_id
stringlengths 7
16
| description
stringlengths 55
95.2k
|
|---|---|
pmc-6057411-1 | A 71-year-old woman with a past medical history of uterine cancer 25 years before, herpes-zoster infection two years before, recent diagnosis of human immunodeficiency virus (HIV) infection, and cervical adenopathies under investigation presented at the first medical appointment at the Infectious Diseases Unit referring a 3-week history of fever, weight loss of 20 kg, and hemoptoic cough, as well as diarrhea with one year of evolution. On physical examination, she was cachectic and weak, had axillary temperature of 38°C, blood pressure of 112/80 mmHg, respiration rate of 40 per minute, heart rate of 142 beats per minute, and oxygen saturation of 95% in room air. She also presented with pain and tenderness at the palpation of the hypogastric region, and during the consultation, she presented cardiorespiratory arrest. Advanced life support with favorable response was performed, and she was subsequently transferred to the emergency room where it was necessary to initiate aminergic support and proceed to orotracheal intubation and mechanical invasive ventilation. The complementary diagnostic exams revealed white blood cell count 14,740/μL with absolute neutrophil count 13,180/μL (89.4%) and absolute lymphocyte count 970/μL (6.6%) with 113 CD4+/μL cells, hemoglobin level 11.3 g/d, and platelet count 2,33,000/μL. She presented with blood creatinine 1.34 mg/dL, pancreatic amylase 222 U/L (4 times above the upper limit of normal), pancreatic lipase 174 U/L (3 times above the upper limit of normal), and seric lactates 6.5 mmol/L. Viral load of HIV by polymerase chain reaction was 2,330,220 copies/mL. Thoracic, abdominal, and pelvic computed tomography (CT) revealed pneumoperitoneum, peritonitis, diffuse parietal thickening, and dilatation of the intestinal loops of the jejunum with splenic infarction ().
An emerging surgery exploratory laparotomy was performed having been found enteric peritonites of the large cavity, occlusion with transition point at the level of the distal jejunum and poor perfusion, and thickening of the distal loops and perforation at the level of the distal ileum. Segmental enterectomy of approximately 35 cm of jejunum/ileum has been performed, including ischemic loop and ileal perforation. In the postoperative period, she was admitted to the intensive care unit, and broad-spectrum antibiotic therapy has been initiated. Nevertheless, she evolved with progressive clinical deterioration with increasing need of amines and without favorable hemodynamic response. The patient passed away the same day. The histological examination of the segmental enterectomy piece and available postmortem revealed acute transmural inflammation of the enteric wall, with suppuration and necrosis and extensive lesions of acute fibrinoexudative serositis with fungal hyphae of the Aspergillus spp. type. There were no images of angioinvasion, epithelioid granulomas, or signs of malignancy. The culture of peritoneal fluid obtained during surgery revealed polybacterial and fungal overinfection with Enterococcus faecium, Escherichia coli, and Candida albicans. |
pmc-6057417-1 | An 18-year-old female patient was admitted to the endocrinology unit for assessment and preoperative management of a retroperitoneal PG. The patient's past medical history was significant for psoriasis since age 2, for which she has been getting an association of betamethasone and salicylic acid. The patient also reports a history of functional colopathy for the past 3 months. No other significant history of endocrine or tumoral conditions was reported. The patient has been suffering from recurring episodes of excessive perspiration and palpitations over the past 4 years, associated with other symptoms of hypertension such as headaches and tinnitus. The patient also reported multiple episodes of recurrent right-sided abdominal pain worsening over the past year.
Her physical exam upon admission was normal with a BMI (Body Mass Index) = 21.8 kg/m2, a BP (blood pressure) = 130/90 mmHg bilaterally (no postural hypotension was noted), and a heart rate (HR) =88 beats per minute (bpm). The cutaneous examination showed facial erythrosis and eczematous lesions of the upper and lower extremities. No pigmentation disorders nor cutaneous superficial neurofibromas were noted. EKG analysis showed a sinus rhythm and a left ventricular hypertrophy (LVH). An abdominal computed tomography (CT) scan revealed no adrenal abnormalities but a 7.0 x 5.0 cm tissular-like retroperitoneal mass in contact with the abdominal aorta and the inferior vena cava, intimately related and displacing anteriorly the head of the pancreas (). Abdominal MRI and elevated urinary methylated metabolites of catecholamines (Metanephrine = 3.2 μmol / 24h (normal range (NR) 0.2 to 1), Normetanephrine = 47.5 μmol / 24 h (NR: 0.4 to 2.1)) confirmed the diagnosis of catecholamine-secreting retroperitoneal PG.
Twenty-four hours after admission, the patient developed a cardiogenic shock. Her initial vital signs were as follows: Glasgow Coma Scale (GCS) = 14 (E4 V4 M6), BP = 82/46 mmHg, HR = 150 bpm, a respiratory rate at 25 cycles per minute with a SpO2 (peripheral oxygen saturation) at 60% with cold distal extremities and cyanosis. Capillary blood glucose was 150 mg/dl. Fluid resuscitation using 500 ml of Ringer Lactate solution and oxygen through high concentration mask were both promptly started and the patient was transferred to the ICU.
On admission, clinical assessment showed signs of heart failure, elevated troponin, and lactates markers and an EKG revealed sinus tachycardia with a frequency of 130 bpm. The patient was hypoxic with a SpO2 at 95% under 9 L/min of oxygen. Two right femoral central lines were placed (venous and arterial) and the patient was started on Noradrenalin (at a rate of 0.5 μg/kg/min). An echocardiography revealed a global hypokinesia with a left ventricular ejection fraction (LVEF) at 15%, requiring the patient to be put on 15 μg/kg/min of Dobutamine as inotropic support.
Seeing how the patient was in no shape to undergo open surgery, we opted for a preoperative radiological percutaneous transarterial embolization (TAE), under local anesthesia. It consisted of coiling of four major feeding vessels, 2 arising from the right renal artery and 2 more from the lumbar arteries (L2 and L3), using hydrogel with Polyzene®-F coating microparticules (). The patient was gradually weaned off catecholamines during embolization. She was completely weaned off vasoactive drugs in the next 24 hours. 48 hours after embolization, a follow-up echocardiography showed an overall normokinetic left ventricle (LV), an improved FEVG at 50%, and an aortic VTI (velocity time integral) at 20m/s. Lactate levels went back to normal over the next 48 hours. In the postembolization period, the patient experienced several nonsymptomatic hypertension peaks (systolic blood pressure (SBP) = 220mmHg) and received intravenous nicardipine at a rate of 5 mg/H. The extremities warmed up and the daily urine output was maintained.
Three days after embolization, the patient was taken to the operating room for the tumor to be surgically removed through a right subcostal approach. Perioperative exploration found a retroperitoneal soft encapsulated tumor measuring 7.0 cm in diameter, in intimate contact with the abdominal aorta, the right renal vein, and the inferior vena cava (). Embolization caused no complications. The tumor's adhesions were carefully released from adjacent organs including the right kidney, the duodenum, and the head of the pancreas. There was no need to place a double J ureteral stent preoperatively. Upon manipulation of the mass, there was moderate elevation in the blood pressure that was controlled with intravenous propranolol and nicardipine. A complete resection of the tumor was performed and no adjacent organs were removed or injured during the surgery ().
The patient experienced episodes of hypotension after the tumor excision and received intravenous noradrenaline at a rate of 0.3 μg/kg/min. The patient was then transferred back to the ICU and extubated in fast track manner. She was weaned off vasoactive drugs in the following 6 hours.
sums up the lab work-up of the patient during her stay.
During close ICU monitoring, the patient presented several episodes of hypoglycemia and hypokalemia and was given intravenous supplementation of glucose and potassium. A postoperative echocardiography showed a hyperkinetic myocardium with an enlarged LV, an IVS (interventricular septum) measuring 13 mm, a lateral wall measuring 14 mm, and a much improved LVEF at 70%.
The patient was subsequently discharged after spending 4 days in the ICU and transferred to a general surgery service. Pathological report of the tumor mass confirmed the diagnosis of benign extra-adrenal PG. A one-month echocardiography follow-up noted nothing significant. She now completely recovered and is back to her daily life. |
pmc-6057571-1 | Case 1: a 24-year-old female patient was referred to our department for the treatment of multiple impacted supernumerary teeth, which were detected on an orthopantomogram obtained at a dental clinic. An intraoral examination did not detect any abnormalities with regard to the size or shape of the patient's tooth crowns or the relationship between his dental age and chronological age, but a panoramic radiograph revealed three supernumerary teeth which were situated behind the 18, 48 and 38 (). There was no any other specific oral finding and relevant familial history of dental abnormalities. The patient was educated about the presence of multiple supernumerary teeth and the extraction of the two mandibular supernumerary teeth was indicated before orthodontic treatment (). |
pmc-6057571-2 | Case 2: a 19-year-old girl was referred to our department because of a recurrent pericoronitis relevant to the lower right third molar 48. General physical and extra oral examination did not show any abnormality and medical/family history was non-contributory. Orthopantomogram has revealed a presence of 3 supernumerary teeth which were situated behind the 18, 28 and 48 (). Surgical removal of the right mandibular supernumerary tooth was planned with extraction of the 48 () and the others ST will remain under surveillance following the patient decision. |
pmc-6057660-1 | A 60-year-old male was referred to our department, complaining about gradually worsening hoarseness, during the last 8 month period. Occasional dysphagia and foreign-body sensation were also reported upon referral. The patient was a heavy smoker for more than 20 years, reporting an average of 20 cigarettes per day. Alcohol was also a factor, and although no real alcohol abuse or indulgence was noted, the patient was a rather frequent user.
Medical history only revealed arterial hypertension under treatment with beta blockers. Haematological and biochemical tests did not show any significant abnormalities.
Physical examination included a full head and neck examination, complemented with flexible fiberoptic laryngoscopy. Typical ear, nose and throat examination did not reveal any abnormal findings and neck palpation was negative. However, fiberoptic laryngoscopy revealed a lesion affecting both vocal cords and anterior commissure, while vocal cord mobility appeared impaired. On these grounds, a cervicothoracic and upper abdomen computed tomography (CT) scan with intravenous gadolinium was decided and the patient was scheduled for direct microlaryngoscopy and biopsy of the lesion under general anaesthesia.
Imaging confirmed the laryngeal lesion, yet it also indicated a second lesion about 2 cm below the inferior end of the primary one, arising somewhere between the first and second tracheal ring. Intermediate tissue appeared grossly normal (). No signs of enlarged cervical lymph nodes were noted and laryngeal cartilages showed no abnormal findings.
On the other hand, histopathological examination after biopsy of the lesion under general anaesthesia confirmed the diagnosis of squamous cell carcinoma. The lesion was carefully mapped and proved to be a glottic carcinoma affecting the anterior commissure and appearing in strong correlation with the thyroid cartilage. The lesion infiltrated the left and the first tertile of the right vocal cord. No subglottic extension was noted. In this context, the patient was informed and consent for radical surgical therapy was obtained.
The patient underwent total laryngectomy and wide excision of the trachea which included the second tumour within safe limits (). The procedure was complimented with left thyroid lobectomy and bilateral selective neck dissection (Robin’s levels II–IV). Paratracheal lymph nodes (Robin’s level VI) were also carefully dissected. The overall postoperative course was uneventful. The patient was discharged from our department on day 16 with very good swallow function and was decannulated after 1 week. Surgical resection was followed by postoperative radiation therapy (6400 cGy/32 fraction).
The final pathological report was of crucial importance in our case. First of all, the surgical margins of resection were found to be free of disease. Second, histological sections from the tumour of the glottis showed the characteristic morphology of squamous cell carcinoma. Cancer cells were large in size and polygonal in shape with eosinophilic cytoplasm and nuclei with moderate variation in size and shape. There were a moderate number of mitoses and keratinisation could be focally observed. Cancer cells showed an infiltrative pattern consisting mainly of nests and trabeculae that invaded the vocalis muscle in both the vocal cords. The perichondrium of thyroid cartilage was focally invaded by cancer cells. Histological sections from the tumour of the trachea showed morphological features identical to those of the tumour of the glottis. An upward infiltrating pattern could be noticed. Moreover, a comparative immunohistochemical study of the two tumours showed strong positivity of cancer cells in stains for keratins AE1/AE3 and 34βΕ12 and moderate positivity in stains for CK5/6, CK8/18 and epithelial membrane antigen. Immunohistochemistry for D2-40 antigen (podoplanin) illustrated the positivity of the lymphatic endothelium. Immunohistochemical stains for other vascular endothelia (CD31 and CD34 antigens) were also performed, and were negative. In the region between the two tumours, many lymphatics containing neoplastic emboli could be observed (). Finally, two tumour-infiltrated lymph nodes (the larger being of 1.2 cm diameter) with extracapsular spread were found in the left neck dissection specimen. A pT4a(m)N2b stage, according to eighth edition TNM staging, was established. |
pmc-6057786-1 | A 10-year-old female presented to the emergency room with diffuse abdominal pain for 1 day, and two episodes of vomiting. The clinical and laboratory findings were consistent with appendicitis. Therefore, the girl was taken to the operating room and surgical table set up for SIPES appendectomy, while glove port was prepared (
). A 2-cm vertical incision was made in the fascia underlying the umbilicus to enter the peritoneal cavity. A wound retractor (Alexis, Size XS, Applied Medical Resources Corp., Rancho Santa Margarita, CA) was placed directly through the fascia, and a 6.5 size latex sterile powder-free surgical glove was connected to it (
). The thumb of the glove was cut off and a 5-mm trocar (Karl Storz, Germany) was introduced in the abdomen for CO
2
insufflation and introduction of the monopolar hook and tied to the wound retractor to prevent dislocation (
). A 5-mm 45-cm scope (Stryker Endoscopy, San Jose, CA) was connected to the light cord using a 90° angulated light adapter (Karl Storz) and introduced through a 2-mm incision in one of the finger tips. With standard reusable 5-mm straight laparoscopic instruments, introduced in the same technique as the camera, the appendix was identified, and the mesoappendix divided. The appendix was grabbed, the capnoperitoneum was deflated, and the appendix exteriorized and amputated over a polyglactin suture ligation extracorporeally. The fascial incision was approximated with a running 2–0 polyglactin suture. Finally, the skin incision was closed using interrupted subcuticular 4–0 poliglecaprone sutures (
). Histological examination confirmed the diagnosis of appendicitis. There were no intra- or postoperative complications. The patient was discharged on postoperative day 2. |
pmc-6057860-1 | A 73-year-old Japanese female with a history of diabetes mellitus, hypertension, and hyperlipidemia was found to have a cystic lesion in the pancreas by abdominal ultrasonography. Her mother had died of gastric cancer, and her aunt had died of pancreatic cancer. Although she previously had a benign colon polyp, the family history and medical records did not meet the Amsterdam criteria II for Lynch syndrome. The asymptomatic cyst of the pancreas was periodically checked. Over 7 years, the cyst slowly enlarged and was radiologically suspected to be an intraductal papillary mucinous neoplasm (IPMN). At 9 years, she presented with a dull feeling in the stomach and was diagnosed with acute pancreatitis. She received medical treatment then was referred to our clinic for further examination.
Dynamic computed tomography and endoscopic ultrasonography revealed no cyst. Instead, a solid tumor was observed in the main pancreatic duct of the pancreatic body (Fig. –). The main duct of the pancreatic tail was dilated due to obstruction. The tumor was enhanced from the early to delayed phases. Cytology from the pancreatic duct by endoscopic retrograde cholangiopancreatography indicated an adenocarcinoma; however, mucous secretion was not detected, suggesting that IPMN was unlikely. The maximum standardized uptake value of the lesion was 6.8 by positron emission tomography (Additional file ). On laboratory examination, hematologic and biochemical data values were all within normal ranges. Serum levels of carcinoembryonic antigen (CEA), carbohydrate antigen (CA) 19-9, and pancreatic cancer-associated antigens (DUPAN-2 and SPAN-1) were all within normal ranges.
The pre-operative diagnosis was invasive ductal adenocarcinoma, and the patient underwent pancreatoduodenectomy and D2 lymph node dissection. The clinicopathologic diagnosis was stage I ductal adenocarcinoma. The surgical margin was free of tumor cells. No lymph node or distant metastasis was detected; thus, the tumors-nodes-metastasis (TNM) stage was pT1aN0M0. The postoperative course was uneventful, and the patient was discharged at postoperative day 22 without comorbidity. The patient received six courses of S-1 (100 mg/day) as the postoperative adjuvant therapy. She has undergone medical check-ups every month including tumor markers (CEA and CA19-9) bimonthly. Computed tomography and ultrasonography have been done every 3 months. Although CEA has fluctuated between 4 and 11 ng/ml, no evidence of recurrence has been detected so far.
The resected specimen contained a 22 × 10-mm circumscribed nodular tumor in the pancreatic main duct (Fig. –). Microscopically, the tumor grew in an expansive manner. The border between the tumor and non-tumor areas was well defined and associated with prominent lymphocytic infiltration. Contrary to typical invasive ductal adenocarcinomas characterized by tubular structures with abundant stroma, the tumor cells proliferated in a medullary pattern, with fewer stromal components. Close examination revealed marked nuclear pleomorphism with prominent nucleoli. Syncytial cells were observed sparsely. Although the pancreas had been radiologically followed for 9 years due to the presence of a suspected cystic lesion, the pancreas did not actually have any cysts. The distal portion of the pancreatic duct was dilated due to obstruction, but no neoplastic/metaplastic changes were observed. Immunohistochemical analysis revealed that the tumor was positive for cytokeratin (CK)-7 and CK-20, and focally positive for mucin (MUC) 5AC and MUC6. The tumor was negative for MUC2 and caudal-type homeobox (CDX) 2 (Additional file ). These staining patterns supported neither IPMN nor intraductal tubulopapillary neoplasm. Based collectively on these observations, the tumor was diagnosed as MCP.
Possible contribution of oncogenic gene mutations and microsatellite instability (MSI) to MCP carcinogenesis is mentioned in the literature; therefore, further pathologic characterization was performed. A KRAS codon 12 mutation (G12V) was detected in the tumor tissue. Immunohistochemical analysis for MutL homolog (MLH) 1, MutS homolog (MSH) 2, MSH6, and postmeiotic segregation increased (PMS) 2 demonstrated normal positive staining patterns, indicating microsatellite stability. Together with the family history that did not match the Amsterdam II/Bethesda criteria, Lynch syndrome was clinically ruled out. In situ hybridization for Epstein-Barr virus (EBV) peptide nucleic acid was negative.
Only a few papers have described the histopathologic characteristics and clinical outcomes of MCP, and the pathogenesis of this malignancy is largely unknown. Clinicopathologic features of 20 MCPs in the literature and the present case are summarized in Table [–]. Although a better prognosis compared to usual ductal adenocarcinoma of the pancreas is suggested, 15 patients died of disease (70%), 11 within 1 year of diagnosis. This indicates that MCP essentially has a poor prognosis, even though some patients experience longer survival compared to patients with more common ductal adenocarcinomas. Six patients survived for ≥ 24 months, and two survived for ≥ 5 years. The present patient has been followed for 29 months without recurrence, which may be due in part because she underwent surgical intervention of stage I disease, after watchful waiting for 9 years. None of previous MCPs was reported to have watchful surveillance prior to surgery.
Previous studies of MCP suggest two possible genetic pathways: KRAS mutation and MSI. In the literature, four of five high-MSI cases had wild-type KRAS, whereas all KRAS-mutant MCPs (n = 7) showed microsatellite stability (Table ). These findings indicate that aberrations in these two pathways may occur in a mutually exclusive manner in patients with MCPs. According to The Cancer Genome Atlas (TCGA) network analyses of typical pancreatic ductal carcinomas, KRAS mutation is the most frequent genomic event (140/150, 93%) while MSI is not observed []. Therefore, MSI in the five MCP patients should be noted as a potentially specific event. In contrast, KRAS mutation alone cannot distinguish MCP from typical pancreatic ductal adenocarcinomas. Four of seven patients with KRAS-mutant MCP died within 1 year; these outcomes are similar to those of patients with advanced typical ductal adenocarcinomas. If KRAS-mutant MCPs share other common molecular signatures with typical ductal adenocarcinomas, such as TP53 mutation and copy number losses of cyclin-dependent kinase inhibitor (CDKN) 2A and SMAD4 [, ], characteristic histology in these cases may depend on inflammatory events unrelated to genetic background. One case of microsatellite-stable MCP showed positivity for EBV RNA []. The current patient experienced an episode of acute pancreatitis. In situ hybridization for EBV was negative, suggesting that EBV infection was not associated with this case. Although the WHO classification of MCP is based on morphological characteristics such as pushing growth of highly pleomorphic carcinoma cells, including syncytial cells, no specific markers have been identified that distinguish KRAS-mutant MCP from undifferentiated/poorly differentiated ductal adenocarcinomas. Together with genomic divergence, inflammation-related episodes in a few MCPs allow us to hypothesize that MCP potentially consists of more than one subtype and that adventitious events such as acute infection may contribute to the histopathology. Detailed molecular characterization using larger numbers of MCP cases should be conducted in future studies. |
pmc-6057863-1 | A 63-year-old man was evaluated for anemia (hemoglobin 11.8 g/dl) and hypoalbuminemia (albumin 3.7 g/dl) in another hospital. He had been diagnosed with gastric polyposis 5 years ago. He underwent esophagogastroduodenoscopy, which showed multiple reddish polyps accompanied by bleeding and erosion throughout the stomach (Fig. ) and two elevated lesions with irregular margins in the anterior wall of the corpus (Fig. ) and lesser curvature of the angular region (Fig. ) of the stomach. Histopathological diagnosis of the two elevated lesions by biopsy showed well-differentiated adenocarcinomas. He was referred to our hospital for treatment of gastric polyposis with gastric cancers. He had no medical history except for gastric polyposis, no family history, and no physical findings such as skin pigmentation or abnormalities of the hair and nails. Blood biochemical tests were negative for tumor markers (carcinoembryonic antigen, 0.6 ng/ml; carbohydrate antigen 19–9, 6.7 U/ml). Computed tomography showed gastric wall thickening, but no lymphadenopathy or distant metastasis. Colonoscopy showed only a polyp in the transverse colon, with a histopathological diagnosis of adenoma. The clinical stage was T1a N0 M0 stage IA according to the Japanese Gastric Cancer Association staging system (14th edition). He underwent laparoscopy-assisted total gastrectomy with D1+ dissection and Roux-en-Y esophagojejunostomy. The resected specimen revealed numerous small and large polyps throughout the stomach and two elevated lesions in the corpus and angular region, respectively (Fig. ). Histopathological examination showed the polyps to comprise edematous lamina propria with hyperplastic foveolar epithelium and cystically dilated glands, indicating hamartomatous polyps (Fig. ). The elevated lesion in the corpus was a well-differentiated adenocarcinoma, restricted to the mucosa (Fig. ). The other elevated lesion in the angular region was a well-to-poorly differentiated adenocarcinoma invading the submucosa (Fig. ) with lymphatic permeation in the submucosa and muscularis propria detected by immunohistochemical staining with D2-40 (Fig. ). The carcinoma showed tubular formation in the mucosa (Fig. ), dedifferentiating gradually as it invaded the submucosa (Fig. ). Seven of 50 lymph nodes were metastasized by carcinoma cells, which was histopathologically similar to the primary tumor (no. 4d and 7). The final pathological stage was T2 N3 M0 stage IIIA. After receiving informed consent, we analyzed the patient’s genomic DNA to obtain a definitive diagnosis of hamartomatous polyposis. Genomic DNA was extracted from formalin-fixed, paraffin-embedded specimens of hamartomatous polyps and carcinoma, and target genes were comprehensively analyzed by next-generation sequencing with a multiple cancer-associated gene panel. The analysis identified somatic mutations in APC, KRAS, TP53, and ERBB2 genes in carcinoma, but failed to detect any germline mutations, including in SMAD4, BMPR1A, or PTEN, in hamartomatous polyps and carcinoma. However, based on the few characteristic physical findings and the histopathological features of the polyps, the final diagnosis was juvenile polyposis restricted to the stomach with gastric cancers. The patient was discharged on postoperative day 8 and has been monitored carefully with no adjuvant chemotherapy, by his request. There is no evidence of recurrence 16 months after surgery. |
pmc-6058375-1 | A 72-year-old man visited a hospital with submental tumors without B symptoms. He and his family had no history of hematologic disease. Laboratory tests showed normal blood cell counts. There were no atypical cells in the peripheral blood. Serum lactate dehydrogenase (LDH) levels were within the normal range however, the soluble interleukin-2 receptor (sIL-2R) levels were elevated (1095 U/mL). The computed tomography (CT) scan showed tumorous masses in the nasal cavities (40 × 26 mm) and the paranasal sinuses, submental masses (right 23 × 15 mm, left 19 × 11 mm), and enlarged multiple jugular lymph nodes. Positron emission tomography/CT (PET/CT) showed abnormal uptake of 18F-Fluorodeoxyglucose (FDG) in each lesion. The maximum standardized uptake values for the bilateral ethmoid sinuses and right submental masses were 13.0 and 4.4, respectively (Fig. ).
The histology of the biopsy from nasal cavity masses showed diffuse infiltration of large lymphoid cells with centroblast-like or immunoblast-like features. In immunohistochemistry the large lymphoid cells were positive for CD20, CD79a, CD5, bcl-2, bcl-6, and MUM-1 and negative for CD3, CD10, cyclinD1, CD56, SOX11, and TIA-1 (Fig. ). The Ki-67 labeling index was approximately 90%. Moderate level of c-myc protein was observed in about 60% of tumor cells. Weak to intermediate expression of cyclin D2 was observed in only 10% of tumor cells. In situ hybridization investigations for Epstein-Barr virus (EBV) encoded small RNA did not detect EBV. IGH-BCL2 translocation was not detected by polymerase chain reaction. No break of MYC and BCL6 were detected by fluorescent in situ hybridization. G-banding investigation showed the following karyotype: 46, XY, − 6,add(9)(p22), add(12)(p13), − 19, add(22)(q13), +mar1, and + mar2. G-banding, flow cytometry analysis, and cytological examinations on bone marrow smear specimens did not reveal involvement of lymphoma cells. Thus, a diagnosis of CD5-positive DLBCL (non-germinal center B-cell like type according to Hans algorithm) of the nasal cavity was established. After administration of 8 cycles of R-THPCOP (rituximab, pirarubicin, cyclophosphamide, vincristine and prednisolone) with 3 cycles of intrathecal chemotherapy, consisting of methotrexate and cytarabine, complete remission was achieved. Eight months after the first chemotherapy administration, local recurrences occurred in the left nasal cavity, left submental node, bilateral internal jugular nodes, and epipharynx. The patient was therefore given 4 cycles of the DeVIC regimen (dexamethasone, etoposide, ifosfamide and carboplatin) as salvage therapy.
Although abnormal 18F-FDG uptake on PET/CT disappeared from the nasal cavities and the paranasal sinuses after the second round of therapy, the patient suffered from respiratory disturbance, fever and general fatigue without lymph node swelling. Laboratory tests showed normal white blood cell counts, anemia (hemoglobin 8.2 g/dL), and thrombocytopenia (51 × 103/μL). Serum levels of LDH, sIL-2R, and ferritin were elevated (757 U/L, 5770 U/ml, and 1681 μg/L, respectively). CT images showed splenomegaly, but no tumorous lesion anywhere in the body. No apparent recurrence was observed in imaging studies, but there were elevated levels of serum markers and respiratory disturbance of uncertain cause, which clinically suggested intravascular recurrence of CD5-positive DLBCL. Therefore, a random skin biopsy was performed. The random skin biopsy of the left thigh revealed atypical large lymphoid cells within the lumens of the small blood vessels in the deep dermis and subcutis. Tumor cells were localized in intravascular spaces and did not invade the extravascular stroma. In immunohistochemical analyses, these cells showed positive expression for CD79a, PAX5, CD5, bcl-6, and MUM-1 and negative expression for CD20, CD3, CD4, CD8, and CD10 (Fig. ). The positivity rate of cyclin D2 was less than 1%. Bone marrow smear specimens showed hemophagocytosis (HPC) (Fig. ). According to proposed hemophagocytic lymphohistiocytosis diagnostic criteria by Filipovich et al [], hemophagocytic lymphohistiocytosis was clinicopathologically diagnosed. Lymphoma cells were not detected in smear and histological specimens from the bone marrow biopsy, but G-banding of bone marrow cells showed complex karyotypes, suggesting a minimal residue of neoplastic cells in the bone marrow. The histological diagnosis was the Asian variant of intravascular lymphoma, which was suspected to be the purely intravascular recurrence of CD5-positive DLBCL primarily arising from nasal cavities. The patient died 3 weeks after the recurrence was diagnosed. |
pmc-6058415-1 | An 84-year-old woman with hypertension presented to the emergency department with epigastric pain, nausea, and dizziness for 3 hours. A 12-lead electrocardiogram showed a junctional rhythm at rate of 40 and 2 mm inferior ST-elevations with lateral ST depressions. High-sensitivity troponin-I level was 0.01 ng/mL. Initial management included aspirin, clopidogrel, and intravenous heparin, and she was subsequently taken emergently to the catheterization laboratory. Attempts to engage the right coronary artery (RCA) were unsuccessful despite using multiple guide catheters. The left coronary system showed no angiographic evidence of coronary artery disease with left to right collaterals. Contrast injection in the right coronary sinus suggested ostial total occlusion of the RCA (). Probing with a coronary wire near where the RCA ostium was presumed to be located was associated with an increase in the heart rate with an idioventricular rhythm and resolution of inferior ST-elevation. The RCA was then easily engaged with a guide catheter. Angiographic evaluation of the RCA showed a smooth vessel with no evidence of coronary artery disease except for abrupt termination of the distal PL2 branch (). A computed tomography angiogram was then done to explore the cause of the right ostial occlusion and revealed an aortic root thrombus (21 × 16 mm) with extension into the right coronary sinus, together with near complete obliteration of the left atrial appendage with another large thrombus ( and ). Serial electrocardiograms demonstrated paroxysmal atrial fibrillation with complete resolution of inferior ST-segment elevation. Subsequent troponin-I levels peaked at 74 ng/mL. A transthoracic echocardiogram showed inferobasal septal hypokinesis and ejection fraction of 45%. A brain magnetic resonance imaging obtained secondary to mental status changes that occurred a few hours after the procedure showed multiple embolic cerebral infarcts and complete occlusion of the left internal carotid artery. The patient was treated with intravenous heparin and bridged to warfarin therapy. She was discharged home in good condition on hospital day 5. Follow-up 6 months after the index hospitalization revealed no symptoms or signs of disease recurrence. |
pmc-6058420-1 | A 29-year-old South Asian male with no significant medical history presented to the emergency department with a 14-day symptom complex of persistent, high-grade fever refractory to antibiotics and antipyretics, malaise, and anorexia with a 10-pound weight loss. There were no recent medications, ill contacts, or travel history. His vital signs affirmed normotensive blood pressures, a resting sinus tachycardia of 110 beats per minute, and pulse oximetry of 98% on room air with a mild pyrexia of 38.8°C. Physical examination revealed bilateral conjunctivitis with chemosis, a strawberry tongue glossitis, palmar desquamation, and ichthyosis (see , respectively). There was no evidence of lymphadenopathy or dermatologic manifestations, such as rash.
Recent pertinent laboratory investigations (see ) included a leukocytosis and notable thrombocytosis, normal comprehensive metabolic panel, markedly elevated inflammatory markers of erythrocyte sedimentation rate, and C-reactive protein. An extensive infectious disease diagnostic workup indicated negative blood, urine, and stool cultures and normal tests for human immunodeficiency virus, mycobacterium tuberculosis, hepatitis B and C, influenza A and B, adenovirus, echovirus, coxsackie virus, dengue, malaria, leptospirosis, mycoplasma, legionella, Epstein-Barr virus, cytomegalovirus, and Clostridium difficile toxin. An in-depth immunological panel revealed no evidence of vasculitides or rheumatological disease, such as systemic lupus erythematosus, rheumatoid arthritis, Sjogren’s syndrome, polyarteritis nodosa, the polyangiitis spectrum, and cryoglobulinemia. A potential adverse drug reaction was not entertained as the patient was not administered any recent therapeutic or complementary alternative agents. Cardiovascular testing with both an electrocardiogram and echocardiogram were normal and advanced imaging with a pan-body computed tomography scan was also unremarkable. He was deemed to have an incomplete presentation of KD and was initiated on high-dose enteric-coated aspirin (Bayer HealthCare Pharmaceuticals LLC, Berlin, Germany) 325 mg every 8 hours, as well as single infusion of intravenous immunoglobulin (GammaGard, Baxter International Inc, Glenview, IL) at a dose of 2 g/kg over a 12-hour period. Subsequently, his clinical syndrome gradually resolved over the ensuring hospitalization as his pyrexia de-effervesced along with steady improvement of his inflammatory markers. He did not receive any glucocorticoids or immunomodulating therapies. He was safely discharged after 1 week of inpatient care on low-dose aspirin monotherapy with gastroprotective proton-pump inhibitors and subsequently scheduled for a dedicated cardiac computed tomography angiogram that did not reveal any CAAs at a later outpatient clinic appointment (2 weeks from index hospitalization). |
pmc-6058470-1 | A 49-year-old male with a diagnosis of CF presented to his routine CF outpatient department complaining of feeling generally unwell. He reported increased cough, but this was predominantly non-productive. There was a drop in lung function, from a baseline forced expiratory volume in one second (FEV1) of 2.39 l (65% of the predicted volume) to 2.19 l (60% predicted). A sputum sample was obtained following chest physiotherapy and sent for routine culture on blood agar, chocolate agar, Sabouraud agar, Staphylococcus agar, m-Kleb agar and cepacia selective agar. Given the non-specific symptoms and mild drop in FEV1, it was agreed that no immediate treatment was required and a follow-up in 4 weeks’ time was arranged.
