_id
stringlengths 7
16
| description
stringlengths 55
95.2k
|
|---|---|
pmc-6136674-1 | A 90-year-old male presented to the emergency department complaining of severe abdominal and back pain. The symptoms began 3 hours earlier. The patient was severely obese and under chronic pharmacological therapy for arterial hypertension and coronary artery disease (previous coronary artery bypass graft). The abdominal computed tomography angiogram (CTA) showed an 11-cm AAA with a retroperitoneal hematoma and a posterior wall rupture (
). The aortic rupture was partially contained by the vertebral bodies and retroperitoneum. A unique lobulated renal mass was detected in pelvic region (CFPK or pancake kidney
) (
). Three renal arteries were detected arising from both iliac axes: one (8 mm in diameter) from the proximal portion of the right common iliac artery, the second (9 mm in diameter) from the right hypogastric artery, and the third (4 mm in diameter) from the distal segment of the left common iliac artery (
). The proximal neck (between the superior mesenteric artery and the AAA) was 20 mm in length and 23 to 24 mm in diameter with no intraluminal thrombus or wall calcification. The patient was conscious and hemodynamically stable (systolic blood pressure: 90–100 mm Hg). Considering the presence of a favorable proximal aortic neck, the partial hemodynamic stability, the age, and the obesity, an endovascular treatment was preferred. Only aorto-uni-iliac endografts were available for emergency procedures.
Preoperative planning was performed using 3mensio Vascular (Pie Medical Imaging) during patient transport to the operating theater and anesthetic induction.
Under general anesthesia, inguinal longitudinal cut-down was performed bilaterally and the common femoral arteries were isolated. An Endurant aorto-uni-iliac endograft (Medtronic Endovascular) was introduced through the right access. The C-arm was rotated at 50°-left anterior oblique and the preoperative angiogram was performed. The endograft was deployed below the origin of superior mesenteric artery, using the inframesenteric nondilated aorta as proximal sealing zone (∼20 mm in length). Two Endurant endograft extensions (Medtronic) were necessary to obtain sufficient sealing at the right common iliac artery with the occlusion of the upper renal artery. Through the left access, a Talent occluder was deployed in the proximal left common iliac artery, above the origin of left renal artery. The completion angiogram showed patency of the endografts and no endoleak from left iliac axis or renal or lumbar arteries (
). The procedure was completed with an extra-anatomical femorofemoral suprapubic bypass graft (8 mm-Silver Dacron). Operative procedure time was 220 minutes and 120cc of contrast agent was injected (iomeprol, Iomeron 300; Bracco).
Ventilator support was removed after 24 hours and the abdominal and lumbar pain disappeared. Acute renal failure developed (
) but no dialysis was necessary. The patient returned to the ward on the 9th postoperative day and started mobilization. The postoperative duplex ultrasound showed endograft patency with no endoleak. Renal function gradually improved (
) and the patient was discharged on the 12th postoperative day.
At 1 month, the renal function remained mildly altered (creatinine serum level: 1.9 mg/dL). After intravenous hydration, the abdominal CTA showed patency of the aorto-uni-iliac endograft and femorofemoral bypass graft, sac shrinkage, and no evidence of endoleaks. The pelvic kidney presented no ischemic lesions and was perfused by two renal arteries (lower right and left) (
). |
pmc-6136675-1 | A 26-year-old healthy man without any medical history complained of dysphagia. Routine chest radiography showed enlargement of the upper mediastinum at the sternal angle, indicating the presence of an arch anomaly. A barium swallow revealed an indentation of the esophagus on its right aspect. Computed tomographic angiography (CTA) scan showed the presence of a right-sided aortic arch, with the left common carotid artery originating first, right common carotid artery second, followed by the right subclavian artery (RSA) and LSA arising from a Kommerell diverticulum that compressed the esophagus (
).
The patient presented with dysphagia because of esophageal compression, so endovascular treatment was contraindicated and the patient underwent open repair.
The patient was taken to the operating room. Selective lung ventilation was used. Cerebrospinal fluid drainage (LiquoGuard, Möller Medical GmbH) was applied to prevent paraplegia.
A right thoracotomy was performed in the third intercostal space. The distal aortic arch and the RSA were identified and dissected. A careful dissection of the posterior wall of the Kommerell diverticulum adjacent to the vertebral body was undertaken in the left hemithorax until the LSA was of normal diameter. The vessel was surrounded with a silicone tape (
). That posterior approach prevented any injuries from the Kommerell dissection adjacent to the esophagus. A strategy of simple side-biting division of the aberrant subclavian at the junction with the aorta was considered unsafe, because of posterior location of the diverticulum (in the left hemithorax), and the necessity to evert the aorta for clamping. Graft replacement with left heart bypass was the chosen technique. Heparin 1 mg/kg was administered. Left heart bypass was established from the right inferior pulmonary vein to the descending thoracic aorta under mild hypothermia (32–34°C). Aortic clamping was done between the right carotid artery and RSA to have a good aortic wall for a safe anastomosis. One vascular clamp was placed distal to the right carotid artery and another in the descending thoracic aorta. Small bulldog clamps were placed on the RSA and the distal LSA. The aorta was transected distal to the RSA and distal to the Kommerell diverticulum insertion. The aorta was opened and an end-to-end anastomosis with a 26 mm Dacron vascular graft was performed between the distal arch and the distal descending thoracic aorta. Because the distal stump of the LSA was far away in the left hemithorax (precluding a safe end-to-end anastomosis), it was transected and oversewn with a 5/0 monofilamentous suture. After releasing the vascular clamp, the stump retracted back to the left and the esophagus was freed from the vascular compression. After protamine administration, pulse oximetry of the left hand showed 100% saturation, so supraclavicular left carotid–subclavian artery bypass was not considered necessary. The postoperative recovery was uneventful and the patient was discharged home on postoperative day 7.
The patient was free of dysphagia at 10 months postoperative without any other symptoms. Follow-up barium swallow was normal and CTA showed complete exclusion of the Kommerell diverticulum and adequate subclavian blood flow (
). |
pmc-6136677-1 | A 41-year-old man, working in a furniture confection plant, experienced severe “tearing” chest pain upon heavy lifting. On presentation in another health facility, a chest computed tomography (CT) scan, with incomplete imaging of the iliofemoral axis, revealed a type A aortic dissection (DeBakey type I). Following transfer to our center, physical examination showed a pulseless left femoral artery, while no sign of acute limb ischemia was present. The patient underwent a mechanical Bentall procedure with hemiarch replacement under circulatory arrest for a total procedure time of 7 hours, 45 minutes. The immediate postoperative course was uneventful. The femoral pulses were symmetrical and well palpable once the patient rewarmed. Thirty-six hours after surgery, the patient was extubated and complained of severe pain to his left buttock. The lower limb pulses were present and no sensory or strength deficit was found. The left limb was normal, while the buttock was tense and painful especially upon flexion and adduction of the hip. A GCS was suspected. A CT angiography scan of the pelvis showed a dissection flap ending proximal to the iliac bifurcation without direct involvement of the iliac arteries. The false lumen was thrombosed and preferentially oriented toward the common left iliac artery. The opacification of the left internal and external iliac arteries was good. Preoperative CT angiography showed left gluteus muscle swelling (
). This was likely related to a malperfusion following thrombotic or embolic occlusion (
). The patient was diagnosed with GCS, further supported by a peak creatine kinase of 91 865 U/L.
A Kocher-Langenbeck procedure (
) was performed under general anesthesia with the patient placed in a right lateral decubitus position, with his legs bent at a 30° to 40° angle. An incision was made from the posterior superior iliac crest up to 5 cm of the greater trochanter and then to the lateral aspect of the femoral shaft. The tensor fascia latæ was fully opened longitudinally. The superficial and deep fascia of the gluteus maximus muscle and the fascia of the tractus iliotibialis were incised, revealing the heavily compressed muscles. The muscle bulged out of the incision. Muscles were then split along their fibers allowing opening of the fascia of the medius gluteus muscle where necrotic fibers were retracted anteriorly. The gluteus minimus muscle exhibited normal color. The left buttock was left open for 4 days, after which the skin was closed primarily, leaving the fascia open. Frequent dressing change was required as the edema was heavily seeping out of the wound. After 4 days, the muscle had significantly decreased in size and closing only the skin allowed the muscle to be completely tension free. The patient was discharged home on postoperative day 13. After 17 weeks, the patient returned to work and noticed intermittent claudication. Peripheral vascular impedance plethysmography and contrast-enhanced CT confirmed a 50% stenosis of the left iliac arterial axis. The patient was treated conservatively and is doing well without residual claudication 2 years thereafter. |
pmc-6136680-1 | A 63-year-old male patient had initially undergone a mechanical aortic valve replacement 17 years earlier for bicuspid aortic valve stenosis. He was referred with increasing shortness of breath on exertion and 5.6 cm dilatation of the ascending aorta on computed tomography. Aortic dimensions on intraoperative transesophageal echocardiogram measured at the level of the sinuses of Valsalva, the sinotubular junction, and the proximal ascending aorta were 5.2 cm, 5.2 cm, and 5 cm, respectively. During dissection of the aortic root, the left coronary button tissue was friable and therefore a hemi-Cabrol anastomosis with a 10 mm prosthetic graft was performed. This was routed to the right side of the tube graft and anastomosed to its anterior surface (
). |
pmc-6136680-2 | A 67-year-old female patient was referred with an extensive aneurysm of the thoracic aorta, severe aortic regurgitation, and exertional angina. Embarking on a staged repair, via median sternotomy, we undertook biological aortic root, ascending aorta, and arch replacement with a conventional elephant trunk procedure. The head and neck vessel were reimplanted with a trifurcated graft.
In addition to being friable, the left coronary ostium had migrated due to the significant aneurysmal dilatation of the aortic root. On this occasion, a 10 mm prosthetic graft was routed to the left side of the tube graft as the presence of the trifurcated graft would compromise the function of the hemi-Cabrol (
). |
pmc-6136886-1 | A 52-year-old male with a 30-year history of chronic low back pain of unknown etiology presented to a rheumatology clinic. He noted low back pain associated with morning stiffness that worsened throughout the day. He also described increased difficulty with ambulation associated with bilateral paresthesia of the lower extremities, saddle paresthesia, and increased urinary urgency. His past medical history was significant for hypertension, hyperlipidemia, and tonsillectomy as a child. He had no known history of trauma or fractures. He smoked for more than 30 years but denied any alcohol or drug use. His physical examination revealed severely limited range of motion of the cervical and lumbar spine with a modified Schober’s test of 2.4 cm. He also had significant weakness in his hip flexors with decreased patellar reflexes. He was positive for human leukocyte antigen (HLA) B27. Radiographs of the lumbar spine showed sacroiliitis and syndesmophytes in the lumbar spine. He was diagnosed with ankylosing spondylitis based on these results. He was also clinically diagnosed with cauda equina syndrome though a lumbar spine magnetic resonance imaging (MRI) done later did not show any cord compression. The recommendation was to start treatment with adalimumab pending the results of tuberculosis screening.
While awaiting initiation of therapy, the patient had worsening lower extremity weakness and was admitted three weeks after presentation to the rheumatology clinic. He was afebrile on admission. His initial physical exam showed bilateral lower extremity weakness that was worse in the right lower extremity with bilateral diminished reflexes. His initial labs showed an elevated C-reactive protein (CRP) of 48 mg/L and no leukocytosis. A repeat lumbar spine MRI in the hospital showed no evidence of cord compression. His thoracic spine MRI, however, demonstrated T7-T8 discitis with concern for osteomyelitis but no pathological fracture. He underwent emergent surgical decompression of the thoracic spine from T7 to T10 (Figures -). A swab of the surgical site showed rare Gram-positive cocci on Gram stain, and he was started on empiric vancomycin by the infectious disease specialist. His condition showed little improvement over the next few days, and the culture from his surgical specimen showed no growth. He then had interventional radiology (IR) aspiration of the T7-T8 disc space one week later that revealed rare Gram-negative rods on Gram stain. The infectious disease team started him on cefepime at that point and continued with vancomycin. The culture of the aspirated fluid again showed no growth on culture. Rheumatology was consulted and suggested that the etiology of the discitis could be inflammatory due to long-standing ankylosing spondylitis. This was supported by repeat lab evaluation two days after the IR aspiration which showed an increasing CRP of 129 mg/L despite antibiotic therapy as well as a low procalcitonin of 0.12 ng/mL. The hospitalist, infectious disease, and rheumatology teams all reviewed the case. The negative cultures and history of long-standing ankylosing spondylitis suggested sterile inflammatory discitis, but they could not definitively exclude an infectious etiology. The group then decided to complete a six-week course of vancomycin and cefepime prior to starting adalimumab due to the risks of starting immunosuppressive therapy in a patient with possible infectious discitis.
The patient was followed by infectious disease as an outpatient shortly after completing his six-week course of antibiotics. He showed a significant improvement in his lower extremity weakness and paresthesia, and his CRP had decreased to 35.6 mg/L. The infectious disease specialist then cleared him to start biological therapy. He started a course of adalimumab 40 mg subcutaneous every two weeks at his rheumatologist's office where he continued to show gradual improvement in both his ambulation and paresthesia. He will continue to be monitored over the next few months by his rheumatologist as he continues adalimumab therapy with repeat thoracic and lumbar spine MRIs in two months. |
pmc-6136888-1 | A 27-year-old male with no medical history presented to our emergency department with four days of atypical chest pain. He endorsed flu-like symptoms two weeks prior that failed to resolve with over-the-counter medications and amoxicillin. He also reported watery diarrhea and intermittent hematochezia. A complete cardiovascular workup was unremarkable. On admission, his hemoglobin decreased from 14 g/dl (baseline) to 10 g/dl due to a single episode of painless hematochezia. C-reactive protein was 6.5 and erythrocyte sedimentation rate was 60. All stool studies, including Clostridium difficile toxin, were negative. Coagulation studies were within normal limits. Physical exam was unremarkable, except for guaiac-positive stool. Colonoscopy revealed mild erythematous mucosa of the terminal ileum and a localized area of severely congested, erythematous, and inflamed mucosa in the rectum. Random biopsies were taken from the colon and rectum. IS were found in biopsies of the ascending colon, transverse colon, descending colon, sigmoid colon, rectum, and cecum. Terminal ileum and rectum biopsies also showed severe acute inflammatory changes with cryptitis and early crypt abscess formation (Figure ). All histological samples displayed no evidence of inflammatory bowel disease. However, the presence of overwhelming spirochete invasion suggested these changes were secondary to IS (Figures -). Testing for sexually transmitted diseases via polymerase chain reaction for human immunodeficiency, gonorrhea, chlamydia, herpes simplex virus, cytomegalovirus, and rapid plasma reagin was negative. He was treated with metronidazole and an improvement in symptoms was seen within three days (Kevin Green, Ciel Harris, Asim Suja, Miguel Malespin, Silvio de Melo, Jr.: Intestinal Spirochetosis: An Obscure Cause of Lower Gastrointestinal Bleeding--poster presentation. World Congress of Gastroenterology Mtg. October 17, 2017). |
pmc-6136889-1 | Fifty-nine-year-old woman presented to a pulmonary outpatient department for management of recurrent pneumonias due to bronchiectasis diagnosed two years ago. She was found to have on an average of four to five episodes of lower respiratory tract infections (LRTI) per year during the same period. She was apparently well until about two years ago when she started developing LRTI which was initially treated with various antibiotics including fluoroquinolones, beta-lactam antibiotics and macrolides at different walk-in clinics. Chest X-rays obtained before the presentation were normal. Computed tomography (CT) of the chest which was obtained at our hospital revealed right lower lobe focal cylindrical bronchiectasis. This was presumed to be post-infectious based on LRTI history. Frequency of LRTI increased from an average of two episodes in six months to three to four episodes in six months. Repeat sputum cultures grew pseudomonas aeruginosa every time. She was managed symptomatically with airways mucus clearance and fluoroquinolones as needed.
History for pulmonary childhood infections, immunodeficiency, severe allergies and other risk factors for bronchiectasis was negative. Serum immunoglobulin G subgroups and immunoglobulin E levels were normal arguing against immunodeficiency and ABPA. Upon closer review of the computed tomography of the chest, a possible endobronchial lesion was noticed resembling a polyp of about half a centimeter in length (Figure ) at the right lower lobe posterior segment. Flexible bronchoscopy was performed revealing thick yellow-green secretions originating from the right lower lobe with an endobronchial lesion in the posterior segment at the same level as the CT scan abnormality. Cultures from the bronchoalveolar once again grew pseudomonas aeruginosa and pathology from the biopsy of the endobronchial mass revealed acute inflammation with predominant neutrophils which we related to ongoing infection. Over the next six months, the patient had three hospitalizations due to LRTI. Department of cardiothoracic surgery was consulted and the patient underwent a video-assisted thoracoscopic surgery and a right lower lobectomy was performed due to BSI of 15. The resected lobe was sent to a pathologist for histopathological analysis. An impacted 1.3 cm non-surgical plastic foreign body was discovered in the right lower bronchus by the pathologist during the gross examination of the specimen (Figures , ). The histology of the airway and lung parenchyma surrounding the foreign body showed chronic inflammation and reactive benign tissue growth. Post-operative recovery in the hospital lasted four days and was uneventful. The patient had no recollection of aspiration or choking in the past which could explain the foreign body, nor did she have risk factors for aspiration such as dementia, alcoholism, drug use, stroke, medications, etc. Subsequently, the patient has had no recurrence of infections in the one-year follow-up. |
pmc-6137173-1 | A 6-year-old female child (114 cm, 17 kg) scheduled for adenotonsillectomy. Due to a traumatic fracture, she wore a plaster cast in the upper limb. She reported a history of sleep apneas. Notably, her past medical history did not include any reaction to drugs or food. Pre-operative physical examination was negative.
On the day of surgery, preoxygenation was applied and anesthesia was induced with Sevoflurane at increasing concentrations. Baseline oxygen saturation, non-invasive blood pressure (NIBP) and heart rate were 98%, 106/57 mmHg and 112 beats/min, respectively. A 22-gauge cannula was inserted and Fentanyl (1 μg/kg), Propofol (3 mg/kg), Dexamethasone (0.3 mg/kg) and Rocuronium (0.6 mg/kg) were administered.
The patient underwent oral intubation (4.5-mm cuffed endotracheal tube) without complications. Anesthesia was maintained with Sevoflurane (Minimum Alveolar Concentration 1, MAC 1) and Remifentanil (0.25 μg/kg/min). Mechanical ventilation was started with low tidal volume (6–7 ml/kg), a positive-end expiratory pressure setting of 5 cm H2O, and a FiO2 of 0.3.
After 7 min from initial drug administration, we observed a collapse of NIBP (58/17 mmHg), of SpO2 (to 77%) and a decrease of EtCO2 (to 26 mmHg). Overall, there was a decrease of more than 30% from baseline. The procedure was suddenly suspended together with Remifentanil infusion, while Sevoflurane was maintained for neuroprotection and awareness prevention. Initial resuscitation with a prompt infusion of saline solution (20 mL/kg) and Albumin 5% (i.e., 15 mL/kg), did not improve clinical parameters. We also observed a continuous worsening of SpO2 and an increase in peak pressure (up to 43 cmH2O). A quick check of the orotracheal tube position was performed, immediately followed by endotracheal suction maneuver and an increase in FiO2 (up to 1). SpO2 slightly increased (to 92%) without, however, any improvement in NIBP. Consequently, adrenaline was administered (two bolus of 20 mcg each) with a quick but transient improvement of NIBP value. Dopamine infusion was started (from 4 μg/kg/min up to 12 μg/kg/min) without any effect. Femoral arterial and central venous catheters were inserted. Due to the persistence of hypotension, Adrenaline was continuously administered (i.e., 0.4 μg/kg/min), followed by the administration of Hydrocortisone (5 mg/kg) while Sevoflurane was suspended only when an hemodynamic stability (due to Adrenaline infusion) was reached. At this point, we observed a progressive improvement of NIBP (up to 119/55 mmHg) and SpO2 (up to 100%).
In order to reach a precise diagnosis, we performed hemogasanalysis, thoracic X-Ray and echocardiography examinations, which excluded potential cardiovascular and respiratory diseases, as for example pneumothorax, pulmonary embolism, cardiogenic shock). Consequently, we hypothesized an anaphylactic shock. Tryptase test was positive (12, range 1–10) whereas total IgE test (PRIST, Paper Radio Immuno-Sorbent Test) was negative.
Finally, the patient was extubated in the operating room without the need of reversal agents then she was transferred to the PICU (Pediatric Intensive Care Unit) for monitoring and after 24 h she was discharged. Neither neurological nor systemic impairments were reported. |
pmc-6137194-1 | A 48-year-old woman visited out-patient clinic of neurology after 2 weeks of headache. The localization of headache was mainly on right side of head. It showed as intermittent dull pain, especially at night. Headache was relieved after taking pain reliever. However, headache occurred again when she stopped taking medicine. The patient visited out-patient clinic of neurology again. There was no abnormal change in brain parenchyma after taking brain CT scan. However, occupying lesion was found in the right sphenoid sinus. This patient was immediately hospitalized in the Otolaryngology Department. Further paranasal sinus CT demonstrated abnormal density of the right sphenoid sinus with calcification and lesion on the sinus wall (Figure ). Patient was treated by transnasal endoscopic sphenoidotomy without antifungal therapy. Histopathological examination diagnosed right sphenoid sinus as SSFB (Figure ). No further recurrence of her headache was found after 14 months follow-up. |
pmc-6137194-2 | A 46-year-old woman visited out-patient clinic of neurology after 1 month of headache. The localization of headache was mainly on left forehead. It showed as persistent dull pain, especially at night. Patient had occasional dizziness. After taking medicine prescribed from community hospital, headache relieved, but could not cure. Then, patient visited our out-patient clinic of neurology. There was no positive symptoms in nervous system. Brain MRI exam demonstrated that few demyelination in white matter of both frontal lobe and inflammation in sphenoid sinus. This patient was then hospitalized in the Otolaryngology Department. Further paranasal sinus CT demonstrated inflammation in left sphenoid sinus. Patient undertook transnasal endoscopic sphenoidotomy without antifungal therapy. Histopathological examination diagnosed left sphenoid sinus as SSFB. No further recurrence of her headache happened after 11 months follow-up. |
pmc-6137194-3 | A 66-year-old woman was admitted in the Neurology Department because of 2 month repeatedly headache, aggravating within 1 week. The localization of headache was mainly on left side of forehead, tempus, and cheek. It showed as intermittent pain, worse in the morning and tended to aggravate when she lowered her head. 1 week before she was admitted in hospital, headache was persistent accompanied by upper teeth pain on left side. She had hypertension (blood pressure 177/88 mmHg) and occasional nasal bleeding. There was no positive symptoms in nervous system. Brain CT imagine showed scattered demyelination in white matter of both frontoparietal lobes and inflammation in the left maxillary and sphenoid sinus. Further enhanced Brain MRI also demonstrated scattered demyelination in white matter of both frontoparietal lobes, inflammation of paranasal sinuses, and mucoceles in the left sphenoid sinus. Then, this patient was referred to the Otolaryngology Department. Further paranasal sinus CT demonstrated abnormal intensity of soft tissue in left sphenoid sinus, protrusion to the sinus cavity with nodular calcification. Patient was treated by transnasal endoscopic sphenoidotomy without antifungal therapy. Histopathological examination diagnosed left sphenoid sinus as SSFB. Follow-up of 10 months demonstrated no further recurrence of her headache. |
pmc-6137194-4 | A 61-year-old woman visited out-patient clinic of neurology because of 1 year intermittent distending pain on the right occipital, aggravating within 10 days. She received treatment from the community hospital but without relief. There was no positive symptoms in nervous system. CT scan did not show any abnormal alteration in brain parenchyma. It indicated right fungal sphenoid sinusitis. Then, this patient was referred to the Otolaryngology Department. Paranasal sinus CT abnormal intensity of soft tissue in right sphenoid sinus with calcification, bone damage on sinus wall, fungal sphenoid sinusitis. Patient undertook transnasal endoscopic sphenoidotomy without antifungal therapy. Histopathological examination diagnosed right sphenoid sinus as SSFB. Follow-up of 5 months demonstrated no further recurrence of her headache. |
pmc-6137194-5 | A 50-year-old woman visited out-patient clinic of neurology because of 1 year intermittent sharp pain on the left head and face, aggravating within 15 days. In the past 1 year, headache occurred every day and lasted for 3–4 h, symptom was worse at day time, particularly after bending. There was no nausea and vomiting. Gradually, pain localized on left cheek, accompanying with left superior teeth and eye pain. She was treated with Vitamin B1, Mecobalamin and Carbamazepine, but without relief. There was clear tenderness on the position of left supraorbital nerve and infraorbital nerve. She was preliminarily diagnosed as trigeminal neuralgia and was admitted in the Neurology Department. Enhanced brain MRI showed left sphenoid sinusitis with mucoceles, but without any abnormal alteration in brain parenchyma. Consultation of ENT doctor suggested to perform paranasal sinus CT scan. It demonstrated that left sphenoid sinusitis with abnormal intensity of soft tissue, absorbent thinning of front sinus wall, bone hyperplasia of side and rear sinus wall. Then, this patient was referred to the Otolaryngology Department. Patient was treated by transnasal endoscopic sphenoidotomy without antifungal therapy. Histopathological examination diagnosed left sphenoid sinus as SSFB. No further recurrence of her headache was found after 4 years follow-up. |
pmc-6137194-6 | A 59-year-old woman visited out-patient clinic of neurology because of 3 years intermittent sharp pain on left orbital. She was diagnosed as trigeminal neuralgia in the community hospital. Then, she was treated with Carbamazepine, Mecobalamin and acupuncture, but without significant relief. Our examination found tenderness at the exit of the left supraorbital nerve. MRI imagine demonstrated that partial empty sella and left sphenoid sinus. This patient was referred to the Otolaryngology Department. Paranasal sinus CT demonstrated inflammation of left sphenoid sinus. Patient was treated by transnasal endoscopic sphenoidotomy without antifungal therapy. Histopathological examination diagnosed left sphenoid sinus as SSFB. Follow-up of 2 month demonstrated no further recurrence of her headache.
All of the major clinical information in patients with SSFB was summarized in the Table . |
pmc-6137611-1 | A 57-year-old woman was treated by cholecystectomy for gallbladder lithiasis. Coelioscopic surgery was uneventful and the patient was discharged the next day, but she came back to the hospital three days after surgery, with bilious fluid extruding from the right surgical orifice. Abdominal computed tomography (CT) showed a right subcutaneous fluid collection with a small biloma at the site of cholecystectomy (not shown). For direct identification of the biliary breach, Magnetic Resonance Imaging (MRI) with hepatobiliary-specific contrast agent (Gadoxetic acid – Primovist®) was performed. Only the hepatobiliary phase (i.e. one hour after intravenous injection of the MRI contrast at bedside) was performed using tridimensional fat-saturated T1-weighted imaging. Opacification of the biliary ducts was excellent and opacified bile was depicted in the peritoneum. Thick reformations (based on 1.5 mm thickness FS T1 acquisition) located the biliary leak at the proximal portion of the common biliary duct (Figure ). The MRI findings were confirmed on endoscopic retrograde cholangiography, and the duct breach was treated by sphincterotomy and temporary covered stent placement (Figure ). |
pmc-6137720-1 | A 56-year-old woman who had autosomal dominant RP with a heterozygous PRPH2 mutation (c.410G > A) complained of metamorphopsia in her left eye. Her best corrected visual acuity (BCVA) had declined from 1.0 (20/20) to 0.4 (20/50). Further examination revealed CNV with serous retinal detachment (Fig. ). She was treated with as-needed injections for 2 years; however, she experienced a recurrence during which her vision deteriorated to 0.2 (20/100). Therefore, we switched to a bimonthly regimen that continued for 6 years. No recurrence was noted during that time, and her left visual acuity remained 0.2 (20/100). In total, the patient received 34 anti-VEGF injections in 8 years (bevacizumab × 2, pegaptanib × 2, ranibizumab × 11, aflibercept × 19, in that order).
The patient’s central visual field was assessed using the mean deviation (MD) value on a Humphrey field analyser with a 10–2 SITA standard program (Carl Zeiss Meditec, Inc., Dublin, CA). The MD values decreased similarly in both eyes (Fig. ). The slope of the MD values during the 8-year treatment period was − 0.68 dB/year in the right eye (without CNV) and − 0.32 dB/year in the left eye (with CNV). Although her peripheral visual field loss was noted to have progressed based on Goldmann perimetry tests, her visual field in the left eye was preserved even after 8 years (Fig. ). No serious adverse events were observed during treatment. |
pmc-6137868-1 | A 5-month-old boy presented with psychomotor developmental retardation and was admitted to the pediatric neurodevelopmental unit of Bayi Children’s Hospital. He could not control his head, was prone to hypsokinesis, was unable to turn over or grasp, and had high muscle tension. The parents of the patient denied heredity history or consanguineous marriage.
A urine sample was prepared with urease pretreatment methods, according to the method in the reported literature []. Derivatization was performed with 100 μL bis-(trimethylsilyl) trifluoracetamide (BSTFA) + 1% trimethylchlorosilane at 90 °C for 40 min, the metabolites were analyzed by GC-MS after cooling. The final derivatized metabolites were injected into the GC-MS, using a split-less mode per microliter. The temperature of the injection port was set at 250 °C. The initial temperature of the column oven was 60 °C and held for 2 min, then increased with the speed of 10 °C/min until reaching the temperature of 220 °C, held for 3 min; then it was increased with the speed of 15 °C/min to the final temperature of 325 °C and held for 5 min. The temperature of the ion source and transfer line was 280 °C and 300 °C, respectively. The run time lasted for 33 min, and the scan range was programmed from m/z 50 to 550. Finally, qualitative analyses of the characteristic mass spectrogram of each flow peak and the ratio of the peak area of 2-HG to that of creatinine was used as the quantitative index [].
Following the manufacturer’s instructions, genomic DNA was isolated from the peripheral blood specimens of the three people (patient and his parents) with the RelaxGene Blood DNA System (TianGen, Beijing, China). PCR amplified the entire coding region sequences, covering all 10 exons and the exon-intron boundary sequences of L2HGDH with primers as described by Topcu []. The PCR products were sequenced directly on an ABI 3730 sequencer (Applied Biosystem, Foster City, USA). The results were analyzed with the Gene tool program and Chromas program. The naming of the mutations was on the basis of Human Genome Variation Society (HGVS) guidelines (), according to GenBank NCBI reference sequence NM_024884.2. We used three prediction software programs, SIFT, PloyPhen-2, and MutationTaster, to predict the potential pathogenicity of the sequence mutations. On structural analysis, the protein (Uniport ID: Q9H9P8) of L2HGDH for human was downloaded from Uniport (/). Then its three-dimensional structure was predicted using I-TASSER () with the default parameters and the model with the highest C-score was selected. We used the InterPro () to predict the domain of protein Q9H9P8. Finally, the predicted structure and the functional domains were visualized by PyMol 2.1 ().
Brain MRI revealed symmetrical, high-signal changes in the subcortical white matter, basal ganglia, and cerebellar dentate nuclei. The lateral ventricular wall showed multiple nodular gray matter heterotopia. The right side of the cerebellar hemisphere and vermis showed dysplasia (Fig. ).
GC-MS analysis showed visibly increased excretion of 2-HG (209.70 mmol/mol cre, normal range 0.00~ 19.85 mmol/mol cre) in the urine. The peak area ratio of 2-HG was 20.84, and the normal peak area ratio was 0.25, which was the 99.5 percentile of 500 newborns with normal metabolism. The retention time was 13.88. The characteristic ion used for quantification was m/z 349 (Fig. ).
We identified two novel mutations in exon 3 of the patient. One was a homozygous missense mutation (c.407 A > G, p.K136R). We used three prediction software programs, SIFT, PloyPhen-2, and MutationTaster, to predict the potential pathogenicity of the sequence mutations. The results were “damaging (0 score)”, “probably damaging (1 score)” and “disease causing (26 score)” respectively. This mutation was not present in the 1000 Genome Project, NHLBI GO Exome Sequencing Project and and InNormal Database (MyGenostics, number of 1000). The mutation site p.K136R of the protein was located in the pocket (shown in th black ellipse) of the FAD/NAD(P)-binding domain(Fig. ). The other mutation was a heterozygous deletion of one nucleotide (c.408delG, p.K136SfsX3), which would be expected to cause a premature stop codon at position 138 in the protein sequence. Further pedigree analysis of the healthy parents confirmed that the two novel mutations segregated with the disease in an autosomal recessive trait. His asymptomatic mother had the heterozygous missense mutation (c.407 A > G, p.K136R). His asymptomatic father showed both the heterozygous missense mutation (c.407 A > G, p.K136R) and the heterozygous delete mutation (c.408 del G, p.K136SfsX3) (Fig. ). Finally, we predicted the homozygous missense mutation (c.407 A > G, p.K136R) was the pathogenic mutation of the patient. |
pmc-6137890-1 | A 43-years-old male of Japanese Brazilian with hypesthesia from the right lower lip to the mental region consulted a hospital for the first visit. Computed tomography (CT) revealed a round radiolucent area in the right mandibular body, and biopsy was carried out, leading to a diagnosis of schwannoma. He was referred to the Department of Oral and Maxillofacial Surgery, Gunma University Hospital, for detailed examination and treatment for the first time in March 2015.
His physical status was moderate and nutritional status favorable. There was no other notable factor. On visual inspection, there was no tumor lesion in the oral cavity (Fig. ). Hypesthesia extending from the right lower lip to the mental region was noted, and the perception level was approximately 50% of that on the unaffected side. CT imaging revealed dilation of the mandibular canal (Fig. ), and magnetic resonance imaging (MRI) showed an irregular high signal intensity on horizontal sections of short inversion time inversion recovery (STIR). On sagittal sections, dilation of the right mandibular canal was observed around the mandibular foramen. Dynamic images showed crescendo enhancement (Fig. ).
Preoperative biopsy findings carried out at the first hospital visited by the patient suggested a schwannoma involving the Antoni A region. Briefly, the lesion was immature, suggesting the presence of an active potential. Considering the risk of future tumor growth, the tumor was extirpated under general anesthesia in late April 2015. A macroscopically observed intraoperative finding was a cystic tumor (3.2 × 1.0 cm) associated with the inferior alveolar nerve and vessels; hence, the inferior alveolar nerve was ligated/cut and extirpated as a mass (Fig. a, b). Intraoperative rapid diagnosis confirmed the absence of tumor cells at the margins of the resected nerve specimen. During the 2-year postoperative follow-up, radiopacity was enhanced at the wound site after extirpation of the tumor, confirming favorable bone outgrowth (Fig. c, d). There have been no subsequent clinical findings or images suggestive of relapse.
In a hematoxylin-and-eosin (H-E)-stained specimen, bundle-like tumor proliferation was observed around the nerve fiber. In addition, outgrowth of tumor cells was noted around nerve fibers, separating the nerve fiber bundle (Fig. a–c).
