text
stringlengths 4
2.47k
|
|---|
he cellular response to DSBs depends on damage signaling including the phosphorylation of the histone H2AX (γH2AX). However, a lack of γH2AX formation in heterochromatin (HC) is generally observed after DNA damage induction. Here, we examine γH2AX and repair protein foci along linear ion tracks traversing heterochromatic regions in human or murine cells and find the DSBs and damage signal streaks bending around highly compacted DNA.
|
Human epidermal growth factor receptor type 2 (HER2) overexpression supports proliferation of androgen-independent prostate cancer (PC)
|
Twenty-one consecutive patients suffering from chronic (mean disease duration 29.9 years), therapy-resistant ET were treated with MRgFUS CTT.
|
To date, human (h) Upf1 protein (p) (hUpf1p), a group 1 RNA helicase named after its Saccharomyces cerevisiae orthologue that functions in both translation termination and NMD, has been the only factor shown to be required for NMD in mammalian cells.
|
microRNA (miR)-182, miR-200a, miR-200b and miR-200c were highly overexpressed in the SEOC cell lines relative to normal human ovarian surface epithelial cells and were assessed in RNA extracted from serum as candidate biomarkers
|
The heterodimeric Rag GTPases localize mTORC1 to lysosomes by their amino-acid-dependent interaction with the lysosomal Ragulator complex.
|
This study further confirmed the importance of DGAT1 in triglyceride synthesis in bovine mammary tissue.
|
This study was to evaluate Tomita and Tokuhashi scoring systems in selecting surgical procedure and predicting prognosis of extradural spinal metastases.
|
Reactive oxygen species induce oxidative damage in DNA precursors, i.e. dNTPs, leading to point mutations upon incorporation. Escherichia coli mutT strains, deficient in the activity hydrolysing 8-oxo-7,8-dihydro-2'-deoxyguanosine 5'-triphosphate (8-oxo-dGTP), display more than a 100-fold higher spontaneous mutation frequency over the wild-type strain. 8-oxo-dGTP induces A to C transversions when misincorporated opposite template A.
|
Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5).
|
Thus, late I(Na) inhibition appears to be a promising option for diastolic dysfunction and arrhythmias in HF where CaMKII is found to be increased.
|
Flow cytometric analysis using the apoptotic marker, Annexin V, shows that this endogenous re-expression is sufficient to drive the SCLC cells to apoptosis.
|
The HEAT-repeat protein Pds5B
|
The incorporation of 5-azacytosine residues into DNA causes potent inhibition of DNA (Cytosine-C5) methyltransferases. T
|
The Turcot syndrome has been defined as the simultaneous presence of multiple polyposis of the colon and a malignant brain tumor.
|
The orally bioavailable MDM2 antagonist RG7112 and pegylated interferon α 2a target JAK2V617F-positive progenitor and stem cells.
|
In agreement with previous studies, we show that CSF Ng is significantly increased in AD as compared with healthy controls.
|
A transmembrane domain (TMD) at the N-terminus of a membrane protein is a signal sequence that targets the protein to the endoplasmic reticulum (ER) membrane.
|
gall tumors develop after integration of the T-DNA of virulent Agrobacterium tumefaciens strains into the plant genome
|
And persistent pain produced by peripheral tissue injury and inflammation was modeled by formalin test.
|
ChaFRADIC is a powerful and practicable tool for protease and peptidase research,
|
Thyroid hormones enter the choroid plexus via thyroid hormone transmembrane transporters and leave the choroid plexus to enter the cerebrospinal fluid via either thyroid hormone transmembrane transporters or via choroid plexus-derived transthyretin secreted into the cerebrospinal fluid.
|
FGFR genes have important effects on bone development, and mutations in 4 "hot spot" exons of FGFR1-3 are found in many patients with craniosynostosis and some with synostotic plagiocephaly
|
Platelet biomarkers in Alzheimer's disease.
