answers
sequencelengths 1
6
| passages
sequence | query
stringlengths 5
429
| query_id
int32 1
1.19M
| query_type
stringclasses 5
values | wellFormedAnswers
sequencelengths 0
53
|
|---|---|---|---|---|---|
[
"IM injections are usually given in the thigh."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Ventrogluteal site. 1 With the palm of your hand, locate the greater trochanter of the femur. 2 SSpread your index and middle fingers posteriorly from the anterior superior iliac spine to the furthest area possible. This is the correct injection site. 3 Remove your fingers and insert the needle at a 90-degree angle.",
"Proceeding With the IM Injection. 1 1. Wash your hands prior to starting the procedure. 2 2. Reassure the patient and explain how the procedure will unfold. 3 3. Sanitize the area with an alcohol swab. 4. Encourage the patient to 1 relax. 5. Insert the needle into the specific location. 6. Pull back the plunger before injecting.",
"S.C. drugs can be injected into the fat pads on the abdomen, buttocks, upper back, and lateral upper arms and thighs (shaded in the illustrations below). If your patient requires frequent S.C. injections, make sure to rotate injection sites.",
"The following are sites where you can give a subcutaneous injection: 1 Abdomen: Uncover your abdomen. 2 Thigh: Uncover the entire leg. 3 Lower back: Uncover the back from the waist to the top of the buttocks. Upper Arm: Uncover the arm to the shoulder.",
"Warning: include(/web/sites/books/home/medical/NursesDrugHandbook/inc/top.inc): failed to open stream: No such file or directory in /web/sites/books/htdocs/medical/NursesDrugHandbook/safe_drug_admin/identifying_injection_sites/IdentifyingInjectionSites.php on line 1.",
"Your healthcare provider has prescribed a medicine that must be given by intramuscular (IM) injection. IM injections use a needle and syringe to send medicine to large muscles in your body. IM injections are usually given in the thigh, hip, or upper arm. You were shown how to give yourself an IM injection in the hospital. This sheet will help you remember those steps when you are at home. Name of medicine: ________________________. Amount per injection: ________________________.",
"The thigh is a good place to give yourself an injection because it is easy to see. It is also a good spot for children younger than three years old. Ventrogluteal Muscle (Hip): To find the correct location, place the heel of your hand on the upper, outer part of the thigh where it meets the buttocks.",
"Needle and syringe sizes. The appropriate size of the needle and syringe are. important for the type of medication. In general, use a small, short needle. Your healthcare provider. will discuss appropriate needle and syringe sizes. with you.",
"Learning to give an intramuscular (IM) injection may become a necessity if you, or a family member, suffer from an illness that requires injections of medication. The doctor will make this decision as they provide medical care and the doctor or nurse will explain to the caregiver how to give an intramuscular injection.",
"Talk to your doctor about which medications may be most appropriate for you. The information reflected here is dependent upon the correct functioning of our algorithm. From time-to-time, our system might experience bugs or glitches that affect the accuracy or correct application of mathematical algorithms. We will do our best to update the site if we are made aware of any malfunctioning or misapplication of these algorithms."
],
"url": [
"http://books.mcgraw-hill.com/medical/NursesDrugHandbook/safe_drug_admin/identifying_injection_sites/IdentifyingInjectionSites.php",
"http://www.wikihow.com/Give-an-Intramuscular-Injection",
"http://books.mcgraw-hill.com/medical/NursesDrugHandbook/safe_drug_admin/identifying_injection_sites/IdentifyingInjectionSites.php",
"https://www.drugs.com/cg/how-to-give-a-subcutaneous-injection.html",
"http://books.mcgraw-hill.com/medical/NursesDrugHandbook/safe_drug_admin/identifying_injection_sites/IdentifyingInjectionSites.php",
"http://healthsource.sw.org/Search/3,86535",
"http://www.wikihow.com/Give-an-Intramuscular-Injection",
"http://www.cc.nih.gov/ccc/patient_education/pepubs/subq.pdf",
"http://www.wikihow.com/Give-an-Intramuscular-Injection",
"https://treato.com/Injections,Thigh+Pain/?a=s"
]
} | thigh injection | 519,841 | DESCRIPTION | [] |
[
"The temperatures generally range between 18 °C and 32 °C and there is around 19mm of rainfall over the course of 2 days."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Averages for Seville in September. In September, Seville normally receives at least 9 hours of sunshine per day. It generally starts to feel slightly cooler but the weather is still incredible for tourists. The temperatures generally range between 18 °C and 32 °C and there is around 19mm of rainfall over the course of 2 days.",
"Average temperatures for September at cities throughout Spain are listed below in degrees Celsius and Fahrenheit. The tables give the normals for maximum and minimum monthly temperatures based on weather data collected from 1971 to 2000.",
"The earliest sunrise of the month in Sevilla is 7:54 AM on September 1 and the latest sunrise is 24 minutes later at 8:18 AM on September 30. The latest sunset is 8:52 PM on September 1 and the earliest sunset is 44 minutes earlier at 8:08 PM on September 30.",
"No matter what season it is or the weather at the time, Seville has the perfect climate for you. With more than six months of mild temperatures and sunny days, the city is an attractive destination for your next holidays in Spain. Check out the weather forecast for Seville.",
"The months March, April, May and October have nice weather with a good average temperature. Hot season / summer is in June, July, August and September. Seville has dry periods in June, July, August and September. On average, the warmest month is July. On average, the coolest month is January. November is the wettest month.",
"Seville’s Sunny Days Are Waiting For You. In terms of weather, Seville enjoys an amazing climate. Spring and fall are the best time of the year to spend your holidays in Spain. During both seasons you’ll find extremely sunny days along with fantastic temperatures.",
"Over the course of September in Sevilla, the length of the day is rapidly decreasing. From the start to the end of the month, the length of the day decreases by 1 hour, 8 minutes, implying an average daily decrease of 2 minutes, 21 seconds, and weekly decrease of 16 minutes, 29 seconds.",
"Holiday Weather. In September, Seville normally receives at least 9 hours of sunshine per day. It generally starts to feel slightly cooler but the weather is still incredible for tourists. The temperatures generally range between 18 °C and 32 °C and there is around 19mm of rainfall over the course of 2 days.",
"Average Weather in September in Sevilla Spain. In Sevilla, the month of September is characterized by rapidly falling daily high temperatures, with daily highs decreasing by 9°F, from 93°F to 84°F over the course of the month, and rarely exceeding 101°F or dropping below 75°F.",
"Seville: Annual Weather Averages. July is the hottest month in Seville with an average temperature of 28°C (82°F) and the coldest is January at 11°C (52°F) with the most daily sunshine hours at 12 in July. The wettest month is March with an average of 90mm of rain."
],
"url": [
"http://www.holiday-weather.com/seville/averages/september/",
"https://www.currentresults.com/Weather/Spain/temperature-september.php",
"https://weatherspark.com/m/34152/9/Average-Weather-in-September-in-Sevilla-Spain",
"http://www.seville-traveller.com/weather-seville/",
"https://weather-and-climate.com/average-monthly-Rainfall-Temperature-Sunshine,seville,Spain",
"http://www.seville-traveller.com/weather-seville/",
"https://weatherspark.com/m/34152/9/Average-Weather-in-September-in-Sevilla-Spain",
"http://www.holiday-weather.com/seville/averages/september/",
"https://weatherspark.com/m/34152/9/Average-Weather-in-September-in-Sevilla-Spain",
"http://www.holiday-weather.com/seville/averages/"
]
} | weather in seville spain in september | 545,933 | DESCRIPTION | [
"In September, the weather in Seville, Spain is that the temperatures generally range between 18 degrees C and 32 degrees C and around 19 millimeter of rainfall over the course of 2 days. "
] |
[
"Three, symbol of plurality."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"Ancient numbers and numerology. Number – a symbol that expresses an idea, an abstraction. Many scientists agree that there is any possible knowledge of the mind in abstract form. The figures also – this is a language of communication. We express our thoughts through language, based on numerical symbolism.",
"Below is a list of the knowledge that the ancient magicians credited with the first ten numbers. One – a number close to God. The Egyptians in the hymns to Amon Ra or declaring that he – “single” or “only one”. For the Pythagoreans the number “one” is an expression of the Supreme God – an invisible and comprehensive.",
"Four – in Egypt, it meant the number of the four quarters of the earth and the four sons of Horus symbolized, as well as the four cardinal directions. In the Bible we find mention of the four Evangelists, the four beasts in Ezekiel, is there 4 anchors, 4 horns, 4 elements.",
"Ancient Egyptians had an understanding of fractions, however they did not write simple fractions as 3/5 or 4/9 because of restrictions in notation. The Egyptian scribe wrote fractions with the numerator of 1. They used the hieroglyph an open mouth above the number to indicate its reciprocal.",
"Each month is introduced by its number in the sequence of 12 months in the Egyptian calendar, with the ancient Egyptian name of the month in an early New Kingdom list, the late New Kingdom month name, its early medieval equivalent in Coptic (Christian) Egypt, and the rough equivalent in the modern calendar in the ideal official year when it matched ...",
"Festivals in the ancient Egyptian calendar. Ancient Egyptian festivals centred on procession by land and river, and were celebrated on particular days or series of days in the official year.",
"The Number Sense. The number sense is not the ability to count, but the ability to recognize that something has changes in a small collection. Some animal species are capable of this. The number of young that the mother animal has, if changed, will be noticed by all mammals and most birds.",
"Three: symbol of plurality. The basic symbol for plurality among the ancient Egyptians was the number three: even the way they wrote the word for plurality in hieroglyphics consisted of three vertical marks ( | | | ). Triads of deities were also used in Egyptian religion to signify a complete system.",
"Ancient Egyptian Numbers. Egyptian Numbers --- Introduction --- Addition --- Multiplication --- Fractions. Enter a number from 1 to 9999999 to see how the Egyptians would have written it, or enter a number to count with. In the Arabic number system, we have ten digits (from 0-9) and we can make as big a number as we want with these. We use all ten digits to count to nine, then we combine them to make bigger numbers. So we never run out of numbers, as long as there is room to write them down. The ancient Egyptians didn't think this.",
"Ancient Egyptian Hieroglyphic writing, numerals and mathematical problems using the ancient numbers and the Rosetta stone. Champollion & Hieroglyphs. Ancient Egyptian history covers a continuous period of over three thousand years. To put this in perspective – most modern countries count their histories in hundreds of years."
],
"url": [
"http://numerologystars.com/ancient-numerology/",
"http://numerologystars.com/ancient-numerology/",
"http://numerologystars.com/ancient-numerology/",
"http://www.math.wichita.edu/history/topics/num-sys.html",
"http://www.ucl.ac.uk/museums-static/digitalegypt/ideology/festivaldates.html",
"http://www.ucl.ac.uk/museums-static/digitalegypt/ideology/festivaldates.html",
"http://www.math.wichita.edu/history/topics/num-sys.html",
"https://en.wikipedia.org/wiki/Numbers_in_Egyptian_mythology",
"http://gwydir.demon.co.uk/jo/numbers/egypt/intro.htm",
"https://discoveringegypt.com/egyptian-hieroglyphic-writing/"
]
} | special meaning of numbers in ancient egypt | 501,096 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Barclays uses cookies on this website. They help us to know a little bit about you and how you use our website, which improves the browsing experience and marketing – both for you and for others. They are stored locally on your computer or mobile device. To accept cookies continue browsing as normal.",
"Barclays has more than 325 years of history from our beginnings in Lombard Street.",
"Credit cards have a long and storied history, as you now know. But the above merely. represents the 3,000 foot view of the early years. For a complete look at the major. milestones in the history of credit cards, check out the following timeline.",
"The Moorish Bazaar. The study of the history of marketing, as a discipline, is meaningful because it helps to define the baselines upon which change can be recognized and understand how the discipline evolves in response to those changes.",
"© Johnson & Johnson Consumer Inc. 2006-2017. This site is published by Johnson & Johnson Consumer Inc., which is solely responsible for its content. It is intended for visitors from the United States. The RED CROSS Design is a registered trademark of JOHNSON & JOHNSON. Products bearing this trademark have no connection with the American National Red Cross.",
"Marketers tend to distinguish between the history of marketing practice and the history of marketing thought: Although the history of marketing thought and the history of marketing practice are distinct fields of study, they intersect at different junctures.",
"Later, the application of Li polymer battery brings a longer life, higher charging efficiency, higher conversional rate and green friendly power bank. The embryonic and development stage of power bank was 2001-2009. It was first invented in 2011 Las Vegas International Consumer Electronic Show. As some professional teams started to research and develop the core technology of power bank it gained its precise definition: the framework of a power bank consists of mostly complete managing circuit, a chip and a battery.",
"A biblical reference to a money box can be found in the Old Testament, in the second book of Kings. Majapahit Piggy Bank (Circa 15th Century) - The animal depicted is technically not a pig but the Javanese celeng, a small, swayed-back, black-skinned wild boar.",
"Complete History. by John Kiernan, Personal Finance Editor. The birthdate of the credit card ultimately depends upon your definition of the product. American merchants in the 1800’s extended credit to trusted customers, enabling them to. pay at a later date – often timed with things like crop yields.",
"By Jeffry Pilcher, CEO/President & Publisher of The Financial Brand. These days the piggy bank is taken for granted — it’s a coin bank, shaped like a pig. Kids love them."
],
"url": [
"https://www.home.barclays/about-barclays/history.html",
"https://www.home.barclays/about-barclays/history.html",
"https://www.mesacc.edu/sites/default/files/pages/section/news/media-coverage/When%20Were%20Credit%20Cards%20Invented_%20A%20Complete%20History.pdf",
"https://en.wikipedia.org/wiki/History_of_marketing",
"https://www.band-aid.com/",
"https://en.wikipedia.org/wiki/History_of_marketing",
"https://www.easyacc.com/media-center/a-brief-history-of-power-bank-what-has-it-replaced-and-what-has-failed-to-replace-it/",
"https://thefinancialbrand.com/24204/history-of-piggy-banks/",
"https://www.mesacc.edu/sites/default/files/pages/section/news/media-coverage/When%20Were%20Credit%20Cards%20Invented_%20A%20Complete%20History.pdf",
"https://thefinancialbrand.com/24204/history-of-piggy-banks/"
]
} | what bank invented branding | 578,401 | PERSON | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"US EPA. Consolidated List of Lists. This consolidated list of chemicals subject to reporting requirements under the Emergency Planning and Community Right-to-Know Act (EPCRA), Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) and Section 112(r) of the Clean Air Act. You may need Adobe Reader to view files on this page.",
"An updated SDS must be attached to each chemical entry in Tier II ManagerTM. Contact chemical suppliers for SDSs with new physical and health risks. Facilities are encouraged to submit 2017 Tier II UPDATE (current calendar year) reports in order to prepare for the upcoming reporting year.",
"Consolidated List of Lists This consolidated list of chemicals subject to reporting requirements under the Emergency Planning and Community Right-to-Know Act (EPCRA), Comprehensive Environmental Response, Compensation and Liability Act (CERCLA) and Section 112(r) of the Clean Air Act.",
"EHS are subject to the reporting requirements of EPCRA section 311 (provide material safety. data sheet or a list of covered chemicals to the SERC or TERC, LEPC, and local fire department) and section 312 (submit inventory form -Tier I or Tier II). The minimum threshold for section. 311-312 reporting for EHS substances is 500 pounds or the TPQ, whichever is less.",
"Electronic Safety Data Sheets (SDSs) must be attached to current (2017) Tier II chemical entries in the Tier II Manager TM Chemical Section (Step 2 of filing process). Electronic SDSs may be obtained from your chemical supplier or manufacturer and must listed the new applicable physical and health risks.",
"NEW TIER II CHEMICAL PHYSICAL AND HEALTH RISK CATEGORIES were updated in Tier II Manager TM in mid-2017 and a category list is included in the Resource Links below. All 302 EHS and 311 safety data sheet (SDS) submissions, as well as 312 Tier II UPDATE (current calendar year) and ANNUAL (official Tier II) report submissions, will contain the new categories. A SDS, with new categories listed, must be attached to each chemical entry in Tier II Manager TM. Contact chemical suppliers for new or updated SDSs.",
"List of chemicals subject to reporting requirements under the Emergency Planning and Community Right- To-Know Act (EPCRA), Comprehensive Environmental Response, Compensation and Liability Act (CERCLA), and Section 112(r) of the Clean Air Act.",
"SYSTEM REQUIREMENTS for the Tier II Manager™ Online Reporting System: 1 Must use Internet Explorer 11 (non-compatibility mode) or higher, Firefox 20 or higher, or Chrome 26 or higher. 2 Mac users, with Safari, can use Chrome or Firefox versions listed above. 3 Need Adobe Acrobat Reader to use this system.",
"SERC/LEPC/TIER II Reporting. NEW TIER II CHEMICAL PHYSICAL AND HEALTH RISK CATEGORIES have been updated in Tier II Manager and a list is included in the Resource Links below. All 302 EHS and 311 SDS submissions, as well as 312 Tier II Update (current calendar year) submissions, will contain the new categories.",
"Clean Air Act (CAA). This consolidated list does not include all hazardous chemicals subject to. the reporting requirements in EPCRA sections 311 and 312, for which material safety data sheets. (MSDS) must be developed under the Hazard Communication Standard (29 CFR1910.1200)."
],
"url": [
"https://www.epa.gov/epcra/consolidated-list-lists",
"https://www.illinois.gov/iema/Preparedness/SERC/Pages/SERC_Tier2.aspx",
"https://www.epa.gov/epcra/consolidated-list-lists",
"https://www.bnl.gov/esh/env/compliance/docs/SaraTitleList.pdf",
"https://www.illinois.gov/iema/Preparedness/SERC/Pages/SERC_Tier2.aspx",
"https://www.illinois.gov/iema/Preparedness/SERC/Pages/SERC_Tier2.aspx",
"https://www.epa.gov/epcra/consolidated-list-lists",
"https://www.illinois.gov/iema/Preparedness/SERC/Pages/SERC_Tier2.aspx",
"https://www.illinois.gov/iema/Preparedness/SERC/Pages/SERC_Tier2.aspx",
"https://www.bnl.gov/esh/env/compliance/docs/SaraTitleList.pdf"
]
} | list of ehs chemicals for tier ii reporting | 1,174,093 | ENTITY | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Oh honey this is how far your story went, who do you think you are. Oh honey stop the prattle, because you don't matter to me anymore x2. gili.gili,gi..lii,gili,gili,gil. gili.gili,gi..lii,gili,gili,gil.",
"Accommodation, restaurants and activities are more sparse here. What you get in Gili Meno, is a glorious slice of island life, that you don’t have to share with the crowds. Walking around the island and observing the diversity of flaura, fauna and birdlife around the saltwater lake should be on any visitor’s itinerary. The island also houses a bird park and a turtle hatchery.",
"Gilli is a young warlock who entered the Decennial Tournament in Camelot in which there are no rules. Despite the risk of his own execution, he used magic to increase his chance of victory.",
"Merlin warns Gilli of the danger of using magic in Camelot and tells him he had best withdraw. Gilli refuses, saying he has every right to be in the tournament - there are no rules and he is simply using his particular skill. He makes it to the final round of the tournament meaning he would face either Arthur or Uther having killed at least one opponent and possibly two.",
"With a combination of idyllic conditions and reputable dive outfits, we’ve narrowed down the top spots to get certified – from the Caribbean to the Maldives, and everywhere in between. Clown fish, Halik Reef, Gili Trawangan, Indonesia.",
"Learning to freedive in Indonesia. Freediving. It's easy to understand its appeal. Keen to experience the deep ocean without the cumbersome steel tank and tangle of tubes myself, I decided to give it a whirl on a trip to Indonesia's Gili Islands. Freediving is an athletic sport, requiring a certain standard of fitness so you can swim down to a reef and then fin your way up to the surface again.",
"There’s more budget accommodation on offer in Gili Trawangan, much less in Gili Meno, and in Gili Air, budget accommodation is really out of the way. To have a comfortable stay, and be close to the beach in the Gili islands, you really want to budget IDR450,000 – 600,000 a night.",
"Welcome to Gili Islands. Picture three miniscule desert islands, fringed by white-sand beaches and coconut palms, sitting in a turquoise sea: the Gilis are a vision of paradise.",
"If you have the time to visit all three Gilis, you really should. Experiencing the different vibes of these diverse islands first-hand is the best part of the Gili experience, and understanding what makes this cluster of paradise islands so unique. Check out our aerial map of Gili Meno for a bird’s eye view of the island here.",
"— Gilli to Merlin. Every ten years, a tournament is held in Camelot where there are no rules and anyone may enter. Gilli decides to enter the tournament this particular year. While travelling to Camelot, he is accosted by two bullies also on their way to the tournament named Tindr and Nollar who steal his sword."
