
new variety arising within these few generations; and that, if we may trust
to the description of observers, we are likely soon to have another such
example in Australia.
On passing from Humanity under its individual form, to Humanity as socially
embodied, we find the general law still more variously exemplified. The
change from the homogeneous to the heterogeneous is displayed equally in
the progress of civilization as a whole, and in the progress of every tribe
or nation; and is still going on with increasing rapidity. As we see in
existing barbarous tribes, society in its first and lowest form is a
homogeneous aggregation of individuals having like powers and like
functions: the only marked difference of function being that which
accompanies difference of sex. Every man is warrior, hunter, fisherman,
tool-maker, builder; every woman performs the same drudgeries; every family
is self-sufficing, and save for purposes of aggression and defence, might
as well live apart from the rest. Very early, however, in the process of
social evolution, we find an incipient differentiation between the
governing and the governed. Some kind of chieftainship seems coeval with
the first advance from the state of separate wandering families to that of
a nomadic tribe. The authority of the strongest makes itself felt among a
body of savages as in a herd of animals, or a posse of schoolboys. At
first, however, it is indefinite, uncertain; is shared by others of
scarcely inferior power; and is unaccompanied by any difference in
occupation or style of living: the first ruler kills his own game, makes
his own weapons, builds his own hut, and economically considered, does not
differ from others of his tribe. Gradually, as the tribe progresses, the
contrast between the governing and the governed grows more decided. Supreme
power becomes hereditary in one family; the head of that family, ceasing to
provide for his own wants, is served by others; and he begins to assume the
sole office of ruling.
At the same time there has been arising a co-ordinate species of
government--that of Religion. As all ancient records and traditions prove,
the earliest rulers are regarded as divine personages. The maxims and
commands they uttered during their lives are held sacred after their
deaths, and are enforced by their divinely-descended successors; who in
their turns are promoted to the pantheon of the race, there to be
worshipped and propitiated along with their predecessors: the most ancient
of whom is the supreme god, and the rest subordinate gods. For a long time
these connate forms of government--civil and religious--continue closely
associated. For many generations the king continues to be the chief priest,
and the priesthood to be members of the royal race. For many ages religious
law continues to contain more or less of civil regulation, and civil law to
possess more or less of religious sanction; and even among the most
advanced nations these two controlling agencies are by no means completely
differentiated from each other.
Having a common root with these, and gradually diverging from them, we find
yet another controlling agency--that of Manners or ceremonial usages. All
titles of honour are originally the names of the god-king; afterwards of
God and the king; still later of persons of high rank; and finally come,
some of them, to be used between man and man. All forms of complimentary
address were at first the expressions of submission from prisoners to their
conqueror, or from subjects to their ruler, either human or
divine--expressions that were afterwards used to propitiate subordinate
authorities, and slowly descended into ordinary intercourse. All modes of
salutation were once obeisances made before the monarch and used in worship
of him after his death. Presently others of the god-descended race were
similarly saluted; and by degrees some of the salutations have become the
due of all.[A] Thus, no sooner does the originally homogeneous social mass
differentiate into the governed and the governing parts, than this last
exhibits an incipient differentiation into religious and secular--Church
and State; while at the same time there begins to be differentiated from
both, that less definite species of government which rules our daily
intercourse--a species of government which, as we may see in heralds'
colleges, in books of the peerage, in masters of ceremonies, is not without
a certain embodiment of its own. Each of these is itself subject to
successive differentiations. In the course of ages, there arises, as among
ourselves, a highly complex political organization of monarch, ministers,
lords and commons, with their subordinate administrative departments,
courts of justice, revenue offices, &c., supplemented in the provinces by
municipal governments, county governments, parish or union governments--all
of them more or less elaborated. By its side there grows up a highly
complex religious organization, with its various grades of officials, from
archbishops down to sextons, its colleges, convocations, ecclesiastical
courts, &c.; to all which must be added the ever multiplying independent
sects, each with its general and local authorities. And at the same time
there is developed a highly complex aggregation of customs, manners, and
temporary fashions, enforced by society at large, and serving to control
those minor transactions between man and man which are not regulated by
civil and religious law. Moreover it is to be observed that this ever
increasing heterogeneity in the governmental appliances of each nation, has
been accompanied by an increasing heterogeneity in the governmental
appliances of different nations; all of which are more or less unlike in
their political systems and legislation, in their creeds and religious
institutions, in their customs and ceremonial usages.
[A] For detailed proof of these assertions see essay on _Manners and
Fashion_.
Simultaneously there has been going on a second differentiation of a more
familiar kind; that, namely, by which the mass of the community has been
segregated into distinct classes and orders of workers. While the governing
part has undergone the complex development above detailed, the governed
part has undergone an equally complex development, which has resulted in
that minute division of labour characterizing advanced nations. It is
needless to trace out this progress from its first stages, up through the
caste divisions of the East and the incorporated guilds of Europe, to the
elaborate producing and distributing organization existing among ourselves.
Political economists have long since described the evolution which,
beginning with a tribe whose members severally perform the same actions
each for himself, ends with a civilized community whose members severally
perform different actions for each other; and they have further pointed out
the changes through which the solitary producer of any one commodity is
transformed into a combination of producers who, united under a master,
take separate parts in the manufacture of such commodity. But there are yet
other and higher phases of this advance from the homogeneous to the
heterogeneous in the industrial organization of society.
Long after considerable progress has been made in the division of labour
among different classes of workers, there is still little or no division of
labour among the widely separated parts of the community; the nation
continues comparatively homogeneous in the respect that in each district
the same occupations are pursued. But when roads and other means of transit
become numerous and good, the different districts begin to assume different
functions, and to become mutually dependent. The calico manufacture locates
itself in this county, the woollen-cloth manufacture in that; silks are
produced here, lace there; stockings in one place, shoes in another;
pottery, hardware, cutlery, come to have their special towns; and
ultimately every locality becomes more or less distinguished from the rest
by the leading occupation carried on in it. Nay, more, this subdivision of
functions shows itself not only among the different parts of the same
nation, but among different nations. That exchange of commodities which
free-trade promises so greatly to increase, will ultimately have the effect
of specializing, in a greater or less degree, the industry of each people.
So that beginning with a barbarous tribe, almost if not quite homogeneous
in the functions of its members, the progress has been, and still is,
towards an economic aggregation of the whole human race; growing ever more
heterogeneous in respect of the separate functions assumed by separate
nations, the separate functions assumed by the local sections of each
nation, the separate functions assumed by the many kinds of makers and
traders in each town, and the separate functions assumed by the workers
united in producing each commodity.
Not only is the law thus clearly exemplified in the evolution of the social
organism, but it is exemplified with equal clearness in the evolution of
all products of human thought and action, whether concrete or abstract,
real or ideal. Let us take Language as our first illustration.
The lowest form of language is the exclamation, by which an entire idea is
vaguely conveyed through a single sound; as among the lower animals. That
human language ever consisted solely of exclamations, and so was strictly
homogeneous in respect of its parts of speech, we have no evidence. But
that language can be traced down to a form in which nouns and verbs are its
only elements, is an established fact. In the gradual multiplication of
parts of speech out of these primary ones--in the differentiation of verbs
into active and passive, of nouns into abstract and concrete--in the rise
of distinctions of mood, tense, person, of number and case--in the
formation of auxiliary verbs, of adjectives, adverbs, pronouns,
prepositions, articles--in the divergence of those orders, genera, species,
and varieties of parts of speech by which civilized races express minute
modifications of meaning--we see a change from the homogeneous to the
heterogeneous. And it may be remarked, in passing, that it is more
especially in virtue of having carried this subdivision of function to a
greater extent and completeness, that the English language is superior to
all others.
Another aspect under which we may trace the development of language is the
differentiation of words of allied meanings. Philology early disclosed the
truth that in all languages words may be grouped into families having a
common ancestry. An aboriginal name applied indiscriminately to each of an
extensive and ill-defined class of things or actions, presently undergoes
modifications by which the chief divisions of the class are expressed.
These several names springing from the primitive root, themselves become
the parents of other names still further modified. And by the aid of those
systematic modes which presently arise, of making derivations and forming
compound terms expressing still smaller distinctions, there is finally
developed a tribe of words so heterogeneous in sound and meaning, that to
the uninitiated it seems incredible that they should have had a common
origin. Meanwhile from other roots there are being evolved other such
tribes, until there results a language of some sixty thousand or more
unlike words, signifying as many unlike objects, qualities, acts.
Yet another way in which language in general advances from the homogeneous
to the heterogeneous, is in the multiplication of languages. Whether as Max
Mueller and Bunsen think, all languages have grown from one stock, or
whether, as some philologists say, they have grown from two or more stocks,
it is clear that since large families of languages, as the Indo-European,
are of one parentage, they have become distinct through a process of
continuous divergence. The same diffusion over the Earth's surface which
has led to the differentiation of the race, has simultaneously led to a
differentiation of their speech: a truth which we see further illustrated
in each nation by the peculiarities of dialect found in several districts.
Thus the progress of Language conforms to the general law, alike in the
evolution of languages, in the evolution of families of words, and in the
evolution of parts of speech.
On passing from spoken to written language, we come upon several classes of
facts, all having similar implications. Written language is connate with
Painting and Sculpture; and at first all three are appendages of
Architecture, and have a direct connection with the primary form of all
Government--the theocratic. Merely noting by the way the fact that sundry
wild races, as for example the Australians and the tribes of South Africa,
are given to depicting personages and events upon the walls of caves, which
are probably regarded as sacred places, let us pass to the case of the
Egyptians. Among them, as also among the Assyrians, we find mural paintings
used to decorate the temple of the god and the palace of the king (which
were, indeed, originally identical); and as such they were governmental
appliances in the same sense that state-pageants and religious feasts were.
Further, they were governmental appliances in virtue of representing the
worship of the god, the triumphs of the god-king, the submission of his
subjects, and the punishment of the rebellious. And yet again they were
governmental, as being the products of an art reverenced by the people as a
sacred mystery. From the habitual use of this pictorial representation
there naturally grew up the but slightly-modified practice of
picture-writing--a practice which was found still extant among the Mexicans
at the time they were discovered. By abbreviations analogous to those still
going on in our own written and spoken language, the most familiar of these
pictured figures were successively simplified; and ultimately there grew up
a system of symbols, most of which had but a distant resemblance to the
things for which they stood. The inference that the hieroglyphics of the
Egyptians were thus produced, is confirmed by the fact that the
picture-writing of the Mexicans was found to have given birth to a like
family of ideographic forms; and, among them, as among the Egyptians, these
had been partially differentiated into the _kuriological_ or imitative, and
the _tropical_ or symbolic: which were, however, used together in the same
record. In Egypt, written language underwent a further differentiation:
whence resulted the _hieratic_ and the _epistolographic_ or _enchorial_:
both of which are derived from the original hieroglyphic. At the same time
we find that for the expression of proper names which could not be
otherwise conveyed, phonetic symbols were employed; and though it is
alleged that the Egyptians never actually achieved complete alphabetic
writing, yet it can scarcely be doubted that these phonetic symbols
occasionally used in aid of their ideographic ones, were the germs out of
which alphabetic writing grew. Once having become separate from
hieroglyphics, alphabetic writing itself underwent numerous
differentiations--multiplied alphabets were produced; between most of
which, however, more or less connection can still be traced. And in each
civilized nation there has now grown up, for the representation of one set
of sounds, several sets of written signs used for distinct purposes.
Finally, through a yet more important differentiation came printing; which,
uniform in kind as it was at first, has since become multiform.
While written language was passing through its earlier stages of
development, the mural decoration which formed its root was being
differentiated into Painting and Sculpture. The gods, kings, men, and
animals represented, were originally marked by indented outlines and
. In most cases these outlines were of such depth, and the object
they circumscribed so far rounded and marked out in its leading parts, as
to form a species of work intermediate between intaglio and bas-relief. In
other cases we see an advance upon this: the raised spaces between the
figures being chiselled off, and the figures themselves appropriately
tinted, a painted bas-relief was produced. The restored Assyrian
architecture at Sydenham exhibits this style of art carried to greater
perfection--the persons and things represented, though still barbarously
, are carved out with more truth and in greater detail: and in the
winged lions and bulls used for the angles of gateways, we may see a
considerable advance towards a completely sculptured figure; which,
nevertheless, is still , and still forms part of the building. But
while in Assyria the production of a statue proper seems to have been
little, if at all, attempted, we may trace in Egyptian art the gradual
separation of the sculptured figure from the wall. A walk through the
collection in the British Museum will clearly show this; while it will at
the same time afford an opportunity of observing the evident traces which
the independent statues bear of their derivation from bas-relief: seeing
that nearly all of them not only display that union of the limbs with the
body which is the characteristic of bas-relief, but have the back of the
statue united from head to foot with a block which stands in place of the
original wall. Greece repeated the leading stages of this progress. As in
Egypt and Assyria, these twin arts were at first united with each other and
with their parent, Architecture, and were the aids of Religion and
Government. On the friezes of Greek temples, we see bas-reliefs
representing sacrifices, battles, processions, games--all in some sort
religious. On the pediments we see painted sculptures more or less united
with the tympanum, and having for subjects the triumphs of gods or heroes.
Even when we come to statues that are definitely separated from the
buildings to which they pertain, we still find them ; and only in
the later periods of Greek civilization does the differentiation of
sculpture from painting appear to have become complete.
In Christian art we may clearly trace a parallel re-genesis. All early
paintings and sculptures throughout Europe were religious in
subject--represented Christs, crucifixions, virgins, holy families,
apostles, saints. They formed integral parts of church architecture, and
were among the means of exciting worship; as in Roman Catholic countries
they still are. Moreover, the early sculptures of Christ on the cross, of
virgins, of saints, were : and it needs but to call to mind the
painted madonnas and crucifixes still abundant in continental churches and
highways, to perceive the significant fact that painting and sculpture
continue in closest connection with each other where they continue in
closest connection with their parent. Even when Christian sculpture was
pretty clearly differentiated from painting, it was still religious and
governmental in its subjects--was used for tombs in churches and statues of
kings: while, at the same time, painting, where not purely ecclesiastical,
was applied to the decoration of palaces, and besides representing royal
personages, was almost wholly devoted to sacred legends. Only in quite
recent times have painting and sculpture become entirely secular arts. Only
within these few centuries has painting been divided into historical,
landscape, marine, architectural, genre, animal, still-life, &c., and
sculpture grown heterogeneous in respect of the variety of real and ideal
subjects with which it occupies itself.
Strange as it seems then, we find it no less true, that all forms of
written language, of painting, and of sculpture, have a common root in the
politico-religious decorations of ancient temples and palaces. Little
resemblance as they now have, the bust that stands on the console, the
landscape that hangs against the wall, and the copy of the _Times_ lying
upon the table, are remotely akin; not only in nature, but by extraction.
The brazen face of the knocker which the postman has just lifted, is
related not only to the woodcuts of the _Illustrated London News_ which he
is delivering, but to the characters of the _billet-doux_ which accompanies
it. Between the painted window, the prayer-book on which its light falls,
and the adjacent monument, there is consanguinity. The effigies on our
coins, the signs over shops, the figures that fill every ledger, the coats
of arms outside the carriage panel, and the placards inside the omnibus,
are, in common with dolls, blue-books, paper-hangings, lineally descended
from the rude sculpture-paintings in which the Egyptians represented the
triumphs and worship of their god-kings. Perhaps no example can be given
which more vividly illustrates the multiplicity and heterogeneity of the
products that in course of time may arise by successive differentiations
from a common stock.
Before passing to other classes of facts, it should be observed that the
evolution of the homogeneous into the heterogeneous is displayed not only
in the separation of Painting and Sculpture from Architecture and from each
other, and in the greater variety of subjects they embody, but it is
further shown in the structure of each work. A modern picture or statue is
of far more heterogeneous nature than an ancient one. An Egyptian
sculpture-fresco represents all its figures as on one plane--that is, at
the same distance from the eye; and so is less heterogeneous than a
painting that represents them as at various distances from the eye. It
exhibits all objects as exposed to the same degree of light; and so is less
heterogeneous than a painting which exhibits different objects and
different parts of each object as in different degrees of light. It uses
scarcely any but the primary colours, and these in their full intensity;
and so is less heterogeneous than a painting which, introducing the primary
colours but sparingly, employs an endless variety of intermediate tints,
each of heterogeneous composition, and differing from the rest not only in
quality but in intensity. Moreover, we see in these earliest works a great
uniformity of conception. The same arrangement of figures is perpetually
reproduced--the same actions, attitudes, faces, dresses. In Egypt the modes
of representation were so fixed that it was sacrilege to introduce a
novelty; and indeed it could have been only in consequence of a fixed mode
of representation that a system of hieroglyphics became possible. The
Assyrian bas-reliefs display parallel characters. Deities, kings,
attendants, winged figures and animals, are severally depicted in like
positions, holding like implements, doing like things, and with like
expression or non-expression of face. If a palm-grove is introduced, all
the trees are of the same height, have the same number of leaves, and are
equidistant. When water is imitated, each wave is a counterpart of the
rest; and the fish, almost always of one kind, are evenly distributed over
the surface. The beards of the kings, the gods, and the winged figures, are
everywhere similar: as are the manes of the lions, and equally so those of
the horses. Hair is represented throughout by one form of curl. The king's
beard is quite architecturally built up of compound tiers of uniform curls,
alternating with twisted tiers placed in a transverse direction, and
arranged with perfect regularity; and the terminal tufts of the bulls'
tails are represented in exactly the same manner. Without tracing out
analogous facts in early Christian art, in which, though less striking,
they are still visible, the advance in heterogeneity will be sufficiently
manifest on remembering that in the pictures of our own day the composition
is endlessly varied; the attitudes, faces, expressions, unlike; the
subordinate objects different in size, form, position, texture; and more or
less of contrast even in the smallest details. Or, if we compare an
Egyptian statue, seated bolt upright on a block, with hands on knees,
fingers outspread and parallel, eyes looking straight forward, and the two
sides perfectly symmetrical in every particular, with a statue of the
advanced Greek or the modern school, which is asymmetrical in respect of
the position of the head, the body, the limbs, the arrangement of the hair,
dress, appendages, and in its relations to neighbouring objects, we shall
see the change from the homogeneous to the heterogeneous clearly
manifested.
In the co-ordinate origin and gradual differentiation of Poetry, Music and
Dancing, we have another series of illustrations. Rhythm in speech, rhythm
in sound, and rhythm in motion, were in the beginning parts of the same
thing, and have only in process of time become separate things. Among
various existing barbarous tribes we find them still united. The dances of
savages are accompanied by some kind of monotonous chant, the clapping of
hands, the striking of rude instruments: there are measured movements,
measured words, and measured tones; and the whole ceremony, usually having
reference to war or sacrifice, is of governmental character. In the early
records of the historic races we similarly find these three forms of
metrical action united in religious festivals. In the Hebrew writings we
read that the triumphal ode composed by Moses on the defeat of the
Egyptians, was sung to an accompaniment of dancing and timbrels. The
Israelites danced and sang "at the inauguration of the golden calf. And as
it is generally agreed that this representation of the Deity was borrowed
from the mysteries of Apis, it is probable that the dancing was copied from
that of the Egyptians on those occasions." There was an annual dance in
Shiloh on the sacred festival; and David danced before the ark. Again, in
Greece the like relation is everywhere seen: the original type being there,
as probably in other cases, a simultaneous chanting and mimetic
representation of the life and adventures of the god. The Spartan dances
were accompanied by hymns and songs; and in general the Greeks had "no
festivals or religious assemblies but what were accompanied with songs and
dances"--both of them being forms of worship used before altars. Among the
Romans, too, there were sacred dances: the Salian and Lupercalian being
named as of that kind. And even in Christian countries, as at Limoges, in
comparatively recent times, the people have danced in the choir in honour
of a saint. The incipient separation of these once united arts from each
other and from religion, was early visible in Greece. Probably diverging
from dances partly religious, partly warlike, as the Corybantian, came the
war dances proper, of which there were various kinds; and from these
resulted secular dances. Meanwhile Music and Poetry, though still united,
came to have an existence separate from dancing. The aboriginal Greek
poems, religious in subject, were not recited, but chanted; and though at
first the chant of the poet was accompanied by the dance of the chorus, it
ultimately grew into independence. Later still, when the poem had been
differentiated into epic and lyric--when it became the custom to sing the
lyric and recite the epic--poetry proper was born. As during the same
period musical instruments were being multiplied, we may presume that music
came to have an existence apart from words. And both of them were beginning
to assume other forms besides the religious. Facts, having like
implications might be cited from the histories of later times and peoples:
as the practices of our own early minstrels, who sang to the harp heroic
narratives versified by themselves to music of their own composition: thus
uniting the now separate offices of poet, composer, vocalist, and
instrumentalist. But, without further illustration, the common origin and
gradual differentiation of Dancing, Poetry, and Music will be sufficiently
manifest.
The advance from the homogeneous to the heterogeneous is displayed not only
in the separation of these arts from each other and from religion, but also
in the multiplied differentiations which each of them afterwards undergoes.
Not to dwell upon the numberless kinds of dancing that have, in course of
time, come into use; and not to occupy space in detailing the progress of
poetry, as seen in the development of the various forms of metre, of rhyme,
and of general organization; let us confine our attention to music as a
type of the group. As argued by Dr. Burney, and as implied by the customs
of still extant barbarous races, the first musical instruments were,
without doubt, percussive--sticks, calabashes, tom-toms--and were used
simply to mark the time of the dance; and in this constant repetition of
the same sound, we see music in its most homogeneous form.
The Egyptians had a lyre with three strings. The early lyre of the Greeks
had four, constituting their tetrachord. In course of some centuries lyres
of seven and eight strings were employed. And, by the expiration of a
thousand years, they had advanced to their "great system" of the double
octave. Through all which changes there of course arose a greater
heterogeneity of melody. Simultaneously there came into use the different
modes--Dorian, Ionian, Phrygian, AEolian, and Lydian--answering to our keys;
and of these there were ultimately fifteen. As yet, however, there was but
little heterogeneity in the time of their music.
Instrumental music during this period being merely the accompaniment of
vocal music, and vocal music being completely subordinated to words, the
singer being also the poet, chanting his own compositions and making the
lengths of his notes agree with the feet of his verses,--there unavoidably
arose a tiresome uniformity of measure, which, as Dr. Burney says, "no
resources of melody could disguise." Lacking the complex rhythm obtained by
our equal bars and unequal notes the only rhythm was that produced by the
quantity of the syllables and was of necessity comparatively monotonous.
And further, it may be observed that the chant thus resulting, being like
recitative, was much less clearly differentiated from ordinary speech than
is our modern song.
Nevertheless, in virtue of the extended range of notes in use, the variety
of modes, the occasional variations of time consequent on changes of metre,
and the multiplication of instruments, music had, towards the close of
Greek civilization, attained to considerable heterogeneity--not indeed as
compared with our music, but as compared with that which preceded it. As
yet, however, there existed nothing but melody: harmony was unknown. It was
not until Christian church-music had reached some development, that music
in parts was evolved; and then it came into existence through a very
unobtrusive differentiation. Difficult as it may be to conceive _a priori_
how the advance from melody to harmony could take place without a sudden
leap, it is none the less true that it did so. The circumstance which
prepared the way for it was the employment of two choirs singing
alternately the same air. Afterwards it became the practice--very possibly
first suggested by a mistake--for the second choir to commence before the
first had ceased; thus producing a fugue.
With the simple airs then in use, a partially harmonious fugue might not
improbably thus result: and a very partially harmonious fugue satisfied the
ears of that age, as we know from still preserved examples. The idea having
once been given, the composing of airs productive of fugal harmony would
naturally grow up; as in some way it _did_ grow up out of this alternate
choir-singing. And from the fugue to concerted music of two, three, four,
and more parts, the transition was easy. Without pointing out in detail the
increasing complexity that resulted from introducing notes of various
lengths, from the multiplication of keys, from the use of accidentals, from
varieties of time, and so forth, it needs but to contrast music as it is,
with music as it was, to see how immense is the increase of heterogeneity.
We see this if, looking at music in its _ensemble_, we enumerate its many
different genera and species--if we consider the divisions into vocal,
instrumental, and mixed; and their subdivisions into music for different
voices and different instruments--if we observe the many forms of sacred
music, from the simple hymn, the chant, the canon, motet, anthem, &c., up
to the oratorio; and the still more numerous forms of secular music, from
the ballad up to the serenata, from the instrumental solo up to the
symphony.
Again, the same truth is seen on comparing any one sample of aboriginal
music with a sample of modern music--even an ordinary song for the piano;
which we find to be relatively highly heterogeneous, not only in respect of
the varieties in the pitch and in the length of the notes, the number of
different notes sounding at the same instant in company with the voice, and
the variations of strength with which they are sounded and sung, but in
respect of the changes of key, the changes of time, the changes of _timbre_
of the voice, and the many other modifications of expression. While between
the old monotonous dance-chant and a grand opera of our own day, with its
endless orchestral complexities and vocal combinations, the contrast in
heterogeneity is so extreme that it seems scarcely credible that the one
should have been the ancestor of the other.
Were they needed, many further illustrations might be cited. Going back to
the early time when the deeds of the god-king, chanted and mimetically
represented in dances round his altar, were further narrated in
picture-writings on the walls of temples and palaces, and so constituted a
rude literature, we might trace the development of Literature through
phases in which, as in the Hebrew Scriptures, it presents in one work
theology, cosmogony, history, biography, civil law, ethics, poetry; through
other phases in which, as in the Iliad, the religious, martial, historical,
the epic, dramatic, and lyric elements are similarly commingled; down to
its present heterogeneous development, in which its divisions and
subdivisions are so numerous and varied as to defy complete classification.
Or we might trace out the evolution of Science; beginning with the era in
which it was not yet differentiated from Art, and was, in union with Art,
the handmaid of Religion; passing through the era in which the sciences
were so few and rudimentary, as to be simultaneously cultivated by the same
philosophers; and ending with the era in which the genera and species are
so numerous that few can enumerate them, and no one can adequately grasp
even one genus. Or we might do the like with Architecture, with the Drama,
with Dress.
But doubtless the reader is already weary of illustrations; and our promise
has been amply fulfilled. We believe we have shown beyond question, that
that which the German physiologists have found to be the law of organic
development, is the law of all development. The advance from the simple to
the complex, through a process of successive differentiations, is seen
alike in the earliest changes of the Universe to which we can reason our
way back; and in the earliest changes which we can inductively establish;
it is seen in the geologic and climatic evolution of the Earth, and of
every single organism on its surface; it is seen in the evolution of
Humanity, whether contemplated in the civilized individual, or in the
aggregation of races; it is seen in the evolution of Society in respect
alike of its political, its religious, and its economical organization; and
it is seen in the evolution of all those endless concrete and abstract
products of human activity which constitute the environment of our daily
life. From the remotest past which Science can fathom, up to the novelties
of yesterday, that in which Progress essentially consists, is the
transformation of the homogeneous into the heterogeneous.
* * * * *
And now, from this uniformity of procedure, may we not infer some
fundamental necessity whence it results? May we not rationally seek for
some all-pervading principle which determines this all-pervading process of
things? Does not the universality of the _law_ imply a universal _cause_?
That we can fathom such cause, noumenally considered, is not to be
supposed. To do this would be to solve that ultimate mystery which must
ever transcend human intelligence. But it still may be possible for us to
reduce the law of all Progress, above established, from the condition of an
empirical generalization, to the condition of a rational generalization.
Just as it was possible to interpret Kepler's laws as necessary
consequences of the law of gravitation; so it may be possible to interpret
this law of Progress, in its multiform manifestations, as the necessary
consequence of some similarly universal principle. As gravitation was
assignable as the _cause_ of each of the groups of phenomena which Kepler
formulated; so may some equally simple attribute of things be assignable as
the cause of each of the groups of phenomena formulated in the foregoing
pages. We may be able to affiliate all these varied and complex evolutions
of the homogeneous into the heterogeneous, upon certain simple facts of
immediate experience, which, in virtue of endless repetition, we regard as
necessary.
The probability of a common cause, and the possibility of formulating it,
being granted, it will be well, before going further, to consider what must
be the general characteristics of such cause, and in what direction we
ought to look for it. We can with certainty predict that it has a high
degree of generality; seeing that it is common to such infinitely varied
phenomena: just in proportion to the universality of its application must
be the abstractness of its character. We need not expect to see in it an
obvious solution of this or that form of Progress; because it equally
refers to forms of Progress bearing little apparent resemblance to them:
its association with multiform orders of facts, involves its dissociation
from any particular order of facts. Being that which determines Progress of
every kind--astronomic, geologic, organic, ethnologic, social, economic,
artistic, &c.--it must be concerned with some fundamental attribute
possessed in common by these; and must be expressible in terms of this
fundamental attribute. The only obvious respect in which all kinds of
Progress are alike, is, that they are modes of _change_; and hence, in some
characteristic of changes in general, the desired solution will probably be
found. We may suspect _a priori_ that in some law of change lies the
explanation of this universal transformation of the homogeneous into the
heterogeneous.
Thus much premised, we pass at once to the statement of the law, which is
this:--_Every active force produces more than one change--every cause
produces more than one effect._
Before this law can be duly comprehended, a few examples must be looked at.
When one body is struck against another, that which we usually regard as
the effect, is a change of position or motion in one or both bodies. But a
moment's thought shows us that this is a careless and very incomplete view
of the matter. Besides the visible mechanical result, sound is produced;
or, to speak accurately, a vibration in one or both bodies, and in the
surrounding air: and under some circumstances we call this the effect.
Moreover, the air has not only been made to vibrate, but has had sundry
currents caused in it by the transit of the bodies. Further, there is a
disarrangement of the particles of the two bodies in the neighbourhood of
their point of collision; amounting in some cases to a visible
condensation. Yet more, this condensation is accompanied by the
disengagement of heat. In some cases a spark--that is, light--results, from
the incandescence of a portion struck off; and sometimes this incandescence
is associated with chemical combination.
Thus, by the original mechanical force expended in the collision, at least
five, and often more, different kinds of changes have been produced. Take,
again, the lighting of a candle. Primarily this is a chemical change
consequent on a rise of temperature. The process of combination having once
been set going by extraneous heat, there is a continued formation of
carbonic acid, water, &c.--in itself a result more complex than the
extraneous heat that first caused it. But accompanying this process of
combination there is a production of heat; there is a production of light;
there is an ascending column of hot gases generated; there are currents
established in the surrounding air. Moreover, the decomposition of one
force into many forces does not end here: each of the several changes
produced becomes the parent of further changes. The carbonic acid given off
will by and by combine with some base; or under the influence of sunshine
give up its carbon to the leaf of a plant. The water will modify the
hygrometric state of the air around; or, if the current of hot gases
containing it come against a cold body, will be condensed: altering the
temperature, and perhaps the chemical state, of the surface it covers. The
heat given out melts the subjacent tallow, and expands whatever it warms.
The light, falling on various substances, calls forth from them reactions
by which it is modified; and so divers colours are produced. Similarly even
with these secondary actions, which may be traced out into ever-multiplying
ramifications, until they become too minute to be appreciated. And thus it
is with all changes whatever. No case can be named in which an active force
does not evolve forces of several kinds, and each of these, other groups of
forces. Universally the effect is more complex than the cause.
Doubtless the reader already foresees the course of our argument. This
multiplication of results, which is displayed in every event of to-day, has
been going on from the beginning; and is true of the grandest phenomena of
the universe as of the most insignificant. From the law that every active
force produces more than one change, it is an inevitable corollary that
through all time there has been an ever-growing complication of things.
Starting with the ultimate fact that every cause produces more than one
effect, we may readily see that throughout creation there must have gone
on, and must still go on, a never-ceasing transformation of the homogeneous
into the heterogeneous. But let us trace out this truth in detail.[B]
[B] A correlative truth which ought also to be taken into account
(that the state of homogeneity is one of unstable equilibrium),
but which it would greatly encumber the argument to exemplify in
connection with the above, will be found developed in the essay
on _Transcendental Physiology_.
Without committing ourselves to it as more than a speculation, though a
highly probable one, let us again commence with the evolution of the solar
system out of a nebulous medium.[C] From the mutual attraction of the atoms
of a diffused mass whose form is unsymmetrical, there results not only
condensation but rotation: gravitation simultaneously generates both the
centripetal and the centrifugal forces. While the condensation and the rate
of rotation are progressively increasing, the approach of the atoms
necessarily generates a progressively increasing temperature. As this
temperature rises, light begins to be evolved; and ultimately there results
a revolving sphere of fluid matter radiating intense heat and light--a sun.
[C] The idea that the Nebular Hypothesis has been disproved because
what were thought to be existing nebulae have been resolved into
clusters of stars is almost beneath notice. _A priori_ it was
highly improbable, if not impossible, that nebulous masses should
still remain uncondensed, while others have been condensed
millions of years ago.
There are good reasons for believing that, in consequence of the high
tangential velocity, and consequent centrifugal force, acquired by the
outer parts of the condensing nebulous mass, there must be a periodical
detachment of rotating rings; and that, from the breaking up of these
nebulous rings, there must arise masses which in the course of their
condensation repeat the actions of the parent mass, and so produce planets
and their satellites--an inference strongly supported by the still extant
rings of Saturn.
Should it hereafter be satisfactorily shown that planets and satellites
were thus generated, a striking illustration will be afforded of the highly
heterogeneous effects produced by the primary homogeneous cause; but it
will serve our present purpose to point to the fact that from the mutual
attraction of the particles of an irregular nebulous mass there result
condensation, rotation, heat, and light.
It follows as a corollary from the Nebular Hypothesis, that the Earth must
at first have been incandescent; and whether the Nebular Hypothesis be true
or not, this original incandescence of the Earth is now inductively
established--or, if not established, at least rendered so highly probable
that it is a generally admitted geological doctrine. Let us look first at
the astronomical attributes of this once molten globe. From its rotation
there result the oblateness of its form, the alternations of day and night,
and (under the influence of the moon) the tides, aqueous and atmospheric.
From the inclination of its axis, there result the precession of the
equinoxes and the many differences of the seasons, both simultaneous and
successive, that pervade its surface. Thus the multiplication of effects is
obvious. Several of the differentiations due to the gradual cooling of the
Earth have been already noticed--as the formation of a crust, the
solidification of sublimed elements, the precipitation of water, &c.,--and
we here again refer to them merely to point out that they are simultaneous
effects of the one cause, diminishing heat.
Let us now, however, observe the multiplied changes afterwards arising from
the continuance of this one cause. The cooling of the Earth involves its
contraction. Hence the solid crust first formed is presently too large for
the shrinking nucleus; and as it cannot support itself, inevitably follows
the nucleus. But a spheroidal envelope cannot sink down into contact with a
smaller internal spheroid, without disruption; it must run into wrinkles as
the rind of an apple does when the bulk of its interior decreases from
evaporation. As the cooling progresses and the envelope thickens, the
ridges consequent on these contractions must become greater, rising
ultimately into hills and mountains; and the later systems of mountains
thus produced must not only be higher, as we find them to be, but they must
be longer, as we also find them to be. Thus, leaving out of view other
modifying forces, we see what immense heterogeneity of surface has arisen
from the one cause, loss of heat--a heterogeneity which the telescope shows
us to be paralleled on the face of the moon, where aqueous and atmospheric
agencies have been absent.
But we have yet to notice another kind of heterogeneity of surface
similarly and simultaneously caused. While the Earth's crust was still
thin, the ridges produced by its contraction must not only have been small,
but the spaces between these ridges must have rested with great evenness
upon the subjacent liquid spheroid; and the water in those arctic and
antarctic regions in which it first condensed, must have been evenly
distributed. But as fast as the crust grew thicker and gained corresponding
strength, the lines of fracture from time to time caused in it, must have
occurred at greater distances apart; the intermediate surfaces must have
followed the contracting nucleus with less uniformity; and there must have
resulted larger areas of land and water. If any one, after wrapping up an
orange in wet tissue paper, and observing not only how small are the
wrinkles, but how evenly the intervening spaces lie upon the surface of the
orange, will then wrap it up in thick cartridge-paper, and note both the
greater height of the ridges and the much larger spaces throughout which
the paper does not touch the orange, he will realize the fact, that as the
Earth's solid envelope grew thicker, the areas of elevation and depression
must have become greater. In place of islands more or less homogeneously
scattered over an all-embracing sea, there must have gradually arisen
heterogeneous arrangements of continent and ocean, such as we now know.
Once more, this double change in the extent and in the elevation of the
lands, involved yet another species of heterogeneity, that of coast-line. A
tolerably even surface raised out of the ocean, must have a simple, regular
sea-margin; but a surface varied by table-lands and intersected by
mountain-chains must, when raised out of the ocean, have an outline
extremely irregular both in its leading features and in its details. Thus
endless is the accumulation of geological and geographical results slowly
brought about by this one cause--the contraction of the Earth.
When we pass from the agency which geologists term igneous, to aqueous and
atmospheric agencies, we see the like ever-growing complications of
effects. The denuding actions of air and water have, from the beginning,
been modifying every exposed surface; everywhere causing many different
changes. Oxidation, heat, wind, frost, rain, glaciers, rivers, tides,
waves, have been unceasingly producing disintegration; varying in kind and
amount according to local circumstances. Acting upon a tract of granite,
they here work scarcely an appreciable effect; there cause exfoliations of
the surface, and a resulting heap of _debris_ and boulders; and elsewhere,
after decomposing the feldspar into a white clay, carry away this and the
accompanying quartz and mica, and deposits them in separate beds,
fluviatile and marine. When the exposed land consists of several unlike
formations, sedimentary and igneous, the denudation produces changes
proportionably more heterogeneous. The formations being disintegrable in
different degrees, there follows an increased irregularity of surface. The
areas drained by different rivers being differently constituted, these
rivers carry down to the sea different combinations of ingredients; and so
sundry new strata of distinct composition are formed.
And here indeed we may see very simply illustrated, the truth, which we
shall presently have to trace out in more involved cases, that in
proportion to the heterogeneity of the object or objects on which any force
expends itself, is the heterogeneity of the results. A continent of complex
structure, exposing many strata irregularly distributed, raised to various
levels, tilted up at all angles, must, under the same denuding agencies,
give origin to immensely multiplied results; each district must be
differently modified; each river must carry down a different kind of
detritus; each deposit must be differently distributed by the entangled
currents, tidal and other, which wash the contorted shores; and this
multiplication of results must manifestly be greatest where the complexity
of the surface is greatest.
It is out of the question here to trace in detail the genesis of those
endless complications described by Geology and Physical Geography: else we
might show how the general truth, that every active force produces more
than one change, is exemplified in the highly involved flow of the tides,
in the ocean currents, in the winds, in the distribution of rain, in the
distribution of heat, and so forth. But not to dwell upon these, let us,
for the fuller elucidation of this truth in relation to the inorganic
world, consider what would be the consequences of some extensive cosmical
revolution--say the subsidence of Central America.
The immediate results of the disturbance would themselves be sufficiently
complex. Besides the numberless dislocations of strata, the ejections of
igneous matter, the propagation of earthquake vibrations thousands of miles
around, the loud explosions, and the escape of gases; there would be the
rush of the Atlantic and Pacific Oceans to supply the vacant space, the
subsequent recoil of enormous waves, which would traverse both these oceans
and produce myriads of changes along their shores, the corresponding
atmospheric waves complicated by the currents surrounding each volcanic
vent, and the electrical discharges with which such disturbances are
accompanied. But these temporary effects would be insignificant compared
with the permanent ones. The complex currents of the Atlantic and Pacific
would be altered in direction and amount. The distribution of heat achieved
by these ocean currents would be different from what it is. The arrangement
of the isothermal lines, not even on the neighbouring continents, but even
throughout Europe, would be changed. The tides would flow differently from
what they do now. There would be more or less modification of the winds in
their periods, strengths, directions, qualities. Rain would fall scarcely
anywhere at the same times and in the same quantities as at present. In
short, the meteorological conditions thousands of miles off, on all sides,
would be more or less revolutionized.
Thus, without taking into account the infinitude of modifications which
these changes of climate would produce upon the flora and fauna, both of
land and sea, the reader will see the immense heterogeneity of the results
wrought out by one force, when that force expends itself upon a previously
complicated area; and he will readily draw the corollary that from the
beginning the complication has advanced at an increasing rate.
Before going on to show how organic progress also depends upon the
universal law that every force produces more than one change, we have to
notice the manifestation of this law in yet another species of inorganic
progress--namely, chemical. The same general causes that have wrought out
the heterogeneity of the Earth, physically considered, have simultaneously
wrought out its chemical heterogeneity. Without dwelling upon the general
fact that the forces which have been increasing the variety and complexity
of geological formations, have, at the same time, been bringing into
contact elements not previously exposed to each other under conditions
favourable to union, and so have been adding to the number of chemical
compounds, let us pass to the more important complications that have
resulted from the cooling of the Earth.
There is every reason to believe that at an extreme heat the elements
cannot combine. Even under such heat as can be artificially produced, some
very strong affinities yield, as for instance, that of oxygen for hydrogen;
and the great majority of chemical compounds are decomposed at much lower
temperatures. But without insisting upon the highly probable inference,
that when the Earth was in its first state of incandescence there were no
chemical combinations at all, it will suffice our purpose to point to the
unquestionable fact that the compounds that can exist at the highest
temperatures, and which must, therefore, have been the first that were
formed as the Earth cooled, are those of the simplest constitutions. The
protoxides--including under that head the alkalies, earths, &c.--are, as a
class, the most stable compounds we know: most of them resisting
decomposition by any heat we can generate. These, consisting severally of
one atom of each component element, are combinations of the simplest
order--are but one degree less homogeneous than the elements themselves.
More heterogeneous than these, less stable, and therefore later in the
Earth's history, are the deutoxides, tritoxides, peroxides, &c.; in which
two, three, four, or more atoms of oxygen are united with one atom of metal
or other element. Higher than these in heterogeneity are the hydrates; in
which an oxide of hydrogen, united with an oxide of some other element,
forms a substance whose atoms severally contain at least four ultimate
atoms of three different kinds. Yet more heterogeneous and less stable
still are the salts; which present us with compound atoms each made up of
five, six, seven, eight, ten, twelve, or more atoms, of three, if not more,
kinds. Then there are the hydrated salts, of a yet greater heterogeneity,
which undergo partial decomposition at much lower temperatures. After them
come the further-complicated supersalts and double salts, having a
stability again decreased; and so throughout. Without entering into
qualifications for which we lack space, we believe no chemist will deny it
to be a general law of these inorganic combinations that, _other things
equal_, the stability decreases as the complexity increases.
And then when we pass to the compounds of organic chemistry, we find this
general law still further exemplified: we find much greater complexity and
much less stability. An atom of albumen, for instance, consists of 482
ultimate atoms of five different kinds. Fibrine, still more intricate in
constitution, contains in each atom, 298 atoms of carbon, 40 of nitrogen, 2
of sulphur, 228 of hydrogen, and 92 of oxygen--in all, 660 atoms; or, more
strictly speaking--equivalents. And these two substances are so unstable as
to decompose at quite ordinary temperatures; as that to which the outside
of a joint of roast meat is exposed. Thus it is manifest that the present
chemical heterogeneity of the Earth's surface has arisen by degrees, as the
decrease of heat has permitted; and that it has shown itself in three
forms--first, in the multiplication of chemical compounds; second, in the
greater number of different elements contained in the more modern of these
compounds: and third, in the higher and more varied multiples in which
these more numerous elements combine.
To say that this advance in chemical heterogeneity is due to the one cause,
diminution of the Earth's temperature, would be to say too much; for it is
clear that aqueous and atmospheric agencies have been concerned; and,
further, that the affinities of the elements themselves are implied. The
cause has all along been a composite one: the cooling of the Earth having
been simply the most general of the concurrent causes, or assemblage of
conditions. And here, indeed, it may be remarked that in the several
classes of facts already dealt with (excepting, perhaps, the first), and
still more in those with which we shall presently deal, the causes are more
or less compound; as indeed are nearly all causes with which we are
acquainted. Scarcely any change can with logical accuracy be wholly
ascribed to one agency, to the neglect of the permanent or temporary
conditions under which only this agency produces the change. But as it does
not materially affect our argument, we prefer, for simplicity's sake, to
use throughout the popular mode of expression.
Perhaps it will be further objected, that to assign loss of heat as the
cause of any changes, is to attribute these changes not to a force, but to
the absence of a force. And this is true. Strictly speaking, the changes
should be attributed to those forces which come into action when the
antagonist force is withdrawn. But though there is an inaccuracy in saying
that the freezing of water is due to the loss of its heat, no practical
error arises from it; nor will a parallel laxity of expression vitiate our
statements respecting the multiplication of effects. Indeed, the objection
serves but to draw attention to the fact, that not only does the exertion
of a force produce more than one change, but the withdrawal of a force
produces more than one change. And this suggests that perhaps the most
correct statement of our general principle would be its most abstract
statement--every change is followed by more than one other change.
Returning to the thread of our exposition, we have next to trace out, in
organic progress, this same all-pervading principle. And here, where the
evolution of the homogeneous into the heterogeneous was first observed, the
production of many changes by one cause is least easy to demonstrate. The
development of a seed into a plant, or an ovum into an animal, is so
gradual, while the forces which determine it are so involved, and at the
same time so unobtrusive, that it is difficult to detect the multiplication
of effects which is elsewhere so obvious. Nevertheless, guided by indirect
evidence, we may pretty safely reach the conclusion that here too the law
holds.
Observe, first, how numerous are the effects which any marked change works
upon an adult organism--a human being, for instance. An alarming sound or
sight, besides the impressions on the organs of sense and the nerves, may
produce a start, a scream, a distortion of the face, a trembling consequent
upon a general muscular relaxation, a burst of perspiration, an excited
action of the heart, a rush of blood to the brain, followed possibly by
arrest of the heart's action and by syncope: and if the system be feeble,
an indisposition with its long train of complicated symptoms may set in.
Similarly in cases of disease. A minute portion of the small-pox virus
introduced into the system, will, in a severe case, cause, during the first
stage, rigors, heat of skin, accelerated pulse, furred tongue, loss of
appetite, thirst, epigastric uneasiness, vomiting, headache, pains in the
back and limbs, muscular weakness, convulsions, delirium, &c.; in the
second stage, cutaneous eruption, itching, tingling, sore throat, swelled
fauces, salivation, cough, hoarseness, dyspn[oe]a, &c.; and in the third
stage, [oe]dematous inflammations, pneumonia, pleurisy, diarrh[oe]a,
inflammation of the brain, ophthalmia, erysipelas, &c.: each of which
enumerated symptoms is itself more or less complex. Medicines, special
foods, better air, might in like manner be instanced as producing
multiplied results.
Now it needs only to consider that the many changes thus wrought by one
force upon an adult organism, will be in part paralleled in an embryo
organism, to understand how here also, the evolution of the homogeneous
into the heterogeneous may be due to the production of many effects by one
cause. The external heat and other agencies which determine the first
complications of the germ, may, by acting upon these, superinduce further
complications; upon these still higher and more numerous ones; and so on
continually: each organ as it is developed serving, by its actions and
reactions upon the rest, to initiate new complexities. The first pulsations
of the f[oe]tal heart must simultaneously aid the unfolding of every part.
The growth of each tissue, by taking from the blood special proportions of
elements, must modify the constitution of the blood; and so must modify the
nutrition of all the other tissues. The heart's action, implying as it does
a certain waste, necessitates an addition to the blood of effete matters,
which must influence the rest of the system, and perhaps, as some think,
cause the formation of excretory organs. The nervous connections
established among the viscera must further multiply their mutual
influences: and so continually.
Still stronger becomes the probability of this view when we call to mind
the fact, that the same germ may be evolved into different forms according
to circumstances. Thus, during its earlier stages, every embryo is
sexless--becomes either male or female as the balance of forces acting upon
it determines. Again, it is a well-established fact that the larva of a
working-bee will develop into a queen-bee, if, before it is too late, its
food be changed to that on which the larvae of queen-bees are fed. Even more
remarkable is the case of certain entozoa. The ovum of a tape-worm, getting
into its natural habitat, the intestine, unfolds into the well-known form
of its parent; but if carried, as it frequently is, into other parts of the
system, it becomes a sac-like creature, called by naturalists the
_Echinococcus_--a creature so extremely different from the tape-worm in
aspect and structure, that only after careful investigations has it been
proved to have the same origin. All which instances imply that each advance
in embryonic complication results from the action of incident forces upon
the complication previously existing.
Indeed, we may find _a priori_ reason to think that the evolution proceeds
after this manner. For since it is now known that no germ, animal or
vegetable, contains the slightest rudiment, trace, or indication of the
future organism--now that the microscope has shown us that the first
process set up in every fertilized germ, is a process of repeated
spontaneous fissions ending in the production of a mass of cells, not one
of which exhibits any special character: there seems no alternative but to
suppose that the partial organization at any moment subsisting in a growing
embryo, is transformed by the agencies acting upon it into the succeeding
phase of organization, and this into the next, until, through
ever-increasing complexities, the ultimate form is reached. Thus, though
the subtilty of the forces and the slowness of the results, prevent us from
_directly_ showing that the stages of increasing heterogeneity through
which every embryo passes, severally arise from the production of many
changes by one force, yet, _indirectly_, we have strong evidence that they
do so.
We have marked how multitudinous are the effects which one cause may
generate in an adult organism; that a like multiplication of effects must
happen in the unfolding organism, we have observed in sundry illustrative
cases; further, it has been pointed out that the ability which like germs
have to originate unlike forms, implies that the successive transformations
result from the new changes superinduced on previous changes; and we have
seen that structureless as every germ originally is, the development of an
organism out of it is otherwise incomprehensible. Not indeed that we can
thus really explain the production of any plant or animal. We are still in
the dark respecting those mysterious properties in virtue of which the
germ, when subject to fit influences, undergoes the special changes that
begin the series of transformations. All we aim to show, is, that given a
germ possessing these mysterious properties, the evolution of an organism
from it, probably depends upon that multiplication of effects which we have
seen to be the cause of progress in general, so far as we have yet traced
it.
When, leaving the development of single plants and animals, we pass to that
of the Earth's flora and fauna, the course of our argument again becomes
clear and simple. Though, as was admitted in the first part of this
article, the fragmentary facts Palaeontology has accumulated, do not clearly
warrant us in saying that, in the lapse of geologic time, there have been
evolved more heterogeneous organisms, and more heterogeneous assemblages of
organisms, yet we shall now see that there _must_ ever have been a tendency
towards these results. We shall find that the production of many effects by
one cause, which, as already shown, has been all along increasing the
physical heterogeneity of the Earth, has further involved an increasing
heterogeneity in its flora and fauna, individually and collectively. An
illustration will make this clear.
Suppose that by a series of upheavals, occurring, as they are now known to
do, at long intervals, the East Indian Archipelago were to be, step by
step, raised into a continent, and a chain of mountains formed along the
axis of elevation. By the first of these upheavals, the plants and animals
inhabiting Borneo, Sumatra, New Guinea, and the rest, would be subjected to
slightly modified sets of conditions. The climate in general would be
altered in temperature, in humidity, and in its periodical variations;
while the local differences would be multiplied. These modifications would
affect, perhaps inappreciably, the entire flora and fauna of the region.
The change of level would produce additional modifications: varying in
different species, and also in different members of the same species,
according to their distance from the axis of elevation. Plants, growing
only on the sea-shore in special localities, might become extinct. Others,
living only in swamps of a certain humidity, would, if they survived at
all, probably undergo visible changes of appearance. While still greater
alterations would occur in the plants gradually spreading over the lands
newly raised above the sea. The animals and insects living on these
modified plants, would themselves be in some degree modified by change of
food, as well as by change of climate; and the modification would be more
marked where, from the dwindling or disappearance of one kind of plant, an
allied kind was eaten. In the lapse of the many generations arising before
the next upheaval, the sensible or insensible alterations thus produced in
each species would become organized--there would be a more or less complete
adaptation to the new conditions. The next upheaval would superinduce
further organic changes, implying wider divergences from the primary forms;
and so repeatedly.
But now let it be observed that the revolution thus resulting would not be
a substitution of a thousand more or less modified species for the thousand
original species; but in place of the thousand original species there would
arise several thousand species, or varieties, or changed forms. Each
species being distributed over an area of some extent, and tending
continually to colonize the new area exposed, its different members would
be subject to different sets of changes. Plants and animals spreading
towards the equator would not be affected in the same way with others
spreading from it. Those spreading towards the new shores would undergo
changes unlike the changes undergone by those spreading into the mountains.
Thus, each original race of organisms, would become the root from which
diverged several races differing more or less from it and from each other;
and while some of these might subsequently disappear, probably more than
one would survive in the next geologic period: the very dispersion itself
increasing the chances of survival. Not only would there be certain
modifications thus caused by change of physical conditions and food, but
also in some cases other modifications caused by change of habit. The fauna
of each island, peopling, step by step, the newly-raised tracts, would
eventually come in contact with the faunas of other islands; and some
members of these other faunas would be unlike any creatures before seen.
Herbivores meeting with new beasts of prey, would, in some cases, be led
into modes of defence or escape differing from those previously used; and
simultaneously the beasts of prey would modify their modes of pursuit and
attack. We know that when circumstances demand it, such changes of habit
_do_ take place in animals; and we know that if the new habits become the
dominant ones, they must eventually in some degree alter the organization.
Observe, now, however, a further consequence. There must arise not simply a
tendency towards the differentiation of each race of organisms into several
races; but also a tendency to the occasional production of a somewhat
higher organism. Taken in the mass these divergent varieties which have
been caused by fresh physical conditions and habits of life, will exhibit
changes quite indefinite in kind and degree; and changes that do not
necessarily constitute an advance. Probably in most cases the modified type
will be neither more nor less heterogeneous than the original one. In some
cases the habits of life adopted being simpler than before, a less
heterogeneous structure will result: there will be a retrogradation. But it
_must_ now and then occur, that some division of a species, falling into
circumstances which give it rather more complex experiences, and demand
actions somewhat more involved, will have certain of its organs further
differentiated in proportionately small degrees,--will become slightly more
heterogeneous.
Thus, in the natural course of things, there will from time to time arise
an increased heterogeneity both of the Earth's flora and fauna, and of
individual races included in them. Omitting detailed explanations, and
allowing for the qualifications which cannot here be specified, we think it
is clear that geological mutations have all along tended to complicate the
forms of life, whether regarded separately or collectively. The same causes
which have led to the evolution of the Earth's crust from the simple into
the complex, have simultaneously led to a parallel evolution of the Life
upon its surface. In this case, as in previous ones, we see that the
transformation of the homogeneous into the heterogeneous is consequent upon
the universal principle, that every active force produces more than one
change.
The deduction here drawn from the established truths of geology and the
general laws of life, gains immensely in weight on finding it to be in
harmony with an induction drawn from direct experience. Just that
divergence of many races from one race, which we inferred must have been
continually occurring during geologic time, we know to have occurred during
the pre-historic and historic periods, in man and domestic animals. And
just that multiplication of effects which we concluded must have produced
the first, we see has produced the last. Single causes, as famine, pressure
of population, war, have periodically led to further dispersions of mankind
and of dependent creatures: each such dispersion initiating new
modifications, new varieties of type. Whether all the human races be or be
not derived from one stock, philology makes it clear that whole groups of
races now easily distinguishable from each other, were originally one
race,--that the diffusion of one race into different climates and
conditions of existence, has produced many modified forms of it.
Similarly with domestic animals. Though in some cases--as that of
dogs--community of origin will perhaps be disputed, yet in other cases--as
that of the sheep or the cattle of our own country--it will not be
questioned that local differences of climate, food, and treatment, have
transformed one original breed into numerous breeds now become so far
distinct as to produce unstable hybrids. Moreover, through the
complications of effects flowing from single causes, we here find, what we
before inferred, not only an increase of general heterogeneity, but also of
special heterogeneity. While of the divergent divisions and subdivisions of
the human race, many have undergone changes not constituting an advance;
while in some the type may have degraded; in others it has become decidedly
more heterogeneous. The civilized European departs more widely from the
vertebrate archetype than does the savage. Thus, both the law and the cause
of progress, which, from lack of evidence, can be but hypothetically
substantiated in respect of the earlier forms of life on our globe, can be
actually substantiated in respect of the latest forms.
If the advance of Man towards greater heterogeneity is traceable to the
production of many effects by one cause still more clearly may the advance
of Society towards greater heterogeneity be so explained. Consider the
growth of an industrial organization. When, as must occasionally happen,
some individual of a tribe displays unusual aptitude for making an article
of general use--a weapon, for instance--which was before made by each man
for himself, there arises a tendency towards the differentiation of that
individual into a maker of such weapon. His companions--warriors and
hunters all of them,--severally feel the importance of having the best
weapons that can be made; and are therefore certain to offer strong
inducements to this skilled individual to make weapons for them. He, on the
other hand, having not only an unusual faculty, but an unusual liking, for
making such weapons (the talent and the desire for any occupation being
commonly associated), is predisposed to fulfil these commissions on the
offer of an adequate reward: especially as his love of distinction is also
gratified. This first specialization of function, once commenced, tends
ever to become more decided. On the side of the weapon-maker continued
practice gives increased skill--increased superiority to his products: on
the side of his clients, cessation of practice entails decreased skill.
Thus the influences that determine this division of labour grow stronger in
both ways; and the incipient heterogeneity is, on the average of cases,
likely to become permanent for that generation, if no longer.
Observe now, however, that this process not only differentiates the social
mass into two parts, the one monopolizing, or almost monopolizing, the
performance of a certain function, and the other having lost the habit, and
in some measure the power, of performing that function; but it tends to
imitate other differentiations. The advance we have described implies the
introduction of barter,--the maker of weapons has, on each occasion, to be
paid in such other articles as he agrees to take in exchange. But he will
not habitually take in exchange one kind of article, but many kinds. He
does not want mats only, or skins, or fishing gear, but he wants all these;
and on each occasion will bargain for the particular things he most needs.
What follows? If among the members of the tribe there exist any slight
differences of skill in the manufacture of these various things, as there
are almost sure to do, the weapon-maker will take from each one the thing
which that one excels in making: he will exchange for mats with him whose
mats are superior, and will bargain for the fishing gear of whoever has the
best. But he who has bartered away his mats or his fishing gear, must make
other mats or fishing gear for himself; and in so doing must, in some
degree, further develop his aptitude. Thus it results that the small
specialities of faculty possessed by various members of the tribe, will
tend to grow more decided. If such transactions are from time repeated,
these specializations may become appreciable. And whether or not there
ensue distinct differentiations of other individuals into makers of
particular articles, it is clear that incipient differentiations take place
throughout the tribe: the one original cause produces not only the first
dual effect, but a number of secondary dual effects, like in kind, but
minor in degree. This process, of which traces may be seen among groups of
schoolboys, cannot well produce any lasting effects in an unsettled tribe;
but where there grows up a fixed and multiplying community, these
differentiations become permanent, and increase with each generation. A
larger population, involving a greater demand for every commodity,
intensifies the functional activity of each specialized person or class;
and this renders the specialization more definite where it already exists,
and establishes it where it is nascent. By increasing the pressure on the
means of subsistence, a larger population again augments these results;
seeing that each person is forced more and more to confine himself to that
which he can do best, and by which he can gain most. This industrial
progress, by aiding future production, opens the way for a further growth
of population, which reacts as before: in all which the multiplication of
effects is manifest. Presently, under these same stimuli, new occupations
arise. Competing workers, ever aiming to produce improved articles,
occasionally discover better processes or raw materials. In weapons and
cutting tools, the substitution of bronze for stone entails upon him who
first makes it a great increase of demand--so great an increase that he
presently finds all his time occupied in making the bronze for the articles
he sells, and is obliged to depute the fashioning of these to others: and,
eventually, the making of bronze, thus gradually differentiated from a
pre-existing occupation, becomes an occupation by itself.
But now mark the ramified changes which follow this change. Bronze soon
replaces stone, not only in the articles it was first used for, but in many
others--in arms, tools, and utensils of various kinds; and so affects the
manufacture of these things. Further, it affects the processes which these
utensils subserve, and the resulting products--modifies buildings,
carvings, dress, personal decorations. Yet again, it sets going sundry
manufactures which were before impossible, from lack of a material fit for
the requisite tools. And all these changes react on the people--increase
their manipulative skill, their intelligence, their comfort,--refine their
habits and tastes. Thus the evolution of a homogeneous society into a
heterogeneous one, is clearly consequent on the general principle, that
many effects are produced by one cause.
Our limits will not allow us to follow out this process in its higher
complications: else might we show how the localization of special
industries in special parts of a kingdom, as well as the minute subdivision
of labour in the making of each commodity, are similarly determined. Or,
turning to a somewhat different order of illustrations, we might dwell on
the multitudinous changes--material, intellectual, moral,--caused by
printing; or the further extensive series of changes wrought by gunpowder.
But leaving the intermediate phases of social development, let us take a
few illustrations from its most recent and its passing phases. To trace the
effects of steam-power, in its manifold applications to mining, navigation,
and manufactures of all kinds, would carry us into unmanageable detail. Let
us confine ourselves to the latest embodiment of steam-power--the
locomotive engine.
This, as the proximate cause of our railway system, has changed the face of
the country, the course of trade, and the habits of the people. Consider,
first, the complicated sets of changes that precede the making of every
railway--the provisional arrangements, the meetings, the registration, the
trial section, the parliamentary survey, the lithographed plans, the books
of reference, the local deposits and notices, the application to
Parliament, the passing Standing-Orders Committee, the first, second, and
third readings: each of which brief heads indicates a multiplicity of
transactions, and the development of sundry occupations--as those of
engineers, surveyors, lithographers, parliamentary agents, share-brokers;
and the creation of sundry others--as those of traffic-takers,
reference-takers. Consider, next, the yet more marked changes implied in
railway construction--the cuttings, embankings, tunnellings, diversions of
roads; the building of bridges and stations; the laying down of ballast,
sleepers, and rails; the making of engines, tenders, carriages and waggons:
which processes, acting upon numerous trades, increase the importation of
timber, the quarrying of stone, the manufacture of iron, the mining of
coal, the burning of bricks: institute a variety of special manufactures
weekly advertised in the _Railway Times_; and, finally, open the way to
sundry new occupations, as those of drivers, stokers, cleaners,
plate-layers, &c., &c. And then consider the changes, more numerous and
involved still, which railways in action produce on the community at large.
The organization of every business is more or less modified: ease of
communication makes it better to do directly what was before done by proxy;
agencies are established where previously they would not have paid; goods
are obtained from remote wholesale houses instead of near retail ones; and
commodities are used which distance once rendered inaccessible. Again, the
rapidity and small cost of carriage tend to specialize more than ever the
industries of different districts--to confine each manufacture to the parts
in which, from local advantages, it can be best carried on. Further, the
diminished cost of carriage, facilitating distribution, equalizes prices,
and also, on the average, lowers prices: thus bringing divers articles
within the means of those before unable to buy them, and so increasing
their comforts and improving their habits. At the same time the practice of
travelling is immensely extended. Classes who never before thought of it,
take annual trips to the sea; visit their distant relations; make tours;
and so we are benefited in body, feelings, and intellect. Moreover, the
more prompt transmission of letters and of news produces further
changes--makes the pulse of the nation faster. Yet more, there arises a
wide dissemination of cheap literature through railway book-stalls, and of
advertisements in railway carriages: both of them aiding ulterior progress.
And all the innumerable changes here briefly indicated are consequent on
the invention of the locomotive engine. The social organism has been
rendered more heterogeneous in virtue of the many new occupations
introduced, and the many old ones further specialized; prices in every
place have been altered; each trader has, more or less, modified his way of
doing business; and almost every person has been affected in his actions,
thoughts, emotions.
Illustrations to the same effect might be indefinitely accumulated. That
every influence brought to bear upon society works multiplied effects; and
that increase of heterogeneity is due to this multiplication of effects;
may be seen in the history of every trade, every custom, every belief. But
it is needless to give additional evidence of this. The only further fact
demanding notice, is, that we here see still more clearly than ever, the
truth before pointed out, that in proportion as the area on which any force
expends itself becomes heterogeneous, the results are in a yet higher
degree multiplied in number and kind. While among the primitive tribes to
whom it was first known, caoutchouc caused but a few changes, among
ourselves the changes have been so many and varied that the history of them
occupies a volume.[D] Upon the small, homogeneous community inhabiting one
of the Hebrides, the electric telegraph would produce, were it used,
scarcely any results; but in England the results it produces are
multitudinous. The comparatively simple organization under which our
ancestors lived five centuries ago, could have undergone but few
modifications from an event like the recent one at Canton; but now the
legislative decision respecting it sets up many hundreds of complex
modifications, each of which will be the parent of numerous future ones.
[D] "Personal Narrative of the Origin of the Caoutchouc, or
India-Rubber Manufacture in England." By Thomas Hancock.
Space permitting, we could willingly have pursued the argument in relation
to all the subtler results of civilization. As before, we showed that the
law of Progress to which the organic and inorganic worlds conform, is also
conformed to by Language, Sculpture, Music, &c.; so might we here show that
the cause which we have hitherto found to determine Progress holds in these
cases also. We might demonstrate in detail how, in Science, an advance of
one division presently advances other divisions--how Astronomy has been
immensely forwarded by discoveries in Optics, while other optical
discoveries have initiated Microscopic Anatomy, and greatly aided the
growth of Physiology--how Chemistry has indirectly increased our knowledge
of Electricity, Magnetism, Biology, Geology--how Electricity has reacted on
Chemistry and Magnetism, developed our views of Light and Heat, and
disclosed sundry laws of nervous action.
In Literature the same truth might be exhibited in the manifold effects of
the primitive mystery-play, not only as originating the modern drama, but
as affecting through it other kinds of poetry and fiction; or in the still
multiplying forms of periodical literature that have descended from the
first newspaper, and which have severally acted and reacted on other forms
of literature and on each other. The influence which a new school of
Painting--as that of the pre-Raffaelites--exercises upon other schools; the
hints which all kinds of pictorial art are deriving from Photography; the
complex results of new critical doctrines, as those of Mr. Ruskin, might
severally be dwelt upon as displaying the like multiplication of effects.
But it would needlessly tax the reader's patience to pursue, in their many
ramifications, these various changes: here become so involved and subtle as
to be followed with some difficulty.
Without further evidence, we venture to think our case is made out. The
imperfections of statement which brevity has necessitated, do not, we
believe, militate against the propositions laid down. The qualifications
here and there demanded would not, if made, affect the inferences. Though
in one instance, where sufficient evidence is not attainable, we have been
unable to show that the law of Progress applies; yet there is high
probability that the same generalization holds which holds throughout the
rest of creation. Though, in tracing the genesis of Progress, we have
frequently spoken of complex causes as if they were simple ones; it still
remains true that such causes are far less complex than their results.
Detailed criticisms cannot affect our main position. Endless facts go to
show that every kind of progress is from the homogeneous to the
heterogeneous; and that it is so because each change is followed by many
changes. And it is significant that where the facts are most accessible and
abundant, there are these truths most manifest.
However, to avoid committing ourselves to more than is yet proved, we must
be content with saying that such are the law and the cause of all progress
that is known to us. Should the Nebular Hypothesis ever be established,
then it will become manifest that the Universe at large, like every
organism, was once homogeneous; that as a whole, and in every detail, it
has unceasingly advanced towards greater heterogeneity; and that its
heterogeneity is still increasing. It will be seen that as in each event of
to-day, so from the beginning, the decomposition of every expended force
into several forces has been perpetually producing a higher complication;
that the increase of heterogeneity so brought about is still going on, and
must continue to go on; and that thus Progress is not an accident, not a
thing within human control, but a beneficent necessity.
* * * * *
A few words must be added on the ontological bearings of our argument.
Probably not a few will conclude that here is an attempted solution of the
great questions with which Philosophy in all ages has perplexed itself. Let
none thus deceive themselves. Only such as know not the scope and the
limits of Science can fall into so grave an error. The foregoing
generalizations apply, not to the genesis of things in themselves, but to
their genesis as manifested to the human consciousness. After all that has
been said, the ultimate mystery remains just as it was. The explanation of
that which is explicable, does but bring out into greater clearness the
inexplicableness of that which remains behind. However we may succeed in
reducing the equation to its lowest terms, we are not thereby enabled to
determine the unknown quantity: on the contrary, it only becomes more
manifest that the unknown quantity can never be found.
Little as it seems to do so, fearless inquiry tends continually to give a
firmer basis to all true Religion. The timid sectarian, alarmed at the
progress of knowledge, obliged to abandon one by one the superstitions of
his ancestors, and daily finding his cherished beliefs more and more
shaken, secretly fears that all things may some day be explained; and has a
corresponding dread of Science: thus evincing the profoundest of all
infidelity--the fear lest the truth be bad. On the other hand, the sincere
man of science, content to follow wherever the evidence leads him, becomes
by each new inquiry more profoundly convinced that the Universe is an
insoluble problem. Alike in the external and the internal worlds, he sees
himself in the midst of perpetual changes, of which he can discover neither
the beginning nor the end. If, tracing back the evolution of things, he
allows himself to entertain the hypothesis that all matter once existed in
a diffused form, he finds it utterly impossible to conceive how this came
to be so; and equally, if he speculates on the future, he can assign no
limit to the grand succession of phenomena ever unfolding themselves before
him. On the other hand, if he looks inward, he perceives that both
terminations of the thread of consciousness are beyond his grasp: he cannot
remember when or how consciousness commenced, and he cannot examine the
consciousness that at any moment exists; for only a state of consciousness
that is already past can become the object of thought, and never one which
is passing.
When, again, he turns from the succession of phenomena, external or
internal, to their essential nature, he is equally at fault. Though he may
succeed in resolving all properties of objects into manifestations of
force, he is not thereby enabled to realize what force is; but finds, on
the contrary, that the more he thinks about it, the more he is baffled.
Similarly, though analysis of mental actions may finally bring him down to
sensations as the original materials out of which all thought is woven, he
is none the forwarder; for he cannot in the least comprehend
sensation--cannot even conceive how sensation is possible. Inward and
outward things he thus discovers to be alike inscrutable in their ultimate
genesis and nature. He sees that the Materialist and Spiritualist
controversy is a mere war of words; the disputants being equally
absurd--each believing he understands that which it is impossible for any
man to understand. In all directions his investigations eventually bring
him face to face with the unknowable; and he ever more clearly perceives it
to be the unknowable. He learns at once the greatness and the littleness of
human intellect--its power in dealing with all that comes within the range
of experience; its impotence in dealing with all that transcends
experience. He feels, with a vividness which no others can, the utter
incomprehensibleness of the simplest fact, considered in itself. He alone
truly _sees_ that absolute knowledge is impossible. He alone _knows_ that
under all things there lies an impenetrable mystery.
II. MANNERS AND FASHION.
Whoever has studied the physiognomy of political meetings, cannot fail to
have remarked a connection between democratic opinions and peculiarities of
costume. At a Chartist demonstration, a lecture on Socialism, or a _soiree_
of the Friends of Italy, there will be seen many among the audience, and a
still larger ratio among the speakers, who get themselves up in a style
more or less unusual. One gentleman on the platform divides his hair down
the centre, instead of on one side; another brushes it back off the
forehead, in the fashion known as "bringing out the intellect;" a third has
so long forsworn the scissors, that his locks sweep his shoulders. A
considerable sprinkling of moustaches may be observed; here and there an
imperial; and occasionally some courageous breaker of conventions exhibits
a full-grown beard.[E] This nonconformity in hair is countenanced by
various nonconformities in dress, shown by others of the assemblage. Bare
necks, shirt-collars _a la_ Byron, waistcoats cut Quaker fashion,
wonderfully shaggy great coats, numerous oddities in form and colour,
destroy the monotony usual in crowds. Even those exhibiting no conspicuous
peculiarity, frequently indicate by something in the pattern or make-up of
their clothes, that they pay small regard to what their tailors tell them
about the prevailing taste. And when the gathering breaks up, the varieties
of head gear displayed--the number of caps, and the abundance of felt
hats--suffice to prove that were the world at large like-minded, the black
cylinders which tyrannize over us would soon be deposed.
[E] This was written before moustaches and beards had become common.
The foreign correspondence of our daily press shows that this relationship
between political discontent and the disregard of customs exists on the
Continent also. Red republicanism has always been distinguished by its
hirsuteness. The authorities of Prussia, Austria, and Italy, alike
recognize certain forms of hat as indicative of disaffection, and fulminate
against them accordingly. In some places the wearer of a blouse runs a risk
of being classed among the _suspects_; and in others, he who would avoid
the bureau of police, must beware how he goes out in any but the ordinary
colours. Thus, democracy abroad, as at home, tends towards personal
singularity.
Nor is this association of characteristics peculiar to modern times, or to
reformers of the State. It has always existed; and it has been manifested
as much in religious agitations as in political ones. Along with dissent
from the chief established opinions and arrangements, there has ever been
some dissent from the customary social practices. The Puritans,
disapproving of the long curls of the Cavaliers, as of their principles,
cut their own hair short, and so gained the name of "Roundheads." The
marked religious nonconformity of the Quakers was accompanied by an
equally-marked nonconformity of manners--in attire, in speech, in
salutation. The early Moravians not only believed differently, but at the
same time dressed differently, and lived differently, from their fellow
Christians.
That the association between political independence and independence of
personal conduct, is not a phenomenon of to-day only, we may see alike in
the appearance of Franklin at the French court in plain clothes, and in the
white hats worn by the last generation of radicals. Originality of nature
is sure to show itself in more ways than one. The mention of George Fox's
suit of leather, or Pestalozzi's school name, "Harry Oddity," will at once
suggest the remembrance that men who have in great things diverged from the
beaten track, have frequently done so in small things likewise. Minor
illustrations of this truth may be gathered in almost every circle. We
believe that whoever will number up his reforming and rationalist
acquaintances, will find among them more than the usual proportion of those
who in dress or behaviour exhibit some degree of what the world calls
eccentricity.
If it be a fact that men of revolutionary aims in politics or religion, are
commonly revolutionists in custom also, it is not less a fact that those
whose office it is to uphold established arrangements in State and Church,
are also those who most adhere to the social forms and observances
bequeathed to us by past generations. Practices elsewhere extinct still
linger about the headquarters of government. The monarch still gives assent
to Acts of Parliament in the old French of the Normans; and Norman French
terms are still used in law. Wigs, such as those we see depicted in old
portraits, may yet be found on the heads of judges and barristers. The
Beefeaters at the Tower wear the costume of Henry VIIth's body-guard. The
University dress of the present year varies but little from that worn soon
after the Reformation. The claret- coat, knee-breeches, lace shirt
frills, ruffles, white silk stockings, and buckled shoes, which once formed
the usual attire of a gentleman, still survive as the court-dress. And it
need scarcely be said that at _levees_ and drawing-rooms, the ceremonies
are prescribed with an exactness, and enforced with a rigour, not elsewhere
to be found.
Can we consider these two series of coincidences as accidental and
unmeaning? Must we not rather conclude that some necessary relationship
obtains between them? Are there not such things as a constitutional
conservatism, and a constitutional tendency to change? Is there not a class
which clings to the old in all things; and another class so in love with
progress as often to mistake novelty for improvement? Do we not find some
men ready to bow to established authority of whatever kind; while others
demand of every such authority its reason, and reject it if it fails to
justify itself? And must not the minds thus contrasted tend to become
respectively conformist and nonconformist, not only in politics and
religion, but in other things? Submission, whether to a government, to the
dogmas of ecclesiastics, or to that code of behaviour which society at
large has set up, is essentially of the same nature; and the sentiment
which induces resistance to the despotism of rulers, civil or spiritual,
likewise induces resistance to the despotism of the world's opinion. Look
at them fundamentally, and all enactments, alike of the legislature, the
consistory, and the saloon--all regulations, formal or virtual, have a
common character: they are all limitations of men's freedom. "Do
this--Refrain from that," are the blank formulas into which they may all be
written: and in each case the understanding is that obedience will bring
approbation here and paradise hereafter; while disobedience will entail
imprisonment, or sending to Coventry, or eternal torments, as the case may
be. And if restraints, however named, and through whatever apparatus of
means exercised, are one in their action upon men, it must happen that
those who are patient under one kind of restraint, are likely to be patient
under another; and conversely, that those impatient of restraint in
general, will, on the average, tend to show their impatience in all
directions.
That Law, Religion, and Manners are thus related--that their respective
kinds of operation come under one generalization--that they have in certain
contrasted characteristics of men a common support and a common
danger--will, however, be most clearly seen on discovering that they have a
common origin. Little as from present appearances we should suppose it, we
shall yet find that at first, the control of religion, the control of laws,
and the control of manners, were all one control. However incredible it may
now seem, we believe it to be demonstrable that the rules of etiquette, the
provisions of the statute-book, and the commands of the decalogue, have
grown from the same root. If we go far enough back into the ages of
primeval Fetishism, it becomes manifest that originally Deity, Chief, and
Master of the ceremonies were identical. To make good these positions, and
to show their bearing on what is to follow, it will be necessary here to
traverse ground that is in part somewhat beaten, and at first sight
irrelevant to our topic. We will pass over it as quickly as consists with
the exigencies of the argument.
* * * * *
That the earliest social aggregations were ruled solely by the will of the
strong man, few dispute. That from the strong man proceeded not only
Monarchy, but the conception of a God, few admit: much as Carlyle and
others have said in evidence of it. If, however, those who are unable to
believe this, will lay aside the ideas of God and man in which they have
been educated, and study the aboriginal ideas of them, they will at least
see some probability in the hypothesis. Let them remember that before
experience had yet taught men to distinguish between the possible and the
impossible; and while they were ready on the slightest suggestion to
ascribe unknown powers to any object and make a fetish of it; their
conceptions of humanity and its capacities were necessarily vague, and
without specific limits. The man who by unusual strength, or cunning,
achieved something that others had failed to achieve, or something which
they did not understand, was considered by them as differing from
themselves; and, as we see in the belief of some Polynesians that only
their chiefs have souls, or in that of the ancient Peruvians that their
nobles were divine by birth, the ascribed difference was apt to be not one
of degree only, but one of kind.
Let them remember next, how gross were the notions of God, or rather of
gods, prevalent during the same era and afterwards--how concretely gods
were conceived as men of specific aspects dressed in specific ways--how
their names were literally "the strong," "the destroyer," "the powerful
one,"--how, according to the Scandinavian mythology, the "sacred duty of
blood-revenge" was acted on by the gods themselves,--and how they were not
only human in their vindictiveness, their cruelty, and their quarrels with
each other, but were supposed to have amours on earth, and to consume the
viands placed on their altars. Add to which, that in various mythologies,
Greek, Scandinavian, and others, the oldest beings are giants; that
according to a traditional genealogy the gods, demi-gods, and in some cases
men, are descended from these after the human fashion; and that while in
the East we hear of sons of God who saw the daughters of men that they were
fair, the Teutonic myths tell of unions between the sons of men and the
daughters of the gods.
Let them remember, too, that at first the idea of death differed widely
from that which we have; that there are still tribes who, on the decease of
one of their number, attempt to make the corpse stand, and put food into
his mouth; that the Peruvians had feasts at which the mummies of their dead
Incas presided, when, as Prescott says, they paid attention "to these
insensible remains as if they were instinct with life;" that among the
Feejees it is believed that every enemy has to be killed twice; that the
Eastern Pagans give extension and figure to the soul, and attribute to it
all the same substances, both solid and liquid, of which our bodies are
composed; and that it is the custom among most barbarous races to bury
food, weapons, and trinkets along with the dead body, under the manifest
belief that it will presently need them.
Lastly, let them remember that the other world, as originally conceived, is
simply some distant part of this world--some Elysian fields, some happy
hunting-ground, accessible even to the living, and to which, after death,
men travel in anticipation of a life analogous in general character to that
which they led before. Then, co-ordinating these general facts--the
ascription of unknown powers to chiefs and medicine men; the belief in
deities having human forms, passions, and behaviour; the imperfect
comprehension of death as distinguished from life; and the proximity of the
future abode to the present, both in position and character--let them
reflect whether they do not almost unavoidably suggest the conclusion that
the aboriginal god is the dead chief: the chief not dead in our sense, but
gone away carrying with him food and weapons to some rumoured region of
plenty, some promised land, whither he had long intended to lead his
followers, and whence he will presently return to fetch them.
This hypothesis once entertained, is seen to harmonize with all primitive
ideas and practices. The sons of the deified chief reigning after him, it
necessarily happens that all early kings are held descendants of the gods;
and the fact that alike in Assyria, Egypt, among the Jews, Ph[oe]nicians,
and ancient Britons, kings' names were formed out of the names of the gods,
is fully explained. The genesis of Polytheism out of Fetishism, by the
successive migrations of the race of god-kings to the other world--a
genesis illustrated in the Greek mythology, alike by the precise genealogy
of the deities, and by the specifically asserted apotheosis of the later
ones--tends further to bear it out. It explains the fact that in the old
creeds, as in the still extant creed of the Otaheitans, every family has
its guardian spirit, who is supposed to be one of their departed relatives;
and that they sacrifice to these as minor gods--a practice still pursued by
the Chinese and even by the Russians. It is perfectly congruous with the
Grecian myths concerning the wars of the Gods with the Titans and their
final usurpation; and it similarly agrees with the fact that among the
Teutonic gods proper was one Freir who came among them by adoption, "but
was born among the _Vanes_, a somewhat mysterious _other_ dynasty of gods,
who had been conquered and superseded by the stronger and more warlike Odin
dynasty." It harmonizes, too, with the belief that there are different gods
to different territories and nations, as there were different chiefs; that
these gods contend for supremacy as chiefs do; and it gives meaning to the
boast of neighbouring tribes--"Our god is greater than your god." It is
confirmed by the notion universally current in early times, that the gods
come from this other abode, in which they commonly live, and appear among
men--speak to them, help them, punish them. And remembering this, it
becomes manifest that the prayers put up by primitive peoples to their gods
for aid in battle, are meant literally--that their gods are expected to
come back from the other kingdom they are reigning over, and once more
fight the old enemies they had before warred against so implacably; and it
needs but to name the Iliad, to remind every one how thoroughly they
believed the expectation fulfilled.
All government, then, being originally that of the strong man who has
become a fetish by some manifestation of superiority, there arises, at his
death--his supposed departure on a long projected expedition, in which he
is accompanied by his slaves and concubines sacrificed at his tomb--there
arises, then, the incipient division of religious from political control,
of civil rule from spiritual. His son becomes deputed chief during his
absence; his authority is cited as that by which his son acts; his
vengeance is invoked on all who disobey his son; and his commands, as
previously known or as asserted by his son, become the germ of a moral
code: a fact we shall the more clearly perceive if we remember, that early
moral codes inculcate mainly the virtues of the warrior, and the duty of
exterminating some neighbouring tribe whose existence is an offence to the
deity.
From this point onwards, these two kinds of authority, at first complicated
together as those of principal and agent, become slowly more and more
distinct. As experience accumulates, and ideas of causation grow more
precise, kings lose their supernatural attributes; and, instead of
God-king, become God-descended king, God-appointed king, the Lord's
anointed, the viceregent of heaven, ruler reigning by Divine right. The old
theory, however, long clings to men in feeling, after it has disappeared in
name; and "such divinity doth hedge a king," that even now, many, on first
seeing one, feel a secret surprise at finding him an ordinary sample of
humanity. The sacredness attaching to royalty attaches afterwards to its
appended institutions--to legislatures, to laws. Legal and illegal are
synonymous with right and wrong; the authority of Parliament is held
unlimited; and a lingering faith in governmental power continually
generates unfounded hopes from its enactments. Political scepticism,
however, having destroyed the divine _prestige_ of royalty, goes on ever
increasing, and promises ultimately to reduce the State to a purely secular
institution, whose regulations are limited in their sphere, and have no
other authority than the general will. Meanwhile, the religious control has
been little by little separating itself from the civil, both in its essence
and in its forms. While from the God-king of the savage have arisen in one
direction, secular rulers who, age by age, have been losing the sacred
attributes men ascribed to them; there has arisen in another direction, the
conception of a deity, who, at first human in all things, has been
gradually losing human materiality, human form, human passions, human modes
of action: until now, anthropomorphism has become a reproach.
Along with this wide divergence in men's ideas of the divine and civil
ruler has been taking place a corresponding divergence in the codes of
conduct respectively proceeding from them. While the king was a
deputy-god--a governor such as the Jews looked for in the Messiah--a
governor considered, as the Czar still is, "our God upon Earth,"--it, of
course, followed that his commands were the supreme rules. But as men
ceased to believe in his supernatural origin and nature, his commands
ceased to be the highest; and there arose a distinction between the
regulations made by him, and the regulations handed down from the old
god-kings, who were rendered ever more sacred by time and the accumulation
of myths. Hence came respectively, Law and Morality: the one growing ever
more concrete, the other more abstract; the authority of the one ever on
the decrease, that of the other ever on the increase; originally the same,
but now placed daily in more marked antagonism.
Simultaneously there has been going on a separation of the institutions
administering these two codes of conduct. While they were yet one, of
course Church and State were one: the king was arch-priest, not nominally,
but really--alike the giver of new commands and the chief interpreter of
the old commands; and the deputy-priests coming out of his family were thus
simply expounders of the dictates of their ancestry: at first as
recollected, and afterwards as ascertained by professed interviews with
them. This union--which still existed practically during the middle ages,
when the authority of kings was mixed up with the authority of the pope,
when there were bishop-rulers having all the powers of feudal lords, and
when priests punished by penances--has been, step by step, becoming less
close. Though monarchs are still "defenders of the faith," and
ecclesiastical chiefs, they are but nominally such. Though bishops still
have civil power, it is not what they once had. Protestantism shook loose
the bonds of union; Dissent has long been busy in organizing a mechanism
for the exercise of religious control, wholly independent of law; in
America, a separate organization for that purpose already exists; and if
anything is to be hoped from the Anti-State-Church Association--or, as it
has been newly named, "The Society for the Liberation of Religion from
State Patronage and Control"--we shall presently have a separate
organization here also.
Thus alike in authority, in essence, and in form, political and spiritual
rule have been ever more widely diverging from the same root. That
increasing division of labour which marks the progress of society in other
things, marks it also in this separation of government into civil and
religious; and if we observe how the morality which forms the substance of
religions in general, is beginning to be purified from the associated
creeds, we may anticipate that this division will be ultimately carried
much further.
Passing now to the third species of control--that of Manners--we shall find
that this, too, while it had a common genesis with the others, has
gradually come to have a distinct sphere and a special embodiment. Among
early aggregations of men before yet social observances existed, the sole
forms of courtesy known were the signs of submission to the strong man; as
the sole law was his will, and the sole religion the awe of his supposed
supernaturalness. Originally, ceremonies were modes of behaviour to the
god-king. Our commonest titles have been derived from his names. And all
salutations were primarily worship paid to him. Let us trace out these
truths in detail, beginning with titles.
The fact already noticed, that the names of early kings among divers races
are formed by the addition of certain syllables to the names of their
gods--which certain syllables, like our _Mac_ and _Fitz_, probably mean
"son of," or "descended from"--at once gives meaning to the term _Father_
as a divine title. And when we read, in Selden, that "the composition out
of these names of Deities was not only proper to Kings: their Grandes and
more honorable Subjects" (no doubt members of the royal race) "had
sometimes the like;" we see how the term _Father_, properly used by these
also, and by their multiplying descendants, came to be a title used by the
people in general. And it is significant as bearing on this point, that
among the most barbarous nation in Europe, where belief in the divine
nature of the ruler still lingers, _Father_ in this higher sense is still a
regal distinction. When, again, we remember how the divinity at first
ascribed to kings was not a complimentary fiction but a supposed fact; and
how, further, under the Fetish philosophy the celestial bodies are believed
to be personages who once lived among men; we see that the appellations of
oriental rulers, "Brother to the Sun," &c., were probably once expressive
of a genuine belief; and have simply, like many other things, continued in
use after all meaning has gone out of them. We may infer, too, that the
titles God, Lord, Divinity, were given to primitive rulers literally--that
the _nostra divinitas_ applied to the Roman emperors, and the various
sacred designations that have been borne by monarchs, down to the still
extant phrase, "Our Lord the King," are the dead and dying forms of what
were once living facts. From these names, God, Father, Lord, Divinity,
originally belonging to the God-king, and afterwards to God and the king,
the derivation of our commonest titles of respect is clearly traceable.
There is reason to think that these titles were originally proper names.
Not only do we see among the Egyptians, where Pharaoh was synonymous with
king, and among the Romans, where to be Caesar, meant to be Emperor, that
the proper names of the greatest men were transferred to their successors,
and so became class names; but in the Scandinavian mythology we may trace a
human title of honour up to the proper name of a divine personage. In
Anglo-Saxon _bealdor_, or _baldor_, means _Lord_; and Balder is the name of
the favourite of Odin's sons--the gods who with him constitute the Teutonic
Pantheon. How these names of honour became general is easily understood.
The relatives of the primitive kings--the grandees described by Selden as
having names formed on those of the gods, and shown by this to be members
of the divine race--necessarily shared in the epithets, such as _Lord_,
descriptive of superhuman relationships and nature. Their ever-multiplying
offspring inheriting these, gradually rendered them comparatively common.
And then they came to be applied to every man of power: partly from the
fact that, in these early days when men conceived divinity simply as a
stronger kind of humanity, great persons could be called by divine epithets
with but little exaggeration; partly from the fact that the unusually
potent were apt to be considered as unrecognized or illegitimate
descendants of "the strong, the destroyer, the powerful one;" and partly,
also, from compliment and the desire to propitiate.
Progressively as superstition diminished, this last became the sole cause.
And if we remember that it is the nature of compliment, as we daily hear
it, to attribute more than is due--that in the constantly widening
application of "esquire," in the perpetual repetition of "your honour" by
the fawning Irishman, and in the use of the name "gentleman" to any
coalheaver or dustman by the lower classes of London, we have current
examples of the depreciation of titles consequent on compliment--and that
in barbarous times, when the wish to propitiate was stronger than now, this
effect must have been greater; we shall see that there naturally arose an
extensive misuse of all early distinctions. Hence the facts, that the Jews
called Herod a god; that _Father_, in its higher sense, was a term used
among them by servants to masters; that _Lord_ was applicable to any person
of worth and power. Hence, too, the fact that, in the later periods of the
Roman Empire, every _ man saluted his neighbour as _Dominus_ and _Rex_.
But it is in the titles of the middle ages, and in the growth of our modern
ones out of them, that the process is most clearly seen. _Herr_, _Don_,
_Signior_, _Seigneur_, _Sennor_, were all originally names of rulers--of
feudal lords. By the complimentary use of these names to all who could, on
any pretence, be supposed to merit them, and by successive degradations of
them from each step in the descent to a still lower one, they have come to
be common forms of address. At first the phrase in which a serf accosted
his despotic chief, _mein herr_ is now familiarly applied in Germany to
ordinary people. The Spanish title _Don_, once proper to noblemen and
gentlemen only, is now accorded to all classes. So, too, is it with
_Signior_ in Italy. _Seigneur_, and _Monseigneur_, by contraction in
_Sieur_ and _Monsieur_, have produced the term of respect claimed by every
Frenchman. And whether _Sire_ be or be not a like contraction of _Signior_,
it is clear that, as it was borne by sundry of the ancient feudal lords of
France, who, as Selden says, "affected rather to bee stiled by the name of
_Sire_ than Baron, as _Le Sire de Montmorencie_, _Le Sire de Beaulieu_, and
the like," and as it has been commonly used to monarchs, our word _Sir_,
which is derived from it, originally meant lord or king. Thus, too, is it
with feminine titles. _Lady_, which, according to Horne Tooke, means
_exalted_, and was at first given only to the few, is now given to all
women of education. _Dame_, once an honourable name to which, in old books,
we find the epithets of "highborn" and "stately" affixed, has now, by
repeated widenings of its application, become relatively a term of
contempt. And if we trace the compound of this, _ma Dame_, through its
contractions--_Madam_, _ma'am_, _mam_, _mum_, we find that the "Yes'm" of
Sally to her mistress is originally equivalent to "Yes, my exalted," or
"Yes, your highness." Throughout, therefore, the genesis of words of honour
has been the same. Just as with the Jews and with the Romans, has it been
with the modern Europeans. Tracing these everyday names to their primitive
significations of _lord_ and _king_, and remembering that in aboriginal
societies these were applied only to the gods and their descendants, we
arrive at the conclusion that our familiar _Sir_ and _Monsieur_ are, in
their primary and expanded meanings, terms of adoration.
Further to illustrate this gradual depreciation of titles, and to confirm
the inference drawn, it may be well to notice in passing, that the oldest
of them have, as might be expected, been depreciated to the greatest
extent. Thus, _Master_--a word proved by its derivation and by the
similarity of the connate words in other languages (Fr., _maitre_ for
_master_; Russ., _master_; Dan., _meester_; Ger., _meister_) to have been
one of the earliest in use for expressing lordship--has now become
applicable to children only, and under the modification of "Mister," to
persons next above the labourer. Again, knighthood, the oldest kind of
dignity, is also the lowest; and Knight Bachelor, which is the lowest order
of knighthood, is more ancient than any other of the orders. Similarly,
too, with the peerage: Baron is alike the earliest and least elevated of
its divisions. This continual degradation of all names of honor has, from
time to time, made it requisite to introduce new ones having that
distinguishing effect which the originals had lost by generality of use;
just as our habit of misapplying superlatives has, by gradually destroying
their force, entailed the need for fresh ones. And if, within the last
thousand years, this process has produced effects thus marked, we may
readily conceive how, during previous thousands, the titles of gods and
demi-gods came to be used to all persons exercising power; as they have
since come to be used to persons of respectability.
If from names of honour we turn to phrases of honour, we find similar
facts. The Oriental styles of address, applied to ordinary people--"I am
your slave," "All I have is yours," "I am your sacrifice"--attribute to the
individual spoken to the same greatness that _Monsieur_ and _My Lord_ do:
they ascribe to him the character of an all-powerful ruler, so immeasurably
superior to the speaker as to be his owner. So, likewise, with the Polish
expressions of respect--"I throw myself under your feet," "I kiss your
feet." In our now meaningless subscription to a formal letter--"Your most
obedient servant,"--the same thing is visible. Nay, even in the familiar
signature "Yours faithfully," the "yours," if interpreted as originally
meant, is the expression of a slave to his master.
All these dead forms were once living embodiments of fact--were primarily
the genuine indications of that submission to authority which they verbally
assert; were afterwards naturally used by the weak and cowardly to
propitiate those above them; gradually grew to be considered the due of
such; and, by a continually wider misuse, have lost their meanings, as
_Sir_ and _Master_ have done. That, like titles, they were in the beginning
used only to the God-king, is indicated by the fact that, like titles, they
were subsequently used in common to God and the king. Religious worship has
ever largely consisted of professions of obedience, of being God's
servants, of belonging to him to do what he will with. Like titles,
therefore, these common phrases of honour had a devotional origin.
Perhaps, however, it is in the use of the word _you_ as a singular pronoun
that the popularizing of what were once supreme distinctions is most
markedly illustrated. This speaking of a single individual in the plural,
was originally an honour given only to the highest--was the reciprocal of
the imperial "we" assumed by such. Yet now, by being applied to
successively lower and lower classes, it has become all but universal. Only
by one sect of Christians, and in a few secluded districts, is the
primitive _thou_ still used. And the _you_, in becoming common to all ranks
has simultaneously lost every vestige of the honour once attaching to it.
But the genesis of Manners out of forms of allegiance and worship, is above
all shown in men's modes of salutation. Note first the significance of the
word. Among the Romans, the _salutatio_ was a daily homage paid by clients
and inferiors to superiors. This was alike the case with civilians and in
the army. The very derivation of our word, therefore, is suggestive of
submission. Passing to particular forms of obeisance (mark the word again),
let us begin with the Eastern one of baring the feet. This was, primarily,
a mark of reverence, alike to a god and a king. The act of Moses before the
burning bush, and the practice of Mahometans, who are sworn on the Koran
with their shoes off, exemplify the one employment of it; the custom of the
Persians, who remove their shoes on entering the presence of their monarch,
exemplifies the other. As usual, however, this homage, paid next to
inferior rulers, has descended from grade to grade. In India, it is a
common mark of respect; a polite man in Turkey always leaves his shoes at
the door, while the lower orders of Turks never enter the presence of their
superiors but in their stockings; and in Japan, this baring of the feet is
an ordinary salutation of man to man.
Take another case. Selden, describing the ceremonies of the Romans,
says:--"For whereas it was usual either to kiss the Images of their Gods,
or adoring them, to stand somewhat off before them, solemnly moving the
right hand to the lips, and then, casting it as if they had cast kisses, to
turne the body on the same hand (which was the right forme of Adoration),
it grew also by custom, first that the emperors, being next to Deities, and
by some accounted as Deities, had the like done to them in acknowledgment
of their Greatness." If, now, we call to mind the awkward salute of a
village school-boy, made by putting his open hand up to his face and
describing a semicircle with his forearm; and if we remember that the
salute thus used as a form of reverence in country districts, is most
likely a remnant of the feudal times; we shall see reason for thinking that
our common wave of the hand to a friend across the street, represents what
was primarily a devotional act.
Similarly have originated all forms of respect depending upon inclinations
of the body. Entire prostration is the aboriginal sign of submission. The
passage of Scripture, "Thou hast put all under his feet," and that other
one, so suggestive in its anthropomorphism, "The Lord said unto my Lord,
sit thou at my right hand, until I make thine enemies thy footstool,"
imply, what the Assyrian sculptures fully bear out, that it was the
practice of the ancient god-kings of the East to trample upon the
conquered. And when we bear in mind that there are existing savages who
signify submission by placing the neck under the foot of the person
submitted to, it becomes obvious that all prostration, especially when
accompanied by kissing the foot, expressed a willingness to be trodden
upon--was an attempt to mitigate wrath by saying, in signs, "Tread on me if
you will." Remembering, further, that kissing the foot, as of the Pope and
of a saint's statue, still continues in Europe to be a mark of extreme
reverence; that prostration to feudal lords was once general; and that its
disappearance must have taken place, not abruptly, but by gradual
modification into something else; we have ground for deriving from these
deepest of humiliations all inclinations of respect; especially as the
transition is traceable. The reverence of a Russian serf, who bends his
head to the ground, and the salaam of the Hindoo, are abridged
prostrations; a bow is a short salaam; a nod is a short bow.
Should any hesitate to admit this conclusion, then perhaps, on being
reminded that the lowest of these obeisances are common where the
submission is most abject; that among ourselves the profundity of the bow
marks the amount of respect; and lastly, that the bow is even now used
devotionally in our churches--by Catholics to their altars, and by
Protestants at the name of Christ--they will see sufficient evidence for
thinking that this salutation also was originally worship.
The same may be said, too, of the curtsy, or courtesy, as it is otherwise
written. Its derivation from _courtoisie_, courteousness, that is,
behaviour like that at court, at once shows that it was primarily the
reverence paid to a monarch. And if we call to mind that falling upon the
knees, or upon one knee, has been a common obeisance of subjects to rulers;
that in ancient manuscripts and tapestries, servants are depicted as
assuming this attitude while offering the dishes to their masters at table;
and that this same attitude is assumed towards our own queen at every
presentation; we may infer, what the character of the curtsy itself
suggests, that it is an abridged act of kneeling. As the word has been
contracted from _courtoisie_ into curtsy; so the motion has been contracted
from a placing of the knee on the floor, to a lowering of the knee towards
the floor. Moreover, when we compare the curtsy of a lady with the awkward
one a peasant girl makes, which, if continued, would bring her down on both
knees, we may see in this last a remnant of that greater reverence required
of serfs. And when, from considering that simple kneeling of the West,
still represented by the curtsy, we pass Eastward, and note the attitude of
the Mahomedan worshipper, who not only kneels but bows his head to the
ground, we may infer that the curtsy also, is an evanescent form of the
aboriginal prostration.
In further evidence of this it may be remarked, that there has but recently
disappeared from the salutations of men, an action having the same
proximate derivation with the curtsy. That backward sweep of the foot with
which the conventional stage-sailor accompanies his bow--a movement which
prevailed generally in past generations, when "a bow and a scrape" went
together, and which, within the memory of living persons, was made by boys
to their schoolmaster with the effect of wearing a hole in the floor--is
pretty clearly a preliminary to going on one knee. A motion so ungainly
could never have been intentionally introduced; even if the artificial
introduction of obeisances were possible. Hence we must regard it as the
remnant of something antecedent: and that this something antecedent was
humiliating maybe inferred from the phrase, "scraping an acquaintance;"
which, being used to denote the gaining of favour by obsequiousness,
implies that the scrape was considered a mark of servility--that is, of
_serf_-ility.
Consider, again, the uncovering of the head. Almost everywhere this has
been a sign of reverence, alike in temples and before potentates; and it
yet preserves among us some of its original meaning. Whether it rains,
hails, or shines, you must keep your head bare while speaking to the
monarch; and on no plea may you remain covered in a place of worship. As
usual, however, this ceremony, at first a submission to gods and kings, has
become in process of time a common civility. Once an acknowledgment of
another's unlimited supremacy, the removal of the hat is now a salute
accorded to very ordinary persons, and that uncovering, originally reserved
for entrance into "the house of God," good manners now dictates on entrance
into the house of a common labourer.
Standing, too, as a mark of respect, has undergone like extensions in its
application. Shown, by the practice in our churches, to be intermediate
between the humiliation signified by kneeling and the self-respect which
sitting implies, and used at courts as a form of homage when more active
demonstrations of it have been made, this posture is now employed in daily
life to show consideration; as seen alike in the attitude of a servant
before a master, and in that rising which politeness prescribes on the
entrance of a visitor.
Many other threads of evidence might have been woven into our argument. As,
for example, the significant fact, that if we trace back our still existing
law of primogeniture--if we consider it as displayed by Scottish clans, in
which not only ownership but government devolved from the beginning on the
eldest son of the eldest--if we look further back, and observe that the old
titles of lordship, _Signor_, _Seigneur_, _Sennor_, _Sire_, _Sieur_, all
originally mean, senior, or elder--if we go Eastward, and find that
_Sheick_ has a like derivation, and that the Oriental names for priests, as
_Pir_, for instance, are literally interpreted _old man_--if we note in
Hebrew records how primeval is the ascribed superiority of the first-born,
how great the authority of elders, and how sacred the memory of
patriarchs--and if, then, we remember that among divine titles are "Ancient
of Days," and "Father of Gods and men;"--we see how completely these facts
harmonize with the hypothesis, that the aboriginal god is the first man
sufficiently great to become a tradition, the earliest whose power and
deeds made him remembered; that hence antiquity unavoidably became
associated with superiority, and age with nearness in blood to "the
powerful one;" that so there naturally arose that domination of the eldest
which characterizes all history, and that theory of human degeneracy which
even yet survives.
We might further dwell on the facts, that _Lord_ signifies high-born, or,
as the same root gives a word meaning heaven, possibly heaven-born; that,
before it became common, _Sir_ or _Sire_, as well as _Father_, was the
distinction of a priest; that _worship_, originally worth-ship--a term of
respect that has been used commonly, as well as to magistrates--is also our
term for the act of attributing greatness or worth to the Deity; so that to
ascribe worth-ship to a man is to worship him. We might make much of the
evidence that all early governments are more or less distinctly theocratic;
and that among ancient Eastern nations even the commonest forms and customs
appear to have been influenced by religion. We might enforce our argument
respecting the derivation of ceremonies, by tracing out the aboriginal
obeisance made by putting dust on the head, which probably symbolizes
putting the head in the dust: by affiliating the practice prevailing among
certain tribes, of doing another honour by presenting him with a portion of
hair torn from the head--an act which seems tantamount to saying, "I am
your slave;" by investigating the Oriental custom of giving to a visitor
any object he speaks of admiringly, which is pretty clearly a carrying out
the compliment, "All I have is yours."
Without enlarging, however, on these and many minor facts, we venture to
think that the evidence already assigned is sufficient to justify our
position. Had the proofs been few or of one kind, little faith could have
been placed in the inference. But numerous as they are, alike in the case
of titles, in that of complimentary phrases, and in that of
salutes--similar and simultaneous, too, as the process of depreciation has
been in all of these; the evidences become strong by mutual confirmation.
And when we recollect, also, that not only have the results of this process
been visible in various nations and in all times, but that they are
occurring among ourselves at the present moment, and that the causes
assigned for previous depreciations may be seen daily working out other
ones--when we recollect this, it becomes scarcely possible to doubt that
the process has been as alleged; and that our ordinary words, acts, and
phrases of civility were originally acknowledgments of submission to
another's omnipotence.
Thus the general doctrine, that all kinds of government exercised over men
were at first one government--that the political, the religious, and the
ceremonial forms of control are divergent branches of a general and once
indivisible control--begins to look tenable. When, with the above facts
fresh in mind, we read primitive records, and find that "there were giants
in those days"--when we remember that in Eastern traditions Nimrod, among
others, figures in all the characters of giant, king, and divinity--when we
turn to the sculptures exhumed by Mr. Layard, and contemplating in them the
effigies of kings driving over enemies, trampling on prisoners, and adored
by prostrate slaves, then observe how their actions correspond to the
primitive names for the divinity, "the strong," "the destroyer," "the
powerful one"--when we find that the earliest temples were also the
residences of the kings--and when, lastly, we discover that among races of
men still living, there are current superstitions analogous to those which
old records and old buildings indicate; we begin to realize the probability
of the hypothesis that has been set forth.
Going back, in imagination, to the remote era when men's theories of things
were yet unformed; and conceiving to ourselves the conquering chief as
dimly figured in ancient myths, and poems, and ruins; we may see that all
rules of conduct whatever spring from his will. Alike legislator and judge,
all quarrels among his subjects are decided by him; and his words become
the Law. Awe of him is the incipient Religion; and his maxims furnish its
first precepts. Submission is made to him in the forms he prescribes; and
these give birth to Manners. From the first, time develops political
allegiance and the administration of justice; from the second, the worship
of a being whose personality becomes ever more vague, and the inculcation
of precepts ever more abstract; from the third, forms of honour and the
rules of etiquette.
In conformity with the law of evolution of all organized bodies, that
general functions are gradually separated into the special functions
constituting them, there have grown up in the social organism for the
better performance of the governmental office, an apparatus of law-courts,
judges, and barristers; a national church, with its bishops and priests;
and a system of caste, titles, and ceremonies, administered by society at
large. By the first, overt aggressions are cognized and punished; by the
second, the disposition to commit such aggressions is in some degree
checked; by the third, those minor breaches of good conduct, which the
others do not notice, are denounced and chastised. Law and Religion control
behaviour in its essentials: Manners control it in its details. For
regulating those daily actions which are too numerous and too unimportant
to be officially directed, there comes into play this subtler set of
restraints. And when we consider what these restraints are--when we analyze
the words, and phrases, and salutes employed, we see that in origin as in
effect, the system is a setting up of temporary governments between all men
who come in contact, for the purpose of better managing the intercourse
between them.
* * * * *
From the proposition, that these several kinds of government are
essentially one, both in genesis and function, may be deduced several
important corollaries, directly bearing on our special topic.
Let us first notice, that there is not only a common origin and office for
all forms of rule, but a common necessity for them. The aboriginal man,
coming fresh from the killing of bears and from lying in ambush for his
enemy, has, by the necessities of his condition, a nature requiring to be
curbed in its every impulse. Alike in war and in the chase, his daily
discipline has been that of sacrificing other creatures to his own needs
and passions. His character, bequeathed to him by ancestors who led similar
lives, is moulded by this discipline--is fitted to this existence. The
unlimited selfishness, the love of inflicting pain, the bloodthirstiness,
thus kept active, he brings with him into the social state. These
dispositions put him in constant danger of conflict with his equally savage
neighbour. In small things as in great, in words as in deeds, he is
aggressive; and is hourly liable to the aggressions of others like natured.
Only, therefore, by the most rigorous control exercised over all actions,
can the primitive unions of men be maintained. There must be a ruler
strong, remorseless, and of indomitable will; there must be a creed
terrible in its threats to the disobedient; and there must be the most
servile submission of all inferiors to superiors. The law must be cruel;
the religion must be stern; the ceremonies must be strict.
The co-ordinate necessity for these several kinds of restraint might be
largely illustrated from history were there space. Suffice it to point out,
that where the civil power has been weak, the multiplication of thieves,
assassins, and banditti, has indicated the approach of social dissolution;
that when, from the corruptness of its ministry, religion has lost its
influence, as it did just before the Flagellants appeared, the State has
been endangered; and that the disregard of established social observances
has ever been an accompaniment of political revolutions. Whoever doubts the
necessity for a government of manners proportionate in strength to the
co-existing political and religious governments, will be convinced on
calling to mind that until recently even elaborate codes of behaviour
failed to keep gentlemen from quarrelling in the streets and fighting duels
in taverns; and on remembering further, that even now people exhibit at the
doors of a theatre, where there is no ceremonial law to rule them, a degree
of aggressiveness which would produce confusion if carried into social
intercourse.
As might be expected, we find that, having a common origin and like general
functions, these several controlling agencies act during each era with
similar degrees of vigour. Under the Chinese despotism, stringent and
multitudinous in its edicts and harsh in the enforcement of them, and
associated with which there is an equally stern domestic despotism
exercised by the eldest surviving male of the family, there exists a system
of observances alike complicated and rigid. There is a tribunal of
ceremonies. Previous to presentation at court, ambassadors pass many days
in practising the required forms. Social intercourse is cumbered by endless
compliments and obeisances. Class distinctions are strongly marked by
badges. The chief regret on losing an only son is, that there will be no
one to perform the sepulchral rites. And if there wants a definite measure
of the respect paid to social ordinances, we have it in the torture to
which ladies submit in having their feet crushed. In India, and indeed
throughout the East, there exists a like connection between the pitiless
tyranny of rulers, the dread terrors of immemorial creeds, and the rigid
restraint of unchangeable customs: the caste regulations continue still
unalterable; the fashions of clothes and furniture have remained the same
for ages; suttees are so ancient as to be mentioned by Strabo and Diodorus
Siculus; justice is still administered at the palace-gates as of old; in
short, "every usage is a precept of religion and a maxim of jurisprudence."