Co-morbidities of the patient included osteoporosis and pancreatic insufficiency; he was also receiving maintenance treatment for allergic bronchopulmonary aspergillosis (ABPA) in the form of oral anti-fungal therapy and long-term low-dose oral corticosteroids. Cultured respiratory samples in the previous year had consistently grown non-epidemic
Pseudomonas aeruginosa. The patient was receiving a continuous alternating inhaled anti-pseudomonal antibiotic regime in the form of tobramycin (TOBI 300mg BD) and aztreonam lysine (Cayston 75mg tds). The diagnosis of CF was made in adulthood and was based upon the presence of bilateral upper zone bronchiectasis on a chest CT scan and a raised sweat chloride level following a sweat test. Initial genetic testing revealed one copy of the F508del mutation, a second mutation was not identified despite extended screening. Family history included a younger sister who had died aged 23 years from pancreatitis. Serum immunoglobulin testing at the annual screen performed two months prior was within normal limits aside from a chronically raised IgG anti-aspergillus of 154 mg/L.
A sputum sample taken at the clinic appointment was positive for
P. aeruginosa, and extended 10 day incubation on cepacia selective agar resulted in isolation of a cream coloured colony. The colony was identified as
Elizabethkingia miricola by MALDI-TOF (matrix-assisted laser desorption/ionisation time-of-flight) mass spectrometry. At the next appointment, worsening symptoms were observed, including increasing shortness of breath, wheeze and productive cough. There was a further drop in FEV1 to 1.91 L (52% predicted) (
). An oral course of chloramphenicol (500 mg four times a day) along with prednisolone (30 mg daily) for 2 weeks was commenced and a further sputum sample was obtained. Chloramphenicol was chosen empirically based on a previously observed clinical response to the agent and also patient preference to avoid ciprofloxacin due to skin photosensitivity. The sputum culture taken prior to treatment initiation was again positive for
P. aeruginosa and
E. miricola.
A further 4 weeks later, symptoms were somewhat improved and FEV1 had increased to 2.19 l (60% predicted). However, another 2 weeks later, symptoms deteriorated again, with an associated decline in lung function (FEV1, 1.95 l; 53% predicted). Sputum cultures from the previous encounter were again positive for
P. aeruginosa and
E. miricola. Sensitivities from previous samples revealed
E. miricola resistant to meropenem and ceftazidime, but sensitive to piperacillin/tazobactam and ciprofloxacin (CIP). A 2-week course of oral CIP (750 mg thrice daily) was therefore commenced.
The patient noted an improvement in symptoms and at the next clinic appointment FEV1 had improved to 2.08 l (57% predicted). Sputum then grew
P. aeruginosa and yeast only. A further four subsequent sputum samples 1, 4, 8 and 12 months later have grown
P. aeruginosa but no
E. miricola, and lung function returned towards baseline. |
pmc-6059516-1 | A 66-year-old African American female with a past medical history of refractory immunoglobulin G (IgG) lambda MM, essential hypertension, and chronic kidney disease presented to the emergency department with five days of right upper quadrant pain.
Her MM was diagnosed one year prior when she presented with altered mental status, uremia, hypercalcemia, hypoalbuminemia, and paraproteinemia. A skeletal survey at that time revealed multiple thoracic spinal lytic lesions and an eroding soft tissue mass at the level of T10. Further evaluation revealed a very high IgG level, elevated M protein band, and a kappa/lambda ratio <0.01 (normal 0.26-1.65). A biopsy from the soft tissue mass revealed a plasmacytoma. Radiation therapy was initiated for 10 days. She received three cycles of bortezomib and dexamethasone followed by two cycles of bortezomib, dexamethasone, and lenalidomide. Her disease progressed, and a subsequent bone marrow biopsy revealed hypercellular bone marrow with 70% atypical plasma cells. The patient subsequently received seven cycles of carfilzomib, lenalidomide, and dexamethasone. She was not a candidate for bone marrow transplantation given the high plasma cell burden.
On her current presentation, the pain was sudden in onset, intermittent, worse with eating, and without radiation. The pain was associated with nausea and anorexia, but she was without any change in bowel habits. She denied any previous similar episodes. Upon physical exam, the patient was in distress but remained alert and oriented. Her vital signs were all stable. She exhibited right upper quadrant abdominal tenderness without rebound or guarding. Her initial labs are presented in Table . The patient was admitted to the hospital for further evaluation of her abnormal labs and supportive treatment.
The patient was started on intravenous hydration and was made nil per os. An abdominal ultrasound revealed a distended GB with sludge (Figure ). The GB wall was thickened up to 9.5 mm, and the sonographic Murphy sign was positive. The common bile duct and common hepatic duct measured 6.3 mm and 3 mm, respectively. The liver measured 18.3 cm and exhibited normal echogenicity. There were no intraparenchymal masses or fluid collections. The portal and hepatic veins were patent.
The patient was diagnosed with acute cholecystitis. Intravenous piperacillin-tazobactam 3.37 g every eight hours was initiated, and the patient was referred for open cholecystectomy given her overall condition and lactic acidosis. Intra-operatively, the GB was thickened and firm but not overly distended or perforated. The GB was dissected from the liver edge, and a liver biopsy was performed successfully.
The pathology report from the cholecystectomy revealed chronic cholecystitis with involvement of the GB submucosa and serosa by abnormal plasma cells with lambda light chain restriction (Figure ). Subsequently, Congo red stain of the GB sections revealed apple-green birefringence throughout the submucosal areas consistent with amyloid deposits. The liver biopsy exhibited abnormal plasma cells in periportal locations with lambda light chain restriction as well; Congo red stain was not done on the liver sample.
The patient declined any further treatment for MM and decided to proceed with hospice care. She was discharged home with comfort measures. |
pmc-6059518-1 | A 62-year-old woman with a past medical history of hypertension is admitted to the emergency room due to altered mental status noticed on awakening. She was somnolent, bradycardic and hypertensive, with a heart rate of 50 beats/min and blood pressure of 165/82 mmHg. On the neurological exam, the patient had a Glasgow Coma Scale (GCS) of 12 points (ocular: three points, verbal: four points, motor: five points), the patient was apathetic with non-fluent speech and normal nomination; no other abnormalities were found. The laboratory workup at admission was normal. An emergency brain computed tomography (CT) showed bilateral thalamic hypodensities. A 12-lead electrocardiogram, chest X-ray, transthoracic echocardiogram, carotid and vertebral Doppler ultrasound were performed, all of them reported normal. Magnetic resonance imaging (MRI) of the brain showed bilateral thalamic hyperintensities in diffusion-weighted imaging (DWI), T2 and fluid-attenuated inversion recovery (FLAIR) sequences (Figure ).
The etiology of the stroke remained cryptogenic after the approach. The patient was discharged after eight days with improvement in alertness. She persisted with episodes of somnolence, apathy, bradylalia and hypophonia without any motor deficit. |
pmc-6059519-1 | A 66-year-old gentleman presented with a four-month history of a progressive weakness of finger extension involving all digits of the right hand. On initial clinic evaluation, he had 0 out of 5 strength in the extension of all fingers, including the thumb, but without any weakness of wrist extension. A radial deviation of the wrist was not documented. He did not have any pain or numbness. Electromyography (EMG) and nerve conduction study (NCV) showed posterior interosseous nerve (PIN) entrapment at the arcade of Frohse (AF). Magnetic resonance imaging (MRI) showed a homogeneously hyperintense lesion within the supinator muscle on T1-weighted imaging (Figure ).
The lesion measured 3 cm medial to lateral, 1.5 cm in depth, and 3.3 cm anterior-posterior. Mass effect was seen on the neurovascular bundle at the AF. A 10-cm incision was made along the posterior border of the brachioradialis (BCRL) muscle (Figure ).
The fascia in between the brachioradialis (BCRL) and extensor carpi radialis longus (ECRL) was incised and a plane was developed using blunt dissection (Figure ).
The fascia of the extensor carpi radialis brevis (ECRB) was divided sharply and the lipoma was visible, arising deep to the superficial head of the supinator (Figure ).
The radial nerve bifurcation into the superficial radial nerve and PIN was identified. The AF and the superficial head of the supinator muscle were divided until the lipoma was fully exposed (Figure ).
The PIN was draped across the outer surface of the lipoma and then continued its course deep to the remaining superficial head of the supinator (Figure ).
There was a swelling of the PIN proximal to its compression site by the lipoma and the AF. The PIN nerve fibers appeared slightly spread at the attachment site of the lipoma. The PIN was stimulated with a nerve stimulator probe and there was no response distally. We did external neurolysis and swept the PIN laterally to allow for the complete excision of the lipoma (Figure ).
Pathology revealed mature adipose tissue consistent with lipoma without any nerve fibers. At a four-month follow-up visit, the patient regained 4 out of 5 strength of finger extension in all digits. |
pmc-6059520-1 | A 28-year-old African American female with no significant past medical or surgical history presented with complaints of dysphagia to liquids, globus sensation, frequent throat clearing, and cough for approximately the past two to three years. She also had intermittent regurgitation without blood or undigested food. A review of systems was otherwise negative for weight loss, odynophagia, dyspepsia, reflux, post-prandial bloating, early satiety, shortness of breath, recent illness, fevers, and chills. She had no sick contacts. Family history was non-contributory. The patient's social history included current cigarette smoking of 0.5 pack per day for the past one to two years, daily smoking of marijuana, and no alcohol consumption. The patient was not taking any medications. She had undergone a barium swallow within the past two years, with no pathologic findings. For these symptoms, she underwent an initial esophagogastroduodenoscopy with the findings of a white sub-mucosal lesion in the mid-esophagus at 35 cm. Biopsies were not taken of the mass at that time, but there were biopsies of the proximal and distal esophagus surrounding the lesion, with pathology indicating benign mucosa with no eosinophilic infiltrate. Esophageal, gastric, and duodenal mucosa was otherwise unremarkable. She was referred to a gastroenterologist at our institution for a follow-up endoscopic ultrasound.
EUS was conducted and showed a single 4-mm sub-mucosal nodule in the middle third of the esophagus at 35 cm from the incisors. The nodule was yellow and firm with a negative pillow sign. This is displayed in Figure . Sonographically, the lesion was oval and described as intramural, sub-epithelial, anechoic, and within the deep mucosa in layer 2 with well-defined borders. This image is seen in Figure . Saline was injected to raise the lesion and band ligation with snare mucosal resection was performed. The result is shown in Figure . The pathology of the tumor revealed a granular cell tumor with peripheral and deep margins negative. She was referred to medical oncology for further work-up.
Medical oncology reassured the patient that a granular cell tumor is typically a benign mucosal tumor with a low risk of recurrence and malignant degeneration. It was recommended that she continue to follow with gastroenterology for surveillance endoscopy. She was also given a referral for an esophageal motility specialist due to her continued dysphagia. She did have subsequent esophageal manometry conducted, which showed 60% peristalsis, indicating a degree of impaired peristalsis, along with the presence of a manometric hiatal hernia. She continues to follow with her primary care physician and gastroenterologist for further management but continues to have a degree of dysphagia. |
pmc-6059522-1 | A 67-year-old right-handed female hairdresser working in a hair salon for 30 years with predominantly female customers presented to a plastic surgeon with a three-month history of a swollen, painful, and intermittently discharging lesion in the pulp of her third finger. She denied fever, chills, history of trauma, or having noted any foreign body in her wound. She reported a long-standing history of limited cutaneous systemic sclerosis, Raynaud’s syndrome, and frequent small ulcers at her fingertips. A swab grew coliform bacteria after she took repeated courses of antibiotics which failed to resolve her symptoms. The patient mentioned having to remove embedded hairs regularly from the skin of her hands, feet, and even her chest, but denied similar reactions in the past. Regular medication included ramipril and vitamin D.
On physical examination, the surgeon documented a swollen, tender, erythematous, finger pulp with a small, crusty papule that did not produce discharge and was without evidence of lymphangitis. Plain radiographs suggested a foreign body, without osteomyelitis (Figure ). Differential diagnoses included other foreign bodies from trauma; bacterial, viral or fungal infection, an arthropod bite, and calcinosis infection. A calcinosis nodule was noted in the pulp of her right fourth finger (Figure ). Because of her occupation, the surgeon diagnosed pilonidal sinus with secondary abscess formation.
The surgeon recommended surgery and performed a fish mouth incision under local anaesthesia, incorporating an ellipse around the sinus, and excising the sinus cavity. The surgeon washed and sutured the wound. As the wound showed signs of infection three days post-operatively, the patient received a one-week course of oral amoxicillin/clavulanic acid. Sutures were removed on the twelfth post-operative day; however, because of renewed signs of infection, the patient took a further two-week course of oral flucloxacillin. The wound healed, and the patient returned to work one month after surgery. Three months postoperatively, she remains asymptomatic but has chosen not to use gloves. |
pmc-6059524-1 | A 15-year-old, otherwise healthy male, presented to our ED for evaluation of a left knee injury. The patient stated that just prior to arrival he was playing soccer when he felt a "pop" just below his left knee as he was about to kick the ball. This was followed by immediate pain. The patient had been unable to bear weight on that knee ever since. In the ED, the patient reported his pain as an 8/10 in severity, worse with movement. Physical exam demonstrated an edematous left knee anteriorly. There was significant tenderness to palpation just inferior of the left patella. The patient’s knee was held in minimal flexion, without the ability to fully extend. He was neurovascularly intact throughout.
Radiographs were obtained of the left knee, tibia, and fibula. Radiographs demonstrated a fracture of the left tibial tubercle. The visualized osseous structures were otherwise in anatomic alignment and the joint spaces were preserved. There was no significant left knee joint effusion identified.
Given the location of the fracture and the patient’s inability to extend at the knee, the clinician had a high suspicion for patellar tendon involvement. A POCUS exam was performed by the treating physician using high-resolution ultrasound (10-5 MHz linear array transducer). The ultrasound revealed a cortical irregularity and interruption at the left proximal tibia, consistent with a displacement of the tibial tuberosity. The patellar tendon was confirmed to still be attached to the avulsed portion (Figure ).
The patient was admitted and scheduled for surgery the following day to correct the left tibial avulsion fracture. Open reduction and internal fixation of the left tibial tubercle was performed successfully. |
pmc-6059524-2 | A 31-year old man presented to the ED with a complaint of left knee pain after a 10-foot fall from a ladder three days prior. On exam, the patient was unable to fully extend the left knee. He had a marked effusion without warmth or erythema. The patient was neurovascularly intact throughout. Radiographs of the left knee were performed which demonstrated cortical irregularity of the medial tibial plateau consistent with medial tibial plateau fracture. Given the extent of the edema and limitation in range of motion of the knee, the decision to perform a POCUS was made to assess for further injury.
The ultrasound examination was performed by the treating emergency physician using a 12-4 MHz linear array transducer. The examination revealed significant hemarthrosis of the left knee. The patellar tendon showed no evidence of rupture. A bony avulsion over the anterior tibial spine was visualized that had not been noted on initial radiography in the ED (Figure ).
The patient was seen by orthopedics in the ED. After evaluation of the patient and discussion of the ultrasound findings, the radiographs were reviewed once again and it appeared that there was likely a missed anterior tibial spine fracture. The patient was placed in a knee immobilizer and discharged with strict instructions to follow up with orthopedics for outpatient surgery. |
pmc-6059527-1 | A 60-year-old woman presented for evaluation of a pruritic plaque located on the sacral region that had been present for a year. She had received silicone oil injections into the site two years prior to developing the new skin lesion. Neither she nor her family had psoriasis.
Cutaneous examination revealed yellowish firm verrucous plaques bilaterally located on the skin of her gluteal cleft (Figure ). The plaques were considered to be a lichenoid granulomatous reaction to the silicone. The patient received four monthly sessions of intralesional triamcinolone acetonide (2 ml of 10 mg/mL); she also used a high-potency topical corticosteroid (clobetasol, 0.05% ointment) once a day for four months, which provided no improvement.
The initial plaques became red and a new 6-mm, erythematous plaque with a silvery scale developed on her right buttock (Figure ). The morphology of the new right buttock plaque was different than that of her presenting skin lesions; the clinical differential diagnosis of the new plaque included squamous cell carcinoma, psoriasis, and lichen planus. Dermatoscopic evaluation of the new plaque showed a scaly surface with red globules characteristic of the papillary blood vessels observed in psoriasis (Figure ).
Six months after her final triamcinolone injection, a punch biopsy of the 6-mm plaque was performed. Microscopic examination of the epidermis demonstrated confluent parakeratosis with neutrophilic microabscesses, regular acanthosis, elongated rete ridges, and a thin or absent granular layer (Figure ). The upper dermis showed chronic inflammation consisting of lymphocytes, edema, and vascular ectasia with tortuous capillaries. These pathologic findings established the diagnosis of psoriasis.
In addition, there were abundant histiocytes with vacuolated cytoplasm throughout the dermis. Stains for bacteria, fungi, and mycobacteria were negative. Correlation of the patient’s history and these pathologic findings were diagnostic of a silicone granuloma.
Immunohistochemical studies were performed. The dermal mononuclear cells were predominantly positive for CD4 and the epidermal mononuclear cells were predominantly positive for CD8 (Figure ). These immunohistochemistry findings are characteristic of psoriasis [].
The entire area of psoriasis was excised in the biopsy specimen; therefore, no treatment of the lesion was required. The patient was started on oral hydroxychloroquine, 200 mg twice a day for two months, to treat the granuloma; there was no improvement. However, at her eight-month follow-up, the patient’s psoriasis lesion had not recurred and she had not developed any additional lesions of psoriasis. |
pmc-6059531-1 | A 51-year-old female had a history of hypertension and stage 4, human epidermal growth factor receptor 2 (HER-2) positive, gastric adenocarcinoma with peritoneal, bone, and lymph nodes metastasis. She presented with an episode of a tonic-clonic seizure. She did not have any previous history of seizures. The patient was diagnosed with stage 4 cancer two years ago. She was started on trastuzumab, cisplatin, and capecitabine for three cycles and continued trastuzumab until her presentation (the last cycle was four weeks prior to presentation). Her vital signs and labs are presented in Table .
A brain MRI with and without contrast (Figure ) revealed bilateral, symmetric areas of T2-weighted-fluid-attenuated inversion recovery (T2-FLAIR) hyperintensity involving the occipital and posterior parietal lobes. There was no evidence of acute stroke, intracranial hemorrhage, or intracranial metastasis. These findings were suggestive of PRES. The multidisciplinary tumor board committee decided that PRES could be attributed to the toxic effect of trastuzumab or hypertension. The patient was discharged on levetiracetam with a plan to continue trastuzumab, strictly control blood pressure (BP), and repeat the MRI in three months. During that period, the patient’s blood pressure was controlled on multiple encounters with all readings < 140/90. A repeated brain MRI with and without contrast revealed persistent T2-FLAIR hyperintensity in the occipital and posterior parietal lobes suggestive of PRES. The tumor board decided to hold trastuzumab for one month. The patient was admitted with a worsening epigastric pain and concern for disease progression. Esophagogastroduodenoscopy (Figure ) revealed a large, malignant-appearing, partially obstructing mass in the gastric body with no active bleeding. |
pmc-6059532-1 | An obese 70-year-old man presented with rapidly progressive, asymptomatic pigmentation of six-months' duration affecting his lower extremities. The pigmentation started in a small area on his calf and spread rapidly. His medical history was significant for uncontrolled type-two diabetes mellitus, hypertension, and chronic back pain. Following a back surgery, the patient experienced an infected hematoma with S. aureus and suffered from recurrent S. aureus infections. As a result he was managed with 100 mg prophylactic minocycline twice daily for six years.
On physical examination, blue-grey hyperpigmentation extended below the knees into a confluent patch over bilateral shins and dorsal surfaces of the feet (Figure ). Evaluation of the soles revealed heavy pigmentation in the non-dependent areas with complete sparing of weightbearing surfaces (Figure ). A perifollicular pigment distribution was noted near the proximal extensor aspect of his legs. No other areas of skin were involved including palms, body creases, or oral mucosa.
On histopathology, the papillary and superficial reticular dermis contained pigment in perivascular macrophages and within dermal dendrocytes (Figure ). The complex pigment was positive with both the Perl's Prussian blue method for iron (Figure ) and the Fontana-Masson method for melanin (Figure ).
After discussion of the available treatment options, the patient opted not to pursue therapy given the intensity of pigmentation and his significant comorbidities. |
pmc-6059655-1 | Our patient is a 53-year-old male who worked as a coal miner. In spring of 2017, he noticed enlarging scalp nodules and right hip pain. He also complained of fatigue but was otherwise asymptomatic. Because of the hip pain and nodules, he came to the emergency department where a CT scan showed an enlarged right frontal scalp mass that measured about 4 cm (). MRI also revealed a right frontal scalp mass and extensive vasogenic edema localized to the right frontal lobe with a 5 mm midline shift at the foramen of Monroe (). A subsequent CT chest, abdomen, and pelvis was performed and showed a lytic lesion in his ilium and a single enlarged right hilar lymph node (not shown). A follow-up nuclear medicine bone scan demonstrated multiple areas of increased uptake concerning for metastasis (). One of the largest areas was in the right frontal scalp. After discussion with the patient and the need for a definitive diagnosis, he was consented for subtotal resection of the right frontal scalp mass.
He was taken to the operating room where a right frontal scalp incision was performed for subtotal resection of likely metastatic cancer. The mass was primarily located within the right frontal scalp but extended through the skull into the right frontal cortex. It did not however appear to be involved with the brain parenchyma. The resection consisted of removing scalp mass and taking a core biopsy from the specimen. Histopathology of the biopsy showed a diffuse and monotonous infiltrate composed of small cells with irregular nuclei, condensed chromatin and inconspicuous nucleoli (). On immunohistochemistry, the cells are CD20 positive B-cells and co-express CD10 and Bcl-2 but do not express CD3, 5, 23, 43 and cyclin D1 (). CD21 was present highlighting a disrupted follicular dendritic cell meshwork. Ki-67 proliferation rate was low (less than 20%). By flow cytometry, a dim kappa light chain-restricted B-cell population was identified expressing CD10. The FISH assay revealed t(14;18) IGH (immunoglobulin heavy chain locus)-Bcl-2 fusion. These findings support the definitive diagnosis of follicular lymphoma, WHO grade 1, diffuse pattern stage IV.
After definitive diagnosis was made, the patient was then referred to radiation oncology for follow-up. By time of presentation to radiation oncology, the patient was showing symptoms of lower extremity numbness, personality changes, and some memory loss. The radiation oncologist discussed the diagnosis with the patient and his family and came up with a treatment plan to combat the unusual presentation of follicular lymphoma with the intracranial extension from the calvarium. The treatment plan consisted of repeat MRI’s; local (palliative) XRT (4 Grays over two fractions) and systemic chemo-immunotherapy (6 cycles) followed by rituximab maintenance. Lumbar puncture was done a month after resolution of vasogenic edema to assess leptomeningeal spread later proven negative for malignant cells. MRI showed complete resolution of the right scalp mass post-radiotherapy and after the patient had already underwent 3 cycles of chemo-immunotherapy. PET/CT done approximately 3 months since therapy initiation showed no suspicion for abnormal hypermetabolic activity, which suggested the absence of active malignancy. |
pmc-6060187-1 | An 81-year-old Japanese woman with a 2-week history of abdominal distension presented to our hospital for assessment. The patient did not have a past history of malignancy, with only a cesarean section as a relevant feature in her history. Endoscopic examination at a previous hospital revealed the presence of early carcinomas in the stomach and distal esophagus. The patient was referred to our hospital for endoscopic resection.
Laboratory data, as well as serum carcinoembryonic antigen, squamous cell carcinoma antigen, and cytokeratin-19 fragment levels, were close to normal limits. Endoscopic examination revealed mild granular elevated lesions, with slightly depressed irregular mucosa, extending from the anterior wall to the right wall of the distal esophagus (Fig. ). This irregular mucosa further extended from the anterior wall to the left wall, with the boundary on the oral side being unclear (Fig. ). A superficial elevated tumor-like lesion was also observed in the lower body of the stomach, with a diameter of about 10 mm (Fig. ). Based on the endoscopic biopsy specimen, this gastric lesion was diagnosed as a well-differentiated tubular adenocarcinoma. On the other hand, the preoperative biopsy specimens of the esophageal tumor showed intraepithelial tumor cells, which were isolated or in clusters, and consisted of large clear cells with atypical nuclei and prominent nucleoli. No glandular structures and no obvious intracytoplasmic mucin were observed. These histological findings were consistent with a malignant melanoma, with a pagetoid spread of invasive adenocarcinoma or squamous cell carcinoma, and Paget’s disease as a differential diagnosis. Immunohistochemically, the tumor cells diffusely stained positive for CK7 and partially for CK20, with negative staining for S100 protein and HMB-47. On the basis of these results, a diagnosis of malignant melanoma was excluded. All human mucin core proteins examined (MUC2, MUC5AC, and HIK1083) were also negative. Furthermore, p53 overexpression was observed in all tumor cells. From these results, we diagnosed the tumor as Paget’s disease or a pagetoid spread of an esophageal carcinoma. On enhanced computed tomography (CT) and [18F]-fluoro-deoxy-glucose positron emission tomography (FDG-PET)/CT imaging, no lymph node and distant metastases were identified (Fig. ). FDG uptake was observed only in the lower body of the stomach, with these lesions considered to reflect past endoscopic submucosal dissection (ESD) for early gastric cancer (Fig. ). Although we could not define the margin of the tumor, previous reports of esophageal Paget’s disease indicated a wide extension of Paget cells in the esophageal mucosa. On the basis of these findings, we planned ESD for the treatment of the gastric lesion, followed by a thoracoscopic esophagectomy (TE) and hand-assisted laparoscopic proximal gastrectomy (HALPG) for the treatment of esophagogastric Paget’s disease. Histological examination of the ESD specimen revealed a well-differentiated mucosal adenocarcinoma (11 mm × 8 mm) without lymphovascular involvement. The lateral and vertical margins of the resected tissue were free of tumor cells, and ESD was considered as a curative resection.
TE and HALPG, with lymph node dissection, were performed at 43 days after the gastric ESD. Regional lymph nodes were dissected, with no metastatic invasion identified in the thoracic and abdominal lymph nodes. Reconstruction with a gastric tube was performed after esophagectomy, using a hand-assisted laparoscopy procedure via a post-sternal route.
Histological examination of the surgically resected specimen was performed. Macroscopically, the mucosa of the lower thoracic and abdominal esophagus was slightly irregular and depressed, with submucosal capillary hyperplasia (Fig. ). No tumor mass or ulceration was observable in the resected material. With iodine staining, the mucosa of the lower esophagus, which was congruous with the irregular and depressed area, did not stain. Furthermore, isolated small iodine-stained foci were observed in the gastric mucosa adjacent to esophagogastric junction (Fig. ). Microscopically, these foci consisted of squamous metaplasia of the gastric mucosa. The sectioned tissues were stained with hematoxylin and eosin (HE) and periodic acid-Schiff (PAS)/Alcian blue. As well, immunohistochemical staining for CK5, CK7, CK20, CDX2, MUC2, MUC5AC, HIK1083, p53, p63, S100, and HMB-45 was performed. Microscopic examination revealed neoplastic cells, with a large atypical nucleus and pale-staining cytoplasm, in the lower part of the esophageal epithelium, occurring either singly or in clusters (Fig. ). Reserve cell hyperplasia (Fig. ) and squamous metaplasia (Fig. ) were observed in the gastric mucosa, adjacent to the esophagogastric junction, and an intraepithelial squamous cell carcinoma (SCC) was observed within the squamous metaplasia (Fig. ). Components of the intraepithelial squamous cell carcinoma were identified following the Paget cells in the esophageal squamous epithelium. Only a few Paget cells stained positively for PAS/Alcian blue. Immunohistochemically, negative staining for CK5 (Fig. ) and p63 was identified in Paget cells, with positive staining for CK7 (Fig. ). The Paget cells showed no reactivity for intestinal mucin (MUC2) and gastric foveolar mucin (MUC5AC), but a few Paget cells were positive for gastric gland mucin (HIK1083). On the other hand, the intraepithelial SCC showed positive reactivity for CK5 and p63, but no reactivity for CK7 and CK20. Overexpression of p53 was observed in both Paget cells (Fig. ) and the intraepithelial SCC. Histochemical and immunohistochemical results are summarized in Table , and schematic representation of the distribution of Paget cells and squamous cell carcinoma of the esophagogastric junction is shown in Fig. . Because there were any findings of Barrett’s esophagus neither endoscopically nor pathologically, macroscopic esophagogastric junction and pathological squamocolumnar junction were identical. Regional lymph node metastases were not identified on pathological assessment.
At the last follow-up, conducted 2 years and 8 months after surgery, the patient’s health status was fairly good, with no recurrence of the EMPD or carcinoma.
EMPD was first described in a patient with urinary bladder carcinoma in 1889 []. Since this initial report, EMPD has been described in various sites of the body, most commonly the vulva, perianal region, scrotum, penis, and axilla []. EMPD is subdivided into primary and secondary types on the basis of the presence or absence of associated malignancies. Primary EMPD is thought to be derived from an underlying neoplastic transformation of the intraepidermal portion of a sweat gland, whereas secondary EMPD is caused by the intraepidermal spread of neoplastic cells, typically derived from an underlying adenocarcinoma [, ].
Esophageal Paget’s disease is quite rare, with only a few cases having been reported [–]. Yates and Koss [] described esophageal Paget’s disease associated with a poorly differentiated squamous cell carcinoma of the distal esophagus, whereas Norihisa et al. [] reported a case of adenosquamous carcinoma of the esophagus with pagetoid extension of the adenocarcinoma component. Therefore, both of these cases were diagnosed as a pagetoid growth of an advanced esophageal carcinoma. On the other hand, Nonomura et al. [] and Matsukuma et al. [] reported esophageal Paget’s disease associated with an early underlying carcinoma, one being an intraepithelial carcinoma and the other, a minimally invasive adenocarcinoma of the esophagus. Ishihara et al. [] also reported a case of an early invasive carcinoma, which consisted of pagetoid squamous cell carcinoma in situ combined with early invasive components and choriocarcinoma at the metastatic site. Abraham et al. [] reported a close relationship between Paget cells in the esophagus and an underlying poorly differentiated adenocarcinoma in the esophagus or esophagogastric junction. From these reports, all previously reported cases of Paget’s disease of the esophagus were thought to be secondary to an underlying carcinoma, although the malignant component varied in each case. In our case, we identified an SCC component, with squamous metaplasia and reserve cell hyperplasia, in the gastric mucosa of the esophagogastric junction, which was followed by Paget cells. However, unlike typical Paget’s disease, only few Paget cells were positive for PAS/Alcian blue staining and immunohistochemically positive for gastric gland mucin, whereas a strong p53 overexpression was observed in both SCC component and Paget cells.
Reserve cells are small undifferentiated cells found as a single layer beneath the endocervical columnar epithelium. They have the capacity to transform into both endocervical columnar and squamous epithelium in the endocervix []. Reserve cell hyperplasia and epithelial dysplasia are frequently observed in the squamocolumnar junction of the cervix uteri, and squamous cell carcinoma of the cervix uteri is considered to be derived from these changes []. Reserve cell hyperplasia and squamous cell metaplasia of the gastric mucosa are rare phenomena. In 1981, Takubo [] reported the resemblance of squamous cell metaplasia to reserve cell hyperplasia in the cervix uteri and considered squamous metaplasia or reserve cell hyperplasia with atypical change as a precursor of SCC in the esophagogastric junction. However, this hypothesis has not been fully elucidated. From histological findings and immunohistochemical results in our case, we speculate that the Paget cells were derived from the squamous cell carcinoma, developing in the squamous metaplasia and reserve cell hyperplasia of the esophagogastric junction. The difference in the pattern of expression of cytokeratin and p63 might reflect the glandular differentiation of tumor cells.