Immunohistologically, the tumor cells were positive for Glut-1 and weakly positive for EMA and Claudin-1. The tumor cells were negative for S-100, but the residual nerve fibers were positive for S-100 (Fig. a–e). Based on these findings, the histopathological diagnosis was INPN. The MIB-1 expression rate of INPN, indicating its cell proliferation ability, was 1.6% (Fig. ).
To examine the pathogenesis of this tumor, FISH, which facilitates the detection of gene localization on the chromosomes, was carried out. In this procedure, a cloned gene or DNA fragment is labeled with a non-isotopic compound and hybridized with chromosomal DNA on a glass slide to directly detect the site of in situ hybridization, as a fluorescent signal, on a chromosome. FISH is safer and simpler than conventional autoradiography. In addition, it is advantageous as the results can be obtained in a short time. As standards, the fluorescent body of chromosome 9 (orange signal) indicates the ABL gene, that of chromosome 22 (green signal) indicates the BCR gene, and a yellow signal indicates the BCR-ABL fusion gene. Cellular signals on INPN were visually counted and classified. Measurement criteria for detecting the ALK fusion gene using the FISH method were quoted as diagnostic criteria. The principle is similar to that of BCR-ABL fusion gene detection. Samples with < 5 positive cells per 50 cells (< 5/50 or < 10%) were regarded as negative, and those with > 25 positive cells per 50 cells (> 25/50 or > 50%) were regarded as positive. The results showed that signals suggestive of BCR-ABL fusion gene formation were observed in 30 of 50 cells. In 12 of the 50 cells, the green signal of the BCR gene was present in the absence of fusion gene signals, suggesting deletion of the BCR region. Thus, 42 of the 50 cells were positive, suggesting chromosome 22 abnormalities. According to the above diagnostic criteria, our patient was regarded as having a chromosome 22 abnormality. Based on this finding, it was confirmed that this disease was a tumorous lesion (Fig. ). |
pmc-6137938-1 | A 23-year-old Caucasian woman presented to our emergency department with abdominal pain and recurrent nausea of 6 days’ duration, which had progressively worsened over the past few hours, but without vomiting. The pain, she described, was rather diffuse but more intense in the epigastric region. She denied reflux, diarrhea, urinary symptoms, and fever. She reported that she had been having intermittent problems with diffuse abdominal pain throughout her adult life, but usually milder than this current episode.
Regarding her medical history, she had suffered from a jejunal atresia in her left-upper abdomen which required surgical treatment in her neonatal period. It was initially treated with a Bishop–Koop side-to-side jejunojejunostomy with chimney. The stoma was reversed approximately 7 months later.
A physical examination revealed a flat and soft abdomen with a big scar across her upper abdomen, without any evidence of a hernia. Abdominal palpation revealed a mild tenderness in her lower abdomen, particularly in the right lower quadrant. No abdominal masses were palpable. Bowel sounds were normal. A laboratory examination (complete blood count, electrolytes, C-reactive protein, liver, pancreatic, thyroid, and renal function) revealed no abnormality.
A contrast-enhanced computed tomography (CT) scan of her abdomen with rectal contrast enema was performed. The CT scan demonstrated a markedly altered anatomy of the midgut with a rather usual course of the hindgut (Fig. –). The normal anatomy of the gastrointestinal tract and the anatomical situation in the present case are graphically illustrated in Fig. and , respectively. The duodenum crossed from right to left ventral to the superior mesenteric artery (SMA), suggesting an intraperitoneal position in all of its portions, with the duodenojejunal flexure situated slightly to the left of the midline. The proximal jejunum then crossed back to the right abdomen, posterior to the SMA, suggesting a retroperitoneal position (Fig. ). The following slightly dilated jejunal loops were found lying in the right abdomen. Further distally the distal jejunum/proximal ileum crossed back to the left lower abdomen, remaining in an intraperitoneal position ventral to the mesenteric root. Most of the ileal loops were situated in the left lower abdomen (Fig. ); the cecum was found slightly left of the midline in the umbilical region in close proximity to the ligament of Treitz (Fig. ), thus suggesting a narrow mesenteric pedicle. The ascending colon coursed from the right mid-abdomen toward the ileocecal pole in the left mid-abdomen. Both ascending colon and cecum remained ventral to the mesenteric root in an intraperitoneal position. The transverse colon dorsally crossed the pedicle of the SMA and the superior mesenteric vein (SMV) in a retro-arterial position (Fig. ), defining this anatomic midgut variation as reversed rotation, and extended to the left abdomen to continue as a normal left colic flexure and descending colon. We further noted an inverted relationship of the SMV to the SMA with the vein lying to the left of the artery and an aplasia of the uncinate process (Fig. ). No thickened bowel walls or peritoneal fluid were present.
CT demonstrated no evidence of frank volvulus, bowel ischemia, or acute bowel obstruction. The patient was diagnosed as having a variant of reversed intestinal rotation.
She was immediately started on intravenously administered fluids and analgesics (metamizole), which offered instant pain relief. The clinical findings did not indicate a need for immediate hospital admission or surgical intervention. |
pmc-6138077-1 | The dogs, a three-year-old male castrated Pomeranian and two seven-year-old male castrated cross breeds, were presented to the Onderstepoort Veterinary Academic Hospital (OVAH) three days after ingestion of the paraquat. Acute vomiting of clear bright blue fluid with crumbly granules, corresponding with the colour of the herbicide and consistency of the cooked maize-meal, followed by inappetence, had been noted by the owner. The dogs were lethargic with congested mucous membranes, shortened capillary refill time, mild tachycardia, dehydration, severe ulcerative stomatitis and mild tachypnoea. Mild generalised muscle tremors occurred in one dog. All canine patients were normotensive, and abnormal lung sounds were not detected on thoracic auscultation. Peripheral blood oxygen saturation (SpO2) was above 95% at presentation in all dogs. Mild relative haemoconcentration and hyperalbuminaemia were present in two dogs. Moderate leukopaenia because of moderate neutropaenia and mild lymphopaenia, likely associated with endotoxaemia, were recorded in one dog. Hyponatraemia and hypokalaemia occurred in all dogs, likely secondary to vomiting and anorexia. One dog had mild type A hyperlactataemia (3.8 mmol/L [reference interval 0 mmol/L – 2.5 mmol/L]) that resolved post-hydration (1.4 mmol/L). Faecal evaluation negative for ova, alkaline urine (pH 8), mild proteinuria (1–2+/4) with inactive sediment and moderate glucosuria (2–3+/4) in the presence of normoglycaemia were found in all dogs. Thoracic radiographs showed no changes in one dog, mild perihilar broncho-interstitial lung pattern in another and diffuse reticular interstitial lung pattern in the third dog. |
pmc-6138098-1 | In November 2008 a two-year-old wild female cheetah from a temporary holding facility developed seizures, a raised tail and arched back. She died despite treatment and was submitted to the National Zoological Gardens of South Africa for necropsy examination.
The female cheetah was one of four young adults in a project tasked with re-establishing cheetah populations in protected, fenced reserves. To maximise survival orphaned young animals go through a re-wilding process to ensure they are fit and able to hunt effectively before being released. This is done by keeping the cheetah in a 1 ha enclosure initially. Antelope and birds are shot on the reserve as cheetah food. Once cheetahs are able to open and feed off a full carcass, they are released from the enclosure and monitored intensively. Management, handling and feeding schedules were consistent among the female and three males; the female was the only mortality.
Tissue preservation in the cheetah was poor due to delayed presentation. A representative sample of all tissues except eye and spinal cord were examined histologically. Macroscopic and histological features were non-specific and non-diagnostic. Four lead pellet fragments of less than one millimetre diameter were found in the stomach. Tissue lead concentrations of 15.6 ppm and 17 ppm (wet weight) for kidney and liver respectively were determined at the Onderstepoort Veterinary Institute Toxicology Department using atomic absorption spectrophotometry, and were highly suggestive of lead poisoning (). Organ sample and blanks were acid digested and compared with standard lead solutions. |
pmc-6138098-2 | In April 2013 a seven-year-old male cheetah in a captive breeding centre became excited, started having seizures, became laterally recumbent and began to salivate excessively before dying under anaesthesia for examination. The cheetahs in this facility are kept for breeding purposes, housed in pairs in pens 0.4 ha – 1 ha in size, captive-born and hand-reared to facilitate management and reduce stress. Unlike most cases, this cheetah was wild-born and brought to the breeding centre as an adult 2 years prior to his death. He was housed alone due to his aggression to conspecifics. On the day of his death two males in an adjacent enclosure had been run along a passage between female enclosures to detect oestrus, eliciting excitement from all cheetahs in the vicinity.
The diet of cheetahs at this facility consists of meat from shot feral donkeys, horses, and occasionally rabbit, goat or chicken. This cheetah was fed large chunks of meat as his aggression precluded feeding minced meat in a dish. All cheetahs receive additional vitamin and mineral supplementation.
Necropsy revealed a lead bullet in the stomach. Tissues were submitted to the National Zoological Gardens of South Africa for histological examination, but not for lead determination. Histological findings were non-diagnostic and a presumptive diagnosis of lead poisoning was made. |
pmc-6138103-1 | A 13-year-old adolescent girl was admitted to the Department of Child and Adolescent Psychiatry with complaints of lack of enjoyment of pleasurable activities, sleep disturbances, suicidal thoughts, binge eating episodes, self-induced vomiting episodes and excessive exercising, leading to significant weight loss last 1 year in association with a situation of a family conflict.
The patient lived with her mother and sister. She was very distressed and unhappy because her mother forced her to talk with her father. She stated that her father had deserted them for someone else 9 years ago, she did not talk and see him until this time anymore and she found this difficult to accept him and everyday her father phoned her mother and insisted on establishing a new relationship. In this month, she began to take money from home without permission, especially after each time her father called her mother. And she started to have conflicts with her peers and siblings.
She was admitted to the paediatric inpatient clinics in two different hospitals because of self-induced vomiting episodes and weight loss before admission to the Department of Child and Adolescent Psychiatry. She had no complaints of dysphagia, retrosternal pain and heartburn; physical examinations and detailed investigations including blood tests and abdominal-pelvic ultrasound and endoscopy were normal on both paediatric occasions. Paediatric gastroenterology specialist reported that this medical condition was not associated with any primary oesophageal motility disorders (achalasia, diffuse oesophageal spasm, nutcracker oesophagus, etc.) and secondary oesophageal motility disorders (diabetes mellitus, scleroderma, etc.). Following this, she was referred to a child and adolescent psychiatry outpatient clinic along with a pre-diagnosis of psychiatric disorders to be able to associate with secondary oesophageal motility disorders.
At the psychiatric evaluation, she expressed no fear of getting fat but her self-esteem was strongly affected by her physical appearance, and she seemed very unhappy. She reported binge eating episodes and self-induced vomiting at least 7–8 times a day. She had lost 13 kg in the previous 6 months (weight: 41 kg, height: 162 cm, body mass index: 15.6 at admission). Laboratory evaluations including haemogram, liver function tests, total protein, vitamin B12, folic acid, T3, T4, TSH, FSH, LH, E2, prolactin levels were within normal limits. The abdominal-pelvic ultrasound and plain abdominal radiography were repeated and reported as normal. A physical examination at the paediatric clinic ruled out medical complications. Achalasia and other oesophageal motility disorders were ruled out according to physical examinations and test results. Baseline psychiatric evaluation with the Children’s Depression Inventory and the Clinical Global Impression scale revealed scores of 40 and 7 (extremely ill), respectively. According to those evaluations and DSM-IV-TR criteria, the patient was diagnosed with major depressive disorder and BN, and she was started on fluoxetine 20 mg per day. Cognitive behavioural therapy focusing on body-focused cognitions was also started. Partial response to treatment was observed at the 11th week (i.e. binge or vomiting reduced to 2–3 per day and weight gain of 1.4 kg), and fluoxetine was titrated to 40 mg/day. The subject of seeing her father was closed. She stated that this made her feel good, and she registered for a painting course.
While she was under follow-up in a child and adolescent psychiatry clinic, she was admitted to a paediatric gastroenterology clinic because of complaints of dysphagia with retrosternal pain, heartburn, involuntary vomiting of undigested food and weight loss. Oesophagogastrodu-odenoscopy showed retention of liquid in the oesophagus, so oesophageal manometry was quickly carried out, and the results were strongly consistent with achalasia in the patient. After a joint meeting of the paediatric gastroenterology and paediatric surgery departments, a decision to operate was made. The patient underwent surgery, and oesophagogastromyotomy and fundoplication were performed during the operation. After surgery, her vomiting decreased. And she stated that she felt better but she still experienced anxiety regarding her physical appearance and weight. She was receiving 40 mg/day fluoxetine and cognitive behavioural therapy sessions weekly, and she is still under follow-up. Her Children’s Depression Inventory and the Clinical Global Impression scale scores were 25 and 2 (borderline mentally ill), respectively, during her last visit. |
pmc-6138109-1 | Permission to report on this case was granted by the Research Ethics Committee of the Faculty of Health Sciences of the University of Pretoria.
A 26-year-old man was arrested for attempted burglary and because of what was described as abnormal behaviour while in custody was sent for psychiatric observation in terms of Sections 77, 78 and 79 of the Criminal Procedure Act, No. 51 of 1977, as amended. The observation was done at Weskoppies Hospital, a tertiary psychiatric hospital in Pretoria, South Africa. Following the observation period, he was diagnosed with schizophrenia, the charges were dropped and he was referred back to Weskoppies Hospital for treatment as an Involuntary Mental Health Care User under the Mental Health Care Act, No. 17 of 2002.
Because of the patient’s severe psychotic state, it was not possible to obtain a reliable background history from him. No collateral history was available because no relative had accompanied him at the time of admission and the police could only supply information related to his arrest.
The patient presented as being unkempt and poorly groomed. He moved with ease and showed no signs of agitation, aggression or psychomotor abnormalities, but was uncooperative. During the interview, it was clear that he was psychotic. His speech was extremely disorganised but with a normal tone, melody and rhythm. He suffered from a severe thought form disorder, presenting mostly with loosening of associations, derailment and neologisms. He would usually give inappropriate answers to questions, but when he did start to answer appropriately, he became tangential almost immediately. He presented with partial hearing impairment. Because of the presence of persecutory, grandiose, referential and bizarre delusions, it was clear that he also had a thought content disturbance. Perceptual disturbances were present in the form of auditory hallucinations. Affect was deemed to be appropriate, but it was difficult to assess the patient’s mood because of his psychotic state. He was poorly oriented, portrayed poor judgement and had no insight into his psychiatric problem. The patient was admitted with a working diagnosis of schizophrenia with the possibility of his psychotic symptoms being substance induced.
During the course of his stay in hospital, his psychotic symptoms did not improve significantly despite optimal treatment with two different first-generation antipsychotics. His auditory hallucinations did disappear, but the delusions and disorganised speech remained. Shortly after admission, his speech slowly decreased until he became mute, but returned with the introduction of a higher antipsychotic dose.
Even though he was clearly thought disordered, it started to become clear that he might also have an aphasia. His speech was fluent and had a normal rate and melody, but he presented with poverty of speech content and paraphasic errors (including neologisms). Yet at times his speech would also be agrammatical. His language comprehension and ability to repeat phrases were intact.
Around the time when the evaluation of his aphasia was taking place, it was reported that he had suffered several tonic-clonic seizures during the course of his admission. He was subsequently sent for an electroencephalogram (EEG). The EEG revealed excessive diffuse low-voltage theta slow-wave activity, medium-voltage delta slow-wave activity in the frontal areas maximal on the left and isolated sharp transients in the left frontal area indicative of localised left frontal dysfunction with possible epileptiform features.
At that time, his general physical examination was normal. Neurological examination revealed increased tone in both legs with brisk knee and ankle reflexes, which seemed to have been missed by the doctor on admission. The plantar response was extensor bilaterally, but power, sensation and proprioception in the legs were intact. Neuropsychiatric examination revealed the presence of multiple frontal lobe functional abnormalities. The rest of the neurological examination, including that of the cranial nerves, was normal.
Because of his clinical presentation, treatment-resistant psychosis and the EEG result, he was sent for a computed tomography scan of his brain.
The scan revealed a large left frontal mass lesion with multiple cystic areas, a high-density centre containing calcium and a low-density area containing fat. A magnetic resonance imaging scan was subsequently done, and the report suggested the presence of a large, left frontal lobe, multicystic inhomogenous tumour with characteristics consistent with a ganglioglioma or pleomorphic xanthoastrocytoma.
The tumour was successfully resected. The histology report revealed an irregular, firm tumour 3 × 2 × 1.5 cm in size. It was cystic with a fibrous wall and contents consisting mostly of blood – although bone fragments and fat were also identified. A diagnosis of a mature teratoma was made.
During the weeks that followed his surgery, there was very little change in his condition – he was still aphasic, thought disordered and delusional, although his seizures were well controlled on anticonvulsant medication. It was during this time that the social worker was finally able to locate his family. They travelled to Pretoria to pick him up. An interview with the family revealed that they had lost touch with him several years before and that he had been presumed dead. They also revealed that the problems started during his final year of high school when he started getting seizures and became hard of hearing.
The patient was discharged into the care of his family with a referral letter to follow-up at a healthcare facility in their province of residence. He was therefore lost to follow-up locally. |
pmc-6138118-1 | A 13-year-old female Motswana student, who is the first born in a family of two children and being raised by a single unemployed mother, was referred to a psychiatric hospital by her local facility. She presented with a 1 week history of calling out for people who were not there as if she were conversing with them and seeing things other people could not see. She was also reported to often appear anxious and was not sleeping well at night. The symptoms appeared to worsen daily, prompting the caregivers to seek help. There have been no preceding life events that may have precipitated the symptoms, and she had never been admitted or been on treatment for any psychiatric disorder before the current presentation.
Ms K was born via a normal vaginal delivery at 32 weeks gestational age, with a birth weight of 2.1 kg. The mother was Gravida 2, Para 2, and antenatal history was unremarkable. Her mother highlighted that the patient had delayed developmental milestones as she did not walk and talk until after age two. Regarding social development, Ms K was reported to prefer solitary activities, and if she interacted with others, she would choose children younger than her. She reportedly attended a normal stream school for 2 years but was transferred to a special needs school (i.e. school for children with learning difficulties) because of academic difficulties.
On medical history, she has been diagnosed with a complex congenital heart disease: pulmonary atresia, large ventricular septal defect, pulmonary regurgitation, right ventricular hypertension and failure. She underwent corrective surgeries for the cardiac conditions at ages 6 years and 12 years, an umbilical herniorrhaphy at 3 years and clubfoot repair at 2 years.
Typical features of DGS on physical appearance were a broad flat nose, small ears and a thoracolumbar scoliosis, whereas the typical long face, hypertelorism and micrognathia were absent. Physical examination revealed a mediastinal scar and a pansystolic murmur. Her blood pressure was 113/83 mmHg, pulse rate was 114 beats/minute and temperature was 35.8 °C. Investigations such as full blood count, liver function test, urea and electrolytes were within normal ranges. A chromosomal analysis was positive for chromosome 22 deletion syndrome.
Mental status assessment on the index consultation revealed a well-nourished adolescent. She was very restless, pacing up and down the interview room, thus making it difficult to establish a rapport. There was no eye contact. She had a labile affect. She was socially inappropriate as she kept undressing during the interview. Thought process was mostly tangential. She had fixed belief that her family members were bewitching her. She reported that God was commanding her to take her clothes off and she admitted to seeing a short man in the interview room.
A working diagnosis of acute schizophrenia-like psychotic disorder was made using the International Classification of Diseases-10 (ICD-10) diagnostic criteria. The patient was admitted on haloperidol 3 mg at night. Four days post admission, she was noted to have increased motor activity, restlessness and sialorrhea, whereas the psychotic symptoms persisted. Manic symptoms such as elated or irritable mood and increased energy were absent. On suspicion of akathisia, haloperidol was stopped and she was started on olanzapine, 5 mg once daily at night. The extra pyramidal side effects (EPSE) symptoms reduced after 2 days. Psychotic symptoms subsided on day nine post admission. She stabilised 2 weeks after admission and was discharged on olanzapine 5 mg once daily at night. She was reviewed in an outpatient clinic after 2 weeks and remained stable. She continued reviews as an outpatient for 4 months and medication dose was reduced to 2.5 mg nocte. A month later, she presented to OPD with history of poor sleep at night, laughing inappropriately and isolating self. Medication was reviewed upwards to olanzapine 5 mg nocte as it was on discharge. For long-term management, patient was to be enrolled in vocational training and behavioural therapy. A definitive diagnosis of early-onset schizophrenia in a patient with DiGeorge syndrome was made. |
pmc-6138121-1 | On 2 May 2012, a 29-year-old male farmer from Underberg was admitted to a hospital in Pietermaritzburg, KZN. The patient reported contact with a stray puppy some two months before the onset of symptoms. The patient provided shelter for the puppy, but after a few days the animal developed symptoms which in retrospect could have been considered consistent with rabies. The dog subsequently died and was buried on the farm. After consideration of the patient history, rabies was deemed likely. Saliva, skin and cerebrospinal fluid (CSF) were collected over the course of his illness and sent to the NICD-NHLS in Johannesburg but were consistently negative for the presence of rabies virus RNA using conventional as well as real-time RT-PCR methods. To further investigate, the puppy (referred to as Dog GA) was exhumed and the decomposed brain material sent to the University of Pretoria in 50% glycerol-saline solution for molecular testing on 11 May 2012. Rabies-specific IgG was detected in the serum of the patient; however, this was likely as a result of the vaccine he received upon admission. Initial rabies-specific serological tests on CSF were negative. Subsequent CSF samples collected over four weeks indicated the presence of rabies-specific IgG at low titres. The FAT confirmed the presence of rabies virus antigen in a post-mortem brain biopsy specimen of the patient. Real-time RT-PCR was also performed on this specimen at the NICD-NHLS and the product sequenced (referred to as SPU 134/12). |
pmc-6138121-2 | On 28 August 2012, a 21-year-old male was admitted to a local hospital in KZN. Upon investigation, it was found that a dog (referred to as Dog VG) bit the patient on 19 July 2012 whilst he was visiting his girlfriend in the Tshelimnyama area. The owners of Dog VG mentioned that the dog was usually well behaved but suddenly started showing strange behaviour and that the dog was not vaccinated during the recent vaccine campaign in the area. Following these events, the owner chained the dog; however, the dog broke free and went missing. Other people from the neighbourhood reported seeing Dog VG attacking other dogs on several occasions. Dog VG was killed during one of these attacks. The carcass of Dog VG was found slightly submerged in water and in an advanced state of decomposition on 28 August 2012. Brain material was subsequently sent to the University of Pretoria in 50% glycerol-saline solution for molecular testing on 30 August 2012. |
pmc-6138208-1 | A 4-year-old intact female Jack Russel terrier was referred with complaints of severe neck pain and ataxia. The patient had an altercation with a porcupine 2 weeks previously, and at that time several quills were removed from her mouth and around the mandible by the referring veterinarian. Of these quills, one had penetrated the soft palate and two more were found imbedded in the oropharynx. The owner stated that since the incident, the patient was at times so painful that she would only move her eyes. The patient presented clinically with ataxia and weakness with delayed proprioception of the right thoracic and pelvic limbs. Manipulation of the neck was painful in all directions, especially to the right side. Neuro-localisation was a right-sided lesion between C1 and C5. All other clinical parameters, routine haematology, serum biochemistry and urinalysis were within normal limits at presentation and during the stay in our hospital. |
pmc-6138217-1 | A 9-year-old sterilised female domestic short-hair cat was referred with a history of intermittent vomiting and anorexia of 3 months duration. Initial investigations included a faecal floatation, urine analysis, serum biochemistry as well as a full-blood count that all yielded results within the normal range. Abdominal ultrasonography and a feline pancreatic–specific lipase test did not reveal any abnormalities. The cat was treated with prochlorperazine (Stemetil, Sanofi-Aventis) at 0.5 mg/kg per os (PO) twice per day (bid), omeprazole (Losec, AstraZeneca) at 1 mg/kg PO once per day (oid), enrofloxacin (Baytril, Bayer) at 5 mg/kg PO oid and sucralfate (Ulsanic suspension, Aspen Pharmacare) at 1 mL per 3 kg PO bid intermittently during the 3-month period. Medical therapy failed to improve the clinical condition, with vomiting and anorexia becoming more persistent. Three months after the initial investigation, a serum chemistry profile, full-blood count and urine analysis were repeated, which revealed mild hypochloraemia (98 mmol/L [normal 109 mmol/L – 122 mmol/L]) and moderate hypokalaemia (2.3 mmol/L [normal 3.5 mmol/L – 5.8 mmol/L]). In addition to the above tests, a SNAP feline leukaemia virus/feline immunodeficiency virus (FeLV/FIV) test, as well as high-definition oscillometry blood pressure readings were performed, which were with the normal range. Thoracic radiographs showed no abnormalities either. The cat was then referred to a specialist physician for further investigation. |
pmc-6138218-1 | A hand-reared 5-month-old male intact steenbok weighing 5 kg was presented at the Onderstepoort Veterinary Academic Hospital (OVAH) for investigation of dysuria of approximately 7 days’ duration. The steenbok had been maintained on a diet of commercially available wildlife pellets (Antelope 16% pellets, EPOL, Worcester, South Africa), lucerne hay, cow’s milk and fresh grass since weaning. The owner reported that diarrhoea had been present for 4 days prior to presentation and oral treatment with electrolyte solution had been undertaken. The steenbok had also been vocalising and straining during urination and had only managed to pass small amounts of urine for 5 days prior to presentation. On clinical examination at admission, the steenbok appeared to be agitated and a significantly enlarged bladder was found on palpation of the abdomen. No other abnormalities were evident on a general physical examination.
Urinalysis revealed urine with a pH of 8, and bacterial cocci, epithelial cells and small crystals were found on cytological examination. Urolithiasis was suspected and radiographic and ultrasonographic evaluations of the caudal abdomen performed. Radiographic examination of the abdomen was unremarkable, but the ultrasonographic evaluation revealed an enlarged bladder with fine hyperechoic debris on the ventral bladder wall. Agitation of the bladder by manipulation of the patient produced a snow-globe effect (). Additionally, a hyperechoic mass, 3.75 mm in diameter, was observed obstructing the distal urethra proximal to the glans penis ().
A provisional diagnosis of obstructive urolithiasis of the distal urethra was made. Treatment options considered included a tube cystotomy with normograde catheterisation or urine diversion surgery such as a perineal urethrostomy. The latter approach was decided upon in this case.
Haematological and biochemical analyses were found to be within normal limits for antelopes with a haematocrit of 49.4% (Pospísil et al. ; Vahala & Kase ). Pre-operative medication included amoxicillin clavulanic acid (10.5 mg/kg bodyweight [bwt]: Augmentin, Glaxo Smith Kline, Johannesburg, South Africa), meloxicam (2 mg/kg bwt: Metacam, Boehringer Ingelheim, Randburg, South Africa), hyoscine butyl bromide (4 mg/kg bwt: Buscopan, Boehringer Ingelheim, Randburg, South Africa) and butorphanol tartrate (0.05 mg/kg bwt: Torbugesic, Zoetis, Sandton, South Africa). After placement of an intravenous catheter in the left jugular vein, general anaesthesia was induced using propofol (1 mg/kg bwt: Propofol, Fresenius Kabi, Midrand, South Africa) and maintained with 3% isoflurane (15 mg/kg bwt: Isofor, Safeline Pharmaceuticals, Roodepoort, South Africa). The perineal region was aseptically prepared and draped. The urethral process at the distal urethra was amputated and an attempt made to perform retrograde catheterisation using a feline catheter (3 gauge Buster Barium Cat Catheter, Kruuse, Midrand, South Africa). Both catheter placement and retrograde lavage with ringers lactate (Hartmann’s solution, Fresenius Kabi, Midrand, South Africa) failed.
Perineal urethrostomy was performed by making a 3 cm mid-perineal incision ventral to the anus. The penile body was located through blunt and sharp dissection and freed from surrounding soft tissue. Dissection between the penile body and dorsal penile vessels was performed. Blunt dissection identified the retractor penis muscle and the ischiocavernosus muscle attachment to the penis. These were carefully transected before an incision was made through the corpus spongiosum into the urethra. The urethral mucosa was then left unsutured. A feline catheter (3 gauge Buster Barium Cat Catheter) was introduced into the urethra and directed initially towards the bladder. Lavage from this catheter did relieve the obstruction towards the glans penis but not proximally towards the bladder. An additional more proximal incision was made into the urethra, at which point retrograde lavage relieved the obstruction towards the bladder, with small white uroliths visible within the catheter. The feline catheter was then sutured into place facing towards the bladder and the urethrostomy site closed. Significant blood loss and hypothermia were evident during the surgical procedure, which lasted 2 h. The following day a peripheral venous blood sample was obtained for haematological analysis, which indicated a haematocrit of 23%. There are no published reference ranges for haematocrit values in the steenbok, although the normal haematocrit of the springbok (Antidorcas marsupialis), a larger antelope, has been recorded as 48% (Pospísil et al. ; Vahala & Kase ). This antelope was therefore anaemic. The steenbok was maintained on a therapeutic regimen of amoxicillin clavulanic acid (10.5 mg/kg bwt: Augmentin) and meloxicam (0.6 mg/kg bwt: Metacam) administered by subcutaneous injection. Oral fluid therapy via a bottle was commenced at 3-h intervals and ad lib water was supplied, as intravenous fluid therapy was not tolerated. The steenbok became agitated each time an attempt was made to install an intravenous fluid system. The oral fluids were supplemented three times daily with ammonium chloride (200 mg/kg bwt: Ammonium Chloride, Trans Pharm, Hermanstad, South Africa) to acidify the urine (Mavangira, Cornish & Angelos ; Sprake ). Acidification of the urine was important as struvite uroliths are most commonly associated with ruminants, the urine pH was increased to 8 and magnesium calcium phosphate crystals were present in the urine (Sullivan et al. ; Van Metre et al. ). The patient was given ad lib fresh buffalo thorn leaves (browse) and fresh grated vegetables at 0.5% bodyweight daily.
The steenbok maintained a normal appetite, normal clinical parameters and regularly passed small amounts of urine through the catheter during the first 24 h post-operative period. The urine pH was 8 and specific gravity was 1.018. Magnesium calcium phosphate carbonate uroliths were found to be present in each urine sample ().
During the next 24-h post-operative period, the steenbok maintained normal clinical parameters and appetite, although it started to vocalise and show straining behaviour when passing urine. Urinalysis at this stage revealed a pH of 7.5, small numbers of leukocytes and numerous erythrocytes in each urine sample.
The animal became depressed and showed a reduced appetite during the third day post-operatively. The indwelling urinary catheter was removed and the steenbok continued to pass small amounts of urine. Urinalysis revealed a pH of 6.4 and no crystals to be present.
The steenbok died at the beginning of the fourth post-operative day.
At necropsy, the carcass was anaemic, showed serous atrophy of cardiac coronary and bone marrow fat and multi-organ atrophy, all signs of cachexia. Dissection of the urogenital tract revealed severe post-surgical peri-urethral haematoma formation in the region of the urethrostomy site and a 7 mm unsutured linear incision in the ventral urethra, 1 cm distal to the ischiadic arch. Complete urethral obstruction with cream-white, sandy granules ranging between 0.5 mm and 1 mm in size, 50 mm proximal to the glans penis, was present. The urinary bladder was significantly distended but not ruptured and no macroscopic or microscopic ureteral and renal complications were seen. The liver showed mild periacinar hepatosis, which was microscopically characterised by moderate widespread periacinar hepatocellular necrosis. Other significant microscopic changes included localised chronic-active pyogranulomatous urethritis at the urethrostomy site and mild focal fibrosing cystitis. Significant enlargement of both adrenal glands was evident. Death was attributed to systemic hypoxaemia following significant post-surgical blood loss whilst suffering from anaemia and energy depletion because of stress and cachexia. No pathological evidence for uraemia was found.
Quantitative analysis of the uroliths was performed by the Minnesota Urolith Centre, USA. On physical appearance, the uroliths were 1.0 mm – 2.5 mm in diameter, had a rough surface and were white in colour ().
The uroliths were classified as magnesium calcium phosphate carbonate uroliths. |
pmc-6138238-1 | A 32 year-old woman with a history of hypothyroidism and pre-eclampsia initially presented to an outside hospital with acute onset dense left hemiplegia, right gaze preference, and left-sided neglect. Her initial National Institute of Health Stroke Scale (NIHSS) was 14 and she had an admission Glasgow Coma Scale (GCS) of 10. A computed tomography (CT) angiogram of her neck revealed complete occlusion of the right cervical internal carotid artery (ICA). She was outside the time window for intravenous thrombolysis; however, she underwent mechanical thrombectomy using a stent retreiver device and aspiration (Penumbra System®, Alameda, CA). Immediately after the procedure, there was a successful restoration of the blood flow to the distal ICA, proximal middle cerebral artery (MCA), and to the anterior cerebral artery (ACA), with residual distal M2 occlusion. She was intubated for the procedure and was extubated in the following days. Her left-sided weakness persisted and a repeat CTA showed re-occlusion of the right cervical ICA. No further intervention was done and she was treated with aspirin and statin for secondary stroke prophylaxis. The stroke was deemed cryptogenic after work-up for a potential source was negative including an echocardiogram which demonstrated a normal ejection fraction, normal left atrial size, and negative bubble study. A workup for prothrombotic and hypercoagulable states were negative as well. Magnetic resonance imaging (MRI) of the brain was done which showed a large area of diffusion restriction with corresponding decreased apparent diffusion coefficient (ADC) and T2 hyperintensity in the right frontal, parietal, temporal lobes and in the basal ganglia with areas of hypointensities on gradient echo sequencing, which suggested infarction in these areas with some areas of hemorrhagic conversion (Figure ).
Subsequently, she was discharged to an inpatient rehabilitation center. While at the rehabilitation center, about four weeks after her stroke, she developed moderate to severe insidious onset headache. A repeat MRI, done four days after the onset of headache, showed diffusion restriction (with corresponding decreased ADC) and a ring-enhancing lesion in the right basal ganglia which involved part of the previous ischemic stroke. An extensive area of T2 hyperintensity was seen around this lesion consistent with vasogenic edema (Figure ).
With a recent invasive procedure along with the MRI findings, the possibility of an abscess was entertained, even though she did not have systemic signs of an infection (afebrile, WBC count 7800/mm3, negative blood cultures). She was empirically started on broad-spectrum antibiotics (vancomycin, cefepime, and metronidazole) and admitted to our institute for further management. On day three of admission to our hospital, she developed a high-grade fever and had an acute deterioration in her mentation that progressed to coma. An MRI was repeated to evaluate for any progression of the disease and to obtain stereotactic images for drainage. In addition to the previously mentioned ring-enhancing lesion, the post-contrast sequences now demonstrated enhancement of the right lateral ventricular wall which was suggestive of ventriculitis (Figure ).