A similar relationship of phenomena was exhibited in Europe during the
Middle Ages. While all its governments were autocratic, while feudalism
held sway, while the Church was unshorn of its power, while the criminal
code was full of horrors and the hell of the popular creed full of terrors,
the rules of behaviour were both more numerous and more carefully conformed
to than now. Differences of dress marked divisions of rank. Men were
limited by law to a certain width of shoe-toes; and no one below a
specified degree might wear a cloak less than so many inches long. The
symbols on banners and shields were carefully attended to. Heraldry was an
important branch of knowledge. Precedence was strictly insisted on. And
those various salutes of which we now use the abridgments were gone through
in full. Even during our own last century, with its corrupt House of
Commons and little-curbed monarchs, we may mark a correspondence of social
formalities. Gentlemen were still distinguished from lower classes by
dress; people sacrificed themselves to inconvenient requirements--as
powder, hooped petticoats, and towering head-dresses; and children
addressed their parents as _Sir_ and _Madam_.
A further corollary naturally following this last, and almost, indeed,
forming part of it, is, that these several kinds of government
decrease in stringency at the same rate. Simultaneously with the
decline in the influence of priesthoods, and in the fear of eternal
torments--simultaneously with the mitigation of political tyranny, the
growth of popular power, and the amelioration of criminal codes; has taken
place that diminution of formalities and that fading of distinctive marks,
now so observable. Looking at home, we may note that there is less
attention to precedence than there used to be. No one in our day ends an
interview with the phrase "your humble servant." The employment of the word
_Sir_, once general in social intercourse, is at present considered bad
breeding; and on the occasions calling for them, it is held vulgar to use
the words "Your Majesty," or "Your Royal Highness," more than once in a
conversation. People no longer formally drink each other's healths; and
even the taking wine with each other at dinner has ceased to be
fashionable. The taking-off of hats between gentlemen has been gradually
falling into disuse. Even when the hat is removed, it is no longer swept
out at arm's length, but is simply lifted. Hence the remark made upon us by
foreigners, that we take off our hats less than any other nation in
Europe--a remark that should be coupled with the other, that we are the
freest nation in Europe.
As already implied, this association of facts is not accidental. These
titles of address and modes of salutation, bearing about them, as they all
do, something of that servility which marks their origin, become
distasteful in proportion as men become more independent themselves, and
sympathise more with the independence of others. The feeling which makes
the modern gentleman tell the labourer standing bareheaded before him to
put on his hat--the feeling which gives us a dislike to those who cringe
and fawn--the feeling which makes us alike assert our own dignity and
respect that of others--the feeling which thus leads us more and more to
discountenance all forms and names which confess inferiority and
submission; is the same feeling which resists despotic power and
inaugurates popular government, denies the authority of the Church and
establishes the right of private judgment.
A fourth fact, akin to the foregoing, is, that these several kinds of
government not only decline together, but corrupt together. By the same
process that a Court of Chancery becomes a place not for the administration
of justice, but for the withholding of it--by the same process that a
national church, from being an agency for moral control, comes to be merely
a thing of formulas and tithes and bishoprics--by this same process do
titles and ceremonies that once had a meaning and a power become empty
forms.
Coats of arms which served to distinguish men in battle, now figure on the
carriage panels of retired grocers. Once a badge of high military rank, the
shoulder-knot has become, on the modern footman, a mark of servitude. The
name Banneret, which once marked a partially-created Baron--a Baron who had
passed his military "little go"--is now, under the modification of Baronet,
applicable to any one favoured by wealth or interest or party feeling.
Knighthood has so far ceased to be an honour, that men now honour
themselves by declining it. The military dignity _Escuyer_ has, in the
modern Esquire, become a wholly unmilitary affix. Not only do titles, and
phrases, and salutes cease to fulfil their original functions, but the
whole apparatus of social forms tends to become useless for its original
purpose--the facilitation of social intercourse. Those most learned in
ceremonies, and most precise in the observance of them, are not always the
best behaved; as those deepest read in creeds and scriptures are not
therefore the most religious; nor those who have the clearest notions of
legality and illegality, the most honest. Just as lawyers are of all men
the least noted for probity; as cathedral towns have a lower moral
character than most others; so, if Swift is to be believed, courtiers are
"the most insignificant race of people that the island can afford, and with
the smallest tincture of good manners."
But perhaps it is in that class of social observances comprehended under
the term Fashion, which we must here discuss parenthetically, that this
process of corruption is seen with the greatest distinctness. As contrasted
with Manners, which dictate our minor acts in relation to other persons,
Fashion dictates our minor acts in relation to ourselves. While the one
prescribes that part of our deportment which directly affects our
neighbours; the other prescribes that part of our deportment which is
primarily personal, and in which our neighbours are concerned only as
spectators. Thus distinguished as they are, however, the two have a common
source. For while, as we have shown, Manners originate by imitation of the
behaviour pursued _towards_ the great; Fashion originates by imitation _of_
the behaviour of the great. While the one has its derivation in the titles,
phrases, and salutes used _to_ those in power; the other is derived from
the habits and appearances exhibited _by_ those in power.
The Carib mother who squeezes her child's head into a shape like that of
the chief; the young savage who makes marks on himself similar to the scars
carried by the warriors of his tribe (which is probably the origin of
tattooing); the Highlander who adopts the plaid worn by the head of his
clan; the courtiers who affect greyness, or limp, or cover their necks, in
imitation of their king; and the people who ape the courtiers; are alike
acting under a kind of government connate with that of Manners, and, like
it too, primarily beneficial. For notwithstanding the numberless
absurdities into which this copyism has led the people, from nose-rings to
ear-rings, from painted faces to beauty-spots, from shaven heads to
powdered wigs, from filed teeth and stained nails to bell-girdles, peaked
shoes, and breeches stuffed with bran,--it must yet be concluded, that as
the strong men, the successful men, the men of will, intelligence, and
originality, who have got to the top, are, on the average, more likely to
show judgment in their habits and tastes than the mass, the imitation of
such is advantageous.
By and by, however, Fashion, corrupting like these other forms of rule,
almost wholly ceases to be an imitation of the best, and becomes an
imitation of quite other than the best. As those who take orders are not
those having a special fitness for the priestly office, but those who see
their way to a living by it; as legislators and public functionaries do not
become such by virtue of their political insight and power to rule, but by
virtue of birth, acreage, and class influence; so, the self-elected clique
who set the fashion, gain this prerogative, not by their force of nature,
their intellect, their higher worth or better taste, but gain it solely by
their unchecked assumption. Among the initiated are to be found neither the
noblest in rank, the chief in power, the best cultured, the most refined,
nor those of greatest genius, wit, or beauty; and their reunions, so far
from being superior to others, are noted for their inanity. Yet, by the
example of these sham great, and not by that of the truly great, does
society at large now regulate its goings and comings, its hours, its dress,
its small usages. As a natural consequence, these have generally little or
none of that suitableness which the theory of fashion implies they should
have. But instead of a continual progress towards greater elegance and
convenience, which might be expected to occur did people copy the ways of
the really best, or follow their own ideas of propriety, we have a reign of
mere whim, of unreason, of change for the sake of change, of wanton
oscillations from either extreme to the other--a reign of usages without
meaning, times without fitness, dress without taste. And thus life _a la
mode_, instead of being life conducted in the most rational manner, is life
regulated by spendthrifts and idlers, milliners and tailors, dandies and
silly women.
To these several corollaries--that the various orders of control exercised
over men have a common origin and a common function, are called out by
co-ordinate necessities and co-exist in like stringency, decline together
and corrupt together--it now only remains to add that they become needless
together. Consequent as all kinds of government are upon the unfitness of
the aboriginal man for social life; and diminishing in coerciveness as they
all do in proportion as this unfitness diminishes; they must one and all
come to an end as humanity acquires complete adaptation to its new
conditions. That discipline of circumstances which has already wrought out
such great changes in us, must go on eventually to work out yet greater
ones. That daily curbing of the lower nature and culture of the higher,
which out of cannibals and devil worshippers has evolved philanthropists,
lovers of peace, and haters of superstition, cannot fail to evolve out of
these, men as much superior to them as they are to their progenitors. The
causes that have produced past modifications are still in action; must
continue in action as long as there exists any incongruity between man's
desires and the requirements of the social state; and must eventually make
him organically fit for the social state. As it is now needless to forbid
man-eating and Fetishism, so will it ultimately become needless to forbid
murder, theft, and the minor offences of our criminal code. When human
nature has grown into conformity with the moral law, there will need no
judges and statute-books; when it spontaneously takes the right course in
all things, as in some things it does already, prospects of future reward
or punishment will not be wanted as incentives; and when fit behaviour has
become instinctive, there will need no code of ceremonies to say how
behaviour shall be regulated.
Thus, then, may be recognised the meaning, the naturalness, the necessity
of those various eccentricities of reformers which we set out by
describing. They are not accidental; they are not mere personal caprices,
as people are apt to suppose. On the contrary, they are inevitable results
of the law of relationship above illustrated. That community of genesis,
function, and decay which all forms of restraint exhibit, is simply the
obverse of the fact at first pointed out, that they have in two sentiments
of human nature a common preserver and a common destroyer. Awe of power
originates and cherishes them all: love of freedom undermines and
periodically weakens them all. The one defends despotism and asserts the
supremacy of laws, adheres to old creeds and supports ecclesiastical
authority, pays respect to titles and conserves forms; the other, putting
rectitude above legality, achieves periodical instalments of political
liberty, inaugurates Protestantism and works out its consequences, ignores
the senseless dictates of Fashion and emancipates men from dead customs.
To the true reformer no institution is sacred, no belief above criticism.
Everything shall conform itself to equity and reason; nothing shall be
saved by its prestige. Conceding to each man liberty to pursue his own ends
and satisfy his own tastes, he demands for himself like liberty; and
consents to no restrictions on this, save those which other men's equal
claims involve. No matter whether it be an ordinance of one man, or an
ordinance of all men, if it trenches on his legitimate sphere of action, he
denies its validity. The tyranny that would impose on him a particular
style of dress and a set mode of behaviour, he resists equally with the
tyranny that would limit his buyings and sellings, or dictate his creed.
Whether the regulation be formally made by a legislature, or informally
made by society at large--whether the penalty for disobedience be
imprisonment, or frowns and social ostracism, he sees to be a question of
no moment. He will utter his belief notwithstanding the threatened
punishment; he will break conventions spite of the petty persecutions that
will be visited on him. Show him that his actions are inimical to his
fellow-men, and he will pause. Prove that he is disregarding their
legitimate claims--that he is doing what in the nature of things must
produce unhappiness; and he will alter his course. But until you do
this--until you demonstrate that his proceedings are essentially
inconvenient or inelegant, essentially irrational, unjust, or ungenerous,
he will persevere.
Some, indeed, argue that his conduct _is_ unjust and ungenerous. They say
that he has no right to annoy other people by his whims; that the gentleman
to whom his letter comes with no "Esq." appended to the address, and the
lady whose evening party he enters with gloveless hands, are vexed at what
they consider his want of respect, or want of breeding; that thus his
eccentricities cannot be indulged save at the expense of his neighbours'
feelings; and that hence his nonconformity is in plain terms selfishness.
He answers that this position, if logically developed, would deprive men of
all liberty whatever. Each must conform all his acts to the public taste,
and not his own. The public taste on every point having been once
ascertained, men's habits must thenceforth remain for ever fixed; seeing
that no man can adopt other habits without sinning against the public
taste, and giving people disagreeable feelings. Consequently, be it an era
of pig-tails or high-heeled shoes, of starched ruffs or trunk-hose, all
must continue to wear pig-tails, high-heeled shoes, starched ruffs, or
trunk-hose to the crack of doom.
If it be still urged that he is not justified in breaking through others'
forms that he may establish his own, and so sacrificing the wishes of many
to the wishes of one, he replies that all religious and political changes
might be negatived on like grounds. He asks whether Luther's sayings and
doings were not extremely offensive to the mass of his contemporaries;
whether the resistance of Hampden was not disgusting to the time-servers
around him; whether every reformer has not shocked men's prejudices, and
given immense displeasure by the opinions he uttered. The affirmative
answer he follows up by demanding what right the reformer has, then, to
utter these opinions; whether he is not sacrificing the feelings of many to
the feelings of one: and so proves that, to be consistent, his antagonists
must condemn not only all nonconformity in actions, but all nonconformity
in thoughts.
His antagonists rejoin that _his_ position, too, may be pushed to an
absurdity. They argue that if a man may offend by the disregard of some
forms, he may as legitimately do so by the disregard of all; and they
inquire--Why should he not go out to dinner in a dirty shirt, and with an
unshorn chin? Why should he not spit on the drawing-room carpet, and
stretch his heels up to the mantel-shelf?
The convention-breaker answers, that to ask this, implies a confounding of
two widely-different classes of actions--the actions that are _essentially_
displeasurable to those around, with the actions that are but
_incidentally_ displeasurable to them. He whose skin is so unclean as to
offend the nostrils of his neighbours, or he who talks so loudly as to
disturb a whole room, may be justly complained of, and rightly excluded by
society from its assemblies. But he who presents himself in a surtout in
place of a dress-coat, or in brown trousers instead of black, gives offence
not to men's senses, or their innate tastes, but merely to their
prejudices, their bigotry of convention. It cannot be said that his costume
is less elegant or less intrinsically appropriate than the one prescribed;
seeing that a few hours earlier in the day it is admired. It is the implied
rebellion, therefore, that annoys. How little the cause of quarrel has to
do with the dress itself, is seen in the fact that a century ago black
clothes would have been thought preposterous for hours of recreation, and
that a few years hence some now forbidden style may be nearer the
requirements of Fashion than the present one. Thus the reformer explains
that it is not against the natural restraints, but against the artificial
ones, that he protests; and that manifestly the fire of sneers and angry
glances which he has to bear, is poured upon him because he will not bow
down to the idol which society has set up.
Should he be asked how we are to distinguish between conduct that is
_absolutely_ disagreeable to others, and conduct that is _relatively_ so,
he answers, that they will distinguish themselves, if men will let them.
Actions intrinsically repugnant will ever be frowned upon, and must ever
remain as exceptional as now. Actions not intrinsically repugnant will
establish themselves as proper. No relaxation of customs will introduce the
practice of going to a party in muddy boots, and with unwashed hands; for
the dislike of dirt would continue were Fashion abolished to-morrow. That
love of approbation which now makes people so solicitous to be _en regle_
would still exist--would still make them careful of their personal
appearance--would still induce them to seek admiration by making themselves
ornamental--would still cause them to respect the natural laws of good
behaviour, as they now do the artificial ones. The change would simply be
from a repulsive monotony to a picturesque variety. And if there be any
regulations respecting which it is uncertain whether they are based on
reality or on convention, experiment will soon decide, if due scope be
allowed.
When at length the controversy comes round, as controversies often do, to
the point whence it started, and the "party of order" repeat their charge
against the rebel, that he is sacrificing the feelings of others to the
gratification of his own wilfulness, he replies once for all that they
cheat themselves by mis-statements. He accuses them of being so despotic,
that, not content with being masters over their own ways and habits, they
would be masters over his also; and grumble because he will not let them.
He merely asks the same freedom which they exercise; they, however, propose
to regulate his course as well as their own--to cut and clip his mode of
life into agreement with their approved pattern; and then charge him with
wilfulness and selfishness, because he does not quietly submit! He warns
them that he shall resist, nevertheless; and that he shall do so, not only
for the assertion of his own independence, but for their good. He tells
them that they are slaves, and know it not; that they are shackled, and
kiss their chains; that they have lived all their days in prison, and
complain at the walls being broken down. He says he must persevere,
however, with a view to his own release; and in spite of their present
expostulations, he prophesies that when they have recovered from the fright
which the prospect of freedom produces, they will thank him for aiding in
their emancipation.
Unamiable as seems this find-fault mood, offensive as is this defiant
attitude, we must beware of overlooking the truths enunciated, in dislike
of the advocacy. It is an unfortunate hindrance to all innovation, that in
virtue of their very function, the innovators stand in a position of
antagonism; and the disagreeable manners, and sayings, and doings, which
this antagonism generates, are commonly associated with the doctrines
promulgated. Quite forgetting that whether the thing attacked be good or
bad, the combative spirit is necessarily repulsive; and quite forgetting
that the toleration of abuses seems amiable merely from its passivity; the
mass of men contract a bias against advanced views, and in favour of
stationary ones, from intercourse with their respective adherents.
"Conservatism," as Emerson says, "is debonnair and social; reform is
individual and imperious." And this remains true, however vicious the
system conserved, however righteous the reform to be effected. Nay, the
indignation of the purists is usually extreme in proportion as the evils to
be got rid of are great. The more urgent the required change, the more
intemperate is the vehemence of its promoters. Let no one, then, confound
with the principles of this social nonconformity the acerbity and the
disagreeable self-assertion of those who first display it.
* * * * *
The most plausible objection raised against resistance to conventions, is
grounded on its impolicy, considered even from the progressist's point of
view. It is urged by many of the more liberal and intelligent--usually
those who have themselves shown some independence of behaviour in earlier
days--that to rebel in these small matters is to destroy your own power of
helping on reform in greater matters. "If you show yourself eccentric in
manners or dress, the world," they say, "will not listen to you. You will
be considered as crotchety, and impracticable. The opinions you express on
important subjects, which might have been treated with respect had you
conformed on minor points, will now inevitably be put down among your
singularities; and thus, by dissenting in trifles, you disable yourself
from spreading dissent in essentials."
Only noting, as we pass, that this is one of those anticipations which
bring about their own fulfilment--that it is because most who disapprove
these conventions do not show their disapproval, that the few who do show
it look eccentric--and that did all act out their convictions, no such
inference as the above would be drawn, and no such evil would
result;---noting this as we pass, we go on to reply that these social
restraints, and forms, and requirements, are not small evils, but among the
greatest. Estimate their sum total, and we doubt whether they would not
exceed most others. Could we add up the trouble, the cost, the jealousies,
vexations, misunderstandings, the loss of time and the loss of pleasure,
which these conventions entail--could we clearly realize the extent to
which we are all daily hampered by them, daily enslaved by them; we should
perhaps come to the conclusion that the tyranny of Mrs. Grundy is worse
than any other tyranny we suffer under. Let us look at a few of its hurtful
results; beginning with those of minor importance.
It produces extravagance. The desire to be _comme il faut_, which underlies
all conformities, whether of manners, dress, or styles of entertainment, is
the desire which makes many a spendthrift and many a bankrupt. To "keep up
appearances," to have a house in an approved quarter furnished in the
latest taste, to give expensive dinners and crowded _soirees_, is an
ambition forming the natural outcome of the conformist spirit. It is
needless to enlarge on these follies: they have been satirized by hosts of
writers, and in every drawing-room. All that here concerns us, is to point
out that the respect for social observances, which men think so
praiseworthy, has the same root with this effort to be fashionable in mode
of living; and that, other things equal, the last cannot be diminished
without the first being diminished also. If, now, we consider all that this
extravagance entails--if we count up the robbed tradesmen, the stinted
governesses, the ill-educated children, the fleeced relatives, who have to
suffer from it--if we mark the anxiety and the many moral delinquencies
which its perpetrators involve themselves in; we shall see that this regard
for conventions is not quite so innocent as it looks.
Again, it decreases the amount of social intercourse. Passing over the
reckless, and those who make a great display on speculation with the
occasional result of getting on in the world to the exclusion of much
better men, we come to the far larger class who, being prudent and honest
enough not to exceed their means, and yet having a strong wish to be
"respectable," are obliged to limit their entertainments to the smallest
possible number; and that each of these may be turned to the greatest
advantage in meeting the claims upon their hospitality, are induced to
issue their invitations with little or no regard to the comfort or mutual
fitness of their guests. A few inconveniently-large assemblies, made up of
people mostly strange to each other or but distantly acquainted, and having
scarcely any tastes in common, are made to serve in place of many small
parties of friends intimate enough to have some bond of thought and
sympathy. Thus the quantity of intercourse is diminished, and the quality
deteriorated. Because it is the custom to make costly preparations and
provide costly refreshments; and because it entails both less expense and
less trouble to do this for many persons on a few occasions than for few
persons on many occasions; the reunions of our less wealthy classes are
rendered alike infrequent and tedious.
Let it be further observed, that the existing formalities of social
intercourse drive away many who most need its refining influence: and drive
them into injurious habits and associations. Not a few men, and not the
least sensible men either, give up in disgust this going out to stately
dinners, and stiff evening-parties; and instead, seek society in clubs, and
cigar-divans, and taverns. "I'm sick of this standing about in
drawing-rooms, talking nonsense, and trying to look happy," will answer one
of them when taxed with his desertion. "Why should I any longer waste time
and money, and temper? Once I was ready enough to rush home from the office
to dress; I sported embroidered shirts, submitted to tight boots, and cared
nothing for tailors' and haberdashers' bills. I know better now. My
patience lasted a good while; for though I found each night pass stupidly,
I always hoped the next would make amends. But I'm undeceived. Cab-hire and
kid gloves cost more than any evening party pays for; or rather--it is
worth the cost of them to avoid the party. No, no; I'll no more of it. Why
should I pay five shillings a time for the privilege of being bored?"
If, now, we consider that this very common mood tends towards
billiard-rooms, towards long sittings over cigars and brandy-and-water,
towards Evans's and the Coal Hole, towards every place where amusement may
be had; it becomes a question whether these precise observances which
hamper our set meetings, have not to answer for much of the prevalent
dissoluteness. Men must have excitements of some kind or other; and if
debarred from higher ones will fall back upon lower. It is not that those
who thus take to irregular habits are essentially those of low tastes.
Often it is quite the reverse. Among half a dozen intimate friends,
abandoning formalities and sitting at ease round the fire, none will enter
with greater enjoyment into the highest kind of social intercourse--the
genuine communion of thought and feeling; and if the circle includes women
of intelligence and refinement, so much the greater is their pleasure. It
is because they will no longer be choked with the mere dry husks of
conversation which society offers them, that they fly its assemblies, and
seek those with whom they may have discourse that is at least real, though
unpolished. The men who thus long for substantial mental sympathy, and will
go where they can get it, are often, indeed, much better at the core than
the men who are content with the inanities of gloved and scented
party-goers--men who feel no need to come morally nearer to their fellow
creatures than they can come while standing, tea-cup in hand, answering
trifles with trifles; and who, by feeling no such need, prove themselves
shallow-thoughted and cold-hearted.
It is true, that some who shun drawing-rooms do so from inability to bear
the restraints prescribed by a genuine refinement, and that they would be
greatly improved by being kept under these restraints. But it is not less
true that, by adding to the legitimate restraints, which are based on
convenience and a regard for others, a host of factitious restraints based
only on convention, the refining discipline, which would else have been
borne with benefit, is rendered unbearable, and so misses its end. Excess
of government variably defeats itself by driving away those to be governed.
And if over all who desert its entertainments in disgust either at their
emptiness or their formality, society thus loses its salutary influence--if
such not only fail to receive that moral culture which the company of
ladies, when rationally regulated, would give them, but, in default of
other relaxation, are driven into habits and companionships which often end
in gambling and drunkenness; must we not say that here, too, is an evil not
to be passed over as insignificant?
Then consider what a blighting effect these multitudinous preparations and
ceremonies have upon the pleasures they profess to subserve. Who, on
calling to mind the occasions of his highest social enjoyments, does not
find them to have been wholly informal, perhaps impromptu? How delightful a
picnic of friends, who forget all observances save those dictated by good
nature! How pleasant the little unpretended gatherings of book-societies,
and the like; or those purely accidental meetings of a few people well
known to each other! Then, indeed, we may see that "a man sharpeneth the
countenance of his friend." Cheeks flush, and eyes sparkle. The witty grow
brilliant, and even the dull are excited into saying good things. There is
an overflow of topics; and the right thought, and the right words to put it
in, spring up unsought. Grave alternates with gay: now serious converse,
and now jokes, anecdotes, and playful raillery. Everyone's best nature is
shown; everyone's best feelings are in pleasurable activity; and, for the
time, life seems well worth having.
Go now and dress for some half-past eight dinner, or some ten o'clock "at
home;" and present yourself in spotless attire, with every hair arranged to
perfection. How great the difference! The enjoyment seems in the inverse
ratio of the preparation. These figures, got up with such finish and
precision, appear but half alive. They have frozen each other by their
primness; and your faculties feel the numbing effects of the atmosphere the
moment you enter it. All those thoughts, so nimble and so apt awhile since,
have disappeared--have suddenly acquired a preternatural power of eluding
you. If you venture a remark to your neighbour, there comes a trite
rejoinder, and there it ends. No subject you can hit upon outlives half a
dozen sentences. Nothing that is said excites any real interest in you; and
you feel that all you say is listened to with apathy. By some strange
magic, things that usually give pleasure seem to have lost all charm.
You have a taste for art. Weary of frivolous talk, you turn to the table,
and find that the book of engravings and the portfolio of photographs are
as flat as the conversation. You are fond of music. Yet the singing, good
as it is, you hear with utter indifference; and say "Thank you" with a
sense of being a profound hypocrite. Wholly at ease though you could be,
for your own part, you find that your sympathies will not let you. You see
young gentlemen feeling whether their ties are properly adjusted, looking
vacantly round, and considering what they shall do next. You see ladies
sitting disconsolately, waiting for some one to speak to them, and wishing
they had the wherewith to occupy their fingers. You see the hostess
standing about the doorway, keeping a factitious smile on her face, and
racking her brain to find the requisite nothings with which to greet her
guests as they enter. You see numberless traits of weariness and
embarrassment; and, if you have any fellow feeling, these cannot fail to
produce a feeling of discomfort. The disorder is catching; and do what you
will you cannot resist the general infection. You struggle against it; you
make spasmodic efforts to be lively; but none of your sallies or your good
stories do more than raise a simper or a forced laugh: intellect and
feeling are alike asphyxiated. And when, at length, yielding to your
disgust, you rush away, how great is the relief when you get into the fresh
air, and see the stars! How you "Thank God, that's over!" and half resolve
to avoid all such boredom for the future!
What, now, is the secret of this perpetual miscarriage and disappointment?
Does not the fault lie with all these needless adjuncts--these elaborate
dressings, these set forms, these expensive preparations, these many
devices and arrangements that imply trouble and raise expectation? Who that
has lived thirty years in the world has not discovered that Pleasure is
coy; and must not be too directly pursued, but must be caught unawares? An
air from a street-piano, heard while at work, will often gratify more than
the choicest music played at a concert by the most accomplished musicians.
A single good picture seen in a dealer's window, may give keener enjoyment
than a whole exhibition gone through with catalogue and pencil. By the time
we have got ready our elaborate apparatus by which to secure happiness, the
happiness is gone. It is too subtle to be contained in these receivers,
garnished with compliments, and fenced round with etiquette. The more we
multiply and complicate appliances, the more certain are we to drive it
away.
The reason is patent enough. These higher emotions to which social
intercourse ministers, are of extremely complex nature; they consequently
depend for their production upon very numerous conditions; the more
numerous the conditions, the greater the liability that one or other of
them will be disturbed, and the emotions consequently prevented. It takes a
considerable misfortune to destroy appetite; but cordial sympathy with
those around may be extinguished by a look or a word. Hence it follows,
that the more multiplied the _unnecessary_ requirements with which social
intercourse is surrounded, the less likely are its pleasures to be
achieved. It is difficult enough to fulfil continuously all the
_essentials_ to a pleasurable communion with others: how much more
difficult, then, must it be continuously to fulfil a host of
_non-essentials_ also! It is, indeed, impossible. The attempt inevitably
ends in the sacrifice of the first to the last--the essentials to the
non-essentials. What chance is there of getting any genuine response from
the lady who is thinking of your stupidity in taking her in to dinner on
the wrong arm? How are you likely to have agreeable converse with the
gentleman who is fuming internally because he is not placed next to the
hostess? Formalities, familiar as they may become, necessarily occupy
attention--necessarily multiply the occasions for mistake,
misunderstanding, and jealousy, on the part of one or other--necessarily
distract all minds from the thoughts and feelings that should occupy
them--necessarily, therefore, subvert those conditions under which only any
sterling intercourse is to be had.
And this indeed is the fatal mischief which these conventions entail--a
mischief to which every other is secondary. They destroy those highest of
our pleasures which they profess to subserve. All institutions are alike in
this, that however useful, and needful even, they originally were, they not
only in the end cease to be so, but become detrimental. While humanity is
growing, they continue fixed; daily get more mechanical and unvital; and by
and by tend to strangle what they before preserved. It is not simply that
they become corrupt and fail to act; they become obstructions. Old forms of
government finally grow so oppressive, that they must be thrown off even at
the risk of reigns of terror. Old creeds end in being dead formulas, which
no longer aid but distort and arrest the general mind; while the
State-churches administering them, come to be instruments for subsidizing
conservatism and repressing progress. Old schemes of education, incarnated
in public schools and colleges, continue filling the heads of new
generations with what has become relatively useless knowledge, and, by
consequence, excluding knowledge which is useful. Not an organization of
any kind--political, religious, literary, philanthropic--but what, by its
ever-multiplying regulations, its accumulating wealth, its yearly addition
of officers, and the creeping into it of patronage and party feeling,
eventually loses its original spirit, and sinks into a mere lifeless
mechanism, worked with a view to private ends--a mechanism which not merely
fails of its first purpose, but is a positive hindrance to it.
Thus is it, too, with social usages. We read of the Chinese that they have
"ponderous ceremonies transmitted from time immemorial," which make social
intercourse a burden. The court forms prescribed by monarchs for their own
exaltation, have, in all times and places, ended in consuming the comfort
of their lives. And so the artificial observances of the dining-room and
saloon, in proportion as they are many and strict, extinguish that
agreeable communion which they were originally intended to secure. The
dislike with which people commonly speak of society that is "formal," and
"stiff," and "ceremonious," implies the general recognition of this fact;
and this recognition, logically developed, involves that all usages of
behaviour which are not based on natural requirements, are injurious. That
these conventions defeat their own ends is no new assertion. Swift,
criticising the manners of his day, says--"Wise men are often more uneasy
at the over-civility of these refiners than they could possibly be in the
conversation of peasants and mechanics."
But it is not only in these details that the self-defeating action of our
arrangements is traceable: it is traceable in the very substance and nature
of them. Our social intercourse, as commonly managed, is a mere semblance
of the reality sought. What is it that we want? Some sympathetic converse
with our fellow-creatures: some converse that shall not be mere dead words,
but the vehicle of living thoughts and feelings--converse in which the eyes
and the face shall speak, and the tones of the voice be full of
meaning--converse which shall make us feel no longer alone, but shall draw
us closer to another, and double our own emotions by adding another's to
them. Who is there that has not, from time to time, felt how cold and flat
is all this talk about politics and science, and the new books and the new
men, and how a genuine utterance of fellow-feeling outweighs the whole of
it? Mark the words of Bacon:--"For a crowd is not a company, and faces are
but a gallery of pictures, and talk but a tinkling cymbal, where there is
no love."
If this be true, then it is only after acquaintance has grown into
intimacy, and intimacy has ripened into friendship, that the real communion
which men need becomes possible. A rationally-formed circle must consist
almost wholly of those on terms of familiarity and regard, with but one or
two strangers. What folly, then, underlies the whole system of our grand
dinners, our "at homes," our evening parties--assemblages made up of many
who never met before, many others who just bow to each other, many others
who though familiar feel mutual indifference, with just a few real friends
lost in the general mass! You need but look round at the artificial
expressions of face, to see at once how it is. All have their disguises on;
and how can there be sympathy between masks? No wonder that in private
every one exclaims against the stupidity of these gatherings. No wonder
that hostesses get them up rather because they must than because they wish.
No wonder that the invited go less from the expectation of pleasure than
from fear of giving offence. The whole thing is a gigantic mistake--an
organized disappointment.
And then note, lastly, that in this case, as in all others, when an
organization has become effete and inoperative for its legitimate purpose,
it is employed for quite other ones--quite opposite ones. What is the usual
plea put in for giving and attending these tedious assemblies? "I admit
that they are stupid and frivolous enough," replies every man to your
criticisms; "but then, you know, one must keep up one's connections." And
could you get from his wife a sincere answer, it would be--"Like you, I am
sick of these frivolities; but then, we must get our daughters married."
The one knows that there is a profession to push, a practice to gain, a
business to extend: or parliamentary influence, or county patronage, or
votes, or office, to be got: position, berths, favours, profit. The other's
thoughts runs upon husbands and settlements, wives and dowries. Worthless
for their ostensible purpose of daily bringing human beings into
pleasurable relations with each other, these cumbrous appliances of our
social intercourse are now perseveringly kept in action with a view to the
pecuniary and matrimonial results which they indirectly produce.
Who then shall say that the reform of our system of observances is
unimportant? When we see how this system induces fashionable extravagance,
with its entailed bankruptcy and ruin--when we mark how greatly it limits
the amount of social intercourse among the less wealthy classes--when we
find that many who most need to be disciplined by mixing with the refined
are driven away by it, and led into dangerous and often fatal courses--when
we count up the many minor evils it inflicts, the extra work which its
costliness entails on all professional and mercantile men, the damage to
public taste in dress and decoration by the setting up of its absurdities
as standards for imitation, the injury to health indicated in the faces of
its devotees at the close of the London season, the mortality of milliners
and the like, which its sudden exigencies yearly involve;--and when to all
these we add its fatal sin; that it blights, withers up, and kills, that
high enjoyment it professedly ministers to--that enjoyment which is a chief
end of our hard struggling in life to obtain--shall we not conclude that to
reform our system of etiquette and fashion, is an aim yielding to few in
urgency?
* * * * *
There needs, then, a protestantism in social usages. Forms that have ceased
to facilitate and have become obstructive--whether political, religious, or
other--have ever to be swept away; and eventually are so swept away in all
cases. Signs are not wanting that some change is at hand. A host of
satirists, led on by Thackeray, have been for years engaged in bringing our
sham-festivities, and our fashionable follies, into contempt; and in their
candid moods, most men laugh at the frivolities with which they and the
world in general are deluded. Ridicule has always been a revolutionary
agent. That which is habitually assailed with sneers and sarcasms cannot
long survive. Institutions that have lost their roots in men's respect and
faith are doomed; and the day of their dissolution is not far off. The time
is approaching, then, when our system of social observances must pass
through some crisis, out of which it will come purified and comparatively
simple.
How this crisis will be brought about, no one can with any certainty say.
Whether by the continuance and increase of individual protests, or whether
by the union of many persons for the practice and propagation of some
better system, the future alone can decide. The influence of dissentients
acting without co-operation, seems, under the present state of things,
inadequate. Standing severally alone, and having no well-defined views;
frowned on by conformists, and expostulated with even by those who secretly
sympathize with them; subject to petty persecutions, and unable to trace
any benefit produced by their example; they are apt, one by one, to give up
their attempts as hopeless. The young convention-breaker eventually finds
that he pays too heavily for his nonconformity. Hating, for example,
everything that bears about it any remnant of servility, he determines, in
the ardour of his independence, that he will uncover to no one. But what he
means simply as a general protest, he finds that ladies interpret into a
personal disrespect. Though he sees that, from the days of chivalry
downwards, these marks of supreme consideration paid to the other sex have
been but a hypocritical counterpart to the actual subjection in which men
have held them--a pretended submission to compensate for a real domination;
and though he sees that when the true dignity of women is recognised, the
mock dignities given to them will be abolished; yet he does not like to be
thus misunderstood, and so hesitates in his practice.
In other cases, again, his courage fails him. Such of his
unconventionalities as can be attributed only to eccentricity, he has no
qualms about: for, on the whole, he feels rather complimented than
otherwise in being considered a disregarder of public opinion. But when
they are liable to be put down to ignorance, to ill-breeding, or to
poverty, he becomes a coward. However clearly the recent innovation of
eating some kinds of fish with knife and fork proves the fork-and-bread
practice to have had little but caprice for its basis, yet he dares not
wholly ignore that practice while fashion partially maintains it. Though he
thinks that a silk handkerchief is quite as appropriate for drawing-room
use as a white cambric one, he is not altogether at ease in acting out his
opinion. Then, too, he begins to perceive that his resistance to
prescription brings round disadvantageous results which he had not
calculated upon. He had expected that it would save him from a great deal
of social intercourse of a frivolous kind--that it would offend the fools,
but not the sensible people; and so would serve as a self-acting test by
which those worth knowing would be separated from those not worth knowing.
But the fools prove to be so greatly in the majority that, by offending
them, he closes against himself nearly all the avenues though which the
sensible people are to be reached. Thus he finds, that his nonconformity is
frequently misinterpreted; that there are but few directions in which he
dares to carry it consistently out; that the annoyances and disadvantages
which it brings upon him are greater than he anticipated; and that the
chances of his doing any good are very remote. Hence he gradually loses
resolution, and lapses, step by step, into the ordinary routine of
observances.
Abortive as individual protests thus generally turn out, it may possibly be
that nothing effectual will be done until there arises some organized
resistance to this invisible despotism, by which our modes and habits are
dictated. It may happen, that the government of Manners and Fashion will be
rendered less tyrannical, as the political and religious governments have
been, by some antagonistic union. Alike in Church and State, men's first
emancipations from excess of restriction were achieved by numbers, bound
together by a common creed or a common political faith. What remained
undone while there were but individual schismatics or rebels, was effected
when there came to be many acting in concert. It is tolerably clear that
these earliest instalments of freedom could not have been obtained in any
other way; for so long as the feeling of personal independence was weak and
the rule strong, there could never have been a sufficient number of
separate dissentients to produce the desired results. Only in these later
times, during which the secular and spiritual controls have been growing
less coercive, and the tendency towards individual liberty greater, has it
become possible for smaller and smaller sects and parties to fight against
established creeds and laws; until now men may safely stand even alone in
their antagonism.
The failure of individual nonconformity to customs, as above illustrated,
suggests that an analogous series of changes may have to be gone through in
this case also. It is true that the _lex non scripta_ differs from the _lex
scripta_ in this, that, being unwritten, it is more readily altered; and
that it has, from time to time, been quietly ameliorated. Nevertheless, we
shall find that the analogy holds substantially good. For in this case, as
in the others, the essential revolution is not the substituting of any one
set of restraints for any other, but the limiting or abolishing the
authority which prescribes restraints. Just as the fundamental change
inaugurated by the Reformation, was not a superseding of one creed by
another, but an ignoring of the arbiter who before dictated creeds--just as
the fundamental change which Democracy long ago commenced, was not from
this particular law to that, but from the despotism of one to the freedom
of all; so, the parallel change yet to be wrought out in this supplementary
government of which we are treating, is not the replacing of absurd usages
by sensible ones, but the dethronement of that secret, irresponsible power
which now imposes our usages, and the assertion of the right of all
individuals to choose their own usages. In rules of living, a West-end
clique is our Pope; and we are all <DW7>s, with but a mere sprinkling of
heretics. On all who decisively rebel, comes down the penalty of
excommunication, with its long catalogue of disagreeable and, indeed,
serious consequences.
The liberty of the subject asserted in our constitution, and ever on the
increase, has yet to be wrested from this subtler tyranny. The right of
private judgment, which our ancestors wrung from the church, remains to be
claimed from this dictator of our habits. Or, as before said, to free us
from these idolatries and superstitious conformities, there has still to
come a protestantism in social usages. Parallel, therefore, as is the
change to be wrought out, it seems not improbable that it may be wrought
out in an analogous way. That influence which solitary dissentients fail to
gain, and that perseverance which they lack, may come into existence when
they unite. That persecution which the world now visits upon them from
mistaking their nonconformity for ignorance or disrespect, may diminish
when it is seen to result from principle. The penalty which exclusion now
entails may disappear when they become numerous enough to form visiting
circles of their own. And when a successful stand has been made, and the
brunt of the opposition has passed, that large amount of secret dislike to
our observances which now pervades society, may manifest itself with
sufficient power to effect the desired emancipation.
Whether such will be the process, time alone can decide. That community of
origin, growth, supremacy, and decadence, which we have found among all
kinds of government, suggests a community in modes of change also. On the
other hand, Nature often performs substantially similar operations, in ways
apparently different. Hence these details can never be foretold.
* * * * *
Meanwhile, let us glance at the conclusions that have been reached. On the
one side, government, originally one, and afterwards subdivided for the
better fulfilment of its function, must be considered as having ever been,
in all its branches--political, religious, and ceremonial--beneficial; and,
indeed, absolutely necessary. On the other side, government, under all its
forms, must be regarded as subserving a temporary office, made needful by
the unfitness of aboriginal humanity for social life; and the successive
diminutions of its coerciveness in State, in Church, and in Custom, must be
looked upon as steps towards its final disappearance. To complete the
conception, there requires to be borne in mind the third fact, that the
genesis, the maintenance, and the decline of all governments, however
named, are alike brought about by the humanity to be controlled: from which
may be drawn the inference that, on the average, restrictions of every kind
cannot last much longer than they are wanted, and cannot be destroyed much
faster than they ought to be.
Society, in all its developments, undergoes the process of exuviation.
These old forms which it successively throws off, have all been once
vitally united with it--have severally served as the protective envelopes
within which a higher humanity was being evolved. They are cast aside only
when they become hindrances--only when some inner and better envelope has
been formed; and they bequeath to us all that there was in them good. The
periodical abolitions of tyrannical laws have left the administration of
justice not only uninjured, but purified. Dead and buried creeds have not
carried with them the essential morality they contained, which still
exists, uncontaminated by the sloughs of superstition. And all that there
is of justice and kindness and beauty, embodied in our cumbrous forms of
etiquette, will live perennially when the forms themselves have been
forgotten.
III. THE GENESIS OF SCIENCE.
There has ever prevailed among men a vague notion that scientific knowledge
differs in nature from ordinary knowledge. By the Greeks, with whom
Mathematics--literally _things learnt_--was alone considered as knowledge
proper, the distinction must have been strongly felt; and it has ever since
maintained itself in the general mind. Though, considering the contrast
between the achievements of science and those of daily unmethodic thinking,
it is not surprising that such a distinction has been assumed; yet it needs
but to rise a little above the common point of view, to see that no such
distinction can really exist: or that at best, it is but a superficial
distinction. The same faculties are employed in both cases; and in both
cases their mode of operation is fundamentally the same.
If we say that science is organized knowledge, we are met by the truth that
all knowledge is organized in a greater or less degree--that the commonest
actions of the household and the field presuppose facts colligated,
inferences drawn, results expected; and that the general success of these
actions proves the data by which they were guided to have been correctly
put together. If, again, we say that science is prevision--is a seeing
beforehand--is a knowing in what times, places, combinations, or sequences,
specified phenomena will be found; we are yet obliged to confess that the
definition includes much that is utterly foreign to science in its ordinary
acceptation. For example, a child's knowledge of an apple. This, as far as
it goes consists in previsions. When a child sees a certain form and
colours, it knows that if it puts out its hand it will have certain
impressions of resistance, and roundness, and smoothness; and if it bites,
a certain taste. And manifestly its general acquaintance with surrounding
objects is of like nature--is made up of facts concerning them, so grouped
as that any part of a group being perceived, the existence of the other
facts included in it is foreseen.
If, once more, we say that science is _exact_ prevision, we still fail to
establish the supposed difference. Not only do we find that much of what we
call science is not exact, and that some of it, as physiology, can never
become exact; but we find further, that many of the previsions constituting
the common stock alike of wise and ignorant, _are_ exact. That an
unsupported body will fall; that a lighted candle will go out when immersed
in water; that ice will melt when thrown on the fire--these, and many like
predictions relating to the familiar properties of things have as high a
degree of accuracy as predictions are capable of. It is true that the
results predicated are of a very general character; but it is none the less
true that they are rigorously correct as far as they go: and this is all
that is requisite to fulfil the definition. There is perfect accordance
between the anticipated phenomena and the actual ones; and no more than
this can be said of the highest achievements of the sciences specially
characterised as exact.
Seeing thus that the assumed distinction between scientific knowledge and
common knowledge is not logically justifiable; and yet feeling, as we must,
that however impossible it may be to draw a line between them, the two are
not practically identical; there arises the question--What is the
relationship that exists between them? A partial answer to this question
may be drawn from the illustrations just given. On reconsidering them, it
will be observed that those portions of ordinary knowledge which are
identical in character with scientific knowledge, comprehend only such
combinations of phenomena as are directly cognizable by the senses, and are
of simple, invariable nature. That the smoke from a fire which she is
lighting will ascend, and that the fire will presently boil water, are
previsions which the servant-girl makes equally well with the most learned
physicist; they are equally certain, equally exact with his; but they are
previsions concerning phenomena in constant and direct relation--phenomena
that follow visibly and immediately after their antecedents--phenomena of
which the causation is neither remote nor obscure--phenomena which may be
predicted by the simplest possible act of reasoning.
If, now, we pass to the previsions constituting what is commonly known as
science--that an eclipse of the moon will happen at a specified time; and
when a barometer is taken to the top of a mountain of known height, the
mercurial column will descend a stated number of inches; that the poles of
a galvanic battery immersed in water will give off, the one an inflammable
and the other an inflaming gas, in definite ratio--we perceive that the
relations involved are not of a kind habitually presented to our senses;
that they depend, some of them, upon special combinations of causes; and
that in some of them the connection between antecedents and consequents is
established only by an elaborate series of inferences. The broad
distinction, therefore, between the two orders of knowledge, is not in
their nature, but in their remoteness from perception.
If we regard the cases in their most general aspect, we see that the
labourer, who, on hearing certain notes in the adjacent hedge, can describe
the particular form and colours of the bird making them; and the
astronomer, who, having calculated a transit of Venus, can delineate the
black spot entering on the sun's disc, as it will appear through the
telescope, at a specified hour; do essentially the same thing. Each knows
that on fulfilling the requisite conditions, he shall have a preconceived
impression--that after a definite series of actions will come a group of
sensations of a foreknown kind. The difference, then, is not in the
fundamental character of the mental acts; or in the correctness of the
previsions accomplished by them; but in the complexity of the processes
required to achieve the previsions. Much of our commonest knowledge is, as
far as it goes, rigorously precise. Science does not increase this
precision; cannot transcend it. What then does it do? It reduces other
knowledge to the same degree of precision. That certainty which direct
perception gives us respecting coexistences and sequences of the simplest
and most accessible kind, science gives us respecting coexistences and
sequences, complex in their dependencies or inaccessible to immediate
observation. In brief, regarded from this point of view, science may be
called _an extension of the perceptions by means of reasoning_.
On further considering the matter, however, it will perhaps be felt that
this definition does not express the whole fact--that inseparable as
science may be from common knowledge, and completely as we may fill up the
gap between the simplest previsions of the child and the most recondite
ones of the natural philosopher, by interposing a series of previsions in
which the complexity of reasoning involved is greater and greater, there is
yet a difference between the two beyond that which is here described. And
this is true. But the difference is still not such as enables us to draw
the assumed line of demarcation. It is a difference not between common
knowledge and scientific knowledge; but between the successive phases of
science itself, or knowledge itself--whichever we choose to call it. In its
earlier phases science attains only to _certainty_ of foreknowledge; in its
later phases it further attains to _completeness_. We begin by discovering
_a_ relation: we end by discovering _the_ relation. Our first achievement
is to foretell the _kind_ of phenomenon which will occur under specific
conditions: our last achievement is to foretell not only the kind but the
_amount_. Or, to reduce the proposition to its most definite
form--undeveloped science is _qualitative_ prevision: developed science is
_quantitative_ prevision.
This will at once be perceived to express the remaining distinction between
the lower and the higher stages of positive knowledge. The prediction that
a piece of lead will take more force to lift it than a piece of wood of
equal size, exhibits certainty, but not completeness, of foresight. The
kind of effect in which the one body will exceed the other is foreseen; but
not the amount by which it will exceed. There is qualitative prevision
only. On the other hand, the prediction that at a stated time two
particular planets will be in conjunction; that by means of a lever having
arms in a given ratio, a known force will raise just so many pounds; that
to decompose a specified quantity of sulphate of iron by carbonate of soda
will require so many grains--these predictions exhibit foreknowledge, not
only of the nature of the effects to be produced, but of the magnitude,
either of the effects themselves, of the agencies producing them, or of the
distance in time or space at which they will be produced. There is not only
qualitative but quantitative prevision.
And this is the unexpressed difference which leads us to consider certain
orders of knowledge as especially scientific when contrasted with knowledge
in general. Are the phenomena _measurable_? is the test which we
unconsciously employ. Space is measurable: hence Geometry. Force and space
are measurable: hence Statics. Time, force, and space are measurable: hence
Dynamics. The invention of the barometer enabled men to extend the
principles of mechanics to the atmosphere; and Aerostatics existed. When a
thermometer was devised there arose a science of heat, which was before
impossible. Such of our sensations as we have not yet found modes of
measuring do not originate sciences. We have no science of smells; nor have
we one of tastes. We have a science of the relations of sounds differing in
pitch, because we have discovered a way to measure them; but we have no
science of sounds in respect to their loudness or their _timbre_, because
we have got no measures of loudness and _timbre_.
Obviously it is this reduction of the sensible phenomena it represents, to
relations of magnitude, which gives to any division of knowledge its
especially scientific character. Originally men's knowledge of weights and
forces was in the same condition as their knowledge of smells and tastes is
now--a knowledge not extending beyond that given by the unaided sensations;
and it remained so until weighing instruments and dynamometers were
invented. Before there were hour-glasses and clepsydras, most phenomena
could be estimated as to their durations and intervals, with no greater
precision than degrees of hardness can be estimated by the fingers. Until a
thermometric scale was contrived, men's judgments respecting relative
amounts of heat stood on the same footing with their present judgments
respecting relative amounts of sound. And as in these initial stages, with
no aids to observation, only the roughest comparisons of cases could be
made, and only the most marked differences perceived; it is obvious that
only the most simple laws of dependence could be ascertained--only those
laws which being uncomplicated with others, and not disturbed in their
manifestations, required no niceties of observation to disentangle them.
Whence it appears not only that in proportion as knowledge becomes
quantitative do its previsions become complete as well as certain, but that
until its assumption of a quantitative character it is necessarily confined
to the most elementary relations.
Moreover it is to be remarked that while, on the one hand, we can discover
the laws of the greater proportion of phenomena only by investigating them
quantitatively; on the other hand we can extend the range of our
quantitative previsions only as fast as we detect the laws of the results
we predict. For clearly the ability to specify the magnitude of a result
inaccessible to direct measurement, implies knowledge of its mode of
dependence on something which can be measured--implies that we know the
particular fact dealt with to be an instance of some more general fact.
Thus the extent to which our quantitative previsions have been carried in
any direction, indicates the depth to which our knowledge reaches in that
direction. And here, as another aspect of the same fact, we may further
observe that as we pass from qualitative to quantitative prevision, we pass
from inductive science to deductive science. Science while purely inductive
is purely qualitative: when inaccurately quantitative it usually consists
of part induction, part deduction: and it becomes accurately quantitative
only when wholly deductive. We do not mean that the deductive and the
quantitative are coextensive; for there is manifestly much deduction that
is qualitative only. We mean that all quantitative prevision is reached
deductively; and that induction can achieve only qualitative prevision.
Still, however, it must not be supposed that these distinctions enable us
to separate ordinary knowledge from science; much as they seem to do so.
While they show in what consists the broad contrast between the extreme
forms of the two, they yet lead us to recognise their essential identity;
and once more prove the difference to be one of degree only. For, on the
one hand, the commonest positive knowledge is to some extent quantitative;
seeing that the amount of the foreseen result is known within certain wide
limits. And, on the other hand, the highest quantitative prevision does not
reach the exact truth, but only a very near approximation to it. Without
clocks the savage knows that the day is longer in the summer than in the
winter; without scales he knows that stone is heavier than flesh: that is,
he can foresee respecting certain results that their amounts will exceed
these, and be less than those--he knows _about_ what they will be. And,
with his most delicate instruments and most elaborate calculations, all
that the man of science can do, is to reduce the difference between the
foreseen and the actual results to an unimportant quantity.
Moreover, it must be borne in mind not only that all the sciences are
qualitative in their first stages,--not only that some of them, as
Chemistry, have but recently reached the quantitative stage--but that the
most advanced sciences have attained to their present power of determining
quantities not present to the senses, or not directly measurable, by a slow
process of improvement extending through thousands of years. So that
science and the knowledge of the uncultured are alike in the nature of
their previsions, widely as they differ in range; they possess a common
imperfection, though this is immensely greater in the last than in the
first; and the transition from the one to the other has been through a
series of steps by which the imperfection has been rendered continually
less, and the range continually wider.
These facts, that science and the positive knowledge of the uncultured
cannot be separated in nature, and that the one is but a perfected and
extended form of the other, must necessarily underlie the whole theory of
science, its progress, and the relations of its parts to each other. There
must be serious incompleteness in any history of the sciences, which,
leaving out of view the first steps of their genesis, commences with them
only when they assume definite forms. There must be grave defects, if not a
general untruth, in a philosophy of the sciences considered in their
interdependence and development, which neglects the inquiry how they came
to be distinct sciences, and how they were severally evolved out of the
chaos of primitive ideas.
Not only a direct consideration of the matter, but all analogy, goes to
show that in the earlier and simpler stages must be sought the key to all
subsequent intricacies. The time was when the anatomy and physiology of the
human being were studied by themselves--when the adult man was analyzed and
the relations of parts and of functions investigated, without reference
either to the relations exhibited in the embryo or to the homologous
relations existing in other creatures. Now, however, it has become manifest
that no true conceptions, no true generalizations, are possible under such
conditions. Anatomists and physiologists now find that the real natures of
organs and tissues can be ascertained only by tracing their early
evolution; and that the affinities between existing genera can be
satisfactorily made out only by examining the fossil genera to which they
are allied. Well, is it not clear that the like must be true concerning all
things that undergo development? Is not science a growth? Has not science,
too, its embryology? And must not the neglect of its embryology lead to a
misunderstanding of the principles of its evolution and of its existing
organization?
There are _a priori_ reasons, therefore, for doubting the truth of all
philosophies of the sciences which tacitly proceed upon the common notion
that scientific knowledge and ordinary knowledge are separate; instead of
commencing, as they should, by affiliating the one upon the other, and
showing how it gradually came to be distinguishable from the other. We may
expect to find their generalizations essentially artificial; and we shall
not be deceived. Some illustrations of this may here be fitly introduced,
by way of preliminary to a brief sketch of the genesis of science from the
point of view indicated. And we cannot more readily find such illustrations
than by glancing at a few of the various _classifications_ of the sciences
that have from time to time been proposed. To consider all of them would
take too much space: we must content ourselves with some of the latest.
* * * * *
Commencing with those which may be soonest disposed of, let us notice first
the arrangement propounded by Oken. An abstract of it runs thus:--
Part I. MATHESIS.--_Pneumatogeny_: Primary Art, Primary
Consciousness, God, Primary Rest, Time, Polarity, Motion, Man,
Space, Point, Line, Surface, Globe, Rotation.--_Hylogeny_:
Gravity, Matter, Ether, Heavenly Bodies, Light, Heat, Fire.
(He explains that MATHESIS is the doctrine of the whole;
_Pneumatogeny_ being the doctrine of immaterial totalities,
and _Hylogeny_ that of material totalities.)
Part II. ONTOLOGY.--_Cosmogeny_: Rest, Centre, Motion, Line, Planets,
Form, Planetary System, Comets.--_Stoechiogeny_: Condensation,
Simple Matter, Elements, Air, Water, Earth.--_Stoechiology_:
Functions of the Elements, &c. &c.--_Kingdoms of Nature_:
Individuals.
(He says in explanation that "ONTOLOGY teaches us the phenomena of
matter. The first of these are the heavenly bodies comprehended by
_Cosmogeny_. These divide into elements--_Stoechiogeny_. The earth
element divides into minerals--_Mineralogy_. These unite into one
collective body--_Geogeny_. The whole in singulars is the living, or
_Organic_, which again divides into plants and animals. _Biology_,
therefore, divides into _Organogeny_, _Phytosophy_, _Zoosophy_.")
FIRST KINGDOM.--MINERALS. _Mineralogy_, _Geology_.
Part III. BIOLOGY.--_Organosophy_, _Phytogeny_, _Phyto-physiology_,
_Phytology_, _Zoogeny_, _Physiology_, _Zoology_, _Psychology_.
A glance over this confused scheme shows that it is an attempt to classify
knowledge, not after the order in which it has been, or may be, built up in
the human consciousness; but after an assumed order of creation. It is a
pseudo-scientific cosmogony, akin to those which men have enunciated from
the earliest times downwards; and only a little more respectable. As such
it will not be thought worthy of much consideration by those who, like
ourselves, hold that experience is the sole origin of knowledge. Otherwise,
it might have been needful to dwell on the incongruities of the
arrangements--to ask how motion can be treated of before space? how there
can be rotation without matter to rotate? how polarity can be dealt with
without involving points and lines? But it will serve our present purpose
just to point out a few of the extreme absurdities resulting from the
doctrine which Oken seems to hold in common with Hegel, that "to
philosophize on Nature is to re-think the great thought of Creation." Here
is a sample:--
"Mathematics is the universal science; so also is Physio-philosophy,
although it is only a part, or rather but a condition of the
universe; both are one, or mutually congruent.
"Mathematics is, however, a science of mere forms without substance.
Physio-philosophy is, therefore, _mathematics endowed with
substance_."
From the English point of view it is sufficiently amusing to find such a
dogma not only gravely stated, but stated as an unquestionable truth. Here
we see the experiences of quantitative relations which men have gathered
from surrounding bodies and generalized (experiences which had been
scarcely at all generalized at the beginning of the historic period)--we
find these generalized experiences, these intellectual abstractions,
elevated into concrete actualities, projected back into Nature, and
considered as the internal frame-work of things--the skeleton by which
matter is sustained. But this new form of the old realism, is by no means
the most startling of the physio-philosophic principles. We presently read
that,
"The highest mathematical idea, or the fundamental principle of all
mathematics is the zero = 0."...
"Zero is in itself nothing. Mathematics is based upon nothing, and,
_consequently_, arises out of nothing.
"Out of nothing, _therefore_, it is possible for something to arise;
for mathematics, consisting of propositions, is something, in
relation to 0."
By such "consequentlys" and "therefores" it is, that men philosophize when
they "re-think the great thought of creation." By dogmas that pretend to be
reasons, nothing is made to generate mathematics; and by clothing
mathematics with matter, we have the universe! If now we deny, as we _do_
deny, that the highest mathematical idea is the zero;--if, on the other
hand, we assert, as we _do_ assert, that the fundamental idea underlying
all mathematics, is that of equality; the whole of Oken's cosmogony
disappears. And here, indeed, we may see illustrated, the distinctive
peculiarity of the German method of procedure in these matters--the bastard
_a priori_ method, as it may be termed. The legitimate _a priori_ method
sets out with propositions of which the negation is inconceivable; the _a
priori_ method as illegitimately applied, sets out either with propositions
of which the negation is _not_ inconceivable, or with propositions like
Oken's, of which the _affirmation_ is inconceivable.
It is needless to proceed further with the analysis; else might we detail
the steps by which Oken arrives at the conclusions that "the planets are
coagulated colours, for they are coagulated light; that the sphere is the
expanded nothing;" that gravity is "a weighty nothing, a heavy essence,
striving towards a centre;" that "the earth is the identical, water the
indifferent, air the different; or the first the centre, the second the
radius, the last the periphery of the general globe or of fire." To comment
on them would be nearly as absurd as are the propositions themselves. Let
us pass on to another of the German systems of knowledge--that of Hegel.
The simple fact that Hegel puts Jacob B[oe]hme on a par with Bacon,
suffices alone to show that his stand-point is far remote from the one
usually regarded as scientific: so far remote, indeed, that it is not easy
to find any common basis on which to found a criticism. Those who hold that
the mind is moulded into conformity with surrounding things by the agency
of surrounding things, are necessarily at a loss how to deal with those,
who, like Schelling and Hegel, assert that surrounding things are
solidified mind--that Nature is "petrified intelligence." However, let us
briefly glance at Hegel's classification. He divides philosophy into three
parts:--
1. _Logic_, or the science of the idea in itself, the pure idea.
2. _The Philosophy of Nature_, or the science of the idea considered
under its other form--of the idea as Nature.
3. _The Philosophy of the Mind_, or the science of the idea in its
return to itself.
Of these, the second is divided into the natural sciences, commonly so
called; so that in its more detailed form the series runs thus:--Logic,
Mechanics, Physics, Organic Physics, Psychology.
Now, if we believe with Hegel, first, that thought is the true essence of
man; second, that thought is the essence of the world; and that, therefore,
there is nothing but thought; his classification, beginning with the
science of pure thought, may be acceptable. But otherwise, it is an obvious
objection to his arrangement, that thought implies things thought of--that
there can be no logical forms without the substance of experience--that the
science of ideas and the science of things must have a simultaneous origin.
Hegel, however, anticipates this objection, and, in his obstinate idealism,
replies, that the contrary is true; that all contained in the forms, to
become something, requires to be thought: and that logical forms are the
foundations of all things.
It is not surprising that, starting from such premises, and reasoning after
this fashion, Hegel finds his way to strange conclusions. Out of _space_
and _time_ he proceeds to build up _motion_, _matter_, _repulsion_,
_attraction_, _weight_, and _inertia_. He then goes on to logically evolve
the solar system. In doing this he widely diverges from the Newtonian
theory; reaches by syllogism the conviction that the planets are the most
perfect celestial bodies; and, not being able to bring the stars within his
theory, says that they are mere formal existences and not living matter,
and that as compared with the solar system they are as little admirable as
a cutaneous eruption or a swarm of flies.[F]
[F] It is somewhat curious that the author of "The Plurality of
Worlds," with quite other aims, should have persuaded himself
into similar conclusions.
Results so outrageous might be left as self-disproved, were it not that
speculators of this class are not alarmed by any amount of incongruity with
established beliefs. The only efficient mode of treating systems like this
of Hegel, is to show that they are self-destructive--that by their first
steps they ignore that authority on which all their subsequent steps
depend. If Hegel professes, as he manifestly does, to develop his scheme by
reasoning--if he presents successive inferences as _necessarily following_
from certain premises; he implies the postulate that a belief which
necessarily follows after certain antecedents is a true belief: and, did an
opponent reply to one of his inferences, that, though it was impossible to
think the opposite, yet the opposite was true, he would consider the reply
irrational. The procedure, however, which he would thus condemn as
destructive of all thinking whatever, is just the procedure exhibited in
the enunciation of his own first principles.
Mankind find themselves unable to conceive that there can be thought
without things thought of. Hegel, however, asserts that there _can_ be
thought without things thought of. That ultimate test of a true
proposition--the inability of the human mind to conceive the negation of
it--which in all other cases he considers valid, he considers invalid where
it suits his convenience to do so; and yet at the same time denies the
right of an opponent to follow his example. If it is competent for him to
posit dogmas, which are the direct negations of what human consciousness
recognises; then is it also competent for his antagonists to stop him at
every step in his argument by saying, that though the particular inference
he is drawing seems to his mind, and to all minds, necessarily to follow
from the premises, yet it is not true, but the contrary inference is true.
Or, to state the dilemma in another form:--If he sets out with
inconceivable propositions, then may he with equal propriety make all his
succeeding propositions inconceivable ones--may at every step throughout
his reasoning draw exactly the opposite conclusion to that which seems
involved.
Hegel's mode of procedure being thus essentially suicidal, the Hegelian
classification which depends upon it, falls to the ground. Let us consider
next that of M. Comte.
As all his readers must admit, M. Comte presents us with a scheme of the
sciences which, unlike the foregoing ones, demands respectful
consideration. Widely as we differ from him, we cheerfully bear witness to
the largeness of his views, the clearness of his reasoning, and the value
of his speculations as contributing to intellectual progress. Did we
believe a serial arrangement of the sciences to be possible, that of M.
Comte would certainly be the one we should adopt. His fundamental
propositions are thoroughly intelligible; and if not true, have a great
semblance of truth. His successive steps are logically co-ordinated; and he
supports his conclusions by a considerable amount of evidence--evidence
which, so long as it is not critically examined, or not met by counter
evidence, seems to substantiate his positions. But it only needs to assume
that antagonistic attitude which _ought_ to be assumed towards new
doctrines, in the belief that, if true, they will prosper by conquering
objectors--it needs but to test his leading doctrines either by other facts
than those he cites, or by his own facts differently applied, to at once
show that they will not stand. We will proceed thus to deal with the
general principle on which he bases his hierarchy of the sciences.
In the second chapter of his _Cours de Philosophie Positive_, M. Comte
says:--"Our problem is, then, to find the one _rational_ order, amongst a
host of possible systems."... "This order is determined by the degree of
simplicity, or, what comes to the same thing, of generality of their
phenomena." And the arrangement he deduces runs thus: _Mathematics_,
_Astronomy_, _Physics_, _Chemistry_, _Physiology_, _Social Physics_. This
he asserts to be "the true _filiation_ of the sciences." He asserts
further, that the principle of progression from a greater to a less degree
of generality, "which gives this order to the whole body of science,
arranges the parts of each science." And, finally, he asserts that the
gradations thus established _a priori_ among the sciences, and the parts of
each science, "is in essential conformity with the order which has
spontaneously taken place among the branches of natural philosophy;" or, in
other words--corresponds with the order of historic development.
Let us compare these assertions with the facts. That there may be perfect
fairness, let us make no choice, but take as the field for our comparison,
the succeeding section treating of the first science--Mathematics; and let
us use none but M. Comte's own facts, and his own admissions. Confining
ourselves to this one science, of course our comparisons must be between
its several parts. M. Comte says, that the parts of each science must be
arranged in the order of their decreasing generality; and that this order
of decreasing generality agrees with the order of historic development. Our
inquiry must be, then, whether the history of mathematics confirms this
statement.
Carrying out his principle, M. Comte divides Mathematics into "Abstract
Mathematics, or the Calculus (taking the word in its most extended sense)
and Concrete Mathematics, which is composed of General Geometry and of
Rational Mechanics." The subject-matter of the first of these is _number_;
the subject-matter of the second includes _space_, _time_, _motion_,
_force_. The one possesses the highest possible degree of generality; for
all things whatever admit of enumeration. The others are less general;
seeing that there are endless phenomena that are not cognizable either by
general geometry or rational mechanics. In conformity with the alleged law,
therefore, the evolution of the calculus must throughout have preceded the
evolution of the concrete sub-sciences. Now somewhat awkwardly for him, the
first remark M. Comte makes bearing upon this point is, that "from an
historical point of view, mathematical analysis _appears to have risen out
of_ the contemplation of geometrical and mechanical facts." True, he goes
on to say that, "it is not the less independent of these sciences logically
speaking;" for that "analytical ideas are, above all others, universal,
abstract, and simple, and geometrical conceptions are necessarily founded
on them."
We will not take advantage of this last passage to charge M. Comte with
teaching, after the fashion of Hegel, that there can be thought without
things thought of. We are content simply to compare the two assertions,
that analysis arose out of the contemplation of geometrical and mechanical
facts, and that geometrical conceptions are founded upon analytical ones.
Literally interpreted they exactly cancel each other. Interpreted, however,
in a liberal sense, they imply, what we believe to be demonstrable, that
the two had _a simultaneous origin_. The passage is either nonsense, or it
is an admission that abstract and concrete mathematics are coeval. Thus, at
the very first step, the alleged congruity between the order of generality
and the order of evolution, does not hold good.
But may it not be that though abstract and concrete mathematics took their
rise at the same time, the one afterwards developed more rapidly than the
other; and has ever since remained in advance of it? No: and again we call
M. Comte himself as witness. Fortunately for his argument he has said
nothing respecting the early stages of the concrete and abstract divisions
after their divergence from a common root; otherwise the advent of Algebra
long after the Greek geometry had reached a high development, would have
been an inconvenient fact for him to deal with. But passing over this, and
limiting ourselves to his own statements, we find, at the opening of the
next chapter, the admission, that "the historical development of the
abstract portion of mathematical science has, since the time of Descartes,
been for the most part _determined_ by that of the concrete." Further on we
read respecting algebraic functions that "most functions were concrete in
their origin--even those which are at present the most purely abstract; and
the ancients discovered only through geometrical definitions elementary
algebraic properties of functions to which a numerical value was not
attached till long afterwards, rendering abstract to us what was concrete
to the old geometers." How do these statements tally with his doctrine?
Again, having divided the calculus into algebraic and arithmetical, M.
Comte admits, as perforce he must, that the algebraic is more general than
the arithmetical; yet he will not say that algebra preceded arithmetic in
point of time. And again, having divided the calculus of functions into the
calculus of direct functions (common algebra) and the calculus of indirect
functions (transcendental analysis), he is obliged to speak of this last as
possessing a higher generality than the first; yet it is far more modern.
Indeed, by implication, M. Comte himself confesses this incongruity; for he
says:--"It might seem that the transcendental analysis ought to be studied
before the ordinary, as it provides the equations which the other has to
resolve; but though the transcendental _is logically independent of the
ordinary_, it is best to follow the usual method of study, taking the
ordinary first." In all these cases, then, as well as at the close of the
section where he predicts that mathematicians will in time "create
procedures of _a wider generality_," M. Comte makes admissions that are
diametrically opposed to the alleged law.
In the succeeding chapters treating of the concrete department of
mathematics, we find similar contradictions. M. Comte himself names the
geometry of the ancients _special_ geometry, and that of moderns the
_general_ geometry. He admits that while "the ancients studied geometry
with reference to the _bodies_ under notice, or specially; the moderns
study it with reference to the _phenomena_ to be considered, or generally."
He admits that while "the ancients extracted all they could out of one line
or surface before passing to another," "the moderns, since Descartes,
employ themselves on questions which relate to any figure whatever." These
facts are the reverse of what, according to his theory, they should be. So,
too, in mechanics. Before dividing it into statics and dynamics, M. Comte
treats of the three laws of _motion_, and is obliged to do so; for statics,
the more _general_ of the two divisions, though it does not involve motion,
is impossible as a science until the laws of motion are ascertained. Yet
the laws of motion pertain to dynamics, the more _special_ of the
divisions. Further on he points out that after Archimedes, who discovered
the law of equilibrium of the lever, statics made no progress until the
establishment of dynamics enabled us to seek "the conditions of equilibrium
through the laws of the composition of forces." And he adds--"At this day
_this is the method universally employed_. At the first glance it does not
appear the most rational--dynamics being more complicated than statics, and
precedence being natural to the simpler. It would, in fact, be more
philosophical to refer dynamics to statics, as has since been done." Sundry
discoveries are afterwards detailed, showing how completely the development
of statics has been achieved by considering its problems dynamically; and
before the close of the section M. Comte remarks that "before hydrostatics
could be comprehended under statics, it was necessary that the abstract
theory of equilibrium should be made so general as to apply directly to
fluids as well as solids. This was accomplished when Lagrange supplied, as
the basis of the whole of rational mechanics, the single principle of
virtual velocities." In which statement we have two facts directly at
variance with M. Comte's doctrine;--first, that the simpler science,
statics, reached its present development only by the aid of the principle
of virtual velocities, which belongs to the more complex science, dynamics;
and that this "single principle" underlying all rational mechanics--this
_most general form_ which includes alike the relations of statical,
hydrostatical, and dynamical forces--was reached so late as the time of
Lagrange.
Thus it is _not_ true that the historical succession of the divisions of
mathematics has corresponded with the order of decreasing generality. It is
_not_ true that abstract mathematics was evolved antecedently to, and
independently of concrete mathematics. It is _not_ true that of the
subdivisions of abstract mathematics, the more general came before the more
special. And it is _not_ true that concrete mathematics, in either of its
two sections, began with the most abstract and advanced to the less
abstract truths.
It may be well to mention, parenthetically, that in defending his alleged
law of progression from the general to the special, M. Comte somewhere
comments upon the two meanings of the word _general_, and the resulting
liability to confusion. Without now discussing whether the asserted
distinction can be maintained in other cases, it is manifest that it does
not exist here. In sundry of the instances above quoted, the endeavors made
by M. Comte himself to disguise, or to explain away, the precedence of the
special over the general, clearly indicate that the generality spoken of,
is of the kind meant by his formula. And it needs but a brief consideration
of the matter to show that, even did he attempt it, he could not
distinguish this generality, which, as above proved, frequently comes last,
from the generality which he says always comes first. For what is the
nature of that mental process by which objects, dimensions, weights, times,
and the rest, are found capable of having their relations expressed
numerically? It is the formation of certain abstract conceptions of unity,
duality and multiplicity, which are applicable to all things alike. It is
the invention of general symbols serving to express the numerical relations
of entities, whatever be their special characters. And what is the nature
of the mental process by which numbers are found capable of having their
relations expressed algebraically? It is just the same. It is the formation
of certain abstract conceptions of numerical functions which are the same
whatever be the magnitudes of the numbers. It is the invention of general
symbols serving to express the relations between numbers, as numbers
express the relations between things. And transcendental analysis stands to
algebra in the same position that algebra stands in to arithmetic.
To briefly illustrate their respective powers;--arithmetic can express in
one formula the value of a _particular_ tangent to a _particular_ curve;
algebra can express in one formula the values of _all_ tangents to a
_particular_ curve; transcendental analysis can express in one formula the
values of _all_ tangents to _all_ curves. Just as arithmetic deals with the
common properties of lines, areas, bulks, forces, periods; so does algebra
deal with the common properties of the numbers which arithmetic presents;
so does transcendental analysis deal with the common properties of the
equations exhibited by algebra. Thus, the generality of the higher branches
of the calculus, when compared with the lower, is the same kind of
generality as that of the lower branches when compared with geometry or
mechanics. And on examination it will be found that the like relation
exists in the various other cases above given.
Having shown that M. Comte's alleged law of progression does not hold among
the several parts of the same science, let us see how it agrees with the
facts when applied to separate sciences. "Astronomy," says M. Comte, at the
opening of Book III., "was a positive science, in its geometrical aspect,
from the earliest days of the school of Alexandria; but Physics, which we
are now to consider, had no positive character at all till Galileo made his
great discoveries on the fall of heavy bodies." On this, our comment is
simply that it is a misrepresentation based upon an arbitrary misuse of
words--a mere verbal artifice. By choosing to exclude from terrestrial
physics those laws of magnitude, motion, and position, which he includes in
celestial physics, M. Comte makes it appear that the one owes nothing to
the other. Not only is this altogether unwarrantable, but it is radically
inconsistent with his own scheme of divisions. At the outset he says--and
as the point is important we quote from the original--"Pour la _physique
inorganique_ nous voyons d'abord, en nous conformant toujours a l'ordre de
generalite et de dependance des phenomenes, qu'elle doit etre partagee en
deux sections distinctes, suivant qu'elle considere les phenomenes generaux
de l'univers, ou, en particulier, ceux que presentent les corps terrestres.
D'ou la physique celeste, ou l'astronomie, soit geometrique, soit
mechanique; et la physique terrestre."
Here then we have _inorganic physics_ clearly divided into _celestial
physics_ and _terrestrial physics_--the phenomena presented by the
universe, and the phenomena presented by earthly bodies. If now celestial
bodies and terrestrial bodies exhibit sundry leading phenomena in common,
as they do, how can the generalization of these common phenomena be
considered as pertaining to the one class rather than to the other? If
inorganic physics includes geometry (which M. Comte has made it do by
comprehending _geometrical_ astronomy in its sub-section--celestial
physics); and if its sub-section--terrestrial physics, treats of things
having geometrical properties; how can the laws of geometrical relations be
excluded from terrestrial physics? Clearly if celestial physics includes
the geometry of objects in the heavens, terrestrial physics includes the
geometry of objects on the earth. And if terrestrial physics includes
terrestrial geometry, while celestial physics includes celestial geometry,
then the geometrical part of terrestrial physics precedes the geometrical
part of celestial physics; seeing that geometry gained its first ideas from
surrounding objects. Until men had learnt geometrical relations from bodies
on the earth, it was impossible for them to understand the geometrical
relations of bodies in the heavens.
So, too, with celestial mechanics, which had terrestrial mechanics for its
parent. The very conception of _force_, which underlies the whole of
mechanical astronomy, is borrowed from our earthly experiences; and the
leading laws of mechanical action as exhibited in scales, levers,
projectiles, &c., had to be ascertained before the dynamics of the solar
system could be entered upon. What were the laws made use of by Newton in
working out his grand discovery? The law of falling bodies disclosed by
Galileo; that of the composition of forces also disclosed by Galileo; and
that of centrifugal force found out by Huyghens--all of them
generalizations of terrestrial physics. Yet, with facts like these before
him, M. Comte places astronomy before physics in order of evolution! He
does not compare the geometrical parts of the two together, and the
mechanical parts of the two together; for this would by no means suit his
hypothesis. But he compares the geometrical part of the one with the
mechanical part of the other, and so gives a semblance of truth to his
position. He is led away by a verbal delusion. Had he confined his
attention to the things and disregarded the words, he would have seen that
before mankind scientifically co-ordinated _any one class of phenomena_
displayed in the heavens, they had previously co-ordinated _a parallel
class of phenomena_ displayed upon the surface of the earth.
Were it needful we could fill a score pages with the incongruities of M.
Comte's scheme. But the foregoing samples will suffice. So far is his law
of evolution of the sciences from being tenable, that, by following his
example, and arbitrarily ignoring one class of facts, it would be possible
to present, with great plausibility, just the opposite generalization to
that which he enunciates. While he asserts that the rational order of the
sciences, like the order of their historic development, "is determined by
the degree of simplicity, or, what comes to the same thing, of generality
of their phenomena;" it might contrariwise be asserted, that, commencing
with the complex and the special, mankind have progressed step by step to a
knowledge of greater simplicity and wider generality. So much evidence is
there of this as to have drawn from Whewell, in his _History of the
Inductive Sciences_, the general remark that "the reader has already seen
repeatedly in the course of this history, complex and derivative principles
presenting themselves to men's minds before simple and elementary ones."
Even from M. Comte's own work, numerous facts, admissions, and arguments,
might be picked out, tending to show this. We have already quoted his words
in proof that both abstract and concrete mathematics have progressed
towards a higher degree of generality, and that he looks forward to a
higher generality still. Just to strengthen this adverse hypothesis, let us
take a further instance. From the _particular_ case of the scales, the law
of equilibrium of which was familiar to the earliest nations known,
Archimedes advanced to the more _general_ case of the unequal lever with
unequal weights; the law of equilibrium of which _includes_ that of the
scales. By the help of Galileo's discovery concerning the composition of
forces, D'Alembert "established, for the first time, the equations of
equilibrium of _any_ system of forces applied to the different points of a
solid body"--equations which include all cases of levers and an infinity of
cases besides. Clearly this is progress towards a higher
generality--towards a knowledge more independent of special
circumstances--towards a study of phenomena "the most disengaged from the
incidents of particular cases;" which is M. Comte's definition of "the most
simple phenomena." Does it not indeed follow from the familiarly admitted
fact, that mental advance is from the concrete to the abstract, from the
particular to the general, that the universal and therefore most simple
truths are the last to be discovered? Is not the government of the solar
system by a force varying inversely as the square of the distance, a
simpler conception than any that preceded it? Should we ever succeed in
reducing all orders of phenomena to some single law--say of atomic action,
as M. Comte suggests--must not that law answer to his test of being
_independent_ of all others, and therefore most simple? And would not such
a law generalize the phenomena of gravity, cohesion, atomic affinity, and
electric repulsion, just as the laws of number generalize the quantitative
phenomena of space, time and force?
The possibility of saying so much in support of an hypothesis the very
reverse of M. Comte's, at once proves that his generalization is only a
half-truth. The fact is, that neither proposition is correct by itself; and
the actuality is expressed only by putting the two together. The progress
of science is duplex: it is at once from the special to the general, and
from the general to the special: it is analytical and synthetical at the
same time.
M. Comte himself observes that the evolution of science has been
accomplished by the division of labour; but he quite misstates the mode in
which this division of labour has operated. As he describes it, it has
simply been an arrangement of phenomena into classes, and the study of each
class by itself. He does not recognise the constant effect of progress in
each class upon _all_ other classes; but only on the class succeeding it in
his hierarchical scale. Or if he occasionally admits collateral influences
and intercommunications, he does it so grudgingly, and so quickly puts the
admissions out of sight and forgets them, as to leave the impression that,
with but trifling exceptions, the sciences aid each other only in the order
of their alleged succession. The fact is, however, that the division of
labour in science, like the division of labour in society, and like the
"physiological division of labour" in individual organisms, has been not
only a specialization of functions, but a continuous helping of each
division by all the others, and of all by each. Every particular class of
inquirers has, as it were, secreted its own particular order of truths from
the general mass of material which observation accumulates; and all other
classes of inquirers have made use of these truths as fast as they were
elaborated, with the effect of enabling them the better to elaborate each
its own order of truths.
It was thus in sundry of the cases we have quoted as at variance with M.
Comte's doctrine. It was thus with the application of Huyghens's optical
discovery to astronomical observation by Galileo. It was thus with the
application of the isochronism of the pendulum to the making of instruments
for measuring intervals, astronomical and other. It was thus when the
discovery that the refraction and dispersion of light did not follow the
same law of variation, affected both astronomy and physiology by giving us
achromatic telescopes and microscopes. It was thus when Bradley's discovery
of the aberration of light enabled him to make the first step towards
ascertaining the motions of the stars. It was thus when Cavendish's
torsion-balance experiment determined the specific gravity of the earth,
and so gave a datum for calculating the specific gravities of the sun and
planets. It was thus when tables of atmospheric refraction enabled
observers to write down the real places of the heavenly bodies instead of
their apparent places. It was thus when the discovery of the different
expansibilities of metals by heat, gave us the means of correcting our
chronometrical measurements of astronomical periods. It was thus when the
lines of the prismatic spectrum were used to distinguish the heavenly
bodies that are of like nature with the sun from those which are not. It
was thus when, as recently, an electro-telegraphic instrument was invented
for the more accurate registration of meridional transits. It was thus when
the difference in the rates of a clock at the equator, and nearer the
poles, gave data for calculating the oblateness of the earth, and
accounting for the precession of the equinoxes. It was thus--but it is
needless to continue.
Here, within our own limited knowledge of its history, we have named ten
additional cases in which the single science of astronomy has owed its
advance to sciences coming _after_ it in M. Comte's series. Not only its
secondary steps, but its greatest revolutions have been thus determined.
Kepler could not have discovered his celebrated laws had it not been for
Tycho Brahe's accurate observations; and it was only after some progress in
physical and chemical science that the improved instruments with which
those observations were made, became possible. The heliocentric theory of
the solar system had to wait until the invention of the telescope before it
could be finally established. Nay, even the grand discovery of all--the law
of gravitation--depended for its proof upon an operation of physical
science, the measurement of a degree on the Earth's surface. So completely
indeed did it thus depend, that Newton _had actually abandoned his
hypothesis_ because the length of a degree, as then stated, brought out
wrong results; and it was only after Picard's more exact measurement was
published, that he returned to his calculations and proved his great
generalization. Now this constant intercommunion, which, for brevity's
sake, we have illustrated in the case of one science only, has been taking
place with all the sciences. Throughout the whole course of their evolution
there has been a continuous _consensus_ of the sciences--a _consensus_
exhibiting a general correspondence with the _consensus_ of faculties in
each phase of mental development; the one being an objective registry of
the subjective state of the other.
* * * * *
From our present point of view, then, it becomes obvious that the
conception of a _serial_ arrangement of the sciences is a vicious one. It
is not simply that the schemes we have examined are untenable; but it is
that the sciences cannot be rightly placed in any linear order whatever. It
is not simply that, as M. Comte admits, a classification "will always
involve something, if not arbitrary, at least artificial;" it is not, as he
would have us believe, that, neglecting minor imperfections a
classification may be substantially true; but it is that any grouping of
the sciences in a succession gives a radically erroneous idea of their
genesis and their dependencies. There is no "one _rational_ order among a
host of possible systems." There is no "true _filiation_ of the sciences."
The whole hypothesis is fundamentally false. Indeed, it needs but a glance
at its origin to see at once how baseless it is. Why a _series_? What
reason have we to suppose that the sciences admit of a _linear_
arrangement? Where is our warrant for assuming that there is some
_succession_ in which they can be placed? There is no reason; no warrant.
Whence then has arisen the supposition? To use M. Comte's own phraseology,
we should say, it is a metaphysical conception. It adds another to the
cases constantly occurring, of the human mind being made the measure of
Nature. We are obliged to think in sequence; it is the law of our minds
that we must consider subjects separately, one after another: _therefore_
Nature must be serial--_therefore_ the sciences must be classifiable in a
succession. See here the birth of the notion, and the sole evidence of its
truth. Men have been obliged when arranging in books their schemes of
education and systems of knowledge, to choose _some_ order or other. And
from inquiring what is the best order, have naturally fallen into the
belief that there is an order which truly represents the facts--have
persevered in seeking such an order; quite overlooking the previous
question whether it is likely that Nature has consulted the convenience of
book-making.
For German philosophers, who hold that Nature is "petrified intelligence,"
and that logical forms are the foundations of all things, it is a
consistent hypothesis that as thought is serial, Nature is serial; but that
M. Comte, who is so bitter an opponent of all anthropomorphism, even in its
most evanescent shapes, should have committed the mistake of imposing upon
the external world an arrangement which so obviously springs from a
limitation of the human consciousness, is somewhat strange. And it is the
more strange when we call to mind how, at the outset, M. Comte remarks that
in the beginning "_toutes les sciences sont cultivees simultanement par les
memes esprits_;" that this is "_inevitable et meme indispensable_;" and how
he further remarks that the different sciences are "_comme les diverses
branches d'un tronc unique_." Were it not accounted for by the distorting
influence of a cherished hypothesis, it would be scarcely possible to
understand how, after recognising truths like these, M. Comte should have
persisted in attempting to construct "_une echelle encyclopedique_."
The metaphor which M. Comte has here so inconsistently used to express the
relations of the sciences--branches of one trunk--is an approximation to
the truth, though not the truth itself. It suggests the facts that the
sciences had a common origin; that they have been developing
simultaneously; and that they have been from time to time dividing and
sub-dividing. But it does not suggest the yet more important fact, that the
divisions and sub-divisions thus arising do not remain separate, but now
and again re-unite in direct and indirect ways. They inosculate; they
severally send off and receive connecting growths; and the intercommunion
has been ever becoming more frequent, more intricate, more widely ramified.
There has all along been higher specialization, that there might be a
larger generalization; and a deeper analysis, that there might be a better
synthesis. Each larger generalization has lifted sundry specializations
still higher; and each better synthesis has prepared the way for still
deeper analysis.
And here we may fitly enter upon the task awhile since indicated--a sketch
of the Genesis of Science, regarded as a gradual outgrowth from common
knowledge--an extension of the perceptions by the aid of the reason. We
propose to treat it as a psychological process historically displayed;
tracing at the same time the advance from qualitative to quantitative
prevision; the progress from concrete facts to abstract facts, and the
application of such abstract facts to the analysis of new orders of
concrete facts; the simultaneous advance in generalization and
specialization; the continually increasing subdivision and reunion of the
sciences; and their constantly improving _consensus_.
* * * * *
To trace out scientific evolution from its deepest roots would, of course,
involve a complete analysis of the mind. For as science is a development of
that common knowledge acquired by the unaided senses and uncultured reason,
so is that common knowledge itself gradually built up out of the simplest
perceptions. We must, therefore, begin somewhere abruptly; and the most
appropriate stage to take for our point of departure will be the adult mind
of the savage.
Commencing thus, without a proper preliminary analysis, we are naturally
somewhat at a loss how to present, in a satisfactory manner, those
fundamental processes of thought out of which science ultimately
originates. Perhaps our argument may be best initiated by the proposition,
that all intelligent action whatever depends upon the discerning of
distinctions among surrounding things. The condition under which only it is
possible for any creature to obtain food and avoid danger is, that it shall
be differently affected by different objects--that it shall be led to act
in one way by one object, and in another way by another. In the lower
orders of creatures this condition is fulfilled by means of an apparatus
which acts automatically. In the higher orders the actions are partly
automatic, partly conscious. And in man they are almost wholly conscious.
Throughout, however, there must necessarily exist a certain classification
of things according to their properties--a classification which is either
organically registered in the system, as in the inferior creation, or is
formed by experience, as in ourselves. And it may be further remarked, that
the extent to which this classification is carried, roughly indicates the
height of intelligence--that, while the lowest organisms are able to do
little more than discriminate organic from inorganic matter; while the
generality of animals carry their classifications no further than to a
limited number of plants or creatures serving for food, a limited number of
beasts of prey, and a limited number of places and materials; the most
degraded of the human race possess a knowledge of the distinctive natures
of a great variety of substances, plants, animals, tools, persons, &c., not
only as classes but as individuals.
What now is the mental process by which classification is effected?
Manifestly it is a recognition of the _likeness_ or _unlikeness_ of things,
either in respect of their sizes, colours, forms, weights, textures,
tastes, &c., or in respect of their modes of action. By some special mark,
sound, or motion, the savage identifies a certain four-legged creature he
sees, as one that is good for food, and to be caught in a particular way;
or as one that is dangerous; and acts accordingly. He has classed together
all the creatures that are _alike_ in this particular. And manifestly in
choosing the wood out of which to form his bow, the plant with which to
poison his arrows, the bone from which to make his fish-hooks, he
identifies them through their chief sensible properties as belonging to the
general classes, wood, plant, and bone, but distinguishes them as belonging
to sub-classes by virtue of certain properties in which they are _unlike_
the rest of the general classes they belong to; and so forms genera and
species.
And here it becomes manifest that not only is classification carried on by
grouping together in the mind things that are _like_; but that classes and
sub-classes are formed and arranged according to the _degrees of
unlikeness_. Things widely contrasted are alone distinguished in the lower
stages of mental evolution; as may be any day observed in an infant. And
gradually as the powers of discrimination increase, the widely contrasted
classes at first distinguished, come to be each divided into sub-classes,
differing from each other less than the classes differ; and these
sub-classes are again divided after the same manner. By the continuance of
which process, things are gradually arranged into groups, the members of
which are less and less _unlike_; ending, finally, in groups whose members
differ only as individuals, and not specifically. And thus there tends
ultimately to arise the notion of _complete likeness_. For manifestly, it
is impossible that groups should continue to be sub-divided in virtue of
smaller and smaller differences, without there being a simultaneous
approximation to the notion of _no difference_.
Let us next notice that the recognition of likeness and unlikeness, which
underlies classification, and out of which continued classification evolves
the idea of complete likeness--let us next notice that it also underlies
the process of _naming_, and by consequence _language_. For all language
consists, at the beginning, of symbols which are as _like_ to the things
symbolized as it is practicable to make them. The language of signs is a
means of conveying ideas by mimicking the actions or peculiarities of the
things referred to. Verbal language is also, at the beginning, a mode of
suggesting objects or acts by imitating the sounds which the objects make,
or with which the acts are accompanied. Originally these two languages were
used simultaneously. It needs but to watch the gesticulations with which
the savage accompanies his speech--to see a Bushman or a Kaffir dramatizing
before an audience his mode of catching game--or to note the extreme
paucity of words in all primitive vocabularies; to infer that at first,
attitudes, gestures, and sounds, were all combined to produce as good a
_likeness_ as possible, of the things, animals, persons, or events
described; and that as the sounds came to be understood by themselves the
gestures fell into disuse: leaving traces, however, in the manners of the
more excitable civilized races. But be this as it may, it suffices simply
to observe, how many of the words current among barbarous peoples are like
the sounds appertaining to the things signified; how many of our own oldest
and simplest words have the same peculiarity; how children tend to invent
imitative words; and how the sign-language spontaneously formed by deaf
mutes is invariably based upon imitative actions--to at once see that the
notion of _likeness_ is that from which the nomenclature of objects takes
its rise.
Were there space we might go on to point out how this law of life is
traceable, not only in the origin but in the development of language; how
in primitive tongues the plural is made by a duplication of the singular,
which is a multiplication of the word to make it _like_ the multiplicity of
the things; how the use of metaphor--that prolific source of new words--is
a suggesting of ideas that are _like_ the ideas to be conveyed in some
respect or other; and how, in the copious use of simile, fable, and
allegory among uncivilized races, we see that complex conceptions, which
there is yet no direct language for, are rendered, by presenting known
conceptions more or less _like_ them.
This view is further confirmed, and the predominance of this notion of
likeness in primitive times further illustrated, by the fact that our
system of presenting ideas to the eye originated after the same fashion.
Writing and printing have descended from picture-language. The earliest
mode of permanently registering a fact was by depicting it on a wall; that
is--by exhibiting something as _like_ to the thing to be remembered as it
could be made. Gradually as the practice grew habitual and extensive, the
most frequently repeated forms became fixed, and presently abbreviated;
and, passing through the hieroglyphic and ideographic phases, the symbols
lost all apparent relations to the things signified: just as the majority
of our spoken words have done.
Observe again, that the same thing is true respecting the genesis of
reasoning. The _likeness_ that is perceived to exist between cases, is the
essence of all early reasoning and of much of our present reasoning. The
savage, having by experience discovered a relation between a certain object
and a certain act, infers that the _like_ relation will be found in future
cases. And the expressions we constantly use in our arguments--"_analogy_
implies," "the cases are not _parallel_," "by _parity_ of reasoning,"
"there is no _similarity_,"--show how constantly the idea of likeness
underlies our ratiocinative processes.
Still more clearly will this be seen on recognising the fact that there is
a certain parallelism between reasoning and classification; that the two
have a common root; and that neither can go on without the other. For on
the one hand, it is a familiar truth that the attributing to a body in
consequence of some of its properties, all those other properties in virtue
of which it is referred to a particular class, is an act of inference. And,
on the other hand, the forming of a generalization is the putting together
in one class, all those cases which present like relations; while the
drawing a deduction is essentially the perception that a particular case
belongs to a certain class of cases previously generalized. So that as
classification is a grouping together of _like things_; reasoning is a
grouping together of _like relations_ among things. Add to which, that
while the perfection gradually achieved in classification consists in the
formation of groups of _objects_ which are _completely alike_; the
perfection gradually achieved in reasoning consists in the formation of
groups of _cases_ which are _completely alike_.
Once more we may contemplate this dominant idea of likeness as exhibited in
art. All art, civilized as well as savage, consists almost wholly in the
making of objects _like_ other objects; either as found in Nature, or as
produced by previous art. If we trace back the varied art-products now
existing, we find that at each stage the divergence from previous patterns
is but small when compared with the agreement; and in the earliest art the
persistency of imitation is yet more conspicuous. The old forms and
ornaments and symbols were held sacred, and perpetually copied. Indeed, the
strong imitative tendency notoriously displayed by the lowest human races,
ensures among them a constant reproducing of likenesses of things, forms,
signs, sounds, actions, and whatever else is imitable; and we may even
suspect that this aboriginal peculiarity is in some way connected with the
culture and development of this general conception, which we have found so
deep and widespread in its applications.
And now let us go on to consider how, by a further unfolding of this same
fundamental notion, there is a gradual formation of the first germs of
science. This idea of likeness which underlies classification,
nomenclature, language spoken and written, reasoning, and art; and which
plays so important a part because all acts of intelligence are made
possible only by distinguishing among surrounding things, or grouping them
into like and unlike;--this idea we shall find to be the one of which
science is the especial product. Already during the stage we have been
describing, there has existed _qualitative_ prevision in respect to the
commoner phenomena with which savage life is familiar; and we have now to
inquire how the elements of _quantitative_ prevision are evolved. We shall
find that they originate by the perfecting of this same idea of likeness;
that they have their rise in that conception of _complete likeness_ which,
as we have seen, necessarily results from the continued process of
classification.
For when the process of classification has been carried as far as it is
possible for the uncivilized to carry it--when the animal kingdom has been
grouped not merely into quadrupeds, birds, fishes, and insects, but each of
these divided into kinds--when there come to be sub-classes, in each of
which the members differ only as individuals, and not specifically; it is
clear that there must occur a frequent observation of objects which differ
so little as to be indistinguishable. Among several creatures which the
savage has killed and carried home, it must often happen that some one,
which he wished to identify, is so exactly like another that he cannot tell
which is which. Thus, then, there originates the notion of _equality_. The
things which among ourselves are called _equal_--whether lines, angles,
weights, temperatures, sounds or colours--are things which produce in us
sensations that cannot be distinguished from each other. It is true that we
now apply the word _equal_ chiefly to the separate phenomena which objects
exhibit, and not to groups of phenomena; but this limitation of the idea
has evidently arisen by subsequent analysis. And that the notion of
equality did thus originate, will, we think, become obvious on remembering
that as there were no artificial objects from which it could have been
abstracted, it must have been abstracted from natural objects; and that the
various families of the animal kingdom chiefly furnish those natural
objects which display the requisite exactitude of likeness.
The same order of experiences out of which this general idea of equality is
evolved, gives birth at the same time to a more complex idea of equality;
or, rather, the process just described generates an idea of equality which
further experience separates into two ideas--_equality of things_ and
_equality of relations_. While organic, and more especially animal forms,
occasionally exhibit this perfection of likeness out of which the notion of
simple equality arises, they more frequently exhibit only that kind of
likeness which we call _similarity_; and which is really compound equality.
For the similarity of two creatures of the same species but of different
sizes, is of the same nature as the similarity of two geometrical figures.
In either case, any two parts of the one bear the same ratio to one
another, as the homologous parts of the other. Given in any species, the
proportions found to exist among the bones, and we may, and zoologists do,
predict from any one, the dimensions of the rest; just as, when knowing the
proportions subsisting among the parts of a geometrical figure, we may,
from the length of one, calculate the others. And if, in the case of
similar geometrical figures, the similarity can be established only by
proving exactness of proportion among the homologous parts; if we express
this relation between two parts in the one, and the corresponding parts in
the other, by the formula A is to B as _a_ is to _b_; if we otherwise write
this, A to B = _a_ to _b_; if, consequently, the fact we prove is that the
relation of A to B _equals_ the relation of _a_ to _b_; then it is manifest
that the fundamental conception of similarity is _equality of relations_.
With this explanation we shall be understood when we say that the notion of
equality of relations is the basis of all exact reasoning. Already it has
been shown that reasoning in general is a recognition of _likeness_ of
relations; and here we further find that while the notion of likeness of
things ultimately evolves the idea of simple equality, the notion of
likeness of relations evolves the idea of equality of relations: of which
the one is the concrete germ of exact science, while the other is its
abstract germ.
Those who cannot understand how the recognition of similarity in creatures
of the same kind, can have any alliance with reasoning, will get over the
difficulty on remembering that the phenomena among which equality of
relations is thus perceived, are phenomena of the same order and are
present to the senses at the same time; while those among which developed
reason perceives relations, are generally neither of the same order, nor
simultaneously present. And if further, they will call to mind how Cuvier
and Owen, from a single part of a creature, as a tooth, construct the rest
by a process of reasoning based on this equality of relations, they will
see that the two things are intimately connected, remote as they at first
seem. But we anticipate. What it concerns us here to observe is, that from
familiarity with organic forms there simultaneously arose the ideas of
_simple equality_, and _equality of relations_.
At the same time, too, and out of the same mental processes, came the first
distinct ideas of _number_. In the earliest stages, the presentation of
several like objects produced merely an indefinite conception of
multiplicity; as it still does among Australians, and Bushmen, and Damaras,
when the number presented exceeds three or four. With such a fact before us
we may safely infer that the first clear numerical conception was that of
duality as contrasted with unity. And this notion of duality must
necessarily have grown up side by side with those of likeness and equality;
seeing that it is impossible to recognise the likeness of two things
without also perceiving that there are two. From the very beginning the
conception of number must have been, as it is still, associated with the
likeness or equality of the things numbered. If we analyze it, we find that
simple enumeration is a registration of repeated impressions of any kind.
That these may be capable of enumeration it is needful that they be more or
less alike; and before any _absolutely true_ numerical results can be
reached, it is requisite that the units be _absolutely equal_. The only way
in which we can establish a numerical relationship between things that do
not yield us like impressions, is to divide them into parts that _do_ yield
us like impressions. Two unlike magnitudes of extension, force, time,
weight, or what not, can have their relative amounts estimated, only by
means of some small unit that is contained many times in both; and even if
we finally write down the greater one as a unit and the other as a fraction
of it, we state, in the denominator of the fraction, the number of parts
into which the unit must be divided to be comparable with the fraction.
It is, indeed, true, that by an evidently modern process of abstraction, we
occasionally apply numbers to unequal units, as the furniture at a sale or
the various animals on a farm, simply as so many separate entities; but no
true result can be brought out by calculation with units of this order.
And, indeed, it is the distinctive peculiarity of the calculus in general,
that it proceeds on the hypothesis of that absolute equality of its
abstract units, which no real units possess; and that the exactness of its
results holds only in virtue of this hypothesis. The first ideas of number
must necessarily then have been derived from like or equal magnitudes as
seen chiefly in organic objects; and as the like magnitudes most frequently
observed were magnitudes of extension, it follows that geometry and
arithmetic had a simultaneous origin.
Not only are the first distinct ideas of number co-ordinate with ideas of
likeness and equality, but the first efforts at numeration displayed the
same relationship. On reading the accounts of various savage tribes, we
find that the method of counting by the fingers, still followed by many
children, is the aboriginal method. Neglecting the several cases in which
the ability to enumerate does not reach even to the number of fingers on
one hand, there are many cases in which it does not extend beyond ten--the
limit of the simple finger notation. The fact that in so many instances,
remote, and seemingly unrelated nations, have adopted _ten_ as their basic
number; together with the fact that in the remaining instances the basic
number is either _five_ (the fingers of one hand) or _twenty_ (the fingers
and toes); almost of themselves show that the fingers were the original
units of numeration. The still surviving use of the word _digit_, as the
general name for a figure in arithmetic, is significant; and it is even
said that our word _ten_ (Sax. tyn; Dutch, tien; German, zehn) means in its
primitive expanded form _two hands_. So that originally, to say there were
ten things, was to say there were two hands of them.
From all which evidence it is tolerably clear that the earliest mode of
conveying the idea of any number of things, was by holding up as many
fingers as there were things; that is--using a symbol which was _equal_, in
respect of multiplicity, to the group symbolized. For which inference there
is, indeed, strong confirmation in the recent statement that our own
soldiers are even now spontaneously adopting this device in their dealings
with the Turks. And here it should be remarked that in this recombination
of the notion of equality with that of multiplicity, by which the first
steps in numeration are effected, we may see one of the earliest of those
inosculations between the diverging branches of science, which are
afterwards of perpetual occurrence.
Indeed, as this observation suggests, it will be well, before tracing the
mode in which exact science finally emerges from the merely approximate
judgments of the senses, and showing the non-serial evolution of its
divisions, to note the non-serial character of those preliminary processes
of which all after development is a continuation. On re-considering them it
will be seen that not only are they divergent growths from a common
root,--not only are they simultaneous in their progress; but that they are
mutual aids; and that none can advance without the rest. That completeness
of classification for which the unfolding of the perceptions paves the way,
is impossible without a corresponding progress in language, by which
greater varieties of objects are thinkable and expressible. On the one hand
it is impossible to carry classification far without names by which to
designate the classes; and on the other hand it is impossible to make
language faster than things are classified.
Again, the multiplication of classes and the consequent narrowing of each
class, itself involves a greater likeness among the things classed
together; and the consequent approach towards the notion of complete
likeness itself allows classification to be carried higher. Moreover,
classification necessarily advances _pari passu_ with rationality--the
classification of _things_ with the classification of _relations_. For
things that belong to the same class are, by implication, things of which
the properties and modes of behaviour--the co-existences and sequences--are
more or less the same; and the recognition of this sameness of
co-existences and sequences is reasoning. Whence it follows that the
advance of classification is necessarily proportionate to the advance of
generalizations. Yet further, the notion of _likeness_, both in things and
relations, simultaneously evolves by one process of culture the ideas of
_equality_ of things and _equality_ of relations; which are the respective
bases of exact concrete reasoning and exact abstract reasoning--Mathematics
and Logic. And once more, this idea of equality, in the very process of
being formed, necessarily gives origin to two series of relations--those of
magnitude and those of number: from which arise geometry and the calculus.
Thus the process throughout is one of perpetual subdivision and perpetual
intercommunication of the divisions. From the very first there has been
that _consensus_ of different kinds of knowledge, answering to the
_consensus_ of the intellectual faculties, which, as already said, must
exist among the sciences.
Let us now go on to observe how, out of the notions of _equality_ and
_number_, as arrived at in the manner described, there gradually arose the
elements of quantitative prevision.
Equality, once having come to be definitely conceived, was readily
applicable to other phenomena than those of magnitude. Being predicable of
all things producing indistinguishable impressions, there naturally grew up
ideas of equality in weights, sounds, colours, &c.; and indeed it can
scarcely be doubted that the occasional experience of equal weights,
sounds, and colours, had a share in developing the abstract conception of
equality--that the ideas of equality in size, relations, forces,
resistances, and sensible properties in general, were evolved during the
same period. But however this may be, it is clear that as fast as the
notion of equality gained definiteness, so fast did that lowest kind of
quantitative prevision which is achieved without any instrumental aid,
become possible.
The ability to estimate, however roughly, the amount of a foreseen result,
implies the conception that it will be _equal to_ a certain imagined
quantity; and the correctness of the estimate will manifestly depend upon
the accuracy at which the perceptions of sensible equality have arrived. A
savage with a piece of stone in his hand, and another piece lying before
him of greater bulk but of the same kind (a fact which he infers from the
_equality_ of the two in colour and texture) knows about what effort he
must put forth to raise this other piece; and he judges accurately in
proportion to the accuracy with which he perceives that the one is twice,
three times, four times, &c. as large as the other; that is--in proportion
to the precision of his ideas of equality and number. And here let us not
omit to notice that even in these vaguest of quantitative previsions, the
conception of _equality of relations_ is also involved. For it is only in
virtue of an undefined perception that the relation between bulk and weight
in the one stone is _equal_ to the relation between bulk and weight in the
other, that even the roughest approximation can be made.
But how came the transition from those uncertain perceptions of equality
which the unaided senses give, to the certain ones with which science
deals? It came by placing the things compared in juxtaposition. Equality
being predicated of things which give us indistinguishable impressions, and
no accurate comparison of impressions being possible unless they occur in
immediate succession, it results that exactness of equality is
ascertainable in proportion to the closeness of the compared things. Hence
the fact that when we wish to judge of two shades of colour whether they
are alike or not, we place them side by side; hence the fact that we
cannot, with any precision, say which of two allied sounds is the louder,
or the higher in pitch, unless we hear the one immediately after the other;
hence the fact that to estimate the ratio of weights, we take one in each
hand, that we may compare their pressures by rapidly alternating in thought
from the one to the other; hence the fact, that in a piece of music, we can
continue to make equal beats when the first beat has been given, but cannot
ensure commencing with the same length of beat on a future occasion; and
hence, lastly, the fact, that of all magnitudes, those of _linear
extension_ are those of which the equality is most accurately
ascertainable, and those to which by consequence all others have to be
reduced. For it is the peculiarity of linear extension that it alone allows
its magnitudes to be placed in _absolute_ juxtaposition, or, rather, in
coincident position; it alone can test the equality of two magnitudes by
observing whether they will coalesce, as two equal mathematical lines do,
when placed between the same points; it alone can test _equality_ by trying
whether it will become _identity_. Hence, then, the fact, that all exact
science is reducible, by an ultimate analysis, to results measured in equal
units of linear extension.
Still it remains to be noticed in what manner this determination of
equality by comparison of linear magnitudes originated. Once more may we
perceive that surrounding natural objects supplied the needful lessons.
From the beginning there must have been a constant experience of like
things placed side by side--men standing and walking together; animals from
the same herd; fish from the same shoal. And the ceaseless repetition of
these experiences could not fail to suggest the observation, that the
nearer together any objects were, the more visible became any inequality
between them. Hence the obvious device of putting in apposition, things of
which it was desired to ascertain the relative magnitudes. Hence the idea
of _measure_. And here we suddenly come upon a group of facts which afford
a solid basis to the remainder of our argument; while they also furnish
strong evidence in support of the foregoing speculations. Those who look
sceptically on this attempted rehabilitation of the earliest epochs of
mental development, and who more especially think that the derivation of so
many primary notions from organic forms is somewhat strained, will perhaps
see more probability in the several hypotheses that have been ventured, on
discovering that all measures of _extension_ and _force_ originated from
the lengths and weights of organic bodies; and all measures of _time_ from
the periodic phenomena of either organic or inorganic bodies.
Thus, among linear measures, the cubit of the Hebrews was the _length of
the forearm_ from the elbow to the end of the middle finger; and the
smaller scriptural dimensions are expressed in _hand-breadths_ and _spans_.
The Egyptian cubit, which was similarly derived, was divided into digits,
which were _finger-breadths_; and each finger-breadth was more definitely
expressed as being equal to four _grains of barley_ placed breadthwise.
Other ancient measures were the orgyia or _stretch of the arms_, the
_pace_, and the _palm_. So persistent has been the use of these natural
units of length in the East, that even now some of the Arabs mete out cloth
by the forearm. So, too, is it with European measures. The _foot_ prevails
as a dimension throughout Europe, and has done since the time of the
Romans, by whom, also, it was used: its lengths in different places varying
not much more than men's feet vary. The heights of horses are still
expressed in _hands_. The inch is the length of the terminal joint of _the
thumb_; as is clearly shown in France, where _pouce_ means both thumb and
inch. Then we have the inch divided into three _barley-corns_.
So completely, indeed, have these organic dimensions served as the
substrata of all mensuration, that it is only by means of them that we can
form any estimate of some of the ancient distances. For example, the length
of a degree on the Earth's surface, as determined by the Arabian
astronomers shortly after the death of Haroun-al-Raschid, was fifty-six of
their miles. We know nothing of their mile further than that it was 4000
cubits; and whether these were sacred cubits or common cubits, would remain
doubtful, but that the length of the cubit is given as twenty-seven inches,
and each inch defined as the thickness of six barley-grains. Thus one of
the earliest measurements of a degree comes down to us in barley-grains.
Not only did organic lengths furnish those approximate measures which
satisfied men's needs in ruder ages, but they furnished also the standard
measures required in later times. One instance occurs in our own history.
To remedy the irregularities then prevailing, Henry I. commanded that the
ulna, or ancient ell, which answers to the modern yard, should be made of
the exact length of _his own arm_.
Measures of weight again had a like derivation. Seeds seem commonly to have
supplied the unit. The original of the carat used for weighing in India is
_a small bean_. Our own systems, both troy and avoirdupois, are derived,
primarily from wheat-corns. Our smallest weight, the grain, is _a grain of
wheat_. This is not a speculation; it is an historically registered fact.
Henry III. enacted that an ounce should be the weight of 640 dry grains of
wheat from the middle of the ear. And as all the other weights are
multiples or sub-multiples of this, it follows that the grain of wheat is
the basis of our scale. So natural is it to use organic bodies as weights,
before artificial weights have been established, or where they are not to
be had, that in some of the remoter parts of Ireland the people are said to
be in the habit, even now, of putting a man into the scales to serve as a
measure for heavy commodities.