|
Determinants of the replication-timing program are re-established during early G1 phase of each cell cycle and lost in G2 phase, but it is not known when TAD structure and inter-TAD contacts are re-established after their elimination during mitosis.
|
Thus, methylated RARβ(2) and APC genes might be valuable urinary molecular markers for early detection of bilharzial and nonbilharzial bladder cancer.
|
spliceR uses the full-length transcript output from RNA-seq assemblers to detect single or multiple exon skipping, alternative donor and acceptor sites, intron retention, alternative first or last exon usage, and mutually exclusive exon events. For each of these events spliceR also annotates the genomic coordinates of the differentially spliced elements, facilitating downstream sequence analysis. For each transcript isoform fraction values are calculated to identify transcript switching between conditions. Lastly, spliceR predicts the coding potential, as well as the potential nonsense mediated decay (NMD) sensitivity of each transcript.
|
The Ca(2+) paradox represents a good model to study Ca(2+) overload injury in ischemic heart diseases. We and others have demonstrated that contracture and calpain are involved in the Ca(2+) paradox-induced injury.
|
In the subgroup of patients with low-grade gliomas, depressive patients had a significantly shorter survival time compared with nondepressive subjects (P = 0.031, Kaplan-Meier survival analysis).
|
Orteronel is a nonsteroidal, selective inhibitor of 17,20-lyase that was recently in phase 3 clinical development as a treatment for castration-resistant prostate cancer.
|
We have previously shown that the amount of movement exhibited by patients with schizophrenia is positively correlated with the volume of left anterior cingulate cortex and that this quantity of movement can be increased by modafinil.
|
These SDs, often referred to as peri-infarct depolarizations, cause vasoconstriction and recruitment of the penumbra into the ischemic core in the critical first hours after focal ischemic stroke; however, the real-time spatiotemporal dynamics of SD-induced injury to synaptic circuitry in the penumbra remain unknown.
|
In human and mice spermatids, di- and tri-methylated H3K79 temporally overlapped with hyperacetylated H4 and thus accompanied chromatin reorganization
|
SET domain, first identified within and named after proteins encoded by three Drosophila genes [Su(var)3-9, E(z), and Trithorax], is recognized as a signature motif for histone methyltransferases
|
Stem cell therapy for treatment of cardiac disease has shown therapeutic potential.
|
Cytoplasmic export of the RNA-binding protein HuR, a process that critically regulates its function, was recently shown to be inhibited by the AMP-activated protein kinase (AMPK)
|
Hence, acquisition of 5hmC in cell-specific distal regulatory regions may represent a major event of enhancer progression toward an active state and participate in selective activation of tissue-specific genes.
|
Germline mutations in BRCA genes are associated with breast and ovarian cancer susceptibility.
|
The maximum-tolerated dose and recommended phase II dose of bortezomib in this schedule is 1.6 mg/m(2). Biologic activity (inhibition of nuclear factor-kappa B-related markers) and antitumor activity is seen in AIPCa at tolerated doses of bortezomib.
|
Epidemiological and virological data suggest that measles vaccine does not cause SSPE.
|
Patients were exposed earlier than controls to the refrigerator (X2 = 9.9, df = 3, P = 0.04) and refrigerator exposure at birth was found to be a risk factor for CD (OR = 2.08 (95% CI: 1.01-4.29), P = 0.05). Comparable results were obtained looking for the exposure to freezer at home.
|
Myocardial MTOR activity changes during hypertrophy and heart failure (HF).
|
Nicotinamide, which protected against both UVB and UVA, is a promising agent for skin cancer prevention.
|
Although many clinics offer PGD for HA by gender selection, an approach that detects the presence of the underlying F8 mutation has several advantages.
|
In July 2015, the US Food and Drug Administration approved the first of a new class of drugs for the treatment of heart failure: Valsartan/sacubitril (formerly known as LCZ696 and currently marketed by Novartis as Entresto) combines the angiotensin receptor blocker valsartan and the neprilysin inhibitor prodrug sacubitril in a 1:1 ratio in a sodium supramolecular complex.