She underwent a stereotactic drainage of the lesion, which aspirated purulent material. The patient was continued on broad-spectrum antibiotics. Vancomycin was discontinued after 10 days. Cefepime was switched to ceftriaxone, which along with metronidazole, was continued for a total of six weeks. An extensive laboratory workup was done which did not reveal a potential source of infection or immunocompromised state. Due to the high suspicion for an abscess and the purulent aspirate, a bacterial DNA probe was carried out on the aspirate, which revealed the presence of Fusobacterium necrophorum. Since Fusobacterium necrophorum is the implicated organism in Lemierre's syndrome, a surveillance of signs were carried out on the patient but failed to reveal neck pain or thrombosis of the internal jugular vein (imaged with an ultrasound of the neck). On post-drainage day one, her mental status improved and she progressed to her baseline prior to her discharge from the hospital. |
pmc-6138458-1 | A 39-year-old Caucasian male presented for a dermatological evaluation. His exam demonstrated an 8-millimeter flat, brown papule within a large tattoo covering most of the upper back (Figure ). The patient was uncertain regarding the lesion’s initial presentation, the pattern of its growth and appearance, how long the lesion has been present, and whether the lesion was present at the time of tattooing. A shave removal of the lesion was performed.
The original excision showed an atypical intraepidermal melanocytic proliferation (Figures -). The dermis contained scattered foci of tattoo pigment and fibrosis (Figures -). An early evolving melanoma in situ could not be excluded. The lesion was re-excised with a 5-millimeter margin. No residual melanocytic lesion was detected on examination; only scar tissue was present. The patient has healed well since then. He continues to have his skin monitored. |
pmc-6138459-1 | A 62-year-old male with a history of gastroesophageal reflux and deep vein thrombosis/pulmonary embolism, developed sudden onset headache prior to his scheduled Nissen fundoplication. The patient presented to an outside hospital neurologically intact, but due to intractable symptoms, a non-contrasted head computed tomography (CT) was ordered which was significant for a right-sided caudate ICH with ventricular extension but without hydrocephalus (Figure ) (ICH score 1). Of note, the patient’s coagulation labs were within normal range.
En route to our hospital, the patient declined dramatically requiring intubation upon arrival. Repeat imaging was significant for expansion of the ICH with worsening of the IVH and associated hydrocephalus (Figure ). The patient was localizing on the right upper extremity and withdrawing in the left upper extremity and bilateral lower extremities to noxious stimuli (GCS 7t, ICH score 2). An external ventricular drain (EVD) was placed and the patient was admitted to the intensive care unit (ICU). Vascular imaging was negative for underlying malformations. A repeat CT head six hours post EVD placement demonstrated a collapsed ventricle secondary to cerebrospinal fluid (CSF) drainage, but the progression of perihematoma edema and midline shift (Figure ). With increasing mass effect and failure of neurological improvement with CSF drainage, it was decided to take the patient to the operating room for ICH evacuation.
Following anesthetization, a 5 cm curvilinear right frontal incision was made behind the hairline. A 4 cm craniotomy was performed followed by identification of the posterior aspect of the right frontal superior sulcus, and then stereotactic trans-sulcal introduction of a 75 mm sheath and obturator (BrainPath, NICO Corp, Indianapolis, Indiana). Under exoscope magnification, the inferior depth of the hematoma was evacuated with gentle irrigation and suction. A small opening into the right lateral ventricle was identified, and a straight rigid endoscope was used to atraumatically enter the ventricle for further ventricular clot evacuation and irrigation. The endoscope was removed and the trans-sulcal port was slightly retracted in successive fashion to deliver more of the frontal ICH into view. With the use of suction, irrigation, and a side cutting resection device (Myriad, NICO Corp, Indianapolis, Indiana), the remainder of parenchymal hematoma was extracted. A post-operative head CT showed near complete removal of the ICH and IVH from the right lateral ventricle but with residual hematoma predominantly within the left lateral and third ventricles (Figure ).
Due to the persistence of third ventricle IVH, the patient received intrathecal tPA post-operative day two (two doses, 1 mg each, nine hours apart) followed by successful weaning and removal of the ventricular drain. After three days, the patient was discharged to a long-term acute care hospital. At the three-month follow-up visit, the patient had transitioned to a skilled nursing facility. At the five-month follow-up visit, the patient was living at home, neurologically intact except for a slight facial droop and mild gait imbalance with a goal to return to work in the coming month. At each follow-up, head CT at each outpatient visit was negative for hydrocephalus. |
pmc-6138538-1 | A 28-year-old previously healthy woman, at 39 weeks and one day of gestation, was admitted to our hospital and underwent an emergency caesarean section because of premature rupture of membranes. On postoperative day (POD) 2, she developed a fever with right back pain. On physical examination, decreased breath sounds on the right were noted; however, abdominal tenderness or signs of infection were not observed at the surgical site. A blood examination revealed a white blood cell (WBC) of 13,890 cells/μL and a C-reactive protein (CRP) level of 13.87 mg/dL. Flomoxef was administered intravenously, but the patient’s fever persisted. On POD 7, chest computed tomography (CT) revealed a right-sided pleural effusion without loculations (Fig. A). Abdominal CT did not reveal an abscess. Pleural fluid analysis on POD 8 revealed a cloudy yellow effusion that was not malodorous and WBC of 83,080 cells/μL with 70% neutrophils, glucose of 59 mg/dL, lactate dehydrogenase of 796 U/L, and total protein of 4.77 mg/dL, although pH was not evaluated. The patient was subsequently diagnosed with empyema. A tube was inserted into the patient’s chest on the right side, and combined sulbactam/ampicillin was administered intravenously. In spite of these treatments, the patient’s clinical condition did not improve. On POD 13, small pinpoint colonies, which did not yield visible bacteria in a Gram stain, were observed on a plate of cultured pleural fluid on POD 8. Based on this result, M. hominis empyema was suspected, and clindamycin (CLDM) was administered intravenously (600 mg every 0800 h). M. hominis was detected in the pleural fluid by PCR assay. It was also detected by PCR assay in the patient’s vaginal secretions obtained on POD 7. Moreover, small pinpoint colonies, which were similar to those of the pleural fluid, were observed on the plate of a blood culture obtained on POD 3. These were regarded as M. hominis, although they were not analysed by PCR assay (Fig. ). After the start of CLDM treatment, the patient recovered rapidly, and the chest tube was removed on POD 20. On POD 21, her fever resolved. On POD 29, the patient was discharged home with continued CLDM treatment (450 mg orally every 0600 h). On POD 50, a chest radiograph showed only a linear atelectasis in the right lower lung field (Fig. B), a blood examination showed improvement in the WBC (7150 cells/μL) and CRP level (0.17 mg/dL), and the oral administration of CLDM was terminated. |
pmc-6138539-1 | A 64-year-old man presented with a fever and was diagnosed with pneumonia. He had a history of recurrent pneumonia. Chest computed tomography (CT) showed numerous cysts in the right lower lobe in addition to infiltrative shadows. Mycobacterium abscessus was identified in the sputum. Chest X-ray images showed infiltrative shadows in the left upper and right lower lung fields (Fig. A). Chest CT showed multilocular cystic shadows (Fig. B). After treating the pneumonia, an open right lower lobectomy was performed. Histopathological evaluation of the surgical specimen indicated polycystic lesions in the lower lobe of the right lung. There was a dark brown pus-like liquid in the lumen, but bacterial culture was negative. The large cystic lesions had smaller cysts scattered around them. The inner surface of the cysts was lined with ciliated bronchial epithelium that was not atypical, and there were aggregates of small lymphocytes in the surrounding stroma. The cyst wall was covered with ciliated columnar epithelium. |
pmc-6138539-2 | A 41-year-old man was diagnosed with pneumonia. His past medical history included recurrent pneumonia. Chest X-ray showed infiltrative shadows in the right lower lung field (Fig. A). Chest CT showed numerous cystic lesions and infiltrative shadows in the right lower lobe (Fig. B). An open right lower lobectomy was performed three months after treating the pneumonia. Histopathological evaluation of the surgical specimen revealed numerous cysts of up to 4 cm in diameter in the lungs.
In both cases, histological findings of the resected specimen showed multiple cysts that were composed of fibrous walls lined by ciliated columnar cells, with no bronchial cartilage (Fig. A and B). Therefore, the pathologies were diagnosed as CCAM type 1. Atypical cells were not identified. |
pmc-6138540-1 | A 76-year-old man, former smoker (80 pack-years), with hypertension and hyperlipidaemia was referred to our hospital with a diagnosis of AE with IPF in 2013. After admission to our hospital, he was treated with steroid pulse therapy followed by systemic corticosteroid and cyclosporine therapy. His respiratory condition gradually improved, and corticosteroid dose was tapered. However, he needed 2 L/min of oxygen via a nasal cannula at the time of discharge. Corticosteroid dose was tapered gradually in the outpatient clinic. His forced vital capacity (FVC) declined by 8% in approximately 30 months after remission of AE. Nintedanib (300 mg/day) was administered in December 2015 because of the decline in FVC and a history of AE with IPF. A new small nodular lesion, measuring 13.5 mm × 11.7 mm (Fig. A), appeared adjacent to the honeycomb lung of the right lower lung lobe on a chest computed tomography (CT) scan before the initiation of nintedanib. Because of moderate deterioration of liver function after five months of nintedanib therapy, nintedanib was discontinued for two weeks and resumed after normalization of liver function at 200 mg/day.
The patient complained of right lower abdominal pain in September 2016. Acute gangrenous appendicitis was suspected on an abdominal CT scan. We observed neither deterioration of pulmonary function nor enlargement of the nodule (10.7 mm × 12.5 mm (Fig. B)) in the right lower lung lobe during nintedanib use. Nintedanib was discontinued, and his appendicitis improved with antibiotics.
In January 2017, four months after the discontinuation of nintedanib, the nodule in the right lower lobe increased in size from 10.7 mm × 12.5 mm to 20.8 mm × 22.0 mm (Fig. C). The patient underwent a resection of the nodule, which was diagnosed as squamous cell carcinoma (Fig. ). |
pmc-6138541-1 | A 62-year old man with rheumatoid arthritis treated with tofacitinib and severe chronic obstructive pulmonary disease was admitted after developing an iatrogenic pneumothorax from a Computed Tomography-guided core biopsy of a left upper lobe lung nodule. He remained hemodynamically stable but had dyspnoea, oxygen desaturation, and chest pain. His symptoms improved after insertion of an 8.5F intercostal catheter that was attached to an underwater seal drain (UWSD), but over the following two days, a large air leak persisted, and a chest radiograph showed a persistent small left apical pneumothorax. Histology of the nodule demonstrated necrotizing granulomas and no evidence of malignancy.
On day three of admission, the patient developed progressively worsening subcutaneous emphysema. Chest radiograph showed minor retraction of the intercostal catheter, and a sideport was thought to be located in the subcutaneous tissue. The catheter was removed, and the patient rapidly became hemodynamically unstable, with diminished left-sided breath sounds and type 2 respiratory failure. Tension pneumothorax was diagnosed, and a 28F thoracostomy tube was inserted, attached to a UWSD (Fig. ).
From days three to 23, the patient’s clinical state improved, but there was no reduction in air leak.
On day 23 of admission, EBV insertion was performed. Immediately prior to the procedure, the UWSD was switched to a DDS (Rocket® Portable Suction Unit (PSU), Rocket Medical, England) to provide objective flow data during bronchoscopic balloon occlusion of the left upper lobe airways. There was no reduction in flow on the PSU digital display when individual left upper lobe segmental airways were occluded with a Fogarty catheter, but there was marked reduction in flow with balloon occlusion of the entire left upper lobe bronchus. Use of the Chartis® System (Pulmonx, Switzerland) showed no evidence of left-sided lobar collateral ventilation. Given the patient’s severe chronic obstructive pulmonary disease and diminished respiratory reserve, the decision to induce total lobar collapse with EBVs was decided against, but based on the anatomical position of the air leak caused by the CT-guided biopsy, one Pulmonx Zephyr® 5.5 mm EBV was deployed into LB3 and another into the lingula bronchus (Fig. ). He returned to the ward with the PSU set at −20 cmH2O.
On days 23–29, the flow readings showed ongoing, but steadily diminishing, air leak. The patient expressed a wish to return home, so he was discharged with the thoracostomy tube attached to a Pneumostat® Chest Drain Valve (Maquet, Germany) and a plan for elective readmission 2 weeks later (day 43) to reattach the PSU and measure the degree of leak.
On day 41, the patient represented with a febrile illness and mild pain and erythema at the thoracostomy tube site. A superficial, localized wound infection was diagnosed, and he was commenced on intravenous antibiotics. Occasional, but reduced, bubbling was noted in the Pneumostat® device. Chest radiograph showed no discernible pneumothorax. The Rocket® PSU was reattached on constant suction (−20 cmH2O). By day 43, air leak flow readings had reduced to zero, and bubbling ceased (Fig. ). The thoracostomy tube was safely removed, with repeat imaging showing no pneumothorax. The wound infection resolved with antibiotics, and on day 46, he was discharged home. |
pmc-6138542-1 | A 78-year-old male with a history of early gastric cancer and meningioma of the brain underwent right middle lobectomy and lymphadenectomy for squamous cell lung carcinoma two years and four months ago. After the surgery, he received adjuvant chemotherapy with tegafur-uracil fortwo2 years. He underwent regular check-ups, including computed tomography and SCCA. He was doing well without recurrence of cancer. His SCCA levels ranged from 0.8 ng/mL to 1.9 ng/mL.
He underwent blood testing including SCCA as part of a regular check-up six days after getting a fever. He was diagnosed with influenza B infection three days before the blood test. He did not take any anti-influenza drugs. His fever resolved by day 5. His SCCA level was 17.1 ng/mL. Computed tomography of the chest and abdomen revealed neither recurrence of cancer nor new lesions. We suspected that the SCCA level became elevated due to the influenza infection. One month later, his SCCA level decreased to 1.6 ng/mL (Fig. ). Levels of cytokeratin 19 fragments remained low throughout this period. |
pmc-6138913-1 | A 63-year-old white man with no significant comorbidities was diagnosed as having mRCC affecting his right kidney with metastatic spread in the Th11 vertebra and multiple pulmonary sites (Figs. –, ). He underwent a cytoreductive nephrectomy in December 2015. A histological examination was consistent with clear cell carcinoma, predominantly grade 2–3 (focally grade 4) with small areas of sarcomatoid differentiation and necrosis. The tumor stage was assessed as pT1b pN1 cM1. He was sent to the Comprehensive Cancer Center of the University Hospital in Hradec Králové, where he started therapy with sunitinib (50 mg daily, 4 weeks on/2 weeks off schedule) in December 2015. Considering the bone metastases, treatment with denosumab was started simultaneously. Owing to poor tolerability (nausea, fatigue, and anorexia) of the treatment, the schedule was changed to 2 weeks on/1 week off. Due to progressive back pain, combined analgesic therapy with opiates was required (oxycodone, transdermal fentanyl patches). Disease progression was documented in his lungs and spine after 4 months on sunitinib in April 2016. His progressive back pain resulted in hospital admission to perform analgesic radiotherapy to the Th 9–12 area with a dose of 20 Gy in five fractions on 5 consecutive days. He developed diarrhea during the hospitalization. A possible infectious etiology was ruled out with microbiological stool examination, as well as examination for Clostridium difficile and its toxin, and he was started on symptomatic therapy with an antidiarrheal treatment (diphenoxylate hydrochloride 2.5 mg three times a day) and probiotics.
After finishing radiotherapy, nivolumab therapy was started in May 2016 within an expanded access program at an absolute dose of 300 mg every 14 days. Both diarrhea and back pain were gradually resolving during treatment, enabling dose reduction of the opiates. Our patient completed a total of six doses of nivolumab with no laboratory or clinical signs of adverse effects.
However, 14 days following the last dose of nivolumab, he reported a change in behavior and a history of uncontrollable movements. His family started to say that he was strange and restless. He personally felt very well when taking nivolumab and the pain was even improving. He was fully aware of the uncontrollable movements, and although he could think rationally, he was not able to influence or stop them.
There was no family history of neurological or mental illness, and he denied any head trauma or neurological disorders in the past. A physical neurological examination revealed no significant findings in his head and peripheral nerves, but there were mild generalized choreatic movements of his upper extremities and head. A psychiatrist described our patient as cooperative, with pronounced choreatic movements of the entire body. His behavior was described as social, without signs of hostility or aggression, and at a reasonable psychomotor tempo. His mood was described as mildly dysphoric in response to the current situation of somatic manifestations. Laboratory tests showed no marked abnormalities. The only medication he was on at that time was a transdermal fentanyl patch (100 mcg/hour changed every 3 days), and he intermittently used antidiarrheal medications (diphenoxylate hydrochloride 2.5 mg or probiotics based on Lactobacillus acidophilus metabolites); during the sunitinib treatment, he irregularly used metoclopramide 10 mg, but he denied any history of neuroleptic use. Because of a serious suspicion of a possible side effect associated with immunotherapy, he was admitted to our hospital on 11 August 2016. A general overview of the timeline of the case report is shown in an additional file (see Additional file ).
CT (computed tomography) of his chest, abdomen, and pelvis showed signs of tumor regression in his lungs and bones (Figs. –, ). CT of his brain ruled out brain lesions or infiltrative brain damage. Because of the deterioration of choreatic movements, a magnetic resonance imaging (MRI) of his brain was performed. There were no signs of any tumor lesion. However, the MRI revealed a symmetrical, pathologically increased signal within the basal ganglia consistent with possible inflammatory involvement of these structures (Fig. ).
Serum laboratory tests for infection and autoimmune diseases were negative. A cerebrospinal fluid (CSF) examination yielded negative results for bacterial and viral involvement and for the presence of malignant cells. Specific neuroimmunological examination of the CSF showed only mild inflammatory changes without any evidence of tissue destruction and no signs of primary infectious etiology. Anti-paraneoplastic antigen Ma2 (anti-PNMA2) IgG class autoantibodies were the only positive findings. Flow cytometry of CSF demonstrated a majority of lymphocytes (approximately 61%); most of the lymphocyte population was represented by T cells (approximately 95%), with the dominant proportion being CD4+ helper T cells (Fig. ).
According to the recommendations for the management of irAE, high-dose intravenously administered corticosteroid therapy was started: Solu-Medrol (methylprednisolone) 2 mg/kg per day. Trimethoprim/sulfamethoxazole was administered simultaneously to prevent possible infectious complications: 960 mg twice a day (BID) twice a week. Despite the high dose of intravenously administered corticosteroid therapy, there was further deterioration of choreiform movements. The choreiform, athetoid, and ballistic movements spread to his lower limbs and trunk. The choreiform movements were so intense that our patient was unable to rest or lie on a bed. Furthermore, he developed a paranoid hallucinatory syndrome with suicidal thoughts. He was started on antipsychotic therapy (clonazepam 2 mg per day, haloperidol 15 mg per day, olanzapine 20 mg per day) after consultation with a psychiatrist and a neurologist and he experienced partial improvement. Considering the lack of a significant effect of corticosteroid therapy, the administration of infliximab at a dose of 5 mg/kg was started. However, infliximab did not achieve any clinical effect.
Our patient and his family insisted on discharge from our hospital. According to the conclusion of a psychiatric examination, he was pronounced capable of signing an against-medical-advice discharge form and was discharged on 23 August 2016. An early out-patient visit to administer a further dose of infliximab was scheduled, and he was duly informed about the importance of doing so. However, he did not come to visit and refused any further treatment despite the provided information about possible adverse consequences.
He was eventually admitted to the standard ward on 13 September 2016, presenting with a fever and soporific state (Glasgow Coma Scale 5) on admission. Because of urinary retention (initially 1000 ml) and elevated levels of C-reactive protein, we suspected urinary infection, and he was started on intravenously administered amoxicillin/clavulanic acid 3.6 g/day and intravenously administered hydration. No other laboratory abnormalities were found. He partially regained consciousness after 2 days of treatment, with clinical manifestations of aggression and choreiform movement as described above. Therefore, therapy with antipsychotics and corticosteroids was reintroduced. However, his condition started to deteriorate again, and he developed bronchopneumonia. His level of consciousness started to deteriorate again, and he died 4 days following admission.
An autopsy confirmed the histology of clear cell renal cancer with metastatic para-aortic lymph nodes and necrotic Th11 vertebra, probably due to necrotic metastasis rather than radiotherapy-induced focal necrosis. Considering the clinical suspicion of aseptic meningitis, his brain was extensively examined. Its weight was 1480 g, and there were no macroscopically notable findings. A histological examination revealed inconclusive areas, suggesting focal lymphocytic meningitis of the entire brain—the cerebrum, brainstem, and cervical spinal cord (Fig. )—and multiple perivascular lymphocytic infiltrates, which were most prominent in the basal ganglia on both sides; these findings were consistent with the MRI examination (Fig. ). The perivascular infiltrates localized in the frontal lobe and basal ganglia were immunohistochemically analyzed for surface markers of CD4 and CD8 T cells (Figs. , and , ). The ratio of CD4+/CD8+, which is typically 3:1 in aseptic meningitis, was unusually low (approximately 1:1) in both sections. |
pmc-6139003-1 | In 2010 a 75 year-old female patient presented at our clinic with a 2-year history of pain and recent emergence of a discharging sinus at her left upper leg. She had a history of bilateral gonarthrosis and underwent elective right and left knee total arthroplasty 5 years before. The procedures and the post-operative follow-up were uneventful. Her physical examination revealed slight swelling and tenderness with a mild seropurulent discharge on the antero-lateral aspect on her proximal left leg. There was no other systemic complaint. Her personal and family histories were unrevealing. There was no history of fever, trauma, previous tuberculosis or bone tumors. Lower limb x-rays were performed and the radiographic examination revealed a well demarcated cystic structure in her left tibia, 4 cm below the distal tibial component of the knee arthroplasty (). A purulent sample was collected and sent for microbiological study, after which, to better investigate the nature of the cyst, an incisional biopsy of the lesion was performed, and the sample subjected to histopathologic examination. The laboratory study isolated Pseudomonas aeruginosa, and appropriate antibiotics where then administered according to the susceptibility test carried out. Pathology results revealed hydatid cyst of the tibia. Segmental resection was planned, and the surgical approach revealed a diaphyseal cyst adherent to the surrounding tissues, which were markedly oedematous, with multiple membranous whitish tissues in aggregation. Fluid was aspirated from the cyst, and the sample was sent for microbiology and serology tests. After curettage of the lesion and power-pulse lavage, povidone-iodine-alcohol solution was injected. Due to the fragility of the remaining tibial diaphysis, an external fixator was applied. Microscopy confirmed the diagnosis and revealed osseous tissue with hyaline and germinative membranes, lymphocytes, and monocytes.
Albendazole and praziquantel, antihelminthic drugs, at doses of 10 and 25 mg/kg, respectively, were started. The patient recovered uneventfully and was discharged shortly after the procedure. She was clinically and radiologically evaluated in the following months, revealing progressive bone growth, remodeling and consolidation, having the external fixator extracted 6 months after the initial procedure.
The patient then remained exempt of pain, swelling or other complications, until May 2014, when suddenly she comes to our clinic, complaining of pain and unable to bear weight on her left knee.
X-ray studies revealed a pathologic periprosthetic fracture, below the tibial component, resulting from an extension of the previously treated hydatic cyst (). A treatment plan was performed, and our patient underwent surgical intervention. Both of the total knee arthoplasty components exhibited signs of loosening (), and after extraction of them, a total revision knee arthroplasty was performed (). The cancellous bone loss in the tibial component was considerable, and this defect was addressed by autologous bone graft implemention around the tibial stem and plateau. The patient functional outcome was excellent. She recovered motility of her left knee, and now more than 24 months has passed and she is fully weight bearing with no pain, knee instability or discomfort. |
pmc-6139107-1 | A 19-year-old male was referred to our hospital by a primary care physician for a history of intermittent cramping pain in the right flank persisting for several days. His abdomen was flat and soft; however, he complained of abdominal pain upon pressure in the right lower quadrant. Most laboratory test results revealed normal limits except for elevated white blood count (11,170/μL) and serum C-reactive protein level (1.6 mg/dL). Contrast-enhanced computed tomography (Fig. ) revealed intussusception at the ileocecal region, which appeared as a “target” sign with a tumorous oval mass of 56 × 41 mm as a leading point of intussusception. An urgent operation was performed because of the risk of colonic ischemia due to intussusception. At laparotomy, the bowels had already spontaneously reduced, and a mass was palpable in the ileocecal region. We performed an ileocecal resection, aiming to avoid the potential of relapse of intussusception due to the residual mass. The postoperative course was uneventful and the patient was discharged on day 16 postoperatively. The resected specimen (Fig. ) comprised an oval cystic lesion of 45 × 35 × 22 mm that protruded into the enteric lumen at the ileocecal valve. The cyst was filled with brown-colored stiff material and did not communicate with the original enteric lumen upon macroscopy. Histological analysis (Fig. ) revealed that the inner surface of the cyst was completely lined with colonic mucosa and was situated within the intestinal wall of the ileocecal valve. The original muscle layer of the intestine was separated into two layers at the cyst portion and was shared with the muscle layer of the cyst. Thus, we concluded that the cyst was a type of intestinal duplication. Although histological analysis could not identify any opening in the cyst wall, a discontinuity of the muscle layer was observed at the top of the cyst near the transitional point of ileocecal mucosa and the mucosa lined through the hole formed by the lack of muscle layer (Fig. ).
Intestinal duplication was first described by Fitz in 1884 []; in 1937, Ladd provided a detailed description of the clinical and pathological aspects of duplication of the alimentary tract as a congenital malformation []. He defined the three characteristic features of duplication: (1) well-formed smooth muscle layers, (2) an epithelial lining comprising some portion of the alimentary tract, and (3) contiguity with a portion of the alimentary tract. Furthermore, the duplication lesion shares a portion of its wall with that of the adjacent alimentary tract, usually sharing a common blood supply []. Duplication of the alimentary tract has been divided into the tubular (14%) and cystic (86%) types. The tubular type often has one or more direct communications with the adjacent bowel, whereas the cystic type usually does not communicate with the lumen of the adjacent bowel and contains a sticky mucoid fluid that is either chocolate or cafe au lait colored or almost colorless [, , ]. Lately, some communicating duplication cysts have been reported in adults [, , , ].
In 2016, Kyo et al. reported a similar cystic lesion filled with stool in an adult colon; however, that cyst was clearly communicating with the original bowel through a tubular twig []. They suggested that the cystic feature of duplication was a result of the accumulation of stool in the tubular duplication over the years. In the present case, the duplication cyst was not communicating with the enteric lumen. The cyst content was oval, with a consistency similar to that of stool, and was brown, suggesting that the presence of the stercobilin, which is a metabolic byproduct of bile produced via reduction of bilirubin by bacterial flora in the intestine, is responsible for the brown color of human fecal matter []. These findings indicate that the cyst communicated with the alimentary tract before being closed via an unknown mechanism. Our histological study revealed a focal discontinuity of the muscle layer in the cystic wall and a lining of mucosa through a defect in the muscle. Because these features of mucosa, also known as mucosal bridges, were sometimes seen after healing of an ulcer [, ] and because there was evidence of previous communication with the original bowel, our histological findings indicated a vestige of the opening site of cystic duplication. Similar to the case reported by Tamvakopoulos et al. [], it is likely that our case had a directly communicated hole between the cyst and bowel lumen. The hole closed during the healing process, resulting in a discontinuity in the muscular layer and the formation of a mucosal bridge after the stool poured into the cyst through an orifice and subsequently triggered intussusception in adulthood. In adults, intussusception is considered a rare condition and is observed in less than 5% of all cases []. More than 80% of these cases are caused by organic lesions, such as inflammatory bowel disease, postoperative adhesions, and benign and malignant tumors. Additionally, malignancy accounts for a maximum of 30% and 66% of intussusception cases occurring in the small and large bowel, respectively []. The combination of both intussusception and duplication is rare, especially in adults [, , , , ]. These cases have mostly non-specific clinical profile and are difficult to diagnose preoperatively. Because of the large proportion of organic lesions and the significant risk of malignancy, surgical intervention is often required in adult intussusceptions []. Regarding the surgical procedure, the possibility of concomitant malignancy should be considered carefully in any case, although prompt intervention is frequently required depending on the clinical symptoms. We decided to perform an emergency surgery considering the possibility of the relapse of intussusception due to mass and the bowel ischemia, which may have led to bowel perforation and peritonitis. Only a few cases have reported on malignant tumors derived from bowel duplication cysts [–]; moreover, cases in young adults are extremely rare []. The patient’s age and radiological examination findings were not indicative of coexisting malignancy. On conducting laparotomy, regional lymphadenopathy in the mesenterium, adhesion to the peritoneum, or peritoneal seeding was not observed, and ileocecal resection was performed. The patient’s clinical course was uneventful; therefore, the patient was discharged and has been free from abdominal symptoms for more than 5 years since surgery. |
pmc-6139108-1 | A 59-year-old Japanese man was referred to hospital with right upper quadrant pain. He underwent laparoscopic cholecystectomy on the diagnosis of cholelithiasis. However, because intraoperative pathological diagnosis revealed GBC, we performed an extended cholecystectomy that included resections of the gallbladder bed and extrahepatic bile duct, and D2 lymphadenectomy, with choledochojejunostomy reconstruction. The pathological diagnosis was well-differentiated adenocarcinoma of the gallbladder, T2 N0 M0, stage II (Union for International Cancer Control, 7th edition) (Fig. ).
The patient’s clinical course and associated tumor makers are illustrated in Fig. . He was treated with adjuvant gemcitabine (GEM). GEM (1600 mg/body) was administered weekly, three times every 4 weeks. Three months after surgery, abnormal 18F-fluorodeoxyglucose (FDG) uptake was detected in segment 5 (S5) of the patient’s liver (Fig. ), which suggested metastatic recurrence. We commenced adoptive immunotherapies with cytokine-activated killer (CAK) cell infusions at our clinic, combined with chemotherapy. After a year of adjuvant chemotherapy and immunotherapy, the S5 lesion had disappeared on FDG-PET.
CAK cells consist of activated T cells that express high levels of the activating receptor, natural-killer group 2, member D (NKG2D), and activated natural killer (NK) cells (Fig. ). The procedure for CAK cell generation has been described previously [, ]. Briefly, peripheral blood mononuclear cells (PBMCs) were collected with a blood cell separator (Haemonetics CCS, Haemonetics Corporation, Braintree, MA, USA) and cryopreserved until use. PBMCs were stimulated with both human recombinant interleukin (IL)-2 (rIL-2, 200 U/ml; Primmune Inc. Kobe, Japan) and 5 μg/ml antibody to CD3 (MACS GMP CD3 pure; Miltenyi Biotec Inc. Auburn, CA, USA). After 7 days in culture, PBMCs were transferred to a culture bag system (KBM550, Kohjin Bio, Osaka, Japan) and expanded for 7 days to obtain sufficient numbers of CAK cells.
At 4 years and 6 months post-surgery, contrast-enhanced magnetic resonance imaging (MRI) showed low-signal lesions in S7 and S8 in the hepatobiliary phase. 18F-fluorodeoxyglucose positron emission tomography (FDG-PET) revealed abnormal FDG uptake in the same lesions detected by MRI (Fig. ), which suggested metastatic recurrence. Therefore, GEM and cisplatin (CDDP) were administered as second-line chemotherapy. GEM (1600 mg/body) and CDDP (40 mg/body) were administered intravenously on days 1 and 8, followed by a week rest period. The patient had a stable disease response to chemotherapy and immunotherapy for 9 months (as defined by the Response Evaluation Criteria in Solid Tumors). However, because the lesions increased in size again, we performed open microwave coagulo-necrotic therapy (MCN) for the S7 and S8 lesions. No peritoneal dissemination or liver metastasis was detected during this procedure.
Three years after the initial MCN, a solitary liver metastasis was detected at the S4 liver surface by contrast-enhanced MRI (Fig. ), for which MCN was conducted again in consideration of the solitary lesion being in the liver surface. During this procedure, peritoneal seeding was found and intraoperatively diagnosed as adenocarcinoma, indicating peritoneal GBC dissemination. Histopathological examination of the disseminated nodule specimens showed many infiltrating mononuclear CD3+ cells around the tumor cells (Fig. ). A month after the second MCN, the patient’s carcinoembryonic antigen (CEA) level had increased to 24.8 ng/ml, although imaging showed no recurrence. Therefore, GEM and tegafur-gimeracil-oteracil potassium (TS-1) were administered as third-line chemotherapy. GEM (1600 mg/body) was administered intravenously on day 1, and TS-1 (120 mg/day) was administered orally for 2 weeks, followed by a week rest period. After nine cycles of GEM and TS-1, the CEA had decreased to a normal level.
For second-line adoptive immunotherapy, we used adoptive infusions of tumor-associated antigen-pulsed dendritic cell-activated killer (DAK) cell immunotherapy. Because immunohistochemistry showed MUC-1 positive cells in the disseminated tumors (Fig. ), we chose long MUC-1 peptides for the tumor-associated antigens. For the DAK cell culture, we prepared immature dendritic cells from plastic-adherent PBMCs, using recombinant human granulocyte/monocyte colony-stimulating factor (GM-CSF; 100 ng/ml; Primmune Inc.) and recombinant human IL-4 (500 U/ml; Primmune Inc.) for 7 days. MUC-1 long peptides (Miltenyi Biotec, Bergisch Gladbach, Germany) were added to immature dendritic cells at a final concentration of 50 nmol/ml, then incubated for 12 h following by addition of human recombinant tumor necrosis factor-α (TNF-α, 500 U/ml; Primmune Inc.) and interferon-α (IFN-α; 500 U/ml; MSD Inc. Tokyo, Japan). Autologous lymphocytes were then added to the dendritic cells at a ratio of 20:1 (lymphocytes:dendritic cells) and cultured for 7 days. The cells were then activated and expanded with IL-2 and antibody to CD3 for 14 days, as with the CAK cell culture.
Over the past 9 years, we have performed adoptive cell therapy procedures 59 times, including 38 CAK cell infusions and 21 MUC-1-pulsed DAK cell infusions, at 1–3-month intervals, along with chemotherapy. All the cultures we used were inspected for contamination with endotoxin, β-glucan, and peptide-glycan using a Toxinometer ET-6000 (Wako Pure Chemical Industries, Ltd., Osaka Japan), according to Food and Drug Administration guidelines. Mycoplasma contamination was checked using a Mycoalert kit (Lonza Rockland Inc., ME, USA).
The cell processing and adoptive immunotherapy procedures were approved by the ethics committee of our institution with the patient’s written informed consent for the procedure, based on the Act on Securement of Safety of Regenerative Medicine in Japan.