Similarly with time. Astronomical periodicity, and the periodicity of
animal and vegetable life, are simultaneously used in the first stages of
progress for estimating epochs. The simplest unit of time, the day, nature
supplies ready made. The next simplest period, the mooneth or month, is
also thrust upon men's notice by the conspicuous changes constituting a
lunation. For larger divisions than these, the phenomena of the seasons,
and the chief events from time to time occurring, have been used by early
and uncivilized races. Among the Egyptians the rising of the Nile served as
a mark. The New Zealanders were found to begin their year from the
reappearance of the Pleiades above the sea. One of the uses ascribed to
birds, by the Greeks, was to indicate the seasons by their migrations.
Barrow describes the aboriginal Hottentot as denoting periods by the number
of moons before or after the ripening of one of his chief articles of food.
He further states that the Kaffir chronology is kept by the moon, and is
registered by notches on sticks--the death of a favourite chief, or the
gaining of a victory, serving for a new era. By which last fact, we are at
once reminded that in early history, events are commonly recorded as
occurring in certain reigns, and in certain years of certain reigns: a
proceeding which practically made a king's reign a measure of duration.
And, as further illustrating the tendency to divide time by natural
phenomena and natural events, it may be noticed that even by our own
peasantry the definite divisions of months and years are but little used;
and that they habitually refer to occurrences as "before sheep-shearing,"
or "after harvest," or "about the time when the squire died." It is
manifest, therefore, that the more or less equal periods perceived in
Nature gave the first units of measure for time; as did Nature's more or
less equal lengths and weights give the first units of measure for space
and force.
It remains only to observe, as further illustrating the evolution of
quantitative ideas after this manner, that measures of value were similarly
derived. Barter, in one form or other, is found among all but the very
lowest human races. It is obviously based upon the notion of _equality of
worth_. And as it gradually merges into trade by the introduction of some
kind of currency, we find that the _measures of worth_, constituting this
currency, are organic bodies; in some cases _cowries_, in others
_cocoa-nuts_, in others _cattle_, in others _pigs_; among the American
Indians peltry or _skins_, and in Iceland _dried fish_.
Notions of exact equality and of measure having been reached, there came to
be definite ideas of relative magnitudes as being multiples one of another;
whence the practice of measurement by direct apposition of a measure. The
determination of linear extensions by this process can scarcely be called
science, though it is a step towards it; but the determination of lengths
of time by an analogous process may be considered as one of the earliest
samples of quantitative prevision. For when it is first ascertained that
the moon completes the cycle of her changes in about thirty days--a fact
known to most uncivilized tribes that can count beyond the number of their
fingers--it is manifest that it becomes possible to say in what number of
days any specified phase of the moon will recur; and it is also manifest
that this prevision is effected by an opposition of two times, after the
same manner that linear space is measured by the opposition of two lines.
For to express the moon's period in days, is to say how many of these units
of measure are contained in the period to be measured--is to ascertain the
distance between two points in time by means of a _scale of days_, just as
we ascertain the distance between two points in space by a scale of feet or
inches: and in each case the scale coincides with the thing
measured--mentally in the one; visibly in the other. So that in this
simplest, and perhaps earliest case of quantitative prevision, the
phenomena are not only thrust daily upon men's notice, but Nature is, as it
were, perpetually repeating that process of measurement by observing which
the prevision is effected. And thus there may be significance in the remark
which some have made, that alike in Hebrew, Greek, and Latin, there is an
affinity between the word meaning moon, and that meaning measure.
This fact, that in very early stages of social progress it is known that
the moon goes through her changes in about thirty days, and that in about
twelve moons the seasons return--this fact that chronological astronomy
assumes a certain scientific character even before geometry does; while it
is partly due to the circumstance that the astronomical divisions, day,
month, and year, are ready made for us, is partly due to the further
circumstances that agricultural and other operations were at first
regulated astronomically, and that from the supposed divine nature of the
heavenly bodies their motions determined the periodical religious
festivals. As instances of the one we have the observation of the
Egyptians, that the rising of the Nile corresponded with the heliacal
rising of Sirius; the directions given by Hesiod for reaping and ploughing,
according to the positions of the Pleiades; and his maxim that "fifty days
after the turning of the sun is a seasonable time for beginning a voyage."
As instances of the other, we have the naming of the days after the sun,
moon, and planets; the early attempts among Eastern nations to regulate the
calendar so that the gods might not be offended by the displacement of
their sacrifices; and the fixing of the great annual festival of the
Peruvians by the position of the sun. In all which facts we see that, at
first, science was simply an appliance of religion and industry.
After the discoveries that a lunation occupies nearly thirty days, and that
some twelve lunations occupy a year--discoveries of which there is no
historical account, but which may be inferred as the earliest, from the
fact that existing uncivilized races have made them--we come to the first
known astronomical records, which are those of eclipses. The Chaldeans were
able to predict these. "This they did, probably," says Dr. Whewell in his
useful history, from which most of the materials we are about to use will
be drawn, "by means of their cycle of 223 months, or about eighteen years;
for at the end of this time, the eclipses of the moon begin to return, at
the same intervals and in the same order as at the beginning." Now this
method of calculating eclipses by means of a recurring cycle,--the _Saros_
as they called it--is a more complex case of prevision by means of
coincidence of measures. For by what observations must the Chaldeans have
discovered this cycle? Obviously, as Delambre infers, by inspecting their
registers; by comparing the successive intervals; by finding that some of
the intervals were alike; by seeing that these equal intervals were
eighteen years apart; by discovering that _all_ the intervals that were
eighteen years apart were equal; by ascertaining that the intervals formed
a series which repeated itself, so that if one of the cycles of intervals
were superposed on another the divisions would fit. This once perceived,
and it manifestly became possible to use the cycle as a scale of time by
which to measure out future periods. Seeing thus that the process of so
predicting eclipses, is in essence the same as that of predicting the
moon's monthly changes by observing the number of days after which they
repeat--seeing that the two differ only in the extent and irregularity of
the intervals, it is not difficult to understand how such an amount of
knowledge should so early have been reached. And we shall be less
surprised, on remembering that the only things involved in these previsions
were _time_ and _number_; and that the time was in a manner self-numbered.
Still, the ability to predict events recurring only after so long a period
as eighteen years, implies a considerable advance in civilization--a
considerable development of general knowledge; and we have now to inquire
what progress in other sciences accompanied, and was necessary to, these
astronomical previsions. In the first place, there must clearly have been a
tolerably efficient system of calculation. Mere finger-counting, mere
head-reckoning, even with the aid of a regular decimal notation, could not
have sufficed for numbering the days in a year; much less the years,
months, and days between eclipses. Consequently there must have been a mode
of registering numbers; probably even a system of numerals. The earliest
numerical records, if we may judge by the practices of the less civilized
races now existing, were probably kept by notches cut on sticks, or strokes
marked on walls; much as public-house scores are kept now. And there seems
reason to believe that the first numerals used were simply groups of
straight strokes, as some of the still-extant Roman ones are; leading us to
suspect that these groups of strokes were used to represent groups of
fingers, as the groups of fingers had been used to represent groups of
objects--a supposition quite in conformity with the aboriginal system of
picture writing and its subsequent modifications. Be this so or not,
however, it is manifest that before the Chaldeans discovered their _Saros_,
there must have been both a set of written symbols serving for an extensive
numeration, and a familiarity with the simpler rules of arithmetic.
Not only must abstract mathematics have made some progress, but concrete
mathematics also. It is scarcely possible that the buildings belonging to
this era should have been laid out and erected without any knowledge of
geometry. At any rate, there must have existed that elementary geometry
which deals with direct measurement--with the apposition of lines; and it
seems that only after the discovery of those simple proceedings, by which
right angles are drawn, and relative positions fixed, could so regular an
architecture be executed. In the case of the other division of concrete
mathematics--mechanics, we have definite evidence of progress. We know that
the lever and the inclined plane were employed during this period: implying
that there was a qualitative prevision of their effects, though not a
quantitative one. But we know more. We read of weights in the earliest
records; and we find weights in ruins of the highest antiquity. Weights
imply scales, of which we have also mention; and scales involve the primary
theorem of mechanics in its least complicated form--involve not a
qualitative but a quantitative prevision of mechanical effects. And here we
may notice how mechanics, in common with the other exact sciences, took its
rise from the simplest application of the idea of _equality_. For the
mechanical proposition which the scales involve, is, that if a lever with
_equal_ arms, have _equal_ weights suspended from them, the weights will
remain at _equal_ altitudes. And we may further notice, how, in this first
step of rational mechanics, we see illustrated that truth awhile since
referred to, that as magnitudes of linear extension are the only ones of
which the equality is exactly ascertainable, the equalities of other
magnitudes have at the outset to be determined by means of them. For the
equality of the weights which balance each other in scales, wholly depends
upon the equality of the arms: we can know that the weights are equal only
by proving that the arms are equal. And when by this means we have obtained
a system of weights,--a set of equal units of force, then does a science of
mechanics become possible. Whence, indeed, it follows, that rational
mechanics could not possibly have any other starting-point than the scales.
Let us further remember, that during this same period there was a limited
knowledge of chemistry. The many arts which we know to have been carried on
must have been impossible without a generalized experience of the modes in
which certain bodies affect each other under special conditions. In
metallurgy, which was extensively practised, this is abundantly
illustrated. And we even have evidence that in some cases the knowledge
possessed was, in a sense, quantitative. For, as we find by analysis that
the hard alloy of which the Egyptians made their cutting tools, was
composed of copper and tin in fixed proportions, there must have been an
established prevision that such an alloy was to be obtained only by mixing
them in these proportions. It is true, this was but a simple empirical
generalization; but so was the generalization respecting the recurrence of
eclipses; so are the first generalizations of every science.
Respecting the simultaneous advance of the sciences during this early
epoch, it only remains to remark that even the most complex of them must
have made some progress--perhaps even a greater relative progress than any
of the rest. For under what conditions only were the foregoing developments
possible? There first required an established and organized social system.
A long continued registry of eclipses; the building of palaces; the use of
scales; the practice of metallurgy--alike imply a fixed and populous
nation. The existence of such a nation not only presupposes laws, and some
administration of justice, which we know existed, but it presupposes
successful laws--laws conforming in some degree to the conditions of social
stability--laws enacted because it was seen that the actions forbidden by
them were dangerous to the State. We do not by any means say that all, or
even the greater part, of the laws were of this nature; but we do say, that
the fundamental ones were. It cannot be denied that the laws affecting life
and property were such. It cannot be denied that, however little these were
enforced between class and class, they were to a considerable extent
enforced between members of the same class. It can scarcely be questioned,
that the administration of them between members of the same class was seen
by rulers to be necessary for keeping their subjects together. And knowing,
as we do, that, other things equal, nations prosper in proportion to the
justness of their arrangements, we may fairly infer that the very cause of
the advance of these earliest nations out of aboriginal barbarism, was the
greater recognition among them of the claims to life and property.
But supposition aside, it is clear that the habitual recognition of these
claims in their laws, implied some prevision of social phenomena. Even thus
early there was a certain amount of social science. Nay, it may even be
shown that there was a vague recognition of that fundamental principle on
which all the true social science is based--the equal rights of all to the
free exercise of their faculties. That same idea of _equality_, which, as
we have seen, underlies all other science, underlies also morals and
sociology. The conception of justice, which is the primary one in morals;
and the administration of justice, which is the vital condition of social
existence; are impossible, without the recognition of a certain likeness in
men's claims, in virtue of their common humanity. _Equity_ literally means
_equalness_; and if it be admitted that there were even the vaguest ideas
of equity in these primitive eras, it must be admitted that there was some
appreciation of the equalness of men's liberties to pursue the objects of
life--some appreciation, therefore, of the essential principle of national
equilibrium.
Thus in this initial stage of the positive sciences, before geometry had
yet done more than evolve a few empirical rules--before mechanics had
passed beyond its first theorem--before astronomy had advanced from its
merely chronological phase into the geometrical; the most involved of the
sciences had reached a certain degree of development--a development without
which no progress in other sciences was possible.
Only noting as we pass, how, thus early, we may see that the progress of
exact science was not only towards an increasing number of previsions, but
towards previsions more accurately quantitative--how, in astronomy, the
recurring period of the moon's motions was by and by more correctly
ascertained to be nineteen years, or two hundred and thirty-five lunations;
how Callipus further corrected this Metonic cycle, by leaving out a day at
the end of every seventy-six years; and how these successive advances
implied a longer continued registry of observations, and the co-ordination
of a greater number of facts--let us go on to inquire how geometrical
astronomy took its rise.
The first astronomical instrument was the gnomon. This was not only early
in use in the East, but it was found also among the Mexicans; the sole
astronomical observations of the Peruvians were made by it; and we read
that 1100 B.C., the Chinese found that, at a certain place, the length of
the sun's shadow, at the summer solstice, was to the height of the gnomon,
as one and a half to eight. Here again it is observable, not only that the
instrument is found ready made, but that Nature is perpetually performing
the process of measurement. Any fixed, erect object--a column, a dead palm,
a pole, the angle of a building--serves for a gnomon; and it needs but to
notice the changing position of the shadow it daily throws, to make the
first step in geometrical astronomy. How small this first step was, may be
seen in the fact that the only things ascertained at the outset were the
periods of the summer and winter solstices, which corresponded with the
least and greatest lengths of the mid-day shadow; and to fix which, it was
needful merely to mark the point to which each day's shadow reached.
And now let it not be overlooked that in the observing at what time during
the next year this extreme limit of the shadow was again reached, and in
the inference that the sun had then arrived at the same turning point in
his annual course, we have one of the simplest instances of that combined
use of _equal magnitudes_ and _equal relations_, by which all exact
science, all quantitative prevision, is reached. For the relation observed
was between the length of the sun's shadow and his position in the heavens;
and the inference drawn was that when, next year, the extremity of his
shadow came to the same point, he occupied the same place. That is, the,
ideas involved were, the equality of the shadows, and the equality of the
relations between shadow and sun in successive years. As in the case of the
scales, the equality of relations here recognized is of the simplest order.
It is not as those habitually dealt with in the higher kinds of scientific
reasoning, which answer to the general type--the relation between two and
three equals the relation between six and nine; but it follows the
type--the relation between two and three, equals the relation between two
and three; it is a case of not simply _equal_ relations, but _coinciding_
relations. And here, indeed, we may see beautifully illustrated how the
idea of equal relations takes its rise after the same manner that that of
equal magnitude does. As already shown, the idea of equal magnitudes arose
from the observed coincidence of two lengths placed together; and in this
case we have not only two coincident lengths of shadows, but two coincident
relations between sun and shadows.
From the use of the gnomon there naturally grew up the conception of
angular measurements; and with the advance of geometrical conceptions there
came the hemisphere of Berosus, the equinoctial armil, the solstitial
armil, and the quadrant of Ptolemy--all of them employing shadows as
indices of the sun's position, but in combination with angular divisions.
It is obviously out of the question for us here to trace these details of
progress. It must suffice to remark that in all of them we may see that
notion of equality of relations of a more complex kind, which is best
illustrated in the astrolabe, an instrument which consisted "of circular
rims, moveable one within the other, or about poles, and contained circles
which were to be brought into the position of the ecliptic, and of a plane
passing through the sun and the poles of the ecliptic"--an instrument,
therefore, which represented, as by a model, the relative positions of
certain imaginary lines and planes in the heavens; which was adjusted by
putting these representative lines and planes into parallelism and
coincidence with the celestial ones; and which depended for its use upon
the perception that the relations between these representative lines and
planes were _equal_ to the relations between those represented.
Were there space, we might go on to point out how the conception of the
heavens as a revolving hollow sphere, the discovery of the globular form of
the earth, the explanation of the moon's phases, and indeed all the
successive steps taken, involved this same mental process. But we must
content ourselves with referring to the theory of eccentrics and epicycles,
as a further marked illustration of it. As first suggested, and as proved
by Hipparchus to afford an explanation of the leading irregularities in the
celestial motions, this theory involved the perception that the
progressions, retrogressions, and variations of velocity seen in the
heavenly bodies, might be reconciled with their assumed uniform movement in
circles, by supposing that the earth was not in the centre of their orbits;
or by supposing that they revolved in circles whose centres revolved round
the earth; or by both. The discovery that this would account for the
appearances, was the discovery that in certain geometrical diagrams the
relations were such, that the uniform motion of a point would, when looked
at from a particular position, present analogous irregularities; and the
calculations of Hipparchus involved the belief that the relations
subsisting among these geometrical curves were _equal_ to the relations
subsisting among the celestial orbits.
Leaving here these details of astronomical progress, and the philosophy of
it, let us observe how the relatively concrete science of geometrical
astronomy, having been thus far helped forward by the development of
geometry in general, reacted upon geometry, caused it also to advance, and
was again assisted by it. Hipparchus, before making his solar and lunar
tables, had to discover rules for calculating the relations between the
sides and angles of triangles--_trigonometry_, a subdivision of pure
mathematics. Further, the reduction of the doctrine of the sphere to the
quantitative form needed for astronomical purposes, required the formation
of a _spherical trigonometry_, which was also achieved by Hipparchus. Thus
both plane and spherical trigonometry, which are parts of the highly
abstract and simple science of extension, remained undeveloped until the
less abstract and more complex science of the celestial motions had need of
them. The fact admitted by M. Comte, that since Descartes the progress of
the abstract division of mathematics has been determined by that of the
concrete division, is paralleled by the still more significant fact that
even thus early the progress of mathematics was determined by that of
astronomy.
And here, indeed, we may see exemplified the truth, which the subsequent
history of science frequently illustrates, that before any more abstract
division makes a further advance, some more concrete division must suggest
the necessity for that advance--must present the new order of questions to
be solved. Before astronomy presented Hipparchus with the problem of solar
tables, there was nothing to raise the question of the relations between
lines and angles; the subject-matter of trigonometry had not been
conceived. And as there must be subject-matter before there can be
investigation, it follows that the progress of the concrete divisions is as
necessary to that of the abstract, as the progress of the abstract to that
of the concrete.
Just incidentally noticing the circumstance that the epoch we are
describing witnessed the evolution of algebra, a comparatively abstract
division of mathematics, by the union of its less abstract divisions,
geometry and arithmetic--a fact proved by the earliest extant samples of
algebra, which are half algebraic, half geometric--we go on to observe that
during the era in which mathematics and astronomy were thus advancing,
rational mechanics made its second step; and something was done towards
giving a quantitative form to hydrostatics, optics, and harmonics. In each
case we shall see as before, how the idea of equality underlies all
quantitative prevision; and in what simple forms this idea is first
applied.
As already shown, the first theorem established in mechanics was, that
equal weights suspended from a lever with equal arms would remain in
equilibrium. Archimedes discovered that a lever with unequal arms was in
equilibrium when one weight was to its arm as the other arm to its weight;
that is--when the numerical relation between one weight and its arm was
_equal_ to the numerical relation between the other arm and its weight.
The first advance made in hydrostatics, which we also owe to Archimedes,
was the discovery that fluids press _equally_ in all directions; and from
this followed the solution of the problem of floating bodies: namely, that
they are in equilibrium when the upward and downward pressures are _equal_.
In optics, again, the Greeks found that the angle of incidence is _equal_
to the angle of reflection; and their knowledge reached no further than to
such simple deductions from this as their geometry sufficed for. In
harmonics they ascertained the fact that three strings of _equal_ lengths
would yield the octave, fifth and fourth, when strained by weights having
certain definite ratios; and they did not progress much beyond this. In the
one of which cases we see geometry used in elucidation of the laws of
light; and in the other, geometry and arithmetic made to measure the
phenomena of sound.
Did space permit, it would be desirable here to describe the state of the
less advanced sciences--to point out how, while a few had thus reached the
first stages of quantitative prevision, the rest were progressing in
qualitative prevision--how some small generalizations were made respecting
evaporation, and heat, and electricity, and magnetism, which, empirical as
they were, did not in that respect differ from the first generalizations of
every science--how the Greek physicians had made advances in physiology and
pathology, which, considering the great imperfection of our present
knowledge, are by no means to be despised--how zoology had been so far
systematized by Aristotle, as, to some extent, enabled him from the
presence of certain organs to predict the presence of others--how in
Aristotle's _Politics_, there is some progress towards a scientific
conception of social phenomena, and sundry previsions respecting them--and
how in the state of the Greek societies, as well as in the writings of
Greek philosophers, we may recognise not only an increasing clearness in
that conception of equity on which the social science is based, but also
some appreciation of the fact that social stability depends upon the
maintenance of equitable regulations. We might dwell at length upon the
causes which retarded the development of some of the sciences, as for
example, chemistry: showing that relative complexity had nothing to do with
it--that the oxidation of a piece of iron is a simpler phenomenon than the
recurrence of eclipses, and the discovery of carbonic acid less difficult
than that of the precession of the equinoxes--but that the relatively slow
advance of chemical knowledge was due, partly to the fact that its
phenomena were not daily thrust on men's notice as those of astronomy were;
partly to the fact that Nature does not habitually supply the means, and
suggest the modes of investigation, as in the sciences dealing with time,
extension, and force; and partly to the fact that the great majority of the
materials with which chemistry deals, instead of being ready to hand, are
made known only by the arts in their slow growth; and partly to the fact
that even when known, their chemical properties are not self-exhibited, but
have to be sought out by experiment.
Merely indicating all these considerations, however, let us go on to
contemplate the progress and mutual influence of the sciences in modern
days; only parenthetically noticing how, on the revival of the scientific
spirit, the successive stages achieved exhibit the dominance of the same
law hitherto traced--how the primary idea in dynamics, a uniform force, was
defined by Galileo to be a force which generates _equal_ velocities in
_equal_ successive times--how the uniform action of gravity was first
experimentally determined by showing that the time elapsing before a body
thrown up, stopped, was _equal_ to the time it took to fall--how the first
fact in compound motion which Galileo ascertained was, that a body
projected horizontally will have a uniform motion onwards and a uniformly
accelerated motion downwards; that is, will describe _equal_ horizontal
spaces in _equal_ times, compounded with _equal_ vertical increments in
_equal_ times--how his discovery respecting the pendulum was, that its
oscillations occupy _equal_ intervals of time whatever their length--how
the principle of virtual velocities which he established is, that in any
machine the weights that balance each other, are reciprocally as their
virtual velocities; that is, the relation of one set of weights to their
velocities _equals_ the relation of the other set of velocities to their
weights;--and how thus his achievements consisted in showing the equalities
of certain magnitudes and relations, whose equalities had not been
previously recognised.
When mechanics had reached the point to which Galileo brought it--when the
simple laws of force had been disentangled from the friction and
atmospheric resistance by which all their earthly manifestations are
disguised--when progressing knowledge of _physics_ had given a due insight
into these disturbing causes--when, by an effort of abstraction, it was
perceived that all motion would be uniform and rectilinear unless
interfered with by external forces--and when the various consequences of
this perception had been worked out; then it became possible, by the union
of geometry and mechanics, to initiate physical astronomy. Geometry and
mechanics having diverged from a common root in men's sensible experiences;
having, with occasional inosculations, been separately developed, the one
partly in connexion with astronomy, the other solely by analyzing
terrestrial movements; now join in the investigations of Newton to create a
true theory of the celestial motions. And here, also, we have to notice the
important fact that, in the very process of being brought jointly to bear
upon astronomical problems, they are themselves raised to a higher phase of
development. For it was in dealing with the questions raised by celestial
dynamics that the then incipient infinitesimal calculus was unfolded by
Newton and his continental successors; and it was from inquiries into the
mechanics of the solar system that the general theorems of mechanics
contained in the "Principia,"--many of them of purely terrestrial
application--took their rise. Thus, as in the case of Hipparchus, the
presentation of a new order of concrete facts to be analyzed, led to the
discovery of new abstract facts; and these abstract facts having been laid
hold of, gave means of access to endless groups of concrete facts before
incapable of quantitative treatment.
Meanwhile, physics had been carrying further that progress without which,
as just shown, rational mechanics could not be disentangled. In
hydrostatics, Stevinus had extended and applied the discovery of
Archimedes. Torricelli had proved atmospheric pressure, "by showing that
this pressure sustained different liquids at heights inversely proportional
to their densities;" and Pascal "established the necessary diminution of
this pressure at increasing heights in the atmosphere:" discoveries which
in part reduced this branch of science to a quantitative form. Something
had been done by Daniel Bernoulli towards the dynamics of fluids. The
thermometer had been invented; and a number of small generalizations
reached by it. Huyghens and Newton had made considerable progress in
optics; Newton had approximately calculated the rate of transmission of
sound; and the continental mathematicians had succeeded in determining some
of the laws of sonorous vibrations. Magnetism and electricity had been
considerably advanced by Gilbert. Chemistry had got as far as the mutual
neutralization of acids and alkalies. And Leonardo da Vinci had advanced in
geology to the conception of the deposition of marine strata as the origin
of fossils. Our present purpose does not require that we should give
particulars. All that it here concerns us to do is to illustrate the
_consensus_ subsisting in this stage of growth, and afterwards. Let as look
at a few cases.
The theoretic law of the velocity of sound enunciated by Newton on purely
mechanical considerations, was found wrong by one-sixth. The error remained
unaccounted for until the time of Laplace, who, suspecting that the heat
disengaged by the compression of the undulating strata of the air, gave
additional elasticity, and so produced the difference, made the needful
calculations and found he was right. Thus acoustics was arrested until
thermology overtook and aided it. When Boyle and Marriot had discovered the
relation between the density of gases and the pressures they are subject
to; and when it thus became possible to calculate the rate of decreasing
density in the upper parts of the atmosphere; it also became possible to
make approximate tables of the atmospheric refraction of light. Thus
optics, and with it astronomy, advanced with barology. After the discovery
of atmospheric pressure had led to the invention of the air-pump by Otto
Guericke; and after it had become known that evaporation increases in
rapidity as atmospheric pressure decreases; it became possible for Leslie,
by evaporation in a vacuum, to produce the greatest cold known; and so to
extend our knowledge of thermology by showing that there is no zero within
reach of our researches. When Fourier had determined the laws of conduction
of heat, and when the Earth's temperature had been found to increase below
the surface one degree in every forty yards, there were data for inferring
the past condition of our globe; the vast period it has taken to cool down
to its present state; and the immense age of the solar system--a purely
astronomical consideration.
Chemistry having advanced sufficiently to supply the needful materials, and
a physiological experiment having furnished the requisite hint, there came
the discovery of galvanic electricity. Galvanism reacting on chemistry
disclosed the metallic bases of the alkalies, and inaugurated the
electro-chemical theory; in the hands of Oersted and Ampere it led to the
laws of magnetic action; and by its aid Faraday has detected significant
facts relative to the constitution of light. Brewster's discoveries
respecting double refraction and dipolarization proved the essential truth
of the classification of crystalline forms according to the number of axes,
by showing that the molecular constitution depends upon the axes. In these
and in numerous other cases, the mutual influence of the sciences has been
quite independent of any supposed hierarchical order. Often, too, their
inter-actions are more complex than as thus instanced--involve more
sciences than two. One illustration of this must suffice. We quote it in
full from the _History of the Inductive Sciences_. In Book XI., chap. II.,
on "The Progress of the Electrical Theory," Dr. Whewell writes:--
"Thus at that period, mathematics was behind experiment, and a
problem was proposed, in which theoretical results were wanted for
comparison with observation, but could not be accurately obtained; as
was the case in astronomy also, till the time of the approximate
solution of the problem of three bodies, and the consequent formation
of the tables of the moon and planets, on the theory of universal
gravitation. After some time, electrical theory was relieved from
this reproach, mainly in consequence of the progress which astronomy
had occasioned in pure mathematics. About 1801 there appeared in the
_Bulletin des Sciences_, an exact solution of the problem of the
distribution of electric fluid on a spheroid, obtained by Biot, by
the application of the peculiar methods which Laplace had invented
for the problem of the figure of the planets. And, in 1811, M.
Poisson applied Laplace's artifices to the case of two spheres acting
upon one another in contact, a case to which many of Coulomb's
experiments were referrible; and the agreement of the results of
theory and observation, thus extricated from Coulomb's numbers
obtained above forty years previously, was very striking and
convincing."
Not only do the sciences affect each other after this direct manner, but
they affect each other indirectly. Where there is no dependence, there is
yet analogy--_equality of relations_; and the discovery of the relations
subsisting among one set of phenomena, constantly suggests a search for the
same relations among another set. Thus the established fact that the force
of gravitation varies inversely as the square of the distance, being
recognized as a necessary characteristic of all influences proceeding from
a centre, raised the suspicion that heat and light follow the same law;
which proved to be the case--a suspicion and a confirmation which were
repeated in respect to the electric and magnetic forces. Thus again the
discovery of the polarization of light led to experiments which ended in
the discovery of the polarization of heat--a discovery that could never
have been made without the antecedent one. Thus, too, the known
refrangibility of light and heat lately produced the inquiry whether sound
also is not refrangible; which on trial it turns out to be.
In some cases, indeed, it is only by the aid of conceptions derived from
one class of phenomena that hypotheses respecting other classes can be
formed. The theory, at one time favoured, that evaporation is a solution of
water in air, was an assumption that the relation between water and air is
_like_ the relation between salt and water; and could never have been
conceived if the relation between salt and water had not been previously
known. Similarly the received theory of evaporation--that it is a diffusion
of the particles of the evaporating fluid in virtue of their atomic
repulsion--could not have been entertained without a foregoing experience
of magnetic and electric repulsions. So complete in recent days has become
this _consensus_ among the sciences, caused either by the natural
entanglement of their phenomena, or by analogies in the relations of their
phenomena, that scarcely any considerable discovery concerning one order of
facts now takes place, without very shortly leading to discoveries
concerning other orders.
To produce a tolerably complete conception of this process of scientific
evolution, it would be needful to go back to the beginning, and trace in
detail the growth of classifications and nomenclatures; and to show how, as
subsidiary to science, they have acted upon it, and it has reacted upon
them. We can only now remark that, on the one hand, classifications and
nomenclatures have aided science by continually subdividing the
subject-matter of research, and giving fixity and diffusion to the truths
disclosed; and that on the other hand, they have caught from it that
increasing quantitativeness, and that progress from considerations touching
single phenomena to considerations touching the relations among many
phenomena, which we have been describing.
Of this last influence a few illustrations must be given. In chemistry it
is seen in the facts, that the dividing of matter into the four elements
was ostensibly based upon the single property of weight; that the first
truly chemical division into acid and alkaline bodies, grouped together
bodies which had not simply one property in common, but in which one
property was constantly related to many others; and that the classification
now current, places together in groups _supporters of combustion_,
_metallic and non-metallic bases_, _acids_, _salts_, &c., bodies which are
often quite unlike in sensible qualities, but which are like in the
majority of their _relations_ to other bodies. In mineralogy again, the
first classifications were based upon differences in aspect, texture, and
other physical attributes. Berzelius made two attempts at a classification
based solely on chemical constitution. That now current, recognises as far
as possible the _relations_ between physical and chemical characters. In
botany the earliest classes formed were _trees_, _shrubs_, and _herbs_:
magnitude being the basis of distinction. Dioscorides divided vegetables
into _aromatic_, _alimentary_, _medicinal_, and _vinous_: a division of
chemical character. Caesalpinus classified them by the seeds, and
seed-vessels, which he preferred because of the _relations_ found to
subsist between the character of the fructification and the general
character of the other parts.
While the "natural system" since developed, carrying out the doctrine of
Linnaeus, that "natural orders must be formed by attention not to one or
two, but to _all_ the parts of plants," bases its divisions on like
peculiarities which are found to be _constantly related_ to the greatest
number of other like peculiarities. And similarly in zoology, the
successive classifications, from having been originally determined by
external and often subordinate characters not indicative of the essential
nature, have been gradually more and more determined by those internal and
fundamental differences, which have uniform _relations_ to the greatest
number of other differences. Nor shall we be surprised at this analogy
between the modes of progress of positive science and classification, when
we bear in mind that both proceed by making generalizations; that both
enable us to make previsions differing only in their precision; and that
while the one deals with equal properties and relations, the other deals
with properties and relations that approximate towards equality in variable
degrees.
Without further argument, it will, we think, be sufficiently clear that the
sciences are none of them separately evolved--are none of them independent
either logically or historically; but that all of them have, in a greater
or less degree, required aid and reciprocated it. Indeed, it needs but to
throw aside theses, and contemplate the mixed character of surrounding
phenomena, to at once see that these notions of division and succession in
the kinds of knowledge are none of them actually true, but are simple
scientific fictions: good, if regarded merely as aids to study; bad, if
regarded as representing realities in Nature. Consider them critically, and
no facts whatever are presented to our senses uncombined with other
facts--no facts whatever but are in some degree disguised by accompanying
facts: disguised in such a manner that all must be partially understood
before any one can be understood. If it be said, as by M. Comte, that
gravitating force should be treated of before other forces, seeing that all
things are subject to it, it may on like grounds be said that heat should
be first dealt with; seeing that thermal forces are everywhere in action;
that the ability of any portion of matter to manifest visible gravitative
phenomena depends on its state of aggregation, which is determined by heat;
that only by the aid of thermology can we explain those apparent exceptions
to the gravitating tendency which are presented by steam and smoke, and so
establish its universality, and that, indeed, the very existence of the
solar system in a solid form is just as much a question of heat as it is
one of gravitation.
Take other cases:--All phenomena recognised by the eyes, through which only
are the data of exact science ascertainable, are complicated with optical
phenomena; and cannot be exhaustively known until optical principles are
known. The burning of a candle cannot be explained without involving
chemistry, mechanics, thermology. Every wind that blows is determined by
influences partly solar, partly lunar, partly hygrometric; and implies
considerations of fluid equilibrium and physical geography. The direction,
dip, and variations of the magnetic needle, are facts half terrestrial,
half celestial--are caused by earthly forces which have cycles of change
corresponding with astronomical periods. The flowing of the gulf-stream and
the annual migration of icebergs towards the equator, depending as they do
on the balancing of the centripetal and centrifugal forces acting on the
ocean, involve in their explanation the Earth's rotation and spheroidal
form, the laws of hydrostatics, the relative densities of cold and warm
water, and the doctrines of evaporation. It is no doubt true, as M. Comte
says, that "our position in the solar system, and the motions, form, size,
equilibrium of the mass of our world among the planets, must be known
before we can understand the phenomena going on at its surface." But,
fatally for his hypothesis, it is also true that we must understand a great
part of the phenomena going on at its surface before we can know its
position, &c., in the solar system. It is not simply that, as we have
already shown, those geometrical and mechanical principles by which
celestial appearances are explained, were first generalized from
terrestrial experiences; but it is that the very obtainment of correct
data, on which to base astronomical generalizations, implies advanced
terrestrial physics.
Until after optics had made considerable advance, the Copernican system
remained but a speculation. A single modern observation on a star has to
undergo a careful analysis by the combined aid of various sciences--has to
_be digested by the organism of the sciences_; which have severally to
assimilate their respective parts of the observation, before the essential
fact it contains is available for the further development of astronomy. It
has to be corrected not only for nutation of the earth's axis and for
precession of the equinoxes, but for aberration and for refraction; and the
formation of the tables by which refraction is calculated, presupposes
knowledge of the law of decreasing density in the upper atmospheric strata;
of the law of decreasing temperature, and the influence of this on the
density; and of hygrometric laws as also affecting density. So that, to get
materials for further advance, astronomy requires not only the indirect aid
of the sciences which have presided over the making of its improved
instruments, but the direct aid of an advanced optics, of barology, of
thermology, of hygrometry; and if we remember that these delicate
observations are in some cases registered electrically, and that they are
further corrected for the "personal equation"--the time elapsing between
seeing and registering, which varies with different observers--we may even
add electricity and psychology. If, then, so apparently simple a thing as
ascertaining the position of a star is complicated with so many phenomena,
it is clear that this notion of the independence of the sciences, or
certain of them, will not hold.
Whether objectively independent or not, they cannot be subjectively
so--they cannot have independence as presented to our consciousness; and
this is the only kind of independence with which we are concerned. And
here, before leaving these illustrations, and especially this last one, let
us not omit to notice how clearly they exhibit that increasingly active
_consensus_ of the sciences which characterizes their advancing
development. Besides finding that in these later times a discovery in one
science commonly causes progress in others; besides finding that a great
part of the questions with which modern science deals are so mixed as to
require the co-operation of many sciences for their solution; we find in
this last case that, to make a single good observation in the purest of the
natural sciences, requires the combined assistance of half a dozen other
sciences.
Perhaps the clearest comprehension of the interconnected growth of the
sciences may be obtained by contemplating that of the arts, to which it is
strictly analogous, and with which it is inseparably bound up. Most
intelligent persons must have been, at one time or other, struck with the
vast array of antecedents pre-supposed by one of our processes of
manufacture. Let him trace the production of a printed cotton, and consider
all that is implied by it. There are the many successive improvements
through which the power-looms reached their present perfection; there is
the steam-engine that drives them, having its long history from Papin
downwards; there are the lathes in which its cylinder was bored, and the
string of ancestral lathes from which those lathes proceeded; there is the
steam-hammer under which its crank shaft was welded; there are the
puddling-furnaces, the blast-furnaces, the coal-mines and the iron-mines
needful for producing the raw material; there are the slowly improved
appliances by which the factory was built, and lighted, and ventilated;
there are the printing engine, and the die house, and the colour laboratory
with its stock of materials from all parts of the world, implying
cochineal-culture, logwood-cutting, indigo-growing; there are the
implements used by the producers of cotton, the gins by which it is
cleaned, the elaborate machines by which it is spun: there are the vessels
in which cotton is imported, with the building-slips, the rope-yards, the
sail-cloth factories, the anchor-forges, needful for making them; and
besides all these directly necessary antecedents, each of them involving
many others, there are the institutions which have developed the requisite
intelligence, the printing and publishing arrangements which have spread
the necessary information, the social organization which has rendered
possible such a complex co-operation of agencies.
Further analysis would show that the many arts thus concerned in the
economical production of a child's frock, have each of them been brought to
its present efficiency by slow steps which the other arts have aided; and
that from the beginning this reciprocity has been ever on the increase. It
needs but on the one hand to consider how utterly impossible it is for the
savage, even with ore and coal ready, to produce so simple a thing as an
iron hatchet; and then to consider, on the other hand, that it would have
been impracticable among ourselves, even a century ago, to raise the tubes
of the Britannia bridge from lack of the hydraulic press; to at once see
how mutually dependent are the arts, and how all must advance that each may
advance. Well, the sciences are involved with each other in just the same
manner. They are, in fact, inextricably woven into this same complex web of
the arts; and are only conventionally independent of it. Originally the two
were one. How to fix the religious festivals; when to sow; how to weigh
commodities; and in what manner to measure ground; were the purely
practical questions out of which arose astronomy, mechanics, geometry.
Since then there has been a perpetual inosculation of the sciences and the
arts. Science has been supplying art with truer generalizations and more
completely quantitative previsions. Art has been supplying science with
better materials, and more perfect instruments. And all along the
interdependence has been growing closer, not only between art and science,
but among the arts themselves, and among the sciences themselves.
How completely the analogy holds throughout, becomes yet clearer when we
recognise the fact that _the sciences are arts to each other_. If, as
occurs in almost every case, the fact to be analyzed by any science, has
first to be prepared--to be disentangled from disturbing facts by the afore
discovered methods of other sciences; the other sciences so used, stand in
the position of arts. If, in solving a dynamical problem, a parallelogram
is drawn, of which the sides and diagonal represent forces, and by putting
magnitudes of extension for magnitudes of force a measurable relation is
established between quantities not else to be dealt with; it may be fairly
said that geometry plays towards mechanics much the same part that the fire
of the founder plays towards the metal he is going to cast. If, in
analyzing the phenomena of the rings surrounding the point of
contact between two lenses, a Newton ascertains by calculation the amount
of certain interposed spaces, far too minute for actual measurement; he
employs the science of number for essentially the same purpose as that for
which the watchmaker employs tools. If, before writing down his observation
on a star, the astronomer has to separate from it all the errors resulting
from atmospheric and optical laws, it is manifest that the
refraction-tables, and logarithm-books, and formulae, which he successively
uses, serve him much as retorts, and filters, and cupels serve the assayer
who wishes to separate the pure gold from all accompanying ingredients.
So close, indeed, is the relationship, that it is impossible to say where
science begins and art ends. All the instruments of the natural philosopher
are the products of art; the adjusting one of them for use is an art; there
is art in making an observation with one of them; it requires art properly
to treat the facts ascertained; nay, even the employing established
generalizations to open the way to new generalizations, may be considered
as art. In each of these cases previously organized knowledge becomes the
implement by which new knowledge is got at: and whether that previously
organized knowledge is embodied in a tangible apparatus or in a formula,
matters not in so far as its essential relation to the new knowledge is
concerned. If, as no one will deny, art is applied knowledge, then such
portion of a scientific investigation as consists of applied knowledge is
art. So that we may even say that as soon as any prevision in science
passes out of its originally passive state, and is employed for reaching
other previsions, it passes from theory into practice--becomes science in
action--becomes art. And when we thus see how purely conventional is the
ordinary distinction, how impossible it is to make any real
separation--when we see not only that science and art were originally one;
that the arts have perpetually assisted each other; that there has been a
constant reciprocation of aid between the sciences and arts; but that the
sciences act as arts to each other, and that the established part of each
science becomes an art to the growing part--when we recognize the closeness
of these associations, we shall the more clearly perceive that as the
connexion of the arts with each other has been ever becoming more intimate;
as the help given by sciences to arts and by arts to sciences, has been age
by age increasing; so the interdependence of the sciences themselves has
been ever growing greater, their mutual relations more involved, their
_consensus_ more active.
* * * * *
In here ending our sketch of the Genesis of Science, we are conscious of
having done the subject but scant justice. Two difficulties have stood in
our way: one, the having to touch on so many points in such small space;
the other, the necessity of treating in serial arrangement a process which
is not serial--a difficulty which must ever attend all attempts to
delineate processes of development, whatever their special nature. Add to
which, that to present in anything like completeness and proportion, even
the outlines of so vast and complex a history, demands years of study.
Nevertheless, we believe that the evidence which has been assigned suffices
to substantiate the leading propositions with which we set out. Inquiry
into the first stages of science confirms the conclusion which we drew from
the analysis of science as now existing, that it is not distinct from
common knowledge, but an outgrowth from it--an extension of the perception
by means of the reason.
That which we further found by analysis to form the more specific
characteristic of scientific previsions, as contrasted with the previsions
of uncultured intelligence--their quantitativeness--we also see to have
been the characteristic alike in the initial steps in science, and of all
the steps succeeding them. The facts and admissions cited in disproof of
the assertion that the sciences follow one another, both logically and
historically, in the order of their decreasing generality, have been
enforced by the sundry instances we have met with, in which the more
general or abstract sciences have been advanced only at the instigation of
the more special or concrete--instances serving to show that a more general
science as much owes its progress to the presentation of new problems by a
more special science, as the more special science owes its progress to the
solutions which the more general science is thus led to attempt--instances
therefore illustrating the position that scientific advance is as much from
the special to the general as from the general to the special.
Quite in harmony with this position we find to be the admissions that the
sciences are as branches of one trunk, and that they were at first
cultivated simultaneously; and this harmony becomes the more marked on
finding, as we have done, not only that the sciences have a common root,
but that science in general has a common root with language,
classification, reasoning, art; that throughout civilization these have
advanced together, acting and reacting upon each other just as the separate
sciences have done; and that thus the development of intelligence in all
its divisions and subdivisions has conformed to this same law which we have
shown that the sciences conform to. From all which we may perceive that the
sciences can with no greater propriety be arranged in a succession, than
language, classification, reasoning, art, and science, can be arranged in a
succession; that, however needful a succession may be for the convenience
of books and catalogues, it must be recognized merely as a convention; and
that so far from its being the function of a philosophy of the sciences to
establish a hierarchy, it is its function to show that the linear
arrangements required for literary purposes, have none of them any basis
either in Nature or History.
There is one further remark we must not omit--a remark touching the
importance of the question that has been discussed. Unfortunately it
commonly happens that topics of this abstract nature are slighted as of no
practical moment; and, we doubt not, that many will think it of very little
consequence what theory respecting the genesis of science may be
entertained. But the value of truths is often great, in proportion as their
generality is wide. Remote as they seem from practical application, the
highest generalizations are not unfrequently the most potent in their
effects, in virtue of their influence on all those subordinate
generalizations which regulate practice. And it must be so here. Whenever
established, a correct theory of the historical development of the sciences
must have an immense effect upon education; and, through education, upon
civilization. Greatly as we differ from him in other respects, we agree
with M. Comte in the belief that, rightly conducted, the education of the
individual must have a certain correspondence with the evolution of the
race.
No one can contemplate the facts we have cited in illustration of the early
stages of science, without recognising the _necessity_ of the processes
through which those stages were reached--a necessity which, in respect to
the leading truths, may likewise be traced in all after stages. This
necessity, originating in the very nature of the phenomena to be analyzed
and the faculties to be employed, more or less fully applies to the mind of
the child as to that of the savage. We say more or less fully, because the
correspondence is not special but general only. Were the _environment_ the
same in both cases, the correspondence would be complete. But though the
surrounding material out of which science is to be organized, is, in many
cases, the same to the juvenile mind and the aboriginal mind, it is not so
throughout; as, for instance, in the case of chemistry, the phenomena of
which are accessible to the one, but were inaccessible to the other. Hence,
in proportion as the environment differs, the course of evolution must
differ. After admitting sundry exceptions, however, there remains a
substantial parallelism; and, if so, it becomes of great moment to
ascertain what really has been the process of scientific evolution. The
establishment of an erroneous theory must be disastrous in its educational
results; while the establishment of a true one must eventually be fertile
in school-reforms and consequent social benefits.
IV. THE PHYSIOLOGY OF LAUGHTER.
Why do we smile when a child puts on a man's hat? or what induces us to
laugh on reading that the corpulent Gibbon was unable to rise from his
knees after making a tender declaration? The usual reply to such questions
is, that laughter results from a perception of incongruity. Even were there
not on this reply the obvious criticism that laughter often occurs from
extreme pleasure or from mere vivacity, there would still remain the real
problem--How comes a sense of the incongruous to be followed by these
peculiar bodily actions? Some have alleged that laughter is due to the
pleasure of a relative self-elevation, which we feel on seeing the
humiliation of others. But this theory, whatever portion of truth it may
contain, is, in the first place, open to the fatal objection, that there
are various humiliations to others which produce in us anything but
laughter; and, in the second place, it does not apply to the many instances
in which no one's dignity is implicated: as when we laugh at a good pun.
Moreover, like the other, it is merely a generalization of certain
conditions to laughter; and not an explanation of the odd movements which
occur under these conditions. Why, when greatly delighted, or impressed
with certain unexpected contrasts of ideas, should there be a contraction
of particular facial muscles, and particular muscles of the chest and
abdomen? Such answer to this question as may be possible, can be rendered
only by physiology.
* * * * *
Every child has made the attempt to hold the foot still while it is
tickled, and has failed; and probably there is scarcely any one who has not
vainly tried to avoid winking, when a hand has been suddenly passed before
the eyes. These examples of muscular movements which occur independently of
the will, or in spite of it, illustrate what physiologists call
reflex-action; as likewise do sneezing and coughing. To this class of
cases, in which involuntary motions are accompanied by sensations, has to
be added another class of cases, in which involuntary motions are
unaccompanied by sensations:--instance the pulsations of the heart; the
contractions of the stomach during digestion. Further, the great mass of
seemingly-voluntary acts in such creatures as insects, worms, molluscs, are
considered by physiologists to be as purely automatic as is the dilatation
or closure of the iris under variations in quantity of light; and similarly
exemplify the law, that an impression on the end of an afferent nerve is
conveyed to some ganglionic centre, and is thence usually reflected along
an efferent nerve to one or more muscles which it causes to contract.
In a modified form this principle holds with voluntary acts. Nervous
excitation always _tends_ to beget muscular motion; and when it rises to a
certain intensity, always does beget it. Not only in reflex actions,
whether with or without sensation, do we see that special nerves, when
raised to a state of tension, discharge themselves on special muscles with
which they are indirectly connected; but those external actions through
which we read the feelings of others, show us that under any considerable
tension, the nervous system in general discharges itself on the muscular
system in general: either with or without the guidance of the will. The
shivering produced by cold, implies irregular muscular contractions, which,
though at first only partly involuntary, become, when the cold is extreme,
almost wholly involuntary. When you have severely burnt your finger, it is
very difficult to preserve a dignified composure: contortion of face, or
movement of limb, is pretty sure to follow. If a man receives good news
with neither change of feature nor bodily motion, it is inferred that he is
not much pleased, or that he has extraordinary self-control--either
inference implying that joy almost universally produces contraction of the
muscles; and so, alters the expression, or attitude, or both. And when we
hear of the feats of strength which men have performed when their lives
were at stake--when we read how, in the energy of despair, even paralytic
patients have regained for a time the use of their limbs; we see still more
clearly the relations between nervous and muscular excitements. It becomes
manifest both that emotions and sensations tend to generate bodily
movements, and that the movements are vehement in proportion as the
emotions or sensations are intense.[G]
[G] For numerous illustrations see essay on "The Origin and Function
of Music."
This, however, is not the sole direction in which nervous excitement
expends itself. Viscera as well as muscles may receive the discharge. That
the heart and blood-vessels (which, indeed, being all contractile, may in a
restricted sense be classed with the muscular system) are quickly affected
by pleasures and pains, we have daily proved to us. Every sensation of any
acuteness accelerates the pulse; and how sensitive the heart is to
emotions, is testified by the familiar expressions which use heart and
feeling as convertible terms. Similarly with the digestive organs. Without
detailing the various ways in which these may be influenced by our mental
states, it suffices to mention the marked benefits derived by dyspeptics,
as well as other invalids, from cheerful society, welcome news, change of
scene, to show how pleasurable feeling stimulates the viscera in general
into greater activity.
There is still another direction in which any excited portion of the
nervous system may discharge itself; and a direction in which it usually
does discharge itself when the excitement is not strong. It may pass on the
stimulus to some other portion of the nervous system. This is what occurs
in quiet thinking and feeling. The successive states which constitute
consciousness, result from this. Sensations excite ideas and emotions;
these in their turns arouse other ideas and emotions; and so, continuously.
That is to say, the tension existing in particular nerves, or groups of
nerves, when they yield us certain sensations, ideas, or emotions,
generates an equivalent tension in some other nerves, or groups of nerves,
with which there is a connexion: the flow of energy passing on, the one
idea or feeling dies in producing the next.
Thus, then, while we are totally unable to comprehend how the excitement of
certain nerves should generate feeling--while, in the production of
consciousness by physical agents acting on physical structure, we come to
an absolute mystery never to be solved; it is yet quite possible for us to
know by observation what are the successive forms which this absolute
mystery may take. We see that there are three channels along which nerves
in a state of tension may discharge themselves; or rather, I should say,
three classes of channels. They may pass on the excitement to other nerves
that have no direct connexions with the bodily members, and may so cause
other feelings and ideas; or they may pass on the excitement to one or more
motor nerves, and so cause muscular contractions; or they may pass on the
excitement to nerves which supply the viscera, and may so stimulate one or
more of these.
For simplicity's sake, I have described these as alternative routes, one or
other of which any current of nerve-force must take; thereby, as it may be
thought, implying that such current will be exclusively confined to some
one of them. But this is by no means the case. Rarely, if ever, does it
happen that a state of nervous tension, present to consciousness as a
feeling, expends itself in one direction only. Very generally it may be
observed to expend itself in two; and it is probable that the discharge is
never absolutely absent from any one of the three. There is, however,
variety in the _proportions_ in which the discharge is divided among these
different channels under different circumstances. In a man whose fear
impels him to run, the mental tension generated is only in part transformed
into a muscular stimulus: there is a surplus which causes a rapid current
of ideas. An agreeable state of feeling produced, say by praise, is not
wholly used up in arousing the succeeding phase of the feeling, and the new
ideas appropriate to it; but a certain portion overflows into the visceral
nervous system, increasing the action of the heart, and probably
facilitating digestion. And here we come upon a class of considerations and
facts which open the way to a solution of our special problem.
For starting with the unquestionable truth, that at any moment the existing
quantity of liberated nerve-force, which in an inscrutable way produces in
us the state we call feeling, _must_ expend itself in some
direction--_must_ generate an equivalent manifestation of force
somewhere--it clearly follows that, if of the several channels it may take,
one is wholly or partially closed, more must be taken by the others; or
that if two are closed, the discharge along the remaining one must be more
intense; and that, conversely, should anything determine an unusual efflux
in one direction, there will be a diminished efflux in other directions.
Daily experience illustrates these conclusions. It is commonly remarked,
that the suppression of external signs of feeling, makes feeling more
intense. The deepest grief is silent grief. Why? Because the nervous
excitement not discharged in muscular action, discharges itself in other
nervous excitements--arouses more numerous and more remote associations of
melancholy ideas, and so increases the mass of feelings. People who conceal
their anger are habitually found to be more revengeful than those who
explode in loud speech and vehement action. Why? Because, as before, the
emotion is reflected back, accumulates, and intensifies. Similarly, men
who, as proved by their powers of representation, have the keenest
appreciation of the comic, are usually able to do and say the most
ludicrous things with perfect gravity.
On the other hand, all are familiar with the truth that bodily activity
deadens emotion. Under great irritation we get relief by walking about
rapidly. Extreme effort in the bootless attempt to achieve a desired end,
greatly diminishes the intensity of the desire. Those who are forced to
exert themselves after misfortunes, do not suffer nearly so much as those
who remain quiescent. If any one wishes to check intellectual excitement,
he cannot choose a more efficient method than running till he is exhausted.
Moreover, these cases, in which the production of feeling and thought is
hindered by determining the nervous energy towards bodily movements, have
their counterparts in the cases in which bodily movements are hindered by
extra absorption of nervous energy in sudden thoughts and feelings. If,
when walking along, there flashes on you an idea that creates great
surprise, hope, or alarm, you stop; or if sitting cross-legged, swinging
your pendent foot, the movement is at once arrested. From the viscera, too,
intense mental action abstracts energy. Joy, disappointment, anxiety, or
any moral perturbation rising to a great height, will destroy appetite; or
if food has been taken, will arrest digestion; and even a purely
intellectual activity, when extreme, will do the like.
Facts, then, fully bear out these _a priori_ inferences, that the nervous
excitement at any moment present to consciousness as feeling, must expend
itself in some way or other; that of the three classes of channels open to
it, it must take one, two, or more, according to circumstances; that the
closure or obstruction of one, must increase the discharge through the
others; and conversely, that if to answer some demand, the efflux of
nervous energy in one direction is unusually great, there must be a
corresponding decrease of the efflux in other directions. Setting out from
these premises, let us now see what interpretation is to be put on the
phenomena of laughter.
* * * * *
That laughter is a display of muscular excitement, and so illustrates the
general law that feeling passing a certain pitch habitually vents itself in
bodily action, scarcely needs pointing out. It perhaps needs pointing out,
however, that strong feeling of almost any kind produces this result. It is
not a sense of the ludicrous, only, which does it; nor are the various
forms of joyous emotion the sole additional causes. We have, besides, the
sardonic laughter and the hysterical laughter, which result from mental
distress; to which must be added certain sensations, as tickling, and,
according to Mr. Bain, cold, and some kinds of acute pain.
Strong feeling, mental or physical, being, then, the general cause of
laughter, we have to note that the muscular actions constituting it are
distinguished from most others by this, that they are purposeless. In
general, bodily motions that are prompted by feelings are directed to
special ends; as when we try to escape a danger, or struggle to secure a
gratification. But the movements of chest and limbs which we make when
laughing have no object. And now remark that these quasi-convulsive
contractions of the muscles, having no object, but being results of an
uncontrolled discharge of energy, we may see whence arise their special
characters--how it happens that certain classes of muscles are affected
first, and then certain other classes. For an overflow of nerve-force,
undirected by any motive, will manifestly take first the most habitual
routes; and if these do not suffice, will next overflow into the less
habitual ones. Well, it is through the organs of speech that feeling passes
into movement with the greatest frequency. The jaws, tongue, and lips are
used not only to express strong irritation or gratification; but that very
moderate flow of mental energy which accompanies ordinary conversation,
finds its chief vent through this channel. Hence it happens that certain
muscles round the mouth, small and easy to move, are the first to contract
under pleasurable emotion. The class of muscles which, next after those of
articulation, are most constantly set in action (or extra action, we should
say) by feelings of all kinds, are those of respiration. Under pleasurable
or painful sensations we breathe more rapidly: possibly as a consequence of
the increased demand for oxygenated blood. The sensations that accompany
exertion also bring on hard-breathing; which here more evidently responds
to the physiological needs. And emotions, too, agreeable and disagreeable,
both, at first, excite respiration; though the last subsequently depress
it. That is to say, of the bodily muscles, the respiratory are more
constantly implicated than any others in those various acts which our
feelings impel us to; and, hence, when there occurs an undirected discharge
of nervous energy into the muscular system, it happens that, if the
quantity be considerable, it convulses not only certain of the articulatory
and vocal muscles, but also those which expel air from the lungs.
Should the feeling to be expended be still greater in amount--too great to
find vent in these classes of muscles--another class comes into play. The
upper limbs are set in motion. Children frequently clap their hands in
glee; by some adults the hands are rubbed together; and others, under still
greater intensity of delight, slap their knees and sway their bodies
backwards and forwards. Last of all, when the other channels for the escape
of the surplus nerve-force have been filled to overflowing, a yet further
and less-used group of muscles is spasmodically affected: the head is
thrown back and the spine bent inwards--there is a slight degree of what
medical men call opisthotonos. Thus, then, without contending that the
phenomena of laughter in all their details are to be so accounted for, we
see that in their _ensemble_ they conform to these general
principles:--that feeling excites to muscular action; that when the
muscular action is unguided by a purpose, the muscles first affected are
those which feeling most habitually stimulates; and that as the feeling to
be expended increases in quantity, it excites an increasing number of
muscles, in a succession determined by the relative frequency with which
they respond to the regulated dictates of feeling.
There still, however, remains the question with which we set out. The
explanation here given applies only to the laughter produced by acute
pleasure or pain: it does not apply to the laughter that follows certain
perceptions of incongruity. It is an insufficient explanation that in these
cases, laughter is a result of the pleasure we take in escaping from the
restraint of grave feelings. That this is a part-cause is true. Doubtless
very often, as Mr. Bain says, "it is the coerced form of seriousness and
solemnity without the reality that gives us that stiff position from which
a contact with triviality or vulgarity relieves us, to our uproarious
delight." And in so far as mirth is caused by the gush of agreeable feeling
that follows the cessation of mental strain, it further illustrates the
general principle above set forth. But no explanation is thus afforded of
the mirth which ensues when the short silence between the _andante_ and
_allegro_ in one of Beethoven's symphonies, is broken by a loud sneeze. In
this, and hosts of like cases, the mental tension is not coerced but
spontaneous--not disagreeable but agreeable; and the coming impressions to
which the attention is directed, promise a gratification that few, if any,
desire to escape. Hence, when the unlucky sneeze occurs, it cannot be that
the laughter of the audience is due simply to the release from an irksome
attitude of mind: some other cause must be sought.
This cause we shall arrive at by carrying our analysis a step further. We
have but to consider the quantity of feeling that exists under such
circumstances, and then to ask what are the conditions that determine the
direction of its discharge, to at once reach a solution. Take a case. You
are sitting in a theatre, absorbed in the progress of an interesting drama.
Some climax has been reached which has aroused your sympathies--say, a
reconciliation between the hero and heroine, after long and painful
misunderstanding. The feelings excited by this scene are not of a kind from
which you seek relief; but are, on the contrary, a grateful relief from the
painful feelings with which you have witnessed the previous estrangement.
Moreover, the sentiments these fictitious personages have for the moment
inspired you with, are not such as would lead you to rejoice in any
indignity offered to them; but rather, such as would make you resent the
indignity. And now, while you are contemplating the reconciliation with a
pleasurable sympathy, there appears from behind the scenes a tame kid,
which, having stared round at the audience, walks up to the lovers and
sniffs at them. You cannot help joining in the roar which greets this
_contretemps_. Inexplicable as is this irresistible burst on the hypothesis
of a pleasure in escaping from mental restraint; or on the hypothesis of a
pleasure from relative increase of self-importance, when witnessing the
humiliation of others; it is readily explicable if we consider what, in
such a case, must become of the feeling that existed at the moment the
incongruity arose. A large mass of emotion had been produced; or, to speak
in physiological language, a large portion of the nervous system was in a
state of tension. There was also great expectation with respect to the
further evolution of the scene--a quantity of vague, nascent thought and
emotion, into which the existing quantity of thought and emotion was about
to pass.
Had there been no interruption, the body of new ideas and feelings next
excited, would have sufficed to absorb the whole of the liberated nervous
energy. But now, this large amount of nervous energy, instead of being
allowed to expend itself in producing an equivalent amount of the new
thoughts and emotions which were nascent, is suddenly checked in its flow.
The channels along which the discharge was about to take place, are closed.
The new channel opened--that afforded by the appearance and proceedings of
the kid--is a small one; the ideas and feelings suggested are not numerous
and massive enough to carry off the nervous energy to be expended. The
excess must therefore discharge itself in some other direction; and in the
way already explained, there results an efflux through the motor nerves to
various classes of the muscles, producing the half-convulsive actions we
term laughter.
This explanation is in harmony with the fact, that when, among several
persons who witness the same ludicrous occurrence, there are some who do
not laugh; it is because there has arisen in them an emotion not
participated in by the rest, and which is sufficiently massive to absorb
all the nascent excitement. Among the spectators of an awkward tumble,
those who preserve their gravity are those in whom there is excited a
degree of sympathy with the sufferer, sufficiently great to serve as an
outlet for the feeling which the occurrence had turned out of its previous
course. Sometimes anger carries off the arrested current; and so prevents
laughter. An instance of this was lately furnished me by a friend who had
been witnessing the feats at Franconi's. A tremendous leap had just been
made by an acrobat over a number of horses. The clown, seemingly envious of
this success, made ostentatious preparation for doing the like; and then,
taking the preliminary run with immense energy, stopped short on reaching
the first horse, and pretended to wipe some dust from its haunches. In the
majority of the spectators, merriment was excited; but in my friend, wound
up by the expectation of the coming leap to a state of great nervous
tension, the effect of the baulk was to produce indignation. Experience
thus proves what the theory implies: namely, that the discharge of arrested
feelings into the muscular system, takes place only in the absence of other
adequate channels--does not take place if there arise other feelings equal
in amount to those arrested.
Evidence still more conclusive is at hand. If we contrast the incongruities
which produce laughter with those which do not, we at once see that in the
non-ludicrous ones the unexpected state of feeling aroused, though wholly
different in kind, is not less in quantity or intensity. Among
incongruities that may excite anything but a laugh, Mr. Bain instances--"A
decrepit man under a heavy burden, five loaves and two fishes among a
multitude, and all unfitness and gross disproportion; an instrument out of
tune, a fly in ointment, snow in May, Archimedes studying geometry in a
siege, and all discordant things; a wolf in sheep's clothing, a breach of
bargain, and falsehood in general; the multitude taking the law in their
own hands, and everything of the nature of disorder; a corpse at a feast,
parental cruelty, filial ingratitude, and whatever is unnatural; the entire
catalogue of the vanities given by Solomon, are all incongruous, but they
cause feelings of pain, anger, sadness, loathing, rather than mirth." Now
in these cases, where the totally unlike state of consciousness suddenly
produced, is not inferior in mass to the preceding one, the conditions to
laughter are not fulfilled. As above shown, laughter naturally results only
when consciousness is unawares transferred from great things to small--only
when there is what we call a _descending_ incongruity.
And now observe, finally, the fact, alike inferable _a priori_ and
illustrated in experience, that an _ascending_ incongruity not only fails
to cause laughter, but works on the muscular system an effect of exactly
the reverse kind. When after something very insignificant there arises
without anticipation something very great, the emotion we call wonder
results; and this emotion is accompanied not by an excitement of the
muscles, but by a relaxation of them. In children and country people, that
falling of the jaw which occurs on witnessing something that is imposing
and unexpected, exemplifies this effect. Persons who have been
wonder-struck at the production of very striking results by a seemingly
inadequate cause, are frequently described as unconsciously dropping the
things they held in their hands. Such are just the effects to be
anticipated. After an average state of consciousness, absorbing but a small
quantity of nervous energy, is aroused without the slightest notice, a
strong emotion of awe, terror, or admiration; joined with the astonishment
due to an apparent want of adequate causation. This new state of
consciousness demands far more nervous energy than that which it has
suddenly replaced; and this increased absorption of nervous energy in
mental changes, involves a temporary diminution of the outflow in other
directions: whence the pendent jaw and the relaxing grasp.
One further observation is worth making. Among the several sets of channels
into which surplus feeling might be discharged, was named the nervous
system of the viscera. The sudden overflow of an arrested mental
excitement, which, as we have seen, results from a descending incongruity,
must doubtless stimulate not only the muscular system, as we see it does,
but also the internal organs; the heart and stomach must come in for a
share of the discharge. And thus there seems to be a good physiological
basis for the popular notion that mirth-creating excitement facilitates
digestion.
* * * * *
Though in doing so I go beyond the boundaries of the immediate topic, I may
fitly point out that the method of inquiry here followed, is one which
enables us to understand various phenomena besides those of laughter. To
show the importance of pursuing it, I will indicate the explanation it
furnishes of another familiar class of facts.
All know how generally a large amount of emotion disturbs the action of the
intellect, and interferes with the power of expression. A speech delivered
with great facility to tables and chairs, is by no means so easily
delivered to an audience. Every schoolboy can testify that his trepidation,
when standing before a master, has often disabled him from repeating a
lesson which he had duly learnt. In explanation of this we commonly say
that the attention is distracted--that the proper train of ideas is broken
by the intrusion of ideas that are irrelevant. But the question is, in what
manner does unusual emotion produce this effect; and we are here supplied
with a tolerably obvious answer. The repetition of a lesson, or set speech
previously thought out, implies the flow of a very moderate amount of
nervous excitement through a comparatively narrow channel. The thing to be
done is simply to call up in succession certain previously-arranged
ideas--a process in which no great amount of mental energy is expended.
Hence, when there is a large quantity of emotion, which must be discharged
in some direction or other; and when, as usually happens, the restricted
series of intellectual actions to be gone through, does not suffice to
carry it off; there result discharges along other channels besides the one
prescribed: there are aroused various ideas foreign to the train of thought
to be pursued; and these tend to exclude from consciousness those which
should occupy it.
And now observe the meaning of those bodily actions spontaneously set up
under these circumstances. The school-boy saying his lesson, commonly has
his fingers actively engaged--perhaps in twisting about a broken pen, or
perhaps squeezing the angle of his jacket; and if told to keep his hands
still, he soon again falls into the same or a similar trick. Many anecdotes
are current of public speakers having incurable automatic actions of this
class: barristers who perpetually wound and unwound pieces of tape; members
of parliament ever putting on and taking off their spectacles. So long as
such movements are unconscious, they facilitate the mental actions. At
least this seems a fair inference from the fact that confusion frequently
results from putting a stop to them: witness the case narrated by Sir
Walter Scott of his school-fellow, who became unable to say his lesson
after the removal of the waistcoat-button that he habitually fingered while
in class. But why do they facilitate the mental actions? Clearly because
they draw off a portion of the surplus nervous excitement. If, as above
explained, the quantity of mental energy generated is greater than can find
vent along the narrow channel of thought that is open to it; and if, in
consequence, it is apt to produce confusion by rushing into other channels
of thought; then by allowing it an exit through the motor nerves into the
muscular system, the pressure is diminished, and irrelevant ideas are less
likely to intrude on consciousness.
This further illustration will, I think, justify the position that
something may be achieved by pursuing in other cases this method of
psychological inquiry. A complete explanation of the phenomena, requires us
to trace out _all_ the consequences of any given state of consciousness;
and we cannot do this without studying the effects, bodily and mental, as
varying in quantity at each other's expense. We should probably learn much
if we in every case asked--Where is all the nervous energy gone?
V. THE ORIGIN AND FUNCTION OF MUSIC
When Carlo, standing, chained to his kennel, sees his master in the
distance, a slight motion of the tail indicates his but faint hope that he
is about to be let out. A much more decided wagging of the tail, passing
by-and-by into lateral undulations of the body, follows his master's nearer
approach. When hands are laid on his collar, and he knows that he is really
to have an outing, his jumping and wriggling are such that it is by no
means easy to loose his fastenings. And when he finds himself actually
free, his joy expends itself in bounds, in pirouettes, and in scourings
hither and thither at the top of his speed. Puss, too, by erecting her
tail, and by every time raising her back to meet the caressing hand of her
mistress, similarly expresses her gratification by certain muscular
actions; as likewise do the parrot by awkward dancing on his perch, and the
canary by hopping and fluttering about his cage with unwonted rapidity.
Under emotions of an opposite kind, animals equally display muscular
excitement. The enraged lion lashes his sides with his tail, knits his
brows, protrudes his claws. The cat sets up her back; the dog retracts his
upper lip; the horse throws back his ears. And in the struggles of
creatures in pain, we see that the like relation holds between excitement
of the muscles and excitement of the nerves of sensation.
In ourselves, distinguished from lower creatures as we are by feelings
alike more powerful and more varied, parallel facts are at once more
conspicuous and more numerous. We may conveniently look at them in groups.
We shall find that pleasurable sensations and painful sensations,
pleasurable emotions and painful emotions, all tend to produce active
demonstrations in proportion to their intensity.
In children, and even in adults who are not restrained by regard for
appearances, a highly agreeable taste is followed by a smacking of the
lips. An infant will laugh and bound in its nurse's arms at the sight of a
brilliant colour or the hearing of a new sound. People are apt to beat time
with head or feet to music which particularly pleases them. In a sensitive
person an agreeable perfume will produce a smile; and smiles will be seen
on the faces of a crowd gazing at some splendid burst of fireworks. Even
the pleasant sensation of warmth felt on getting to the fireside out of a
winter's storm, will similarly express itself in the face.
Painful sensations, being mostly far more intense than pleasurable ones,
cause muscular actions of a much more decided kind. A sudden twinge
produces a convulsive start of the whole body. A pain less violent, but
continuous, is accompanied by a knitting of the brows, a setting of the
teeth or biting of the lip, and a contraction of the features generally.
Under a persistent pain of a severer kind, other muscular actions are
added: the body is swayed to and fro; the hands clench anything they can
lay hold of; and should the agony rise still higher, the sufferer rolls
about on the floor almost convulsed.
Though more varied, the natural language of the pleasurable emotions comes
within the same generalization. A smile, which is the commonest expression
of gratified feeling, is a contraction of certain facial muscles; and when
the smile broadens into a laugh, we see a more violent and more general
muscular excitement produced by an intenser gratification. Rubbing together
of the hands, and that other motion which Dickens somewhere describes as
"washing with impalpable soap in invisible water," have like implications.
Children may often be seen to "jump for joy." Even in adults of excitable
temperament, an action approaching to it is sometimes witnessed. And
dancing has all the world through been regarded as natural to an elevated
state of mind. Many of the special emotions show themselves in special
muscular actions. The gratification resulting from success, raises the head
and gives firmness to the gait. A hearty grasp of the hand is currently
taken as indicative of friendship. Under a gush of affection the mother
clasps her child to her breast, feeling as though she could squeeze it to
death. And so in sundry other cases. Even in that brightening of the eye
with which good news is received we may trace the same truth; for this
appearance of greater brilliancy is due to an extra contraction of the
muscle which raises the eyelid, and so allows more light to fall upon, and
be reflected from, the wet surface of the eyeball.
The bodily indications of painful emotions are equally numerous, and still
more vehement. Discontent is shown by raised eyebrows and wrinkled
forehead; disgust by a curl of the lip; offence by a pout. The impatient
man beats a tattoo with his fingers on the table, swings his pendent leg
with increasing rapidity, gives needless pokings to the fire, and presently
paces with hasty strides about the room. In great grief there is wringing
of the hands, and even tearing of the hair. An angry child stamps, or rolls
on its back and kicks its heels in the air; and in manhood, anger, first
showing itself in frowns, in distended nostrils, in compressed lips, goes
on to produce grinding of the teeth, clenching of the fingers, blows of the
fist on the table, and perhaps ends in a violent attack on the offending
person, or in throwing about and breaking the furniture. From that pursing
of the mouth indicative of slight displeasure, up to the frantic struggles
of the maniac, we shall find that mental irritation tends to vent itself in
bodily activity.
All feelings, then--sensations or emotions, pleasurable or painful--have
this common characteristic, that they are muscular stimuli. Not forgetting
the few apparently exceptional cases in which emotions exceeding a certain
intensity produce prostration, we may set it down as a general law that,
alike in man and animals, there is a direct connection between feeling and
motion; the last growing more vehement as the first grows more intense.
Were it allowable here to treat the matter scientifically, we might trace
this general law down to the principle known among physiologists as that of
_reflex action_.[H] Without doing this, however, the above numerous
instances justify the generalization, that mental excitement of all kinds
ends in excitement of the muscles; and that the two preserve a more or less
constant ratio to each other.
[H] Those who seek information on this point may find it in an
interesting tract by Mr. Alexander Bain, on _Animal Instinct and
Intelligence_.
* * * * *
"But what has all this to do with _The Origin and Function of Music_?" asks
the reader. Very much, as we shall presently see. All music is originally
vocal. All vocal sounds are produced by the agency of certain muscles.
These muscles, in common with those of the body at large, are excited to
contraction by pleasurable and painful feelings. And therefore it is that
feelings demonstrate themselves in sounds as well as in movements.
Therefore it is that Carlo barks as well as leaps when he is let out--that
puss purrs as well as erects her tail--that the canary chirps as well as
flutters. Therefore it is that the angry lion roars while he lashes his
sides, and the dog growls while he retracts his lip. Therefore it is that
the maimed animal not only struggles, but howls. And it is from this cause
that in human beings bodily suffering expresses itself not only in
contortions, but in shrieks and groans--that in anger, and fear, and grief,
the gesticulations are accompanied by shouts and screams--that delightful
sensations are followed by exclamations--and that we hear screams of joy
and shouts of exultation.
We have here, then, a principle underlying all vocal phenomena; including
those of vocal music, and by consequence those of music in general. The
muscles that move the chest, larynx, and vocal chords, contracting like
other muscles in proportion to the intensity of the feelings; every
different contraction of these muscles involving, as it does, a different
adjustment of the vocal organs; every different adjustment of the vocal
organs causing a change in the sound emitted;--it follows that variations
of voice are the physiological results of variations of feeling; it follows
that each inflection or modulation is the natural outcome of some passing
emotion or sensation; and it follows that the explanation of all kinds of
vocal expression, must be sought in this general relation between mental
and muscular excitements. Let us, then, see whether we cannot thus account
for the chief peculiarities in the utterance of the feelings: grouping
these peculiarities under the heads of _loudness_, _quality_, _or timbre_,
_pitch_, _intervals_, and _rate of variation_.
* * * * *
Between the lungs and the organs of voice, there is much the same relation
as between the bellows of an organ and its pipes. And as the loudness of
the sound given out by an organ-pipe increases with the strength of the
blast from the bellows; so, other things equal, the loudness of a vocal
sound increases with the strength of the blast from the lungs. But the
expulsion of air from the lungs is effected by certain muscles of the chest
and abdomen. The force with which these muscles contract, is proportionate
to the intensity of the feeling experienced. Hence, _a priori_, loud sounds
will be the habitual results of strong feelings. That they are so we have
daily proof. The pain which, if moderate, can be borne silently, causes
outcries if it becomes extreme. While a slight vexation makes a child
whimper, a fit of passion calls forth a howl that disturbs the
neighbourhood. When the voices in an adjacent room become unusually
audible, we infer anger, or surprise, or joy. Loudness of applause is
significant of great approbation; and with uproarious mirth we associate
the idea of high enjoyment. Commencing with the silence of apathy, we find
that the utterances grow louder as the sensations or emotions, whether
pleasurable or painful, grow stronger.
That different _qualities_ of voice accompany different mental states, and
that under states of excitement the tones are more sonorous than usual, is
another general fact admitting of a parallel explanation. The sounds of
common conversation have but little resonance; those of strong feeling have
much more. Under rising ill temper the voice acquires a metallic ring. In
accordance with her constant mood, the ordinary speech of a virago has a
piercing quality quite opposite to that softness indicative of placidity. A
ringing laugh marks an especially joyous temperament. Grief unburdening
itself uses tones approaching in _timbre_ to those of chanting: and in his
most pathetic passages an eloquent speaker similarly falls into tones more
vibratory than those common to him. Now any one may readily convince
himself that resonant vocal sounds can be produced only by a certain
muscular effort additional to that ordinarily needed. If after uttering a
word in his speaking voice, the reader, without changing the pitch or the
loudness, will _sing_ this word, he will perceive that before he can sing
it, he has to alter the adjustment of the vocal organs; to do which a
certain force must be used; and by putting his fingers on that external
prominence marking the top of the larynx, he will have further evidence
that to produce a sonorous tone the organs must be drawn out of their usual
position. Thus, then, the fact that the tones of excited feeling are more
vibratory than those of common conversation, is another instance of the
connexion between mental excitement and muscular excitement. The speaking
voice, the recitative voice, and the singing voice, severally exemplify one
general principle.
That the _pitch_ of the voice varies according to the action of the vocal
muscles, scarcely needs saying. All know that the middle notes, in which
they converse, are made without any appreciable effort; and all know that
to make either very high or very low notes requires a considerable effort.
In either ascending or descending from the pitch of ordinary speech, we are
conscious of an increasing muscular strain, which, at both extremes of the
register, becomes positively painful. Hence it follows from our general
principle, that while indifference or calmness will use the medium tones,
the tones used during excitement will be either above or below them; and
will rise higher and higher, or fall lower and lower, as the feelings grow
stronger. This physiological deduction we also find to be in harmony with
familiar facts. The habitual sufferer utters his complaints in a voice
raised considerably above the natural key; and agonizing pain vents itself
in either shrieks or groans--in very high or very low notes. Beginning at
his talking pitch, the cry of the disappointed urchin grows more shrill as
it grows louder. The "Oh!" of astonishment or delight, begins several notes
below the middle voice, and descends still lower. Anger expresses itself in
high tones, or else in "curses not loud but _deep_." Deep tones, too, are
always used in uttering strong reproaches. Such an exclamation as "Beware!"
if made dramatically--that is, if made with a show of feeling--must be many
notes lower than ordinary. Further, we have groans of disapprobation,
groans of horror, groans of remorse. And extreme joy and fear are alike
accompanied by shrill outcries.
Nearly allied to the subject of pitch, is that of _intervals_; and the
explanation of them carries our argument a step further. While calm speech
is comparatively monotonous, emotion makes use of fifths, octaves, and even
wider intervals. Listen to any one narrating or repeating something in
which he has no interest, and his voice will not wander more than two or
three notes above or below his medium note, and that by small steps; but
when he comes to some exciting event he will be heard not only to use the
higher and lower notes of his register, but to go from one to the other by
larger leaps. Being unable in print to imitate these traits of feeling, we
feel some difficulty in fully realizing them to the reader. But we may
suggest a few remembrances which will perhaps call to mind a sufficiency of
others. If two men living in the same place, and frequently seeing one
another, meet, say at a public assembly, any phrase with which one may be
heard to accost the other--as "Hallo, are you here?"--will have an ordinary
intonation. But if one of them, after long absence, has unexpectedly
returned, the expression of surprise with which his friend may greet
him--"Hallo! how came you here?"--will be uttered in much more strongly
contrasted tones. The two syllables of the word "Hallo" will be, the one
much higher and the other much lower than before; and the rest of the
sentence will similarly ascend and descend by longer steps.
Again, if, supposing her to be in an adjoining room, the mistress of the
house calls "Mary," the two syllables of the name will be spoken in an
ascending interval of a third. If Mary does not reply, the call will be
repeated probably in a descending fifth; implying the slightest shade of
annoyance at Mary's inattention. Should Mary still make no answer, the
increasing annoyance will show itself by the use of a descending octave on
the next repetition of the call. And supposing the silence to continue, the
lady, if not of a very even temper, will show her irritation at Mary's
seemingly intentional negligence by finally calling her in tones still more
widely contrasted--the first syllable being higher and the last lower than
before.
Now, these and analogous facts, which the reader will readily accumulate,
clearly conform to the law laid down. For to make large intervals requires
more muscular action than to make small ones. But not only is the _extent_
of vocal intervals thus explicable as due to the relation between nervous
and muscular excitement, but also in some degree their _direction_, as
ascending or descending. The middle notes being those which demand no
appreciable effort of muscular adjustment; and the effort becoming greater
as we either ascend or descend; it follows that a departure from the middle
notes in either direction will mark increasing emotion; while a return
towards the middle notes will mark decreasing emotion. Hence it happens
that an enthusiastic person uttering such a sentence as--"It was the most
splendid sight I ever saw!" will ascend to the first syllable of the word
"splendid," and thence will descend: the word "splendid" marking the climax
of the feeling produced by the recollection. Hence, again, it happens that,
under some extreme vexation produced by another's stupidity, an irascible
man, exclaiming--"What a confounded fool the fellow is!" will begin
somewhat below his middle voice, and descending to the word "fool," which
he will utter in one of his deepest notes, will then ascend again. And it
may be remarked, that the word "fool" will not only be deeper and louder
than the rest, but will also have more emphasis of articulation--another
mode in which muscular excitement is shown.
There is some danger, however, in giving instances like this; seeing that
as the mode of rendering will vary according to the intensity of the
feeling which the reader feigns to himself, the right cadence may not be
hit upon. With single words there is less difficulty. Thus the "Indeed!"
with which a surprising fact is received, mostly begins on the middle note
of the voice, and rises with the second syllable; or, if disapprobation as
well as astonishment is felt, the first syllable will be below the middle
note, and the second lower still. Conversely, the word "Alas!" which marks
not the rise of a paroxysm of grief, but its decline, is uttered in a
cadence descending towards the middle note; or, if the first syllable is in
the lower part of the register, the second ascends towards the middle note.
In the "Heigh-ho!" expressive of mental and muscular prostration, we may
see the same truth; and if the cadence appropriate to it be inverted the
absurdity of the effect clearly shows how the meaning of intervals is
dependent on the principle we have been illustrating.
The remaining characteristic of emotional speech which we have to notice is
that of _variability of pitch_. It is scarcely possible here to convey
adequate ideas of this more complex manifestation. We must be content with
simply indicating some occasions on which it may be observed. On a meeting
of friends, for instance--as when there arrives a party of much-wished-for
visitors--the voices of all will be heard to undergo changes of pitch not
only greater but much more numerous than usual. If a speaker at a public
meeting is interrupted by some squabble among those he is addressing, his
comparatively level tones will be in marked contrast with the rapidly
changing one of the disputants. And among children, whose feelings are less
under control than those of adults, this peculiarity is still more decided.
During a scene of complaint and recrimination between two excitable little
girls, the voices may be heard to run up and down the gamut several times
in each sentence. In such cases we once more recognise the same law: for
muscular excitement is shown not only in strength of contraction but also
in the rapidity with which different muscular adjustments succeed each
other.
Thus we find all the leading vocal phenomena to have a physiological basis.
They are so many manifestations of the general law that feeling is a
stimulus to muscular action--a law conformed to throughout the whole
economy, not of man only, but of every sensitive creature--a law,
therefore, which lies deep in the nature of animal organization. The
expressiveness of these various modifications of voice is therefore innate.
Each of us, from babyhood upwards, has been spontaneously making them, when
under the various sensations and emotions by which they are produced.
Having been conscious of each feeling at the same time that we heard
ourselves make the consequent sound, we have acquired an established
association of ideas between such sound and the feeling which caused it.
When the like sound is made by another, we ascribe the like feeling to him;
and by a further consequence we not only ascribe to him that feeling, but
have a certain degree of it aroused in ourselves: for to become conscious
of the feeling which another is experiencing, is to have that feeling
awakened in our own consciousness, which is the same thing as experiencing
the feeling. Thus these various modifications of voice become not only a
language through which we understand the emotions of others, but also the
means of exciting our sympathy with such emotions.
Have we not here, then, adequate data for a theory of music? These vocal
peculiarities which indicate excited feeling, _are those which especially
distinguish song from ordinary speech_. Every one of the alterations of
voice which we have found to be a physiological result of pain or pleasure,
_is carried to its greatest extreme in vocal music_. For instance, we saw
that, in virtue of the general relation between mental and muscular
excitement, one characteristic of passionate utterance is _loudness_. Well,
its comparative loudness is one of the distinctive marks of song as
contrasted with the speech of daily life; and further, the _forte_ passages
of an air are those intended to represent the climax of its emotion. We
next saw that the tones in which emotion expresses itself, are, in
conformity with this same law, of a more sonorous _timbre_ than those of
calm conversation. Here, too, song displays a still higher degree of the
peculiarity; for the singing tone is the most resonant we can make. Again,
it was shown that, from a like cause, mental excitement vents itself in the
higher and lower notes of the register; using the middle notes but seldom.
And it scarcely needs saying that vocal music is still more distinguished
by its comparative neglect of the notes in which we talk, and its habitual
use of those above or below them and, moreover, that its most passionate
effects are commonly produced at the two extremities of its scale, but
especially the upper one.
A yet further trait of strong feeling, similarly accounted for, was the
employment of larger intervals than are employed in common converse. This
trait, also, every ballad and _aria_ carries to an extent beyond that heard
in the spontaneous utterances of emotion: add to which, that the direction
of these intervals, which, as diverging from or converging towards the
medium tones, we found to be physiologically expressive of increasing or
decreasing emotion, may be observed to have in music like meanings. Once
more, it was pointed out that not only extreme but also rapid variations of
pitch, are characteristic of mental excitement; and once more we see in the
quick changes of every melody, that song carries the characteristic as far,
if not farther. Thus, in respect alike of _loudness_, _timbre_, _pitch_,
_intervals_, and _rate of variation_, song employs and exaggerates the
natural language of the emotions;--it arises from a systematic combination
of those vocal peculiarities which are the physiological effects of acute
pleasure and pain.
Besides these chief characteristics of song as distinguished from common
speech, there are sundry minor ones similarly explicable as due to the
relation between mental and muscular excitement; and before proceeding
further, these should be briefly noticed. Thus, certain passions, and
perhaps all passions when pushed to an extreme, produce (probably through
their influence over the action of the heart) an effect the reverse of that
which has been described: they cause a physical prostration, one symptom of
which is a general relaxation of the muscles, and a consequent trembling.
We have the trembling of anger, of fear, of hope, of joy; and the vocal
muscles being implicated with the rest, the voice too becomes tremulous.
Now, in singing, this tremulousness of voice is very effectively used by
some vocalists in highly pathetic passages; sometimes, indeed, because of
its effectiveness, too much used by them--as by Tamberlik, for instance.
Again, there is a mode of musical execution known as the _staccato_,
appropriate to energetic passages--to passages expressive of exhilaration,
of resolution, of confidence. The action of the vocal muscles which
produces this staccato style, is analogous to the muscular action which
produces the sharp, decisive, energetic movements of body indicating these
states of mind; and therefore it is that the staccato style has the meaning
we ascribe to it. Conversely, slurred intervals are expressive of gentler
and less active feelings; and are so because they imply the smaller
muscular vivacity due to a lower mental energy. The difference of effect
resulting from difference of _time_ in music, is also attributable to the
same law. Already it has been pointed out that the more frequent changes of
pitch which ordinarily result from passion, are imitated and developed in
song; and here we have to add, that the various rates of such changes,
appropriate to the different styles of music, are further traits having the
same derivation. The slowest movements, _largo_ and _adagio_, are used
where such depressing emotions as grief, or such unexciting emotions as
reverence, are to be portrayed; while the more rapid movements, _andante_,
_allegro_, _presto_, represent successively increasing degrees of mental
vivacity; and do this because they imply that muscular activity which flows
from this mental vivacity. Even the _rhythm_, which forms a remaining
distinction between song and speech, may not improbably have a kindred
cause. Why the actions excited by strong feeling should tend to become
rhythmical, is not very obvious; but that they do so there are divers
evidences. There is the swaying of the body to and fro under pain or grief,
of the leg under impatience or agitation. Dancing, too, is a rhythmical
action natural to elevated emotion. That under excitement speech acquires a
certain rhythm, we may occasionally perceive in the highest efforts of an
orator. In poetry, which is a form of speech used for the better expression
of emotional ideas, we have this rhythmical tendency developed. And when we
bear in mind that dancing, poetry, and music are connate--are originally
constituent parts of the same thing, it becomes clear that the measured
movement common to them all implies a rhythmical action of the whole
system, the vocal apparatus included; and that so the rhythm of music is a
more subtle and complex result of this relation between mental and muscular
excitement.
But it is time to end this analysis, which, possibly we have already
carried too far. It is not to be supposed that the more special
peculiarities of musical expression are to be definitely explained. Though
probably they may all in some way conform to the principle that has been
worked out, it is obviously impracticable to trace that principle in its
more ramified applications. Nor is it needful to our argument that it
should be so traced. The foregoing facts sufficiently prove that what we
regard as the distinctive traits of song, are simply the traits of
emotional speech intensified and systematized. In respect of its general
characteristics, we think it has been made clear that vocal music, and by
consequence all music, is an idealization of the natural language of
passion.
* * * * *
As far as it goes, the scanty evidence furnished by history confirms this
conclusion. Note first the fact (not properly an historical one, but fitly
grouped with such) that the dance-chants of savage tribes are very
monotonous; and in virtue of their monotony are much more nearly allied to
ordinary speech than are the songs of civilized races. Joining with this
the fact that there are still extant among boatmen and others in the East,
ancient chants of a like monotonous character, we may infer that vocal
music originally diverged from emotional speech in a gradual, unobtrusive
manner; and this is the inference to which our argument points. Further
evidence to the same effect is supplied by Greek history. The early poems
of the Greeks--which, be it remembered, were sacred legends embodied in
that rhythmical, metaphorical language which strong feeling excites--were
not recited, but chanted: the tones and the cadences were made musical by
the same influences which made the speech poetical.
By those who have investigated the matter, this chanting is believed to
have been not what we call singing, but nearly allied to our recitative;
(far simpler indeed, if we may judge from the fact that the early Greek
lyre, which had but _four_ strings, was played in _unison_ with the voice,
which was therefore confined to four notes;) and as such, much less remote
from common speech than our own singing is. For recitative, or musical
recitation, is in all respects intermediate between speech and song. Its
average effects are not so _loud_ as those of song. Its tones are less
sonorous in _timbre_ than those of song. Commonly it diverges to a smaller
extent from the middle notes--uses notes neither so high nor so low in
_pitch_. The _intervals_ habitual to it are neither so wide nor so varied.
Its _rate of variation_ is not so rapid. And at the same time that its
primary _rhythm_ is less decided, it has none of that secondary rhythm
produced by recurrence of the same or parallel musical phrases, which is
one of the marked characteristics of song. Thus, then, we may not only
infer, from the evidence furnished by existing barbarous tribes, that the
vocal music of pre-historic times was emotional speech very slightly
exalted; but we see that the earliest vocal music of which we have any
account, differed much less from emotional speech than does the vocal music
of our days.
That recitative--beyond which, by the way, the Chinese and Hindoos seem
never to have advanced--grew naturally out of the modulations and cadences
of strong feeling, we have indeed still current evidence. There are even
now to be met with occasions on which strong feeling vents itself in this
form. Whoever has been present when a meeting of Quakers was addressed by
one of their preachers (whose practice it is to speak only under the
influence of religious emotion), must have been struck by the quite unusual
tones, like those of a subdued chant, in which the address was made. It is
clear, too, that the intoning used in some churches, is representative of
this same mental state; and has been adopted on account of the
instinctively felt congruity between it and the contrition, supplication,
or reverence verbally expressed.
* * * * *
And if, as we have good reason to believe, recitative arose by degrees out
of emotional speech, it becomes manifest that by a continuance of the same
process song has arisen out of recitative. Just as, from the orations and
legends of savages, expressed in the metaphorical, allegorical style
natural to them, there sprung epic poetry, out of which lyric poetry was
afterwards developed; so, from the exalted tones and cadences in which such
orations and legends were delivered, came the chant or recitative music,
from whence lyrical music has since grown up. And there has not only thus
been a simultaneous and parallel genesis, but there is also a parallelism
of results. For lyrical poetry differs from epic poetry, just as lyrical
music differs from recitative: each still further intensifies the natural
language of the emotions. Lyrical poetry is more metaphorical, more
hyperbolic, more elliptical, and adds the rhythm of lines to the rhythm of
feet; just as lyrical music is louder, more sonorous, more extreme in its
intervals, and adds the rhythm of phrases to the rhythm of bars. And the
known fact that out of epic poetry the stronger passions developed lyrical
poetry as their appropriate vehicle, strengthens the inference that they
similarly developed lyrical music out of recitative.
Nor indeed are we without evidences of the transition. It needs but to
listen to an opera to hear the leading gradations. Between the
comparatively level recitative of ordinary dialogue, the more varied
recitative with wider intervals and higher tones used in exciting scenes,
the still more musical recitative which preludes an air, and the air
itself, the successive steps are but small; and the fact that among airs
themselves gradations of like nature may be traced, further confirms the
conclusion that the highest form of vocal music was arrived at by degrees.
Moreover, we have some clue to the influences which have induced this
development; and may roughly conceive the process of it. As the tones,
intervals, and cadences of strong emotion were the elements out of which
song was elaborated; so, we may expect to find that still stronger emotion
produced the elaboration: and we have evidence implying this. Instances in
abundance may be cited, showing that musical composers are men of extremely
acute sensibilities. The Life of Mozart depicts him as one of intensely
active affections and highly impressionable temperament. Various anecdotes
represent Beethoven as very susceptible and very passionate. Mendelssohn is
described by those who knew him to have been full of fine feeling. And the
almost incredible sensitiveness of Chopin has been illustrated in the
memoirs of George Sand. An unusually emotional nature being thus the
general characteristic of musical composers, we have in it just the agency
required for the development of recitative and song. Intenser feeling
producing intenser manifestations, any cause of excitement will call forth
from such a nature, tones and changes of voice more marked than those
called forth from an ordinary nature--will generate just those
exaggerations which we have found to distinguish the lower vocal music from
emotional speech, and the higher vocal music from the lower. Thus it
becomes credible that the four-toned recitative of the early Greek poets
(like all poets, nearly allied to composers in the comparative intensity of
their feelings), was really nothing more than the slightly exaggerated
emotional speech natural to them, which grew by frequent use into an
organized form. And it is readily conceivable that the accumulated agency
of subsequent poet-musicians, inheriting and adding to the products of
those who went before them, sufficed, in the course of the ten centuries
which we know it took, to develope this four-toned recitative into a vocal
music having a range of two octaves.
Not only may we so understand how more sonorous tones, greater extremes of
pitch, and wider intervals, were gradually introduced; but also how there
arose a greater variety and complexity of musical expression. For this same
passionate, enthusiastic temperament, which naturally leads the musical
composer to express the feelings possessed by others as well as himself, in
extremer intervals and more marked cadences than they would use, also leads
him to give musical utterance to feelings which they either do not
experience, or experience in but slight degrees. In virtue of this general
susceptibility which distinguishes him, he regards with emotion, events,
scenes, conduct, character, which produce upon most men no appreciable
effect. The emotions so generated, compounded as they are of the simpler
emotions, are not expressible by intervals and cadences natural to these,
but by combinations of such intervals and cadences: whence arise more
involved musical phrases, conveying more complex, subtle, and unusual
feelings. And thus we may in some measure understand how it happens that
music not only so strongly excites our more familiar feelings, but also
produces feelings we never had before--arouses dormant sentiments of which
we had not conceived the possibility and do not know the meaning; or, as
Richter says--tells us of things we have not seen and shall not see.
* * * * *
Indirect evidences of several kinds remain to be briefly pointed out. One
of them is the difficulty, not to say impossibility, of otherwise
accounting for the expressiveness of music. Whence comes it that special
combinations of notes should have special effects upon our emotions?--that
one should give us a feeling of exhilaration, another of melancholy,
another of affection, another of reverence? Is it that these special
combinations have intrinsic meanings apart from the human
constitution?--that a certain number of aerial waves per second, followed
by a certain other number, in the nature of things signify grief, while in
the reverse order they signify joy; and similarly with all other intervals,
phrases, and cadences? Few will be so irrational as to think this. Is it,
then, that the meanings of these special combinations are conventional
only?--that we learn their implications, as we do those of words, by
observing how others understand them? This is an hypothesis not only devoid
of evidence, but directly opposed to the experience of every one. How,
then, are musical effects to be explained? If the theory above set forth be
accepted, the difficulty disappears. If music, taking for its raw material
the various modifications of voice which are the physiological results of
excited feeling, intensifies, combines, and complicates them--if it
exaggerates the loudness, the resonance, the pitch, the intervals, and the
variability, which, in virtue of an organic law, are the characteristics of
passionate speech--if, by carrying out these further, more consistently,
more unitedly, and more sustainedly, it produces an idealized language of
emotion; then its power over us becomes comprehensible. But in the absence
of this theory, the expressiveness of music appears to be inexplicable.
Again, the preference we feel for certain qualities of sound presents a
like difficulty, admitting only of a like solution. It is generally agreed
that the tones of the human voice are more pleasing than any others. Grant
that music takes its rise from the modulations of the human voice under
emotion, and it becomes a natural consequence that the tones of that voice
should appeal to our feelings more than any others; and so should be
considered more beautiful than any others. But deny that music has this
origin, and the only alternative is the untenable position that the
vibrations proceeding from a vocalist's throat are, objectively considered,
of a higher order than those from a horn or a violin. Similarly with harsh
and soft sounds. If the conclusiveness of the foregoing reasonings be not
admitted, it must be supposed that the vibrations causing the last are
intrinsically better than those causing the first; and that, in virtue of
some pre-established harmony, the higher feelings and natures produce the
one, and the lower the other. But if the foregoing reasonings be valid, it
follows, as a matter of course, that we shall like the sounds that
habitually accompany agreeable feelings, and dislike those that habitually
accompany disagreeable feelings.
Once more, the question--How is the expressiveness of music to be otherwise
accounted for? may be supplemented by the question--How is the genesis of
music to be otherwise accounted for? That music is a product of
civilization is manifest; for though savages have their dance-chants, these
are of a kind scarcely to be dignified by the title musical: at most, they
supply but the vaguest rudiment of music, properly so called. And if music
has been by slow steps developed in the course of civilization, it must
have been developed out of something. If, then, its origin is not that
above alleged, what is its origin?
Thus we find that the negative evidence confirms the positive, and that,
taken together, they furnish strong proof. We have seen that there is a
physiological relation, common to man and all animals, between feeling and
muscular action; that as vocal sounds are produced by muscular action,
there is a consequent physiological relation between feeling and vocal
sounds; that all the modifications of voice expressive of feeling are the
direct results of this physiological relation; that music, adopting all
these modifications, intensifies them more and more as it ascends to its
higher and higher forms, and becomes music simply in virtue of thus
intensifying them; that, from the ancient epic poet chanting his verses,
down to the modern musical composer, men of unusually strong feelings prone
to express them in extreme forms, have been naturally the agents of these
successive intensifications; and that so there has little by little arisen
a wide divergence between this idealized language of emotion and its
natural language: to which direct evidence we have just added the
indirect--that on no other tenable hypothesis can either the expressiveness
or the genesis of music be explained.
* * * * *
And now, what is the _function_ of music? Has music any effect beyond the
immediate pleasure it produces? Analogy suggests that it has. The
enjoyments of a good dinner do not end with themselves, but minister to
bodily well-being. Though people do not marry with a view to maintain the
race, yet the passions which impel them to marry secure its maintenance.
Parental affection is a feeling which, while it conduces to parental
happiness, ensures the nurture of offspring. Men love to accumulate
property, often without thought of the benefits it produces; but in
pursuing the pleasure of acquisition they indirectly open the way to other
pleasures. The wish for public approval impels all of us to do many things
which we should otherwise not do,--to undertake great labours, face great
dangers, and habitually rule ourselves in a way that smooths social
intercourse: that is, in gratifying our love of approbation we subserve
divers ulterior purposes. And, generally, our nature is such that in
fulfilling each desire, we in some way facilitate the fulfilment of the
rest. But the love of music seems to exist for its own sake. The delights
of melody and harmony do not obviously minister to the welfare either of
the individual or of society. May we not suspect, however, that this
exception is apparent only? Is it not a rational inquiry--What are the
indirect benefits which accrue from music, in addition to the direct
pleasure it gives?
But that it would take us too far out of our track, we should prelude this
inquiry by illustrating at some length a certain general law of
progress;--the law that alike in occupations, sciences, arts, the divisions
that had a common root, but by continual divergence have become distinct,
and are now being separately developed, are not truly independent, but
severally act and react on each other to their mutual advancement. Merely
hinting thus much, however, by way of showing that there are many analogies
to justify us, we go on to express the opinion that there exists a
relationship of this kind between music and speech.
All speech is compounded of two elements, the words and the tones in which
they are uttered--the signs of ideas and the signs of feelings. While
certain articulations express the thought, certain vocal sounds express the
more or less of pain or pleasure which the thought gives. Using the word
_cadence_ in an unusually extended sense, as comprehending all
modifications of voice, we may say that _cadence is the commentary of the
emotions upon the propositions of the intellect_. This duality of spoken
language, though not formally recognised, is recognised in practice by
every one; and every one knows that very often more weight attaches to the
tones than to the words. Daily experience supplies cases in which the same
sentence of disapproval will be understood as meaning little or meaning
much, according to the inflections of voice which accompany it; and daily
experience supplies still more striking cases in which words and tones are
in direct contradiction--the first expressing consent, while the last
express reluctance; and the last being believed rather than the first.
These two distinct but interwoven elements of speech have been undergoing a
simultaneous development. We know that in the course of civilization words
have been multiplied, new parts of speech have been introduced, sentences
have grown more varied and complex; and we may fairly infer that during the
same time new modifications of voice have come into use, fresh intervals
have been adopted, and cadences have become more elaborate. For while, on
the one hand, it is absurd to suppose that, along with the undeveloped
verbal forms of barbarism, there existed a developed system of vocal
inflections; it is, on the other hand, necessary to suppose that, along
with the higher and more numerous verbal forms needed to convey the
multiplied and complicated ideas of civilized life, there have grown up
those more involved changes of voice which express the feelings proper to
such ideas. If intellectual language is a growth, so also, without doubt,
is emotional language a growth.
Now, the hypothesis which we have hinted above, is, that beyond the direct
pleasure which it gives, music has the indirect effect of developing this
language of the emotions. Having its root, as we have endeavoured to show,
in those tones, intervals, and cadences of speech which express
feeling--arising by the combination and intensifying of these, and coming
finally to have an embodiment of its own; music has all along been reacting
upon speech, and increasing its power of rendering emotion. The use in
recitative and song of inflections more expressive than ordinary ones, must
from the beginning have tended to develope the ordinary ones. Familiarity
with the more varied combinations of tones that occur in vocal music, can
scarcely have failed to give greater variety of combination to the tones in
which we utter our impressions and desires. The complex musical phrases by
which composers have conveyed complex emotions, may rationally be supposed
to have influenced us in making those involved cadences of conversation by
which we convey our subtler thoughts and feelings.
That the cultivation of music has no effect on the mind, few will be absurd
enough to contend. And if it has an effect, what more natural effect is
there than this of developing our perception of the meanings of
inflections, qualities, and modulations of voice; and giving us a
correspondingly increased power of using them? Just as mathematics, taking
its start from the phenomena of physics and astronomy, and presently coming
to be a separate science, has since reacted on physics and astronomy to
their immense advancement--just as chemistry, first arising out of the
processes of metallurgy and the industrial arts, and gradually growing into
an independent study, has now become an aid to all kinds of
production--just as physiology, originating out of medicine and once
subordinate to it, but latterly pursued for its own sake, is in our day
coming to be the science on which the progress of medicine depends;--so,
music, having its root in emotional language, and gradually evolved from
it, has ever been reacting upon and further advancing it. Whoever will
examine the facts, will find this hypothesis to be in harmony with the
method of civilization everywhere displayed.
It will scarcely be expected that much direct evidence in support of this
conclusion can be given. The facts are of a kind which it is difficult to
measure, and of which we have no records. Some suggestive traits, however,
may be noted. May we not say, for instance, that the Italians, among whom
modern music was earliest cultivated, and who have more especially
practised and excelled in melody (the division of music with which our
argument is chiefly concerned)--may we not say that these Italians speak in
more varied and expressive inflections and cadences than any other nation?
On the other hand, may we not say that, confined almost exclusively as they
have hitherto been to their national airs, which have a marked family
likeness, and therefore accustomed to but a limited range of musical
expression, the Scotch are unusually monotonous in the intervals and
modulations of their speech? And again, do we not find among different
classes of the same nation, differences that have like implications? The
gentleman and the clown stand in very decided contrast with respect to
variety of intonation. Listen to the conversation of a servant-girl, and
then to that of a refined, accomplished lady, and the more delicate and
complex changes of voice used by the latter will be conspicuous. Now,
without going so far as to say that out of all the differences of culture
to which the upper and lower classes are subjected, difference of musical
culture is that to which alone this difference of speech is ascribable; yet
we may fairly say that there seems a much more obvious connexion of cause
and effect between these than between any others. Thus, while the inductive
evidence to which we can appeal is but scanty and vague, yet what there is
favours our position.
* * * * *
Probably most will think that the function here assigned to music is one of
very little moment. But further reflection may lead them to a contrary
conviction. In its bearings upon human happiness, we believe that this
emotional language which musical culture developes and refines, is only
second in importance to the language of the intellect; perhaps not even
second to it. For these modifications of voice produced by feelings, are
the means of exciting like feelings in others. Joined with gestures and
expressions of face, they give life to the otherwise dead words in which
the intellect utters its ideas; and so enable the hearer not only to
_understand_ the state of mind they accompany, but to _partake_ of that
state. In short, they are the chief media of _sympathy_. And if we consider
how much both our general welfare and our immediate pleasures depend upon
sympathy, we shall recognise the importance of whatever makes this sympathy
greater. If we bear in mind that by their fellow-feeling men are led to
behave justly, kindly and considerately to each other--that the difference
between the cruelty of the barbarous and the humanity of the civilized,
results from the increase of fellow-feeling; if we bear in mind that this
faculty which makes us sharers in the joys and sorrows of others, is the
basis of all the higher affections--that in friendship, love, and all
domestic pleasures, it is an essential element; if we bear in mind how much
our direct gratifications are intensified by sympathy,--how, at the
theatre, the concert, the picture gallery, we lose half our enjoyment if we
have no one to enjoy with us; if, in short, we bear in mind that for all
happiness beyond what the unfriended recluse can have, we are indebted to
this same sympathy;--we shall see that the agencies which communicate it
can scarcely be overrated in value.
The tendency of civilization is more and more to repress the antagonistic
elements of our characters and to develope the social ones--to curb our
purely selfish desires and exercise our unselfish ones--to replace private
gratifications by gratifications resulting from, or involving, the
happiness of others. And while, by this adaptation to the social state, the
sympathetic side of our nature is being unfolded, there is simultaneously
growing up a language of sympathetic intercourse--a language through which
we communicate to others the happiness we feel, and are made sharers in
their happiness.
This double process, of which the effects are already sufficiently
appreciable, must go on to an extent of which we can as yet have no
adequate conception. The habitual concealment of our feelings diminishing,
as it must, in proportion as our feelings become such as do not demand
concealment, we may conclude that the exhibition of them will become much
more vivid than we now dare allow it to be; and this implies a more
expressive emotional language. At the same time, feelings of a higher and
more complex kind, as yet experienced only by the cultivated few, will
become general; and there will be a corresponding development of the
emotional language into more involved forms. Just as there has silently
grown up a language of ideas, which, rude as it at first was, now enables
us to convey with precision the most subtle and complicated thoughts; so,
there is still silently growing up a language of feelings, which
notwithstanding its present imperfection, we may expect will ultimately
enable men vividly and completely to impress on each other all the emotions
which they experience from moment to moment.
Thus if, as we have endeavoured to show, it is the function of music to
facilitate the development of this emotional language, we may regard music
as an aid to the achievement of that higher happiness which it indistinctly
shadows forth. Those vague feelings of unexperienced felicity which music
arouses--those indefinite impressions of an unknown ideal life which it
calls up, may be considered as a prophecy, to the fulfilment of which music
is itself partly instrumental. The strange capacity which we have for being
so affected by melody and harmony, may be taken to imply both that it is
within the possibilities of our nature to realize those intenser delights
they dimly suggest, and that they are in some way concerned in the
realization of them. On this supposition the power and the meaning of music
become comprehensible; but otherwise they are a mystery.
We will only add, that if the probability of these corollaries be admitted,
then music must take rank as the highest of the fine arts--as the one
which, more than any other, ministers to human welfare. And thus, even
leaving out of view the immediate gratifications it is hourly giving, we
cannot too much applaud that progress of musical culture which is becoming
one of the characteristics of our age.
VI. THE NEBULAR HYPOTHESIS.
Inquiring into the pedigree of an idea is not a bad means of roughly
estimating its value. To have come of respectable ancestry, is _prima
facie_ evidence of worth in a belief as in a person; while to be descended
from a discreditable stock is, in the one case as in the other, an
unfavorable index. The analogy is not a mere fancy. Beliefs, together with
those who hold them, are modified little by little in successive
generations; and as the modifications which successive generations of the
holders undergo, do not destroy the original type, but only disguise and
refine it, so the accompanying alterations of belief, however much they
purify, leave behind the essence of the original belief.
Considered genealogically, the received theory respecting the creation of
the Solar System is unmistakeably of low origin. You may clearly trace it
back to primitive mythologies. Its remotest ancestor is the doctrine that
the celestial bodies are personages who originally lived on the Earth--a
doctrine still held by some of the <DW64>s Livingstone visited. Science
having divested the sun and planets of their divine personalities, this old
idea was succeeded by the idea which even Kepler entertained, that the
planets are guided in their courses by presiding spirits: no longer
themselves gods, they are still severally kept in their orbits by gods. And
when gravitation came to dispense with these celestial steersmen, there was
begotten a belief, less gross than its parent, but partaking of the same
essential nature, that the planets were originally launched into their
orbits from the Creator's hand. Evidently, though much refined, the
anthropomorphism of the current hypothesis is inherited from the aboriginal
anthropomorphism, which described gods as a stronger order of men.