],
"url": [
"http://lyricstranslate.com/en/gili-gili-gili-gili.html",
"http://ingili.com/whats-the-difference-between-gili-trawangan-gili-meno-and-gili-air/",
"http://merlin.wikia.com/wiki/Gilli",
"http://merlin.wikia.com/wiki/Gilli",
"https://www.lonelyplanet.com/indonesia/nusa-tenggara/gili-islands",
"https://www.lonelyplanet.com/indonesia/nusa-tenggara/gili-islands",
"http://ingili.com/whats-the-difference-between-gili-trawangan-gili-meno-and-gili-air/",
"https://www.lonelyplanet.com/indonesia/nusa-tenggara/gili-islands",
"http://ingili.com/whats-the-difference-between-gili-trawangan-gili-meno-and-gili-air/",
"http://merlin.wikia.com/wiki/Gilli"
]
} | what is gilli gilli | 751,010 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Internet Explorer. Open Internet Explorer, and click Tools.. Click Internet Options, and then select the Content tab. Click Settings under the AutoComplete heading. Locate the box that says User names and passwords on forms and click the box to check it.ozilla Firefox. Navigate to the login page of the site you want to save a password for, and enter your password. Click Remember when Firefox asks you if you want the password to be remembered. Turn the Password Manager on if you are not prompted to save the passwords that you enter.",
"1 Launch Internet Explorer. 2 Select. 3 Under Personal information, click AutoComplete. 4 To stop password saving, uncheck User names and passwords on forms. 5 To clear all existing saved usernames and passwords, click on Clear Passwords, then click OK in the warning dialog box. To clear all existing saved usernames and passwords, click on Clear Passwords, then click OK in the warning dialog box. 2 Note: You may have websites for which you wish to save the username and password, but you do not want Internet Explorer to prompt you on any future sites.",
"To remove a stored password or other stored information in Internet Explorer 9 or 8: 1 From the menu, select. 2 On the tab, under Browsing history, click. 3 Check the item(s) you want to delete:4 Temporary Internet files: Copies of web pages, images, and media that are saved for faster viewing.o remove a stored password or other stored information in Internet Explorer 9 or 8: 1 From the menu, select. 2 On the tab, under Browsing history, click. 3 Check the item(s) you want to delete:",
"Internet Explorer 9 and 8. To remove a stored password or other stored information in Internet Explorer 9 or 8: 1 From the menu, select. 2 On the tab, under Browsing history, click. 3 Check the item(s) you want to delete: 4 Temporary Internet files: Copies of web pages, images, and media that are saved for faster viewing.o remove a stored password or other stored information in Internet Explorer 9 or 8: 1 From the menu, select. 2 On the tab, under Browsing history, click. 3 Check the item(s) you want to delete:",
"To remove a stored password or other stored information in Internet Explorer 7: 1 From the menu, select. 2 On the tab, under, click. 3 You now have several options: 4 Delete files: Deletes temporary Internet files (copies of web pages, images, and media that are saved for faster viewing).5 Cookies.o remove a stored password or other stored information in Internet Explorer 9 or 8: 1 From the menu, select. 2 On the tab, under Browsing history, click. 3 Check the item(s) you want to delete:",
"To delete all the saved passwords stored in your Internet Explorer, you just have to click on the Settings icon located in the toolbar of your IE, then click on Internet Options.You will now see a new window of Internet Options.o delete all the saved passwords stored in your Internet Explorer, you just have to click on the Settings icon located in the toolbar of your IE, then click on Internet Options.",
"Internet Explorer. To delete individual passwords: when using IE and a saved password is pre-filled on your screen, simply highlight the username that displays there, and press the Delete key to remove just that one username/password combination from IE.Internet Explorer will then prompt you to confirm that you do want to delete it.o delete individual passwords: when using IE and a saved password is pre-filled on your screen, simply highlight the username that displays there, and press the Delete key to remove just that one username/password combination from IE. Internet Explorer will then prompt you to confirm that you do want to delete it.",
"Internet Explorer for Windows. To disable password saving in Internet Explorer on Windows: 1 Launch Internet Explorer. 2 Select. 3 Under Personal information, click AutoComplete. 4 To stop password saving, uncheck User names and passwords on forms. To clear all existing saved usernames and passwords, click on Clear Passwords, then click OK in the warning dialog box. 2 Note: You may have websites for which you wish to save the username and password, but you do not want Internet Explorer to prompt you on any future sites.",
"1 In the AutoComplete Settings dialog box, select the User names and passwords on forms check box (if it is not already selected), select the Prompt me to save passwords check box (if it is not already selected), and then click OK. 2 Click OK again to close the Internet Options dialog box. In the AutoComplete Settings dialog box, select the User names and passwords on forms check box (if it is not already selected), select the Prompt me to save passwords check box (if it is not already selected), and then click OK. 2 Click OK again to close the Internet Options dialog box.",
"1. Open Internet Explorer by clicking the Start button. In the search box, type Internet Explorer, and then, in the list of results, click Internet Explorer. 2. Click the Tools button, and then click Internet Options. 3. Click the Content tab. 4. Under AutoComplete, and then click Settings.5. Select or clear the Address bar, Forms, User names and passwords on forms, and Ask me before saving passwords check boxes.6. Click OK, and then click OK again.lick the Tools button, and then click Internet Options. 3. Click the Content tab. 4. Under AutoComplete, and then click Settings. 5. Select or clear the Address bar, Forms, User names and passwords on forms, and Ask me before saving passwords check boxes. 6. Click OK, and then click OK again."
],
"url": [
"http://www.ehow.com/how_6543861_auto-save-passwords.html",
"http://kb.mit.edu/confluence/display/istcontrib/Disable+Password+Saving+in+Web+Browsers",
"https://kb.iu.edu/d/alcx",
"https://kb.iu.edu/d/alcx",
"https://kb.iu.edu/d/alcx",
"http://www.majorgeeks.com/content/page/how_to_manage_your_internet_explorer_saved_passwords.html",
"http://www.bu.edu/tech/services/support/desktop/software/troubleshooting/removing-password-from-browsers-saved-password-list/",
"http://kb.mit.edu/confluence/display/istcontrib/Disable+Password+Saving+in+Web+Browsers",
"https://support.microsoft.com/en-us/kb/306895",
"http://answers.microsoft.com/en-us/ie/forum/ie8-windows_7/i-cant-get-internet-explorer-to-remember-login-and/37f35adf-5485-436b-9592-bac23d50595b"
]
} | how to save password and login info on internet explorer | 378,275 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Nonfuel uses of fossil fuels (for purposes other than their energy value) create carbon dioxide emissions and also sequester carbon in nonfuel products, such as plastics. In 2009, carbon dioxide emissions from nonfuel uses of energy inputs totaled 83 million metric tons—15.3 percent below the 2008 total (Table 13).",
"Yet fossil fuels are finite resources and they can also irreparably harm the environment. According to the Environmental Protection Agency, the burning of fossil fuels was responsible for 79 percent of U.S. greenhouse gas emissions in 2010. These gases insulate the planet, and could lead to potentially catastrophic changes in the earth’s climate.",
"Combustion of gas fuels (e.g., natural gas) accounted for 18.5% (1551 million metric tons of carbon) of the total emissions from fossil fuels in 2007 and reflects a gradually increasing global utilization of natural gas.",
"In 2009, the second-largest source of U.S. carbon dioxide emissions (after fossil fuel consumption) was natural gas production (Figure 16 and Table 16), which includes flaring of natural gas at the wellhead and scrubbing of carbon dioxide from natural gas after it has been produced.",
"Technologies such as Carbon Capture and Storage (CCS) may help reduce the greenhouse gas emissions generated by fossil fuels, and nuclear energy can be a zero-carbon alternative for electricity generation.",
"Different fuels emit different amounts of carbon dioxide (CO2) in relation to the energy they produce when burned. To analyze emissions across fuels, compare the amount of CO2 emitted per unit of energy output or heat content. Pounds of CO2 emitted per million British thermal units (Btu) of energy for various fuels:",
"Natural gas. 117.0. The amount of CO2 produced when a fuel is burned is a function of the carbon content of the fuel. The heat content, or the amount of energy produced when a fuel is burned, is mainly determined by the carbon (C) and hydrogen (H) content of the fuel. Heat is produced when C and H combine with oxygen (O) during combustion.",
"Fossil-Fuel CO2 Emissions. Flue-gas emissions from fossil-fuel combustion-Wikipedia, the free ... Fossil Fuel Emissions Can Overwhelm Planet's Ability To Absorb ... US Carbon Dioxide Emissions Down 11 Percent Since 2007. Fossil Fuels Need to Stay Unburned to Meet Climate Target.",
"Trends. Since 1751 approximately 337 billion metric tonnes of carbon have been released to the atmosphere from the consumption of fossil fuels and cement production. Half of these emissions have occurred since the mid 1970s. The 2007 global fossil-fuel carbon emission estimate, 8365 million metric tons of carbon, represents an all-time high and a 1.7% increase from 2006.",
"Fossil fuels, including coal, oil and natural gas, are currently the world's primary energy source. Formed from organic material over the course of millions of years, fossil fuels have fueled U.S. and global economic development over the past century."
],
"url": [
"http://www.eia.gov/environment/emissions/ghg_report/ghg_carbon.cfm",
"http://www.eesi.org/topics/fossil-fuels/description",
"http://cdiac.ornl.gov/trends/emis/tre_glob.html",
"http://www.eia.gov/environment/emissions/ghg_report/ghg_carbon.cfm",
"http://www.eesi.org/topics/fossil-fuels/description",
"http://www.eia.gov/tools/faqs/faq.cfm?id=73&t=11",
"http://www.eia.gov/tools/faqs/faq.cfm?id=73&t=11",
"http://www.huffingtonpost.com/2013/10/09/fossil-fuel-emissions-oecd_n_4069672.html",
"http://cdiac.ornl.gov/trends/emis/tre_glob.html",
"http://www.eesi.org/topics/fossil-fuels/description"
]
} | what are fossil fuel emissions | 559,041 | DESCRIPTION | [] |
[
"Morrison County"
] | {
"is_selected": [
0,
0,
0,
1,
0,
0
],
"passage_text": [
"Cushing Assessor. Find Cushing Minnesota assessor, assessment, auditor's, and appraiser's office, revenue commissions, GIS, and tax equalization departments. Assessors provide information on property and land tax assessment, property listings, values, valuations, property search, and records. Cushing Assessor.",
"34367 County 60 Cushing, MN 56443. Property Overview - 34367 County 60, Cushing, MN 56443 is a single family home built in 1958. This property was last sold for $142,000 in 2015 and currently has an estimated value of Price Unavailable.",
"Cushing, Morrison County, Minnesota Land for Sale. Looking for rural homes and land for sale in Cushing, Morrison County, Minnesota? LandWatch.com has thousands of rural properties in Cushing, Morrison County, Minnesota, including hunting & fishing properties, cabins, Land for sale and land auctions. Choose from small acreage lots to massive 500+ acre estates.",
"Cushing Township, Morrison County, Minnesota. Cushing Township is a township in Morrison County, Minnesota, United States. The population was 632 at the 2000 census. The unincorporated community of Cushing is located within the township. Cushing Township was organized in 1891.",
"Cushing, Minnesota. Cushing is an unincorporated community in Cushing Township, Morrison County, Minnesota, United States. The community is located along U.S. Highway 10 near Morrison County Road 5, Bear Road. Nearby places include Randall, Little Falls, and Motley.",
"According to the Cushing public records, the property at 34367 County 60, Cushing, MN 56443 has approximately 1,200 square feet, 4 beds and 1 bath. Nearby schools include Browerville Elementary School and Browerville Secondary School."
],
"url": [
"http://www.countyoffice.org/cushing-mn-assessor/",
"http://www.realtor.com/realestateandhomes-detail/34367-County-60_Cushing_MN_56443_M88960-16382",
"http://www.landwatch.com/Minnesota_land_for_sale/Cushing",
"https://en.wikipedia.org/wiki/Cushing_Township,_Morrison_County,_Minnesota",
"https://en.wikipedia.org/wiki/Cushing,_Minnesota",
"http://www.realtor.com/realestateandhomes-detail/34367-County-60_Cushing_MN_56443_M88960-16382"
]
} | what county is cushing mn | 604,858 | LOCATION | [
"Cushing is in Morrison County, Minnesota. "
] |
[
"A showcase is a glass container with valuable objects inside it."
] | {
"is_selected": [
0,
0,
1,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"The Times Literary Supplement (2011) Annual showcase from home and abroad, with a different selection at each performance. Times, Sunday Times (2011) Annual showcase, with a different triple bill at each performance. Times, Sunday Times (2015) More than sixty will have their work showcased at five free catwalk shows at 1.15pm daily this week.",
"Define showcase (verb) and get synonyms. What is showcase (verb)? showcase (verb) meaning, pronunciation and more by Macmillan Dictionary",
"Showcase definition: A showcase is a glass container with valuable objects inside it, for example at an... | Meaning, pronunciation, translations and examples English Dictionary | Thesaurus | Translator | Grammar | Scrabble | Blog",
"showcase noun to show someone or something in a way that attracts attention and emphasizes their good qualities a comedy sketch that showcases their unique style of humour",
"Definition and synonyms of showcase from the online English dictionary from Macmillan Publishers Limited.",
"This is the British English definition of showcase. View American English definition of showcase. Change your default dictionary to American English. View the pronunciation for showcase. CamelCase a way of writing compound words or phrases in which there are no spaces between words and a capital letter is used at the start of each new word",
"‘Growing stacks of finished bowls in the showcase added to the enthusiasm.’. display, public display, show, showing, presentation, demonstration, mounting, spectacle. View synonyms. 1.1 A place or occasion for presenting something favorably to general attention.",
"Example sentences containing 'showcase'. His new shop will showcase his idea of a shared wardrobe for men and women. Times, Sunday Times (2015)The winners and the nominees go on to showcase their work at the if. Times, Sunday Times (2007)Or we put it behind glass in the showcase where it can last and last.",
"A showcase is a glass container with valuable objects inside it, for example at an exhibition or in a museum. American English: showcase Brazilian Portuguese: vitrina",
"Definition of 'showcase'. showcase. A showcase is a glass container with valuable objects inside it, for example at an exhibition or in a museum. You use showcase to refer to a situation or setting in which something is displayed or presented to its best advantage. The festival remains a valuable showcase for new talent. [+ for]"
],
"url": [
"https://www.collinsdictionary.com/dictionary/english/showcase",
"https://www.macmillandictionary.com/dictionary/british/showcase_2",
"https://www.collinsdictionary.com/dictionary/english/showcase",
"https://www.macmillandictionary.com/dictionary/british/showcase_2",
"https://www.macmillandictionary.com/dictionary/british/showcase_2",
"https://www.macmillandictionary.com/dictionary/british/showcase_2",
"https://en.oxforddictionaries.com/definition/us/showcase",
"https://www.collinsdictionary.com/dictionary/english/showcase",
"https://www.collinsdictionary.com/dictionary/english/showcase",
"https://www.collinsdictionary.com/dictionary/english/showcase"
]
} | definition of showcase | 138,161 | DESCRIPTION | [] |
[
"Choose Upload resume. Browse the documents stored on your computer, select the resume you would like to upload, and select Open. Name your resume the default name will match the file title from your computer. You have the option to edit the name of the resume. Click Complete Upload."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Add Your Resume. Attach your Resume. We accept .DOC, .DOCX, .PDF, .RTF, .TXT, .ODT, .WPS up to 1000 KB. We do not accept scanned documents, images, or resumes containing images and/or icons.",
"I actually stopped using my laptop for the iPad. It was frustrating having to go to the laptop just to upload a resume to career builder. I just downloaded iCab browser in the app store. I sent my resume to an external email account and signed in. You need to open the email through the iCab browser and download the file there. ICab has its own download drop box. I was able to them go to career builder and upload a resume without a problem.",
"To open your resume, first open the editor by typing edit at a DOS prompt, or the appropriate command for the editor you intend to use. Next, choose the Open File option from the FILE menu. Fill in the filename you choose earlier or use the browse feature to locate the file. STEP 4:",
"Once you have found a position that you would like to apply for, many companies have the capability to allow you to apply online. If a company does offer online applications, you will see an orange button at the bottom and top of the job posting that says “Apply Now”. 1. The first option is to upload your resume. Please keep in mind we only accept Word Documents (.doc or .docx), PDF Document (.pdf), RTF (rich text format), and TXT (text file).",
"Set up your profile and upload a resume so employers can find you. We accept .DOC, .DOCX, .PDF, .RTF, .TXT, .ODT, .WPS up to 1000 KB. We do not accept scanned documents, images, or resumes containing images and/or icons. It is recommended that you keep your resume less than 5 pages long.",
"Click Upload or build resume. Choose Upload resume. Browse the documents stored on your computer, select the resume you would like to upload, and select Open. Name your resume—the default name will match the file title from your computer. You have the option to edit the name of the resume. Click Complete Upload.",
"If a company does offer online applications, you will see an orange button at the bottom and top of the job posting that says “Apply Now”. You have two options when applying for a job: 1. The first option is to upload your resume.",
"You can upload or build up to five resumes. 1 Sign into your USAJOBS account. 2 Click Documents—it will default to display resumes. 3 Click Upload or build resume. Choose Upload 1 resume. Browse the documents stored on your computer, select the resume you would like to upload, and select Open.",
"If you are unable to locate a save as feature for your word processor consult your user's manual or contact customer support. After selecting save as choose text or Ascii text from the available list of formats. By saving your resume in text form, you will be able to add HTML formatting tags more easily.",
"Click the Attach or Upload button on the Web page when you get to the resume section of the application. A separate dialog box should appear on the screen. Click the Browse button. Locate your resume file on your computer's hard drive. Click on the file's name to select it for attachment. Click the Attach or Upload button in the dialog box to add the resume to your online application. Confirm that your resume is attached to your application."