At the time of reporting, 9 years and 6 months have passed since the initial cholecystectomy, and 18 months have passed since the peritoneal metastasis was detected. At this time, the patient is receiving GEM and CDDP as fourth-line chemotherapy because of increased CEA levels. Although an undeniable metastasis was found in his para-aortic lymph node (Fig. ), the patient visits our clinic regularly for an immunotherapy. His only immunotherapy-related adverse event was a low-grade fever that did not noticeably lower his quality of life.
The reported 5-year survival rates of patients with GBC are stage 0, 80%; stage I, 50%; stage II, 28% []; and stages III–IV, < 10% []. Reportedly, 47% of the GBC cases are discovered incidentally during laparoscopic cholecystectomy, as in this case []. Therefore, careful histopathological review should follow surgery for cholelithiasis. The 5-year survival for incidental GBC has been shown to increase to 80% when patients undergo curative surgery [].
Complete resection is the only potentially curative treatment for GBC. However, even in cases of metastatic GBC, resection might lead to long-term survival if the metastatic lesions are resectable and well controlled with other therapies []; there was no standard surgical treatment that has been established for recurrent GBC. Then, we chose MCN as part of multidisciplinary therapy. The main chemotherapeutic agents for GBC are GEM, CDDP, and 5-FU, alone or in combination. The combination of GEM and CDDP for unresectable patients elicited response rates of 21 to 48%, with median survival times (MST) of 4.6 months to 11 months in several reports [–]. As these responses are not satisfactory, and the benefits of adjuvant chemotherapy for GBC are unclear, multidisciplinary therapy is required for patients with GBC.
Immunotherapy may be a promising modality among multidisciplinary treatments for far-advanced cancers. Shimizu et al. reported a survival benefit associated with postoperative adjuvant immunotherapies that included autologous tumor lysate-pulsed dendritic-cell vaccine and activated T cell transfer among patients with intrahepatic bile duct cancer []. Kimura et al. also reported that adjuvant immunotherapies improved postsurgical prognosis in a randomized controlled, phase III trial of patients with lung cancer []. Yang et al. reported that DC-activated, cytokine-induced killer cells enhanced the anti-tumor effects of chemotherapy in patients with advanced non-small cell lung cancer []. We also previously reported on the synergistic effects of gemcitabine and CAK cell immunotherapy []. The numbers of tumor-infiltrating lymphocytes have also been reported to be a prognostic factor [].
Because there was no standard treatment that has been established other than GEM at that time, we used immunotherapy combined with GEM. There was no significant chemotherapy-related adverse event in the first GEM and CDDP therapy. Therefore, we chose GEM and CDDP therapy as fourth-line chemotherapy combined with second-line immunotherapy, expecting for their synergistic effects.
The CAK cells used in the current case were a heterogeneous population that included activated NK cells and T cells, which are important tumor-antigen-independent effectors of immune response to tumors []. Because NKG2D is an activating receptor found on activated NK and activated T cells, high NKG2D expression was used to characterize the quality of CAK cells used for infusion. Our earlier report and other studies showed that the strength of the anti-tumor immune response depended on surface levels of NKG2D [–]. CAK cells are thought to have affected tumor repression in the current patient. We considered CD3+ tumor-infiltrating lymphocytes detected in the resected disseminated nodules to reflect this.
The second-line adoptive immunotherapy that we used was DAK cell therapy. Many studies have reported the efficacy and safety of tumor-associated, antigen-pulsed, dendritic cell-activated lymphocyte therapy [–]. MUC-1 expression was confirmed by immunostaining a sample of the disseminated tumor, which encouraged us to use MUC-1 long-peptide vaccine as the tumor-associated antigen. MUC-1 has been shown to be a tumor-associated antigen and target molecule for dendritic cell-based immunotherapy in advanced biliary tract cancer [, ].
At present, the patient visits our clinic regularly for immunotherapy. He has suffered no apparent immunotherapy-related side effect except for low-grade fever. Since there are few reports about topical treatments for the recurrent GBC, we suppose this case would be valuable to assess the significance of the surgical treatments including MCN for the recurrent GBC. Although distinguishing between the contributions of chemotherapy and immunotherapy to his clinical response is not possible, the present case nevertheless suggests the auxiliary effects of immunotherapy for far-advanced cancers. |
pmc-6139109-1 | A 70-year-old woman was admitted to our hospital because of upper abdominal pain. Her medical history included appendicitis at 20 years old. Upon physical examination, left hypochondriac pain and tenderness in the upper abdomen were noted. The laboratory examinations revealed elevated inflammatory markers (white blood cell count = 13400/μL, C-reactive protein = 11.58 mg/dL) and biliary enzymes (lactate dehydrogenase = 250 U/L, alkaline phosphatase = 535 U/L, γ-glutamyltranspeptidase = 76 U/L). The levels of tumor markers were also elevated (carcinoembryonic antigen = 9.4 U/mL, cancer antigen 19-9 = 550 U/mL). Pancreatic tumor markers were not elevated (s-pancreas-1 antigen = 20.0 U/mL, duke pancreatic monoclonal antigen type 2 ≤ 25 U/mL). Contrast-enhanced computed tomography (CT) revealed a markedly dilated main pancreatic duct (MPD) 55 mm in length in the whole pancreas, and the whole pancreatic parenchyma was thinning with atrophy (Fig. ). In addition, gastropancreatic fistula and splenopancreatic fistula were detected, suggesting penetration of the pancreatic tumor (Fig. , , ). As seen on the CT examination, dilatation of the MPD was detected on magnetic resonance imaging, and its content was visualized using low signal intensity on T1-weighted images and high signal intensity at T2-weighted images (Fig. ). The wall of the MPD and fistula had high signal intensity on diffusion-weighted images. Upon examination by upper gastrointestinal endoscopy, four gastropancreatic fistulas were identified on the posterior wall of the gastric body and mucus discharged from the gastropancreatic fistulas (Fig. ). Cytological examination of the mucus did not reveal any signs of malignancy. On the basis of the findings, the patient was pre-operatively diagnosed with IPMN of main ductal type penetrating into the stomach and spleen and surgery planned for her treatment. A total pancreatectomy, splenectomy, and distal gastrectomy combined with resection of the fistulas were performed. Considering the malignant potential based on the main ductal type with > 10 mm MPD dilatation, we also performed lymphadenectomy. The total operation time was 426 min, and the total intraoperative blood loss was 575 mL. Macroscopic examination of the resected specimen indicated swelling of the whole pancreas. When the resected specimen was divided, mucus swelled out, and then most of the cut surface of the whole pancreas was occupied by the dilated MPD and the mucus accompanied by atrophy of the pancreatic parenchyma (Fig. ). The gastropancreatic fistula (Fig. ) and splenopancreatic fistula (Fig. ) were macroscopically identified. In the spleen, bleeding and infarction were detected in addition to the mucus penetration. Microscopic examination of the resected specimen revealed cancer cells in the epithelium of the MPD in part of the tumor (Fig. ). There was no sign of infiltration on the cancer cells, and the remaining part of the MPD epithelium was adenoma (Fig. ). At the gastropancreatic fistula (Fig. ) and splenopancreatic fistula (Fig. ), no cancer cells were detected, only mucus and inflammatory cells. Finally, we diagnosed the tumor as non-invasive intraductal papillary-mucinous cancer (IPMC) of the pancreas. No postoperative complications were noted. The patient has remained disease-free without evidence of recurrence for 15 months.
During the last three decades, an increasing number of reports of IPMN of the pancreas have been published [, , ]. Though IPMNs originate from the pancreatic duct cells similar to invasive ductal adenocarcinoma of the pancreas, IPMN exhibits a unique clinical feature different from invasive ductal adenocarcinoma, such as secretion of a large quantity of mucin by the neoplasm, and slow and expansive growth associated with low malignant potentials for metastasis and invasion compared to invasive ductal adenocarcinoma. Fistula formation into other organs is also one of the characteristic features of IPMNs. With regard to its incidence, Kimura et al. initially reported nine cases with IPMN which penetrated into other organs such as common bile duct or developed fistula formation []. Kobayashi et al. also investigated that the incidence of the fistula formation was 6.6% (18 out of 274 cases) []. The organs penetrated were also reported in their investigation: duodenum (67%), stomach (44%), common bile duct (33%), colon (6%), and small intestine (6%). Notably, 39% of the cases with fistula formation developed into multiple organs fistula formation. In the report, the spleen is not reported as the organ penetrated into by IPMN, and furthermore, to the best of our knowledge, there have been no reports describing IPMN cases penetrating into the spleen. In this context, our IPMN case, which exhibited penetration into multiple organs including the spleen, is very rare, suggesting significance of reporting the case. The pathogenesis of fistula formation in IPMN is generally considered to be divided into two main types based on the underlying mechanism: invasive penetration of cancer cells and mechanical penetration. Though invasive penetration is derived from direct invasion of organs by cancer cells, mechanical penetration is due to the high inner pressure of a mucus-filled pancreatic duct [, ]. Kobayashi et al. reported that three out of nine cases (33%) had invasive penetration, and mechanical penetration was shown in the remaining six cases (67%) []. In the current case, cancer cells did not exist in the area of the fistulas, suggesting mechanical penetration as the underlying mechanism in the development of the fistula. Our finding that the mucus in the MPD swelled out when the resected specimen was divided may be associated with the high inner pressures, which may support mechanical penetration as the pathogenesis of fistula formation in this case. Several previous studies have reported that inflammation is also involved in mechanical penetration [–]. Based on our finding of inflammatory cells at the fistulas in this case, inflammation may exist at the fistula, resulting in mechanical penetration. Furthermore, when considering mechanical penetration apart from invasive penetration, a pressure gradient seems to be necessary for fistula development. Lumen organs, including the duodenum, stomach, and bile duct, may easily be under lower pressure than solid organs, such as the spleen, which could be one reason why fistula formation into the spleen is rare compared to the lumen organs. Kawarada et al. reported a 5-year survival rate of IPMC with penetration of 46.5% in Japan []. Kimura et al. reported a 5-year survival rate of IPMC with penetration or invasion of neighboring organs of 28% []. In our case, the follow-up period was just 15 months. Although the previously reported prognosis might not be applied to our case since the abovementioned prognosis was concerning about cases with invasive carcinoma, not about non-invasive carcinoma, further observation would be necessary in our case. |
pmc-6139126-1 | A 49-year-old Egyptian man presented to our emergency department with a 48-hour history of cough. The cough was productive of a small amount of sputum and caused abdominal discomfort. He denied a previous similar episode. He was fatigued but recalled no chest pain, emesis, fever, chills, night sweats, melena, constipation, or diarrhea. His past medical history was only significant for obesity but he denied having diabetes mellitus, hypertension, or ischemic heart disease. His past history was significant for laparoscopic Roux-en-Y gastric bypass electively done for weight loss. He denied tobacco, alcohol, or illicit drug use. His family history was noncontributory.
In the emergency department, he was afebrile with a temperature of 36.9 °C, and a blood pressure of 152/74 mmHg, pulse of 98 beats/minute, respiratory rate of 18 beats/minute, and oxygen saturation of 98% on room air. His physical examination showed that he was in mild distress, cooperative, alert, and oriented to person, place, and time. His respiratory examination revealed that his lungs were clear to auscultation bilaterally, with no wheezes, no rhonchi, and no rales. His cardiovascular examination showed regular rate and rhythm, no murmurs, rubs, or gallops. His abdomen was soft, nontender, nondistended, no hepatosplenomegaly, normal bowel sounds, stool guaiac negative, no guarding, no rigidity, and no rebound tenderness. Inspection showed scars consistent with a previous abdominal laparoscopic surgery.
Basic laboratory investigations were ordered. Levels of cardiac enzymes were normal with troponin-I levels being undetectable. A basic metabolic panel showed that the electrolyte levels were within normal limits. Complete blood count with differential was unremarkable. Kidney function tests were within normal limits except for a low urea (1.52 mmol/L).
A chest X-ray was ordered to rule out possible differential diagnoses for the presenting symptoms. An anteroposterior chest X-ray showed a collection or air under the right diaphragmatic copula (Fig. ). Further imaging by a CT scan of his abdomen with contrast was obtained and showed that the supposed air underneath the raised right copula of the diaphragm was a loop of colon with no evidence of free air or free fluid with evidence of slight eventration and thinning of the right copula of the diaphragm (Fig. ). Chilaiditi sign was diagnosed radiologically and due to the symptomatic nature of the presentation, a diagnosis of Chilaiditi syndrome was made.
He was managed with intravenously administered fluids, cough suppressants, and pain control. The pain resolved with supportive treatment and he was in a stable condition before being discharged home. After informing our patient of the results of the imaging studies, he chose to be discharged home after the pain subsided. Follow up after 1 year showed that he had been asymptomatic with no acute complaints and no further workup or interventions were warranted. |
pmc-6139209-1 | A 20-year-old man was referred to our institution from an oncological clinic where he was undergoing maintenance chemotherapy for metastatic alveolar rhabdomyosarcoma. In routine EKG, there was concerning new EKG abnormalities with a possible new AV block. Prior EKGs had been without abnormal findings (). Given the new EKG changes, the patient was admitted to an outside hospital for observation. Prior to his admission, the patient had been asymptomatic and had unlimited exercise capacity. He denied any tick bites or rashes in the recent past but reported that he had been hiking over the summer in Orange County, NY.
The patient had a medical history of left forearm alveolar rhabdomyosarcoma, diagnosed 16 months prior to this presentation for which he had undergone radiation therapy to his arm and chemotherapy including irinotecan, carboplatin, vincristine, doxorubicin (cumulative dose 300 mg/m2; initial regimen, which had been completed), and a combination of cyclophosphamide, vinorelbine, and temsirolimus (maintenance chemotherapy regimen). Recent imaging including PET had shown no evidence of disease, and the patient was deemed to be in remission at the time of presentation. The patient's baseline EKG prior to his presentation showed a normal sinus rhythm with a PR interval of 152 msec ().
The patient's home medications were sulfamethoxazole and trimethoprim prophylaxis, cyclophosphamide, and zolpidem. He was a lifetime nonsmoker, did not consume alcohol or illicit drugs, and lived with his family with no cardiac family history.
On arrival to our institution, the patient was asymptomatic. His blood pressure was 108/63 mmHg, heart rate was regular and between 80 and 115 bpm, he was afebrile at 36.4°C, and his oxygen saturation was 100% on room air. His physical exam was unremarkable, with no cardiopulmonary findings, no focal neurological deficits, and no abnormal skin findings. The initial EKG on admission revealed coarse atrial fibrillation with a ventricular rate of 60 beats per minute ().
Initial laboratory results were only notable for a hemoglobin of 10.0 mg/dl, a mild relative lymphocytopenia with a normal white blood cell count. TSH and troponin I levels were within normal limits. Echocardiogram showed normal left and right heart function with no wall motion abnormalities, mild tricuspid valve regurgitation, and no pericardial effusion.
A cardiac MRI, performed 2 days after presentation, showed mild right atrial dilatation and no other abnormalities. In particular, no signs of inflammation or masses were found. Additionally, on hospital day 2, telemetry monitoring and EKG revealed spontaneous conversion to normal sinus rhythm with a profoundly prolonged PR interval of 460 msec ().
Further workup during the hospital course revealed a twice positive B. burgdorferi IgG and IgM immunoblot (performed at ARUP Laboratories; IgG: bands present: 66, 45, 41, 39, 23, and 18 kDa, IgM: bands present: 41 and 39 kDa). |
pmc-6139221-1 | A 41-year-old white man presented to Montefiore Medical Center on June 15, 2017 with one day of fever and confusion. His past medical history was significant for recently diagnosed mediastinal germ cell tumor being treated with etoposide, ifosfamide, and cisplatin therapy. His last dose of chemotherapy was administered the week prior to presentation.
On presentation to the emergency department, he was febrile, hypotensive, tachycardic, and tachypneic. His initial white blood cell count was 0.1 with an absolute neutrophil count of zero. His creatinine was 5.32 mg/dL, elevated from a baseline of 2.0 mg/dL a week prior. A computed tomography (CT) of the chest, abdomen, and pelvis showed patchy bilateral airspace consolidations compatible with pneumonia. He was intubated, started on broad spectrum antibiotics, and admitted to the medical intensive care unit on multiple vasopressors for hemodynamic support. His clinical course was complicated by a progressive decline in hemoglobin associated with gastrointestinal (GI) bleeding that remained refractory to blood transfusions. Three endoscopies were performed that demonstrated gastric mucosal ischemia, multiple ulcers, and large quantities of blood in the upper GI tract. No active bleeding was identified. To identify the source of hemorrhage, the patient underwent a CT angiogram of the abdomen and a mesenteric angiogram, which were also unremarkable. Empiric embolization of the left gastric artery was performed with no resolution of bleeding. On hospital day 24, he developed a catastrophic upper gastrointestinal bleed requiring multiple transfusions of packed red blood cells. He underwent an emergent total gastrectomy for presumed stress gastritis. The stomach was grossly distended and filled with fresh blood. The patient was stabilized and returned to the operating room on postoperative day number two for reconstruction with a Roux-en-Y esophagojejunostomy, feeding jejunostomy tube placement, and formal abdominal wall closure.
Pathology specimen of the gastrectomy identified an angioinvasive mold with irregular nonseptate hyphae visualized, consistent with invasive mucormycosis (). Concomitantly, respiratory cultures grew Aspergillus fumigatus, and serum (1⟶3)-β-D-glucan was noted to be elevated to 294 pg/mL. On hospital day 27, he was started on liposomal amphotericin B and voriconazole to treat the dual fungal infections while awaiting identification of the mucormycete. Since tissue was not sent for culture, paraffin-embedded formalin fixed tissue sections were sent to the University of Washington Medical Center for molecular identification. Fungal DNA amplification using a 28S (D1/D2 region) primer set followed by sequencing was used to identify the isolate as Mycotypha microspora (GenBank accession number MH680712) [].
The patient was noted to have significant kidney injury on admission with worsening of his renal function on the dual antifungal regimen. After 20 days of amphotericin therapy in combination with voriconazole, the decision was made to switch to isavuconazole in an attempt to avoid permanent nephrotoxicity. On hospital day 65, after completing two weeks of isavuconazole, the level of serum (1⟶3)-β-D-glucan was 246 pg/mL, and a repeat CT of the chest showed an increase in numerous bilateral pulmonary nodules and tree-in-bud infiltrates, both consistent with progressive aspergillosis. This was concerning for failure of the isavuconazole therapy. The patient was subsequently switched to posaconazole combined with micafungin, which was continued for 5 weeks, after which monotherapy with posaconazole was continued. On hospital day 85, a repeat CT of the chest showed decreasing multilobar nodular opacities. This was correlated with a decreased serum (1⟶3)-β-D-glucan level of 63 pg/mL. The patient did not have recurrence of GI bleeding and was discharged on hospital day 98 on oral posaconazole with a plan to continue treatment indefinitely pending resolution of pulmonary findings on repeat imaging. |
pmc-6139222-1 | We present a case of a 60-year-old overweight female with a past medical history of type 2 diabetes, hypothyroidism, hyperlipidemia, hypertension, and internal hemorrhoids presented to her primary care physician for a health maintenance exam. She does not drink alcohol, is a lifelong nonsmoker, and denies illicit drug use. Past surgeries included cholecystectomy and total abdominal hysterectomy. She does not take antiplatelet and anticoagulant medications. She complained of hematuria during the review of systems. A CT scan was performed without contrast for the hematuria and revealed diffuse hepatic steatosis. A follow-up MRI Liver with Gadavist revealed hepatosplenomegaly with hepatic steatosis with no evidence of liver masses. Upon further discussion, she revealed complaints of pruritus. Labs were drawn after the imaging and revealed the following: AST 48 U/L (10-35 U/L), ALT 46 U/L (6-29 U/L), alkaline phosphatase 333 U/L (33-130 U/L), total bilirubin 0.4 mg/dl (0.2-1.2 mg/dl), and GGT 861 U/L (3-70 U/L) ().
She was ultimately referred to a gastroenterologist and further serologic testing was performed. She had a negative viral hepatitis panel, smooth muscle antibody, immunoglobulin-G, anti-Mitochondrial Antibody (AMA), iron saturation, ferritin, alpha-one antitrypsin genotype, and ceruloplasmin. She was a nondrinker. She had metabolic risk factors for nonalcoholic fatty liver disease but the elevated alkaline phosphatase prompted further work-up. She underwent subcostal CT guided core liver biopsy with a 17-gauge guide needle and an 18-gauge core biopsy needle inserted coaxially. Four total passes were made and ranged in size from 0.6 to 1.5 cm. The patient tolerated the procedure well. The liver biopsy revealed abundant central zone macrovesicular steatosis and a large amount of ballooning hepatocytes with Mallory-Denk bodies, consistent with steatohepatitis with fibrosis. Elevations in alkaline phosphatase can be seen in up to 1/3 of patients with nonalcoholic steatohepatitis [], as was the case in this patient.
Two days after the biopsy, she began experiencing intermittent bouts of acute chest and epigastric abdominal pain with nausea, nonbloody emesis, and increasing stool frequency. She had several visits to the emergency department and was found to have worsening alkaline phosphatase and bilirubin levels. On postbiopsy day twelve, she had an elevated lipase of 1002 U/L (normal 20-50 U/L), but MRI/MRCP failed to reveal any abnormalities, though she was pain-free at the time of the study. The pain continued intermittently but would resolve spontaneously, with work-ups and imaging modalities (US and CT imaging) revealing no defining etiology. Seventeen days status after liver biopsy, she presented again with acute onset of epigastric pain, sharp, severe, nonradiating, and associated with nonbloody emesis, and no melena. She was found to have an elevated alkaline phosphatase and bilirubin once again but also a lipase of 2235 U/L (normal 25-50 U/L). Contrasted CT scan, ordered urgently and performed while the pain was present, finally showed pancreatitis with hyperdense material within the common bile duct.
She was referred to a tertiary center for further management. She initially underwent EGD that failed to reveal any abnormalities, including any signs of bleeding. She subsequently underwent ERCP with sphincterotomy and 9-12 mm balloon sweep of small blood clot from the left intrahepatic duct (Figures , , and ). A 10 French by 7 cm stent was placed in the common bile duct and there was adequate bile flow. There was no evidence of further bleeding and no need for embolization. She had no further bouts of abdominal complaints.
A follow-up ERCP was performed 8 weeks later and a 9-12 mm balloon sweep with contrast was performed that did not reveal any biliary dilation or obstruction. The stent was removed successfully. Biliary drainage was noted to be adequate after procedure. Her alkaline phosphatase and bilirubin returned to their baseline prior to the liver biopsy (). She did not have any recurrence or relapse of her symptoms. There were no further signs of bleeding and her hemoglobin returned to baseline. |
pmc-6139223-1 | A 49-year-old male with a history of alcoholism, chronic pancreatitis with pancreatic duct stenting, and newly diagnosed diabetes mellitus type II was admitted to our hospital for abdominal pain, melena, nausea, and vomiting in the setting of necrotizing pancreatitis and blood loss anemia with a hemoglobin count of 6.6 g/dL. CT showed pancreatic tail atrophy from prior necrosis, a new area of necrosis measuring 7.1 × 4.9 × 4.9 cm at the superior aspect of the pancreas body and a new 2.3 × 2.2 × 2.8 cm fluid collection inferior-posterior to the uncinate process. (The latter fluid collection communicated with the second portion of the duodenum on CT and would later be identified as the IPDA pseudoaneurysm.) There was extravasation of contrast within this latter fluid collection, suggestive of active bleeding (). During this time, the patient responded well to volume resuscitation and remained hemodynamically stable. It was felt that this bleeding was likely the result of inflammatory erosion into an artery. Given the patient's stability, the decision was made to attempt angiography with embolization. Surgical correction was considered at this time but ultimately would be more morbid and challenging given the degree of inflammation with his necrotizing pancreatitis.
A superior mesenteric arteriogram showed a pseudoaneurysm arising from the IPDA with intermittent hemorrhage (). The microcatheter and wire could not be advanced past the pseudoaneurysm or into the pseudoaneurysm without buckling and displacing the microcatheter from the IPDA. In addition, the feeding artery from the superior pancreaticoduodenal artery could not be seen from celiac catheterization. Placing a microcoil in the proximal IPDA would have blocked the access to the pseudoaneurysm for definitive treatment. Thus, the decision was made to embolize the pseudoaneurysm with liquid N-butyl-2-cyanoacrylate (NBCA). Follow-up digital subtraction arteriography confirmed successful occlusion of the pseudoaneurysm and IPDA.
Thereafter, the patient was initially admitted to the surgical intensive care unit for close monitoring. He did have persistent melanous bowel movements, requiring 2 units immediately, one unit at 34 hours, and 4 units at 57 hours post embolization. His melanotic stools resolved 5 days post embolization. Repeat CT angiogram on hospital day 5 showed complete occlusion of the IPDA. A small amount of gas was noted in a thick-walled duodenum along the region of prior embolization, which was concerning for ischemic necrosis without perforation. Upper endoscopy the following day showed normal stomach with mild duodenitis and no evidence of necrosis or bleeding. He was discharged in stable condition on hospital day 7, tolerating a regular diet without blood in his stool. He was doing well at his 1-month follow-up appointment and denying abdominal pain or melanotic bowel movements. |
pmc-6139234-1 | A 35-year-old man was referred to plastic surgical department with a progressive, ulcerating lesion near the angle of the mandible suspicious for skin carcinoma (). It had gradually grown to 20 mm in diameter over four months. Thirteen years previously, the patient was diagnosed with an undifferentiated nasopharyngeal cancer with lymph node involvement classified as T2aN2M0. The patient was treated with radiochemotherapy and had no recurrence. The radiation therapy had led to osteonecrosis and chronic radiation-induced dermatitis/fibrosis of the skin at the site of the radiotherapy. After the primary lesion emerged the patient developed multiple 5-6mm tumors on the extensor side of arms, lower limbs, and postauricular, which clinically presented as prurigo nodularis. The patient did not have a personal or family history of skin disorders.
A pouch biopsy was taken from the lesion near the mandible in order to rule out radiotherapy induced malignancy. Subsequent histologic examination identified it as prurigo nodularis (). The pathological examination showed a hyperkeratosis and parakeratosis epidermis with irregular acanthosis. The patient was offered a referral to a dermatologist for evaluation but expressed a desire for surgical treatment. The lesion was excised with a close margin in local anesthesia and the defect was closed directly. This was once again histologically confirmed as prurigo nodularis. The patient healed without any complications. The remaining nodules on the limbs and postauricular were referred to a dermatologist. |
pmc-6139700-1 | A 41-year-old female was diagnosed with infantile-onset HPP at the age of 5 months, presenting with recurrent pneumonia and rib fractures. She had additional fractures of the extremities, rickets, and short stature. In 1998, the patient was found to have bilateral subtrochanteric femoral shaft pseudofractures after a fall down a flight of stairs and was treated with intramedullary nail (IMN) fixation at the time. In 2012, she suffered a left tibial fragility fracture from stepping off a sidewalk curb. She was initially treated with a cast, walking boot, cane, walker, and eventually was full non-weight-bearing due to fracture nonhealing (Fig.
A). Her height, 138.4 cm (54.5″), was less than mid-parental height of 174 cm (68.5″). She was edentulous. Baseline labs in November 2013 included ALP 8 U/L (38–126) and vitamin B6 2450 mcg/L (5–50). Gene testing of ALPL showed compound heterozygous mutations c.526G>A (p.Ala176Thr) and c.1132G>C (pAsp378His).
In December 2015, she started asfotase alfa, 1 mg/kg subcutaneous injection six times per week. One month later, she underwent elective osteotomy of the left tibia and fibula with IMN fixation. Serial radiographs after the procedure demonstrated callus formation by 1 month postoperatively (2 months after initiating enzyme replacement therapy; Fig.
B). The patient began physical therapy shortly after surgery and was full weight-bearing by 2 months post-op. By 5 months post-op (6 months after initiating astatase alfa), there was a definite increase in bridging callus formation (Fig.
C), and the patient was able to ambulate independently at this time. By 11 months post-op, radiographs demonstrated union of the left tibia and fibular osteotomies (Fig.
D). Notably, at this time she reported greatly improved walking tolerance, up to distances of 4 miles. At physical therapy sessions, her subjective bone pain scores were documented to improve from 8 to 10 (on a 1 to 10 scale) at the start of asfotase alfa to 3 to 6 by 9 months of replacement therapy.
Moreover, the subtrochanteric femoral pseudofractures showed little remodeling at the fracture line over the 17 years before starting asfotase alfa (Fig.
A, B). By 11 months of replacement therapy, radiographs showed marked healing with near resolution of the fracture line (Fig.
C) and continued bone healing at 14 months of replacement therapy (Fig.
D). |
pmc-6139700-2 | A 61-year-old male presented with a fragility fracture of the right femur in May 2006, which required intramedullary rod placement in December 2008. He had persistent pain and a waddling gait. Serial radiographs demonstrated nonunion of the fracture 8 years later despite operative intervention. In 2014, he complained of left knee pain, as well as difficulties with gait and balance and saw another orthopedic surgeon. Radiographs demonstrated a new fracture of the left femoral diaphysis as well as the continued nonunion of the previous right femur fracture. He declined operative intervention because he was dissatisfied with the lack of healing of the contralateral fracture and sought another opinion.
Physical examination showed poor dentition and a waddling gait. A complete laboratory workup was completed and significant for ALP 6 U/L (39–177), phosphorus 5.5 mg/dL (2.5–4.5), and vitamin B6 >100 µg/L (5.3–46.7). Based on these results, HPP was suspected and genetic testing confirmed HPP with compound mutations c.874C>A (p.Pro292Thr) and c.1195G>A (p.Ala399Thr).
In March 2015, the patient initiated a course of teriparatide to assist with fracture healing. After 6 months, he discontinued this treatment, as he was unable to tolerate the side effects of the drug and X-rays did not demonstrate interval healing.
The subject received first dose of asfotase alfa in October 2015. In November 2016, radiographs revealed interval healing of the left femur fracture. In February 2017, bilateral radiographs demonstrated complete healing of the right femur and near resolution of the left femur (Fig. ), and the patient reported significantly less pain with ambulation, improvement in gait, and overall improved quality of life. |
pmc-6139905-1 | The patient was a 23-year-old female (46, XY karyotype) diagnosed with hypertension (180/120 mmHg) since age 14 and a BMI of 20.8 kg/m2. There was no obvious masculinization, and her parents stated that there were no obvious abnormalities in vulva development at birth. Antihypertensive drug therapy (nifedipine sustained-release tablets) had been taken continuously, and blood pressure was controlled to 130–140/80–90 mmHg. The patient sought treatment at our hospital due to menstrual disorders. The patient is the only child of non-consanguineous healthy parents from Northeast China. The study was approved by the ethics committees of China Medical University, and informed consent was obtained from the patient and her parents.
Imaging examinations included an ultrasonic cardiogram, a colour Doppler ultrasound of the carotid artery and lower limb arteries, a pelvic colour Doppler ultrasound (SSA660A, Toshiba), and a contrast-enhanced adrenal computer tomography scan (16-slice computer tomography machine, GE Lightspeed). Laboratory tests included measurements of serum potassium, natrium, testosterone, free testosterone, androstenedione, dehydroepiandrosterone sulphate, adrenocorticotropic hormone, cortisol, 17-hydroxyprogesterone, renin, and aldosterone using chemiluminescence immunoassays and biochemical assays.
Peripheral blood samples from the patient and her parents were collected for gene analysis. Direct sequencing was performed on all the exons and the exon–intron boundaries of CYP21A2 (NM_000500) and CYP11B1 (NM_000497.3).
PolyPhen-2 (, Protein ID for CYP11B1 is NP_000488.3 or P15538) and SIFT/Provean (/) were used to predict whether an amino acid substitution affects protein function. The alignment in CYP11 families was performed using CYP11B1 sequences from different species and other human steroidogenic P450 cytochromes. PolyPhen-2 and DNAMAN software was used for multiple amino acid sequence alignment. CYP11B2 (PDB entry: 4DVQ.A), which shares 93.6% sequence identity with CYP11B1, was selected as the template for model building of CYP11B1. The structural representations were generated using PyMOL 2.0.6. |
pmc-6139907-1 | We report a case of a 36-year-old woman of Yoruba ethnicity who presented with absence of menses. A physical examination revealed a woman with feminine appearance characterized by long plaited hair and well-developed breasts. As part of the investigations to unravel the sex status, she had a resting standard 12-lead ECG following standard protocol. The ECG was in sinus rhythm and it revealed a masculine electrocardiographic pattern with OSDES score of 9 (T-wave pattern in lead V1, 3; ST segment in lead V2 or V3, 3; QRS rotation, 2; heart rate of 79, 1) as shown in Fig. . An abdominopelvic ultrasonography done by a radiologist showed absence of uterus, fallopian tubes, and ovaries. When our patient was considered for transvaginal scan, she declined but embraced translabial ultrasound as she claimed to be a virgin. Translabial ultrasonography revealed the presence of undescended hypoplastic testes with associated testicular microlithiasis at the external inguinal rings bilaterally (Fig. ). The karyotyping done using blood revealed no gross chromosomal abnormalities involving structural or number changes. The chromosomal sex of male (46,XY) was reported (Fig. ). The sex-determining region Y (SRY) was also done using QIAmp Blood Mini Kit (Qiagen) by extracting deoxyribonucleic acid (DNA) from a peripheral blood sample of our patient. Polymerase chain reaction was done with a pair of SRY forward (tacaggccatgcacagagag) and reverse (tcttgagtgtgtggctttcg) primers and Taq DNA polymerase with the use of appropriate positive and negative controls. Electrophoresis of the polymerase chain reaction product was done in 2% agarose gels and the bands visualized under ultraviolet (UV) light. The result showed that the blood sample was positive for the SRY gene which further confirmed the male status (Fig. ). The genetic sex testing result confirmed initial electrocardiographically determined sex status of our patient. She was counseled and later had the testes removed to prevent malignant transformation. |
pmc-6140099-1 | A 74-year-old female patient with an acute non-ST-segment elevation myocardial infarction (NSTEMI) was referred for coronary angiography. Transradial access was established with a 10 cm 6F Introducer sheath (Glidesheath, Terumo Medical Corporation). Coronary angiography with a 6F Judkins right 4 diagnostic catheter revealed a long and heavily calcified lesion of the proximal segment and ostium of the right coronary artery (RCA). During the retrieval of the diagnostic catheter, the patient complained of severe pain in her right arm due to spasm of the radial artery. After repetitive intravenous administration of midazolam up to 8 mg and nitroglycerine through the radial sheath, retrieval of the catheter was finally possible. PCI of the lesion in the proximal RCA was then performed over a 5F Amplatz left 1 guiding catheter (Launcher, Medtronic) using an extra support guidewire (Galeo ES, Biotronik) and a 3.0/15 semi compliant balloon (Across HP, Acrostak) for predilatation. A 3.5/48 drug-eluting stent (DES) (XIENCE Xpedition, Abbot Vascular) was then placed in the predilated coronary segment and inflated to 18 atm (). A mixture of contrast media and saline at a ratio of 1 : 1 was used for all balloon inflations. After a second more proximal inflation, the balloon catheter did not deflate completely and the operator was unable to pull it back into the 5F guiding catheter (). Excessive inflation and deflation with the indeflator and forced aspiration with a 50 ml syringe were unable to deflate the balloon that was stuck at the RCA ostium. The operator then decided to pull back the entire equipment including the guiding catheter, guidewire, and stent balloon at once. Finally, the balloon catheter became released from the stent remaining in place in the coronary artery. An attempt to burst the balloon in the ascending aorta by inflation well over rated burst pressure (RBP), as well as puncturing the balloon within the guide catheter with multiple stiff guidewires, also failed.