There is an antagonist hypothesis which does not propose to honour the
Unknown Power manifested in the Universe, by such titles as "The
Master-Builder," or "The Great Artificer;" but which regards this Unknown
Power as probably working after a method quite different from that of human
mechanics. And the genealogy of this hypothesis is as high as that of the
other is low. It is begotten by that ever-enlarging and ever-strengthening
belief in the presence of Law, which accumulated experiences have gradually
produced in the human mind. From generation to generation Science has been
proving uniformities of relation among phenomena which were before thought
either fortuitous or supernatural in their origin--has been showing an
established order and a constant causation where ignorance had assumed
irregularity and arbitrariness. Each further discovery of Law has increased
the presumption that Law is everywhere conformed to. And hence, among other
beliefs, has arisen the belief that the Solar System originated, not by
_manufacture_ but by _evolution_. Besides its abstract parentage in those
grand general conceptions which positive Science has generated, this
hypothesis has a concrete parentage of the highest character. Based as it
is on the law of universal gravitation, it may claim for its remote
progenitor the great thinker who established that law. The man who gave it
its general shape, by promulgating the doctrine that stars result from the
aggregation of diffused matter, was the most diligent, careful, and
original astronomical observer of modern times. And the world has not seen
a more learned mathematician than the man who, setting out with this
conception of diffused matter concentrating towards its centre of gravity,
pointed out the way in which there would arise, in the course of its
concentration, a balanced group of sun, planets, and satellites, like that
of which the Earth is a member.
Thus, even were there but little direct evidence assignable for the Nebular
Hypothesis, the probability of its truth would still be strong. Its own
high derivation and the low derivation of the antagonist hypothesis, would
together form a weighty reason for accepting it--at any rate,
provisionally. But the direct evidence assignable for the Nebular
Hypothesis is by no means little. It is far greater in quantity, and more
varied in kind, than is commonly supposed. Much has been said here and
there on this or that class of evidences; but nowhere, as far as we know,
have all the evidences, even of one class, been fully stated; and still
less has there been an adequate statement of the several groups of
evidences in their _ensemble_. We propose here to do something towards
supplying the deficiency: believing that, joined with the _a priori_
reasons given above, the array of _a posteriori_ reasons will leave little
doubt in the mind of any candid inquirer.
And first, let us address ourselves to those recent discoveries in stellar
astronomy, which have been supposed to conflict with this celebrated
speculation.
* * * * *
When Sir William Herschel, directing his great reflector to various
nebulous spots, found them resolvable into clusters of stars, he inferred,
and for a time maintained, that all nebulous spots are clusters of stars
exceedingly remote from us. But after years of conscientious investigation,
he concluded that "there were nebulosities which are not of a starry
nature;" and on this conclusion was based his hypothesis of a diffused
luminous fluid, which by its eventual aggregation, produced stars. A
telescopic power much exceeding that used by Herschel, has enabled Lord
Rosse to resolve some of the nebulae previously unresolved; and, returning
to the conclusion which Herschel first formed on similar grounds but
afterwards rejected, many astronomers have assumed that, under sufficiently
high powers, every nebula would be decomposed into stars--that the
resolvability is solely a question of distance. The hypothesis now commonly
entertained is, that all nebulae are galaxies more or less like in nature to
that immediately surrounding us; but that they are so inconceivably remote,
as to look, through an ordinary telescope, like small faint spots. And not
a few have drawn the corollary, that by the discoveries of Lord Rosse the
Nebular Hypothesis has been disproved.
Now, even supposing that these inferences respecting the distances and
natures of the nebulae are valid, they leave the Nebular Hypothesis
substantially as it was. Admitting that each of those faint spots is a
sidereal system, so far removed that its countless stars give less light
than one small star of our own sidereal system; the admission is in no way
inconsistent with the belief, that stars and their attendant planets have
been formed by the aggregation of nebulous matter. Though, doubtless, if
the existence of nebulous matter now in course of concentration be
disproved, one of the evidences of the Nebular Hypothesis is destroyed; yet
the remaining evidences remain just as they were. It is a perfectly tenable
position, that though nebular condensation is now nowhere to be seen in
progress, yet it was once going on universally. And, indeed, it might be
argued that the still-continued existence of diffused nebulous matter is
scarcely to be expected; seeing that the causes which have resulted in the
aggregation of one mass, must have been acting on all masses, and that
hence the existence of masses not aggregated would be a fact calling for
explanation. Thus, granting the immediate conclusions suggested by these
recent disclosures of the six-feet reflector, the corollary which many have
drawn is inadmissible.
But we do not grant these conclusions. Receiving them though we have, for
years past, as established truths, a critical examination of the facts has
convinced us that they are quite unwarrantable. They involve so many
manifest incongruities, that we have been astonished to find men of science
entertaining them even as probable hypotheses. Let us consider these
incongruities.
In the first place, mark what is inferable from the distribution of nebulae.
"The spaces which precede or which follow simple nebulae," says
Arago, "and, _a fortiori_, groups of nebulae, contain generally few
stars. Herschel found this rule to be invariable. Thus, every time
that, during a short interval, no star approached, in virtue of the
diurnal motion, to place itself in the field of his motionless
telescope, he was accustomed to say to the secretary who assisted
him, 'Prepare to write; nebulae are about to arrive.'"
How does this fact consist with the hypothesis that nebulae are remote
galaxies? If there were but one nebula, it would be a curious coincidence
were this one nebula so placed in the distant regions of space, as to agree
in direction with a starless spot in our own sidereal system. If there were
but two nebulae, and both were so placed, the coincidence would be
excessively strange. What, then, shall we say on finding that there are
thousands of nebulae so placed? Shall we believe that in thousands of cases
these far-removed galaxies happen to agree in their visible positions with
the thin places in our own galaxy? Such a belief is next to impossible.
Still more manifest does the impossibility of it become when we consider
the general distribution of nebulae. Besides again showing itself in the
fact that "the poorest regions in stars are near the richest in nebulae,"
the law above specified applies to the heavens as a whole. In that zone of
celestial space where stars are excessively abundant, nebulae are rare;
while in the two opposite celestial spaces that are furthest removed from
this zone, nebulae are abundant. Scarcely any nebulae lie near the galactic
circle (or plane of the Milky Way); and the great mass of them lie round
the galactic poles. Can this also be mere coincidence? When to the fact
that the general mass of nebulae are antithetical in position to the general
mass of stars, we add the fact that local regions of nebulae are regions
where stars are scarce, and the further fact that single nebulae are
habitually found in comparatively starless spots; does not the proof of a
physical connexion become overwhelming? Should it not require an infinity
of evidence to show that nebulae are not parts of our sidereal system? Let
us see whether any such infinity of evidence is assignable. Let us see
whether there is even a single alleged proof which will bear examination.
"As seen through colossal telescopes," says Humboldt, "the
contemplation of these nebulous masses leads us into regions from
whence a ray of light, according to an assumption not wholly
improbable, requires millions of years to reach our earth--to
distances for whose measurement the dimensions (the distance of
Sirius, or the calculated distances of the binary stars in Cygnus and
the Centaur) of our nearest stratum of fixed stars scarcely suffice."
Now, in this somewhat confused sentence there is expressed a more or less
decided belief, that the distances of the nebulae from our galaxy of stars
as much transcend the distances of our stars from each other, as these
interstellar distances transcend the dimensions of our planetary system.
Just as the diameter of the Earth's orbit, is an inappreciable point when
compared with the distance of our Sun from Sirius; so is the distance of
our Sun from Sirius, an inappreciable point when compared with the distance
of our galaxy from those far removed galaxies constituting nebulae. Observe
the consequences of this assumption.
If one of these supposed galaxies is so remote that its distance dwarfs our
interstellar spaces into points, and therefore makes the dimensions of our
whole sidereal system relatively insignificant; does it not inevitably
follow that the telescopic power required to resolve this remote galaxy
into stars, must be incomparably greater than the telescopic power required
to resolve the whole of our own galaxy into stars? Is it not certain that
an instrument which can just exhibit with clearness the most distant stars
of our own cluster, must be utterly unable to separate one of these remote
clusters into stars? What, then, are we to think when we find that the same
instrument which decomposes hosts of nebulae into stars, _fails_ to resolve
completely our own Milky Way? Take a homely comparison. Suppose a man
surrounded by a swarm of bees, extending, as they sometimes do, so high in
the air as to be individually almost invisible, were to declare that a
certain spot on the horizon was a swarm of bees; and that he knew it
because he could see the bees as separate specks. Astounding as the
assertion would be, it would not exceed in incredibility this which we are
criticising. Reduce the dimensions to figures, and the absurdity becomes
still more palpable. In round numbers, the distance of Sirius from the
Earth is a million times the distance of the Earth from the Sun; and,
according to the hypothesis, the distance of a nebula is something like a
million times the distance of Sirius.
Now, our own "starry island, or nebula," as Humboldt calls it, "forms a
lens-shaped, flattened, and everywhere detached stratum, whose major axis
is estimated at seven or eight hundred, and its minor axis at a hundred and
fifty times the distance of Sirius from the Earth."[I] And since it is
concluded that our Solar System is near the centre of this aggregation, it
follows that our distance from the remotest parts of it is about four
hundred distances of Sirius. But the stars forming these remotest parts are
not individually visible, even through telescopes of the highest power.
How, then, can such telescopes make individually visible the stars of a
nebula which is a million times the distance of Sirius? The implication is,
that a star rendered invisible by distance becomes visible if taken two
thousand five hundred times further off! Shall we accept this implication?
or shall we not rather conclude that the nebulae are _not_ remote galaxies?
Shall we not infer that, be their nature what it may, they must be at least
as near to us as the extremities of our own sidereal system?
[I] Cosmos. (Seventh Edition.) Vol. i. pp. 79, 80.
Throughout the above argument, it is tacitly assumed that differences of
apparent magnitude among the stars, result mainly from differences of
distance. On this assumption the current doctrines respecting the nebulae
are founded; and this assumption is, for the nonce, admitted in each of the
foregoing criticisms. From the time, however, when it was first made by Sir
W. Herschel, this assumption has been purely gratuitous; and it now proves
to be totally inadmissible. But, awkwardly enough, its truth and its
untruth are alike fatal to the conclusions of those who argue after the
manner of Humboldt. Note the alternative.
On the one hand, what follows from the untruth of the assumption? If
apparent largeness of stars is not due to comparative nearness, and their
successively smaller sizes to their greater and greater degrees of
remoteness, what becomes of the inferences respecting the dimensions of our
sidereal system and the distances of nebulae? If, as has lately been shown,
the almost invisible star 61 Cygni has a greater parallax than [alpha]
Cygni, though, according to an estimate based on Sir W. Herschel's
assumption, it should be about twelve times more distant--if, as it turns
out, there exist telescopic stars which are nearer to us than Sirius; of
what worth is the conclusion that the nebulae are very remote, because their
component luminous masses are made visible only by high telescopic powers?
Clearly, if the most brilliant star in the heavens and a star that cannot
be seen by the naked eye, prove to be equidistant, relative distances
cannot be in the least inferred from relative visibilities. And if so,
nebulae may be comparatively near, though the starlets of which they are
made up appear extremely minute.
On the other hand, what follows if the truth of the assumption be granted?
The arguments used to justify this assumption in the case of the stars,
equally justify it in the case of the nebulae. It cannot be contended that,
on the average, the _apparent_ sizes of the stars indicate their distances,
without its being admitted that, on the average, the _apparent_ sizes of
the nebulae indicate their distances--that, generally speaking, the larger
are the nearer, and the smaller are the more distant. Mark, now, the
necessary inference respecting their resolvability. The largest or nearest
nebulae will be most easily resolved into stars; the successively smaller
will be successively more difficult of resolution; and the irresolvable
ones will be the smallest ones. This, however, is exactly the reverse of
the fact. The largest nebulae are either wholly irresolvable, or but
partially resolvable under the highest telescopic powers; while a great
proportion of quite small nebulae, are easily resolved by far less powerful
telescopes. An instrument through which the great nebula in Andromeda, two
and a half degrees long and one degree broad, appears merely as a diffused
light, decomposes a nebula of fifteen minutes diameter into twenty thousand
starry points. At the same time that the individual stars of a nebula eight
minutes in diameter are so clearly seen as to allow of their number being
estimated, a nebula covering an area five hundred times as great shows no
stars at all. What possible explanation can be given of this on the current
hypothesis?
Yet a further difficulty remains--one which is, perhaps, still more
obviously fatal than the foregoing. This difficulty is presented by the
phenomena of the Magellanic clouds. Describing the larger of these, Sir
John Herschel says:--
"The nubecula major, like the minor, consists partly of large
tracts and ill-defined patches of irresolvable nebula, and of
nebulosity in every stage of resolution, up to perfectly resolved
stars like the Milky Way; as also of regular and irregular nebulae
properly so called, of globular clusters in every stage of
resolvability, and of clustering groups sufficiently insulated and
condensed to come under the designation of 'cluster of
stars.'"--"Cape Observations," p. 146.
In his "Outlines of Astronomy," Sir John Herschel, after repeating this
description in other words, goes on to remark that--
"This combination of characters, rightly considered, is in a high
degree instructive, affording an insight into the probable
comparative distance of _stars_ and _nebulae_, and the real brightness
of individual stars as compared with one another. Taking the apparent
semi-diameter of the nubecula major at three degrees, and regarding
its solid form as, roughly speaking, spherical, its nearest and most
remote parts differ in their distance from us by a little more than a
tenth part of our distance from its centre. The brightness of objects
situated in its nearer portions, therefore, cannot be _much_
exaggerated, nor that of its remoter _much_ enfeebled, by their
difference of distance. Yet within this globular space we have
collected upwards of six hundred stars of the seventh, eighth, ninth,
and tenth magnitude, nearly three hundred nebulae, and globular and
other clusters _of all degrees of resolvability_, and smaller
scattered stars of every inferior magnitude, from the tenth to such
as by their magnitude and minuteness constitute irresolvable
nebulosity, extending over tracts of many square degrees. Were there
but one such object, it might be maintained without utter
improbability that its apparent sphericity is only an effect of
foreshortening, and that in reality a much greater proportional
difference of distance between its nearer and more remote parts
exists. But such an adjustment, improbable enough in one case, must
be rejected as too much so for fair argument in two. It must,
therefore, be taken as a demonstrated fact, that stars of the seventh
or eighth magnitude, and irresolvable nebula, may co-exist within
limits of distance not differing in proportion more than as nine to
ten."--"Outlines of Astronomy," pp. 614, 615.
Now, we think this supplies a _reductio ad absurdum_ of the doctrine we are
combating. It gives us the choice of two incredibilities. If we are to
believe that one of these nebulae is so remote that its hundred thousand
stars look like a milky spot, invisible to the naked eye; we must also
believe that there are single stars so enormous that though removed to this
same distance they remain visible. If we accept the other alternative, and
say that many nebulae are no further off than our own stars of the eighth
magnitude; then it is requisite to say that at a distance not greater than
that at which a single star is still faintly visible to the naked eye,
there may exist a group of a hundred thousand stars which is invisible to
the naked eye. Neither of these positions can be entertained. What, then,
is the conclusion that remains? This, only:--that the nebulae are not
further off from us than parts of our own sidereal system, of which they
must be considered members; and that when they are resolvable into discrete
masses, these masses cannot be considered as stars in anything like the
ordinary sense of that word.
And now, having seen the untenability of this idea, rashly espoused by
sundry astronomers, that the nebulae are extremely remote galaxies; let us
consider whether the various appearances they present are not reconcileable
with the Nebular Hypothesis.
Given a rare and widely-diffused mass of nebulous matter, having a
diameter, say as great as the distance from the Sun to Sirius,[J] what are
the successive changes that will take place in it? Mutual gravitation will
approximate its atoms; but their approximation will be opposed by atomic
repulsion, the overcoming of which implies the evolution of heat. As fast
as this heat partially escapes by radiation, further approximation will
take place, attended by further evolution of heat, and so on continuously:
the processes not occurring separately as here described, but
simultaneously, uninterruptedly, and with increasing activity. Eventually,
this slow movement of the atoms towards their common centre of gravity,
will bring about phenomena of another order.
[J] Any objection made to the extreme tenuity this involves, is met
by the calculation of Newton, who proved that were a spherical
inch of air removed four thousand miles from the Earth, it would
expand into a sphere more than filling the orbit of Saturn.
Arguing from the known laws of atomic combination, it will happen that when
the nebulous mass has reached a particular stage of condensation--when its
internally-situated atoms have approached to within certain distances, have
generated a certain amount of heat, and are subject to a certain mutual
pressure (the heat and pressure both increasing as the aggregation
progresses); some of them will suddenly enter into chemical union. Whether
the binary atoms so produced be of kinds such as we know, which is
possible; or whether they be of kinds simpler than any we know, which is
more probable; matters not to the argument. It suffices that molecular
combination of some species will finally take place. When it does take
place, it will be accompanied by a great and sudden disengagement of heat;
and until this excess of heat has escaped, the newly-formed binary atoms
will remain uniformly diffused, or, as it were, dissolved in the
pre-existing nebulous medium.
But now mark what must by-and-by happen. When radiation has adequately
lowered the temperature, these binary atoms will precipitate; and having
precipitated, they will not remain uniformly diffused, but will aggregate
into _flocculi_: just as water, when precipitated from air, collects into
clouds. This _a priori_ conclusion is confirmed by the observation of those
still extant portions of nebulous matter which constitute comets; for,
"that the luminous part of a comet is something in the nature of a smoke,
fog, or cloud, suspended in a transparent atmosphere, is evident," says Sir
John Herschel.
Concluding, then, that a nebulous mass will, in course of time, resolve
itself into flocculi of precipitated denser matter, floating in the rarer
medium from which they were precipitated, let us inquire what will be the
mechanical results. We shall find that they will be quite different from
those occurring in the original homogeneous mass; and also quite different
from those which would occur among discrete masses dispersed through empty
space. Bodies dispersed through empty space, would move in straight lines
towards their common centre of gravity. So, too, would bodies dispersed
through a resisting medium, provided they were spherical, or of forms
presenting symmetrical faces to their lines of movement. But _irregular_
bodies dispersed through a resisting medium, will _not_ move in straight
lines towards their common centre of gravity. A mass which presents an
irregular face to its line of movement through a resisting medium, must
necessarily be deflected from its original course, by the unequal reactions
of the medium on its different sides. Hence each _flocculus_, as by analogy
we term one of these precipitated masses of gas or vapour, will acquire a
movement, not towards the common centre of gravity, but towards one or
other side of it; and this oblique movement, accelerated as well as changed
in direction by the increasing centripetal force, but retarded by the
resisting medium, will result in a spiral, ending in the common centre of
gravity. Observe, however, that this conclusion, valid as far as it goes,
by no means proves a common spiral movement of all the flocculi; for as
they must not only be varied in their forms, but disposed in all varieties
of position, their respective movements will be deflected, not towards one
side of the common centre of gravity, but towards various sides. How then
can there result a spiral movement common to them all? Very simply. Each
flocculus, in describing its spiral course, must give motion to the rarer
medium through which it is moving.
Now, the probabilities are infinity to one against all the respective
motions thus impressed on this rarer medium, exactly balancing each other.
And if they do not balance each other, the inevitable result must be a
rotation of the whole mass of the rarer medium in one direction. But
preponderating momentum in one direction, having caused rotation of the
medium in that direction, the rotating medium must in its turn gradually
arrest such flocculi as are moving in opposition, and impress its own
motion upon them; and thus there will ultimately be formed a rotating
medium with suspended flocculi partaking of its motion, while they move in
converging spirals towards the common centre of gravity.
Before comparing these conclusions with the facts, let us pursue the
reasoning a little further, and observe the subordinate actions, and the
endless modifications which will result from them. The respective flocculi
must not only be drawn towards their common centre of gravity, but also
towards neighbouring flocculi. Hence the whole assemblage of flocculi will
break up into subordinate groups: each group concentrating towards its
local centre of gravity, and in so doing acquiring a vortical movement,
like that subsequently acquired by the whole nebula. Now, according to
circumstances, and chiefly according to the size of the original nebulous
mass, this process of local aggregation will produce various results. If
the whole nebula is but small, the local groups of flocculi may be drawn
into the common centre of gravity before their constituent masses have
coalesced with each other. In a larger nebula, these local aggregations may
have concentrated into rotating spheroids of vapour, while yet they have
made but little approach towards the general focus of the system. In a
still larger nebula, where the local aggregations are both greater and more
remote from the common centre of gravity, they may have condensed into
masses of molten matter before the general distribution of them has greatly
altered. In short, as the conditions in each case determine, the discrete
masses produced may vary indefinitely in number, in size, in density, in
motion, in distribution.
And now let us return to the visible characters of the nebulae, as observed
through modern telescopes. Take first the description of those nebulae
which, by the hypothesis, must be in an early stage of evolution.
"Among the _irregular nebulae_," says Sir John Herschel, "may be
comprehended all which, to _a want of complete, and in most
instances, even of partial resolvability_ by the power of the 20-feet
reflector, unite such a deviation from the circular or elliptic form,
or such a want of symmetry (with that form) as preclude their being
placed in Class 1, or that of regular nebulae. This second class
comprises many of the most remarkable and interesting objects in the
heavens, _as well as the most extensive in respect of the area they
occupy_."
And, referring to this same order of objects, M. Arago says:--"The forms of
very large diffuse nebulae do not appear to admit of definition; they have
no regular outline."
Now this coexistence of largeness, irresolvability, irregularity, and
indefiniteness of outline, is extremely significant. The fact that the
largest nebulae are either irresolvable or very difficult to resolve, might
have been inferred _a priori_; seeing that irresolvability, implying that
the aggregation of precipitated matter has gone on to but a small extent,
will be found in nebulae of wide diffusion. Again, the irregularity of these
large, irresolvable nebulae, might also have been expected; seeing that
their outlines, compared by Arago to "the fantastic figures which
characterize clouds carried away and tossed about by violent and often
contrary winds," are similarly characteristic of a mass not yet gathered
together by the mutual attraction of its parts. And once more, the fact
that these large, irregular, irresolvable nebulae have indefinite
outlines--outlines that fade off insensibly into surrounding darkness--is
one of like meaning.
Speaking generally (and of course differences of distance negative anything
beyond an average statement), the spiral nebulae are smaller than the
irregular nebulae, and more resolvable; at the same time that they are not
so small as the regular nebulae, and not so resolvable. This is as,
according to the hypothesis, it should be. The degree of condensation
causing spiral movement, is a degree of condensation also implying masses
of flocculi that are larger, and therefore more visible, than those
existing in an earlier stage. Moreover, the forms of these spiral nebulae
are quite in harmony with the explanation given. The curves of luminous
matter which they exhibit, are _not_ such as would be described by more or
less discrete masses starting from a state of rest, and moving through a
resisting medium to a common centre of gravity; but they _are_ such as
would be described by masses having their movements modified by the
rotation of the medium.
In the centre of a spiral nebula is seen a mass both more luminous and more
resolvable than the rest. Assume that, in process of time, all the spiral
streaks of luminous matter which converge to this centre are drawn into it,
as they must be; assume further, that the flocculi or other discrete bodies
constituting these luminous streaks aggregate into larger masses at the
same time that they approach the central group, and that the masses forming
this central group also aggregate into larger masses (both which are
necessary assumptions); and there will finally result a more or less
globular group of such larger masses, which will be resolvable with
comparative ease. And, as the coalescence and concentration go on, the
constituent masses will gradually become fewer, larger, brighter, and more
densely collected around the common centre of gravity. See now how
completely this inference agrees with observation. "The circular form is
that which most commonly characterizes resolvable nebulae," writes Arago.
"Resolvable nebulae," says Sir John Herschel, "are almost universally round
or oval." Moreover, the centre of each group habitually displays a closer
clustering of the constituent masses than elsewhere; and it is shown that,
under the law of gravitation, which we know extends to the stars, this
distribution is _not_ one of equilibrium, but implies progressing
concentration. While, just as we inferred that, according to circumstances,
the extent to which aggregation has been carried must vary; so we find
that, in fact, there are regular nebulae of all degrees of resolvability,
from those consisting of innumerable minute discrete masses, to those in
which there are a few large bodies worthy to be called stars.
On the one hand, then, we see that the notion, of late years uncritically
received, that the nebulae are extremely remote galaxies of stars like those
which make up our own Milky Way, is totally irreconcileable with the
facts--involves us in sundry absurdities. On the other hand, we see that
the hypothesis of nebular condensation harmonizes with the most recent
results of stellar astronomy: nay more--that it supplies us with an
explanation of various appearances which in its absence would be
incomprehensible.
* * * * *
Descending now to the Solar System, let us consider first a class of
phenomena in some sort transitional--those offered by comets. In comets we
have now existing a kind of matter like that out of which, according to the
Nebular Hypothesis, the Solar System was evolved. For the explanation of
them, we must hence go back to the time when the substances forming the sun
and planets were yet unconcentrated.
When diffused matter, precipitated from a rarer medium, is aggregating,
there are certain to be here and there produced small flocculi, which,
either in consequence of local currents or the conflicting attractions of
adjacent masses, remain detached; as do, for instance, minute shreds of
cloud in a summer sky. In a concentrating nebula these will, in the great
majority of cases, eventually coalesce with the larger flocculi near to
them. But it is tolerably evident that some of the remotest of these small
flocculi, formed at the outermost parts of the nebula, will _not_ coalesce
with the larger internal masses, but will slowly follow without overtaking
them. The relatively greater resistance of the medium necessitates this. As
a single feather falling to the ground will be rapidly left behind by a
pillow-full of feathers; so, in their progress to the common centre of
gravity, will the outermost shreds of vapour be left behind by the great
masses of vapour internally situated. But we are not dependent merely on
reasoning for this belief. Observation shows us that the less concentrated
external parts of nebulae, _are_ left behind by the more concentrated,
internal parts. Examined through high powers, all nebulae, even when they
have assumed regular forms, are seen to be surrounded by luminous streaks,
of which the directions show that they are being drawn into the general
mass. Still higher powers bring into view still smaller, fainter, and more
widely-dispersed streaks. And it cannot be doubted that the minute
fragments which no telescopic aid makes visible, are yet more numerous and
widely dispersed. Thus far, then, inference and observation are at one.
Granting that the great majority of these outlying portions of nebulous
matter will be drawn into the central mass long before it reaches a
definite form, the presumption is that some of the very small, far-removed
portions will not be so; but that before they arrive near it, the central
mass will have contracted into a comparatively moderate bulk. What now will
be the characters of these late-arriving portions?
In the first place, they will have extremely eccentric orbits. Left behind
at a time when they were moving towards the centre of gravity in
slightly-deflected lines, and therefore having but very small angular
velocities, they will approach the central mass in greatly elongated
ellipses; and rushing round it will go off again into space. That is, they
will behave just as we see comets do; whose orbits are usually so eccentric
as to be indistinguishable from parabolas.
In the second place, they will come from all parts of the heavens. Our
supposition implies that they were left behind at a time when the nebulous
mass was of irregular shape, and had not acquired a definite rotary motion;
and as the separation of them would not be from any one surface of the
nebulous mass more than another, the conclusion must be that they will come
to the central body from various directions in space. This, too, is exactly
what happens. Unlike planets, whose orbits approximate to one plane, comets
have orbits that show no relation to each other; but cut the plane of the
ecliptic at all angles.
In the third place, applying the reasoning already used, these remotest
flocculi of nebulous matter will, at the outset, be deflected from their
straight courses to the common centre of gravity, not all on one side, but
each on such side as its form determines. And being left behind before the
rotation of the nebula is set up, they will severally retain their
different individual motions. Hence, following the concentrating mass, they
will eventually go round it on all sides; and as often from right to left
as from left to right. Here again the inference perfectly corresponds with
the facts. While all the planets go round the sun from west to east, comets
as often go round the sun from east to west as from west to east. Out of
210 comets known in 1855, 104 are direct, and 106 are retrograde. This
equality is what the law of probabilities would indicate.
Then, in the fourth place, the physical constitution of comets completely
accords with the hypothesis. The ability of nebulous matter to concentrate
into a concrete form, depends on its mass. To bring its ultimate atoms into
that proximity requisite for chemical union--requisite, that is, for the
production of denser matter--their repulsion must be overcome. The only
force antagonistic to their repulsion, is their mutual gravitation. That
their mutual gravitation may generate a pressure and temperature of
sufficient intensity, there must be an enormous accumulation of them; and
even then the approximation can slowly go on only as fast as the evolved
heat escapes. But where the quantity of atoms is small, and therefore the
force of mutual gravitation small, there will be nothing to coerce the
atoms into union. Whence we infer that these detached fragments of nebulous
matter will continue in their original state. We find that they do so.
Comets consist of an extremely rare medium, which, as shown by the
description already quoted from Sir John Herschel, has characters like
those we concluded would belong to partially-condensed nebulous matter.
Yet another very significant fact is seen in the distribution of comets.
Though they come from all parts of the heavens, they by no means come in
equal abundance from all parts of the heavens; but are far more numerous
about the poles of the ecliptic than about its plane. Speaking generally,
comets having orbit-planes that are highly inclined to the ecliptic, are
comets having orbits of which the major axes are highly inclined to the
ecliptic--comets that come from high latitudes. This is not a necessary
connexion; for the planes of the orbits _might_ be highly inclined to the
ecliptic while the major axes were inclined to it very little. But in the
absence of any habitually-observed relation of this kind, it may safely be
concluded that, _on the average_, highly-inclined cometary orbits are
cometary orbits with highly-inclined major axes; and that thus, a
predominance of cometary orbits cutting the plane of the ecliptic at great
angles, implies a predominance of cometary orbits having major axes that
cut the ecliptic at great angles. Now the predominance of highly inclined
cometary orbits, may be gathered from the following table, compiled by M.
Arago, to which we have added a column giving the results up to a date two
years later.
-------------------------------------------------------------------------
| Inclinations. |Number of Comets |Number of Comets |Number of Comets |
| |in 1831. |in 1853. |in 1855. |
-------------------------------------------------------------------------
| Deg. to Deg. | | | |
| From 0 to 10 | 9 | 19 | 19 |
| " 10 " 20 | 13 | 18 | 19 |
| " 20 " 30 | 10 | 13 | 14 |
| " 30 " 40 | 17 | 22 | 22 |
| " 40 " 50 | 14 | 35 | 36 |
| " 50 " 60 | 23 | 27 | 29 |
| " 60 " 70 | 17 | 23 | 25 |
| " 70 " 80 | 19 | 26 | 27 |
| " 80 " 90 | 15 | 18 | 19 |
-------------------------------------------------------------------------
| Total | 137 | 201 | 210 |
-------------------------------------------------------------------------
At first sight this table seems not to warrant our statement. Assuming the
alleged general relation between the inclinations of cometary orbits, and
the directions in space from which the comets come, the table may be
thought to show that the frequency of comets increases as we progress from
the plane of the ecliptic up to 45 deg., and then decreases up to 90 deg. But this
apparent diminution arises from the fact that the successive zones of space
rapidly diminish in their areas on approaching the poles. If we allow for
this, we shall find that the excess of comets continues to increase up to
the highest angles of inclination. In the table below, which, for
convenience, is arranged in inverted order, we have taken as standards of
comparison the area of the zone round the pole, and the number of comets it
contains; and having ascertained the areas of the other zones, and the
numbers of comets they should contain were comets equally distributed, we
have shown how great becomes the deficiency in descending from the poles of
the ecliptic to its plane.
-------------------------------------------------------------------------
| | | Number of | Actual | | Relative |
| Between | Area of | Comets, if | Number of |Deficiency.|Abundance. |
| | Zone. | equally | Comets. | | |
| | |distributed.| | | |
-------------------------------------------------------------------------
| Deg. Deg. | | | | | |
| 90 and 80 | 1 | 19 | 19| 0 | 11.5 |
| 80 " 70 | 2.98| 56.6| 27| 29.6| 5.5 |
| 70 " 60 | 4.85| 92 | 25| 67 | 3.12|
| 60 " 50 | 6.6 | 125 | 29| 96 | 2.66|
| 50 " 40 | 8.13| 154 | 36| 118 | 2.68|
| 40 " 30 | 9.42| 179 | 22| 157 | 1.4 |
| 30 " 20 | 10.42| 198 | 14| 184 | 0.8 |
| 20 " 10 | 11.1 | 210 | 19| 191 | 1.04|
| 10 " 0 | 11.5 | 218 | 19| 199 | 1 |
-------------------------------------------------------------------------
In strictness, the calculation should be made with reference, not to the
plane of the ecliptic, but to the plane of the sun's equator; and this
might or might not render the progression more regular. Probably, too, the
progression would be made somewhat different were the calculation based, as
it should be, not on the inclinations of orbit-planes, but on the
inclinations of major axes. But even as it is, the result is sufficiently
significant: since, though the conclusion that comets are 11.5 times more
abundant about the poles of the ecliptic than about its plane, can be but a
rough approximation to the truth, yet no correction of it is likely very
much to change this strong contrast.
What, then, is the meaning of this fact? It has several meanings. It
negatives the supposition, favoured by Laplace among others, that comets
are bodies that were wandering in space, or have come from other systems;
for the probabilities are infinity to one against the orbits of such
wandering bodies showing any definite relation to the plane of the Solar
System. For the like reason, it negatives the hypothesis of Lagrange,
otherwise objectionable, that comets have resulted from planetary
catastrophes analogous to that which is supposed to have produced the
asteroids. It clearly shows that, instead of comets being _accidental_
members of the Solar System, they are _necessary_ members of it--have as
distinct a structural relation to it as the planets themselves. That comets
are abundant round the axis of the Solar System, and grow rarer as we
approach its plane, implies that the genesis of comets has followed some
_law_--a law in some way concerned with the genesis of the Solar System.
If we ask for any so-called final cause of this arrangement, none can be
assigned: until a probable use for comets has been shown, no reason can be
given why they should be thus distributed. But when we consider the
question as one of physical science, we see that comets are antithetical to
planets, not only in their great rarity, in their motions as indifferently
direct or retrograde, in their eccentric orbits, and in the varied
directions of those orbits; but we see the antithesis further marked in
this, that while planets have some relation to the plane of nebular
rotation, comets have some relation to the axis of nebular rotation.[K] And
without attempting to explain the nature of this relation, the mere fact
that such a relation exists, indicates that comets have resulted from a
process of evolution--points to a past time when the matter now forming the
Solar System extended to those distant regions of space which comets visit.
[K] It is alike remarkable and suggestive, that a parallel relation
exists between the distribution of nebulae and the axis of our
galaxy. Just as comets are abundant around the poles of our Solar
System, and rare in the neighbourhood of its plane: so are nebulae
abundant around the poles of our sidereal system, and rare in the
neighbourhood of its plane.
See, then, how differently this class of phenomena bears on the
antagonistic hypotheses. To the hypothesis commonly received, comets are
stumbling-blocks: why there should be hundreds (or probably thousands) of
extremely rare aeriform masses rushing to and fro round the sun, it cannot
say; any more than it can explain their physical constitutions, their
various and eccentric movements, or their distribution. The hypothesis of
evolution, on the other hand, not only allows of the general answer, that
they are minor results of the genetic process; but also furnishes us with
something like explanations of their several peculiarities.
* * * * *
And now, leaving these erratic bodies, let us turn to the more familiar and
important members of the Solar System. It was the remarkable harmony
subsisting among their movements, which first made Laplace conceive that
the sun, planets, and satellites had resulted from a common genetic
process. As Sir William Herschel, by his observations on the nebulae, was
led to the conclusion that stars resulted from the aggregation of diffused
matter; so Laplace, by his observations on the structure of the Solar
System, was led to the conclusion that only by the rotation of aggregating
matter were its peculiarities to be explained. In his "Exposition du
Systeme du Monde," he enumerates as the leading evidences of evolution:--1.
The movements of the planets in the same direction and almost in the same
plane; 2. The movements of the satellites in the same direction as those of
the planets; 3. The movement of rotation of these various bodies and of the
sun in the same direction as the orbitual motions, and in planes little
different; 4. The small eccentricity of the orbits of the planets and
satellites, as contrasted with the great eccentricity of the cometary
orbits. And the probability that these harmonious movements had a common
cause, he calculates as two hundred thousand billions to one.
Observe that this immense preponderance of probability does not point to a
common cause under the form ordinarily conceived--an Invisible Power
working after the method of "a Great Artificer;" but to an Invisible Power
working after the method of evolution. For though the supporters of the
common hypothesis may argue that it was necessary for the sake of stability
that the planets should go round the sun in the same direction and nearly
in one plane, they cannot thus account for the direction of the axial
motions. The mechanical equilibrium would not have been at all interfered
with, had the sun been without any rotatory movement; or had he revolved on
his axis in a direction opposite to that in which the planets go round him;
or in a direction at right angles to the plane of their orbits. With equal
safety the motion of the Moon round the Earth might have been the reverse
of the Earth's motion round its axis; or the motion of Jupiter's satellites
might similarly have been at variance with his axial motion; or that of
Saturn's satellites with his. As, however, none of these alternatives have
been followed, the uniformity must be considered, in this case as in all
others, evidence of subordination to some general law--implies what we call
natural causation, as distinguished from arbitrary arrangement.
Hence the hypothesis of evolution would be the only probable one, even in
the absence of any clue to the particular mode of evolution. But when we
have, propounded by a mathematician whose authority is second to none, a
definite theory of this evolution based on established mechanical laws,
which accounts for these various peculiarities, as well as for many minor
ones, the conclusion that the Solar System _was_ evolved becomes almost
irresistible.
The general nature of Laplace's theory scarcely needs stating. Books of
popular astronomy have familiarized most readers with his
conceptions;--namely, that the matter now condensed into the Solar System,
once formed a vast rotating spheroid of extreme rarity extending beyond the
orbit of Neptune; that as this spheroid contracted, its rate of rotation
necessarily increased; that by augmenting centrifugal force its equatorial
zone was from time to time prevented from following any further the
concentrating mass, and so remained behind as a revolving ring; that each
of the revolving rings thus periodically detached, eventually became
ruptured at its weakest point, and contracting on itself, gradually
aggregated into a rotating mass; that this, like the parent mass, increased
in rapidity of rotation as it decreased in size, and, where the centrifugal
force was sufficient, similarly threw off rings, which finally collapsed
into rotating spheroids; and that thus out of these primary and secondary
rings there arose planets and their satellites, while from the central mass
there resulted the sun. Moreover, it is tolerably well known that this _a
priori_ reasoning harmonizes with the results of experiment. Dr. Plateau
has shown that when a mass of fluid is, as far may be, protected from the
action of external forces, it will, if made to rotate with adequate
velocity, form detached rings; and that these rings will break up into
spheroids which turn on their axes in the same direction with the central
mass. Thus, given the original nebula, which, acquiring a vortical motion
in the way we have explained, has at length concentrated into a vast
spheroid of aeriform matter moving round its axis--given this, and
mechanical principles explain the rest. The genesis of a solar system
displaying movements like those observed, may be predicted; and the
reasoning on which the prediction is based is countenanced by
experiment.[L]
[L] It is true that, as expressed by him, these propositions of
Laplace are not all beyond dispute. An astronomer of the highest
authority, who has favoured me with some criticisms on this
essay, alleges that instead of a nebulous ring rupturing at one
point, and collapsing into a single mass, "all probability would
be in favour of its breaking up into many masses." This
alternative result certainly seems to be more likely. But
granting that a nebulous ring would break up into many masses, it
may still be contended that, since the chances are infinity to
one against these being of equal sizes and equidistant, they
could not remain evenly distributed round their orbit: this
annular chain of gaseous masses would break up into groups of
masses; these groups would eventually aggregate into larger
groups; and the final result would be the formation of a single
mass. I have put the question to an astronomer scarcely second in
authority to the one above referred to, and he agrees that this
would probably be the process.
But now let us inquire whether, besides these most conspicuous
peculiarities of the Solar System, sundry minor ones are not similarly
explicable. Take first the relation between the planes of the planetary
orbits and the plane of the sun's equator. If, when the nebulous spheroid
extended beyond the orbit of Neptune, all parts of it had been revolving
exactly in the same plane or rather in parallel planes--if all its parts
had had one axis; then the planes of the successive rings would have been
coincident with each other and with that of the sun's rotation. But it
needs only to go back to the earlier stages of concentration, to see that
there could exist no such complete uniformity of motion. The flocculi,
already described as precipitated from an irregular and widely-diffused
nebula, and as starting from all points to their common centre of gravity,
must move not in one plane but in innumerable planes, cutting each other at
all angles.
The gradual establishment of a vortical motion such as we saw must
eventually arise, and such as we at present see indicated in the spiral
nebulae, is the gradual approach toward motion in one plane--the plane of
greatest momentum. But this plane can only slowly become decided. Flocculi
not moving in this plane, but entering into the aggregation at various
inclinations, will tend to perform their revolutions round its centre in
their own planes; and only in course of time will their motions be partly
destroyed by conflicting ones, and partly resolved into the general motion.
Especially will the outermost portions of the rotating mass retain for long
time their more or less independent directions; seeing that neither by
friction nor by the central forces will they be so much restrained. Hence
the probabilities are, that the planes of the rings first detached will
differ considerably from the average plane of the mass; while the planes of
those detached latest will differ from it less. Here, again, inference to a
considerable extent agrees with observation. Though the progression is
irregular, yet on the average the inclinations decrease on approaching the
sun.
Consider next the movements of the planets on their axes. Laplace alleged
as one among other evidences of a common genetic cause, that the planets
rotate in a direction the same as that in which they go round the sun, and
on axes approximately perpendicular to their orbits. Since he wrote, an
exception to this general rule has been discovered in the case of Uranus,
and another still more recently in the case of Neptune--judging, at least,
from the motions of their respective satellites. This anomaly has been
thought to throw considerable doubt on his speculation; and at first sight
it does so. But a little reflection will, we believe, show that the anomaly
is by no means an insoluble one; and that Laplace simply went too far in
putting down as a certain result of nebular genesis, what is, in some
instances, only a probable result. The cause he pointed out as determining
the direction of rotation, is the greater absolute velocity of the outer
part of the detached ring. But there are conditions under which this
difference of velocity may be relatively insignificant, even if it exists:
and others in which, though existing to a considerable extent, it will not
suffice to determine the direction of rotation.
Note, in the first place, that in virtue of their origin, the different
strata of a concentrating nebulous spheroid, will be very unlikely to move
with equal angular velocities: only by friction continued for an indefinite
time will their angular velocities be made uniform; and especially will the
outermost strata, for reasons just now assigned, maintain for the longest
time their differences of movement. Hence, it is possible that in the rings
first detached the outer rims may not have greater absolute velocities; and
thus the resulting planets may have retrograde rotations. Again, the
sectional form of the ring is a circumstance of moment; and this form must
have differed more or less in every case. To make this clear, some
illustration will be necessary. Suppose we take an orange, and assuming the
marks of the stalk and the calyx to represent the poles, cut off round the
line of the equator a strip of peel. This strip of peel, if placed on the
table with its ends meeting, will make a ring shaped like the hoop of a
barrel--a ring whose thickness in the line of its diameter is very small,
but whose width in a direction perpendicular to its diameter is
considerable. Suppose, now, that in place of an orange, which is a spheroid
of very slight oblateness, we take a spheroid of very great oblateness,
shaped somewhat like a lens of small convexity. If from the edge or equator
of this lens-shaped spheroid, a ring of moderate size were cut off, it
would be unlike the previous ring in this respect, that its greatest
thickness would be in the line of its diameter, and not in a line at right
angles to its diameter: it would be a ring shaped somewhat like a quoit,
only far more slender. That is to say, according to the oblateness of a
rotating spheroid, the detached ring may be either a hoop-shaped ring or a
quoit-shaped ring.
One further fact must be noted. In a much-flattened or lens-shaped
spheroid, the form of the ring will vary with its bulk. A very slender
ring, taking off just the equatorial surface, will be hoop-shaped; while a
tolerably massive ring, trenching appreciably on the diameter of the
spheroid, will be quoit-shaped. Thus, then, according to the oblateness of
the spheroid and the bulkiness of the detached ring, will the greatest
thickness of that ring be in the direction of its plane, or in a direction
perpendicular to its plane. But this circumstance must greatly affect the
rotation of the resulting planet. In a decidedly hoop-shaped nebulous ring,
the differences of velocity between the inner and outer surfaces will be
very small; and such a ring, aggregating into a mass whose greatest
diameter is at right angles to the plane of the orbit, will almost
certainly give to this mass a predominant tendency to rotate in a direction
at right angles to the plane of the orbit. Where the ring is but little
hoop-shaped, and the difference of the inner and outer velocities also
greater, as it must be, the opposing tendencies--one to produce rotation in
the plane of the orbit, and the other rotation perpendicular to it--will
both be influential; and an intermediate plane of rotation will be taken
up. While, if the nebulous ring is decidedly quoit-shaped, and therefore
aggregates into a mass whose greatest dimension lies in the plane of the
orbit, both tendencies will conspire to produce rotation in that plane.
On referring to the facts, we find them, as far as can be judged, in
harmony with this view. Considering the enormous circumference of Uranus's
orbit, and his comparatively small mass, we may conclude that the ring from
which he resulted was a comparatively slender, and therefore a hoop-shaped
one: especially if the nebulous mass was at that time less oblate than
afterwards, which it must have been. Hence, a plane of rotation nearly
perpendicular to his orbit, and a direction of rotation having no reference
to his orbitual movement. Saturn has a mass seven times as great, and an
orbit of less than half the diameter; whence it follows that his genetic
ring, having less than half the circumference, and less than half the
vertical thickness (the spheroid being then certainly _as_ oblate, and
indeed _more_ oblate), must have had considerably greater width--must have
been less hoop-shaped, and more approaching to the quoit-shaped:
notwithstanding difference of density, it must have been at least two or
three times as broad in the line of its plane. Consequently, Saturn has a
rotatory movement in the same direction as the movement of translation, and
in a plane differing from it by thirty degrees only.
In the case of Jupiter, again, whose mass is three and a half times that of
Saturn, and whose orbit is little more than half the size, the genetic ring
must, for the like reasons, have been still broader--decidedly
quoit-shaped, we may say; and there hence resulted a planet whose plane of
rotation differs from that of his orbit by scarcely more than three
degrees. Once more, considering the comparative insignificance of Mars,
Earth, Venus, and Mercury, it follows that the diminishing circumferences
of the rings not sufficing to account for the smallness of the resulting
masses, the rings must have been slender ones--must have again approximated
to the hoop-shaped; and thus it happens that the planes of rotation again
diverge more or less widely from those of the orbits. Taking into account
the increasing oblateness of the original spheroid in the successive stages
of its concentration, and the different proportions of the detached rings,
it seems to us that the respective rotatory motions are not at variance
with the hypothesis.
Not only the directions, but also the velocities of rotation are thus
explicable. It might naturally be supposed that the large planets would
revolve on their axes more slowly than the small ones: our terrestrial
experiences incline us to expect this. It is a corollary from the Nebular
Hypothesis, however, more especially when interpreted as above, that while
large planets will rotate rapidly, small ones will rotate slowly; and we
find that in fact they do so. Other things equal, a concentrating nebulous
mass that is diffused through a wide space, and whose outer parts have,
therefore, to travel from great distances to the common centre of gravity,
will acquire a high axial velocity in course of its aggregation: and
conversely with a small mass. Still more marked will be the difference
where the form of the genetic ring conspires to increase the rate of
rotation. Other things equal, a genetic ring that is broadest in the
direction of its plane will produce a mass rotating faster than one that is
broadest at right angles to its plane; and if the ring is absolutely as
well as relatively broad, the rotation will be very rapid. These conditions
were, as we saw, fulfilled in the case of Jupiter; and Jupiter goes round
his axis in less than ten hours. Saturn, in whose case, as above explained,
the conditions were less favourable to rapid rotation, takes ten hours and
a half. While Mars, Earth, Venus, and Mercury, whose rings must have been
slender, take more than double the time: the smallest taking the longest.
From the planets, let us now pass to the satellites. Here, beyond the
conspicuous facts commonly adverted to, that they go round their primaries
in the same directions that these turn on their axes, in planes diverging
but little from their equators, and in orbits nearly circular, there are
several significant traits which must not be passed over.
One of them is, that each set of satellites repeats in miniature the
relations of the planets to the sun, both in the respects just named, and
in the order of the sizes. On progressing from the outside of the Solar
System to its centre, we see that there are four large external planets,
and four internal ones which are comparatively small. A like contrast holds
between the outer and inner satellites in every case. Among the four
satellites of Jupiter, the parallel is maintained as well as the
comparative smallness of the number allows: the two outer ones are the
largest, and the two inner ones the smallest. According to the most recent
observations made by Mr. Lassell, the like is true of the four satellites
of Uranus. In the case of Saturn, who has eight secondary planets revolving
round him, the likeness is still more close in arrangement as in number:
the three outer satellites are large, the inner ones small; and the
contrasts of size are here much greater between the largest, which is
nearly as big as Mars, and the smallest, which is with difficulty
discovered even by the best telescopes.
Moreover, the analogy does not end here. Just as with the planets, there is
at first a general increase of size on travelling inwards from Neptune and
Uranus, which do not differ very widely, to Saturn, which is much larger,
and to Jupiter, which is the largest; so of the eight satellites of Saturn,
the largest is not the outermost, but the outermost save two; so of
Jupiter's four secondaries, the largest is the most remote but one. Now
these analogies are inexplicable by the theory of final causes. For
purposes of lighting, if this be the presumed object of these attendant
bodies, it would have been far better had the larger been the nearer: at
present, their remoteness renders them of less service than the smallest.
To the Nebular Hypothesis, however, these analogies give further support.
They show the action of a common physical cause. They imply a _law_ of
genesis, holding in the secondary systems as in the primary system.
Still more instructive shall we find the distribution of the
satellites--their absence in some instances, and their presence in other
instances, in smaller or greater numbers. The argument from design fails to
account for this distribution. Supposing it be granted that planets nearer
the Sun than ourselves, have no need of moons (though, considering that
their nights are as dark, and, relatively to their brilliant days, even
darker than ours, the need seems quite as great)--supposing this to be
granted; what is to be said of Mars, which, placed half as far again from
the Sun as we are, has yet no moon? Or again, how are we to explain the
fact that Uranus has but half as many moons as Saturn, though he is at
double the distance? While, however, the current presumption is untenable,
the Nebular Hypothesis furnishes us with an explanation. It actually
enables us to predict, by a not very complex calculation, where satellites
will be abundant and where they will be absent. The reasoning is as
follows.
In a rotating nebulous spheroid that is concentrating into a planet, there
are at work two antagonist mechanical tendencies--the centripetal and the
centrifugal. While the force of gravitation draws all the atoms of the
spheroid together, their tangential momentum is resolvable into two parts,
of which one resists gravitation. The ratio which this centrifugal force
bears to gravitation, varies, other things equal, as the square of the
velocity. Hence, the aggregation of a rotating nebulous spheroid will be
more or less strongly opposed by this outward impetus of its particles,
according as its rate of rotation is high or low: the opposition, in equal
spheroids, being four times as great when the rotation is twice as rapid;
nine times as great when it is three times as rapid; and so on. Now, the
detachment of a ring from a planet-forming body of nebulous matter, implies
that at its equatorial zone the centrifugal force produced by concentration
has become so great as to balance gravity. Whence it is tolerably obvious
that the detachment of rings will be most frequent from those masses in
which the centrifugal tendency bears the greatest ratio to the gravitative
tendency. Though it is not possible to calculate what proportions these two
tendencies had to each other in the genetic spheroid which produced each
planet; it is possible to calculate where each was the greatest and where
the least. While it is true that the ratio which centrifugal force now
bears to gravity at the equator of each planet, differs widely from that
which it bore during the earlier stages of concentration; and while it is
true that this change in the ratio, depending on the degree of contraction
each planet has undergone, has in no two cases been the same; yet we may
fairly conclude that where the ratio is still the greatest, it has been the
greatest from the beginning. The satellite-forming tendency which each
planet had, will be approximately indicated by the proportion now existing
in it between the aggregating power, and the power that has opposed
aggregation. On making the requisite calculations, a remarkable harmony
with this inference comes out. The following table shows what fraction the
centrifugal force is of the centripetal force in every case; and the
relation which that fraction bears to the number of satellites.
Mercury. Venus. Earth. Mars. Jupiter. Saturn. Uranus.
1 1 1 1 1 1 1
--- --- --- --- --- --- ---
362 282 289 326 14 6.2 9
1 4 8 4 (or 6
Satellite. Satellites. Satellites according
and three to
rings. Herschel.)
Thus, taking as our standard of comparison the Earth with its one moon, we
see that Mercury and Mars, in which the centrifugal force is relatively
less, have no moons. Jupiter, in which it is far greater, has four moons.
Uranus, in which it is greater still, has certainly four, and probably more
than four. Saturn, in which it is the greatest, being nearly one-sixth of
gravity, has, including his rings, eleven attendants. The only instance in
which there is imperfect conformity with observation is that of Venus. Here
it appears that the centrifugal force is relatively a very little greater
than in the Earth; and according to the hypothesis, Venus ought, therefore,
to have a satellite. Of this seeming anomaly there are two explanations.
Not a few astronomers have asserted that Venus _has_ a satellite. Cassini,
Short, Montaigne of Limoges, Roedkier, and Montbarron, professed to have
seen it; and Lambert calculated its elements. Granting, however, that they
were mistaken, there is still the fact that the diameter of Venus is
variously estimated; and that a very small change in the data would make
the fraction less instead of greater than that of the Earth. But admitting
the discrepancy, we think that this correspondence, even as it now stands,
is one of the strongest confirmations of the Nebular Hypothesis.[M]
[M] Since this essay was published, the data of the above
calculations have been changed by the discovery that the Sun's
distance is three millions of miles less than was supposed. Hence
results a diminution in his estimated mass, and in the masses of
the planets (except the Earth and Moon). No revised estimate of
the masses having yet been published, the table is re-printed in
its original form. The diminution of the masses to the alleged
extent of about one-tenth, does not essentially alter the
relations above pointed out.
Certain more special peculiarities of the satellites must be mentioned as
suggestive. One of them is the relation between the period of revolution
and that of rotation. No discoverable purpose is served by making the Moon
go round its axis in the same time that it goes round the Earth: for our
convenience, a more rapid axial motion would have been equally good; and
for any possible inhabitants of the Moon, much better. Against the
alternative supposition, that the equality occurred by accident, the
probabilities are, as Laplace says, infinity to one. But to this
arrangement, which is explicable neither as the result of design nor of
chance, the Nebular Hypothesis furnishes a clue. In his "Exposition du
Systeme du Monde," Laplace shows, by reasoning too detailed to be here
repeated, that under the circumstances such a relation of movements would
be likely to establish itself.
Among Jupiter's satellites, which severally display these same synchronous
movements, there also exists a still more remarkable relation. "If the mean
angular velocity of the first satellite be added to twice that of the
third, the sum will be equal to three times that of the second;" and "from
this it results that the situations of any two of them being given, that of
the third can be found." Now here, as before, no conceivable advantage
results. Neither in this case can the connexion have been accidental: the
probabilities are infinity to one to the contrary. But again, according to
Laplace, the Nebular Hypothesis supplies a solution. Are not these
significant facts?
Most significant fact of all, however, is that presented by the rings of
Saturn. As Laplace remarks, they are, as it were, still extant witnesses of
the genetic process he propounded. Here we have, continuing permanently,
forms of matter like those through which each planet and satellite once
passed; and their movements are just what, in conformity with the
hypothesis, they should be. "La duree de la rotation d'une planete doit
donc etre, d'apres cette hypothese, plus petite que la duree de la
revolution du corps le plus voisin qui circule autour d'elle," says
Laplace.[N] And he then points out that the time of Saturn's rotation is to
that of his rings as 427 to 438--an amount of difference such as was to be
expected.
[N] "Mecanique Celeste," p. 346.
But besides the existence of these rings, and their movements in the
required manner, there is a highly suggestive circumstance which Laplace
has not remarked--namely, the place of their occurrence. If the Solar
System was produced after the manner popularly supposed, then there is no
reason why the rings of Saturn should not have encircled him at a
comparatively great distance. Or, instead of being given to Saturn, who in
their absence would still have had eight satellites, such rings might have
been given to Mars, by way of compensation for a moon. Or they might have
been given to Uranus, who, for purposes of illumination, has far greater
need of them. On the common hypothesis, we repeat, no reason can be
assigned for their existence in the place where we find them. But on the
hypothesis of evolution, the arrangement, so far from offering a
difficulty, offers another confirmation. These rings are found where alone
they could have been produced--close to the body of a planet whose
centrifugal force bears a great proportion to his gravitative force. That
permanent rings should exist at any great distance from a planet's body,
is, on the Nebular Hypothesis, manifestly impossible. Rings detached early
in the process of concentration, and therefore consisting of gaseous matter
having extremely little power of cohesion, can have no ability to resist
the disrupting forces due to imperfect balance; and must, therefore,
collapse into satellites. A liquid ring is the only one admitting of
permanence. But a liquid ring can be produced only when the aggregation is
approaching its extreme--only when gaseous matter is passing into liquid,
and the mass is about to assume the planetary form. And even then it cannot
be produced save under special conditions. Gaining a rapidly-increasing
preponderance, as the gravitative force does during the closing stages of
concentration, the centrifugal force cannot in ordinary cases cause the
detachment of rings when the mass has become dense. Only where the
centrifugal force has all along been very great, and remains powerful to
the last, as in Saturn, can liquid rings be formed. Thus the Nebular
Hypothesis shows us why such appendages surround Saturn, but exist nowhere
else.
And then, let us not forget the fact, discovered within these few years,
that Saturn possesses a _nebulous_ ring, through which his body is seen as
through a thick veil. In a position where alone such a thing seems
preservable--suspended, as it were, between the denser rings and the
planet--there still continues one of these annular masses of diffused
matter from which satellites and planets are believed to have originated.
We find, then, that besides those most conspicuous peculiarities of the
Solar System, which first suggested the theory of its evolution, there are
many minor ones pointing in the same direction. Were there no other
evidence, these mechanical arrangements would, considered in their
totality, go far to establish the Nebular Hypothesis.
* * * * *
From the mechanical arrangements of the Solar System, turn we now to its
physical characters; and, first, let us consider the inferences deducible
from relative specific gravities.
The fact that, speaking generally, the denser planets are the nearer to the
Sun, is by some considered as adding another to the many indications of
nebular origin. Legitimately assuming that the outermost parts of a
rotating nebulous spheroid, in its earlier stages of concentration, will be
comparatively rare; and that the increasing density which the whole mass
acquires as it contracts, must hold of the outermost parts as well as the
rest; it is argued that the rings successively detached will be more and
more dense, and will form planets of higher and higher specific gravities.
But passing over other objections, this explanation is quite inadequate to
account for the facts. Using the Earth as a standard of comparison, the
relative densities run thus:--
Neptune. Uranus. Saturn. Jupiter. Mars. Earth. Venus. Mercury. Sun.
0.14 0.24 0.14 0.24 0.95 1.00 0.92 1.12 0.25
Two seemingly insurmountable objections are presented by this series. The
first is, that the progression is but a broken one. Neptune is as dense as
Saturn, which, by the hypothesis, it ought not to be. Uranus is as dense as
Jupiter, which it ought not to be. Uranus is denser than Saturn, and the
Earth is denser than Venus--facts which not only give no countenance to,
but directly contradict, the alleged explanation. The second objection,
still more manifestly fatal, is the low specific gravity of the Sun. If,
when the matter of the Sun filled the orbit of Mercury, its state of
aggregation was such that the detached ring formed a planet having a
specific gravity equal to that of iron; then the Sun itself, now that it
has concentrated, should have a specific gravity much greater than that of
iron; whereas its specific gravity is not much above that of water. Instead
of being far denser than the nearest planet, it is not one-fourth as dense.
And a parallel relation holds between Jupiter and his smallest
satellite.[O]
[O] The impending revision of the estimated masses of the planets,
entailed by the discovery that the Sun's distance is less than
was supposed, will alter these specific gravities. It will make
most of the contrasts still stronger.
While these anomalies render untenable the position that the relative
specific gravities of the planets are direct indications of nebular
condensation; it by no means follows that they negative it. On the
contrary, we believe that the facts admit of an interpretation quite
consistent with the hypothesis of Laplace.
There are three possible causes of unlike specific gravities in the members
of our Solar System:--1. Differences between the kinds of matter or matters
composing them. 2. Differences between the quantities of matter; for, other
things equal, the mutual gravitation of atoms will make a large mass denser
than a small one. 3. Differences between the structures: the masses being
either solid or liquid throughout, or having central cavities filled with
elastic aeriform substance. Of these three conceivable causes, that
commonly assigned is the first, more or less modified by the second. The
extremely low specific gravity of Saturn, which but little exceeds that of
cork (and, on this hypothesis, must at his surface be considerably less
than that of cork) is supposed to arise from the intrinsic lightness of his
substance. That the Sun weighs not much more than an equal bulk of water,
is taken as evidence that the matter he consists of is but little heavier
than water; although, considering his enormous gravitative force, which at
his surface is twenty-eight times the gravitative force at the surface of
the Earth, and considering his enormous mass, which is 390,000 times that
of the Earth, the matter he is made of can, in such case, have no analogy
to the liquids or solids we know. However, spite of these difficulties, the
current hypothesis is, that the Sun and planets, inclusive of the Earth,
are either solid or liquid, or have solid crusts with liquid nuclei: their
unlike specific gravities resulting from unlikenesses of substance. And
indeed, at first sight, this would seem to be the only tenable supposition;
seeing that, unless prevented by some immense resisting force, gravitation
must obliterate any internal cavity by collapsing the surrounding liquid or
solid matter.
Nevertheless, that the Earth, in common with other members of the Solar
System, is solid, or else consists of a solid shell having a cavity
entirely filled with molten matter, is not an established fact: it is
nothing but a supposition. We must not let its familiarity and apparent
feasibility delude us into an uncritical acceptance of it. If we find an
alternative supposition which, physically considered, is equally possible,
we are bound to consider it. And if it not only avoids the difficulties
above pointed out, but many others hereafter to be mentioned, we must give
it the preference.
Before proceeding to consider what the Nebular Hypothesis indicates
respecting the internal structures of the Sun and planets, we may state
that our reasonings, though of a kind not admitting of direct verification,
are nothing more than deductions from the established principles of
physics. We have submitted them to an authority not inferior to any that
can be named; and while unprepared to commit himself to them, he yet sees
nothing to object.
Starting, then, with a rotating spheroid of aeriform matter, in the later
stages of its concentration, but before it has begun to take a liquid or
solid form, let us inquire what must be the actions going on in it. Mutual
gravitation continually aggregates its atoms into a smaller and denser
mass; and the aggregating force goes on increasing, as the common centre of
gravity is approached. An obstacle to concentration, however, exists in the
centrifugal force, which at this stage bears a far higher ratio to gravity
than afterwards, and in a gaseous spheroid must produce a very oblate form.
At the same time, the approximation of the atoms is resisted by a force
which, in being overcome, is evolved as heat. This heat must be greatest
where the atoms are subject to the highest pressure--namely, about the
central parts. And as fast as it escapes into space, further approximation
and further generation of heat must take place. But in a gaseous spheroid,
having internal parts hotter than its external parts, there must be some
circulation. The currents must set from the hottest region to the coolest
by some particular route; and from the coolest to the hottest by some other
route. In a very oblate spheroid, the coolest region must be that about the
equator: the surface there bearing so large a ratio to the mass. Hence
there will be currents from the centre to the equator, and others from the
equator to the centre. What will be the special courses of these currents?
Supposing an original state of rest, about to pass into motion in obedience
to the disturbing forces, the currents commencing at the centre will follow
the lines of most rapidly-decreasing density; seeing that the inertia will
be least in those lines. That is to say, there will be a current from the
centre towards each pole, along the axis of rotation; and the space thus
continually left vacant will be filled by the collapse of matter coming in
at right angles to the axis. The process cannot end here, however. If there
are constant currents from the centre towards the poles, there must be a
constant accumulation at the poles; the spheroid will be ever becoming more
protuberant about the poles than the conditions of mechanical equilibrium
permit. If, however, the mass at the poles is thus ever in excess, it must,
by the forces acting on it, be constantly moved over the outer surface of
the spheroid from the poles towards the equator: thus only can that form
which rotation necessitates be maintained. And a further result of this
transfer of matter from the centre, by way of the poles, to the equator,
must be the establishment of counter-currents from the equator in
diametrical lines, to the centre.
Mark now the changes of temperature that must occur in these currents. An
aeriform mass ascending from the centre towards either pole, will expand as
it approaches the surface, in consequence of the diminution of pressure.
But expansion, involving an absorption of heat, will entail a diminished
temperature; and the temperature will be further lowered by the greater
freedom of radiation into space. This rarefied and cooled mass must be
still more rarefied and cooled in its progress over the surface of the
spheroid to the equator. Continually thrust further from the pole by the
ceaseless accumulation there, it must acquire an ever-increasing rotatory
motion and an ever-increasing centrifugal force: whence must follow
expansion and absorption of heat. To the refrigeration thus caused must be
added that resulting from radiation, which, at each advance towards the
equator, will be less hindered. And when the mass we have thus followed
arrives at the equator, it will have reached its maximum rarity and maximum
coolness. Conversely, every portion of a current proceeding in a
diametrical direction from the equator to the centre, must progressively
rise in temperature; in virtue alike of the increasing pressure, the
gradual arrest of motion, and the diminished rate of radiation. Note,
lastly, that this circulation will go on, but slowly. As the matter
proceeding from the equator towards the centre must have its rotatory
motion destroyed, while that proceeding from the poles to the equator must
have rotatory motion given to it, it follows that an enormous amount of
inertia has to be overcome; and this must make the currents so slow as to
prevent them from producing anything like an equality of temperature.
Such being the constitution of a concentrating spheroid of gaseous matter,
where will the gaseous matter begin to condense into liquid? The usual
assumption has been, that in a nebulous mass approaching towards the
planetary form, the liquefaction will first occur at the centre. We believe
this assumption is inconsistent with established physical principles.
Observe first that it is contrary to analogy. That the matter of the Earth
was liquid before any of it became solid, is generally admitted. Where has
it first solidified? Not at the centre, but at the surface. Now the general
principles which apply to the condensation of liquid matter into solid,
apply also to the condensation of gaseous matter into liquid. Hence if the
once liquid substance of the Earth first solidified at the surface, the
implication is that its once aeriform substance first liquified at the
surface.
But we have no need to rest in analogy. On considering what must happen in
a rotating gaseous spheroid having currents moving as above described, we
shall see that external condensation is a corollary. A nebulous mass, when
it has arrived at this stage, will consist of an aeriform mixture of
various matters; the heavier and more condensible matters being contained
in the rarer or less condensible, in the same way that water is contained
in air. And the inference must be, that at a certain stage, some of these
denser matters will be precipitated in the shape of a cloud.[P]
[P] The reader will perhaps say that this process is the one
described as having taken place early in the history of nebular
evolution; and this is true. But the same actions will be
repeated in media of different densities.
Now, what are the laws of precipitation from gases? If a gas through which
some other substance is diffused in a gaseous state, expands in consequence
of the removal of pressure, it will, when the rarefaction and consequent
cooling reach a certain point, begin to let fall the suspended substance.
Conversely, if, a gas, saturated even with some substance, is subject to
increased pressure, and is allowed to retain the additional heat which that
pressure generates; so far from letting fall what it contains, it will gain
the power to take up more. See then, the inference respecting condensation
in a nebulous spheroid. The currents proceeding from the equator to the
centre, subject to increasing pressure, and acquiring the heat due both to
this increasing pressure and to arrested motion, will have no tendency to
deposit their suspended substances, but rather the reverse: a formation of
liquid matter at the centre of the mass will be impossible. Contrariwise,
the gaseous currents moving from the centre to the poles and thence to the
equator, expanding as they go, first from diminished pressure and
afterwards from increased centrifugal force; and losing heat, not only by
expansion, but by more rapid radiation; will have less and less power to
retain the matter diffused through them. The earliest precipitation will
take place in the region of extremest rarefaction; namely, about the
equator. An equatorial belt of cloud will be first formed, and widened into
a zone, will by-and-by begin to condense into liquid.[Q] Gradually this
liquid film will extend itself on each side the equator, and encroaching on
the two hemispheres, will eventually close over at the poles: thus
producing a thin hollow globe, or rather spheroid, filled with gaseous
matter. We do not mean that this condensation will take place at the very
outermost surface; for probably, round the denser gases forming the
principal mass, there will extend strata of gases too rare and too cool to
be entangled in these processes. It is the surface of this inner spheroid
of denser gases to which our reasoning points as the place of earliest
condensation.
[Q] The formation of Saturn's rings is thus rendered comprehensible.
The internal circulation we have described, continuing, as it must, after
the formation of this liquid film, there will still go on the radiation of
heat, and the progressive aggregation. The film will thicken at the expense
of the internal gaseous substances precipitated on it. As it thickens, as
the globe contracts, and as the gravitative force augments, the pressure
will increase; and the evolution and radiation of heat will go on more
rapidly. Eventually, however, when the liquid shell becomes very thick, and
the internal cavity relatively small, the obstacle put to the escape of
heat by this thick liquid shell, with its slowly-circulating currents, will
turn the scale: the temperature of the outer surface will begin to
diminish, and a solid crust will form while the internal cavity is yet
unobliterated.
"But what," it may be asked, "will become of this gaseous nucleus when
exposed to the enormous gravitative pressure of a shell some thousands of
miles thick? How can aeriform matter withstand such a pressure?" Very
readily. It has been proved that even when the heat generated by
compression is allowed to escape, some gases remain uncondensible by any
force we can produce. An unsuccessful attempt lately made at Vienna to
liquify oxygen, clearly shows this enormous resistance. The steel piston
employed was literally shortened by the pressure used: and yet the gas
remained unliquified! If, then, the expansive force is thus immense when
the heat evolved is dissipated, what must it be when that heat is in great
measure detained; as in the case we are considering? Indeed, the
experiments of M. Cagniard de Latour have shown that gases may, under
pressure, acquire the density of liquids while retaining the aeriform
state; provided the temperature continues extremely high. In such a case,
every addition to the heat is an addition to the repulsive power of the
atoms: the increased pressure itself generates an increased ability to
resist; and this remains true to whatever extent the compression is
carried. Indeed, it is a corollary from the persistence of force, that if,
under increasing pressure, a gas retains all the heat evolved, its
resisting force is _absolutely unlimited_. Hence, the internal planetary
structure we have described, is as physically stable a one as that commonly
assumed.
And now let us see how this hypothesis tallies with the facts. One
inference from it must be, that large masses will progress towards final
consolidation more slowly than small masses. Though a large concentrating
spheroid will, from its superior aggregative force, generate heat more
rapidly than a small one; yet, having, relatively to its surface, a much
greater quantity of heat to get rid of, it will be longer than a small one
in going through the changes we have described. Consequently, at a time
when the smaller members of our Solar System have arrived at so advanced a
stage of aggregation as almost to have obliterated their central cavities,
and so reached high specific gravities; the larger members will still be at
that stage in which the central cavities bear great ratios to the
surrounding shells, and will therefore have low specific gravities. This
contrast is just what we find. The small planets Mercury, Venus, the Earth,
and Mars, differing from each other comparatively little in density as in
size, are about four times as dense as Jupiter and Uranus, and seven times
as dense as Saturn and Neptune--planets exceeding them in size as oranges
exceed peas; and they are four times as dense as the Sun, which in mass is
nearly 5,000,000 times greater than the smallest of them.
The obvious objection that this hypothesis does not explain the minor
differences, serves but to introduce a further confirmation. It may be
urged that Jupiter is of greater specific gravity than Saturn, though,
considering his superior mass, his specific gravity should be less; and
that still more anomalous is the case of the Sun, which, though containing
a thousand times the matter that Jupiter does, is nearly of the same
specific gravity. The solution of these difficulties lies in the modifying
effects of centrifugal force. Had the various masses to be compared been
all along in a state of rest, then the larger should have been uniformly
the less dense. But during the concentrating process they have been
rotating with various velocities. The consequent centrifugal force has in
each case been in antagonism with gravitation; and, according to its
amount, has hindered the concentration to a greater or less degree. The
efficient aggregative force has in each case been the excess of the
centripetal tendency over the centrifugal. Whence we may infer that
wherever this excess has been the least, the consolidation must have been
the most hindered, and the specific gravity will be the smallest. This,
too, we find to be the fact. Saturn, at whose equator the centrifugal force
is even now almost one-sixth of gravity, and who, by his numerous
satellites, shows us how strong an antagonist to concentration it was in
earlier stages of his evolution, is little more than half as dense as
Jupiter, whose concentration has been hindered by a centrifugal force
bearing a much smaller ratio to the centripetal.
On the other hand, the Sun, whose latter stages of aggregation have met
with comparatively little of this opposition, and whose atoms tend towards
their common centre with a force ten times as great as that which Jupiter's
atoms are subject to, has, notwithstanding his immense bulk, reached a
specific gravity as great as that of Jupiter; and he has done this partly
for the reason assigned, and partly because the process of consolidation
has been, and still is, actively going on, while that of Jupiter has long
since almost ceased.
Before pointing out further harmonies let us meet an objection. Laplace,
taking for data Jupiter's mass, diameter, and rate of rotation, calculated
the degrees of compression at the poles which his centrifugal force should
produce, supposing his substance to be homogeneous; and finding that the
calculated amount of oblateness was greater than the actual amount,
inferred that his substance must be denser towards the centre. The
inference seems unavoidable; is diametrically opposed to the hypothesis of
a shell of denser matter with a gaseous nucleus; and we confess that on
first meeting with this fact we were inclined to think it fatal. But there
is a consideration, apt to be overlooked, which completely disposes of it.
A compressed elastic medium tends ever with great energy to give a
spherical figure to the chamber in which it is confined. This truth is
alike mathematically demonstrable, and recognized in practice by every
engineer. In the case before us, the expansive power of the gaseous nucleus
is such as to balance the gravitation of the shell of the planet; and this
power perpetually strives to make the planet a perfect sphere. Thus the
tendency of the centrifugal force to produce oblateness, is opposed not
only by the force of gravity but by another force of great intensity; and
hence the degree of oblateness produced is relatively small.
This difficulty being as we think, satisfactorily met, we go on to name
some highly significant facts giving indirect support to our hypothesis.
And first with respect to the asteroids, or planetoids, as they are
otherwise called. Now that these have proved to be so numerous--now that it
has become probable that beyond some sixty already discovered there are
many more--the supposition of Olbers, that they are the fragments of an
exploded planet which once occupied the vacant region they fill, has gained
increased probability. The alternative supposition of Laplace, that they
are the products of a nebulous ring which separated into many fragments
instead of collapsing into a single mass, seems inconsistent with the
extremely various, and in some cases extremely great, inclinations of their
orbits; as well as with their similarly various and great eccentricities.
For these the theory of Olbers completely accounts--indeed, it necessarily
involves them; while at the same time it affords us a feasible explanation
of meteors, and especially the periodic swarms of them, which would else be
inexplicable. The fact, inferred from the present derangement of their
orbits, that if the planetoids once formed parts of one mass, it must have
exploded myriads of years ago, is no difficulty, but rather the reverse.
Taking Olbers' supposition, then, as the most tenable one, let us ask how
such an explosion could have occurred. If planets are internally
constituted as is commonly assumed, no conceivable cause of it can be
named. A solid mass may crack and fall to pieces, but it cannot violently
explode. So, too, with a liquid mass covered by a crust. Though, if
contained in an unyielding shell and artificially raised to a very high
temperature, a liquid might so expand as to burst the shell and
simultaneously flash into vapour; yet, if contained in a yielding crust,
like that of a planet, it would not do so: it would crack the crust and
give off its expansive force gradually. But the planetary structure above
supposed, supplies us with all the requisite conditions to an explosion,
and an adequate cause for it. We have in the interior of the mass, a cavity
serving as a sufficient reservoir of force. We have this cavity filled with
gaseous matters of high tension. We have in the chemical affinities of
these matters a source of enormous expansive power--power capable of being
quite suddenly liberated. And we have in the increasing heat of the shell,
consequent on progressing concentration, a cause of such instantaneous
chemical change and the resulting explosion. The explanation thus supplied,
of an event which there can be little doubt has occurred, and which is not
otherwise accounted for, adds to the probability of the hypothesis.
One further evidence, and that not the least important, is deducible from
geology. From the known rate at which the temperature rises as we pierce
deeper into the substance of the Earth, it has been inferred that its solid
crust is some forty miles thick. And if this be its thickness, we have a
feasible explanation of volcanic phenomena, as well as of elevations and
subsidences. But proceeding on the current supposition that the Earth's
interior is wholly filled with molten matter, Prof. Hopkins has calculated
that to cause the observed amount of precession of the equinoxes, the
Earth's crust must be at least eight hundred miles thick. Here is an
immense discrepancy. However imperfect may be the data from which it is
calculated that the Earth is molten at forty miles deep, it seems very
unlikely that this conclusion differs from the truth so widely as forty
miles does from eight hundred. It seems scarcely conceivable that if the
crust is thus thick, it should by its contraction and corrugation, produce
mountain chains, as it has done during quite modern geologic epochs. It is
not easy on this supposition to explain elevations and subsidences of small
area. Neither do the phenomena of volcanoes appear comprehensible. Indeed
to account for these, Prof. Hopkins has been obliged to make the gratuitous
and extremely improbable assumption, that there are isolated lakes of
molten matter enclosed in this thick crust, and situated, as they must be,
not far from its outer surface.
But irreconcileable as appear the astronomical with the geological facts,
if we take for granted that the Earth consists wholly of solid and liquid
substances, they become at once reconcileable if we adopt the conclusion
that the Earth has a gaseous nucleus. If there is an internal cavity of
considerable diameter occupied only by aeriform matter--if the density of
the surrounding shell is, as it must in that case be, greater than the
current supposition implies; then there will be a larger quantity of matter
contained in the equatorial protuberance, and an adequate cause for the
precession. Manifestly there may be found some proportion between the
central space and its envelope, which will satisfy the mechanical
requirements, without involving a thicker crust than geological phenomena
indicate.[R]
[R] Since this was written, M. Poinsot has shown that the precession
would be the same whether the Earth were solid or hollow.
We conceive, then, that the hypothesis we have set forth, is in many
respects preferable to that ordinarily received. We can know nothing by
direct observation concerning the central parts either of our own planet or
any other: indirect methods are alone possible. The idea which has been
tacitly adopted, is just as speculative as that we have opposed to it; and
the only question is, which harmonizes best with established facts. Thus
compared, the advantage is greatly on the side of the new one. It disposes
of sundry anomalies, and explains things that seem else incomprehensible.
We are no longer obliged to assume such wide differences between the
substances of the various planets: we need not think of any of them as like
cork or water. We are shown how it happens that the larger planets have so
much lower specific gravities than the smaller, instead of having higher
ones, as might have been expected; and we are further shown why Saturn is
the lightest of all. That Mercury is relatively so much heavier than the
Sun; that Jupiter is specifically lighter than his smallest satellite; that
Saturn's rings have a density one and a half times as great as Saturn; are
no longer mysteries. A feasible cause is assigned for the catastrophe which
produced the asteroids. And some apparently incongruous peculiarities in
the Earth's structure are brought to an agreement. May we not say, then,
that being deducible from the Nebular Hypothesis, this alleged planetary
structure gives further indirect support to that hypothesis?
* * * * *
In considering the specific gravities of the heavenly bodies, we have been
obliged to speak of the heat evolved by them. But we have yet to point out
the fact that in their present conditions with respect to temperature, we
find additional materials for building up our argument; and these too of
the most substantial character.
Heat must inevitably be generated by the aggregation of diffused matter
into a concrete form; and throughout our reasonings we have assumed that
such generation of heat has been an accompaniment of nebular condensation.
If, then, the Nebular Hypothesis be true, we ought to find in all the
heavenly bodies, either present high temperature or marks of past high
temperature.
As far as observation can reach, the facts prove to be what theory
requires. Various evidences conspire to show that, below a certain depth,
the Earth is still molten. And that it was once wholly molten, is implied
by the circumstance that the rate at which the temperature increases on
descending below its surface, is such as would be found in a mass that had
been cooling for an indefinite period. The Moon, too, shows us, by its
corrugations and its conspicuous volcanoes, that in it there has been a
process of refrigeration and contraction, like that which had gone on in
the Earth. And in Venus, the existence of mountains similarly indicates an
igneous reaction of the interior upon a solidifying crust.
On the common theory of creation, these phenomena are inexplicable. To what
end the Earth should once have existed in a molten state, incapable of
supporting life, it cannot say. To satisfy this supposition, the Earth
should have been originally created in a state fit for the assumed purposes
of creation; and similarly with the other planets. While, therefore, to the
Nebular Hypothesis the evidence of original incandescence and still
continued internal heat, furnish strong confirmation, they are, to the
antagonist hypothesis, insurmountable difficulties.
But the argument from temperature does not end here. There remains to be
noticed a more conspicuous and still more significant fact. If the Solar
System was formed by the concentration of diffused matter, which evolved
heat while gravitating into its present dense form; then there are certain
obvious corollaries respecting the relative temperatures of the resulting
bodies. Other things equal, the latest-formed mass will be the latest in
cooling--will, for an almost infinite time, possess a greater heat than the
earlier-formed ones. Other things equal, the largest mass will, because of
its superior aggregative force, become hotter than the others, and radiate
more intensely. Other things equal, the largest mass, notwithstanding the
higher temperature it reaches, will, in consequence of its relatively small
surface, be the slowest in losing its evolved heat. And hence, if there is
one mass which was not only formed after the rest, but exceeds them
enormously in size, it follows that this one will reach an intensity of
incandescence much beyond that reached by the rest; and will continue in a
state of intense incandescence long after the rest have cooled.
Such a mass we have in the Sun. It is a corollary from the Nebular
Hypothesis, that the matter forming the Sun assumed its present concrete
form, at a period much more recent than that at which the planets became
definite bodies. The quantity of matter contained in the Sun is nearly five
million times that contained in the smallest planet, and above a thousand
times that contained in the largest. And while, from the enormous
gravitative force of the atoms, the evolution of heat has been intense, the
facilities of radiation have been relatively small. Hence the
still-continued high temperature. Just that condition of the central body
which is a necessary inference from the Nebular Hypothesis, we find
actually existing in the Sun.
It may be well to consider a little more closely, what is the probable
condition of the Sun's surface. Round the globe of incandescent molten
substances, thus conceived to form the visible body of the Sun, there is
known to exist a voluminous atmosphere: the inferior brilliancy of the
Sun's border, and the appearances during a total eclipse, alike show
this.[S] What now must be the constitution of this atmosphere? At a
temperature approaching a thousand times that of molten iron, which is the
calculated temperature of the solar surface, very many, if not all, of the
substances we know as solid, would become gaseous; and though the Sun's
enormous attractive force must be a powerful check on this tendency to
assume the form of vapour, yet it cannot be questioned that if the body of
the Sun consists of molten substances, some of them must be constantly
undergoing evaporation. That the dense gases thus continually being
generated will form the entire mass of the solar atmosphere, is not
probable. If anything is to be inferred, either from the Nebular
Hypothesis, or from the analogies supplied by the planets, it must be
concluded that the outermost part of the solar atmosphere consists of what
are called permanent gases--gases that are not condensible into fluid even
at low temperatures. If we consider what must have been the state of things
here, when the surface of the Earth was molten, we shall see that round the
still molten surface of the Sun, there probably exists a stratum of dense
aeriform matter, made up of sublimed metals and metallic compounds, and
above this a stratum of comparatively rare medium analogous to air. What
now will happen with these two strata? Did they both consist of permanent
gases, they could not remain separate: according to a well-known law, they
would eventually form a homogeneous mixture. But this will by no means
happen when the lower stratum consists of matters that are gaseous only at
excessively high temperatures. Given off from a molten surface, ascending,
expanding, and cooling, these will presently reach a limit of elevation
above which they cannot exist as vapour, but must condense and precipitate.
Meanwhile the upper stratum, habitually charged with its quantum of these
denser matters, as our air with its quantum of water, and ready to deposit
them on any depression of temperature, must be habitually unable to take up
any more of the lower stratum; and therefore this lower stratum will remain
quite distinct from it.
[S] See Herschel's "Outlines of Astronomy."
Since the foregoing paragraph was originally published, in 1858, the
proposition it enunciates as a corollary from the Nebular Hypothesis, has
been in great part verified. The marvellous disclosures made by
spectrum-analysis, have proved beyond the possibility of doubt, that the
solar atmosphere contains, in a gaseous state, the metals, iron, calcium,
magnesium, sodium, chromium, and nickel, along with small quantities of
barium, copper, and zinc. That there exist in the solar atmosphere other
metals like those which we have on the Earth, is probable; and that it
contains elements which are unknown to us, is very possible.
Be this as it may, however, the proposition that the Sun's atmosphere
consists largely of metallic vapours, must take rank as an established
truth; and that the incandescent body of the Sun consists of molten metals,
follows almost of necessity. That an _a priori_ inference which probably
seemed to many readers wildly speculative, should be thus conclusively
justified by observations, made without reference to any theory, is a
striking fact; and it gives yet further support to the hypothesis from
which this _a priori_ conclusion was drawn. It may be well to add that
Kirchhoff, to whom we owe this discovery respecting the constitution of the
solar atmosphere, himself remarks in his memoir of 1861, that the facts
disclosed are in harmony with the Nebular Hypothesis.
And here let us not omit to note also, the significant bearing which
Kirchhoff's results have on the doctrine contended for in a foregoing
section. Leaving out the barium, copper, and zinc, of which the quantities
are inferred to be small, the metals existing as vapours in the Sun's
atmosphere, and by consequence as molten in his incandescent body, have an
average specific gravity of 4.25. But the average specific gravity of the
Sun is about 1. How is this discrepancy to be explained? To say that the
Sun consists almost wholly of the three lighter metals named, would be
quite unwarranted by the evidence: the results of spectrum-analysis would
just as much warrant the assertion that the Sun consists almost wholly of
the three heavier. Three metals (two of them heavy) having been already
left out of the estimate because their quantities appear to be small, the
only legitimate assumption on which to base an estimate of specific
gravity, is that the rest are present in something like equal amounts. Is
it then that the lighter metals exist in larger proportions in the molten
mass, though not in the atmosphere? This is very unlikely: the known
habitudes of matter rather imply that the reverse is the case. Is it then
that under the conditions of temperature and gravitation existing in the
Sun, the state of liquid aggregation is wholly unlike that existing here?
This is a very strong assumption: it is one for which our terrestrial
experiences afford no adequate warrant; and if such unlikeness exists, it
is very improbable that it should produce so immense a contrast in specific
gravity as that of 4 to 1. The more legitimate conclusion is that the Sun's
body is not made up of molten matter all through; but that it consists of a
molten shell with a gaseous nucleus. And this we have seen to be a
corollary from the Nebular Hypothesis.
* * * * *
Considered in their _ensemble_, the several groups of evidences assigned
amount almost to proof. We have seen that, when critically examined, the
speculations of late years current respecting the nature of the nebulae,
commit their promulgators to sundry absurdities; while, on the other hand,
we see that the various appearances these nebulae present, are explicable as
different stages in the precipitation and aggregation of diffused matter.
We find that comets, alike by their physical constitution, their
immensely-elongated and variously-directed orbits, the distribution of
those orbits, and their manifest structural relation to the Solar System,
bear testimony to the past existence of that system in a nebulous form. Not
only do those obvious peculiarities in the motions of the planets which
first suggested the Nebular Hypothesis, supply proofs of it, but on closer
examination we discover, in the slightly-diverging inclinations of their
orbits, in their various rates of rotation, and their differently-directed
axes of rotation, that the planets yield us yet further testimony; while
the satellites, by sundry traits, and especially by their occurrence in
greater or less abundance where the hypothesis implies greater or less
abundance, confirm this testimony. By tracing out the process of planetary
condensation, we are led to conclusions respecting the internal structure
of planets which at once explain their anomalous specific gravities, and at
the same time reconcile various seemingly contradictory facts. Once more,
it turns out that what is _a priori_ inferable from the Nebular Hypothesis
respecting the temperatures of the resulting bodies, is just what
observation establishes; and that both the absolute and the relative
temperatures of the Sun and planets are thus accounted for. When we
contemplate these various evidences in their totality--when we observe
that, by the Nebular Hypothesis, the leading phenomena of the Solar System,
and the heavens in general, are explicable; and when, on the other hand, we
consider that the current cosmogony is not only without a single fact to
stand on, but is at variance with all our positive knowledge of Nature; we
see that the proof becomes overwhelming.
It remains only to point out that while the genesis of the Solar System,
and of countless other systems like it, is thus rendered comprehensible,
the ultimate mystery continues as great as ever. The problem of existence
is not solved: it is simply removed further back. The Nebular Hypothesis
throws no light on the origin of diffused matter; and diffused matter as
much needs accounting for as concrete matter. The genesis of an atom is not
easier to conceive than the genesis of a planet. Nay, indeed, so far from
making the Universe a less mystery than before, it makes it a greater
mystery. Creation by manufacture is a much lower thing than creation by
evolution. A man can put together a machine; but he cannot make a machine
develop itself. The ingenious artizan, able as some have been, so far to
imitate vitality as to produce a mechanical pianoforte-player, may in some
sort conceive how, by greater skill, a complete man might be artificially
produced; but he is unable to conceive how such a complex organism
gradually arises out of a minute structureless germ. That our harmonious
universe once existed potentially as formless diffused matter, and has
slowly grown into its present organized state, is a far more astonishing
fact than would have been its formation after the artificial method
vulgarly supposed. Those who hold it legitimate to argue from phenomena to
noumena, may rightly contend that the Nebular Hypothesis implies a First
Cause as much transcending "the mechanical God of Paley," as this does the
fetish of the savage.
VII. BAIN ON THE EMOTIONS AND THE WILL.
After the controversy between the Neptunists and the Vulcanists had been
long carried on without definite results, there came a reaction against all
speculative geology. Reasoning without adequate data having led to nothing,
inquirers went into the opposite extreme, and confining themselves wholly
to collecting data, relinquished reasoning. The Geological Society of
London was formed with the express object of accumulating evidence; for
many years hypotheses were forbidden at its meetings; and only of late have
attempts to organize the mass of observations into consistent theory been
tolerated.
This reaction and subsequent re-reaction, well illustrate the recent
history of English thought in general. The time was when our countrymen
speculated, certainly to as great an extent as any other people, on all
those high questions which present themselves to the human intellect; and,
indeed, a glance at the systems of philosophy that are or have been current
on the Continent, suffices to show how much other nations owe to the
discoveries of our ancestors. For a generation or two, however, these more
abstract subjects have fallen into neglect; and, among those who plume
themselves on being "practical," even into contempt. Partly, perhaps, a
natural accompaniment of our rapid material growth, this intellectual phase
has been in great measure due to the exhaustion of argument, and the
necessity for better data. Not so much with a conscious recognition of the
end to be subserved, as from an unconscious subordination to that rhythm
traceable in social changes as in other things, an era of theorizing
without observing, has been followed by an era of observing without
theorizing. During the long-continued devotion to concrete science, an
immense quantity of raw material for abstract science has been accumulated;
and now there is obviously commencing a period in which this accumulated
raw material will be organized into consistent theory. On all
sides--equally in the inorganic sciences, in the science of life, and in
the science of society--may we note the tendency to pass from the
superficial and empirical to the more profound and rational.
In Psychology this change is conspicuous. The facts brought to light by
anatomists and physiologists during the last fifty years, are at length
being used towards the interpretation of this highest class of biological
phenomena; and already there is promise of a great advance. The work of Mr.
Alexander Bain, of which the second volume has been recently issued, may be
regarded as especially characteristic of the transition. It gives us in
orderly arrangement, the great mass of evidence supplied by modern science
towards the building-up of a coherent system of mental philosophy. It is
not in itself a system of mental philosophy, properly so called; but a
classified collection of materials for such a system, presented with that
method and insight which scientific discipline generates, and accompanied
with occasional passages of an analytical character. It is indeed that
which it in the main professes to be--a natural history of the mind.
Were we to say that the researches of the naturalist who collects and
dissects and describes species, bear the same relation to the researches of
the comparative anatomist tracing out the laws of organization, which Mr.
Bain's labours bear to the labours of the abstract psychologist, we should
be going somewhat too far; for Mr. Bain's work is not wholly descriptive.
Still, however, such an analogy conveys the best general conception of what
he has done; and serves most clearly to indicate its needfulness. For as,
before there can be made anything like true generalizations respecting the
classification of organisms and the laws of organization, there must be an
extensive accumulation of the facts presented in numerous organic bodies;
so, without a tolerably-complete delineation of mental phenomena of all
orders, there can scarcely arise any adequate theory of the mind. Until
recently, mental science has been pursued much as physical science was
pursued by the ancients: not by drawing conclusions from observations and
experiments, but by drawing them from arbitrary a priori assumptions. This
course, long since abandoned in the one case with immense advantage, is
gradually being abandoned in the other; and the treatment of Psychology as
a division of natural history, shows that the abandonment will soon be
complete.
Estimated as a means to higher results, Mr. Bain's work is of great value.
Of its kind it is the most scientific in conception, the most catholic in
spirit, and the most complete in execution. Besides delineating the various
classes of mental phenomena as seen under that stronger light thrown on
them by modern science, it includes in the picture much which previous
writers had omitted--partly from prejudice, partly from ignorance. We refer
more especially to the participation of bodily organs in mental changes;
and the addition to the primary mental changes, of those many secondary
ones which the actions of the bodily organs generate. Mr. Bain has, we
believe, been the first to appreciate the importance of this element in our
states of consciousness; and it is one of his merits that he shows how
constant and large an element it is. Further, the relations of voluntary
and involuntary movements are elucidated in a way that was not possible to
writers unacquainted with the modern doctrine of reflex action. And beyond
this, some of the analytical passages that here and there occur, contain
important ideas.
Valuable, however, as is Mr. Bain's work, we regard it as essentially
transitional. It presents in a digested form the results of a period of
observation; adds to these results many well-delineated facts collected by
himself; arranges new and old materials with that more scientific method
which the discipline of our times has fostered; and so prepare the way for
better generalizations. But almost of necessity its classifications and
conclusions are provisional. In the growth of each science, not only is
correct observation needful for the formation of true theory; but true
theory is needful as a preliminary to correct observation. Of course we do
not intend this assertion to be taken literally; but as a strong expression
of the fact that the two must advance hand in hand. The first crude theory
or rough classification, based on very slight knowledge of the phenomena,
is requisite as a means of reducing the phenomena to some kind of order;
and as supplying a conception with which fresh phenomena may be compared,
and their agreement or disagreement noted. Incongruities being by and by
made manifest by wider examination of cases, there comes such modification
of the theory as brings it into a nearer correspondence with the evidence.
This reacts to the further advance of observation. More extensive and
complete observation brings additional corrections of theory. And so on
till the truth is reached. In mental science, the systematic collection of
facts having but recently commenced, it is not to be expected that the
results can be at once rightly formulated. All that may be looked for are
approximate generalizations which will presently serve for the better
directing of inquiry. Hence, even were it not now possible to say in what
way it does so, we might be tolerably certain that Mr. Bain's work bears
the stamp of the inchoate state of Psychology.
We think, however, that it will not be difficult to find in what respects
its organization is provisional; and at the same time to show what must be
the nature of a more complete organization. We propose here to attempt
this: illustrating our positions from his recently-issued second volume.
* * * * *
Is it possible to make a true classification without the aid of analysis?
or must there not be an analytical basis to every true classification? Can
the real relations of things be determined by the obvious characteristics
of the things? or does it not commonly happen that certain hidden
characteristics, on which the obvious ones depend, are the truly
significant ones? This is the preliminary question which a glance at Mr.
Bain's scheme of the emotions suggests.
Though not avowedly, yet by implication, Mr. Bain assumes that a right
conception of the nature, the order, and the relations of the emotions, may
be arrived at by contemplating their conspicuous objective and subjective
characters, as displayed in the adult. After pointing out that we lack
those means of classification which serve in the case of the sensations, he
says--
"In these circumstances we must turn our attention to _the manner
of diffusion_ of the different passions and emotions, in order to
obtain a basis of classification analogous to the arrangement of the
sensations. If what we have already advanced on that subject be at
all well founded, this is the genuine turning point of the method to
be chosen, for the same mode of diffusion will always be accompanied
by the same mental experience, and each of the two aspects would
identify, and would be evidence of, the other. There is, therefore,
nothing so thoroughly characteristic of any state of feeling as the
nature of the diffusive wave that embodies it, or the various organs
specially roused into action by it, together with the manner of the
action. The only drawback is our comparative ignorance, and our
inability to discern the precise character of the diffusive currents
in every case; a radical imperfection in the science of mind as
constituted at present.
"Our own consciousness, formerly reckoned the only medium of
knowledge to the mental philosopher, must therefore be still referred
to as a principal means of discriminating the varieties of human
feeling. We have the power of noting agreement and difference among
our conscious states, and on this we can raise a structure of
classification. We recognise such generalities as pleasure, pain,
love, anger, through the property of mental or intellectual
discrimination that accompanies in our mind the fact of an emotion. A
certain degree of precision is attainable by this mode of mental
comparison and analysis; the farther we can carry such precision the
better; but that is no reason why it should stand alone to the
neglect of the corporeal embodiments through which one mind reveals
itself to others. The companionship of inward feeling with bodily
manifestation is a fact of the human constitution, and deserves to be
studied as such; and it would be difficult to find a place more
appropriate than a treatise on the mind for setting forth the
conjunctions and sequences traceable in this department of nature. I
shall make no scruple in conjoining with the description of the
mental phenomena the physical appearances, in so far as I am able to
ascertain them.
"There is still one other quarter to be referred to in settling a
complete arrangement of the emotions, namely, the varieties of human
conduct, and the machinery created in subservience to our common
susceptibilities. For example, the vast superstructure of fine art
has its foundations in human feeling, and in rendering an account of
this we are led to recognise the interesting group of artistic or
aesthetic emotions. The same outward reference to conduct and
creations brings to light the so-called moral sense in man, whose
foundations in the mental system have accordingly to be examined.
"Combining together these various indications, or sources of
discrimination,--outward objects, diffusive mode or expression,
inward consciousness, resulting conduct and institutions--I adopt the
following arrangement of the families or natural orders of emotion."
Here, then, are confessedly adopted, as bases of classification, the most
manifest characters of the emotions; as discerned subjectively, and
objectively. The mode of diffusion of an emotion is one of its outside
aspects; the institutions it generates form another of its outside aspects;
and though the peculiarities of the emotion as a state of consciousness,
seem to express its intrinsic and ultimate nature, yet such peculiarities
as are perceptible by simple introspection, must also be classed as
superficial peculiarities. It is a familiar fact that various intellectual
states of consciousness turn out, when analyzed, to have natures widely
unlike those which at first appear; and we believe the like will prove true
of emotional states of consciousness. Just as our concept of space, which
is apt to be thought a simple, undecomposable concept, is yet resolvable
into experiences quite different from that state of consciousness which we
call space; so, probably, the sentiment of affection or reverence is
compounded of elements that are severally distinct from the whole which
they make up. And much as a classification of our ideas which dealt with
the idea of space as though it were ultimate, would be a classification of
ideas by their externals; so, a classification of our emotions, which,
regarding them as simple, describes their aspects in ordinary
consciousness, is a classification of emotions by their externals.
Thus, then, Mr. Bain's grouping is throughout determined by the most
manifest attributes--those objectively displayed in the natural language of
the emotions, and in the social phenomena that result from them, and those
subjectively displayed in the aspects the emotions assume in an analytical
consciousness. And the question is--Can they be correctly grouped after
this method?
We think not; and had Mr. Bain carried farther an idea with which he has
set out, he would probably have seen that they cannot. As already said, he
avowedly adopts "the natural-history-method:" not only referring to it in
his preface, but in his first chapter giving examples of botanical and
zoological classifications, as illustrating the mode in which he proposes
to deal with the emotions. This we conceive to be a philosophical
conception; and we have only to regret that Mr. Bain has overlooked some of
its most important implications. For in what has essentially consisted the
progress of natural-history-classification? In the abandonment of grouping
by external, conspicuous characters; and in the making of certain internal,
but all-essential characters, the bases of groups. Whales are not now
ranged along with fish, because in their general forms and habits of life
they resemble fish; but they are ranged with mammals, because the type of
their organization, as ascertained by dissection, corresponds with that of
the mammals. No longer considered as sea-weeds in virtue of their forms and
modes of growth, zoophytes are now shown, by examination of their economy,
to belong to the animal kingdom.
It is found, then, that the discovery of real relationships involves
analysis. It has turned out that the earlier classifications, guided by
general resemblances, though containing much truth, and though very useful
provisionally, were yet in many cases radically wrong; and that the true
affinities of organisms, and the true homologies of their parts, are to be
made out only by examining their hidden structures. Another fact of great
significance in the history of classification is also to be noted. Very
frequently the kinship of an organism cannot be made out even by exhaustive
analysis, if that analysis is confined to the adult structure. In many
cases it is needful to examine the structure in its earlier stages; and
even in its embryonic stage. So difficult was it, for instance, to
determine the true position of the Cirrhipedia among animals, by examining
mature individuals only, that Cuvier erroneously classed them with
Mollusca, even after dissecting them; and not until their early forms were
discovered, were they clearly proved to belong to the Crustacea. So
important, indeed, is the study of development as a means to
classification, that the first zoologists now hold it to be the only
absolute criterion.
Here, then, in the advance of natural-history-classification, are two
fundamental facts, which should be borne in mind when classifying the
emotions. If, as Mr. Bain rightly assumes, the emotions are to be grouped
after the natural-history-method; then it should be the
natural-history-method in its complete form, and not in its rude form. Mr.
Bain will doubtless agree in the position, that a correct account of the
emotions in their natures and relations, must correspond with a correct
account of the nervous system--must form another side of the same ultimate
facts. Structure and function must necessarily harmonize. Structures which
have with each other certain ultimate connexions, must have functions that
have answering connexions. Structures that have arisen in certain ways,
must have functions that have arisen in parallel ways. And hence if
analysis and development are needful for the right interpretation of
structures, they must be needful for the right interpretation of functions.
Just as a scientific description of the digestive organs, must include not
only their obvious forms and connexions, but their microscopic characters,
and also the ways in which they severally result by differentiation from
the primitive mucous membrane; so must a scientific account of the nervous
system, include its general arrangements, its minute structure, and its
mode of evolution; and so must a scientific account of nervous actions,
include the answering three elements. Alike in classing separate organisms,
and in classing the parts of the same organism, the complete
natural-history-method involves ultimate analysis, aided by development;
and Mr. Bain, in not basing his classification of the emotions on
characters reached through these aids, has fallen short of the conception
with which he set out.
"But," it will perhaps be asked, "how are the emotions to be analyzed, and
their modes of evolution to be ascertained? Different animals, and
different organs of the same animal, may readily be compared in their
internal and microscopic structures, as also in their developments; but
functions, and especially such functions as the emotions, do not admit of
like comparisons."
It must be admitted that the application of these methods is here by no
means so easy. Though we can note differences and similarities between the
internal formations of two animals; it is difficult to contrast the mental
states of two animals. Though the true morphological relations of organs
may be made out by the observations of embryos; yet, where such organs are
inactive before birth, we cannot completely trace the history of their
actions. Obviously, too, the pursuance of inquiries of the kind indicated,
raises questions which science is not yet prepared to answer; as, for
instance--Whether all nervous functions, in common with all other
functions, arise by gradual differentiations, as their organs do? Whether
the emotions are, therefore, to be regarded as divergent modes of action,
that have become unlike by successive modifications? Whether, as two organs
which originally budded out of the same membrane, have not only become
different as they developed, but have also severally become compound
internally, though externally simple: so two emotions, simple and near akin
in their roots, may not only have grown unlike, but may also have grown
involved in their natures, though seeming homogeneous to consciousness. And
here, indeed, in the inability of existing science to answer these
questions which underlie a true psychological classification, we see how
purely provisional any present classification is likely to be.
Nevertheless, even now, classification may be aided by development and
ultimate analysis to a considerable extent; and the defect in Mr. Bain's
work is, that he has not systematically availed himself of them as far as
possible. Thus we may, in the first place, study the evolution of the
emotions up through the various grades of the animal kingdom: observing
which of them are earliest and exist with the lowest organization and
intelligence; in what order the others accompany higher endowments; and how
they are severally related to the conditions of life. In the second place,
we may note the emotional differences between the lower and the higher
human races--may regard as earlier and simpler those feelings which are
common to both, and as later and more compound those which are
characteristic of the most civilized. In the third place, we may observe
the order in which the emotions unfold during the progress from infancy to
maturity. And lastly, comparing these three kinds of emotional development,
displayed in the ascending grades of the animal kingdom, in the advance of
the civilized races, and in individual history, we may see in what respects
they harmonize, and what are the implied general truths.
Having gathered together and generalized these several classes of facts,
analysis of the emotions would be made easier. Setting out with the
unquestionable assumption, that every new form of emotion making its
appearance in the individual or the race, is a modification of some
pre-existing emotion, or a compounding of several pre-existing emotions; we
should be greatly aided by knowing what always are the pre-existing
emotions. When, for example, we find that very few if any of the lower
animals show any love of accumulation, and that this feeling is absent in
infancy--when we see that an infant in arms exhibits anger, fear, wonder,
while yet it manifests no desire of permanent possession, and that a brute
which has no acquisitive emotion can nevertheless feel attachment,
jealousy, love of approbation; we may suspect that the feeling which
property satisfies, is compounded out of simpler and deeper feelings. We
may conclude that as, when a dog hides a bone, there must exist in him a
prospective gratification of hunger; so there must similarly at first, in
all cases where anything is secured or taken possession of, exist an ideal
excitement of the feeling which that thing will gratify. We may further
conclude that when the intelligence is such that a variety of objects come
to be utilized for different purposes--when, as among savages, divers wants
are satisfied through the articles appropriated for weapons, shelter,
clothing, ornament; the act of appropriating comes to be one constantly
involving agreeable associations, and one which is therefore pleasurable,
irrespective of the end subserved. And when, as in civilized life, the
property acquired is of a kind not conducing to one order of
gratifications, but is capable of administering to all gratifications, the
pleasure of acquiring property grows more distinct from each of the various
pleasures subserved--is more completely differentiated into a separate
emotion.
This illustration, roughly as it is sketched, will show what we mean by the
use of comparative psychology in aid of classification. Ascertaining by
induction the actual order of evolution of the emotions, we are led to
suspect this to be their order of successive dependence; and are so led to
recognize their order of ascending complexity; and by consequence their
true groupings.
Thus, in the very process of arranging the emotions into grades, beginning
with those involved in the lowest forms of conscious activity and end with
those peculiar to the adult civilized man, the way is opened for that
ultimate analysis which alone can lead us to the true science of the
matter. For when we find both that there exist in a man feelings which do
not exist in a child, and that the European is characterized by some
sentiments which are wholly or in a great part absent from the savage--when
we see that, besides the new emotions that arise spontaneously as the
individual becomes completely organized, there are new emotions making
their appearance in the more advanced divisions of our race; we are led to
ask--How are new emotions generated? The lowest savages have not even the
ideas of justice or mercy: they have neither words for them nor can they be
made to conceive them; and the manifestation of them by Europeans they
ascribe to fear or cunning. There are aesthetic emotions common among
ourselves, that are scarcely in any degree experienced by some inferior
races; as, for instance, those produced by music. To which instances may be
added the less marked but more numerous contrasts that exist between
civilized races in the degrees of their several emotions. And if it is
manifest, both that all the emotions are capable of being permanently
modified in the course of successive generations, and that what must be
classed as new emotions may be brought into existence; then it follows that
nothing like a true conception of the emotions is to be obtained, until we
understand how they are evolved.
Comparative psychology, while it raises this inquiry, prepares the way for
answering it. When observing the differences between races, we can scarcely
fail to observe also how these differences correspond with differences in
their conditions of existence, and therefore in their daily experiences.
Note the contrast between the circumstances and between the emotional
natures of savage and civilized. Among the lowest races of men, love of
property stimulates to the obtainment only of such things as satisfy
immediate desires or desires of the immediate future. Improvidence is the
rule: there is little effort to meet remote contingencies. But the growth
of established societies, having gradually given security of possession,
there has been an increasing tendency to provide for coming years: there
has been a constant exercise of the feeling which is satisfied by a
provision for the future; and there has been a growth of this feeling so
great that it now prompts accumulation to an extent beyond what is needful.
Note, again, that under the discipline of social life--under a comparative
abstinence from aggressive actions, and a performance of those
mutually-serviceable actions implied by the division of labour--there has
been a development of those gentle emotions of which inferior races exhibit
but the rudiments. Savages delight in giving pain rather than pleasure--are
almost devoid of sympathy. While among ourselves philanthropy organizes
itself in laws, establishes numerous institutions, and dictates countless
private benefactions.
From which and other like facts, does it not seem an unavoidable inference
that new emotions are developed by new experiences--new habits of life? All
are familiar with the truth, that in the individual, each feeling may be
strengthened by performing those actions which it prompts; and to say that
the feeling is _strengthened_, is to say that it is in part _made_ by these
actions. We know further, that not unfrequently, individuals, by
persistence in special courses of conduct, acquire special likings for such
courses disagreeable as these may be to others; and these whims, or morbid
tastes, imply incipient emotions corresponding to these special activities.
We know that emotional characteristics, in common with all others, are
hereditary; and the differences between civilized nations descended from
the same stock, show us the cumulative results of small modifications
hereditarily transmitted. And when we see that between savage and civilized
races, which diverged from each other in the remote past, and have for a
hundred generations followed modes of life becoming ever more unlike, there
exist still greater emotional contrasts; may we not infer that the more or
less distinct emotions which characterize civilized races, are the
organized results of certain daily-repeated combinations of mental states
which social life involves? Must we not say that habits not only modify
emotions in the individual, and not only beget tendencies to like habits
and accompanying emotions in descendants, but that when the conditions of
the race make the habits persistent, this progressive modification may go
on to the extent of producing emotions so far distinct as to seem new? And
if so, we may suspect that such new emotions, and by implication all
emotions analytically considered, consist of aggregated and consolidated
groups of those simpler feelings which habitually occur together in
experience: that they result from combined experiences, and are constituted
of them.