|
In this new release, JASPAR grows into a meta-database of collections of TFBS models derived by diverse approaches. We present JASPAR CORE--an expanded version of the original, non-redundant collection of annotated, high-quality matrix-based transcription factor binding profiles, JASPAR FAM--a collection of familial TFBS models and JASPAR phyloFACTS--a set of matrices computationally derived from statistically overrepresented, evolutionarily conserved regulatory region motifs from mammalian genomes.
|
Further analysis revealed that the DNA sequence, TTCAAGTCCCGCCCTCCGCT from -65 to -46
|
We evaluated survival and CSC phenotype in mice harboring sarcoma metastases after TKI therapy. We exposed dissociated primary sarcoma tumors to sorafenib, regorafenib, and pazopanib, and we used tissue microarray (TMA) and primary sarcoma samples to evaluate the frequency and intensity of CSC markers after neoadjuvant therapy with sorafenib and pazopanib. Parametric and non-parametric statistical analyses were performed as appropriate.RESULTS: After functionally validating the CSC phenotype of ALDHbright sarcoma cells, we observed that sorafenib and regorafenib were cytotoxic to sarcoma cell lines (P<0.05), with a corresponding 1.4 - 2.8 fold increase in ALDHbright cells from baseline (P<0.05).
|
Today, woolsorters' disease and other industrial manifestations of anthrax are extremely rare,
|
Probe-to-bone test and simple X-rays are both standard tests for the diagnosis of diabetic foot osteomyelitis. This study demonstrates the importance of considering jointly clinical information (probe-to-bone test) and diagnostic tests (simple radiography) to increase agreement among clinicians on diagnosis of diabetic foot osteomyelitis.
|
The accelerator implements a version of the Needleman-Wunsch algorithm for nucleotide sequence alignment. Sequence lengths are constrained only by available memory; the product of sequence lengths in the current implementation can be up to 2(22). The machine is implemented as two NuBus boards connected to a Mac IIf/x, using a mixture of TTL and FPGA technology clocked at 10 MHz.
|
The MTREC complex specifically binds to CUTs, meiotic mRNAs and unspliced pre-mRNA transcripts and targets these RNAs for degradation by the nuclear exosome, while the TRAMP complex has only a minor role in this process
|
The association between these two conditions is, at most, weak, but a gluten-free diet may still bring symptomatic relief for reflux symptoms in coeliac disease
|
We find that cleavage patterns at centromeres are unique within the genome and are incompatible with symmetrical structures, including octameric nucleosomes and (Cse4/H4)2 tetrasomes.
|
The family Reduviidae (Hemiptera: Heteroptera), or assassin bugs, is among the most diverse families of the true bugs, with more than 6,000 species.
|
Spt-Ada-Gcn5-acetyltransferase (SAGA)
|
To test the hypothesis that the contradictory modifications are due to imprinting, we used a SNP analysis of RNA-seq data to demonstrate that both alleles of certain ZNF genes having H3K9me3 and H3K36me3 are transcribed. We next analyzed isolated ZNF 3' exons using stably integrated episomes.
|
enome-wide studies of CCCTC-binding factor (CTCF) and cohesin provide insight into chromatin structure and regulation
|
Aliskiren, the first orally effective direct renin inhibitor, is an effective antihypertensive agent with distinctive properties including placebo-like tolerability, pharmacologic effects that persist after drug discontinuation, and a unique mechanism of action.
|
Moreover, CSE-regulated COX-2, PGE(2), and IL-6 generation was inhibited by pretreatment with TLR4 Ab; inhibitors of c-Src (PP1), NADPH oxidase (diphenylene iodonium chloride and apocynin), p38 MAPK (SB202190), MEK1/2 (U0126), JNK1/2 (SP600125), and NF-kappaB (helenalin); a ROS scavenger (N-acetyl-l-cysteine); and transfection with siRNA of TLR4, MyD88, TRAF6, Src, p47(phox), p38, p42, JNK2, or p65.