FDG-PET/CT imaging is currently accepted as the most accurate technique for exploring metastatic lesions of a solid tumor. The combination of metabolic and structural information provided by the PET and CT portions, respectively, has improved the accuracy of tumor staging, detection of recurrence, and therapeutic monitoring, having an enormous impact on patient management [, ]. In patients with EMPD, 18F-FDG PET/CT diagnosis of primary lesions is mainly dependent on the thickness of the lesions, whereas it is more sensitive for the diagnosis of lymph node and distant metastases []. In this case, thick primary lesions showed an intense uptake of 18F-FDG (SUVmax 14.9 and 7.5), whereas thin primary lesions showed only a mild 18F-FDG uptake (mean SUVmax 3.25 ± 0.24). Three of the 10 cases reported, however, showed no 18F-FDG uptake at primary site, as in our case. In 3 of these 10 cases with lymph node invasion and distant metastases of EMPD were upstaged by PET/CT, rather than conventional staging examination. To determine the appropriate treatment strategy for EMPD based on staging, PET/CT may play an important role, although some EMPD might be 18F-FDG negative.
Traditionally, EMPD has been surgically managed, especially in the early stage of the disease. Achieving adequate margins for the primary lesions is an important factor in reducing the risk of recurrence. In patients unfit for radical surgery, radiotherapy is proposed as alternative treatment, as long as invasive disease has been excluded []. In the surgical treatment of esophageal cancer, thoracoscopic esophagectomy is generally regarded, and accepted, as a minimally invasive surgery []. Biere et al. reported on the short-term benefits of minimally invasive esophagectomy for patients with resectable esophageal cancer, with prevention of pulmonary infection being an important benefit. Furthermore, thoracoscopic esophagectomy with three-field lymphadenectomy, pursuing best loco-regional control by surgery, is a feasible and safe alternative treatment commonly performed in Japan []. Our case was diagnosed as early stage Paget’s disease of the esophagus by endoscopic, CT, and PET/CT findings. But because of the unclear and extensive proximal margin of the tumor, a thoracoscopic esophagectomy was performed to obtain a wide local excision of the EMPD. However, in the pathological diagnosis, Paget’s disease and squamous cell carcinoma were identified in the mucosal layer. Therefore, curative resection with ESD could have been possible. ESD is an effective treatment for superficial esophageal neoplasms. Funakawa et al. [] reported a success rate of 99.4% (164/165) for en bloc resection and 90.9% (150/165) for complete en bloc resection, with no instance of fatal complications. However, the reported incidence of esophageal strictures after ESD for near-circumferential or circumferential esophageal neoplasms is extremely high at 88–100% []. Post-ESD strictures seriously lower patients’ quality of life, being associated with several symptoms, including dysphagia, nausea, vomiting, weight loss, and even cachexia. In contrast, esophagogastric junction cancers have a high rate of submucosal invasion, irrespective of size, compared to non-junctional cancers []. Furthermore, the rates of positive lymphatic and/or venous invasion were remarkably higher in junctional cancers []. Therefore, when ESD is performed for near-circumferential junctional cancer as in our case, attention must be paid to the occurrence of esophageal stricture. It is important to evaluate the risk of recurrence by pathological diagnosis and to consider whether additional treatment, including surgical resection, should be performed. |
pmc-6060433-1 | A 67-year old female with acute respiratory failure due to severe AS was referred for consideration of TAVI. She underwent ventricular septal defect repair at the age of 10. At the age of 57 she presented with progressive breathlessness secondary to severe mitral regurgitation and underwent a mitral valve replacement with a 27 mm Carpentier Edwards Magna Valve. Six years later she developed further progressive dyspnoea and underwent an urgent redo mitral valve replacement for a stenotic prosthetic mitral valve. A 33 mm Carbomedics Valve was inserted into the mitral position. She has end-stage renal disease requiring haemodialysis.
Transthoracic echocardiography showed a degenerated bicuspid aortic valve with a peak velocity of 5.2 m/s (peak gradient 108 mmHg; mean gradient 68 mmHg, area of 0.43 cm2). The mitral valve prosthesis was functioning normally. Invasive coronary angiography revealed normal coronary arteries. Following a Heart team discussion, it was decided to perform TAVI due to her previous mitral and redo mitral valve replacement. The aortic valve was a Sievers Type 0 bicuspid valve. The aortic annulus minimum diameter was 17 mm, maximum diameter 24 mm, perimeter 69 mm, and an area of 355 mm2 (Figure ). The common femoral arteries measured 6 mm bilaterally. A technical concern regarding TAVI in this lady was the interaction of the TAVI valve with the mitral valve prosthesis and the risk of valve embolization during deployment. The MSCT identified the rim between the mitral valve prosthesis and the aortic annulus to measure 10 mm, which was felt to provide an adequate landing zone for the THV, with the risk of valve embolization deemed to be small.
The right femoral artery was cannulated and a 14 French E-sheath was introduced. The annulus area was felt to be between two valve sizes (23and 26 mm Sapien S3 valves). The valve was crossed retrogradely using an Amplatz Left1 diagnostic catheter and a “straight” standard wire. The wire was then exchanged with a pre-shaped small Safari wire (Boston Scientific, Natick, MA, USA). A balloon aortic valvuloplasty was performed and simultaneous aortogram was performed. An aortogram confirmed that during inflation the 20 mm balloon adequately filled the aortic annulus and was in contact with the hinge points (Figure ). Coronary filling was also visualized. It was therefore decided to implant a 23 mm Edwards Sapien S3 Valve. Careful attention was given during valve positioning ensuring the valve skirt was positioned just below the hinge points. The valve was confirmed to be well positioned with good hemodynamics without paravalvular regurgitation. Following valve deployment, MSCT was performed confirming circular expansion of the valve and no infringement on the mitral valve prosthesis (Figure ).
In cases of BAV, large aortic annuli pose a challenge for the TAVI operator as large annular dimensions fall outside the recommended sizing ranges for currently available THVs. There are concerns regarding significant paravalvular leakage post TAVI deployment in this group of patients. In certain cases with large annuli the inter-commisural space can be used for the landing zone with good effect. Improvements in THV design (in particular the sealing skirt) and technical considerations such as landing the valve in the inter-commisural space means that these patients can be treated with good outcomes. This forms the rationale of some TAVI operators who suggest to size and land the THV 4 mm above the measured annulus. |
pmc-6060433-2 | A 58 year-old male with end stage renal disease due to IgA nephropathy who had previously undergone a renal transplant which had failed was declined for redo renal transplantation. He had progressive dyspnoea and a history of syncope on exertion. The transthoracic echocardiogram confirmed severe stenosis of a BAV with a peak velocity of 3.9 m/s (peak gradient 61 mmHg, mean gradient of 39 mmHg and area of 0.89 cm2). There was also the presence of moderate aortic regurgitation. Coronary angiography revealed non-flow limiting coronary artery disease. MSCT confirmed a Sievers Type 1 bicuspid valve with a partial raphe between the right and left cusps. The aortic annulus was large with a perimeter measuring 98 mm, mean Sinus of Valsalva diameter of 40 mm and an inter-commisural distance of 29 mm (Figure ). Both common femoral arteries were of large caliber and measured 8 mm on the left and 9 mm on the right. Following discussion by the Heart team and careful analysis of the MSCT it was felt that TAVI was technically possible if deployed at the inter-commisural space.
TAVI was performed under local anesthetic and the right femoral artery was cannulated and a 20 Fr sheath was inserted. The left femoral artery was cannulated and a 7 Fr sheath was inserted. The left femoral vein was used for insertion of a temporary pacemaker lead. The bicuspid aortic valve was crossed retrogradely using a Amplatz Left 1 diagnostic catheter and a hydrophilic coated straight tipped Glidewire. This was exchanged for a pre-shaped Safari wire and placed in the left ventricular apex. A balloon valvuloplasty was performed using a 25 mm balloon and a simultaneous aortogram was performed. The aortogram revealed a leak of contrast into the left ventricular cavity during balloon aortic valvuloplasty and felt to be an inadequate seal. A 34 mm Evolut CoreValve was deployed at the level of the leaflet tips, with hemodynamics and echocardiography confirming a good result with no significant PVL. The peak velocity across the TAVI valve was 1.8 m/s, peak gradient of 14 mmHg and area of 1.11 cm2. |
pmc-6060474-1 | A 71-year-old man was admitted to our hospital with dysfunction in the right hip without a history of hip injury. The patient had local repeated pain over 4 months and gradually lost the capacity to stand and walk because of the hip pain. However, the patient did not report resting pain while sleeping. Before his illness, the patient’s regular activities were walking and going up and down stairs without strenuous exercise. Physical examination revealed tenderness and restricted range of motion of the right hip. Percussion pain was found in the direction of the right lower limb alignment. The length of the right leg was 4 cm shorter than the left leg. Computed tomography (CT) scans with three-dimensional reconstruction showed the deficiency of the right femoral head and neck (Fig. ). Based on the self-reported clinical history, and the physical and radiologic examination, we firstly presumed that end-stage avascular necrosis of the femoral head, cancer metastasis or tuberculosis (TB) might be the causes of the bone defect. Subsequently, we carried out a series of radiologic and laboratory examinations to validate our judgement. However, in relevant laboratory examinations, including alkaline phosphatase, cancer markers, white blood cell (WBC) count, erythrocyte sedimentation rate (ESR), high-sensitivity C-reactive protein (hs-CRP), TB and purified protein derivative (PPD) test, the results suggested no abnormal values. In addition, magnetic resonance imaging (MRI) and emission computed tomography (ECT) showed a signal change in the right acetabular, suggesting the disappeared femoral head and neck were eroded by pathologic tissue (Fig. ). Thus, cancer and TB would not be the pathologic cause of the bone defect. Subsequently, the titre of the patient’s rapid plasma regain (RPR) test was 1:128, which indicated the probability of syphilis. The RPR test possesses the advantage of high sensitivity to syphilis and low specificity. Collagenosis, chronic liver diseases, TB and HIV infection may lead to a false-positive result of RPR test by raising the antibody titre. Our patient denied having a history of these diseases. Furthermore, no evidence existed of the related clinical and laboratory findings, such as negative HIV test. The diagnosis of syphilis was eventually validated by the positive result of the Treponema pallidum haemagglutination assay (TPHA) test [, ], which is highly specific to syphilis. Percutaneous needle biopsy of synovium in the right hip joint also revealed that periangitis, obliterative endarteritis and an intense infiltration of plasma cells accompanied by scattered macrophages and lymphocytes [, ] were in the lesion. These correspond to the characteristics of syphilitic lesions. The patient denied having had previous rash or genital ulcers but admitted having unprotected sexual intercourse more than 1 year earlier. Thus, we concluded that syphilitic arthritis caused by early syphilis, rather than cancer metastasis or TB, results in the deficiency of the right femoral head and neck.
To confirm the duration of syphilis, we repeatedly asked the patient his history in detail. The patient admitted that he once sought treatment for pain in the right knee in the Division of Pain Management in our hospital 4 months ago. At that time, the patient reported that the pain in the right knee had lasted for 1 year while the symptom had little influence on the joint function. He had a fever, which peaked at 38.2 °C. The WBC count was 12.5 × 10^9/L. ESR was 72 mm/h. The right lower limb swelled, especially the knee. The puncture synovial fluid culture showed no growth. The values of TB, PPD test and cancer markers were in the normal limits. X-ray film showed osteoarthritis of the right knee joint. Then, the physicians diagnosed osteoarthritis accompanied with active infection, with unknown cause. The patient improved and was discharged after the treatment of painkiller, intravenous mezlocillin, oral meloxicam and the joint injection of sodium hyaluronate.
After becoming familiarised with the disease course, we planned to perform a THA on the patient, to which the patient consented. The operation was performed in the left recumbent position, under general anaesthesia and through the lateral approach. After opening the joint capsule, clear synovial fluid was discharged and was sampled for bacterial culture. Thickened joint capsule was accompanied by synovial hyperplasia. Extensive bone defect was found on the lateral wall of the right acetabulum. Granulomatous tissue occupied both the acetabular and stump of the femur neck and substituted for the femoral head and neck. No purulent fluid existed. An excisional biopsy was performed from the site of the stump of the femur neck. The frozen section examination suggested that the biological tissue was pathologically modified by syphilis (Fig. ). The specific features were obliterative endarteritis and a perivascular infiltration with plasma cells and lymphocytes. Furthermore, we observed degenerated vessels and osteonecrosis. After a radical joint debridement, the patient received THA as we originally planned. We performed bone graft to rebuild the extensive acetabular lateral wall defect. The synovial fluid culture showed no growth postoperatively. The paraffin and the frozen sections examinations were consistent.
The intraoperative and postoperative x-ray examinations of the pelvis indicated a favourable implantation of the prosthesis (Fig. ). The patient underwent standard postoperative physical therapy, including a rehabilitation programme [, ]. In addition, the patient received intravenous penicillin 4.8 million units twice daily and azithromycin 0.5 g daily for 12 days and subsequent intramuscular injections of benzathine benzylpenicillin at a dose of 2.4 million units per week for 4 weeks. One year after the last intramuscular injection, an RPR test was performed, and the result suggested a negative finding of syphilis.
We asked the patient to exercise in bed within 3 months after the operation. Afterward, he began weight-bearing exercises. After our treatment, the patient recovered full mobility without pain. At the follow-up of 1, 3 and 5.5 years after the operation, the patient presented with a pain-free and functional hip prosthesis without local signs of infection and loosening. The values of hs-CRP and erythrocyte sedimentation rate (ESR) are also in normal range. X-ray examination revealed the prosthesis location was stable without signs of loosening or migration and that bone healing was satisfactory at the acetabular bone graft site (Fig. ). |
pmc-6060536-1 | The patient is a 59-year-old male with a postoperative union of a left tibial plateau fracture who, after open reduction and internal fixation, underwent surgery for implant removal at a local hospital (Fig. ). The first day after surgery, at approximately 9 a.m., he complained of severe pain in the wound region and developed a fever in which the highest temperature reached was 39 °C. Upon examination, the patient was conscious without chills and other discomfort, and the incision was severely swollen and filled with hemorrhagic content. Analgesic therapy was given, but the patient did not feel pain relief. Early on the second morning, the patient started to become irritable and apathetic and the incision was inflamed. The following afternoon, at approximately 3 p.m., the patient felt increasing pain out of proportion to the physical findings accompanied by progressive swelling, numbness, and weakness of the limb. The skin around the wound was darkened, and tension blisters were visible (Fig. ). The patient was delirious on the third morning after surgery, the systemic skin turned yellow, and there was a large amount of dark red, bloody discharge drainage from the incision with bubbles of gas, and a foul, sweetish, unpleasant odor was smelled in the incision. A physical examination revealed subcutaneous crepitus extending along the length of the limb, roentgenograms revealed the accumulation of gas in soft tissue (Fig. ), the lower limb skin temperature decreased, the dorsal artery of the foot could not be touched, and the patient had no response to pain in the lower extremities. Anaerobic infection gas gangrene was highly suspected, and the patient was transferred to our hospital at approximately 7 p.m.
Left lower extremity incision decompression was carried out immediately. Upon incision, the musculature was found to be extensively necrotic and crepitant, the appearance of the affected muscles was purplish red and brown with a characteristic foul odor, there was an absence of bleeding from the divided surface, and the musculature failed to contract on transverse section. Also, the secretions attached to necrotic muscles were dirty brownish and irritating (Fig. ). The smear of secretions revealed more bulky Gram-positive bacilli. Subsequently, a left femoral amputation was performed the following night at approximately 11 p.m., and the stump was left open after meticulous hemostasis (Fig. and ). At the same time, general supportive therapy (fluid resuscitation, blood transfusions, plasmapheresis) and antibiotic therapy (penicillin) were given to stabilize the patient’s vital signs intraoperatively and postoperatively. After surgery, the stump was dressed regularly, and the stump was closed when the condition of the patient improved and the culture of the discharge from the granulating stump showed an absence of gas bacilli. Finally, with the follow-up treatment, the patient recovered and was discharged 2 weeks after left femoral amputation. |
pmc-6060540-1 | Patient 2: A 58 years-old woman came to our attention for tachycardia. Laboratory evaluation showed mild hyperthyroidism and thyroid ultrasound revealed a multinodular goiter. Thyroid scintiscan confirmed the diagnosis of a toxic multinodular goiter, with a 2 cm hyperfunctioning left nodule. A FNAB evaluation performed on the most relevant non-hyperfunctioning nodule (15 mm on right lobe) showed was benign features (Thy 2). Serum calcitonin was borderline increased (13.2 pg/ml). Due to the symptoms of hyperthyroidism and dysphagia, the patient underwent total thyroidectomy and the final histology showed struma with CCH and medullary multifocal microcarcinoma (maximum diameter 6 mm on left lobe). |
pmc-6060543-1 | A 22-year-old man was referred to our hospital with complaints of left eye redness and swelling for more than a month. He had no history of nausea or vomiting, but he also complained of mild blurred vision, double vision and occasional headache for more than a week.
On further questioning, the patient revealed a history of a trauma. He was involved in a motor vehicle accident and received a head injury that involved basilar skull fractures and resulted in a subarachnoid haemorrhage and epidural haematoma. The patient received conservative treatment and was discharged from a local hospital following the alleviation of symptoms. However, the patient developed symptoms in the left eye 4 months after the injury. These symptoms included blurred vision, swelling, and hyperaemia of the left eye.
He denied a history of diabetes and hypertension. There was no history of pneumonia, tuberculosis, or any other infectious diseases. There was also no history of fever, sickness or any surgery. There was no loss of appetite or loss of weight. He was a non-smoker with no allergies to any medications.
On examination, the visual acuity and intraocular pressure in the right eye of the patient were 6/5 and 17 mmHg, respectively, and the corresponding values for the left eye were 4/5 and 25 mmHg. On physical examination, there was no eyelid swelling, exophthalmos, ptosis or visual decrease of the right eye, and this eye was almost normal except for slight hyperaemia (Fig. ). Extraocular muscle movement showed no limitation in the right eye (Fig. ). However, the left eye exhibited eyelid swelling, mild ptosis, exophthalmos, chemosis, and corkscrew hyperaemia centred on the cornea (Figs. and ). Furthermore, there were some limitations of eye movement, and abduction and elevation of the left eye was − 1, yet movement on adduction and depression were normal (Fig. ). The left anterior chamber was slightly shallow and quiet, but the right anterior chamber was normal. The cornea was clear with intact corneal sensation in both eyes, and there was no relative afferent pupillary defect and no anisocoria noted. The vitreous and lens were clear. Fundus examinations did not show disc swelling, obvious vascular dilatation or tortuosity, cotton wool spots or haemorrhages of either eye. The resident doctor previously doubted the presence of glaucoma, and he was admitted to our hospital. Optical coherence tomography (OCT) and field of vision tests did not reveal any abnormalities. By contrast, the MRI of the periorbital region revealed a broadening of the left superior ophthalmic vein, slight thickening of the left lateral rectus muscle, and an expansion of the left cavernous sinus, yet the right superior ophthalmic vein, extraocular muscles and cavernous sinus were almost normal (Fig. ). These results aroused suspicion of the left CCF, so the patient was transferred to the neurosurgery department. The neurological examination was normal with the exception of a periorbital bruit on the left side. Thus, a tentative diagnosis of a left CCF was made. Surprisingly, cerebral angiography revealed a crevasse in the inner side of the intracavernous segment of the right internal carotid artery, the right cerebrovascular (CVA) filling delay, and arterial blood traversing the intercavernous sinus to reach the contralateral cavern, which resulted in the dilatation of the left ophthalmic vein (Fig. ). Therefore, the patient was ultimately diagnosed with right CCF. Embolization surgery was suggested, but no additional treatment for the eyes was mentioned since most studies show that symptoms in the eyes could be completely relieved after aetiological treatment.
Detachable balloon catheter embolization surgery was performed after several days. The surgery was successful, and the patient recovered well. All symptoms, including the redness and swelling of the left eye, the blurred vision, and the double vision, were resolved. On physical examination prior to the patient’s discharge, the visual acuity was improved to 5/5, and the intraocular pressure was 18 mmHg in the left eye, which was within the normal range. Additionally, the exophthalmos, chemosis and hyperaemia of the left eye were significantly relieved (Fig. ). |
pmc-6060754-1 | The patient is a six-year-old Caucasian boy, the younger in a family of two children (his sister was born with sensorineural hearing loss due to a common mutation of GJB2:35delG and received cochlear implants; her speech and development were normal after long-lasting successful rehabilitation). The patient was born after a normal, full-term pregnancy, delivered via normal, vaginal delivery at 40 weeks, with APGAR scores of 10/10. Early development was affected by recurrent upper respiratory tract infections frequently treated with antibiotics. At the age of 2, he was developmentally on target in motor and cognitive skills, used language for communication, and displayed normal interests, social activities, and behaviours that were appropriate for his age. At the age of 3, his parents noticed speech regression and behavioural deteriorations with unexplained irritability, tantrums, aggression, impaired reciprocal social interactions with limited and stereotyped interests and activities, and unusual responses to visual and auditory stimuli (i.e., moderate impairment to sort out multiple objects in visual scene, an inability to discern the orientation between objects in space resulting in fine motor dysfunction, and anxious reactions to normal hearing stimuli). Consequently, the patient was diagnosed with early childhood autism, mental retardation, and attention-deficit hyperactivity disorder (ADHD) after psychological and psychiatric evaluations, using the Diagnostic and Statistical Manual of Mental Disorders, 4th Edition, Text Revision (DSM-IV-TR) criteria (American Psychiatric Association ). The diagnoses allowed him to access a specialized programme for children with autism in a government-funded early intervention programme. He has since participated in behavioural treatments organized in a kindergarten for autistic children. At the age of 4, the patient underwent a detailed paediatric and neurologic evaluation which did not reveal any clinically meaningful abnormalities. The 1,5 T MRI brain scans were normal. The sleep-phase electroencephalogram (EEG) revealed bilateral, synchronous and asynchronous centro-temporal spikes and spike-wave complexes; however, epileptic-like events had never been observed in the patient’s behaviour. Due to increased behavioural problems and ongoing EEG abnormalities, a pharmacologic treatment with valproic acid was introduced and maintained for 12 months; but it had no effect on behaviour or the EEG. Concomitantly, at the age of 5, methylphenidate, an ADHD medication, was introduced and maintained for 6 months; however, it did not affect attention span while significantly worsening core symptoms of autism. The patient was re-evaluated at the age of 6 by a child neurologist with no new findings.
Genetic testing for Fragile X syndrome was negative. A genome-wide search for imbalances as causes of ASD was also negative. However, a PET examination was performed that revealed a marked decrease in 18FDG glucose metabolism in temporal areas of the brain and within basal ganglia and cerebellum. These findings prompted the introduction of KD therapy as recommended by the International Ketogenic Diet Study Group (Kossoff et al. ).
At the age of 6, the patient scored 43 points on the adapted Childhood Autism Rating Scale (CARS). According to this scale, scores of 34 and over at the age of 6 indicate severe cases of ASD (Schopler et al. ). The patient had difficulty in controlling and maintaining his emotions, and was over-active. He also suffered from many auditory phobias and object obsessions, had difficulty with social interactions, and obsessively asked questions; however, nonverbal communication was normal. Of note, children with these types of symptoms are often diagnosed with high-functioning autism. The intellectual development of the patient, as measured by the Wechsler Intelligence Scale for Children- revised (WISC-R) at the age of 6 years and 1 month, revealed a Full Scale IQ of 82 - a border-line score for being considered intellectually disabled (Wechsler ); the Performance Scale IQ of 62 was lower than average, but the Verbal Scale IQ of 102 was average.
The KD was introduced at the age of 6 years and 1 month, soon after the neuropsychological evaluation. Eligibility for the KD treatment was in concordance with the generally accepted guidelines (Kossoff et al. ). The recommended diet was a classic KD with a 2:1 ratio of fats to proteins + carbohydrates that was slowly introduced at home over a 4-week period. The patient achieved optimal ketosis, where his β-hydroxybutyrate level in serum was over 4.0 mmol/l and his stable blood glucose ranged from 65 to 78 mg/dL. After 1 month on this classic KD, the diet was switched per the parents’ request to a MAD to allow for 15–18 g of carbohydrates daily and more proteins; the MAD was maintained for the next five months. While on the MAD, urine ketones were moderate (over 40 mg/dL) consistently and β-hydroxybutyrate level in serum was over 2.0 mmol/l; the diet was well-tolerated. After five months on the MAD, the patient refused the required fat intake and, in accordance with dietary recommendations, he was placed on the LGIT. The LGIT limited carbohydrate intake to 40–60 g per day (approx. 10% of daily calories) and restricted carbohydrates from foods with known high glycemic index scores. After the introduction of the LGIT, the patient’s ketones were still detectable in urine at low to moderate levels (5–15 mg/dL). The patient also received vitamin and mineral supplements according to the recommended daily allowance for his age (Kossoff et al. ). Metabolic outcome was monitored at 1, 3, 6, and 12 months after diet initiation of the classic KD. Throughout the observation period, no clinically meaningful changes in blood laboratory parameters (including those relevant for liver and kidney functions, electrolytes, cholesterol, and lipid profiles) were observed. The levels of vitamin D as well as free and total carnitine were normal. No clinically meaningful abnormalities were also evident in urinalysis.
Of note, improvements in clinical outcomes were observed as early as 1 month after the classic KD initiation. They first included behaviour normalization with less hyperactivity and aggressive behaviours. The patient adhered to the diet according to his dietician’s recommendation and no side effects of the KD were observed, as mentioned earlier. Throughout the whole dietary treatment time, no psychopharmacological treatment was needed.
Another psychological evaluation was performed when the patient was on the LGIT at the age of 7 years and 5 months. This occurred 16 months after the initial classic KD implementation. During this second evaluation, the patient scored 27 points on the CARS scale - an improvement of 16 points relative to his first evaluation. On this scale, scores of 28–36 indicate mild to moderate cases of ASD, while lower (< 28) scores indicate minimal-to-no symptoms cases. Some of the improvements on the scale included: reduced hyperactivity, fear, anxiety, emotional reactions, and abnormal visual/auditory reactions, increased attention, improved use of objects, adaptability to changes, and communication abilities. The patient’s behavior had notably changed, especially in regard to his emotions. His communication abilities also improved. The intellectual development of the patient, as measured by the WISC-R at the age of 7 years and 5 months, also improved his Full Scale IQ increased from 82 to 99 (now considered average), Verbal Scale IQ increased from 102 to 113 (now considered average), and Performance Scale IQ increased from 62 to 83 (now considered slightly lower than average). |
pmc-6060766-1 | A 35-year-old woman presented with blurred vision and photopsia in both eyes for 3 months. Her BCVA was 20/63 OU (in each eye). Ophthalmoscopy and ophthalmic B scan of the right eye revealed bullous retinal detachment in the posterior pole (Fig. a, b). The patient was treated with oral prednisone at 30 mg per day for over 6 years for nephritic syndrome. FFA of the right eye revealed hyperfluorescent leakage in areas corresponding to exudative retinal detachment (Fig. c). OCT of the right eye disclosed neuro-retinal detachment (Fig. d). The left eye had focal retinal pigment epithelial detachment in the inferior retina. The right eye received a 50% dose of verteporfin PDT with a spot size of 5000 μm to cover the abnormal vascular area in indocyanine green angiography (Fig. e). One month later, the SRF was partly reduced (Fig. f, g), while 3 months later, there was retinal reattachment, and the complete absence of SRF was confirmed by ophthalmic B scan and OCT (Fig. h, i). At the 6-month examination after photodynamic therapy, the BCVA improved to 20/50 in the right eye, and a mottled appearance was observed in the fundus (Fig. j). FFA showed a mottled shape upon fluorescence transmission, and no fluorescein leakage was observed (Fig. k). ICGA showed hypofluorescence in the lesion area (Fig. l). |
pmc-6060766-2 | A 35-year-old man first noted visual loss in both eyes and was diagnosed with classic central serous chorioretinopathy; he received argon laser photocoagulation in the right eye at another hospital. Two years later at the age of 37, the patient experienced severe blurring in the left eye, with a BCVA of 20/80 in the right eye and 20/200 in the left eye. Ophthalmoscopy of the left eye disclosed exudative lesions in the macula and inferotemporal retina (Fig. a), which were confirmed as bullous retinal detachment by ophthalmic B scan (Fig. b). FFA revealed hyperfluorescent leakage in areas of exudative retinal detachment (Fig. c). OCT disclosed SRF, sub-retinal fibrin adjacent, and retinal folds in the lesion area (Fig. d). His left eye received a 50% dose of verteporfin PDT with two spots of 6000 and 3000 μm under the guidance of ICGA (Fig. e). One month after PDT, the SRF obviously decreased and sub-retinal fibrin disappeared based on ophthalmic B scan and OCT (Fig. f, g). Three months later, ophthalmoscopy and ophthalmic B scan showed that the exudative retinal detachment was resolved completely at the macula (Fig. h, i). FFA revealed a mottled appearance of transmitted fluorescence and no hyperfluorescent leakage (Fig. j), and OCT showed the complete resolution of SRF and the disappearance of retinal folds (Fig. k). ICGA also disclosed the disappearance of hyperfluorescent leakage and the mottled appearance that remained (Fig. l). At the 6-month examination, his BCVA improved to 20/40 in the left eye and remained stable. |
pmc-6060766-3 | A 38-year-old man with a history of blurred vision in the right eye for 1 year was diagnosed with CSC in the left eye, which was treated with argon laser photocoagulation 10 years ago. His BCVA was 20/63 in the right eye and 20/200 in the left eye. Ophthalmoscopy of the right eye revealed retinal detachment accompanied with yellowish, fibrinoid exudative lesions in the temporal macula (Fig. a). Ophthalmic B scan confirmed bullous retinal detachment in the right eye (Fig. b). FFA disclosed multiple intense sub-retinal leakage in areas corresponding to exudative lesion and in the superior retina (Fig. c). OCT disclosed large amounts of SRF in the macular and temporal retinal areas (Fig. d). His right eye received a 50% dose of verteporfin PDT with three spots under the guidance of ICGA (Fig. e). Ophthalmic B scan disclosed obviously reduced bullous retinal detachment 1 month after PDT (Fig. f), and his BCVA improved to 20/25. However, the SRF slowly resolved. Although the OCT image revealed a reduction in sub-retinal fibrin, the SRF remained and resolved slowly until the second month after PDT (Fig. g). Considering the slow resolution of SRF, the patient received a second 50% dose of verteporfin PDT in the right eye. We adjusted the therapeutic area with a spot size of 5000 μm under the guidance of ICGA. One month after the second PDT (3 months after the first PDT), ophthalmoscopy of the right eye revealed the disappearance of the yellowish, fibrinoid exudative lesions (Fig. h). Additionally, the reattached retina was observed on B scan, and SRF in the temporal area markedly decreased in the OCT image (Fig. i, j). OCT revealed nearly resolved SRF 2 months after the second PDT (Fig. k), and the SRF was completely resolved 3 months after the second PDT (Fig. l). The patient’s BCVA of the right eye improved to 20/20 in the third month after the second PDT and remained stable until the sixth month after the second PDT. No recurrence occurred during the follow-up of more than 6 months after the second PDT. |
pmc-6060766-4 | A 48-year-old man presented with blurred vision in the left eye for 2 weeks. He had a history of intravitreal injection of triamcinolone acetonide (TA) for a misdiagnosis of uveitis in the left eye 1 month prior to examination. Additionally, his left eye was treated with two periocular injections of dexamethasone, one intravitreal injection of conbercept and one application of laser photocoagulation within 1 month at other hospital. However, there was with no improvement of visual acuity. His BCVA was 20/20 in the right eye and 20/200 in the left when he came to our outpatient facility. Ophthalmoscopy of the left eye disclosed intraocular TA in the nasal retina and non-rhegmatogenous retinal detachment with multifocal exudative lesions in the posterior pole (Fig. a). An ophthalmic B scan revealed retinal detachment in the left eye (Fig. b). FFA showed multiple hyperfluorescent leakage in areas corresponding to exudative retinal detachment at baseline (Fig. c). OCT disclosed SRF at the area of macula and temporal retina (Fig. d). His left eye received a 50% dose of verteporfin PDT with two spots of 5000 μm and one spot of 3000 μm under the guidance of ICGA (Fig. e). One month later, an ophthalmic B scan revealed obviously reduced bullous retinal detachment, and OCT disclosed the decreased SRF (Fig. f, g). Three months after PDT, ophthalmoscopy and an ophthalmic B scan revealed the completely resolved exudative retinal detachment (Fig. h, i). FFA showed hypofluorescence, and ICGA revealed hypofluorescence in the lesion area (Fig. j, k). SRF on the OCT image disappeared, and the macula regained normal anatomic structure (Fig. l). At the 6-month examination, his vision acuity improved to 20/100 in the left eye, and no recurrence occurred. |
pmc-6060766-5 | A 50-year-old man presented with blurred vision in the right eye for a year. His BCVA was 20/200 in the right eye, while the left eye worsened to no light perception because of glaucoma at an early age. Ophthalmoscopy of the right eye disclosed non-rhegmatogenous retinal detachment in the posterior pole, and ophthalmic B scan confirmed the bullous retinal detachment (Fig. a, b). FFA revealed several hyperfluorescent leakages around the optic disc corresponding to exudative lesions (Fig. c). OCT of the right eye disclosed exudative retinal detachment with serious SRF, sub-retinal fibrin, and retinal folds (Fig. d). Five spots of 50% dose of verteporfin PDT were administered under the guidance of ICGA (Fig. e). One month after PDT, an ophthalmic B scan revealed obviously reduced bullous retinal detachment (Fig. f). SRF and sub-retinal fibrin decreased and the retinal folds disappeared from the OCT image (Fig. g). Three months after PDT, ophthalmoscopy and an ophthalmic B scan revealed that the bullous retinal detachment was completely resolved (Fig. h, i). A mottled shape was observed by fluorescence transmission, and no fluorescein leakage was found in the FFA image (Fig. j). OCT showed normal macula structure in the right eye (Fig. k). ICGA disclosed hypofluorescence in the lesion area (Fig. l). His BCVA improved to 20/40, with no recurrence during the follow-up of more than 6 months. |
pmc-6060766-6 | A 35-year-old man presented with blurred vision in the left eye for near 3 months. His BCVA was 20/25 in the right eye and 20/800 in the left eye. Ophthalmoscopy of the left eye revealed retinal detachment in the inferior retina (Fig. a). An ophthalmic B scan confirmed bullous retinal detachment in the left eye (Fig. b). FFA disclosed multiple hyperfluorescent leakages in areas of temporal retina and hypofluorescent exudative retinal lesions corresponding to retinal detachment in the inferior retina (Fig. c). OCT disclosed large amounts of SRF (Fig. d). His left eye received a 50% dose of verteporfin PDT with two spots of 5000 μm under the guidance of ICGA (Fig. e). One month after PDT, the SRF was partly resolved based on an ophthalmic B scan and OCT (Fig. f, g). Three months after PDT, SRF was completely resolved, as confirmed by ophthalmic B scan, OCT, and ophthalmoscopy (Fig. h–j). At the 6-month examination after photodynamic therapy, his BCVA improved to 20/80 in the left eye. An FFA image showed a mottled shape in fluorescence transmission, and no fluorescein leakage was found (Fig. k). An ICGA image showed the disappearance of hyperfluorescence leakage in the lesion area (Fig. l). |
pmc-6060782-1 | A 9-year-old girl sustained a growth plate fracture of the right distal radius (Salter–Harris type II). She was initially treated with cast immobilization following a closed reduction (Fig. a–c). Although the fracture healed after several weeks, wrist pain and unsightly appearance of the wrist developed within a year, following which she was referred for management. Physical examination revealed a visible radial deviation deformity of the wrist and prominence of the ulnar head with a complaint of ulnar-sided wrist pain although forearm rotation and the range of wrist flexion–extension were not impaired. Radiographs revealed a shortening deformity of the distal radius with an abnormal radial inclination of the articular surface (almost 0°; Fig. a), and CT revealed that the physeal bar existed at the center of the growth plate (Fig. b). CT scan was performed on both wrists to evaluate the deformity and for preoperative simulation with a low-radiation setting (scan pitch, 0.562:1; speed, 5.62 mm/rot, 30 mA, 120 kV) []. On the basis of these findings, she was diagnosed with partial physeal arrest, with significant growth remaining. A two-stage operation was planned to remove the physeal bar with the Langenskiöld procedure after gradual lengthening with distraction osteogenesis. The first stage aimed to correct the deformities of the wrist, and the second stage was intended to reestablish the physeal growth. Informed consent was obtained from the patient’s guardians to report the procedure. All procedures were approved by the Ethics Committee of the institution (registration number, 13558), and adhered to all of the recommended guidelines of the institution for an experimental investigation involving human subjects.