When, in the circumstances of any race, some one kind of action or set of
actions, sensation or set of sensations, is usually followed, or
accompanied by, various other sets of actions or sensations, and so entails
a large mass of pleasurable or painful states of consciousness; these, by
frequent repetition, become so connected together that the initial action
or sensation brings the ideas of all the rest crowding into consciousness:
producing, in a degree, the pleasures or pains that have before been felt
in reality. And when this relation, besides being frequently repeated in
the individual, occurs in successive generations, all the many nervous
actions involved tend to grow organically connected. They become
incipiently reflex; and on the occurrence of the appropriate stimulus, the
whole nervous apparatus which in past generations was brought into activity
by this stimulus, becomes nascently excited. Even while yet there have been
no individual experiences, a vague feeling of pleasure or pain is produced;
constituting what we may call the body of the emotion. And when the
experiences of past generations come to be repeated in the individual, the
emotion gains both strength and definiteness; and is accompanied by the
appropriate specific ideas.
This view of the matter, which we believe the established truths of
Physiology and Psychology unite in indicating, and which is the view that
generalizes the phenomena of habit, of national characteristics, of
civilization in its moral aspects, at the same time that it gives us a
conception of emotion in its origin and ultimate nature, may be illustrated
from the mental modifications undergone by animals.
It is well-known that on newly-discovered lands not inhabited by man, birds
are so devoid of fear as to allow themselves to be knocked over with
sticks; but that in the course of generations, they acquire such a dread of
man as to fly on his approach; and that this dread is manifested by young
as well as old. Now unless this change be ascribed to the killing-off of
the least fearful, and the preservation and multiplication of the more
fearful, which, considering the comparatively small number killed by man,
is an inadequate cause; it must be ascribed to accumulated experiences; and
each experience must be held to have a share in producing it. We must
conclude that in each bird that escapes with injuries inflicted by man, or
is alarmed by the outcries of other members of the flock (gregarious
creatures of any intelligence being necessarily more or less sympathetic),
there is established an association of ideas between the human aspect and
the pains, direct and indirect, suffered from human agency. And we must
further conclude, that the state of consciousness which impels the bird to
take flight, is at first nothing more than an ideal reproduction of those
painful impressions which before followed man's approach; that such ideal
reproduction becomes more vivid and more massive as the painful
experiences, direct or sympathetic, increase; and that thus the emotion in
its incipient state, is nothing else than an aggregation of the revived
pains before experienced.
As, in the course of generations, the young birds of this race begin to
display a fear of man before yet they have been injured by him; it is an
unavoidable inference that the nervous system of the race has been
organically modified by these experiences: we have no choice but to
conclude that when a young bird is thus led to fly, it is because the
impression produced on its senses by the approaching man, entails, through
an incipiently-reflex action, a partial excitement of all those nerves
which in its ancestors had been excited under the like conditions; that
this partial excitement has its accompanying painful consciousness; and
that the vague painful consciousness thus arising, constitutes emotion
proper--_emotion undecomposable into specific experiences, and therefore
seemingly homogeneous_.
If such be the explanation of the fact in this case, then it is in all
cases. If emotion is so generated here, then it is so generated throughout.
We must perforce conclude that the emotional modifications displayed by
different nations, and those higher emotions by which civilized are
distinguished from savage, are to be accounted for on the same principle.
And concluding this, we are led strongly to suspect that the emotions in
general have severally thus originated.
Perhaps we have now made sufficiently clear what we mean by the study of
the emotions through analysis and development. We have aimed to justify the
positions that, without analysis aided by development, there cannot be a
true natural history of the emotions; and that a natural history of the
emotions based on external characters, can be but provisional. We think
that Mr. Bain, in confining himself to an account of the emotions as they
exist in the adult civilized man, has neglected those classes of facts out
of which the science of the matter must chiefly be built. It is true that
he has treated of habits as modifying emotions in the individual; but he
has not recognized the fact, that where conditions render habits persistent
in successive generations, such modifications are cumulative: he has not
hinted that the modifications produced by habit are emotions in the making.
It is true, also, that he occasionally refers to the characteristics of
children; but he does not systematically trace the changes through which
childhood passes into manhood, as throwing light on the order and genesis
of the emotions. It is further true that he here and there refers to
national traits in illustration of his subject; but these stand as isolated
facts, having no general significance: there is no hint of any relation
between them and the national circumstances; while all those many moral
contrasts between lower and higher races which throw great light on
classification, are passed over. And once more, it is true that many
passages of his work, and sometimes, indeed, whole sections of it, are
analytical; but his analyses are incidental--they do not underlie his
entire scheme, but are here and there added to it. In brief, he has written
a Descriptive Psychology, which does not appeal to Comparative Psychology
and Analytical Psychology for its leading ideas. And in doing this, he has
omitted much that should be included in a natural history of the mind;
while to that part of the subject with which he has dealt, he has given a
necessarily-imperfect organization.
* * * * *
Even leaving out of view the absence of those methods and criteria on which
we have been insisting, it appears to us that meritorious as is Mr. Bain's
book in its details, it is defective in some of its leading ideas. The
first paragraphs of his first chapter, quite startled us by the strangeness
of their definitions--a strangeness which can scarcely be ascribed to
laxity of expression. The paragraphs run thus:--
"Mind is comprised under three heads--Emotion, Volition, and
Intellect.
"EMOTION is the name here used to comprehend all that is understood
by feelings, states of feeling, pleasures, pains, passions,
sentiments, affections. Consciousness, and conscious states also for
the most part denote modes of emotion, although there is such a thing
as the Intellectual consciousness.
"VOLITION, on the other hand, indicates the great fact that our
Pleasures and Pains, which are not the whole of our emotions, prompt
us to action, or stimulate the active machinery of the living
framework to perform such operations as procure the first and abate
the last. To withdraw from a scalding heat and cling to a gentle
warmth, are exercises of volition."
The last of these definitions, which we may most conveniently take first,
seems to us very faulty. We cannot but feel astonished that Mr. Bain,
familiar as he is with the phenomena of reflex action, should have so
expressed himself as to include a great part of them along with the
phenomena of volition. He seems to be ignoring the discriminations of
modern science, and returning to the vague conceptions of the past--nay
more, he is comprehending under volition what even the popular speech would
hardly bring under it. If you were to blame any one for snatching his foot
from the scalding water into which he had inadvertently put it, he would
tell you that he could not help it; and his reply would be indorsed by the
general experience, that the withdrawal of a limb from contact with
something extremely hot, is quite involuntary--that it takes place not only
without volition, but in defiance of an effort of will to maintain the
contact. How, then, can that be instanced as an example of volition, which
occurs even when volition is antagonistic? We are quite aware that it is
impossible to draw any absolute line of demarcation between automatic
actions and actions which are not automatic. Doubtless we may pass
gradually from the purely reflex, through the consensual, to the voluntary.
Taking the case Mr. Bain cites, it is manifest that from a heat of such
moderate degree that the withdrawal from it is wholly voluntary, we may
advance by infinitesimal steps to a heat which compels involuntary
withdrawal; and that there is a stage at which the voluntary and
involuntary actions are mixed. But the difficulty of absolute
discrimination is no reason for neglecting the broad general contrast; any
more than it is for confounding light with darkness. If we are to include
as examples of volition, all cases in which pleasures and pains "stimulate
the active machinery of the living framework to perform such operations as
procure the first and abate the last," then we must consider sneezing and
coughing, as examples of volition; and Mr. Bain surely cannot mean this.
Indeed, we must confess ourselves at a loss. On the one hand if he does not
mean it, his expression is lax to a degree that surprises us in so careful
a writer. On the other hand, if he does mean it, we cannot understand his
point of view.
A parallel criticism applies to his definition of Emotion. Here, too, he
has departed from the ordinary acceptation of the word; and, as we think,
in the wrong direction. Whatever may be the interpretation that is
justified by its derivation, the word Emotion has come generally to mean
that kind of feeling which is not a direct result of any action on the
organism; but is either an indirect result of such action, or arises quite
apart from such action. It is used to indicate those sentient states which
are independently generated in consciousness; as distinguished from those
generated in our corporeal framework, and known as sensations. Now this
distinction, tacitly made in common speech, is one which Psychology cannot
well reject; but one which it must adopt, and to which it must give
scientific precision. Mr. Bain, however, appears to ignore any such
distinction. Under the term "emotion," he includes not only passions,
sentiments, affections, but all "feelings, states of feeling, pleasures,
pains,"--that is, all sensations. This does not appear to be a mere lapse
of expression; for when, in the opening sentence, he asserts that "mind is
comprised under the three heads--Emotion, Volition, and Intellect," he of
necessity implies that sensation is included under one of these heads; and
as it cannot be included under Volition or Intellect, it must be classed
with Emotion: as it clearly is in the next sentence.
We cannot but think this is a retrograde step. Though distinctions which
have been established in popular thought and language, are not unfrequently
merged in the higher generalizations of science (as, for instance, when
crabs and worms are grouped together in the sub-kingdom _Annulosa_;) yet
science very generally recognizes the validity of these distinctions, as
real though not fundamental. And so in the present case. Such community as
analysis discloses between sensation and emotion, must not shut out the
broad contrast that exists between them. If there needs a wider word, as
there does, to signify any sentient state whatever; then we may fitly adopt
for this purpose the word currently so used, namely, "Feeling." And
considering as Feelings all that great division of mental states which we
do not class as Cognitions, may then separate this great division into the
two orders, Sensations and Emotions.
* * * * *
And here we may, before concluding, briefly indicate the leading outlines
of a classification which reduces this distinction to a scientific form,
and developes it somewhat further--a classification which, while suggested
by certain fundamental traits reached without a very lengthened inquiry, is
yet, we believe, in harmony with that disclosed by detailed analysis.
Leaving out of view the Will, which is a simple homogeneous mental state,
forming the link between feeling and action, and not admitting of
subdivisions; our states of consciousness fall into two great
classes--COGNITIONS and FEELINGS.
COGNITIONS, or those modes of mind in which we are occupied with the
_relations_ that subsist among our feelings, are divisible into four great
sub-classes.
_Presentative cognitions_; or those in which consciousness is occupied in
localizing a sensation impressed on the organism--occupied, that is, with
the relation between this presented mental state and those other presented
mental states which make up our consciousness of the part affected: as when
we cut ourselves.
_Presentative-representative cognitions_; or those in which consciousness
is occupied with the relation between a sensation or group of sensations
and the representations of those various other sensations that accompany it
in experience. This is what we commonly call perception--an act in which,
along with certain impressions presented to consciousness, there arise in
consciousness the ideas of certain other impressions ordinarily connected
with the presented ones: as when its visible form and colour, lead us to
mentally endow an orange with all its other attributes.
_Representative cognitions_; or those in which consciousness is occupied
with the relations among ideas or represented sensations: as in all acts of
recollection.
_Re-representative cognitions_; or those in which the occupation of
consciousness is not by representation of special relations, that have
before been presented to consciousness; but those in which such represented
special relations are thought of merely as comprehended in a general
relation--those in which the concrete relations once experienced, in so far
as they become objects of consciousness at all, are incidentally
represented, along with the abstract relation which formulates them. The
ideas resulting from this abstraction, do not themselves represent actual
experiences; but are symbols which stand for groups of such actual
experiences--represent aggregates of representations. And thus they may be
called re-representative cognitions. It is clear that the process of
re-representation is carried to higher stages, as the thought becomes more
abstract.
FEELINGS, or those modes of mind in which we are occupied, not with the
relations subsisting between our sentient states, but with the sentient
states themselves, are divisible into four parallel sub-classes.
_Presentative feelings_, ordinarily called sensations, are those mental
states in which, instead of regarding a corporeal impression as of this or
that kind, or as located here or there, we contemplate it in itself as
pleasure or pain: as when eating.
_Presentative-representative feelings_, embracing a great part of what we
commonly call emotions, are those in which a sensation, or group of
sensations or group of sensations and ideas, arouses a vast aggregation of
represented sensations; partly of individual experience, but chiefly deeper
than individual experience, and, consequently, indefinite. The emotion of
terror may serve as an example. Along with certain impressions made on the
eyes or ears, or both, are recalled in consciousness many of the pains to
which such impressions have before been the antecedents; and when the
relation between such impressions and such pains has been habitual in the
race, the definite ideas of such pains which individual experience has
given, are accompanied by the indefinite pains that result from inherited
experience--vague feelings which we may call organic representations. In an
infant, crying at a strange sight or sound while yet in the nurse's arms,
we see these organic representations called into existence in the shape of
dim discomfort, to which individual experience has yet given no specific
outlines.
_Representative feelings_, comprehending the ideas of the feelings above
classed, when they are called up apart from the appropriate external
excitements. As instances of these may be named the feelings with which the
descriptive poet writes, and which are aroused in the minds of his readers.
_Re-representative feelings_, under which head are included those more
complex sentient states that are less the direct results of external
excitements than the indirect or reflex results of them. The love of
property is a feeling of this kind. It is awakened not by the presence of
any special object, but by ownable objects at large; and it is not from the
mere presence of such object, but from a certain ideal relation to them,
that it arises. As before shown (p. 311) it consists, not of the
represented advantages of possessing this or that, but of the represented
advantages of possession in general--is not made up of certain concrete
representations, but of the abstracts of many concrete representations; and
so is re-representative. The higher sentiments, as that of justice, are
still more completely of this nature. Here the sentient state is compounded
out of sentient states that are themselves wholly, or almost wholly,
re-representative: it involves representations of those lower emotions
which are produced by the possession of property, by freedom of action,
etc.; and thus is re-representative in a higher degree.
This classification, here roughly indicated and capable of further
expansion, will be found in harmony with the results of detailed analysis
aided by development. Whether we trace mental progression through the
grades of the animal kingdom, through the grades of mankind, or through the
stages of individual growth; it is obvious that the advance, alike in
cognitions and feelings, is, and must be, from the presentative to the more
and more remotely representative. It is undeniable that intelligence
ascends from those simple perceptions in which consciousness is occupied in
localizing and classifying sensations, to perceptions more and more
compound, to simple reasoning, to reasoning more and more complex and
abstract--more and more remote from sensation. And in the evolution of
feelings, there is a parallel series of steps. Simple sensations;
sensations combined together; sensations combined with represented
sensations; represented sensations organized into groups, in which their
separate characters are very much merged; representations of these
representative groups, in which the original components have become still
more vague. In both cases, the progress has necessarily been from the
simple and concrete to the complex and abstract: and as with the
cognitions, so with the feelings, this must be the basis of classification.
The space here occupied with criticisms on Mr. Bain's work, we might have
filled with exposition and eulogy, had we thought this the more important.
Though we have freely pointed out what we conceive to be its defects, let
it not be inferred that we question its great merits. We repeat that, as a
natural history of the mind, we believe it to be the best yet produced. It
is a most valuable collection of carefully-elaborated materials. Perhaps we
cannot better express our sense of its worth, than by saying that, to those
who hereafter give to this branch of Psychology a thoroughly scientific
organization, Mr. Bain's book will be indispensable.
VIII. ILLOGICAL GEOLOGY.
That proclivity to generalization which is possessed in greater or less
degree by all minds, and without which, indeed, intelligence cannot exist,
has unavoidable inconveniences. Through it alone can truth be reached; and
yet it almost inevitably betrays into error. But for the tendency to
predicate of every other case, that which has been found in the observed
cases, there could be no rational thinking; and yet by this indispensable
tendency, men are perpetually led to found, on limited experience,
propositions which they wrongly assume to be universal or absolute. In one
sense, however, this can scarcely be regarded as an evil; for without
premature generalizations the true generalization would never be arrived
at. If we waited till all the facts were accumulated before trying to
formulate them, the vast unorganized mass would be unmanageable. Only by
provisional grouping can they be brought into such order as to be dealt
with; and this provisional grouping is but another name for premature
generalization.
How uniformly men follow this course, and how needful the errors are as
steps to truth, is well illustrated in the history of Astronomy. The
heavenly bodies move round the Earth in circles, said the earliest
observers: led partly by the appearances, and partly by their experiences
of central motions in terrestrial objects, with which, as all circular,
they classed the celestial motions from lack of any alternative conception.
Without this provisional belief, wrong as it was, there could not have been
that comparison of positions which showed that the motions are not
representable by circles; and which led to the hypothesis of epicycles and
eccentrics. Only by the aid of this hypothesis, equally untrue, but capable
of accounting more nearly for the appearances, and so of inducing more
accurate observations--only thus did it become possible for Copernicus to
show that the heliocentric theory is more feasible than the geocentric
theory; or for Kepler to show that the planets move round the sun in
ellipses. Yet again, without the aid of this approximate truth discovered
by Kepler, Newton could not have established that general law from which it
follows, that the motion of a heavenly body round its centre of gravity is
not necessarily in an ellipse, but may be in any conic section. And lastly,
it was only after the law of gravitation had been verified, that it became
possible to determine the actual courses of planets, satellites, and
comets; and to prove that, in consequence of perturbations, their orbits
always deviate, more or less, from regular curves. Thus, there followed one
another five provisional theories of the Solar System, before the sixth and
absolutely true theory was reached. In which five provisional theories,
each for a time held as final, we may trace both the tendency men have to
leap from scanty data to wide generalizations, that are either untrue or
but partially true; and the necessity there is for these transitional
generalizations as steps to the final one.
In the progress of geological speculation the same laws of thought are
clearly displayed. We have dogmas that were more than half false, passing
current for a time as universal truths. We have evidence collected in proof
of these dogmas; by and by a colligation of facts in antagonism with them;
and eventually a consequent modification. In conformity with this somewhat
improved hypothesis, we have a better classification of facts; a greater
power of arranging and interpreting the new facts now rapidly gathered
together; and further resulting corrections of hypothesis. Being, as we are
at present, in the midst of this process, it is not possible to give an
adequate account of the development of geological science as thus regarded:
the earlier stages are alone known to us. Not only, however, is it
interesting to observe how the more advanced views now received respecting
the Earth's history, have been evolved out of the crude views which
preceded them; but we shall find it extremely instructive to observe this.
We shall see how greatly the old ideas still sway, both the general mind,
and the minds of geologists themselves. We shall see how the kind of
evidence that has in part abolished these old ideas, is still daily
accumulating, and threatens to make other like revolutions. In brief, we
shall see whereabouts we are in the elaboration of a true theory of the
Earth; and, seeing our whereabouts, shall be the better able to judge,
among various conflicting opinions, which best conform to the ascertained
direction of geological discovery.
It is alike needless and impracticable here to enumerate the many
speculations which were in earlier ages propounded by acute
men--speculations some of which contained portions of truth. Falling in
unfit times, these speculations did not germinate; and hence do not concern
us. We have nothing to do with ideas, however good, out of which no science
grew; but only with those which gave origin to the system of Geology that
now exists. We therefore begin with Werner.
Taking for data the appearances of the Earth's crust in a narrow district
of Germany; observing the constant order of superposition of strata, and
their respective physical characters; Werner drew the inference that strata
of like characters succeeded each other in like order over the entire
surface of the Earth. And seeing, from the laminated structure of many
formations and the organic remains contained in others, that they were
sedimentary; he further inferred that these universal strata had been in
succession precipitated from a chaotic menstruum which once covered our
planet. Thus, on a very incomplete acquaintance with a thousandth part of
the Earth's crust, he based a sweeping generalization applying to the whole
of it. This Neptunist hypothesis, mark, borne out though it seemed to be by
the most conspicuous surrounding facts, was quite untenable if analyzed.
That a universal chaotic menstruum should deposit, one after another,
numerous sharply-defined strata, differing from each other in composition,
is incomprehensible. That the strata so deposited should contain the
remains of plants and animals, which could not have lived under the
supposed conditions, is still more incomprehensible. Physically absurd,
however, as was this hypothesis, it recognized, though under a distorted
form, one of the great agencies of geological change--that of water. It
served also to express the fact that the formations of the Earth's crust
stand in some kind of order. Further, it did a little towards supplying a
nomenclature, without which much progress was impossible. Lastly, it
furnished a standard with which successions of strata in various regions
could be compared, the differences noted, and the actual sections
tabulated. It was the first provisional generalization; and was useful, if
not indispensable, as a step to truer ones.
Following this rude conception, which ascribed geological phenomena to one
agency, acting during one primeval epoch, there came a greatly-improved
conception, which ascribed them to two agencies, acting alternately during
successive epochs. Hutton, perceiving that sedimentary deposits were still
being formed at the bottom of the sea from the detritus carried down by
rivers; perceiving, further, that the strata of which the visible surface
chiefly consists, bore marks of having been similarly formed out of
pre-existing land; and inferring that these strata could have become land
only by upheaval after their deposit; concluded that throughout an
indefinite past, there had been periodic convulsions, by which continents
were raised, with intervening eras of repose, during which such continents
were worn down and transformed into new marine strata, fated to be in their
turns elevated above the surface of the ocean. And finding that igneous
action, to which sundry earlier geologists had ascribed basaltic rocks, was
in countless places a source of disturbance, he taught that from it
resulted these periodic convulsions. In this theory we see:--first, that
the previously-recognized agency of water was conceived to act, not as by
Werner, after a manner of which we have no experience, but after a manner
daily displayed to us; and second, that the igneous agency, before
considered only as a cause of special formations, was recognized as a
universal agency, but assumed to act in an unproved way. Werner's sole
process, Hutton developed from the catastrophic and inexplicable into the
uniform and explicable; while that antagonistic second process, of which he
first adequately estimated the importance, was regarded by him as a
catastrophic one, and was not assimilated to known processes--not
explained. We have here to note, however, that the facts collected and
provisionally arranged in conformity with Werner's theory, served, after a
time, to establish Hutton's more rational theory--in so far, at least, as
aqueous formations are concerned; while the doctrine of periodic
subterranean convulsions, crudely as it was conceived by Hutton, was a
temporary generalization needful as a step towards the theory of igneous
action.
Since Hutton's time, the development of geological thought has gone still
further in the same direction. These early sweeping doctrines have received
additional qualifications. It has been discovered that more numerous and
more heterogeneous agencies have been at work, than was at first believed.
The igneous hypothesis has been rationalized, as the aqueous one had
previously been: the gratuitous assumption of vast elevations suddenly
occurring after long intervals of quiescence, has grown into the consistent
theory, that islands and continents are the accumulated results of
successive small upheavals, like those experienced in ordinary earthquakes.
To speak more specifically, we find, in the first place, that instead of
assuming the denudation produced by rain and rivers to be the sole means of
wearing down lands and producing their irregularities of surface,
geologists now see that denudation is only a part-cause of such
irregularities; and further, that the new strata deposited at the bottom of
the sea, are not the products of river-sediment solely, but are in part due
to the action of waves and tidal currents on the coasts. In the second
place, we find that Hutton's conception of upheaval by subterranean forces,
has not only been modified by assimilating these subterranean forces to
ordinary earthquake-forces; but modern inquiries have shown that, besides
elevations of surface, subsidences are thus produced; that local upheavals,
as well as the general upheavals, which raise continents, come within the
same category; and that all these changes are probably consequent on the
progressive collapse of the Earth's crust upon its cooling and contracting
nucleus--the only adequate cause. In the third place, we find that beyond
these two great antagonist agencies, modern Geology recognises sundry minor
ones: as those of glaciers and icebergs; those of coral-polypes; those of
_Protozoa_ having siliceous or calcareous shells--each of which agencies,
insignificant as it seems, is found capable of slowly working terrestrial
changes of considerable magnitude. Thus, then, the recent progress of
Geology has been a still further departure from primitive conceptions.
Instead of one catastrophic cause, once in universal action, as supposed by
Werner--instead of one general continuous cause, antagonized at long
intervals by a catastrophic cause, as taught by Hutton; we now recognize
several causes, all more or less general and continuous. We no longer
resort to hypothetical agencies to explain the phenomena displayed by the
Earth's crust; but we are day by day more clearly perceiving that these
phenomena have arisen from forces like those now at work, which have acted
in all varieties of combination, through immeasurable periods of time.
* * * * *
Having thus briefly traced the evolution of geologic science, and noted its
present form, let us go on to observe the way in which it is still swayed
by the crude hypotheses it set out with; so that even now, old doctrines
that are abandoned as untenable in theory, continue in practice to mould
the ideas of geologists, and to foster sundry beliefs that are logically
indefensible. We shall see, both how those simple sweeping conceptions with
which the science commenced, are those which every student is apt at first
to seize hold of, and how several influences conspire to maintain the twist
thus resulting--how the original nomenclature of periods and formations
necessarily keeps alive the original implications; and how the need for
arranging new data in some order, naturally results in their being thrust
into the old classification, unless their incongruity with it is very
glaring. A few facts will best prepare the way for criticism.
Up to 1839 it was inferred, from their crystalline character, that the
metamorphic rocks of Anglesea are more ancient than any rocks of the
adjacent main land; but it has since been shown that they are of the same
age with the slates and grits of Carnarvon and Merioneth. Again, slaty
cleavage having been first found only in the lowest rocks, was taken as an
indication of the highest antiquity: whence resulted serious mistakes; for
this mineral characteristic is now known to occur in the Carboniferous
system. Once more, certain red conglomerates and grits on the north-west
coast of Scotland, long supposed from their lithological aspect to belong
to the Old Red Sandstone, are now identified with the Lower Silurians.
These are a few instances of the small trust to be placed in mineral
qualities, as evidence of the ages or relative positions of strata. From
the recently-published third edition of _Siluria_, may be culled numerous
facts of like implication. Sir R. Murchison considers it ascertained, that
the siliceous Stiper stones of Shropshire are the equivalents of the
Tremadock slates of North Wales. Judged by their fossils, Bala slate and
limestone are of the same age as the Caradoc sandstone, lying forty miles
off. In Radnorshire, the formation classed as upper Llandovery rock, is
described at different spots, as "sandstone or conglomerate," "impure
limestone," "hard coarse grits," "siliceous grit"--a considerable variation
for so small an area as that of a county. Certain sandy beds on the left
bank of the Towy, which Sir R. Murchison had, in his _Silurian System_,
classed as Caradoc sandstone (evidently from their mineral characters), he
now finds, from their fossils, belong to the Llandeilo formation.
Nevertheless, inferences from mineral characters are still habitually drawn
and received. Though _Siluria_, in common with other geological works,
supplies numerous proofs that rocks of the same age are often of
widely-different composition a few miles off, while rocks of widely
different ages are often of similar composition; and though Sir. R.
Murchison shows us, as in the case just cited, that he has himself in past
times been misled by trusting to lithological evidence; yet his reasoning,
all through _Siluria_, shows that he still thinks it natural to expect
formations of the same age to be chemically similar, even in remote
regions. For example, in treating of the Silurian rocks of South Scotland,
he says:--"When traversing the tract between Dumfries and Moffat in 1850,
it occurred to me that the dull reddish or purple sandstone and schist to
the north of the former town, which so resembled the bottom rocks of the
Longmynd, Llanberis, and St. David's, would prove to be of the same age;"
and further on he again insists upon the fact that these strata "are
absolutely of the same composition as the bottom rocks of the Silurian
region."
On this unity of mineral character it is, that this Scottish formation is
concluded to be contemporaneous with the lowest formations in Wales; for
the scanty palaeontological evidence suffices neither for proof nor
disproof. Now, had there been a continuity of like strata in like order
between Wales and Scotland, there might have been little to criticise in
this conclusion. But since Sir R. Murchison himself admits, that in
Westmoreland and Cumberland, some members of the system "assume a
lithological aspect different from what they maintain in the Silurian and
Welsh region," there seems no reason to expect mineralogical continuity in
Scotland. Obviously therefore, the assumption that these Scottish
formations are of the same age with the Longmynd of Shropshire, implies the
latent belief that certain mineral characters indicate certain eras.
Far more striking instances, however, of the influence of this latent
belief remain to be given. Not in such comparatively near districts as the
Scottish lowlands only, does Sir R. Murchison expect a repetition of the
Longmynd strata; but in the Rhenish provinces, certain "quartzose
flagstones and grits, like those of the Longmynd," are seemingly concluded
to be of contemporaneous origin, because of their likeness. "Quartzites in
roofing-slates with a greenish tinge that reminded us of the lower slates
of Cumberland and Westmoreland," are evidently suspected to be of the same
age. In Russia, he remarks that the carboniferous limestones "are overlaid
along the western edge of the Ural chain by sandstones and grits, which
occupy much the same place in the general series as the millstone grit of
England;" and in calling this group, as he does, the "representative of the
millstone grit," Sir R. Murchison clearly shows that he thinks likeness of
mineral composition some evidence of equivalence in time, even at that
great distance. Nay, on the flanks of the Andes and in the United States,
such similarities are looked for, and considered as significant of certain
ages. Not that Sir R. Murchison contends theoretically for this relation
between lithological character and date. For on the page from which we have
just quoted (_Siluria_, p. 387), he says, that "whilst the soft Lower
Silurian clays and sands of St. Petersburg have their equivalents in the
hard schists and quartz rocks with gold veins in the heart of the Ural
mountains, the equally soft red and green Devonian marls of the Valdai
Hills are represented on the western flank of that chain, by hard,
contorted, and fractured limestones." But these, and other such admissions,
seem to go for little. Whilst himself asserting that the Potsdam-sandstone
of North America, the Lingula-flags of England, and the alum-slates of
Scandinavia are of the same period--while fully aware that among the
Silurian formations of Wales, there are oolitic strata like those of
secondary age; yet is his reasoning more or less by the
assumption, that formations of like qualities probably belong to the same
era. Is it not manifest, then, that the exploded hypothesis of Werner
continues to influence geological speculation?
"But," it will perhaps be said, "though individual strata are not
continuous over large areas, yet systems of strata are. Though within a few
miles the same bed gradually passes from clay into sand, or thins out and
disappears, yet the group of strata to which it belongs does not do so; but
maintains in remote regions the same relations to other groups."
This is the generally-current belief. On this assumption the received
geological classifications appear to be framed. The Silurian system, the
Devonian system, the Carboniferous system, etc., are set down in our books
as groups of formations which everywhere succeed each other in a given
order; and are severally everywhere of the same age. Though it may not be
asserted that these successive systems are universal; yet it seems to be
tacitly assumed that they are so. In North and South America, in Asia, in
Australia, sets of strata are assimilated to one or other of these groups;
and their possession of certain mineral characters and a certain order of
superposition are among the reasons assigned for so assimilating them.
Though, probably, no competent geologist would contend that the European
classification of strata is applicable to the globe as a whole; yet most,
if not all geologists, write as though it were so. Among readers of works
on Geology, nine out of ten carry away the impression that the divisions,
Primary, Secondary and Tertiary, are of absolute and uniform application;
that these great divisions are separable into subdivisions, each of which
is definitely distinguishable from the rest, and is everywhere recognizable
by its characters as such or such; and that in all parts of the Earth,
these minor systems severally began and ended at the same time. When they
meet with the term "carboniferous era," they take for granted that it was
an era universally carboniferous--that it was, what Hugh Miller indeed
actually describes it, an era when the Earth bore a vegetation far more
luxuriant than it has since done; and were they in any of our colonies to
meet with a coal-bed, they would conclude that, as a matter of course, it
was of the same age as the English coal-beds.
Now this belief that geologic "systems" are universal, is quite as
untenable as the other. It is just as absurd when considered _a priori_;
and it is equally inconsistent with the facts. Though some series of strata
classed together as Oolite, may range over a wider district than any one
stratum of the series; yet we have but to ask what were the circumstances
of its deposit, to see that the Oolitic series, like one of its individual
strata, must be of local origin; and that there is not likely to be
anywhere else, a series that exactly corresponds, either in its characters
or in its commencement and termination. For the formation of such a series
implies an area of subsidence, in which its component beds were thrown
down. Every area of subsidence is necessarily limited; and to suppose that
there exist elsewhere groups of beds completely answering to those known as
Oolite, is to suppose that, in contemporaneous areas of subsidence, like
processes were going on. There is no reason to suppose this; but every
reason to suppose the reverse. That in contemporaneous areas of subsidence
throughout the globe, the conditions would cause the formation of Oolite,
or anything like it, is an assumption which no modern geologist would
openly make: he would say that the equivalent series of beds found
elsewhere, would very likely be of dissimilar mineral character.
Moreover, in these contemporaneous areas of subsidence, the phenomena going
on would not only be more or less different in kind; but in no two cases
would they be likely to agree in their commencements and terminations. The
probabilities are greatly against separate portions of the Earth's surface
beginning to subside at the same time, and ceasing to subside at the same
time--a coincidence which alone could produce equivalent groups of strata.
Subsidences in different places begin and end with utter irregularity; and
hence the groups of strata thrown down in them can but rarely correspond.
Measured against each other in time, their limits will disagree. They will
refuse to fit into any scheme of definite divisions. On turning to the
evidence, we find that it daily tends more and more to justify these _a
priori_ positions. Take, as an example, the Old Red Sandstone system. In
the north of England this is represented by a single stratum of
conglomerate. In Herefordshire, Worcestershire, and Shropshire, it expands
into a series of strata from eight to ten thousand feet thick, made up of
conglomerates, red, green, and white sandstones, red, green, and spotted
marls, and concretionary limestones. To the south-west, as between
Caermarthen and Pembroke, these Old Red Sandstone strata exhibit
considerable lithological changes; and there is an absence of fossil
fishes. On the other side of the Bristol Channel, they display further
changes in mineral characters and remains. While in South Devon and
Cornwall, the equivalent strata, consisting chiefly of slates, schists, and
limestones, are so wholly different, that they were for a long time classed
as Silurian. When we thus see that in certain directions the whole group of
deposits thins out, and that its mineral characters as well as its fossils
change within moderate distances; does it not become clear that the whole
group of deposits was a local one? And when we find, in other regions,
formations analogous to these Old Red Sandstone or Devonian formations; is
it certain--is it even probable--that they severally began and ended at the
same time with them? Should it not require overwhelming evidence to make us
believe as much?
Yet so strongly is geological speculation swayed by the tendency to regard
the phenomena as general instead of local, that even those most on their
guard against it seem unable to escape its influence. At page 158 of his
_Principles of Geology_, Sir Charles Lyell says:--
"A group of red marl and red sandstone, containing salt and gypsum,
being interposed in England between the Lias and the Coal, all other
red marls and sandstones, associated some of them with salt, and
others with gypsum, and occurring not only in different parts of
Europe, but in North America, Peru, India, the salt deserts of Asia,
those of Africa--in a word, in every quarter of the globe, were
referred to one and the same period.... It was in vain to urge as an
objection the improbability of the hypothesis which implies that all
the moving waters on the globe were once simultaneously charged with
sediment of a red colour. But the rashness of pretending to identify,
in age, all the red sandstones and marls in question, has at length
been sufficiently exposed, by the discovery that, even in Europe,
they belong decidedly to many different epochs."
Nevertheless, while in this and numerous passages of like implication, Sir
C. Lyell protests against the bias here illustrated, he seems himself not
completely free from it. Though he utterly rejects the old hypothesis that
all over the Earth the same continuous strata lie upon each other in
regular order, like the coats of an onion, he still writes as though
geologic "systems" do thus succeed each other. A reader of his _Manual_
would certainly suppose him to believe, that the Primary epoch ended, and
the Secondary epoch commenced, all over the world at the same time--that
these terms really correspond to distinct universal eras in Nature. When he
assumes, as he does, that the division between Cambrian and Lower Silurian
in America, answers chronologically to the division between Cambrian and
Lower Silurian in Wales--when he takes for granted that the partings of
Lower from Middle Silurian, and of Middle Silurian from Upper, in the one
region, are of the same dates as the like partings in the other region;
does it not seem that he believes geologic "systems" to be universal, in
the sense that their separations were in all places contemporaneous? Though
he would, doubtless, disown this as an article of faith, is not his
thinking unconsciously influenced by it? Must we not say that though the
onion-coat hypothesis is dead, its spirit is traceable, under a
transcendental form, even in the conclusions of its antagonists?
* * * * *
Let us now consider another leading geological doctrine, introduced to us
by the cases just mentioned. We mean the doctrine that strata of the same
age contain like fossils; and that, therefore, the age and relative
position of any stratum may be known by its fossils. While the theory that
strata of like mineral characters were everywhere deposited simultaneously,
has been ostensibly abandoned, there has been accepted the theory that in
each geologic epoch similar plants and animals existed everywhere; and
that, therefore, the epoch to which any formation belongs may be known by
the organic remains contained in the formation. Though, perhaps, no leading
geologist would openly commit himself to an unqualified assertion of this
theory, yet it is tacitly assumed in current geological reasoning.
This theory, however, is scarcely more tenable than the other. It cannot be
concluded with any certainty, that formations in which similar organic
remains are found, were of contemporaneous origin; nor can it be safely
concluded that strata containing different organic remains are of different
ages. To most readers these will be startling propositions; but they are
fully admitted by the highest authorities. Sir Charles Lyell confesses that
the test of organic remains must be used "under very much the same
restrictions as the test of mineral composition." Sir Henry de la Beche,
who variously illustrates this truth, gives, as one instance, the great
incongruity there must be between the fossils of our carboniferous rocks
and those of the marine strata deposited at the same period. But though, in
the abstract, the danger of basing positive conclusions on evidence derived
from fossils, is clearly recognized; yet, in the concrete, this danger is
generally disregarded. The established conclusions respecting the ages of
strata, take but little note of it; and by some geologists it seems
altogether ignored. Throughout his _Siluria_, Sir R. Murchison habitually
assumes that the same, or kindred, species, lived in all parts of the Earth
at the same time. In Russia, in Bohemia, in the United States, in South
America, strata are classed as belonging to this or that part of the
Silurian system, because of the similar fossils contained in them--are
concluded to be everywhere contemporaneous if they enclose a proportion of
identical or allied forms. In Russia the relative position of a stratum is
inferred from the fact that, along with some Wenlock forms, it yields the
_Pentamerus oblongus_. Certain crustaceans called Eurypteri, being
characteristic of the Upper Ludlow rock, it is remarked that "large
Eurypteri occur in a so-called black grey-wacke slate in Westmoreland, in
Oneida County, New York, which will probably be found to be on the parallel
of the Upper Ludlow rock:" in which word "probably," we see both how
dominant is this belief of universal distribution of similar creatures at
the same period, and how apt this belief is to make its own proof, by
raising the expectation that the ages are identical when the forms are
alike. Besides thus interpreting the formations of Russia, England, and
America, Sir R. Murchison thus interprets those of the antipodes. Fossils
from Victoria Colony, he agrees with the Government-surveyor in classing as
of Lower Silurian or Llandovery age: that is, he takes for granted that
when certain crustaceans and mollusks were living in Wales, certain similar
crustaceans and mollusks were living in Australia.
Yet the improbability of this assumption may be readily shown from Sir R.
Murchison's own facts. If, as he points out, the crustacean fossils of the
uppermost Silurian rocks in Lanarkshire are, "with one doubtful exception,"
"all distinct from any of the forms on the same horizon in England;" how
can it be fairly presumed that the forms existing on the other side of the
Earth during the Silurian period, were nearly allied to those existing
here? Not only, indeed, do Sir R. Murchison's conclusions tacitly assume
this doctrine of universal distribution, but he distinctly enunciates it.
"The mere presence of a graptolite," he says, "will at once decide that the
enclosing rock is Silurian;" and he says this, notwithstanding repeated
warnings against such generalizations. During the progress of Geology, it
has over and over again happened that a particular fossil, long considered
characteristic of a particular formation, has been afterwards discovered in
other formations. Until some twelve years ago, Goniatites had not been
found lower than the Devonian rocks; but now, in Bohemia, they have been
found in rocks classed as Silurian. Quite recently, the Orthoceras,
previously supposed to be a type exclusively Palaeozoic, has been detected
along with mesozoic Ammonites and Belemnites. Yet hosts of such experiences
fail to extinguish the assumption, that the age of a stratum may be
determined by the occurrence in it of a single fossil form.
Nay, this assumption survives evidence of even a still more destructive
kind. Referring to the Silurian system in Western Ireland, Sir R. Murchison
says, "in the beds near Maam, Professor Nicol and myself collected remains,
some of which would be considered Lower, and others Upper, Silurian;" and
he then names sundry fossils which, in England, belong to the summit of the
Ludlow rocks, or highest Silurian strata; "some, which elsewhere are known
only in rocks of Llandovery age," that is, of middle Silurian age; and
some, only before known in Lower Silurian strata, not far above the most
ancient fossiliferous beds. Now what do these facts prove? Clearly, they
prove that species which in Wales are separated by strata more than twenty
thousand feet deep, and therefore seem to belong to periods far more remote
from each other, were really coexistent. They prove that the mollusks and
crinoids held characteristic of early Silurian strata, and supposed to have
become extinct long before the mollusks and crinoids of the later Silurian
strata came into existence, were really flourishing at the same time with
these last; and that these last possibly date back to as early a period as
the first. They prove that not only the mineral characters of sedimentary
formations, but also the collections of organic forms they contain, depend,
to a great extent, on local circumstances. They prove that the fossils met
with in any series of strata, cannot be taken as representing anything like
the whole Flora and Fauna of the period they belong to. In brief, they
throw great doubt upon numerous geological generalizations.
Notwithstanding facts like these, and notwithstanding his avowed opinion
that the test of organic remains must be used "under very much the same
restrictions as the test of mineral composition," Sir Charles Lyell, too,
bases positive conclusions on this test: even where the community of
fossils is slight and the distance great. Having decided that in various
places in Europe, middle Eocene strata are distinguished by nummulites; he
infers, without any other assigned evidence, that wherever nummulites are
found--in Morocco, Algeria, Egypt, in Persia, Scinde, Cutch, Eastern
Bengal, and the frontiers of China--the containing formation is middle
Eocene. And from this inference he draws the following important
corollary:--
"When we have once arrived at the conviction that the nummulitic
formation occupies a middle place in the Eocene series, we are struck
with the comparatively modern date to which some of the greatest
revolutions in the physical geography of Europe, Asia, and northern
Africa must be referred. All the mountain chains, such as the Alps,
Pyrenees, Carpathians, and Himalayas, into the composition of whose
central and loftiest parts the nummulitic strata enter bodily, could
have had no existence till after the middle Eocene
period."--_Manual_, p. 232.
A still more marked case follows on the next page. Because a certain bed at
Claiborne in Alabama, which contains "_four hundred_ species of marine
shells," includes among them the _Cardita planicosta_, "and _some others_
identical with European species, or very nearly allied to them," Sir C.
Lyell says it is "highly probable the Claiborne beds agree in age with the
central or Bracklesham group of England." When we find contemporaneity
supposed on the strength of a community no greater than that which
sometimes exists between strata of widely-different ages in the same
country, it seems very much as though the above-quoted caution had been
forgotten. It appears to be assumed for the occasion, that species which
had a wide range in space had a narrow range in time; which is the reverse
of the fact. The tendency to systematize overrides the evidence, and
thrusts Nature into a formula too rigid to fit her endless variety.
"But," it may be urged, "surely, when in different places the order of
superposition, the mineral characters, and the fossils, agree, it may be
safely concluded that the formations thus corresponding are equivalents in
time. If, for example, the United States display the same succession of
Silurian, Devonian, and Carboniferous systems, lithologically similar, and
characterized by like fossils, it is a fair inference that these groups of
strata were severally deposited in America at the same periods that they
were deposited here."
On this position, which seems a strong one, we have, in the first place, to
remark, that the evidence of correspondence is always more or less
suspicious. We have already adverted to the several "idols"--if we may use
Bacon's metaphor--to which geologists unconsciously sacrifice, when
interpreting the structures of unexplored regions. Carrying with them the
classification of strata existing in Europe, and assuming that groups of
strata in other parts of the world must answer to some of the groups of
strata known here, they are necessarily prone to assert parallelism on
insufficient evidence. They scarcely entertain the previous question,
whether the formations they are examining have or have not any European
equivalents; but the question is--with which of the European series shall
they be classed?--with which do they most agree?--from which do they differ
least? And this being the mode of enquiry, there is apt to result great
laxity of interpretation. How lax the interpretation really is, may be
readily shown. When strata are discontinuous, as between Europe and
America, no evidence can be derived from the order of superposition, apart
from mineral characters and organic remains; for, unless strata can be
continuously traced, mineral characters and organic remains are the only
means of classing them as such or such.
As to the test of mineral characters, we have seen that it is almost
worthless; and no modern geologist would dare to say it should be relied
on. If the Old Red Sandstone series in mid-England, differs wholly in
lithological aspect from the equivalent series in South Devon, it is clear
that similarities of texture and composition can have no weight in
assimilating a system of strata in another quarter of the globe to some
European system. The test of fossils, therefore, is the only one that
remains; and with how little strictness this test is applied, one case will
show. Of forty-six species of British Devonian corals, only six occur in
America; and this, notwithstanding the wide range which the Anthozoa are
known to have. Similarly of the Mollusca and Crinoidea, it appears that,
while there are sundry genera found in America that are found here, there
are scarcely any of the same species. And Sir Charles Lyell admits that
"the difficulty of deciding on the exact parallelism of the New York
subdivisions, as above enumerated, with the members of the European
Devonian, is very great, so few are the species in common." Yet it is on
the strength of community of fossils, that the whole Devonian series of the
United States is assumed to be contemporaneous with the whole Devonian
series of England. And it is partly on the ground that the Devonian of the
United States corresponds in time with our Devonian, that Sir Charles Lyell
concludes the superjacent coal-measures of the two countries to be of the
same age. Is it not, then, as we said, that the evidence in these cases is
very suspicious?
Should it be replied, as it may fairly be, that this correspondence from
which the synchronism of distant formations is inferred, is not a
correspondence between particular species or particular genera, but between
the general characters of the contained assemblages of fossils--between the
_facies_ of the two Faunas; the rejoinder is, that though such
correspondence is a stronger evidence of synchronism it is still an
insufficient one. To infer synchronism from such correspondence, involves
the postulate that throughout each geologic era there has habitually
existed a recognizable similarity between the groups of organic forms
inhabiting all the different parts of the Earth; and that the causes which
have in one part of the Earth changed the organic forms into those which
characterize the next era, have simultaneously acted in all other parts of
the Earth, in such ways as to produce parallel changes of their organic
forms. Now this is not only a large assumption to make; but it is an
assumption contrary to probability. The probability is, that the causes
which have changed Faunas have been local rather than universal; that hence
while the Faunas of some regions have been rapidly changing, those of
others have been almost quiescent; and that when such others have been
changed, it has been, not in such ways as to maintain parallelism, but in
such ways as to produce divergence.
Even supposing, however, that districts some hundreds of miles apart,
furnished groups of strata that completely agreed in their order of
superposition, their mineral characters, and their fossils, we should still
have inadequate proof of contemporaneity. For there are conditions, very
likely to occur, under which such groups might differ widely in age. If
there be a continent of which the strata crop out on the surface obliquely
to the line of coast--running, say, west-northwest, while the coast runs
east and west--it is clear that each group of strata will crop out on the
beach at a particular part of the coast; that further west the next group
of strata will crop out on the beach; and so continuously. As the
localization of marine plants and animals is in a considerable degree
determined by the nature of the rocks and their detritus, it follows that
each part of this coast will have its more or less distinct Flora and
Fauna. What now must result from the action of the waves in the course of a
geologic epoch? As the sea makes slow inroads on the land, the place at
which each group of strata crops out on the beach will gradually move
towards the west: its distinctive fish, mollusks, crustaceans, and
sea-weeds, migrating with it. Further, the detritus of each of these groups
of strata will, as the point of outcrop moves westwards, be deposited over
the detritus of the group in advance of it. And the consequence of these
actions, carried on for one of those enormous periods required for geologic
changes, will be that, corresponding to each eastern stratum, there will
arise a stratum far to the west which, though occupying the same position
relatively to other beds, formed of like materials, and containing like
fossils, will yet be perhaps a million years later in date.
* * * * *
But the illegitimacy, or at any rate the great doubtfulness, of many
current geological inferences, is best seen when we contemplate terrestrial
changes now going on: and ask how far such inferences are countenanced by
them. If we carry out rigorously the modern method of interpreting
geological phenomena, which Sir Charles Lyell has done so much to
establish--that of referring them to causes like those at present in
action--we cannot fail to see how improbable are sundry of the received
conclusions.
Along each line of shore that is being worn away by the waves, there are
being formed mud, sand, and pebbles. This detritus, spread over the
neighbouring sea-bottom, has, in each locality, a more or less special
character; determined by the nature of the strata destroyed. In the English
Channel it is not the same as in the Irish Channel; on the east coast of
Ireland it is not the same as on the west coast; and so throughout. At the
mouth of each great river, there is being deposited sediment differing more
or less from that of other rivers in colour and quality; forming strata
that are here red, there yellow, and elsewhere brown, grey, or dirty white.
Besides which various formations, going on in deltas and along shores,
there are some much wider and still more contrasted formations. At the
bottom of the AEgaean Sea, there is accumulating a bed of Pteropod shells,
which will eventually, no doubt, become a calcareous rock. For some
hundreds of thousands of square miles, the ocean-bed between Great Britain
and North America, is being covered with a stratum of chalk; and over large
areas in the Pacific, there are going on deposits of coralline limestone.
Thus, throughout the Earth, there are at this moment being produced an
immense number of strata differing from each other in lithological
characters. Name at random any one part of the sea-bottom, and ask whether
the deposit there taking place is like the deposit taking place at some
distant part of the sea-bottom, and the almost-certainly correct answer
will be--No. The chances are not in favour of similarity, but very greatly
against it.
In the order of superposition of strata there is occurring a like variety.
Each region of the Earth's surface has its special history of elevations,
subsidences, periods of rest; and this history in no case fits
chronologically with the history of any other portion. River deltas are now
being thrown down on formations of quite different ages. While here there
has been deposited a series of beds many hundreds of feet thick, there has
elsewhere been deposited but a single bed of fine mud. While one region of
the Earth's crust, continuing for a vast epoch above the surface of the
ocean, bears record of no changes save those resulting from denudation;
another region of the Earth's crust gives proof of various changes of
level, with their several resulting masses of stratified detritus. If
anything is to be judged from current processes, we must infer, not only
that everywhere the succession of sedimentary formations differs more or
less from the succession elsewhere; but also that in each place, there
exist groups of strata to which many other places have no equivalents.
With respect to the organic bodies imbedded in formations now in progress,
the like truth is equally manifest, if not more manifest. Even along the
same coast, within moderate distances, the forms of life differ very
considerably; much more on coasts that are remote from each other. Again,
dissimilar creatures that are living together near the same shore, do not
leave their remains in the same beds of sediment. For instance, at the
bottom of the Adriatic, where the prevailing currents cause the deposits to
be here of mud, and there of calcareous matter, it is proved that different
species of co-existing shells are being buried in these respective
formations. On our own coasts, the marine remains found a few miles from
shore, in banks where fish congregate, are different from those found close
to the shore, where only littoral species flourish. A large proportion of
aquatic creatures have structures that do not admit of fossilization; while
of the rest, the great majority are destroyed, when dead, by the various
kinds of scavengers that creep among the rocks and weeds. So that no one
deposit near our shores can contain anything like a true representation of
the Fauna of the surrounding sea; much less of the co-existing Faunas of
other seas in the same latitude; and still less of the Faunas of seas in
distant latitudes. Were it not that the assertion seems needful, it would
be almost absurd to say, that the organic remains now being buried in the
Dogger Bank, can tell us next to nothing about the fish, crustaceans,
mollusks, and corals that are being buried in the Bay of Bengal.
Still stronger is the argument in the case of terrestrial life. With more
numerous and greater contrasts between the plants and animals of remote
places, there is a far more imperfect registry of them. Schouw marks out on
the Earth more than twenty botanical regions, occupied by groups of forms
so far distinct from each other, that, if fossilized, geologists would
scarcely be disposed to refer them all to the same period. Of Faunas, the
Arctic differs from the Temperate; the Temperate from the Tropical; and the
South Temperate from the North Temperate. Nay, in the South Temperate Zone
itself, the two regions of South Africa and South America are unlike in
their mammals, birds, reptiles, fishes, mollusks, insects. The shells and
bones now lying at the bottoms of lakes and estuaries in these several
regions, have certainly not that similarity which is usually looked for in
those of contemporaneous strata; and the recent forms exhumed in any one of
these regions would very untruly represent the present Flora and Fauna of
the Earth. In conformity with the current style of geological reasoning, an
exhaustive examination of deposits in the Arctic circle, might be held to
prove that though at this period there were sundry mammals existing, there
were no reptiles; while the absence of mammals in the deposits of the
Galapagos Archipelago, where there are plenty of reptiles, might be held to
prove the reverse. And at the same time, from the formations extending for
two thousand miles along the great barrier-reef of Australia--formations in
which are imbedded nothing but corals, echinoderms, mollusks, crustaceans,
and fish, along with an occasional turtle, or bird, or cetacean, it might
be inferred that there lived in our epoch neither terrestrial reptiles nor
terrestrial mammals.
The mention of Australia, indeed, suggests an illustration which, even
alone, would amply prove our case. The Fauna of this region differs widely
from any that is found elsewhere. On land all the indigenous mammals,
except bats, belong to the lowest, or implacental division; and the insects
are singularly different from those found elsewhere. The surrounding seas
contain numerous forms that are more or less strange; and among the fish
there exists a species of shark, which is the only living representative of
a genus that flourished in early geologic epochs. If, now, the modern
fossiliferous deposits of Australia were to be examined by one ignorant of
the existing Australian Fauna; and if he were to reason in the usual
manner; he would be very unlikely to class these deposits with those of the
present time. How, then, can we place confidence in the tacit assumption
that certain formations in remote parts of the Earth are referable to the
same period, because the organic remains contained in them display a
certain community of character? or that certain others are referable to
different periods, because the _facies_ of their Faunas are different?
"But," it will be replied, "in past eras the same, or similar, organic
forms were more widely distributed than now." It may be so; but the
evidence adduced by no means proves it. The argument by which this
conclusion is reached, runs a risk of being quoted as an example of
reasoning in a circle. As already pointed out, between formations in remote
regions there is no means of ascertaining equivalence but by fossils. If,
then, the contemporaneity of remote formations is concluded from the
likeness of their fossils; how can it be said that similar plants and
animals were once more widely distributed, because they are found in
contemporaneous strata in remote regions? Is not the fallacy manifest? Even
supposing there were no such fatal objection as this, the evidence commonly
assigned would still be insufficient. For we must bear in mind that the
community of organic remains commonly thought sufficient for inferring
correspondence in time, is a very imperfect community. When the compared
sedimentary beds are far apart, it is scarcely expected that there will be
many species common to the two: it is enough if there be discovered a
considerable number of common genera. Now had it been proved that,
throughout geologic time, each genus lived but for a short period--a period
measured by a single group of strata--something might be inferred. But what
if we learn that many of the same genera continued to exist throughout
enormous epochs, measured by several vast systems of strata? "Among
molluscs, the genera _Avicula_, _Modiola_, _Terebratula_, _Lingula_, and
_Orbicula_, are found from the Silurian rocks upwards to the present day."
If, then, between the lowest fossiliferous formations and the most recent,
there exists this degree of community; must we not infer that there will
probably often exist a degree of community between strata that are far from
contemporaneous?
Thus the reasoning from which it is concluded that similar organic forms
were once more widely spread, is doubly fallacious; and, consequently, the
classifications of foreign strata based on this conclusion are
untrustworthy. Judging from the present distribution of life, we can
scarcely expect to find similar remains in geographically remote strata of
the same age; and where, between the fossils of geographically remote
strata, we do find much similarity, it is probably often due rather to
likeness of conditions than to contemporaneity. If from causes and effects
such as we now witness, we reason back to the causes and effects of past
epochs, we discover inadequate warrant for sundry of the received
doctrines. Seeing, as we do, that in large areas of the Pacific this is a
period characterized by abundance of corals; that in the North Atlantic it
is a period in which a great chalk-deposit is being formed; and that in the
valley of the Mississippi it is a period of new coal-basins--seeing also,
as we do, that in one extensive continent this is peculiarly an era of
implacental mammals, and that in another extensive continent it is
peculiarly an era of placental mammals; we have good reason to hesitate
before accepting these sweeping generalizations which are based on a
cursory examination of strata occupying but a tenth part of the Earth's
surface.
* * * * *
At the outset, this article was to have been a review of the works of Hugh
Miller; but it has grown into something much more general. Nevertheless,
the remaining two doctrines which we propose to criticise, may be
conveniently treated in connection with his name, as that of one who fully
committed himself to them. And first, a few words with regard to his
position.
That he was a man whose life was one of meritorious achievement, every one
knows. That he was a diligent and successful working geologist, scarcely
needs saying. That with indomitable perseverance he struggled up from
obscurity to a place in the world of literature and science, shows him to
have been highly endowed in character and intelligence. And that he had a
remarkable power of presenting his facts and arguments in an attractive
form, a glance at any of his books will quickly prove. By all means, let us
respect him as a man of activity and sagacity, joined with a large amount
of poetry. But while saying this we must add, that his reputation stands by
no means so high in the scientific world as in the world at large. Partly
from the fact that our Scotch neighbours are in the habit of blowing the
trumpet rather loudly before their notabilities--partly because the
charming style in which his books are written has gained him a large circle
of readers--partly, perhaps, through a praiseworthy sympathy with him as a
self-made man; Hugh Miller has met with an amount of applause which, little
as we wish to diminish it, must not be allowed to blind the public to his
defects as a man of science.
The truth is, he was so far committed to a foregone conclusion, that he
could not become a philosophical geologist. He might be aptly described as
a theologian studying geology. The dominant idea with which he wrote, may
be seen in the titles of his books--_Law versus Miracle_,--_Footprints of
the Creator_,--_The Testimony of the Rocks_. Regarding geological facts as
evidence for or against certain religious conclusions, it was scarcely
possible for him to deal with geological facts impartially. His ruling aim
was to disprove the Development Hypothesis, the assumed implications of
which were repugnant to him; and in proportion to the strength of his
feeling, was the one-sidedness of his reasoning. He admitted that "God
might as certainly have _originated_ the species by a law of development,
as he _maintains_ it by a law of development; the existence of a First
Great Cause is as perfectly compatible with the one scheme as with the
other." Nevertheless, he considered the hypothesis at variance with
Christianity; and therefore combated with it. He apparently overlooked the
fact that the doctrines of geology in general, as held by himself, had been
rejected by many on similar grounds; and that he had himself been
repeatedly attacked for his anti-Christian teachings. He seems not to have
perceived that, just as his antagonists were wrong in condemning as
irreligious, theories which he saw were not irreligious; so might he be
wrong in condemning, on like grounds, the Theory of Evolution. In brief, he
fell short of that highest faith, which knows that all truths must
harmonize; and which is, therefore, content trustfully to follow the
evidence whithersoever it leads.
Of course it is impossible to criticize his works without entering on this
great question to which he chiefly devoted himself. The two remaining
doctrines to be here discussed, bear directly on this question; and, as
above said, we propose to treat them in connection with Hugh Miller's name,
because, throughout his reasonings, he assumes their truth. Let it not be
supposed, however, that we shall aim to prove what he has aimed to
disprove. While we purpose showing that his arguments against the
Development Hypothesis are based on invalid assumptions; we do not purpose
showing that the opposing arguments are based on valid assumptions. We hope
to make it apparent that the geological evidence at present obtained, is
insufficient for either side; further, that there seems little probability
of sufficient evidence ever being obtained; and that if the question is
eventually decided, it must be decided on other than geological data.
* * * * *
The first of the current doctrines to which we have just referred, is, that
there occur in the records of former life on our planet, certain great
blanks--that though, generally, the succession of fossil forms is tolerably
continuous, yet that at two places there occur wide gaps in the series
whence it is inferred that, on at least two occasions, the previously
existing inhabitants of the Earth were almost wholly destroyed, and a
different class of inhabitants created. Comparing the general life on the
Earth to a thread, Hugh Miller says:--
"It is continuous from the present time up to the commencement of
the Tertiary period; and then so abrupt a break occurs, that, with
the exception of the microscopic diatomaceae to which I last evening
referred, and of one shell and one coral, not a single species
crossed the gap. On its further or remoter side, however, where the
Secondary division closes, the intermingling of species again begins,
and runs on till the commencement of this great Secondary division;
and then, just where the Palaeozoic division closes, we find another
abrupt break, crossed, if crossed at all,--for there still exists
some doubt on the subject,--by but two species of plant."
These breaks are considered to imply actual new creations on the surface of
our planet; not only by Hugh Miller, but by the majority of geologists. And
the terms Palaeozoic, Mesozoic, and Cainozoic, are used to indicate these
three successive systems of life. It is true that some accept this belief
with caution: knowing how geologic research has been all along tending to
fill up what were once thought wide breaks. Sir Charles Lyell points out
that "the hiatus which exists in Great Britain between the fossils of the
Lias and those of the Magnesian Limestone, is supplied in Germany by the
rich fauna and flora of the Muschelkalk, Keuper, and Bunter Sandstein,
which we know to be of a date precisely intermediate." Again he remarks
that "until lately the fossils of the coal-measures were separated from
those of the antecedent Silurian group by a very abrupt and decided line of
demarcation; but recent discoveries have brought to light in Devonshire,
Belgium, the Eifel, and Westphalia, the remains of a fauna of an
intervening period." And once more, "we have also in like manner had some
success of late years in diminishing the hiatus which still separates the
Cretaceous and Eocene periods in Europe." To which let us add that since
Hugh Miller penned the passage above quoted, the second of the great gaps
he refers to has been very considerably narrowed by the discovery of strata
containing Palaeozoic genera and Mesozoic genera intermingled. Nevertheless,
the occurrence of two great revolutions in the Earth's Flora and Fauna
appears still to be held by many; and geologic nomenclature habitually
assumes it.
Before seeking a solution of these phenomena, let us glance at the several
minor causes that produce breaks in the geological succession of organic
forms: taking first, the more general ones which modify climate, and,
therefore, the distribution of life. Among these may be noted one which has
not, we believe, been named by writers on the subject. We mean that
resulting from a certain slow astronomic rhythm, by which the northern and
southern hemispheres are alternately subject to greater extremes of
temperature. In consequence of the slight ellipticity of its orbit, the
Earth's distance from the sun varies to the extent of some 3,000,000 of
miles. At present, the aphelion occurs at the time of our northern summer;
and the perihelion during the summer of the southern hemisphere. In
consequence, however, of that slow movement of the Earth's axis which
produces the precession of the equinoxes, this state of things will in time
be reversed: the Earth will be nearest to the sun during the summer of the
northern hemisphere, and furthest from it during the southern summer or
northern winter. The period required to complete the slow movement
producing these changes, is nearly 26,000 years; and were there no
modifying process, the two hemispheres would alternately experience this
coincidence of summer with the least distance from the sun, during a period
of 13,000 years. But there is also a still slower change in the direction
of the axis major of the Earth's orbit; from which it results that the
alternation we have described is completed in about 21,000 years. That is
to say, if at a given time the Earth is nearest to the sun at our
mid-summer, and furthest from the sun at our mid-winter: then, in 10,500
years afterwards, it will be furthest from the sun at our mid-summer, and
nearest at our mid-winter.
Now the difference between the distances from the sun at the two extremes
of this alternation, amounts to one-thirtieth; and hence, the difference
between the quantities of heat received from the sun on a summer's day
under these opposite conditions amounts to one-fifteenth. Estimating this,
not with reference to the zero of our thermometers, but with reference to
the temperature of the celestial spaces, Sir John Herschel calculates "23 deg.
Fahrenheit as the least variation of temperature under such circumstances
which can reasonably be attributed to the actual variation of the sun's
distance." Thus, then, each hemisphere has at a certain epoch, a short
summer of extreme heat, followed by a long and very cold winter. Through
the slow change in the direction of the Earth's axis, these extremes are
gradually mitigated. And at the end of 10,500 years, there is reached the
opposite state--a long and moderate summer, with a short and mild winter.
At present, in consequence of the predominance of sea in the southern
hemisphere, the extremes to which its astronomical conditions subject it,
are much ameliorated; while the great proportion of land in the northern
hemisphere, tends to exaggerate such contrast as now exists in it between
winter and summer: whence it results that the climates of the two
hemispheres are not widely unlike. But 10,000 years hence, the northern
hemisphere will undergo annual variations of temperature far more marked
than now.
In the last edition of his _Outlines of Astronomy_, Sir John Herschel
recognizes this as an element in geological processes: regarding it as
possibly a part-cause of those climatic changes indicated by the records of
the Earth's past. That it has had much to do with the larger changes of
climate of which we have evidence, seems unlikely, since there is reason to
think that these have been far slower and more lasting; but that it must
have entailed a rhythmical exaggeration and mitigation of the climates
otherwise produced, seems beyond question. And it seems also beyond
question that there must have been a consequent rhythmical change in the
distribution of organisms--a rhythmical change to which we here wish to
draw attention, as one cause of minor breaks in the succession of fossil
remains. Each species of plant and animal, has certain limits of heat and
cold within which only it can exist; and these limits in a great degree
determine its geographical position. It will not spread north of a certain
latitude, because it cannot bear a more northern winter, nor south of a
certain latitude, because the summer heat is too great; or else it is
indirectly restrained from spreading further by the effect of temperature
on the humidity of the air, or on the distribution of the organisms it
lives upon.
But now, what will result from a slow alteration of climate, produced as
above described? Supposing the period we set out from is that in which the
contrast of seasons is least marked, it is manifest that during the
progress towards the period of the most violent contrast, each species of
plant and animal will gradually change its limits of distribution--will be
driven back, here by the winter's increasing cold, and there by the
summer's increasing heat--will retire into those localities that are still
fit for it. Thus during 10,000 years, each species will ebb away from
certain regions it was inhabiting; and during the succeeding 10,000 years
will flow back into those regions. From the strata there forming, its
remains will disappear; they will be absent from some of the supposed
strata; and will be found in strata higher up. But in what shapes will they
re-appear? Exposed during the 21,000 years of their slow recession and
their slow return, to changing conditions of life, they are likely to have
undergone modifications; and will probably re-appear with slight
differences of constitution and perhaps of form--will be new varieties or
perhaps new sub-species.
To this cause of minor breaks in the succession of organic forms--a cause
on which we have dwelt because it has not been taken into account--we must
add sundry others. Besides these periodically-recurring alterations of
climate, there are the irregular ones produced by re-distributions of land
and sea; and these, sometimes less, sometimes greater, in degree, than the
rhythmical changes, must, like them, cause in each region the ebb and flow
of species; and consequent breaks, small or large as the case may be, in
the palaeontological series. Other and more special geological changes must
produce other and more local blanks in the succession of fossils. By some
inland elevation the natural drainage of a continent is modified; and
instead of the sediment it previously brought down to the sea, a great
river begins to bring down sediment unfavourable to various plants and
animals living in its delta: wherefore these disappear from the locality,
perhaps to re-appear in a changed form after a long epoch. Upheavals or
subsidences of shores or sea-bottoms, involving deviations of marine
currents, must remove the habitats of many species to which such currents
are salutary or injurious; and further, this re-distribution of currents
must alter the places of sedimentary deposits, and so stop the burying of
organic remains in some localities, and commence it in others. Had we
space, many more such causes of blanks in our palaeontological records might
be added. But it is needless here to enumerate them. They are admirably
explained and illustrated in Sir Charles Lyell's _Principles of Geology_.
Now, if these minor revolutions of the Earth's surface produce minor breaks
in the series of fossilized remains; must not great revolutions produce
great breaks? If a local upheaval or subsidence causes throughout its small
area the absence of some links in the chain of fossil forms; does it not
follow that an upheaval or subsidence extending over a large part of the
Earth's surface, must cause the absence of a great number of such links
throughout a very wide area?
When during a long epoch a continent, slowly subsiding, gives place to a
far-spreading ocean some miles in depth, at the bottom of which no deposits
from rivers or abraded shores can be thrown down; and when, after some
enormous period, this ocean-bottom is gradually elevated and becomes the
site of new strata; it is clear that the fossils contained in these new
strata are likely to have but little in common with the fossils of the
strata below them. Take, in illustration, the case of the North Atlantic.
We have already named the fact that between this country and the United
States, the ocean-bottom is being covered with a deposit of chalk--a
deposit that has been forming, probably, ever since there occurred that
great depression of the Earth's crust from which the Atlantic resulted in
remote geologic times. This chalk consists of the minute shells of
Foraminifera, sprinkled with remains of small Entomostraca, and probably a
few Pteropod-shells: though the sounding lines have not yet brought up any
of these last. Thus, in so far as all high forms of life are concerned,
this new chalk-formation must be a blank. At rare intervals, perhaps, a
polar bear drifted on an iceberg, may have its bones scattered over the
bed; or a dead, decaying whale may similarly leave traces. But such remains
must be so rare, that this new chalk-formation, if visible, might be
examined for a century before any of them were disclosed. If now, some
millions of years hence, the Atlantic-bed should be raised, and estuary or
shore deposits laid upon it, these deposits would contain remains of a
Flora and Fauna so distinct from everything below them, as to appear like a
new creation.
Thus, along with continuity of life on the Earth's surface, there not only
_may_ be, but there _must_ be, great gaps, in the series of fossils; and
hence these gaps are no evidence against the doctrine of Evolution.
* * * * *
One other current assumption remains to be criticized; and it is the one on
which, more than on any other, depends the view taken respecting the
question of development.
From the beginning of the controversy, the arguments for and against have
turned upon the evidence of progression in organic forms, found in the
ascending series of our sedimentary formations. On the one hand, those who
contend that higher organisms have been evolved out of lower, joined with
those who contend that successively higher organisms have been created at
successively later periods, appeal for proof to the facts of Palaeontology;
which, they say, countenance their views. On the other hand, the
Uniformitarians, who not only reject the hypothesis of development, but
deny that the modern forms of life are higher than the ancient ones, reply
that the Palaeontological evidence is at present very incomplete; that
though we have not yet found remains of highly-organized creatures in
strata of the greatest antiquity, we must not assume that no such creatures
existed when those strata were deposited; and that, probably, geological
research will eventually disclose them.
It must be admitted that thus far, the evidence has gone in favour of the
latter party. Geological discovery has year after year shown the small
value of negative facts. The conviction that there are no traces of higher
organisms in earlier strata, has resulted not from the absence of such
remains, but from incomplete examination. At p. 460 of his _Manual of
Elementary Geology_, Sir Charles Lyell gives a list in illustration of
this. It appears that in 1709, fishes were not known lower than the Permian
system. In 1793 they were found in the subjacent Carboniferous system; in
1828 in the Devonian; in 1840 in the Upper Silurian. Of reptiles, we read
that in 1710 the lowest known were in the Permian; in 1844 they were
detected in the Carboniferous; and in 1852 in the Upper Devonian. While of
the Mammalia the list shows that in 1798 none had been discovered below the
middle Eocene; but that in 1818 they were discovered in the Lower Oolite;
and in 1847 in the Upper Trias.
The fact is, however, that both parties set out with an inadmissible
postulate. Of the Uniformitarians, not only such writers as Hugh Miller,
but also such as Sir Charles Lyell,[T] reason as though we had found the
earliest, or something like the earliest, strata. Their antagonists,
whether defenders of the Development Hypothesis or simply Progressionists,
almost uniformly do the like. Sir R. Murchison, who is a Progressionist,
calls the lowest fossiliferous strata, "Protozoic." Prof. Ansted uses the
same term. Whether avowedly or not, all the disputants stand on this
assumption as their common ground.
[T] Sir Charles Lyell is no longer to be classed among
Uniformitarians. With rare and admirable candour he has, since
this was written, yielded to the arguments of Mr. Darwin.
Yet is this assumption indefensible, as some who make it very well know.
Facts may be cited against it which show that it is a more than
questionable one--that it is a highly improbable one; while the evidence
assigned in its favour will not bear criticism.
Because in Bohemia, Great Britain, and portions of North America, the
lowest unmetamorphosed strata yet discovered, contain but slight traces of
life, Sir R. Murchison conceives that they were formed while yet few, if
any, plants or animals had been created; and, therefore, classes them as
"Azoic." His own pages, however, show the illegitimacy of the conclusion
that there existed at that period no considerable amount of life. Such
traces of life as have been found in the Longmynd rocks, for many years
considered unfossiliferous, have been found in some of the lowest beds; and
the twenty thousand feet of superposed beds, still yield no organic
remains. If now these superposed strata throughout a depth of four miles,
are without fossils, though the strata over which they lie prove that life
had commenced; what becomes of Sir R. Murchison's inference? At page 189 of
_Siluria_, a still more conclusive fact will be found. The "Glengariff
grits," and other accompanying strata there described as 13,500 feet thick,
contain no signs of contemporaneous life. Yet Sir R. Murchison refers them
to the Devonian period--a period that had a large and varied marine Fauna.
How then, from the absence of fossils in the Longmynd beds and their
equivalents, can we conclude that the Earth was "azoic" when they were
formed?
"But," it may be asked, "if living creatures then existed, why do we not
find fossiliferous strata of that age, or an earlier age?" One reply is,
that the non-existence of such strata is but a negative fact--we have not
found them. And considering how little we know even of the two-fifths of
the Earth's surface now above the sea, and how absolutely ignorant we are
of the three-fifths below the sea, it is rash to say that no such strata
exist. But the chief reply is, that these records of the Earth's earlier
history have been in great part destroyed, by agencies that are ever
tending to destroy such records.
It is an established geological doctrine, that sedimentary strata are
liable to be changed, more or less completely, by igneous action. The rocks
originally classed as "transition," because they were intermediate in
character between the igneous rocks found below them, and the sedimentary
strata found above them, are now known to be nothing else than sedimentary
strata altered in texture and appearance by the intense heat of adjacent
molten matter; and hence are renamed "metamorphic rocks." Modern researches
have shown, too, that these metamorphic rocks are not, as was once
supposed, all of the same age. Besides primary and secondary strata that
have been transformed by igneous action, there are similarly-changed
deposits of tertiary origin; and that, even for a quarter of a mile from
the point of contact with neighbouring granite. By this process fossils are
of course destroyed. "In some cases," says Sir Charles Lyell, "dark
limestones, replete with shells and corals, have been turned into white
statuary marble, and hard clays, containing vegetable or other remains,
into slates called mica-schist or hornblende-schist; every vestige of the
organic bodies having been obliterated."
Again, it is fast becoming an acknowledged truth, that igneous rock, of
whatever kind, is the product of sedimentary strata that have been
completely melted. Granite and gneiss, which are of like chemical
composition, have been shown, in various cases, to pass one into the other:
as at Valorsine, near Mont Blanc, where the two, in contact, are observed
to "both undergo a modification of mineral character. The granite still
remaining unstratified, becomes charged with green particles; and the
talcose gneiss assumes a granitiform structure without losing its
stratification." In the Aberdeen-granite, lumps of unmelted gneiss are
frequently found; and we can ourselves bear witness that on the banks of
Loch Sunart, there is ample proof that the granite of that region, when it
was molten, contained incompletely-fused clots of sedimentary strata. Nor
is this all. Fifty years ago, it was thought that all granitic rocks were
primitive, or existed before any sedimentary strata; but it is now "no easy
task to point out a single mass of granite demonstrably more ancient than
all the known fossiliferous deposits."
In brief, accumulated evidence clearly shows, that by contact with, or
proximity to, the molten matter of the Earth's nucleus, all beds of
sediment are liable to be actually melted, or partially fused, or so heated
as to agglutinate their particles; and that according to the temperature
they have been raised to, and the circumstances under which they cool, they
assume the forms of granite, porphyry, trap, gneiss, or rock otherwise
altered. Further, it is manifest that though strata of various ages have
been thus changed, yet that the most ancient strata have been so changed to
the greatest extent: both because they have habitually lain nearer to the
centre of igneous agency; and because they have been for a longer period
liable to the effects of this agency. Whence it follows, that sedimentary
strata passing a certain antiquity, are unlikely to be found in an
unmetamorphosed state; and that strata much earlier than those are certain
to have been melted up. Thus if, throughout a past of indefinite duration,
there had been at work those aqueous and igneous agencies which we see
still at work, the state of the Earth's crust might be just what we find
it. We have no evidence which puts a limit to the period throughout which
this formation and destruction of strata has been going on. For aught the
facts prove, it may have been going on for ten times the period measured by
our whole series of sedimentary deposits.
Besides having, in the present appearances of the Earth's crust, no data
for fixing a commencement to these processes--besides finding that the
evidence permits us to assume such commencement to have been inconceivably
remote, as compared even with the vast eras of geology; we are not without
positive grounds for inferring the inconceivable remoteness of such
commencement. Modern geology has established truths which are
irreconcilable with the belief that the formation and destruction of strata
began when the Cambrian rocks were formed; or at anything like so recent a
time. One fact from _Siluria_ will suffice. Sir R. Murchison estimates the
vertical thickness of Silurian strata in Wales, at from 26,000 to 27,000
feet, or about five miles; and if to this we add the vertical depth of the
Cambrian strata, on which the Silurians lie conformably, there results, on
the lowest computation, a total depth of seven miles.
Now it is held by geologists, that this vast accumulation of strata must
have been deposited in an area of gradual subsidence. These strata could
not have been thus laid on each other in regular order, unless the Earth's
crust had been at that place sinking, either continuously or by very small
steps. Such an immense subsidence, however, must have been impossible
without a crust of great thickness. The Earth's molten nucleus tends ever,
with enormous force, to assume the form of a regular oblate spheroid. Any
depression of its crust below the surface of equilibrium, and any elevation
of its crust above that surface, have to withstand immense resistance. It
follows inevitably that, with a thin crust, nothing but small elevations
and subsidences would be possible; and that, conversely, a subsidence of
seven miles implies a crust of comparatively great strength, or, in other
words, of great thickness. Indeed, if we compare this inferred subsidence
in the Silurian period, with such elevations and depressions as our
existing continents and oceans display, we see no evidence that the Earth's
crust was appreciably thinner then than now. What are the implications? If,
as geologists generally admit, the Earth's crust has resulted from that
slow cooling which is even still going on--if we see no sign that at the
time when the earliest Cambrian strata were formed, this crust was
appreciably thinner than now; we are forced to conclude that the era during
which it acquired that great thickness possessed in the Cambrian period,
was enormous as compared with the interval between the Cambrian period and
our own. But during the incalculable series of epochs thus inferred, there
existed an ocean, tides, winds, waves, rain, rivers. The agencies by which
the denudation of continents and filling up of seas have all along been
carried on, were as active then as now. Endless successions of strata must
have been formed. And when we ask--Where are they? Nature's obvious reply
is--They have been destroyed by that igneous action to which so great a
part of our oldest-known strata owe their fusion or metamorphosis.
Only the last chapter of the Earth's history has come down to us. The many
previous chapters, stretching back to a time immeasurably remote, have been
burnt; and with them all the records of life we may presume they contained.
The greater part of the evidence which might have served to settle the
Development-controversy, is for ever lost; and on neither side can the
arguments derived from Geology be conclusive.
"But how happen there to be such evidences of progression as exist?" it may
be asked. "How happens it that, in ascending from the most ancient strata
to the most recent strata, we do find a succession of organic forms, which,
however irregularly, carries us from lower to higher?" This question seems
difficult to answer. Nevertheless, there is reason for thinking that
nothing can be safely inferred from the apparent progression here cited.
And the illustration which shows as much, will, we believe, also show how
little trust is to be placed in certain geological generalizations that
appear to be well established. With this somewhat elaborate illustration,
to which we now pass, our criticisms may fitly conclude.
Let us suppose that in a region now covered by wide ocean, there begins one
of those great and gradual upheavals by which new continents are formed. To
be precise, let us say that in the South Pacific, midway between New
Zealand and Patagonia, the sea-bottom has been little by little thrust up
towards the surface, and is about to emerge. What will be the successive
phenomena, geological and biological, which are likely to occur before this
emerging sea-bottom has become another Europe or Asia?
In the first place, such portions of the incipient land as are raised to
the level of the waves, will be rapidly denuded by them: their soft
substance will be torn up by the breakers, carried away by the local
currents, and deposited in neighbouring deeper water. Successive small
upheavals will bring new and larger areas within reach of the waves; fresh
portions will each time be removed from the surfaces previously denuded;
and further, some of the newly-formed strata, being elevated nearly to the
level of the water, will be washed away and re-deposited. In course of
time, the harder formations of the upraised sea-bottom will be uncovered.
These being less easily destroyed, will remain permanently above the
surface; and at their margins will arise the usual breaking down of rocks
into beach-sand and pebbles. While in the slow process of this elevation,
going on at the rate of perhaps two or three feet in a century, most of the
sedimentary deposits produced will be again and again destroyed and
reformed; there will, in those adjacent areas of subsidence which accompany
areas of elevation, be more or less continuous successions of sedimentary
deposits.
And now what will be the character of these new strata? They will
necessarily contain scarcely any traces of life. The deposits that had
previously been slowly formed at the bottom of this wide ocean, would be
sprinkled with fossils of but few species. The oceanic Fauna is not a rich
one; its hydrozoa do not admit of preservation; and the hard parts of its
few kinds of molluscs and crustaceans and insects are mostly fragile.
Hence, when the ocean-bed was here and there raised to the surface--when
its strata of sediment with their contained organic fragments were torn up
and long washed about by the breakers before being re-deposited--when the
re-deposits were again and again subject to this violent abrading action by
subsequent small elevations, as they would mostly be; what few fragile
organic remains they contained, would be in nearly all cases destroyed.
Thus such of the first-formed strata as survived the repeated changes of
level, would be practically "azoic;" like the Cambrian of our geologists.
When by the washing away of the soft deposits, the hard sub-strata had been
exposed in the shape of rocky islets, and a footing had thus been
furnished, the pioneers of a new life might be expected to make their
appearance. What would they be? Not any of the surrounding oceanic species,
for these are not fitted for a littoral life; but species flourishing on
some of the far-distant shores of the Pacific. Of such the first to
establish themselves would be sea-weeds and zoophytes; both because their
swarming spores and gemmules would be the most readily conveyed with
safety, and because when conveyed they would find fit food. It is true that
Cirrhipeds and Lamellibranchs, subsisting on the minute creatures which
everywhere people the sea, would also find fit food.
But passing over the fact that the germs of such higher forms are neither
so abundant nor so well fitted to bear long voyages, there is the more
important fact that the individuals arising from these germs can reproduce
only sexually, and that this vastly increases the obstacles to the
establishment of their races. The chances of early colonization are
immensely in favour of species which, multiplying by agamogenesis, can
people a whole shore from a single germ; and immensely against species
which, multiplying only by gamogenesis, must be introduced in considerable
numbers that some may survive, meet, and propagate. Thus we infer that the
earliest traces of life left in the sedimentary deposits near these new
shores, will be traces of life as humble as that indicated in the most
ancient rocks of Great Britain and Ireland. Imagine now that the processes
we have briefly indicated, continue--that the emerging lands become wider
in extent, and fringed by higher and more varied shores; and that there
still go on those ocean-currents which, at long intervals, convey from far
distant shores immigrant forms of life. What will result? Lapse of time
will of course favour the introduction of such new forms: admitting, as it
must, of those combinations of fit conditions, which, under the law of
probabilities, can occur only at very distant intervals. Moreover, the
increasing area of the islands, individually and as a group, implies
increasing length of coast; from which there follows a longer line of
contact with the streams and waves that bring drifting masses; and,
therefore, a greater chance that germs of fresh life will be stranded.
And once more, the comparatively-varied shores, presenting physical
conditions that change from mile to mile, will furnish suitable habitats
for more numerous species. So that as the elevation proceeds, three causes
conspire to introduce additional marine plants and animals. To what classes
will the increasing Fauna be for a long period confined? Of course, to
classes of which individuals, or their germs, are most liable to be carried
far away from their native shores by floating sea-weed or drift-wood; to
classes which are also least likely to perish in transit, or from change of
climate; and to those which can best subsist around coasts comparatively
bare of life. Evidently, then, corals, annelids, inferior molluscs, and
crustaceans of low grade, will chiefly constitute the early Fauna. The
large predatory members of these classes, will be later in establishing
themselves; both because the new shores must first become well peopled by
the creatures they prey on, and because, being more complex, they or their
ova must be less likely to survive the journey, and the change of
conditions.
We may infer, then, that the strata deposited next after the almost "azoic"
strata, would contain the remains of invertebrata, allied to those found
near the shores of Australia and South America. Of such invertebrate
remains, the lower beds would furnish comparatively few genera, and those
of relatively low types; while in the upper beds the number of genera would
be greater, and the types higher: just as among the fossils of our Silurian
system. As this great geologic change slowly progressed through its long
history of earthquakes, volcanic disturbances, minor upheavals and
subsidences--as the extent of the archipelago became greater and its
smaller islands coalesced into larger ones, while its coast line grew still
longer and more varied, and the neighbouring sea more thickly inhabited by
inferior forms of life; the lowest division of the vertebrata would begin
to be represented. In order of time, fish would naturally come after the
lower invertebrata: both as being less likely to have their ova transported
across the waste of waters, and as requiring for their subsistence a
pre-existing Fauna of some development. They might be expected to make
their appearance along with the predaceous crustaceans; as they do in the
uppermost Silurian rocks.
And here, too, let us remark, that as, during this long epoch we have been
describing, the sea would have made great inroads on some of the newly
raised lands that had remained stationary; and would probably in some
places have reached masses of igneous or metamorphic rocks; there might, in
course of time, arise by the decomposition and denudation of such rocks,
local deposits with oxide of iron, like our Old Red Sandstone. And
in these deposits might be buried the remains of the fish then peopling the
neighbouring sea.
Meanwhile, how would the surfaces of the upheaved masses be occupied? At
first their deserts of naked rocks and pebbles would bear only the humblest
forms of vegetal life, such as we find in grey and orange patches on our
own rugged mountain sides; for these alone could flourish on such surfaces,
and their spores would be the most readily transported. When, by the decay
of such protophytes, and that decomposition of rock effected by them, there
had resulted a fit habitat for mosses; these, of which the germs might be
conveyed in drifted trees, would begin to spread. A soil having been
eventually thus produced, it would become possible for plants of higher
organization to find roothold; and as in the way we have described the
archipelago and its constituent islands grew larger, and had more
multiplied relations with winds and waters, such higher plants might be
expected ultimately to have their seeds transferred from the nearest lands.
After something like a Flora had thus colonized the surface, it would
become possible for insects to exist; and of air-breathing creatures,
insects would manifestly be among the first to find their way from
elsewhere.
As, however, terrestrial organisms, both vegetal and animal, are much less
likely than marine organisms to survive the accidents of transport from
distant shores; it is clear that long after the sea surrounding these new
lands had acquired a varied Flora and Fauna, the lands themselves would
still be comparatively bare; and thus that the early strata, like our
Silurians, would afford no traces of terrestrial life. By the time that
large areas had been raised above the ocean, we may fairly suppose a
luxuriant vegetation to have been acquired. Under what circumstances are we
likely to find this vegetation fossilized? Large surfaces of land imply
large rivers with their accompanying deltas; and are liable to have lakes
and swamps. These, as we know from extant cases, are favourable to rank
vegetation; and afford the conditions needful for preserving it in the
shape of coal-beds. Observe, then, that while in the early history of such
a continent a carboniferous period could not occur, the occurrence of a
carboniferous period would become probable after long-continued upheavals
had uncovered large areas. As in our own sedimentary series, coal-beds
would make their appearance only after there had been enormous
accumulations of earlier strata charged with marine fossils.
Let us ask next, in what order the higher forms of animal life would make
their appearance. We have seen how, in the succession of marine forms,
there would be something like a progress from the lower to the higher:
bringing us in the end to predaceous molluscs, crustaceans, and fish. What
are likely to succeed fish? After marine creatures, those which would have
the greatest chance of surviving the voyage would be amphibious reptiles:
both because they are more tenacious of life than higher animals, and
because they would be less completely out of their element. Such reptiles
as can live in both fresh and salt water, like alligators; and such as are
drifted out of the mouths of great rivers on floating trees, as Humboldt
says the Orinoco alligators are; might be early colonists.
It is manifest, too, that reptiles of other kinds would be among the first
vertebrata to people the new continent. If we consider what will occur on
one of those natural rafts of trees, soil, and matted vegetable matter,
sometimes swept out to sea by such currents as the Mississippi, with a
miscellaneous living cargo; we shall see that while the active,
hot-blooded, highly-organized creatures will soon die of starvation and
exposure, the inert, cold-blooded ones, which can go long without food,
will live perhaps for weeks; and so, out of the chances from time to time
occurring during long periods, reptiles will be the first to get safely
landed on foreign shores: as indeed they are even now known sometimes to
be. The transport of mammalia being comparatively precarious, must, in the
order of probability, be longer postponed; and would, indeed, be unlikely
to occur until by the enlargement of the new continent, the distances of
its shores from adjacent lands had been greatly diminished, or the
formation of intervening islands had increased the chances of survival.
Assuming, however, that the facilities of immigration had become adequate;
which would be the first mammals to arrive and live? Not large herbivores;
for they would be soon drowned if by any accident carried out to sea. Not
the carnivora; for these would lack appropriate food, even if they outlived
the voyage. Small quadrupeds frequenting trees, and feeding on insects,
would be those most likely both to be drifted away from their native lands
and to find fit food in a new one. Insectivorous mammals, like in size to
those found in the Trias and the Stonesfield slate, might naturally be
looked for as the pioneers of the higher vertebrata. And if we suppose the
facilities of communication to be again increased, either by a further
shallowing of the intervening sea and a consequent multiplication of
islands, or by an actual junction of the new continent with an old one,
through continued upheavals; we should finally have an influx of the larger
and more perfect mammals.
Now rude as is this sketch of a process that would be extremely elaborate
and involved, and open as some of its propositions are to criticisms which
there is no space here to meet; no one will deny that it represents
something like the biologic history of the supposed new continent. Details
apart, it is manifest that simple organisms, able to flourish under simple
conditions of life, would be the first successful immigrants; and that more
complex organisms, needing for their existence the fulfilment of more
complex conditions, would afterwards establish themselves in something like
an ascending succession. At the one extreme we see every facility. The new
individuals can be conveyed in the shape of minute germs; these are
infinite in their numbers; they are diffused in the sea; they are
perpetually being carried in all directions to great distances by
ocean-currents; they can survive such long journeys unharmed; they can find
nutriment wherever they arrive; and the resulting organisms can multiply
asexually with great rapidity.
At the other extreme, we see every difficulty. The new individuals must be
conveyed in their adult forms; their numbers are, in comparison, utterly
insignificant; they live on land, and are very unlikely to be carried out
to sea; when so carried, the chances are immense against their escape from
drowning, starvation, or death by cold; if they survive the transit, they
must have a pre-existing Flora or Fauna to supply their special food; they
require, also, the fulfilment of various other physical conditions; and
unless at least two individuals of different sexes are safely landed, the
race cannot be established. Manifestly, then, the immigration of each
successively higher order of organisms, having, from one or other
additional condition to be fulfilled, an enormously-increased probability
against it, would naturally be separated from the immigration of a lower
order by some period like a geologic epoch.
And thus the successive sedimentary deposits formed while this new
continent was undergoing gradual elevation, would seem to furnish clear
evidence of a general progress in the forms of life. That lands thus raised
up in the midst of a wide ocean, would first give origin to unfossiliferous
strata; next, to strata containing only the lowest marine forms; next, to
strata containing higher marine forms, ascending finally to fish; and that
the strata above these would contain reptiles, then small mammals, then
great mammals; seems to us to be demonstrable from the known laws of
organic life.
And if the succession of fossils presented by the strata of this supposed
new continent, would thus simulate the succession presented by our own
sedimentary series; must we not say that our own sedimentary series very
possibly records nothing more than the phenomena accompanying one of these
great upheavals? We think this must be considered not only possible, but
highly probable: harmonizing as it does with the unavoidable conclusion
before pointed out, that geological changes must have been going on for a
period immeasurably greater than that of which we have records. And if the
probability of this conclusion be admitted, it must be admitted that the
facts of Palaeontology can never suffice either to prove or disprove the
Development Hypothesis; but that the most they can do is, to show whether
the last few pages of the Earth's biologic history are or are not in
harmony with this hypothesis--whether the existing Flora and Fauna can or
can not be affiliated upon the Flora and Fauna of the most recent geologic
times.
IX. THE DEVELOPMENT HYPOTHESIS.
In a debate upon the development hypothesis, lately narrated to me by a
friend, one of the disputants was described as arguing, that as, in all our
experience, we know no such phenomenon as transmutation of species, it is
unphilosophical to assume that transmutation of species ever takes place.
Had I been present, I think that, passing over his assertion, which is open
to criticism, I should have replied that, as in all our experience we have
never known a species _created_, it was, by his own showing,
unphilosophical to assume that any species ever had been created.
Those who cavalierly reject the Theory of Evolution, as not adequately
supported by facts, seem quite to forget that their own theory is supported
by no facts at all. Like the majority of men who are born to a given
belief, they demand the most rigorous proof of any adverse belief, but
assume that their own needs none. Here we find, scattered over the globe,
vegetable and animal organisms numbering, of the one kind (according to
Humboldt), some 320,000 species, and of the other, some 2,000,000 species
(see Carpenter); and if to these we add the numbers of animal and vegetable
species that have become extinct, we may safely estimate the number of
species that have existed, and are existing, on the Earth, at not less than
_ten millions_. Well, which is the most rational theory about these ten
millions of species? Is it most likely that there have been ten millions of
special creations? or is it most likely that by continual modifications,
due to change of circumstances, ten millions of varieties have been
produced, as varieties are being produced still?
Doubtless many will reply that they can more easily conceive ten millions
of special creations to have taken place, than they can conceive that ten
millions of varieties have arisen by successive modifications. All such,
however, will find, on inquiry, that they are under an illusion. This is
one of the many cases in which men do not really believe, but rather
_believe they believe_. It is not that they can truly conceive ten millions
of special creations to have taken place, but that they _think they can do
so_. Careful introspection will show them that they have never yet realized
to themselves the creation of even _one_ species. If they have formed a
definite conception of the process, let them tell us how a new species is
constructed, and how it makes its appearance. Is it thrown down from the
clouds? or must we hold to the notion that it struggles up out of the
ground? Do its limbs and viscera rush together from all the points of the
compass? or must we receive the old Hebrew idea, that God takes clay and
moulds a new creature? If they say that a new creature is produced in none
of these modes, which are too absurd to be believed; then they are required
to describe the mode in which a new creature _may_ be produced--a mode
which does _not_ seem absurd: and such a mode they will find that they
neither have conceived nor can conceive.
Should the believers in special creations consider it unfair thus to call
upon them to describe how special creations take place, I reply, that this
is far less than they demand from the supporters of the Development
Hypothesis. They are merely asked to point out a _conceivable_ mode. On the
other hand, they ask, not simply for a _conceivable_ mode, but for the
_actual_ mode. They do not say--Show us how this _may_ take place; but they
say--Show us how this _does_ take place. So far from its being unreasonable
to put the above question, it would be reasonable to ask not only for a
_possible_ mode of special creation, but for an _ascertained_ mode; seeing
that this is no greater a demand than they make upon their opponents.
And here we may perceive how much more defensible the new doctrine is than
the old one. Even could the supporters of the Development Hypothesis merely
show that the origination of species by the process of modification is
conceivable, they would be in a better position than their opponents. But
they can do much more than this. They can show that the process of
modification has effected, and is effecting, decided changes in all
organisms subject to modifying influences. Though, from the impossibility
of getting at a sufficiency of facts, they are unable to trace the many
phases through which any existing species has passed in arriving at its
present form, or to identify the influences which caused the successive
modifications; yet, they can show that any existing species--animal or
vegetable--when placed under conditions different from its previous ones,
_immediately begins to undergo certain changes of structure fitting it for
the new conditions_. They can show that in successive generations these
changes continue, until ultimately the new conditions become the natural
ones. They can show that in cultivated plants, in domesticated animals, and
in the several races of men, such alterations have taken place. They can
show that the degrees of difference so produced are often, as in dogs,
greater than those on which distinctions of species are in other cases
founded. They can show that it is a matter of dispute whether some of these
modified forms _are_ varieties or separate species. They can show, too,
that the changes daily taking place in ourselves--the facility that attends
long practice, and the loss of aptitude that begins when practice
ceases--the strengthening of passions habitually gratified, and the
weakening of those habitually curbed--the development of every faculty,
bodily, moral, or intellectual, according to the use made of it--are all
explicable on this same principle. And thus they can show that throughout
all organic nature there _is_ at work a modifying influence of the kind
they assign as the cause of these specific differences: an influence which,
though slow in its action, does, in time, if the circumstances demand it,
produce marked changes--an influence which, to all appearance, would
produce in the millions of years, and under the great varieties of
condition which geological records imply, any amount of change.
Which, then, is the most rational hypothesis?--that of special creations
which has neither a fact to support it nor is even definitely conceivable;
or that of modification, which is not only definitely conceivable, but is
countenanced by the habitudes of every existing organism?
That by any series of changes a protozoon should ever become a mammal,
seems to those who are not familiar with zoology, and who have not seen how
clear becomes the relationship between the simplest and the most complex
forms when intermediate forms are examined, a very grotesque notion.
Habitually looking at things rather in their statical than in their
dynamical aspect, they never realize the fact that, by small increments of
modification, any amount of modification may in time be generated. That
surprise which they feel on finding one whom they last saw as a boy, grown
into a man, becomes incredulity when the degree of change is greater.
Nevertheless, abundant instances are at hand of the mode in which we may
pass to the most diverse forms, by insensible gradations. Arguing the
matter some time since with a learned professor, I illustrated my position
thus:--You admit that there is no apparent relationship between a circle
and an hyperbola. The one is a finite curve; the other is an infinite one.
All parts of the one are alike; of the other no two parts are alike. The
one incloses a space; the other will not inclose a space though produced
for ever. Yet opposite as are these curves in all their properties, they
may be connected together by a series of intermediate curves, no one of
which differs from the adjacent ones in any appreciable degree. Thus, if a
cone be cut by a plane at right angles to its axis we get a circle. If,
instead of being perfectly at right angles, the plane subtends with the
axis an angle of 89 deg. 59', we have an ellipse, which no human eye, even when
aided by an accurate pair of compasses, can distinguish from a circle.
Decreasing the angle minute by minute, the ellipse becomes first
perceptibly eccentric, then manifestly so, and by and by acquires so
immensely elongated a form, as to bear no recognisable resemblance to a
circle. By continuing this process, the ellipse passes insensibly into a
parabola; and ultimately, by still further diminishing the angle, into an
hyperbola. Now here we have four different species of curve--circle,
ellipse, parabola, and hyperbola--each having its peculiar properties and
its separate equation, and the first and last of which are quite opposite
in nature, connected together as members of one series, all producible by a
single process of insensible modification.
But the blindness of those who think it absurd to suppose that complex
organic forms may have arisen by successive modifications out of simple
ones, becomes astonishing when we remember that complex organic forms are
daily being thus produced. A tree differs from a seed immeasurably in every
respect--in bulk, in structure, in colour, in form, in specific gravity, in
chemical composition: differs so greatly that no visible resemblance of any
kind can be pointed out between them. Yet is the one changed in the course
of a few years into the other: changed so gradually, that at no moment can
it be said--Now the seed ceases to be, and the tree exists. What can be
more widely contrasted than a newly-born child and the small,
semi-transparent, gelatinous spherule constituting the human ovum? The
infant is so complex in structure that a cyclopaedia is needed to describe
its constituent parts. The germinal vesicle is so simple that it may be
defined in a line. Nevertheless, a few months suffice to develop the one
out of the other; and that, too, by a series of modifications so small,
that were the embryo examined at successive minutes, even a microscope
would with difficulty disclose any sensible changes. That the uneducated
and the ill-educated should think the hypothesis that all races of beings,
man inclusive, may in process of time have been evolved from the simplest
monad, a ludicrous one, is not to be wondered at. But for the physiologist,
who knows that every individual being is so evolved--who knows further,
that in their earliest condition the germs of all plants and animals
whatever are so similar, "that there is no appreciable distinction amongst
them which would enable it to be determined whether a particular molecule
is the germ of a conferva or of an oak, of a zoophyte or of a man;"[U]--for
him to make a difficulty of the matter is inexcusable. Surely if a single
cell may, when subjected to certain influences, become a man in the space
of twenty years; there is nothing absurd in the hypothesis that under
certain other influences, a cell may in the course of millions of years
give origin to the human race. The two processes are generically the same;
and differ only in length and complexity.
[U] Carpenter.
We have, indeed, in the part taken by many scientific men in this
controversy of "Law _versus_ Miracle," a good illustration of the tenacious
vitality of superstitions. Ask one of our leading geologists or
physiologists whether he believes in the Mosaic account of the creation,
and he will take the question as next to an insult. Either he rejects the
narrative entirely, or understands it in some vague non-natural sense. Yet
one part of it he unconsciously adopts; and that, too, literally. For
whence has he got this notion of "special creations," which he thinks so
reasonable, and fights for so vigorously? Evidently he can trace it back to
no other source than this myth which he repudiates. He has not a single
fact in nature to quote in proof of it; nor is he prepared with any chain
of abstract reasoning by which it may be established. Catechise him, and he
will be forced to confess that the notion was put into his mind in
childhood as part of a story which he now thinks absurd. And why, after
rejecting all the rest of this story, he should strenuously defend this
last remnant of it as though he had received it on valid authority, he
would be puzzled to say.
X. THE SOCIAL ORGANISM.
Sir James Macintosh got great credit for the saying, that "constitutions
are not made, but grow." In our day, the most significant thing about this
saying is, that it was ever thought so significant. As from the surprise
displayed by a man at some familiar fact, you may judge of his general
culture; so from the admiration which an age accords to a new thought, its
average degree of enlightenment may be inferred. That this apophthegm of
Macintosh should have been quoted and re-quoted as it has, shows how
profound has been the ignorance of social science. A small ray of truth has
seemed brilliant, as a distant rushlight looks like a star in the
surrounding darkness.
Such a conception could not, indeed, fail to be startling when let fall in
the midst of a system of thought to which it was utterly alien. Universally
in Macintosh's day, things were explained on the hypothesis of manufacture,
rather than that of growth: as indeed they are, by the majority, in our own
day. It was held that the planets were severally projected round the sun
from the Creator's hand; with exactly the velocity required to balance the
sun's attraction. The formation of the Earth, the separation of sea from
land, the production of animals, were mechanical works from which God
rested as a labourer rests. Man was supposed to be moulded after a manner
somewhat akin to that in which a modeller makes a clay-figure. And of
course, in harmony with such ideas, societies were tacitly assumed to be
arranged thus or thus by direct interposition of Providence; or by the
regulations of law-makers; or by both.
Yet that societies are not artificially put together, is a truth so
manifest, that it seems wonderful men should have ever overlooked it.
Perhaps nothing more clearly shows the small value of historical studies,
as they have been commonly pursued. You need but to look at the changes
going on around, or observe social organization in its leading
peculiarities, to see that these are neither supernatural, nor are
determined by the wills of individual men, as by implication historians
commonly teach; but are consequent on general natural causes. The one case
of the division of labour suffices to show this. It has not been by command
of any ruler that some men have become manufacturers, while others have
remained cultivators of the soil. In Lancashire, millions have devoted
themselves to the making of cotton-fabrics; in Yorkshire, another million
lives by producing woollens; and the pottery of Staffordshire, the cutlery
of Sheffield, the hardware of Birmingham, severally occupy their hundreds
of thousands. These are large facts in the structure of English society;
but we can ascribe them neither to miracle, nor to legislation. It is not
by "the hero as king," any more than by "collective wisdom," that men have
been segregated into producers, wholesale distributors, and retail
distributors.
The whole of our industrial organization, from its main outlines down to
its minutest details, has become what it is, not simply without legislative
guidance, but, to a considerable extent, in spite of legislative
hindrances. It has arisen under the pressure of human wants and activities.
While each citizen has been pursuing his individual welfare, and none
taking thought about division of labour, or, indeed, conscious of the need
for it, division of labour has yet been ever becoming more complete. It has
been doing this slowly and silently: scarcely any having observed it until
quite modern times. By steps so small, that year after year the industrial
arrangements have seemed to men just what they were before--by changes as
insensible as those through which a seed passes into a tree; society has
become the complex body of mutually-dependent workers which we now see. And
this economic organization, mark, is the all-essential organization.
Through the combination thus spontaneously evolved, every citizen is
supplied with daily necessaries; while he yields some product or aid to
others. That we are severally alive to-day, we owe to the regular working
of this combination during the past week; and could it be suddenly
abolished, a great proportion of us would be dead before another week
ended. If these most conspicuous and vital arrangements of our social
structure, have arisen without the devising of any one, but through the
individual efforts of citizens to satisfy their own wants; we may be
tolerably certain that the less important arrangements have similarly
arisen.
"But surely," it will be said, "the social changes directly produced by
law, cannot be classed as spontaneous growths. When parliaments or kings
order this or that thing to be done, and appoint officials to do it, the
process is clearly artificial; and society to this extent becomes a
manufacture rather than a growth." No, not even these changes are
exceptions, if they be real and permanent changes. The true sources of such
changes lie deeper than the acts of legislators. To take first the simplest
instance. We all know that the enactments of representative governments
ultimately depend on the national will: they may for a time be out of
harmony with it, but eventually they must conform to it. And to say that
the national will finally determines them, is to say that they result from
the average of individual desires; or, in other words--from the average of
individual natures. A law so initiated, therefore, really grows out of the
popular character.
In the case of a Government representing a dominant class, the same things
holds, though not so manifestly. For the very existence of a class
monopolizing all power, is due to certain sentiments in the commonalty. But
for the feeling of loyalty on the part of retainers, a feudal system could
not exist. We see in the protest of the Highlanders against the abolition
of heritable jurisdictions, that they preferred that kind of local rule.
And if to the popular nature, must thus be ascribed the growth of an
irresponsible ruling class; then to the popular nature must be ascribed the
social arrangements which that class creates in the pursuit of its own
ends. Even where the Government is despotic, the doctrine still holds. The
character of the people is, as before, the original source of this
political form; and, as we have abundant proof, other forms suddenly
created will not act, but rapidly retrograde to the old form. Moreover,
such regulations as a despot makes, if really operative, are so because of
their fitness to the social state. His acts being very much swayed by
general opinion--by precedent, by the feeling of his nobles, his
priesthood, his army--are in part immediate results of the national
character; and when they are out of harmony with the national character,
they are soon practically abrogated.
The failure of Cromwell permanently to establish a new social condition,
and the rapid revival of suppressed institutions and practices after his
death, show how powerless is a monarch to change the type of the society he
governs. He may disturb, he may <DW44>, or he may aid the natural process
of organization; but the general course of this process is beyond his
control. Nay, more than this is true. Those who regard the histories of
societies as the histories of their great men, and think that these great
men shape the fates of their societies, overlook the truth that such great
men are the products of their societies. Without certain
antecedents--without a certain average national character, they could
neither have been generated nor could have had the culture which formed
them. If their society is to some extent re-moulded by them, they were,
both before and after birth, moulded by their society--were the results of
all those influences which fostered the ancestral character they inherited,
and gave their own early bias, their creed, morals, knowledge, aspirations.
So that such social changes as are immediately traceable to individuals of
unusual power, are still remotely traceable to the social causes which
produced these individuals, and hence, from the highest point of view, such
social changes also, are parts of the general developmental process.
Thus that which is so obviously true of the industrial structure of
society, is true of its whole structure. The fact that "constitutions are
not made, but grow," is simply a fragment of the much larger fact, that
under all its aspects and through all its ramifications, society is a
growth and not a manufacture.
* * * * *
A perception that there exists some analogy between the body politic and a
living individual body, was early reached; and from time to time
re-appeared in literature. But this perception was necessarily vague and
more or less fanciful. In the absence of physiological science, and
especially of those comprehensive generalizations which it has but recently
reached, it was impossible to discern the real parallelisms.
The central idea of Plato's model Republic, is the correspondence between
the parts of a society and the faculties of the human mind. Classifying
these faculties under the heads of Reason, Will, and Passion, he classifies
the members of his ideal society under what he regards as three analogous
heads:--councillors, who are to exercise government; military or executive,
who are to fulfil their behests; and the commonalty, bent on gain and
selfish gratification. In other words, the ruler, the warrior, and the
craftsman, are, according to him, the analogues of our reflective,
volitional, and emotional powers. Now even were there truth in the implied
assumption of a parallelism between the structure of a society and that of
a man, this classification would be indefensible. It might more truly be
contended that, as the military power obeys the commands of the Government,
it is the Government which answers to the Will; while the military power is
simply an agency set in motion by it. Or, again, it might be contended that
whereas the Will is a product of predominant desires, to which the Reason
serves merely as an eye, it is the craftsmen, who, according to the alleged
analogy, ought to be the moving power of the warriors.
Hobbes sought to establish a still more definite parallelism: not, however
between a society and the human mind, but between a society and the human
body. In the introduction to the work in which he developes this
conception, he says--
"For by art is created that great LEVIATHAN called a COMMONWEALTH,
or STATE, in Latin CIVITAS, which is but an artificial man; though of
greater stature and strength than the natural, for whose protection
and defence it was intended, and in which the _sovereignty_ is an
artificial _soul_, as giving life and motion to the whole body; the
_magistrates_ and other _officers_ of judicature and execution,
artificial _joints_; _reward_ and _punishment_, by which, fastened to
the seat of the sovereignty, every joint and member is moved to
perform his duty, are the _nerves_, that do the same in the body
natural; the _wealth_ and _riches_ of all the particular members are
the _strength_; _salus populi_, the _people's safety_, its
_business_; _counsellors_, by whom all things needful for it to know
are suggested unto it, are the _memory_; _equity_ and _laws_ an
artificial _reason_ and _will_; _concord_, _health_; _sedition_,
_sickness_; _civil war_, _death_,"
And Hobbes carries this comparison so far as actually to give a drawing of
the Leviathan--a vast human-shaped figure, whose body and limbs are made up
of multitudes of men. Just noting that these different analogies asserted
by Plato and Hobbes, serve to cancel each other (being, as they are, so
completely at variance), we may say that on the whole those of Hobbes are
the more plausible. But they are full of inconsistencies. If the
sovereignty is the _soul_ of the body politic, how can it be that
magistrates, who are a kind of deputy-sovereigns, should be comparable to
_joints_? Or, again, how can the three mental functions, memory, reason,
and will, be severally analogous, the first to counsellors, who are a class
of public officers, and the other two to equity and laws, which are not
classes of officers, but abstractions? Or, once more, if magistrates are
the artificial joints of society, how can reward and punishment be its
nerves? Its nerves must surely be some class of persons. Reward and
punishment must in societies, as in individuals, be _conditions_ of the
nerves, and not the nerves themselves.