During a further pullback of the system, the still inflated balloon became stuck again in the small and vasospastic radial artery. The operator was unable to pull or push the balloon in any direction and was unable to wedge the balloon into the 6F radial sheath. Moreover, a forced pullback of the partially inflated balloon catheter resulted in invagination of the distal part of the balloon (, white arrow). After injecting local anesthesia on the middle forearm, transcutaneous puncture of the balloon through the skin and the radial artery wall was performed with a 23 gauge syringe needle using fluoroscopy for guidance (), and contrast media were aspirated with the syringe (). Retrieval of the deflated balloon was then possible through the radial sheath. Reintubation of the RCA with a fresh guiding catheter revealed a good angiographic result in the proximal segment and relevant acute recoil at the ostium of the calcified RCA. Implantation of a second short 4.0/9 mm DES (BMX-Alpha, Biosensors) was necessary to mechanically stabilize the lesion. Injection of contrast media through the sheath confirmed the integrity of the radial artery at the puncture site (). Radial compression was used to close the 6F access site. The clinical follow-up remained uneventful. |
pmc-6140128-1 | A 71-year-old male presented to an outside institution in 2015 for evaluation of slowly enlarging bilateral cervical lymphadenopathy, parotid swelling, and night sweats. Medical history was significant for melanoma removed from the bridge of his nose in 2015, and active smoking for over 40 years.
During his initial workup at the OSH, computed tomography (CT) imaging showed multiple enlarged bilateral parotid lesions, scattered enlarged level I and II nodes, and upper mediastinal lymph nodes. He underwent ultrasound-guided fine needle aspiration (FNA) and core needle biopsy of a large left neck lymph node measuring 4.0 × 1.9 cm. Cytology was consistent with WT. Additionally, a level IA neck dissection was performed. Pathology revealed WT and no evidence of malignancy or lymphoma. Six-month follow-up imaging showed stable appearance of the bilateral parotid masses and cervical lymph nodes; however, there was interval enlargement of right upper mediastinal paratracheal lymph nodes.
He relocated in September 2016 and transitioned care to our institution. Thoracic surgery performed endoscopic bronchial ultrasound and transbronchial biopsies of the right paratracheal node. Cytopathology revealed absence of malignant cells. Flow cytometry was negative for lymphoma. He elected for close surveillance with serial imaging in lieu of mediastinoscopy. Six-month follow up imaging showed stable size of the mediastinal lymph nodes and slight enlargement of a left neck lymph node () and he was subsequently referred to the Department of Otolaryngology.
Physical examination revealed bilateral enlarged parotid glands and bulky cervical lymphadenopathy slightly larger on the right. Facial nerve function was intact bilaterally. The patient was counseled on smoking cessation. He was discussed at our multidisciplinary tumor board. Given the progression of cervical disease, he underwent level II lymph node dissection with removal of a large nodal conglomerate and culture of cystic contents. Histopathology once again confirmed WT (). Culture and lymphoma workup were negative. In follow-up, he had quit smoking and elected to continue close observation. |
pmc-6140272-1 | A 3-year-old girl, with no prior medical history, was admitted in our center with a three-week history of an abdominal mass discovered by her mother. On physical examination, a firm, painless mass in the left flank was palpable. Complete examination showed no other abnormality. In particular, no neurological deficit was detected.
Abdominal ultrasonography revealed a large heterogeneous tumor of 69 × 67 × 97 cm originating from the upper pole of the left kidney, deviating it towards the midline. The mass is located on the periphery of the upper pole of the kidney, and a vascular pedicle seemed to emerge from the renal sinus. No calcification or hemorrhagic component was found. Magnetic resonance imaging (MRI) and computed tomography (CT) showed an encapsulated tumor but with a nodular infiltration of the retroperitoneal fatty tissues. It extended through the T11-T12 and T12-L1 neural foramina, forming an intraspinal mass from T11 to L1 and compressing the spinal cord (). Assessment of tumor extension revealed two infracentimetric metastases in the lungs. The tumor and its extradural extension showed a major hypermetabolic activity on positron emission tomography (PET). Bone marrow aspiration uncovered no medullary involvement. The urine catecholamines, neural specific enolase, alpha-foetoprotein, and human chorionic gonadotropin were normal. Laboratory studies evidenced only a small rise in LDH (417 IU/L) and fibrinogen (7.2 g/L).
Considering this extremely unusual clinicoradiological presentation, a posterior transcutaneous needle biopsy was performed, as recommended in the International Society of Pediatric Oncology renal study group SIOP-RTSG 2001 protocol. The histopathologic features revealed a triphasic nephroblastoma, with no anaplastic feature.
Meanwhile, the patient started complaining of major paresthesia and leg pain, requiring urgent treatment with corticosteroids and chemotherapy. Due to the neurological threat and the lung nodules, chemotherapy according to the SIOP-RTSG 2001 for stage IV nephroblastoma was administered, including three drugs (vincristine, actinomycine D, and doxorubicine).
The patient's evolution was rapidly satisfying, with the rapid and complete receding of neurological symptoms. The preoperative assessment, after four courses of chemotherapy, indicated a massive regression of the tumor volume by 53%, with measures of 67 × 46 × 77 cm, and a complete disappearance of the intraspinal extension. The lung nodules were no longer detected on CT imaging.
After six courses of chemotherapy, a left nephrectomy was performed. Macroscopic examination identified a large tumor attached to the kidney, enclosed in a thick fibrous capsule. The microscopic examination concluded to a triphasic nephroblastoma with regressive changes, of intermediate risk and without capsular rupture, thereby staging it as a stage I of the SIOP-RTSG 2001 classification. The tumor consisted in tumor epithelial component (abortive tubules and glomeruli) surrounded by metanephric blastema and tumor immature spindled cell stroma without any anaplasia or emboli of tumor cells. The histology of the kidney was unremarkable without any nephrogenic rest. Postoperative treatment included 29 weeks of chemotherapy with the same three drugs. After 24 months of evolution, the child is in good health and has no neurological deficit. |
pmc-6140355-1 | A 13-year-old boy was referred to our tertiary young adult hip service by a Paediatric Orthopaedic Surgeon for evaluation of left groin pain and a decreased range of movement in the left hip. He was a keen rugby player and had experienced an avulsion fracture of the AIIS during a rugby game which was played without a warm up six months previously. MRI just after injury showed a single bony fragment measuring 12 mm × 4 mm × 12 mm at the rectus femoris origin of the AIIS and it was retracted inferiorly 3 cm, anteriorly 1 cm and laterally 0.5 cm. Conservative treatment was advised by the Paediatric Orthopaedic Surgeon and he was referred to a physiotherapist for mobilisation and subsequently muscle strengthening.
Five months post-injury he was progressing well with the physiotherapy, although, he still felt a sharp pain in his left groin when running with a ball while playing rugby. Flexion was restricted to 70° and a decrease in internal rotation in comparison with the opposite side was observed while abduction, adduction, extension and external rotation were comparable to the other side. There was no significant tenderness and no bruise in the region of the groin, and no distal neurovascular deficit. Plain radiographs demonstrated hypertrophic calcification in the region of the rectus femoris avulsion, whilst the hip joints were normal in appearance. A CT scan showed well corticated heterotopic bone formation at the site, measuring approximately 3.5 cm at maximum diameter (). Motion analysis using the three-dimensional CT datasets clearly showed the impinging area especially in 70° of hip flexion.
Both conservative and surgical management were suggested and discussed with the patient and his parents. They chose to go ahead with surgery, as he could not play rugby well because of the pain and restricted range of movement. The patient wanted to play rugby at a fairly high level, hopefully nationally, in the future. At arthroscopy, he was found to have a well corticated large lesion of heterotopic ossification, and it was dissected carefully from the muscles (). Once the dissection was completed, it was extracted via an incision to deliver the lesion. A dynamic impingement test was performed on the table to ensure there was no residual impingement and the impingement lesion was resected with a 5.5 mm arthroscopic burr. A thorough washout was carried out before closure.
The patient was advised not to perform any rotational activities in deep flexion for six weeks postoperatively and to follow the 16-week post-operative rehabilitation protocol. He was also advised prophylaxis against heterotopic ossification. Eight weeks following the procedure, the wound had healed well and there were no obvious signs of complications such as infection or deep vein thrombosis. Along with this, he demonstrated a pain-free, fully functional range of movement in his left hip joint and was delighted with his progress. Plain radiographs showed no further signs of calcification (). He was advised to continue to attend physiotherapy for at least another eight weeks and to engage in more gentle sporting activities like cricket and basketball, which he had enjoyed before the injury. At the 1-year follow-up, he remains asymptomatic with a full range of movement in his hip and continues to play rugby at a high level. |
pmc-6140401-1 | Patient A.III.1 is a 30-year-old female, who presented with antibody deficiency at age 15 and the diagnosis of CTLA-4 insufficiency was made at the age of 27 years. Additional complicating features included CNS involvement, psoriatic skin irritation, arthralgia, and a recurrent enteropathy, treated by steroids and immunoglobulin replacement therapy (IGRT).
By the age of 30 years she had lost 6 kg of weight during 3 months and multiple enlarged lymph nodes on both sides of the diaphragm were detected. Supraclavicular lymph node resection revealed a grade IV EBV-associated Hodgkin lymphoma with mixed cellularity (Figure ). Laboratory findings showed a viral EBV load of 59,000 IU/ml blood.
The EBV viremia was treated with four courses of rituximab. The patient recently received her first course of AVD-Brentuximab and is currently stable.
Patient H.II.1 was a 21-year-old male, who presented with protracted diarrhea, ITP, and AIHA at the age of 10 years. The cytopenias became steroid-dependent and prompted intensive immunosuppression and finally splenectomy at the age of 20 years.
Moreover, he developed lymphocytic CNS lesions and recurrent generalized lymphadenopathies during his adolescence. Repeated biopsies revealed polyclonal cellularity in the lymph nodes and aplasia, fibrosis, and nodular lymphocytic aggregates in the bone marrow, compatible with an autoimmune lymphoproliferative syndrome-phenotype (Figure ). Additional, he suffered from a cholestatic giant cell hepatitis at the age of 17 years (Figure ).
At the age of 21 years, his EBV load had risen from 2,000 copies/ml to 8,400 copies/ml within 4 weeks, accompanied with high fevers and worsening clinical condition. He was admitted to intensive care due to progressive respiratory insufficiency, severe pancytopenia, and severe colitis. Despite immunosuppressive treatment with everolimus and prednisolone, rituximab, and high dose dexamethasone, the patient deteriorated and developed sepsis. Sequential therapy approaches with MMF, ATG, and G-CSF were made and quadruple-therapy for a concomitant atypical tuberculosis was initiated. Nonetheless, his condition worsened and he died 4 months after the onset of his EBV viremia. Pathology revealed post-mortem the diagnosis of an EBV-associated classic Hodgkin lymphoma with bone marrow infiltration (Figures , ). |
pmc-6140401-2 | Patient B.II.3 is a 54-year-old male, in whom CTLA-4 insufficiency was revealed by family screening at the age of 49 (). Fever, night sweats, and fatigue occurred just a few months later, EBV viral load began to rise, and a generalized lymphadenopathy was detected. In addition, pancytopenia developed in the context of a hemophagocytic syndrome. Laboratory values showed an IL2-receptor load of 44.141 U/ml and an EBV load of 297.000 copies/ml blood. Although a therapy with high dose corticosteroids, rituximab, and etoposide was initiated, his condition aggravated and he developed Aspergillus fumigatus sepsis. Aged 51 bone marrow biopsy revealed a classical Hodgkin lymphoma. With an adjusted chemotherapy protocol AVD (bleomycin was excluded due to aspergillosis) the patient reached clinical remission, subsequent bone marrow transplantation was successfully realized and the patient is in complete remission for more than 3 years.
Patient L.II.2 is a 20-year-old male, who initially presented with inguinal and axillary lymphadenopathy and severe pancolitis, at the age of 16 years. The diagnosis of lymphocyte-rich Hodgkin lymphoma was established based on an inguinal lymph node biopsy.
Laboratory values remained negative for EBV, but immunohistochemical staining was positive for CD15, CD30, EBV-LMP, and EBV in situ-hybridization. Histological work-up showed architectural effacement by a diffuse and partially nodular infiltrate of lymphocytes and histiocytes; these cells were interspersed with Reed-Sternberg cells (Figure ).
The Hodgkin lymphoma was treated with three courses of ABVD chemotherapy (Euronet PHL-C1 2007), the colitis with corticosteroids, sirolimus, and belatacept and the hypogammaglobulinemia with IGRT. PET-CT at the first re-evaluation after 3 months showed, that the lymphoma was now in remission. He underwent matched unrelated bone marrow transplantation with reduced intensity 7 months after diagnosis and is now alive and well 2 years post-BMT.
Patient JJ.II.2 is a 31-year-old male, who presented with antibody deficiency at the age of 10 years (CVID Euroclass B+smB-CD21low TR high). In the course of his illness, he developed recurrent respiratory infections, intermittent cytopenia, renal impairment necessitating dialysis, fluctuating EBV levels, enteropathy, and bilateral granulomatous lesions in the lungs. At the age of 28 years a heterozygous mutation in CTLA4 was detected.
A few months later, clinical assessment indicated a weak patient with enlarged inguinal lymph nodes accompanied by intermittent fevers and the diagnosis of a Hodgkin lymphoma with mixed cellularity including bone marrow infiltration was made; EBV-PCR detected a low positive result of 90 copies/ml blood. Complete remission was reached by six cycles of AVD protocol; the patient is alive and well more than 500 days after his initial cancer diagnosis without any signs of recurrence.
Patient MM.II.1 is a 40-year-old male, who initially presented with haemolytic anemia at the age of 14 years and diagnostic workup led to the diagnosis of a CVID (EUROClass B+smB-21low TR norm). Several pneumonias and recurrent autoimmune phenomena with haemolysis and thrombocytopenia occurred and were temporarily controlled by corticosteroids and azathioprine.
After 13 years of clinical remission, MM.II.1 presented with lymphadenopathy and B symptoms at the age of 33 years. His condition deteriorated rapidly and a diagnosis of an EBV-associated classical Hodgkin lymphoma (grade IIIB) was made based on cervical lymph node resection (Figure ). Laboratory values showed an EBV load of <500 copies/ml and a CMV load of <1,000 copies/ml blood. Complete remission was reached with four cycles of ABVD chemotherapy protocol.
During remission, recurrent gastrointestinal irritations and relapses of a past encephalomyelitis occurred intermittently. So far, there are no hints for recurrence of the lymphoma and the patient remains in remission for 7 years.
Patient K.II.1 was a 52-year-old female, who was the first out of four patients with Non-Hodgkin-Lymphoma in our cohort. She was diagnosed with CVID during her twenties and received IGRT for decades. At the ages of 33 and 39 years hyper-cellularity and lymphocytic infiltrations were found in her bone marrow, but malignant cell growth could be ruled out. However, 6 years later at the age of 45 years, generalized lymph node enlargement appeared accompanied with fevers, night sweats, and weight loss. Cervical lymph node biopsy revealed clonal lymphoproliferation with typical features of a DLBCL with EBV association.
The lymphoma was treated with four courses of rituximab with only partial response, thus she received four cycles of R-CHOP 21 and could reach a complete remission.
After 4 years of remission, she developed recurrent abdominal and retroperitoneal lymphadenopathy, but biopsies negated malignant transformation. At the age of 51 years, her clinical condition deteriorated soon and finally the diagnosis of a non-EBV-associated DLBCL (grade IVb) was made based on an additional diffuse hepatic lesion biopsy. Pathology examination described compact atypical B cell infiltrate with a component of high reactive T cells. The non-EBV-associated DLBCL only responded partially to treatment with two cycles of R-CHOP, two cycles of R-DHAP, as well as one cycle of R-BEAM. In the end, she suffered from CMV-viremia and deceased due to pneumonia and gastric bleeding 7 months following the relapse at the age of 52 years.
Patient UU.III.3 was a 51-year-old female, who had severe and recurrent gastroenteritis for many years. Clinical records are rare and even genotyping could not be made prior her death, but family screening revealed a heterozygous CTLA4 mutation in five out of seven siblings and in four out of her five children. At the age of 50 years she presented with inguinal lymphadenopathy accompanied with B symptoms and she was diagnosed with DLBCL based on inguinal lymph node resection.
Despite five cycles of R-CHOP, local radiotherapy, and radio-immune-therapy with ibritumomab-tiuxetan, the patient died 13 months after cancer diagnosis.
Patient CO.I.1 was a 62-year-old male, whose CVID diagnosis was first made at the age of 38 years and a heterozygous mutation in CTLA4 was identified at the age of 61 years following clinical assessment. His clinical history followed a long history of recurrent but steroid-sensitive granulomatous infiltration in kidney, skin, lung, and conjunctivae. Finally, he complained of weight loss and fatigue over months at the age of 62. Biopsy of a hepatic lesion revealed morphological features of a DLBCL germline subtype. Immunohistochemical staining showed atypical lymphoid infiltrates, which were positive for CD20, Bcl6 and Bcl2, and negative staining for CD3, CD5, CD10, MUM-1, TdT, and EBERish.
The lymphoma was treated with three cycles of R-CHOP chemotherapy (two with reduced, one with full intensity), his health deteriorated and he deceased after a short and fulminant sepsis just 3 months after cancer onset.
Patient FF.II.1 was a 23-year-old male, who initially attracted clinical assessment at the age of 6 years and at the age of 16 years with treatment-dependent immune thrombocytopenia (ITP). He presented at age 22 with diffuse lymphadenopathy and in the years prior to his diagnosis he had benign lymphadenopathy with negative biopsies on multiple locations. At the time of his diagnosis, the lesions had increased in size, number, and PET-CT avidity prompting repeated biopsies. Those revealed typical features of a Burkitt lymphoma without EBV association. Laboratory values showed overall lymphopenic levels and negative EBV, CMV, and toxoplasma ranges. Immunohistochemical staining was positive for CD10, CD20, PAX5, c-MYC, and 100% for proliferation index Ki-67.
The lesions were refractory to four cycles of R-Hyper-CVAD and showed only a minimal response to two cycles of R-ICE. Next, he started treatment with rituximab and selinixor on study KPT330, but he was taken off the study because of disease progression with worsening thoracic and retroperitoneal lymphadenopathy. Ultimately, another therapy attempt was started following the DA-R-EPOCH protocol, but nonetheless the patient died of his progressive disease with thoracic and retroperitoneal lymphadenopathy at the age of 23 years. |
pmc-6140401-3 | Patient B.II.4 is a 47-year old female, who had manifested with antibody deficiency, recurrent hypokalaemic periods due to severe diarrhea, and chronic renal failure most likely due to lymphocytic renal infiltrations during her early forties. Her CTLA4 mutation was found at the age of 43 years by screening of 71 unrelated patients with CVID and enteropathy ().
Two years prior her CTLA-4 insufficiency diagnosis, at the age of 41 years, she developed an EBV-associated and poorly differentiated gastric adenocarcinoma (type M, Figure ), that was treated by radical mucosal resection. Nonetheless the cancer relapsed 3 years later—again EBV-associated (Figure )—and the patient finally underwent total gastrectomy at the age of 44 years and reached a complete remission; 19 lymph nodes were negative for cancer. Her clinical condition improved steadily under immunosuppressive therapy and today her intestinal symptoms are well-controlled.
Patient XX.II.1 is a 44-year-old male, who had manifested with a number of hospitalisations due to gastrointestinal symptoms such as appendicitis and severe diarrhea, that prompted many years on budesonide and anti-TNF-α treatment.
Gastroscopy at the age of 42 years showed severe atrophic gastritis with extensive intestinal metaplasia, a well-known risk-factors of gastric cancer (). The diagnosis of an in situ adenocarcinoma was based on two tubular adenomas and extensive endoscopic resection of the lesions was performed (Figure ). Laboratory values showed EBV load of 7,510 UI/ml blood and no CMV level, but PCR of biopsies were positive for EBV, CMV, and in presence of H. pylori.
He is receiving sirolimus, ustekinumab, and will start an antibiotic treatment for H. pylori. First control by gastroscopy 6 months after diagnosis showed two quiescent tubular adenomas with low grade dysplasia—gastrectomy might finally be performed when aggravation occurs.
Both patients who developed EBV-associated gastric cancer had received abatacept, a CTLA-4-Ig-fusion-protein, which is expected to improve especially the gastrointestinal symptoms in adult autoimmune enteropathy but could raise EBV serum levels (). In fact, abatacept treatment has to be interrupted in patient B.II.4 after 7 months due to increased serum levels of EBV copies and rituximab treatment was needed, but nonetheless a relapse of gastric cancer developed 2 months after interruption and patient finally underwent total gastrectomy. However, patient B.II.4 resumed abatacept treatment 18 months after her relapse following mucosal healing for her severe CTLA4-associated enteropathy, reporting a repeated sustained clinical recovery of her bowel symptoms under abatacept until today. The second case (XX.II.1) stopped his therapy with abatacept after 3 months when EBV level rose and switched to sirolimus plus ustekinumab to control sustained intestinal symptoms with protracted diarrhea. EBV load decreased within few weeks after interruption of abatacept to <500 copies/ml blood.
Nonetheless both patients will need yearly follow-up by gastroscopy and carefully monitoring of EBV load.
Patient M.II.3 was a 35-year-old male, who suffered from chronic diarrhea since he was 10 years (). Additional features were bacterial pneumonia and acute hepatitis with uncertain etiology around the age of 24 years, that needed corticosteroid pulse treatment. Around this time, he was diagnosed with CVID and started IGRT.
Acute gastritis mucosal lesions prompted recurrent endoscopies around the age of 28 years, and finally multiple biopsies at the age of 34 years revealed a poorly differentiated adenocarcinoma, a well-differentiated tubular adenocarcinoma and epithelium cells with CMV-associated antigen; no metastasis was found (Figure ).
For treatment, he underwent total gastrectomy without perioperative chemotherapy, but protracted diarrhea and enterocolitis continued postoperatively for months despite immunosuppressive therapy. Recurrence of cancerous lesions has been monitored by gastroscopies, but he never fully recovered and died 25 months after gastrectomy following a Klebsiella pneumonia-induced sepsis.
Patient G.III.2 is a 25-year-old male, who had repeated gastrointestinal examinations and recurrent active gastritis over several years, which was initially diagnosed as Crohn's disease at the age of seven years (). Additionally, he developed trilineage cytopenia and CT scan examination revealed interstitial pulmonary nodules. Despite aggressive immunosuppressive treatment he required partial colectomy at the age of 14 years, which improved his condition together with budesonide and anti-TNF-α treatment. However, his atrophic gastritis progressed and at the age of 17 years endoscopic biopsies revealed an early invasive adenocarcinoma without EBV or CMV association. The patient's treatment consisted of a total gastrectomy. Histopathology of the stomach revealed diffuse marked chronic active gastritis with multifocal areas of low to high grade dysplasia and an early invasive adenocarcinoma; 20 lymph nodes were negative for cancer. Remission was reached, but enterocolitis is still active and he requires intensive immunosuppressive therapy due to the neurological, hematological and respiratory involvement. Nonetheless, the patient is in complete remission for 7 years.
Patient CM.II.2 is a 29-year-old female, who has developed recurrent infections since the age of one year and was diagnosed with CVID at the age of 14 years, treated with IGRT.
At the age of 20 years, assessment of curious paraesthesia and muscle power decrease revealed a vitamin B12 deficiency-associated pernicious anemia. Following this diagnosis, gastroscopy discovered an early gastric adenoma (gastric type) with high grade dysplasia and without EBV or CMV association. Endoscopic submucosal dissection was made and she has been on regular follow-ups, which repetitively confirmed chronic active gastritis. Finally, at the age of 25 years, follow-up gastroscopy revealed a poorly differentiated gastric adenocarcinoma, again without viral association (Figure ).
The treatment consisted of laparoscopic subtotal gastrectomy. Chemotherapy was not realized and the patient does not have any cancer relapse since more than 3 years and is still treated only by IGRT. |
pmc-6141051-1 | A 21-year-old Caucasian female with a past medical history of fibromyalgia and a family history of hypertension (both grandparents) was admitted with a three-day history of headache and blurring of vision in her left eye. Her BP was 210/150 and physical examination was essentially normal, apart from the visual acuity of 6/4 (right eye) and 6/1 (left eye) with papilledema. Laboratory workup revealed a normal blood count, renal function, liver function, serum angiotensin-converting enzyme (ACE), 24-hour urinary catecholamine/cortisol, chest x-ray, abdominal/renal ultrasound, sestamibi scan, computed tomography (CT) of the head/renal angiogram, and magnetic resonance imaging (MRI) of the aorta/chest/ovaries. The renin-aldosterone level was raised with a recumbent aldosterone/renin of 8.5 ng/dl and 908 ng/ml/hr, respectively, as well as a standing aldosterone/renin of 19.30 ng/dl and 1964 ng/ml/hour (hr), respectively. An electrocardiogram was significant for left ventricular hypertrophy (LVH) (Figure ), an echo showed LVH and an ejection fraction of 45%, and a transesophageal echocardiogram confirmed an incidental leiomyomatous interventricular septum. Her medications, which were continued on admission, included tramadol, 100 mg twice daily (bid), and low-dose estrogen OCP. During the hospital course, Labetalol, 200 mg bid, was started. The BP remained at 165/105 mm Hg with a heart rate (HR) of 58 beats per min (bpm). Labetalol was discontinued and Moxonidine, 200 mcg, Indapamide, 5 mg, and amlodipine, 10 mg (all once daily), were initiated. By hospital day 15, the BP remained elevated at 170/100 mmHg with HR at 88 bpm. The OCP and amlodipine were stopped and metoprolol, 25 mg bid, was started. By hospital day 32, her BP was 108/60 mmHg. A diagnosis of MH due to OCP was made, and all anti-hypertensive medications were stopped except for the metoprolol. The patient was discharged home on metoprolol with a BP of 107/55 mmHg. On follow-up in the medical clinic three months later, the visual disturbances had completely resolved and her BP was 98/56 mmHg. Repeat renin/aldosterone was normal. Her visual acuity was 6/4 (right) and 6/5 (left).
The metoprolol was stopped, and a BP check one year later was 103/58 mmHg. |
pmc-6141052-1 | An 84-year-old right-handed female was diagnosed with PD at the age of 75. Her initial symptoms included bradykinesia, rigidity, and resting tremor of the right hand. The patient was initially started on levodopa/carbidopa 250/25 mg twice daily, which resulted in a significant improvement of her symptoms. Levodopa dosage was gradually increased over the years to levodopa/carbidopa 250/25 mg, four times a day. After a total of eight years on levodopa therapy, the patient started experiencing numbness of lips, along with difficulty in speaking approximately 45 minutes before the next scheduled levodopa dose. The patient described these episodes as sudden numbness, predominantly of the upper lip and a ‘feeling of the lips becoming heavy.’ This usually progressed within minutes to difficulty in speaking and freely opening the jaw. Neurological examination during these episodes showed an alert, awake, and oriented patient with difficulty in pronouncing both monosyllabic and polysyllabic words. Sensations to fine touch were decreased on the upper lip but were intact bilaterally on the rest of the face as well as the body. The patient’s anxiety and frustration over these symptoms resulted in a visit to the emergency room. The possibility of transient ischemic attack (TIA) was ruled out with a detailed neurological consult including brain and carotid imaging. A cardiovascular workup was also done which was unremarkable. Physical examinations during all these episodes showed an anxious patient, with difficulty in speaking and generalized decreased motor strength throughout the body.
After a careful review of history and discussion of the case with her primary doctor, a diagnosis of levodopa’s “wearing off” phenomenon was made. The patient consulted her neurologist with respect to the symptoms and was put on a controlled release form of levodopa with the addition of ropinirole. The new regimen successfully ameliorated the wearing-off phenomenon. Interestingly it was noted that delaying the scheduled dose of levodopa would cause the return of the symptoms. |
pmc-6141053-1 | A 77-year-old man with no history of skin cancer presented to the outpatient dermatology clinic for a scalp lesion of three weeks duration. He reported rapid lesion growth, but no change in the overall appearance nor any associated symptoms. Examination revealed a mobile, round, exophytic nodule with overlying ulceration and hemorrhagic crust, approximately 1.5 cm in diameter (Figure ). Given a high clinical suspicion of malignancy, the lesion was excised three weeks following the initial visit using a fusiform (elliptical) incision with 1 cm margins. The lesion immediately prior to the procedure is seen in Figure .
A histopathologic examination of an excisional biopsy of the cutaneous lesion revealed a proliferation of spindle and pleomorphic tumor cells, which flattened the overlying epidermis (Figure ) and extended to the subcutaneous tissue (Figure ). The tumor cells were large and polygonal and contained eosinophilic cytoplasm. They expressed diffuse CD10 positivity (Figure ) and focal CD68 positivity. The tumor cells were negative for p40 and SOX10, excluding the possibility of sarcomatoid carcinoma and melanoma, respectively. The histopathologic findings were found to be consistent with invasive pleomorphic dermal sarcoma. The tumor measured 3.3 cm at the largest dimension, and tumor cells were found to be present at the surgical margin. There was no evidence of lymphovascular or perineural invasion.
A surgical, wide, local excision was planned. Preparatory computed tomography (CT) imaging revealed an approximately 3.9 cm focus of enhancement with central ulceration in the soft tissue of the posterior scalp and confirmed a lack of bony erosion in the underlying calvarium. No metastatic adenopathy was appreciated. Figure demonstrates the scalp vertex prior to surgery. A wide local excision was performed using a 2 cm margin around the remaining tumor for a 7.5 cm area of planned excision. The repair utilized a 7x3.5 cm full-thickness skin graft from the left upper chest. The immediate post-surgical course was uncomplicated. Wound care with sterile petrolatum gauze dressing (Figure ) sutured to the scalp for two weeks helped with successful graft healing (Figure ). At the one-month follow-up after the operation, a review of systems did not reveal systemic relapse and an examination of the surgical scar and cervical lymph nodes did not reveal local recurrence. The patient will continue to have close monitoring by the dermatology team twice per year. |
pmc-6141057-1 | A 64-year-old woman with multinodular goiter and depressive disorder with no other associated comorbidities presented to the internal medicine department with facial swelling, dyspnea of moderate exertion, and a feeling of pressure on the face and chest for one month. She presented with no skin lesions or fever.
The physical examination revealed a slight degree of superior vena cava syndrome (SVCS), with facial edema and flushing of the cheeks, and edema of the upper limbs, with a slight increase in jugular venous pressure.
An abdominal-thoracic-cervical computer tomography (CT) scan was performed (Figure ) and showed a large mass in the anterior mediastinum.
Computed tomography (CT)-guided biopsy of this mass was performed in April 2014. The diagnosis was compatible with thymic carcinoma (Figure ). Laboratory tests demonstrated low levels of hemoglobin (11.4 g/dL) and high levels of L-lactate dehydrogenase (622 UI/L). A baseline echocardiogram was performed, repeated every three months, and returned normal.
With a diagnosis of unresectable thymic carcinoma stage III by the Masaoka-Koga system (infiltration of large vessels) and mild superior vena cava syndrome, induction chemotherapy treatment was planned (doxorubicin 40 mg/m2 intravenous (IV) Day 1, cisplatin 40 mg/m2 IV Day 1, vincristine 0.6 mg/m2 IV Day 3, and cyclophosphamide 700 mg/m2 IV Day 4 every three weeks) with corticosteroids (dexamethasone 12 mg daily) for the SVCS.
After three cycles of chemotherapy, the maximum patient toxicity was grade (G) 2 alopecia, G1 pseudo-influenza syndrome, G1 anemia, and G1 nausea. In the re-evaluation CT performed in July 2014, stabilization of the disease was obtained (Figure ).
The case was evaluated again in the multidisciplinary oncological committee, and surgical resection was rejected due to the great vessels tumor infiltration. It was decided to administer radical radiotherapy treatment and to undertake a new reassessment of the resectability of the tumor at the end of the treatment.
External beam radiotherapy to the mediastinal mass was administered on tomotherapy, a dose of 5040 cGy in 28 fractions was delivered, and the patient tolerated treatment well. The CT performed two months after the completion of radiotherapy showed stable disease and post-radiotherapy sequelae (G1 pneumonitis). Surgery was definitively dismissed and radiological follow-up was decided. Three months later, pleural and pericardial progression of the disease was observed. A positron emission tomography/CT (PET/CT) scan was performed, confirming the CT findings.
Palliative chemotherapy with a carboplatin area under the curve (AUC) of 5 and paclitaxel 175 mg/m2 IV every 21 days was started. After three cycles, the disease was stabilized, with acceptable tolerability (G1 neurotoxicity, G2 alopecia, G1 nausea, G1 asthenia, G1 arthromyalgia, G2 anemia, G1 thrombocytopenia, and G1 afebrile neutropenia). It was decided to administer a total of six cycles, with a stabilization on CT in September 2015. Follow-up without treatment was started.
Six months later, the progression of the disease was confirmed by the appearance of new pleural and pericardial implants. At that moment, the patient was asymptomatic, with an Eastern Cooperative Oncology Group (ECOG) scale performance status (PS) of 0 and with a normal echocardiogram and blood test. The second line of palliative treatment was started in January 2016 under compassionate use with 50 mg of sunitinib orally once a day, in six-week cycles (i.e., four weeks of treatment followed by two weeks without treatment). After the first cycle, it was necessary to lower the dose to 37.5 mg per day due to significant toxicity (G2 afebrile neutropenia, G1 thrombocytopenia, G1 hypertension and G3 asthenia), thereafter, her tolerance to sunitinib improved to grade 1 toxicities. Two months after initiating treatment with sunitinib, subclinical hypothyroidism was found, but it was resolved after starting treatment with 50 mcg per day of levothyroxine. After the dose reduction of sunitinib, the patient presented an ECOG PS of 0. After three cycles, a partial response of the disease was obtained (Figure ).