In the first operation, closed-wedge osteotomy was used to correct the distal radius, and lengthening was started using an external fixator (Orthofix MiniRail Fixator™; Orthofix Inc., Verona, Italy). Before the operation, 3-D computer models of the bilateral radius and ulna were created from the CT data. Referring to the standard mirror image of the contralateral counterparts, the spatial position of the planes for osteotomy was estimated. Additionally, precise information on screw positions and directions for the external fixator was gained followed by computational lengthening of the distal fragment of the radius by 25 mm (Fig. ). The operation was performed according to this preoperative planning and the osteotomy site was lengthened from 1 week postoperatively to 7 weeks (total lengthening, 25 mm; as planned). The external fixator was removed 18 weeks postoperatively when adequate maturation of the callus at the bone interval and complete correction of the deformities were confirmed through plain radiographs (Fig. a–c).
To plan the second operation, the affected radius was rescanned on CT after lengthening was complete. The scan revealed that the area of the osseous bar was approximately 20% of the growth plate. At this time, the patient was 11 years old with the predicted growth of approximately 25 mm in the distal ulna []. The 3-D computer models of the radius and the physeal bar were created using these data. In addition, the patient-specific guide was designed as a surgical guide to target the physeal bar model surrounded by multiple K-wires. PBR was performed using this patient-specific guide as described previously, and with careful debridement with a motorized shaver, confirmed the thoroughness of the bar excision for direct visualization using the 1.7-mm endoscope once the “physeal cartilage ring” was observed []. After that, the surgical bone wax was interposed into the space. Postoperatively, the affected limb remained immobilized for 2 weeks. After 2 years of PBR, no recurrence of the wrist deformities was observed, and the patient did not complain of any pain and restriction of the motion. Furthermore, radiographs demonstrated no growth disturbance and restoration of normal length of forearm bones, which remained constant since the first operation (Fig. a, b). The patient regained full activity of her wrist and was able to participate in athletics. |
pmc-6060966-1 | A 4-year-old boy presented with diphallia (). Initial physical examination revealed two completely developed penise with urine flow from both urethras and two anal dimples with anal atresia. Meconium flow from right urethra was observed upon closer examination. There was one testis on each side of the scrotum. On his first day of life, laparotomy was performed that showed duplicated rectum, colon, cecum, and appendix and duplication of 5 cm of terminal ileum. Ileostomy was performed from the proximal region of the duplicated bowel. Doppler ultrasonography (USG) showed two completely developed penises, two cavernous bodies, one spongious body, and normal vascular supply to each penis. Abdominal USG and magnetic resonance imaging (MRI) showed one kidney and one ureter on each side and two bladders. Right urethra was catheterized, and cystography revealed a large rectovesical fistula between the right colon and the right bladder (). Second cystography was performed via left urethra and showed no abnormalities (). MRI revealed two prostatic glands. Conventional urodynamic study was performed during the patient’s first year of life. Capacity of right half bladder was 50 mL and capacity of left side was 40 mL, while the normal expected bladder capacity is 63-70 mL. Compliances of half bladders were 8 and 7 cm H2O/mL, respectively.
Abdominoperineal pull-through was performed in patient’s first month of life. One of the right colons was removed after closing its fistula.
When the patient was 4 years old, cystoscopy through each urethra, right total penectomy, and right-to-left end-to-side urethral-urethrostomy were performed (). Cystourethroscopic examination revealed that both urethras, bladder necks, and bladders were normal. Because the left penis was closer to the midline, it was decided to perform right penectomy. After the dissection and excision of the two cavernous bodies, anterior urethra was dissected and removed. At this level, end-to-side urethra-urethrostomy was performed. Postoperative follow-up of 18 months was uneventful and without dilation of the upper urinary tract or any urinary tract infection (). On observation, the patient’s voiding was normal. Informed consent was obtained from the parents of the patient. |
pmc-6060973-1 | A 15-year and 11-month-old male patient was referred to our genetics unit at the age of 15 years. He was born at term to a third-degree consanguineous healthy parents with a healthy birth weight (3250 g), height (53 cm), and occipitofrontal circumference (34 cm). There was a prolonged labour, and the APGAR score was 7-8. His motor milestones were delayed, and he never walked alone. In addition, he had a social smile and could talk approximately 10 simple words. His seizures, although mostly absent, started at the age of 18 months and were well-controlled by valproic acid. Meanwhile, he also experienced clonic and generalized tonic–clonic (GTCS) and atonic seizures and had spasticity predominant in the lower extremities with no pathological reflexes. While electroencephalography revealed generalized spike-wave activities, electromyography and metabolic tests were normal. Furthermore, the brain magnetic resonance imaging (MRI) performed at the age of 3 years revealed moderate atrophy with prominent folia in the upper parts of the supratentorial cerebellar vermian region. Moreover, symmetric T2 hyperintensities were observed at the retroatrial periventricular deep white matter. Diffusion tensor imaging images obtained at the age 14 years revealed the involvement of tegmental to corticospinal atrophy (). Besides, the atrophy of the cerebellum had progressed compared to previous MRI studies (). The patient’s last examination determined contractures on the large joints, dyskinetic tremor, and dystonia. Of note, this study was reported per the tenets of the Declaration of Helsinki and was approved by the institutional review board and ethical committee of our university. We obtained written informed consent from the patient.
The exome sequencing revealed a homozygous nonsense change in the KCNMA1 gene NM_001161352.1:c.1372[C>T];[C>T] NP_001154824.1:p.[(Arg458*)];[(Arg458*)]. The variant was not observed in any publicly available database (e.g., EXAC, EVS, and 1000 genomes) or in our internal database. In addition, we identified another variant, rs60734921, in the CACNAH1 gene, which has been described in a study as a risk factor for generalized idiopathic epilepsy (). While the population frequency of the variant in the CACNAH1 gene was 0.0012/39 according to the EXAC, it was classified as a variant of unknown significance in the dbSNP database (). |
pmc-6060978-1 | A 27-year-old male, victim of aggressive, blunt trauma with a 4-day history of symptoms was admitted to our surgery unit. The patient presented abdominal pain, was hypotensive (100/50 mmHg), perspiring, and drowsy. The abdominal examination revealed diffuse tenderness and rebound tenderness to palpation, 2 periumbilical ecchymoses of 2/2 cm, many others within the left deltoid area and on the lower limbs. Abdominal sonography revealed peritoneal fluid in all spaces with fibrin, chest X-rays unremarkable. Laboratory investigation showed hemoglobin and white blood cell count with normal values, creatinine 4.04 mg/dL, urea 209 mg/dL, mild acidosis, lactate 21 mmol/L, creatinine-kinase 1910 U/L, lactate-dehydrogenase 451 U/L, and ethanol 34 mg/dL. During laparotomy, we discovered 2 perforations on the ileum and general peritonitis with pus. We performed an enterectomy, about 20 cm of ileum, and an end-ileostomy with a mucous fistula on the distal ileum, saline lavage, four drainages, and a laparostomy. Following surgery, the patient was admitted to the intensive care unit (ICU) with septic shock and multiple organ dysfunction syndrome (MODS). We initiated empirical therapy with broad-spectrum antibiotics with ertapenem and vancomycin. The antibiogram from the peritoneal liquid revealed S. putrefaciens, S. cerevisiae, and Candida species susceptible to amikacin, gentamicin, ciprofloxacin, third-generation cephalosporins, and fluconazole. On the second day following surgery, we intervened again, and we discovered multiple intraperitoneal abscesses. We washed the patient once more, drained, and treated him surgically with a laparostomy. From the peritoneal liquid, Acinetobacter baumannii developed that were susceptible to colistin, and the same bacteria was discovered within the tracheal secretion. The patient remained on mechanical ventilation, inotropic support, and sedated. Fever (38.5 ºC), leukocytosis (22850/μL), high lactate (31.5), very high inflammatory markers (presepsin, procalcitonin, C-reactive protein), and higher inotropic support (from 10 to 25 μg/hour of norepinephrine) convinced us to repeat the intervention including both washing and laparostomy with negative pressure. Until the 11th day following surgery, the patient remained intubated, with inotropic support, had high fever (38 ºC), and very grave general status-MODS. He also had septic shock, with a positive antibiogram from the venous catheter for Klebsiella pneumoniae susceptible to sulfamethoxazole with trimethoprim, and for Staphylococcus hominis susceptible to vancomycin and levofloxacin. From the tracheal secretion, the bacteria found in the peritoneal liquid (A. baumannii) was sampled analogously. Every other day, we repeated the intervention to change the kit for intra-abdominal negative pressure. On the 12th day following surgery, the general status of the patient had improved. Thus, he no longer remained intubated, was hemodynamically stable, without inotropic support, with spontaneous respirations, and had a functional ileostomy. We changed 6 kits of negative abdominal pressure, the antibiogram from the peritoneal cavity was positive once again for Klebsiella and Acinetobacter with antibiotic therapy (). During the last 3 interventions, we progressively closed the abdomen, and upon the 10th repeated intervention, we closed the entire abdomen, after which the patient was discharged from the ICU after 20 days where he had been administered many doses of antibiotherapy. The patient was discharged from the surgery unit on the 30th day after admission and had completely recovered.
After 6 months, the patient returned to close the ileostomy, and after another 8 months, he returned with a median postoperative hernia (). Given both the large defect and due to the weight gained, we chose to resolve the hernia with an intraperitoneal mesh. This method was unsuccessful, and even the antibiogram was negative; the patient developed ulceration of the skin which was resolved surgically. We removed the mesh and performed a muscular-cutaneous flap (). Written informed consent was obtained from the patient who participated in this case. |
pmc-6061092-1 | Patient A1 was born to a 22-year-old G1P0- > 1 mother after an uncomplicated pregnancy via C/S due to large for gestational age status. The parents did not report known consanguinity. California state-expanded newborn screening revealed a complex pattern, including a low methionine level of 5 μmol/L (cut-off is less than 8). Follow-up labs showed a methionine level of 3 μmol/L (normal > 10) and a total plasma homocysteine level of 246.6 μmol/L (normal < 10). He was started on betaine and cyanocobalamin for a possible cobalamin synthesis defect while the work-up continued. MTHFR sequencing (All Children’s Hospital, St. Petersburg, FL) showed homozygosity for the “A1298C” c.1298A > C (p.Glu429Ala) functional polymorphism and also homozygosity for a c.177G > T (p.Try59Cys) variant with conflicting in silico algorithm prediction results regarding its pathogenicity. Carrier testing was recommended but could not be completed. Based on this molecular information, in combination with the clinical presentation and biochemical abnormalities, the patient was diagnosed with severe MTHFR deficiency.
There were numerous challenges to providing comprehensive care that were identified early. It was readily apparent during the initial interactions that there was language difficulty, and the parents demonstrated very limited understanding of inborn errors of metabolism, metabolic management recommendations, and genetic diseases in general, yet did not ask any questions. They spoke an indigenous language, and a Mixteco Bajo interpreter from Silacayoapam, Oaxaca, certified for medical translation at our hospital, was used whenever possible, but sometimes, the discussions occurred in Spanish. The family inconsistently attended follow-up visits in the clinic, with some of the identifiable barriers being the distance they had to drive for clinic visits, and their intermittent stream of income due to seasonal work. A local public health nurse was utilized as much as possible to perform home health visits, ensure receipt of medications mailed to the home, and act as a local contact to provide assistance whenever needed.
Despite these interventions, there were still concerns as well as biochemical evidence that the family did not give medications to the patient as prescribed. During the frequent follow-up clinic visits, the parents were repeatedly counseled regarding natural history, anticipatory guidance, medications and dietary changes, and recurrence risks. They reported that their son’s early developmental milestones were normal up to at least 6 months of age. However, with serial clinical exams, he had clear neurological concerns including microcephaly, hypotonia, and perhaps subclinical abnormal movements that could be interpreted as seizures. He was admitted into the pediatric intensive care unit at 11.5 months of age because of pneumonia and respiratory failure. Overt seizures developed, and he continued to clinically decompensate. He became poorly responsive to environmental stimuli, whereupon discussions occurred with the family regarding his poor prognosis and to consider withdrawal of care. The family made requests centered around their traditional medicine belief system (see the “” section), and he passed away at 12.5 months of age when medical care was withdrawn. |
pmc-6061450-1 | A 26-year-old female presented with pain in both ankles for over one year. History revealed recurrent bilateral ankle sprains. Pain was mainly triggered by ankle plantar flexion during walking, specifically when wearing high heels. There were no complaints of instability or swelling after activity. She did not perform any sports activities. Physical examination revealed recognizable tenderness on palpation, especially on the medial and posterolateral aspect of both ankles. Some crepitus was felt over the flexor hallucis longus (FHL) tendon at the level of the ankle joint. The hyper-plantar flexion test was positive bilaterally. Weight-bearing radiographs and the computed tomography (CT) showed a talus bipartitus in both ankles, with early degenerative changes in the subtalar joint, especially at the posterior facet (Fig. ).
Conservative treatment by means of physiotherapy was unsuccessful. Since the left ankle was most symptomatic, in close correspondence with the patient, it was decided to treat the left ankle surgically by means of an arthroscopic excision of the fragment through the two-portal hindfoot approach [, ].
The procedure was carried out in our outpatient clinic under general anaesthesia with the patient in the prone position. Standard posterolateral and medial portals were used. With the arthroscope in the posterolateral portal, the FHL tendon was identified. The posterior bony fragment was released from its surrounding tissues, being the posterior talofibular, talocalcaneal and tibiotalar ligaments and the flexor retinaculum (Fig. ). Subsequently, the fragment was split into a posteromedial and posterolateral part by means of a chisel to ease extraction through the portals.
Postoperatively, the patient was allowed full weight bearing as tolerated. At 6-week follow-up, the patient was free of symptoms and she was able to perform all normal daily activities without discomfort considering the operated ankle; however, the right ankle remained symptomatic. The portals had healed uneventfully and no transient or permanent neurovascular compromises were noticed. At one year following surgery, the patient was satisfied with the results (NRS 10/10) and AOFAS score had improved from 36 preoperatively to 90. The radiographs showed no signs of progressive degeneration at the level of the subtalar joint, as compared to the preoperative situation (Fig. ). Due to the ongoing symptomatic right ankle, she was keen on having a similar arthroscopic surgical intervention. Two years following the second arthroscopic procedure, she had no pain and was not restricted in any of her activities. At final follow-up, ten years postoperatively, she was satisfied with the result for both her ankles (NRS 10/10), there were no pain issues (NRS 0/10) and she rated her ankle function as being ‘normal’. |
pmc-6061450-2 | A 18-year-old male presented with posterior ankle pain for 18 months without a preceding trauma. Pain aggravated during physical activity and prevented his participation in rugby. On examination, the right ankle was swollen and was specifically tender posterolaterally. Plantar flexion was restricted by 20 degrees, as compared to the contralateral unaffected ankle. The hyper-plantar flexion test was positive. Standard weight-bearing radiographs and the CT scan revealed a talus bipartitus (Fig. ). Conservative treatment consisted of physiotherapy, a single corticosteroid injection and immobilization in a cast for 6 weeks. Despite these conservative measures, symptoms persisted with a significant impact on patient’ quality of life and therefore surgery was initiated. Since there was a considerable sized bony fragment, affecting a significant portion of the subtalar joint, it was decided to fix the fragment onto the talar body by means of a screw. Minimal interference with the periosteal tissue during the fixation was achieved by an arthroscopically assisted surgical technique. A standard two-portal hindfoot endoscopy was performed. The fragment was detached by means of a small fragment curved periosteal elevator. The pseudoarthrotic tissue was debrided by means of a curette and shaver. In order to stimulate bone healing, the fragment and talar body were microfractured with a dedicated probe. After adequate repositioning the fragment, fixation was obtained by two small fragment cannulated partially threaded cancellous screws. Postoperatively, the ankle was immobilized in a lower leg cast for 12 weeks, 6-week non-weight bearing and 6-week weight bearing and prophylactic dosages of low molecular weight heparin were given during the entire immobilization period (Fig. ).
At three-month follow-up, the weight-bearing radiographs showed a good position of the fixed fragment with early signs of union. The patient was allowed full weight bearing as tolerated and physiotherapy was initiated. At 6-month follow-up, the patient had no pain and a full range of motion on physical examination. Patient was allowed to resume his rugby activities as tolerated. At one year after surgery, the patient was persistently free of symptoms and had fully resumed rugby activities. The AOFAS score had improved from 24 preoperative to 91. Patient satisfaction was maximal (NRS 10/10). At final follow-up, 8 years after the surgery, he was still satisfied with the result (NRS 7/10), had occasionally pain after activity (NRS 4/10) and rated his ankle function as ‘nearly normal’. |
pmc-6061450-3 | A 30-year-old male presented with intermittent but progressive pain of the right ankle during activity without ankle swelling or laxity. There was a history of congenital bilateral clubfeet, for which he was treated conservatively in lower leg casts. Physical examination revealed a stiff hindfoot in varus at both sides and a flatfoot deformity. The weight-bearing radiographs showed a flattened talus. On CT scan, besides the extensive degeneration of both the ankle and subtalar joint, a strongly deformed talus bipartitus was detected (Fig. ). Due to the limited impact of the complaints on his daily life, it was decided to start with steroid infiltrations in the subtalar joint. These injections were effective, and the ankle remained asymptomatic for several months. Injections were repeated occasionally if the pain aggravated. At final follow-up, 15 years following the onset of symptoms, he was still treated conservatively. |
pmc-6061498-1 | A 95-year-old male presented to the Emergency Department of a Level 1 Major Trauma Centre (MTC) after being hit by a car and sustaining major trauma. The patient was previously fit and well with a past history of hypertension (American Society of Anaesthesiologists (ASA) Grade 2), and lived independently with an exercise tolerance of 700 yards without walking aids. Upon presentation, the patient underwent a complete trauma assessment and was found to have sustained the following injuries giving him an injury severity score (ISS) of 22—right flail chest with rib fractures 2–7, right scapular fracture, lumbar vertebral body fracture, sacral alar fracture, Rockwood grade 2/3 dislocation of the acromioclavicular joint (ACJ), Gustillo and Anderson grade IIIB open fracture with partial bone loss of the tibia and fibula (see Fig. ), and an open right mid-foot fracture. The spinal, pelvic, scapular and rib fractures were managed non-operatively as was the ACJ dislocation.
Prior to undertaking any surgical intervention, the patient was treated in a high dependency (HDU) setting to manage his thoracic injuries. Surgery was required for the open tibial and foot fractures, and he underwent a total of four procedures for this. The first was application of an external fixator, debridement of the wound and temporisation with a negative pressure therapy dressing. The open foot fracture was debrided and primarily closed. As per the joint British Orthopaedic and Plastic Surgical guidelines, this procedure was performed with senior orthoplastic input within 24 h of the injury. Initial management was in line with BOAST4 protocol []. The second procedure on day 5 post-injury was primary tibial shortening following further bony debridement, and free ALT flap, following which the patient remained on HDU for 2 further days as per local protocol. On day 20, the patient had a circular frame applied to the leg with no adverse effects to the flap. Approximately 3 months after the frame was applied, the patient developed a pin site infection which required revision of the frame, which was the fourth operation. The pin site infection was felt to be due to loosening of the pins within osteopaenic bone and Exogen® treatment was commenced.
Soft tissue management in this case required free tissue transfer as local options were not available. Discussion within the multidisciplinary team, and with the patient, determined that the only alternative to free tissue transfer would be amputation. The left ALT flap was raised with a strip of vastus lateralis and the donor site was closed primarily. The flap was anastamosed end-to-side onto the posterior tibial artery, and end-to-end onto the venae commitantes (see Fig. ). A small skin graft was required for the dorsum of the foot.
Following the acute event, the patient was discharged home once ambulatory and continued to live independently with assistance from his family. The frame was removed at 10 months (see Figs. and ) and at 15 months he weight-bears without a cast or boot and has resumed his pre-injury activities with excellent soft tissue cover. |
pmc-6061765-1 | A 20-year-old woman presented with complaints of fever, abdominal pain, and blurred vision in both eyes. She was diagnosed with SLE three years before presentation and was managing her condition with oral prednisone and hydroxychloroquine. A general physical examination was performed followed by radiological, biochemical, and ophthalmological examinations. Informed consent was taken before sharing her case with this academic journal.
The eyelids and conjunctiva of her right eye were unremarkable. We noted endothelial dusting on the posterior surface of her cornea. The refractive error and visual acuity of the right eye were 6/18 + 1.0 DS. The right pupil was not dilated due to the presence of posterior synechiae; fundus details were hazy and not completely visible due to dense vitreous haze. We noted no active vitreitis, but observed complete posterior vitreous detachment. The intraocular pressure of the right and left eyes was 12 mmHg. Both eyes had keratic precipitate. A cataract extraction was performed in the right eye, and a posterior chamber intraocular lens was placed.
Refractive error and visual acuity of her left eye were 6/9 + 0.75 DS. We noted ectropion uvea and endothelial dusting. The left pupil was mid-dilated, and the macula and vessels were unremarkable. However, a hypopigmented lesion on the retina inferior to the inferior arcade was present along with a hyperpigmented choroidal lesion. In the left eye, we also noted cells in the anterior chamber and anterior vitreous.
The B-scan ultrasonography revealed bilateral vitreous detachment. Thyroid profile, detailed urine report, and echocardiography results were normal. Her erythrocyte sedimentation rate (150 mm/h) and C-reactive protein levels (33 mg/dL) were elevated. Her serum C3 and C4 levels were within the reference ranges. Anticardiolipin antibodies and lupus anticoagulant levels were unremarkable, and tests for viral markers for hepatitis B and C were negative. An abdominal ultrasonography revealed that her liver measured 19.4 cm and had a subtle echotexture; the hepatic veins were not dilated. Her spleen measured 17.5 cm with uniform echotexture, and we noted bilateral early medullary nephrocalcinosis with Grade I parenchymal changes. A color Doppler showed dilatation of the portal vein (1.3 mm) and the splenic vein (1 cm).
Figure shows the patient’s optical coherence tomography scan and Figure presents the patient’s B-scan. In the right eye, the average retinal thickness is 270.8 µm, the central thickness is 213 µm, and the total volume is 7.66 mm3. In the left eye, the average retinal thickness is 271.9 µm, the central thickness is 195 µm, and the total volume is 7.69 mm3 (Figure ). |
pmc-6062634-1 | A thirty-two-year-old female patient from Mexico City was hospitalized in the National Medical Centre 20 of November-ISSSTE, which is a tertiary care hospital in Mexico City, due to general discomfort and a background of lymphoblastic leukemia, allogeneic bone marrow transplant, and cervical cancer. Five days before hospital admission, she displayed shooting cephalea, night sweats, asthenia, adynamia, dyspnoea, and a fever (39°C) of unknown origin that occurred primarily at night. Additionally, she showed transvaginal bleeding, which led her to seek treatment. When she was admitted into the unit, she exhibited haematomas in her arms and legs; a clinical report showed a leukocyte count of 1,800 cells per cubic millimeter, 4.5% neutrophils, 8.5 g/dL hemoglobin, 24.5% haematocrit and a platelet count of 11,000 cells/mm3. During the first day in the hospital, the patient received a blood transfusion and presented additional complications unrelated to the infection. A fever of 39°C and fatigue in addition to sweating were recorded for 3 days, but no sign of an infection focus could be identified. Despite the aforementioned, the patient was still treated with imipenem (500 mg IV/6 h) and ciprofloxacin (500 mg/8 h) for 16 days and showed no improvement. A chest X-ray was performed to check for the presence of a pneumonic focus or injuries; however, no sign of infection could be detected. Being that the fever (39°C) persisted after the previously described treatment, 20 mL of venous blood was taken from a central venous catheter and inoculated into two aerobic blood culture bottles. A gram-negative bacterium was isolated from the central catheter, but the automated Vitek 2® system was not able to identify it. Then, a new treatment was given to the patient consisting of amikacin (1 g/24 h for 15 days), ceftazidime (2 g/8 h for 15 days), caspofungin (500 mg/24 h for 15 days), and normal human immunoglobulin. Ten days after completing this second treatment, 20 mL of blood was taken from a peripheral vein and cultured in two bottles; nevertheless, both cultures were negative.
Because fever (39°C) and fatigue together with sweating reappeared, two haemocultures from a peripheral vein were performed 20 days after taking the second treatment. The blood culture bottles tested positive for gram-negative rods after a 24-h incubation, and the bacterium grew on a GC agar base and sheep blood medium. The strain could not be reliably identified using the Vitek 2® automated equipment, but the symptoms (primarily night fever and sweats) suggested the possibility of an infection caused by Brucella spp.
The strain was sent to the Microbiology Department at the National School of Biological Sciences, National Polytechnic Institute (IPN) in Mexico City for proper identification. The isolated bacterium was tested with polyvalent antisera against Brucella, and a positive agglutination reaction was observed. Based on this result, a molecular approach to confirm the presence of Brucella spp. was taken. Hence, DNA was obtained employing the DNAzol® reagent following the Thermo Fisher Scientific's protocol. An end-point polymerase chain reaction (PCR) was performed to amplify a specific sequence of the bscp31 gene (223 bp), which is specific to Brucella as previously described by Baily et al. (). Given the positive results, we proceeded to identify the species following a multiplex PCR assay as previously reported by García-Yoldi et al. (). The results of this test were negative, indicating that the isolated bacterium did not belong to the Brucella species. These contradicting results called for further testing, therefore a broad-range PCR reaction focused on the amplification of a segment of the 16S ribosomal gene (510 bp) was performed following the conditions described by Aguilera-Arreola et al. (). The PCR product was sequenced, and the 16S assembled sequence (16S_B1) was uploaded into GenBank under accession number . A maximum likelihood (ML) analysis was performed in order to test the phylogenetic relationship between the 16S consensus sequence of the strain against a set of the most similar Ochrobactrum 16S sequences found in the GenBank. The species and the corresponding GenBank accession numbers of the sequences used in this ML analysis were as follows: Ochrobactrum sp. (D63836), O. anthropi (D63837, NR074243, NR043184, JQ435696, JQ435714, AB683957, HQ596561, AB490238, AJ867292, AJ867292, AJ867290, AJ867289, and AJ242580), O. intermedium (U70978, AJ242583, AJ242582, AB840685, AB840661, AB840696, AB840682, AB840667, and AB840687), O. ciceri (DQ647056), O. daejonense (NR109061), O. grignonense (NR028901), B. abortus (X13695), B. ovis (L26168), B. melitensis (L26166), B. neotomae (L26167), B. suis (L26169), B. canis (L37584), Pseudochrobactrum lubricantis (NR104538), Paenochrobactrum sp. (KC494696), Crabtreella sp. (EU165533), and Bartonella alsatica (AJ002139). To perform the ML method, an algorithm in the aLRT-PHYML programme () in conjunction with an optimized base frequency and an estimated transition/transversion ratio were used. Optimization of the tree topology and branch length were obtained, and the confidence of each node was estimated via the approximate likelihood ratio test (aLRT) () using the Shimodaira-Hasegawa-like option. The Bartonella alsatica 16S sequence was included as an outgroup. The resulting ML phylogeny revealed that the 16S sequence of the tested bacterium (16S_B1) had the closest phylogenetic relationship with the O. anthropi 16S sequences deposited in GenBank. This relationship was revealed when the location of the 16S sequence obtained was found within a clade containing exclusively O. anthropi 16S sequences (aLRT >70; Figure ). Conversely, this sequence was not located within the clade containing O. intermedium 16S sequences.
The susceptibility of the strain to 19 antimicrobial agents was tested by the Kirby-Bauer method as established by the Clinical Laboratory Standards Institute and considering suggestions for Haemophilus spp. and gram-negative bacteria. The strain was resistant to ampicillin, cefazoline, ceftazidime, cefoxitin, ceftriaxone, cefepime, aztreonam, nitrofurantoin, ampicillin/sulbactam, amoxicillin/clavulanic acid, piperacillin/tazobactam, meropenem, and tetracycline. The strain showed susceptibility to trimethoprim/sulfamethoxazole, ertapenem, amikacin, gentamicin, and ciprofloxacin. Based on the sensitivity of the isolated strain to these antibiotics, the chosen treatment for the patient was amikacin (1 g/24 h) and ciprofloxacin (500 mg/8 h) for 31 days. The patient completed the treatment and responded favorably to the combination of antibiotics; at the end of the treatment, the fever had disappeared, and the patient was released from the hospital. Three months later, the patient came back into the hospital for a medical check-up, but no symptoms related to the former infection were recorded.