|
plicing defects account for 16% of the mutant alleles in the PCCA and PCCB genes, encoding both subunits of the propionyl-CoA carboxylase (PCC) enzyme, defective in propionic acidemia
|
We report enzymatic studies of the secondary structure of Alu RNAs transcribed in vitro from two recently retroposed Alu elements
|
Fluorescein photodiagnosis of idiopathic retinal vasculitis, aneurysms, and neuroretinitis (IRVAN) syndrome: A case report and long-term outcome of photocoagulation therapy.
|
Radiographic investigation revealed an anomalous enlargement of the left transverse process of the fifth lumbar vertebra forming a pseudarthrosis with the infrajacent ala of the sacrum.
|
PHA-E is a natural product extracted from red kidney beans, and it has been reported to induce cell apoptosis by blocking EGFR in lung cancer cells
|
For example, mutations of the MITF gene cause Waardenburg syndrome type 2A as well as Tietz syndrome.
|
Ear, nose and throat symptoms and signs were studied in 15 patients with Kartagener's syndrome: a triad consisting of chronic rhinosinusitis, chronic bronchitis with bronchiectasis, and situs inversus.
|
Siltuximab for multicentric Castleman's disease: a randomised, double-blind, placebo-controlled trial.
|
AREAS COVERED: This review provides a digest of all current experience and evidence about pharmacological agents recently described as having a role in the treatment of BS, including interleukin (IL)-1 inhibitors, tocilizumab, rituximab, alemtuzumab, ustekinumab, interferon-alpha-2a, and apremilast.
|
We studied the inhibition of angiotensin converting enzyme (ACE) in eight infants with congestive heart failure (CHF) poorly controlled with digoxin and diuretics, treated orally with 0.25 mg kg-1 enalapril maleate once a day
|
Higher second fourth digit ratio predicts higher incidence of prostate cancer in prostate biopsy.
|
CONCLUSION: Meigs' syndrome should be considered at the differential diagnosis for a patient with pelvic mass, pleural effusion and ascites with normal cytology, increased CA125 levels.
|
We reported a 7-year-old girl with myoclonic-astatic epilepsy of early childhood (Doose syndrome).
|
Sevoflurane can be effectively and safely used for short-term sedation of ICU patients with stable hemodynamic conditions.
|
A combination of molecular hybridization studies and long-range polymerase chain reaction was used to isolate a 6-kb full-length long interspersed nuclear element (LINE or L1)
|
The BIOASQ infrastructure, including benchmark datasets, evaluation mechanisms, and the results of the participants and baseline methods, is publicly available.CONCLUSIONS: A publicly available evaluation infrastructure for biomedical semantic indexing and QA has been developed, which includes benchmark datasets, and can be used to evaluate systems that: assign MESH headings to published articles or to English questions; retrieve relevant RDF triples from ontologies, relevant articles and snippets from PUBMED Central; produce "exact" and paragraph-sized "ideal" answers (summaries). The results of the systems that participated in the 2013 BIOASQ competition are promising.
|
The common mutations found in the lysosomal enzyme deficient in Gaucher disease, beta-glucocerebrosidase, earmark these proteins for destruction by the endoplasmic reticulum-localised protein folding machinery, resulting in enzyme insufficiency, lysosomal glycolipid storage and subsequent pathology
|
Telomerase complex genes mutations (DKC1, TERC, TERT, and NOP10) lead to premature telomere shortening and are responsible for different forms of dyskeratosis congenita
|
RNA processing events that take place on the transcribed pre-mRNA include capping, splicing, editing, 3' processing, and polyadenylation. Most of these processes occur co-transcriptionally while the RNA polymerase II (Pol II) enzyme is engaged in transcriptional elongation
|
RET gene mutations were found in significant proportions of familial (50%) and sporadic (15-20%) HSCR, while homozygosity for EDNRB or EDN3 mutations accounted for the rare HSCR-Waardenburg syndrome (WS) association.