After 16 cycles of treatment with sunitinib and a progression-free survival (PFS) of 23 months, tumor progression was observed with the appearance of liver metastases in December 2017. The ECOG PS of the patient was 1 at that time. For this reason, in January 2018, the third line of palliative treatment under compassionate use was started with oral capecitabine (650 mg/m2 twice daily on Days 1-14) and gemcitabine (1000 mg/m2 IV on Days 1 and 8) every three weeks. To date, two cycles have been administered with good tolerability (G1 thrombocytopenia, G1 anemia, and G1 asthenia), pending re-evaluation with CT in one month. The current ECOG PS is 1. The overall survival (OS) obtained to date since diagnosis is 48 months. |
pmc-6141060-1 | A 46-year-old male with stage IVB nodular sclerosis Hodgkin lymphoma received treatment with six cycles of ABVD (doxorubicin, bleomycin, vinblastine, dacarbazine) and then autologous stem cell transplant. Despite these treatments, he had progression of his disease. The positron emission tomography (PET) showed hypermetabolic activity in the anterior mediastinal mass and left hilar lymph node. He underwent radiation to the mediastinum. A subsequent computed tomography (CT) scan of the chest and liver showed a progression of the anterior mediastinal mass measuring 3.7 x 2.2 cm and a new mass in the left lobe of the liver measuring 2.9 x 2.8 cm (Figures -).
A liver biopsy of the mass showed recurrent classical Hodgkin lymphoma. He was started on brentuximab vedotin at a dose of 1.8 mg/kg after administration of oral diphenhydramine 25 mg and oral acetaminophen 650 mg. Three weeks later, the second cycle was administered at the same dose with the same premedications. After receiving 10 mL of the medication, he developed facial flushing, swelling, generalized rash, and a scratchy sensation in his throat. He was given hydrocortisone 100 mg intravenously and his symptoms improved. Prior to the next cycle of treatment, the diphenhydramine 25 mg was changed to the intravenous (iv) route and dexamethasone sodium phosphate 20 mg iv and famotidine 20mg iv were added. During his third brentuximab vedotin infusion, he developed facial flushing and swelling, scratchy throat, and a rash. The infusion was stopped and he was given diphenhydramine 25 mg iv. His symptoms resolved gradually. It was decided to admit him to the hospital for cycle four for brentuximab vedotin desensitization. He was premedicated with methylprednisolone 60 mg iv, acetaminophen 650 mg orally, famotidine 20 mg iv, diphenhydramine 50 mg iv, and montelukast 10 mg orally. The following protocol was used for brentuximab vedotin at 1.8 mg/kg (Table ).
The patient had no complications during the desensitization process. For cycle five, he was admitted as well, and similarly, had no hypersensitivity reactions. The dose of brentuximab vedotin was reduced to 1.2 mg/kg on cycle six for worsening neuropathy, but the desensitization was continued. After cycle six, the treatment with brentuximab vedotin was discontinued due to worsening neuropathy and progression of the cancer. The PET scan showed several new hypermetabolic foci in the liver with mildly hypermetabolic lung nodules slightly progressed from prior imaging studies. He was started on nivolumab for further management of his Hodgkin lymphoma. |
pmc-6141216-1 | A 15-year-old girl presented to our hospital’s emergency department with episodes of generalized tonic-clonic seizures (GTCS) for the previous two days. She had seven to eight episodes per day, each lasting for approximately two minutes with associated frothing, tongue biting, urinary and fecal incontinence, and rolling of the eyes.
Initial assessment found the patient to be alert with a Glasgow coma scale (GCS) score of 15/15, albeit irritable and anxious. Her heart rate was 100 beats per minute with a respiratory rate of 20 per minute, blood pressure of 140/100 mmHg, and a temperature of 98°F. Neurological examination revealed intact cranial nerve responses. An ophthalmological examination revealed round pupils that were equally reactive to light and accommodation. Extraocular movements were normal while a fundoscopic examination revealed normal intraocular definitions. The patient was subsequently admitted for initial stabilization and subsequent workup.
Initial laboratory investigations showed hyponatremia (126.1 mEq/L) and hypokalemia (3.08 mEq/L). Her hemoglobin was low (11.5 g/dL) and alkaline phosphatase (ALP) was raised (147 U/L). T2-weighted and fluid-attenuated inversion recovery (FLAIR) magnetic resonance imaging (MRI) sequences discovered hyperintense lesions in the right frontal lobe, bilateral parietal lobes, left occipital lobe, and right temporal lobe (Figures -).
A cerebrospinal fluid (CSF) analysis via lumbar puncture was unremarkable except for oligoclonal bands. Serum and CSF polymerase chain reactions (PCR) and serologies for common bacterial and viral etiologies were negative. An electroencephalogram (EEG) showed a background rhythm of a moderate amplitude of 8 Hz and an alpha activity with an anterior-to-posterior gradient. This background activity was intermixed with theta and delta waveforms that were more prominent in the right temporal region.
The patient did not provide a history that could elucidate the semblance of a previous demyelinating disease. In lieu of these findings, our patient was diagnosed with ADEM. She was subsequently started on a regimen of intravenous (IV) methylprednisone (30 mg/kg/day) and oral divalproex sodium (500 mg BID). In the ensuing days, she remained seizure-free but developed insomnia and poor appetite with a decreased oral intake. She also started complaining of generalized abdominal and bone pains, which were conservatively managed with acetaminophen as needed. An abdominal ultrasound was carried out, which showed a contracted gallbladder but no gallstones, biliary sludge, or thickening of the wall of the gallbladder.
The patient was discharged after eight days with a prescription for oral prednisone (2 mg/kg/day) to prevent a relapse of ADEM as well clonazepam and levetiracetam for seizure control. She remained symptom-free for the next two months. The MRI performed on a follow-up visit revealed a resolution of previously noted lesions on T2-weighted-FLAIR sequences.
After two months, she presented to our outpatient setting with recurring complaints of generalized abdominal pain and proximal lower limb pain for the last two days. She also reported a new development of tea-colored urine and fatigue for the last one week. She was admitted for further workup under the suspicion of idiopathic myositis. A physical examination was negative apart from marked tenderness that was observed along the proximal half of the lower limbs. Laboratory investigations showed a creatinine phosphokinase (CPK) of 22 U/L, serum lactate dehydrogenase (LDH) of 153 U/L, thyroid-stimulating hormone (TSH) of 0.99 mIU/L, C-reactive protein (CRP) of 0.3 mg/L, and an erythrocyte sedimentation rate (ESR) of 24 mm/hour. A simple urine test was performed in which the urine sample of the patient was exposed to sunlight, which showed darkening of urine (Figure ).
Urine analysis revealed that the specimen was positive for proteins (2+), ketones (2+), bilirubin (1+), nitrite (1+), trace leukocyte esterase, and red blood cells. Urinary porphyrins and urinary porphobilinogen were ordered along with nerve conduction studies (NCS), electromyography (EMG), and MRI of the spine. The NCS, EMG, and MRI spine results were unremarkable. Total porphyrins in urine came out to be >1500 µg/L, 24-hour urine porphyrins were >1650 µg/24 hours, and urine porphobilinogen levels were 16.97 mg/24 hours. Hence, she was diagnosed with AIP and started on appropriate management. |
pmc-6141217-1 | A 35-year-old pregnant patient at 16 weeks presented to our emergency department with symptoms of vomiting, loose motions, confusion, fever, slurred speech, and blurring of vision for four days. The patient was treated with intravenous fluids for hyperemesis gravidarum in another hospital without much improvement during the previous 14 days. On examination, the patient was awake, restless, confused, responding verbally, following one step commands on repeated verbal stimuli, neck soft, restricted extraocular movement, incomplete ophthalmoparesis with bilateral lateral and medial gaze paresis and ocular bobbing in upward vertical gaze. Both plantars were down-going and the patient was moving all four limbs simultaneously. The tone was normal in all four limbs. Power was 4/5 in both upper limbs and 0/5 in lower. The muscle stretch reflexes were 4/5 in all four limbs.
Laboratory investigations showed hemoglobin of 13.2, total leucocytes count of 11.2 with 40% lymphocytes. Urine detailed report showed a leucocyte count of 10 and was nitrite positive. Other tests including platelet count, urea, and creatinine, electrolytes all came out normal. Ultrasound was ordered which showed single alive intrauterine gestation of 16 weeks. Magnetic resonance imaging (MRI) showed hyper-intense and diffusion restricted areas in the peri-tectal region and bilateral medical thalami (symmetrical) suggestive of WE as shown in Figure .
The patient received thiamine 100 mg two times daily for three days then 100 mg once daily till complete resolution of symptoms; the patient also received other vitamin B supplements during hospitalization. The patient’s condition improved dramatically over the next few days and she was discharged on parenteral nutrition. |
pmc-6141219-1 | A 61-year-old woman with a history of treated pulmonary tuberculosis in childhood, bronchiectasis, hypertension, hypothyroidism, polymyalgia rheumatica, and hyperlipidemia presented to our clinic with two months of shortness of breath on exertion associated with worsening lower extremity edema, vomiting, subjective fever, and watery diarrhea three days prior to admission.
Upon admission, she presented hemodynamically stable. On physical examination, she had bibasilar lung crackles and pitting edema bilaterally. Her blood urea nitrogen level was 82 mg/dL, creatinine level was 11.91 mg/dL, sodium was 129 mmol/L, potassium was 8.6 mmol/L, bicarbonate was 19 mmol/L, and hemoglobin was 7.3 g/dL. She was admitted due to acute kidney injury (AKI) secondary to acute tubular necrosis, presumably from volume depletion. An attempt was made to manage the AKI medically, but oliguria and worsening acidosis and hyperkalemia prompted hemodialysis.
Further studies revealed the presence of serum myeloperoxidase (MPO)-anti-neutrophil cytoplasmic antibodies (ANCA), serum anti-glomerular basement membrane (GBM), and red blood cells in her urine. She received intravenous methylprednisolone 500 mg for three days. A renal biopsy showed MPO-ANCA mediated with concurrent anti-GBM disease crescentic necrotizing and focal sclerosing glomerulonephritis, establishing the diagnosis of Goodpasture syndrome with rapidly progressive glomerulonephritis. She received four cycles of rituximab and continued with prednisone 60 mg daily.
The hospital course was complicated by a Clostridium difficile infection and hospital-acquired pneumonia (HAP). Also, she acutely presented an episode of respiratory distress: her respiration rate was >24 breaths/minute, oxygen saturation was <90%, heart rate was >120, blood pressure was 180/100 mmHg, and we noted labored breathing via accessory muscles, expiratory wheezing, and expectoration of frothy secretions. The patient was intubated and transferred to the cardiac care unit. A 12-lead electrocardiogram (ECG) showed an ST and T wave abnormality (Figure ) compatible with anterolateral ischemia.
A transthoracic echocardiogram (TTE) revealed an ejection fraction (EF) of 20% to 25%, grade 2 diastolic dysfunction, systolic right atrial pressure (RAP) of 15 mmHg, and right ventricle systolic pressure (RVSP) of 59 mmHg. The left ventricle was normal in size, but there were regional wall motion abnormalities. Apical and basal segments contracted normally, but the mid-anteroseptal, inferolateral, and anteroapical walls were hypokinetic. The anteroapical wall appeared to be dyskinetic. She was started on carvedilol and lisinopril. A follow-up TTE three weeks later revealed an EF of 50%, grade 1 diastolic dysfunction, systolic RAP of 3 mmHg, and RVSP of 33 mmHg with an improvement in the previously described wall motion abnormalities, suggestive of resolving the mid-ventricular variant of Takotsubo cardiomyopathy (Video ). Pheochromocytoma was not ruled out given the absence of typical signs and symptoms.
Late in her hospital course, she presented two episodes of respiratory distress considered secondary to Goodpasture syndrome and fluid overload; these episodes were managed with nasal intermittent positive pressure ventilation and furosemide. The patient required resumed intermittent dialysis and was successfully discharged. On an 18-month follow-up office visit, she remained asymptomatic, cardiovascular wise. However, because of the chronic kidney disease, she underwent a kidney transplant. |
pmc-6141260-1 | This 38-year-old military man was referred for the evaluation of radicular pain over the posterior aspect of his right leg and numbness at the planter aspect of his right foot for 3 weeks of duration. The patient had a history of being injured by several missile fragments 11 years before admission. With probable diagnosis of S1 root radiculopathy from L5–S1 disc herniation, lumbar myelography in another institution was normal. With continuing discomfort, he was referred to our institution.
His neurological exam revealed distal sciatica at the course of S1 root, with hypoesthesia of the right sole. Further examination and palpation revealed a painful and pulsatile mass in the popliteal region. A bruit was heard in auscultation. With the diagnosis of a pseudoaneurysm, selective angiography was done and this revealed a pseudoaneurysm arising from the proximal segment of the anterior tibial artery. The artery bowed because of the compressive effect of the pseudoaneurysms (
). With consideration of the existence of difference between the size of the aneurysm in angiography and the size of the mass in palpation, contrasted CT scan was done to estimate the exact size of the aneurysm. This showed a large isointense mass with rim enhancement surrounding a hyperdense area. The rim was compatible with the pseudocapsule of the aneurysm and the isointense mass was an old clot where hyperdense area was the patent part of the aneurysm (
). |
pmc-6141408-1 | A 40-year-old woman known for type 1 diabetes presented to the emergency room with back pain, diffuse myalgia, asthenia, and fever (38.5 °C). She had been taking nonsteroidal anti-inflammatory medication for 5 days following a trauma of the left ankle. Physical examination showed hypotension with arterial blood pressure of 70/30 mmHg. The patient remained hypotensive despite fluid resuscitation with crystalloids and required continuous norepinephrine infusion. At the time of admission, the patient complained of important pain in the left limb, although this was associated with a normal clinical examination. A small skin defect on the left ankle in relationship with the initial trauma was, however, noted. The gynecologic examination was normal. Laboratory tests on admission showed elevated plasma C-reactive protein and procalcitonin levels (320 mg/L and 23 μg/L, respectively), an estimated glomerular filtration rate of 15 mL/min/1.73 m2, an absolute neutrophil count of 1.4 G/L with increased band forms, thrombocytopenia (63 G/L), increased thromboplastin time, and very elevated creatine kinase levels (143,000 U/L). The patient was admitted to the intensive care unit (ICU) with the diagnosis of septic shock, and empiric antibiotic therapy was initiated with piperacillin/tazobactam plus clindamycin. A CT scan of the limb did not show radiologic signs of necrotizing fasciitis, but the patient subsequently rapidly developed signs of arthritis of both ankles plus the right elbow, which required surgical lavage. Synovial fluid and blood cultures came back positive with group A streptococcus (S. pyogenes), and the antibiotic therapy was deescalated for high-dose IV penicillin G. In spite of the initial acute renal failure and rhadomyolysis, the patient did not need renal support therapy during the ICU stay, could be transferred to the ward after 6 days, and recovered without sequelae. The final diagnosis was a toxic shock syndrome due to group A streptococcus with septic oligoarthritis, most probably originating from a skin lesion and a left ankle trauma, in young woman with type 1 diabetes. |
pmc-6141414-1 | During a routine health check-up of a 73-year-old woman, abdominal ultrasonography incidentally revealed a retroperitoneal tumor with a maximum diameter of approximately 80 mm at the upper pole of her right kidney. She was admitted to our institution for examination of the tumor. The patient had been taking medication for hypertension, and her blood pressure had been maintained at 120–130 mmHg with 20-mg/day nifedipine and 2.5-mg/day carvedilol. She had no notable abnormal findings in her general biochemistry, complete blood count, or the coagulation test. Various tumor markers, including carcinoembryonic antigen, carbohydrate antigen 19-9, squamous cell carcinoma-related antigen, and carbohydrate antigen 125, levels were also within normal ranges. Her blood noradrenaline and dopamine levels were within normal ranges, but her adrenaline level was elevated at 0.12 ng/ml and the 24-h urinary excretion of catecholamines and their metabolites were all increased (Table ). The adrenal cortical hormone seemed to be within the normal range, but the 1-mg dexamethasone suppression test revealed mild autonomous cortisol secretion (5.9 μg/dl). Contrast-enhanced computed tomography (CT) revealed a cystic retroperitoneal tumor with a maximum diameter of 88 mm within the right adrenal gland (Fig. ). The tumor included a walled nodule, revealed by its contrast effect in the early phase. The interior of the cyst was filled with a low-density fluid with no observed contrast effect. On magnetic resonance imaging (MRI), the nodule exhibited a low signal in the T1-weighted image and a high signal in the T2-weighted image. The cyst wall accumulated an abnormal level of the marker in both 123I-MIBG scintigraphy and positron emission tomography with 2-deoxy-2-[fluorine-18] fluoro-D-glucose/CT (Fig. , ). From these findings, although the 24-h urinary excretion of catecholamines and their metabolites were not sufficiently high enough to meet the diagnostic criteria of pheochromocytoma, in consideration of image findings and clinical course, we strongly suspected that the tumor was predominantly a degenerating pheochromocytoma. The patient was scheduled to undergo tumor resection.
However, preoperative MRI incidentally revealed a cerebral aneurysm, 8 mm in diameter, at the junction of the basilar and superior cerebellar arteries (Fig. ). We, therefore, discussed with a neurosurgeon, anesthesiologist, and endocrinologist whether the retroperitoneal tumor or the cerebral aneurysm should be prioritized for treatment. Based on its size and location, the annual rupture rate of this cerebral aneurysm was estimated to be approximately 1% [], and its deep location and large size posed a relatively high surgical risk. We, therefore, decided to proceed with the resection of the tumor, aware of the risk of an intraoperative rupture of the aneurysm subsequent to surgery-induced hypertension.
We decided to conduct more rigorous blood pressure management for the patient’s surgery. Her preoperative blood pressure was managed under 120 mmHg using 32-mg/day doxazosin and 2.5-mg/day carvedilol. We used epidural anesthesia for thorough analgesic management and general anesthesia centered on propofol and remifentanil, and we carefully monitored the blood pressure. After inducing general anesthesia, a lumbar catheter was placed to monitor for intraoperative rupture of the cerebral aneurysm. In addition, we used transcranial motor-evoked potential and somatosensory-evoked potential monitoring to track her intraoperative neurological function. Subsequently, the surgical procedure was performed via a right subcostal incision with upper midline extension. During the surgery, we focused on fluctuations in blood pressure. Prior to full-scale tumor mobilization to prevent excessive secretion of catecholamine, we first ligated and separated the feeder arteries, consisting of three right adrenal arteries, followed by the drainage vein, consisting of a right adrenal vein. Next, we removed the tumor with minimal mobilization. The tumor had not noticeably invaded the surroundings. There was no blood outflow from the lumber catheter during the procedure. We withdrew the catheter immediately post and used head CT to confirm there had been no intracranial hemorrhage. No intraoperative blood pressure fluctuation was observed, and the cerebral aneurysm monitoring devices showed no abnormality. Complete resection (R0) was achieved by pathologically determining the negative surgical margin during surgery.
Macroscopically, the cystic tumor was approximately 100 mm in diameter with an interior that was almost necrotic (Fig. ). Microscopically, two types of atypical cells with enlarged heterozygous nuclei were observed in a part of the cyst wall (Fig. ): neuroblastic cells positive for neuron-specific enolase (Fig. -) and cells morphologically similar to ganglion cells and positive for S-100 (Fig. -). The ganglion cells were also immunohistochemically positive for tyrosine hydroxylase, DOPA decarboxylase, dopamine-beta-hydroxylase, and phenylethanolamine-N-methyltransferase. These two types of atypical cells were observed to form nodules without intermixing. Because no tumor cells judged as pheochromocytoma were observed, the tumor was histopathologically diagnosed as nodular GNB within the right adrenal gland. In addition, because the position of the tumor cells coincided with the site where 123I-MIBG scintigraphy showed abnormal accumulation, the tumor was diagnosed as a catecholamine-producing GNB.
The postoperative course was good, and the patient’s blood pressure after surgery was maintained under 110 mmHg with no antihypertensive agents. She was discharged on the 7th day postoperatively. An examination after discharge confirmed that her blood and urinary catecholamine levels and metabolite excretion had returned to normal (Table ). Three months postoperatively, no recurrence was observed.
GNBs frequently occur in children, but their onset in adults is extremely rare []. Adult GNBs have a high potential to be malignant, and there have been many reports of distant metastasis to various organs, including the liver and bones []. Most reported adult GNBs do not produce catecholamines; therefore, catecholamine-producing GNBs are considered to be particularly rare []. In our case, GNB developed in the adrenal gland. Including this case, there have been only 14 case reports in the English-language literature on GNB in adult adrenal glands [–], except for composite types with pheochromocytomas. Among these 14 cases, only four (including the present case) involved catecholamine-producing GNBs [–] (Table ). Hypertension has been reported in approximately 10% children with neuroblastoma [], but only one other case of an adult GNB patient with hypertension has been reported []. In that case and ours, the 24-h urinary excretion of catecholamines and their metabolites showed abnormally high levels, suggesting a relationship between the tumor and hypertension. It is difficult to distinguish a catecholamine-producing GNB complicated with hypertension from a pheochromocytoma based on catecholamine dynamics, such as the 24-h urinary excretion of catecholamines and their metabolites, or 123I-MIBG scintigraphy. We, therefore, assumed that the tumor was a pheochromocytoma preoperatively. However, because both pheochromocytomas and GNBs are classified as malignant tumors, it was appropriate to resect the tumor.
It was also noteworthy that our case had a cerebral aneurysm. A catecholamine-producing tumor with a cerebral aneurysm requires much more cautious management, but there is no definite consensus over management because of limited reports. A search of PubMed found no previous reports of GNB with a cerebral aneurysm, although there have been five reported cases of pheochromocytoma with cerebral aneurysms [–]. In four of these cases, treatment of the tumor preceded the treatment of the cerebral aneurysm [–], even though in all four cases, the risk of rupture was very high or there was a history of rupture. One of these four cases developed cerebral infarction during the cerebral aneurysm surgery. In the fifth case, treatment for the pheochromocytoma proceeded because of the low risk of rupture []. In all of these cases, the focus during surgery was only on fluctuations in blood pressure. In the present case, we thoroughly monitored for a potential rupture using an intraoperative lumbar catheter, monitored somatosensory and motor-evoked potentials to track neurological function, and performed a head CT immediately after surgery. Even though the risk of spontaneous rupture of the cerebral aneurysm was low, the intraoperative blood pressure fluctuation owing to the catecholamine-producing tumor had the potential to affect the status of the aneurysm. If any of these intraoperative monitoring processes suggested an aneurysmal rupture, we would have performed an immediate craniotomy to repair it. If the tumor surgery was in its final stage, we would have performed a craniotomy after completing the resection; conversely, if the feeding arteries had not been treated and the tumor surgery was still at an early stage, we would have given priority to the craniotomy.
For catecholamine-producing tumors with a cerebral aneurysm, whether the tumor is pheochromocytoma or GNB, careful consideration should be given to the order in which the treatments should take place, taking into consideration the risk of rupture and the possibility of malignancy. Our strategy for this catecholamine-producing tumor with cerebral aneurysm may be helpful in the treatment of similar cases in the future. |
pmc-6141424-1 | A 57-year-old housewife (mother of a family) suffering from weakness and fatigue was admitted into our clinic. The results of cell blood count (CBC) showed Hb=5 normochromic normocytic anemia. The level of ferritin was 394 Nano grams per milliliter. The level of total bilirubin and direct bilirubin were 4.3 and 0.8 milligrams per deciliter, respectively. The level of LDH was 800 milligram per deciliter. Direct and indirect coombs tests were strongly positive. According to the results of bone marrow biopsy and immunoelectrophoresis, the definitive diagnosis of Waldenstrom's macroglobulinemia (WM) was made. She was treated with a combination of rituximab, cyclophosphamide, dexamethasone and thalidomide. She did not experience relapse episode.
She had five children; two daughters and three sons. She used to suffer from dermatitis and eczema many years ago. There was not any other significant chronic disease or immunodeficiency disorder in her past medical history. In the past health history, regardless of solid fats in her diet, she maintained a well-balanced diet, but she had a sedentary lifestyle with stress. Her body mass index was normal. She used mobile phone rarely. Regarding the social determinants of health, she came from a family of the middle socioeconomic status and lived in a crowded neighborhood. In her family and personal history, there were not any significant familial or environmental risk factors for lymphoproliferative cancers including carcinogenic drugs, pesticides, herbicides, hair color, air freshener spray, detergents, tobacco or other chemical carcinogenic agents. |
pmc-6141424-2 | A 32-year-old married housewife, who was the fourth child of her family, complained that she had been suffering from fatigue and abdominal pain for the past 15 years. The spleen was palpable 3 cm below the costal margin. The following results were noted: WBC: 100,000, Hb: 10, and PLT: 800,000. The level of MCV, MCH and MCHC were within normal range. The results of bone marrow aspiration and biopsy confirmed the chronic myelogenous leukemia (CML). She was treated with 400 milligrams of imatinib per day and responded to the treatment. She did not experience any relapse.
She had a daughter and a son. In her past medical history, she had been suffering from morphea-like patches on her abdomen and back (a localized type of scleroderma that causes discolored, painless patches on the skin) for the past 15 years. Her healthy brother has also experienced morphea. She was a stressful person and had not enough physical activity, but followed a healthy diet. The patient was considered obese with a BMI at nearly 30. She played computer games on her own cell phone at least 2 hours daily and kept it close by overnight. She had been living in the same neighborhood as her parents until 3 years before diagnosis of her malignancy. No significant environmental risk factor was detected in her personal history. |
pmc-6141424-3 | The fifth child was a 28-year-old married housewife suffering from fever and abdominal pain. She had splenomegaly without systematic lymphadenopathy. Findings of sonography showed two hypoechoic masses (10×8 and 29×27 millimeter). The results of abdominal and pelvic computed tomography (CT) with oral and intravenous contrast were similar to the sonography findings. There were not any abnormal findings in lung CT scan and bone marrow biopsy. Splenectomy was done and splenic involvement by diffuse large B-cell lymphoma was identified. Following surgery, the patient received 8 cycles of R-CHOP chemotherapy (Rituximab: 375 mg/m2, Cyclophosphamide: 750 mg/m2, Doxorubicin: 50 mg/m2, Vincristine: 1/4 mg/m2, Prednisone: 100 mg/m2). Meanwhile, 8 cycles of Rituximab were also administered every three months. Finally, the patient entered remission and has not experienced any relapse until now. Her past medical history showed that she suffered from infertility and was childless. The past health history was the same as other family members. Her body mass index was normal. She did not spend more than an hour on her mobile phone daily. She lived in the same neighborhood as her parents. The patient did not report over exposure to the environmental risk factors. The descriptive characteristics of all three cases are presented in . |
pmc-6141432-1 | An 11-year-old boy was referred to the Dermatology outpatient clinic with a complaint of patchy hair loss on his scalp noticed by parents one month before. On examination, he had 3 x 2 cm patch of alopecia on the occiput, without scarring. A diagnosis of alopecia areata was considered and treated with topical steroids. Four months later, he presented with intermittent fever, cough and weight loss that started from the past 45 days.
On examination, he was pale and cachexic with hepato-splenomegaly (16cm and 16.4cm, respectively). There was no cyanosis, clubbing, lymphadenopathy or pedal oedema. Alopecia over the scalp was regressing. Rest of the systemic examination was normal. Investigations showed anemia (Hb: 5.2 Gm%), elevated acute-phase reactants (ESR -99mm/hr, CRP-185mg/L) & Serum LDH levels (428IU/L) with hypo-albuminemia (3.14 Gm/dl). Mantoux test and serological tests for the diagnosis of HIV, HCV, HBsAg were negative. Sputum AFB and aerobic culture were also negative. USG abdomen and contrast-enhanced computed tomography (CECT) () identified enlarged lymph nodes in the abdomen (extending from D11 to L4 vertebral level) and thorax (paratracheal), so a preliminary diagnosis of lymphoma was made. There was no evidence of consolidation or other abnormalities in CECT thorax. Bone marrow study showed no evidence of infiltration. A diagnostic laparoscopic biopsy was done, and histopathological () examination (Reed-Sternberg cells) and immunohistochemistry {positive CD15 & CD30 (membrane and Golgi zone), negative CD 20, CD 3, LCA, ALK 1} was consistent with classical Hodgkin's lymphoma (Lymphocyte-rich). A diagnosis of stage III B classical Hodgkin's lymphoma was considered.
On the sixth post laparoscopic day, two episodes of generalised tonic-clonic seizures followed by altered sensorium were observed. Magnetic resonance imaging (MRI) brain (, ) was suggestive of pontine demyelination. MRI showed no evidence of tumor deposits in brain. He was afebrile and had no dyselectrolytemia [sodium: 138meq/L (135-145mmol/L), Potassium: 4.1mmol/L(3.3-4.6mmol/L), Chloride: 102mmol/L (98-106mmol/L), Calcium:8.6mg/dl (8.4-10.2mg/dl), Phosphorous:3.4mg/dl (2.9-5.4mg/dl), Mg:1.8meq/L(1.5-2.3mg/dl)]. There were no rapid shifts in the electrolyte levels during hospitalization. Other causes of pontine myelinolysis were ruled out (AST: 25U/L (10-40U/L), ALT: 40U/L (5-45U/L), Serum albumin: 3.3gm/dl (3.5-5.6gm/dl), Plasma Ammonia: 24 micromol/L (11-35 micromol/L), Random blood sugar: 90mg/dl (60-140mg/dl), Serum urea: 16 (7-18mg/dl), serum ceruloplasmin:25mg/dl (15-45mg/dl), Urine copper:40mcg/24hrs (0-70mcg/24hrs) and a normal ANA profile).
He was started on vitamin supplementation on day 1 of admission due to the malnourished state and was continued parenterally during and after the operative procedure. Neurologist opinion was obtained and a probable diagnosis of demyelination as a paraneoplastic manifestation of Hodgkin's lymphoma was considered as other casuses were ruled out. Cerebro-spinal fluid (CSF) analysis, including cell cytology to look for abnormal cells, was normal, and he was started on high-dose Methylprednisolone. Later, he developed a high-grade fever with seizures. Repeat CSF analysis revealed normal cell count and protein, no abnormal cells, but showed positive titers for HSV-2 (ELISA). Deterioration of the clinical condition was attributed to HSV infection. Electroencephalogram (EEG) showed a severe diffuse disturbance of electrical function, so he was started on IV Acyclovir and continued on antiepileptics (Levetiracetam 50mg/kg/day & Phenobarbitone 6mg/kg/day). Seizures were controlled; however, he sustained neurological deficits (spasticity& dystonia). He was started on chemotherapy (ABVD) once his general condition improved. Abdominal lymph nodes and hepatosplenomegaly regressed following chemotherapy and his functional capacity for basic work activities (i.e., the ability to sit, walk with support and feed himself) improved over a period of time. |
pmc-6141742-1 | The proband (2.5 years old) was a male child from a non-consanguineous family with no immunodeficiency history. The mother reported two abortions prior to the birth of the child by cesarean section at 37 weeks. The patient was discharged from the hospital after 48 h without any clinical manifestations. The first clinical manifestation was bullous impetigo at 18 days of age, which was treated with oxacillin and amikacin for 28 days.
Thereafter, the child was hospitalized with pneumonia, with chest X-ray showing a hypotransparent lesion in the lower right lobe (Figure ). The patient was treated with antibiotics for 35 days (5 days of clavulanate, 10 days of cefuroxime, and 20 days of cefepime and vancomycin). Due to his bullous impetigo and pneumonia, with a delayed response to treatment and low weight development, primary immunodeficiency was suspected, and the patient was discharged from the hospital with sulfamethoxazole-trimethoprim (TMP-SMX) and itraconazole prophylaxis at 3 months of age. At 5 months of age, he developed axillary lymphadenitis caused by a BCG vaccination reaction. His regional BCG infection (BCGitis) improved after isoniazid and ethambutol treatment for 45 days, with a normal BCG scar and without BCG dissemination.
The patient then developed a persistent subcutaneous nodule in his upper limb at 6 months of age. Biopsy showed granulomatous dermatitis with epithelioid histiocytes, few lymphocytes and no giant cells, and it was negative for BK and fungi. At 9 months of age, a new episode of pneumonia developed. Thorax computed tomography (CT) revealed a hypotransparent lesion in the left upper lobe that improved with cefuroxime treatment. However, chest X-ray confirmed a consolidation lesion in the left upper lobes (Figure ), and subcutaneous nodular lesion biopsy showed nonspecific granular cells. The pulmonary lesions improved with treatment. His prophylaxis treatment was suspended at 10 months of age.
The patient developed bacterial cervical adenitis, which was treated with amoxicillin and clavulanate for 21 days, with total resolution when he was 1 year old. However, 1 month later, he started to present intermittent fever and received a new diagnosis of pneumonia and large consolidation lesions. The pediatric service indicated an oncology study, which revealed a normal myelogram. There was no evidence of neoplasm. Pulmonary biopsy showed a granuloma lesion with areas of central necrosis that was not caseous and was negative for BK and fungi; abdominal ultrasound was normal, and PCR was negative for BK in gastric lavage and culture. Immunological tests revealed hypergammaglobulinemia and a subpopulation of CD4, CD8, and CD19 lymphocytes above the 90th percentile. According to chest X-ray, the parents had no contact with BK. His lesion improved markedly after prolonged antibiotic therapy, with the presence of a hypotransparent lesion.
The hypothesis for primary immunodeficiency in phagocytes was investigated using the dihydrorhodamine (DHR) assay, and the abnormal result of ROS production in granulocytes after stimulation was suggestive of CGD (Figure ). We then performed flavocytochrome b558 staining to observe gp91phox and p22phox expression at the membrane by flow cytometry. The lack of membrane flavocytochrome b558 in this patient in comparison to his mother and a healthy donor suggested gp91phox and p22phox expression failure (Figure ). In addition, we sequenced the CYBB gene to confirm CGD diagnosis. The sequence data were analyzed using NCBI () and Ensembl SNP () databases. This analysis confirmed a missense mutation (c.376T > C) in exon 5 that leads to a C126R substitution in the gp91phox protein; conversely, the mother and healthy donor presented the normal sequence, confirming a diagnosis of CGD caused by a de novo mutation (Figure ). Cysteine 126 is conserved, and this C126R substitution has a 180 score according to the Grantham matrix in MutationTaster () (Figure ). At follow-up visits, the patient showed improvement with long-term sulfamethoxazole and itraconazole treatment for CGD prophylaxis. |
pmc-6142315-1 | A 6-year-old Chinese girl presented to People’s hospital of Leshan, Department of Ophthalmology, in August 2017. The parents reported their child with a progressive loss of vision and bluish discoloration of sclera. Family history was negative for known conspicuous eye disorders, no infections or abnormalities in pregnancy or birth, and show no genetic disorders were known. General pediatric physical examination was normal for all systems. The parents and other members of the family were all native Chinese, had no abnormality of the eyes. Overall general physical examination was normal for all systems.