These findings highlight the importance of O. anthropi as a nosocomial pathogen (even when it displays few virulence factors) and the importance of using more than one method to identify this uncommon pathogen. |
pmc-6062643-1 | A 74-year-old woman was referred for CABG treatment. She had a history of diabetes mellitus and dyslipidemia and previously underwent percutaneous stenting of the mid right coronary artery and the proximal left anterior descending artery (LAD). Preoperative coronary angiography revealed 90% in-stent stenosis of the proximal LAD and 75% stenosis of the diagonal branch (Fig. ). In addition, she had three instances of in-stent stenosis at the LAD. Whenever restenosis was diagnosed, the implementation of percutaneous coronary intervention (PCI) was repeated. Taking this history into consideration, we decided to perform a left ITA (LITA)-LAD bypass and a right ITA (RITA) diagonal branch bypass. The ITAs were mobilized as skeletonized grafts. We routinely used nicorandil (4 mg/h) and diltiazem (4 mg/h) during CABG operation for the prevention of vasospasm.
At first, we performed RITA diagonal bypass. Subsequently, we performed anastomosis of LITA-LAD bypass. After CABG, the patient had stable circulation (BP 126/54 mmHg, HR 62 bpm) without changes in ST segment as monitored by electrocardiogram. When we examined blood flow of the RITA diagonal bypass, transit time flow measurement revealed reasonable blood flow (flow rate 20 mL/min, pulsative index 3.4, diastolic flow of 82%). On the other hand, the LITA graft showed comparatively poorer blood flow (flow rate 15 mL/min, pulsative index 2.1, diastolic flow 74%) than the RITA graft. Flow competition between the RITA and LITA was unlikely to occur considering the location of the stenotic lesion. In addition, taking into the consideration the perfused region of the LAD and the severe stenosis in the stent, the graft blood flow was too low and technical anastomotic stenosis was suspected. We re-anastomosed the LITA-LAD bypass. However, even after re-anastomosis of LITA-LAD bypass, transit time flow measurement revealed worsening of graft flow compared to before (LITA-LAD: flow rate 7 mL/min, pulsatile index 4.8, diastolic flow 68%; RITA diagonal: flow rate 11 mL/min, pulsatile index 5.6, diastolic flow 76%). We immediately closed the wound and moved the patient to a hybrid operating room to examine the causes of this progressively low graft flow.
We performed coronary angiography and detected vasospasms in the native coronary arteries (Fig. ) without ST elevation, as seen on the electrocardiogram. We performed intracoronary injections of verapamil (5 mg) and isosorbide dinitrate (6 mg) through the ITA graft, but no improvement was observed. We subsequently injected fasudil (20 mg) through the LITA and observed that coronary flow through the LITA graft improved (thrombolysis in myocardial infarction risk score of 3) (Fig. ). The intracoronary fasudil injection did not cause systemic hypotension, as demonstrated by the postinjection measurement of 86/56 mmHg compared with the preinjection measurement of 93/52 mmHg. We subsequently applied intra-aortic balloon pumping to secure coronary blood flow.
On postoperative day 1, coronary angiography revealed a patent bypass graft and sufficient coronary runoff (Fig. ). Electrocardiogram showed no ischemic changes. Peak postoperative CK, CK-MB, and troponin T were 582 U/L (41–153 U/L), 7.6 IU/L (4–18 IU/L), and 0.307 ng/mL (0–0.014 ng/mL), respectively. The patient experienced an uneventful clinical course without vasospasm recurrence and was discharged on postoperative day 11. |
pmc-6062763-1 | A 76-year-old man with a past medical history of coronary artery disease, hypertension, and severe septal hypertrophy suspicious for hypertrophic cardiomyopathy, presented to the hospital with progressive symptoms of heart failure. He had been suffering from worsening dyspnea and lower extremity edema for several months. Lab work over the preceding months had shown deranged liver function tests, concerning for right heart failure. He was admitted for intravenous diuretic and inotrope therapy. At his cardiology clinic appointment prior to this hospital admission, an ECG showed typical atrial flutter and diffuse low voltage []. A right heart catheterization showed moderately elevated right greater than left filling pressures with a right atrial pressure 18 mmHg, pulmonary capillary wedge pressure 21 mmHg and a Fick cardiac index 1.6 liters/min/m2. The ScvO2 was 48%.
Of note, a year prior to this admission, a transthoracic echocardiogram (TEE) had shown severe asymmetric septal hypertrophy (2.6 cm), suspicious for hypertrophic cardiomyopathy, but had not been further evaluated. A repeat TEE at the present admission showed a left ventricular ejection fraction (LVEF) of 35% as well as the aforementioned septal hypertrophy []. However, due to the significant low voltage on ECG, despite the significant LVH on echocardiogram and history of hypertension, a cardiac MRI was ordered to rule out infiltrative cardiomyopathy as opposed to hypertrophic cardiomyopathy.
The images showed normal left ventricular chamber size with severe, asymmetric left ventricular hypertrophy, primarily involving the septal wall with a maximum septal thickness of 27 mm []. The LVEF was measured at 40%. Also noted was diffuse, global late gadolinium enhancement of the left ventricular myocardium, consistent with a diagnosis of cardiac amyloidosis []. The only extracardiac clinical finding suggestive of systemic amyloidosis was carpal tunnel syndrome. Serum and urine electrophoresis did not detect a monoclonal protein, and serum free light chain ratio was low, which significantly lowered the suspicion for AL-amyloidosis. An abdominal fat pad biopsy was ordered which came back negative. Finally, an endomyocardial biopsy was performed which showed a pink amorphous interstitial infiltrate exhibiting apple green birefringence with Congo red stain, confirming cardiac amyloidosis. The subtype was likely wild-type ATTR or variant ATTR amyloidosis.
Incidentally, the cardiac MRI also found a left upper lobe mass which, on further workup, was characterized as adenocarcinoma. No further differentiation of the subtype of ATTR amyloidosis was pursued, as this would not have changed management, especially in view of the poor prognosis portended by the adenocarcinoma. |
pmc-6062771-1 | A 44-year-old Caucasian woman presented to the emergency room with a 2-week history of anorexia, progressive weakness, and difficulty walking. She had a past medical history of obesity, schizophrenia, and bipolar disorder. Her past surgical history was significant for Roux-en-Y gastric bypass surgery 23 years ago. The patient was functionally independent 2 months prior to admission with acute deterioration in the 2 weeks preceding the admission.
Initial examination revealed a markedly pale and malnourished woman with a body mass index of 14.9 who had lost 8 kg in the preceding 4 months. She had tachycardia with mild epigastric tenderness. She was awake and oriented to person, place, and time. Her pupils were equal, round, reactive to light, and her cranial nerve function was normal. Her strength was 4/5 in bilateral upper extremities and 3/5 in bilateral lower extremities, with preserved sensation. Normal reflexes including unsustained ankle clonus were present bilaterally. Laboratory tests on admission revealed the following: white blood cell count 4800/mm3 (normal); hemoglobin 10.1 g/dL (mildly low); mean corpuscular volume 111 fL (mildly high); blood glucose 106 mg/dL (normal); albumin 2.2 g/dL (low); prothrombin time 11.3 seconds (normal); total bilirubin 2.3 mg/dL (normal-high); alkaline phosphatase 201 U/L (normal); aspartate aminotransferase 175 U/L (high); alanine aminotransferase 65 U/L (high); ammonia 98 µmol/L (high); folate 16 ng/mL (normal); and vitamin B12 1745 pg/mL (normal). Hepatic ultrasound showed a moderately fatty liver without mass or cirrhosis. Initial therapy consisted of 100 mg thiamine, 1 mg folic acid, multivitamins, and magnesium sulfate. The patient’s home medications, quetiapine and clonazepam, were held. A nasojejunal tube was placed and feeding was started slowly.
The day after admission the patient abruptly became nonverbal and responsive only to pain. She also developed flaccid paralysis of both arms and persistent rhythmic jerking of her legs and feet. These findings are not typical of Wernike or Wernike-Korsakoff syndromes. Refeeding syndrome (with encephalopathic/neurologic manifestations of electrolyte abnormalities) was considered; however, her repeat serum laboratory tests were unremarkable (including sodium of 140, glucose 80, and phosphate 2.9). Additionally, 1-hour electroencephalogram was negative for seizures. Cerebrospinal fluid analysis was unremarkable, ruling out infectious and aseptic meningitis. Brain magnetic resonance imaging (MRI) revealed lesions involving the splenium of the corpus callosum and the posterior limb of both internal capsules ( and ). While extrapontine myelinolysis and hypoglycemic encephalopathy were considered, the aforementioned laboratory values preclude their diagnosis. Atherosclerotic ischemic stroke comes to mind; however, it is inconsistent with this pattern of diffusion restriction. The pattern is most consistent with type B MBD (focal corpus callosum lesions, as opposed to type A with complete callosal involvement), and the patient’s clinical findings match those of MBD. The patient was started on intravenous (IV) methylprednisolone succinate and thiamine, intramuscular cyanocobalamin, and oral pyridoxine. The patient’s course was complicated by a gastrojejunal anastomotic bleeding ulcer and an iatrogenic pneumothorax that eventually necessitated temporary mechanical ventilation. After 10 days of treatment, the patient had complete resolution of her encephalopathy with return to her previous baseline mental function. Repeat brain MRI obtained 15 days from initial scans showed resolution of her splenium and internal capsule defects (). |
pmc-6062772-1 | A 65-year-old male with past medical history of hypertension, diabetes mellitus type 2, hyperlipidemia, and end-stage renal diseases secondary to biopsy-proven immunoglobulin A nephropathy came to our hospital with dysuria, dark urine, and fever going on for the last 3 days. His vitals showed a temperature of 39.3°C, blood pressure of 164/89 mm Hg, pulse of 99 beats per minute, and respiratory rate of 20 breaths per minute. The examination was unremarkable except for mild lower abdominal tenderness. Initial laboratory workup was remarkable for white blood cells (WBCs) of 10 900/µL (3100-8500/µL), neutrophil percentage of 87% (25% to 62%), absolute neutrophils of 9500/µL (1700-6300/µL), platelets of 174 000/µL (140 00-440 000/µL), sodium of 135 mmol/L (136-145 mmol/L), lactic acid of 1.1 mmol/L (0.5-2.2 mmol/L), blood urea nitrogen of 47 mg/dL (9-21 mg/dL), and creatinine of 4.5 mg/dL (0.6-1.1 mg/dL). Urine analysis showed 1+ bacteria, large leukocytes, WBC >50/high-power field (HPF), and squamous epithelial cells 0 to 5/HPF. Keeping in mind urosepsis, blood cultures were drawn from 2 peripheral sites along with urine culture, and he was started on intravenous ceftriaxone and intravenous fluid as per sepsis protocol. Nephrology was consulted and the patient got dialysis the next day secondary to end-stage renal diseases. The patient started showing improvement. On day 2, the patient was afebrile, and WBC started trending down along with resolution of dysuria. Blood cultures did not grow anything, but 3 days later urine culture grew R planticola sensitive to all main-line antibiotics, including ceftriaxone, ciprofloxacin, nitrofurantoin, cefazolin, gentamicin, and trimethoprim-sulfamethoxazole. The patient was subsequently discharged on the fourth day on ciprofloxacin renal dose 250 mg orally every 12 hours for 4 more days to complete 7 days of treatment. The patient was seen in clinic after 2 weeks with complete resolution of symptoms. |
pmc-6062773-1 | A 60-year-old man with a history of acute myeloblastic leukemia status postallogenic HSCT 2 months prior, tonic-clonic seizures, coronary artery disease, polycystic kidney disease, and hypertension presented with fever, diarrhea, and abdominal pain. He had been taking tacrolimus 0.5 mg BID, and levetiracetam 500 mg BID. He was transferred to the intensive care unit for persistent hypotension and acute hypoxic respiratory failure requiring intubation. Initial vitals included a temperature 100.2°F, blood pressure 70/43 mm Hg, heart rate 89 beats per minute, respiratory rate 20 breaths per minute, and 92% on room air. Pertinent physical examination findings included pallor and right upper quadrant abdominal tenderness with a positive Murphy’s sign. Initial laboratory tests were normal except for hemoglobin 10.1 g/dL, hematocrit 29.1%, platelets 79 000/µL (130 000-450 000/µL), sodium 133 mmol/L (136-144 mmol/L), bicarbonate 20 mmol/L (22-32 mmol/L), blood urea nitrogen 21 mg/dL, creatinine 2 mg/dL, and albumin 3.4 g/dL (3.5-5 g/dL). Initial arterial blood gas showed pH 7.37, pCO2 30.9 mm Hg; pO2 66 mm Hg; and a base excess of −8. Blood cultures were positive for Pseudomonas aeruginosa.
He was diagnosed with septic shock and started on acyclovir, voricanazole, vancomycin, tobramycin, metronidazole, and cefepime for empiric coverage given his immunocompromised state. Later that day, vasopressors (norepinephrine, epinephrine, vasopressin, and phenylephrine) were initiated along with stress dose steroids (hydrocortisone 100 mg TID). Empiric antibiotics were adjusted to meropenem instead of flagyl and cefepime. That night, the patient became progressively acidotic (pH of 7.37 earlier to pH of 7.22); therefore, it was decided to initiate continuous renal replacement therapy.
The following day his tacrolimus level was 8.6 ng/mL (10-20 ng/mL) and creatinine was 2.2 (baseline = 1.8). The patient inadvertently received 15 mg intravenous tacrolimus instead of his scheduled 0.5 mg intravenous. Four hours later, a random tacrolimus level was 36.4 ng/mL. Tacrolimus was subsequently discontinued. Based on several case studies and literature review, phenytoin 200 mg BID was started for 4 doses and rifampin was started for 2 doses at 600 mg in order to potentially limit the patient’s tacrolimus toxicity. Levetiracetam was stopped during the administration of phenytoin; and rifampin was discontinued after 2 doses given its side effect profile. Sixteen hours postinjection, the tacrolimus level decreased to 26.4 ng/mL and to 9 ng/mL after 64 hours (). Creatinine decreased to 1.1 after 30 hours (). He was extubated 5 days later without any new neurological findings and his creatinine returned to baseline. |
pmc-6062774-1 | A 55-year-old female presented to the emergency department for evaluation of severe lower flank pain radiating to her lower abdomen and chest. Further review of symptoms revealed that she also had cough, night sweats, chills, and an unintentional weight loss of 31 pounds over 3 months. Clinical examination was significant for bilateral axillary lymphadenopathy. Subsequently, a computed tomography (CT) scan of her chest, abdomen, and pelvis was performed that revealed extensive bilateral lymphadenopathy (above and below the diaphragm) as well as a new right upper lobe (RUL) thin-walled cavitary lung lesion with spiculated margins (). A positron-emission tomography (PET)-CT scan showed highly metabolically active lymphadenopathy in the neck, chest, abdomen, and pelvis but minimal to no PET avidity within the RUL cavitary lesion (). Axillary lymph node sampling showed moderate-to-large B-lymphocytes (positive for CD5, CD20, and cyclin D1), with fluorescence in situ hybridization positive for t(11; 14), consistent with MCL. Although a bone marrow biopsy revealed low disease burden (<10% involvement), her lymphoma demonstrated a high proliferation rate (Ki67 proliferation index 30%), and she was diagnosed with stage IV-B MCL.
Prior to initiation of chemotherapy, she was referred to the pulmonary clinic for workup of the lung lesion, which was felt to have radiographic features atypical for lymphoma. She was an active, 30 pack-year smoker with symptoms of stable chronic bronchitis, sinusitis, and scant hemoptysis. Serum tuberculosis testing (TB-quantiferon) was negative. Although no prior self-history of cancer, she had a strong family history for cancer (lung cancer [father, paternal uncle, and paternal grandfather], cervical cancer [mother], and premenopausal breast cancer [paternal aunt]). Chest CT was significant for severe emphysema, multiple indeterminate pulmonary nodules, and a 1.7 × 1.1 cm, subpleural, thin-walled cavitary lesion with spiculated margins in the RUL (). Initial differential diagnosis included malignancy (primary/metastatic carcinoma and less likely lymphoma), subacute or chronic infections (such as tuberculosis and fungal infection), and vasculitis. Bronchoscopy was unremarkable, and bronchoalveolar lavage showed 87% macrophages, 10% neutrophils, and 2% lymphocytes, without malignant cells. Respiratory cultures grew 1+ Aspergillus flavus. Serum antineutrophil cytoplasmic antibodies and rheumatoid arthritis factor were negative. A short-interval (2 months) follow-up CT imaging showed stable pulmonary nodules but a persistent RUL cavitary lesion. A video-assisted thoracoscopic wedge resection was performed to exclude other diagnoses prior to initiation of chemotherapy for MCL. Pathological examination revealed a lepidic predominant, well-differentiated adenocarcinoma (pathological stage T1a), with coexistent foci of lymphoid infiltrates within and adjacent to adenocarcinoma (). The lymphoid infiltrate had histological features (convoluted irregular small nuclei; ). By immunohistochemistry, the adenocarcinoma component was strongly positive with thyroid transcription factor-1, confirming pulmonary origin () and discounting the possibility of metastasis from a possible mammary carcinoma. In addition, immunohistochemical profile (positive for B-cell markers CD20, pax5, and BCL1 [cyclin D1]; and ) was consistent with MCL. Multidisciplinary consensus was that no additional surgery, lymph node sampling, or adjuvant chemotherapy was needed. She was subsequently observed for both adenocarcinoma and lymphoma (high proliferation rate but with low disease burden), with surveillance imaging. A year later, however, she presented with dyspnea and a new right-sided pleural effusion (cytology positive for adenocarcinoma, negative for epithelial growth factor receptor/anaplastic lymphoma kinase). She received 6 cycles of carboplatin/pemetrexed/bevacizumab with good treatment response; however, she declined further maintenance therapy due to an intolerance of side effects. A few months later (a year ago), she presented with weight loss, chills, and night sweats, and CT imaging showed progressive lymphadenopathy concerning for MCL. She received ibrutinib and rituximab with good response initially; however, she could not complete the prescribed therapy due to side effects and was unfortunately lost to follow-up at the time of this writing. |
pmc-6062775-1 | We present the case of a 70-year-old female who was sent to the hospital by her family physician for an elevated blood urea nitrogen of 84 g/dL and a creatinine of 6.1 mg/dL. Baseline values were normal 1 month prior. Her chief complaints were weakness, decreased appetite, bilateral lower extremity swelling, and discoloration for the past 3 weeks. She has a past medical history significant for SSc, diagnosed in 1980, Raynaud’s disease, hypertension, and neuropathy. Of note, she was recently started on mycophenolate mofetil at a dose of 500 mg twice daily for treatment of her SSc.
On physical examination, she was hypertensive to 164/72 mm Hg, had bilateral lower extremity edema, and skin changes limited to her hands and feet, consistent with lcSSc. Her urinalysis was positive for proteinuria and hematuria. Her complete blood count was significant for decreased hemoglobin of 8.6 g/dL. Her serologies were positive for ANA at 1:160, and MPO antibodies, at a level of 23.8 by ELISA (enzyme-linked immunosorbent assay). PR-3 antibodies, p-ANCA, and c-ANCA were negative. Renal biopsy demonstrated an acute necrotizing vasculitis superimposed on chronic changes related to her SSc. Light microscopy demonstrated 28 to 38 glomeruli of which 10% were globally sclerosed. The majority of the remaining glomeruli show prominent ischemic-type wrinkling of capillary walls (). Necrotizing vasculitis of the artery is seen, with prominent transmural necrosis and inflammatory infiltrate with prominent thickening of surrounding arterioles due to concentric hyperplasia (). Ten percent of glomeruli per section show crescents ().
Electron microscopy confirmed the absence of immune complexes as well as tubular epithelial necrosis and diffuse foot process effacement. Treatment was initiated with 8 sessions of plasma exchange with albumin, pulse steroids at a dose of 500 mg intravenous for 3 days, and rituximab at 1 g for 2 doses 2 weeks apart. The patient unfortunately remains hemodialysis dependent. |
pmc-6062915-1 | A one month old baby girl was brought by her mother to the lactation clinic for further evaluation due to the difficulty of breastfeeding. The mother complained of pain in the nipple which was present throughout the entire breastfeeding session and usually recurred with each episode of breastfeeding. Two weeks after delivery, the mother noticed a tooth on the baby’s lower left gum. A week later, she noticed an ulcer under her baby’s tongue, which occasionally bled.
In light of the continuous pain during breastfeeding, the mother became reluctant to continue and infant formula milk was given as a substitute. Self-examination by the mother did not reveal any nipple crack or breast injury. Her antenatal history was uneventful. There was strong family history of natal teeth, and this baby’s siblings had similar problems.
On examination, the mother’s breast appeared to be normal and consistent with a lactating breast. There was no inflammation or engorgement. Some mild eczema was noted around the nipple, but there was no infection. Cervical and axillary lymph nodes were not palpable.
Examination of the oral cavity of the baby revealed a neonatal tooth over the left anterior region of the mandibular ridge. The tooth measured 2 mm × 1 mm in size, was whitish opaque, and had Grade II mobility (Fig. ). There was also a whitish ulcer over the ventral aspect of the tongue measuring 1 mm × 1 mm (Fig. ). The parents declined radiological investigations and tongue biopsy for the baby. Hence, the clinical diagnosis was neonatal tooth associated with Riga-Fede disease causing difficulty in breastfeeding.
The baby was then referred to the pediatric dental surgery department. After a thorough discussion with the parents, the neonatal tooth was extracted under local anesthesia. The tooth had a crown but lacked a root. Following extraction, the baby did not have any complication such as bleeding and infection. The wound healed well within 2 days and she successfully resumed taking breast feeds.
Currently, at 10 months post-extraction, the child is growing well and still breastfeeding. Examination of the oral cavity revealed that only one central lower incisor tooth was present (Fig. ). |
pmc-6062932-1 | A 14-year-old female patient presented to the emergency department with a sudden onset of left leg pain and oedema. She had a fever of 38 °C once a few days before. Physical evaluation revealed a swollen and painful left leg with reduced range of motion of the left hip and bumps palpated on the right tibia proximal metaphysis. No signs of arthritis, possible intestinal inflammation or skin changes were seen during physical evaluation. The patient’s blood pressure and urinary output were normal. After the emergency ultrasound exam revealed a diagnosis of femoral and pelvic deep vein thrombosis, she was admitted to the hospital. According to her parents, the patient had had no chronic diseases to date. They indicated that she had a foot fracture at the age of 8 years. There were no autoimmune or auto-inflammatory disorders in the patient’s family history.
Initial investigations revealed high levels of inflammatory markers (CRP and ESR), and a severe microcytic anaemia as well as thrombocytosis, hypoalbuminemia and elevated fibrinogen concentration and D-dimer values (Table ). Suspecting an infectious cause, a urinalysis was performed, and haematuria and proteinuria were detected. Both blood and urine cultures were sterile. X-rays of the legs were done (Fig. ), showing sites of hyperostosis and sclerosis in the metaphysis of the right tibia along with a periosteal reaction, suggesting a possible osteomyelitis or oncological processes in the bones. As the diagnosis of acute osteomyelitis could not be disproved, broad-spectrum antibiotics were prescribed. However, the CRP level did not change significantly over the first few days, so other causes of acute thrombosis and inflammation were investigated. An abdominal ultrasound showed a giant, homogenous pelvic mass and hydronephrosis of the left kidney. Kidney function was quite abnormal as the creatinine level was 185 μmol/L and urinary protein excretion of 7 g over 24 h was detected. Within the next few days the patient’s kidney function deteriorated further, with a creatinine value increasing to 307 μmol/L with poor urine output and high blood pressure. The patient had no prior history of kidney problems.
Due to the findings of the abdominal ultrasound and leg X-ray, the child underwent a whole-body computed tomography (CT) scan. Multiple bone lesions were observed, the most severe of which were located in the left scapula, the fifth rib projection near the spine and a large deformity of the left pelvic bone close to the acetabulum (Fig. ). The left iliopsoas muscle also appeared to be abnormal. Moreover, renal parenchymal thickening and oedema were found. Investigations for possible endocrine disorders were performed (Table ). Signs of hyperparathyroidism were present together with hypocalcaemia, hypomagnesaemia and a low vitamin D3 concentration, as well as hypocalciuria in the 24-h urine test and hyperphosphaturia based on phosphate fractional excretion (Table ).
Bone and left kidney biopsies were performed. The bone biopsy from the affected site of the left pelvic bone demonstrated intertrabecular stromal fibrosis, several epithelioid granulomas with a central zone of necrosis and polymorphonuclear cells. Moreover, histological evaluation showed a few sites with plasma cell infiltration, including some cells positive for immunoglobulin G (IgG) and immunoglobulin G4 (IgG4). Histological examination of the surrounding connective tissue found mucoid oedema. The renal biopsy revealed an acute and active crescentic glomerulonephritis (GN) with ANCA-associated vasculitis (Fig. ). Special staining was performed for the kidney sample, and no IgG subclasses were found.
Due to the results of left kidney biopsy together with thrombosis of the deep veins, additional screening for autoimmune diseases was carried out. The child tested positive for antinuclear antibodies (ANA 1:100), antibodies against centromere protein B (anti-CENP B), antibodies against proliferating cell nuclear antigens (anti-PCNA) and C-ANCA (Table ). High levels of ferritin were also found (448 μg/L), indicating the possibility of both autoimmune and thrombotic causes of anaemia. However, antiphospholipid antibodies were not detected. Concerning the bone biopsy results, serum IgG levels were tested and only IgG4 was slightly increased (Table ).
Since multiple bone lesions were detected, the fracture history was reviewed. At the age of 8 years our patient had not only a foot fracture, but also complained of pain in the left elbow and back. It appeared that she was diagnosed with CRMO at that time, based on the results of a biopsy from the fracture site as well as a CT of the left foot (Fig. ) and a whole-body radionuclide scan. The radionuclide scan showed multiple sites of CRMO lesions, with three in the spine, one in the left hand, one in the left scapula, one in the left pelvic bone and two in the right leg. Surgery for the broken foot was performed and treatment with antibiotics and nonsteroidal anti-inflammatory drugs (NSAIDs) was prescribed for a month. When the patient’s pain decreased over time, analgesics were discontinued due to the impression of a self-limiting disease course. For the next 6 years she was free from complaints except for painless unilateral right periorbital oedema appearing on and off for the last 2–3 years and observed without medical supervision. Due to this oedema and slight exophthalmos of the right eye during current episode, additional head and spine magnetic resonance imaging (MRI) was performed, and a new CRMO lesion in a right periorbital region was diagnosed (Fig. ) together with deformation and lipoid degeneration of the seventh neck vertebrae (Fig. ).
Treatment was started for the vasculitis with cyclophosphamide and prednisolone according to the renal-limited vasculitis management protocol. No pain reliever was necessary. Severe metabolic disturbances and hyperparathyroidism were treated with alfacalcidol, calcium and magnesium supplements. Kidney and ureter stents were placed for 1 month due to hydronephrosis. Secondary GN-associated hypertension was treated with ACE (angiotensin converting enzyme) inhibitors. Anticoagulants were prescribed for deep vein thrombosis for 6 months until full recanalisation of the left femoral vein had occurred.
After 1.5 years of treatment, the child is free of complaints. Her auto-inflammatory, metabolic and endocrinological conditions are being monitored by a multidisciplinary team of physicians. All microelements and parathormone levels are within the normal range. There are no signs of hypertension and the patient’s kidney function has recovered. To date, there are no clinical or diagnostic signs of deep vein thrombosis. The patient is still on maintenance treatment with azathioprine according to the kidney vasculitis treatment protocol and receiving microelements supplementation. |
pmc-6062935-1 | The proband, a 24 year old male from Southern Italy, presented at age 16ys to the Ophthalmology Clinic, Policlinico Hospital, Italy, with a history of subacute, painless, and rapidly progressive bilateral vision loss. At the time of presentation, the proband appeared to be healthy, a well-developed boy but with clear signs of anxiety. One month prior to presentation, he had noticed impaired sight at his right eye and, within a few days, he could only see shadows. One week after the loss of sight in his right eye, the same symptom occurred in his left eye. Ophthalmologic examinations, at the moment of hospitalization, revealed at right eye (RE), BCVA of 20/200; hyperemic optic disk, tortuosity, and telangiectasia of retinal vasculature and absence of leakage and staining of the retinal vessels were revealed using fluorescein angiography. OCT examination showed an increase of nerve fibers layer thickness (average RNFL 108.58) and CVC examination revealed a deep central scotoma at RE, while there was not any alteration at left eye (LE). After six weeks, the young man presented the same symptomatology at his LE. Progressively, both optic nerves developed atrophy that was documented by OCT examination. CVC examination was no more possible because the visual acuity dropped to only light perception. All the family members underwent a complete ophthalmological examination. Visual acuity was 20/20 in all members. Fundus examination showed a hyperemic optic disk and vessels tortuosity in the proband’s young brother (III:2) and sister (III:3), whereas it was normal for the other family members. Visual field analysis was performed in all the available family members (Fig. ) and resulted within normal ranges as well as the OCT-RNFL thickness examinations that were also in the normal range (NR: 97.3−/+ 9.6 μm). After disease onset, the proband started ubiquinone analog therapy with Idebenone (100 mg b.i.d.) without any improvement of visual acuity. Additionally, the proband had experienced epilepsy at 13 years of age, with recurrent tonic-clonic seizures that were under control with Oxcabazepine tablets 1800 mg/day, Topiramate tablets 400 mg/day, paroxetine hydrochloride tablets 20 mg/day, Pregabalin tablets 450 mg/day, Lorazepam tablets 1 mg/day as needed. He had no history of smoking, alcohol and of any illicit drug use. Interestingly, family history was significant for intellectual disability and hyperactivity in the mother (II:1) and siblings (III:2 and III:3) (Fig. ) as outlined below; no one of the family used tobacco or alcohol with the exception of II:3 who referred tobacco abuse (Fig. ).
To measure intelligence as IQ score in agreement with the age of patients, the Wechsler Intelligence Scalefor Children - Revised (WISC-R) was used for subjects aged 6 to 16 years, whereas the Wechsler Adult Intelligence Scale - Revised (WAIS-R) for subjects aged 17 to 90 years. The test showed that the proband manifested mild intellectual disability, whereas his available relatives all resulted in borderline intellectual functioning (Table ). Recently, the youngest brother (III-2), who was suffering from severe migraine, at the age of 20ys, has developed recurrent seizures such as the proband, that are under control by Clonazepam 2.5 mg drops (12 drops/day) and Lacosamide tablets 400 mg/day. This study was conducted with the approval of the Institutional Review Board of Azienda Consorziale Policlinico Bari and Bari University. Before recruitment into our study, all participants and their guardians signed written informed consent in accordance with the guidelines of the Declaration of Helsinki. This research abided by the process of collection of data from patients with genetic diseases and the requirements of the Italian Ministry of Public Health. Written informed consent was obtained from the participant or from their parents for publication of this Case report.
Total genomic DNA was extracted by standard methods from peripheral blood of the patient and his relatives and from control subjects. Mitochondrial DNA genetic analysis was positive for the LHON m.3460G > A primary mutation in the proband and in all the family members; the mutation resulted as homoplasmic in the proband as well as in four LHON unaffected (II-1; II-3; III-2; III-3) while it was heteroplasmic in three LHON unaffected (I-2; II-2; III-4) subjects Table ; showing a mean frequency of the mutant allele of 35% (range 30–40%) (Fig. ).
We then measured mtDNA copy number, estimated as mtDNA/nDNA ratio [], in peripheral blood samples from the proband and unaffected family members and then they were compared to control group’s (Table ). The control group consisted of 90 unrelated subjects who had no history of a retinal disease, eye trauma or surgery, nor any evidence of systemic or neurological disease. MtDNA copy number of the homoplasmic relatives was evaluated in previous work []. Frequency distribution of the mtDNA copy number showed that the peak of mtDNA content shifted progressively towards higher values from control (210 ± 86) to affected (240 ± 86) to unaffected (548 ± 217) subjects with very high statistical significance: controls versus unaffected subjects, P < 0.001; proband versus unaffected subjects, P < 0.001 (ANOVA test). Furthermore, though the limitation of the sample size, when we compared mtDNA copy numbers between subjects harboring homo- or heteroplasmic m.3460G > A mutation, no difference was observed.