But the chief errors of these comparisons made by Plato and Hobbes, lie
much deeper. Both thinkers assume that the organization of a society is
comparable, not simply to the organization of a living body in general, but
to the organization of the human body in particular. There is no warrant
whatever for assuming this. It is in no way implied by the evidence; and is
simply one of those fancies which we commonly find mixed up with the truths
of early speculation. Still more erroneous are the two conceptions in this,
that they construe a society as an artificial structure. Plato's model
republic--his ideal of a healthful body politic--is to be consciously put
together by men; just as a watch might be: and Plato manifestly thinks of
societies in general as thus originated. Quite specifically does Hobbes
express this view. "For by _art_," he says, "is created that great
LEVIATHAN called a COMMONWEALTH." And he even goes so far as to compare the
supposed social contract, from which a society suddenly originates, to the
creation of a man by the divine fiat. Thus they both fall into the extreme
inconsistency of considering a community as similar in structure to a human
being, and yet as produced in the same way as an artificial mechanism--in
in nature, an organism; in history, a machine.
Notwithstanding errors, however, these speculations have considerable
significance. That such analogies, crudely as they are thought out, should
have been alleged by Plato and Hobbes and many others, is a reason for
suspecting that _some_ analogy exists. The untenableness of the particular
comparisons above instanced, is no ground for denying an essential
parallelism; for early ideas are usually but vague adumbrations of the
truth. Lacking the great generalizations of biology, it was, as we have
said, impossible to trace out the real relations of social organizations to
organizations of another order. We propose here to show what are the
analogies which modern science discloses to us.
Let us set out by succinctly stating the points of similarity and the
points of difference. Societies agree with individual organisms in four
conspicuous peculiarities:--
1. That commencing as small aggregations, they insensibly augment in
mass: some of them eventually reaching ten thousand times what
they originally were.
2. That while at first so simple in structure as to be considered
structureless, they assume, in the course of their growth, a
continually-increasing complexity of structure.
3. That though in their early, undeveloped states, there exists in
them scarcely any mutual dependence of parts, their parts
gradually acquire a mutual dependence; which becomes at last so
great, that the activity and life of each part is made possible
only by the activity and life of the rest.
4. That the life and development of a society is independent of, and
far more prolonged than, the life and development of any of its
component units; who are severally born, grow, work, reproduce,
and die, while the body politic composed of them survives
generation after generation, increasing in mass, completeness of
structure, and functional activity.
These four parallelisms will appear the more significant the more we
contemplate them. While the points specified, are points in which societies
agree with individual organisms, they are points in which individual
organisms agree with each other, and disagree with all things else. In the
course of its existence, every plant and animal increases in mass, in a way
not parallelled by inorganic objects: even such inorganic objects as
crystals, which arise by growth, show us no such definite relation between
growth and existence as organisms do. The orderly progress from simplicity
to complexity, displayed by bodies politic in common with all living
bodies, is a characteristic which distinguishes living bodies from the
inanimate bodies amid which they move. That functional dependence of parts,
which is scarcely more manifest in animals or plants than nations, has no
counterpart elsewhere. And in no aggregate except an organic, or a social
one, is there a perpetual removal and replacement of parts, joined with a
continued integrity of the whole.
Moreover, societies and organisms are not only alike in these
peculiarities, in which they are unlike all other things; but the highest
societies, like the highest organisms, exhibit them in the greatest degree.
We see that the lowest animals do not increase to anything like the sizes
of the higher ones; and, similarly, we see that aboriginal societies are
comparatively limited in their growths. In complexity, our large civilized
nations as much exceed primitive savage tribes, as a vertebrate animal does
a zoophyte. Simple communities, like simple creatures, have so little
mutual dependence of parts, that subdivision or mutilation causes but
little inconvenience; but from complex communities, as from complex
creatures, you cannot remove any considerable organ without producing great
disturbance or death of the rest. And in societies of low type, as in
inferior animals, the life of the aggregate, often cut short by division or
dissolution, exceeds in length the lives of the component units, very far
less than in civilized communities and superior animals; which outlive many
generations of their component units.
On the other hand, the leading differences between societies and individual
organisms are these:--
1. That societies have no specific external forms. This, however, is a
point of contrast which loses much of its importance, when we remember that
throughout the vegetal kingdom, as well as in some lower divisions of the
animal kingdom, the forms are often very indefinite--definiteness being
rather the exception than the rule; and that they are manifestly in part
determined by surrounding physical circumstances, as the forms of societies
are. If, too, it should eventually be shown, as we believe it will, that
the form of every species of organism has resulted from the average play of
the external forces to which it has been subject during its evolution as a
species; then, that the external forms of societies should depend, as they
do, on surrounding conditions, will be a further point of community.
2. That though the living tissue whereof an individual organism consists,
forms a continuous mass, the living elements of a society do not form a
continuous mass; but are more or less widely dispersed over some portion of
the Earth's surface. This, which at first sight appears to be a fundamental
distinction, is one which yet to a great extent disappears when we
contemplate all the facts. For, in the lower divisions of the animal and
vegetal kingdoms, there are types of organization much more nearly allied,
in this respect, to the organization of a society, than might be
supposed--types in which the living units essentially composing the mass,
are dispersed through an inert substance, that can scarcely be called
living in the full sense of the word. It is thus with some of the
_Protococci_ and with the _Nostoceae_, which exist as cells imbedded in a
viscid matter. It is so, too, with the _Thalassicollae_--bodies that are
made up of differentiated parts, dispersed through an undifferentiated
jelly. And throughout considerable portions of their bodies, some of the
_Acalephae_ exhibit more or less distinctly this type of structure.
Indeed, it may be contended that this is the primitive form of all
organization; seeing that, even in the highest creatures, as in ourselves,
every tissue developes out of what physiologists call a blastema--an
unorganized though organizable substance, through which organic points are
distributed. Now this is very much the case with a society. For we must
remember that though the men who make up a society, are physically separate
and even scattered; yet that the surface over which they are scattered is
not one devoid of life, but is covered by life of a lower order which
ministers to their life. The vegetation which clothes a country, makes
possible the animal life in that country; and only through its animal and
vegetal products can such a country support a human society. Hence the
members of the body politic are not to be regarded as separated by
intervals of dead space; but as diffused through a space occupied by life
of a lower order. In our conception of a social organism, we must include
all that lower organic existence on which human existence, and therefore
social existence, depends. And when we do this, we see that the citizens
who make up a community, may be considered as highly vitalized units
surrounded by substances of lower vitality, from which they draw their
nutriment: much as in the cases above instanced. Thus, when examined, this
apparent distinction in great part disappears.
3. That while the ultimate living elements of an individual organism, are
mostly fixed in their relative positions, those of the social organism are
capable of moving from place to place, seems a marked disagreement. But
here, too, the disagreement is much less than would be supposed. For while
citizens are locomotive in their private capacities, they are fixed in
their public capacities. As farmers, manufacturers, or traders, men carry
on their business at the same spots, often throughout their whole lives;
and if they go away occasionally, they leave behind others to discharge
their functions in their absence. Each great centre of production, each
manufacturing town or district, continues always in the same place; and
many of the firms in such town or district, are for generations carried on
either by the descendants or successors of those who founded them. Just as
in a living body, the cells that make up some important organ, severally
perform their functions for a time and then disappear, leaving others to
supply their places; so, in each part of a society, the organ remains,
though the persons who compose it change. Thus, in social life, as in the
life of an animal, the units as well as the larger agencies formed of them,
are in the main stationary as respects the places where they discharge
their duties and obtain their sustenance. And hence the power of individual
locomotion does not practically affect the analogy.
4. The last and perhaps the most important distinction, is, that while in
the body of an animal, only a special tissue is endowed with feeling; in a
society, all the members are endowed with feeling. Even this distinction,
however, is by no means a complete one. For in some of the lowest animals,
characterized by the absence of a nervous system, such sensitiveness as
exists is possessed by all parts. It is only in the more organized forms
that feeling is monopolized by one class of the vital elements. Moreover,
we must remember that societies, too, are not without a certain
differentiation of this kind. Though the units of a community are all
sensitive, yet they are so in unequal degrees. The classes engaged in
agriculture and laborious occupations in general, are much less
susceptible, intellectually and emotionally, than the rest; and especially
less so than the classes of highest mental culture. Still, we have here a
tolerably decided contrast between bodies politic and individual bodies.
And it is one which we should keep constantly in view. For it reminds us
that while in individual bodies, the welfare of all other parts is rightly
subservient to the welfare of the nervous system, whose pleasurable or
painful activities make up the good or evil of life; in bodies politic, the
same thing does not hold, or holds to but a very slight extent. It is well
that the lives of all parts of an animal should be merged in the life of
the whole; because the whole has a corporate consciousness capable of
happiness or misery. But it is not so with a society; since its living
units do not and cannot lose individual consciousness; and since the
community as a whole has no corporate consciousness. And this is an
everlasting reason why the welfare of citizens cannot rightly be sacrificed
to some supposed benefit of the State; but why, on the other hand, the
State is to be maintained solely for the benefit of citizens. The corporate
life must here be subservient to the lives of the parts; instead of the
lives of the parts being subservient to the corporate life.
Such, then, are the points of analogy and the points of difference. May we
not say that the points of difference serve but to bring into clearer light
the points of analogy. While comparison makes definite the obvious
contrasts between organisms commonly so called, and the social organism; it
shows that even these contrasts are not so decided as was to be expected.
The indefiniteness of form, the discontinuity of the parts, the mobility of
the parts, and the universal sensitiveness, are not only peculiarities of
the social organism which have to be stated with considerable
qualifications; but they are peculiarities to which the inferior classes of
animals present approximations. Thus we find but little to conflict with
the all-important analogies. That societies slowly augment in mass; that
they progress in complexity of structure; that at the same time their parts
become more mutually dependent; that their living units are removed and
replaced without destroying their integrity; and further, that the extents
to which they display these peculiarities are proportionate to their vital
activities; are traits that societies have in common with organic bodies.
And these traits in which they agree with organic bodies and disagree with
all other things--these traits which in truth specially characterize
organic bodies, entirely subordinate the minor distinctions: such
distinctions being scarcely greater than those which separate one half of
the organic kingdom from the other. The _principles_ of organization are
the same; and the differences are simply differences of application.
Here ending this general survey of the facts which justify the comparison
of a society to a living body; let us look at them in detail. We shall find
that the parallelism becomes the more marked the more closely it is traced.
* * * * *
The lowest animal and vegetal forms--_Protozoa_ and _Protophyta_--are
chiefly inhabitants of the water. They are minute bodies, most of which are
made individually visible only by the microscope. All of them are extremely
simple in structure; and some of them, as the _Rhizopods_, almost
structureless. Multiplying, as they ordinarily do, by the spontaneous
division of their bodies, they produce halves, which may either become
quite separate and move away in different directions, or may continue
attached. By the repetition of this process of fission, aggregations of
various sizes and kinds are formed. Among the _Protophyta_ we have some
classes, as the _Diatomaceae_ and the Yeast-plant, in which the individuals
may be either separate, or attached in groups of two, three, four, or more;
other classes in which a considerable number of individual cells are united
into a thread (_Conferva_, _Monilia_); others in which they form a net work
(_Hydrodictyon_); others in which they form plates (_Ulva_); and others in
which they form masses (_Laminaria_, _Agaricus_): all which vegetal forms,
having no distinction of root, stem, or leaf, are called _Thallogens_.
Among the _Protozoa_ we find parallel facts. Immense numbers of
_Am[oe]ba_-like creatures, massed together in a framework of horny fibres,
constitute Sponge. In the _Foraminifera_, we see smaller groups of such
creatures arranged into more definite shapes. Not only do these almost
structureless _Protozoa_ unite into regular or irregular aggregations of
various sizes; but among some of the more organized ones, as the
_Vorticellae_, there are also produced clusters of individuals, proceeding
from a common stock. But these little societies of monads, or cells, or
whatever else we may call them, are societies only in the lowest sense:
there is no subordination of parts among them--no organization. Each of the
component units lives by and for itself; neither giving nor receiving aid.
There is no mutual dependence, save that consequent on mere mechanical
union.
Now do we not here discern analogies to the first stages of human
societies? Among the lowest races, as the Bushmen, we find but incipient
aggregation: sometimes single families; sometimes two or three families
wandering about together. The number of associated units is small and
variable; and their union inconstant. No division of labour exists except
between the sexes; and the only kind of mutual aid is that of joint attack
or defence. We see nothing beyond an undifferentiated group of individuals,
forming the germ of a society; just as in the homogeneous groups of cells
above described, we see only the initial stage of animal and vegetal
organization.
The comparison may now be carried a step higher. In the vegetal kingdom we
pass from the _Thallogens_, consisting of mere masses of similar cells, to
the _Acrogens_, in which the cells are not similar throughout the whole
mass; but are here aggregated into a structure serving as leaf, and there
into a structure serving as root: thus forming a whole in which there is a
certain subdivision of functions among the units; and therefore a certain
mutual dependence. In the animal kingdom we find analogous progress. From
mere unorganized groups of cells, or cell-like bodies, we ascend to groups
of such cells arranged into parts that have different duties. The common
Polype, from whose substance may be separated individual cells which
exhibit, when detached, appearances and movements like those of the
solitary _Am[oe]ba_, illustrates this stage. The component units, though
still showing great community of character, assume somewhat diverse
functions in the skin, in the internal surface, and in the tentacles. There
is a certain amount of "physiological division of labour."
Turning to societies, we find these stages paralleled in the majority of
aboriginal tribes. When, instead of such small variable groups as are
formed by Bushmen, we come to the larger and more permanent groups formed
by savages not quite so low, we begin to find traces of social structure.
Though industrial organization scarcely shows itself, except in the
different occupations of the sexes; yet there is always more or less of
governmental organization. While all the men are warriors and hunters, only
a part of them are included in the council of chiefs; and in this council
of chiefs some one has commonly supreme authority. There is thus a certain
distinction of classes and powers; and through this slight specialization
of functions, is effected a rude co-operation among the increasing mass of
individuals, whenever the society has to act in its corporate capacity.
Beyond this analogy in the slight extent to which organization is carried,
there is analogy in the indefiniteness of the organization. In the _Hydra_,
the respective parts of the creature's substance have many functions in
common. They are all contractile; omitting the tentacles, the whole of the
external surface can give origin to young _hydrae_; and when turned inside
out, stomach performs the duties of skin, and skin the duties of stomach.
In aboriginal societies such differentiations as exist are similarly
imperfect. Notwithstanding distinctions of rank, all persons maintain
themselves by their own exertions. Not only do the head men of the tribe,
in common with the rest, build their own huts, make their own weapons, kill
their own food; but the chief does the like. Moreover, in the rudest of
these tribes, such governmental organization as exists is very inconstant.
It is frequently changed by violence or treachery, and the function of
ruling assumed by other members of the community. Thus between the rudest
societies and some of the lowest forms of animal life there is analogy
alike in the slight extent to which organization is carried, in the
indefiniteness of this organization, and in its want of fixity.
A further complication of the analogy is at hand. From the aggregation of
units into organized groups, we pass to the multiplication of such groups,
and their coalescence into compound groups. The _Hydra_, when it has
reached a certain bulk, puts forth from its surface a bud, which, growing
and gradually assuming the form of the parent, finally becomes detached;
and by this process of gemmation, the creature peoples the adjacent water
with others like itself. A parallel process is seen in the multiplication
of those lowly-organized tribes above described. One of them having
increased to a size that is either too great for co-ordination under so
rude a structure, or else that is greater than the surrounding country can
supply with game and other wild food, there arises a tendency to divide;
and as in such communities there are ever occurring quarrels, jealousies,
and other causes of division, there soon comes an occasion on which a part
of the tribe separates under the leadership of some subordinate chief, and
migrates. This process being from time to time repeated, an extensive
region is at length occupied with numerous separate tribes descended from a
common ancestry. The analogy by no means ends here. Though in the common
_Hydra_, the young ones that bud out from the parent soon become detached
and independent; yet throughout the rest of the class _Hydrozoa_, to which
this creature belongs, the like does not generally happen. The successive
individuals thus developed continue attached; give origin to other such
individuals which also continue attached; and so there results a compound
animal. As in the _Hydra_ itself, we find an aggregation of units which,
considered separately, are akin to the lowest _Protozoa_; so here, in a
_Zoophyte_, we find an aggregation of such aggregations. The like is also
seen throughout the extensive family of _Polyzoa_ or _Molluscoida_. The
Ascidian Mollusks, too, in their many varied forms, show us the same thing:
exhibiting, at the same time, various degrees of union subsisting among the
component individuals. For while in the _Salpae_ the component individuals
adhere so slightly that a blow on the vessel of water in which they are
floating will separate them; in the _Botryllidae_ there exists a vascular
connexion between them, and a common circulation.
Now in these various forms and degrees of aggregation, may we not see
paralleled the union of groups of connate tribes into nations? Though in
regions where circumstances permit, the separate tribes descended from some
original tribe, migrate in all directions, and become far removed and quite
separate; yet, in other cases, where the territory presents barriers to
distant migration, this does not happen: the small kindred communities are
held in closer contact, and eventually become more or less united into a
nation. The contrast between the tribes of American Indians and the
Scottish clans, illustrates this. And a glance at our own early history, or
the early histories of continental nations, shows this fusion of small
simple communities taking place in various ways and to various extents. As
says M. Guizot, in his history of "The Origin of Representative
Government,"--
"By degrees, in the midst of the chaos of the rising society, small
aggregations are formed which feel the want of alliance and union
with each other.... Soon inequality of strength is displayed among
neighbouring aggregations. The strong tend to subjugate the weak, and
usurp at first the rights of taxation and military service. Thus
political authority leaves the aggregations which first instituted
it, to take a wider range."
That is to say, the small tribes, clans, or feudal unions, sprung mostly
from a common stock, and long held in contact as occupants of adjacent
lands, gradually get united in other ways than by mere adhesion of race and
proximity.
A further series of changes begins now to take place; to which, as before,
we shall find analogies in individual organisms. Returning again to the
_Hydrozoa_, we observe that in the simplest of the compound forms, the
connected individuals developed from a common stock, are alike in
structure, and perform like functions: with the exception, indeed, that
here and there a bud, instead of developing into a stomach, mouth, and
tentacles, becomes an egg-sac. But with the oceanic _Hydrozoa_, this is by
no means the case. In the _Calycophoridae_, some of the polypes growing from
the common germ, become developed and modified into large, long, sack-like
bodies, which by their rhythmical contractions move through the water,
dragging the community of polypes after them. In the _Physophoridae_, a
variety of organs similarly arise by transformation of the budding polypes;
so that in creatures like the _Physalia_, commonly known as the "Portuguese
Man-of-war," instead of that tree-like group of similar individuals forming
the original type of the class, we have a complex mass of unlike parts
fulfilling unlike duties. As an individual _Hydra_ may be regarded as a
group of _Protozoa_, which have become partially metamorphosed into
different organs; so a _Physalia_ is, morphologically considered, a group
of _Hydrae_ of which the individuals have been variously transformed to fit
them for various functions.
This differentiation upon differentiation, is just what takes place in the
evolution of a civilized society. We observed how, in the small communities
first formed, there arises a certain simple political organization--there
is a partial separation of classes having different duties. And now we have
to observe how, in a nation formed by the fusion of such small communities,
the several sections, at first alike in structures and modes of activity,
gradually become unlike in both--gradually become mutually-dependent parts,
diverse in their natures and functions.
The doctrine of the progressive division of labour, to which we are here
introduced, is familiar to all readers. And further, the analogy between
the economical division of labour and the "physiological division of
labour," is so striking, as long since to have drawn the attention of
scientific naturalists: so striking, indeed, that the expression
"physiological division of labour," has been suggested by it. It is not
needful, therefore, that we should treat this part of our subject in great
detail. We shall content ourselves with noting a few general and
significant facts, not manifest on a first inspection.
Throughout the whole animal kingdom, from the _C[oe]lenterata_ upwards, the
first stage of evolution is the same. Equally in the germ of a polype and
in the human ovum, the aggregated mass of cells out of which the creature
is to arise, gives origin to a peripheral layer of cells, slightly
differing from the rest which they include; and this layer subsequently
divides into two--the inner, lying in contact with the included yelk, being
called the mucous layer, and the outer, exposed to surrounding agencies,
being called the serous layer: or, in the terms used by Prof. Huxley, in
describing the development of the _Hydrozoa_--the endoderm and ectoderm.
This primary division marks out a fundamental contrast of parts in the
future organism. From the mucous layer, or endoderm, is developed the
apparatus of nutrition; while from the serous layer, or ectoderm, is
developed the apparatus of external action. Out of the one arise the organs
by which food is prepared and absorbed, oxygen imbibed, and blood purified;
while out of the other arise the nervous, muscular, and osseous systems, by
whose combined actions the movements of the body as a whole are effected.
Though this is not a rigorously-correct distinction, seeing that some
organs involve both of these primitive membranes, yet high authorities
agree in stating it as a broad general distinction.
Well, in the evolution of a society, we see a primary differentiation of
analogous kind; which similarly underlies the whole future structure. As
already pointed out, the only manifest contrast of parts in primitive
societies, is that between the governing and the governed. In the least
organized tribes, the council of chiefs may be a body of men distinguished
simply by greater courage or experience. In more organized tribes, the
chief-class is definitely separated from the lower class, and often
regarded as different in nature--sometimes as god-descended. And later, we
find these two becoming respectively freemen and slaves, or nobles and
serfs. A glance at their respective functions, makes it obvious that the
great divisions thus early formed, stand to each other in a relation
similar to that in which the primary divisions of the embryo stand to each
other. For, from its first appearance, the class of chiefs is that by which
the external acts of the society are controlled: alike in war, in
negotiation, and in migration. Afterwards, while the upper class grows
distinct from the lower, and at the same time becomes more and more
exclusively regulative and defensive in its functions, alike in the persons
of kings and subordinate rulers, priests, and military leaders; the
inferior class becomes more and more exclusively occupied in providing the
necessaries of life for the community at large. From the soil, with which
it comes in most direct contact, the mass of the people takes up and
prepares for use, the food and such rude articles of manufacture as are
known; while the overlying mass of superior men, maintained by the working
population, deals with circumstances external to the
community--circumstances with which, by position, it is more immediately
concerned. Ceasing by-and-by to have any knowledge of, or power over, the
concerns of the society as a whole, the serf-class becomes devoted to the
processes of alimentation; while the noble class, ceasing to take any part
in the processes of alimentation, becomes devoted to the co-ordinated
movements of the entire body politic.
Equally remarkable is a further analogy of like kind. After the mucous and
serous layers of the embryo have separated, there presently arises between
the two, a third, known to physiologists as the vascular layer--a layer out
of which are developed the chief blood-vessels. The mucous layer absorbs
nutriment from the mass of yelk it encloses; this nutriment has to be
transferred to the overlying serous layer, out of which the nervo-muscular
system is being developed; and between the two arises a vascular system by
which the transfer is effected--a system of vessels which continues ever
after to be the transferrer of nutriment from the places where it is
absorbed and prepared, to the places where it is needed for growth and
repair. Well, may we not trace a parallel step in social progress?
Between the governing and the governed, there at first exists no
intermediate class; and even in some societies that have reached
considerable sizes, there are scarcely any but the nobles and their kindred
on the one hand, and the serfs on the other: the social structure being
such, that the transfer of commodities takes place directly from slaves to
their masters. But in societies of a higher type, there grows up between
these two primitive classes, another--the trading or middle class. Equally,
at first as now, we may see that, speaking generally, this middle class is
the analogue of the middle layer in the embryo. For all traders are
essentially distributors. Whether they be wholesale dealers, who collect
into large masses the commodities of various producers; or whether they be
retailers, who divide out to those who want them, the masses of commodities
thus collected together; all mercantile men are agents of transfer from the
places where things are produced to the places where they are consumed.
Thus the distributing apparatus of a society, answers to the distributing
apparatus of a living body; not only in its functions, but in its
intermediate origin and subsequent position, and in the time of its
appearance.
Without enumerating the minor differentiations which these three great
classes afterwards undergo, we will merely note that throughout, they
follow the same general law with the differentiations of an individual
organism. In a society, as in a rudimentary animal, we have seen that the
most general and broadly contrasted divisions are the first to make their
appearance; and of the subdivisions it continues true in both cases, that
they arise in the order of decreasing generality.
Let us observe next, that in the one case as in the other, the
specializations are at first very incomplete; and become more complete as
organization progresses. We saw that in primitive tribes, as in the
simplest animals, there remains much community of function between the
parts that are nominally different--that, for instance, the class of chiefs
long remain industrially the same as the inferior class; just as in a
_Hydra_, the property of contractility is possessed by the units of the
endoderm as well as by those of the ectoderm. We noted also how, as the
society advanced, the two great primitive classes partook less and less of
each other's functions. And we have here to remark, that all subsequent
specializations are at first vague, and gradually become distinct. "In the
infancy of society," says M. Guizot, "everything is confused and uncertain;
there is as yet no fixed and precise line of demarcation between the
different powers in a state." "Originally kings lived like other
landowners, on the incomes derived from their own private estates." Nobles
were petty kings; and kings only the most powerful nobles. Bishops were
feudal lords and military leaders. The right of coining money was possessed
by powerful subjects, and by the Church, as well as by the king. Every
leading man exercised alike the functions of landowner, farmer, soldier,
statesman, judge. Retainers were now soldiers, and now labourers, as the
day required. But by degrees the Church has lost all civil jurisdiction;
the State has exercised less and less control over religious teaching; the
military class has grown a distinct one; handicrafts have concentrated in
towns; and the spinning-wheels of scattered farmhouses have disappeared
before the machinery of manufacturing districts. Not only is all progress
from the homogeneous to the heterogeneous; but at the same time it is from
the indefinite to the definite.
Another fact which should not be passed over, is that in the evolution of a
large society out of an aggregation of small ones, there is a gradual
obliteration of the original lines of separation--a change to which, also,
we may see analogies in living bodies. Throughout the sub-kingdom
_Annulosa_, this is clearly and variously illustrated. Among the lower
types of this sub-kingdom, the body consists of numerous segments that are
alike in nearly every particular. Each has its external ring; its pair of
legs, if the creature has legs; its equal portion of intestines, or else
its separate stomach; its equal portion of the great blood-vessel, or, in
some cases, its separate heart; its equal portion of the nervous cord, and,
perhaps, its separate pair of ganglia. But in the highest types, as in the
large _Crustacea_, many of the segments are completely fused together; and
the internal organs are no longer uniformly repeated in all the segments.
Now the segments of which nations at first consist, lose their separate
external and internal structures in a similar manner. In feudal times, the
minor communities governed by feudal lords, were severally organized in the
same rude way; and were held together only by the fealty of their
respective rulers to some suzerain. But along with the growth of a central
power, the demarcations of these local communities disappeared; and their
separate organizations merged into the general organization. The like is
seen on a larger scale in the fusion of England, Wales, Scotland, and
Ireland; and, on the Continent, in the coalescence of provinces into
kingdoms. Even in the disappearance of law-made divisions, the process is
analogous. Among the Anglo-Saxons, England was divided into tithings,
hundreds, and counties: there were county courts, courts of hundred, and
courts of tithing. The courts of tithing disappeared first; then the courts
of hundred, which have, however, left traces; while the county-jurisdiction
still exists.
But chiefly it is to be noted, that there eventually grows up an
organization which has no reference to these original divisions, but
traverses them in various directions, as is the case in creatures belonging
to the sub-kingdom just named; and, further, that in both cases it is the
sustaining organization which thus traverses old boundaries, while in both
cases it is the governmental, or co-ordinating organization in which the
original boundaries continue traceable. Thus, in the highest _Annulosa_,
the exo-skeleton and the muscular system, never lose all traces of their
primitive segmentation; but throughout a great part of the body, the
contained viscera do not in the least conform to the external divisions.
Similarly, with a nation, we see that while, for governmental purposes,
such divisions as counties and parishes still exist, the structure
developed for carrying on the nutrition of society, wholly ignores these
boundaries: our great cotton-manufacture spreads out of Lancashire into
North Derbyshire; Leicestershire and Nottinghamshire have long divided the
stocking-trade between them; one great centre for the production of iron
and iron-goods, includes parts of Warwickshire, Staffordshire,
Worcestershire; and those various specializations of agriculture which have
made different parts of England noted for different products, show no more
respect to county-boundaries than do our growing towns to the boundaries of
parishes.
If, after contemplating these analogies of structure, we inquire whether
there are any such analogies between the processes of organic change, the
answer is--yes. The causes which lead to increase of bulk in any part of
the body politic, are of like nature with those which lead to increase of
bulk in any part of an individual body. In both cases the antecedent is
greater functional activity, consequent on greater demand. Each limb,
viscus, gland, or other member of an animal, is developed by exercise--by
actively discharging the duties which the body at large requires of it; and
similarly, any class of labourers or artisans, any manufacturing centre, or
any official agency, begins to enlarge when the community devolves on it an
increase of work. In each case, too, growth has its conditions and its
limits. That any organ in a living being may grow by exercise, there needs
a due supply of blood: all action implies waste; blood brings the materials
for repair; and before there can be growth, the quantity of blood supplied
must be more than that requisite for repair.
So is it in a society. If to some district which elaborates for the
community particular commodities--say the woollens of Yorkshire--there
comes an augmented demand; and if, in fulfilment of this demand, a certain
expenditure and wear of the manufacturing organization are incurred; and
if, in payment for the extra supply of woollens sent away, there comes back
only such quantity of commodities as replaces the expenditure, and makes
good the waste of life and machinery; there can clearly be no growth. That
there may be growth, the commodities obtained in return must be more than
sufficient for these ends; and just in proportion as the surplus is great
will the growth be rapid. Whence it is manifest that what in commercial
affairs we call _profit_, answers to the excess of nutrition over waste in
a living body. Moreover, in both cases, when the functional activity is
high and the nutrition defective, there results not growth but decay. If in
an animal, any organ is worked so hard that the channels which bring blood
cannot furnish enough for repair, the organ dwindles; and if in the body
politic, some part has been stimulated into great productivity, and cannot
afterwards get paid for all its produce, certain of its members become
bankrupt, and it decreases in size.
One more parallelism to be here noted, is, that the different parts of the
social organism, like the different parts of an individual organism,
compete for nutriment; and severally obtain more or less of it according as
they are discharging more or less duty. If a man's brain be overexcited, it
will abstract blood from his viscera and stop digestion; or digestion
actively going on, will so affect the circulation through the brain as to
cause drowsiness; or great muscular exertion will determine such a quantity
of blood to the limbs, as to arrest digestion or cerebral action, as the
case may be. So, likewise, in a society, it frequently happens that great
activity in some one direction, causes partial arrests of activity
elsewhere, by abstracting capital, that is commodities: as instance the way
in which the sudden development of our railway-system hampered commercial
operations; or the way in which the raising of a large military force
temporarily stops the growth of leading industries.
* * * * *
The last few paragraphs introduce the next division of our subject. Almost
unawares we have come upon the analogy which exists between the blood of a
living body, and the circulating mass of commodities in the body politic.
We have now to trace out this analogy from its simplest to its most complex
manifestations.
In the lowest animals there exists no blood properly so called. Through the
small aggregation of cells which make up a _Hydra_, permeate the juices
absorbed from the food. There is no apparatus for elaborating a
concentrated and purified nutriment, and distributing it among the
component units; but these component units directly imbibe the unprepared
nutriment, either from the digestive cavity or from each other. May we not
say that this is what takes place in an aboriginal tribe? All its members
severally obtain for themselves the necessaries of life in their crude
states; and severally prepare them for their own uses as well as they can.
When there arises a decided differentiation between the governing and the
governed, some amount of transfer begins between those inferior
individuals, who, as workers, come directly in contact with the products of
the earth, and those superior ones who exercise the higher functions--a
transfer parallel to that which accompanies the differentiation of the
ectoderm from the endoderm. In the one case, as in the other, however, it
is a transfer of products that are little if at all prepared; and takes
place directly from the unit which obtains to the unit which consumes,
without entering into any general current.
Passing to larger organisms--individual and social--we find the first
advance upon this arrangement. Where, as among the compound _Hydrozoa_,
there is an aggregation of many such primitive groups as form _Hydrae_; or
where, as in a _Medusa_, one of these groups has become of great size;
there exist rude channels running throughout the substance of the body: not
however, channels for the conveyance of prepared nutriment, but mere
prolongations of the digestive cavity, through which the crude
chyle-aqueous fluid reaches the remoter parts, and is moved backwards and
forwards by the creature's contractions. Do we not find in some of the more
advanced primitive communities, an analogous condition? When the men,
partially or fully united into one society, become numerous--when, as
usually happens, they cover a surface of country not everywhere alike in
its products--when, more especially, there arise considerable classes that
are not industrial; some process of exchange and distribution inevitably
arises. Traversing here and there the earth's surface, covered by that
vegetation on which human life depends, and in which, as we say, the units
of a society are imbedded, there are formed indefinite paths, along which
some of the necessaries of life occasionally pass, to be bartered for
others which presently come back along the same channels. Note, however,
that at first little else but crude commodities are thus
transferred--fruits, fish, pigs or cattle, skins, etc.: there are few, if
any, manufactured products or articles prepared for consumption. And note
further, that such distribution of these unprepared necessaries of life as
takes place, is but occasional--goes on with a certain slow, irregular
rhythm.
Further progress in the elaboration and distribution of nutriment, or of
commodities, is a necessary accompaniment of further differentiation of
functions in the individual body or in the body politic. As fast as each
organ of a living animal becomes confined to a special action, it must
become dependent on the rest for all those materials which its position and
duty do not permit it to obtain for itself; in the same way that, as fast
as each particular class of a community becomes exclusively occupied in
producing its own commodity, it must become dependent on the rest for the
other commodities it needs. And, simultaneously, a more
perfectly-elaborated blood will result from a highly-specialized group of
nutritive organs, severally adapted to prepare its different elements; in
the same way that the stream of commodities circulating throughout a
society, will be of superior quality in proportion to the greater division
of labour among the workers. Observe, also, that in either case the
circulating mass of nutritive materials, besides coming gradually to
consist of better ingredients, also grows more complex. An increase in the
number of the unlike organs which add to the blood their waste matters, and
demand from it the different materials they severally need, implies a blood
more heterogeneous in composition--an _a priori_ conclusion which,
according to Dr. Williams, is inductively confirmed by examination of the
blood throughout the various grades of the animal kingdom. And similarly,
it is manifest that as fast as the division of labour among the classes of
a community, becomes greater, there must be an increasing heterogeneity in
the currents of merchandise flowing throughout that community.
The circulating mass of nutritive materials in individual organisms and in
social organisms, becoming alike better in the quality of its ingredients
and more heterogeneous in composition, as the type of structure becomes
higher; eventually has added to it in both cases another element, which is
not itself nutritive, but facilitates the process of nutrition. We refer,
in the case of the individual organism, to the blood-discs; and in the case
of the social organism, to money. This analogy has been observed by Liebig,
who in his "Familiar Letters on Chemistry," says:
"Silver and gold have to perform in the organization of the State,
the same function as the blood corpuscles in the human organization.
As these round discs, without themselves taking an immediate share in
the nutritive process, are the medium, the essential condition of the
change of matter, of the production of the heat, and of the force by
which the temperature of the body is kept up and the motions of the
blood and all the juices are determined, so has gold become the
medium of all activity in the life of the State."
And blood-corpuscles being like money in their functions, and in the fact
that they are not consumed in nutrition, he further points out, that the
number of them which in a considerable interval flows through the great
centres, is enormous when compared with their absolute number; just as the
quantity of money which annually passes through the great mercantile
centres, is enormous when compared with the total quantity of money in the
kingdom. Nor is this all. Liebig has omitted the significant circumstance,
that only at a certain stage of organization does this element of the
circulation make its appearance. Throughout extensive divisions of the
lower animals, the blood contains no corpuscles; and in societies of low
civilization, there is no money.
Thus far, we have considered the analogy between the blood in a living body
and the consumable and circulating commodities in the body politic. Let us
now compare the appliances by which they are respectively distributed. We
shall find in the development of these appliances, parallelisms not less
remarkable than those above set forth. Already we have shown that, as
classes, wholesale and retail distributors discharge in a society, the
office which the vascular system discharges in an individual creature; that
they come into existence later than the other two great classes, as the
vascular layer appears later than the mucous and serous layers; and that
they occupy a like intermediate position. Here, however, it remains to be
pointed out that a complete conception of the circulating system in a
society, includes not only the active human agents who propel the currents
of commodities, and regulate their distribution; but includes, also, the
channels of communication. It is the formation and arrangement of these, to
which we now direct attention.
Going back once more to those lower animals in which there is found nothing
but a partial diffusion, not of blood, but only of crude nutritive fluids,
it is to be remarked that the channels through which the diffusion takes
place, are mere excavations through the half-organized substance of the
body: they have no lining membranes, but are mere _lacunae_ traversing a
rude tissue. Now countries in which civilization is but commencing, display
a like condition: there are no roads properly so called; but the wilderness
of vegetal life covering the earth's surface, is pierced by tracks, through
which the distribution of crude commodities takes place. And while in both
cases, the acts of distribution occur only at long intervals (the currents,
after a pause, now setting towards a general centre, and now away from it),
the transfer is in both cases slow and difficult. But among other
accompaniments of progress, common to animals and societies, comes the
formation of more definite and complete channels of communication.
Blood-vessels acquire distinct walls; roads are fenced and gravelled. This
advance is first seen in those roads or vessels that are nearest to the
chief centres of distribution; while the peripheral roads and peripheral
vessels, long continue in their primitive states. At a yet later stage of
development, where comparative finish of structure is found throughout the
system as well as near the chief centres, there remains in both cases the
difference, that the main channels are comparatively broad and straight,
while the subordinate ones are narrow and tortuous in proportion to their
remoteness.
Lastly, it is to be remarked that there ultimately arise in the higher
social organisms, as in the higher individual organisms, main channels of
distribution still more distinguished by their perfect structures, their
comparative straightness, and the absence of those small branches which the
minor channels perpetually give off. And in railways we also see, for the
first time in the social organism, a specialization with respect to the
directions of the currents--a system of double channels conveying currents
in opposite directions, as do the arteries and veins of a well-developed
animal.
These parallelisms in the evolutions and structures of the circulating
systems, introduce us to others in the kinds and rates of the movements
going on through them. In the lowest societies, as in the lowest creatures,
the distribution of crude nutriment is by slow gurgitations and
regurgitations. In creatures that have rude vascular systems, as in
societies that are beginning to have roads and some transfer of commodities
along them, there is no regular circulation in definite courses; but
instead, periodical changes of the currents--now towards this point, and
now towards that. Through each part of an inferior mollusk's body, the
blood flows for a while in one direction, then stops, and flows in the
opposite direction; just as through a rudely-organized society, the
distribution of merchandise is slowly carried on by great fairs, occurring
in different localities, to and from which the currents periodically set.
Only animals of tolerably complete organizations, like advanced
communities, are permeated by constant currents that are definitely
directed. In living bodies, the local and variable currents disappear when
there grow up great centres of circulation, generating more powerful
currents, by a rhythm which ends in a quick, regular pulsation. And when in
social bodies, there arise great centres of commercial activity, producing
and exchanging large quantities of commodities, the rapid and continuous
streams drawn in and emitted by these centres, subdue all minor and local
circulations: the slow rhythm of fairs merges into the faster one of weekly
markets, and in the chief centres of distribution, weekly markets merge
into daily markets; while in place of the languid transfer from place to
place, taking place at first weekly, then twice or thrice a week, we
by-and-by get daily transfer, and finally transfer many times a day--the
original sluggish, irregular rhythm, becomes a rapid, equable pulse.
Mark, too, that in both cases the increased activity, like the greater
perfection of structure, is much less conspicuous at the periphery of the
vascular system. On main lines of railway, we have, perhaps, a score trains
in each direction daily, going at from thirty to fifty miles an hour; as,
through the great arteries, the blood rushes rapidly in successive gushes.
Along high roads, there move vehicles conveying men and commodities with
much less, though still considerable, speed, and with a much less decided
rhythm; as, in the smaller arteries, the speed of the blood is greatly
diminished, and the pulse less conspicuous. In parish-roads, narrow, less
complete, and more tortuous, the rate of movement is further decreased and
the rhythm scarcely traceable; as in the ultimate arteries. In those still
more imperfect by-roads which lead from these parish-roads to scattered
farmhouses and cottages, the motion is yet slower and very irregular; just
as we find it in the capillaries. While along the field-roads, which, in
their unformed, unfenced state, are typical of _lacunae_, the movement is
the slowest, the most irregular, and the most infrequent; as it is, not
only in the primitive _lacunae_ of animals, and societies, but as it is also
in those _lacunae_ in which the vascular system ends among extensive
families of inferior creatures.
Thus, then, we find between the distributing systems of living bodies and
the distributing systems of bodies politic, wonderfully close parallelisms.
In the lowest forms of individual and social organisms, there exist neither
prepared nutritive matters nor distributing appliances; and in both, these,
arising as necessary accompaniments of the differentiation of parts,
approach perfection as this differentiation approaches completeness. In
animals, as in societies, the distributing agencies begin to show
themselves at the same relative periods, and in the same relative
positions. In the one, as in the other, the nutritive materials circulated,
are at first crude and simple, gradually become better elaborated and more
heterogeneous, and have eventually added to them a new element facilitating
the nutritive processes. The channels of communication pass through similar
phases of development, which bring them to analogous forms. And the
directions, rhythms, and rates of circulation, progress by like steps to
like final conditions.
* * * * *
We come at length to the nervous system. Having noticed the primary
differentiation of societies into the governing and governed classes, and
observed its analogy to the differentiation of the two primary tissues
which respectively develope into organs of external action and organs of
alimentation; having noticed some of the leading analogies between the
development of industrial arrangements and that of the alimentary
apparatus; and having, above, more fully traced the analogies between the
distributing systems, social and individual; we have now to compare the
appliances by which a society, as a whole, is regulated, with those by
which the movements of an individual creature are regulated. We shall find
here, parallelisms equally striking with those already detailed.
The class out of which governmental organization originates, is, as we have
said, analogous in its relations to the ectoderm of the lowest animals and
of embryonic forms. And as this primitive membrane, out of which the
nervo-muscular system is evolved, must, even in the first stage of its
differentiation, be slightly distinguished from the rest by that greater
impressibility and contractility characterizing the organs to which it
gives rise; so, in that superior class which is eventually transformed into
the directo-executive system of a society (its legislative and defensive
appliances), does there exist in the beginning, a larger endowment of the
capacities required for these higher social functions. Always, in rude
assemblages of men, the strongest, most courageous, and most sagacious,
become rulers and leaders; and, in a tribe of some standing, this results
in the establishment of a dominant class, characterized on the average by
those mental and bodily qualities which fit them for deliberation and
vigorous combined action. Thus that greater impressibility and
contractility, which in the rudest animal types characterize the units of
the ectoderm, characterize also the units of the primitive social ectoderm;
since impressibility and contractility are the respective roots of
intelligence and strength.
Again, in the unmodified ectoderm, as we see it in the _Hydra_, the units
are all endowed both with impressibility and contractility; but as we
ascend to higher types of organization, the ectoderm differentiates into
classes of units which divide those two functions between them: some,
becoming exclusively impressible, cease to be contractile; while some,
becoming exclusively contractile, cease to be impressible. Similarly with
societies. In an aboriginal tribe, the directive and executive functions
are diffused in a mingled form throughout the whole governing class. Each
minor chief commands those under him, and if need be, himself coerces them
into obedience. The council of chiefs itself carries out on the
battle-field its own decisions. The head chief not only makes laws, but
administers justice with his own hands. In larger and more settled
communities, however, the directive and executive agencies begin to grow
distinct from each other. As fast as his duties accumulate, the head chief
or king confines himself more and more to directing public affairs, and
leaves the execution of his will to others: he deputes others to enforce
submission, to inflict punishments, or to carry out minor acts of offence
and defence; and only on occasions when, perhaps, the safety of the society
and his own supremacy are at stake, does he begin to act as well as direct.
As this differentiation establishes itself, the characteristics of the
ruler begin to change. No longer, as in an aboriginal tribe, the strongest
and most daring man, the tendency is for him to become the man of greatest
cunning, foresight, and skill in the management of others; for in societies
that have advanced beyond the first stage, it is chiefly such qualities
that insure success in gaining supreme power, and holding it against
internal and external enemies. Thus that member of the governing class who
comes to be the chief directing agent, and so plays the same part that a
rudimentary nervous centre does in an unfolding organism, is usually one
endowed with some superiorities of nervous organization.
In those somewhat larger and more complex communities possessing, perhaps,
a separate military class, a priesthood, and dispersed masses of population
requiring local control, there necessarily grow up subordinate governing
agents; who as their duties accumulate, severally become more directive and
less executive in their characters. And when, as commonly happens, the king
begins to collect round himself advisers who aid him by communicating
information, preparing subjects for his judgment, and issuing his orders;
we may say that the form of organization is comparable to one very general
among inferior types of animals, in which there exists a chief ganglion
with a few dispersed minor ganglia under its control.
The analogies between the evolution of governmental structures in
societies, and the evolution of governmental structures in living bodies,
are, however, more strikingly displayed during the formation of nations by
the coalescence of small communities--a process already shown to be, in
several respects, parallel to the development of those creatures that
primarily consist of many like segments. Among other points of community
between the successive rings which make up the body in the lower
_Articulata_, is the possession of similar pairs of ganglia. These pairs of
ganglia, though united together by nerves, are very incompletely dependent
on any general controlling power. Hence it results that when the body is
cut in two, the hinder part continues to move forward under the propulsion
of its numerous legs; and that when the chain of ganglia has been divided
without severing the body, the hind limbs may be seen trying to propel the
body in one direction, while the fore limbs are trying to propel it in
another. Among the higher _Articulata_, however, a number of the anterior
pairs of ganglia, besides growing larger, unite in one mass; and this great
cephalic ganglion, becoming the co-ordinator of all the creature's
movements, there no longer exists much local independence.
Now may we not in the growth of a consolidated kingdom out of petty
sovereignties or baronies, observe analogous changes? Like the chiefs and
primitive rulers above described, feudal lords, exercising supreme power
over their respective groups of retainers, discharge functions analogous to
those of rudimentary nervous centres; and we know that at first they, like
their analogues, are distinguished by superiorities of directive and
executive organization. Among these local governing centres, there is, in
early feudal times, very little subordination. They are in frequent
antagonism; they are individually restrained chiefly by the influence of
large parties in their own class; and are but imperfectly and irregularly
subject to that most powerful member of their order who has gained the
position of head suzerain or king. As the growth and organization of the
society progresses, these local directive centres fall more and more under
the control of a chief directive centre. Closer commercial union between
the several segments, is accompanied by closer governmental union; and
these minor rulers end in being little more than agents who administer, in
their several localities, the laws made by the supreme ruler: just as the
local ganglia above described, eventually become agents which enforce, in
their respective segments, the orders of the cephalic ganglion.
The parallelism holds still further. We remarked above, when speaking of
the rise of aboriginal kings, that in proportion as their territories and
duties increase, they are obliged not only to perform their executive
functions by deputy, but also to gather round themselves advisers to aid
them in their directive functions; and that thus, in place of a solitary
governing unit, there grows up a group of governing units, comparable to a
ganglion consisting of many cells. Let us here add, that the advisers, and
chief officers who thus form the rudiment of a ministry, tend from the
beginning to exercise a certain control over the ruler. By the information
they give and the opinions they express, they sway his judgment and affect
his commands. To this extent he therefore becomes a channel through which
are communicated the directions originating with them; and in course of
time, when the advice of ministers becomes the acknowledged source of his
actions, the king assumes very much the character of an automatic centre,
reflecting the impressions made on him from without.
Beyond this complication of governmental structure, many societies do not
progress; but in some, a further development takes place. Our own case best
illustrates this further development, and its further analogies. To kings
and their ministries have been added, in England, other great directive
centres, exercising a control which, at first small, has been gradually
becoming predominant: as with the great governing ganglia that especially
distinguish the highest classes of living beings. Strange as the assertion
will be thought, our Houses of Parliament discharge in the social economy,
functions that are in sundry respects comparable to those discharged by the
cerebral masses in a vertebrate animal. As it is in the nature of a single
ganglion to be affected only by special stimuli from particular parts of
the body; so it is in the nature of a single ruler to be swayed in his acts
by exclusive personal or class interests. As it is in the nature of an
aggregation of ganglia, connected with the primary one, to convey to it a
greater variety of influences from more numerous organs, and thus to make
its acts conform to more numerous requirements; so it is in the nature of a
king surrounded by subsidiary controlling powers, to adapt his rule to a
greater number of public exigencies. And as it is in the nature of those
great and latest-developed ganglia which distinguish the higher animals, to
interpret and combine the multiplied and varied impressions conveyed to
them from all parts of the system, and to regulate the actions in such way
as duly to regard them all; so it is in the nature of those great and
latest-developed legislative bodies which distinguish the most advanced
societies, to interpret and combine the wishes and complaints of all
classes and localities, and to regulate public affairs as much as possible
in harmony with the general wants.
The cerebrum co-ordinates the countless heterogeneous considerations which
affect the present and future welfare of the individual as a whole; and the
legislature co-ordinates the countless heterogeneous considerations which
affect the immediate and remote welfare of the whole community. We may
describe the office of the brain as that of _averaging_ the interests of
life, physical, intellectual, moral, social; and a good brain is one in
which the desires answering to these respective interests are so balanced,
that the conduct they jointly dictate, sacrifices none of them. Similarly,
we may describe the office of a Parliament as that of _averaging_ the
interests of the various classes in a community; and a good Parliament is
one in which the parties answering to these respective interests are so
balanced, that their united legislation concedes to each class as much as
consists with the claims of the rest. Besides being comparable in their
duties, these great directive centres, social and individual, are
comparable in the processes by which their duties are discharged.
It is now an acknowledged truth in psychology, that the cerebrum is not
occupied with direct impressions from without, but with the ideas of such
impressions: instead of the actual sensations produced in the body, and
directly appreciated by the sensory ganglia or primitive nervous centres,
the cerebrum receives only the representations of these sensations; and its
consciousness is called _representative_ consciousness, to distinguish it
from the original or _presentative_ consciousness. Is it not significant
that we have hit on the same word to distinguish the function of our House
of Commons? We call it a _representative_ body, because the interests with
which it deals--the pains and pleasures about which it consults--are not
directly presented to it, but represented to it by its various members; and
a debate is a conflict of representations of the evils or benefits likely
to follow from a proposed course--a description which applies with equal
truth to a debate in the individual consciousness. In both cases, too,
these great governing masses take no part in the executive functions. As,
after a conflict in the cerebrum, those desires which finally predominate,
act on the subjacent ganglia, and through their instrumentality determine
the bodily actions; so the parties which, after a parliamentary struggle,
gain the victory, do not themselves carry out their wishes, but get them
carried out by the executive divisions of the Government. The fulfilment of
all legislative decisions still devolves on the original directive
centres--the impulse passing from the Parliament to the Ministers, and from
the Ministers to the King, in whose name everything is done; just as those
smaller, first-developed ganglia, which in the lowest vertebrata are the
chief controlling agents, are still, in the brains of the higher
vertebrata, the agents through which the dictates of the cerebrum are
worked out.
Moreover, in both cases these original centres become increasingly
automatic. In the developed vertebrate animal, they have little function
beyond that of conveying impressions to, and executing the determinations
of, the larger centres. In our highly organized government, the monarch has
long been lapsing into a passive agent of Parliament; and now, ministers
are rapidly falling into the same position.
Nay, between the two cases there is a parallelism, even in respect of the
exceptions to this automatic action. For in the individual creature, it
happens that under circumstances of sudden alarm, as from a loud sound
close at hand, an unexpected object starting up in front, or a slip from
insecure footing, the danger is guarded against by some quick involuntary
jump, or adjustment of the limbs, that takes place before there is time to
consider the impending evil, and take deliberate measures to avoid it: the
rationale of which is, that these violent impressions produced on the
senses, are reflected from the sensory ganglia to the spinal cord and
muscles, without, as in ordinary cases, first passing through the cerebrum.
In like manner, on national emergencies, calling for prompt action, the
King and Ministry, not having time to lay the matter before the great
deliberative bodies, themselves issue commands for the requisite movements
or precautions: the primitive, and now almost automatic, directive centres,
resume for a moment their original uncontrolled power. And then, strangest
of all, observe that in either case there is an afterprocess of approval or
disapproval. The individual on recovering from his automatic start, at once
contemplates the cause of his fright; and, according to the case, concludes
that it was well he moved as he did, or condemns himself for his groundless
alarm. In like manner, the deliberative powers of the State, discuss, as
soon as may be, the unauthorized acts of the executive powers; and,
deciding that the reasons were or were not sufficient, grant or withhold a
bill of indemnity.[V]
[V] It may be well to warn the reader against an error fallen into by
one who criticised this essay on its first publication--the error
of supposing that the analogy here intended to be drawn, is a
specific analogy between the organization of society in England,
and the human organization. As said at the outset, no such
specific analogy exists. The above parallel, is one between the
most-developed systems of governmental organization, individual
and social; and the vertebrate type is instanced, merely as
exhibiting this most-developed system. If any specific comparison
were made, which it cannot rationally be, it would be to some
much lower vertebrate form than the human.
Thus far in comparing the governmental organization of the body politic
with that of an individual body, we have considered only the respective
co-ordinating centres. We have yet to consider the channels through which
these co-ordinating centres receive information and convey commands. In the
simplest societies, as in the simplest organisms, there is no "internuncial
apparatus," as Hunter styled the nervous system. Consequently, impressions
can be but slowly propagated from unit to unit throughout the whole mass.
The same progress, however, which, in animal-organization, shows itself in
the establishment of ganglia or directive centres, shows itself also in the
establishment of nerve-threads, through which the ganglia receive and
convey impressions, and so control remote organs. And in societies the like
eventually takes place.
After a long period during which the directive centres communicate with
various parts of the society through other means, there at last comes into
existence an "internuncial apparatus," analogous to that found in
individual bodies. The comparison of telegraph-wires to nerves, is familiar
to all. It applies, however, to an extent not commonly supposed. We do not
refer to the near alliance between the subtle forces employed in the two
cases; though it is now held that the nerve-force, if not literally
electric, is still a special form of electric action, related to the
ordinary form much as magnetism is. But we refer to the structural
arrangements of our telegraph-system. Thus, throughout the vertebrate
sub-kingdom, the great nerve-bundles diverge from the vertebrate axis, side
by side with the great arteries; and similarly, our groups of
telegraph-wires are carried along the sides of our railways. The most
striking parallelism, however, remains. Into each great bundle of nerves,
as it leaves the axis of the body along with an artery, there enters a
branch of the sympathetic nerve; which branch, accompanying the artery
throughout its ramifications, has the function of regulating its diameter
and otherwise controlling the flow of blood through it according to the
local requirements. Analogously, in the group of telegraph-wires running
alongside each railway, there is one for the purpose of regulating the
traffic--for retarding or expediting the flow of passengers and
commodities, as the local conditions demand. Probably, when our now
rudimentary telegraph-system is fully developed, other analogies will be
traceable.
Such, then, is a general outline of the evidence which justifies, in
detail, the comparison of societies to living organisms. That they
gradually increase in mass; that they become little by little more complex;
that at the same time their parts grow more mutually dependent; and that
they continue to live and grow as wholes, while successive generations of
their units appear and disappear; are broad peculiarities which bodies
politic display, in common with all living bodies; and in which they and
living bodies differ from everything else. And on carrying out the
comparison in detail, we find that these major analogies involve many minor
analogies, far closer than might have been expected. To these we would
gladly have added others. We had hoped to say something respecting the
different types of social organization, and something also on social
metamorphoses; but we have reached our assigned limits.
XI. USE AND BEAUTY
In one of his essays, Emerson remarks, that what Nature at one time
provides for use, she afterwards turns to ornament; and he cites in
illustration the structure of a sea-shell, in which the parts that have for
a while formed the mouth are at the next season of growth left behind, and
become decorative nodes and spines.
It has often occurred to me that this same remark might be extended to the
progress of Humanity. Here, too, the appliances of one era serve as
embellishments to the next. Equally in institutions, creeds, customs, and
superstitions, we may trace this evolution of beauty out of what was once
purely utilitarian.
The contrast between the feeling with which we regard portions of the
Earth's surface still left in their original state, and the feeling with
which the savage regarded them, is an instance that naturally comes first
in order of time. If any one walking over Hampstead Heath, will note how
strongly its picturesqueness is brought out by contrast with the
surrounding cultivated fields and the masses of houses lying in the
distance; and will further reflect that, had this irregular gorse-covered
surface extended on all sides to the horizon, it would have looked dreary
and prosaic rather than pleasing; he will see that to the primitive man a
country so clothed presented no beauty at all. To him it was merely a haunt
of wild animals, and a ground out of which roots might be dug. What have
become for us places of relaxation and enjoyment--places for afternoon
strolls and for gathering flowers--were his places for labour and food,
probably arousing in his mind none but utilitarian associations.
Ruined castles afford an obvious instance of this metamorphosis of the
useful into the beautiful. To feudal barons and their retainers, security
was the chief, if not the only end, sought in choosing the sites and styles
of their strongholds. Probably they aimed as little at the picturesque as
do the builders of cheap brick houses in our modern towns. Yet what where
erected for shelter and safety, and what in those early days fulfilled an
important function in the social economy, have now assumed a purely
ornamental character. They serve as scenes for picnics; pictures of them
decorate our drawing-rooms; and each supplies its surrounding districts
with legends for Christmas Eve.
Following out the train of thought suggested by this last illustration, we
may see that not only do the material exuviae of past social states become
the ornaments of our landscapes; but that past habits, manners, and
arrangements, serve as ornamental elements in our literature. The tyrannies
that, to the serfs who bore them, were harsh and dreary facts; the feuds
which, to those who took part in them, were very practical life-and-death
affairs; the mailed, moated, sentinelled security that was irksome to the
nobles who needed it; the imprisonments, and tortures, and escapes, which
were stern and quite prosaic realities to all concerned in them; have
become to us material for romantic tales--material which when woven into
Ivanhoes and Marmions, serves for amusement in leisure hours, and become
poetical by contrast with our daily lives.
Thus, also, is it with extinct creeds. Stonehenge, which in the hands of
the Druids had a governmental influence over men, is in our day a place for
antiquarian excursions; and its attendant priests are worked up into an
opera. Greek sculptures, preserved for their beauty in our galleries of
art, and copied for the decoration of pleasure grounds and entrance halls,
once lived in men's minds as gods demanding obedience; as did also the
grotesque idols that now amuse the visitors to our museums.
Equally marked is this change of function in the case of minor
superstitions. The fairy lore, which in past times was matter of grave
belief, and held sway over people's conduct, has since been transformed
into ornament for _A Midsummer Night's Dream_, _The Tempest_, _The Fairy
Queen_, and endless small tales and poems; and still affords subjects for
children's story-books, themes for ballets, and plots for Planche's
burlesques. Gnomes, and genii, and afrits, losing all their terrors, give
piquancy to the woodcuts in our illustrated edition of the _Arabian
Nights_. While ghost-stories, and tales of magic and witchcraft, after
serving to amuse boys and girls in their leisure hours, become matter for
jocose allusions that enliven tea-table conversation.
Even our serious literature and our speeches are very generally relieved by
ornaments drawn from such sources. A Greek myth is often used as a parallel
by which to vary the monotony of some grave argument. The lecturer breaks
the dead level of his practical discourse by illustrations drawn from
bygone customs, events, or beliefs. And metaphors, similarly derived, give
brilliancy to political orations, and to _Times_ leading articles.
Indeed, on careful inquiry, I think it will be found that we turn to
purposes of beauty most bygone phenomena that are at all conspicuous. The
busts of great men in our libraries, and their tombs in our churches; the
once useful but now purely ornamental heraldic symbols; the monks, nuns,
and convents, that give interest to a certain class of novels; the bronze
mediaeval soldiers used for embellishing drawing-rooms; the gilt Apollos
that recline on time-pieces; the narratives that serve as plots for our
great dramas; and the events that afford subjects for historical
pictures;--these and such like illustrations of the metamorphosis of the
useful into the beautiful, are so numerous as to suggest that, did we
search diligently enough, we should find that in some place, or under some
circumstances, nearly every notable product of the past has assumed a
decorative character.
And here the mention of historical pictures reminds me that an inference
may be drawn from all this, bearing directly on the practice of art. It has
of late years been a frequent criticism upon our historical painters, that
they err in choosing their subjects from the past; and that, would they
found a genuine and vital school, they must render on canvas the life and
deeds and aims of our own time. If, however, there be any significance in
the foregoing facts, it seems doubtful whether this criticism is a just
one. For if it be the process of things, that what has performed some
practical function in society during one era, becomes available for
ornament in a subsequent one; it almost follows that, conversely, whatever
is performing some practical function now, or has very recently performed
one, does not possess the ornamental character; and is, consequently,
inapplicable to any purpose of which beauty is the aim, or of which it is a
needful ingredient.
Still more reasonable will this conclusion appear, when we consider the
nature of this process by which the useful is changed into the ornamental.
An essential pre-requisite to all beauty is _contrast_. To obtain artistic
effect, light must be put in juxtaposition with shade, bright colours with
dull colours, a fretted surface with a plain one. _Forte_ passages in music
must have _piano_ passages to relieve them; concerted pieces need
interspersing with solos; and rich chords must not be continuously
repeated. In the drama we demand contrast of characters, of scenes, of
sentiment, of style. In prose composition an eloquent passage should have a
comparatively plain setting; and in poems great effect is obtained by
occasional change of versification. This general principle will, I think,
explain the transformation of the bygone useful into the present beautiful.
It is by virtue of their contrast with our present modes of life, that past
modes of life look interesting and romantic. Just as a picnic, which is a
temporary return to an aboriginal condition, derives, from its
unfamiliarity, a certain poetry which it would not have were it habitual;
so, everything ancient gains, from its relative novelty to us, an element
of interest. Gradually as, by the growth of society, we leave behind the
customs, manners, arrangements, and all the products, material and mental,
of a bygone age--gradually as we recede from these so far that there arises
a conspicuous difference between them and those we are familiar with; so
gradually do they begin to assume to us a poetical aspect, and become
applicable for ornament. And hence it follows that things and events which
are close to us, and which are accompanied by associations of ideas not
markedly contrasted with our ordinary associations are relatively
inappropriate for purposes of art.
XII. THE SOURCES OF ARCHITECTURAL TYPES.
When lately looking through the gallery of the Old Water-Colour Society, I
was struck with the incongruity produced by putting regular architecture
into irregular scenery. In one case, where the artist had introduced a
perfectly symmetrical Grecian edifice into a mountainous and somewhat wild
landscape, the discordant effect was particularly marked. "How very
unpicturesque," said a lady to her friend, as they passed; showing that I
was not alone in my opinion. Her phrase, however, set me speculating. Why
unpicturesque? Picturesque means, like a picture--like what men choose for
pictures. Why then should this be not fit for a picture?
Thinking the matter over, it seemed to me that the artist had sinned
against that unity which is essential to a good picture. When the other
constituents of a landscape have irregular forms, any artificial structure
introduced must have an irregular form, that it may seem _part_ of the
landscape. The same general character must pervade it and surrounding
objects; otherwise it, and the scene amid which it stands, become not _one_
thing but _two_ things; and we say it looks out of place. Or, speaking
psychologically, the associated ideas called up by a building with its
wings, windows, and all its parts symmetrically disposed, differ widely
from the ideas associated with an entirely irregular landscape; and the one
set of ideas tends to banish the other.
Pursuing the train of thought, sundry illustrative facts came to my mind. I
remembered that a castle, which is more irregular in outline than any other
kind of building, pleases us most when seated amid crags and precipices;
while a castle on a plain seems an incongruity. The partly-regular and
partly-irregular forms of our old farm-houses, and our gabled gothic manors
and abbeys, appear quite in harmony with an undulating, wooded country. In
towns we prefer symmetrical architecture; and in towns it produces in us no
feeling of incongruity, because all surrounding things--men, horses,
vehicles--are symmetrical also.
And here I was reminded of a notion that has frequently recurred to me;
namely, that there is some relationship between the several kinds of
architecture and the several classes of natural objects. Buildings in the
Greek and Roman styles seem, in virtue of their symmetry, to take their
type from animal life. In the partly-irregular Gothic, ideas derived from
the vegetable world appear to predominate. And wholly irregular buildings,
such as castles, may be considered as having inorganic forms for their
basis.
Whimsical as this speculation looks at first sight, it is countenanced by
numerous facts. The connexion between symmetrical architecture and animal
forms, may be inferred from the _kind_ of symmetry we expect, and are
satisfied with, in regular buildings. Thus in a Greek temple we require
that the front shall be symmetrical in itself, and that the two flanks
shall be alike; but we do not look for uniformity between the flanks and
the front, nor between the front and the back. The identity of this
symmetry with that found in animals is obvious. Again, why is it that a
building making any pretension to symmetry displeases us if not quite
symmetrical? Probably the reply will be--Because we see that the designer's
idea is not fully carried out; and that hence our love of completeness is
offended. But then there come the further questions--How do we know that
the architect's conception was symmetrical? Whence comes this notion of
symmetry which we have, and which we attribute to him? Unless we fall back
upon the old doctrine of innate ideas, we must admit that the idea of
bilateral symmetry is derived from without; and to admit this is to admit
that it is derived from the higher animals.
That there is some relationship between Gothic architecture and vegetable
forms is a position generally admitted. The often-remarked analogy between
a groined nave and an avenue of trees with interlacing branches, shows that
the fact has forced itself on men's observation. It is not only in this
analogy, however, that the kinship is seen. It is seen still better in the
essential characteristic of Gothic; namely, what is termed its _aspiring_
tendency. That predominance of vertical lines which so strongly
distinguishes Gothic from other styles, is the most marked peculiarity of
trees, when compared with animals or rocks. To persons of active
imagination, a tall Gothic tower, with its elongated apertures and clusters
of thin projections running from bottom to top, suggests a vague notion of
growth.
Of the alleged connexion between inorganic forms and the wholly irregular
and the castellated styles of building, we have, I think, some proof in the
fact that when an edifice is irregular, the _more_ irregular it is the more
it pleases us. I see no way of accounting for this fact, save by supposing
that the greater the irregularity the more strongly are we reminded of the
inorganic forms typified, and the more vividly are aroused the agreeable
ideas of rugged and romantic scenery associated with those forms.
Further evidence of these several relationships of styles of architecture
to classes of natural objects, is supplied by the kinds of decoration they
respectively represent. The public buildings of Greece, while characterized
in their outlines by the bilateral symmetry seen in the higher animals,
have their pediments and entablatures covered with sculptured men and
beasts. Egyptian temples and Assyrian palaces, while similarly symmetrical
in their general plan, are similarly ornamented on their walls and at their
doors. In Gothic, again, with its grove-like ranges of clustered columns,
we find rich foliated ornaments abundantly employed. And accompanying the
totally irregular, inorganic outlines of old castles, we see neither
vegetable nor animal decorations. The bare, rock-like walls are surmounted
by battlements, consisting of almost plain blocks, which remind us of the
projections on the edge of a rugged cliff.
But perhaps the most significant fact is the harmony that may be observed
between each type of architecture and the scenes in which it is indigenous.
For what is the explanation of this harmony, unless it be that the
predominant character of surrounding things has, in some way, determined
the mode of building adopted?
That the harmony exists is clear. Equally in the cases of Egypt, Assyria,
Greece, and Rome, town life preceded the construction of the symmetrical
buildings that have come down to us. And town life is one in which, as
already observed, the majority of familiar objects are symmetrical. We
instinctively feel the naturalness of this association. Out amid the
fields, a formal house, with a central door flanked by an equal number of
windows to right and left, strikes us as unrural--looks as though
transplanted from a street; and we cannot look at one of those stuccoed
villas, with mock windows carefully arranged to balance the real ones,
without being reminded of the suburban residence of a retired tradesman.
In styles indigenous in the country, we not only find the general
irregularity characteristic of surrounding things, but we may trace some
kinship between each kind of irregularity and the local circumstances. We
see the broken rocky masses amid which castles are commonly placed,
mirrored in their stern, inorganic forms. In abbeys, and such-like
buildings, which are commonly found in comparatively sheltered districts,
we find no such violent dislocations of masses and outlines; and the
nakedness appropriate to the fortress is replaced by decorations reflecting
the neighbouring woods. Between a Swiss cottage and a Swiss view there is
an evident relationship. The angular roof, so bold and so
disproportionately large when compared to other roofs, reminds one of the
adjacent mountain peaks; and the broad overhanging eaves have a sweep and
inclination like those of the lower branches of a pine tree. Consider, too,
the apparent kinship between the flat roofs that prevail in Eastern cities,
interspersed with occasional minarets, and the plains that commonly
surround them, dotted here and there by palm trees. You cannot contemplate
a picture of one of these places, without being struck by the predominance
of horizontal lines, and their harmony with the wide stretch of the
landscape.
That the congruity here pointed out should hold in every case must not be
expected. The Pyramids, for example, do not seem to come under this
generalization. Their repeated horizontal lines do indeed conform to the
flatness of the neighbouring desert; but their general contour seems to
have no adjacent analogue. Considering, however, that migrating races,
carrying their architectural systems with them, would naturally produce
buildings having no relationship to their new localities; and that it is
not always possible to distinguish styles which are indigenous, from those
which are naturalized; numerous anomalies must be looked for.
The general idea above illustrated will perhaps be somewhat misinterpreted.
Possibly some will take the proposition to be that men _intentionally_ gave
to their buildings the leading characteristics of neighbouring objects. But
this is not what is meant. I do not suppose that they did so in times past,
any more than they do so now. The hypothesis is, that in their choice of
forms men are unconsciously influenced by the forms encircling them. That
flat-roofed, symmetrical architecture should have originated in the East,
among pastoral tribes surrounded by their herds and by wide plains, seems
to imply that the builders were swayed by the horizontality and symmetry to
which they were habituated. And the harmony which we have found to exist in
other cases between indigenous styles and their localities, implies the
general action of like influences. Indeed, on considering the matter
psychologically, I do not see how it could well be otherwise. For as all
conceptions must be made up of images, and parts of images, received
through the senses--as it is impossible for a man to conceive any design
save one of which the elements have come into his mind from without; and as
his imagination will most readily run in the direction of his habitual
perceptions; it follows, almost necessarily, that the characteristic which
predominates in these habitual perceptions must impress itself on his
design.
XIII. THE USE OF ANTHROPOMORPHISM.
That long fit of indignation which seizes all generous natures when in
youth they begin contemplating human affairs, having fairly spent itself,
there slowly grows up a perception that the institutions, beliefs, and
forms so vehemently condemned are not wholly bad. This reaction runs to
various lengths. In some, merely to a comparative contentment with the
arrangements under which they live. In others to a recognition of the
fitness that exists between each people and its government, tyrannical as
that may be. In some, again, to the conviction, that hateful though it is
to us, and injurious as it would be now, slavery was once beneficial--was
one of the necessary phases of human progress. Again, in others, to the
suspicion that great benefit has indirectly arisen from the perpetual
warfare of past times; insuring as this did the spread of the strongest
races, and so providing good raw material for civilization. And in a few
this reaction ends in the generalization that all modes of human thought
and action subserve, in the times and places in which they occur, some
useful function: that though bad in the abstract, they are relatively
good--are the best which the then existing conditions admit of.
A startling conclusion to which this faith in the essential beneficence of
things commits us, is that the religious creeds through which mankind
successively pass, are, during the eras in which they are severally held,
the best that could be held; and that this is true, not only of the latest
and most refined creeds, but of all, even to the earliest and most gross.
Those who regard men's faiths as given to them from without--as having
origins either directly divine or diabolical, and who, considering their
own as the sole example of the one, class all the rest under the other,
will think this a very shocking opinion. I can imagine, too, that many of
those who have abandoned current theologies, and now regard religions as so
many natural products of human nature--men who, having lost that antagonism
towards their old creed which they felt while shaking themselves free from
it, can now see that it was highly beneficial to past generations, and is
beneficial still to a large part of mankind;--I can imagine even these
hardly prepared to admit that all religions, down to the lowest Fetichism,
have, in their places, fulfilled useful functions. If such, however, will
consistently develop their ideas, they will find this inference involved.
For if it be true that humanity in its corporate as well as in its
individual aspect, is a growth and not a manufacture, it is obvious that
during each phase men's theologies, as well as their political and social
arrangements, must be determined into such forms as the conditions require.
In the one case as in the other, by a tentative process, things from time
to time re-settle themselves in a way that best consists with national
equilibrium. As out of plots and the struggles of chieftains, it
continually results that the strongest gets to the top, and by virtue of
his proved superiority ensures a period of quiet, and gives society time to
grow; as out of incidental expedients there periodically arise new
divisions of labour, which get permanently established only by serving
men's wants better than the previous arrangements did; so, the creed which
each period evolves is one more in conformity with the needs of the time
than the creed which preceded it. Not to rest in general statements,
however, let us consider why this must be so. Let us see whether, in the
genesis of men's ideas of deity, there is not involved a necessity to
conceive of deity under the aspect most influential with them.
It is now generally admitted that a more or less idealized humanity is the
form which every conception of a personal God must take. Anthropomorphism
is an inevitable result of the laws of thought. We cannot take a step
towards constructing an idea of God without the ascription of human
attributes. We cannot even speak of a divine will without assimilating the
divine nature to our own; for we know nothing of volition save as a
property of our own minds.
While this anthropomorphic tendency, or rather necessity, is manifested by
themselves with sufficient grossness--a grossness that is offensive to
those more advanced--Christians are indignant at the still grosser
manifestations of it seen among uncivilized men. Certainly, such
conceptions as those of some Polynesians, who believe that their gods feed
on the souls of the dead, or as those of the Greeks, who ascribed to the
personages of their Pantheon every vice, from domestic cannibalism
downward, are repulsive enough. But if, ceasing to regard these notions
from the outside, we more philosophically regard them from the inside--if
we consider how they looked to believers, and observe the relationships
they bore to the natures and needs of such; we shall begin to think of them
with some tolerance. The question to be answered is, whether these beliefs
were beneficent in their effects on those who held them; not whether they
would be beneficent for us, or for perfect men; and to this question the
answer must be that while absolutely bad, they were relatively good.
For is it not obvious that the savage man will be most effectually
controlled by his fears of a savage deity? Must it not happen, that if his
nature requires great restraint, the supposed consequences of
transgression, to be a check upon him, must be proportionately terrible;
and for these to be proportionately terrible, must not his god be conceived
as proportionately cruel and revengeful? Is it not well that the
treacherous, thievish, lying Hindoo should believe in a hell where the
wicked are boiled in cauldrons, rolled down mountains bristling with
knives, and sawn asunder between flaming iron posts? And that there may be
provided such a hell, is it not needful that he should believe in a
divinity delighting in human immolations and the self-torture of fakirs?
Does it not seem clear that during the earlier ages in Christendom, when
men's feelings were so hard that a holy father could describe one of the
delights of heaven to be the contemplation of the torments of the
damned--does it not seem clear that while the general nature was so
unsympathetic, there needed, to keep men in order, all the prospective
tortures described by Dante, and a deity implacable enough to inflict them?
And if, as we thus see, it is well for the savage man to believe in a
savage god, then we may also see the great usefulness of this
anthropomorphic tendency; or, as before said, necessity. We have in it
another illustration of that essential beneficence of things visible
everywhere throughout nature. From this inability under which we labour to
conceive of a deity save as some idealization of ourselves, it inevitably
results that in each age, among each people, and to a great extent in each
individual, there must arise just that conception of deity best adapted to
the needs of the case. If, being violent and bloodthirsty, the nature be
one calling for stringent control, it evolves the idea of a ruler still
more violent and bloodthirsty, and fitted to afford this control. When, by
ages of social discipline, the nature has been partially humanized, and the
degree of restraint required has become less, the diabolical
characteristics before ascribed to the deity cease to be so predominant in
the conception of him. And gradually, as all need for restraint disappears,
this conception approximates towards that of a purely beneficent necessity.
Thus, man's constitution is in this, as in other respects, self-adjusting,
self-balancing. The mind itself evolves a compensating check to its own
movements; varying always in proportion to the requirement. Its centrifugal
and its centripetal forces are necessarily in correspondence, because the
one generates the other. And so we find that the forms of both religious
and secular rule follow the same law. As an ill-controlled national
character produces a despotic terrestrial government, so also does it
produce a despotic celestial government--the one acting through the senses,
the other through the imagination; and in the converse case the same
relationship holds good.
Organic as this relationship is in its origin, no artificial interference
can permanently affect it. Whatever perturbations an external agency may
seem to produce, they are soon neutralized in fact, if not in appearance. I
was recently struck with this in reading a missionary account of the
"gracious visitations of the Holy Spirit at Vewa," one of the Feejee
islands. Describing a "penitent meeting," the account says:--
"Certainly the feelings of the Vewa people were not ordinary. They
literally roared for hours together for the disquietude of their
souls. This frequently terminated in fainting from exhaustion, which
was the only respite some of them had till they found peace. They no
sooner recovered their consciousness than they prayed themselves
first into an agony, then again into a state of entire
insensibility."
Now these Feejee islanders are the most savage of all the uncivilized
races. They are given to cannibalism, infanticide, and human sacrifices;
they are so bloodthirsty and so treacherous, that members of the same
family dare not trust each other; and, in harmony with these
characteristics, they have for their aboriginal god, a serpent. Is it not
clear then, that these violent emotions which the missionaries describe,
these terrors and agonies of despair which they rejoiced over, were nothing
but the worship of the old god under a new name? Is it not clear that these
Feejees had simply understood those parts of the Christian creed which
agree in spirit with their own--the vengeance, the perpetual torments, the
diabolism of it; that these, harmonizing with their natural conceptions of
divine rule, were realized by them with extreme vividness; and that the
extremity of the fear which made them "literally roar for hours together,"
arose from the fact that while they could fully take in and believe the
punitive element, the merciful one was beyond their comprehension? This is
the obvious inference. And it carries with it the further one, that in
essence their new belief was merely their old one under a new form--the
same substantial conception with a different history and different names.
However great, therefore, may be the seeming change adventitiously produced
in a people's religion, the anthropomorphic tendency prevents it from being
other than a superficial change--insures such modifications of the new
religion as to give it all the potency of the old one--obscures whatever
higher elements there may be in it until the people have reached the
capability of being acted upon by them: and so, re-establishes the
equilibrium between the impulses and the control they need. If any one
requires detailed illustrations of this, he will find them in abundance in
the history of the modifications of Christianity throughout Europe.
Ceasing then to regard heathen theologies from the personal point of view,
and considering them solely with reference to the function they fulfil
where they are indigenous, we must recognise them in common with all
theologies, as good for their time and places; and this mental necessity
which disables us from conceiving a deity save as some idealization of
ourselves, we must recognise as the agency by which harmony is produced and
maintained between every phase of human character and its religious creed.
INDEX.
A
Abstract and concrete, relations of, 174.
Actions, voluntary and involuntary, 319.
Analogies of the rudest societies to the lowest forms of life, 398,
402.
Analogies of function between living beings and societies, 410.
Annulosa, structure of compared to that of nations, 408, 422.
Anthropomorphism, necessity of, 422.
Architectural ideas, origin of, 439.
Architecture, relationship to natural objects, 435; illustrations of,
435-437; town, why symmetrical, 435; country, why irregular, 437.
Arts, interconnexion of, 187.
Astronomic influences upon climate produce breaks in geological
succession, 356.
Automatic actions of men and governments, 426.
Australia, fauna of, 350.
B
Bain "On the Emotions and Will," estimate of, 302.
Beauty, its evolution from utility, 429, 433.
Beliefs, how to judge of them, 442.
Bow, derivation of the, 78.
Breaks in the geological record, Hugh Miller upon, 355; produced by
astronomic causes, 356; by re-distributions of land and sea, 359.
Buildings related to landscape, 438; cause of incongruities in, 438;
relation unintentional, 439.
C
Cambrian rocks, inference from their thickness, 366.
Calculus, origin of, 158.
Castles, built with no reference to art, 430.
Cause, single, produces more than one effect, 32; illustrated in
geological phenomena, 35; in chemical, 40; in organic evolution,
42; in social progress, 50; in use of locomotive engine, 53.
Central America, effects of subsidence of, 38.
Centrifugal force and condensation, 287.
Cerebrum, analogy of to houses of parliament, 423, 426.
Circulation in animal bodies and bodies politic, 410, 411; rates of
movement in, 417; of money and blood-discs, 414.
Classifications of science, progress of, 183; what they indicate,
125; Oken's, 125; Hegel's, 128; Comte's, 131; serial arrangement
vicious, 144.
Classification, the mental process in, 147; advances with
rationality, 157; how it has aided science, 182; of the cognitions,
321; of the feelings, 323; in Psychology, for the present must be
provisional, 300, 301.
Climate, changes in, produced by astronomic rhythm, 356; by
re-distributions of land and sea, 359.
Comets, formation of, 256; orbits of, 258; distribution of, 259, 261.
Common knowledge, nature of, 117; relation of, to science, 118, 122.
Comte's hierarchy of the sciences, 131.
Consciousness, mystery of, 197.
Condensation of nebula, 250.
Contrast, its relation to beauty, 432.
Creeds suited to the age that holds them, 441, 443.
Curtsy, origin of, 79.
D
Densities of the planets, 278-280.
Development hypothesis, neither proved nor disproved by Paleontology,
367, 376; defense of, 379.
Direct creation inconceivable, 378; no examples of, 377; origin of
the notion, 383.
E
Earth, internal constitution of, 290.
Earth's crust, 5; contraction of, 35.
Ectoderm social and embryonic, 419.
Education, bearing of evolution of science upon, 193.
Emotions in animals, genesis of, 315.
Emotional language, 232; importance of, 235, 238.
Engine, locomotive, results of invention of, 53.
Equality, origin of notion of, 152,158; of things and relations, 153.
Evolution of the emotions, 311.
Evolution of governmental and nervous structures, 420.
F
Fashion, origin of, 90; corruption of, 91.
Feeling and action, relation of, 199, 208.
Feeling, mystery of, 197; effects of surplus in producing laughter,
201; why it disturbs the intellect, 207.
Feeling a stimulus to muscular action, 211, 220; shown in loudness of
voice, 215; in quality or timbre, 215; in pitch, 216; in intervals,
217; in variability of pitch, 219; relation of, to vocal sounds in
ourselves, 220; in others, 220; causes prostration, 222;
classification of the feelings, 323.
Feejee islanders, penitent meeting among, 444.
Final cause, 262, 272, 275, 293.
Fossils as tests of age and position, 339, 347.
Function of music, 231-235.
G
Generalizations, premature, use of, 323; as seen in history of
Astronomy, 326; in Geology, 327.
Genesis of new emotions in civilization, 313; in animals, 315.
Geological evidence, value of, 8.
Geologic "systems," are they universal? 335-339.
Geometry, origin of, 158, 167.
God, origin of the conception of, 65.
Gothic architecture, source of, 435, 436.
Government, rise of, 12, 69, 92; three-fold nature of, 13, 65, 83;
separation of civil from religious, 69; early need of severe, 85;
progressive amelioration of, 88; course of all, 114; results from
national character, 387.
Great men, relation of to social changes, 388.
Greek and Roman architecture, derivation of, 435.
H
Heathen theologies, estimate of, 44.
Heat of heavenly bodies, source of, 292.
Hegel's classification of philosophy, 128.
History as commonly studied, small, value of, 385.
Hobb's parallelism of society and the human body, 389.
Homogeneous, change of to heterogeneous, 3; seen in genesis of solar
system, 3; in phenomena of earth's crust, 5; in the advance of life
in general, 7; in the progress of man, 10; in growth of
civilization, 12; in government, 13; in language, 17; in painting
and sculpture, 20; in poetry, music, and dancing, 24; cause of this
universal change, 32.
Hutton's geological system, 327; contrast of the modern with, 330.
Hydra compared with primitive tribes, 401, 407, 412, 420.
Hydrozoa, analogies of, 401, 403, 412.
I
Industrial organization, 385.
Industrial arrangements, development of compared with that of the
alimentary organs, 410.
Insensible modifications effect great changes, 379; illustrated by
geometrical curves, 318; by physiological development, 382.
Internal structure of sun and planets, 281-286.
K
King's councils compared to ganglia, 421, 423.
Knowledge, experience the source of all, 126; relations of various
kinds of, 167.
L
Language, differentiation of, 17; origin of written, 18; origin of
verbal, 149; origin of emotional, 220.
La Place's theory of planetary evolution, 263-265.
Laughter, common explanations of, 194; movements in, 200; groups of
muscles successively affected in, 201; caused by incongruities,
203; facilitates digestion, 207.
Law, origin of, 70.
Likeness and unlikeness, recognition of, the basis of classification,
147; the basis of language, 149; of reasoning, 150; of art, 151;
leads to science, 152.
Logic, how evolved, 158.
Lyell, Sir Charles, criticism upon, 338, 342.
M
Man, progress of, 10.
Manners, genesis of, 77; decline of the influence of, 89; conformity
in manners leads to extravagance, 99; conformity in, decreases
social intercourse, 100; defeats the true end of social life, 102,
107.
Mathematics, how evolved, 158.
Mechanics, rise of science of, 168.
Mineral qualities of rocks untrustworthy tests of age or position,
332.
Miller Hugh, estimate of, 352.
Motion of nebulous matter, 251-253.
Morality, origin of, 70.
Muscular movements, cause of, 195; arrested by feeling, 199; in
laughter purposeless, 201; of animals when excited, 211; variations
of, produce changes of voice, 214.
Music, increasing heterogeneity of, 26; relation of mental to
muscular excitement, the source of, 214; theory of, 221-224; its
history confirms the theory, 224-228; negative proof of theory of,
228-231.
Murchison Sir R. I., criticism upon his "Siluria," 332, 340, 363,
366.
N
Nebula, are they parts of our siderial system? 243, 249; condensation
of, 250; motion in, 251; significance of forms of, 254; structure
of spiral, 254.
Nebular hypothesis, 3, 34; its high derivation, 239; it explains
cometary phenomena, 262.
Negative facts in geology, small value of, 362-365.
Nervous system, effects of excitement in, 195; directions of
discharge of excitement in, 197; course of discharge unguided by
purpose, 201.
Number, origin of conception of, 154.
O
Oken's classification of knowledge, 125.
P
Painting and sculpture, origin of, 20.
Paleontology neither proves nor disproves development, 367, 376.
Picturesque, meaning of, 433.
Planetoids, origin of 289.
Plato's model republic, central idea of, 388.
Previsions and ordinary knowledge, 117; previsions known as science,
118; common and scientific, 123; when quantitative arose, 158;
increase in precision, 171.
Primary divisions of a germ and of a society, 404-407.
Progress, current meaning of, 1; present inquiry concerning, 2; law
of progress exemplified in the genesis of solar system, 3; in the
phenomena of the earth's crust, 5; in the advance of life in
general, 7; in the history of man, 10; in the growth of
civilization, 12; in government, 13; in language, 17; in painting
and sculpture, 20; in poetry, music, and dancing, 24; statement of
the principle which determines progress of every kind, 32; the
principle of progress illustrated in geological phenomena, 35; in
chemical, 40; in organic evolution, 42; in social advancement, 50;
in use of locomotive engine, 54; this principle does not explain
things in themselves, 58; progress of science, 141; of astronomical
discovery, 165, 171.
Progress of animals and societies in forming channels of
communication, 416.
Psychology, relation of English thought to, 301; classification in,
for the present, must be provisional, 300, 301.
R
Reasoning, nature of, 150; basis of, 154; advances with
classification, 157.
Reformers, eccentricities of, 61; why necessary, 93; not selfish, 95,
97; difficulties of social, 110.
Reform, how is it to be effected? 111.
Religion aided by inquiry, 58.
Religious ideas, account of primitive, 66.
S
Saturn, rings of, 276.
Satellites, distribution of, 272-276.
Savage men need a savage deity, 443.
Science, limits of, 58; definition of, 119; when complete, 120; test
of the depth of, 122; slow growth of, 123; duplex progress of, 141;
ultimate analysis of exact, 160.
Sciences, early simultaneous advance of, 165; not independent of each
other, 186; aid each other by analogies, 181; mutual influence of
modern, 178.
Sculpture and painting, origin of, 20.
Solar System, movements of planets on their axes in, 267-271.
Strata now forming, lithological differences in, 347; differences in
the order of superposition of, 348; differences in the organic
remains of, 349.
Societies and individual organisms, points of agreement between,
391-393; differences of, examined, 393-397.
Social intercourse, philosophy of, 105.
Social changes, true source of, 386.
Spectrum analysis, 295.
Spiral nebula, 255.
Steam-engine, multiplied effects of, 53.
Sun, constitution of, 294, 296; relation of plane of its equator to
plane of planetary orbits, 266.
T
Telegraph wires, comparison of to nerves, 427.
Titles, derivation of, 72; depreciation of, 74.
Truth, ultimate test of, 130.
U
Useful passes into the beautiful, 430, 433.
V
Voice, cause of loudness of, 215; cause of quality of, 215; of pitch
of, 216; intervals in, 217; variability of the pitch of, 219.
Voluntary and involuntary actions, 319.
W
Werner's system of Geology, 328; contrast of, with the modern system,
330.
THE END.
End of the Project Gutenberg EBook of Illustrations of Universal Progress, by
Herbert Spencer
***
|
{
"pile_set_name": "Gutenberg (PG-19)"
}
|
]]>Best laser dentistry in Sharjah Medical Directory – Find the best laser dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers. Laser dentistry is a new and revolutionary way of treating dental problems and conditions related to the teeth and gums. Patients who dread the traditional drill will certainly be pleased at how painless laser dentistry treatments are, in addition to the fact that most processes do not need stitches after, and heal a lot faster.
Laser dentistry offers plenty of advantages compared to the traditional form of dentistry. Some patients request to not have anesthesia at all since the process is painless although some may experience minimal discomfort, treatments heal faster and do not need stitches, and the chances of you getting a bacterial infection are less to none since the lasers kill bacteria.
Below are laser dentistry procedures for the teeth:
o Detection of Cavity – lasers help in detecting cavity, even at the earliest stages. Lights on the laser gives signals to the dentist when a cavity is present, allowing your dentist to treat it as soon as possible.
o Tooth Fillings – lasers will soon replace the drill when it comes to the application of dental fillings. The fillings are not only applied precisely, but bacteria is also eliminated and destroyed in the process.
o Treatment for sensitive teeth – say goodbye to teeth sensitivity when it comes to drinking hot or cold drinks as laser dentistry offers treatment for sensitive teeth.
o Teeth whitening – laser dentistry offers lasting and instant results when it comes to whitening teeth. Teeth can be whitened up to 10 shades, and it only takes one trip to the dentist.
Below are laser treatment procedures for the gums:
o Treatment for gummy smile – get the smile you always wanted with the help of lasers. Lasers help show more teeth instead of gums by reshaping the gums.
o Frenula – this is a treatment for children who are tongue tied or children who are having trouble breastfeeding.
o Crown Lengthening – lasers can help reshape both the tooth and gums for healthier looking teeth.
o Epulis – laser dentistry can help in the treatment of skin tissue folds that are caused by dentures that are ill fitting.
Laser dentistry Location Map
Lots of people fear to visit a dental clinic because they fear the pain which they might have to undergo during the whole process of treatment. If you belong to such a group of people, then you really need to update yourself about the latest developments that have taken place in the world of dentistry. Now, new and improved dentistry methods are used by the dentists and the pain caused during the treatment has become the thing of the past. Laser dentistry is one of the best ways to ensure that dental treatment becomes a quick, easy and painless experience for you!
Today, lots of dentists use laser to treat the patient. In this process the water is first energized with laser and then this energised water is used by the laser dentist to treat the patient. This procedure can be used to treat all kind of dental issues including dental implant, tooth removal and filling. The best thing about it is that the laser treatment takes less time than any other method and it is an easy and painless process.
More and more dentists are specializing in laser treatment. An expert laser dentist would be able to perform all kinds of dental treatment. Laser dentistry can be used effectively in cosmetic dentistry as well. The patient who opts of it does not have to bear the pain of injections. This is the main reason that more and more patients are opting for laser treatment.
The cost of laser treatment is higher than any other dental treatment method. However, it won’t be hard to find a dentist who provides flexible payment options to his patients. If you have a family dentist, that it would be much easier for you to negotiate on payment terms with him. If your family dentist does not specialise in laser treatment, then you can still seek his reference for a good laser dentist.
So now there is no need to for you to fear the dentist! With laser dentistry, you will be able to undergo all kinds of dental treatment without any pain! But still, it is best to take care of your teeth at the first place! By just following the fundamentals of brushing your teeth and flossing regularly, you can eliminate the chances of any kind of oral issue to a large extent. However, if at any time, you require to undergo a dental treatment, then laser dentistry is always going to be ready to serve you!Best laser dentistry in Sharjah Medical Directory – Find the best laser dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
]]>Best laser teeth whitening in Sharjah Medical Directory – Find the best laser teeth whitening in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
Laser teeth whitening is widely used for both in-surgery and home teeth whitening. Its main advantage is the considerable acceleration of the whitening process, but it also offers professional-quality whitening results.
Laser teeth whitening is one of the latest developments in home teeth whitening, and according to several reviews the use of a blue light during the whitening treatment can speed up results. In fact, what we consider as a laser light is in most cases a halogen or LED light.
It is widely accepted that a beautiful, bright smile is an important contributing factor in our social, professional and personal relations. Most of us are often jealous of the white pearly teeth of celebrities in the media and wish we could have an equally attractive smile.
This can be a really expensive treatment if we opt for in-surgery whitening. Several years ago, there was no alternative to having one’s teeth whitened at a dentist’s surgery. Nowadays, some home teeth-whitening kits include a handheld blue laser light which is equally effective to the laser light used by dentists.
Do-it-yourself laser teeth whitening can have the same spectacular effect as a laser treatment at your dentist’s surgery at a fraction of the cost and in the privacy and comfort of your home.
Professional Teeth Whitening
People who choose to have their teeth professionally whitened are usually aware of the cost and the time the whole process this would require.
Before the whitening process starts, the dentist always makes sure that your teeth are healthy. If fillings are necessary, the dentist will tell you that these have to be done before the whitening process. After that, the dentist will assess how stained and discolored your teeth are in order to inform you about the necessary sessions and the cost involved.
Conventional procedure may start with a preliminary cleansing of the teeth and the necessary customized moulding of the mouth trays so that the whitening gel can be properly and evenly applied on the teeth. Customized mouth trays are very important for safe and effective whitening because they fit perfectly on the teeth and they do not allow the whitening gel to come in contact with the gums and irritate them. The whitening gel most dentists use is hydrogen peroxide which can lighten the teeth for more than 10 shades.
The same process with the use of mouth trays may take several visits to the dentist, but the dentist may ask you to perform a couple of self-maintenance treatments in between visits to the dental surgery.
Laser teeth whitening can be a lot faster and produce better results as the light energy can easily accelerate the whitening process. The gums are always protected with a resin-based barrier and the teeth are exposed to the blue light for about 15 minutes. More advanced treatment procedures that involve less heat on the teeth and reduced ultraviolet emissions may allow the teeth to be exposed to the blue light for about 30 minutes. This can reduce the number of visits to the dentist until the desired results are achieved. For teeth that are not severely discolored, the desired whitening result can be achieved in just one session.
Home Laser Teeth Whitening
Home whitening kits can provide high quality whitening results in the most affordable way. A quality whitening kit contains, apart from the whitening gel (usually carbamide peroxide), and the customizable mouth trays, a blue light for optimum results. These kits usually have the same whitening results as in-surgery laser teeth whitening, and there are thousands of positive users’ testimonials and teeth-whitening reviews to prove it.
Home teeth-whitening kits are designed in such a way as to allow for easy use and they always come with simple and clear instructions. Also, the use of the blue light can optimize the treatment so that the final results can be as spectacular.
Whitening your teeth at home is both safe and simple. Most people have noticeable results even from the first use, but it may take from 5 to 10 days for excellent, professional-quality results.
Laser teeth whitening Location Map
Laser teeth whitening is a process that can only be done in a professional whitening clinic. It is also the most effective way to whiten your teeth that you can find today. With most people seeing results in just one visit, it is also a very fast way to whiten your teeth to get a brighter smile. How badly your teeth are stained will determine how many visits will need to be made to make your teeth whiter. Laser teeth whitening used to be one of the most expensive methods to use as you had to pay the high price tag of the dentist’s time.
When you have your teeth laser whitened, your professionally will use a bleaching gel to whiten your teeth. The gums and inside of the mouth are protected from the bright light and whitening gel, and then a laser is focused on the teeth, which causes the whitening gel to penetrate more deeply into the teeth than a lot of other methods. You certainly would never be able to get this kind of results with a kit you bought at the grocery or chemist store. Laser whitening is very popular because of its speedy results. Most people will only need one visit to the dentist to have a bright looking new smile and a session usually only lasts about an hour and the latest systems that take just 30 minutes!.
Even though your laser whitening professional will try very hard to protect the tender tissues inside the mouth, sometimes there can be side effects from laser teeth whitening. While there is typically not any discomfort from the session itself, if any of the whitening gel come into contact with the gums or inside of the mouth, they can cause some irritation. Some people who have their teeth whitened may already have sensitive teeth. Contact an experienced laser whitening professional that you can trust, and as a team you can help stop any problems that might come up before you have the treatment.
Laser whitening costs can vary depending on which professional clinic you choose. In most area’s the dentist will charge you the most. That’s not because they may get you a better result or that they are any safer, it’s mainly their time that you are paying for. Non-dentist professional laser whitening clinic’s can save you a lot of money and give you great results that can last much longer too – maybe even several years depending on your life style. When considering if the price is worth it, you may want to ask yourself how much money you would spend on custom trays, gels and strips at home. Also thinking about your own time and the hassle of bleaching frequently at home might make laser teeth whitening a better method to choose.
Furthermore, not all laser teeth whitening systems are the same. Shopping mall systems are the least effective as they use very weak whitening gels. Mall treatment times can take 1 hour or more and require multiple applications in order to show any difference. The most effective laser whitening system is the latest 30 minute system that can whiten your teeth by up to 14 shades in just one treatment! So make sure you choose the right system if you want the very best result for your money.
Laser teeth whitening is gaining popularity because it is seen so much on television and in the media. Just about every makeover show uses this method to whiten a smile and it makes a big difference in the way people look and feel. Having better self-image is important to many people, and laser teeth whitening has helped people all around the world smile more brightly and now for a lot less.Best laser teeth whitening in Sharjah Medical Directory – Find the best laser teeth whitening in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
Performed with a pin-like instrument, the pinhole surgical technique takes just a few minutes per tooth. Using a pin sized entry point, the specially designed tool loosens the gum tissue, moving the gum on top of the exposed gums. Collagen strips are then placed through the entry point to keep the gums in place during the healing process.
Results are immediate and the pinpoint-sized entry heals within 24 hours. Post-op, patients report only mild swelling and no downtime is needed for recovery.
Surgical procedure: With traditional gum grafting, an incision is usually made on roof of your mouth to extract gum tissue, sometimes an alternative donor source is used. Must create an incision in palate to extract gum tissue, then gum tissue is sewn atop exposed roots. With the pinhole surgical technique, a small, pinhole sized entry point is used to glide gums over area of exposed roots. Collagen strips are placed to keep gums in place.
Amount of teeth treated: Only Only a few teeth can be treated at a time with traditional gum grafting. Wit pinhole gum surgery, numerous teeth can be treated in one visit.
Length of surgery: Gum grafting can take over 90 minutes, while the pinhole procedure requires less than an hour.
Recovery time: The stitches used during gum grafting can take up to 10 days. With pinhole rejuvenation, there is virtually no recovery time.
Gum rejuvenation Location Map
What is gum recession?
Gum recession refers to the loss of gum tissue along the gumline. This can occur as a result of periodontal disease (gingivitis, periodontitis, advanced periodontitis), the natural aging process, or abrasive habits when it comes to brushing the teeth.
Why should gum recession be taken seriously?
When gum recession occurs, the root structure of the tooth becomes exposed. This means that tooth decay and other problems can affect the teeth along the gumline and beneath it. Since healthy gums are essential for a healthy mouth, getting gum recession treated is important for lasting dental wellness.
All of the tools and techniques used to perform the Chao Pinhole® Surgical Technique were created by Dr. John Chao.
How does the Chao Pinhole Surgical Technique (PST) differ from traditional gum grafting?
Traditional gum recession treatments involve the use of donor tissue or soft tissue grafts in order to rebuild the gumline. This soft tissue would be sutured in place and would join with existing gum tissue as it healed.
While this traditional grafting treatment is effective, comparable results with better patient experience can be achieved through the Chao Pinhole® Surgical Technique.
How is Chao Pinhole Surgical Technique (PST) performed?
During the Chao Pinhole Surgical Technique, a needle is used to make a small hole in the patient’s existing gum tissue. Through this pinhole, special instruments are used to gently loosen the gum tissue. These tools help expand and slide the gumline to cover the exposed root structure.
There are no grafts, no sutures, and no incisions needed with the Chao Pinhole Surgical Technique. It simply involves the adjustment of the existing tissue.
What are the benefits of Chao Pinhole Surgical Technique (PST)?
The benefits of the Chao Pinhole Surgical Technique are many:
• Less discomfort for the patient after treatment
• Faster recovery for the patient than traditional grafting
• No need for uncomfortable sutures
• No need for scalpels or invasive surgical tools
• No need to take donor tissue from the patient’s palate
• Excellent, natural-looking, long-lasting results
]]>Best gum disease treatment in Sharjah Medical Directory – Find the best gum disease treatment in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
Are you in need of a gum disease treatment? If you are showing signs of any gum disease, then visit your general dentist, as it is important for you to seek treatment immediately. The sooner the issue is dealt with the better!
Are you in need of a gum disease treatment? If you are showing signs of any gum disease, then visit your general dentist, as it is important for you to seek treatment immediately. The sooner the issue is dealt with the better!
If this is in fact you, then you will have to choose between gum surgery and a non-surgical treatment. Your choice will depend on the stage of your disease. This article is going to help you understand both types of procedures.
Once you have been diagnosed with a gum disease such as gingivitis, which causes swollen gums, then you will most likely be referred to a specialist. Be sure to have all of your medical information straight and prepared. After your appointment, you will be told if you will need a non-surgical treatment or a surgical one.
Non-surgical procedures consist of two main practices. The first is a professional dental cleaning, as this is the simplest form of reversing gum disease. By having a simple cleaning you can fight off diseases. A second option is scaling and root planing. This is a very deep cleaning for your teeth and is done under a local anesthetic.
If your disease is more advanced, then you will have to consider a surgical gum disease treatment. There are several of these treatments, so be sure to cover each gum surgery option with your dentist before going under the knife. One of the main procedures is flap surgery, which is when the gums are lifted back and all of the tartar is removed from the teeth.
The doctor then replaces the gums so that they fit snugly around the teeth again, as they once did. This reduces the size of space around the teeth and prevents further disease. Another option is having a bone graft done. This is done when suffering from periodontal disease.
The best way to prevent gum disease is to take care of your teeth from the start. If you are diligent and visit your dentist once a year for a check up and a cleaning, then you should be able to avoid any disease.
If you are still stricken with an oral disease, then most of the time you can still be treated with a non-surgical gum disease treatment. There are many gum disease treatments available, so if you have unhealthy teeth and gums, then do not become discouraged. If you are on top of it there is hope for a healthy mouth!
Gum disease treatment Location Map
Gum Disease Treatment? If you’re like me, you can’t stand the thought of somebody drilling and probing in your teeth and gums. Is it, however, an inevitable consequence of poor dental hygiene? Is it too late? Of course it is not rocket science here – if you don’t take care of your mouth, there will be consequences. Most people who are 35 and over are in a similar predicament, so you are not alone.
What are Gum Disease Symptoms?
Halitosis (bad breath that does not go away) Gums that are Red and Swollen
Bleeding gums
Gum recession
Gums that bleed
Loose teeth
Gums that are red, swollen, and tender
See your dentist if you have any of these signs! What can you do to address these signs of gum disease? Before answering this question you need to answer a more fundamental question:
What is the Cause of Periodontal Gum Disease?
The simple answer is found in a dirty word and it is not 4 letters. What is that word? Bacteria! Yes, bacteria is the bad guy and if not controlled it will wreak havoc on your teeth and gums. Bacteria produce toxins that corrode the teeth and gum line. Over time you will start to notice pain from drinks and foods that are at extreme temperatures. This is one of the signs, but what are the others?
So What is the Secret to a Winning Formula for Fighting Gum Disease?
The answer is simple – control bacteria effectively and you win the battle against gum disease. Settle for less and you are daily paddling up a creek — without a paddle! That can be be tiring for your body. Your body needs the opportunity to turn the tide and regenerate. You can do, you just have to pick the right solution. Most commercial products, quite frankly, just don’t cut it. They may kill bacteria, but usually it is only at the moment of application and they fail to reach the hard-to-reach areas of the gum line, where bacteria thrive. Moreover, these mouthwashes and toothpastes include alcohol and SLS, which are not the purest and best ingredients for the mouth – they can be harsh, even contributing to dry mouth.
Natural Options for Gum Disease Treatment
Our ancestors have used proven botanical ingredients to care for their teeth and gums. These oils have been used for centuries. The secret to success is that oils seep into the teeth and gum lines and remain there! Why is this so important? It is important because this means that they are staying in contact with the bacteria 24×7, kill it off and controlling it.Best gum disease treatment in Sharjah Medical Directory – Find the best gum disease treatment in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
]]>http://medicalguide.ae/gum-disease-treatment-sharjah/feed/01240General Dentistry Sharjahhttp://medicalguide.ae/general-dentistry-sharjah/
http://medicalguide.ae/general-dentistry-sharjah/#respondWed, 16 Nov 2016 11:55:59 +0000http://beautyguide.ae/?p=1234Best general dentistry in Sharjah Medical Directory – Find the best general dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers. General dentistry is a branch of medicine involved in the care of teeth. It focuses on the diagnosis, prevention, study and treatment of a variety …
]]>Best general dentistry in Sharjah Medical Directory – Find the best general dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers. General dentistry is a branch of medicine involved in the care of teeth. It focuses on the diagnosis, prevention, study and treatment of a variety of disorders and conditions of the maxillofacial areas and associated structures in the human body, as well as the oral cavity. The oral cavity is simply a medical term for the mouth.
Individuals who practice general dentistry are called dentists. Dentists can go on to specialize in a variety of areas. Individuals in general dentistry work with a team including dental assistants, dental technicians, dental therapists and dental hygienists. There are some people who undermine the importance of general dentistry. In actual fact, this type of medical treatment is very important. Oral diseases are highly prevalent across the globe and has turned into one of the major public health problems. It’s more common in lower socio-economic groups but oral diseases can be found in all classes and in any area of the world.
General dentistry focuses on both preventative activities and therapeutic treatments. A large portion of dentistry is to prevent diseases like tooth decay and periodontal disease. Tooth decay, also called dental caries, is a bacterial infection f the tooth that destroys the organic matter of the tooth through the production of acids caused by food debris that collects on the surface of the tooth. Periodontal disease is a disease that affects one or more of the periodontal tissues. The most commonly seen periodontal diseases are gingivitis and periodontitis.
Other treatments completed in dentistry include teeth restoration such as fillings, removal or extraction of teeth that can’t be fixed, scaling teeth for the treatment of periodontal problems and treatment of abscessed teeth like a root canal.
Every country has specific regulations required of those who wish to pursue dentistry as a career. In the United States all dentists must have at least two years of undergraduate studies. Most go on to complete a full BA degree before pursuing specific dentistry training. After undergraduate training, anyone who want to get into general dentistry needs to go through four years of dental school. Once completed, the student will qualify as a Doctor of Dental Surgery or a Doctor of Dental Medicine. If the individual wishes to go further than general dentistry into a specialty, additional education is required.
General dentistry training allows a dentist to carry out most dental treatments. The most common ones like fillings, crowns, bridges, root canals, teeth extraction and periodontal therapy can be completed by an individual who has completed all the training for general dentistry. This type of training also allow the dentist to prescribe medications like antibiotics and sedatives. The dentist can also perform examinations, complete diagnoses and complete x-rays.
One of the main tasks of general dentistry is to encourage the prevention of oral diseases. Education is crucial and includes teaching patients about proper hygiene and regular check-ups.
Sharjah general dentistry List
Find bellow list of the best general dentistry in Sharjah UAE. Find online listings, phone numbers, addresses, maps, driving directions and more. Directory of general dentistry in Sharjah. Find general dentistry reviews, websites, phone numbers, addresses, and profiles. See reviews, photos, directions, phone numbers and more for the best general dentistry in Sharjah, United Arab Emirates.
General dentistry Location Map
To maintain a proper healthy body, it is very essential to maintain healthy teeth. The teeth are an important part of the human body and so if their health is neglected, it affects the entire body. For this reason, dentistry is an essential part of modern healthcare. If proper dental facilities are not available, the society will not be healthy. The role played by the dentist in maintaining the health of the people is very crucial. Proper oral hygiene is key to maintain a healthy body and soul.
There are a number of specializations in the field of dentistry. General dentistry is the amalgam of all these fields. It has a number of branches such as oral surgery, periodontics, orthodontics and pediatric dentistry. The general dentist works in a number of fields and treats a number of different types of cases. Some of his responsibilities include identifying the various diseases and conditions that affect the teeth, creating and managing dental treatment plans, and leading the entire dental team which consists of other professionals such as technicians, diagnosticians and other paramedical staff.
In some cases, the help of a specialist may be needed. The general dentist cannot perform complicated procedures. In such cases, the general dentist will refer the case to specialists who have experience in the field. For example, dental implants are always performed by cosmetic dental surgeons. However, normal procedures such as fillings, cleaning and simpler cosmetic procedures such as teeth whitening are performed by the general dentist.
Apart from diagnosing, treating and preventing diseases that affect the teeth, the general dentist also provides reliable information to patients. He also provides guidance to maintain proper oral hygiene. If you need any information, it is best to approach your general dentist.
Many developments have been made in the field of general dentistry. These developments are a result of new discoveries and inventions in other fields such as biomedical engineering, therapeutics and material sciences. The field of general dentistry owes a lot to these fields. As technology is progressing at a rapid pace, we can expect even better developments and procedures in the near future. In the future, dental procedures will be not only be more effective but also easily affordable for everyone, thanks to new technology.Best general dentistry in Sharjah Medical Directory – Find the best general dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
Endodontic dentistry is used when all non-surgical methods to treat the tooth fail. Endodontic dentistry carried various procedural errors and risks in the past, due to the difficulty of accessing and visualizing the teeth apices.