],
"url": [
"https://www.careerbuilder.com/JobSeeker/PostNewResume.aspx?sslRedirectCnt=1",
"https://discussions.apple.com/thread/2714162?start=0&tstart=0",
"http://www.as.wvu.edu/~lbrady/208keathley.html",
"http://www.fuzeqna.com/careerbuilder/ext/kb454-apply-upload-resume-how-do-i-attach-my-resume-to-a-job-i-am-applying-to",
"https://www.careerbuilder.com/JobSeeker/PostNewResume.aspx?sslRedirectCnt=1",
"https://www.usajobs.gov/Help/how-to/account/documents/resume/upload/",
"http://www.fuzeqna.com/careerbuilder/ext/kb454-apply-upload-resume-how-do-i-attach-my-resume-to-a-job-i-am-applying-to",
"https://www.usajobs.gov/Help/how-to/account/documents/resume/upload/",
"http://www.as.wvu.edu/~lbrady/208keathley.html",
"http://woman.thenest.com/attach-resume-online-job-application-1460.html"
]
} | how to upload a resume using browse | 384,644 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Call: 1-505-998-3793. All calls made to this number from a T-Mobile handset are free from roaming, airtime, or long distance charges. Calls made to this number from landlines and non-T-Mobile phones will incur international long distance charges as well as any other additional charges that may apply. Customer Care representatives are available daily from 3 a.m. to 10 p.m. PT.",
"Submit a Support Ticket. Service & Support Hours: 9 am - 5 pm Pacific Time. Due to an increase in inquiries and requests for assistance, our response times are a little longer than usual. Please note: It may take up to two weeks to respond to your inquiry, but we promise we will take care of you as soon as humanly possible.",
"Learn more about PAX. PAX Labs, Inc., aims to deliver the ultimate vaporization experience. At PAX Labs, Inc., we are leading the vaporization movement with our innovative, premium vaporizers, PAX and JUUL. Founded by two Stanford Design Program graduates, San Francisco-based PAX Labs, Inc. was developed with the mission of making smoking obsolete.",
"Large Inventory. Give your customers a local phone number to call and text you. Over 700 Prefixes & Area Codes Twilio maintains phone number inventory that is 50 times larger than the phone numbers provisioned daily in every area code and prefix we service. If you can’t find what you need, please let us know. See all coverage.",
"Get excellent customer support for resolving yahoo email issues at this number. 1 Direct Phone Number: 888-348-1555. 2 Call Time: Average Wait: 2 mins — 24/7 Support, also available on Holidays. 3 Third Party Support * : 888-386-0444. Call Time: Average Wait: 1 min.",
"PAX Pro's Support Team. Service & Support Hours: 9 am - 5 pm Pacific Time. Due to an increase in inquiries and requests for assistance, our response times are a little longer than usual. Please note: It may take up to two weeks to respond to your inquiry, but we promise we will take care of you as soon as humanly possible.",
"https://www.pepboys.com/customer_care/policies/shipping. 25% Off Select Parts and Accessories. Receive 25% Off Your Online or In-Store Purchase. Use promotional code MMJ25 at checkout to receive discount. Not valid in combination with any other discounts, promotions or items already on sale. Not valid on gift cards, special orders, installed merchandise, commercial or fleet purchases.",
"Telephone numbers are subject to change. Local and national telephone rates apply. Back. Toll-free phone number is for landlines. You may be charged when calling from a mobile phone. This number may not be accessible from some mobile network providers. For more information, contact your network provider. Back. Free phone technical support number is not accessible by mobile phone. Back.",
"Give your customers a local phone number to call and text you. 1 Over 700 Prefixes & Area Codes Twilio maintains phone number inventory that is 50 times larger than the phone numbers provisioned daily in every area code and prefix we service. If you can’t find what you need, please let us know.",
"A Real Alternative to Cigarettes. Several years ago our talented (and vapor-fanatic) team of designers and engineers debuted the PAX vaporizer. We're proud to introduce our latest innovation, JUUL - an intensely satisfying closed-system vapor experience. We hope you enjoy it as much as we enjoyed making it."
],
"url": [
"https://www.t-mobile.com/contact-us.html",
"https://www.paxvapor.com/support-ticket/",
"https://www.paxvapor.com/about/",
"https://www.twilio.com/phone-numbers",
"https://contactforhelp.com/yahoo/",
"https://www.paxvapor.com/support-ticket/",
"https://www.pepboys.com/customer_care/",
"https://support.apple.com/en-us/HT201232",
"https://www.twilio.com/phone-numbers",
"https://www.juulvapor.com/"
]
} | juul customer care phone number | 433,704 | NUMERIC | [] |
[
"Good reasons in support of conclusion."
] | {
"is_selected": [
0,
1,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"To introduce the philosophical argument for (G), recall premise (A) from the argument from abstract language: the Constitution's meaning is a function of the framers' intentions--in particular, what they intended to communicate with their language, not how they expected their language to apply in particular cases.",
"Philosophical Terms and Methods. An argument is not the same thing as a quarrel. The goal of an argument is not to attack your opponent, or to impress your audience. The goal of an argument is to offer good reasons in support of your conclusion, reasons that all parties to your dispute can accept. Nor is an argument just the denial of what the other person says.",
"In this argument, it is clear what the premises are, and what the conclusion is. Sometimes it will take skill to identify the conclusion and the premises of an argument. You will often have to extract premises and conclusions from more complex and lengthy passages of prose.",
"The pragmatic approach is motivated by the view that the nature of an argument cannot be completely captured in terms of its structure. In contrast to structural definitions of arguments, pragmatic definitions appeal to the function of arguments.",
"Traditionally, the term philosophy referred to any body of knowledge. In this sense, philosophy is closely related to religion, mathematics, natural science, education and politics.",
"This article takes propositions rather than sentences or statements or utterances to be the primary truth bearers. The reasons offered within the argument are called “premises”, and the proposition that the premises are offered for is called the “conclusion”.",
"logical argument - a course of reasoning aimed at demonstrating a truth or falsehood; the methodical process of logical reasoning; I can't follow your line of reasoning. line of reasoning, argumentation, argument, line. abstract thought, logical thinking, reasoning - thinking that is coherent and logical. line of inquiry, line of questioning - an ordering of questions so as to develop a particular argument.",
"The structure of an argument is not a function of the syntactic and semantic features of the propositions that compose it. Rather, it is imposed on these propositions by the intentions of a reasoner to use some as support for one of them. Typically in presenting an argument, a reasoner will use expressions to flag the intended structural components of her argument.",
"The focus of this article is on understanding an argument as a collection of truth-bearers (that is, the things that bear truth and falsity, or are true and false) some of which are offered as reasons for one of them, the conclusion.",
"casuistry - argumentation that is specious or excessively subtle and intended to be misleading. policy - a line of argument rationalizing the course of action of a government; they debated the policy or impolicy of the proposed legislation."
],
"url": [
"http://www.thefreedictionary.com/Philosophical+argument",
"http://www.jimpryor.net/teaching/vocab/argument.html",
"http://www.jimpryor.net/teaching/vocab/argument.html",
"http://www.iep.utm.edu/argument/",
"https://en.wikipedia.org/wiki/Philosophy",
"http://www.iep.utm.edu/argument/",
"http://www.thefreedictionary.com/Philosophical+argument",
"http://www.iep.utm.edu/argument/",
"http://www.iep.utm.edu/argument/",
"http://www.thefreedictionary.com/Philosophical+argument"
]
} | philosophical argument definition | 474,407 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"I was trying to reach their construction group about service on our street (other 2 streets in subdivision have Charter - we have Windstream Yuck!). The number for Tammy is good and she was very helpful. A supervisor called me back same day and has maintained contact and updates me as things are progressing.",
"Charter Communications Headquarters 12405 Powerscourt Dr. St. Louis, MO 63131. Phone Number: If you want to contact Charter Communications headquarters by phone call 1-314-965-0555. If customer service better fits your needs, call 1-888-438-2427 or 1-203-905-7801. Email: You can request corporate information from the investor relations website [+], but we did not find a corporate email address.",
"Tubetown, Ritter’s local content and coverage channel, will offer live coverage of seven high school baseball games to its customers in Arkansas on Tubetown (channel 21) and three games in West Tennessee on Tubetown (channel 11). Tubetown will also stream all of its broadcasts on YouTube Live.",
"What the Charter HR Paycard offers: 1 No monthly maintenance fee. 2 Free online account access. 3 Use free and unlimited at points of sale. Make purchases and pay bills 1 online. Low balance text alerts. Direct deposit text 1 alerts. Free personalized message on 2 card. Works with any job, unemployment, tax refund, etc.",
"Charter Communications. Pay your bill with doxo: Charter Communications. Pay Charter Communications quickly and securely with your Visa, MasterCard, or Discover credit card or debit card, or with your bank account, online or with your mobile phone. Charter Communications was added to the directory by a user on November 18, 2009.",
"The above addresses for Charter are for informational purposes only. Broadband Reports/DSL Reports does not forward feedback left here to Corporate Communications or General Inquiries. Representatives of Charter DO NOT act upon feedback submitted in this FAQ, nor are they likely to ever read it. Again, this is NOT an official Charter site.",
"Like people no two businesses are the same. Charter HR recognizes the individual needs of each organization and designs a customized HR service program to meet your company's precise business challenges. No boxes, no one-size-fits-all. Get the service your company needs, in the way you need it.",
"Write A Review For Charter Communications Corporate Headquarters. Note: This is not to be used to contact Charter Communications Corporate Offices nor is this site affiliated with them in any way. The purpose of this site is supply you with their phone number and address as well as share your thoughts about Charter Communications.",
"As a pioneer in the telecom industry, we are your local communication connection. We offer the latest communication innovations for your home and business, including customized business solutions, high-speed internet, local and long-distance phone services and premium television services. Our wholesale operations provide advanced connectivity opportunities throughout the Mid-South.",
"As one of the leading PEOs, Charter HR provides payroll and workers' compensation for thousands of client companies' employees. Charter HR programs transfer the client employers' human resource and payroll responsibilities to Charter HR. Upon completion of a simple transfer and enrollment process, Charter HR assumes the related functions and responsibilities. Charter HR is not just a check-writing or payroll processing service."
],
"url": [
"http://www.dslreports.com/faq/14490",
"http://www.headquartersinfo.com/charter-communications-headquarters-information/",
"https://www.rittercommunications.com/",
"http://www.mycharterhr.com/content.php?id=sv",
"https://www.doxo.com/info/charter-communications",
"http://www.dslreports.com/faq/14490",
"http://www.mycharterhr.com/content.php?id=sv",
"http://ecorporateoffices.com/CharterCommunications-2844",
"https://www.rittercommunications.com/",
"http://mycharterhr.com/"
]
} | charter communications payroll phone number | 90,862 | NUMERIC | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Numerology. 1 Chaldean Numerology. The numerical value of ortho- in Chaldean Numerology is: 7. 2 Pythagorean Numerology. The numerical value of ortho- in Pythagorean Numerology is: 4.",
"RLC circuit. An RLC circuit is an electrical circuit consisting of a resistor (R), an inductor (L), and a capacitor (C), connected in series or in parallel. The name of the circuit is derived from the letters that are used to denote the constituent components of this circuit, where the sequence of the components may vary from RLC.",
"Most people will see an orthopedist at some time in their life, and many people will see their orthopedist very often. Yet there is often confusion about what different types of problems and conditions orthopedic surgeons treat. Orthopedics is the study of the musculoskeletal system.",
"ortho-. 1. a combining form occurring in loanwords from Greek, where it meant “straight,” “upright,” “right,” “correct” (orthodox) and on this model used in the formation of compound words (orthopedic). 2. Chemistry. a combining form used in the name of that acid in a given series of acids that contains the most water (orthoboric acid).",
"Ortho- (prefix): Prefix meaning straight or erect. From the Greek orthos that means just that: straight or erect. Examples of terms involving ortho- include orthodontics (straightening the teeth), orthopaedics (straightening the child), orthopnea (breathing easily only in an upright position), orthostatic (an upright posture), etc.",
"Definitions for ortho-. Here are all the possible meanings and translations of the word ortho-. Wiktionary(0.00 / 0 votes)Rate this definition: ortho-(Prefix) straight, right, proper. ortho-(Prefix) Having an extra proportion of water.",
"1. Combining forms meaning straight, normal, in proper order. 2. chemistry Italicized prefix denoting that a compound has two substitutions on adjacent carbon atoms in a benzene ring. For terms beginning ortho- or o-, see the specific name.",
"1. Prefix denoting straight, normal, in proper order. 2. In chemistry, italicized prefix denoting that a compound has two substitutions on adjacent carbon atoms in a benzene ring. For terms beginning ortho- or o-, see the specific name. 3. The most hydrated of a series of oxoacids, for example, orthophosphoric acid, H3PO4.",
"Ortho is a Greek prefix meaning “straight,” “upright,” “right,” or “correct”. Ortho may refer to: In science. arene substitution patterns, two substituents that occupy adjacent positions on an aromatic ring. Chlordane, an organochlorine compound that was used as a pesticide.",
"Three Things to Know About Orthopedics. 1 Orthopedic conditions are the most common reason people seek medical care, although not every patient with an orthopedic condition is seen by an orthopedic specialist. 2 The Greek word 'ortho' means straight and 'pedics' comes from the word 'pais' meaning child. For many centuries, orthopedists have been involved in the treatment of crippled children. One of conditions orthopedists have treated for centuries is scoliosis in children."
],
"url": [
"http://www.definitions.net/definition/ortho-",
"https://en.wikipedia.org/wiki/RLC_circuit",
"https://www.verywell.com/orthopedics-4014679",
"http://www.dictionary.com/browse/ortho-",
"http://www.medicinenet.com/script/main/art.asp?articlekey=4666",
"http://www.definitions.net/definition/ortho-",
"http://medical-dictionary.thefreedictionary.com/ortho-",
"http://medical-dictionary.thefreedictionary.com/ortho-",
"https://en.wikipedia.org/wiki/Ortho",
"https://www.verywell.com/orthopedics-4014679"
]
} | what does rlc mean in ortho | 647,146 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Seattle, WA Electric Companies. YP - The Real Yellow PagesSM - helps you find the right local businesses to meet your specific needs. Search results are sorted by a combination of factors to give you a set of choices in response to your search criteria.",
"Related Articles for Electric Companies more related articles » What to Know About: Electrical Work » From frayed wires to down powerlines, what can an electrician do to help your home get back on track. Power Outage Checklist » Power outages are unpredictable, so planning ahead is key to staying safe.",
"Food and beverage. 1 American Seafoods — management company for fishing vessels in the Bering Sea. 2 Beecher's Handmade Cheese. 3 Caffe Vita Coffee Roasting Company — coffee retailer. 4 Darigold — dairy agricultural marketing cooperative. 5 Jones Soda — soft drink maker. 6 Pagliacci Pizza — pizza restaurant chain. 7 Seattle's Best Coffee.",
"This is a list of large or well-known interstate or international companies headquartered in the Seattle metropolitan area. As of November 2016, Seattle, Washington was home to six Fortune 500 companies: Internet retailer Amazon.com (#18), coffee chain Starbucks (#146), clothing merchant Nordstrom (#197), Weyerhaeuser (#373), Expeditors International (#390), and Alaska Airlines (#459).",
"Tech startup companies built in Seattle, the people behind them, the events they organize.",
"List of companies based in Seattle - Companies formerly headquartered in Seattle. 1 Airborne Express (ground operations acquired by DHL, Plantation, Florida; air operations spun off as ABX Air, Wilmington, Ohio) 2 Associated Grocers (acquired by Unified Western Grocers of Los Angeles) 3 Boeing (now in Chicago, Illinois)",
"Electric Companies in Seattle on YP.com. See reviews, photos, directions, phone numbers and more for the best Electric Companies in Seattle, WA. Start your search by typing in the business name below. What do you want to find?",
"Seattle, WA Electric Companies. About Search Results. YP - The Real Yellow PagesSM - helps you find the right local businesses to meet your specific needs. Search results are sorted by a combination of factors to give you a set of choices in response to your search criteria.",
"From Business: North Coast Electric is one of the largest electrical distributors in the United States that supplies a range of electrical equipment and accessories.",
"List of companies based in Seattle. This is a list of large or well-known interstate or international companies headquartered in the Seattle metropolitan area. As of November 2016, Seattle, Washington was home to six Fortune 500 companies: Internet retailer Amazon.com, coffee chain Starbucks, clothing merchant Nordstrom, Weyerhaeuser, Expeditors International, and Alaska Airlines. Four more are located in the metropolitan area: Costco Wholesale, Microsoft, Paccar, and Expedia."
],
"url": [
"https://www.yellowpages.com/seattle-wa/electric-companies",
"https://www.yellowpages.com/seattle-wa/electric-companies",
"https://en.wikipedia.org/wiki/List_of_companies_based_in_Seattle",
"https://en.wikipedia.org/wiki/List_of_companies_based_in_Seattle",
"http://seattle.startups-list.com/startups/consumer_electronics",
"https://en.wikipedia.org/wiki/List_of_companies_based_in_Seattle",
"https://www.yellowpages.com/seattle-wa/electric-companies",
"https://www.yellowpages.com/seattle-wa/electric-companies",
"https://www.yellowpages.com/seattle-wa/electric-companies",
"https://en.wikipedia.org/wiki/List_of_companies_based_in_Seattle"
]
} | list of electronics companies in seattle | 1,174,092 | PERSON | [] |
[
"In economics, the term marginal is used to indicate the change in some benefit or cost when an additional unit is produced."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"Or maybe that division is breaking even but would be the first division you would cut unless it starts to show more signs of promise. You might refer to that division as being marginal. That usage of the word marginal is not what economists mean by the term, although you might be able to see how they are related. The layman's usage means at the edge or borderline workable. The term marginal cost is not the same as opportunity cost. Opportunity cost is from the perspective of a buyer, while marginal cost is from the perspective of a seller or producer.",
"marginal revenue is calculated with the difference Marginal Revenue 1 TR Q TR Q Since this is a difference, it corresponds to a change in revenue. The production levels Q and Q 1 differ by one units, so TR Q TR Q 1 describes the change in total revenue when production is changed by one unit. The marginal revenue can also be interpreted as an average rate of change. Using the",
"What does it mean to think at the margin? It means to think about your next step forward. The word marginal means additional. The first glass of lemonade on a hot day quenches your thirst, but the next glass, maybe not so much. If you think at the margin, you are thinking about what the next or additional action means for you.",
"Marginal Revenue 1TR Q TR Q . Since this is a difference, it corresponds to a change in revenue. The production levels. Q and Q 1 differ by one units, so TR Q TR Q 1 describes the change in total. revenue when production is changed by one unit.",
"The sum of all those additional costs--from wages to insurance to taxes to emotional burdens and effects on morale--to produce one more computer chip is what economists mean by the marginal cost of a computer chip.",
"It means to think about your next step forward. The word marginal means additional.. The first glass of lemonade on a hot day quenches your thirst, but the next glass, maybe not so much. If you think at the margin, you are thinking about what the next or additional action means for you.",
") And in what you do next, you should weigh the costs and benefits starting afresh for the next few minutes of your time--which is what economists mean when they say, Think at the margin. At the margin, you could get a parking spot for $10 or you could drive around and maybe get a parking spot for free with a probability of, say, 20% in the next hour.",
"Question 1: What does the term marginal mean? In economics, the term marginal is used to indicate the change in some benefit or cost when an additional unit is produced. For instance, the marginal revenue is the change in total revenue when an additional unit is produced. If we let the total revenue function be",
"4. adjective [usually ADJECTIVE noun] Marginal activities, costs, or taxes are not the main part of a business or an economic system, but often make the difference between its success or failure, and are therefore important to control.",
"In economics, the term marginal is used to indicate the change in some benefit or cost. when an additional unit is produced. For instance, the marginal revenue is the change in. total revenue when an additional unit is produced. Since this is a difference, it corresponds to a change in revenue. revenue when production is changed by one unit. The marginal revenue can also be interpreted as an average rate of change. Let’s label these quantities on a graph of a revenue function TR Q()."