We considered the peculiarity of the clinical presentation of the proband, so we reasoned that additional mutations might contribute to the phenotype; we performed Sanger sequencing of the entire mtDNA genome []. All nucleotide variants were annotated according to the procedure described in MtoolBox [] and are reported in Additional file . We identified 55 variants of which 46 contributed to defining the haplogroup U4a1a and 19 variants were prioritized (Additional file ). Interestingly, the proband showed multiple species of mtDNA molecules of variable lengths due to the variability of the number of cytosines inserted in the microsatellite at position m.961 of the MTRNR1 gene which normally contains a (C)5 T(C)4 poly-cytidine tract (NC_012920.1; ). We performed Sanger sequencing of MTRNR1 region in all available relatives, confirming also in these, the microsatellite instability. The specific m.961delT + C(n)ins variant is annotated in Mitomap database () mostly associated to deafness, but no population data are available for it and for variants harboring insertion with a number of C more than 7 (dbSNP link: ). To discriminate among the different lengths of molecules carrying C(n)-microsatellite (mtMS) we cloned the proband appropriate DNA regions and then picked different clones for direct sequencing. We found eight additional species carrying the insertion of 1 to 8Cs starting at position m.961 of the wild-type molecule, which corresponds to a microsatellite of 10 to 17(C). To better investigate on the mtMS instability (mtMSI), fragment analysis was performed in all the available family members. This analysis showed that the MTRNR1 mtMSs may have different lengths and that is heteroplasmic with variable percentages (Fig. ; Additional file ). I-2 had from 9 to 13(C); II-1, II-2, and II-3 had from 9 to 14(C) and 15(C), respectively; III-1 (proband), as well as III-2, III-3 and III-4 had from 9 to 16 (C); III-1 and III-3 showed also additional peaks i.e. 17(C) and 18(C). Quantitative analysis considering both the area and the height of the peaks showed that the 10 (C) microsatellite was the most represented species in I:2; in the second generation, there is a prevalence of 10–12(C) species, whereas in the third generation, there is a decrease of 10–12(C) species amount, with the exception of III-3, and a surge of 13(C) and especially of 14–16(C) and even of 17 and 18(C) which, on the contrary, were not at all present in the second generation (Additional file ). In order to investigate the possible functional effect of the C-microsatellite expansion, the prediction of MTRNR1 secondary structure and folding performed by RNA fold software from Vienna RNA package [], assessed that m.961delT + C(n)ins would expand the size of a proposed loop structure in the MTRNR1. |
pmc-6062967-1 | A 43 year-old woman was included in the prospective phase I clinical trial CELLCORDES (EudraCT number 2015–000238-31) registered at , after providing written informed consent.
Her medical history included a thyroidectomy for goiter and hysterectomy for endometriosis. She presented a severe dysphonia related to scarred VF following a phonosurgery. Five years earlier, she had two laryngeal surgeries: i) suspension laryngoscopy for resection of Reinke edema, in which a right ventricular lesion was discovered and biopsied; ii) cervicotomy with lateral thyrotomy for resection of this lesion, whose definitive histology was in favor of a chondroma. One year later, the patient underwent another suspension laryngoscopy for a granuloma excision in the anterior third of the left VF. The laryngeal pathologies treated did not recur but the persistence of a marked dysphonia 4 years following the last surgery (despite regular speech therapy) justified a new consultation. The patient met the inclusion and exclusion criteria of the clinical trial (listed in Table ) and thus was eligible to receive a local injection of autologous ADSVF.
In videolaryngostroboscopy, a scarred aspect of the VF was observed, particularly an absence of vibration of their middle third. The vocal assessment enabled us to objectify this dysphonia (Table ), with the speech therapist reporting a hoarse, unstable, and slightly breathy voice, with inability to reach high notes. Additional movie and audio files show this in more detail (Additional files , and ). |
pmc-6063002-1 | Our baby was born at 40 weeks and 2 days with a birth weight of 3380 g, to a 37-year-old healthy woman with an uneventful pregnancy. A Caesarean section was performed because of foetal distress and the Apgar score was 5, 7 and 7 at 1, 5 and 10 min respectively. The infant required cardio-pulmonary resuscitation at the first minute and than he was transferred to our Neonatal Intensive Care Unit. He was admitted to our Department with a diagnosis of moderate hypoxic ischemic encephalopathy. Consequently he was submitted to hypothermia treatment at 4 h and immediately he showed a persistent painless penile erection (Fig. ) without discolouration of the scrotum or penis, and with bilaterally palpable testicles. An Ultrasonography examination of the arteries and the veins of the penis (Fig. ), and laboratory findings (blood count and biochemical parameters) were normal. Once confirmed non-ischemic priapism, conservative treatment was chosen. Detumescence occurred after 4 h. The newborn continued to have intermittent erections with minimal stimulation for three days. At discharge physical examination was normal. On follow-up at 15 days and at one month, the patient had a normal physical examination and the mother reported normal erections. |
pmc-6063379-1 | A 42-year-old male with a history of schizophrenia, hypertension, and bipolar disorder was brought to the hospital secondary to an episode of generalized body shaking and urinary incontinence. Vital signs were stable (temperature 95.8 F, heart rate 98, blood pressure 150/87 mmHg, respiratory rate 16, and oxygen saturation 97% on room air). The physical examination, except the neurological exam, was unremarkable. The patient was extremely lethargic and was alert only to place. He followed basic commands and did not have any significant cranial nerve, motor, or sensory deficits. Blood work was significant for sodium of 106 mEq/L with serum osmolality of 226 U/L and creatine phosphokinase (CPK) of 835 U/L. The sodium was corrected cautiously with a rate of 8-10 mEq/L/24 hours with intravenous normal saline, desmopressin, and fluid restriction (1200ml/24 hours). The patient received two 500 mg doses of levetiracetam. He was continued on intravenous levetiracetam 750 mg every 12 hours. His home medications, including benztropine, risperidone, and trazodone, were initiated. On the third day of admission, the patient`s CPK levels were elevated to more than 30,000 U/L. His creatinine increased from 1.01 to 1.51 mg/dl. Urine myoglobin was also elevated. He was diagnosed to have an acute kidney injury and rhabdomyolysis. Levetiracetam was immediately discontinued, as it was considered to be the possible etiology. The patient was treated with aggressive intravenous fluid hydration (normal saline) for rhabdomyolysis and for the improvement of renal function. A gradual improvement of CPK was noted (Figure ) accompanied by an improvement in renal function as well as in the overall clinical condition of the patient. |
pmc-6063380-1 | Mr. R is a 36-year-old right-handed male who was admitted to Neurology service for his altered mental status. The patient has a history of hypertension, fibromyalgia, obstructive sleep apnea, depression and substance abuse. One month prior to his presentation, he underwent cardiopulmonary resuscitation (CPR) when he was found unresponsive at his home. The CPR reportedly lasted for 3-4 minutes. He was hospitalized and was found to be in respiratory failure and acute renal failure. He was intubated and was treated for his renal failure. He gradually recovered and was discharged. His family members started to notice gradually worsening behavioral changes and short-term memory problems because of which, he was brought back to the hospital again.
During the course of hospitalization, the patient showed gradual deterioration in his mental faculties. He underwent two magnetic resonance imaging (MRI) studies – first one during the initial admission and the second one, 10 days later. The initial MRI showed T2/FLAIR hyperintensity signal involving the cerebral white matter. The repeat MRI showed significant worsening of the T2 Flair hyperintensities in white matter (Figures , ). Neuropsychiatric evaluation showed that the patient showed significant deficits in his mental faculties including judgment and memory. A battery of blood and cerebrospinal fluid (CSF) studies including complete blood count (CBC), thyroid function studies, vitamin B12, human immunodeficiency virus (HIV), hepatitis panel and paraneoplastic antibody testing was ordered for the evaluation of his rapidly progressive cognitive decline and none of them came out to be abnormal. The patient later underwent a single-photon emission computed tomography (SPECT) scan followed by brain biopsy, which showed an area of demyelination. Post-biopsy, the patient was administered a trial of steroids which did not change his course. By this time, the patient’s cognitive decline came to a halt and was discharged to a nursing home. It was thought that the initial anoxic injury was responsible for his cognitive decline. Patient’s follow-up visit after two months showed a significant improvement in his mental faculties along with near complete resolution of the white matter changes (Figure ). An Institutional Review Board (IRB) approval from the University of Missouri was obtained for the publication of this case report. The IRB approval number for this case is 2011511. |
pmc-6063381-1 | A 28-year-old lady was referred to the neuro-ophthalmology clinic of Hospital Universiti Sains Malaysia for progressive bilateral visual disturbances over a period of three months. The patient was diagnosed to have diffuse large B-cell lymphoma stage IV with metastases to the breast, pancreas, lungs, and ovaries. The diagnosis was made a year before when she presented with right breast lumps, which were subsequently biopsied.
She completed six cycles of R-CHOP (rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone) together with intrathecal methotrexate, dexamethasone, and cytosine arabinoside over a period of five months after the diagnosis. Four months later, she developed right upper limb neuropathic pain and was diagnosed with peripheral neurolymphomatosis of the right brachial plexus. Positron emission tomography with fluoro-D-glucose integrated with computed tomography (FDG-PET/CT) showed no central or peripheral nervous system involvement. She was initiated on methotrexate, but defaulted after the eighth cycle.
Three months later, she developed gradual onset of visual disturbances in both eyes, described as a loss of the left visual field in both eyes. She denied seeing any floaters or flashes of light. The symptoms worsened a month prior to presentation, associated with short-term memory loss and emotional lability. There was no history of fits, body weakness, or sensory deficits. There were also no symptoms of high intracranial pressure such as headache, nausea, or vomiting. She had no diplopia, dyschromatopsia, or metamorphopsia. She denied any recent trauma.
On examination, best-corrected visual acuity was 6/9 in both eyes. Confrontation visual field testing showed left homonymous hemianopia. Ishihara color vision testing was normal. There was no afferent pupillary defect. Both anterior and posterior segments were unremarkable. Humphrey automated visual field confirmed a dense left homonymous hemianopia (Figure ).
Magnetic resonance imaging (MRI) of the brain revealed a well-defined mass in the splenium of corpus callosum associated with white matter oedema, suggestive of metastases (Figure ).
She was diagnosed with secondary central nervous system neurolymphomatosis and started on a regime of rituximab, ifosfamide, carboplatin, and etoposide. She was also given another cycle of intrathecal methotrexate, steroid (dexamethasone), and cytarabine. After completion of three cycles of chemotherapy over a period of two months, her visual field improved significantly (Figure ).
MRI after completion of chemotherapy showed that the mass in the splenium of corpus callosum had reduced markedly in size (Figure ). |
pmc-6063382-1 | A 53-year-old Hispanic male with history of recurrent thromboembolic events while on warfarin anticoagulation therapy presented to the hospital complaining of shortness of breath, abdominal distention, and persistent right calf pain of three-months duration. The patient complained of palpitations, shortness of breath (SOB), and easy fatigability with frequent chest and abdominal pain. Review of symptoms revealed chest pain of four-year duration, a single episode of syncope, and recurrent deep vein thrombosis (DVT) with pulmonary embolisms (PE). The patient had an inferior vena cava (IVC) filter placed two years before due to the recurrence of these thrombotic events despite being on anticoagulation therapy. His only medication was warfarin of unknown dose. He reported being a heavy alcohol drinker and an active smoker with 15 pack a year, but had no history of illicit drug use. Family history was remarkable for mother with type 2 diabetes mellitus, coronary artery disease, and hypothyroidism; and a sister with systemic lupus erythematosus (SLE).
Upon initial examination, vital signs were within normal limits with a temperature of 37.2°C, blood pressure of 140/85 mmHg, and heart rate regular at 80 beats per minute. Body mass index was 25 kg/m2. Physical exam was remarkable for a 2/6 holosystolic murmur best heard over the left lower sternal border with a tumor plop, no jugular venous distention (3 cm above sternal notch), hepatomegaly, ascites, bilateral lower extremity hyperpigmentation, and +2 pitting edema. Laboratory studies were pertinent for a normocytic normochromic anemia with hemoglobin of 11.8 g/dl, thrombocytopenia (65,000 x 103/uL), and an international normalised ratio (INR) of 3.83. All other values within complete blood count (CBC) and complete metabolic panel (CMP) were unremarkable. No blood cultures were deemed necessary at the time. After hospital admission and further workup for a hypercoagulable state, levels of cardiolipin Ab IgG, IgM, and IgA were found to be elevated and the patient was diagnosed with antiphospholipid syndrome. Malignancy workup was negative.
Transthoracic echocardiography (TTE) showed dilated right atria and ventricle with septal flattening and a small pericardial effusion. A dense echogenic, partially calcified structure, measuring 4.7 cm x 2.7 cm, was seen attached to the anterior leaflet of the tricuspid valve (TV) and prolapsing into the right ventricle (Figure -). No right ventricular outflow tract or pulmonary artery involvement was noted (Figure ). Other pertinent findings included a normal systolic function, and moderate to severe tricuspid regurgitation without evidence of pulmonary arterial hypertension. Further evaluation by two-dimensional transesophageal echocardiography (2D-TEE) confirmed these findings but did not provide additional information. Most likely differential diagnoses of the mass included myxoma vs thrombus. Chest computed tomography (CT) demonstrated a lobulated hypo-attenuating intracavitary right heart mass which appeared to be centered in the tricuspid valve (Figure ). Though no vascularity was identified on cardiac magnetic resonance imaging (CMR), findings were suggestive of a cardiac myxoma of the tricuspid valve (Figure ).
Together, these findings suggested a right cardiac myxoma causing TV regurgitation and congestion (hepatomegaly, ascites, dilated inferior vena cava). With TV myxoma as the most likely diagnosis, cardiothoracic surgery was consulted for possible surgical excision. Because thromboembolic events could not be definitively attributed to the cardiac mass do to his hypercoagulable state and the patient was believed to be at high risk for surgical complications, the surgical team initially proposed a trial of medical management with anticoagulation and metoprolol before re-evaluation for surgery. However, as the patient's heart failure due to severe TV regurgitation continued to progress, surgical intervention was deemed necessary. Mass resection with TV replacement with a bio-prosthetic valve was performed. Operative findings were pertinent for a destroyed TV with a calcified and adherent soft friable mass at the right lateral atrial wall. Pathology report of the surgical specimen was consistent with chronic endocarditis with thrombi, rejecting the hypothesis of a cardiac myxoma and suggesting a diagnosis of NBTE instead. |
pmc-6063383-1 | The patient is a 39-year-old female that presented to an outside facility with right upper quadrant (RUQ) abdominal pain. A contrast-enhanced computed tomography (CT) scan in late arterial phase showed a large 12 cm x 10 cm peripherally enhancing mass extending from the right hepatic dome to the gallbladder fossa (Figure ). Percutaneous biopsy was done, consistent with moderately differentiated intrahepatic cholangiocarcinoma, which was CK19+, MOC31+, CA19-9+, CK7+, and CK20 negative. She had retroperitoneal adenopathy, but no extrahepatic disease in the chest, abdomen, or pelvis. She was transferred to our University of Alabama at Birmingham hospital for surgical consultation. The patient was completely functional, although she suffered from abdominal pain. On physical exam, she displayed moderate RUQ tenderness and right epigastric pain. Her laboratory workup was normal, including a total bilirubin of 0.4 mg/dL (normal range 0.3-1.2 mg/dL), normal transaminases, normal white blood cell count, normal hematocrit, and normal CA 19-9 level of 15 units/ml (normal range 0-35 units/ml). International normalized ratio (INR) was within normal limits.
During review at our institution's multi-disciplinary liver tumor board, she was felt to be "borderline" resectable for an extended right hepatectomy due to concern for inability to obtain negative surgical margins along the left portal vein and relatively small hepatic remnant by volumetric analysis due to the size and location of her tumor. Medical oncology was then consulted to consider neoadjuvant therapy in hopes of “downstaging” this lesion to a resectable situation. After this consultation, her case was again presented in our liver tumor board, and recommendations were for chemotherapy to include gemcitabine and cisplatin, as well as liver-directed therapy to include trans-arterial chemoembolization (TACE) with Irinotecan (DEBIRI). Depending on her response to therapy, the plan was for right portal vein embolization in preparation for extended right hepatectomy.
The patient received four cycles of gemcitabine/cisplatin on days 1 and 8 every 28 days, which was dose guided by blood counts per medical oncology. She also received two DEBIRI TACE procedures, and restaging imaging at three months showed considerable response to therapy, though with persistent right lobe disease and normal appearing left lateral segment (Figure ). By mRECIST criteria, the patient had a large centrally necrotic tumor with nodular areas of enhancement consistent with viable tumor and partial response to liver-directed therapy. A right portal vein embolization was performed (Figure ), and she was scheduled for exploration and resection approximately six weeks later. Post-embolization imaging demonstrated appropriate left lateral segment hypertrophy with expected liver remnant of 30%.
During the procedure, there was no evidence of carcinomatosis. Low central venous pressure management was employed. The lesion occupied the majority of the right liver lobe and extended through segment 4 of the left lobe adjacent to the falciform ligament. Intraoperative ultrasound was performed to ensure no disease in the expected liver remnant.
The liver was completely mobilized from the retroperitoneal attachments. Complete portal and celiac lymphadenectomy was performed, the left hepatic artery to segment 2/3 was identified and preserved in addition to the distal branches of the left portal vein, which were carefully identified by dissection into the porto-umbilical fissure (Figures -).
Once resectability was confirmed, all segment 4 branches of the hepatic artery and portal vein were identified and ligated. The right hepatic artery and right portal vein were ligated. The distal common bile duct was transected, margin confirmed negative, and fluoroscopy confirmed appropriate location of the segment 2/3 ducts joining the left hepatic duct. The left, middle, and right hepatic veins were encircled. The liver was scored at the demarcation of segment 4 and segment 2/3 (Figure ). The liver was transected using a Ligasure device, clips, and sutures for larger vascular radicles. Once the hilar plate was approached, it was clear that the tumor was abutting a portion of portal vein bifurcation. We elected to clamp the portal vein proximally and at the segment 2/3 bifurcation and resect the involved portion of the left portal vein, with primary reconstruction to the distal 2/3 portal vein branch. The specimen was completely transected and removed from the field after dividing the segment 2 and segment 3 bile ducts individually, the portal vein reconstruction was performed with running 6-0 prolene suture with a growth factor, and the liver remnant was reperfused (Figure ). Two separate bile duct anastomoses were performed to a retrocolic Roux limb of jejunum for the segment 2 and segment 3 ducts using 6-0 PDS suture (Figure ). Estimated blood loss for the entire procedure was 500 ml, no blood products were transfused. The patient was closed with one surgical Jackson-Pratt (JP) drain in the resection bed.
Postoperatively, the patient had an expected recovery with normalization of her liver enzymes. The patient has mild expected transaminitis following each of the two TACE treatments, which normalized within one week each. Peak lactic acid was 1.6 mmol/L (normal range 0.5-2.2 mmol/L), peak bilirubin was 2.2 mg/dL on post-op day 3, which returned to 0.8 mg/dL at the time of discharge. The remainder of her complete blood count (CBC) and electrolyte panels was within normal limits. With early ambulation, diet advancement, and pain control, the patient was discharged on post-op day 9.
At follow-up, the patient was doing well. Pathology revealed a moderately differentiated 10.5 cm cholangiocarcinoma with approximately 30% viable tumor with evidence of prior TACE treatment, negative surgical margins, 0/5 positive lymph nodes. Perineural and lymphovascular invasions were identified. The patient was followed for one year, with imaging at three-month intervals. The patient continued to be free of disease with interval surveillance imaging, shown at three months here (Figure ). Due to the discussion at our multi-disciplinary tumor board regarding the negative surgical margins and node-negative disease, any further chemotherapy was withheld due to unclear benefit of further systemic therapy. |
pmc-6063386-1 | A 55-year-old incarcerated male presented to the emergency room with a two-week history of left-sided scrotal pain and swelling.
This patient had a history of prostate cancer and high-grade urothelial bladder cancer. His prostate cancer was diagnosed 15 years prior to the current presentation, managed with radiation, and had since remained stable. The patient's high-grade, high-risk bladder cancer was diagnosed two years prior to current presentation. At the time, the patient initially presented with hematuria. A CT urogram performed at the time revealed a nonspecific bladder mass. Biopsy of the mass confirmed urothelial carcinoma. The patient's therapy course included a transurethral resection of the bladder tumor (TURBT), intravesical mitomycin, interferon alfa-2b, and intravesical BCG therapy. He received a total of seven intravesical injections of 50 mg live BCG per injection (350 mg cumulative dose) over the course of 18 months.
The patient's other significant medical history included rheumatoid arthritis, for which the patient was on weekly methotrexate and daily tofacitinib treatment. Both medications were discontinued on admission.
The patient developed scrotal pain two weeks prior to admission. He initially presented to the emergency department with this pain. At that time, he was diagnosed with acute bacterial epididymitis and was prescribed a course of ciprofloxacin. He had no improvement in his symptoms despite this treatment. Over the subsequent days, he reported experiencing intermittent chills and night sweats. He denied any penile discharge or any history of a sexually transmitted disease.
Evaluation of the testicle with ultrasound revealed multiple diffuse nodular areas of hypoechogenicity (Figure , ), as well as marked hypervascularity involving all of the left-sided structures (Figure , ). Routine blood and urine cultures were negative, and mycobacterial blood and urine cultures, as well as bladder biopsy, were pending as of this writing.
Antituberculous therapy was started based on the following considerations regarding the patient's presentation. The lack of observed response to ciprofloxacin therapy decreased the likelihood of uncomplicated bacterial orchitis. We considered this patient's history of bladder cancer involving multiple BCG treatments and the increased likelihood of BCG orchitis. Possibly, his immunocompromised state secondary to the malignancy, in combination with mitomycin chemotherapy and immunomodulatory rheumatoid arthritis treatment, could have increased his susceptibility to a mycobacterial infection. Finally, as ultrasound findings were characteristic of BCG orchitis, the patient was promptly initiated on a combination therapy with levofloxacin, rifampin, isoniazid, and ethambutol. The patient showed marked improvement in pain control and testicular swelling over the following weeks. |
pmc-6063387-1 | We report a case of a 40-year-old female admitted in October 2017, in a tertiary care hospital in Karachi, Pakistan, with skin lesions for three months and fever for one week.
The first lesion appeared on her left thigh, 3 months back, 3x4 cm in size; it was itchy, tender, red, and swollen. After initial 1-2 days, there was purulent discharge from the lesion, followed by watery discharge, and slight bleeding. It then faded with scarring and induration within a few weeks. One week previously, she developed a fever which was documented to be 102-103°F, intermittent, relieved by antipyretics, and associated with rigors and chills. There was a history of oral ulcers, joint pain, photosensitivity, dyspnea, peptic ulcer disease, and signs of depression. However, none of these signs could be appreciated at the time of presentation. Family history was positive for the consanguineous marriage of the parents.
The general physical and systemic examinations were unremarkable. Upon local examination of the skin, multiple ulcerated lesions with an erythematous base and edematous necrotizing centers with purulent discharge were appreciated on the left thigh, right gluteus, and left arm (Figure ). Bilateral lower limb edema was noted. Right lower limb was hot and tender.
Complete blood count, serum biochemistry, serum electrolytes, liver function tests, renal function tests, and coagulation tests were in normal range. Urine analysis showed a pH of 6.5, leucocytes 12-16 per high power field (HPF), red blood corpuscles 20-25 per HPF, and epithelial cells 2+ per HPF. Culture and sensitivity of purulent discharge showed growth of Klebsiella and Pseudomonas aeruginosa. Chest X-ray and abdominal ultrasound were insignificant. The autoimmune assay was done (Table ).
Punch biopsy of the skin was done. The epidermis was normal. Melanophages and mild lymphoplasmacytic infiltrate was seen in the dermis. Deep dermis showed foamy histiocytes with scattered multinucleated giant cells in subcutaneous fat. Hyaline glass appearance was seen in the lobules of adipose tissue (lobular panniculitis). Based on the histological findings the diagnosis of lupus profundus (LP) was established.
We treated her with antibiotics as per sensitivity to the pus culture, oral hydroxychloroquine 400 mg daily for 12 weeks, and oral corticosteroid 30 mg daily which was tapered to 5 mg daily over six weeks when the lesions scarred with lipoatrophy. Potassium permanganate wash was applied locally on the lesions along with local methylprednisolone aceponate 5 mg daily. The patient was discharged after one week. The patient is still in follow-up for the suspected flare of lesions and also susceptibility to develop systemic lupus erythematosus. |
pmc-6063388-1 | A 62-year-old male with chronic obstructive pulmonary disease (COPD) exacerbation presented to the emergency department with a fever of 100.8°F, tachypnea (22 breaths/minute), and room air hypoxia (90%). He was intubated due to his increased work of breathing. A 7.5 mm endotracheal tube (ETT) was easily placed using 20 mg of etomidate intravenous (IV) and 100 mg of succinylcholine IV for rapid sequence intubation. Placement in the trachea was verified with a color change from purple to gold on a colorimetric CO2 detector and the visualization of ETT passage through the cords. The patient had bilateral breath sounds upon post-intubation auscultation.
The depth of the ETT was verified via chest radiography (CXR). Initially, the endotracheal tube was advanced too far (Figure ). The tube was then pulled back (Figure ), but too much so, with the tip of the tube at about the T3 level. Finally, the tube was advanced to its ideal position (Figure ) approximately 5 cm above the carina, which corresponds to T5-T7, visually seen on CXR between the clavicles. The patient received intravenous antibiotics and steroids, was admitted to the ICU, and discharged on day five without complications. |
pmc-6063391-1 | A 67-year-old female presented to the emergency department with worsening left leg pain and swelling for two days. On presentation, her vital signs and physical examination were unremarkable except for extensive edema of the left leg. DVT ultrasound of the lower extremities revealed an acute DVT of the left distal external iliac, common, and superficial femoral veins. Heparin infusion was initiated. Since the clot was large and recent, thrombolytic therapy was planned. Through ultrasound guided cannulation of the left popliteal vein, catheterization of the inferior vena cava (IVC) from the popliteal vein was performed. A left leg and abdominal venogram showed a patent dilated superficial femoral vein, with a dense thrombus involving the proximal superficial femoral vein extending into the common femoral, external, and common iliac veins (Figure ).
A dose of 12 mg alteplase was infused into the thrombus. Subsequently, catheter directed thrombolysis was perfomed. This led to a resolution of thrombus in the superficial and common femoral veins, but there was significant residual stenosis and thrombus in the left common and external iliac veins. Angioplasty of the left common and external iliac, superficial and common femoral veins was performed. Catheter directed therapy with alteplase at 0.5 mg/hr was infused overnight. The following day, angiography showed patency of the left femoral and external iliac veins, but no forward flow in the left common iliac vein. Intravascular ultrasound (IVUS) revealed a residual thrombus and extrinsic compression of the left common iliac vein from the crossing artery. A diagnosis of MTS was made. Stents were placed in the common and external iliac veins, after which there was no residual irregularity, and a forward flow into the IVC was achieved (Figure ). She was discharged on long-term oral anticoagulation therapy with warfarin. |
pmc-6064016-1 | A 20 year-old female patient was referred to the Department of Operative Dentistry, Dow Dental College, complaining of pain in a previously treated left maxillary lateral incisor. Clinically there was pain on percussion without a discharging sinus and normal mobility. The clinical crown was wider than the contralateral with an unusual cervical depression mesially (). Periodontal examination (CP 12 periodontal probe, Hu Friedy) revealed a 5 mm isolated probing defect on the palatal aspect with an associated shallow palatogingival groove (). Cold test (Roeko Endo Frost, Coltene/Whaledent Pvt Ilt, Mumbai India) revealed that the lateral incisor was non vital, while the adjacent central incisor and canine were vital. Radiographically, there was poorly obturated canal associated with a periapical radiolucency (periapical index score 5) and an untreated accessory root with a patent canal () [34]. A diagnosis of previous inadequate treatment and a chronic apical periodontitis secondary to an un-treated canal was made. It was decided to perform a non-surgical endodontic retreatment. An informed consent was taken from the patient.
All treatments were performed under a magnification 2.5× loupes and an overhead light source (Tao’s Optics, Nanjing, China). After administering local anesthesia of Lidocaine 2% with 1:100000 epinephrine (Medicaine Houns Co. Ltd, Korea), a rubber dam was placed. Restorative material from access cavity was removed with a round diamond bur (size ISO 001/016 Mani, Japan) and previous root filling was removed with ProTaper retreatment files (Dentsply Maillefer, Ballaigues, Switzerland). However, the orifice of accessory root could not be found with this conventional access. Main canal was filled with calcium hydroxide (Calcipast, Cerkamed, Stalowa Wola, Poland) and access cavity was restored with Cavit (ESPE-Premier, Norristown, PA, USA) and patient was recalled after a week. On subsequent appointments, the access was modified by extending more gingivally to involve the cingulum while some gingival tissue was also removed to expose the cingulum completely (). Attempts to locate the accessory canal often resulted in placing the files into the periodontal ligaments of furcation between the two roots.
After much efforts, the canal orifice was eventually located on mesio palatal aspect of modified access cavity with a mesially angulated #10 K-file (SybronEndo Corporation, Orange, CA, USA) (). Working length was established with electronic apex locator (Locapex Five, Ionyx, Blanquefort, France) and verified radiographically. Canal preparation was performed with ProTaper rotary NiTi instruments according to manufacturer instructions (Dentsply Maillefer, Ballaigues, Switzerland). Canal was copiously irrigated between the use of each file with 5.25% sodium hypochlorite (CHLORAXID 5.25%, Cerkamed, Stalowa Wola, Poland). Subsequently, both canals were dried and calcium hydroxide was placed and access cavity closed with a temporary restorative material (Cavit™, 3M, Maplewood, Minnesota, USA) ().
Patient reported after three weeks. By this time all the symptoms had subsided. It was decided to obturate both the canals. After local anesthesia and rubber dam isolation, canals were irrigated with sodium hypochlorite to remove the dressing and dried with paper points. Canals were obturated with warm vertical technique using an obturation device (Elements Obturation Unit, Kerr Corporation, Orange, CA, USA) and a resin based sealer (AH-Plus, Dentsply Maillefer, Ballaigues, Switzerland) (). Access cavity was restored with a flowable composite resin (Filtek flow, 3M, Maplewood, Minnesota, USA). At this point, the surgical correction of palatogingival groove was deferred since some tooth structure was already sacrificed in attempts to locate the accessory orifice.
Patient returned after a month for recall visit and complained of recurring pain and pus discharge. At the time of visit, no sinus tract was detected. Based on symptoms of pain, it was decided to perform surgical retreatment. On next visit a full thickness mucoperiosteal flap was raised with one relieving incision involving the distal papilla of canine (). A defect in buccal plate could be seen located around the apex of accessory root. After further osteotomy of buccal plate, the periapical lesion was enucleated. The lesion was found to have no attachment to the either root and was removed quiet easily (). Due to this fact we decided not to perform root end resection. The bony window was filled with an irradiated allograft (Rocky Mountain Tissue Bank, S. Peoria, Aurora, Colorado, USA) and covered with a resorbable collagen membrane (BioMend, Warsaw, Indiana, USA) (). Sling suturing technique using 3.0 silk sutures (Glysilk, Huailyin Medical Instruments Factory, China) was used for primary closure and simple interrupted sutures were used for relieving incision (). Post-operative instructions were given and patient was recalled. The stitches were removed after a week. On a 2-year follow-up patient reported complete absence of symptoms, reduced periodontal probing depth on palatal aspect and radiographic signs of complete healing but with mild discoloration of clinical crown (). The discoloration was treated with a walking bleach technique using sodium perborate powder. |
pmc-6064017-1 | A 9-years-old female visited a dentoalveolar trauma clinic, 2 h after a bicycle accident. Clinical and radiographic examination revealed presence of a horizontal root fracture at the middle third of the left maxillary lateral incisor and 5 mm displacement in axial direction in the left maxillary central incisor. The patient received initial care after the accident including repositioning of the coronary portion of the left maxillary lateral incisor. Alveolar bone fracture was suspected and a rigid splint involving the maxillary incisors was used ().
Two weeks later during the second visit, surgical extrusion of the left maxillary central incisor was performed and antibiotic was prescribed (Amoxicillin/500 mg during 7 days). As the tooth apices were mature and spontaneous recovery might not occur, this procedure was chosen. The left maxillary central incisor showed negative responses to pulp sensibility test and dental splint was maintained for 3 months.