On ophthalmological examination showed that the cornea were obviously prominent, with a significant bluish discoloration of the sclera in both eyes (Fig. ). The examination of anterior segment eye manifested that an obviously thin cornea with protrusion and the posterior segment was examined by Optosmap Daytona and showed no retinal anomalies or retinal detachment (Fig. ). Pentacam HR anterior segment tomography indicated that keratoconus with steepening in both eyes which have a maximum keratometric power of 54.10 D in the right eye and a maximum keratometric power of 54.40 D in the other eye (Fig. ). The thinnest point of cornea assessed by Pentacam,which showed that the right eye was 324 μm thickness with corneal astigmatism in topography (− 2.6D at 163 degrees) and 313 μm thickness measured in the other eye with corneal astigmatism in topography (− 2.7D at 172 degrees) (Fig. ).
The best corrected visual acuity of right eye was 80/200 and the manifest refraction was − 4.75 /− 2.25 × 180. In the left eye, the best corrected visual acuity was 60/200 with − 3.00/ -4.00 × 170. Intraocular pressure was within normal levels (10 mmHg in the both eyes) []. Axial length was 21.45 mm in the right eye and 21.33 mm in the left eye. All which suggested that she is a refractive myopia. Specular microscopy showed that the right eye with the density of 3,459 cells/mm2 in corneal endothelial and 3,654 cells/mm2 in the left eye. According to clinical symptoms and signs, the child was diagnosed with keratoconus, blue sclera, and refractive myopia. Therefore, a presumptive diagnosis of BCS can be made and referred her to the Contact Lens Department to improve her visual acuity. |
pmc-6142321-1 | An 11-month-old Palestinian baby boy presented with distended abdomen, hepatomegaly, and splenomegaly. On evaluation, his body weight was 8.2 kg (third percentile), height 76 cm, (75th percentile), and head circumference 45.8 cm (75th percentile). His parents are first-degree cousins; our patient has three female siblings. All are healthy of Arab Muslim descent, from Seer village-Qalqilya district, Palestine.
Full metabolic screening, blood count, differential tests, immunology screen, infectious disease screen, urine and biochemical tests, as well as amino acid screening were performed as shown in Table .
Genomic DNA was extracted from our patient and his mother’s blood using NucleoSpin® Blood DNA extraction method (MACHEREY-NAGEL, Germany). His father’s blood sample could not be analyzed due to inaccessibility. The entire SMPD1 gene including the exons and introns (4276 bp) was amplified using LongAmp™ Hot Start Taq 2X Master Mix (New England BioLabs) and the two primers SMPD1-P1F: AGAAGGGTAATCGGGTGTCC and SMPD1-P4R: AGCTCCAGGAAAGGAGAAGG (see Zhang et al. []). These primers were selected among four sets of primers that were previously used to amplify relatively short sequences followed by de novo assembly using Geneious bioinformatics software to obtain the full length of SMPD1 gene []. The polymerase chain reaction (PCR) was performed as follows: 35 cycles at 98 °C for 10 seconds, 53 °C for 15 seconds, 72 °C for 50 seconds, then the cycles followed with 72 °C for 5 minutes. The PCR product was visualized on a TapeStation machine (Agilent), cleaned by AMPure XP beads – Beckman Coulter (X0.6), and eluted in 25 μl elution buffer. The product was loaded again on TapeStation (Agilent) to confirm the exact size of the amplified product and cleaning efficiency. The PCR product was quantified by Qubit® Fluorometer (Invitrogen) machine and diluted to 0.2 ng/μl. Finally, 1 ng was used to prepare the next generation library using Nextera XT kit (Illumina) as recommended by the manufacturer. Library purity and quantity were evaluated again by TapeStation and Qubit machines. Concentration of 4 nM was prepared from the two samples. Two million reads for each sample were targeted. Samples were deep sequenced on NextSeq 500/550 machine using the 150-cycle Mid Output Kit (Illumina).
DNA sequences were de novo assembled and aligned to human reference gene (GenBank; GeneID NG_011780.1, Ensembl version ENSG00000166311 and protein identified as UniProtKB – P17405) using Geneious bioinformatics software (Biomatters Ltd., Auckland, 1010, New Zealand). Multiple sequence alignment was done online () as described by Corpet [].
Due to fever and cough, X-ray imaging of our patient’s chest was done, and was normal. An ultrasound test showed that his liver was 12.1 cm (upper limit for normal 10 cm) with spleen 8.3 cm (upper limit for normal 8.0 cm). No lymphadenopathy was observed. The differential diagnosis for mild hepatosplenomegaly with no lymphadenopathy might underlie a metabolic or hematological disorder. An ophthalmic examination revealed a cherry-red spot in the macula in both eyes.
Complete blood count, differential test, and coagulation test were normal. Microbiology blood culture was negative. Moreover, all tests for Epstein–Barr virus (EBV), cytomegalovirus (CMV), hepatitis (A–C), rubella, Toxoplasma, visceral leishmaniasis, pediatric respiratory panel, and anti-tissue glutamines were negatives.
Urine analysis was normal. Molecular microbiology showed negative results for EBV and CMV by quantitative PCR.
Hyperlipidemia was evident, that is, high total cholesterol, low-density lipoprotein (LDL), and triglycerides, while high-density lipoprotein (HDL; 0.16 mmol/L) showed a lower level than normal (Table ). Cholesterol/HDL ratio (30.25) was significantly high compared to the normal ratio (≤ 4.5).
Amino acid screening showed high level of methionine (63 Umol/L) and threonine (216 Umol/L). Serum alkaline (ALK) phosphatase, alanine aminotransferase (ALT), aspartate aminotransferase (AST), and C-reactive protein (CRP) were above normal limits (Table ).
Several metabolic enzymes were tested and shown to be normal (Table ). The alpha-galactosidase was slightly low but not in disease range.
Physiological oligosaccharide in urine does not evoke an oligosaccharidosis (Table ). A sialic acid assay was conducted, and no increase of free N-acetylneuraminic acid (NANA) storage or excretion was noted, thus, Salla disease was excluded. Free and total plasma carnitine was examined, with slight decrease in free and total carnitine noticed. Sphingomyelinase activity showed remarkable reduction of 0.1 nmol/ml per hour (reference, > 2.5 nmol/ml per hour). Based on clinical findings and laboratory tests, our patient was diagnosed as having NPD. Hence, genetic analysis of SMPD1 gene sequence was needed to ascertain the pathogenic mutations underlying the molecular basis of this disease.
As expected, the amplified product of the two DNA samples (from our patient and his mother) showed bands of approximately 4276 bp using the two primers SMPD1-P1F and SMPD1-P4R (Fig. ). The obtained DNA sequences were aligned, de novo assembled, and compared to the published gene sequence (GenBank GeneID: NG_011780.1, Ensembl version ENSG00000166311 and protein identified as UniProtKB – P17405). A DNA sequence of 4225 and 4229 bp was obtained from mother and patient samples, respectively. The whole gene showed depth of >3000X.
SMPD1 sequence analysis of the samples of our patient and his mother revealed the same two heterozygous mutations: a deletion of one base, thymidine, in exon 2 at position 573 of the coding sequence (Fig. ) and a substitution mutation at position 107 (T>C) in exon 1. The nucleotides were numbered according to reference sequence (GenBank GeneID: NG_011780.1, Ensembl version ENSG00000166311 and protein identified as UniProtKB – P17405). The NGS identified four sequence variants: single nucleotide polymorphism (SNP) 579C/T was detected in variant 1. Variant 2 was shown to be normal and a frameshift c.573delT (NM_000543.4(SMPD1):c.573delT (p.Ser192Alafs) was detected in variant 3 (Fig. and ). The fourth variant was c.107 leading to conversion of valine to alanine at position 36 (NM_000543.4(SMPD1):c.107T>C (p.Val36Ala)). Notably, our patient and his mother shared these two variants as shown in Fig. and . To rule out the presence of other possible causal SMPD1 variants, nucleotide sequences of 863 and 408 bp upstream and downstream from the SMPD1 coding region were amplified using two sets of forward and reverse specific primers, followed by sequencing.
The primer sequences for the upstream and downstream flanking regions were: (smpd5_2F: CTCATCCTTCCGGTCTGTGT,smpd5_2R:GGACACCCGATTACCCTTCT) and (Smpd_3F:AAGGGTGAAAAAGCCCAAAT,Smpd_3RAAAGATCTCCTTGCCCTGCT), respectively. DNA sequence analyses revealed no pathogenic variants in these regions. |
pmc-6142325-1 | We describe a case of disseminated extrapulmonary legionellosis in an immunocompromised 38-year-old Thai woman. The patient was diagnosed in 2002 with systemic lupus erythematosus (SLE) with fever, polyarthritis, oral ulcer, alopecia, and proteinuria. Since then, she has been treated with prednisolone with azathioprine. She achieved clinical remission but remained on prednisolone (5 mg daily) and azathioprine (50 mg daily) for 13 years. In August 2015, 3 months prior to admission, she suffered from cramping abdominal pain, watery diarrhea two or three times daily, and low-grade fever. She was diagnosed with enteritis and treated with ceftriaxone without clinical improvement. The dose of immunosuppressive medication was increased to prednisolone 45 mg daily and hydroxychloroquine 400 mg daily. In September 2015, 2 months prior to admission, she developed proximal muscle weakness with low-grade fever. She was diagnosed with myasthenia gravis and received treatment with pyridostigmine (Mestinon™) 240 mg daily. She remained weak and lost significant weight because of poor appetite and diarrhea. She was admitted to her local hospital in October 2015 for intravenous fluid hydration and pyridostigmine was discontinued because of diarrhea. As her condition was becoming increasingly compromised with high-grade fever, generalized vesicular rash, and proximal muscle weakness, she was referred to our hospital in November, 2015. She did not recall any exposure to potentially contaminated water or animals. She worked as a school teacher. Upon admission, her temperature was 39 °C, heart rate 100 beats/min, and respiratory rate 20 breaths/min. Blood pressure was 90/60 mmHg. Physical examination revealed a cachectic woman with mild pale conjunctivae and anicteric sclerae. Skin examination showed generalized discrete erythematous papules and macules with dry necrotic crust on the scalp, facial area, trunk and extremities. She also had plaques measuring 15 × 15 cm on both inner thighs (Fig. ). Abdominal examination showed mild tenderness and distension. The examination did not reveal any cardiac or pulmonary findings. Neurological examination revealed ptosis in both eyes, proximal muscle weakness (grade IV) of all extremities, but normal sensation and tendon reflexes. Laboratory data shown in Table . Skin biopsy of the crusted lesion revealed varicella zoster virus from polymerase chain reaction (PCR). She was diagnosed with varicella zoster virus infection. At admission, plasma cytomegalovirus (CMV) viral load (Cobas® Taqman amplicon) was 363,000 copies/mm3. She received intravenous ganciclovir injection with adjuvant granulocyte colony-stimulating factor for leukopenia. The timeline of the patient’s illness is illustrated in Additional file . She was also treated empirically for skin and soft tissue infection with piperacillin/tazobactam (12 days), and then meropenem (5 days) and then cefepime (5 days), without any clinical response. Further investigations, computed tomography of the abdomen showed a long segment of jejunal wall thickening and mild rectal wall thickening. Colonoscopy revealed generalized edematous mucosa of the colon without ulceration, and random biopsy was negative. She was diagnosed with CMV syndrome with suspected CMV jejunitis, which later improved with ganciclovir therapy. She was also diagnosed with myasthenia gravis by electromyography, nerve conduction velocity, and presence of acetylcholine receptor antibody. Later on, she developed chest pain and shortness of breath. Computed tomography of the chest revealed bilateral pleural effusion and small pericardial effusion. Echocardiography revealed impaired left ventricular systolic function with 40% ejection fraction along with global hypokinesia. She was diagnosed with lupus myocarditis, and treated with a 5-day course of intravenous immunoglobulin (0.4 g/kg/day) and 5 mg/day intravenous dexamethasone. During her hospitalization for 21 days, she remained febrile with a maximum temperature of 38.5–39 °C, despite the previously mentioned therapy. At that time, she had worsening pain in both thighs at the site of the plaques. Magnetic resonance imaging of both lower extremities revealed diffuse enhancing, hyperintense T2 signals in the muscles at the pelvis at both thighs and legs, with diffuse muscle atrophy and swelling of the skin and subcutaneous tissue (Fig. ). Multiple subcutaneous biopsy specimens were taken from both thighs (site of skin lesions) showed suppurative panniculitis (Fig. ) and presence of Gram-negative bacilli. Acid-fast and Gomori methenamine stains were negative. Tissue biopsies for aerobic microorganisms showed no growth. Bacterial broad-range 16S ribosomal RNA sequencings revealed L. pneumophila (99% similarity to L. pneumophila consensus sequence). Culture for fungi and mycobacteria was negative. Her antimicrobial regimen was changed to intravenous azithromycin, and fever subsided within 5 days. Her thigh lesions gradually improved over the first week of therapy (Fig. ). She was diagnosed with disseminated L. pneumophila infection resulting in panniculitis, myositis and myocarditis. She received intravenous azithromycin for 21 days. Oral azithromycin and ciprofloxacin were continued for 3 months to ensure eradication of the organism from our immunosuppressed patient. She received intravenous ganciclovir until the clearance of CMV viremia (total of 48 days), and then switched to oral valganciclovir maintenance therapy. She underwent physical rehabilitation and was discharged after 64 days hospitalization. Clinically, she is doing well at 1-year follow-up. She did not have any further tests done as follow-up proved successful clinical resolution and eradication of Legionella infection. |
pmc-6142338-1 | A 6-year-old Han Chinese boy had a 5-year history of progressive muscle weakness. His family first noticed he experienced difficulty in walking at approximately 1 year of age. As time progressed, he began to experience difficulties when climbing stairs and lifting heavy objects. He exhibited shortness of breath after activity and relief after rest. However, fever, headache, dizziness, palpitate, cough, sputum and convulsions were not observed. His previous medical history was unremarkable, and there was no family history of neuromuscular disease. His father died of a “work-related injury” five years ago, and his mother is now 40 years old without a significant medical history.
At the age of 4 years, he experienced difficulty in elevating his arms and walking, especially climbing stairs. He was admitted to the hospital with a potential diagnosis of “progressive muscular dystrophy”. The genetic analysis did not detect the 17 common mutation sites of DMD/BMD genes in his samples. Blood biochemical tests revealed increased CK levels of 1000 IU/L (normal range 0–225 IU/L). The doctor recommended he undergo further examinations, but his mother did not consent.
The patient’s condition continued to worsen. At 5 years of age, he visited our department because he would occasionally fall while walking and experienced shortness of breath after activity. CK levels were increased to 1617.00 IU/L (normal range 0–225 IU/L). Shortly after, he received consultation again due to echocardiography and electrocardiogram (ECG) abnormalities in the medical checkup. Medical examinations revealed the following: 1. Hypertrophic cardiomyopathy, 2. A small left ventricular measurement, 3. Lower left ventricular compliance in echocardiography and left ventricular hypertrophy with T wave inversion in ECG. On admission, his constitution indicated short stature without skin disorders, including ichthyosis or skin rash. He did not exhibit any ophthalmopathy or otopathy. He did not exhibit scoliosis or hyperlordosis but had Gower’s sign. His blood pressure was 98/60 mmHg, and his heart rate was 88 beats per minute. Cardiac auscultation revealed a normal rhythm.
Blood biochemical tests revealed increased CK levels of 1832 IU/L (normal range 0–225 IU/L). Routine blood tests revealed increased alanine transaminase (ALT) levels at 144 IU/L (reference range 0–42 IU/L), increased aspartate transaminase (AST) levels at 103 IU/L (reference range 0–42 IU/L), increased lactate dehydrogenase (LDH) levels at 1034 IU/L (reference range 114–240 IU/L), increased creatine kinase isoenzyme levels at 148 IU/L (reference range 0–25 IU/L) and normal triglyceride levels at 0.77 mmol/L (reference range 0.4–1.73 mmol/L). No abnormalities were observed in other routine biochemical tests.
The echocardiography revealed a diffuse and thick left ventricular wall. The left ventricular outflow tract was increasing rapidly, and the ejection fraction was 68%. Chest radiography revealed increased double lung texture, and the heart shadow was normal. The X-ray of bone age revealed that the maturity of the left hand bone was approximately 487 scores, which is equivalent to the age of a 4.8-year-old boy. A 24-h Holter-monitor recorded a sinus rhythm and an altered ST-T. Electromyography and evoked potential examination report revealed the following: 1. Normal movement conduction velocity (MCV) of the left median nerve, left ulnar nerve, left total nerve, and left tibial nerve. 2. Normal sensory conduction velocity (SCV) of the left median nerve, left ulnar nerve, left sural nerve, and left sural nerve. 3. F wave of left median nerve was normal. 4. Regarding H reflex, a normal H wave conduction velocity of the left tibial nerve was observed. 5. Electromyography revealed that the left gastrocnemius muscle and the inner muscle of the right femoral muscles were electrostatic. The mean time limit of the motion unit potential and the wave amplitude were in a normal range, and the electromyography of the examined muscle was normal. Abdominal ultrasonography indicated that the liver, biliary, pancreas, spleen, and kidney were normal. To improve our understanding of NLSD-M, reduce the misdiagnosis rate and prevent physical disability and even premature death, we recruited the child into a study and investigated PNPLA2.
This study was approved by the Ethics Committee of First Affiliated Hospital to Army Medical University. Written informed consent for gene analysis was obtained from the legal guardian of the patient. We performed whole exome sequence capture on peripheral blood DNA samples from the patient. Sanger sequencing was used to validate the PNPLA2 (NM_020376: c.155C > G; p.Thr52Arg) homozygous variant identified by whole exome sequencing. Gene analysis revealed a novel homozygous mutation c.155C > G (p.Thr52Arg) in PNPLA2 (Fig. ). Screening of the family confirmed that his mother was heterozygous for the PNPLA2 gene mutation (Fig. ).
During hospitalization, his mother refused muscle biopsy for her child. This case was confirmed based on the clinical phenotype, blood test results, imaging examination and gene analysis. The patient was administered treatment with the phosphocreatine to protect the heart, and the symptoms were gradually relieved. He was subsequently discharged from the hospital. The follow-up revealed mild worsening of the condition and the development of muscle weakness of lower limbs. However, his heart function did not deteriorate. The patient remained fully ambulant during the follow-up period. He has exhibited no brain or peripheral nerve symptoms to date, and he has been able to continue attending school. |
pmc-6142345-1 | An 86-year-old woman with back pain was referred to our hospital. At the time of presentation, she had no fever and no pain at rest. Roentgenography findings were relatively normal with slight narrowing at L1/2 (Fig. ). She had no known drug allergies. She was administered analgesics and was kept under observation. One month after her first visit to our hospital, her back pain worsened, and her temperature was 37.2 °C. No neurological abnormalities were noted in her lower limbs. Laboratory findings at that time were as follows: C-reactive protein, 11.5 mg/dL (reference, < 0.2 mg/dL); white blood cell count, 7970/mm3 (neutrophils, 87.7%; reference, 4000–8000/mm3); aspartate aminotransferase, 15 IU/L (reference, 13–33 IU/L); alanine aminotransferase, 13 IU/L (reference, 6–30 IU/L); alkaline phosphatase, 291 IU/L (reference, 115–359 IU/L); and creatinine, 1.5 mg/dL (0.4–0.7 mg/dL). Radiographs of the lumbar spine showed collapse of L1 and an absorbable change in the caudal side of L1 (Fig. ). Lumbar MRI confirmed the presence of fluid at the L1/2 disc, edema and destruction of the spinal body of L1/2, and lumbar canal stenosis at the level of L1/2 on fat-saturated T2-weighted images (Fig. ). She was diagnosed with pyogenic spondylitis of the lumbar spine and underwent biopsy of the L1/2 disc. Parvimonas micra, which is a gram-positive anaerobic bacterial species and a resident of the flora of the oral cavity, was identified in the biopsy specimens. Given that the patient was able to tolerate oral medications and the transfer rate of metronidazole to the blood was similar between oral and intravenous administrations, we decided to administer the medications orally. Oral administration of metronidazole (1500 mg/day) was initiated (Fig. ). Forty-four days after starting metronidazole (total intake of 66 g), she complained of tingling in the upper limbs. Cervical spinal disorder was suspected, and cervical spinal MRI demonstrated spinal canal stenosis at C3/4, 5/6, and 6/7. After 4 days, she complained of further symptoms, including sensory disturbance of the tongue, dysarthria, and deglutition disorder. Central nervous system disorder was suspected, and brain MRI was performed. Characteristic brain MRI findings on T2-weighted fluid-attenuated inversion recovery (FLAIR) and diffusion weighted imaging (DWI) led to the diagnosis of MIE (Fig. , ). Metronidazole was discontinued, and her neurological symptoms improved 10 days after discontinuation. On MRI performed 14 days after oral metronidazole discontinuation, most of the abnormal findings of MIE disappeared (Fig. , ). Fortunately, follow-up blood tests revealed the absence of inflammatory reactions 5 days before the discontinuation of metronidazole; no antibiotics were administered after discontinuing metronidazole. At 9 weeks after discontinuation of metronidazole, there was no recurrence of pyogenic spondylitis according to the clinical findings or blood sample results. |
pmc-6142365-1 | The first donor was a 40-year-old man who suffered brain death due to intracranial hemorrhage after a traffic accident. His terminal serum creatinine level was 0.8 mg/dL and his Kidney Donor Profile Index score was 27%. The first recipient was a 45-year-old man with a 20-year history of hypertension and end-stage renal disease (ESRD) due to hypertensive nephropathy, who had received regular hemodialysis for 2 years. In June 2005, at another hospital, single renal transplantation was performed in the right iliac fossa, with a cold ischemia time of 5 h 10 min and a warm ischemia time of 1 h 48 min. After reperfusion, the recipient immediately passed urine. He was administered an immunosuppressive regimen comprising methylprednisolone, cyclosporine, everolimus, and mycophenolate mofetil, and he was discharged 10 days after the transplantation with a serum creatinine level of 1.4 mg/dL. At regular follow-up over the next 6 months, his serum creatinine levels remained within the normal range.
Over the following 9 years, the recipient showed no episodes of rejection, and his serum creatinine levels and creatinine clearance rates were within the normal ranges (Fig. ). In 2010, he underwent coronary percutaneous angioplasty and stent placement for coronary artery disease, and thereafter he regularly took aspirin. However, in June 2014, he suffered a right cerebral aneurysm rupture that resulted in brain death. At that time, his serum creatinine level was 0.94 mg/dL and the creatinine clearance rate was 90 mL/min. Before his death, the patient (while completely conscious) and his family had expressed a wish for his organs to be donated; we therefore harvested the transplanted kidney for reuse.
The second recipient of the kidney was a 40-year-old man with ESRD caused by diabetic nephropathy, who had been undergoing hemodialysis for 5 years and had been added to the waiting list for renal transplantation at that time. His blood group was the same as that of the initial donor and the first recipient (A rhesus positive). There were four human leukocyte antigen mismatches with the original donor and two with the second donor (Table ). Crossmatching with the initial donor was not possible because of the long time that had elapsed since the initial transplantation, but crossmatching with the second donor was negative. A biopsy demonstrated the quality of the donated kidneys: the Remuzzi score was 1 and the Kidney Donor Profile Index score was 74%.
Kidney transplantation was performed in June 2014, with a cold ischemia time of 4 h 12 min and a warm ischemia time of 1 h 12 min. After transplantation, the recipient was administered an induction immunosuppressive regimen comprising basiliximab, high-dose methylprednisolone, and cyclosporine, subsequently shifted gradually to a maintenance immunosuppressive regimen comprising prednisolone, tacrolimus, everolimus, and mycophenolate mofetil. The second recipient was discharged 13 days after the transplantation, and his serum creatinine level was measured at follow-up every 3 months. As of June 2018, his renal function has remained stable, with a serum creatinine level of around 1.24 mg/dL (Fig. ). There have been no episodes of rejection, and the patient has remained in a good clinical condition. |
pmc-6142625-1 | Here we report a 36-year-old female nurse, working full-time 12-h night shifts in a busy intensive care service, with generalized (MGFA IIb) auto-immune MG, symptomatic and dependent on cholinesterase inhibitors. Past medical history includes eczema in her teens, she is a carrier for sickle disease (sickle cell trait (SCT)) and she carried two pregnancies to term. Red blood cells have slightly reduced mean corpuscular volume and mean corpuscular hemoglobin concentration, 75.5 fl and 25.7 pg, respectively. She has no clinical symptoms of anemia and no specific treatment or monitoring. Surgical history includes 1 cesarean (2004), linea alba repair (2011) and breast implant (2014). She is a nonsmoker and does not drink alcohol. She is right-handed. She has a normal body mass index, 20.3 kg/m2, weighing 52 kg for 1.60 m.
Despite already experiencing abnormal weakness, she began running a year before being diagnosed with MG. Prior to running, she played amateur level basketball however this became incompatible with working night-shifts. MG diagnosis was based on clinical signs (right hand weakness - difficulty brushing teeth and hair, carrying light loads, cutting meat, a heavy head, nasal voice, ptosis, diplopia, dysphagia and difficulty masticating and articulating), serum auto-antibodies against nicotinic acetylcholine receptors (AChR) (> 100 nmol/l) and significant decrement on repetitive nerve stimulation (3 Hz) EMG (50% right trapezius, 24% right anconeus, 15% left anconeus, 43% tongue/mouth (CN V/XII)). Myasthenic muscle score (MMS) was 65/100. Initial treatment consisted of intravenous immunoglobulins (2 g/kg over 3 days (100 g)) and 60 mg pyridostigmine (t.i.d). Thoracic CT scan did not show thymoma but was in favour of thymic hyperplasia. Thymectomy was not performed as per the patient’s request.
Despite the patient being informed at diagnosis that sport was contra-indicated, she kept running. Training consisted of 1–2 10 km weekly runs with the beginning being the most difficult. MG symptoms persisted including fatigue, dysphagia and episodes of diplopia at the end of pyridostigmine dose thus aziathoprine (100 mg) was introduced. She performed a half marathon 2 months later, followed by a full marathon and another half marathon. No major difficulty was experienced and performances significantly improved: 5h13mins (8.1 km/h) for a marathon pre-diagnosis to 4h51mins (8.7 km/h) post diagnosis (and treatment), Figs. & .
On clinical evaluation 1 year after MG diagnosis, she had above average respiratory strength (MIP and MEP 135% and 144% of theoretical) and normal respiratory function (FVC 95% of theoretical). On maximal voluntary testing, limb strength was normal (knee extensors and elbow flexors: 128% and 101% of theoretical, respectively and right handgrip strength: 88%). Walking endurance was also considered normal (92% of theoretical 6MWD). The MMS suffered from a ceiling effect with the patient achieving the maximal score of 100 and a score of 4 on the MG-ADL due to episodes of dysphagia, dyspnea with effort and UL fatigue with brushing her teeth and hair. She reported recurrent MG symptoms including loss of hand dexterity (difficulty manipulating medication at work), bulbar symptoms such as dysphagia on her own saliva, a nasal voice and ocular symptoms (ptosis and diplopia). MG-specific quality of life (MGQOL-15-F) was reduced (17/60) particularly with regards to professional and social aspects, reflected in the WHO-QOL Bref with the social relationship and physical health domains being reduced, 11/20 and 13/20 respectively [, ].
She continued regular running without any particular changes in her MG, recurrent right hand weakness persisted and she experienced occasional ocular and bulbar symptoms primarily at the end of pyrodistigmine dose. Quality of life improved significantly over time (Fig. ) and strength remained stable (knee extensors and elbow flexors: 128% and 100% of theoretical, respectively, right handgrip strength: 93%). She discontinued aziathoprine (treatment duration 14 months) and remained exclusively treated with cholinesterase inhibitors (60 mg, b.i.d). |
pmc-6142628-1 | Our patient was a 3-year-old Malay boy, who presented with fever of 2 days’ duration and an episode of generalized tonic-clonic seizure that lasted approximately 5 minutes. There was no up rolling of eye ball or drooling of saliva during the seizure. He had post-ictal drowsiness for 10 minutes. There were no other associated symptoms. Six weeks prior to the presentation he was brought to a general practitioner for fever and skin rashes over his face and upper limbs. He was treated with orally administered paracetamol and cefuroxime axetil. Subsequently, the fever resolved but the skin rashes persisted. On admission, he was diagnosed as having simple febrile seizure and eczema herpeticum. At 13 months of age he was diagnosed as having single gene deletion α-thalassemia trait (αα/−α4.2), and remained asymptomatic since diagnosis. His parents were non-consanguineous. His mother is 35-years old and has α-thalassemia trait. There was history of right ear infection a year before and that had resolved with treatment. He has history of allergy and intermittently was on orally administered desloratadine. There was no other significant past medical history, and he was not on any other medicine prior to the recent presentation. His immunization status was up to date, and developmentally he was normal. He lived with his parents who worked as police officers, and he has another healthy younger sibling of 5-months old. They lived in an apartment in a suburban area. He went to kindergarten when the parents worked.
On admission, a physical examination revealed Glasgow Coma Scale of 15/15, blood pressure 90/46 mmHg, pulse rate 120/minute, and temperature 37.9 °C. He was febrile, pale, with no jaundice, and he had “shotty” cervical lymph nodes. The results of examinations of his throat, tonsils, and ears were normal. Some maculopapular rashes with scaly and crusted areas were noted on his left cheek, both arms and knees, and trunk area. There was hepatosplenomegaly of 4 cm and 3 cm, respectively. There were no bleeding tendencies or neurologic deficit noted. Laboratory findings showed hypochromic microcytic anemia, thrombocytopenia, reticulocytosis, and raised serum LDH. A peripheral blood smear showed significant fragmented red cells, spherocytes, and polychromasia in keeping with MAHA (Fig. ). Serial investigation results showed persistent anemia and thrombocytopenia. His renal function test, liver function test, and coagulation profile were normal (Table ). Direct and indirect Coombs tests were negative (Table ). He was started on orally administered acyclovir for 10 days and received a course of cloxacillin for the rashes. TTP was suspected at this juncture. He was clinically asymptomatic, and was observed without any intervention prior to the results of ADAMTS13 assay. Subsequently, the ADAMTS13 assay results showed zero activities (0%) and markedly high level of ADAMTS13 inhibitor, 93.15 U/mL (negative < 12 U/mL; borderline 12–15 U/mL; positive > 15 U/mL) confirming the diagnosis of secondary TTP. Other laboratory investigations to identify specific secondary causes of TTP were negative: (i) viral studies on parvovirus, Epstein–Barr virus, and dengue virus; and (ii) blood culture and sensitivity. The screening for autoimmune disease showed anti-nuclear antibody positive and borderline double-stranded deoxyribonucleic acid (DNA), however, complement 3 and complement 4 levels were normal. He had no clinical findings to suggest connective tissue disease. He received fresh frozen plasma (FFP) transfusions (10–15 ml/kg per day) for 3 consecutive days. His hemoglobin (Hb) level was 8.1 g/dL and platelet count was 46 × 109/L prior to the transfusions. Subsequently, the counts recovered. He had a Hb level of 8.1 g/dL and platelet count of 168 × 109/L, a day after completed FFP transfusions. His reticulocytes count and LDH level reduced to 4.0% and 337 U/L, respectively. Six months later, the ADAMTS13 activity improved to 20.5%, and ADAMTS13 inhibitor reduced markedly to 14 U/mL. At 12 months, he remained in clinical remission, the ADAMTS13 activity had normalized to 48%; however, the ADAMTS13 inhibitor level was still detectable at 17.5 U/mL. He was given orally administered prednisolone 1 mg/kg per day for 6 weeks and it was tapered off 2 weeks later. A repeated ADAMTS13 activity at the end of the prednisolone course was > 114%. However, there was no result available about the inhibitor level. He is scheduled for follow-up every 3 months with surveillance of ADAMTS13 assay for 1 year. During clinic follow-up at 6 months after treatment, he remained in remission and his full blood counts were normal. A timeline for our patient is given in Fig. . |
pmc-6142631-1 | A 46-year-old man visited the emergency department of our institution due to left lower quadrant pain and a palpable mass in the left upper abdomen. He had no specific relevant past medical history or family history. Physical examination disclosed a large, tender mass in the left abdomen. All laboratory findings were within normal ranges except a slightly increased CRP level (5.82 mg/L). Abdominal plain radiographs showed a large mass-like opacity in the left abdomen (Fig. ). Ultrasonography revealed a large, thick-walled cystic mass without evidence of an intracystic solid portion or septum (Fig. ). The patient underwent computed tomography (CT) scans to evaluate the intra-abdominal mass using a 64-slice multidetector CT scanner. Contrast-enhanced CT images revealed an 18.3 × 12.3 × 21.5 cm sized oval cystic mass with a relatively thick wall in the left upper abdomen (Fig. ). This lesion caused an extrinsic mass effect on the adjacent stomach and pancreas. The boundary between the mass and adjacent pancreas parenchyma was indistinct. Based on these imaging findings, a neurogenic tumor with cystic changes, a mucinous cystadenoma, and a pseudocyst were considered in the differential diagnoses. The patient underwent laparoscopic spleen-preserving distal pancreatectomy without preoperative biopsy due to a risk of rupture.
Intra-operatively, the mass was confirmed to have arisen from the retroperitoneum, closely related to the pancreas tail. Surgeons found hemorrhagic fluid within the cystic mass. The surgical specimen was a large round lump of soft tissue measuring 13 × 10.5 × 4.3 cm in size. On gross section, the cut surface revealed a rubbery texture with a whitish to light yellowish color. Almost half of the mass was composed of a cystic space that was filled with clear, light brownish fluid. The mass was diffusely infiltrating the pancreatic parenchyma. Microscopically, the tumor was composed of uniform sheets of elongated, spindle-shaped cells in a collagenous stroma (Fig. ). The tumor was intermingled with the pancreatic parenchyma (Fig. ). Immunohistochemical study showed the tumor cells were positive for smooth muscle actin (SMA) and beta-catenin (Fig. ), but negative for S-100 protein and CD34. The final pathologic diagnosis was DF. The postoperative course was uneventful, and the patient was discharged on postoperative day 20. The patient remained asymptomatic during an 8-month follow up period. |
pmc-6142668-1 | A 56-year-old female patient was referred to our hospital for a mass lesion in her forearm that had been growing slowly, and she had no history of trauma, infection, fever, or weight loss. During medical history taking, we found that a needle biopsy was performed 4 years ago in another hospital, and the result of the cytology examination was class II. The patient also complained of extension lag of the metacarpophalangeal joint of the middle finger that had gradually proceeded without sensory loss. The physical examination revealed an ill-defined area of swelling at the middle part of the forearm. The palpable mass was swollen, measured about 30×30 mm, was smooth and fixed without tenderness or the Tinel’s sign, and had very hard elasticity.