],
"url": [
"http://www.econlib.org/library/Topics/College/margins.html",
"http://pblpathways.com/calc/C11_5_1.pdf",
"http://www.econlib.org/library/Topics/College/margins.html",
"http://pblpathways.com/calc/C11_5_1.pdf",
"http://www.econlib.org/library/Topics/College/margins.html",
"http://www.econlib.org/library/Topics/College/margins.html",
"http://www.econlib.org/library/Topics/College/margins.html",
"http://pblpathways.com/calc/C11_5_1.pdf",
"https://www.collinsdictionary.com/dictionary/english/marginal",
"http://pblpathways.com/calc/C11_5_1.pdf"
]
} | what do economists mean by the word marginal | 622,876 | DESCRIPTION | [] |
[
"It defines what transactions are subject to OFAC, what is necessary for compliance procedures and what special licensing requirements are necessary to unblock blocked."
] | {
"is_selected": [
0,
1,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"The U.S. prohibits firms from transacting with Specially Designated Nationals, including terrorists and terrorist organizations. Learn the basic FAQs. The U.S. prohibits firms from transacting with Specially Designated Nationals, including terrorists and terrorist organizations. Learn the basic FAQs. SDN List (Specially Designated Nationals List)",
"There are explanations of what an SDN is, an example of an SDN entry and how to determine if it is a match, and also a sample of an SDN list as well as where to obtain lists. It also defines what transactions are subject to OFAC, what is necessary for compliance procedures and what special licensing requirements are necessary to unblock blocked",
"It provides explanations of what OFAC is, what purpose it serves, and how to contact them. It provides information on regulations for financial institutions, penalties, risks and",
"The list of specially designated nationals is maintained by the U.S. Department of The Treasury Office of Foreign Assets Control . Available for the Public The SDN List is publicly available on the U.S Department of The Treasury website along with a Blocked Persons List (SDN) and Human Readable List.",
"The Specially Designated Nationals list is a group of organizations and individuals who are restricted from doing business with the United States, American companies or general Americans. This includes terrorist organizations, individual terrorists and state sponsors of terrorism (such as Iran, and North Korea). The list of specially designated nationals is maintained by the U.S. Department of The Treasury Office of Foreign Assets Control (OFAC).",
"Purpose of Goods Receipt Message indicator in Purchase Orders SAP COMMUNITY NETWORK SDN - sdn.sap.com | BPX - bpx.sap.com | BOC - boc.sap.com | UAC - uac.sap.com © 2010 SAP AG 6 The dummy user is already assigned in the recipient column. We can assign the particular purchasing group user name or some other user names in the column.",
"Compare the complete SDN entry with all of the information you have on the matching name in your transaction. An SDN entry often will have, for example, a full name, address, nationality, passport, tax ID or cedula number, place of birth, date of birth, former names and aliases.",
"Purpose of Goods Receipt Message indicator in Purchase Orders. SAP COMMUNITY NETWORK SDN - sdn.sap.com | BPX - bpx.sap.com | BOC - boc.sap.com | UAC - uac.sap.com. © 2010 SAP AG 7. If you maintain the above settings you have received the simple message in your SAP inbox like Report. Goods Receipt to Buyer.",
"Purpose of Goods Receipt Message indicator in Purchase Orders. SAP COMMUNITY NETWORK SDN - sdn.sap.com | BPX - bpx.sap.com | BOC - boc.sap.com | UAC - uac.sap.com. © 2010 SAP AG 3. Prerequisite. The Knowledge of SAP MM, Table and field name knowledge are required to make use of this document in. real practice.",
"and procedure manual for in-house policy compliance requirements. There are explanations of what an SDN is, an example of an SDN entry and how to. determine if it is a match, and also a sample of an SDN list as well as where to obtain. lists."
],
"url": [
"https://www.thoughtco.com/sdn-list-specially-designated-nationals-list-3209297",
"http://www.patriottechcorp.com/resources/general/OFAC%20Policy%20&%20Procedure%20Manual%202011.pdf",
"http://www.patriottechcorp.com/resources/general/OFAC%20Policy%20&%20Procedure%20Manual%202011.pdf",
"https://www.thoughtco.com/sdn-list-specially-designated-nationals-list-3209297",
"https://www.thoughtco.com/sdn-list-specially-designated-nationals-list-3209297",
"https://archive.sap.com/kmuuid2/e0e19d4c-b72d-2d10-72ad-a38a70c2a53f/Purpose%20of%20Goods%20Receipt%20Message%20indicator.pdf",
"http://www.patriottechcorp.com/resources/general/OFAC%20Policy%20&%20Procedure%20Manual%202011.pdf",
"https://archive.sap.com/kmuuid2/e0e19d4c-b72d-2d10-72ad-a38a70c2a53f/Purpose%20of%20Goods%20Receipt%20Message%20indicator.pdf",
"https://archive.sap.com/kmuuid2/e0e19d4c-b72d-2d10-72ad-a38a70c2a53f/Purpose%20of%20Goods%20Receipt%20Message%20indicator.pdf",
"http://www.patriottechcorp.com/resources/general/OFAC%20Policy%20&%20Procedure%20Manual%202011.pdf"
]
} | purpose of sdn check | 484,126 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"There are many homeopathic remedies that can be used to help combat fear of flying and here are a few examples. Argentum-nitricum: Very anxious, restless, with diarrohea – “what if the plane crashes”. The fear is more related to heights and or claustrophobia, Feel worse for heat and crowds and better for open air.",
"Treatment for fear of flying usually begins with a thorough assessment of your fear. You are then taught how to manage the physical symptoms of anxiety by using breathing and relaxation techniques. Learning to change thoughts that create anxiety is also an important step in the treatment.",
"If you can successfully identify the triggers that produce your anxiety, you've taken the first step. It's important to note that fear of flying is not a single phobia. Most people who fear flying are claustrophobic, or frightened of being locked in the plane and unable to choose when to get off.",
"Overcoming a fear of flying takes a lot of courage and practice. But it is possible with appropriate treatment. I never flew until I was almost 30 years old, and getting over my own fear of flying was one of the most difficult achievements of my life.",
"Aconite: Complete terror and panic and fear of death – “knows the plane will crash”. The fear can suddenly appear before or during the flight. Arsenicum: Restless, cannot bear to be alone and needs constant reassurance that they will survive the flight. The main fear here is a fear of death.",
"For some individuals, the only remedies for fear of flying are prescribed medication and therapy. Doctors prescribe medications that relax them, such as benzodiazepines. This treatment only gives temporary relief to this anxiety.",
"Learning to change thoughts that create anxiety is also an important step in the treatment. After you learn these skills you are ready to practice them using the virtual reality program for fear of flying. You can practice sitting in a plane, take offs, flying in good weather, flying in bad weather and landings.",
"But it is possible with appropriate treatment. I never flew until I was almost 30 years old, and getting over my own fear of flying was one of the most difficult achievements of my life. If you can successfully identify the triggers that produce your anxiety, you've taken the first step.",
"Response from Martin N. Seif, PhD, ABPP: Overcoming a fear of flying takes a lot of courage and practice. But it is possible with appropriate treatment. I never flew until I was almost 30 years old, and getting over my own fear of flying was one of the most difficult achievements of my life.",
"Fear of flying can now be treated successfully in 8-10 weekly sessions. Virtual reality therapy, or VR therapy, is the combination of the most highly successful treatment for fears and phobias (exposure therapy) with a computer generated world that allows you to practice facing your fears."
],
"url": [
"http://www.homeopathy-healing.com/homeopathy-helps-overcome-fear-flying/",
"http://curefearofflying.com/",
"http://www.adaa.org/living-with-anxiety/ask-and-learn/ask-expert/how-can-i-overcome-my-fear-of-flying",
"http://www.adaa.org/living-with-anxiety/ask-and-learn/ask-expert/how-can-i-overcome-my-fear-of-flying",
"http://www.homeopathy-healing.com/homeopathy-helps-overcome-fear-flying/",
"http://traveltips.usatoday.com/remedies-fear-flying-14238.html",
"http://curefearofflying.com/",
"http://www.adaa.org/living-with-anxiety/ask-and-learn/ask-expert/how-can-i-overcome-my-fear-of-flying",
"http://www.adaa.org/living-with-anxiety/ask-and-learn/ask-expert/how-can-i-overcome-my-fear-of-flying",
"http://curefearofflying.com/"
]
} | remedy for fear of flying | 487,258 | DESCRIPTION | [] |
[
"It is the licensing in which you essentially pay for the average number of users who are accessing the system at the same time, instead of paying a fee for every potential user of the system."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Product licenses must be purchased with Software Maintenance for a minimum of one year from delivery. If you receive any edition of this product as a component of XenApp or XenDesktop, your product license covers all licensed User/Device/Concurrent sessions of your XenApp or XenDesktop environment.",
"A wider definition involves named user licenses specific to one user who is typically licensed to use a product on multiple computers; although the most common type of named user license enables users to log on to no more than three computers.",
"License Definitions and Rules. Definitions and License Metrics. Adapter: is defined as each software code interface, installed on each Oracle Internet Application Server Enterprise Edition, which facilitates communication of information between each version of a third party software application or system and Oracle. programs.",
"Citrix combines virtualization, networking and cloud technologies with collaborative services into a full portfolio of products that enable mobile workstyles for users and virtual datacenters for IT. Our wide range of product editions, licensing models and subscription plans ensures you can find the right purchase options for your organization.",
"Definition - What does Named User License mean? A named user license is an exclusive licensure of rights assigned to a single named software user. The user will be named in the license agreement. Named user licenses can be composed of single seat licensures, more commonly known as volume license accounts.",
"In general, concurrent user licensing is significantly less expensive than per seat licensing. With concurrent user licensing, you essentially pay for the average number of users who are accessing the system at the same time, instead of paying a fee for every potential user of the system.",
"Product licenses must be purchased with Software Maintenance for a minimum of one year from delivery. SQL Server, if included with your product, is licensed under a license model and license terms controlled by Microsoft.",
"Concurrent User Licensing Saves You Time, Money and Hassle. There are many ways to base software licenses. Two major licensing categories are user-based (number of users accessing the system) and metered (some unit of measure or cycle) and within each of these categories there are a myriad of sub-categories.",
"occurring or existing simultaneously or side by side: concurrent attacks by land, sea, and air. 2. acting in conjunction; cooperating: the concurrent efforts of several legislators to pass the new law. 3. having equal authority or jurisdiction: two concurrent courts of law.",
"Concurrent User Licensing Saves You Time, Money and Hassle. Tags: entellitrak. There are many ways to base software licenses. Two major licensing categories are user-based (number of users accessing the system) and metered (some unit of measure or cycle) and within each of these categories there are a myriad of sub-categories."
],
"url": [
"https://www.citrix.com/buy/licensing/product.html",
"https://www.techopedia.com/definition/4315/named-user-license",
"http://www.oracle.com/us/corporate/pricing/olsadef-ire-v122304-070549.pdf",
"https://www.citrix.com/buy/licensing/product.html",
"https://www.techopedia.com/definition/4315/named-user-license",
"https://www.micropact.com/blog/detail/concurrent-vs.-per-seat-licenses-the-analogy/",
"https://www.citrix.com/buy/licensing/product.html",
"https://www.micropact.com/blog/detail/concurrent-vs.-per-seat-licenses-the-analogy/",
"http://www.dictionary.com/browse/concurrent",
"https://www.micropact.com/blog/detail/concurrent-vs.-per-seat-licenses-the-analogy/"
]
} | define concurrent licensing | 119,358 | DESCRIPTION | [] |
[
"No, It is located on the Southern part of the Asian continent."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"Some (like Far East) were born during British colonization, but “Near East” and “Middle East” are more modern than that. The word “east” is derived from the Sanskrit word “usās” meaning “dawn” or “morning.” From the perspective of Europe and Asia, this makes sense because the sun rises in the east.",
"In the east, Asia is bordered by the Pacific Ocean, and an almost endless stretch of bays and seas. The Arctic Ocean and a handful of seas front the northern border, while the Bering Sea separates Asia from North America.",
"Asia Description. As the largest and most populous continent in the world with just over 3.8 billion people, Asia is composed of a wide variety of ethnic groups, cultures, environments, economics, historical ties, and governmental systems.",
"In the west, Asia is bordered by Europe, the eastern coastline of the Mediterranean Sea, as well by the Sea of Marmara, the Bosporus Strait, the Black Sea and the Caspian Sea.",
"Middle East: Countries considered part of the Middle East (or West Asia) are shown in a lighter shade of gray. Note that they are all still a part of the continent of Asia. Opinions vary as to what countries make up the modern definition of Asia and the Middle East.",
"Today, the region of the Near East is imprecise and overlaps with the Middle East. It typically refers to southwest Asia, particularly Turkey, Lebanon, Syria, Iraq, Israel, Jordan, Saudi Arabia and other nations of the Arabian Peninsula. It is not as commonly used as “Middle East.”.",
"Today, it still refers to China, Japan and other countries on the eastern rim of Asia, but its use has declined steadily in the latter twentieth century. First used in 1856, the term “ Near East ” was defined specifically against the Far East and referred to the region in Asia that’s west of India.",
"I think of the Middle East as including countries as far West as Morocco and as far West as Iraq and the Arabian Peninsula. Essentially, my definition of the Middle East is also the popular definition of the Arab world.",
"The Middle East is a region on Earth that is located on two continents, both Asia and Africa. The Country India is located on the Southern part of the Asian continent which is not included in the region commonly known as the Middle East. ♫ · 1 year ago. Thumbs up.",
"(3) English naming convention-naming and separating the world as their see fit. Example One, India is Sub Continent of which Continent, Asia or Middle East-Middle East, Example Two-Russian is a Sub Continent or which Continent, Asia or Europe-Europe."
],
"url": [
"http://blog.dictionary.com/east/",
"http://www.worldatlas.com/webimage/countrys/as.htm",
"http://www.worldatlas.com/webimage/countrys/as.htm",
"http://www.worldatlas.com/webimage/countrys/as.htm",
"http://www.worldatlas.com/webimage/countrys/as.htm",
"http://blog.dictionary.com/east/",
"http://blog.dictionary.com/east/",
"http://blog.dictionary.com/east/",
"https://answers.yahoo.com/question/index?qid=20071204173804AA3HYAI",
"https://answers.yahoo.com/question/index?qid=20071204173804AA3HYAI"
]
} | is india near asia | 412,972 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"So how much money should you give as a graduation gift these days? According to a new survey, from RetailMeNot.com, people give an average of $111 for a high school graduation, $243 for a college graduation, and $256 for a grad school graduation.What’s with the funky figures, $111?Why isn’t the average for high school plain old $100? Anyway that is too rich for my blood.ccording to a new survey, from RetailMeNot.com, people give an average of $111 for a high school graduation, $243 for a college graduation, and $256 for a grad school graduation. What’s with the funky figures, $111?",
"The question of how much you should give to a college graduate as a gift is also important. If it’s a relative and you are an important part of their lives, a college degree was a huge effort on their part, so consider giving between $25 and $50 dollars.ust because there is monetary gift etiquette for college graduation and the grads that achieve success, it doesn’t mean it’s always followed to the letter. Only give what you can afford; if the standard $25 is too high for your budget, consider a lower amount.",
"Money is still a favorite. A Retailmenot.com survey found that cash, checks and gift cards remain popular choices, cited as preferred by half the respondents. On average, respondents say $165 is an appropriate cash gift for high-school graduates, while $464 is good for someone earning a bachelor's degree.If your friend or relative just attained a graduate degree, plan on shelling out about $772. Those figures are averages, not round numbers.n average, respondents say $165 is an appropriate cash gift for high-school graduates, while $464 is good for someone earning a bachelor's degree.",
"A survey of 1,075 people by retailmenot.com found that cash, checks and gift cards remain popular choices, cited as preferred by half the respondents. On average, respondents say $165 is an appropriate cash gift for high-school graduates, while $464 is good for someone earning a bachelor's degree.If your friend or relative just attained a graduate degree, plan on shelling out about $772. Those figures are averages, not round numbers.n average, respondents say $165 is an appropriate cash gift for high-school graduates, while $464 is good for someone earning a bachelor's degree.",
"Rich friends and relatives are likely to respond more generously to “how much should I give?” Half of Millionaires would give a high school graduate between $100 and $500, and 60 percent would give a college grad between $100 and $500.ccordingly, grads are more likely to get a gift from a woman, but a gift from a man is likely to be a bigger one. More than half the women surveyed (53 percent) say it’s important to give graduation gifts to close friends, compared to 39 percent of men.",
"A Retailmenot.com survey found that cash, checks and gift cards remain popular choices, cited as preferred by half the respondents. On average, respondents say $165 is an appropriate cash gift for high-school graduates, while $464 is good for someone earning a bachelor's degree.If your friend or relative just attained a graduate degree, plan on shelling out about $772.Those figures are averages, not round numbers. Retailmenot.com survey found that cash, checks and gift cards remain popular choices, cited as preferred by half the respondents. On average, respondents say $165 is an appropriate cash gift for high-school graduates, while $464 is good for someone earning a bachelor's degree.",
"Spend: 20% of your total on the engagement present20% of your total on the shower gift60% of your total on the wedding gift That means if you’re spending $250 total, you’d spend $50 each on the engagement and shower, and $150 on the wedding present.or close family members, the average cost for a gift shoots up to $179, while co-workers will only reap $66 on average. Attending a wedding can be expensive (costing $539 on average, including gifts, travel, and clothing), especially if you’re in the wedding party, so you should factor in those costs too.",
"For some people giving $20 would be a stretch. I think a lot of how much you give depends on how close you are to these nieces and nephews. If not close--if you don't see them or stay in touch, I'd give a lower amount. I gave $50 to my kids' friends on high school graduation.But for close kids or family, I'd give $100.or some people giving $20 would be a stretch. I think a lot of how much you give depends on how close you are to these nieces and nephews. If not close--if you don't see them or stay in touch, I'd give a lower amount. I gave $50 to my kids' friends on high school graduation.",
"Brides-to-be and expecting parents can also expect to be showered with gifts. Again, how much to spend depends on how close you are to the person. The consensus on Baby Center suggests: $20-$25 for a co-worker or acquaintance, $50 for a close friend, or $100 for a best friend or family member.or close family members, the average cost for a gift shoots up to $179, while co-workers will only reap $66 on average. Attending a wedding can be expensive (costing $539 on average, including gifts, travel, and clothing), especially if you’re in the wedding party, so you should factor in those costs too.",
"Most investors (57 percent) say that’s the appropriate amount for a high school grad of a close friend or family member, though 40 percent are more comfortable giving between $100 and $500. Wondering how much to give for a wedding shower gift? Click here to find out what affluent investors have to say.ccordingly, grads are more likely to get a gift from a woman, but a gift from a man is likely to be a bigger one. More than half the women surveyed (53 percent) say it’s important to give graduation gifts to close friends, compared to 39 percent of men."