Advanced technology has made the process precise, easier and with predictable outcomes. Enhanced illumination and magnification have strengthened endodontist’s ability to identify anatomical structures and defects for failure. These include craze lines, lateral canals, isthmus and fractures.
Endodontic Methodology
Modified surgical instruments accommodate a small size of bony window to expose the tooth apex. They allow higher incision precision and promote faster and better healing.
Endodontic dentistry provides a smoother and more precise cavity preparation as it follows the root’s long axis. It also allows for less bone removal to expose the apex as it is smaller than earlier microsurgical piece.
Super EBA and MTA are the top materials of choice for fillers as they seal better than amalgam and avoid tissue staining. Besides apical surgery, hemi sectioning, root retention, apical surgery and bicuspidization all fall within endodontic surgery’s range.
Points of Consideration
Endodontic dentistry, like any other surgery has certain limitations. Many anatomical factors, such as proximity to a maxillary sinus or neurovascular bundle, could pose potential limitations.
Presence of thick bone is another major issue. Apart from the thick bone plates, it contains lingually inclined roots, which means dentists have to remove a lot of bone to reach the apices.
Dentists need to evaluate the periodontal health of the tooth and the restorability, weighing the benefits against risk of treatment modality. In terms of outcome, technical advancement has made endodontic procedure more predictable and successful.
Endodontics Location Map
You probably don’t think of going through endodontic treatment on a daily basis. For some folks though, some teeth symptoms may be an indication that they should at least seek their dentists’ opinions regarding the applicability of the option. Choosing to undergo it can mean a lot to your dental health. The process is actually more commonly known as root canal procedure. It is however more specifically categorized under the branch of endodontics. This gives particular attention to the part of the tooth known as the pulp. This is located at the center of the tooth and extends through canals in the roots.
There is usually no major issue about undergoing endodontic therapy. The pulp actually contains vessels, nerves and tissues that once played a role in nourishing young teeth. As a person matures however, this portion loses its major role because the supply of blood in the gums takes over the role of nourishment. Hence, there is nothing alarming about having pulp removed. Not everyone needs to undergo the option. It is often recommended only for individuals who experience bacterial infection. This usually stems from severe cavities that have gone beyond the surface of the tooth, infecting the structures underneath. Since antibiotics alone cannot treat far beneath, the one other acceptable choice would be to undergo endodontic surgery.
Of course, you can’t decide to go for it on your own. You need a dentist’s assessment to be certain that you do indeed need root canal help. Initially, you may be asked about the symptoms and signs that you’ve noticed. You may for example have particularly sensitive teeth or you may experience swelling. The dentist may perform a visual examination of the problem area in your oral cavity. If there is reason to suspect that you do have a major pulp problem, then x-rays may be recommended. In some cases, electric tools are used to determine the dilemma.
The procedure for endodontic treatment takes more time and effort than tooth removal. After anesthesia has been administered, the top of the tooth is opened and then the damaged pulp is cleaned out. Shaping may then follow to prepare the section for filling. The filler used is often gutta percha which is a material that resembles rubber. On a succeeding visit, the dentist may then restore the crown area where the opening was made.
There can be some complications during and after the procedure. Like any other complicated medical option, infection is a possibility. Moreover, damage to the tooth can happen too. This is likely if the root is differently shaped or if some parts of it cannot be detected by the available tools. In some cases, the pulp may not be completely removed, in which case, pain and discomfort may still be experienced. Some people don’t put a lot of thought into endodontic therapy. That is even if they already experience symptoms. Not choosing to undergo treatment however can lead to tooth extraction. Although this process may seem less daunting than the root canal procedure, it isn’t such a good idea to lose a tooth. This can result in the misalignment of the remaining teeth.Best endodontics in Sharjah Medical Directory – Find the best endodontics in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
]]>http://medicalguide.ae/endodontics-sharjah/feed/01232Emergency Dentist Sharjahhttp://medicalguide.ae/emergency-dentist-sharjah/
http://medicalguide.ae/emergency-dentist-sharjah/#respondWed, 16 Nov 2016 11:45:31 +0000http://beautyguide.ae/?p=1230Best emergency dentist Medical Directory – Find the best emergency dentist with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers. When you are struck with an emergency situation, then you need to get in touch with an emergency dentist. Some situations wherein you would have to get in touch …
]]>Best emergency dentist Medical Directory – Find the best emergency dentist with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers. When you are struck with an emergency situation, then you need to get in touch with an emergency dentist. Some situations wherein you would have to get in touch with an Emergency Dentist are injury to teeth during your daily chores etc. The first and foremost step is you need to go to your family physician who would recommend that you see the dentist. An emergency dentist would be able to attend to your problem since his dental clinic would be well equipped with the latest machinery and equipments. There are instances when your child experiences excruciating teeth pain and it is practically impossible for you to wait till the morning. This is when the services of an emergency dentist are hired.
Individuals who realize that their invisalign has gone from its usual place or is failing to work properly need to visit the emergency-dentist. People normally go to an emergency dentist when they suffer from excruciating pain and when the pain in unbearable and when treatment cannot be delayed. Dentists are professionals who cannot be visited without an appointment. But normally big hospitals have dentists because like mentioned earlier; an emergency can attack you at anytime.
People with broken teeth or broken jaw due to an accident are attended to immediately by the emergency dentist. If you are not aware of any hospitals which have the dentist facility, then you need to browse the net to identify names and addresses of emergency dentists who stay close to your residence. Patients who suffer from knocked teeth need to see an emergency-dentist who would take care of the problem. The person should wash the knocked teeth and do not keep touching the tooth root. Immediately fix an appointment with the dentist.
The emergency dentist would then look out for any fractures and then do the needful. For major repairs to the teeth, a permanent crown is the best option. If a tooth has become loose or has gone out of place from its usual alignment, then the problem can be fixed without any problems. An emergency dentist can also handle gum infections etc.
Dentures fractured in an accident, damage to orthodontic braces are some other problems which are handled by an emergency-dentist. Getting an appointment with a dentist is pretty easy and you could get it at any time or any day. Be it a festival or a bank holiday, getting an appointment with a dentist is not difficult at all.
When visiting the emergency-dentist, explain the entire problem so that he knows how to go about and sort out the issues. Dentists bring a smile on your face even during an accident. The main job of a dentist is to fix the tooth problems in an emergency.
Emergency dentist Location Map
How is emergency dentistry different to normal dentistry?
Much the same as commonplace accidents or injuries, dental emergencies can happen anywhere and at any time, requiring immediate attention from a healthcare professional – something that a regular check-up won’t provide. Emergency dental clinics are open 24 hours a day, every day of the year – even Christmas Day in most cases, treating any problems with the teeth, mouth, and jaw. An emergency dental surgery is run in a different way to the normal dentists office you might be used to, that’s because it is designed to treat patients with much more pressing issues than a brace fitting or tooth whitening procedure. Emergency dentists won’t give appointments for a general dentistry consultation after 11pm and they are not going to assess you for orthodontic treatments at night, they only accept patients who are in pain and need help immediately.
Not only are these types of institutes becoming a necessity because of their prompt service, but they also take a great deal of pressure off nearby hospitals, who are less likely to be capable of dealing with specific dental problems such as root canals or extractions. It’s comforting to know that there is someone who can help within hours if you suffer an accident, any time, day or night.
When should I give the emergency dentist a call?
First of all, a mild tooth ache is no cause for alarm, it could just be a reaction to an extreme temperature, so don’t panic and think you should head to the emergency dentist right away – although you should certainly get it checked out if it persists. Temporary aches and pains are sometimes just a symptom of what we’re eating, the weather, our general health, etc, and will only last a few minutes or so, but ongoing discomfort, particularly regular bouts of throbbing toothache, should warrant a visit to your dentist. You can’t ignore niggling pain that won’t go away, your teeth are trying to tell you that something is wrong; it will only get worse if you dismiss it.
Emergency dental appointments are normally taken up with situations much worse than sensitive teeth, and if you are in need of immediate assistance you will almost certainly know about it. Many patients arriving at the emergency dentist have lost or broken a tooth in an accident and have to be seen by a dentist straight away, this can be quite traumatic and cause a lot of pain, it’s lucky that the majority of patients are referred for treatment within twenty-four hours of the injury occurring. If you experience a similar injury, make an appointment straight away, even if the pain dulls after a few hours, there could be significant damage that needs repairing.
How can the emergency dentist help with broken teeth?
Thanks to constantly advancing medical technology, there are lots of ways an emergency dentist can fix or replace broken teeth – if you’re lucky, they may be able to reattach the natural tooth before it dies. Rebuilding damaged teeth depends on a number of factors; primarily what state the tooth and its empty socket are in when the patient arrives at the surgery. A tooth that has been completely knocked out but is still in a relatively solid condition can be fixed back into the socket if there is enough time to salvage it, but if the tooth has been out of the mouth for more than an hour then the chances of reattaching it are slim, so the dentist may just repair the damage to the gum in preparation for further treatment after healing. Even in this situation there are still options available, such as implants or dental bridges, you don’t have to learn to live with a gap-toothed smile.
If, however, you have suffered gum disease or tooth decay before the breakage, the dentist may not attempt a reattachment, as it’s likely that more deterioration will occur without further treatment. Although superficial chips and cracks can be repaired with composite bonding, crumbling or fractured teeth that are in a state of decay are better off extracted, they will eventually fall out of their own accord if left to rot anyway.
Is there anything I can do to help myself while I wait for the emergency dentist to see me?
You can try to alleviate toothache pain whilst you are waiting to see the dentist by taking strong pain killers, but don’t attempt any kind or surgery on yourself, as this is invariably a terrible idea. Leave the extractions and fixtures to the professionals, unless you want to end up in more pain than you are already in. If you are experiencing severe pain, don’t wait around to be called into the surgery, get there as soon as you can.
For patients who have had whole or parts of their teeth knocked out, hold on to any broken pieces, carefully keep them in a cup of milk – this will keep the tooth alive until it can be reattached. Leave any remaining fragments in the socket, they may serve as a base for fixing the rest of the pieces back in place, or they may need to be removed under anesthetic. If you can, try and replace the tooth in the empty socket as gently as possible, this is the best way to encourage regrowth into the tissue and survival of the tooth, but it’s sometimes to painful to keep it there for any period of time without some type of pain relief.
Hopefully, you should be admitted to see a surgeon within hours of your emergency, but some patients can struggle with travel conditions – be it the weather, car trouble, transport issues – which can really cause problems with damage that needs to be dealt with immediately. If there is heavy bleeding, try pressing a small piece of gauze onto the area or biting down on a cotton wad to stem the flow – this is a common occurrence with broken and dislodged teeth. Where the bleeding is accompanied by severe pain, try taking some Ibuprofen to lessen the swelling and help with the discomfort, but be sure to let your dentist know if you have taken any medications.Best emergency dentist Medical Directory – Find the best emergency dentist with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
]]>Best dental surgery in Sharjah Medical Directory – Find the best dental surgery in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.Over the course of a lifetime, every person undergoes some kind of dental surgery or the other. It is important not to ignore any dental problems that you might be suffering from. Tooth alignment issues, tooth decay, bleeding gums are all the starting symptoms of more complicated dental problems. Dental surgery has changed a great deal over the past decade and advances in the field have meant that most of the procedures are less invasive and the recovery period faster.
The routine procedures such as veneers, teeth whitening and dentures are carried out painlessly and quickly. If your dentist has recommended that you undergo surgery, ensure that you are well-informed about the procedure before you decide to undergo it. With some research you will find that most dental surgery procedures are simple and eventually give you that smile you always wanted.
What Are These Procedures?
There are times when oral health issues progress to a point where you suffer from problematic and painful symptoms. This is when the dentist might recommend dental surgery. Removing teeth, removing damaged gum tissue and realigning the jaws are some of the surgery procedures.
Some of these procedures are carried out for purely cosmetic reasons while others are carried out to rectify an oral problem and maintain dental hygiene. There are different kinds of dental surgery. Here are the most common ones:
• Wisdom Teeth Removal – Wisdom teeth tend to be problematic. Most people experience that they come in crooked. In some cases, they are impacted just below the gum line. This can result in infections and it might damage the adjacent teeth as well. If they are the cause of some dental problems, surgery will be required to have them extracted.• Dental Extractions – Apart from wisdom teeth removal, dental surgeons might have to extract decaying teeth. This is because the tooth itself might be damaged too much. Sometimes, patients prefer extraction to repair.• Dentures – Older patients or those who have too many damaged teeth might opt for dentures. These could be part or full dentures.• Root Canals – If a tooth has got infected; the dentist removes the tooth pulp and the root canal. The tooth is then filled and a crowned. Only local anesthesia is required and all dentists perform this procedure.
Jaw surgery is another kind of dental surgery which is not all that common. If there is a misalignment in the jaw, the surgeon will have to cut it and then realign it. Some people have this surgery done to rectify chewing and dental problems while others do this for cosmetic reasons.
Dental surgery Location Map
Dental surgery involves any type of surgery dealing with the teeth and gums-it can include extraction (pulling teeth,) gum procedures, root canals and cosmetic surgery. In order to be qualified and trained to perform this type of surgery a dentist must go beyond the accredited dental school training and state licensing to get more specialized coursework and then be certified by a professional board in their particular specialty-like dental surgery or orthodontics. If you are considering this type of surgery, whether for cosmetic or health reasons, you should have a basic understanding of the procedures and what is involved.
Extraction – this type of surgery involves removing one or more teeth root and all. This surgery usually can be performed by a general practice dentist. It is usually done when a tooth is dead or rotten-but it can also be done when a person has “extra” or supernumerary teeth, or to remove baby teeth so that permanent teeth can come in. Another common reason for this type of dental surgery is for wisdom teeth extraction. When the wisdom teeth are showing through the gums it is usually a simpler procedure than if they are still under the gums and pushing into other teeth (impacted.)
Gum Repair and Surgery – sometimes the gums become infected with a disease such gingivitis and must be cleaned and repaired with dental surgery. At times the gums even grow over the teeth and must be cut back.
Tooth Replacement – When a tooth is knocked out in an injury or accident, it is sometimes possible to replace the tooth. If you experience this type of accident, quickly put the tooth on ice or in a glass of cold milk and take it to your dentist or dental surgeon. If the root is still alive, you may be able to save your tooth with dental surgery. Any time you hit a tooth and it is loose, you should have it looked at by a dentist to make sure that there is no root damage.
Cosmetic surgery – this type of dental surgery can be performed to remove gaps in teeth or to change the gum line. Your dentist can tell you if surgery or orthodontics would be a better option.
Preparation for Bridges or Prosthetics – when you are preparing to get partial or full dentures or simply a bridge, you may need dental surgery to prepare your gums and mouth for the implants or dentures. You may need to have teeth removed or gums shaped to allow the dentures to fit properly.
Any time you need dental surgery you should try to find the dentist with the proper qualifications to perform the surgery. If it is an emergency, contact your general practice dentist first to see if they can do it or if they have recommendations. If you are going to have cosmetic surgery, you can look around to see what is available.Best dental surgery in Sharjah Medical Directory – Find the best dental surgery in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
]]>Best dental dentures in Sharjah Medical Directory – Find the best dental dentures in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.Dental dentures are artificial replacements used for your natural teeth and gums. An accident, poor dental health, or disease caused you to have only a few healthy natural teeth or none at all. A dentist can recommend dentures to replace the missing teeth.
Dentures are most ideal if you have significant erosion of the gum and jaw line which makes other dental procedures such as crowns and implants less desirable. They also may be used to replace an entire row of teeth rather than a single tooth.
Because dentures are relatively non-invasive, they are well suited to people who are unwilling to go through a more extensive dental procedure such as that used for dental implants.
Elderly people who cannot sit still for a long visit in a dentist’s chair are ideal candidates for dentures. Some people also have eroded their teeth and jaw line to the point that it is difficult to do a crown or dental bridge.
Dentures also may suit you if you are missing a row of several teeth or your entire top or bottom teeth in a line. In these cases it may be easier and less expensive to get an entire set of false teeth rather than trying to rebuild each lost tooth.
Dental dentures Location Map
Your dentist will make impressions of your mouth and fit you with a false tooth or set of teeth that are molded based on the shape of your mouth. You will be asked to bite down on something to check for fitting. The dentures are affixed in place with an adhesive that you can buy in most chain grocery or drug stores.
What are the different types of dentures?
1. Complete Dentures
These dentures replace all of the teeth and are what we often refer to as “false teeth”. They are made of colored plastic base to duplicate the gum tissue and the artificial teeth are made either of porcelain or plastic. Complete dentures are held in place in the mouth by suction, thus forming a seal to the gums, or they can also be attached to dental implants which are placed into the jaw bone through surgical procedure. However, the use of dental implants cost more than the traditional way of attaching complete dentures.
Most people might experience soreness at first during the initial placement of complete dentures and it might take them some time to get used to it. Immediate dentures and conventional dentures are the two types of complete dentures.
Immediate dentures are made in advance and are placed right after your teeth are extracted. Your dentist will first take measurements and models of your jaw and teeth during the first visit to make the immediate dentures. One advantage of immediate dentures is that you don’t have to go without teeth during the healing period (which can usually take up to six months). This type of complete dentures also act as a protection for the tissues and can reduce bleeding after the extraction of the teeth. However, one drawback is that immediate dentures require frequent adjustments during the healing period when the bones and gums shrink over time from reduced swelling.
Conventional dentures are placed in position after the jaw and gum tissues have healed, usually about 8-12 weeks after the tooth/teeth extraction, but sometimes longer.
2. Partial Dentures
Also called “partials” or “removable partial denture prostheses”, this type of dentures are for individuals who still have some natural teeth remaining or when the remaining natural teeth are not strong enough to support a bridge. Partial dentures fill the gap caused by missing teeth and prevent the other natural teeth from shifting position. They are held in place by clasps and rests that are carefully fitted around the natural teeth, and can be taken out for cleaning or at night.
These dentures are made either of metal framework or plastic base to support the artificial teeth needed to replace the lost ones. There are more advanced materials used lately for partial dentures such as Valplast which offers a flexible and durable option and uses internal attachments instead of clasps for a more natural-looking appearance.
Denture care
Both complete and partial dentures, like natural teeth, need to be cleaned regularly to prevent tartar and plaque build up which can cause gum problems, stains, or bad breath. It is important to understand that plaque from dentures can also spread to your natural gums and teeth, causing possible cavities and gum disease in the future.
You should use a soft bristled brush to clean your dentures just as you would brush your regular teeth, with extra care taken to brush your tongue and the area around the gum line. Some foods may get under the gum line of dentures and your false teeth should be taken out occasionally, ideally every night before you go to bed. When you take out your dentures they should be placed in water that is not hot or in a denture solution for maintenance.
How long can they last?
If your dentures were fitted well to your gum line and are properly cared for, they can last many years. Regular visits to the dentist are still necessary to ensure that everything looks and feels right.
Your dentist might also use a denture liner to prolong the life of your dentures. This is done by using the denture liner to refit the denture to the oral tissues. There are also denture repair kits available online or in drug stores to fix minor fractures or cracks. However, it is highly recommended to see your dentist immediately if denture problems occur to be able to repair it properly.
Common problems
Dentures can sometimes cause sores in your mouth due to improper care or being poorly fitted. If you don’t like to wear your dentures due to irritation, soreness, or trouble chewing food, then new false teeth may need to be made or your dentist can adjust your current set of dentures.
Although you may be tempted to adjust or fix poor fitting dentures yourself, this could make the problem worse as you won’t be using the correct materials.
Make an appointment with your dentist, who can mold a new better fitting set of dentures, or who can discuss other more permanent tooth replacement options such as implants.
How much do dentures cost?
The cost of dentures will depend on the type of materials used, as well as the area in which you reside. There are discount dental companies that can provide savings of up to 60% off the usual price.
Unless you already have an active dental insurance policy your need for dentures would likely be deemed as pre-existing. This would result in you having to pay for all costs out of your own pocket.
Depending on the area you live in and the type of dentures you require, one can expect to pay up to a couple of thousand dollars for a new set of dentures. Using a dental insurance alternative such as a discount dental plan can usually provide you with substantial savings if you don’t already have insurance.
People of any age, not just the elderly, may require dental dentures due to accidents, disease, or poor dental hygiene. It is important to continue practicing good oral hygiene and visiting your dentist for checkups at least twice a year to avoid having to go through the procedure of getting dentures to replace missing tooth/teeth due to tooth decay, gum disease, or other issues.Best dental dentures in Sharjah Medical Directory – Find the best dental dentures in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
]]>Best cosmetic dentistry in Sharjah Medical Directory – Find the best cosmetic dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.In today’s quest for beauty and eternal youth cosmetic dentistry is emerging into the forefront. Many patients are choosing to utilize the many different procedures of cosmetic dentistry to improve the look of their smile.
The advances in cosmetic dentistry have restored beautiful smiles to thousands of people who for one reason or another has lost or damaged their teeth. Modern cosmetic dentistry procedures can do wonders to fill up gaps between your teeth, straighten up crooked teeth by putting braces, fill up cavities with fillings or cosmetic dentures and other procedures to restore your smile and help you look younger.
Cosmetic dentistry Location Map
Traditional dentistry deals more with proper oral hygiene and the prevention, diagnosis, and treatment of oral diseases, whereas cosmetic dentistry concentrates more on the improvement of the appearance. It commonly solves issues like crooked or chipped teeth, discoloration, or missing teeth.
Types of Cosmetic Dentistry Treatments:
Bite Reclamation
This treatment is done to change the vertical dimension of people whose teeth have been subjected to years of wear because of too much grinding and acid reflux. After the treatment, patients have a closed and shorter appearance in their smile and face.
Dental Bonding
Bonding helps improve how the teeth look if they are chipped, broken, cracked, stained, or have excess space between them. The procedure involves the application of enamel-like composite resins to the tooth’s surface, molded into shape, hardened with an ultraviolet or laser light, and then polished. The result blends naturally with the surrounding tooth structure and the rest of the teeth, improving the person’s smile.
This cosmetic dental procedure is the easiest of all and can be done with a single office visit. Dental bonding can also be used to fill small cavities or protect the exposed root of the tooth. Modern dentists also use bonding as a replacement for, or an alternative to, silver or amalgam fillings.
Dental Braces
Nowadays, both children and adults are benefiting from dental braces. Braces not only correct crooked or misshapen teeth, but can also help improve irregular bite, jaw joint disorders, or the proper positioning of the jaw.
Dental braces work by applying steady pressure to the teeth to reposition them gradually into alignment. The dentist or orthodontist uses metal, ceramic, or porcelain brackets and bonds them to your teeth. Arch wires are threaded through the brackets to guide the teeth correctly into position. Orthodontic braces are usually worn for about 1-3 years after which retainers replace the braces to hold the teeth in their new position.
Dental Bridges
Bridges are also sometimes called fixed partial dentures and are used to replace missing teeth or to close a gap between the teeth. Material used for the artificial teeth are usually made of gold, porcelain, alloys, or a combination of these materials. The procedure takes 2 visits at one hour each appointment. Bridges can last from 3-15 years if proper oral hygiene is strictly followed.
Dental Crowns
Also known as caps, crowns are placed over a damaged tooth to restore its shape, size, strength, and appearance. Crowns or caps can be made from ceramic, metal, resin, or porcelain-fused-to-metal materials and are cosmetically used to improve broken or severely stained teeth. A costly procedure, crowns are recommended only by dentists when other procedures will not produce effective results. Crowns can last from 5-15 years.
Dentures
Dentures are removable artificial teeth that replace missing teeth and surrounding tissues of the teeth. There are two types of dentures, complete and partial. Partial dentures are used when there are some natural teeth remaining, while complete dentures are applied when all teeth are gone on either the top or bottom row.
Enamel Contouring and Shaping
Also known as odontoplasty, enameloplasty, stripping, sculpting, re-contouring, or contouring, this cosmetic dental procedure is applicable if you have healthy, normal teeth. It involves removing or contouring the dental enamel to change the length, position, or shape of the teeth to improve the appearance. It is used to correct minor imperfections of the teeth and the results can be seen immediately. This procedure is usually combined with bonding, teeth whitening, or veneers.
Inlays/Onlays
Also known as indirect fillings, these are often made from porcelain or composite materials that are used to fill tooth decay or other structural damage in the teeth. Unlike dental fillings which are molded into place immediately during your office visit, inlays and onlays have to be created in a dental laboratory first before your dentist can fit and bond them into place.
When the filling material is bonded in the center of a tooth, it is called an “inlay”; when the filling is done in one or more points in the tooth or includes the biting surface, it is called an “onlay”. This cosmetic dentistry procedure can be an alternative to crowns and can preserve healthy teeth for a long time.
Gum Grafts
Sensitivity to hot and cold might be caused by gum recession and exposure of the root of the tooth. This condition makes the teeth appear long and may subject the tooth root to decay or even bone loss. Gum grafts are a treatment that involves soft tissue grafts that can transfer healthy gum tissue to another part of the mouth to prevent or stop recession of the gums and bone loss in addition to improving the aesthetic look of the gum line.
Implants
Implants are a long-term solution to replace missing teeth and are among one of the most expensive cosmetic dentistry treatments. They are titanium artificial tooth root replacements that are inserted into the bone sockets of the missing teeth. These are a good alternative to bridges and removable dentures.
They are surgically implanted into the jawbone by an oral or maxillofacial surgeon. If bone loss occurred due to periodontal disease, the surgeon will probably have to graft a bone first to secure the implant.
There are three parts of a dental implant: titanium metal that is fused to the jawbone, an abutment that fits over the part of the implant that juts out from the gums, and a crown to provide a natural-looking appearance to the implanted tooth/teeth.
Dental Veneers
Veneers are wafer-thin tooth-colored pieces of porcelain or resin that are bonded to the surface of the teeth. This treatment is done to change the color or shape of the teeth, or to repair and correct broken, chipped, cracked, or gaps between the teeth. Veneers are also used to treat the same problems that bonding procedure addresses, and can be a least expensive alternative to crowns. This cosmetic dentistry procedure takes about 2 separate appointments. Veneers can last 15-20 years if proper care is followed.
Repairing crooked teeth
People who are possible candidate for teeth straightening are those with crooked, crowded, or tilted teeth which can trap bits of food that can lead to tooth decay and gum disease. Unlike orthodontic dentistry which uses braces to solve the problem, cosmetic teeth straightening involves giving local anesthetic to the patient, and then the dentist uses a surgical device (electrosurge unit) that utilizes heat to remove fragments of the gum. This will help shape the gum and adjust to the shape of the new veneers. The teeth are then drilled to be ready to receive the veneers, and the veneers are bonded to the tooth’s front. The surgery often takes an hour and often last between 2-5 years.
Teeth Whitening
Also called bleaching, tooth whitening has become a popular chemical procedure that many individuals undergo to remove stains, or just simply to whiten their teeth. This cosmetic dentistry treatment is one of the least expensive and simplest ways to enhance your smile and appearance.
Over time discoloration of the t00th enamel occurs due to smoking, taking certain medications, aging, or constantly drinking beverages such as tea and coffee. Although various teeth whitening options are available these days like over-the-counter products and home kits, dentist-supervised treatment is still highly recommended for the safest and most effective whitening of stained teeth. However, teeth whitening treatment is not for everyone. It is only suitable for individuals with healthy and unrestored teeth and gums.
Which procedure is best for you?
The condition of your teeth and the expected result that you want will determine which cosmetic dentistry procedure is right for you. Your dentist can answer any questions for you like what to expect through the course of treatment, what changes will look like, and what type of maintenance is required if there are any.
Cost of Cosmetic Dentistry
The costs for cosmetic dentistry differ according to the type of procedure needed by the patient. Cosmetic dentistry is usually not covered by dental insurance, but there are some dental plans that might cover part of the expenses of other procedures like crowns. Knowing the cost of a cosmetic dentistry treatment that you wish to have is very important to know beforehand.
Cosmetic dentistry is becoming more and more popular these days to improve the appearance and smiles of many individuals. With the advent of new technology, a wide array of tools and techniques are readily available to dentists to help their patients achieve the desired results.
However, before undergoing any cosmetic dentistry treatment, an individual should know first the risks and advantages in addition to what to expect during and after the procedure. It is also important to know the credibility of your dentist to perform cosmetic dentistry treatment, how much the procedure will cost and if there is any special maintenance required after the treatment.Best cosmetic dentistry in Sharjah Medical Directory – Find the best cosmetic dentistry in Sharjah with reviews, cost, prices, contact details & telephone numbers. Find amazing deals & great offers.
|
{
"pile_set_name": "Pile-CC"
}
|
The cake bakes – is Rubio cooked?
February 27th, 2016, 5:05pm by Sam Wang
(delegate calculation corrected 2/28)
(See the comment by MAT on how both Democrats and Republicans benefit from a brokered Republican convention.)
Until recently, the most likely way to give someone other than Donald Trump a majority of delegates was to narrow the field of candidates drastically. But the Republicans didn’t do that in time for Super Tuesday (also see this look at the political twists and turns in the NYT). Now what?
As Marco Rubio and friends go on the attack against Trump, is Rubio about to gain new life? Or is he cooked?
Super Tuesday is just three days away. Although the 12 states that vote are not particularly strong for Trump, they could conceivably give him a majority of the delegates awarded so far.
First…let’s note that some people seem to think Rubio is still in the mix to get a substantial number of delegates.
If Rubio wins VA/MN, Cruz and Rubio both top Trump in TX, Trump looks a lot more vulnerable. Still LOTS of volatility in GOP field.
This breathless commentary suggests the feeling that candidates have risen and fallen a lot. That feeling is strongly contradicted by the data.
Candidate numbers have been anything but volatile. National surveys don’t tell us about individual states, but they do give us a barometer of public opinion. By this barometer, Donald Trump has been ahead of all other candidates since July 1 of last year. He has only accumulated support since then. And since late December, his median national support has stayed in the 35-40 percent range.
Trump’s trajectory is notably more stable than Mitt Romney’s in 2012. During the corresponding period, Romney was repeatedly overtaken by other candidates: Newt Gingrich, Rick Santorum, Herman Cain, and Rick Perry. Only in March did Romney assume a durable leading position.
Based on the graph above, it wouldn’t be surprising if Rubio’s attacks had little or no effect. Trump’s supporters seem to be quite dedicated. We will see what the coming wave of super PAC-funded ads can accomplish.
Even if there is movement, it probably won’t have much effect on Tuesday’s results. On that day, 12 states will vote to commit 624 delegates, or 25.2% of all convention delegates. Add that to the 133 (5.4%) delegates from the four early states of Iowa, New Hampshire, South Carolina, and Nevada, and that gets up over 30% of delegates. These layers of the cake are largely baked.
In early states, poll medians mostly predicted the early-state outcomes:
For these candidates, the average difference between polls and outcomes was 3.0 percentage points. Statistical variation would have predicted differences of just 1-2 percentage points, so there was some additional inaccuracy. Generally, all three candidates outperformed their polls: Trump by a median of 1.7%, Cruz by 2.6%, and Rubio by 3.4%. This might be because undecided voters committed at the last moment, or because of strategic voting by supporters of lower-tier candidates. Evangelical support is thought to be hard to capture in surveys, and those voters often don’t like Trump.
Whatever the reason, Cruz and Rubio have overperformed by an average of 1-2 percentage points relative to Trump. The only place where such a small difference could alter the #1 finisher is Minnesota, where one lonely poll shows a three-way tie (Rubio 23%, Cruz 21%, Trump 19%). Even that doesn’t matter since Minnesota will give them each a proportional share of delegates, which might not be altered.
In the rest of the states, Cruz is ahead in two (Texas and Arkansas) and Trump is in first place in eight: Alabama, Alaska, Georgia, Massachusetts, Oklahoma, Tennessee, Vermont, and Virginia. That would suggest some big headlines for Donald Trump on Wednesday.
Trump has attained this level of dominance with average support of only 31% in these states. That is 10 percentage points weaker than his national support. In contrast, Cruz and Rubio’s Super-Tuesday averages are within 1 percentage point of their national numbers. So Trump could do even better in the weeks ahead, especially as contests shift to winner-take-all races.
This statement from Costa glosses over the importance of the actual rules, which are pseudo-proportional. This, combined with continued division in the field of candidates, has serious implications.
Super-Tuesday support for Trump, Cruz, and Rubio add up to an average of only 69% of votes. John Kasich, Ben Carson, and undecideds make up the remaining 31%. As I have written, this division is a real problem for Republicans who oppose Trump. The reason has to do with minimum thresholds, written into state-level rules, to get any delegates at all.
Eight Super Tuesday states require a candidate to get at least 13 to 20 percent of the vote in order to get any statewide delegates. Cruz appears to be below threshold in Alabama, Georgia, and Vermont. Rubio appears to be below threshold in Alaska, Tennessee, Texas, and Vermont. And then there are Congressional district-level delegates, which account for about one-third of the delegates to be awarded. Here, the rules are even worse for runners-up: in addition to the threshold requirement, the tendency is to give two delegates to the top finisher and one delegate to the second-place finisher. At the district level, Cruz and Rubio are about equally likely to fall into the third-place abyss.
(Note: the following calculations were corrected on Feb. 28th to account for pledged party officials and to leave out Wyoming.)
As you can see, the number of delegates drops off fairly steeply for candidates with lower vote share. This dropoff is a direct consequence of the rules, which strongly favor the candidate with the largest fraction of the vote. Combined with early-state delegates, Trump would have a cumulative total of 369 out of 695 delegates, or 53%. So there is a very good chance that Donald Trump will end up with over 50% of cumulative delegates the end of Tuesday night.
(I also note that we now have a firm number: an average vote share of 30% on Tuesday is approximately enough to get Donald Trump 50% of cumulative delegates.)
After Super Tuesday, conditions get even tougher for Rubio. The next few winner-take-all states favor Trump. In Ohio (66 delegates), Trump holds a lead of only 3.5%, so attacks on Trump might flip Ohio – to Ohio Governor John Kasich. That would get Kasich almost caught up with Rubio in delegates. In Florida (99 delegates), Trump leads Rubio by 18 percentage points, making that race a probable humiliation to Rubio in his own home state. If indeed Kasich wins and Rubio loses, look for Kasich to stay in the race to the convention.
In light of this, the best hope for Rubio is to drive Trump’s support down by a few percentage points. It’s a desperate move, but it might delay Marco from being baked into the cake just yet.
I don’t think so if you read the way the it is broken down with the way the Republicans stacked the primary deck. It favors the front runner to encourage others to drop out. You would need a more even vote split for your scenario to work out.
I think Kasich and Carson have to drop out for a brokered convention to happen. As of now I think that Trump is on the path to a majority at the convention. When winner-takes-all kicks in Trump should be near unstoppable.
The convention should be fun to watch. Interesting times indeed!
Mostly agree, though depending on the next 1-2 weeks, Cruz or Rubio might also have to drop out to get a contested nomination at the convention.
I try to avoid using the word “brokered” because there don’t really seem to be brokers any more – just the candidates and their proxies. Republican Party officials and actors don’t have that much influence at this point.
The key to a ‘brokered’ convention are two things – first, not all ‘bound’ delegates are loyal to the candidates. Using NC as a sample, there are 6 bound delegates that are state GOP officials. Presumably as they are establishment by definition, they probably wouldn’t support Trump longer than they have to.
2nd, other delegates ‘pledge’ themselves to a particular candidate prior to being selected as a convention delegate – but – this is where vetting is needed by the candidates, which is where an insider, who knows the rules can play games. If the party members were smart, they’d start declaring as Trump delegates. If a campaign doesn’t pay close attention, all sorts of mischief can occur down the road, and this seems like exactly the sort of detail the Trump camp might not pay attention to.
Lastly, national delegates are usually elected by district & state level delegates, and these are almost always longtime party stalwarts who would be only too happy to elect a secret Rubio supporter as a Trump delegate. If I was a GOP operative, this is how I’d attack the problem.
Disclosure- I ran the national convention delegate selection process for the NC Democratic Party in 2008.
JWY: That would be useful until March 14th (and assuming at least one, and preferably two, non-Trump gets over all delegate thresholds). But when winner-takes-all contests become frequent, you’d still need to narrow the opposition to a single candidate for optimal results.
Mostly just echoing every else–until state go winner-take-all I think that’s correct, but once we get deeper into March/April a couple of candidates would need to drop out so that somebody could win enough of the winner-take-all states to prevent Trump from hitting the 50% of delegates mark.
Yes, the Upshot has done the math, complete with a very cool interactive graphic that plots delegate totals vs time, with sliders that control average winning percentage of each candidate before and after March 6. I presume the people behind that get paid for it, unlike Sam. But the businesspeople running most of the MSM believe that paying clueless pundits large sums brings a better return on investment than paying numerists, even though the numerists will work for much less.
Let’s take Georgia as an example:
Right now the polling average there is:
Trump 37, Rubio 21, Cruz 19.67
Georgia has a 20% threshold both statewide and by CD.
On those numbers Cruz is below the threshold.
So you get the following:
Trump 50
Rubio 26
In point of fact Cruz would likely be above 20 in some of the CD’s which would result in 1-1-1 split, but the key point here is Trump gets a significant majority of the delegates.
By contrast, if you allocate the undecided evenly for Cruz, Rubio and Trump this becomes your polling average
Trump 39
Rubio 23
Cruz 21.8
As a result, this is your delegate split:
Trump 30
Rubio 23
Cruz 23
In this case Trump is far short of a majority of the GA delegates.
This will be repeated in state after state on 3/1.
This is a LOT of volatility in delegate result for not much difference in the statewide vote %.
On 3/1 the story of the night IF Rubio and Cruz are able to get above the delegate thresholds will be the rising chance of a contested convention. This will be wrong in a way – as the winner take all states on 3/15 and later make this less likely than people thing. But the media will run with this story.
This is not the way I think about this problem at all. It’s easy to get lost in details like this, and lose sight of the big picture.
Thresholds are important, and their overall effect contributes to the uncertainty in the total. It’s like my original 2004-2012 meta-analysis of the Presidential race – one has to aggregate everything to get a clear picture. The median estimate is the important thing. That’s why I don’t report individual states.
To my thinking, the way to address this concern is to run the calculation repeatedly, as my script does, allowing natural variations from the polling median. That gives a distribution of outcomes, which can then be used to calculate statistical distributions of likely outcomes. These outcomes would contain a multitude of results that pass above and below the threshold. To be honest, I decided this was not worth the trouble to do. The overall uncertainty is about 10-20 delegates above or below the median that I present.
Since the most probable way to defeat Trump is at a contested convention, Trump’s opponents need to keep him from a majority of the delegates. Super Tuesday’s Cruz-Rubio delegate count in your calculations is slightly higher than Trump’s so Super Tuesday might be a good day for the anti-Trump forces who want a contested convention.
Yes, I think this is right. Maybe not Rubio, but certainly Cruz and Kasich have calculated that by staying in the race they’re far more likely to force a brokered convention where either A) they can play kingmaker or B) they could even horse trade their way to the nomination. I actually think, as Sam points out, that Rubio is in the *worst* position, as he’s the only candidate who doesn’t have a real chance of a state in the near term.
What would happen if you applied a sort of stress test, assuming the Rubio/Cruz assault knocked off 10% of Trump’s support putting him at ~28/29% of the vote. Then redistributing that proportionately. How large an impact does that have on the delegate distribution?
Breaking News: Reince Priebus has just held a press conference and apologized to the American for the Republican Party not having a qualified candidate in this election.
John Kasich, Ben Carlson, Ted Cruz, Marco Rubio and Donald Trump have all announced their withdrawal from the race.
One of my pet theories for awhile now has been that when the GOP establishment finally woke up to the fact that they were staring a Trump nomination in the face, they’d consider a 3rd party run of their own. Not to have any real hope to win the Presidency, but to motivate moderate R’s to turn out & vote for Senate candidates, rather than stay home because they can’t bring themselves to vote for either Trump or Clinton. Also, the smarter ones will realize that should Trump win the Presidency, the Republican Party won’t continue to exist in a form where establishment players are welcomed. So it’s a fight for political survival, they just need someone willing to take one for the team as a trade off for a few months of getting headlines. Someone like Newt Gingrich.
One problem with this theory is the idea that Trump would be bad for the establishment if elected. Yes, he would be more arrogant / independent than average – but Trump would be the King of horse-trading / backroom deals that his supporters allegedly loathe and blame for them getting left behind in society.
He’s more political than ‘the politicians’ he claims to castigate – the difference is he believes that he can do it more effectively. Although, as long as he can fulfil his latest and greatest ambition ,he probably doesn’t really care.
Odd paradox that his supporters don’t want to open their ears to, even with plenty of Trump past history to highlight his true unprincipled character.
The problem for the GOP establishment with a Trump presidency is that it ruins their business.
The Republican Party is a system where pols are elected running on issues that appeal to white working and professional classes and then go to Washington and implement the opposite policies. The plutocrat and big monopoly or government protected business elite pays for the campaigns as long as the policies are favorable to them.
Most Republican establishment workers take jobs with Congress, think tanks, and Republican administrations for a while and eventually retire into protected industry PR or lobbyist jobs where they make big money for their connections. That money is much more than the total investment in campaigns and it represents the payment for the life work of Republican establishment insiders.
Most Republican voters actually prefer the policies of the Democratic Party. But the Republican establishment is lying to them constantly about what they intend to do when they reach Washington. And that lying is successful. The establishment believes the lying succeeds because white identity politics is holding it together and nobody in sophisticated Washington could be foolish enough to implement white identity policies so it’s all safe.
Take the last R debate. Cruz and Rubio promised to pass Gang of Eight amnesty and flood the country with triple the immigration there is now. But they disguised the promises with tough talk and the “path to citizenship” distinction. Cruz and Rubio are, in fact, to the left of Hillary on immigration and said so explicitly at the debate, though they covered it with dog whistles. They figure that by announcing white identity undertones they can scam the boorish working class voters they need.
Trump poses a problem for them because the donor classes aren’t going to provide golden parachutes for policies that actually help the working class. Furthermore once the policy changes are in the open it’s going to be hard to keep up the lie that Republicans care about middle America. Trump will end the white identity dog whistle. Racism won’t be enough to win elections anymore. And even winning elections, Republicans won’t be able to turn around and sell policy to the craven cartel of highest big business bidders.
That’s why the Republican establishment would much, much rather have Hillary than Trump.
MAT, I can totally see Trump’s people missing many nuances, but from what I have read in the rules, the RNC delegates don’t really need to show up for the first ballot–their votes can be counted starting now, as there is no wiggle room.
What’s more, don’t think for a second that Trump will bother with fighting for his own delegates at the convention if they slip away. He will go to court so fast Reince’s head will spin at record speed, and the whole convention will stop in its tracks. It’s gonna be huge.
Interesting fact. The delegates aren’t really bound. The current rules expire at the ‘beginning’ of the convention, and the rules for governing the convention are adopted by majority vote of the delegates. If the GOP wanted to stage a coup, they could free the delegates (Rule 40 is also likely to be an issue, which says a nominee has to win at least 8 states). It would be a total sh**st**m, but if a majority of the delegates on the floor weren’t personally loyal to Trump, it’s possible.
I first heard this idea floated on a radio interview by Michael Steele, who as a former chairman of the RNC presumably knows what he’s talking about.
Now, that is an interesting point, though the version I heard – from Ben Ginsberg, Bush/Cheney lawyer – is a little different. He said that only the first-ballot vote is bound. However, other votes are not: rules votes and credentials votes. He thought there would be lots of struggles at this stage.
The likelihood of a convention coup turns on how many delegates are true loyalists to their pledged candidate. I bet TheGreenPapers and FHQ have something to say on this point. Also, as you say, it would be a total fiasco for the party to stage such a coup, especially if they don’t have an agreed-upon endpoint.
But assuming they stay bound, it all comes down to if Trump is over 50% at the convention. If not, then that’s when all the shenanigans come into play.
My dad was in the Jaycee’s for years, and they had brokered conventions every year to elect the national president. It was great fun. But the frontrunner on the first ballot who fell short almost never, ever was the final winner.
But but but isn’t the GOP the party of law and order? You know, government shutdowns and that sort of thing. And gerrymandering cartographers who compete to see who can make the most concavity-pocked boundaries for congressional districts?
Sam,
Thanks for the reality check. Josh is delusional. and the Times article is excellent. I may have to reassess Trump. Anyone who is disliked by the Koch brothers, Romney, Rove, and McConnell can not be all bad.
This schism in the GOP would seem to overcome whatever other advantages Republicans might have in this election. Brokered convention ?? What happens to the very large enthusiastic chunk of Trump supporters/voters? Do they just fall in line behind what ever nominee the party establishment dictated? and if McConnell follows up with Anti-Trump ads in the general…
This would all seem to improve Hillary’s chances.
No matter what.. a once in a lifetime political event. It will get very interesting in Mid to Late June.
I can’t imagine the GOP wanting to have a contested convention and believe that they would swallow hard and coalesce around Trump. What would they gain if he has a plurality, but the party takes away the prize and gives it to Rubio because they think he’s more electable? Doing that would render him unelectable because then Trump’s supporters would demand an independent run or they would stay home.
The Super Tuesday thresholds will matter, but the polling and Sam’s analysis point to Trump gaining a majority of delegates.
There would be plenty to gain by “giving the prize” to Rubio as he is definitely more electable and he is a Republican unlike Trump. By Trump’s supporters staying home, Rubio stands to gain even further because many of them would have voted Democrat since that is where Trump really leans.
Trump seems to be cozying up to David Duke and the KKK. There seem to be some information that Fred Trump was arrested in a KKK rally when he was 21. Does this hurt Trump? Or are the people supporting trump comfortable with the KKK?
The Kasich strategy is not so far fetched:The scenario requires Ted Cruz to underperform on Tuesday, when seven Southern states, including his home state of Texas, go to the polls. It also requires Marco Rubio to lose his home state of Florida on March 15 and Kasich to win Ohio simultaneously. In that scenario, Weaver said Kasich would likely be the only candidate with a path to take on Trump.http://www.politico.com/story/2016/02/john-kasich-brokered-convention-trump-219934
Maybe he knows this guy. Seriously, though, models like this are experiments to test his ideas, starting with past outcomes as evidence. In the true sense of prediction, I am sure his model has not predicted even one election yet. November would be the first test.
Or these guys (from WSJ 11/7/2012):
“Sheldon Jacobson, a computer scientist and elections forecaster at the University of Illinois, at Urbana-Champaign, told The Wall Street Journal he expected Obama to get 281 electoral votes despite tying Romney with 50% of the two-party popular vote, and losing in Colorado, Florida, North Carolina and Virginia. Steve Rigdon, Prof. Jacobson’s University of Illinois forecasting colleague, was the only forecaster surveyed to predict a Romney victory, basing that in large part on Rasmussen Reports polling data, which he said he considered “the most reliable.” Rigdon predicted that Romney would win 273 electoral votes to Obama’s 265.
They aren’t out with anything on their website(electionanalytics.cs.illinois.edu) yet this year.
Going back to Sam’s article, this seems to me one of those very rare times that the GOP & Democratic establishments are in alignment. Both benefit by a brokered GOP convention.
The GOP establishment benefits in that it’s about their only hope at this point to avoid the Trump Train and all the ensuing damage that will do to the rank & file GOP establishment members in the future. So they need to do whatever they possibly can to keep Trump below the magic 50% mark going in and stacking the delegate decks as I described in a previous comment.
On the other side, the Dem’s can only win with a brokered GOP convention – first, Trump is very, very unlikely to win the nomination if he doesn’t win on the first ballot. The convention will be filled with a majority of non-Trump loyal delegates (even some of those bound to him on a first ballot), many of them old hands that know the rules inside and out. Unless Trump can peel enough outsider delegates from whatever Cruz & Carson may be holding, he’s toast. I think in this case the GOP would prefer dealing with a sitting GOP Senator they may detest to Trump, and will make Cruz some sort of deal, like a VP slot, where he can be hid away in a corner and they don’t have to deal with him all that much.
So when Trump loses on the 19th ballot or so, as is likely, his supporters pitch a royal fit as their revolution got stolen and stay home in anger in November.
The Dems have a smooth running convention, where Bernie gets on stage and says how wonderful Hillary is. The contrast between competency and chaos couldn’t be clearer. In the best possible scenario Trump announces an independent bid, and both him and the GOP nominee go down in flames while spliting the vote.
This graphic shows things well in Trump’s favor – but also quite finely balanced between a majority and a plurality of delegates for Trump – with Cruz actually closer to Trump than you might think.
However, the yuge caveat is that nearly all polls are 100% before the 10th GOP debate, and subsequent lines of attack, outrage over KKK endorsement etc.
So what difference will these things make?
Well, for most Trump loyalists, probably not a lot – they stay with DT through thick and thin. However:
1. A significant minority of Trump supporters are basically decent, if disgruntled, patriots who are far from being white supremacists – especially true of many genuine evangelicals. Although Trump himself has attained almost cult status amongst supporters, I surmise it is likely he will leak a couple of % over a combination of the KKK thing and wider doubts creeping in as to his suitability for President. Most existing supporters will stay, however, so keep him at 29% average across the Super Tues states.
2. The sustained, apparently more convincing, attacks made on Donald, along with the KKK issue, will prevent late deciders breaking for Donald – suggest this could mean his overall support moves only a little, from 29% to 31% (2% added being 10% support of late-deciding 20%), compared to, perhaps, 10% for Rubio and 5% for Cruz – taking them to average 28% and 25% respectively. This might seem excessive – but remember late deciders in the first four contests – even Nevada – were shown to have broken AGAINST Trump, even without the current furore over his bankruptcies, hitting the little guy, KKK etc. Rubio has been the greatest beneficiary of late deciders up to now, even before he found his boxing gloves. Not everyone will like his new style – but he does manage to keep smiling with it all.
3. DIFFERENTIAL TURNOUT – the anti-Trump tide hoped for, and perhaps partially in evidence in Iowa where a turnout smashing all previous records ultimately delivered AGAINST Trump, may be more in evidence now as the reality of a Trump nomination – and all it means for conservatism – kicks in. The attacks in recent days will only have reinforced this – whilst they may not keep many Trump supporters at home or get them switching their votes, it could re-energise the ‘non-Trump’ voters to come out in record numbers. I couldn’t begin to put feasible numbers to this – with no doubt widely varying effects statewide – but suggest it’s not completely unfeasible to see Rubio ultimately match Trump’s vote shares tomorrow.
Remember the fallout from the pre-New Hampshire debate wasn’t fully seen until the NH polling booth itself.
In conclusion, I’d wager Trump will definitely carry Vermont, Massachusetts and Arkansas (thanks to Mike H), but elsewhere is more to play for than the last polls have recorded. He’s a strong favourite in Georgia, and fairly evenly split opposition here will probably deliver him a win here – even if on a vote share lower than other states he fails to win. A 3rd-place finish in Texas won’t look good on him, although anti-Trump late deciders in Texas may coalesce round Cruz and keep Rubio in 3rd.
I missed one important point above, in Trump’s favor. This should have been a postscript to point 2.
That is that the early voting will no doubt be shown to heavily lean Trump’s way when counted in Super Tues states, and will go some way to cancelling out points 2 and 3. Therefore Trump topping the overall vote must still be regarded as inevitable.
Also, given that Trump was at 31% average – but a good few points below this in the most populous state by far – Texas – he obviously averages a little above 31% everywhere else and the others a little lower. This might seem like splitting hairs, but will make the difference between winning and losing a couple of states.
I saw this quote today from a Hugh Hewitt Article:
” Those who accept get tough questions in a respectful, even amiable, environment. We will know soon enough who is the standard bearer, so I think cries of foul or doom are premature. If Trump wins Texas, he knocks out Sen. Ted Cruz. If Trump wins Florida or Ohio, he knocks out Sen. Marco Rubio or Gov. John Kasich respectively. If Trump doesn’t win all three, we go to an open convention as no one will have the necessary 1,237 delegates to win the nomination. That isn’t punditry. It is math…..”
Is Hugh correct? Trump could beat Rubio and Kasich in their own states on Mar 15 and would not be able to accumulate more than 1237 before the convention? I am not sure that Hugh is the expert on polls and delegate math projections. I believe Sam has that title.
If Trump loses all three of those states that would show an erosion of his support going forward. I don’t think it means he mathematically would precluded from clinching though.
Texas is still proportional so it probably wouldn’t be a total loss. Ohio is narrowing and winner take all so that could hurt in delegate count but keeping Kasich in the race might be good for Trump to siphon Rubio votes. Trump still up big in Florida though. Losing that would really hurt his chances in delegate count and show him as vulnerable to Rubio.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
C++ check if empty line
If input is empty line output "0".
I can't use string only char, is it possible?
char liczba[20];
cin>>liczba;
if (liczba!=NULL) { cout << "0"; break; }
does not work for me
A:
You could simply check if (liczba[0] == 0) { ... }, or if (*liczba == 0) { ... }
This checks if the first character in the string a null terminator. If the first character is null, the string is empty.
Here's a complete working example:
#include <iostream>
int main()
{
char message[80];
std::cout << "Give me some input!" << std::endl;
std::cin >> std::noskipws >> message;
if (*message == 0)
{
std::cout << "There's nothing there!\n";
}
else
{
std::cout << "Thank you, that's helpful.\n";
}
}
The std::noskipws tells the stream to treat whitespace as any other character, so you can get empty lines.
|
{
"pile_set_name": "StackExchange"
}
|
The Pew Global Attitudes Project has a new survey out asking residents of forty countries what they think on eight hot button moral issues. Luckily for us, those forty countries constitute most of the world's land area, for easy mapping. They asked about gambling and alcohol (the latter is basically a test of whether a given country is majority Muslim) but it was mostly sex stuff.
Europe, Australia, Canada, and Chile like sex before marriage
Unsurprisingly, there's a lot of disagreement about premarital sex, with African and Asian countries (aside from Korea and Japan) expressing more disapproval:
Argentina's more accepting of gay people than the US
Same goes with homosexuality; the big difference between the two maps is Russia, which is split on premarital sex (much like the US) but really not fond of gay people:
China's more accepting of abortion than the US
Views are split on abortion as well, though some of the results are surprising. I had no idea that South Korea's views on the subject diverged so strongly from Japan and China's; the latter countries are fairly accepting of abortion, while 65 percent of those South Koreans who gave an answer said they think it's unacceptable:
Egypt's surprisingly tolerant of divorce
Divorce is slightly less polarized, with disapproval concentrated in Africa, South Asia, and Southeast Asia (and Bolivia, for whatever reason). Egypt stands out compared to other Muslim countries, especially nearby Tunisia; in Tunisia, about 55 percent of respondents giving an answer disapproved of divorce, compared to only 8 percent of Egyptians giving an answer. That's also considerably lower than the U.S. figure (24 percent).
France is cool with cheating on your spouse
But there are some points of harmony. Basically everyone thinks it's not cool to cheat on your wife. The only country surveyed where a majority did say cheating is acceptable was France; there, about 47 percent disapproved, 12 percent approved, and 40 percent said it's not a moral issue at all.
Everybody loves birth control
And the world is surprisingly unanimous in its acceptance of contraceptives. Pew also found that in the US, views on the topic did not differ much based on political allegiances (Hobby Lobby aside). 8 percent of Republicans find contraceptives morally unacceptable, compared to 6 percent of Democrats and 7 percent of Independents:
|
{
"pile_set_name": "OpenWebText2"
}
|
A. Field of the Invention
The present invention relates to door and window hardware. More particularly, the present invention relates to a mechanically stable and ergonomically improved door and window sash lock.
B. Description of the Prior Art
Sliding windows or patio doors in a building are made for letting in necessary light and air into the room while allowing occupants to have a comfortable viewing of the surrounding nature. At the same time, such doors or windows should be able to lock out harmful elements and potential intruders.
Window latches and locks that are also applied to doors have been developed as the windows in the modernized buildings have long been evolved all together. Of different types of slider window, a single-hung type window is structured to have an upper outside pane in a stationary sash and an inside pane in a sliding sash guided in a window frame along its vertical path between a raised level positioned over the upper sash to half open the window and a lowered position to close the window opening in cooperation with the upper sash. A double-hung type window has two vertically sliding sashes movable in parallel planar paths in a single frame. There are also horizontal sliders. A gliding window has two sashes with at least one sliding horizontally past the other. The respective sashes of the double-hung windows may be made to swing inwardly for the purpose of a safe cleaning but they must be returned to their vertical abutting positions when the window is to be locked. Normally, in the closed position, the mating sashes have the respective proximal sides overlapped to offer the necessary sealing. Therefore, most latches are conveniently positioned near the meeting areas of the two sashes at the exposed surface of the inner sash while the mating keeper or strike is fixed to the accompanying outer sash.
Known latches for windows have their inherent drawbacks. Automatic window sash locks as depicted in U.S. design Pat. No. 395,222 to Fountaine comprise a main latch body attached to a slide-open sash for automatically engaging a fixed keeper on the companion sash or the sash itself that incorporates in its profile a notch so that the sashes are immobilized in the frame when the window is closed. Such sash locks generally include a user-operated component handle to release the automatic locking mechanism, which only needed the sliding closure of the sash to push in a bolt of the sash lock before it protrudes back into engagement with the keeper or notch. To streamline the one-handed user operation in lift or sideway slide opening of the window, the release handle or lever of the sash locks is adapted to be depressed by index to little fingers while the thumb presses on the underside of the proximal sash part to release the lock and slide the sash in one action.
However, the lever needs a substantial projection from the main latch body taking up space upward as well as toward the user for the bolt to create a proper lever or bolt action inside the latch device. This makes a bulky and unappealing lock structure that sticks into the viewing area of glass panes. Under the superficial problem lies a mechanical disadvantage to have to apply a large circular force to retract a locking bolt out of engagement with the counterpart of the other sash. For the internal actuator to move the bolt easily, the lever must extend above and beyond the latch device itself as long as possible. However, such deflecting lever movements produce a long-term adverse force against the secure joint between the latch device and sash during their combined lifetime because normally there is only a couple of fasteners to endure the releasing depressions at repeated window openings.
Hence, there is need for a small form factor sash lock that is not only visually unobtrusive but also mechanically stable and ergonomically fit.
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
When gallerist Johann König sold his first artwork at the tender age of 21, he had a secret he only reluctantly shared with his buyer. Severely sight-impaired as a result of a freak accident in his teens, König could barely make out the contours of the painting he was exchanging for €4,500.
“How serious can you take someone who can’t see the artwork they are trying to sell you?” König told the Guardian at his office inside his gallery, a converted brutalist church in Berlin’s Kreuzberg district. “That fear was always in the back of my mind. I always thought someone would find me out.”
But in what he calls his “coming out” memoir, published in Germany this month with the title Blind Gallerist, König argues his disability has been key to the success he has enjoyed since, encouraging him to develop a distinctly personal idea of what makes good art, and enabling him to navigate an industry that can bedazzle and lead people astray with flashy exteriors.
Born in Cologne in 1981, König grew up in art world royalty. His mother Edda was an actress and illustrator previously married to filmmaker Wim Wenders, his father Kasper a curator whom Süddeutsche Zeitung has dubbed “the inventor of Germany’s post-war avant-garde”.
The cover of Johann König’s new memoir, Blind Gallerist. Photograph: Supplied
His uncle Walther is a leading seller and publisher of art books, painter Gerhard Richter was the best man at his parents’ wedding, and Andy Warhol and David Hockney were regular visitors at his childhood home.
But an accident when he was twelve cut Johann König’s access to the visual business that had made his family’s name. Playing with fishing weights and the gunpowder from a starter pistol in his teenage bedroom, he accidentally caused an explosion which severely damaged both his eyes.
Going blind did not mean the world around him went black, however. “In truth you mostly see a dark rusty brown, a mix of red, brown and black, little craters that appear to be moving”, he writes in his book.
Johann König is listed as one of the hundred most influential people in contemporary art despite being barely able to see it. Photograph: Dpa Picture Alliance/Alamy Stock Photo
“Your vision is as if you want to gaze out from the inside of your body and hit an impenetrable layer. You see as if your vision has been locked inside your body”.
Against the advice of his family, König started his own small gallery in Berlin when he was only 21, specialising at first in concept art and sound installations. His breakthrough work, by Danish sculptor Jeppe Hein, consisted of a motorised metal ball that wrecked the gallery’s interior as soon as a visitor entered the exhibition space.
Following a cornea transplant in his left eye in 2009, König’s vision improved dramatically, though his relationship with visual art remained wary. “At first, I was incredibly drawn towards strong pictures”, he said. The first show he put on after the operation was a large-scale work with bright, unmixed acrylic paints by artist Katharina Grosse.
Danish sculptor Jeppe Hein’s 360° Presence was first shown at the König gallery in 2002 and was considered a breakthrough for König. Photograph: König Gallery
“But I remained sceptical”, König said. “There are some pictures which are incredibly tempting but make promises that they can’t keep. They wear themselves out in their beauty.
“After my operation I saw really significant works, like Duchamp’s urinal or a Picasso, and they felt so marginal. Sometimes being able to see isn’t that great after all, or at least not for me.”
In recent years, König’s eyesight has deteriorated again as the endothelial cells that line the inner surface of his cornea have failed to regenerate. Next month, he is trying out glasses that project footage from a minuscule camera straight behind the cornea.
Part of the König gallery’s interior in St Agnes church. Photograph: Roman März
His gallery, housed since 2015 in St Agnes church, designed by modernist architect Werner Düttmann in the 1960s, has nonetheless established itself as one of Germany’s most influential addresses in the art world, with a roster of artists that includes Turner Prize winner Helen Martin, an annual turnover of €20m and a new London outlet, opened last year inside a garage in Marylebone.
As if to compensate for their disability, König writes in his book, blind people are often capable of an unusual degree of inner concentration and heightened perception.
Critics have praised the 37-year-old’s ability to spy the art world’s vanities and make them work to his advantage. The gallery, which lies almost exactly on the geographic centre point of the German capital, has hosted fashion shows as well as art exhibitions, and sells clothes as well as “souvenirs” made by its artists, photogenically curated on König’s Instagram feed.
St Agnes church was designed in the 1960s by modernist architect Werner Düttmann. Photograph: Hisao Suzuki
In the wake of Britain’s vote to leave the EU, König’s gallery released a collection of hoodies in the bright blue colours of the EU flag, but with one yellow star missing from the circle.
Within weeks, the “EUnify Hoodie” became ubiquitous in Berlin’s hippest galleries, and in February this year even 73-year-old veteran diplomat Wolfgang Ischinger was seen wearing one during the opening of the Munich Security Conference.
In the run-up to May’s European elections, German politicians from the centre-left Social Democrats, the Greens, the pro-business Free and even Angela Merkel’s centre-right wore EU hoodies in campaign posters.
However, Johann König now worries that his gallery’s stunt may end up undermining its original intention. “We wanted to use our reach with young people to remind a younger generation that you cannot take borderless travel and peace in Europe for granted”, he said.
“But when a leading politician wears our EU hoodie in a television ad, that sort of kills the hipness factor in an instant”.
|
{
"pile_set_name": "OpenWebText2"
}
|
Sunday, May 11, 2014
Recently there has been more said on USHCN adjustments. My recent post on a Steven Goddard plot posted at WUWT produced a response, which conceded the plot was wrong, but Anthony said, defensively," The one thing common to all of it though is that it cools the past, and many people don’t see that as a justifiable or even an honest adjustment."
I've previously written in defence of TOBS, as an adjustment which is not only justifiable but necessary. The information requiring it is staring analysts in the face, and they would be negligent to ignore it. I showed a hourly analysis at Ft Collins, Colo, of the effect of the TOBS bias.
But recently, Steven Mosher reminded that the much-loved (by sceptics) John Daly site had posted a much more comprehensive survey, by Jerry Brennan in November 2005. The analysis is here, and his summary datafile, which I will use, is here (text, 29kb), which also identifies the stations.
There are other extensive results files there too, but unfortunately, it's all a jumble of numbers. AFAIK, no graphics. So I thought I would provide some. Below is a histogram of the effect of changing TOB from 5pm to 9am for each of the 190 stations considered by Jerry, and of subsequent changes to midnight (standard). There is also a table from the original paper by Karl et el, 1986, which showed that over the years in the US, about 30% of stations made such a change to 1986. Many more stations would have changed to effectively midnight reporting when MMTS came in. Ther mean effect of the change is 0.66°C cooling. It is no surprise that USHCN adjustments have the effect of "cooling the past".
In the original Karl et el, 1986 paper, there is the following table showing what changes had been made to observing times:
Because evening TOB has a warm bias, through double counting very warm afternoons, the change to 9am has a cooling effect. Here is a histogram of the putative effects for the 190 stations of changing from 5pm observing time to 9am. Positive effect indicates (in °C) the bias that has to be subtracted from temperatures before the change.
The standard setting is midnight, which some stations already observed, and which would become the setting after MMTS conversion. So here is the required adjustment (in °C) for changing from 5pm to midnight:
In fact, midnight mostly has a slightly greater cool bias than 9am. This can be seen in the plot of change to midnight from 9am:
These are large changes, which don't of course apply in full to all stations. A small number were already using midnight. The rest will mostly need some kind of TOBS adjustment, which will "cool the past". But on the evidence, there's no choice.
25 comments:
Congratulations on the increasing influence of your blog. Was Watt's appearance a first for you? I had a look at his post, written in collaboration with Zeke, which clearly demonstrates your influence there. Amusing to see that Anthony' s acolytes seem now to be in rebellion against him in his criticisms of their new champion, Steven Goddard. That said the WUWT crowd has clearly degenerated. While the contributions in the past were pretty flaky they did at least have a semblance of sound science (e.g. Eschenbach, Orssengo). One wonders whither they have decamped.
One of the aforementioned acolytes pronounced that only those weather stations that do not require any adjustment should be used for constructing temperature series. It would be interesting to know how many stations would fall into that category even back to, say, 1945.
Nick,Thank you for your frequent and always useful comments on other blogs which i think bring clarity to some otherwise murky thinking; and of course your work here, as well.
I do have a question which I've been mulling over.
I suspect that a TOB change in raw data will almost always show as a step change. A station move might also produce a detectable step change. Is it also possible to detect step changes in the data which might have persistence equivalent to a TOB change without knowing where to look? Might one infer anything useful from a detected step change lacking a note in the metadata?I suppose I'm suggesting data mining, but in some of my previous activities, data mining did produce useful insights. Would it here, do you think?
Thanks, JFYes, if TOBS changes weren't allowed for by metadata, they should appear as a step change in the data. TOBS is the first step in NCDC processing, so that step shouldn't appear in later processing.
The homogenisation algorithms are a sort of data mining, and should pick it up (if not previously removed). But TOBS changes are near the bottom of the range they would detect. The reason they are important is that they tend to all go one way, since they reflect responses to NWS policies that affected all COOPs. So it is fortunate that metadata can catch them.
I think the thing I was getting at is other unidentified step changes. You would have to look for them in the unprocessed data. Are there unidentified step changes in there? I would think there must be.
I'm sure there are lots of unidentified step changes. That's what the homogenisation focusses on. I think you'd probably want to check diractly against the metadata. That's a big job - I haven't done it. A change of a few tenths is hard to spot.
Nick,Thanks much for helping me with this. I suspected it was the case and wouldn't at all be surprised that there are papers out there which deal with this. I need to look into this some more to satisfy my own curiosity.
Good post Nick. Trying to explain MMTS and TOBs over in the WUWT comment thread seems somewhat sisyphean at times, but at least some folks now realize that averaging absolute temperatures is a bad idea :-p
Didn't notice that comment by Anthony (which, I think, was quoted as an email from him in the post over at WUWT). I for one don't think that homogenization is unjustified, and think the PHA does a pretty good job (having done some work myself testing it).
On the quote, yes, it's in an email and worded to avoid saying that you both agree, as I'm sure you don't. But when challenged as to how he could be involved in defending adjustments, that's what he quoted.
It is very up hill and I for one still cannot see "warm bias" when recording Max Min temps.We discussed this on WUWT and you provided an example which in no way explained how the TOR provided a continuous bias to max Min temps and hence the so called Average temp.Can you for instance supply the actual daily values for a couple of those 5pm stations that you quote for say a week or month?Or at least point me to where I can look at them so that I can go through the readings as if I was calculating the Temperatures?
AC,In this post I just plotted the summary data from the John Daly site - links above. There is lots more data there. For my earlier post, I described in more detail a site at Boulder Colorado. This had good hourly data (few gaps). I have put a zipfile of that data and my R code for that post here.
There appears to be something not quite right with the data file you posted, as it does not look anything like your first diurnal pattern graph from your earlier post, there appears to be a 9 hour shift. Does that mean that 0 is not midnight?
I think the data is in GMT, and is converted in the code to Mountain standard time -7,00, which is used in the graphs.
The code is not a good place to srtart if you are learning R. The data file itself is straightforward; just a listing of temperatures and times. The first part of the code is devoted to extracting that. I've put that in a if(T){} block; you should change that to if(F){}, as it is already done. But I'd suggest using whatever you find familiar.
Thanks for the interesting TOBS posts. I've been meaning to try and break down the TOBS adjustment using hourly data, to see how often it gets the adjustment right or wrong. Do you know of any paper that does this? (I'm on pain killers atm, so I apologize if I missed it in your discussions).
Basically what I'm think of looking at are long term station data that have hourly reporting (or better), then "synthesizing" TOBS daily tmin/tmax breaks, and seeing how well the NCDC algorithms work in correcting that. Does this make sense?
Also, regarding homogenization Brandon and I had a bit of discussion relating to the spatial smearing associated with different homogenization methods, specifically BEST. Wonder what your thoughts are on this to?
Both my earlier study (Boulder) and Jerry's looked at hourly data and analysed as if a min/max thermometer was used. So I think do NOAA. Vose et al 2003 describe how they take 500 reference stations with hourly readings (map on Fig 2) and work out the bias for various reading hours. Then to apply TOBS to a given station, they apply the known TOBS history to that data of the nearest of the 500, presumably extraploated periodically.
Thanks for the sympathies, but I was trying to excuse an even greater than normal level of scatterbrained-ness. ;-) Actually I just had some teeth removed (part of my version of "old-timers disease") so the prescribed narcotic painkillers were related to that.
You are correct that it's difficult to find long continuous records, but I suppose as long as we don't have a correlation between weather-related events and signal drop-outs, that this won't matter too much.
I'll give Voss et al a look. The best way to understand these things are to implement them yourself. Thanks for the tips.
Goddard's mistake was to work on absolute temperatures rather than on anomalies.
Accepting that shifting the time of reading (24 hour) from am or pm to midnight can affect the readings, it should not significantly change the anomalies when averaged over a period of one month or more.
Unless, of course, the anomalies are themselves time-biased. By which I mean that the mean anomalies, when temperatures are read at, say, 12.00 pm, 9.00 am and 5.00 pm, all differ by a significant amount. Which, if they do, would rather upset the reason for using anomalies in the first place.
|
{
"pile_set_name": "Pile-CC"
}
|
Q:
where should i implement click function help me with code
public class ListViewMainActivity extends ListActivity {
// declare class variables
private ArrayList<Item> m_parts = new ArrayList<Item>();
private Runnable viewParts;
private ItemAdapter m_adapter;
Dbhelper mydb =new Dbhelper(this);
ArrayList<Item> abc = new ArrayList<Item>();;
/** Called when the activity is first created. */
public void onCreate(Bundle savedInstanceState) {
super.onCreate(savedInstanceState);
setContentView(R.layout.main);
// instantiate our ItemAdapter class
m_adapter = new ItemAdapter(this, R.layout.list_item, abc);
setListAdapter(m_adapter);
// here we are defining our runnable thread.
viewParts = new Runnable(){
public void run(){
handler.sendEmptyMessage(0);
}
};
// here we call the thread we just defined - it is sent to the handler below.
Thread thread = new Thread(null, viewParts, "MagentoBackground");
thread.start();
}
private Handler handler = new Handler()
{
public void handleMessage(Message msg)
{
// create some objects
// here is where you could also request data from a server
// and then create objects from that data.
abc = mydb.getweek();
m_adapter = new ItemAdapter(ListViewMainActivity.this, R.layout.list_item, abc);
// display the list.
setListAdapter(m_adapter);
}
};
}
Adapter code:
package com.example.myexpenses;
import java.util.ArrayList;
public class ItemAdapter extends ArrayAdapter {
// declaring our ArrayList of items
private ArrayList<Item> objects;
Context context;
/* here we must override the constructor for ArrayAdapter
* the only variable we care about now is ArrayList<Item> objects,
* because it is the list of objects we want to display.
*/
public ItemAdapter(Context context, int textViewResourceId, ArrayList<Item> objects) {
super(context, textViewResourceId, objects);
this.context = context;
this.objects = objects;
}
/*
* we are overriding the getView method here - this is what defines how each
* list item will look.
*/
public View getView(int position, View convertView, ViewGroup parent){
// assign the view we are converting to a local variable
View v = convertView;
// first check to see if the view is null. if so, we have to inflate it.
// to inflate it basically means to render, or show, the view.
if (v == null)
{
LayoutInflater inflater = (LayoutInflater) getContext().getSystemService(Context.LAYOUT_INFLATER_SERVICE);
v = inflater.inflate(R.layout.list_item, null);
}
Item i = objects.get(position);
if (i != null) {
// This is how you obtain a reference to the TextViews.
// These TextViews are created in the XML files we defined.
TextView ttd = (TextView) v.findViewById(R.id.toptextdata);
TextView mtd = (TextView) v.findViewById(R.id.middletextdata);
TextView bt = (TextView) v.findViewById(R.id.bottomtext);
// check to see if each individual textview is null.
// if not, assign some text!
if (ttd != null){
ttd.setText(i.getName());
}
if (mtd != null){
mtd.setText("$" + i.getPrice());
}
if (bt != null){
bt.setText(i.getDetails());
}
}
// the view must be returned to our activity
return v;
}
}
A:
Lots of options to do this thing. I will give you 2 of them and they are very easy.
With yourListView.setOnItemClickListener() Link-1
With
public class YourListActivity extends ListActivity implements
OnItemClickListener { }
Link-2
Good luck.
|
{
"pile_set_name": "StackExchange"
}
|
Rabindranath Tagore Secondary School
Rabindranath Tagore Secondary School is a secondary school within the Mahatma Gandhi Institute family. Named after the famed Indian poet Rabindranath Tagore, it was founded in 2003 by Mr Putty, now deceased, and now Mr. Joggesser is its rector. The school is found in D'Epinay, a small village in Pamplemousses District.
Students of Rabindranath Tagore Secondary School have a deep belief on Tagore's views on education and values. Tagore philosophy is in fact that education is the development of the mind, body and soul. Extra-curricular activities such as sport, music, dance and debating are offered. Physical studies is also offered as a subject for O-level Cambridge-level examination since 2010. Gandhi Day and Tagore Day are celebrated each year as well as other cultures are taught in an additional 9th period.
In 2008, the school performed Post Office, a play by Tagore. The play was performed in many schools of Mauritius and a Gala Show was organised at the Rabindranath Tagore Institute. The play was directed by Mr. Ramphul, a drama coordinator at the school, and the case consisted of 12 students and one teacher. Also the school has been a part of the MUN contest winning Best delegate award. In 2010 A-level examinations, the school made its very first laureates, Kheelesh Poonye and Sooyash Dosonye. The school has made it through 5 years of 100% pass rate at O-level examinations.
Category:Schools in Mauritius
Category:Memorials to Rabindranath Tagore
Category:Educational institutions established in 2003
Category:Pamplemousses District
Category:2003 establishments in Mauritius
|
{
"pile_set_name": "Wikipedia (en)"
}
|
OPTUS Stadium faced its first major test on Sunday with some patrons taking up to 90 minutes to board trains after yesterday's one-day cricket match between Australia and England.
The Public Transport Authority believes up to 90 per cent of the record 54,000 crowd used trains or buses to get to and from the match.
There were reports of cricket fans waiting on the Armadale line for up to an hour while the ABC also reported issues on the Joondalup line.
PTA spokesman David Hynes told 6PR Radio the Armadale line delay was caused by a communications issue with one train driver which resulted in him “missing his slot”.
“That had a big knock on effect,” he told host Gareth Parker.
“It’s like missing a spot in a queue... that slowed the Armadale line of trains for at least two or three trains.”
A PTA spokesperson said the match finished at 7.20pm and the last attendees left the stadium’s new station by train at 8.45pm.
“As per crowd management plans, fans were temporarily stopped from entering the station at both concourses so that platforms could safely be cleared,” the spokesperson said.
Your cookie settings are preventing this third party content from displaying. If you’d like to view this content, please adjust your Cookie Settings . To find out more about how we use cookies, please see our Cookie Guide.
However, Mr Hynes, conceded to 6PR the speed “could have been better”.
“This allows crowds to be managed in the designated corral areas at the front of the station. All bus passengers were cleared within 45 minutes.”
Before the match some fans complained about dramas on bus routes.
“I got on at North Lake Road at 9.45am after three full buses passed,” one passenger posted on social media.
The PTA spokesperson said this was remedied immediately with more buses sent to service the route on the journey in and then on the return journey at the end of the day.
“All services carrying affected passengers arrived before the start of play,” the spokesperson said.
“This was the first time the suburban special event bus network had operated and data from today’s passenger movements will be used to inform future bus and train scheduling.”
The PTA has previously said patrons could expect delays leaving Optus Stadium until the Matagarup footbridge is completed.
|
{
"pile_set_name": "OpenWebText2"
}
|
=====================================================================
THE STANDARD'S
S T O C K G R O K
What Financial Reporters Think of Wall Street
=====================================================================
For money & markets news, visit:
http://www.thestandard.com/subject/finance/
Friday, June 1, 2001
TOP GROKS:
* What's Your Pleasure? Sorry, No Tech Rebounds
* Palm? Please - So Uncool!
* Analysts as Demons, Part 273
PUNDITS SAY THE DARNDEST THINGS:
* Rob Walker, Slate: On the trail of a 'merger of equals'
* David Futrelle, Money.com: It's deja vu all over again
/=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= advertisement=-=-=
THE STANDARD GOES WIRELESS! Now you can get The Standard's cutting edge
Internet Economy news and information delivered straight to your
Web-enabled phone or pager. Whether you log on for breaking news,
stock quotes, or company and people information, you can now retrieve
critical intelligence on the Internet Economy anytime, anywhere you go.
Just enter "thestandard.com" on your key pad to get The Standard's
powerful content. http://click.email-publisher.com/oaaacdsaaP8mxbVDzeiaaaaczb/
=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=/
TOP GROKS
~~~~~~~~~
What's Your Pleasure? Sorry, No Tech Rebounds
While not quite as animated as the office pool predicting the next
alcohol bust for a presidential offspring, stock scribes' recent banter
over the future of tech stocks concluded that a bust of a different
kind is already here - and isn't going away anytime soon.
So what if tech stocks are up 30 percent or so since mid-April?
Jawboning over what the market might do in the short term is "about
as intellectually stimulating as reading the phone book," kvetched
Motley Fool's Bill Mann. As for forecasting the market's next moves,
"I personally don't give a damn," Mann chest-thumped. "That's like
worrying about who is leading at the one-mile mark in a marathon."
Newsweek columnist Jane Bryant Quinn pooh-poohed bright-eyed
investors who treat tech stocks "as if they were lottery tickets -
hoping to win your money back by a lucky draw." Better not hold
your breath, she warned. "Historically, bubbles don't pop and
reinflate," James Stack of InvesTech Research told the Newsweek
columnist.
Read the full Grok:
http://www.thestandard.com/article/0,1902,26841,00.html?nl=stg
----------------------------------------------------------------------
Palm? Please - So Uncool
It wasn't that long ago that all of Wall Street was cheering for Palm,
notes SmartMoney.com. The same could be said of the media. But in
the two weeks since Palm announced that - whoops - fourth-quarter
revenues would sneak in at less than half of the $300 million-ish
predicted, Palm seems to have run out of buzz.
Which do business scribes dislike more, Palm's product or the
company? It's a toss-up. On Yahoo's FinanceVision, commentator
Caleb Goddard bragged about a phone-number swapping session
where his pen-and-paper combo had the job done long before his
Palm Pilot-wielding friend had even figured out how to switch from
the keyboard to graffiti mode. As for reading on the dinky screens,
forget it.
Read the full Grok:
http://www.thestandard.com/article/0,1902,26843,00.html?nl=stg
----------------------------------------------------------------------
Analysts as Demons, Part 273
What's next, a Securities Analyst Registry? Neighbors can log on to
find out whether one of these tainted individuals is residing near
them. Maybe local police can hand out flyers. Maybe it's time to
resurrect the scarlet A, this time for Analyst.
Round one of the media's post-heyday coverage of Net analysts had
a decidedly deconstructionist angle: An up-close-and-personal look
at the way the ex-heroes had spent their bubble days. The early
phase of round two has continued the dissection, but with a twist:
Rather than report more me-too exposes of naughty analyst behavior,
business journos are covering the regulatory investigations into those
naughty analysts. It's the same technique the media used with
Princess Diana. Those mags that purported to be above the slavish
post-mortem coverage simply worked in their share of Di photos by
casting their coverage as a look at the media crush.
Read the full Grok:
http://www.thestandard.com/article/0,1902,26846,00.html?nl=stg
----------------------------------------------------------------------
PUNDITS SAY THE DARNDEST THINGS
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
Rob Walker, Slate
Upshot: On the trail of a "merger of equals."
Do the Math: Lucent Technologies wanted a merger with Alcatel, but
the all-stock transaction reportedly would have dealt Alcatel
shareholders 58 percent of the new company, and Lucent 42 percent.
That looked like an acquisition to everyone but CEO Henry Schacht
& Co.
Seriously, Have You Ever Seen One? "Yes, the merger of equals, an
interesting creature, one that is captivating in the abstract but elusive
in real life."
What Was Henry Thinking? After all, someone has to have the top
job, and then there's the issue of how to divide board seats.
"Variations on this not-shocking discovery - that in any business
merger, one side is going to end up dominant - are played out
constantly."
Beggars Can't Be Choosers: "You would think that Lucent and
Schact would be highly motivated to close the deal and to recognize
that they were not exactly dealing from a position of great strength.
In short, you'd think they'd realize that they were being acquired."
Lucent's Acquisition Epiphany
http://slate.msn.com/cx/moneybox/entries/01-05-30__109015.asp
----------------------------------------------------------------------
David Futrelle, Money.com
Upshot: It's deja vu all over again.
Once Burned, Never Shy: Didn't the tech crash cure most investors
of the idea that there are no second chances? No way. The recent
rally saw the return of bubble-thinking in all of its dubious glory, as
investors plunged back into an assortment of momentum stocks
simply because they were going up.
Tied to the Rails: When Morgan Stanley analyst Jay Deahna recently
issued the not-so-subtly titled report "The Train has Left the Station,"
he created a mini buying frenzy for Teradyne and LAM Research as
investors scrambled to get aboard before it was too late. Too late for
what? The stocks Dehna mentioned are about even with where they
were.
Mea Culpa: "My point here isn't to take pot shots at anyone's stock
picking ability (after all, I'm the guy who recommended Sun last
Friday). The point is that you should base your investment decisions
on a stock's fundamentals - not on fear or greed."
The Tech Express Goes Local
http://www.money.com/money/depts/techinvestor/archive/010531.html
/=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-= advertisement=-=-=
**The Standard's new COMPANY INDEX**
Find information about hundreds of companies in our new COMPANY
INDEX. Browse through the alphabetical listings, industries and
categories, or perform a search to find the company you're looking for.
The Company Dossier hosts articles, a company profile, stock
information and financial overviews, key players and contact
information. http://click.email-publisher.com/oaaacdtaaP8mybVDzeiaaaacAb/
=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=-=/
MORE LINKS
~~~~~~~~~~
Cyberian Winds Blind PC Connection
http://www.msnbc.com/news/580762.asp?cp1=1
Do AOL Insider Sales Belie the Buyback?
http://interactive.wsj.com/articles/SB991170361420468941.htm
(Paid registration required.)
Breaking Up Is (Still) Hard to Do
http://www.msnbc.com/news/578467.asp?cp1=1
What's Next for Microsoft?
http://www.cnbc.com/010530plotkin-stocks.html
Talking Heads' Home on Hold
http://www.nypost.com/business/31497.htm
No Summer Romance in Store for AT&T Wireless
http://www.thestreet.com/tech/telecom/1444593.html
The Prodigal Dot-Coms' Return
http://www.businessweek.com/magazine/content/01_23/b3735094.htm
Venture Capitalists Seek Less Adventure
http://www.usnews.com/usnews/issue/010604/biztech/venture.htm
Rich Prospects for Online Luxury Stores
http://www.forbes.com/2001/05/29/0529luxuryshopping.html
STAFF
~~~~~
Written by Deborah Asbrand ([email protected]).
Edited by Suzan Revah ([email protected]).
GET THE MAGAZINE
~~~~~~~~~~~~~~~~
4 RISK-FREE issues at this URL:
http://click.email-publisher.com/maaaclmaaP8NtbVDzeib/
GET MORE NEWSLETTERS
~~~~~~~~~~~~~~~~~~~~
The Standard newsletters cover the media, stock market,
e-commerce, music, law and more. To SUBSCRIBE to other
newsletters, click here:
http://click.email-publisher.com/maaaclmaaP8NubVDzeib/
To unsubscribe, click here:
http://thestandard.email-publisher.com/u/?bUrKBp.bVDzei
ADVERTISING INFORMATION
~~~~~~~~~~~~~~~~~~~~~~~
For more information on advertising in The Standard
Newsletters, contact:
Erik VanderKolk ([email protected])
FEEDBACK AND PROBLEMS
~~~~~~~~~~~~~~~~~~~~~
Send letters to the editor to [email protected].
Please contact us with any problems that arise:
http://www.thestandard.com/service
[email protected]
You can also contact us via phone or mail:
Standard Media International, Customer Service
866-776-9890 (phone)
Copyright 2001 Standard Media International
|
{
"pile_set_name": "Enron Emails"
}
|
Sen. Tim Kaine Timothy (Tim) Michael KaineBiden promises Democratic senators help in battleground states Second GOP senator to quarantine after exposure to coronavirus The Hill's Morning Report - Sponsored by The Air Line Pilots Association - Pence lauds Harris as 'experienced debater'; Trump, Biden diverge over debate prep MORE (D-Va.) blasted Thomas Modly on Monday after the acting Navy secretary called an ousted aircraft carrier captain “too naive or too stupid” to command the ship.
“Based on the transcript I’ve read, Secretary Modly’s comments were completely inappropriate and beneath the office of the secretary of the Navy,” Kaine, a member of the Senate Armed Services Committee, said in a statement.
At issue is a speech Modly gave to sailors aboard the USS Theodore Roosevelt addressing his decision to relieve Capt. Brett Crozier after a letter Crozier wrote pleading for help with a coronavirus outbreak on the carrier leaked in the media.
ADVERTISEMENT
In the speech, of which a transcript and audio leaked in the media Monday, Modly said that if Crozier didn’t think the letter would leak, he was “too naive or too stupid to be a commanding officer of a ship like this.”
Alternatively, Modly said, if Crozier leaked the letter on purpose, that would be a “serious violation” of the Uniform Code of Military Justice.
Modly also warned sailors that there is “no situation” in which they should go to the media, alleging “the media has an agenda” that “depends on which side of the political aisle they sit.”
In his statement, Kaine called Modly’s speech “deeply disappointing.”
“It’s deeply disappointing that he would deliver a speech on board a U.S. aircraft carrier suggesting that Capt. Crozier might be ‘stupid’ and bashing the media for trying to report the truth,” Kaine said. “These dedicated sailors deserve better from their leadership.”
Crozier’s letter, which was obtained and published by the San Francisco Chronicle last week, warned sailors could die if a majority of the crew wasn’t evacuated from the ship.
ADVERTISEMENT
“We are not at war. Sailors do not need to die,” Crozier wrote. “If we do not act now, we are failing to properly take care of our most trusted asset — our sailors.”
As of Sunday, 155 sailors on the Roosevelt had tested positive for the virus.
Prior to Crozier’s firing, Kaine and fellow Virginia Democratic Sen. Mark Warner Mark Robert WarnerIntelligence chief says Congress will get some in-person election security briefings Overnight Defense: Trump hosts Israel, UAE, Bahrain for historic signing l Air Force reveals it secretly built and flew new fighter jet l Coronavirus creates delay in Pentagon research for alternative to 'forever chemicals' House approves bill to secure internet-connected federal devices against cyber threats MORE wrote a letter to Modly raising several questions about how the Navy intended to handle the outbreak.
|
{
"pile_set_name": "OpenWebText2"
}
|
Three-dimensional nanopillar-array photovoltaics on low-cost and flexible substrates.
Solar energy represents one of the most abundant and yet least harvested sources of renewable energy. In recent years, tremendous progress has been made in developing photovoltaics that can be potentially mass deployed. Of particular interest to cost-effective solar cells is to use novel device structures and materials processing for enabling acceptable efficiencies. In this regard, here, we report the direct growth of highly regular, single-crystalline nanopillar arrays of optically active semiconductors on aluminium substrates that are then configured as solar-cell modules. As an example, we demonstrate a photovoltaic structure that incorporates three-dimensional, single-crystalline n-CdS nanopillars, embedded in polycrystalline thin films of p-CdTe, to enable high absorption of light and efficient collection of the carriers. Through experiments and modelling, we demonstrate the potency of this approach for enabling highly versatile solar modules on both rigid and flexible substrates with enhanced carrier collection efficiency arising from the geometric configuration of the nanopillars.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Welcome to the Bluefly Incorporated third quarter 2008 earnings conference call. (Operator Instructions) During the course of this call the company will make statements that constitute forward-looking statements usually containing the words believe, project, expect or similar expressions. These statements are made pursuant to the Safe Harbor provisions of the Private Securities Litigation Reform Act of 1995. Forward-looking statements inherently involve risks and uncertainties that could cause actual results to differ materially from the forward looking statements.
These statements are only predictions based on assumptions that are believed to be reasonable at the time. The risks and uncertainties are detailed from time to time in the reports we file with the Securities and Exchange Commission including Forms 8-K, 10-Q and 10-K and you should consider them when making an investment decision regarding Bluefly. They may affect whether our forward-looking statements prove to be correct.
We undertake no obligation to publicly update or revise these forward-looking statements. In addition, our discussion today is being recorded and archived for at least 30 days for those who wish to listen at a later date. Those of you listening to the archived version should recognize that the statements that we make are current as of November 12, 2008 and will not have been updated to reflect any subsequent events or changes in the business.
I will now turn the call over to Melissa Payner, Chief Executive Officer for Bluefly.
I will share some of the highlights from the third quarter. Barry will take you through the financial results from the third quarter and at the conclusion of the call, we will conduct a question and answer session.
Given the overall economic environment and the affect that it's had on other retailers, we believe that our third quarter results are quite encouraging. Year over year our net revenue for the quarter grew by approximately 10%. Operating loss including the non cash impact of the FAS 123 R expense, decreased by approximately $252,000.
Although the economic environment in the fourth quarter has become more challenging, we believe that the American consumer will continue their fascination with popular culture and shopping. They are just looking for permission to buy. Those retailers that are nimble enough to showcase the right product at the right price at the right time can gain market share.
Let's talk in a little more detail about our third quarter results. As I mentioned, sales were up by 10% in the quarter. Gross margin dollars grew by 28% and resulted in a gross margin percentage of 36.9%. We saw very strong performances in certain categories which have consistently driven our business season to season.
There was clear delineation between what was working and what wasn't working under the downward pressures of the current economic environment. Let's talk about what was working. Women's dresses have shown great resilience in light of a strong trend in the fall back towards sportswear with an 11% increase in overall dress volume. Day dresses drove the overall dress business with an increase in sales dollars of 27% and an increase in unit sales of 31% over last year.
Evening dresses continued to gain momentum in the fall season after a difficult first half. From a negative 26% in the first half of the year to negative 5% in Q3, as compared to last year, and by October to a positive 9% to last years sales.
After several seasons of the shift to our dresses, we are beginning to see a reversal of that trend for women's collections with an increase of 1% in sales for third quarter. Women's denim has also seen continued growth with a 12% increase compared to last year in sales and a 30% increase in unit sales in the third quarter. We were particularly challenged in these two areas throughout the spring half due to a lack of inventory.
We continue to see explosive growth in contemporary accessories with sales growth of 20% and margin growth of 23% over last year. Contemporary hand bags alone were up 56% for the quarter in sales and up 52% in margin dollars and up 23% in unit sales.
Now let's talk a little bit about what's not working. While designed accessories remains an important component to the total company sales, approximately 20% for the quarter, designer shoes and hand bags have dropped to last year in overall sales by 18%. Mix, late receipts and the current macro economic conditions all played a large role in the drop last year.
The total men's division continues to be challenged with a 14% sales drop in the quarter. The decrease in men's was driven by a decline in overall tailored clothing business which includes suits, dress shirts and designer shoes. We believe that this is a result of the macro economic conditions.
We see men's knits and denim as an opportunity as those businesses have suffered from a lack of new receipts.
Aside from the challenges in some of the larger categories, there are still come smaller categories that continue to see strong growth trends year over year for the quarter. Jewelry, we have 25% increase in sales, a 34% increase in margin dollars and a 36% increase in the unit sales over last year.
In swimwear we have an increase of 14% in sales, an increase of 12% in margin dollars and an increase of 8% in units over last year.
In women's belts we have a 24% increase in sales, 30% increase in margin dollars and a 52% increase in units.
In women's active wear, we have an 80% increase in sales, a 60% increase in margin dollars and a 72% increase in unit sales over last year.
So let's talk a little now about marketing. Marketing expenses including tax related costs for the quarter were $4.1 million, a 61% higher than they were for Q3 2007, but this increase is entirely due to a change in timing for our important and successful partnership with Project Runway.
Expenses for Project Runway's season four were in the fourth quarter of '07 versus Q3 of this year. This shift represents 100% of the increase of the marketing dollars in Q3 and we expect marketing spend for the year end 2008 to be below that of 2007.
We feel that the best way to gain both market share and improve productivity in this economy is with the smart allocation of marketing dollars and a relentless focus on messaging and conversion. Marketing plans for Q4 and beyond are built on three major platforms.
Number one, an aggressive and flexible merchandizing promotional calendar that we revisit daily. Number two, a portfolio approach to on line marketing programs that maximizes sales while continuing to reduce ad to sales ratios. And three, smart 4D off line programs in partnership that include rich media components to build awareness and deepen customer engagement.
In the past month, Bluefly continued to build on its reputation as an innovator and leader in 4D marketing. Two key programs for the period were partnerships with Project Runway and Gossip Girls that included on air integration coupled with on site content that includes merchandise assortment directly tied to the television shows, videos, blogging and other interactive content.
We saw a 70% to new unique visitors year over year during the week in July that featured the premier of Runway Project season five and the exclusive launch of Christian Siriano's, the season four winners first designer collection.
Blog conversations about Bluefly's Q3 grew to more than 8,000 a 70% increase and since the beginning of the year, Bluefly videos have had more than 800,000 hits on You Tube. In the month of October, we also featured Fashion Decision 2008, a widget that appeared a Bluefly as well as all major social networking sites that allowed our community to weigh in on the election and see real time results reported by region.
The buzz about Bluefly is definitely building. A recent Wall Street Journal article celebrated Bluefly for being right for the times, citing 25% more buzz in October versus September according Zeta, an independent researcher.
Now, I will turn the call over to Barry who will run through some of the third quarter details.
Barry Erdos
Let me walk you through the major income statement and balance sheet line items. Net revenue in the third quarter grew by 10% to $19.8 million. Average order size increased 4.2% to $292.00 from $280.00 in the third quarter of 2007. We added over 39,000 new customers in the quarter, a 4.4% increase over last year.
Gross margin for the quarter was 36.9% versus 31.7% in Q3 2007. Gross margin dollars per order increased to $66.23 versus $54.31. As we mentioned on the last call, we were seeing positive benefits from certain initiatives put in place over the last several quarters, most notably in the form of a slight increase in the return rate for the year to date results compared to last year.
We have not a meaningful decrease in the return rate in the third quarter.
As a reminder, cost of goods sold include net product costs, cost of freight, third party carrier costs associated with getting the product to the consumer and the cost of packing materials.
Moving to the selling and fulfillment line; selling and fulfillment expenses increased 7.6% to $4.9 million for the third quarter versus the same period last year. The major components to selling and fulfillment are as follows; operating related costs which are credit card fees, pick and pack and warehousing and customer service. And this decreased 15% to $2.1 million from $2.5 million compared to the same period last year.
As a percentage of net revenues, operating related costs decreased from 13.7% to 10.6% in the quarter. This decrease was driven by efficiencies related to costs associated with fulfillment and customer service as well as the fact that the 2007 numbers included move related costs to our new fulfillment center of $462,000.
Technology spending increased to $1.8 million, an increase to 8.9% of revenue versus 6.3% in 2007. We capitalized approximately $509,000 of expenses in the quarter related to the APG upgrade. Our new web site was placed into service in August of 2008 at a total cost of $5.3 million and depreciation expenses relating to the new website was approximately $293,000 which is included in technology expenses.
E-commerce expenses remained relatively unchanged at approximately $1 million compared to the same period in the prior year. E-commerce expenses also remained relatively unchanged at 5.4% of net revenue compared to the same period last year.
Marketing expense; our total marketing expense including staff related costs for the quarter was $4.1 million versus $2.8 million for the third quarter of 2008. The third quarter included approximately $2.1 million in expenses related to our print and television advertising which was $1.4 million higher compared to the third quarter of 2007.
As Melissa mentioned, the increase is attributed to the timing of the Project Runway fifth season. It launched in July of 2008 during the third quarter whereas Project Runway's season four launched in the fourth quarter of 2007.
General and administrative expenses; G&A expenses decreased by $389,000 versus the third quarter of 2007. Included in the G&A expenses for the third quarter were $594,000 of expenses related to stock based compensation versus $1.5 million for the same period last year.
Turning to the balance sheet, our cash as of September 30, 2008 was $1.9 million, down from $6.7 million at the end of 2007. As we previously announced, in July we drew down on the $3 million commitment provided by two of our major shareholders. This amount is included on our balance sheet as long term notes and presented with accrued interest.
Inventory remained relatively unchanged at $28 million since December 31, 2007. Other current assets of $5.3 million includes $3.2 million in accounts receivable which is comprised of dollars due from credit card companies and $2.1 million of other pre-paid expenses which is mostly marketing related.
Fixed assets increased by $812,000 from year end. As previously mentioned at quarter end we have $5.3 million capitalized related to the cost associated with our APG implementation. At September 30, the company had approximately $3 million of debt on the balance sheet and we have $3.8 million available in our line of credit with Wells Fargo out of $7.5 million.
As of September 30, there were approximately 13.3 million shares of common stock outstanding before giving the effect of the conversions of the remaining series F preferred stock warrants, options or deferred stock units.
Now let me turn the call back to Melissa.
Melissa Payner
While we're continuing to operate in a difficult environment, our business continues to move in a positive direction. We continue to growth in sales and leverage our marketing expenses. We believe our value proposition will continue to be compelling to our customers.
I'd like to turn the call over now for any questions and answers.
Question-and-Answer Session
Operator
(Operator Instructions) There are no questions at this time.
Melissa Payner
Thank you very much.
Copyright policy: All transcripts on this site are the copyright of Seeking Alpha. However, we view them as an important resource for bloggers and journalists, and are excited to contribute to the democratization of financial information on the Internet. (Until now investors have had to pay thousands of dollars in subscription fees for transcripts.) So our reproduction policy is as follows: You may quote up to 400 words of any transcript on the condition that you attribute the transcript to Seeking Alpha and either link to the original transcript or to www.SeekingAlpha.com. All other use is prohibited.
THE INFORMATION CONTAINED HERE IS A TEXTUAL REPRESENTATION OF THE APPLICABLE COMPANY'S CONFERENCE CALL, CONFERENCE PRESENTATION OR OTHER AUDIO PRESENTATION, AND WHILE EFFORTS ARE MADE TO PROVIDE AN ACCURATE TRANSCRIPTION, THERE MAY BE MATERIAL ERRORS, OMISSIONS, OR INACCURACIES IN THE REPORTING OF THE SUBSTANCE OF THE AUDIO PRESENTATIONS. IN NO WAY DOES SEEKING ALPHA ASSUME ANY RESPONSIBILITY FOR ANY INVESTMENT OR OTHER DECISIONS MADE BASED UPON THE INFORMATION PROVIDED ON THIS WEB SITE OR IN ANY TRANSCRIPT. USERS ARE ADVISED TO REVIEW THE APPLICABLE COMPANY'S AUDIO PRESENTATION ITSELF AND THE APPLICABLE COMPANY'S SEC FILINGS BEFORE MAKING ANY INVESTMENT OR OTHER DECISIONS.
|
{
"pile_set_name": "Pile-CC"
}
|
Mothers, Clay Bar
Cleans, Smoothes and Restores!
This system removes potentially damaging contaminants before they can become deeply embedded in your paint. Simple application using the included bottle of showtime, clay bars, and microfiber towel leaves painted surfaces so smooth that you can feel the difference! Save your paint from acid rain, sap, airborn metal particles, bird droppings, and even brake dust.
There are no customer reviews for this product. However, you can be the first person to add a review for this product.
|
{
"pile_set_name": "Pile-CC"
}
|
---
abstract: 'Let ${\mathcal{O}}$ be a maximal order in a definite quaternion algebra over $\mathbb{Q}$ of prime discriminant $p$, and $\ell$ a small prime. We describe a probabilistic algorithm, which for a given left ${\mathcal{O}}$-ideal, computes a representative in its left ideal class of $\ell$-power norm. In practice the algorithm is efficient, and subject to heuristics on expected distributions of primes, runs in expected polynomial time. This breaks the underlying problem for a quaternion analog of the Charles-Goren-Lauter hash function, and has security implications for the original CGL construction in terms of supersingular elliptic curves.'
author:
- 'David Kohel, Kristin Lauter, Christophe Petit[^1], Jean-Pierre Tignol'
title: 'On the quaternion $\ell$-isogeny path problem'
---
*To appear in the LMS Journal of Computation and Mathematics, as a special issue for ANTS (Algorithmic Number Theory Symposium) conference.*
Introduction {#sec:introduction}
============
In this paper, we provide a probabilistic algorithm to solve a quaternion ideal analog of the path problem in supersingular $\ell$-isogeny graphs. The main result is an algorithm for the following. Let ${B_{p,\infty}}$ be a quaternion algebra over ${\mathbb{Q}}$ ramified at $p$ and $\infty$. Let $\ell$ be a “small” prime, typically 2 or 3, or any small constant prime. Given a maximal quaternion order ${\mathcal{O}}$ in ${B_{p,\infty}}$ and a left ${\mathcal{O}}$-ideal $I$, compute an equivalent left ${\mathcal{O}}$-ideal $J = I\beta$ with norm $\ell^k$ for some $k$. This algorithm runs in practice in probabilistic polynomial time, and this effective runtime follows from heuristic assumptions on expected distributions of primes. With minimal adaptation, the algorithm also applies to output an ideal with smooth (or power-smooth) norm. The algorithm is described in terms of a special maximal order, but extends to any maximal order by passing through such a special order.
The motivation for this problem is an explicit equivalence of categories between left ${\mathcal{O}}$-ideals and supersingular elliptic curves (over $\bar{{\mathbb{F}}}_p$). The Deuring correspondence gives a bijection between such curves, up to Galois conjugacy, and isomorphism classes of maximal orders in ${B_{p,\infty}}$. This bijection can be turned into an equivalence of categories by the following construction. Let $E_0/K$ be a fixed elliptic curve with endomorphism ring ${\mathcal{O}}= {\mathrm{End}}(E_0)$ a quaternion order in ${B_{p,\infty}}= {\mathcal{O}}\otimes {\mathbb{Q}}$ (we may take the base field $K = {\mathbb{F}}_{p^2}$ and $E_0$ such that $|E_0(K)| = (p+1)^2$). Associated to any pair $(E_1,\varphi)$ where $\varphi: E_0 \rightarrow E_1$ is an isogeny, we obtain a left ${\mathcal{O}}$-ideal $I = \mathrm{Hom}(E_1,E_0) \varphi$ of norm $n = \deg(\varphi)$ and conversely every left ${\mathcal{O}}$-ideal arises in this way (see Kohel [@Kohel1996 Section 5.3]). In particular, given any isogeny $\psi: E_0 \rightarrow E_1$ of degree $m$, the left ${\mathcal{O}}$-ideal $J = I \hat{\varphi}\psi/n$ is an equivalent ideal of norm $m$, where $\hat\psi$ is the dual of $\psi$.
The problem we address in this work is to solve the quaternion version of the supersingular $\ell$-isogeny path problem: given $E_0$, $E_1$ and a small prime $\ell$, find an $\ell$-power isogeny from $E_0$ to $E_1$. Under this equivalence of categories, the analogous problem is the determination of a $\ell$-power norm left ${\mathcal{O}}$-ideal in the class of a given left ${\mathcal{O}}$-ideal $I$. After introducing the necessary background on quaternion orders and ideals in Section \[sec:quaternions\] and addressing some preliminary algorithmic problems in Sections \[sec:prel\], we solve the $\ell$-power norm problem in Section \[sec:ideals:ellpow\]. Subject to reasonable heuristics on the probability of finding suitable primes, we obtain a probabilistic algorithm which solves this problem in expected polynomial time. The experimental runtime agrees with the most optimistic predictions for the distribution of primes. The algorithm gives a clear distinction between the efficiency of the $\ell$-isogeny problem in the equivalent category of quaternion ideals, whereas the analogous problem in the category of supersingular elliptic curves, on which the security of the Charles, Goren and Lauter hash function [@Charles2009] is based, has to date resisted attack. This dichotomy poses several questions on the extent to which the information from the algebraic category can be transported to the geometric one. In particular, one expects an algorithm for computing the endomorphism ring of a given elliptic curve to provide an effective reduction to the algebraic setting, making the hardness of this problem critical to the underlying security.
The quaternion $\ell$-isogeny path problem {#sec:quaternions}
==========================================
In this section, we first motivate and define the quaternion $\ell$-isogeny path problem. We then recall basic facts on quaternion algebras. We introduce *$p$-extremal* maximal orders, which will play an important role in our solution of the quaternion $\ell$-isogeny problem. We finally discuss properties of reduced norms and ideal morphisms.
“Hard” isogeny problems {#sec:intro:hard}
-----------------------
The motivation for studying the quaternion $\ell$-isogeny problem is based on the analogous (indeed categorically equivalent) problem for supersingular elliptic curves. The difficulty of this problem for elliptic curves underlies the security of the Charles, Goren and Lauter hash function [@Charles2009].
As an example, finding a preimage (inverting the function) amounts to solving the following path problem in the supersingular $\ell$-isogeny graph:
\[prob:preim\] Let $p$ and $\ell$ be prime numbers, $p\neq\ell$. Let $E_0$ and $E_1$ be two supersingular elliptic curves over ${\mathbb{F}}_{p^2}$ with $|E_0({\mathbb{F}}_{p^2})|=|E_1({\mathbb{F}}_{p^2})|=(p+1)^2$. Find $k\in\mathbb{N}$ and an isogeny of degree $\ell^k$ from $E_0$ to $E_1$.
Similarly, finding collisions requires a solution to the following multiple path problem in the supersingular $\ell$-isogeny graph:
\[prob:coll\] Let $p$ and $\ell$ be prime numbers, $p\neq\ell$. Let $E_0$ be a supersingular elliptic curve over ${\mathbb{F}}_{p^2}$. Find $k_1,k_2\in\mathbb{N}$, a supersingular elliptic curve $E_1$ and two distinct isogenies (i.e. with distinct kernels) of degrees respectively $\ell^{k_1}$ and $\ell^{k_2}$ from $E_0$ to $E_1$.
Setting ${\mathcal{O}}= {\mathrm{End}}(E_0)$, we have a category of left ${\mathcal{O}}$-ideals, with morphisms $I \rightarrow I\alpha \subseteq J$, for $\alpha$ in $B = {\mathcal{O}}\otimes {\mathbb{Q}}$, which is equivalent to the category of supersingular elliptic curves and isogenies. The analog of the path problem in supersingular $\ell$-isogeny graphs is that of finding a representative ideal $J$ for given $I$ of norm $\ell^k$. We call this problem the *quaternion $\ell$-isogeny path problem*, and focus on its effective solution in this article.
Quaternion algebras\[sec:intro:QA\]
-----------------------------------
In this work we consider the structure of left ideals of a maximal order in the quaternion algebra $B_{p,\infty}$ ramified only at $p$ and $\infty$. Such an algebra is isomorphic to ${\mathrm{End}}(E) \otimes {\mathbb{Q}}$ for any supersingular elliptic curve $E/{\mathbb{F}}_{p^2}$. Here we denote ${\mathrm{End}}(E) = {\mathrm{End}}_{\bar{{\mathbb{F}}}_p}(E)$ and if we assume $\#E({\mathbb{F}}_{p^2}) = (p+1)^2$, then the full endomorphism ring ${\mathrm{End}}(E)$ is defined over ${\mathbb{F}}_{p^2}$. Any definite quaternion algebra over ${\mathbb{Q}}$ has a presentation of the form ${\mathbb{Q}}\langle{i,j}\rangle$, where $i^2 = a$, $j^2 = b$, $k = ij = -ji$ for negative integers $a,b$. The canonical involution on $B_{p,\infty}$ is given by $$\alpha = x_0 + x_1 i + x_2 j + x_3 k \longmapsto
\bar{\alpha} = x_0 - x_1 i - x_2 j - x_3 k.$$ from which the reduced trace and norm take the form $${\mathrm{Trd}}(\alpha) = \alpha + \bar{\alpha} = 2x_0
\mbox{ and }
{\mathrm{Nrd}}(\alpha) = \alpha \bar{\alpha} = x_0^2 - a x_1^2 - b x_2^2 + ab x_3^2.$$ The integral basis $\{1,i,j,k\}$ has the nice property of being an orthogonal basis with respect to the bilinear form $\langle{x,y}\rangle = {\mathrm{Nrd}}(x + y) - {\mathrm{Nrd}}(x) - {\mathrm{Nrd}}(y)$ associated to the reduced norm. Nevertheless, the order ${\mathcal{O}}= {\mathbb{Z}}\langle{i,j}\rangle$ is never maximal.