The patient was evaluated with radiography, Computed Tomography (CT), and Magnetic Resonance Imaging (MRI). On the x-ray, there was no scalloping, osteolysis, pathological fracture of the radius or ulna, or calcification of soft tissue. On the CT scan, the mass had a low density within the right supinator muscle. The MRI scan of the right forearm revealed a 37×22×27-mm well-defined mass that was hypointense; additionally, the peritumoral fat ring sign was indicated on T1-Weighted Images (T1WI) (Fig. ), and a hyperintense area was shown on T2-weighted images (T2WI) (Fig. ). Intravenous Gadopentetate Dimeglumide of Gadolinium (GDG) enhancement revealed peripheral enhancement of the mass with linear stranding inside the tumor (Fig. ). The imaging findings characterized the mass as intermuscular myxoma; the differential diagnosis might have been myxoma, schwannoma, or intramuscular hemangioma.
Surgical resection was performed under general anesthesia. Local surgical excision of the tumor was performed over the tumor site between the musculus extensor carpi radialis brevis and extensor digitorum communis, taking care to avoid damaging the posterior interosseous nerve. The mass was a well-capsulated cystic, solid, well-defined mass with hard elasticity in the supinator muscle, and it was excised in an en bloc manner from the normal muscle.
During the histological examination, a cut section of the mass showed glossy grey-white glistening gelatinous areas macroscopically. Microscopy showed that the cells were spindle and stellate-shaped, and collagen fiber was in abundance in the mucoid hypocellular material of neoplasms with low vascularity (Fig. ). Mitotic activity, necrosis, and nuclear atipias were not seen. Based on these findings, the pathological diagnosis was an intramuscular myxoma.
Postoperatively, there was no problem during the process of wound healing. However, she had difficulty extending the metacarpophalangeal joint of the right fingers without sensory disturbance. The Manual Muscle Testing System [] showed that the muscle power values of the extensor digitorum, extensor digiti minimi, extensor indicis, extensor pollicis longus, and extensor carpi ulnaris were 0. The muscle power value of the extensor carpi radialis was 3.
She did not undergo an electrophysiological examination; however, on the basis of findings from physical examinations, we made a diagnosis of posterior interosseous nerve palsy due to compression during the operation. We prescribed an orthosis for functional recovery of her fingers. Three months postoperatively, the posterior interosseous nerve palsy improved completely. She has not shown any signs of recurrence detected by MRI 1 year later. |
pmc-6142679-1 | A 33-month-old Caucasian boy presented with leukocoria right eye (OD). Fundus examination OD revealed a solid white predominantly endophytic retinal tumor filling most of the nasal aspect of the fundus (Fig. & ) and extensive vitreous seeding (Fig. ). The tumor extended to the posterior surface of the lens and exhibited preretinal neovascularization on its surface. B-scan ocular ultrasonography OD revealed dense intralesional particles consistent with calcific foci. Genetic testing demonstrated a homozygous non-germline RB1 nonsense mutation. Fundus examination of left eye (OS) revealed a broad-based flat melanotic area of the choroid extending from the subfoveal region to the ora serrata temporally (Fig. ). B-scan ocular ultrasonography OS showed no appreciable choroidal thickening corresponding to the melanotic patch. Anterior segment evaluation OS showed no iris or scleral melanocytosis. Our diagnoses were unilateral nonfamilial retinoblastoma OD and isolated choroidal melanocytosis1 OS. The child was treated by primary enucleation of the retinoblastoma-containing OD. Histopathologic evaluation confirmed the clinical diagnosis of retinoblastoma. The child has been followed for more than 4 years post-enucleation. Follow-up examinations of the fundus OS have shown no change in the patch of choroidal melanocytosis. |
pmc-6142721-1 | A 17-year-old male noticed swelling of his abdomen from six months previously. He reported pain at the left side of the umbilicus. Body weight increased by 5 kg in one year. Computed tomography (CT) was performed at another hospital. A larger abdominal tumor was detected, so he was referred to our hospital for examination. Vital signs and laboratory data were normal, but the abdomen was bulging slightly. CT showed a giant tumor occupying the majority of the abdominal cavity (Figures – and –). The tumor seemed to be divided into two parts. One part was a single cystic lesion, which had no contrast effect from the right abdomen to the pelvic cavity. The other part, from left upper abdomen to the lower abdomen, appeared to have a solid component where the contrast effect was mild. The vessel was seen from the left gastroepiploic artery to the tumor. Magnetic resonance imaging (MRI) showed the tumor had almost entirely low signal density, but T1-weighted image (T1WI), some parts had high signal density (). In T2-weighted image (T2WI), on the other hand, the tumor showed high signal intensity ().
On the gadolinium-enhanced image, the contrast effect was poor, and the high signal area was only slight.
Preoperative diagnosis was a giant abdominal cystic tumor. Differential diagnosis was gastrointestinal stromal tumor (GIST), DT, or lymphangioma.
Surgery was performed for definitive diagnosis and improvement of the symptoms.
A lower midline incision was performed to observe the large tumor contained within a membrane (). The tumor was found to be adhered to both the mesocolon and omentum, and blood vessels were observed to be coming from both; angered vessels bled easily. Fluid in the right part of the tumor was aspirated; about 1.7 L greenish-brown fluid was collected. We separated the tumor from the mesocolon. The omentum artery of the stomach was preserved, and the omentum was also separated from the tumor. In this time, we judged that the tumor originated from the anterior lobe of the transverse mesocolon. The tumor was in contact with the great curvature of the stomach. The adhesion could not be separated, so we partially resected the stomach. The branches from the left gastroepiploic artery had become thick, indicating it was probably the main feeder of the tumor. Furthermore, the tumor was also strongly in contact with the pancreatic tail (). The border line was unclear. If the pancreatic tail was preserved, the capsule of the tumor remained, and the possibility of recurrence existed. So pancreatic tail resection was performed, and the tumor was excised. The tumor itself was 4.2 kg, and aspirated fluid was 1.7 L, so the total tumor weight was 5.9 kg. Operation time was 2 hr 32 min, and bleeding volume was 220 mL.
The tumor is shown in Figures –. It measured 30 × 25 × 10.5 cm. On the right side of the tumor, a cystic component with wall thickening was found. When the tumor was incised, there was a mixture of solid components and parts that showed honeycomb-like texture.
Pathological findings included spindle-shaped or star-shaped tumor cells proliferating diffusely with abundant collagen fiber. Heteromorphism was not noticeable, and the nuclear fission image was not apparent. Beta-catenin was positive in the tumor cell nucleus on immunohistochemistry (Figures and ).
Final diagnosis was an intra-abdominal desmoid tumor.
Postoperative pancreatic fistula occurred but was improved with nonoperative therapy. The patient was discharged on the 16th postoperative day. After discharge, colonoscopy (CS) was unremarkable. The patient is now being followed-up as an outpatient. |
pmc-6142722-1 | A 60-year-old African-American male presented with worsening abdominal pain and weight loss of 30 pounds in one month. Physical examination revealed scleral icterus with mild abdominal tenderness. Laboratory results showed anemia (hemoglobin of 5.7 gm/dL and hematocrit 16.6%), renal failure (creatinine of 20.89 mg/dL), hypercalcemia of 11.3 mg/dL, lipase of 8039 unit/L, alkaline phosphatase of 534 unit/L, and total bilirubin of 17.4 mg/dL. MRI of the abdomen showed a well-circumscribed homogenous mass at the head of pancreas obstructing the biliary system (). EUS showed a hypoechoic mass () and smear of the FNA sampling with a 22G needle revealed numerous atypical plasma cells displaying increased cell size, fine nuclear chromatin, and prominent nucleoli (). Hematoxylin and eosin stain showed basophilic stained plasma cells (). Given the extramedullary plasmacytoma, anemia, renal failure, and hypercalcemia, a diagnosis of multiple myeloma was suspected and confirmed with cytology and bone marrow biopsy with immunohistochemistry. Immunohistochemistry was positive for CD138 and IgA Lambda consistent with plasmacytoma ().
Patient was treated with radiation and chemotherapy for the pancreatic plasmacytoma and multiple myeloma, respectively. His multiple myeloma did not respond to chemotherapy. Unfortunately, the patient developed further complications, including malignant ascites and pericardial effusion. The disease was refractory to chemotherapy and he passed away 10 months after the time of the diagnosis. |
pmc-6142723-1 | A 41-year-old Japanese woman (gravid: 0; para: 0; height: 154 cm; weight: 52.2 kg; body mass index: 22.0 kg/m2) visited our department due to severe vomiting. Although hyperglycemia and hypertension had been identified upon screening at her workplace, she neglected these findings. She underwent medical examination for the vomiting at a local clinic; however, because her condition did not improve, she was referred to our emergency medical center. She had a history of appendicitis at 20 years of age, and she had undergone bilateral ovarian cystectomy for OMA at 28 years of age. She did not have any additional relevant medical or family history.
Her physical examination findings were as follows: blood pressure, 208/94 mmHg; heart rate, 96 beats/min; respiratory rate, 20 breaths/min; temperature, 36.6°C; and arterial oxygen saturation, 98%. In addition, her blood examination findings were hemoglobin level: 6.3 g/dL; hematocrit: 20.1%; white blood cell count: 17.35 × 103/μL; neutrophil percentage: 91.5%; platelet count: 637 × 103/μL; C-reactive protein level: 14.04 mg/dL; albumin level: 1.8 g/dL; blood sugar level: 450 mg/dL; HbA1c (NGSP): 13.7%; and brain natriuretic peptide level: 922.8 pg/mL. Moreover, her tumor marker findings included cancer antigen (CA) 125 level of 636.0 U/mL and CA19-9 level of 610.0 U/mL. Furthermore, her blood gas analysis findings were pH, 7.490; pCO2, 34.0 mmHg; and pO2, 64.9 mmHg. Chest radiography indicated a cardiothoracic ratio of ≤ 50% and a small pleural effusion. T1- and T2-weighted magnetic resonance images (MRI) revealed high-intensity signals in two ovarian tumors (tumor size: right < left) and masses with a maximum diameter of 59 mm in the left ovary (). Notably, positron emission tomography-computed tomography (PTT/CT) did not show abnormal uptake. No clear malignant lesions were observed with MRI and PET/CT findings.
She was diagnosed with heart failure, type 2 diabetes mellitus, hypertension, hypoalbuminemia, and iron deficiency anemia at the initial assessment. In addition, OMA and adenomyosis of the uterus were indicated on CT. Consequently, she underwent conservative treatment without undergoing surgery since her overall status was poor.
Cyclic therapy (Gn-RH agonist, leuprolide acetate 1.88 mg, or goserelin acetate 1.8 mg via subcutaneous injection six times every 4 weeks for 24 weeks; DNG, 2 mg/day, oral administration 24 - 108 weeks) was continued alternately for approximately eight years as endometriosis treatment. Moreover, regular medical examination for tumor markers and ultrasonography was performed every three months.
After approximately seven years of treatment, MRI findings revealed high-intensity signals in two ovarian tumors with a diameter of 35 mm or less, and the tumor size indicated a partial response (). Moreover, the level of tumor marker had decreased.
However, she reported lumbago and underwent careful medical examination at our hospital after approximately eight years of treatment. Malignant transformation of the right ovarian tumor was suspected on ultrasonography (tumor enlargement and a solid mass). MRI findings revealed a mass with a maximum diameter of 114 mm in the right ovary. The solid part of the mass exhibited a low-intensity signal (). PET/CT findings showed increased focal fludeoxyglucose accumulation (SUV max = 10.00) in the solid elements of the right ovary (). Tumor marker findings were as follows: 125 levels, 455.2 U/mL; and CA19-9 levels, 1429.0 U/mL and surgery was performed. She underwent multiple debulking surgeries, including an abdominal total hysterectomy, bilateral salpingooophorectomy, and omentectomy. The pathological diagnosis was clear cell carcinoma of the right ovary (stage 2B [FIGO], T2b), endometriosis of the right ovary, left ovarian metastasis from right ovarian cancer, uterine infiltration from right ovarian cancer, and infiltration of clear cell carcinoma to the tissue in front of the rectum. H&E staining displayed ovarian endometriosis and clear cell carcinoma of the right ovary (Figures and ). Immunohistochemical staining results showed that the cancer cells were positive for paired box gene 8, tumor protein p53, and epithelial membrane antigen (partial positivity). Additionally, the cells were negative for the estrogen receptor, progesterone receptor, Ki-1, and Wilms' tumor suppressor gene 1.
Following surgery, she received six courses of conventional TC (paclitaxel, 175 mg/m2; carboplatin, AUC 5). After chemotherapy, PET/CT did not show abnormal uptake. Currently, she exhibits no evidence of disease after chemotherapy.
Her clinical course is presented in . |
pmc-6142732-1 | A 57-year-old male presented to an outpatient orthopedic clinic with a two-month history of pain and swelling in his right elbow. His past medical history was notable for hypertension and gout, which was controlled with colchicine, febuxostat, and indomethacin. He had undergone right olecranon bursectomy and tenotomy approximately two years prior to presentation, but reported good healing and no pain following this procedure, and otherwise denied recent trauma to the elbow. In addition, in his profession as a farmer, he routinely worked within a fenced area containing horses and pigs, including working on his elbows to clear brush and animal waste. On physical examination, he was noted to be febrile with an oral temperature of 41°C. A small aperture with purulent drainage was noted at the superior portion of his right olecranon bursa. Aspiration of bursal fluid was performed, with microscopic evaluation revealing rare polarizable crystals consistent with pseudogout. Following aspiration, the patient was admitted to the hospital. Initial laboratory data were notable for serum sodium 126 mmol/L, serum creatinine 178 μmol/L (elevated from his baseline value of 75 μmol/L), serum glucose 36.8 mmol/L, hemoglobin A1c 14.2%, white blood cells 7.4 × 109/L, and erythrocyte sedimentation rate 14 mm/hr. Magnetic resonance imaging revealed a prominent soft tissue mass adjacent to the olecranon bursa and the posterior aspect of the medial epicondyle (). The patient underwent incision and debridement of the right olecranon bursa, and intraoperative cultures were obtained. After this procedure, infectious disease consultation was requested, and an antimicrobial regimen consisting of intravenous (IV) ceftriaxone and vancomycin was initiated. On postoperative day 1, cultures from the initial bursa aspiration in the outpatient setting revealed diphtheroids. Subsequent identification of Corynebacterium jeikeium was reported 24 hours later by the hospital-based Vitek 2® microbial identification system. On postoperative day 3, the patient was clinically improved, without significant pain, and was discharged from the hospital to receive oral doxycycline 100 mg twice daily for an additional 14 days. Due to concern for infection, as well as the patient's renal function, he received neither corticosteroids nor nonsteroidal anti-inflammatory medication during or following hospitalization. Both aspiration and intraoperative cultures were sent to a reference laboratory (Mayo Medical Laboratories, Rochester, MN, USA) for bacterial identification and in vitro susceptibility testing. T. bernardiae was isolated as the sole pathogen utilizing matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (score 2.1 with homology of the top ten results). In vitro susceptibility was determined by use of manual agar dilution which demonstrated activity of doxycycline as well as other antimicrobial agents (). Approximately two weeks following discharge, the patient was evaluated in the outpatient infectious disease clinic with marked improvement and no significant edema, erythema, pain, or drainage from his right elbow. |
pmc-6142734-1 | A 61-year-old female with past medical history significant for type 2 diabetes mellitus, hypertension, and dyslipidemia and family history of breast cancer in her brother and maternal aunt presented to the emergency room for recurrent chest pain. She also reported fatigue for the past few months and was being evaluated for worsening anemia by her primary care physician. Her hemoglobin was 6 gm/dl with iron panel consistent with anemia of chronic disease. Her electrocardiogram (ECG) at arrival showed an “RSR pattern” in V1 and V2 leads but was otherwise normal. She underwent a stress myocardial perfusion imaging (MPI) which was negative for cardiac ischemia. A transthoracic echocardiogram revealed a 1.6 cm × 1.5 cm atrial mass attached to the anterior wall of the left atrium, which appeared to cross the mitral valve in ventricular diastole. The left atrial mass was further characterized by a transesophageal echocardiogram (TEE) as a solid, irregularly shaped, partly mobile mass attached to the atrial septum and extending to the anterior mitral valve leaflet (). The segment attached to the septum measured 2.6 cm × 1.43 cm, and the segment attached to the valve measured 1.4 cm × 2.22 cm. In addition, MRI of the heart with gadolinium was done preoperatively which confirmed the circumscribed hypodense mass with speckled appearance which originated at the atrial septum and extended along the anterior mitral valve leaflet (). The mitral valve flow was normal with no evidence of obstruction, stenosis, or regurgitation. The patient underwent a minimal incision valve surgery for resection of the mass which was presumed to be myxoma due to its location. Intraoperatively, on open examination of the left atrium, it was noted that the mass originated from the fossa ovalis region of the interatrial septum and infiltrated the atrial wall down onto the entire anterior leaflet of the mitral valve. A fibrotic density that surrounded the tumor was also noted. The mass along with a portion of the interatrial septum and the mitral valve was resected. The mitral valve was replaced using a 27 mm Hancock II bioprosthetic valve. The atrial septal defect caused by the resection was repaired with a bovine pericardial patch. A postoperative TEE was performed which confirmed the successful placement of the bioprosthetic valve with no paravalvular leak. The patient had an otherwise unremarkable postoperative recovery and was discharged home after fourteen days of hospital stay.
Two weeks following discharge, the patient presented to the emergency with cough, diaphoresis, and palpitations. She was noted to have jugular venous distention and bibasilar crackles on auscultation of the lungs and was found to be in acute heart failure. An urgent transesophageal echocardiography demonstrated severe mitral regurgitation with paravalvular leak (Figures , , , and ). At the same time, the histopathologic examination of the atrial mass showed a high-grade sarcoma consistent with dedifferentiated liposarcoma. The tissue exhibited spindle cells with pleomorphism, multinucleated giant cells, and inflammatory cells. Immunohistochemical stains demonstrated that the neoplastic cells were positive for vimentin, focally positive for S-100, and weakly positive for CDK4 and negative for p53 (). FISH studies performed showed an MDM-2 gene amplification in 95–200 nuclei examined. The patient was aggressively treated with intravenous diuretics and afterload reduction using furosemide and nicardipine infusion. Blood cultures were obtained with suspicion of postsurgical infective endocarditis causing valvular dehiscence. However, cultures did not grow any bacteria. The patient clinically deteriorated due to new-onset atrial fibrillation and worsening heart failure despite medical treatment in CCU. CT chest obtained showed a 1.3 cm lytic iliac bone lesion and 3.1 cm × 2.5 cm right upper mediastinal soft tissue density. Due to high suspicion of metastatic disease, MVR and cardiac transplant were not offered until further evaluation for metastasis. Unfortunately, due to rapid clinical decline with a new diagnosis of high-grade cardiac tumor with possible metastases, the patient opted for hospice care. PET study was not obtained. |
pmc-6142740-1 | A 26-year-old white male presented to the emergency department complaining of one month of persistent hematochezia, lower abdominal pain, and nonbloody emesis. He noted intermittent rectal bleeding for years but never continuously for 1 month. He denied any fevers, weight changes, sick contacts, antibiotic use, or previous colonoscopy. His past medical history included moderate Hemophilia A with factor activity between 1 and 5 percent. He had been prescribed Recombinant human factor VIII but had been noncompliant with visits. When his rectal bleeding increased he was told to take his Recombinant human factor VIII to 4000 units every 12 hours on days that he has heavy bleeding.
His examination was significant for tachycardia, tenderness to palpation to the lower abdomen, and positive fecal occult blood testing. Serum laboratory testing revealed a hemoglobin of 11 g/dL and PT/PTT/INR values within normal limits. His C reactive protein was elevated at 57.8 mg/L (normal ≤ 9.9), erythrocyte sedimentation rate 21 mm/hr (normal 0-15), and albumin 3.5 g/dL (normal 3.5-5.7).
CT imaging of the abdomen and pelvis revealed diffuse abnormal colonic thickening (). After receiving Recombinant human factor VIII infusions without resolution of symptoms, a decision was made to perform colonoscopy () and biopsies which confirmed chronic active ulcerative colitis (). He was started on empiric therapy for inflammatory bowel disease and eventually required high-dose intravenous steroids before he showed clinical improvement. Intravenous methyl prednisolone 40 mg every six hours was given for the first six days followed by 60 mg daily intravenously until discharge. He was given budesonide 9 mg orally once daily for the first six days, mesalamine 800 mg orally three times a day for the first six days, and pantoprazole 40 mg orally for his entire 14-day inpatient stay. He also received metronidazole 500 mg intravenously once daily for the first six days and then orally every eight hours until discharge. Stool cultures showed the usual enteric flora and HIV was negative. His hospitalization was complicated by blood loss anemia, requiring multiple blood transfusions in addition to twice daily dosing of Recombinant human factor VIII. He was eventually discharged after 14 days on an oral steroid taper and, as an outpatient, was to be followed up for initiation of a biologic agent. After discharge the patient was lost to follow-up. |
pmc-6142750-1 | A 13-year-old male was transferred to our Pediatric Hematology/Oncology Clinic for evaluation of a large liver mass detected by an abdominal computed tomography (CT) scan in an outside hospital. He presented with increasing abdominal distension of several months' duration and denied fever, abdominal pain, nausea, vomiting, or loss of appetite. During his admission, a physical examination revealed that the liver edge was palpable 6 cm below the right costal margin and no abdominal tenderness or guarding was present. Laboratory investigations demonstrated slightly elevated lactate dehydrogenase (263 U/L, normal range: 74–250 U/L). His blood count, liver function tests, and other liver enzymes as well as serum alpha-fetoprotein (AFP) were within normal range. Ultrasonography revealed a partially defined hepatic mass with multiple internal cystic foci, and an increased intralesional vascularization is identified (). Magnetic resonance imaging (MRI) of the abdomen revealed a 17 × 18 × 20 cm heterogeneous predominantly cystic mass with thick internal septations, residual solid tissue, and peripheral neovascular formation in the right hepatic lobe (Figures –). Extended right hepatectomy was performed. Intraoperative frozen section was submitted with interpretation of malignant neoplasm. Grossly, the resected specimen consisted of a 19.5 × 14 × 16 cm well-circumscribed mass with a fibrous pseudocapsule. Cut surface of the tumor showed a variegated appearance of gray, solid glistening tumor alternating with soft gelatinous areas with dark-brown and yellow-green areas of hemorrhage and necrosis (). On microscopic examination, the tumor contains alternating hypocellular myxoid areas and hypercellular areas. It was comprised predominantly of pleomorphic cells that are spindle, oval, or stellate shaped and distributed in a fibrous or myxoid stroma (Figures –). Some areas showed fibroblast-like fascicles and bundles. Focally, tumor cells were highly bizarre, with occasional large anaplastic multinucleated giant cells. Atypical mitotic figures were easily identified. Few sharply defined eosinophilic hyaline globules in the tumor cell cytoplasm were observed (). Entrapped bile ducts and hepatic cords were present in areas at the periphery of the tumor (). By immunohistochemistry, tumor cells stained positively for vimentin and alpha1-antitrypsin, partially positive for desmin, and negative for myogenin, smooth muscle actin (SMA), and pancytokeratin (AE1/AE3) (Figures –). The AE1/AE3 stain highlighted the entrapped bile ducts (). The surgical margin was free. On the basis of these findings, a pathological diagnosis of UESL was made. Postoperative positron emission tomography (PET) scan did not reveal residual or metastatic disease. A five-month course of chemotherapy (VAdrC/VIE) including vincristine, doxorubicin, cyclophosphamide, ifosfamide, and etoposide was received, starting at 4 weeks after the operation, and he tolerated the chemotherapy well. The patient has been followed with imaging studies, including a whole-body PET scan.
At 48 months of follow-up, surveillance MRI showed a hyperintense, 7 mm lung lesion on T2-weighted images but PET scan was negative. Chest CT imaging at 50 months following the hepatectomy revealed a 1.7 × 1.4 cm lung nodule in the left lower lobe () with no pleural or pericardial effusions. There was left hepatic lobe hypertrophy with no evidence of local tumor recurrence. The patient underwent lateral thoracotomy with wedge resection of the left lower lobe nodule. Macroscopically, the resected specimen consisted of a well-demarcated mass measuring 1.5 × 1.2 × 0.9 cm with soft and gelatinous cut surface. Histopathological studies revealed that the tumor was composed of pleomorphic stellate and spindled neoplastic cells in a predominantly myxoid matrix; scattered bizarre multinucleated giant cells and atypical mitotic figures were frequently seen (Figures –). No evident intracellular or extracellular eosinophilic hyaline globules were observed. There were bronchioles entrapped within and at the periphery of the tumor (Figures and ). Few isolated bronchioles were focally destroyed by the infiltrating tumor. Background lung parenchyma revealed atelectasis and marked vascular congestion. By immunohistochemistry, the tumor cells were strongly and diffusely positive for vimentin, α1-antitrypsin, and CD10, patchy positive for desmin, CD56, and BCL2, rare staining for CD68, and negative for myogenin and AE1/AE3 (Figures –). The entrapped bronchiolar epithelium was highlighted by AE1/AE3 (). The pathological findings are consistent with metastases of the UESL. A chemotherapy regimen with olaratumab plus doxorubicin was received. At the time of this report, he is 9 months after wedge resection and remains well with no evidence of tumor recurrence. |
pmc-6142755-1 | A 61-year-old male from northern Sri Lanka presented with high-grade fever, neck pain, odynophagia, and dysphagia for three days duration with the background of uncontrolled diabetes mellitus. His last HbA1c was 9.1% one month ago. His symptoms significantly interfered with his oral intake. He did not complain of cough, shortness of breath, headache, and ear, nose, or throat pain. He is a teetotaler and denied sexual promiscuity or substance abuse. There was no recent travel history of significance.
On examination, he was ill and febrile with a temperature of 102°F. Few enlarged (0.5–1 cm) tender lymph nodes were detected on the left anterior cervical chain with minimal neck swelling. Complete ear, nose, throat, and dental examinations were normal. Respiratory rate was 24/min. He maintained the saturation of 98% on room air, and he was hemodynamically stable. Rest of the physical examination was unremarkable.
Investigations showed neutrophilic leukocytosis (WCC 14.3 × 106/microlitre, neutrophils 90%) and elevated inflammatory markers (CRP 327 mg/dl and ESR 94 mm/1st hour), suggestive of a severe bacterial inflammation. Three sets of blood cultures were sterile after incubation. Renal, liver, and thyroid profiles were well within normal limits, and transthoracic two-dimensional echocardiogram was also normal.
Fiber optic laryngoscopic examination showed fullness and inflamed pyriform fossa bilaterally with inflamed arytenoids and aryepiglottis. Contrast-enhanced CT scan of the neck confirmed a prevertebral abscess at the cervical area. Few milliliters of pus was drained before commencing intravenous broad spectrum antibiotics empirically. The aspirated pus later grew Acinetobacter baumannii which was sensitive to broad spectrum of antibiotics such as meropenem, imipenem, and piperacillin-tazobactam. Ultrasound scan-guided therapeutic surgical drainage of 45 ml of pus was removed via the transcervical approach by the otolaryngology team to facilitate early recovery (). |
pmc-6142756-1 | A 12-year-old girl with a previous diagnosis of MFS was admitted in our Pediatric Surgery Unit with sudden onset of chest pain and shortness of breath after sneezing. Her past medical history revealed two previous left spontaneous pneumothorax (two and three months prior to this hospital admission), managed with conservative measures and pleural drainage.
Upon examination, both physical and radiographic findings were compatible with a pneumothorax recurrence on the left side. A thoracic CT scan showed bullous pulmonary dysplasia (). Thoracoscopic treatment included resection of the pneumopleural adhesions and bullae. The procedure was performed with the patient in a lateral decubitus position. Three valved ports, ranging in size from 3 to 5 mm, were used. The first port was placed in the mid to the anterior axillary line in the fifth interspace to determine the position of the major fissure and evaluate the lung parenchyma. The position of the fissure dictates the placement of the other ports. The working ports were placed in the anterior axillary line above and below the camera port. Lung resection, including the parenchymal area involved in the lesion, was performed using the LigaSure® device. A lung specimen was removed using a protective specimen endobag through a 5 mm port. No postsurgical drainage tubes were positioned. The patient was discharged on the eighth postoperative day.
One week later, a pneumothorax recurrence necessitated a second thoracoscopic intervention. Further pulmonary resection of the atypical upper left lobe was performed using a stapling device. Two patches (9.5 × 4.8 cm) were cut from the adhesive/foam complex (TachoSil®), rolled and inserted into the 5 mm trocar, and subsequently stretched over the sutures. No drainage tubes were inserted. The postoperative period was uneventful, and the patient was discharged one week later. Gross findings showed severe emphysematous involvement in the upper lobe with marked bulla formation (). Microscopic examination revealed a characteristic emphysema morphological pattern juxtaposed to normal lung parenchyma ().
Three months later the patient was admitted again, this time with a right-sided pneumothorax. A thoracoscopic intervention on the atypical section of the upper right lobe was performed using a stapling device (), and new pieces of the TachoSil patch were applied. No thoracic drainage tubes were inserted. Microscopic findings shown in Figures and evidenced emphysematous changes. At six-month follow-up, the patient was in good condition with no further pneumothorax recurrences. |
pmc-6142760-1 | A 43-year-old Caucasian male with a past medical history significant for depression which was well controlled with Prozac presented to the Emergency Department with nausea, vomiting, myalgias, and dark colored urine. He admitted to recent travel to Virginia Beach but denied any history of travel outside of the United States. He denied any high risk sexual behavior, previous blood transfusions, or intravenous (IV) drug use. He worked as a police officer with limited field work exposure. He denied any new medications including antibiotics; acetaminophen containing products; nonsteroidal medications; or over-the-counter herbal medications, vitamins, or supplements. He had no previous surgical history or dental procedures and family history was unremarkable for chronic liver disease or gastrointestinal (GI) pathology. His review of systems was negative except for subjective fevers, abdominal pain, diarrhea, and the aforementioned symptoms.
He was evaluated in the Emergency Department and was found to be tachycardic, tachypneic, and febrile with a maximum temperature of 103.1°F. Physical exam revealed a well appearing Caucasian male in no distress who was alert and oriented to place, person, and time. He was noted to have scleral icterus. Cardiovascular exam revealed tachycardia with no murmurs, rubs, or gallops. Pulmonary exam was clear to auscultation without any rales, rhonchi, or wheezing. Abdominal exam revealed a soft, nontender, nondistended abdomen with positive bowel sounds without palpable ascites or organomegaly. Dermatological exam revealed jaundice but no erythema or wounds. Examination of the extremities revealed no evidence of edema, nail splinter hemorrhages, palmar Janeway lesions, or palmar Osler nodes. Initial laboratory evaluation revealed elevated liver biochemistries with an AST of 45 U/L, ALT of 93 U/L, alkaline phosphatase of 139 U/L, total bilirubin of 5.4 mg/dL, direct bilirubin of 2.7 mg/dL, white blood cell count of 15.1 K/cmm, hemoglobin of 14.1 g/dL, platelets of 240 K/cmm, and an INR of 1.50. The patient's alkaline phosphatase was only mildly elevated; therefore the decision was made not to order a gamma-glutamyltransferase. Patient was started on empiric ceftriaxone and admitted to the hospital.
Follow-up evaluation included a viral hepatitis panel (). A right upper quadrant abdominal ultrasound with Doppler flow was performed which showed a normal appearing liver without suspicious mass or biliary duct dilation, an unremarkable gallbladder, a 4 mm common bile duct, and an unremarkable liver Doppler interrogation (Figures and ).
The patient continued to have persistent symptoms of myalgias, fevers, and jaundice; therefore the gastroenterology service was consulted to evaluate the patient. Additional liver serology revealed an acetaminophen level of <5 mcg/mL, salicylate level <0.3 mg/dL, and a ceruloplasmin of 41 mg/dL, and iron studies revealed an iron level of 16 μg/dl, total iron binding capacity of 171 μg/dl, iron saturation of 9.4%, and a ferritin of 1914.0 ng/mL, which were consistent with inflammatory process. His autoimmune workup revealed negative smooth muscle and antimitochondrial antibodies with an ANA of <1:40.
At the same time the Infectious Disease (ID) service was consulted and a full septic workup was pursued including the workup noted in . Doxycycline was added to the regimen until chlamydia was ruled out. The patient continued to have persistent fevers and elevated liver biochemistries with an AST of 51 U/L, ALT of 61 U/L, alkaline phosphatase of 136 U/L, total bilirubin of 3.5 mg/dl, and an INR of 1.36 and therefore on his fourth day in the hospital a magnetic resonance cholangiopancreatography (MRCP) was performed which showed abnormal liver lesions concerning for multiple abscesses given the rapid change from the recent ultrasound.
Interventional radiology was consulted and using computerized tomography (CT) the largest abscess was able to be drained and produced foul-smelling turbid yellow fluid. The cultures revealed streptococcus, not group D, although the lab noted that they were not able to provide susceptibility due to the fastidious nature of the organism. Two sets of blood cultures were obtained and were negative at 120 hours. Due to the negative blood cultures and lack of physical exam findings consistent with endocarditis the ID service determined that echocardiogram was not necessary. The patient began to improve clinically, a PICC line was inserted, and the patient was discharged home on ceftriaxone. Two months later the patient had a follow-up CT of the abdomen and pelvis with and without IV contrast which showed improvement in the liver abscesses and an otherwise unremarkable liver, gallbladder, and biliary tree. Four months later the patient had a colonoscopy performed which showed no evidence of diverticular disease. |
pmc-6142763-1 | A 26-year-old woman, Gravida 3, Para 1, Abortus 1, presented at 19 weeks and 4 days of gestation for evaluation of a short cervix and placenta previa. The patient was asymptomatic, denying pain, vaginal bleeding, leakage of fluid, cramping, or uterine contractions. Ultrasound examination suggested a total placenta previa. The cervix was difficult to visualize and was considered unmeasurable in length. The fetus was in a cephalic presentation (Figures and ). During speculum examination, the cervix could not be visualized. Because of the uncertain diagnosis, a careful digital exam was performed to evaluate the location of the external cervical os which was difficult to assess. A transabdominal ultrasound scan was performed concomitant with the digital examination (). The diagnosis remained unclear, and therefore expectant management with daily vaginal progesterone therapy was initiated. Weekly transvaginal ultrasound scans continued showing similar findings. The patient remained clinically asymptomatic. Retrospective review of the earlier ultrasound images showed that the cervix was compressed against the anterior vaginal wall. The cervix and the lower uterine segment were elongated and stretched along what was thought to be the anterior wall of the uterus (Figures and ). At 26 weeks of gestation, upon repeat transvaginal ultrasound scanning, the cervix was found to be 41 mm in length and the placenta was in an anterior-fundal position with the fetus in a breech presentation (Figures and ). These new findings supported spontaneous resolution of a retroverted incarcerated uterus. The patient had a normal course of pregnancy afterwards. She had a spontaneous vaginal delivery at 39 3/7 weeks and delivered a viable male infant weighing 3,035 grams with APGAR scores of 8 at 1 minute and 9 at 5 minutes. |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.