],
"url": [
"http://us105fm.com/how-much-money-should-you-give-for-graduation/",
"http://www.brighthub.com/education/college/articles/68782.aspx",
"http://www.azcentral.com/story/money/business/2014/05/20/what-and-how-much-to-give-for-graduation/9325805/",
"http://www.azcentral.com/story/money/business/2014/05/20/what-and-how-much-to-give-for-graduation/9325805/",
"http://millionairecorner.com/Content_Free/How-Much-Should-I-Give-for-a-Graduation-Gift.aspx",
"http://www.azcentral.com/story/money/business/consumer/2015/05/11/spend-graduation-gifts/27135621/",
"http://lifehacker.com/how-much-money-should-i-spend-on-gifts-for-different-oc-910350337",
"http://ths.gardenweb.com/discussions/2536075/graduation-gift-how-much-is-acceptable",
"http://lifehacker.com/how-much-money-should-i-spend-on-gifts-for-different-oc-910350337",
"http://millionairecorner.com/Content_Free/How-Much-Should-I-Give-for-a-Graduation-Gift.aspx"
]
} | how much money should you give for a graduation gift to a coworkers child | 325,401 | NUMERIC | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"A. A. A stress test can be used to test for heart disease. Stress tests are tests performed by a doctor and/or trained technician to determine the amount of stress that your heart can manage before developing either an abnormal rhythm or evidence of ischemia (not enough blood flow to the heart muscle).he most commonly performed stress test is the exercise stress test. The exercise stress test -- also called a stress test, exercise electrocardiogram, treadmill test, graded exercise test, or stress ECG -- is used to provide information about how the heart responds to exertion.",
"Rating Newest Oldest. Best Answer: A stress test, sometimes called a treadmill test or exercise test, helps a doctor find out how well your heart handles work. As your body works harder during the test, it requires more oxygen, so the heart must pump more blood.he heart is stressed during the exercise test — thus the name stress test.. The patient then lies quietly for 2-3 hours and another series of pictures is made. These show blood flow to the heart muscle during rest.",
"Best Answer: A stress test, sometimes called a treadmill test or exercise test, helps a doctor find out how well your heart handles work.As your body works harder during the test, it requires more oxygen, so the heart must pump more blood.he heart is stressed during the exercise test — thus the name stress test.. The patient then lies quietly for 2-3 hours and another series of pictures is made. These show blood flow to the heart muscle during rest.",
"The most commonly performed stress test is the exercise stress test. The exercise stress test -- also called a stress test, exercise electrocardiogram, treadmill test, graded exercise test, or stress ECG -- is used to provide information about how the heart responds to exertion.he most commonly performed stress test is the exercise stress test. The exercise stress test -- also called a stress test, exercise electrocardiogram, treadmill test, graded exercise test, or stress ECG -- is used to provide information about how the heart responds to exertion.",
"The stress test consist of starting out walking slowly on a treadmill and than the speed is increased, the treadmill is than slanted and you are walking faster, your blood pressure is being taken while you are on the treadmill and in your other heart arm an IV is inserted with some type of dye.he heart is stressed during the exercise test — thus the name stress test.. The patient then lies quietly for 2-3 hours and another series of pictures is made. These show blood flow to the heart muscle during rest.",
"Definition. A nuclear stress test measures blood flow to your heart at rest and while your heart is working harder as a result of exertion or medication.The test provides images that can show areas of low blood flow through the heart and damaged heart muscle.efinition. A nuclear stress test measures blood flow to your heart at rest and while your heart is working harder as a result of exertion or medication.",
"The results of your stress test may help your doctor decide if you have heart disease, and if so, how severe it is. A stress test, sometimes called a treadmill test or exercise test, helps your doctor find out how well your heart handles work.n exercise stress test, also known as ETT or a treadmill test, helps physicians determine the presence and/or extent of heart disease. When a person exercises, the heart must work harder to provide oxygen-rich blood to the working muscles.",
"Stress testing provides information about how your heart works during physical stress. Some heart problems are easier to diagnose when your heart is working hard and beating fast. During stress testing, you exercise (walk or run on a treadmill or pedal a stationary bike) to make your heart work hard and beat fast.tress testing provides information about how your heart works during physical stress. Some heart problems are easier to diagnose when your heart is working hard and beating fast. During stress testing, you exercise (walk or run on a treadmill or pedal a stationary bike) to make your heart work hard and beat fast.",
"An exercise stress test usually involves walking on a treadmill or riding a stationary bike while your heart rhythm, blood pressure and breathing are monitored.Your doctor may recommend an exercise stress test if he or she suspects you have coronary artery disease or an irregular heart rhythm (arrhythmia).The test may also be used to guide your treatment if you've already been diagnosed with a heart condition. stress test, also called an exercise stress test, gathers information about how your heart works during physical activity. Because exercise makes your heart pump harder and faster than usual, an exercise stress test can reveal problems within your heart that might not be noticeable otherwise.",
"What To Expect During Stress Testing. During all types of stress testing, a doctor, nurse, or technician will always be with you to closely check your health status. Before you start the stress part of a stress test, the nurse will put sticky patches called electrodes on the skin of your chest, arms, and legs.hat To Expect During Stress Testing. During all types of stress testing, a doctor, nurse, or technician will always be with you to closely check your health status. Before you start the stress part of a stress test, the nurse will put sticky patches called electrodes on the skin of your chest, arms, and legs."
],
"url": [
"http://www.webmd.com/heart-disease/guide/stress-test",
"https://answers.yahoo.com/question/index?qid=20071025044145AAIj0Qr",
"https://answers.yahoo.com/question/index?qid=20071025044145AAIj0Qr",
"http://www.webmd.com/heart-disease/guide/stress-test",
"https://answers.yahoo.com/question/index?qid=20071025044145AAIj0Qr",
"http://www.mayoclinic.org/tests-procedures/nuclear-stress-test/basics/definition/PRC-20012978",
"https://www.sharecare.com/health/circulatory-system-health/what-stress-test",
"http://www.nhlbi.nih.gov/health/health-topics/topics/stress/",
"http://www.mayoclinic.org/tests-procedures/stress-test/basics/definition/PRC-20019801",
"http://www.nhlbi.nih.gov/health/health-topics/topics/stress/during"
]
} | what does a stress test onsit of | 630,436 | DESCRIPTION | [] |
[
"The DNA contains the master plan for the creation of the proteins and other molecules and systems of the cell, but the carrying out of the plan involves transfer of the relevant information to RNA in a process called transcription.The RNA to which the information is transcribed is messenger RNA (mRNA)."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
1,
0,
0,
0
],
"passage_text": [
"The resulting mRNA is a single-stranded copy of the gene, which next must be translated into a protein molecule. During translation, which is the second major step in gene expression, the mRNA is read according to the genetic code, which relates the DNA sequence to the amino acid sequence in proteins (Figure 2).n this situation, translation begins at the 5' end of the mRNA while the 3' end is still attached to DNA. In all types of cells, the ribosome is composed of two subunits: the large (50S) subunit and the small (30S) subunit (S, for svedberg unit, is a measure of sedimentation velocity and, therefore, mass).",
"In Translation, you don't convert mRNA into tRNA. The mRNA goes through the Ribosomes, and the tRNA matches the mRNA codons to anti-codons, which makes a peptide chain or proteins.If you want to convert mRNA by hand, you would use a certain method.This is our DNA strand:TAC-ACC-TGA-GGC-ATA-CCA-ATT.he mRNA goes through the Ribosomes, and the tRNA matches the mRNA codons to anti-codons, which makes a peptide chain or proteins. If you want to convert mRNA by hand, you would use a certain method.",
"Description. SeqDNA = rna2dna(SeqRNA) converts an RNA sequence to a DNA sequence by converting any uracil nucleotides (U) in the RNA sequence to thymine nucleotides (T). The DNA sequence is returned in the same format as the RNA sequence.For example, if SeqRNA is a vector of integers, then so is SeqDNA.escription. SeqDNA = rna2dna(SeqRNA) converts an RNA sequence to a DNA sequence by converting any uracil nucleotides (U) in the RNA sequence to thymine nucleotides (T). The DNA sequence is returned in the same format as the RNA sequence.",
"During transcription, the enzyme RNA polymerase (green) uses DNA as a template to produce a pre-mRNA transcript (pink). The pre-mRNA is processed to form a mature mRNA molecule that can be translated to build the protein molecule (polypeptide) encoded by the original gene.n this situation, translation begins at the 5' end of the mRNA while the 3' end is still attached to DNA. In all types of cells, the ribosome is composed of two subunits: the large (50S) subunit and the small (30S) subunit (S, for svedberg unit, is a measure of sedimentation velocity and, therefore, mass).",
"In the simplest sense, expressing a gene means manufacturing its corresponding protein, and this multilayered process has two major steps. In the first step, the information in DNA is transferred to a messenger RNA (mRNA) molecule by way of a process called transcription.n this situation, translation begins at the 5' end of the mRNA while the 3' end is still attached to DNA. In all types of cells, the ribosome is composed of two subunits: the large (50S) subunit and the small (30S) subunit (S, for svedberg unit, is a measure of sedimentation velocity and, therefore, mass).",
"This video shows how to decode the DNA code. We convert the DNA message into the sequence of mRNA bases, then convert to tRNA bases and finally we show the amino acids.1 People & Blogs.his video shows how to decode the DNA code. We convert the DNA message into the sequence of mRNA bases, then convert to tRNA bases and finally we show the amino acids. 1 People & Blogs.",
"The DNA contains the master plan for the creation of the proteins and other molecules and systems of the cell, but the carrying out of the plan involves transfer of the relevant information to RNA in a process called transcription.The RNA to which the information is transcribed is messenger RNA (mRNA).The process associated with RNA polymerase is to unwind the DNA and build a strand of mRNA by placing on the growing mRNA molecule the base complementary to that on the template strand of the DNA.he DNA contains the master plan for the creation of the proteins and other molecules and systems of the cell, but the carrying out of the plan involves transfer of the relevant information to RNA in a process called transcription.",
"In this situation, translation begins at the 5' end of the mRNA while the 3' end is still attached to DNA. In all types of cells, the ribosome is composed of two subunits: the large (50S) subunit and the small (30S) subunit (S, for svedberg unit, is a measure of sedimentation velocity and, therefore, mass).n this situation, translation begins at the 5' end of the mRNA while the 3' end is still attached to DNA. In all types of cells, the ribosome is composed of two subunits: the large (50S) subunit and the small (30S) subunit (S, for svedberg unit, is a measure of sedimentation velocity and, therefore, mass).",
"In the mRNA, Uracil is substituted for thymine as the base complementary to adenine. Since the other strand of the DNA has bases complementary to the template strand, the mRNA has the same sequence of bases at the upper strand of DNA shown above (with U substituted for T) , which is called the coding strand.he DNA contains the master plan for the creation of the proteins and other molecules and systems of the cell, but the carrying out of the plan involves transfer of the relevant information to RNA in a process called transcription.",
"Create the antiparallel DNA or RNA strand. For example, the sequence ATGC is converted to GCAT. Antiparallel combines the two functions Complement and Inverse. Complement. Create the complement DNA or RNA strand.For example, the sequence ATGC is converted to TACG. Inverse. Create the inverse DNA or RNA strand. For example, the sequence ATGC is converted to CGTA.omplement. Create the complement DNA or RNA strand. For example, the sequence ATGC is converted to TACG. Inverse. Create the inverse DNA or RNA strand. For example, the sequence ATGC is converted to CGTA."
],
"url": [
"http://www.nature.com/scitable/topicpage/Translation-DNA-to-mRNA-to-Protein-393",
"http://www.answers.com/Q/How_do_you_convert_mrna_to_trna",
"http://www.mathworks.com/help/bioinfo/ref/rna2dna.html",
"http://www.nature.com/scitable/topicpage/Translation-DNA-to-mRNA-to-Protein-393",
"http://www.nature.com/scitable/topicpage/Translation-DNA-to-mRNA-to-Protein-393",
"http://www.youtube.com/watch?v=mGgYTdPYQjA",
"http://hyperphysics.phy-astr.gsu.edu/hbase/Organic/transcription.html",
"http://www.nature.com/scitable/topicpage/Translation-DNA-to-mRNA-to-Protein-393",
"http://hyperphysics.phy-astr.gsu.edu/hbase/Organic/transcription.html",
"http://www.fr33.net/seqedit.php"
]
} | what converts DNA into mrna | 601,117 | ENTITY | [
"RNA converts DNA into mRNA."
] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Please try again later. Sony's a7/a7r, a6000, NEX cameras are WI-FI enabled and allow direct connection from camera to smartphone. Simply enable the camera to become a WIFI hotspot, and use Sony's Play Memories app, and you can directly transfer, even without a nearby WIFI network.1 Education. 2 Standard YouTube License.ony's a7/a7r, a6000, NEX cameras are WI-FI enabled and allow direct connection from camera to smartphone.",
"Sony's a7/a7r, a6000, NEX cameras are WI-FI enabled and allow direct connection from camera to smartphone.Simply enable the camera to become a WIFI hotspot, and use Sony's Play Memories app, and you can directly transfer, even without a nearby WIFI network.1 Education. 2 Standard YouTube License.ony's a7/a7r, a6000, NEX cameras are WI-FI enabled and allow direct connection from camera to smartphone.",
"How to Connect the Sony Xperia Z to a PC. Two Methods: Using a USB Cable Using Bluetooth. Connecting the Sony Xperia Z to your computer will allow you to transfer photos, music and other files between your phone and the computer.You can connect the Xperia Z to your computer using either a USB cable or Bluetooth connection.avigate to and tap on the name of your device from the list of devices. ” Your phone will now be visible to other Bluetooth devices, including your computer. 6. Enable the Bluetooth feature on your PC. 1 Refer to the manufacturer’s guide for your computer if you need guidance with enabling Bluetooth on your PC.",
"Connect the Sony Xperia Z to your computer using a USB cable. 1 By default, your computer will recommend that you download and install a program called “PC Companion” upon recognizing your Sony Xperia Z.avigate to and tap on the name of your device from the list of devices. ” Your phone will now be visible to other Bluetooth devices, including your computer. 6. Enable the Bluetooth feature on your PC. 1 Refer to the manufacturer’s guide for your computer if you need guidance with enabling Bluetooth on your PC.",
"Gary Fong shows how to pair the Sony a7 with your smartphone. 1 Education. 2 Standard YouTube License.ary Fong shows how to pair the Sony a7 with your smartphone. 1 Education. 2 Standard YouTube License.",
"Check your Bluetooth connection. To see if a Bluetooth accessory is connected to your device, look for the Bluetooth icon in the status bar of your device. If you see (white), Bluetooth is on and a device is connected to your iOS device.If you see (gray), Bluetooth is on but no device is connected.et up and use third-party Bluetooth accessories. Learn how to pair your iOS device with your Bluetooth accessories so you can stream phone calls, music, videos, and more.",
"Pair your device with a Bluetooth accessory. 1 Follow the instructions that came with your Bluetooth accessory or car stereo to place it in discovery or pair mode. 2 If you aren’t sure how to do this, contact the manufacturer. 3 Choose a Bluetooth accessory.4 You might need to enter the PIN or passkey.et up and use third-party Bluetooth accessories. Learn how to pair your iOS device with your Bluetooth accessories so you can stream phone calls, music, videos, and more.",
"To minimize interference between your Wi-Fi and Bluetooth devices, try the following: 1 Change channels on your wireless network. 2 Connect to a 5 GHz wireless network (if possible). 3 Minimize the number of active Bluetooth wireless devices you have connected to the computer or operating in the area. Change channels on your wireless network. 2 For Wi-Fi base stations, reset the base station and it will attempt to use the 2.4 and 5 GHz channels with the least interference when it starts up. 3 Connect to a 5 GHz wireless network (if possible).",
"To minimize interference between your Wi-Fi and Bluetooth devices, try the following: 1 Change channels on your wireless network. 2 For Wi-Fi base stations, reset the base station and it will attempt to use the 2.4 and 5 GHz channels with the least interference when it starts up. Change channels on your wireless network. 2 For Wi-Fi base stations, reset the base station and it will attempt to use the 2.4 and 5 GHz channels with the least interference when it starts up. 3 Connect to a 5 GHz wireless network (if possible).",
"no. bluetooth is unable to broadcast high resolution video since it has a rather limited data transfer rate. to connect wirelessly to your tv you would need a more specialized device meant for streaming video.it may be possible to stream this ove wifi if your connection is good enough but this might also result in a bit of lag or delay. the best choice is of course using a physical hdmi cable.o connect wirelessly to your tv you would need a more specialized device meant for streaming video. it may be possible to stream this ove wifi if your connection is good enough but this might also result in a bit of lag or delay."