Extremal orders\[sec:prob:extremal\]
------------------------------------
In this work we first place the focus on the [*$p$-extremal*]{} maximal orders ${\mathcal{O}}$ containing $\pi$ such that $\pi^2 = -p$. For a general order there exists a unique maximal $2$-sided ideal $\mathfrak{P}$ over $p$, and this ideal is principal if and only if there exists such an element $\pi$. The maximal ideal $\mathfrak{P}$ is a generator of the $2$-sided class group, and $p$-extremal orders are precisely those of trivial $2$-sided class number. In the context of supersingular elliptic curves, these are the maximal orders which are endomorphism rings of elliptic curves defined over ${\mathbb{F}}_p$ with Frobenius endomorphism $\pi$.
Secondly, we focus on orders with distinguished quadratic subring $R$. For a maximal order ${\mathcal{O}}$ we define $
d({\mathcal{O}}) = \min\{ {\mathrm{disc}}(R) : {\mathbb{Z}}\ne R \subsetneq {\mathcal{O}}\}.
$ Among all $p$-extremal maximal quaternion orders, we define a [*special*]{} $p$-extremal maximal order ${\mathcal{O}}$ to be a $p$-extremal maximal order such that $d({\mathcal{O}})$ is minimal.
The following lemma establishes the main properties we need for such an order, after which Lemmas \[lem:disc-4\], \[lem:disc-8\], and \[lem:disc-q\] provide for their existence by explicit construction.
\[lem:special-p-extremal-properties\] Let ${\mathcal{O}}$ be a maximal order in $B_{p,\infty}$ containing a subring ${\mathbb{Z}}\langle{i,j}\rangle$ with $i^2=-q$, $j^2=-p$, and $ij = -ji$, for $q$ coprime to $p$. Set $R = {\mathcal{O}}\cap {\mathbb{Q}}[i]$ and let $D$ be its discriminant. If $R$ is the ring of integers of ${\mathbb{Q}}[i]$, then $R^\perp = Rj$ and $R + Rj$ is a suborder of index $|D|$ in ${\mathcal{O}}$. If $\omega$ is a generator of $R$, then $${\mathrm{Nrd}}(x_1 + y_1\omega + (x_2 + y_2\omega)j) = f(x_1,y_1) + p f(x_2,y_2),$$ where $f(x,y)$ is a principal quadratic form of discriminant $D$.
The triviality of the trace of $j$ and the anti-commuting relation $ij = -ji$ imply that ${\mathbb{Q}}(i)$ has orthogonal complement ${\mathbb{Q}}(i)j$ in $B_{p,\infty}$. Consequently $R^\perp \subset {\mathcal{O}}$ is a lattice in ${\mathbb{Q}}(i)j$ containing $Rj$, hence of the form $\mathfrak{a}j$ for a fractional ideal $\mathfrak{a}$ of $R$ which contains $R$. The prime $p$ is inert in $R$, since $p$ is ramified in $B_{p,\infty}$ but not in $R$. Since the norm is integral on $\mathfrak{a}j$, and ${\mathrm{Nrd}}(j) = p$, it follows that $\mathfrak{a}$ is integral, hence equals $R$. The orthogonality of $R$ and $Rj$ implies that $j\beta = \bar{\beta}j$ for all $\beta$ in $R$, so $jR = Rj$ and $R + Rj$ is closed under multiplication. The form of the norm follows from orthogonality and multiplicativity of the norm: ${\mathrm{Nrd}}(\beta_1 + \beta_2j)
= {\mathrm{Nrd}}(\beta_1) + p {\mathrm{Nrd}}(\beta_2)$. Consequently the discriminant of the norm form is $D^2 p^2$, from which we conclude that $R + Rj$ has index $|D|$ in any maximal order.
By convention, for our special $p$-extremal order ${\mathcal{O}}$, we fix ${\mathbb{Z}}[i] \subseteq R$ with $i^2 = -q$ and $D = {\mathrm{disc}}(R)
= -d({\mathcal{O}})$, and $j^2 = -p$ (i.e. $j = \pi$ above). Being of smallest discriminant, $R$ is necessarily a maximal order whose discriminant is the first of the sequence $$-3, -4, -7, -8, -q \text{ for prime } q \equiv 3 \bmod 4,$$ such that $p$ is ramified or inert in $R$. The next three lemmas establish existence for $q = 1$, $q = 2$, and $q \equiv 3 \bmod 4$ prime. These lemmas incorporate and expand on Propositions 5.1 and 5.2 of Pizer [@Pizer1980]. We recall that an order in a quaternion algebra is [*Eichler*]{} if it is the intersection of two maximal orders.
\[lem:disc-4\] Let $p \equiv 3 \bmod 4$ be a prime, and let $B = {\mathbb{Q}}\langle{i,j}\rangle$ be the quaternion algebra given by the presentation $i^2 = -1$, $j^2 = -p$, and $k = ij = -ji$, and set $R = {\mathbb{Z}}[i]$. Then $B$ is ramified only at $p$ and $\infty$, and ${\mathbb{Z}}\langle{i,j}\rangle$ is contained in exactly two maximal orders with index $4$, described by the inclusion chains: $${\mathbb{Z}}\langle{i,j}\rangle
\subsetneq {\mathbb{Z}}\langle{i,\frac{1+i+j+k}{2}}\rangle
\subsetneq
\left\{
\begin{array}{l}
{\displaystyle}{\mathbb{Z}}\langle{i,\frac{1+j}{2}}\rangle{\raisebox{0.4ex}{,}}\\[2.5mm]
{\displaystyle}{\mathbb{Z}}\langle{i,\frac{1+k}{2}}\rangle\cdot
\end{array}
\right.$$ In particular ${\mathbb{Z}}\langle{i,(1+i+j+k)/2}\rangle$ is an Eichler order, but ${\mathbb{Z}}\langle{i,j}\rangle$ is not.
\[lem:disc-8\] Let $p \equiv 5 \bmod 8$ be a prime, and let $B = {\mathbb{Q}}\langle{i,j}\rangle$ be the quaternion algebra given by the presentation $i^2 = -2$, $j^2 = -p$, and $k = ij = -ji$, and set $R = {\mathbb{Z}}[i]$. Then $B$ is ramified only at $p$ and $\infty$, and ${\mathbb{Z}}\langle{i,j}\rangle$ is contained in exactly two maximal orders with index $8$, described by the inclusion chains: $${\mathbb{Z}}\langle{i,j}\rangle
\subsetneq {\mathbb{Z}}\langle{i,j,\frac{i+k}{2}}\rangle
\subsetneq {\mathbb{Z}}\langle{i,\frac{i+k}{2},\frac{1+j+k}{2}}\rangle
\subsetneq
\left\{
\begin{array}{l}
{\displaystyle}{\mathbb{Z}}\langle{i,\frac{1+j+k}{2},\frac{i+2j+k}{4}}\rangle{\raisebox{0.4ex}{,}}\\[2.5mm]
{\displaystyle}{\mathbb{Z}}\langle{i,\frac{1+j+k}{2},\frac{i+2j-k}{4}}\rangle\cdot
\end{array}
\right.$$ In particular ${\mathbb{Z}}\langle{i,j}\rangle$ is not an Eichler order.
\[lem:disc-q\] Let $p$ and $q$ be primes, with $p \equiv 1 \bmod 4$, $q \equiv 3 \bmod 4$, and $${\left(\!\frac{-p}{q}\!\right)} = 1.$$ Let $B = {\mathbb{Q}}\langle{i,j}\rangle$ be the quaternion algebra given by the relations $i^2 = -q$, $j^2 = -p$, and $k = ij = -ji$, and set $R = {\mathbb{Z}}[(1+i)/2]$. Then $B$ is ramified only at $p$ and $\infty$, and ${\mathbb{Z}}\langle{(1+i)/2,j}\rangle = R + Rj$ is contained in exactly two maximal orders with index $q$, described by the inclusion chains: $${\mathbb{Z}}\langle{(1+i)/2,j}\rangle
\subsetneq
\left\{
\begin{array}{l}
{\displaystyle}{\mathbb{Z}}\langle{\frac{1+i}{2}{\raisebox{0.4ex}{,}}\, j\,{\raisebox{0.4ex}{,}}\frac{ci+k}{q}}\rangle{\raisebox{0.4ex}{,}}\\[2.5mm]
{\displaystyle}{\mathbb{Z}}\langle{\frac{1+i}{2}{\raisebox{0.4ex}{,}}\, j\,{\raisebox{0.4ex}{,}}\frac{ci-k}{q}}\rangle{\raisebox{0.4ex}{,}}\end{array}
\right.$$ where $c$ is any root of $x^2 + p \bmod q$. In particular $R + Rj$ is an Eichler order.
Under the generalized Riemann hypothesis, for $p \equiv 1 \bmod 4$, the smallest $q$ satisfying the conditions of the last lemma is $O(\log(p)^2)$ by a result of Ankeny [@Ankeny1952] (or explicitly $q < 2\log(p)^2$ by Bach [@Bach1990]). In the remainder of this paper, we will assume that ${B_{p,\infty}}$, ${\mathcal{O}}$, and $R$ are suitably constructed from these lemmas with ${\mathrm{disc}}(R)$ the minimal discriminant in which $p$ is inert in the sequence $-3$, $-4$, $-7$, $-8$, or $-q$ for $q \equiv 3 \bmod 4$ prime.
Reduced norms and ideal morphisms {#sec:ideals:properties}
---------------------------------
Now suppose that ${\mathcal{O}}$ is any maximal order. We recall that the reduced norm on ${B_{p,\infty}}$ induces a reduced norm on left ideals defined by any of the equivalent conditions $${\mathrm{Nrd}}(I) := \sqrt{|{\mathcal{O}}/I|}
= \gcd\left(\{\, {\mathrm{Nrd}}(\alpha) \;:\; \alpha \in I \,\}\right),$$ or by $I\bar{I} = {\mathrm{Nrd}}(I){\mathcal{O}}$. It follows that the reduced norm on ideals is multiplicative and compatible with the reduced norm on elements ${\mathrm{Nrd}}(\alpha) =
{\mathrm{Nrd}}(\alpha{\mathcal{O}}) = {\mathrm{Nrd}}({\mathcal{O}}\alpha)$. If $I$ and $J$ are left ${\mathcal{O}}$-ideals, a homomorphism of $I$ to $J$ is a map given by $\alpha \mapsto \alpha\gamma$ for $\gamma$ in ${B_{p,\infty}}^*$, which is an isomorphism if $J = I\gamma$. By the multiplicativity of the reduced norm, isomorphisms are similitudes of quadratic modules (with respect to the reduced norm). In particular, an isomorphism sends a reduced basis to a reduced basis. In fact the normalized norm map $$q_I = \frac{{\mathrm{Nrd}}}{{\mathrm{Nrd}}(I)} : I \longrightarrow {\mathbb{Z}}$$ remains invariant under this isomorphism, in the sense that $q_I(\alpha)
= q_J(\beta)$ for $\alpha$ in $I$ and $\beta = \alpha\gamma$ in $J$. The normalized norm $q_I$ is a positive-definite integral quadratic map, whose bilinear module given by $
\langle{x,y}\rangle = q_I(x+y) - q_I(x) - q_I(y)
$ has determinant $p^2$. This follows from the same property for any maximal order (see Pizer [@Pizer1980 Proposition 1.1]), since $|{\mathcal{O}}/I| = {\mathrm{Nrd}}(I)^2$, and the fact that any submodule of index $m$ in a quadratic module $L$ has determinant $m^2\det(L)$.
The following lemma serves to replace an ideal $I$ with an isomorphic one of different reduced norm.
\[lem:ideal\_norm\_rep\] Let $I$ be a left ${\mathcal{O}}$-ideal of reduced norm $N$ and $\alpha$ an element of $I$. Then $I\gamma$, where $\gamma = \bar{\alpha}/N$, is a left ${\mathcal{O}}$-ideal of norm $q_I(\alpha)$.
By the multiplicativity of the reduced norm, and ${\mathrm{Nrd}}(\alpha) = {\mathrm{Nrd}}(\bar{\alpha})$, we have $${\mathrm{Nrd}}(I\gamma) = {\mathrm{Nrd}}(I){\mathrm{Nrd}}(\gamma)
= N\frac{{\mathrm{Nrd}}(\alpha)}{N^2} = \frac{{\mathrm{Nrd}}(\alpha)}{N} = q_I(\alpha).$$ Clearly $I$ is a fractional left ${\mathcal{O}}$-ideal, so it remains to show that $I\gamma \subseteq {\mathcal{O}}$. Since ${\mathcal{O}}\alpha \subseteq I$, we have $\bar{\alpha} \subseteq \bar{I}$, and hence $I\bar{\alpha} \subseteq I\bar{I} = N{\mathcal{O}}$, from which $I\gamma \subseteq {\mathcal{O}}$ follows.
Preliminary algorithmic results\[sec:prel\]
===========================================
In this section, we provide two algorithmic tools that will be used to solve the quaternion $\ell$-isogeny path problem in Section \[sec:ideals:ellpow\]. The first algorithm computes prime norm representatives in ideal classes. The second one computes representations of integers by the norm form of a $p$-extremal order.
Computing prime norm representatives in ideal classes {#sec:ideals:prime}
-----------------------------------------------------
Given a maximal order ${\mathcal{O}}$ and a left ${\mathcal{O}}$-ideal $I$, we give a probabilistic algorithm that computes another left ${\mathcal{O}}$-ideal $J = I\gamma$ in the same class, but with prime norm. Using Lemma \[lem:ideal\_norm\_rep\], this problem reduces to the problem of finding a prime represented by $q_I$.
[**Prime norm algorithm.**]{} Given a left ${\mathcal{O}}$-ideal $I$ of norm $N$, with a Minkowski-reduced basis $\{\alpha_1,\alpha_2,\alpha_3,\alpha_4\}$. Generate random elements $\alpha = \sum_i x_i \alpha_i$ with $(x_1,x_2,x_3,x_4)$ in a box $[-m,m]^4$ until finding an element $\alpha$ of $I$ with $q_I(\alpha)$ prime, and return $I(\bar{\alpha}/N)$.
Assuming that numbers represented by $q_I$ behave like random numbers, it remains to ensure that $q_I([-m,m]^4)$ contains sufficiently many primes to have a high probability of finding one. If $\{\alpha_1,\alpha_2,\alpha_3,\alpha_4\}$ is a Minkowski-reduced basis, the $q_I(\alpha_i)$ attain the successive minima, and we have the bounds $$p^2 \le 16 q_I(\alpha_1) q_I(\alpha_2) q_I(\alpha_3) q_I(\alpha_4) \le 4 p^2,$$ where $q_I(\alpha_i) \le q_I(\alpha_{i+1})$. For a generic ideal $I$ we expect $q_I(\alpha_4)$ to be in $\tilde{{O}}(\sqrt{p})$. In the worst case, $q_I(\alpha_4)$ is in $\tilde{{O}}(p)$ when $I$ equals an order ${\mathcal{O}}$ containing a subring $R$ with $|{\mathrm{disc}}(R)|$ in $O(\log(p)^n)$. Assuming $I$ is generic, we expect to find $\alpha$ with $q_I(\alpha)$ in $\tilde{{O}}(m^2 \sqrt{p})$. In practice, we find sufficiently many primes $q_I(\alpha)$ for $m$ which grows polynomially in $\log(p)$. However to provably terminate, even under the GRH, it may be necessary to allow $m$ to exceed a function in $O(\sqrt[4]{p})$, in which case the output may exceed $O(p)$.
We implemented a prime norm algorithm in Magma [@Magma]. We tested it on ideals of $\ell$-power norms generated via a random walk from a given maximal order. All our computations with primes of up to 200 bits and random ideals took seconds on an Intel Xeon CPU X5500 processor with 24 GB RAM running at 2.67GHz. The norms of the output ideals $J$ were experimentally only slightly larger than $\sqrt{p}$. The experimental results are given in Appendix \[sec:primeres\].
Representing integers by special orders {#sec:repns_in_orders}
---------------------------------------
We also consider the problem of representing a sufficiently large positive integer $M$ by the norm form of ${\mathcal{O}}$. Suppose that ${\mathcal{O}}$ is a $p$-extremal order, with suborder $R + Rj$, and let $D = {\mathrm{disc}}(R)$. We let $\Phi(x)$ be a monotone function such that a suitable interval $[x,x+\Phi(x)]$ contains sufficiently many primes, and we assume that $M \ge p\,\Phi(M)$. If $\omega$ is a reduced generator of $R$ (of trace $0$ or $\pm 1$), then the norm form on $R + Rj$ is of the form $${\mathrm{Nrd}}(\alpha + \beta j) = f(x_1,y_1) + p f(x_2,y_2),$$ where $\alpha = x_1 + y_1 \omega$ and $\beta = x_2 + y_2 \omega$, and $f(x,y)$ is a principal form. For $(x,y)$ in $[-m,m]^2$ with $m = \lfloor\sqrt{\Phi(M)/|D|}\rfloor$, we have $f(x,y) < \Phi(M)$ and ${\mathrm{Nrd}}(\beta j) < p\,\Phi(M) < M$. This gives the following algorithm on which we build our strong approximation algorithm.
[**Integer representation.**]{} Given an integer $M \ge p\,\Phi(M)$. Set $m = \lfloor\sqrt{\Phi(M)/|D|}\rfloor$, and choose $(x_2,y_2)$ at random in $[-m,m]^2$ until finding a prime $r = M - p f(x_2,y_2)$ which is split in $R$ and for which a prime $\mathfrak{r}$ over $r$ is principal. Let $\alpha = x_1 + y_1 \omega$ be a generator for $\mathfrak{r}$, set $\beta = x_2 + y_2 \omega$, and return $\alpha + \beta j$.
Clearly the output has norm $M$. We assume that primes have density $1/\log(M)$ in the arithmetic progression $M - p\,[0,\Phi(M)]$. Moreover we assume that such primes are equidistributed among primes which are non-split and split in $R$ and, in the latter case, among each of the $h(R)$ ideal classes of $R$. Finally, we must assume that elements $\beta = x_2 + y_2 \omega$ give rise to integers $r = M - p\,{\mathrm{Nrd}}(\beta)$ with the same primality probabilities as random integers in the range $M - p\,[0,\Phi(M)]$. Under such heuristic assumptions, the expected number of random $\beta$ to be tested is $2 h(R) \log(M)$. Detecting a prime $r$, solving for a representative prime $\mathfrak{r}$ over $r$, and determination of a principal generator can be done in expected polynomial time by Cornaccia’s algorithm [@Cornacchia1903].
Under the heuristic assumptions made above, we can appeal to average distributions among all arithmetic progressions $a - p\,[0,\Phi(M)]$, for representatives $a$ of $({\mathbb{Z}}/p{\mathbb{Z}})^*$. In the application that follows, $M$ will be of the form $\ell^e$ or $N\ell^e$, and we can adapt to failure to find primes in a particular arithmetic progression sparsely populated with primes by changing $e$.
Main algorithm {#sec:ideals:ellpow}
==============
In this section, we provide an algorithm to solve the quaternion $\ell$-isogeny path problem. We also sketch a generalization of our approach to build ideal class representatives with powersmooth norms.
Overview of the algorithm {#sec:algorithm_overview}
-------------------------
We reduce the quaternion $\ell$-isogeny problem to a restricted version of the same problem, where we assume that ${\mathcal{O}}$ is a special $p$-extremal maximal order with suborder $R + Rj$ as defined in Section \[sec:intro:QA\]. We also assume that $I$ is a left ${\mathcal{O}}$-ideal with reduced norm $N$, where $N$ is a (large) prime coprime to $\ell$, $|{\mathrm{disc}}(R)|$ and $p$. A reduction from generic left ${\mathcal{O}}$-ideals to left ${\mathcal{O}}$-ideals with the required norms can be effectively performed with the algorithm of Section \[sec:ideals:prime\]. A reduction from general maximal orders to special $p$-extremal orders will be provided in Section \[sec:ideals:gen\].
Using Lemma \[lem:ideal\_norm\_rep\], the quaternion $\ell$-isogeny path problem is also reduced to an effective strong approximation theorem in Section \[sec:ideals:strongapproximation\]. In particular if the ideal is given by a pair of generators $I = {\mathcal{O}}(N,\alpha)$, the quaternion $\ell$-isogeny path problem is reduced to finding $\lambda \in {\mathbb{Z}}$ coprime to $N$ and $$\beta \equiv \lambda\alpha \bmod N{\mathcal{O}}$$ with ${\mathrm{Nrd}}(\beta) = N\ell^e$ for some positive integer $e$.
Sections \[sec:ideals:ellpow:isom\], \[sec:ideals:ellpow:lift\], and \[sec:ideals:ellpow:results\] describe the core of our approach to solve this problem. Since the index of $R + Rj$ in ${\mathcal{O}}$ is coprime to $N$, we have an isomorphism $$\frac{R + Rj}{N(R + Rj)} \cong \frac{{\mathcal{O}}}{N{\mathcal{O}}}\cdot$$ We can therefore choose representative elements in $R + Rj$ as convenient to simplify the algorithm. Since the index $[{\mathcal{O}}:R + Rj] = |{\mathrm{disc}}(R)|$ is assumed to be small (in $O(\log(p)^2)$ under the GRH), the size of the output might be slightly larger, but the distinction is asymptotically insignificant. A direct approach to the strong approximation problem to solve for $\beta$ seems daunting, so instead we reduce to the following steps:
1. Solve for a random $\gamma \in {\mathcal{O}}$ of reduced norm $N\ell^{e_0}$.
2. Solve for $[\mu]$ in $({\mathcal{O}}/N{\mathcal{O}})^*$ such that $({\mathcal{O}}\gamma/N{\mathcal{O}})[\mu] = I/N{\mathcal{O}}$.
3. Solve for the strong approximation of $[\mu]$ (modulo $N$) by $\mu$ in ${\mathcal{O}}$ of reduced norm $\ell^{e_1}$.
Here we denote the element $\mu + N{\mathcal{O}}$ of ${\mathcal{O}}/N{\mathcal{O}}$ by $[\mu]$ to distinguish it from the conjugate $\bar{\mu}$ of $\mu $. The output $\beta = \gamma\mu$ is then an element of $I$ with reduced norm $N\ell^e$ where $e = e_0+e_1$. The element $\gamma$ can be constructed with the algorithm of Section \[sec:repns\_in\_orders\]. We solve for $[\mu]$ by linear algebra in Section \[sec:ideals:ellpow:isom\], showing that we can take $[\mu]$ in $(R/NR)^*[j] \subseteq ({\mathcal{O}}/N{\mathcal{O}})^*$. The core of the algorithm is the final specialized strong approximation algorithm of Section \[sec:ideals:ellpow:lift\], taking $[\mu]$ in $(R/NR)^*[j]$ and constructing the lifting $\mu$ of norm $\ell^e$. The whole algorithm for $p$-extremal orders is analyzed in Section \[sec:ideals:ellpow:results\].
As mentioned above, we finally remove the $p$-extremal condition in Section \[sec:ideals:gen\] by providing a reduction from the general case to the case of $p$-extremal orders, and we generalize our approach to compute ideal representatives of smooth or powersmooth norms in Section \[sec:ideals:psmooth\].
Effective strong approximation\[sec:ideals:strongapproximation\]
----------------------------------------------------------------
Let $B := B_{p,\infty}$ be the quaternion algebra ramified at $p$ and $\infty$. Let ${\mathbb{A}}_{\mathbb{Q}}$ be the rational adèle ring, defined as the restricted product of ${\mathbb{Q}}_v$ with respect to ${\mathbb{Z}}_v$, let $\ell \ne p$ be a “small” prime, and let ${\mathbb{A}}_{{\mathbb{Q}},\ell}$ be the restricted product over all $v \ne \ell$. Let ${\mathbb{A}}_B = B \otimes_{\mathbb{Q}}{\mathbb{A}}_{\mathbb{Q}}$ be the adèle ring of $B$, and ${\mathbb{A}}_{B,\ell} = B \otimes {\mathbb{A}}_{{\mathbb{Q}},\ell}$. Then $B$ embeds diagonally in ${\mathbb{A}}_B$ and is discrete in ${\mathbb{A}}_B$ (see [@Cassels1967 Section 14]). The strong approximation theorem (see [@Cassels1967 Section 15]) asserts that $B$ is dense in ${\mathbb{A}}_{B,\ell}$ (see also Théorème Fondamental 1.4, p. 61 of Vignéras [@Vigneras1980]).
The strong approximation theorem can be viewed as a strong version of the Chinese remainder theorem. We apply this to find an element of a left ${\mathcal{O}}$-ideal $I$ which generates $I$ almost everywhere. Each such ideal is known to be generated by two elements $N$ and $\alpha$, where we may take $N = {\mathrm{Nrd}}(I)$ for the first generator. This follows since locally ${\mathcal{O}}_v = {\mathcal{O}}\otimes {\mathbb{Z}}_v$ is a left principal ideal ring, hence so is the quotient ${\mathcal{O}}/N{\mathcal{O}}$. If $I = {\mathcal{O}}(N,\alpha):={\mathcal{O}}N+{\mathcal{O}}\alpha$, the approximation theorem implies that we can find $\beta$ in $I$ such that $$\beta \equiv \alpha \bmod N{\mathcal{O}}$$ and ${\mathrm{Nrd}}(\beta) = N\ell^e$ for some positive integer $e$, from which $I = {\mathcal{O}}(N,\alpha) = {\mathcal{O}}(N,\beta)$. By Lemma \[lem:ideal\_norm\_rep\], an effective version of this strong approximation theorem is sufficient to solve the quaternion $\ell$-isogeny path problem. In particular, since $\beta$ is in $I$, the ideal $I\bar\beta/N$ is an isomorphic ideal of norm $\ell^e$.
Similarly, solving for $$\beta \equiv \lambda\alpha \bmod N{\mathcal{O}}$$ with $\lambda \in {\mathbb{Z}}$ coprime to $N$ such that we still have $I = {\mathcal{O}}(N,\beta)$, is also sufficient to solve the quaternion $\ell$-isogeny path problem. We will focus on this relaxed effective strong approximation theorem in the next subsections.
Isomorphism of ${\mathcal{O}}/N{\mathcal{O}}$-ideals {#sec:ideals:ellpow:isom}
----------------------------------------------------
In this section, let $I$ be a left ${\mathcal{O}}$-ideal of prime norm $N \ne p$, and let $\gamma$ be an arbitrary element of ${\mathcal{O}}$ of norm $NM$, where $\gcd(N,M) = 1$. Since $N$ is large, we can assume that it does not divide the index $[{\mathcal{O}}:R+Rj]$, hence we have equalities of rings $${\mathcal{O}}/N{\mathcal{O}}= (R+Rj)/N(R + Rj) \cong {\mathbb{M}}_2({\mathbb{Z}}/N{\mathbb{Z}}).$$ We denote by $[\alpha]$ the class of an element $\alpha$ in ${\mathcal{O}}/N{\mathcal{O}}$ (as distinct from its conjugate $\bar{\alpha}$).
We note that ${\mathcal{O}}\gamma/N{\mathcal{O}}$ and $I/N{\mathcal{O}}$ are proper nonzero left ${\mathcal{O}}/N{\mathcal{O}}$-ideals. The following explicit classification of such ideals, in ${\mathbb{M}}_2({\mathbb{Z}}/N{\mathbb{Z}})$, will let us construct an explicit isomorphism between these ideals.
Let $N$ be a prime and $A = {\mathbb{M}}_2({\mathbb{Z}}/N{\mathbb{Z}})$. There exists a bijection $$S : {\mathbb{P}}^1({\mathbb{Z}}/N{\mathbb{Z}}) \times {\mathbb{P}}^1({\mathbb{Z}}/N{\mathbb{Z}}) \longrightarrow
\frac{\{\, \gamma \in A\backslash\{0\} \;:\; \det(\gamma) = 0 \,\}}{({\mathbb{Z}}/N{\mathbb{Z}})^*}{\raisebox{0.4ex}{,}}$$ given by $$S\big((u:v),(x:y)\big) =
\left(\begin{array}{@{}cc@{}} ux & uy \\ vx & vy \end{array}\right)\cdot$$ Under this correspondence, the set of proper nontrivial left $A$-ideals is in bijection with the set $$\{\, {\mathbb{P}}^1({\mathbb{Z}}/N{\mathbb{Z}}) \times (x:y) : (x:y) \in {\mathbb{P}}^1({\mathbb{Z}}/N{\mathbb{Z}}) \,\},$$ and the right action of $A^*/({\mathbb{Z}}/N{\mathbb{Z}})^* = {\mathrm{PGL}}_2({\mathbb{Z}}/N{\mathbb{Z}})$ on left $A$-ideals is transitive and induced by the natural (transpose) action on ${\mathbb{P}}^1({\mathbb{Z}}/N{\mathbb{Z}})$.
The nonzero matrices of determinant zero, modulo $({\mathbb{Z}}/N{\mathbb{Z}})^*$, determine a hypersurface $ad = bc$, which is the image of ${\mathbb{P}}^1 \times {\mathbb{P}}^1$ by the Segre embedding in ${\mathbb{P}}^3$ (= $(A\backslash\{0\})/({\mathbb{Z}}/N{\mathbb{Z}})^*$). It is easily verified that left and right multiplication induce the standard and transpose multiplication on the first and second factors of ${\mathbb{P}}^1 \times {\mathbb{P}}^1$, respectively, under this isomorphism, from which the result follows.
Using an explicit isomorphism ${\mathcal{O}}/N{\mathcal{O}}\cong {\mathbb{M}}_2({\mathbb{Z}}/N{\mathbb{Z}})$, by this lemma we can find $[\mu]$ in $({\mathcal{O}}/N{\mathcal{O}})^*$ such that $
({\mathcal{O}}\gamma/N{\mathcal{O}}) [\mu] = I/N{\mathcal{O}},
$ using linear algebra over ${\mathbb{Z}}/N{\mathbb{Z}}$.
In Section \[sec:ideals:ellpow:lift\] we require an input $[\mu]$ which is a unit in $Rj/N{\mathcal{O}}$. Observing that $[j]$ is a unit, we see that such units form a coset of $(R/NR)^*$: $$({\mathcal{O}}/N{\mathcal{O}})^* \cap Rj/N{\mathcal{O}}= (R/NR)^*[j].$$ We note that $(R/NR)^*$ acts on the $N+1$ proper nontrivial left ${\mathcal{O}}$-ideals, with kernel $({\mathbb{Z}}/N{\mathbb{Z}})^*$. By hypothesis, $R$ is a subring of small discriminant in which $N$ is not ramified. If $N$ is inert in $R$, then the $N+1$ ideals form one orbit. Otherwise, if $N$ is split, there is one orbit of size $N-1$ and two fixed points ${\mathcal{O}}{\mathfrak{p}}_1/N{\mathcal{O}}$ and ${\mathcal{O}}{\mathfrak{p}}_2/N{\mathcal{O}}$, where ${\mathfrak{p}}_1$ and ${\mathfrak{p}}_2$ are the prime ideals of $R$ over $N$. With overwhelming probability, $I/N{\mathcal{O}}$ and ${\mathcal{O}}\gamma/N{\mathcal{O}}$ will not be such fixed points, and so we can solve for $[\mu]$ in $(R/NR)^*[j]$. In the event of failure, we can select a new $\gamma$ or $N$.
Approximating elements of $(R/NR)^*[j]$ by $\ell$-power norm representatives {#sec:ideals:ellpow:lift}
----------------------------------------------------------------------------
In this section, we assume that $\ell$ is a quadratic non-residue modulo $N$. Let also $\omega$ be a generator of $R$ of minimal norm, either $1$, $2$, or $(1+q)/4$, for $q$ a prime congruent to $3$ modulo $4$. We now motivate the restriction to elements of $(R/NR)^*[j]$ in the previous section.
We suppose that we are given as input a lift $\mu_0 = x_0 + y_0 \omega + (z_0 + w_0 \omega) j$ of an arbitrary element of ${\mathcal{O}}/N{\mathcal{O}}$ to $R + Rj$. The relaxed approximation problem is to search for $\lambda$ in ${\mathbb{Z}}$ and $\mu_1 = x_1 + y_1 \omega + (z_1 + w_1 \omega) j$ such that $\mu = \lambda\mu_0 + N\mu_1$ satisfies the norm equation $${\mathrm{Nrd}}(\mu) =
f(\lambda x_0 + N x_1, \lambda y_0 + N y_1) +
p\, f(\lambda z_0 + N z_1, \lambda w_0 + N w_1) = \ell^e,$$ for some $e\in\mathbb{N}$, where $f(x,y) = {\mathrm{Nrd}}(x + y\omega)$ is a principal binary quadratic form of discriminant $D$ as in Lemma \[lem:special-p-extremal-properties\]. The key idea to solve this norm equation, as used in [@Petit2008c] to cryptanalyze the other hash function of Charles-Goren-Lauter, is that it simplifies considerably when $x_0 = y_0 = 0$: $$\label{eq:simplified-normequation}
{\mathrm{Nrd}}(\mu) = N^2 f(x_1, y_1) + p\, f(\lambda z_0 + N z_1, \lambda w_0 + N w_1) = \ell^e.$$ The simple algorithm we now describe to solve this equation justifies the choice of $[\mu] \in (R/NR)^*[j]$ in Section \[sec:ideals:ellpow:isom\].
To construct $\mu$, given $[\mu] \in (R/NR)^*[j]$, we consider a first lift $\mu_0 = (z_0 + w_0 \omega) j$ to $Rj$ as above, and find $\lambda$ in ${\mathbb{Z}}$ and $\mu_1 = (x_1 + y_1 \omega) + (z_1 + w_1 \omega) j$ in $R + Rj$ satisfying the simplified equation . This equation modulo $N$, gives $
\lambda^2 p\,f(z_0,w_0) = \ell^e \bmod N,
$ and since $\ell$ is a quadratic nonresidue modulo $N$, we choose the parity of $e$ depending on whether $p\,f(z_0,w_0)$ is a quadratic residue modulo $N$ or not, and solve for a square root modulo $N$ to find $\lambda$, in $0 < \lambda < N$.
Now for fixed $z_0$, $w_0$, and $\lambda$, Equation implies a linear equation in $z_1$ and $w_1$: $$\label{eq:linear-normequation}
2\lambda p L((z_0,w_0),(z_1,w_1)) = \frac{\ell^e-\lambda^2 p f(z_0,w_0)}{N}\bmod N,$$ where $L$ is the bilinear polynomial $$L((z_0,w_0),(z_1,w_1)) = \langle{z_0 + w_0\omega,z_1 + w_1\omega}\rangle
= 2 z_0z_1 + {\mathrm{Trd}}(\omega)(z_0w_1 + w_0z_1) + 2{\mathrm{Nrd}}(\omega)w_0w_1.$$ Since $N$ is a large prime, such that $\gcd(x_0w_0|D|p,N)=1$, there are exactly $N$ solutions $(z_1,w_1)$ to the linear equation . We choose a random solution satisfying $$|\lambda z_0 + N z_1| < N^2 \text{ and }
|\lambda w_0 + N w_1| < N^2,$$ and equation now leads to a problem of representation of an integer by a binary quadratic form: $$\label{eq:cornaccia-normequation}
f(x_1,y_1) = r := \frac{\ell^e- p f(\lambda z_0 + N z_1, \lambda w_0 + N w_1)}{N^2}\cdot$$ We assume that $e$ was chosen sufficiently large so that $r$ is positive. If $r$ (or $rq$), modulo a smooth square integer factor, is prime, splits and is a norm in $R$, Cornaccia’s algorithm [@Cornacchia1903] can efficiently solve this equation, or determine that no solution exists. In the latter case, we repeat with a new value of $(z_1,w_1)$. Assuming the values of $r$ behave as random values around $N^4|D|p$, we expect to choose $\log(N^4|D|p)h(D)$ values before finding a solution.
In practice, we begin with $e$ the minimal possible value having the correct parity, then we progressively increase it if no solution has been found. For $N$ in the range $\tilde{O}(\sqrt{p})$, we expect the size of $e$ to satisfy $e \sim \log_\ell(N^4|D|p) \sim 3\log_\ell(p)$.
Algorithm analysis and experimental results {#sec:ideals:ellpow:results}
-------------------------------------------
We summarize our algorithm to compute an $\ell$-power norm representative of a left ${\mathcal{O}}$-ideal, where ${\mathcal{O}}$ is a special $p$-extremal maximal order.
Let ${\mathcal{O}}$ be a maximal order in a quaternion algebra $B_{p,\infty}$ and let $\ell$ be a small prime. There exists a probabilistic algorithm, which takes as input a left ${\mathcal{O}}$-ideal and outputs an isomorphic left ${\mathcal{O}}$-ideal of $\ell$-power reduced norm.
Under the most optimistic heuristic assumptions on randomness of representations of integers by quadratic forms and uniform distributions of primes, this algorithm is expected to run in polynomial time and to produce ideals of norm $\ell^{e}$, where $$e \sim \log_\ell(N p\,\Phi(p) |D|) + \log_\ell(N^4 |D| p) - \log_\ell N^2,$$ where the three terms respectively account for the norms of $\gamma$, $\mu$ and $N^{-1}$. Assuming that $\log_\ell(N) \sim \frac{1}{2}\log_\ell(p)$ and that in practice $\Phi(p)\sim\log(p)^n$ suffices, this leads to $$e \sim \frac{7}{2}\log_\ell(p).$$
We implemented the algorithms of this article in Magma [@Magma]. We first tested the algorithm of Section \[sec:repns\_in\_orders\] to compute $N$ times $\ell$-power norm elements in ${\mathcal{O}}$ with $\ell\in\{2,3\}$, for random primes $p$ of sizes up to 200 bits and for $N$ values obtained after applying the algorithm of Section \[sec:ideals:prime\] on an ideal generated via a random walk from ${\mathcal{O}}$. The norm of the outputs were close to the expected values.
We then tested the algorithm of Section \[sec:ideals:ellpow:lift\] for $\ell\in\{2,3\}$, for random $p$ values of sizes up to 200 bits, for $N$ values obtained after applying the algorithm of Section \[sec:ideals:prime\] on an ideal generated via a random walk from ${\mathcal{O}}$, and for $\mu_0 = (z_0+w_0\omega)j$ with randomly chosen $z_0,w_0\in{\mathbb{Z}}/N{\mathbb{Z}}$ not both equal to zero. The exponents of the norms of the quaternions computed were close to the expected value $3\log_\ell p$.
We finally tested the overall algorithm of Section \[sec:ideals:ellpow\] for $\ell\in\{2,3\}$, for random $p$ values of sizes up to 200 bits, and for ideals $I$ generated via a random walk from ${\mathcal{O}}$. The $\ell$-valuation of the norm of the ideals computed were close to the expected value $\frac{7}{2}\log_\ell p$.
All computations were carried out on an Intel Xeon CPU X5500 processor with 24 GB RAM running at 2.67GHz. The algorithm of Section \[sec:ideals:ellpow:lift\] succeeded in less than 100 seconds for all 200 bit primes, and the overall algorithm of Section \[sec:ideals:ellpow\] terminated in less than 250 seconds for primes in this range. Additional experimental results are provided in Appendix \[sec:expres\].
Generalization to arbitrary orders {#sec:ideals:gen}
----------------------------------
We now describe how to remove the condition that ${\mathcal{O}}$ is one of the special orders defined in Section \[sec:intro:QA\]. First we encode the relation between two maximal orders embedded in ${B_{p,\infty}}$ in terms of an associated ideal.
\[lem:eichler-order-ideals\] Suppose that ${\mathcal{O}}_1$ and ${\mathcal{O}}_2$ are given maximal orders in ${B_{p,\infty}}$. Then the Eichler order ${\mathcal{O}}_1 \cap {\mathcal{O}}_2$ has the same index in each of ${\mathcal{O}}_1$ and ${\mathcal{O}}_2$, which we denote $M$, and the set: $$I({\mathcal{O}}_1,{\mathcal{O}}_2) = \{ \alpha \in {B_{p,\infty}}\;|\; \alpha {\mathcal{O}}_2 \bar{\alpha} \subseteq M{\mathcal{O}}_1 \}$$ is a left ${\mathcal{O}}_1$-ideal and right ${\mathcal{O}}_2$-ideal of reduced norm $M$. Conversely, if $I$ is a left ${\mathcal{O}}_1$-ideal with right order ${\mathcal{O}}_2$, such that $I \not\subseteq n{\mathcal{O}}_1$ for any $n > 1$, then $I = I({\mathcal{O}}_1,{\mathcal{O}}_2)$.
The determinant of the norm form of any maximal order ${\mathcal{O}}$ is $p^2$, and for any sub-lattice $L \subset {\mathcal{O}}$ of index $M$, the reduced norm form on $L$ has determinant $M^2\det({\mathcal{O}})$. This establishes the well-known result that the index of an Eichler order in any maximal order is an invariant, called its level.
It is clear by construction that $I({\mathcal{O}}_1,{\mathcal{O}}_2)$ is a left ${\mathcal{O}}_1$-module and a right ${\mathcal{O}}_2$-module. Locally at any prime $q$, we may assume ${\mathcal{O}}_1$ and ${\mathcal{O}}_2$ are ${\mathbb{Z}}_q$-orders such that ${\mathcal{O}}_2 = \alpha^{-1} {\mathcal{O}}_1 \alpha$, for some $\alpha$ in ${\mathcal{O}}_1$ hence also in ${\mathcal{O}}_2$. It follows that we have an inclusion $\alpha {\mathcal{O}}_2 = {\mathcal{O}}_1 \alpha
\subseteq I({\mathcal{O}}_1,{\mathcal{O}}_2)$. However, removing any integer factors (in the center), the reduced norm of a minimal $\alpha$ must equal the level $M{\mathbb{Z}}_q$, which implies equality. The global result follows from the local-global principle.
Conversely, since any left ${\mathcal{O}}_1$-ideal $I$ is locally principal at each prime $q$, one can find locally $\alpha$ such that $I = {\mathcal{O}}_1\alpha$; the right order of I is then ${\mathcal{O}}_2 = \alpha^{-1} {\mathcal{O}}_1 \alpha$. By hypothesis $\alpha$ is not divisible by any integer and we conclude that the Eichler order has level ${\mathrm{Nrd}}(\alpha) = {\mathrm{Nrd}}(I)
= M{\mathbb{Z}}_q$. From the above construction in terms of a local generator, we conclude $I = I({\mathcal{O}}_1,{\mathcal{O}}_2)$.
Let ${\mathcal{O}}_1$ and ${\mathcal{O}}_2$ be maximal orders in a quaternion algebra $B_{p,\infty}$ and let $\ell$ be a small prime. Given an algorithm which takes as input a left ${\mathcal{O}}_1$-ideal and outputs an equivalent left ${\mathcal{O}}_1$-ideal of $\ell$-power reduced norm, there exists an algorithm with the same complexity, up to a constant of size polynomial in the input size of ${\mathcal{O}}_1$ and ${\mathcal{O}}_2$, which takes as input a left ${\mathcal{O}}_2$-ideal and outputs an equivalent left ${\mathcal{O}}_2$-ideal of $\ell$-power reduced norm.
Assume we are given two orders ${\mathcal{O}}_1$, ${\mathcal{O}}_2$ and a left ${\mathcal{O}}_2$-ideal $J$, and set $I = I({\mathcal{O}}_1,{\mathcal{O}}_2)$ as in Lemma \[lem:eichler-order-ideals\]. The ideal $I$ may be of arbitrarily large norm, but is bounded by something polynomial in the specification of ${\mathcal{O}}_1$ and ${\mathcal{O}}_2$ in terms of a basis for ${B_{p,\infty}}$.
Supposing that we have an algorithm for ${\mathcal{O}}_1$, we find representative left ${\mathcal{O}}_1$-ideals for $I$ and $IJ$ such that $I_1 = I\bar{\gamma}_1/{\mathrm{Nrd}}(I)$ with $\gamma_1$ in $I$, and $I_2 = IJ\bar{\gamma}_2/{\mathrm{Nrd}}(IJ)$ with $\gamma_2$ in $IJ$, where $${\mathrm{Nrd}}(\gamma_1) = {\mathrm{Nrd}}(I) \ell^{e_1} \mbox{ and }
{\mathrm{Nrd}}(\gamma_2) = {\mathrm{Nrd}}(IJ) \ell^{e_2}.$$ It follows that $\gamma = \bar{\gamma}_1 \gamma_2/{\mathrm{Nrd}}(I)$ is an element of $J$ with reduced norm ${\mathrm{Nrd}}(\gamma) =
{\mathrm{Nrd}}(J) \ell^{e_1+e_2}$, and hence $J\bar{\gamma}/{\mathrm{Nrd}}(J)$ is of reduced norm $\ell^{e_1+e_2}$.
This provides a reduction of the general case to the case of special $p$-extremal orders, at the cost of two applications of the algorithm of Section \[sec:ideals:ellpow\], and a larger power of $\ell$.
Generalization to powersmooth norms {#sec:ideals:psmooth}
-----------------------------------
We recall that a number $s=\prod\ell_i^{e_i}$ is $S$-powersmooth if $\ell_i^{e_i}<S$. Our algorithms can be easily modified to construct ideal representatives of powersmooth norms. Using the approximations as before, the norm should be of size close to $p^{7/2}$. Since the product of all maximal powers of a prime lower than $S$ can be approximated by $S^{S/\log S}$, an adaptation of our algorithms will allow us to compute $S$-powersmooth representatives of left ideal classes of ${\mathcal{O}}$, with $S\approx\frac{7}{2}\log p$.
Conclusion and future work {#sec:concl}
==========================
In this paper, we provided a probabilistic algorithm to solve a quaternion ideal analog of the path problem in supersingular $\ell$-isogeny graphs. The algorithm runs in expected polynomial time subject to heuristics on expected distributions of primes, and it is efficient in practice.
Following Deuring [@Deuring1941], there is a one-to-one correspondence between supersingular elliptic curves modulo $p$, up to Galois conjugacy, and isomorphism classes of maximal orders in the quaternion algebra ${B_{p,\infty}}$. By identifying isogeny kernels with powersmooth ideals in the quaternion algebra graphs, we expect our techniques to lead to both partial attacks on Charles-Goren-Lauter’s isogeny based hash function (when the initial curve has extremal endomorphism ring), and to security reductions to the problem of computing the endomorphism ring of a supersingular elliptic curve. Similarly, we expect our results to lead to a constructive version of Deuring’s correspondence from maximal orders in ${B_{p,\infty}}$ to their corresponding elements in the category of supersingular elliptic curves.
#### Acknowledgements
The research leading to these results has received funding from the Fonds National de la Recherche - FNRS and from the European Research Council through the European ISEC action HOME/2010/ISEC/AG/INT-011 B-CCENTRE project.
[10]{}
N. C. Ankeny. The least quadratic non residue, [*Annals of Mathematics*]{}, 55(1):65–72, 1952.
E. Bach. Explicit bounds for primality testing and related problems, , 55(191):355–380, 1990.
J. W. S. Cassels. Global fields. In J. W. S. Cassels and A. Frohlich, editors, [*Algebraic Number Theory*]{}, chapter Global Fields, pages 42–84. Academic Press, 1967.
D. X. Charles, K. E. Lauter, and E. Z. Goren. Cryptographic hash functions from expander graphs. , 22(1):93–113, 2009.
G. Cornacchia. Su di un metodo per la risoluzione in numeri interi dell’ equazione $\sum_{h=0}^nc_hx^{n-h}y^h=p$, [*Giornale di Matematiche di Battaglini*]{}, 46:33–90, 1903.
M. Deuring. Die [T]{}ypen der [M]{}ultiplikatorenringe elliptischer [F]{}unktionenkörper. [*Abhandlungen aus dem Mathematischen Seminar der Universität Hamburg*]{}, 14:197–272, 1941.
W. Bosma, J. J. Cannon, C. Fieker, A. Steel (eds.), Handbook of Magma functions, Edition 2.20 (2013), <http://http://magma.maths.usyd.edu.au/magma/>.
D. R. Heath-Brown. The number of primes in a short interval. [*J. Reine Angew. Math.*]{}, 397:162–193, 1989.
D. Kohel. [*Endomorphism rings of elliptic curves over finite fields*]{}, PhD thesis, University of California, Berkeley, 1996.
H. Maier. Primes in short intervals, [*Michigan Math. J.*]{}, 32:221–225, 1985.
C. Petit, K. Lauter, and J.-J. Quisquater. Full cryptanalysis of [LPS]{} and [Morgenstern]{} hash functions. In R. Ostrovsky, R. De Prisco, and I. Visconti, eds., [*SCN*]{}, volume 5229 of [*Lecture Notes in Computer Science*]{}, pages 263–277. Springer, 2008.
A. Pizer. An algorithm for computing modular forms on [$\Gamma_0(N)^*$]{}. [*Journal of Algebra*]{}, 64:340–390, 1980.
A. Selberg. On the normal density of primes in small intervals and the difference between consecutive primes, [*Arch. Math. Naturvid.*]{}, 47:87–105, 1943.
M.-F. Vignéras. [*Arithmétique des algèbres de quaternions*]{}. Springer-Verlag, 1980.
Experimental results {#sec:expres}
====================
In our experiments, the value of $m$ and the function $\Phi$ appearing in the specification of our algorithms were fixed to a priori minimal values based on probabilistic arguments on the distribution of primes, then increased when needed.
Prime norm ideals {#sec:primeres}
-----------------
We show experimental results on the prime norm algorithm of Section \[sec:ideals:prime\] in Figure \[fig:primeres\]. The norms of the ideals constructed seem to be slightly larger than $p^{1/2}$ and the computation time cubic in $\log(p)$.
Quaternion elements with particular norms {#sec:resNorm}
-----------------------------------------
Experimental results on the algorithm of Section \[sec:repns\_in\_orders\] are shown in Figures \[fig:Nellpowel\] and \[fig:ellpowel\], respectively for computing elements of norms $\ell^e$ or $N\ell^e$, for some $e$. The results show the difference between the minimal exponent $e$ needed and a prediction based on probabilitic arguments. All computations took less than one second.
Ideals with $\ell$-power norms
------------------------------
Experimental results on the algorithms of Section \[sec:ideals:ellpow\] are shown in Figures \[fig:liftSize\], \[fig:liftTime\], \[fig:ellpowSize\], \[fig:ellpowTime\].
[^1]: The third author is supported by an F.R.S.-FNRS postdoctoral research fellowship at Université catholique de Louvain, Louvain-la-Neuve.
|
{
"pile_set_name": "ArXiv"
}
|
Introduction {#Sec1}
============
For many years, new drugs of an interesting structure, unknown molecular target, low toxicity and a high therapeutic index have been looked for. This is due to the impossibility of treating many serious diseases, such as bacterial infections or cancer. For a few years, the attention of researchers has been focused on thiosemicarbazide derivatives, which were investigated as a pharmacophore for antimicrobial and anticancer activity (Salgın-Gökşen *et al.*, [@CR27]). In vitro screening of some thiosemicarbazides demonstrated activities against *Escherichia coli*, *Klebsiella pneumoniae* (recultured), methicillin-resistant *Staphylococcus aureus*, methicillin-sensitive *Staphylococcus aureus* and *Mycobacterium tuberculosis* (Sheikly *et al.*, [@CR28]; Umadevi *et al.*, [@CR31]; Patel *et al.*, [@CR22]; Tan *et al.*, [@CR30]). Many of the compounds showed a good antibacterial activity against *K.pneumoniae* (Alagarsamy *et al.*, [@CR1]) and *S. aureus* in comparison with the standard drug---ciprofloxacin (Rane *et al.*, [@CR26]). Additionally, thiosemicarbazides are one of the most promising biologically active compounds which can be used in cancer treatment (Arora *et al.*, [@CR2]; Mohsen *et al.*, [@CR18]). These derivatives have been effectively used against a number of carcinoma cell lines (Perković *et al.*, [@CR24]; Bhata *et al.*, [@CR5]; Malki *et al.*, [@CR15]; Zhang *et al.*, [@CR34]). It has been found that thiosemicarbazide derivatives demonstrated cytotoxic and antiproliferative activity against HeLa, HepG2, MDA-MB-231 and HT-29 cell lines (Mavrova *et al.*, [@CR16]).
In this study, we synthesized new thiosemicarbazide derivatives and investigated their antibacterial, cytotoxic and antiproliferative properties. We expected the presence of the pyridine ring to significantly affect the biological activity of the tested derivatives. Additionally, because the literature lacks information about the effectiveness of thiosemicarbazide derivatives against oral bacteria, we decided to perform in vitro tests against *Streptococcus mutans* and *Streptococcus sanguinis*. It is extremely important because bacterial infections co-occurring with dental caries may be the cause of chronic diseases such as endocarditis, myocardial infarction (Cognasse *et al.*, [@CR8]; Kerrigan *et al.*, [@CR14]) and cancer, for example, pancreatic and gastrointestinal cancer (Meurman, [@CR17]). It is worth highlighting that cancer patients undergoing chemotherapy often suffer from oral complications.
Results and discussion {#Sec2}
======================
Chemistry {#Sec3}
---------
The 1-pyridinecarbonyl-4-substituted thiosemicarbazide derivatives (**1--10**) were prepared by the reactions of 2-, 3- or 4-pyridine carboxylic acid hydrazide with isothiocyanates. The reaction was carried out in methanol as solvent and was refluxed for 30 min. The synthesis of all compounds was accomplished using the reaction illustrated in Scheme [1](#Sch1){ref-type="fig"}.Scheme 1Synthesis 1-pyridinecarbonyl-4-substituted thiosemicarbazide derivatives. Reagents and conditions: (i) NH~2~NH~2~·H~2~O, C~2~H~5~OH, reflux; (ii) RNCS, CH~3~OH, reflux
Compounds **9** and **10** were obtained earlier (Byung *et al.*, [@CR7]; Goldfarb, [@CR11]). According to the Chemical Abstracts Service (SciFinder), some of the compounds (**1--4** and **7**) have the CAS number, but there is no method synthesis and references.
The structures of obtained compounds were confirmed by spectral analysis (^1^H, ^13^C NMR, IR and MS). For compound **2** was performed X-ray diffraction analysis.
Figure [1](#Fig1){ref-type="fig"} shows that this compound crystallizes in the triclinic *P*-1 space group. The molecule of compound **2** has an extended but not planar conformation with the dihedral angle of 47° between the mean planes of aryl rings. In this compound, molecules interact through two N--H...O hydrogen bonds (*d*~N1...O1~ = 2.860(3) Å, ∠~N1--H1...O1~ = 153(4)° and d~N2...O1~ = 2.800(4) Å, ∠~N2--H2...O1~ = 141(4)°) forming dimers. Between the chlorophenyl rings, there is a *π*...*π* interaction with a distance between the ring centroids of 3.728(4) Å. The molecules stack in columns along the *a* axis (Fig. [2](#Fig2){ref-type="fig"}).Fig. 1Molecular structure with atom numbering scheme for compound **2**Fig. 2Crystal packing in compound **2**
Antibacterial activity evaluation {#Sec4}
---------------------------------
All synthesized compounds were initially screened for their potential in vitro antibacterial activity using the agar dilution technique. It was found that seven out of ten thiosemicarbazide derivatives (**1**, **2**, **4--7**, **10**) effectively inhibited some of the tested strains (Table [1](#Tab1){ref-type="table"}).Table 1Zones of bacterial growth inhibition (mm) produced by 100 μg for the more active compounds and standardsCompoundZone of bacterial growth inhibition (mm)*S.aS.eE.cP.aS.mS.sL.aL.*spp.**1**1826221210101224**2**17252042401624**3**07000000**4**2227201435252024**5**10101100151911**6**10990111900**7**01090241057**8**00000000**9**00000000**10**161370282000Cefepime3836352932293129CLX2323151626292424Ethacridine lactate10812424241510*S.a*---*Staphylococcus aureus* ATCC 25923, *S.e*---*Staphylococcus epidermidis* ATCC 12228, *E.c*---*Escherichia coli* ATCC 25922, *P.a*---*Pseudomonas aeruginosa* ATCC 9027, *S.m*---*Streptococcus mutans* PCM 2502*, S.s*---*Streptococcus sanguinis* PCM 2335, *L.a*---*Lactobacillus acidophilus* PCM 210*, L.*spp.---*Lactobacillus* spp.
Two thiosemicarbazides (**1**, **4**) showed potential activity against all tested aerobic Gram-positive, aerobic Gram-negative and microaerobic Gram-positive bacterial strains. Additionally, zones of bacterial growth inhibition of some compounds were higher compared with CLX and ethacridine lactate. Only cefepime was characterized by large zones of inhibition (29--38 mm) in comparison with thiosemicarbazide derivatives. The detailed in vitro antibacterial activity of the potentially active compounds was later determined using the broth microdilution method on the basis of minimal inhibitory concentration (MIC). Six of the compounds (especially **1**, **2**, **4**, but also **5**, **6**, **10**) had a potential activity against aerobic Gram-positive bacteria (MIC = 15.6--500 μg/mL). The antimicrobial activity of derivatives **1**, **2** and **4** against these bacteria was greater or similar to the activity of the control ethacridine lactate. The same compounds (**1**, **2**, **4**, **5** and **6**) were also found to effectively inhibit the growth of Gram-negative *E. coli* at a concentration between 62 and 125 μg/mL. The growth of *Pseudomonas aeruginosa* was moderately inhibited only by compounds **1** and **4** (MIC = 500 μg/mL for both) (Table [2](#Tab2){ref-type="table"}).Table 2Minimum inhibitory concentration (MIC \[μg/mL\]) of the tested compounds against bacterial strainsCompound*S. aureusS. epidermidisE. coliP. aeruginosaS. mutansS. sanguinisL. acidophilus***1**31.2515.662.5500250500125**2**31.2531.2562.5100025025062.5**3**NANANANANANANA**4**31.2531.2562.550031.257.8131.25**5**250125125\>100031.2531.25500**6**25050062.5\>100025015.63\>1000**7**\>1000500\>1000\>10005001000\>1000**8**NANANANANANANA**9**NANANANANANANA**10**1252501000100025010001000Cefepime0.9760.9760.0150.4880.1220.1223.9CLX0.4880.4880.48815.60.4887.810.976Ethacridine lactate31.2531.2515.6312562.531.2531.25NA means inactive
The thiosemicarbazide derivatives (**1**, **2**, **4**, **5**) showed significant activity (MIC = 7.81--500 μg/mL) against the tested pathogenic microaerobic bacteria (causing dental caries). The strongest antibacterial properties were exhibited by compound **4**, whose MIC was 7.81 μg/mL against *S. sanguinis* and 31.25 μg/mL against *S. mutans*, *Lactobacillus acidophilus* and *Lactobacillus* spp. Substance **6** also showed significant activity against the pathogenic oral bacteria *S. sanguinis*, *S. mutans* but simultaneously did not limit the growth of the probiotic dental flora: *L. acidophilus*, *Lactobacillus* spp. These data suggest the possibility of using compounds especially **6** and **4** as well as **1** and **2** in the treatment of caries (Table [2](#Tab2){ref-type="table"}). It is worth noting that among the tested pyridine derivatives, compounds **4** and **5** showed greater or equal activity against *S. mutans* and *S. sanguinis*, and compound **6** against *S. sanguinis*, than the commonly used antiseptic ethacridine lactate. Additionally, the activity of compound **4** against *S. sanguinis* was equal to that of chlorhexidine (CLX) (MIC = 7.81 μg/mL). CLX is an antiseptic drug used in the prophylaxis and treatment of dental caries (Autio-Gold [@CR3]). However, the in vitro activity of the newly synthesized compounds against other tested bacterial strains was found to be lower compared to the controls (Cefepime, CLX and ethacridine lactate).
Cytotoxic activity evaluation {#Sec5}
-----------------------------
The synthesized compounds and the reference antibacterial agents were evaluated for the in vitro cytotoxic activity against the BJ cell line (normal human skin fibroblasts) using the MTT assay. The calculated response parameter was CC~50~, which corresponds to the concentration required for a 50 % reduction of cell viability. The in vitro cytotoxic activity of the synthesized compounds and the reference antibacterial agents is summarized in Fig. [3](#Fig3){ref-type="fig"}.Fig. 3In vitro cytotoxic activity (CC~50~) of the compounds against normal human skin fibroblasts. The data were expressed as mean values ± SD from three independent experiments. *CLX* Chlorhexidine, *EL* Ethacridine lactate
In the cytotoxic study, the novel thiosemicarbazide derivatives showed significant differences in cytotoxicity. The CC~50~ values of the synthesized compounds ranged from 19.5 to 917.4 μg/mL. Among all tested compounds, 4-(2,4-dichlorophenyl)-1-(pyridin-2-yl)carbonylthiosemicarbazide (**4**) exhibited the highest cytotoxic activity with a CC~50~ value of 19.5 μg/mL. Nevertheless, compound **4** showed lower cytotoxicity than the two reference antibacterial agents (CLX and ethacridine lactate), whose CC~50~ values were 8.46 μg/mL and 6.88 μg/mL, respectively. It is worth noting that 4-(4-methylthiophenyl)-1-(pyridin-3-yl)carbonylthiosemicarbazide (**6**) only slightly decreased the BJ cell viability with a CC~50~ value of 917.4 μg/mL. This result indicated that compound **6** showed the lowest cytotoxic activity in comparison with both the tested thiosemicarbazide derivatives and the reference antibacterial agents. Most interestingly, 4-(2,4-dichlorophenyl)-1-(pyridin-3-yl)carbonylthiosemicarbazide (**7** with a CC~50~ of 88.3 μg/mL) significantly decreased cell viability compared to compound **6**. It was not possible to calculate the CC~50~ value for cefepime as it did not reduce cell viability by 50 % at the highest tested concentration of 1500 μg/mL (data not shown). It is widely known that all drugs applicable in the treatment of bacterial infections should exhibit high antibacterial efficiency and low toxicity toward human cells. Thus, many researchers claim that the profile of in vitro cytotoxicity of antibacterial agents may be characterized by the CC~50~/MIC ratio (Kashyap *et al.*, [@CR13]; Panchal *et al.*, [@CR21]; Zoraghi *et al.*, [@CR35]). For this reason, in the present study, we attempted to evaluate the in vitro therapeutic potential of novel thiosemicarbazide derivatives and compared them to the reference antibacterial agents (Table [3](#Tab3){ref-type="table"}).Table 3In vitro therapeutic potential of the compoundsCompoundTIBacterial species*S.a*.*S.e*.*E.c.S.m*.*S.s.L.a*.*L.*spp.*P.a*.**1**6.8213.703.410.850.431.706.830.43**2**0.720.720.360.090.090.360.72ND**3**NDNDNDNDNDNDNDND**4**0.620.620.310.622.500.620.620.43**5**0.190.380.381.531.530.100.09ND**6**3.671.8314.683.6758.70NDNDND**7**ND0.180.080.180.08NDNDND**8**NDNDNDNDNDNDNDND**9**NDNDNDNDNDNDNDND**10**2.251.12ND1.120.560.28NDNDChlorhexidine (CLX)17.3317.3317.3317.331.088.6634.60.54Ethacridine lactate0.220.440.440.110.440.22NDNDTI (therapeutic index): the ratio between CC~50~ and MIC values, ND means not determined, due to lack of CC~50~ or MIC values, *S.a*---*Staphylococcus aureus* ATCC 25923, *S.e*---*Staphylococcus epidermidis* ATCC 12228, *E.c*---*Escherichia coli* ATCC 25922, *P.a*---*Pseudomonas aeruginosa* ATCC 9027, *S.m*---*Streptococcus mutans* PCM 2502*, S.s*---*Streptococcus sanguinis* PCM 2335, *L.a*---*Lactobacillus acidophilus* PCM 210*, L.*spp.---*Lactobacillus* spp.
The TI values below 1 obtained by the tested substances correspond to the lack of therapeutic safety. Among the synthesized compounds, derivatives **1**, **6** and **10** showed the highest values of therapeutic index. Compound **6** exhibited the in vitro therapeutic potential against *S. aureus*, *S. epidermidis*, *E. coli* and, which is important, against *S. mutans* and *S. sanguinis*, with the TI values of 3.67, 1.83, 14.68, 3.67 and 58.7, respectively. The essential observation is that the in vitro therapeutic indices of compound **6** were approximately 4--133 times higher than the in vitro TI values of ethacridine lactate and 58 times higher than the TI value obtained by CLX against *S. mutans*. Compound **1** also showed high in vitro TI values (6.82, 13.7, 3.41, 6.83 against *S. aureus*, *S. epidermidis*, *E. coli* and *L. species*, respectively). Additionally, the TI values of compound **10** against *S. aureus*, *S. epidermidis* and *S. mutans* were greater than those of compound **1**. Nevertheless, among all the tested agents, CLX exhibited the highest in vitro TI values. It should be noted that antibacterial agents which possess a value of therapeutic index higher than 10 can be administered to perform in vivo evaluation (Kashyap *et al.*, [@CR13]; Ghareb *et al.*, [@CR10]). Our two newly synthesized compounds (**1** and **6**) had antibacterial activity and exhibited excellent TI values higher than 10 against some bacterial strains.
Antiproliferative activity evaluation {#Sec6}
-------------------------------------
The synthesized compounds were also evaluated for in vitro antiproliferative activity against various cell lines, i.e., BJ (normal human skin fibroblasts), HepG2 (human hepatocellular carcinoma) and MCF-7 (human breast adenocarcinoma). In order to evaluate cell proliferation, the cells were treated with compounds at concentrations of 0.05, 0.1, 0.5, 1, 5, 10, 25, 50, 100 and 200 µg/mL for 96 h. Among the investigated compounds, only two (**2** and **4**) exhibited antiproliferative activity. Both compounds strongly decreased the BJ, HepG2 and MCF-7 cell proliferation in a concentration-dependent manner (Fig. [4](#Fig4){ref-type="fig"}).Fig. 4Antiproliferative activity of the synthesized compounds against normal human skin fibroblasts (**a**), human hepatocellular carcinoma (**b**) and human breast adenocarcinoma (**c**). The results were expressed as mean values ± SEM from three independent experiments. The IC~50~ values were presented as mean values ± SD.\* Statistical significance obtained at *p* \< *0.01* compared to the control
The results were expressed as mean values ±SEM from three independent experiments. The IC~50~ values were presented as mean values ±SD. Statistical significance was obtained at *p* \< 0.01 compared to the control. In the case of normal human cell line (BJ), compound **4** decreased cell proliferation more potently than compound **2**. The statistical significance for compound **4** against BJ cells was even obtained at 0.1 μg/mL (Fig. [4](#Fig4){ref-type="fig"}a).
Nevertheless, it should be noted that compound **4** suppressed the HepG2 and MCF-7 cell proliferation more effectively than compound **2**, with IC~50~ of 2.09 µg/mL (6.12 µM) and 8.63 µg/mL (25.3 µM), respectively (Fig. [4](#Fig4){ref-type="fig"}b, c).
Therefore, the IC~50~ value of compound **4** against the MCF-7 cell line was approximately two times lower than the IC~50~ value of compound **2**. On the other hand, compound **2** suppressed cell division of hepatocellular carcinoma slightly more potently than that of normal skin fibroblasts. The most pronounced effect was observed with 10 μg/mL of compound **2**, which reduced cell proliferation to 32 % (BJ) and to 18.9 % (HepG2) compared to the control (Fig. [4](#Fig4){ref-type="fig"}a, b). Thus, these data showed that compound **2** at 10 µg/mL is more effective against tumor than normal cells. According to the available literature data, our compounds exhibited a very high antiproliferative potential. The diarylthiosemicarbazide derivatives containing urea group and pyridine group at the para position, which also occur in the structure of our compounds, exhibited various antiproliferative activities against alveolar epithelial, lung and colorectal cell lines. After a 72-h incubation, the IC~50~ values of these compounds ranged from 1.8 to 82.4 μmol (Xin *et al.*, [@CR32]). Moreover, Ghareb and colleagues reported that the thiosemicarbazide and semicarbazide derivatives of benzimidazole hydrazides with hydrazine hydrate afforded N^3^-substituted-5-((2-phenyl-1H-benzo\[d\]imidazol-1-yl)methyl)-4H-1,2,4-triazole-3,4-diamines that have antiproliferative potential against the MCF-7 cell line. Two of them after a 48-h exposure inhibited cell proliferation with an IC~50~ of 13.7 and 16.2 μg/mL (Ghareb *et al.*, [@CR10]). Hence, our results indicated that the synthesized compounds **2** and **4** have a good antiproliferative potential against some tumor cells and may be promising candidates for further anticancer study.
Structure--activity analysis {#Sec7}
----------------------------
An important feature of a potential drug is its bioavailability which determines how an investigated compound can penetrate a biological membrane. Thus, the physiochemical analysis of a molecule known as Lipinski's rule of five is used (Lipinski *et al.*, [@CR100]). For this purpose, all thiosemicarbazides were analyzed in silico estimating their bioavailability via calculating such parameters as molecular weight (MW), partition coefficient (logP), the number of donors and acceptors of hydrogen bonds and the polar surface area (PSA). The obtained data showed that all compounds meet the criteria of Lipinski's rule (Lipinski *et al.*, [@CR100]). The molecular weight of the tested derivatives ranged from 290 to 385 Da (\<500 Da), and the log *p* values ranged from −1.43 to 2.52 (\<5), respectively. All the researched compounds have no more than five hydrogen bond donors (−NH and −OH) and fewer than ten hydrogen bond acceptors (N, O). This is very important information because a decreased number of donors are known to reduce the affinity of P-glycoprotein, and the more the acceptors, the more water molecules are connected. In addition, the amount of donors and acceptors of hydrogen bonds affect the magnitude of the compound's polar surface area (PSA), which is defined as the sum of surfaces of polar atoms (usually of oxygen, nitrogen and attached hydrogen atoms) in a molecule. This is a useful parameter for the prediction of molecular transport properties, particularly in intestinal absorption and blood--brain barrier penetration (Fernandes and Gattass, [@CR200]). Referring to our findings (Table [4](#Tab4){ref-type="table"}), the PSA values of the tested thiosemicarbazide derivatives ranged from 92\[Å^2^\] to 118\[Å^2^\]. Compounds **2** and **4** have demonstrated the highest antibacterial and antiproliferative activities, and their PSA values were 92.5\[Å^2^\] and 94.1\[Å^2^\], respectively.Table 4Molecular properties of the thiosemicarbazides (**1--10**)NoArRM.W. \[amu\]logPmiLogPnnPSATPSAONOHNH\[Å^2^\]**1**Pyridin-2-yl2-FC~6~H~4~290.321.461.0875393.566.044**2Pyridin-2-yl2-ClC** ~**6**~ **H** ~**4**~**306.771.891.6015392.566.0443**Pyridin-2-ylCH~2~CH~2~morph.385.48−1.43−0.21373111.078.516**4Pyridin-2-yl2,4-Cl** ~**2**~ **C** ~**6**~ **H** ~**3**~**341.222.522.2555394.166.0445**Pyridin-2-yl4-CH~3~SC~6~H~4~317.412.041.40553117.766.044**6**Pyridin-3-yl4-CH~3~SC~6~H~4~317.411.561.33953117.066.044**7**Pyridin-3-yl2,4-Cl~2~C~6~H~3~341.222.052.1895393.866.044**8**Pyridin-4-yl4-CH~3~SC~6~H~4~317.411.561.28953117.166.044**9**Pyridin-4-yl2-FC~6~H~4~290.320.980.9685393.166.044**10**Pyridin-4-yl2,4-Cl~2~C~6~H~3~341.222.042.1375393.566.044
The obtained values of topological polar surface area (TPSA) confirmed this relationship (Table [4](#Tab4){ref-type="table"}). It seems that this may be an important parameter for searching for a relation between structure and activity for this group of compounds.
Conclusions {#Sec8}
===========
In this study, we reported the synthesis and antibacterial activity of new compounds with pyridinecarbonyl group connected to the thiosemicarbazide system. It should be noted that two thiosemicarbazide derivatives, i.e., **2** and **4,** exhibited good or moderate inhibition of all the most common caries-associated Gram-positive and Gram-negative bacterial strains. Moreover, these compounds strongly suppressed human hepatocellular carcinoma and human breast adenocarcinoma cell proliferation. The structure--activity relationship of the compounds showed that substitution at the position 2 of the pyridine ring enhances biological activity. The prominent antibacterial and antiproliferative effect of compounds **2** and **4** may be due to changing the number of chlorine atoms in the phenyl ring. Thus, it is worth underlying that 4-(2-chloro/2,4-dichlorophenyl)-1-(pyridine-2yl)carbonylthiosemicarbazide derivatives will be auspicious as potential agents for caries treatment and caries-associated cancer diseases. The physicochemical analysis indicates that the polar surface area is an important parameter for biological activity of the investigated compounds. Our results will have an impact on further investigation in this field in search of thiosemicarbazide compounds as antibacterial and antiproliferative agents.
Experimental {#Sec9}
============
Chemicals and instruments {#Sec10}
-------------------------
The chemicals used for synthesis and analysis were purchased from Merck Co. or Alfa Aesar and used without further purification. Melting points were determined on a Fisher-Johns block and presented without any corrections. The ^1^H and ^13^C NMR spectra were recorded on a Bruker Avance 300 MHz spectrometer in solution noted and with TMS as an internal standard. The IR spectra were recorded on a Thermo Nicolet 6700 ATR device in the range of 500--3500 cm^−1^. The elementary analysis was performed with the application of Perkin-Elmer analyzer (940 Winter St., Waltham, MA, USA). The obtained results were within ±0.4 % of the theoretical value. Follow-up of the reactions and the purity of the newly obtained compounds were checked using TLC on aluminum oxide 60 F~254~ plates (Merck) in a CHCl~3~/C~2~H~5~OH (10:1 and 10:2) solvent system with UV visualization. The carboxylic acid hydrazides were synthesized via the reaction of the appropriate carboxylic acid ester with 98 % hydrazine hydrate in the solution of anhydrous ethanol using the method described earlier (Idhayadhulla *et al.,*[@CR12]; Priebe *et al.*, [@CR25]; Zamani, *et al.*, [@CR33]).
General procedure for the synthesis of 1-pyridinecarbonyl-4-substituted thiosemicarbazide derivatives (1--10) {#Sec11}
-------------------------------------------------------------------------------------------------------------
A mixture of 2-, 3- or 4-pyridinecarboxylic acid hydrazide (0.01 mol), isothiocyanate (0.01 mol) and methanol (15 mL) was heated in a water bath reflux temperature for 0.5 h. The product was filtered, dried and crystallized from mixture methanol--acetonitrile (1:1).
### *4*-*(2*-*Fluorophenyl)*-*1*-*(pyridin*-*2*-*yl)carbonylthiosemicarbazide* (**1**) {#FPar1}
Yield 87 %, m.p. 182--184 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 7.16--7.66 (m, 4H, CH~phenyl~), 8.01--8.69 (m, 4H, CH~pyridine~), 9.52 (s, 1H, --NH exchangeable with D~2~O), 9.88 (s, 1H, NH exchangeable with D~2~O), 10.81 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 116.01, 116.14, 122.98, 124.30, 127.41, 128.34, 130.87, 138.12, 148.95, 149.92, 164.25, 182.48. FT-IR ν: 3312, 1658, 1351 cm^−1^. MS (Cl) *m/z* = 291 \[M^+^\]. Anal.: Calcd. for C~13~H~11~N~4~OSF (290.31): C (53.78), H (3.82), N (19.29). Found: C (53.81), H (3.87), N (19.19) (CAS: 891086-61-6).
### *4*-*(2*-*Chlorophenyl)*-*1*-*(pyridin*-*2*-*yl)carbonylthiosemicarbazide* (**2**) {#FPar2}
Yield 83 %, m.p. 172--174 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 7.25--7.66 (m, 4H, CH~phenyl~), 8.02--8.71 (m, 4H, CH~pyridine~), 9.54 (s, 1H, --NH exchangeable with D~2~O); 9.88 (s, 1H, NH exchangeable with D~2~O); 10.82 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 122.99, 127.47, 128.18, 129.74, 131.00, 138.17, 149.01, 149.87, 164.27, 182.17. FT-IR ν: 3246, 1655, 1354 cm^−1^. MS (CI) *m/z*: 307 (M^+^). Anal.: Calcd. for C~13~H~11~N~4~OSCl (306.77): C (50.89), H (3.61), N (18.29). Found: C (50.91), H (3.64), N (18.33) (CAS: 894234-77-6).
### *4*-*(2*-*Morpholinoethyl)*-*1*-*(pyridin*-*2*-*yl)carbonylthiosemicarbazide* (**3**) {#FPar3}
Yield 90 %, m.p. 196--198 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 2.35--2.59 (m, 4H, 2xCH~2~ morpholine), 3.45--3.52 (4H, 2xCH~2~ morpholine), 3.57--3.58 (m, 2H, --NH--C[H]{.ul}~2~--CH~2~--), 3.74--3.76 (m, 2H, --NH--C[H]{.ul}~2~--CH~2~--), 7.64--8.69 (m, 4H, CH~pyridine~), 8.69 (s, 1H, NH exchangeable with D~2~O), 9.43 (s, 1H, NH exchangeable with D~2~O), 10.63 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 53.22, 53.59, 53.82, 56.50, 56.89, 57.27, 66.44, 66.55, 66.68, 122.94, 127.50, 138.23, 149.03, 149.66, 181.70. FT-IR ν: 3292, 1627, 1338 cm^−1^. MS (CI) *m/z*: 308 (M+). Anal.: Calcd. for C~13~H~19~N~5~O~2~S (309.38): C (50.46), H (6.18), N (22.63). Found: C (50.51), H (6.22), N (22.57) (CAS: 455314-30-4).
### *4*-*(2,4*-*Dichlorophenyl)*-*1*-*(pyridin*-*2*-*yl)carbonylthiosemicarbazide* (**4**) {#FPar4}
Yield 91 %, m.p. 158--160 °C. ^1^H (DMSO-d~6~, 300 MHz) δ: 7.42--7.66 (m, 3H, CH~phenyl~), 8.02--8.69 (m, 4H, CH~pyridine~), 9.57 (s, 1H, NH exchangeable with D~2~O), 9.96 (s, 1H, NH exchangeable with D~2~O), 10.83 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 123.06, 127.46, 127.68, 129.20, 131.72, 132.52, 136.70, 138.15, 148.97, 164.27, 182.35. FT-IR ν: 3242, 3108, 1652, 1346 cm^−1^. MS (CI) *m/z*: 342 (M^+^). Anal.: Calcd. for C~13~H~10~N~4~OSCl~2~ (341.21): C (45.75), H (2.95), N (16.41). Found: C (45.80), H (2.97), N (16.37) (CAS: 891538-65-4).
### *4*-*(4*-*Methylthiophenyl)*-*1*-*(pyridin*-*2*-*yl)carbonylthiosemicarbazide* (**5**) {#FPar5}
Yield 88 %, m.p. 184--186 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 2.28 (s, 3H, CH~3~), 7.01--7.25 (m, 4H, CH~phenyl~), 7.51--8.25 (m, 4H, CH~pyridine~), 8.66 (1 s, 1H, NH exchangeable with D~2~O), 10.53 (s, 1H, NH exchangeable with D~2~O), 12.01 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 14.79, 124.50, 125.47, 125.89, 129.26, 132.24, 137.81, 139.69, 145.62, 149.68, 150.00, 169.69. FT-IR ν: 3236, 3111, 1654, 1324 cm^−1^. MS (CI) *m/z*: 318 (M^+^). Anal.: Calcd. for C~14~H~14~N~4~OS~2~ (318.41): C (52.80), H (4.43), N (17.59). Found: C (52.71), H (4.38), N (17.51).
### *4*-*(4*-*Methylthiophenyl)*-*1*-*(pyridin*-*3*-*yl)carbonylthiosemicarbazide* (**6**) {#FPar6}
Yield 89 %, m.p. 176--177 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 2.47 (s, 3H, CH~3~), 7.23--7.57 (m, 4H, CH~phenyl~), 8.27--8.76 (m, 4H, CH~pyridine~), 9.11 (s, 1H, NH exchangeable with D~2~O), 9.81 (s, 1H, NH exchangeable with D~2~O), 10.76 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 15.58, 123.90, 126.24, 127.14, 128.72, 134.96, 136.05, 136.83, 149.40, 152.84, 165.14, 181.53. FT-IR ν: 3284, 1632, 1341 cm^−1^. MS (CI) *m/z* (%): 319 (M^+^). Anal.: Calcd. for C~14~H~14~N~4~OS~2~ (318.41): C (52.80), H (4.43), N (17.59). Found: C (52.72), H (4.49), N (17.64).
### *4*-*(2,4*-*Dichlorophenyl)*-*1*-*(pyridin*-*3*-*yl)carbonylthiosemicarbazide* (**7**) {#FPar7}
Yield 92 %, m.p. 196--197 °C. ^1^H (DMSO-d~6~, 300 MHz) δ: 7.37--7.68 (m, 3H, CH~phenyl~), 8.27--9.11 (m, 4H, CH~pyridine~), 9.75 (s, 1H, NH exchangeable with D~2~O), 10.02 (s, 1H, NH exchangeable with D~2~O), 10.86 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 123.96, 129.36, 135.14, 148.55, 152.23, 164.80. FT-IR ν: 3331, 3150, 1700, 1359 cm^−1^. MS (CI) *m/z*: 342 (M^+^). Anal.: Calcd. for C~13~H~10~N~4~OSCl~2~ (341.21): C (45.75), H (2.95), N (16.41). Found: C (45.98), H (2.91), N (16.52) (CAS: 475180-05-3).
### *4*-*(4*-*Methylthiophenyl)*-*1*-*(pyridin*-*4*-*yl)carbonylthiosemicarbazide* (**8**) {#FPar8}
Yield 86 %, m.p. 197--198 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 2.47 (s, 3H, CH~3~), 7.23--7.86 (m, 4H, CH~phenyl~), 8.77--8.78 (m, 4H, CH~pyridine~), 9.83 (s, 2H, NH exchangeable with D~2~O), 10.86 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 15.57, 122.15, 126.26, 127.04, 134.97, 136.79, 140.07, 150.67, 164.93, 181.45. FT-IR ν: 3097, 2936, 1667, 1378 cm^−1^. MS (CI) m/z (%): 319 (M^+^). Anal.: Calcd. for C~14~H~14~N~4~OS~2~ (318.41): C (52.80), H (4.43), N (17.59). Found: C (52.96), H (4.51), N (52.68).
### *4*-*(2*-*Fluorophenyl)*-*1*-*(pyridin*-*4*-*yl)carbonylthiosemicarbazide* (**9**) {#FPar9}
Yield 78 %, m.p. 202--204 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 7.18--7.31 (m, 4H, CH~phenyl~), 7.86--8.78 (m, 4H, CH~pyridine~), 9.70 (s, 1H, NH exchangeable with D~2~O), 9.99 (s, 1H, exchangeable with D~2~O), 10.94 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 116.14, 116.27, 122.21, 124.44, 127.51, 128.74, 131.17, 140.00, 150.65, 157.08, 158.70, 165.02, 182.69. FT-IR ν: 3265, 3113, 1677, 1368 cm^−1^. MS (CI) *m/z*: 291 (M^+^). Anal.: Calcd. for C~13~H~11~N~4~OSF (290.31): C (53.78), H (3.82), N (19.29). Found: C (53.65), H (3.74), N (19.42) (Byung *et al.*, [@CR7]).
### *4*-*(2,4*-*Dichlorophenyl)*-*1*-*(pyridin*-*4*-*yl)carbonylthiosemicarbazide* (**10**) {#FPar10}
Yield 84 %, m.p. 164--166 °C. ^1^H NMR (DMSO-d~6~, 300 MHz) δ: 7.37--7.45 (m, 3H, CH~phenyl~), 7.68--8.78 (m, 4H, CH~pyridine~), 9.76 (s, 1H, NH exchangeable with D~2~O), 10.05 (s, 1H, NH exchangeable with D~2~O), 10.95 (s, 1H, NH exchangeable with D~2~O). ^13^C NMR (DMSO-d~6~, 75 MHz) δ: 122.24, 127.81, 129.30, 132.12, 132.92, 133.27, 136.55, 150.65, 165.09, 182.53. FT-IR ν: 3309, 3117, 1677, 1380 cm^−1^. MS (CI) *m/z* (%): 341 (M^+^). Anal.: Calcd. for C~13~H~10~N~4~OSCl~2~ (341.21): C (45.75), H (2.95), N (16.41). Found: C (45.69), H (2.90), N (17.01) (Goldfarb, [@CR11]).
X-ray analysis {#Sec12}
--------------
The X-ray diffraction intensities were collected at 100 K on an Oxford Diffraction Xcalibur CCD diffractometer with graphite-monochromatized MoKα radiation (λ = 0.71073 Å) using the ω scan technique, with an angular scan width of 1.0°. The programs CrysAlis CCD and CrysAlis Red (Oxford Diffraction, Xcalibur CCD System, CRYSALIS Software System, Version 1.171, Oxford Diffraction Ltd. 2009) were used for data collection, cell refinement and data reduction. Absorption corrections were applied using the multi-scan method by Blessing (Blessing, [@CR6]). The structures were solved via direct methods using SHELXS-97 and refined by the full-matrix least-squares on *F*^2^ using the SHELXL-97 (Sheldrick, [@CR29]). Non-hydrogen atoms were refined with anisotropic displacement parameters. The N-bonded H atoms were found in the difference Fourier maps and then remained fixed during the least-squares refinements. All the remaining H atoms were positioned geometrically and allowed to ride on their parent atoms, with U~iso~(H) = 1.2 U~eq~(C). The molecular plots were drawn with Olex2 (Dolomanov *et al.*, [@CR9]).
Antibacterial activity {#Sec13}
----------------------
Panel reference strains of bacteria from the American Type Culture Collection or Polish Collection of Microorganisms, including aerobic Gram-positive bacteria: *Staphylococcus aureus* ATCC 25923 and *Staphylococcus epidermidis* ATCC 12228, and aerobic Gram-negative bacteria: *Escherichia coli* ATCC 25922 and *Pseudomonas aeruginosa* ATCC 9027, as well as microaerobic Gram-positive bacteria: *Lactobacillus* spp., *Lactobacillus acidophilus* PCM 2105, *Streptococcus mutans* PCM 2502 and *Streptococcus sanguinis* PCM 2335, were used. Microbial suspensions with an optical density of 0.5 McFarland standard at 1.5 × 108 CFU/mL (CFU: colony forming unit) were prepared in sterile 0.9 % NaCl. Mueller--Hinton (M--H) broth and M--H agar (Oxoid Ltd., England) for aerobic strains, and MRS Broth Lactobacillus, MRS Agar Lactobacillus (BioMaxima S.A., Poland), BHI Broth and BHI agar (BioMaxima S.A., Poland) for microaerobic strains were used in the microbial tests. All stock solutions of the newly synthesized compounds were prepared in DMSO (the final DMSO concentration used in bacterial tests did not inhibit microbial growth and was less than 1.5 %). The antibacterial activity of the newly synthesized compounds was compared with the controls: cefepime dihydrochloride (Maxipime, Bristol-Myers Squibb Latina), chlorhexidine digluconate ((CLX) Amara Poland) and ethacridine lactate (Rivanolum, PharmaSwiss, Czech Republic).
Disk diffusion method {#Sec14}
---------------------
The preliminary antibacterial activity of the carbazide derivatives against human pathogenic Gram-positive, Gram-negative aerobic and microaerobic bacteria was evaluated by measuring the zones of inhibition in the disk diffusion method (Murray *et al.*, [@CR20]). Each compound (100 µg) was placed on Petri plates with agar medium (previously inoculated with 0.5 McFarland standards with the tested bacterial strains). After 18 h of incubation at 37 °C (for aerobic strains) or 40 h at 35 °C (for microaerobic strains), zones of microbial growth produced around the tested substances were measured and recorded as the diameters of inhibition.
Broth microdilution method {#Sec15}
--------------------------
A broth microdilution method was used to evaluate the minimum inhibition concentration (MIC) according to the CLSI document (CLSI performance standards for antimicrobial susceptibility testing, 2008, Eighteenth International Supplement, CLSI document M7-MIC, Clinical Laboratory Standards Institute, Wayne) with some modifications. The lowest concentration of the tested compound (expressed in μg/mL) which did not allow any visible growth of bacteria was considered as MIC. A serial doubling dilution of the compounds was prepared in 96-well plates (200 μL per well). A suitable medium (M-H Broth, MRS Broth Lactobacillus, BHI Broth) was used as a diluent. The final concentrations of derivatives were 1000--0.015 μg/mL. Finally, 2 μL of inoculum of the tested bacterial strain (1.5 × 108 CFU/mL) was added to each well. The tests were performed either at 36 °C for 18 h (aerobic strains) or at 40 h (microaerobic strains). After incubation, the panel was digitally analyzed at 600 nm using the microplate reader Bio Tech Synergy (USA) with a dedicated software system. The growth intensity in each well was compared with the negative and positive controls.
Cell lines {#Sec16}
----------
Normal human skin fibroblasts (BJ), human hepatocellular carcinoma (HepG2) and human breast adenocarcinoma (MCF-7) were obtained from American Type Culture Collection (ATCC, England, UK). The cells were cultured in Eagle's minimum essential medium (EMEM, ATCC) supplemented with 10 % fetal bovine serum (FBS, PAA Laboratories), 100 U/mL penicillin and 100 μg/mL streptomycin (Sigma-Aldrich). In the case of the MCF-7 cell line, the culture medium was additionally supplemented with 0.01 μg/mL of human recombinant insulin (Sigma-Aldrich). The cells were grown in 75-cm^2^ flasks and maintained at 37 °C in a humidified atmosphere of 5 % CO~2~ and 95 % air.
Cytotoxicity assay {#Sec17}
------------------
In order to determine the cytotoxicity, BJ cells were seeded in flat-bottom 96-well plates in 100 μL of a complete growth medium at a concentration of 1.7 × 104 cells/well and incubated for 24 h at 37 °C in a humidified atmosphere of 5 % CO~2~. Immediately before drug treatment, the synthesized compounds (**1**, **2**, **4**, **5**, **6**, **7**, **10**) were dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich) and then diluted in cell culture medium supplemented with 2 % FBS. Moreover, cefepime dihydrochloride (Maxipime, Bristol-Myers Squibb Latina), chlorhexidine digluconate ((CLX) Amara Poland) and ethacridine lactate (Rivanolum, PharmaSwiss, Czech Republic) were used as reference antibacterial agents. After incubation, the growth medium was replaced with 100 μL of the appropriate serial dilutions of the investigated compounds. Untreated cells were used as negative controls, and different concentrations of DMSO were used as the solvent control. The cell cultures were incubated at 37 °C for 24 h. The cytotoxicity was estimated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay as described by Mosmann with some modifications (Mosmann, [@CR19]). Briefly, the cells were incubated for 3 h with 25 μL of MTT solution (5 μg/mL in PBS buffer) per well. The MTT assay is a rapid colorimetric method based on the conversion of mitochondrial succinate dehydrogenase from yellow, soluble tetrazolium salt to blue formazan crystals to determine the number of viable cells. In order to dissolve formazan crystals in live cells, 100 μL of SDS-HCl solution (10 % SDS in 0.01 N HCl) was added per well. After overnight incubation, absorbance was measured at 570 nm using microplate reader (BioTek ELx50). The MTT assay was repeated in three independent experiments performed in octuplicates. The half-maximal cytotoxic concentration (CC~50~) was defined as the compound concentration (μg/mL) required to reduce cell viability to 50 %. Therapeutic index (TI) is a widely accepted parameter to represent the specificity of antibacterial agents for human (Begg *et al.*, [@CR4]). In this study, the in vitro TI values were calculated as the ratio of CC~50~ (cytotoxic activity) and MIC (antibacterial activity); thus, greater values of in vitro therapeutic index indicate safer specificity for eukaryotic cells.
Cell proliferation assay {#Sec18}
------------------------
In order to evaluate cell proliferation, the cells were seeded in flat-bottom 96-well plates in 100 μL of a complete growth medium at a concentration of 2 × 103 cells/well (BJ), 1.5 × 104 cells/well (HepG2) and 2.5 × 104 cells/well (MCF-7) and incubated for 24 h at 37 °C in a humidified atmosphere of 5 % CO~2~. Before drug exposure, the synthesized compounds (**1--10**) were dissolved in DMSO and then diluted in a complete culture medium supplemented with 10 % FBS. Subsequently, the growth medium was gently removed and the cells were exposed to 100 μL of serial dilutions of the investigated compounds at concentrations ranging from 0.05 to 200 μg/mL. Untreated cells were used as negative controls, and different concentrations of DMSO were used as the solvent control. After 96-h incubation at 37 °C in a humidified atmosphere of 5 % CO~2~, cell proliferation was assessed using the MTT test as described previously (Cytotoxicity assay). The MTT assay was repeated in three independent experiments in quadruplicates. The half-maximal inhibitory concentration (IC~50~) was defined as the compound concentration (μg/mL) required to inhibit cell proliferation to 50 %.
Statistical analysis {#Sec19}
--------------------
The results of the in vitro cell culture experiments were presented as mean values ± standard deviation (SD) or as mean values ± standard error of the mean (SEM). The data were analyzed using one-way ANOVA test followed by Dunnett's test. Differences were considered as significant with *p* \< 0.01 (GraphPad Prism 5, Version 5.04 Software). The values of CC~50~ and IC~50~ were calculated via 4-parameter nonlinear regression analyses using GraphPad Prism 5, version 5.04.
Molecular modeling {#Sec20}
------------------
Molecular modeling was performed using generally available software. The LogP and PSA parameters were performed by using VEGA ZZ program (Pedretti *et al.*, [@CR23]). The geometry and energy of the tested compounds were optimized by AM1 semiempirical method (Dewar *et al.*, [@CR300]). The TPSA, miLogP and hydrogen bond donors and acceptors were calculated by Molinspiration program (<http://www.molinspiration.com/cgi-bin/properties-accessed> 1 February, 2015).
Electronic supplementary material
=================================
{#Sec21}
Below is the link to the electronic supplementary material. Supplementary material 1 (DOC 253 kb)
This study was partially supported by a DS2 grant (Medical University in Lublin, Poland). The paper was developed using the equipment purchased within agreement No. PORPW.01.03.00-06-010/09-00 Operational Program Development of Eastern Poland 2007-2013, Priority Axis I, Modern Economy, Operations 1.3. Innovations Promotion.
|
{
"pile_set_name": "PubMed Central"
}
|
G-protein coupled receptors (GPCRs) are proteins responsible for transducing a signal within a cell. GPCRs have usually seven transmembrane domains. Upon binding of a ligand to an extra-cellular portion or fragment of a GPCR, a signal is transduced within the cell that results in a change in a biological or physiological property or behaviour of the cell. GPCRs, along with G-proteins and effectors (intracellular enzymes and channels modulated by G-proteins), are the components of a modular signalling system that connects the state of intra-cellular second messengers to extra-cellular inputs.
GPCR genes and gene products can modulate various physiological processes and are potential causative agents of disease. The GPCRs seem to be of critical importance to both the central nervous system and peripheral physiological processes.
The GPCR protein superfamily is represented by five families: Family I, receptors typified by rhodopsin and the beta2-adrenergic receptor and currently represented by over 200 unique members; Family II, the parathyroid hormone/calcitonin/secretin receptor family; Family III, the metabotropic glutamate receptor family, Family IV, the CAMP receptor family, important in the chemotaxis and development of D. discoideum; and Family V, the fungal mating pheromone receptor such as STE2.
G proteins represent a family of heterotrimeric proteins composed of α, β and γ subunits, that bind guanine nucleotides. These proteins are usually linked to cell surface receptors (receptors containing seven transmembrane domains) for signal transduction. Indeed, following ligand binding to the GPCR, a conformational change is transmitted to the G protein, which causes the α-subunit to exchange a bound GDP molecule for a GTP molecule and to dissociate from the βγ-subunits.
The GTP-bound form of the α, β and γ-subunits typically functions as an effector-modulating moiety, leading to the production of second messengers, such as cAMP (e.g. by activation of adenyl cyclase), diacylglycerol or inositol phosphates.
More than 20 different types of α-subunits are known in humans. These subunits associate with a small pool of β and γ subunits. Examples of mammalian G proteins include Gi, Go, Gq, Gs and Gt. G proteins are described extensively in Lodish et al., Molecular Cell Biology (Scientific American Books Inc., New York, N.Y., 1995; and also by Downes and Gautam, 1999, The G-Protein Subunit Gene Families. Genomics 62:544-552), the contents of both of which are incorporated herein by reference.
Known and uncharacterized GPCRs currently constitute major targets for drug action and development. There are ongoing efforts to identify new G protein coupled receptors which can be used to screen for new agonists and antagonists having potential prophylactic and therapeutic properties.
More than 300 GPCRs have been cloned to date, excluding the family of olfactory receptors. Mechanistically, approximately 50-60% of all clinically relevant drugs act by modulating the functions of various GPCRs (Cudermann et al., J. Mol. Med., 73:51-63, 1995).
Formyl peptide receptor-like 2 (FPRL2) (SEQ ID NO: 1, human polynucleotide sequence, SEQ ID NO: 2, human amino acid sequence) is a member of FPR Family. The members of this family belong to the GPCR family. Human FPR (SEQ ID NO: 3, human polynucleotide sequence, SEQ ID NO: 4, human amino acid sequence) was first member of the FRP family defined biochemically, in 1976, as a high affinity binding site on the surface of neutrophils for the prototypic N-formyl peptide formyl-methionine-leucyl-phenylalanine (fMLF). It was then cloned in 1990, by Boulay et al. from a differentiated HL-60 myeloid leukemia-cell cDNA library [Boulay, F. et al. (1990) Biochem. Biophys. Res. Commun. 168, 1103-1109; Boulay, F. et al. (1990) Biochemistry 29, 11123-11133]. In transfected cell lines, FPR binds fMLF with high affinity (Kd<1 nM) and is activated by picomolar to low nanomolar concentrations of fMLF in chemotaxis and calcium ion (Ca2+) mobilization assays.
Two additional human genes, designated FPRL1 (FPR-like 1) (SEQ ID NO: 5, human polynucleotide sequence; SEQ ID NO: 6, human amino acid sequence) and FPRL2 (FPR-like 2), were subsequently isolated by low-stringency hybridization using FPR cDNA as a probe [Ye, R. D. et al. (1992) Biochem. Biophys. Res. Commun. 184, 582-589; Bao, L. et al. (1992) Genomics. 13, 437-440] and shown to cluster with FPR on human chromosome 19q13.3 [Murphy, P. M. et al. (1992) J. Biol. Chem. 267, 7637-7643; Bao, L. et al. (1992) Genomics 13, 437-440]. FPRL1 is defined as a low-affinity fMLF receptor, based on its activation only by high concentrations of Fmlf (μM range) in vitro [Murphy, P. M. (1996) Chemoattractant Ligands and their Receptors (Horuk R, ed.), pp. 269-299, CRC Press, Inc., Boca Raton; Prossnitz, E. R. and Ye, R. D. (1997) Pharmacol. Ther. 74, 73-102]. However, it is unclear whether such concentrations of fMLF could be generated at sites of bacterial infection or tissue injury. Therefore, the role of FPRL1 as another bona fide functional fMLF receptor in vivo remains to be determined. FPRL2 does not bind or respond to N-formyl peptides [Durstin, M. et al. (1994) Biochem. Biophys. Res. Commun. 201, 174-179] but instead shares some non-formylated chemotactic peptides identified for FPRL1 [Christophe, T. et al. (2001) J. Biol. Chem. 276, 21585-21593; Betten, A. et al. (2001) J. Clin. Invest. 108, 1221-1228].
Although FPR and FPRL1 were initially detected in phagocytic leukocytes, other cell types also express these receptors but with undefined biological significance. Little information is available about the expression pattern of FPRL2, except that mRNA for this receptor is present in monocytes but not neutrophils [Durstin, M. et al. (1994) Biochem. Biophys. Res. Commun. 201, 174-179]. Functional FPRL2 is also expressed in mature dentritic cells (DCs) [Yang, D. et al. J. Leukoc. Biol. Vol. 72: 598-607 (2002)], which express reduced levels of FPR but do not appear to express FPRL1 [Yang, D. et al. (2001) J. Immunol. 166, 4092-4098; Braun, M. C. et al. (2001) Blood 97, 3531-3536].
The Heme Binding Protein (HBP) (Sequence ID No7: human polynucleotide sequence, Sequence ID No8: human amino acid sequence; Sequence ID No9: mouse polynucleotide sequence, Sequence ID No10: mouse amino acid sequence). The human and mouse HBP cDNAs are 567 and 570 bp long respectively and encode a protein product of 189 and 190 amino acids respectively. This protein is located into the cytoplasm of the cell. HPB binds heme and porphyrins with micromolar Kd. HBP may function as a buffer for overproduced porphyrin as well as heme. Expression studies indicated that the mouse mRNA encoding HBP is expressed in liver, spleen and kidney cells (Blackmon et al; 2002 Arch. of Biochem. and Biophysics 407, p 196-201).
|
{
"pile_set_name": "USPTO Backgrounds"
}
|
Co-morbid medical conditions and medical complications of prostate cancer in Southern Nigeria.
Prostate cancer often co-exists with other diseases. It accounts for 11% of all cancers in Nigerian men, and it is the commonest cause of mortality due to cancer in elderly males in Nigeria. To present co-morbid medical conditions and medical complications of prostate cancer in patients with the disease in Southern Nigeria. The study was carried out prospectively (2002 to 2003) at University of Port Harcourt Teaching Hospital (UPTH), and Nnamdi Azikiwe University Teaching Hospital (NAUTH) Nnewi- both in Southern Nigeria. Using common proforma, patients who presented to the urology units of the two teaching hospitals were evaluated clinically and with relevant investigations for prostate cancer and other diseases. Those with histologically confirmed prostate cancer were included in this study. Data was also collected retrospectively by using the same proforma to obtain information from case files of 37 patients diagnosed with prostate cancer at UPTH. Data from the two institutions were collated and analysed. Of 189 cases analysed, 73.4% had significant medical co-morbid diseases/complications. These included anaemia (69.8%), urinary tract infection (56.1%), chronic renal failure (33.9%), hypertension (41.8%), diabetes mellitus (9.5%), paraplegia (9.5%), congestive cardiac failure (9.0%) and cerebrovascular disease (5.3%). These patients had high disease burden. Improved health education and well coordinated interdisciplinary team work are suggested in managing this malignancy.
|
{
"pile_set_name": "PubMed Abstracts"
}
|
Q:
What is a good icon to indicate that a given item is NOT part of a list?
I need to place an icon next to an email address to indicate that the email address is NOT a member of a given mailing list.
This could be abstracted as: What icon best indicates that the entity it is associated with is NOT a member of a given group?
In my case, I'm going to use an envelope icon to indicate that an email address IS a member of a mailing list. But what icon should I use to indicate non-membership?
A:
The things that come immediately to mind are: envelope with a no entry symbol overlaid; envelope with a green check for "included" and a red X for "excluded"; and green envelope for inclusions and red envelope with a slant mark across it for the exclusions.
Hope that gives you some ideas.
|
{
"pile_set_name": "StackExchange"
}
|
Blog
We can’t continue with this annual ritual of concern – Government needs to take action
It’s difficult to properly grasp the human cost of cold homes. Whether it’s down to the dispassionate language of ‘excess winter mortality’, or the hidden way that cold temperatures lead to circulatory and respiratory problems, it’s not an issue treated with the seriousness it deserves. Perhaps it’s the fact that the problem is most severe for the elderly, who are often neglected in policy and in broader society. Yet every winter we read the same headlines about the 9,000 or so early deaths (four times the toll of motor fatalities), as well as the significant psychological impacts that come from living in a cold home.
The problem of cold homes comes down to three interrelated parts: household income, the cost of fuel, and the energy-efficiency of the building. All three deserve our attention. Compared to our European neighbours, UK household income is fairly high, but unequally distributed. Fuel prices, perhaps surprisingly, are lower than almost anywhere in Europe. Fuel bills, on the other hand, are not, and the answer to this riddle shouldn’t come as a surprise: it’s our housing.
Yes, once again the UK’s failure to ambitiously build and renovate rears its ugly head. Over a third of the homes in the UK were built before 1945 and three quarters before 1980. This puts the UK at the top the rankings for the oldest building stock in Europe. Often these older homes are single dwellings with poor insulation and heating systems that consume four times as much energy. Not only have our European neighbours updated their building stock, many countries in the north use more efficient and less polluting electric or district heating.
Source: European Commission: EU Buildings Database
But there is potential for the UK to chart its own course on housing. For years now, the housing conversation has felt like a live auction for votes, with each political party’s manifesto promising ever more ambitious house-building programmes. And that’s fine, if the reality matches the rhetoric; but we also need to be thinking about the type of developments that we’re planning on building.
NEF has developed proposals to correct the country’s artificially inflated land prices, and ensure that public land is used to provide housing that is both genuinely affordable and developed in response to the needs of the local community. And one of these needs is for energy efficient homes – not only for health of people, but for the planet too. The Committee on Climate Change has put buildings’ energy efficiency as a central plank in its strategies for the UK to meet its climate targets. There have been calls to make energy efficiency part of the National Infrastructure Plan to unlock the levels of public investment that required to renovate the existing building stock.
The cold snap this week will eventually pass, but we can’t continue with the annual ritual of concern for the cost to human life and wellbeing caused by under-heated homes. Our current approach to housing is great at increasing land value, but poor at delivering homes that are affordable, community-led, healthy, and sustainable. An ambitious housing strategy would offer the chance to tackle these entangled issues together.
|
{
"pile_set_name": "OpenWebText2"
}
|
{#sp1 .27}
|
{
"pile_set_name": "PubMed Central"
}
|
In a phrase variously attributed to Oscar Wilde and George Bernard Shaw, the United States and Britain are "two countries divided by a common language."
When it comes to the word liberal, that must certainly be the case. As usual, many Canadians, caught between British and American definitions, are, quite reasonably, in a state of confusion.
In Canada, that confusion was only accentuated last week when Maxime Bernier announced his new party, in which he plans to run candidates in the next federal election.
While the name of the party — the People's Party of Canada or Parti populaire du Canada — implies populism, Bernier has marked himself out as what political theorists I spoke to describe as a classical liberal.
Government intervention
"We don't believe that government intervention is a solution for everything," said Bernier as he formally announced the new party. "Government should not intervene to solve each and every problem on the road to a utopian and unrealistic vision of society."
Calling Bernier a liberal could well infuriate some of his Canadian supporters. But the description above is almost a textbook definition.
Bombarded by U.S. sources such as Fox News or Twitter, Canadians have become exposed to the term liberal in the American sense as a derogatory epithet levelled by opponents of the left, says Laura Stephenson, a professor at Ontario's Western University who specializes in political behaviour.
What's liberal? British Prime Minister Margaret Thatcher, U.S. President Ronald Reagan and Prime Minister Brian Mulroney, here at the G7 Summit in Toronto in June 1988, were often described as neo-liberal, literally 'new liberal.' (Gary Hershorn/Reuters)
"The polarization in the U.S. between the Republicans and the Democrats has become so extreme that you level the term to mean, 'You're one of them,'" says Stephenson.
And Stephenson says the insult can be all-encompassing.
"Are you using the term because you think they're far-left crazies or are you using the term because you think they favour a bit more government intervention?" she asks.
Stephenson says that in Canada, where many people have traditionally thought of liberal as the policies of the Liberal Party of Canada, the term represents some sort of middle-of-the-road political and economic pragmatism. But the bitter U.S. political debate has given it new meaning.
As left as anyone's willing to go
"When the Americans refer to 'liberal,' it is synonymous with 'as left as anyone is willing to go in American politics,'" says Stephenson.
Like common names for plants, the popular use of political terms can end up standing for very different things.
The process is especially confusing since people on the left have used the term "neo-liberal," literally "new liberal," as a pejorative term for the conservative governments of the 1980s including those of Ronald Reagan, Brian Mulroney and Margaret Thatcher, says Stephenson.
So how can liberal mean right and left and mushy middle all at the same time? Part of the problem is that when parties adjust their platforms to keep up with changing times, they seldom choose a new name.
In Britain the Liberal Party grew up in opposition to the entrenched power of the landowning elite. Under the banners of liberty and freedom, liberals celebrated free markets, freedom of thought and speech, and the growing power of the emerging middle class.
This week, in an entire issue celebrating the anniversary of the British magazine's foundation as a beacon of 19th century liberalism, The Economist calls for a renewed radical liberal political movement.
Liberals have become a complacent elite and need to rekindle their desire for radicalism. This week's <a href="https://twitter.com/TheEconomist?ref_src=twsrc%5Etfw">@TheEconomist</a> cover leader: <a href="https://t.co/9dtqlNmamW">https://t.co/9dtqlNmamW</a> —@JeremyCliffe
The magazine's lead essay on the subject seems to frame liberalism as the set of all good things in opposition to all bad things. And while most of us would probably agree that freedom sounds better than tyranny, there is a more subtle practical question of "freedom for who?"
"You'd be hard-pressed to find anyone living in Canada or the United States who isn't a liberal of one kind or another," says Ottawa political theorist Marc Hanvelt, author of The Politics of Eloquence.
Democracy's foundation
Tracing the long liberal tradition back to the philosopher Thomas Hobbes in the 1600s, liberalism emerged as the right not to be governed without your permission and approval, says Hanvelt. As it evolved, that included the right to property in the broadest sense, and the right to trade freely. Effectively, liberalism is the foundation of the modern capitalist democratic tradition.
Hanvelt says that honourable tradition is a long way from the modern U.S. popular discourse, where liberalism now means something like "soft on crime … with no sense of fiscal responsibility."
But quite apart from the relatively recent and pejorative definition, while the word liberal has stayed the same, liberal philosophy has divided into ultimately conflicting branches, says Barbara Arneil, author of a book on John Locke, often described as "the father of liberalism."
When I read Bernier's quote to her over the phone, she responded, "Yes, that's classical liberalism."
"Liberalism takes as its core value the paramountcy of individual freedom, and that's right from the beginning," says Arneil, head of the political science department at the University of British Columbia. "What the state is there to do is protect and preserve individual freedom."
But she says based on that beginning, liberalism has evolved and fractured. Bernier's kind of liberalism is that classical type, but a new thread of liberalism insists governments must be activist.
"In order for someone to be free, they need to have basic provision of education, health care, social assistance, because freedom has no meaning if you're poor, starving and don't have a house," says Arneil.
So in the next federal election nearly everyone can vote liberal, whether middle, left or right. Each of us just has to decide what type we're voting for.
Follow Don on Twitter @don_pittis
|
{
"pile_set_name": "OpenWebText2"
}
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.