|
The RdRP activity of Pol II provides a missing link in molecular evolution, because it suggests that Pol II evolved from an ancient replicase that duplicated RNA genomes.
|
Brown adipose cells are specialized to dissipate chemical energy in the form of heat, as a physiological defence against cold and obesity.
|
modulation of Bmi-1 protein might be involved in human colorectal carcinogenesis by repressing the INK4a/ARF protein
|
Exosome secretion participates in the eradication of obsolete proteins but several findings, essentially in the immune system, indicate that exosomes constitute a potential mode of intercellular communication
|
The combination of cytokines IL-2 and GM-CSF with the anti-GD2 MoAb ch14.18 (Dinutuximab) has shown a significant improvement in outcome for HR-NB. The FDA and EMA approved dinutuximab (Unituxin(R)) in 2015 for the treatment of patients with HR-NB who achieved at least a partial response after multimodality therapy.
|
We evaluated the feasibility and usefulness of reverse transcriptase-polymerase chain reaction (RT-PCR) on fine-needle aspirates for categorization of small blue round cell tumors (SBRCTs). A total of 51 cases, including 25 Ewing sarcoma/peripheral primitive neuroectodermal tumors (PNETs), 11 rhabdomyosarcomas, 13 neuroblastomas, and 2 desmoplastic small round cell tumors (DSRCTs) were analyzed. The detection of the EWS-FLI1 (20/25) and EWS-ERG (4/25) fusion transcripts resolved 24 of 25 cases of Ewing sarcoma/PNET
|
Cranial computed tomography demonstrated abnormal findings that may suggest defective neuronal migration and/or dysgenesis of the brain
|
Many cancers overexpress ATF4, a stress-induced transcription factor that promotes cell survival under hypoxic conditions and other stresses of the tumor microenvironment, but the potential contributions of ATF4 to oncogenesis itself have been little explored. Here, we report that ATF4 promotes oncogene-induced neoplastic transformation by suppressing the expression of cellular senescence-associated genes.
|
Circular RNA may be an ancient, conserved feature of eukaryotic gene expression programs.
|
Dabrafenib is a BRAF kinase inhibitor indicated for the treatment of BRAF V600E mutation-positive melanoma.
|
Viliuisk encephalomyelitis in Eastern Siberia - analysis of 390 cases.
|
Primary tumor type and Tokuhashi scoring independently predicted survival in patients with spinal metastases after surgery.
|
the X-inactivated-specific transcript (Xist) gene, whose gene product consists of RNA which coats and thereby inactivates one of the X chromosomes
|
BTBR T+tf/J (BTBR), a commonly-used model presenting all core autism-related phenotypes
|
Further information about the combined risk of aPC resistance and pregnancy is needed before guidance on the management of affected women can be formulated.
|
activated Bax forms large oligomers that permeabilize the outer mitochondrial membrane, thereby committing cells to apoptosis,
|
estrogen receptor modulator (SERM)
|
reports of microRNA (miR) modulators of both neuronal and immune processes (here termed NeurimmiRs) predict therapeutic potential for manipulating NeurimmiR levels in diseases affecting both the immune system and higher brain functions, such as Alzheimer's disease (AD), Parkinson's disease (PD), multiple sclerosis (MS) and anxiety-related disorders. In our opinion, NeurimmiRs that function within both the nervous and the immune systems, such as miR-132 and miR-124, may act as 'negotiators' between these two interacting compartments.
|
The term septooptic dysplasia was coined in 1956 by de Morsier, who pointed out the association of optic nerve hypoplasia and absence of the septum pellucidum.
|
Here we report the isolation of a cDNA representing the FAA gene, following an expression cloning method similar to the one used to clone the FAC gene. The 5.5-kb cDNA has an open reading frame of 4,368 nucleotides. In contrast to the 63-kD cytosolic protein encoded by the FAC gene, the predicted FAA protein (M(r) 162, 752) contains two overlapping bipartite nuclear localization signals and a partial leucine zipper consensus, which are suggestive of a nuclear localization
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.