],
"url": [
"http://www.youtube.com/watch?v=L0oC42CBi9o",
"http://www.youtube.com/watch?v=L0oC42CBi9o",
"http://www.wikihow.com/Connect-the-Sony-Xperia-Z-to-a-PC",
"http://www.wikihow.com/Connect-the-Sony-Xperia-Z-to-a-PC",
"http://www.youtube.com/watch?v=xmuCAV5ajfc",
"https://support.apple.com/en-us/HT204091",
"https://support.apple.com/en-us/HT204091",
"https://support.apple.com/en-us/HT201542",
"https://support.apple.com/en-us/HT201542",
"http://www.tomsguide.com/answers/id-2309692/connect-laptop-smart.html"
]
} | how to view video from sony a7sii using wifi or blutooth | 385,992 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"The Texas Family Violence Benchbook – September 2011 — ii. Hyperlinks within sections. Some sections have internal hyperlinks on the first page. For instance, the first page of the Texas cases list has a hyperlinked alphabet so the user. can search for cases by the first letter of the citation.",
"If you’ve already been convicted once before of a case with a finding of family violence, then the second arrest will be charged as a 3rd Degree Felony. A 3rd Degree Felony is punishable by 2 to 10 years in prison and/or a fine of up to $10,000.",
"This project was funded by the Department of Justice¶s Office of Violence Against. Women¶s STOP Grant No. WF-08-V30-21069-01, awarded by the Criminal Justice Division. of the Office of the Governor of Texas. The views expressed in this Benchbook.",
"Assault – Domestic Violence – Misdemeanor. The first charge of assault with domestic violence is also class A misdemeanor. It carries a penalty of up to one year in jail and up to a $4,000 fine, but it also carries additional baggage. A family violence finding means you: Can never own a firearm or even ammunition.",
"When you are facing an assault or domestic violence charge you need a criminal defense attorney who focuses on assault and domestic violence cases. Our lawyers have years of experience defending and winning assault cases.",
"“Domestic violence” commonly refers to violence between adults who are married, but “family violence” as defined in the Texas Family Code is broader and includes individuals who are: 1 Related by blood or marriage. 2 Current and/or former spouses. 3 Parents of the same child. Foster parents and children.",
"Felony domestic violence is a charge resulting from violent behavior or the threat of violent behavior toward family members or other domestic partners. In some places, the extent of a victim's injuries determine whether or not an act of domestic violence is considered a felony or misdemeanor.",
"Felony domestic violence is a type of criminal charge. When a person is charged with domestic violence, it means he or she is accused of behaving violently toward family members or people who live with him or her. The violence may involve not only physical harm, but also the threat of physical harm.",
"Several different offenses can fall under the “family violence banner,” but the most common cases are: 1 Assault (offensive touching, sometimes a reduction from a higher charge) – class C misdemeanor, $0 to $500 fine. 2 Assault Family Violence – class A misdemeanor, 0 to 365 days jail and/or up to $4,000 fine.",
"The Texas Family Violence Benchbook – September 2011 — vi. PREFACE. To present the topic of domestic violence in a neutral way does not. mean I condone it, nor does it mean I do not feel compassion and."
],
"url": [
"http://www.txcourts.gov/media/478288/domesticviolencebenchbook.pdf",
"http://www.rosenthalwadas.com/practice-areas/domestic-violence/",
"http://www.txcourts.gov/media/478288/domesticviolencebenchbook.pdf",
"https://www.dunhamlaw.com/assault/",
"https://www.dunhamlaw.com/assault/",
"http://www.rosenthalwadas.com/practice-areas/domestic-violence/",
"http://www.wisegeek.org/what-is-felony-domestic-violence.htm",
"http://www.wisegeek.org/what-is-felony-domestic-violence.htm",
"http://www.rosenthalwadas.com/practice-areas/domestic-violence/",
"http://www.txcourts.gov/media/478288/domesticviolencebenchbook.pdf"
]
} | is domestic violence a felony in texas | 408,586 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Foods with Vitamin K Below is a listing of some common foods and vitamin K content per specified portion. FOODS PORTION VITAMIN K CONTENT* (MICROGRAMS) FOODS PORTION VITAMIN K CONTENT* (MICROGRAMS) page 2 293US1605391-01-01 12/16of 2 Beans, snap, green, frozen, microwaved 1 cup 64 Beans, snap, green or yellow, canned or boiled 1 cup 60",
"Vitamin K is an essential nutrient for maintaining proper blood clotting and healthy bones. It's a fat-soluble vitamin present naturally in many foods....",
"Below is a listing of some common foods and vitamin K content per specified portion. Database for Standard Reference, Release 28 (slightly revised), May 2016. on a 2000-calorie diet. The FDA recommends 80 micrograms of vitamin K.",
"Basic list. http://www.drgourmet.com/md/warfarinbrief.pdf. List of foods with relative amounts of Vitamin K. http://www.drgourmet.com/md/relativewarfarinlist.pdf. Comprehensive list. http://www.drgourmet.com/md/warfarincomprehensive.pdf. In addition there is an easy way to find out about the nutrition content of any food.",
"Animal products and seafood contain very small amounts of vitamin K. They typically provide no more than 5 micrograms of the vitamin per serving. Cheese, eggs, milk, beef, pork, chicken, turkey, tuna, mackerel and shrimp all contain small amounts of vitamin K. Clams, other shellfish and anchovies have trace amounts of the vitamin as well.",
"Vitamin K is an essential nutrient for maintaining proper blood clotting and healthy bones. It's a fat-soluble vitamin present naturally in many foods. Healthy bacteria that live in your intestines can also manufacture vitamin K. Your body can store vitamin K in the liver and fat tissues, making deficiency rare. You do need to limit your vitamin K intake, however, when taking certain medications, such as blood thinners. Video of the Day",
"* Portions as well as vitamin K content as specified in the USDA National Nutrient Database for Standard Reference, Release 28 (slightly revised), May 2016. Based on a 2000-calorie diet. The FDA recommends 80 micrograms of vitamin K.",
"These greens contain anywhere from 265 to 531 micrograms of vitamin K per 1/2 cup cooked and 116 to 299 micrograms per cup raw. According to the Institute of Medicine, men need at least 120 micrograms of vitamin K per day, and women need at least 90 micrograms per day.",
"Foods with Vitamin K Below is a listing of some common foods and vitamin K content per specified portion. FOODS PORTION VITAMIN K CONTENT* (MICROGRAMS) FOODS PORTION VITAMIN K CONTENT* (MICROGRAMS) * Portions as well as vitamin K content as specified in the USDA National Nutrient Database for Standard Reference, Release 28 (slightly revised), May 2016. Based page 1 of 2 on a 2000-calorie diet. The FDA recommends 80 micrograms of vitamin K. Onions, spring or scallions (tops &",
"Below is a listing of some common foods and vitamin K content per specified portion. Database for Standard Reference, Release 28 (slightly revised), May 2016. page 1 of 2 on a 2000-calorie diet. The FDA recommends 80 micrograms of vitamin K."
],
"url": [
"http://www.coumadin.bmscustomerconnect.com/servlet/servlet.FileDownload?file=00Pi000000bxvTFEAY",
"https://www.livestrong.com/article/242314-complete-list-of-foods-that-contain-vitamin-k/",
"http://www.coumadin.bmscustomerconnect.com/servlet/servlet.FileDownload?file=00Pi000000bxvTFEAY",
"http://www.drgourmet.com/askdrgourmet/vitaminkfoods.shtml",
"https://www.livestrong.com/article/242314-complete-list-of-foods-that-contain-vitamin-k/",
"https://www.livestrong.com/article/242314-complete-list-of-foods-that-contain-vitamin-k/",
"http://www.coumadin.bmscustomerconnect.com/servlet/servlet.FileDownload?file=00Pi000000bxvTFEAY",
"https://www.livestrong.com/article/242314-complete-list-of-foods-that-contain-vitamin-k/",
"http://www.coumadin.bmscustomerconnect.com/servlet/servlet.FileDownload?file=00Pi000000bxvTFEAY",
"http://www.coumadin.bmscustomerconnect.com/servlet/servlet.FileDownload?file=00Pi000000bxvTFEAY"
]
} | list of foods and amount of vitamin k | 1,174,091 | ENTITY | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"So if you have COPD, one of the lifestyle changes to make is to stop eating hot dogs, bacon, and lunch meats! Symptoms. 1 Chest Tightness. 2 Cough with Mucus. 3 Shortness of breath that gets worse with mild activity. 4 Fatigue. 5 Frequent respiratory infections. 6 Wheezing.",
"1 Air pollution acts in a similar manner to cigarette smoke. 2 The pollutants cause inflammation in the airways, leading to lung tissue destruction. 3 Close relatives of people with emphysema are more likely to develop the disease themselves.",
"Emphysema Causes. Cigarette smoking is by far the most dangerous behavior that causes people to develop emphysema, and it is also the most preventable cause. Other risk factors include a deficiency of an enzyme called alpha-1-antitrypsin, air pollution, airway reactivity, heredity, male sex, and age. The importance of cigarette smoking as a risk factor for developing emphysema cannot be overemphasized. Cigarette smoke contributes to this disease process in two ways.",
"If you have COPD, this is a must read!! Breathing Techniques. One of the most important things you can do to help your COPD condition is learn a breathing technique that will strengthen your lung function and keep your pH in balance.",
"1 Over years of chronic exposure to cigarette smoke, the decreased elasticity and destruction of alveoli leads to the slow destruction of lung function. 2 Alpha-1-antitrypsin (also known as alpha-1-antiprotease) is a substance that fights a destructive enzyme in the lungs called trypsin (or protease).",
"Enzymes – enzyme deficiency leads to a multitude of health conditions, including acute and chronic bronchitis, asthma, inflammation and food allergies, all of which are part of the general condition, COPD.",
"Chronic asthma is a recurring spasm of the bronchial tubes, often a reaction to infection, smoke, cold air, exercise, pollen or other irritants. Other triggers for COPD are environmental pollution, chemical fumes, including most household cleaners and sprays, dust, mold, and, of course, smoking or second-hand smoke.",
"1 They are used for rapid emptying of the lower intestine and bowel. 2 They are not used for long-term or repeated correction of constipation. 3 With smaller doses than those used for the laxative effect, some saline laxatives are used as antacids. 4 The information that follows applies only to their use as laxatives.",
"Shortness of Breath continued... Many people with COPD find that chewing and swallowing causes air to be cut off from the lungs. This then adds to feeling short of breath. The following guidelines may be helpful to stop shortness of breath at meal times. Try these Suggestions to Decrease Your Shortness of Breath: 1 Try to rest for 30 minutes before meals. 2 If you become short of breath use deep breathing and pursed-lip breathing techniques. 3 Use good body posture to make breathing easier.",
"This type of laxative has been said not to cause a bowel movement but instead allows the patient to have a bowel movement without straining. Combinations—There are many products that you can buy for constipation that contain more than one type of laxative. For example, a product may contain both a stool softener and a stimulant laxative. In general, combination products may be more likely to cause side effects because of the multiple ingredients."
],
"url": [
"http://www.health911.com/copd",
"http://www.emedicinehealth.com/emphysema/page2_em.htm",
"http://www.emedicinehealth.com/emphysema/page2_em.htm",
"http://www.health911.com/copd",
"http://www.emedicinehealth.com/emphysema/page2_em.htm",
"http://www.health911.com/copd",
"http://www.health911.com/copd",
"http://www.mayoclinic.org/drugs-supplements/laxative-oral-route/description/DRG-20070683",
"http://www.webmd.com/lung/copd/copd-symptoms-can-directly-cause-too-much-weight-loss?page=2",
"http://www.mayoclinic.org/drugs-supplements/laxative-oral-route/description/DRG-20070683"
]
} | is emphysema a causal agent of constipation | 409,320 | DESCRIPTION | [] |
[
"Yes"
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"Deep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together.Most deep vein blood clots occur in the lower leg or thigh. They also can occur in other parts of the body.A blood clot in a deep vein can break off and travel through the bloodstream. The loose clot is called an embolus (EM-bo-lus).eep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together.",
"Deep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together. Most deep vein blood clots occur in the lower leg or thigh.They also can occur in other parts of the body.A blood clot in a deep vein can break off and travel through the bloodstream. The loose clot is called an embolus (EM-bo-lus).It can travel to an artery in the lungs and block blood flow.This condition is called pulmonary embolism (PULL-mun-ary EM-bo-lizm), or PE.hey also can occur in other parts of the body. A blood clot in a deep vein can break off and travel through the bloodstream. The loose clot is called an embolus (EM-bo-lus). It can travel to an artery in the lungs and block blood flow. This condition is called pulmonary embolism (PULL-mun-ary EM-bo-lizm), or PE.",
"Deep vein thrombosis (DVT) is a blood clot (thrombus) in a deep vein, usually in the legs. Clots can form in superficial veins and in deep veins.Blood clots with inflammation in superficial veins (called superficial thrombophlebitis or phlebitis) rarely cause serious problems.But clots in deep veins (deep vein thrombosis) require immediate medical care.urgery or an injury can damage your blood vessels and cause a clot to form. Cancer can also cause DVT. Some people have blood that clots too easily, a problem that may run in families.",
"Deep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together. Most deep vein blood clots occur in the lower leg or thigh.They also can occur in other parts of the body. DVT affects 2 million Americans each year.eep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together. Most deep vein blood clots occur in the lower leg or thigh.",
"Deep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together. Most deep vein blood clots occur in the lower leg or thigh.They also can occur in other parts of the body. DVT affects 2 million Americans each year.eep vein thrombosis (throm-BO-sis), or DVT, is a blood clot that forms in a vein deep in the body. Blood clots occur when blood thickens and clumps together. Most deep vein blood clots occur in the lower leg or thigh. They also can occur in other parts of the body. DVT affects 2 million Americans each year.",
"1. Clots in Arteries: Blood clots which form in arteries lead to stroke, transient ischemic attack (TIA or mini-stroke), heart attack, or peripheral arterial clot and gangrene. 2. Clots in Veins: Blood clots which form in the deep veins of the body lead to deep vein thrombosis (DVT) and pulmonary embolism (PE).When a clot forms in the deep veins of the body, it is called deep vein thrombosis, often referred to as DVT for short.. Clots in Arteries: Blood clots which form in arteries lead to stroke, transient ischemic attack (TIA or mini-stroke), heart attack, or peripheral arterial clot and gangrene. 2. Clots in Veins: Blood clots which form in the deep veins of the body lead to deep vein thrombosis (DVT) and pulmonary embolism (PE).",
"Deep vein thrombosis (DVT) is a medical condition that occurs when a blood clot forms in a deep vein. These clots usually develop in the lower leg, thigh, or pelvis, but they can also occur in the arm.ow a clot affects the body depends on the type and location of the clot: 1 A blood clot in a deep vein of the leg, pelvis, and sometimes arm, is called deep vein thrombosis (DVT). 2 This type of blood clot does not cause heart attack or stroke.",
"Deep Vein Thrombosis (DVT) When a clot forms in the deep veins of the body, it is called deep vein thrombosis, often referred to as DVT for short. DVT occurs most commonly in the leg; although it can occur anywhere in the body, such as the veins in the arm, abdomen, or around the brain.. Clots in Arteries: Blood clots which form in arteries lead to stroke, transient ischemic attack (TIA or mini-stroke), heart attack, or peripheral arterial clot and gangrene. 2. Clots in Veins: Blood clots which form in the deep veins of the body lead to deep vein thrombosis (DVT) and pulmonary embolism (PE).",
"Surgery or an injury can damage your blood vessels and cause a clot to form. Cancer can also cause DVT. Some people have blood that clots too easily, a problem that may run in families.Symptoms of DVT include swelling of the affected leg.urgery or an injury can damage your blood vessels and cause a clot to form. Cancer can also cause DVT. Some people have blood that clots too easily, a problem that may run in families.",
"Blood Clots. Blood clotting, or coagulation, is an important process that prevents excessive bleeding when a blood vessel is injured. Platelets (a type of blood cell) and proteins in your plasma (the liquid part of blood) work together to stop the bleeding by forming a clot over the injury.lood Clots. Blood clotting, or coagulation, is an important process that prevents excessive bleeding when a blood vessel is injured. Platelets (a type of blood cell) and proteins in your plasma (the liquid part of blood) work together to stop the bleeding by forming a clot over the injury."
],
"url": [
"http://www.nhlbi.nih.gov/health/health-topics/topics/dvt/",
"http://www.ncbi.nlm.nih.gov/pubmedhealth/PMH0001209/",
"http://www.webmd.com/dvt/tc/deep-vein-thrombosis-topic-overview",
"http://www.vascular.surgery.ucsf.edu/conditions--procedures/deep-vein-thrombosis.aspx",
"http://surgery.ucsf.edu/conditions--procedures/deep-vein-thrombosis.aspx",
"http://files.www.clotconnect.org/DVT_and_PE.pdf",
"http://www.cdc.gov/ncbddd/dvt/facts.html",
"http://files.www.clotconnect.org/DVT_and_PE.pdf",
"http://www.webmd.com/dvt/tc/deep-vein-thrombosis-topic-overview",
"http://www.hematology.org/Patients/Clots/"
]
} | does damage have occur to a vein for a clot to form | 165,241 | DESCRIPTION | [] |
[
"Fluctuations in the amount of insolation and variations in the intensity and timing of heat from the sun."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Global warming is an inescapable issue for our age. But 180 years ago, most scientists believed that Earth had been steadily cooling since it was formed.",
"Analyses of air trapped in glacial ice over the last 800,000 years show that atmospheric carbon dioxide generally ranged between 200 and 300 parts per million by volume (ppmv); increases in these levels were slightly preceded by increases in temperature caused by natural orbital shifts.",
"Changes in Earth’s radiation balance. were the principal driver of past climate changes, but the causes. of such changes are varied. For each case – be it the Ice Ages, the. warmth at the time of the dinosaurs or the fluctuations of the past. millennium – the specific causes must be established individually. In many cases, this can now be done with good confidence, and. many past climate changes can be reproduced with quantitative. models.",
"The key to the Ice Age was temperature--not cold, but warm. Ice comes from snow, and snow from moisture in the air, which in turn comes through evaporation, which comes from warm water.",
"COLD, HARD FACTS Franklin Hadley Cocks ’63 visits the grave of Louis Agassiz, the great proponent of the ice age concept.",
"What causes ice-ages? Fluctuations in the amount of insolation (incoming solar radiation) are the most likely cause of large-scale changes in Earth's climate during the Quaternary. In other words, variations in the intensity and timing of heat from the sun are the most likely cause of the glacial/interglacial cycles.",
"When Louis Agassiz presented the concept of a Great Ice Age to the Swiss Society of Natural Sciences in 1837, his suggestion that the planet had turned colder and then warmed up again was met with skepticism and even hostility, triggering years of fierce scientific debate before the idea was accepted.",
"Schematic of the Earth’s orbital changes (Milankovitch. cycles) that drive the ice age cycles. ‘T’ denotes changes in the tilt (or obliquity) of. the Earth’s axis, ‘E’ denotes changes in the eccentricity of the orbit (due to variations.",
"The Ice Age: Causes and Consequences. Resources › Earth Sciences Resources › Ice Age. The Ice Age has been a longstanding problem for uniformitarian thinking, with many unsolved mysteries. No mere tweaking of today's climate conditions would cause such a catastrophe. A creationist model based on the revealed events of Scripture, however, offers a possible answer.",
"With so much attention focused on global warming, this chilly prospect has been all but forgotten. Given how catastrophic another ice age could be, one might be tempted to ask whether a human-caused increase in atmospheric and ocean temperatures will actually be a boon."