After 20 days, endodontic treatment of the intruded incisor was initiated and calcium hydroxide paste (Calen, SS White-Rio de Janeiro, RJ, Brazil) was placed in the root canal for a 4 weeks. This was followed by obturation and coronal restoration.
Annual controls were performed. Clinical examination revealed normal soft and hard tissues, and left lateral incisor showed positive response to pulp sensitivity tests. During the first six months, monthly radiographic and clinical controls of all the involved teeth were performed. Clinical and radiographic follow-up, showed the stabilization of the horizontal root fracture in the middle third, normal soft and hard tissues, no evidences of root resorption in both teeth and a positive response to pulp sensibility tests of the left maxillary lateral incisor. After 8 years, the radiographic images suggested repairing of the left maxillary lateral incisor with deposition of mineralized tissue between the fragments (). showed the initial and final clinical images. |
pmc-6064020-1 | A 42-year-old male patient was referred to the Endodontic Specialist Clinic in 2016 for the management of left maxillary first premolar with advanced caries. At the time of consultation, tooth #24 was asymptomatic. The patient’s medical history was non-contributory.
Clinical examination revealed subgingival caries on mesial surface of tooth #24 (). The probing depth was within normal limit. The tooth was not tender to percussion, palpation or biting and it was not mobile. Pulp sensibility test (Elements Diagnostic Unit, SybronEndo, Orange, CA, USA) was performed and failed to elicit a response. A periapical radiographic examination revealed a periapical radiolucency of the tooth (). The tooth was diagnosed with pulp necrosis; asymptomatic apical periodontitis.
The patient was advised of the clinical findings and various treatment options were discussed. The patient decided to proceed to the following agreed treatment plan which was; 1) nonsurgical root canal treatment, 2) orthodontic extrusion by a sectional fixed appliance and 3) post-retained all ceramic crown. The potential technical difficulties such as providing coronal seal and exposure of the sound tooth structure via orthodontic extrusion for placement of restorative margin were explained to the patient.
Written consent for the proposed treatment was obtained from patient. At the first visit, nonsurgical root canal treatment was initiated after local administration of 2% mepivacaine with 1:100000 epinephrine (Scandonest 2% Special, Septodont, France). The tooth was isolated with dental dam. The canals were accessed under surgical microscope (OPMI Pico Zeiss Dental Microscope, Germany). The working length was determined using an electronic apex locator (Root ZX mini, J. Morita, Japan) and verified radiographically (). The canals were prepared using NiTi rotary files (ProTaper NEXT rotary files, Dentsply Maillefer, Ballaigues, Switzerland). Sodium hypochlorite (2.5%) was used as an irrigant and calcium hydroxide (Calcipex II, Nishika, Japan) as intracanal medicament. The access cavity was restored with temporary restoration (Intermediate Restorative Material, Dentsply Caulk, Milford, United States). After a week, the root canals were re-entered and irrigated with 2.5% sodium hypochlorite to remove the intracanal medicament. Fitting of master gutta-percha was verified radiographically. Canals were irrigated with 2.5% sodium hypochlorite, 17% ethylene-diamine-tetra-acetic acid, normal saline and 2% chlorhexidine (final irrigation protocol) using passive sonic irrigation (EndoActivator System Kit, Dentsply Maillefer, Ballaigues, Switzerland). The root canals were dried with calibrated absorbent paper points. Warm vertical compaction technique was used to obturate all canals. After the completion of obturation, post space was prepared in the palatal canal using post drill. Five mm of gutta-percha was retained apically and fiber post (RelyX™ Fiber Post, 3M ESPE, United States) was cemented with resin cement (RelyX™ Unicem™ Self-Adhesive Universal Resin Cement, 3M ESPE, United States). Subsequently, composite core was placed on the tooth ().
The patient was then scheduled for an orthodontic extrusion procedure by using a segmental arch techniques (SAT) of fixed appliance. An orthodontic band with labial bracket was fitted and cemented on tooth #24 to allow all remaining crown structures to be protected for retention and resistance during extrusion. Brackets were bonded on the labial surfaces of teeth #21 to 26 (). These neighbouring teeth were used as anchoring teeth. An orthodontic wire (0.016 NiTi) was ligated to the bracket from tooth #21 to tooth #26 to produce the extrusion force on tooth #24, so that the NiTi wire was able to provide a continuous low force for a long time frame. After four weeks, tooth #24 had been extruded for about 1 mm. The same band was debanded and recemented more gingivally. The extrusion force was reapplied with the same arch wire and palatal cusp tip of tooth #24 was reduced to prevent occlusal interference with the lower teeth. After the second four weeks, around 2 mm of extrusion had been achieved and this was judged to be sufficient ().
Following extrusion, fibrotomy was performed under local anaesthesia to prevent relapse. Subsequently, post-retained all ceramic crown preparation was performed and acrylic crown was cemented as provisional crown (). Composite button was placed on provisional crown to retain the position of the extruded tooth #24 (). All ceramic crown was cemented as the final restoration a week later.
At one year review, patient was symptom-free. He expressed his satisfaction with the treatment from aesthetic point of view (). Clinically, the crown was satisfactory and there was no evidence of apical pathology in periapical radiograph (B). |
pmc-6064021-1 | A 35-year-old female was referred to Dental School of Zahedan University of Medial Sciences by her general dentist for consultation about endodontic treatment of her maxillary left lateral incisor (tooth #10). She complained of continuous vague pain in her anterior maxilla. Her medical history was unremarkable. Her maxillary left lateral incisor already had a prepared access cavity and did not respond to the vitality tests. It did not have pain on palpation or percussion. Her oral hygiene was moderate and she did not have any periodontal pocket around her maxillary left lateral incisor. The tooth did not have any sinus tract and the patient had no history of dental trauma. Radiographic examination revealed an unusual root canal system. The lake of centralization of the main canal. Non-surgical root canal treatment was planned for her. Local anesthesia was administered by supra-periosteal injection of 2% lidocaine plus 1:80000 epinephrine (Persocaine, DarouPakhsh, Tehran, Iran). Temporary dressing was removed and the access cavity outline was corrected to find possible anatomical variations. A rubber dam was placed for isolation of the tooth. One orifice was evident in the pulp chamber floor. The orifice of the second canal was found following negotiating the pulp chamber floor with a #10 K-file (Dentsply Maillefer, Ballaigues, Switzerland) and precurving the file palatally. Another radiograph was taken, which confirmed the presence of a second canal ().
The canals underwent mechanical and chemical debridement with M-two rotary files (25/0.06, 20/0.06, 15/0.05, 10/0.04) (VDW GmbH, Germany) for the palatal canal and up to 35/0.04, for the buccal canal using the standard technique. Irrigation was performed using 5.25% sodium hypochlorite.
After root canal instrumentation, 17% EDTA (Asia Chimi Teb, Tehran, Iran) was used to eliminate the smear layer. After rinsing with saline, the canals were dried with sterile paper points and filled with gutta-percha (Meta Biomed Co., Chungcheongbuk do, Korea) and AH-26 sealer (Dentsply, DeTrey, Konstanz, Germany) using lateral compaction technique. The tooth was then temporarily restored (). The patient was referred to prosthetic specialist for permanent restoration and a follow-up radiography was taken after six months (). |
pmc-6064033-1 | A 51-year-old male with no history of systemic disease was admitted to the endodontic department of a private dental clinic. He was suffering from recurrent abscess formation in the right maxillary buccal vestibule near the right upper first molar. Radiographic examination () revealed a circumscribed periapical lesion contiguous to the distobuccal root of the right upper first molar (tooth #16), extended to the mesial of mesiobuccal root of the adjacent second molar (tooth #17). Tooth #16 was root treated and restored with amalgam. The tooth #17, which had an amalgam restoration, had positive responses to an electrical pulp tester (Parkell, Edgewood, NY, USA), and cold test with Endo-Frost (Coltène-Whaledent, Langenau, Germany). In the clinical examination, no sinus tract was found. The patient had some tenderness to palpation of the associated buccal gingiva and expressed pain on percussion on tooth #16. Probing depths of gingival sulcus in both teeth were normal (<3 mm). Following all examinations, the lesion presumed to be a symptomatic apical periodontitis ascribed to treatment failure of the distobuccal root; and a surgical endodontic retreatment planned to be done for this root. The patient was informed about the treatment plan and his consent for the operation was obtained.
After a 0.12% chlorhexidine mouth rinse, under local anesthesia with 2% lidocaine plus 1:80000 epinephrine (Darupakhsh, Tehran, Iran), a full mucoperiosteal flap was retracted. The lesion was curetted and the specimen was sent for histopathological examination. Root-end resection, root-end preparation, and root-end filling with calcium-enriched mixture (CEM) cement (BioniqueDent, Tehran, Iran) was performed and the flap was repositioned (). Histopathological evaluation confirmed a granulomatous inflammatory lesion. Although the surgery was satisfactory, there was no amelioration in symptoms and signs in the two-month follow-up (). As there was a doubt about existing a vertical root fracture (VRF) in the involved tooth, taking a cone-beam computed tomography (CBCT) from that region was prescribed. The scan () was inspected carefully and no evidence of VRF was found. Watching all the slices of the scan (), the spatial relationship between the lesion and the mesiobuccal root of the adjacent upper right second molar was observed. Consequently, endodontic therapy for maxillary second molar was selected as the treatment plan; however, this tooth exhibited positive responses to pulp sensibility tests. At every step, the patient was informed about the diagnosis procedure. Following his consent, the root canal therapy was planned.
After preparing the access cavity under isolation, it was observed that the mesial root canal had no bleeding/vital pulp. It was necrotic despite the existence of vital pulp in the two other root canals. Cleaning and shaping using full-strength sodium hypochlorite was performed; in the same session, root canals were obturated with gutta-percha (Ariadent, Tehran, Iran) using Roth 808 endodontic sealer (Roth Drug Co., Chicago, IL, USA). Subsequently, the coronal restoration with amalgam was carried out (). One week later, the symptoms and clinical signs were comforted. Complete healing of the periapical lesion in the radiographic examinations was achieved at the 18-month follow-up, proving the correctness of the latest treatment plan () |
pmc-6064090-1 | On 20th August 2016, a 42-year-old man with a fever (38.4 °C) was admitted to a local hospital in Hangzhou City, China. He lived in Shenzhen City, but was visiting Hangzhou at the time. His disease began with a headache 1 day earlier. Upon admission, blood tests showed a leukocytosis of 10.48 × 109/L (80% neutrophils). On the night of admission, a lumbar puncture showed high levels of white blood cells (WBCs, 1170 cells/ μL, 83% neutrophils), a protein concentration of 3.0 g/L and a glucose concentration of 1.0 mmol/L in the cerebrospinal fluid (CSF) sample. He was treated with 2.0 g of the antimicrobial ceftriaxone and his situation was not improved.
One day later, the patient’s speech became incoherent and he experienced dyspnea. He was transferred to the intensive care unit and endotracheal intubation was applied. He was administered combined therapy comprising of antibiotics (meropenem and linezolid) and an anti-inflammatory drug (dexamethasone). During the night, the patient was found in a coma with dilated bilateral pupils. Computed tomography scans of his brain illustrated hydrocephalus, cerebral edema and foggy brain ventricles. Ventricle puncture for external CSF drainage was performed to reduce intracranial pressure. Four days after admission, microbial culture results of the CSF samples were negative for bacteria and fungi.
On 31th August, the patient was taken back to Shenzhen at the request of his family, and transferred to Shenzhen Third People’s Hospital, the key institute for handling infectious disease cases. At the time of admission, he was already in a deep coma and unresponsive to simple cues. A blood test showed a leukocytosis of 14.72 × 109 /L (93.3% neutrophils). The CSF appeared light red in color and was mixed with cloudy debris. The WBC count in the CSF had increased substantially to 52,860 cells/ μL (79% lymphocytes), whereas the protein level had increased to 49.96 g/L and the glucose concentration was 0.11 mmol/L. Computed tomography scans showed severe brain swelling. The shape of the cerebral ventricles had become twisted and almost disappeared (Fig. ).
His CSF sample was immediately sent for pathogen detection by NGS at BGI-Shenzhen. Briefly, the CSF sample was centrifuged at 10,000×g for 10 min and the precipitate was used for nucleic acid extraction using the QIAamp DNA Mini Kit (Qiagen), following manufacturer instructions. NGS was performed on the newly developed BGISEQ-500 platform []. The sequencing detection identified 65,658 (out of 246,938,950) sequence reads (0.0266%) uniquely corresponding to the N. fowleri genome (Fig. ) [], and these reads covered a high percentage of the genome (Fig. ). When the reads from the human host were excluded, N. fowleri reads were comprised the most of any microbial species, accounting for 0.3689% of total microbial reads and unknown or unclassified reads (Fig. ), and more than the total reads of bacterium or fungi (Additional file ). A 1.6-kb consensus sequence of the 18S ribosomal RNA of N. fowleri was assembled (GenBank accession no.KY062165) and found to be 99.99% identical to a reference N. fowleri sequence (GenBank accession no. U80059). N. fowleri infection was confirmed by PCR (Fig. ) using the specific primers NFITS-FW (TGAAAACCTTTTTTCCATTTACA) and NFITS-RV (AATAAAAGATTGACCATTTGAAA) covering the 5.8S ribosomal DNA and internal transcribed spacer 2 []. Therefore, all these results indicate that the patient was infected with N. fowleri. In addition, patient history collected from family members showed that the man was splashed by lake water when he attended the Water-Splashing Festival in Shenzhen approximately 1 weeks before symptoms onset, which may be the source of infection. Anti-amoebic drugs including amphotericin B (AmB) at 50 mg/day and fluconazole 0.4 g/day were immediately administered. Unfortunately, symptoms did not improve and the patient’s family requested to cease medical treatment 2 days later. Life support was withdrawn and the patient was pronounced dead on 3rd September. |
pmc-6064128-1 | We present a case of a 65-year-old female patient admitted to the Cardiac Surgery Department in Wroclaw in January 2018 with severe mitral regurgitation (MR) and the history of ischemic heart disease, after elective percutaneous coronary intervention of the circumflex branch of left coronary artery with two drug-eluting stents (DES) implantation 4 years earlier. Furthermore, the patient diagnosed with many chronic conditions, such as metabolic syndrome, obesity with BMI 33 and gastroesophageal reflux disease. Currently, with an exercise dyspnoea for about 2 years, intensifying in recent weeks, she was hospitalized in the Cardiology Department for further diagnostics. The transthoracic echocardiography (TTE) revealed non dilated left ventricle with a normal systolic ejection fraction of 60%, and no evidence of segmental wall motion abnormalities, severe MR with the prolapse of the A2 segment and systolic restriction of the posterior leaflet. Colour Doppler showed a highly distinctive eccentric turbulent jet directed towards the lateral wall and the base of the left atrium with ERO 0.6cm2 and regurgitant volume of 60 ml. Additionally, in the performed coronary angiography, hemodynamically significant narrowing was found in the area of the previously implanted DES. The patient was then consulted by the cardiac surgeon and qualified for surgery. After admission to the Cardiac Surgery Department, as part of the pre-operative preparation, TTE was again performed, in which the severe MR was confirmed and no pathological structures in the right atrium were described. Due to the unclear image in the right pulmonary field, described by the radiologist in the chest X-ray (Fig. ), diagnostics was extended by performing a computed tomography of the chest, which excluded the presence of pathological shadow in the lung parenchyma. There was no referral to the atrial septum in the CT report. The patient was scheduled for mitral valve repair surgery and coronary artery bypass grafting (CABG) with the use of saphenous vein graft to the circumflex artery. During the standard procedure of commencing the cardiopulmonary bypass (CPB) and bicaval cannulation, it was found difficult to insert the cannulas from the atrium into both vena cavas. Therefore the cannulation was performed using the smaller cannula sizes, which eventually allowed to go on bypass. On the free wall of the atrial septum, there was a thickening and an excess of adipose tissue with a firm consistency and the size of a walnut, significantly impeding access to the operated mitral valve through the left atrium, and probably completely preventing surgery by the transseptal approach. In the transesophageal echocardiography (TEE), a characteristic image of LHAS was confirmed by the presence of hypertrophy of the septum, up to 2.7 cm, an hourglass shape with a characteristic indentation at the place of the fossa ovalis (Figs. and ). Based on the intra-operative TEE, as well as by analyzing the chest X-ray and CT scans, the diagnosis of LHAS was made. Due to the asymptomatic course of the LHAS and the complexity of the scheduled operation, the decision was made to leave the change intact. The mitral valve was replaced through the left atrial approach. The surgery was completed in a standard manner and the weaning from the CBP went uneventfully. The patient’s early postoperative period was a routine. |
pmc-6064195-1 | A 44-year-old man presented with visible hematuria, right-sided abdominal pain and a distended abdomen on a background of known large bilateral renal AMLs (right 23 × 21 cm, left 21 × 15 cm) () associated with tuberous sclerosis and a history of multiple previous embolizations, performed without complication.
He had multiple comorbidities including hypertension, a ventriculoperitoneal shunt, and end ileostomy after panproctocolectomy and neoadjuvant radiotherapy in March 2015 for a rectal adenocarcinoma.
His renal function on admission was normal and he was hemodynamically stable initially. Dimercaptosuccinic acid scan was performed, which showed the right kidney contributed 57% and left kidney 43% of the differential renal function, respectively.
Renal CT angiography suggested his right kidney was actively bleeding in the upper pole () and confirmed on direct angiography (); so decision was made to proceed to selective embolization. Five milliliters of polyvinyl alcohol and 5 ml of lipiodol were used. His hemoglobin fell from 94 to 70 g/L and he was transfused with 2 U of red blood cells. His hemoglobin increased to 84 g/L.
He deteriorated the next day, complaining of lethargy, malaise, hematuria, and ongoing abdominal pain. He was febrile, and blood tests revealed a significant fall in hemoglobin level and estimated glomerular filtration rate (eGFR) to 76 g/L and 55 mL/min, respectively. He was then given a dose of gentamicin, 4 U of red blood cells and 2 U of platelets. Repeat CT was nondiagnostic owing to the presence of contrast in his kidneys from the previous intervention. During repeat direct angiography the source of bleeding could be lateralized to the upper pole of the right kidney again. Angiography was also done on the left to ascertain no further bleeding sites. As such it was embolized again; on this occasion with gelfoam and four “tornado” coils ( and ). He was then transferred to the high dependency unit for closer monitoring as he became hemodynamically unstable.
DIC was discovered postprocedure on coagulation studies with an international normalized ratio (INR) of 1.6, decreased fibrinogen, elevated partial thromboplastin time/prothrombin time, and platelets 62; so was transfused 2 U of fresh frozen plasma and 2 more units of red blood cells. He was oliguric and hypertensive with a rapidly declining eGFR and a four-liter positive fluid balance. He was still febrile so piptazobactam and vancomycin were commenced and was upgraded to intensive care unit care for continuous veno-venous hemodiafiltration (CVVHDF). A three-lumen central venous catheter was inserted into the left femoral vein. CVVHDF commenced that evening and continued for 5 days.
Hemoglobin continued to fall so he was given a further 2 U of red blood cells and 2 U of fresh frozen plasma. He had persistent fevers and hematuria. He was on a fentanyl infusion for abdominal pain. INR rose to 1.8.
A hemolysis screen was performed to account for his ongoing hemoglobin decline; however, this was negative.
After 10 days of supportive care, he began improving clinically and after another 2 weeks was discharged to home. He has been referred to the renal transplant service for consideration of a bilateral nephrectomy and transplant but thus far has remained stable and has not reattended our institution. |
pmc-6064627-1 | A 51-year-old male was referred to our center due to a large perineal mass. The mass was first discovered 30 years ago as a chestnut-sized small movable cystic nodule. Subsequently, he watched himself for a long time because of no unusual changes. The cyst started to grow suddenly 4 months previous to the visit and caused great discomfort in the perineum due to its large size.
On physical examination, an approximately 15-cm cystic mass was observed in the left perineum near the anus. There was no sign of inflammation such as tenderness or redness. Ulceration or discharge was not observed. On a digital rectal examination, there were no specific findings in the anus. A colonoscopy was performed and was unremarkable. Magnetic resonance imaging revealed a 6.7 × 16 cm lobulated mass in the medial aspect of the left perineum with an intermediate signal on T1WI, a high signal on T2WI, and peripheral wall and internal septal enhancement (Fig. ). There was no significantly enlarged inguinal lymph node. Laboratory values were within normal ranges, except for TPLA (+), FTA-ABS IgG (+), and FTA-ABS IgM (−). Preoperative pathologic tests such as fine needle aspiration and core needle biopsy were not performed because the mass was considered as an epidermal cystic mass.
The patient underwent excision of the mass with a negative margin. On exploration, a cystic mass with sebum and keratin was identified in the left perineum (Fig. ). It had a clear margin without invasion of anal sphincter and urologic tissues. Because the preoperative diagnosis was a cystic mass such as an epidermal inclusion cyst made by the MR pelvis, the surgery was performed with minimal gross margin. The skin was preserved as much as possible and closed easily without any reconstruction. Histopathological analysis showed the cyst had a thin wall composed of benign squamous epithelium. Some sections of the wall were thick, indicating a microinvasive squamous cell carcinoma (pTisN0M0, pStage0) (Fig. ).
The patient was discharged 2 days after the surgery without a significant postoperative complication. We performed regular follow-up examinations with CT every 6 months, and he showed no evidence of recurrence at 3 years postoperatively. |
pmc-6064714-1 | In January 2015, a 61-year-old Caucasian male was referred to our Oral Pathology and Medicine Unit by his own dentist for white oral lesions, since it was initially thought to be a fungal infection and he had received treatment based on topical antifungals, without a significant clinical improvement.
Past medical history included appendectomy, cholecystectomy, and tonsillectomy. He had never smoked or used drugs recreationally and did not drink alcohol. At the time of the first visit, he was not taking any medication. No symptoms were referred by the patient, but he had noted a progressive increase of the lesion size in recent months. Clinical examination showed a thickened hyperkeratosis, which was confluent in widely exophytic papillary plaques. These lesions appeared homogeneously whitish-gray with verrucous surface and localized on the maxillary gingiva and palatal and alveolar ridge mucosa (Fig. ). Incisional biopsies were performed, and multiple samples of tissue from the lesions were taken, using a 3-mm punch biopsy.
The histopathological analysis revealed exophytic, hyperkeratotic lesions with prominent verruciform or papillary surface and acanthosis forming droplet-shaped epithelial projections into the lamina propria (Fig. ). A sample was described as a hyperkeratosis with finding areas of verrucous hyperplasia. Other two gingival samples showed a hyperkeratosis with focal mild degree dysplasia (Fig. ). Some areas showed intraepithelial alteration compatible with human papillomavirus infection. One portion of the gingival biopsy specimen, previously frozen, was used for DNA (deoxyribonucleic acid) extraction. Human papillomavirus DNA presence was confirmed with polymerase chain reaction (PCR) amplifications, and the viral typing, by direct sequencing of DNA common genomic region L1, displayed positive result for research of HPV subtype. Before surgical procedure, a complete blood cell count was performed to exclude coagulation disorders, along with viral profile. The excision of the lesion has been performed, under local anesthesia, using a diode laser (wavelength 808 nm) set at 1.5 W, the optical fiber, 300 μm, in a pulsated-wave emission mode to reduce the layer carbonization of the tissues (Fig. ). The size of the lesion was 1.25 × 3.0 cm, and the laser settings were fluence 16 J/cm2, pulse length 20 ms, and spot diameter of 2 mm. No postoperative complications, as well as no swelling and/or pain reported by the patient, have been observed. A periodic follow-up every 6 months has been scheduled. At the last oral examination, 2 years after surgery, we found no signs of loss of alveolar process in correspondence of the surgical ablation site, whereas a mild hyperkeratosis of the maxillary vestibular gingiva was clinically objectified (Fig. ). The microscopic examination performed on a tissue specimen taken in the same area of the laser treatment showed no signs of epithelial dysplasia (Fig. ). |
pmc-6064759-1 | A 54-year-old female was referred from the emergency department with sudden onset of dysphagia and odynophagia after ingestion of fishmeal. This was accompanied by a severe left C6 radicular pain. On examination, the patient had no focal neurological deficits.
A lateral X-ray of the neck showed a radiopaque foreign body, 3.5 cm in size in the mediolateral dimension, located in the upper cervical esophagus with the sharp end in the neural foramen at the C5-6 level ().
A computed tomography (CT) angiogram of the cervical spine revealed transluminal migration of the foreign body across the esophagus into the left C5-6 neural foramen abutting the left vertebral artery. There was no evident vertebral artery injury ().
In view of the proximity to the neurovascular structures, the otolaryngologists deferred endoscopic removal of the foreign body. We approached the lesion through an anterior cervical approach with a standard incision used for anterior cervical discectomy on the left side. After retraction of the sternocleidomastoid and the carotid laterally, a hard-metallic linear foreign body was encountered traversing the lumen of the esophagus. The fascial dissection was carried out until the object was clear. The longus colli muscle and the C5-6 disc space was exposed. The foreign body was seen entering into the left C5-6 neural foramen. The metallic body was gently pulled and extracted completely with no injury to the vertebral artery injury (). The patient had immediate relief of her left radicular pain; she was managed with Ryle’s tube feeds for a week and subsequently started on oral feeds and discharged. |
pmc-6064761-1 | A 58-year-old woman with a history of diabetes and hypertension presented to us with chief complaints of recurrent right-sided epistaxis and nasal blockage for the past 4 months, which were progressively worsening. She had no history of headaches, facial numbness, hyposmia, epiphora, aural symptoms, neck swelling or any constitutional symptoms. There was no history of allergy, trauma or smoking in the past. On nasoendoscopic examination, the patient was found to have a mass occupying the right nasal cavity, which was arising from the right lateral nasal wall and free from the nasal septum. The mass was friable and painless on touching (). A flexible nasopharyngolaryngoscopic examination of the nasopharynx, oropharynx and hypopharynx and examinations of the oral cavity were unremarkable. A biopsy taken from the mass revealed features suggestive of a REAH.
A contrasted computed tomography (CT) scan of the paranasal sinuses revealed a homogenous non-enhancing soft tissue lesion in the right middle meatus measuring 2 × 2 cm, with no extension into the paranasal sinuses, nasopharynx or contralateral nasal cavity (). Upon consultation with the patient, and after obtaining the consent, we proceeded with an endoscopic excision of the right nasal cavity REAH under general anesthesia.
On the basis of these findings, the mass was carefully excised from the right lateral nasal wall using a bipolar electrocautery device. Postoperatively, the patient was discharged with penicillin-group antibiotics and was advised to perform regular nasal douching. An intraoperative biopsy of the 2.5 × 1.5 cm mass () showed polypoidal fragments lined with papilliform projections and its stroma composed of numerous elongated-to-irregular-round glands lined by respiratory-type ciliated columnar epithelium.
The lesion also exhibited an absence of atypia, necrosis and basement membrane infiltration ().In view of the characteristic histopatho-
logical features and benign appearance of the mass endoscopically and radiologically, a diagnosis of REAH was made. The lesion was not confirmed through immunohistochemistry because the characteristic features were obtained through histopathology. The patient was carefully followed-up after surgery and the wound had successfully healed 3 months after the initial surgery. There was no evidence of recurrence 6 months after the initial surgery (). |
pmc-6064764-1 | An 11-year-old girl was reported to ambulatory care with fever and headache for 2 weeks. Prior to these symptoms, the patient was in normal health. She had febrile episodes (100–102 °F) without chills or rigors. The fever was associated with severe headache on the right side and was not associated with any vomiting, nausea or aura. The patient did not have any other significant complaints, clinical signs or symptoms pertaining to the ear, nose, throat or chest, or bleeding diathesis except for a history of falling 2 years previously when she was 9 years of age.
We admitted the patient for further evaluation. On clinical examination, the patient had tenderness over the right mastoid bone with an intact tympanic membrane. With the above history, a provisional diagnosis of acute mastoiditis of the right side was made. Pediatric neurology, endocrinology, and ophthalmology consultations were obtained. On fundoscopy, the patient had bilateral papilledema with normal vision on both sides and was referred for further imaging with magnetic resonance imaging (MRI) of the brain which revealed no space-occupying lesions in the brain.
Routine investigations were all within normal limits except for erythrocyte sedimentation rate which showed a three-fold increase in the first hour. Subsequently the Mantoux test was performed which was positive (22-mm induration) and there was increased serum homocysteine.
Subsequently the patient was worked up for tuberculous OM, and a bone scan was performed for OM of the temporal bone. The patient had a positive Mantoux test (22-mm) and 99Tc- MDP triple phase bone scan with single-photon emission computed tomography (SPECT-CT) of the temporal bone which suggested asymmetric uptake with increased radiotracer accumulation in the right temporal bone posteriorly. The patient was kept on AKT but did not respond.
High-resolution computed tomography (HRCT) scan of the temporal bone showed mild sclerosis and cortical destruction involving the right temporal bone (). With these findings, the patient was taken up for debridement to obtain tissue for histopathological diagnosis.
The patient underwent right cortical mastoidectomy under general anesthesia. There was a mass with soft cheese-like material on the sigmoid sinus bony plate. The sigmoid sinus plate was eroded, and the mass was tracked medially and found to be compressing the lumen of the sigmoid sinus. The mass occupied the space between the sigmoid sinus bony plate and the membranous lumen, misleading the diagnosis as lateral sinus thrombosis (). The disease was cleared overall and the sigmoid sinus was found to be normal with good flow as confirmed by needle aspiration.
Tissue was sent for histopathological examination which revealed Mucor mycosis-induced OM of the right temporal bone (). Postoperatively, the patient received 2g cumulative dose of Amphotericin-B (liposomal) along with voriconazole 50mg per day for 3 weeks.
The patient was strictly monitored for liver and renal function tests. The patient was free from symptoms after 3 weeks, with regular follow-ups to date. Post-operative magnetic resonance imaging (MRI) of the brain () and magnetic resonance venography (MRV) () after 6 months revealed post-canalised sigmoid sinus of the right side with good flow contour. |
pmc-6064767-1 | A 3-year old girl presented with swelling over the root of the nose. Her parents had noticed swelling 7 months previously, which was gradually progressive and was the size of a small lemon at the time of presentation. The swelling was not associated with fever, nasal obstruction, bleeding or any other nasal complaints. The patient was prescribed antibiotics and anti-inflammatory drugs by the general practitioner, following which the swelling decreased slightly. The patient had recurrent episodes in which the swelling increased in size. The size of the swelling decreased on medication, but never completed resolved. There was no history of tubercular contact or any other family history of tuberculosis. On examination, the root of the nose was broadened by the ill-defined 2.5×2.0 cm swelling, but the overlying skin was normal ().
On palpation, the swelling was soft and non-tender with a normal temperature. Anterior rhinoscopy revealed no abnormality. Blood analysis showed raised erythrocyte sedimentation rate (ESR; 38mm). The patient had a positive Monteux test, and a chest X- ray showed no abnormality. Contrast enhanced computed tomography (CT) of the nose revealed an enhancing soft tissue mass lesion in the superior aspect of both of the nasal cavities, measuring 2.0 ×1.8 × 2.8 cm (AP × TR × CC), eroding the intervening nasal septum, frontal and nasal bones at the glabella and reaching to the subcutaneous tissue ().
The base of the skull was eroded with a small intracranial extension. Magnetic resonance imaging (MRI) of the brain and paranasal sinus revealed enhancing soft tissue mass in the basifrontal extra-axial region with dural enhancement extending inferiorly into the superior parts of the nasal cavities with osseous destruction ().
The patient underwent endoscopic examination and biopsy under general anesthesia. On endoscopy, a smooth reddish mass was seen in the left nasal cavity. The mass was friable and found to be eroding the nasal septum, reaching the opposite nasal cavity ().
The mass was also found to be eroding the most superior aspect of the nasal septum with intracranial extension. As the mass was invasive with intracranial extension, a biopsy was taken and further definitive surgery was deferred for final histopathology diagnosis. Histopathology showed lesional tissue focally lined pseudostratified ciliated columnar epithelium with subepithelial epithelioid cell granuloma admixed with Langhans giant cells, suggestive of tuberculosis ().
The patient was started on category I anti- tubercular treatment. Isoniazid, rifampicin, pyrazinamide and ethambutol was prescribed for the first 2 months followed by isoniazid and rifampicin for the next 4 months. The swelling subsided on anti-tubercular therapy. At the time of writing, the patient has completed 6 months of anti-tubercular treatment and has been symptom free for 7 months following anti-tubercular therapy. |
pmc-6065149-1 | A 13-year-old Inuit girl (60 kg) presented to a remote nursing station in Arctic Canada. She had admitted to suicidal ideation and overdose, but was unable to disclose the time of ingestion or exposure. Family suspected that she had ingested clonidine and methylphenidate, thought to be the only medications accessible at home. She was otherwise healthy and had no prescribed medications. She had no known drug allergies and did not use alcohol, or any illicit substances.