],
"url": [
"https://www.technologyreview.com/s/416786/global-warming-vs-the-next-ice-age/",
"https://www.technologyreview.com/s/416786/global-warming-vs-the-next-ice-age/",
"http://oceanservice.noaa.gov/education/pd/climate/factsheets/whatcause.pdf",
"http://www.icr.org/article/ice-age-causes-consequences/",
"https://www.technologyreview.com/s/416786/global-warming-vs-the-next-ice-age/",
"http://culter.colorado.edu/~saelias/glacier.html",
"https://www.technologyreview.com/s/416786/global-warming-vs-the-next-ice-age/",
"http://oceanservice.noaa.gov/education/pd/climate/factsheets/whatcause.pdf",
"http://www.icr.org/article/ice-age-causes-consequences/",
"https://www.technologyreview.com/s/416786/global-warming-vs-the-next-ice-age/"
]
} | what causes an ice age | 585,333 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Rise Up by Andra Day From her debut album Cheers to the Fall available now here: http://smarturl.it/CheersToTheFall. this song makes me want to rise up.....",
"Rise like the day. I'll rise up. In spite of the ache. I will rise a thousands times again. And we'll rise up. Rise like the waves. We'll rise up. In spite of the ache. We'll rise up. And we'll do it a thousands times again.",
"Rise Up by Andra Day From her debut album Cheers to the Fall available now here: http://smarturl.it/CheersToTheFall.",
"Rise Up is track #11 on the album Cheers to the Fall. It was written by Jennifer Decilveo, Cassandra Monique Batie. Rise Up is track #11 on the album Cheers to the Fall.",
"Rise Up by Andra Day, from the album 'Cheers to the Fall' available now. iTunes: http://smarturl.it/CheersToTheFall. Apple Music: http://smarturl.it/CTTFAppleMusic. Spotify: http://smarturl.it/AndraDaySpotify. Connect with Andra: http://andraday.com/. https://www.facebook.com/AndraDayMusic.",
"Rise Up by Andra Day, from the album 'Cheers to the Fall' available now. iTunes: http://smarturl.it/CheersToTheFall. Apple Music: http://smarturl.it/CTTFAppleMusic. Spotify: http://smarturl.it/AndraDaySpotify. Connect with Andra: http://andraday.com/.",
"Rise Up by Andra Day, from the album 'Cheers to the Fall' available now. iTunes: http://smarturl.it/CheersToTheFall.",
"And I'll rise up. I'll rise like the day. I'll rise up. I'll rise unafraid. I'll rise up. And I'll do it a thousand times again. And I'll rise up. High like the waves. I'll rise up. In spite of the ache.",
"I'll rise like the day. I'll rise up. I'll rise unafraid. I'll rise up. And I'll do it a thousand times again. And I'll rise up. High like the waves. I'll rise up. In spite of the ache. I'll rise up.",
"I'll rise up. I'll rise unafraid. I'll rise up. And I'll do it a thousand times again. And I'll rise up. High like the waves. I'll rise up. In spite of the ache. I'll rise up. And I'll do it a thousands times again."
],
"url": [
"https://soundcloud.com/andraday/rise-up",
"http://www.metrolyrics.com/rise-up-lyrics-andra-day.html",
"https://soundcloud.com/andraday/rise-up",
"http://www.metrolyrics.com/rise-up-lyrics-andra-day.html",
"http://www.youtube.com/watch?v=kNKu1uNBVkU",
"http://www.youtube.com/watch?v=kNKu1uNBVkU",
"http://www.youtube.com/watch?v=kNKu1uNBVkU",
"http://www.metrolyrics.com/rise-up-lyrics-andra-day.html",
"http://www.metrolyrics.com/rise-up-lyrics-andra-day.html",
"http://www.metrolyrics.com/rise-up-lyrics-andra-day.html"
]
} | lyrics to rise up andra day | 444,102 | ENTITY | [] |
[
"Muskogee County"
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"The Camps and County Locations. Each Camp in Oklahoma was either a main camp or a branch of that camp. Some information about the camps, broken into the counties they were in, beginning with western Oklahoma, follows. Thank you to the OKGenWeb County Coordinaters for their personal comments help on some of these camps. WOODS.",
"The base is named after Brigadier General Edmund L. Gruber, a noted artillery officer and the composer of the Army's official song, The Army Goes Rolling Along. Camp Gruber is located near Braggs, Oklahoma in the Cookson Hills, about 14 miles (23 km) southeast of Muskogee, Oklahoma. The Oklahoma Wildlife Department and the OKARNG have in place an agreement that allows limited hunting by civilians on the base.",
"Camp Gruber is located 1 mile North of Braggs OK on Rt 10. Must use Gate 41, turn right onto Base, go thru Security Checkpoint. Proceed to the billeting office to get a key for the power box at camp sites. Campground is located half mile down on main street. Watch for sign to Blackhawk RV Park on right.",
"TO CAMP GRUBER, OKLAHOMA. YOU ARE NOW stationed in the northeast-. ern section of Oklahoma in the heavily. wooded and picturesque Cookson Hills, a ter-. ritory famed in Indian lore, held high in the. regard of fishermen and hunters before it. became a military reservation, and once ser-. ving as a hiding place for notorious bandits.",
"Camp Gruber: The War Years. AMERICA'S entry into World War II brought many changes to the home front. Northeastern Oklahoma felt the impact firsthand on January 8, 1942, when the Muskogee Phoenix confirmed a report naming the Cookson Hills as the site for a planned military cantonment. The complex would be named Camp Gruber in honor of the late Brigadier General Edmund L. Gruber, composer of The Caisson Song.. The camp was located on Highway 10, eighteen miles east of Muskogee, Oklahoma.",
"Camp Gruber is an Oklahoma Army National Guard (OKARNG) training facility used for Training of OKARNG soldiers. It covers a total of 87 square miles (230 km2).",
"In 1967 the Oklahoma Military Department, Oklahoma Army National Guard (OKARNG), acquired 23,515 acres to establish Camp Gruber as a state-operated training area under a twenty-five year federal license from the Tulsa District of the U.S. Corps of Engineers.",
"Camp Gruber - Cultural Feature (Locale) in Muskogee County. Camp Gruber is a cultural feature (locale) in Muskogee County. The primary coordinates for Camp Gruber places it within the OK 74403 ZIP Code delivery area. In the Maps and Aerial Photos section below, you'll find links to: (1) Local area photos around Camp Gruber, (2) A listing of the nearest hotels to Camp Gruber and (3) Driving Directions to Camp Gruber from almost anywhere.",
"Camp Gruber is located 1 mile North of Braggs OK on Rt 10. Must use Gate 41, turn right onto Base, go thru Security Checkpoint. Proceed to the billeting office to get a key for the power box at camp sites. Campground is located half mile down on main street. Watch for sign to Blackhawk RV Park on right.",
"Because Oklahoma had an optimum location, climate, and natural resources and a large, available work force, the War Department considered the state a good site for pilot and infantry training fields. An infantry training camp was to be built near Braggs, in the Cookson Hills. In 1935 and 1936 the U.S. Department of Agriculture had acquired nearly thirty thousand acres of farmland in eastern Oklahoma, of which 27,322.23 acres were already under federal stewardship. More land was acquired through condemnation."
],
"url": [
"http://rebelcherokee.labdiva.com/ctypowcamps.html",
"https://en.wikipedia.org/wiki/Camp_Gruber",
"http://www.campingroadtrip.com/campgrounds/campground/campground/24353/oklahoma/military-park-camp-gruber-black-hawk-rv-park",
"http://ok.ng.mil/PublishingImages/Pages/camp-gruber/about/Camp%20Gruber%20Brochure.pdf",
"http://www.3riversmuseum.com/camp-gruber-the-war-years.html",
"https://en.wikipedia.org/wiki/Camp_Gruber",
"http://www.okhistory.org/publications/enc/entry.php?entry=CA022",
"http://oklahoma.hometownlocator.com/maps/feature-map,ftc,2,fid,1090861,n,camp%20gruber.cfm",
"http://www.militarycampgrounds.us/oklahoma/blackhawk-rv-park",
"http://www.okhistory.org/publications/enc/entry.php?entry=CA022"
]
} | what county is camp gruber, ok located in | 603,847 | LOCATION | [] |
[
"It is defined as an abnormally low glucose concentration within the cerebrospinal fluid is often suggestive of an underlying infectious or systemic process."
] | {
"is_selected": [
0,
1,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Specific manifestations vary by age and by the severity of the hypoglycemia. In older children and adults, moderately severe hypoglycemia can resemble mania, mental illness, drug intoxication, or drunkenness. In the elderly, hypoglycemia can produce focal stroke-like effects or a hard-to-define malaise.",
"October 17, 2014. Hypoglycorrhachia is defined as an abnormally low glucose concentration within the cerebrospinal fluid is often suggestive of an underlying infectious or systemic process. This is often defined as a glucose concentration less than 40 mg/dL.",
"Hypoglycorrhachia is defined as a cerebrospinal fluid (CSF) glucose level of <45 mg/dl or a CSF to serum glucose ratio ≤0.5, and occurs secondary to glycolysis by bacteria or leukocytes, and/or by altered glucose transport.",
"From Wikipedia, the free encyclopedia. Neuroglycopenia is a medical term that refers to a shortage of glucose (glycopenia) in the brain, usually due to hypoglycemia. Glycopenia affects the function of neurons, and alters brain function and behavior.",
"Hypoglycorrhachia (cerebrospinal fluid (CSF) glucose <45 mg/dl) has been identified as a prognostic factor in patients with meningitis. The differential diagnosis of hypoglycorrhachia and its clinical significance was analyzed in the present study.",
"Brought to you by the Residents & Fellows Section of Neurology®. Hypoglycorrhachia is defined as an abnormally low glucose concentration within the cerebrospinal fluid is often suggestive of an underlying infectious or systemic process. This is often defined as a glucose concentration less than 40 mg/dL.",
"CSF analysis indicated hypoglycorrhachia, elevated protein level, and neutrophilic pleocytosis. The typical cerebrospinal fluid (CSF) findings in patients with TBRM reveal an active inflammatory response with lymphocytosis, hypoglycorrhachia, and elevated protein level, probably as a result of CSF flow blocks.",
"Tell a friend about us, add a link to this page, or visit the webmaster's page for free fun content. Link to this page: <a href=http://medical-dictionary.thefreedictionary.com/hypoglycorrhachia>hypoglycorrhachia</a>. Facebook.",
"The specific problem is: Verifiable sources desperately needed for this section. (August 2012) Neuroglycopenia is a medical term that refers to a shortage of glucose (glycopenia) in the brain, usually due to hypoglycemia. Glycopenia affects the function of neurons, and alters brain function and behavior.",
"The purpose of this study was to determine the differential diagnosis of hypoglycorrhachia and its significance in adults with community-acquired meningitis and to evaluate the reliability of the CSF to serum glucose ratio."
],
"url": [
"https://en.wikipedia.org/wiki/Neuroglycopenia",
"https://www.aan.com/residents-and-fellows/e-pearl-of-the-week/october-17-2014/",
"http://www.sciencedirect.com/science/article/pii/S1201971215001964",
"https://en.wikipedia.org/wiki/Neuroglycopenia",
"http://www.sciencedirect.com/science/article/pii/S1201971215001964",
"https://www.aan.com/residents-and-fellows/e-pearl-of-the-week/october-17-2014/",
"http://medical-dictionary.thefreedictionary.com/hypoglycorrhachia",
"http://medical-dictionary.thefreedictionary.com/hypoglycorrhachia",
"https://en.wikipedia.org/wiki/Neuroglycopenia",
"http://www.sciencedirect.com/science/article/pii/S1201971215001964"
]
} | define hypoglycorrhachia | 122,493 | DESCRIPTION | [] |
[
"Interval"
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"Video: Scales of Measurement: Nominal, Ordinal, Interval & Ratio. When doing research, variables are described on four major scales. In this lesson, we'll look at the major scales of measurement, including nominal, ordinal, interval, and ratio scales.",
"Ratio data is interval data with a natural zero point. For example, time is ratio since 0 time is meaningful. Degrees Kelvin has a 0 point (absolute 0) and the steps in both these scales have the same degree of magnitude. Photo By: dvs.",
"Interval scales have the properties of identity, magnitude, and equal distance. The equal distance between consecutive scale points allows us to know how many units greater than or less than one case is from another on the characteristic being measured.",
"There are four major scales (or types) of measurement of variables: nominal, ordinal, interval and ratio. The scale of measurement depends on the variable itself. Let's look closer at each of the four scales and what types of variables fall into each category. You might have noticed a difference in our two variables.",
"You might have heard of the sequence of terms to describe data : Nominal, Ordinal, Interval and Ratio. They were used quite extensively but have begun to fall out of favor. These terms are used to describe types of data and by some to dictate the appropriate statistical test to use.",
"0 0. Yes, IQ is measured on an interval scale, but some tests also break specific skills into categories that are then measured using interval data. IQ is numeric data expressed in intervals using a fixed measurement scale.",
"The arithmetical average of all the scores and is used with interval or ratio data. It is the most widely used measure of central tendency. Most statistical tests of significance use the mean. The score where 50% of the scores are above it and 50% of the scores are below it. Not as sensitive to extremes in the high and low scores. Best used when the data are skewed and the researcher is interested in the typical score.",
"Many of our standardized tests in psychology use interval scales. An IQ (Intelligence Quotient) score from a standardized test of intelligences is a good example of an interval scale score. IQ scores are derived from a lengthy testing process that requires the participant to complete a number of cognitive tasks.",
"IQ: Ordinal, Interval, or Ratio? As with any measurement, it is important to distinquish between the concept and the operational definition. What is the number your operational definition supplies for the measurement. Concept: How quickly a person masters new material, How adaptable the person is to changes in the situation., etc., etc., etc.",
"Is IQ test scores considered interval scale? -What type of research design is the strongest when I what to adopt a new educational program? Using a pre-test and post-test with control group, the previous method but without the control group, or comparing the performance of two groups of the students giving one the new program and one the old."
],
"url": [
"http://study.com/academy/lesson/scales-of-measurement-nominal-ordinal-interval-ratio.html",
"http://www.usablestats.com/lessons/noir",
"http://www.psychology.emory.edu/clinical/bliwise/Tutorials/SOM/smmod/scalemea/print2.htm",
"http://study.com/academy/lesson/scales-of-measurement-nominal-ordinal-interval-ratio.html",
"http://www.usablestats.com/lessons/noir",
"https://www.wyzant.com/resources/answers/22297/is_iq_test_scores_considered_interval_scale",
"https://quizlet.com/9717138/research-flash-cards/",
"http://www.psychology.emory.edu/clinical/bliwise/Tutorials/SOM/smmod/scalemea/print2.htm",
"http://statistics.bgwoodruff.com/tchng/measurement/iqscale.html",
"https://www.wyzant.com/resources/answers/22297/is_iq_test_scores_considered_interval_scale"
]
} | are test scores interval or ratio data | 25,296 | DESCRIPTION | [
"Test scores are interval data."
] |
[
"Colorectal cancer test use in the adult U.S. population. Seeff LC(1), Nadel MR, Klabunde CN, Thompson T, Shapiro JA, Vernon SW, Coates RJ. Author information: (1)Division of Cancer Prevention and Control, Centers for Disease Control and Prevention, Atlanta, Georgia 30341-3717, USA."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"The use of colorectal cancer tests varied by gender, race, ethnicity, age, education, income, health care coverage, and having a usual source of care. Having seen a physician within the past year had the strongest association with test use.",
"Patterns and predictors of colorectal cancer test use in the adult U.S. population. Seeff LC(1), Nadel MR, Klabunde CN, Thompson T, Shapiro JA, Vernon SW, Coates RJ. (1)Division of Cancer Prevention and Control, Centers for Disease Control and Prevention, Atlanta, Georgia 30341-3717, USA.",
"During this procedure, the surgeon removes the part of your colon that contains the cancer, along with a margin of normal tissue on either side of the cancer. Your surgeon is often able to reconnect the healthy portions of your colon or rectum. Surgery to create a way for waste to leave your body.",
"Tweet This. Among cancers that affect both men and women, colorectal cancer (cancer of the colon or rectum) is the second leading cause of cancer deaths in the United States. Every year, about 140,000 Americans are diagnosed with colorectal cancer, and more than 50,000 people die from it.",
"Colorectal (Colon) Cancer. Colorectal Cancer Screening Tests. The U.S. Preventive Services Task Force recommends that adults age 50 to 75 be screened for colorectal cancer. The decision to be screened after age 75 should be made on an individual basis. If you are older than 75, ask your doctor if you should be screened.",
"Drugs used to treat colorectal cancer. Some common drugs used for colorectal cancer include: 5-Fluorouracil (5-FU), which is often given with the vitamin-like drug leucovorin (also called folinic acid) or a similar drug called levo-leucovorin, which helps it work better. Capecitabine (Xeloda), which is in pill form.",
"Surgery for early-stage colon cancer. If your colon cancer is very small, your doctor may recommend a minimally invasive approach to surgery, such as: Removing polyps during colonoscopy. If your cancer is small, localized in a polyp and in a very early stage, your doctor may be able to remove it completely during a colonoscopy.",
"Chemotherapy uses drugs to destroy cancer cells. Chemotherapy for colon cancer is usually given after surgery if the cancer has spread to the lymph nodes. In this way, chemotherapy may help reduce the risk of cancer recurrence. Chemotherapy may be used before surgery to shrink the cancer before an operation.",
"Patterns and predictors of colorectal cancer test use in the adult U.S. population. Seeff LC(1), Nadel MR, Klabunde CN, Thompson T, Shapiro JA, Vernon SW, Coates RJ. Author information: (1)Division of Cancer Prevention and Control, Centers for Disease Control and Prevention, Atlanta, Georgia 30341-3717, USA.",
"If you’re 50 years old or older, get screened! Among cancers that affect both men and women, colorectal cancer (cancer of the colon or rectum) is the second leading cause of cancer deaths in the United States. Every year, about 140,000 Americans are diagnosed with colorectal cancer, and more than 50,000 people die from it."
],
"url": [
"https://www.ncbi.nlm.nih.gov/pubmed/15139050",
"https://www.ncbi.nlm.nih.gov/pubmed/15139050",
"http://www.mayoclinic.org/diseases-conditions/colon-cancer/diagnosis-treatment/treatment/txc-20188274",
"https://www.cdc.gov/cancer/dcpc/resources/features/colorectalawareness/index.htm",
"https://www.cdc.gov/cancer/colorectal/basic_info/screening/tests.htm",
"https://www.cancer.org/cancer/colon-rectal-cancer/treating/chemotherapy.html",
"http://www.mayoclinic.org/diseases-conditions/colon-cancer/diagnosis-treatment/treatment/txc-20188274",
"http://www.mayoclinic.org/diseases-conditions/colon-cancer/diagnosis-treatment/treatment/txc-20188274",
"https://www.ncbi.nlm.nih.gov/pubmed/15139050",
"https://www.cdc.gov/cancer/dcpc/resources/features/colorectalawareness/index.htm"
]
} | what colorectal cancer is used for | 598,757 | ENTITY | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Franklin had another son, William (c. 1730-1813), who was born out of wedlock. William Franklin served as the last colonial governor of New Jersey, from 1763 to 1776, and remained loyal to the British during the American Revolution. He died in exile in England.",
"Franklin was born in 1706 at Boston. He was the tenth son of a soap and candlemaker. He received some formal education but was principally self-taught. After serving an apprenticeship to his father between the ages of 10 and 12, he went to work for his half-brother James, a printer. In 1721 the latter founded the New England Courant, the fourth newspaper in the colonies. Benjamin secretly contributed 14 essays to it, his first published writings.",
"Reload the page to try again! Press Cmd-0 to reset your zoom. Press Ctrl-0 to reset your zoom. It looks like your browser might be zoomed in or out. Your browser needs to be zoomed to a normal size to record audio.",
" . Freedom,Independence and a firm league of friendship. Congress could not pass laws to collect tax. The government only had one branch. Divided the territory into smaller territories. The Northwest territory would automatically become a state. The Articles of Confederation kept the US from forming strong trading because Congress could not ...",
"Some delegates thought that a revision would not make the government strong enough by proposing the Virgina and New Jersey Plan.",
"Benjamin Franklin’s Early Years. Benjamin Franklin was born on January 17, 1706, in colonial Boston. His father, Josiah Franklin (1657-1745), a native of England, was a candle and soap maker who married twice and had 17 children.",
"During the years 1757-62 and 1764-75, Franklin resided in England, originally in the capacity of agent for Pennsylvania and later for Georgia, New Jersey, and Massachusetts.",
"In 1723, because of dissension with his half-brother, Franklin moved to Philadelphia, where he obtained employment as a printer. He spent only a year there and then sailed to London for 2 more years. Back in Philadelphia, he rose rapidly in the printing industry.",
"Subsequently, Franklin's defense of the American position in the House of Commons during the debates over the Stamp Act's repeal restored his prestige at home. Franklin returned to Philadelphia in May 1775 and immediately became a distinguished member of the Continental Congress.",
"Introduction. One of the leading figures of early American history, Benjamin Franklin (1706-90) was a statesman, author, publisher, scientist, inventor and diplomat. Born into a Boston family of modest means, Franklin had little formal education."