On arrival to the nursing station, she was lethargic but rousable and followed commands. Her vital signs were stable, and she had a Glasgow Coma Scale (GCS) of 10. There was no evidence of meningismus or focal neurological deficits, and both cardiopulmonary and abdominal examinations were unremarkable.
Due to resource limitations, initial investigations were limited to point of care testing which included venous blood gas, electrolytes, glucose, creatinine, complete blood count and INR (international normalized ratio) (see Table ). Results were notable for an elevated creatinine (2.32 mg/dL), elevated INR (5.0) and low serum bicarbonate (17 mmol/L). Alcohol, acetaminophen, salicylate level and chemistries including transaminase levels and lactate were not available.
Two hours after her arrival, the nurses requested a transfer to the closest acute care hospital which was 2600 km away. While awaiting the transport team, she deteriorated clinically, becoming hypotensive (blood pressure 85/50) and neurologically unresponsive. Repeat neurologic assessment at 24 h after arrival had significantly worsened revealing nonreactive, dilated (6 mm) pupils and decerebrate posturing to pain. Available point-of-care laboratory testing was repeated (Table ) revealing an INR was 5.4. An advanced care transport team (physician and respiratory therapist) arrived 28 h after presentation to the nursing station. Upon their arrival, they established an advanced airway and given the concern for increased intracranial pressure (ICP) based on the clinical picture, mannitol (500 mg/kg), phenytoin and ceftriaxone were administered. She received empiric treatment with vitamin K 10 mg IV (intravenous) for the elevated INR.
In discussions with the regional poison centre, the elevated INR and creatinine following overdose were suspicious for unrecognized acetaminophen toxicity. Aproximately 28 h after the patient’s initial presentation, N-acetylcysteine (NAC) was started empirically at a 140 mg/kg IV loading dose and continued at 70 mg/kg IV every 4 h.
The patient arrived at the pediatric tertiary care hospital 38 h after her initial presentation. Her neurologic examination revealed a GCS of 3 with pupils fixed and dilated 5 mm bilaterally, as well as intermittent posturing. Cough and gag reflexes were present. Laboratory investigations (Table ) corroborated the suspected diagnosis of acetaminophen-induced acute liver failure. A CT (computed tomography) brain scan showed diffuse edema with effacement of sulci and basal cisterns, and uncal herniation (Fig. ). Given these findings, she was transferred to a pediatric quaternary care center for evaluation for liver transplantation where she was assessed by neurology, neurosurgery and the liver transplant team. At 60 h post-initial presentation, her neurologic exam demonstrated fixed, dilated and non-reactive pupils, with flaccid tone in the upper extremities and increased tone in lower extremities, but without spasticity or clonus. She had a negative vestibulo-ocular reflex (no eye movement with “doll’s eyes” maneuver), absent gag and cough reflexes, but intact corneal reflexes. An EEG (electroencephalogram) showed continuous generalized slowing consistent with severe metabolic encephalopathy. Additional investigations to rule out alternative etiologies for acute liver failure included viral serologies, autoimmune and metabolic markers, and liver ultrasound, none of which revealed an alternative diagnosis. Given her poor neurologic prognosis, she was deemed ineligible for liver transplant and the withdrawal of life sustaining therapies was recommended.
The family agreed and requested that other family members be present prior to removal of life-sustaining therapy. Given the family’s request to wait a few days until others could arrive, she remained on full ventilatory support and continued to receive intensive care treatments, including NAC 70 mg/kg IV every 4 h until day 5, mannitol for neuroprotection (500 mg/kg IV), vitamin K (10 mg IV) and fresh frozen plasma (10 ml/kg) for coagulopathy. On day 4 her transaminases stabilized, and synthetic liver function studies improved. On Day 6, she spontaneously opened her eyes and lifted her fingers. She made continued neurologic improvements and 8 days post admission she was purposefully moving all extremities. With her remarkable clinical improvement, the care plan was changed from withdrawal of life sustaining treatments to full medical treatment. She was successfully extubated on day 11 following initial presentation and later continued recovery on the pediatric inpatient ward. She was discharged home 34 days following her initial presentation with a near complete neurologic recovery, save for a right third and sixth cranial nerve palsy. |
pmc-6065269-1 | A 43-year-old professional golf player (Male, body mass index [BMI] 28.5) with unilateral Tönnis [] grade 3 primary coxarthritis underwent an otherwise uneventful primary THA with a short cementless MiniHip™ stem (Corin, Cirencester, United Kingdom), as shown on . Preoperative modified Harris Hip Score (mHHS) was 55 points []. A posterolateral approach with the patient positioned in lateral decubitus was done, under epidural hypotensive anaesthesia, with a single preoperative dose of intravenous tranexamic acid and cephazoline administration. Besides preoperative planning and in order to calculate limb lengthening, the Woolson method was used with a Steinman pin inserted proximal to the acetabulum, as a stable pelvic reference point []. Given the patient's level of activity, a fourth generation ceramic on ceramic (CoC) surface was selected (CeramTec™, Plochingen, Germany).
Postoperative rehabilitation protocol consisted of early weight-bearing as tolerated with crutches during the first 2 postoperative weeks, with fixed range of motion exercises at 90° of flexion, neutral internal rotation, 30° of external rotation and 45° of abduction for 3–6 weeks. Subsequently, progression to a single cane on the contralateral hand until the 21st postoperative day was indicated. Noncontact sports were allowed after the 3rd postoperative month and contact sports were allowed but not recommended after 6 months; nevertheless, the patient began to practice soccer at 4 months of follow-up.
The first 7 postoperative months developed in an uneventful fashion. However, around the 8th month of follow-up and without a history of trauma, the patient started complaining about progressive pain referred on the anterior thigh, more excruciating upon axial load. Defined by the patient as 8 points from the Visual Analogue Scale (VAS), pain could be only partially alleviated by non-steroidal anti-inflammatory drugs and protected weight-bearing.
Radiographs evidenced a lateral cortical hypertrophy and periosteal reaction located at zones 2, 3, 8 and 9 of Gruen's classification in anteroposterior and lateral views, respectively, [] without any signs of subsidence or loosening, as shown on . Magnetic resonance imaging (MRI) revealed marked intraosseous oedema around the tip of the stem as well as around the periprosthetic subfascial soft tissues (A and B). Additionally, bone scintigraphy displayed an increased bone turnover at the distal part of the lateral periprosthetic cortical within the three phases of tracer uptake, suggesting increased blood flow (in the arterial phase), tissue hyperaemia (second phase) and increased osteoblastic activity (third phase); which is compatible with a stress fracture [] (). Infection was initially suspected but laboratory values were negative for any inflammatory reaction. Serum C-reactive protein value was 3 mg/ml whereas erythrocyte sedimentation rate was 8 mm/hour.
In this scenario, both an articular aspirate and a bone biopsy of the affected zone were performed at the operating room under general anaesthesia, in order to rule out periprosthetic infection and osteomyelitis. Culture results were negative for infection and pathology analysis revealed areas of osteoclastic resorption nearby haversian canals as well as areas of bone formation with abundant capillaries, increased subperiosteal osteoblastic activity and periosteal thickening () [].
A revision arthroplasty was firstly scheduled at the 9th month of follow-up. Since the patient expressed a VAS for pain of 9 points, crutches were indicated until the date of revision. However, pain, which seemed initially unremitting, started to decrease progressively after the biopsy was developed and the patient commenced to protect weight-bearing, until it disappeared at 1-year follow-up. Therefore, a new surgical procedure was dismissed. At 2 and half years of follow-up, the patient remained asymptomatic, with a mHHS of 98 points and playing golf at the same level as before surgery. At final follow-up, radiographs evidenced a healed fracture with a hypertrophic callus at the lateral femoral cortical (). |
pmc-6065616-1 | A 38-year-old African American man with a three-year history of CD presented to his primary care physician with concerns of dyspnea on exertion and dry cough for one month's duration following a partial colectomy and hospitalization due to toxic megacolon. During this previous hospital stay, he was extubated successfully and tolerated the procedure well. The patient was discharged on a stable maintenance dose of mesalamine. Postoperatively, he started experiencing progressive shortness of breath and a dry cough. The patient reported he had no history of asthma, chronic obstructive pulmonary disease (COPD), sarcoidosis, Goodpasture syndrome, or any chronic lung damage. On physical examination, wheezing was noted during lung auscultation. His laboratory values from his current visit are presented in Table .
Pulmonary function tests (PFTs) showed an obstructive pattern due to decreased forced expiratory volume in the first second (FEV1) as shown in Table .
Bronchoalveolar lavage (BAL) showed high lymphocytic predominance (Table ). A chest x-ray (Figure ) and computed tomography (CT) scan were performed, the findings of which were unremarkable.
Upon his first presentation, we prescribed empiric moxifloxacin due to a suspected postoperative respiratory infection. However, the patient remained clinically symptomatic after a week of antibiotic treatment. PFT results and his symptoms did not improve with the antibiotic trial. His history of CD for the past three years, a recent colectomy, his BAL findings, and his PFT results indicated his clinical symptoms were the result of CD involvement of his respiratory system. The patient was diagnosed with bronchitis due to CD, and a trial of high-dose oral steroids was prescribed, which yielded a dramatic improvement in his clinical symptoms. The patient underwent repeated PFTs, and his FEV1 returned to normal. We monitored him on an oral steroid and tapered the dose to the maintenance level gradually. |
pmc-6065617-1 | A 38-year-old male presented to the surgery outpatient department with complaints of odynophagia and chest pain for two weeks. The symptoms had started after a meal when the patient felt the sensation of a foreign body in the throat, which he reportedly swallowed with a bolus of food. As the initial evaluation with neck and chest X-rays was reported as normal, he did not receive any specific intervention. However, in the third week after ingestion, he developed chest pain and fever. On evaluation with a contrast-enhanced thorax, chest, and abdomen scan, he was diagnosed with a right-sided pleural effusion and a suspected foreign body in the periesophageal region of the lower thoracic esophagus close to the inferior vena cava (Figures , ).
From the hiatus region, the foreign body was located at approximately 5 cm cephalad. An intercostal drain was placed under image guidance and approximately 750 mL of serosanguinous pleural effusion was drained. An upper gastrointestinal contrast study did not show any contrast extravasation from the esophageal lumen. Upper gastrointestinal endoscopy also did not show any signs of recent perforation or a foreign body in the esophagus. An after adequate chest optimization, he underwent laparoscopic foreign body removal.
The procedure was done under general anesthesia in the supine split leg position. After initial access and the creation of a pneumoperitoneum through the left paramedian 12 mm port using an open method, five additional 5 mm ports were placed, including two midclavicular line ports on either side, a left subcostal port for assistance, and an epigastric port for liver retraction. The gastrohepatic ligament was divided to reach the right crus. The phrenoesophageal membrane was then opened to enter the mediastinum. The esophagus was then looped with an umbilical tape at the level of the hiatus and used for subsequent retraction. The right side of the esophagus was dissected meticulously, preserving the vagus nerves. At about 6 cm from the gastro esophageal junction, there was a fibrotic tract along the lateral aspect, which was then cut with scissors exposing the 2.7 cm long metallic foreign body (Figure ).
Right pleura were thickened and were not opened. The foreign body was then extracted and removed under vision (Figure ).
The tract, which was seen extending to the esophagus, was clipped on the esophageal side using a hemolock. A thorough mediastinal lavage was given and a 16 Fr suction drain was placed in the paraesophageal region. An upper gastrointestinal oral contrast study that was done on the second postoperative day did not reveal any contrast leak, and the patient was started on an oral diet. He had an uneventful postoperative course and was discharged on the fifth postoperative day. |
pmc-6065618-1 | A 53-year-old male presented in September of 2009 with a right gluteal mass (Figure ).
Biopsy confirmed the presence of extraskeletal myxoid chondrosarcoma. He received neoadjuvant radiation treatment with total dose of 50 Gray, followed by wide local excision. In October of 2012, he was found to have a left lower lobe lung nodule (Figure ) that was slowly increasing in size.
Because the nodule was close to the diaphragm, it could not be reached for biopsy. The patient underwent a left lower lobectomy. Pathology did confirm that the nature of this nodule was consistent with the patient’s history of EMC. He had surveillance imaging regularly afterward and was found to have multiple small pulmonary nodules in August of 2013 (Figure ).
An extensive discussion and consultations with many experts were undertaken at that time. The patient opted for watchful waiting approach. Routine surveillance imaging since August of 2013 showed a progressive but slow increase of size of the multiple pulmonary nodules as well as the appearance of new nodules (Figures -). Because the progression has been very slow, the patient remained asymptomatic. |
pmc-6066151-1 | A 56- year-old man sought our service with 1-day history of acute pain on his right below-knee amputation stump. He had undergone right below-knee amputation for critical limb ischemia secondary to trauma 3 years before. After surgery, he had excellent rehabilitation and independent ambulation with prosthetic limb.
Upon clinical examination he had normal femoral pulse, absent popliteal pulse, decreased temperature and cyanosis in the distal third of the below-knee amputation stump. Doppler scan showed above-knee popliteal artery occlusion.
Heparin was administered (80UI/Kg), and right lower limb angiography and catheter directed thrombolysis, with Aspirex® (rotational catheter to restore blood flow; Straub Medical AG, Wangs, Switzerland), were carried out, in the attempt to save the below-knee amputation stump.
Right limb angiography showed superficial and deep femoral arteries without lesions and confirmed popliteal artery occlusion (). A 0,014” guide wire was passed through the occluded area, and a thrombectomy catheter was placed intra-thrombus (). An initial bolus dose of 10mg of rTPA was administered and mechanical thrombectomy was performed with Aspirex® (). Angiography showed partial popliteal artery recanalization ().
The thrombectomy device was replaced for a multiperforated catheter, and the patient was referred to the intensive care unit to continue rTPA infusion at dose of 3mg/hour and heparinization in full dose (16UI/kg/hour) for 8 hours under close monitoring. A new angiography showed patency of the popliteal artery with residual stenosis and thrombus (). Angioplasty was performed with a 4x20 Paseo-35 balloon (Biotronik, Bulach, Switzerland), followed by injection of 10mg rTPA ( and ). Final angiography demonstrated patency of the popliteal artery, without residual stenosis or thrombus, and excellent inflow to the below-knee amputation stump ( and ).
The patient had remission of symptoms and was discharged after 5 days. After recovery, he was able for independent ambulation with his prosthetic limb. After 9 years of clinical follow-up the patient remained asymptomatic. |
pmc-6066153-1 | A 56-year-old male patient, diagnosed as pancreatic adenocarcinoma in March 2014, associated with multinodular hepatic metastasis. He initiated on chemotherapy with FOLFIRINOX for four months (discontinued due to systemic toxicity), changed to chemotherapy with gemcitabine, for 4 more months. He presented partial response of the pancreatic tumor, progression of hepatic lesions, and worsening of tumor markers (CA19.9 from 2,100 to 18,000U/mL).
Abdominal MRI after second-line systemic chemotherapy showed growth of secondary hepatic lesions in segments II, IVa ( A), VII ( B) and VI ( C), despite the chemotherapeutic management. In an Oncology multidisciplinary meeting, it was decided to perform SIRT.
Three months after SIRT, there was virtually complete necrosis of the lesions observed in the previous MRI ( D to F). Moreover, there were necrotic areas not showing the previous lesions ( D to E). These findings may correspond to necrosis of recent secondary lesions or from the hepatic parenchyma. A wedge-shaped hyperenhancement area stands out around the lesion in segment VII ( E). |
pmc-6066153-2 | A 66-year-old female patient, diagnosed as multiple hepatic metastases of an adenocarcinoma of unknown primary site, according to percutaneous hepatic biopsy. Past history of breast cancer appropriately treated six years ago.
An abdominal MRI showed a bulky hepatic tumor occupying preferably the right hepatic lobe (white line), not involving the portal vein, but it was unresectable ( A). There was diffuse heterogeneity of the coalescent lesions, with central areas suggesting necrosis ( A). Despite the bulky tumor mass, it did not affect over 60% of total hepatic volume, thus allowing performance of SIRT.
Magnetic resonance imaging was performed after 60 days and revealed extensive necrotic areas of infiltrating lesions in the right hepatic lobe, besides complete necrosis of the lesion in the gallbladder bed ( B and E). |
pmc-6066153-3 | A 57-year-old male patient was diagnosed, in 2012, as urothelial cell carcinoma in the left kidney, with lymph node involvement, after presenting macroscopic hematuria. He was submitted to nephroureterectomy followed by systemic chemotherapy with MVAC protocol (methotrexate, vinblastine, doxorubicin and cisplatin) during 6 months. He remained with no evidence of the disease for 22 months.
In March 2015, the MRI showed a single liver metastasis. Stereotactic body radiotherapy (SBRT) was performed, and he underwent four chemotherapy cycles of gemcitabine and carboplatin, remaining with no evidence of disease for 6 months. In December 2015, in a control MRI, multinodular liver metastases were observed ( A), besides involvement of retroperitoneal lymph nodes. In a multidisciplinary Oncology meeting, it was decided to use the MVAC protocol and perform SIRT for the hepatic disease.
Two months after SIRT, the MRI showed larger tumor lesions and exuberant necrotic areas ( B). The magnetic resonance images in diffusion sequence are excellent to assess tumor viability (displaying restriction to pretreatment diffusion “viable tumor”- ( C). In this case, diffusion restriction was absent (absence of tumor) in the post-treatment with SIRT ( D). |
pmc-6066555-1 | A 49-year-old lady was diagnosed to have carcinoma of sigmoid colon with laparoscopic left hemicolectomy done in early September 2016. Pathology revealed moderately differentiated adenocarcinoma; tumor involved per-colic tissue, one out of 14 regional lymph nodes was positive, all resection margins were clear, hence pathologically staged T3N1M0, stage III disease.
She was planned to have a course of adjuvant chemotherapy with CAPEOX [capecitabine (1000 mg/m2 twice daily oral for 14 days) and oxaliplatin (130 mg/m2 at day 1)] for eight cycles, with an aim to achieve 10% absolute gain in 8-year overall survival (). The first cycle of CAPEOX was started in late October 2016.
At Day 13, she developed fever and grade 3–4 diarrhea (CTCAE v 4.0) () and day 14 capecitabine being withheld. She was then admitted into the hospital through Emergency Department. Complete blood count revealed that she had grade 4 marrow suppression toxicity: total white blood cell: 0.52 × 10∧9/L (normal range: 3-89–9.93 × 10∧9/L), neutrophil: 0.04 × 10∧9/L (normal range: 2.01–7.42 × 10∧9/L), platelet: 25 × 10∧9/L (normal range: 154–371 × 10∧9/L). She necessitated intravenous antibiotics with piperacillin/tazobactam and growth factors were given for neutropenic fever. She was discharged home after hospitalization care for 3 weeks.
In view of stormy side effects of chemotherapy, she was clinically highly suspected to have DPD deficiency. |
pmc-6066556-1 | A 61-year-old woman presented in September 2014 for workup of a 4-month history of progressive right facial palsy, associated with progressively worsening right facial pain. She reported a history of pleomorphic adenoma, first resected in 1973 with 2 recurrences and excisions in 1993 and 2003.
On physical examination, there was a 2 × 2 cm hard, immobile, right sided preauricular mass, associated with multiple palpable level II lymph nodes. Cranial nerves (CN) were intact bilaterally except for complete right CN VII palsy.
Neck MRI revealed a multiloculated cystic lesion involving the superficial and deep lobes of the right parotid gland, and extending posteriorly to the retromandibular vein measuring 3.5 cm. There were six satellite nodules superficial to the right sternocleidomastoid muscle (SCM), highly suspicious for seeding of pleomorphic adenoma, the largest measuring 6 cm. Subsequent fine needle aspirate (FNA) showed pleomorphic adenoma. The patient underwent right parotidectomy, resection of the satellite nodules, and right level II lymph node dissection.
Pathology revealed carcinoma ex-pleomorphic adenoma, with positive cytokeratin (CK) 7 and negative CK5/6, CK20, P63, and thyroid transciption factor 1 (TTF-1). Two out of the six dissected lymph nodes were positive for carcinoma with no extra-capsular extension. However, there was perineural invasion as well as involvement of the SCM (Figure ).
The patient then underwent right radical parotidectomy with modified radical neck dissection, including levels IA, IB, IIA, IIB, III, IV, and VA, as well as right lateral temporal bone resection. Pathology also revealed carcinoma ex-pleomorphic adenoma involving fibroelastic tissue and skeletal muscles with positive margins. Three out of 13 lymph nodes were involved by carcinoma. There was also vascular invasion with tumor involving both the jugular vein and the internal carotid artery.
Postoperative course was smooth except for a minor post-operative infection treated with intravenous antibiotics. The patient then received adjuvant radiation therapy, to a total dose of 66 Gray (Gy) in 33 fractions using Intensity modulated radiation therapy (IMRT) with simultaneous integrated boost (SIB). Radiotherapy course was completed on December 2014.
The patient was then followed up with routine imaging. In August 2016, Brain MRI showed evidence of more than thirty small lesions suggestive of brain metastases. Positron emission tomography (PET) scan showed no evidence of systemic disease.
The patient received 30 Gy in 12 fractions to the whole brain, limiting the dose to the previously irradiated region to 20 Gy, using IMRT, completed in August 2016. Follow up Brain MRI 2 months after radiation therapy showed resolution of the majority of the brain metastatic lesions with only few remaining visible lesions. Follow up Brain MRI 10 weeks later showed progression of the metastatic brain disease with at least 10 visible lesions. PET scan showed evidence of a metastatic liver lesion.
The patient was referred to medical oncology for consideration of systemic treatment. HER-2 staining was performed on the previous surgical specimen and showed overexpression of HER-2 (Figure ). She received four cycles of Trastuzumab Emtansine (TDM1). Follow up PET scan four months later, showed resolution of the liver metastatic lesion (Figure ). MRI brain revealed a significant decrease in the number and size of the metastatic enhancing brain lesions, in keeping with a good response to treatment (Figure ). |
pmc-6066606-1 | A 56 year-old man with a 15 year history of schizophrenia, receiving inpatient care in a psychiatric unit, under continuous oral treatment with haloperidol (20 drops 3 times a day) presents multiple induced lesions of the auricle and the auditory canal ()
two weeks prior to examination the patient complain of itching and show skin lesions with erythema, scaling and red papules on the auricle, history of repeated ear self-injury was recorded, psychiatric staff noted that ear-self injuries were applied by fingers and wooden sticks from hospital garden, itching persists for more than two weeks ago. Moreover, there were no clinical signs of fungal infection on hands and nails.
The diagnosis of acute otitis externa was made in day 2, in the presence of itching on manipulation of the auricle and objective findings at otoscopy, such as the infection confined to the ear canal with greenish fuzzy growth and local area hyperhemic and bleeding.
Sterile cotton swab were collected under aseptic condition from external canal of the patient, the samples were inoculated on blood agar for routine bacterial culture and also on Saborauds Dextrose Agar (SDA) for fungal culture.
Direct microscopy by Lactophenol Cotton Blue (LPCB) wet amount preparation revealed septate acute angle dichotomous branching fungal hyphae.
Routine bacterial culture was sterile, after 48 h of aerobic incubation. However on SDA after five days (day 7) of aerobic incubation, powdery masses of yellow-green colony developed (), the isolate was identified as Aspergillus flavus, with rough and colourless conidiophores and biseriates phialides ()
Present case was first managed by local toilet using dakin to remove the fungal debris from the ear canal. The patient was then started on clotrimazole 1% solution, ear drops were instilled into the affected ear three to four times a day during two weeks.
After one week (day 14) due to the agitation of the patient an oral treatment was initiated itraconazole 100 mg twice daily for 7 days. Instruction for the paramedical staff to monitor the patient so that he no longer handles the ear. The patient were reviewed after 1 week and the ear canal was observed under the microscope to assess the response to treatment at day 21.
Patient responded well to the treatment
Macroscopic colony morphology of Aspergillus flavus on SDA medium (day 10): surface is greenish-yellow with white border, texture is floccose |
pmc-6066699-1 | A 32 year-old male sustained high voltage electrical contact burn over scalp. Patient was treated with dressing for 10 days in other hospital. Patient was presented in our casualty with fever, raised counts and infected wound over scalp. Our patient was not having any history of immune compromise. Patient had undergone debridement of scalp with gross clear margin (). Patient had a sustained fever and raised counts even after adequate debridement (). On clinical examination after two days, there was evidence of hyphae over wound margin and gangrenous changes over scalp surrounding the wound ().
On clinical suspicion of invasive fungal infection (zygomycosis), injection of amphotericin B was started and patient was taken for wide debridement. Tissue biopsy was taken and sent for histopathology examination. Outer bony cortex chiseling was done with high speed diamond burr. Histopathology report of specimen came out to be A. corymbifera. Intravenous amphotericin B injection was continued for 4-week period since diagnosis to complete healing. After two weeks of anti-fungal treatment, clinical condition of patient improved. After confirmation of absence of fungal infection, scalp defect was covered with free anterior lateral thigh flap (). Recipient vessels were superior temporal artery and vein. In post-operative period, patient was on intravenous amphotericin B injection for 2 weeks. Post-operative period was uneventful (). |
pmc-6066702-1 | A previously healthy 42 years old male presented to our institute with history of gradually progressive and painless swelling over left calf since two months. He was a non-smoker, laborer by occupation. The patient noticed a firm swelling in calf region of left leg 5 years ago. No history of trauma or infection prior to the appearance of the mass was reported. No family history of any such swelling in the past. Patient was operated for swelling over calf region 20 years back but no records were available. There was a history of gradual increase in deformity of left foot since 3 years and the patient had started walking on toes on left side with no dorsiflexion at ankle joint.
On examination, there was a single, non-tender, hyperpigmented scar of size 8×3 cm over mid-calf region fixed to underlying structures. A large, well defined non-tender, firm, swelling was palpable in posterior aspect of left leg measuring about 28×8 cm extending from tendoachilles region up to 5 cm distal to popliteal fossa and medially and laterally up to border of tibia and fibula respectively. The overlying skin was normal with no discoloration and local raise of temperature. Movement of knee joint was normal. There was fixed equinus deformity of left foot (). No inflammatory signs, skin changes or adenopathies were present. No bruits were heard on auscultation. Neurovascular examination of left leg and foot was normal. Laboratory findings were within normal limits. Radiological examination revealed large soft tissue mass with linear and streak-like ossification around the left tibia. MR Angiography () showed arteriovenous malformation in left calf with multiple feeding arteries arising from popliteal, peroneal and anterior tibial artery and large draining veins draining deep into venous system of leg. The tibia and fibula marrow showed normal signal intensity.
Because of patient symptoms and with clinical diagnosis of a vascular malformation, a wide surgical excision of the lesion was done. Through a 25 cm longitudinal incision across the calf, posterior compartment muscles were exposed. The mass was found completely involving superficial group of posterior compartment muscles sparing the deep compartment with no attachment to periosteum or bone (). Peroneal artery and vein were found to be embedded in the lesion and thus sacrificed. Plane of dissection was between superficial and deep muscles.
The lesion was completely removed along with overlying cutaneous scar with wide surgical margins leaving posterior tibial artery in continuity. Intraoperative, complete dorsiflexion of foot was achieved with intact vascularity of leg. The excised specimen was very hard like bone and had to be cut longitudinally with saw (). Grossly the resected specimen showed ossified tissue covered with skin and soft tissues including muscle, tendons and adipose tissue measuring 15×7×5 cm. The cut surface of the ossified area was grey white, gritty and congested (). Microscopically, it revealed features of a vascular malformation with numerous blood vessels of variable size and shape composed of arteries and veins which were dissecting soft tissues and interstitial planes of skeletal muscle.
Many of the vessels were thin walled with anastomosing and a sinusoidal appearance. Some of them showed fresh and organized thrombi within this vascular background, extensive osseous metaplasia characterized by mature lamellar bone formation was seen. (). The diagnosis was consistent with arterio-venous malformation with extensive osseous metaplasia. At the time of recent follow up after one year from the operation, no local recurrence of the tumor was demonstrated clinically and radiologically. No restriction of motion of ankle joint was found. Patient is presently walking with a normal gait. |
pmc-6066703-1 | A 27-year-old woman applied for a breast reshaping surgery for aesthetic purposes. There were no other complaints in her medical history. The patient underwent simultaneous mastopexy according to classical Lejour vertical scar technique and breast augmentation surgery using round silicone TSF - 415 mL implants under the pectoral muscle and a breast lift under general anesthesia (). During the operation proper hemostasis was achieved using electrocoagulation. Drains were removed next day after the operation with minimum serohemorrhaging fluid volumes. The later postoperative period was also uneventful.
The patient was discharged from the clinic on the second day after the surgery. Five weeks after the operation patient arrived at the clinic because of tenderness and swelling of the right breast. The patient stated that she had not sustained any traumas. During clinical examination, the upper right breast area was found to be significantly swollen and firm (). Ultrasound examination showed a 2.5 cm heterogeneous liquid strip accumulated around the implant (). The implant was intact. Complete blood count showed an increased amount of leukocytes, and red blood cells and hemoglobin were at the lower limit of the normal level.
No coagulopathies were found. The patient was taken to the operating room where she underwent revision surgery. The purpose was to remove the fluid and to find and stop the cause of its accumulation. During the operation (), a blood clot of 650 mL was removed (). Bleeding from one of the internal mammary artery branches in the implant pocket between the rib cage and the pectoral muscle lower pole was detected and stopped. After the revision, the implant was returned to the lodge. Vacuum drainage was used for one day only. One year after the surgery, there was no recurrence of bleeding, also no clinical evidence of the implant capsule contracture formation was found ().
All procedures performed in this study were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. The patient gave her informed consent prior to her inclusion in this case report. Any details that might disclose the identity of the patient under study were excluded. |
pmc-6066713-1 | A 24-year old male patient presented with history of gradually increasing size of left ear with skin discoloration. On examination it was a pulsatile, compressible, spongy, non-tender swelling with pigmentary changes of skin. Thrill was easily felt and continuous bruit was heard on auscultation. Patient denied bleeding, ulceration or discharge from the lesion. The malformation was involving the whole external ear extending from the helical rim to lobule, neck inferior to the ear and post auricular region. External auditory canal and tympanic membrane were normal. Clinical diagnosis of high flow arterial malformation was made on history and examination ().
The diagnosis was confirmed by MRI and MR Angiography which showed feeding vessel arising from the left external carotid artery (). Preoperative coil embolization was done to reduce vascularity and obtain blood less field during excision (). The surgery was scheduled 48 hours after embolization (). Per-operatively all the large tortuous blood vessels around the affected ear were ligated. The whole lesion was resected along with skin, subcutaneous tissue preserving the auricular cartilage with intact perichondrium (). Reconstruction done with split thickness skin graft harvested from thigh covering the ear cartilage ().
There was partial graft loss in subsequent days but the cartilage was found viable which was re-grafted. Patient was followed for three months with aesthetically acceptable ear. The surgical procedure could be carried out with precision and the auricular cartilage could be preserved with intact perichondrium because the bleeding was controlled by pre-operative embolization. In spite of this there was more than 500 ml blood loss. Post operatively patient lost a significant amount of cartilage as expected due non-vascular skin graft used as cover. This can be well appreciated in the follow up pictures. (Figure 7,8) In spite of offering the patient a reconstruction for the ear, he chose not to go for ear reconstruction as of now and is happy without the grotesque deformity. |
pmc-6066715-1 | A 19-year old male presented to the outpatient department (OPD) with history of sustaining injury to right pinna from a road traffic accident two weeks back. The patient sought treatment in a hospital where primary suturing was done but he developed wound site infection with foul smelling discharge and subsequently presented to us. Examination revealed partial avulsion of right pinna and separation of helix from post auricular skin with intervening sloughed out raw area (). Patient was admitted and started on intravenous antibiotics and underwent a primary debridement and sloughectomy. Infection was progressively controlled with antibiotics and the raw area granulated ().
Due to recurrent risk of failure of sutures and for the benefit of cosmesis, it was planned to provide local flap cover for the raw area with Limberg transposition flap. The recipient area was prepared into a rhomboid as shown in ( and ) and the donor flap marked in the post auricular region as per measurements of the recipient area. Skin flap raised from the post auricular region was transposed to the recipient area and the donor flap sutured to complete the Limberg transposition flap (). Paraffin dressing was applied. There was excellent wound healing as well as cosmesis since the scar was hidden in the post auricular region (). |
Subsets and Splits