],
"url": [
"http://www.history.com/topics/american-revolution/benjamin-franklin",
"http://www.let.rug.nl/usa/biographies/benjamin-franklin/a-short-biography.php",
"https://quizlet.com/8775164/ss-chapter-10-flash-cards/",
"https://quizlet.com/8775164/ss-chapter-10-flash-cards/",
"https://quizlet.com/8775164/ss-chapter-10-flash-cards/",
"http://www.history.com/topics/american-revolution/benjamin-franklin",
"http://www.let.rug.nl/usa/biographies/benjamin-franklin/a-short-biography.php",
"http://www.let.rug.nl/usa/biographies/benjamin-franklin/a-short-biography.php",
"http://www.let.rug.nl/usa/biographies/benjamin-franklin/a-short-biography.php",
"http://www.history.com/topics/american-revolution/benjamin-franklin"
]
} | what did ben franklin contribute to new jersey plan | 618,707 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Gastroparesis is a disorder that occurs when the stomach takes too long to empty food. This disorder, also known as delayed gastric emptying, is a result of weak or abnormal muscles in the stomach. There’s no known cure for gastroparesis, but medical treatment can help you manage your symptoms. Advertisement.",
"Symptoms of gastroparesis may include: 1 feeling full very quickly when eating. 2 feeling sick (nausea) and vomiting. 3 loss of appetite. weight 1 loss. bloating. tummy (abdominal) pain or 1 discomfort. heartburn.",
"Related to Digestive Disorders. Gastroparesis. It is possible that the main title of the report Gastroparesis is not the name you expected. Please check the synonyms listing to find the alternate name(s) and disorder subdivision(s) covered by this report.",
"Other symptoms of gastroparesis include. 1 gastroesophageal reflux (GER), also called acid reflux or acid regurgitation—a condition in which stomach contents flow back up into the esophagus, the organ that connects the mouth to the stomach. 2 pain in the stomach area. 3 abdominal bloating. lack of appetite.",
"Regulatory status: Off-label for treating symptoms of gastroparesis. Effectiveness. Five small studies (n=60), 4 of which reported on symptoms as an outcome. Only 1 study found a statistically significant benefit of oral erythromycin on symptoms compared with metoclopramide.",
"Key points from the evidence. Summary. Only 1 small single-blind, crossover study (n=13) identified in a systematic review (5 studies, varying designs, n = 60) found a statistically significant benefit for erythromycin in the short term for improving symptoms of gastroparesis compared with metoclopramide.",
"Gastroparesis is a long-term (chronic) condition where the stomach can't empty itself in the normal way. Food passes through the stomach more slowly than usual. It's thought to be the result of a problem with the nerves and muscles controlling the emptying of the stomach. If these nerves are damaged, the muscles of your stomach may not work properly and the movement of food can slow down. This page covers: Symptoms of gastroparesis.",
"Synonyms. 1 gastropathy. 2 gastroparesis diabeticorum. 3 gastrointestinal autonomic neuropathy. gastric 1 stasis. gastric atony. delayed gastric 1 emptying. gastric dysmotility. severe functional dyspepsia.",
"Other symptoms of gastroparesis include. gastroesophageal reflux (GER), also called acid reflux or acid regurgitation—a condition in which stomach contents flow back up into the esophagus, the organ that connects the mouth to the stomach. pain in the stomach area. abdominal bloating.",
"The most common symptoms of gastroparesis are nausea, a feeling of fullness after eating only a small amount of food, and vomiting undigested food— sometimes several hours after a meal. Other common symptoms include gastroesophageal reflux (GER), pain in the stomach area, abdominal bloating, and lack of appetite."
],
"url": [
"http://www.healthline.com/health/gastroparesis",
"http://www.nhs.uk/conditions/gastroparesis/Pages/Introduction.aspx",
"http://www.webmd.com/digestive-disorders/gastroparesis",
"https://www.niddk.nih.gov/health-information/digestive-diseases/gastroparesis",
"https://www.nice.org.uk/advice/esuom13/chapter/key-points-from-the-evidence",
"https://www.nice.org.uk/advice/esuom13/chapter/key-points-from-the-evidence",
"http://www.nhs.uk/conditions/gastroparesis/Pages/Introduction.aspx",
"http://www.webmd.com/digestive-disorders/gastroparesis",
"https://www.niddk.nih.gov/health-information/digestive-diseases/gastroparesis",
"https://www.niddk.nih.gov/health-information/digestive-diseases/gastroparesis"
]
} | symptoms of gastroparesis in adults | 507,690 | ENTITY | [] |
[
"The list of of foods that don't contain carbohydrates are meats, oils, animal fats, salt, eggs, beef, veal, pork, poultry and seafood."
] | {
"is_selected": [
0,
1,
1,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Foods that dont contain carbs - What foods contain comlex carbs and is good for sporting like mountain biking? Before and during training? Complex carbs. Carbs can be simple (containing 1 or 2 sugars) or complex (containing 3 or more sugars). Simple carbs are like table sugar, syrups, fruits like bananas, mangos, etc. Complex carbs are like legumes, starchy vegetables like yams, whole grains like brown rice, quinoa, whole grain breads & other cereals.",
"According to LoveToKnow, some of the foods that do not contain carbohydrates include naturally-occurring meats, oils, animal fats and salt. Butter is the only dairy product that does not contain any...",
"Meats and Eggs. Most meats and eggs are carbohydrate free. Choose from beef, veal, pork, poultry, seafood, game meats and organ meats. Just because a food has zero carbs, doesn't automatically mean that it's healthy. Choose lean cuts of meat that have 7 grams of saturated fat or less.",
"According to LoveToKnow, some of the foods that do not contain carbohydrates include naturally-occurring meats, oils, animal fats and salt. Butter is the only dairy product that does not contain any carbohydrates. LoveToKnow explains that naturally-occurring meats, such as beef, chicken, turkey, duck, goose and lamb, do not contain carbs.",
"Veggies and nuts: Veggies except porato and cirn, nuts, wild fish, beans, seeds are all low carb. Don't obsess on avoiding any healthy non-processed foods. Avoid fried foods, sweetened food, or any food that barely resembles the natural ingredients from which it originally started. Eat whole grains, fruits, and other healthy carbs. ...Read more",
"Other types of oils that do not have carbohydrates include fish oils, lard and other forms of animal fats. Dairy products, such as heavy cream and fatty cheeses, usually contain very few carbohydrates.LoveToKnow states that looking for foods that contain zero carbohydrates is easy.",
"Complex carbs: Carbs can be simple (containing 1 or 2 sugars) or complex (containing 3 or more sugars). Simple carbs are like table sugar, syrups, fruits like bananas, mangos, etc. Complex carbs are like legumes, starchy vegetables like yams, whole grains like brown rice, quinoa, whole grain breads & ...Read more.",
"Other types of oils that do not have carbohydrates include fish oils, lard and other forms of animal fats. Dairy products, such as heavy cream and fatty cheeses, usually contain very few carbohydrates. LoveToKnow states that looking for foods that contain zero carbohydrates is easy.",
"Multiple: It's not advisable to avoid foods with carbohydrates as they often contain multiple sources of vitamins, minerals, and fiber. These are vegetables, fruits, breads, and cereals. The only other food groups are proteins and fats and, while important in a balanced diet, should not be eaten exclusively. ...Read more",
"You can also spice up your foods with seasonings or herbs like cinnamon, garlic, lemon pepper and cayenne pepper. Skip condiments like ketchup and barbecue sauce if you are trying to go carb free. Barbecue sauce can contain as many as 6 grams of carbohydrates per serving."
],
"url": [
"https://www.healthtap.com/topics/foods-that-dont-contain-carbs",
"https://www.reference.com/health/foods-contain-carbs-c4f166c19fed48d2",
"http://healthyeating.sfgate.com/five-foods-zero-carbohydrates-9452.html",
"https://www.reference.com/health/foods-contain-carbs-c4f166c19fed48d2",
"https://www.healthtap.com/topics/foods-that-dont-contain-carbs",
"https://www.reference.com/health/foods-contain-carbs-c4f166c19fed48d2",
"https://www.healthtap.com/topics/foods-that-dont-contain-carbs",
"https://www.reference.com/health/foods-contain-carbs-c4f166c19fed48d2",
"https://www.healthtap.com/topics/foods-that-dont-contain-carbs",
"http://healthyeating.sfgate.com/five-foods-zero-carbohydrates-9452.html"
]
} | list of foods that don't contain carbohydrates | 1,174,090 | ENTITY | [] |
[
"Define how one can carry a weapon and legally protect themselves."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Deadly Force – Issues to Consider. The Second Amendment to the U.S. Constitution protects the rights of the people to keep and bear arms. The laws of the State of Washington define how one can carry a weapon and legally protect themselves. While the right to keep and bear arms and the laws pertaining to use of force reside in separate documents, they are closely intertwined on issues of deadly force. The instrument of deadly force is not limited to a firearm and can be anything, including someone’s bare hands.",
"Use of deadly force on private property in WA state? Where can I find Washington state's laws on the use of deadly force on private property? I'm interested in how much force I can use on a burglar or something I think broke into my house to harm me. Are you sure you want to delete this answer?",
"(2) In considering whether to use deadly force under subsection (1)(c) of this section, to arrest or apprehend any person for the commission of any crime, the peace officer must have probable cause to believe that the suspect, if not apprehended, poses a threat of serious physical harm to the officer or a threat of serious physical harm to others.",
"(2) When a person charged with a crime listed in subsection (1) of this section is found not guilty by reason of self-defense, the state of Washington shall reimburse the defendant for all reasonable costs, including loss of time, legal fees incurred, and other expenses involved in his or her defense.",
"(4) Whenever the issue of self-defense under this section is decided by a judge, the judge shall consider the same questions as must be answered in the special verdict under subsection (4) [(5)] of this section.",
"(5) Whenever the issue of self-defense under this section has been submitted to a jury, and the jury has found the defendant not guilty, the court shall instruct the jury to return a special verdict in substantially the following form:",
"(4) This section shall not be construed as: (a) Affecting the permissible use of force by a person acting under the authority of RCW 9A.16.020 or 9A.16.050; or. (b) Preventing a law enforcement agency from adopting standards pertaining to its use of deadly force that are more restrictive than this section.",
"Justifiable homicide or use of deadly force by public officer, peace officer, person aiding. (1) Homicide or the use of deadly force is justifiable in the following cases: (a) When a public officer is acting in obedience to the judgment of a competent court; or.",
"Justifiable homicide or use of deadly force by public officer, peace officer, person aiding. (b) When necessarily used by a peace officer to overcome actual resistance to the execution of the legal process, mandate, or order of a court or officer, or in the discharge of a legal duty.",
"Rating Newest Oldest. Best Answer: first a disclaimer ... I'm NOT an Attorney.. here are the laws regarding the use of Deadly force in Washington State they can be found on the WA State Legislative website www.leg.wa.gov."
],
"url": [
"http://lewiscountywa.gov/sheriff/information-on-use-of-deadly-force",
"https://answers.yahoo.com/question/index?qid=20080701093333AApPiab",
"http://apps.leg.wa.gov/rcw/default.aspx?cite=9A.16.040",
"http://app.leg.wa.gov/rcw/default.aspx?cite=9A.16.110",
"http://app.leg.wa.gov/rcw/default.aspx?cite=9A.16.110",
"http://app.leg.wa.gov/rcw/default.aspx?cite=9A.16.110",
"http://apps.leg.wa.gov/rcw/default.aspx?cite=9A.16.040",
"http://apps.leg.wa.gov/rcw/default.aspx?cite=9A.16.040",
"http://apps.leg.wa.gov/rcw/default.aspx?cite=9A.16.040",
"https://answers.yahoo.com/question/index?qid=20080701093333AApPiab"
]
} | washington deadly force laws | 541,360 | DESCRIPTION | [
"Washington deadly force laws is how one can carry a weapon and legally protect themselves."
] |
[
"'tho' is an an abbreviation of the word 'though', which in turn is an abbreviation of 'although' which means, 'as an alternative'."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Best Answer: 'tho' is an an abbreviation of the word 'though', which in turn is an abbreviation of 'although' ~ which means, 'as an alternative' ~ as in 'another ...",
"Popularity Rank 1 : Tho name was top ranked at 802 position in Australian during year 1998and most recently ranked at 802 position in Australian during year 1998. 2 Name Tho has been Rare throughout the last hundred plus years and ranked at 52104 position. 46 numbers of people were named Tho so far in last 100 years.",
"People with name Tho have leadership qualities. They act in a manner that they receive accolade. They are domineering & pushy. They have inordinate self-esteem. Person with Tho having 1 as Personality number are independent & are not afraid of exploring new avenues.",
"All Acronyms. THO [Internet]; Jan 14, 2018 [cited 2018 Jan 14]. Available from: http://www.allacronyms.com/THO. MHRA 'THO', All Acronyms, 14 January 2018, <http://www.allacronyms.com/THO> [accessed 14 January 2018] Bluebook All Acronyms, THO (Jan. 14, 2018, 2:01 AM), available at http://www.allacronyms.com/THO. CSE All Acronyms. THO [Internet]; January 14, 2018 [cited 2018 JAN 14]. Available from: http://www.allacronyms.com/THO.",
"Best Answer: 'tho' is an an abbreviation of the word 'though', which in turn is an abbreviation of 'although' ~ which means, 'as an alternative' ~ as in 'another way of looking at something'. To me its usage is lazy ....unless you are learning / practising or needing 'shorthand'. Sash.",
"1 Upload failed. 2 We are experiencing some problems, please try again. 3 You can only upload files of type PNG, JPG, or JPEG. 4 You can only upload files of type 3GP, 3GPP, MP4, MOV, AVI, MPG, MPEG, or RM. 5 You can only upload photos smaller than 5 MB. 6 You can only upload videos smaller than 600MB.",
"All Acronyms. tho. [Internet]; Jan 18, 2018 [cited 2018 Jan 18]. Available from: http://www.allacronyms.com/THO./Texting. MHRA 'tho.', All Acronyms, 18 January 2018, <http://www.allacronyms.com/THO./Texting> [accessed 18 January 2018] Bluebook All Acronyms, tho. (Jan. 18, 2018, 9:01 AM), available at http://www.allacronyms.com/THO./Texting. CSE All Acronyms. tho. [Internet]; January 18, 2018 [cited 2018 JAN 18]. Available from: http://www.allacronyms.com/THO./Texting.",
"30 meanings of THO acronym and THO abbreviation. Get the definition of THO by All Acronyms dictionary. Top Definition: Though",
"What exactly does it mean for our lives to have meaning? Dog Section: FUN question, let's see those mean faces? When did nodding your head come to mean yes and...? More questions If it is generally agreed that humans are naturally inquisitive and search for truth meaning and",
"1 meanings of THO. acronym and THO. abbreviation in Texting. Get the definition of THO. in Texting by All Acronyms dictionary. Top Definition: Though In Texting."
],
"url": [
"https://answers.yahoo.com/question/index?qid=20080319053426AAOIo57",
"http://www.babynology.com/name/tho-m.html",
"http://www.babynology.com/name/tho-m.html",
"https://www.allacronyms.com/THO",
"https://answers.yahoo.com/question/index?qid=20080319053426AAOIo57",
"https://answers.yahoo.com/question/index?qid=20080319053426AAOIo57",
"https://www.allacronyms.com/THO./Texting",
"https://www.allacronyms.com/THO",
"https://answers.yahoo.com/question/index?qid=20080319053426AAOIo57",
"https://www.allacronyms.com/THO./Texting"
]
} | what does tho mean | 653,835 | DESCRIPTION | [] |
[
"City College"
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"Private colleges and universities: 1 Academy of Art University. 2 Alliant International University, formerly California School of Professional Psychology. 3 Art Institute of California-San Francisco, a private campus which focuses on video game and design (interior, fashion etc.) based education.",
"Kids Free. The University of San Francisco's main campus is about two miles west of downtown San Francisco. The campus lies near the northeast corner of Golden Gate Park. The closest hotel to the university is south of the campus. Other hotels are located on the northeast to the southeast side of the campus, closer to downtown.",
"Select the checkboxes in each category to toggle the markers on or off the map. To view a list of locations in each category, click on the gray category name in the left menu. To view each location details, click on the green link in the left menu or on the marker within the map. Download the USF campus map.",
"Read More. Hide. Marvel at the sights, revel in the sounds, and soak up the local atmosphere: When you book a room at the best San Francisco hotels near San Francisco State University, you’ll be in the top spot to do it all.",
"Major cities near University of San Francisco. This is a list of large cities closest to University of San Francisco. A big city usually has a population of at least 200,000 and you can often fly into a major airport. If you need to book a flight, search for the nearest airport to University of San Francisco. 1 2 miles to San Francisco, CA. 2 10 miles to Oakland, CA. 3 30 miles to Fremont, CA. 4 43 miles to San Jose, CA. 5 64 miles to Stockton, CA. 6 76 miles to Sacramento, CA.",
"1 University of California, San Francisco, primarily a graduate level health-sciences school, located in the Parnassus Heights/ Inner Sunset neighborhood and in Mission Bay. 2 University of California, Hastings College of the Law located downtown at its Civic Center.",
"Browse Expedia’s selection and check out the best hotels close to San Francisco State University for the world-class spas and restaurants, or snatch up one of the cheap hotel deals near San Francisco State University, if you’re searching for an inexpensive retreat.",
"5.97 mi from San Francisco State University.  .  . 3.9 out of 5 (3,334 reviews). Union Square...Convenient to shopping & restaurant. Rooms are small. Nice Hotel Overall. --------------------------------------------------------------------------------------------------------------------------------.",
"Despite its limited geographical space, San Francisco, California is home to a multitude of colleges and universities. Public colleges and universities include: 1 City College of San Francisco, one of the largest community colleges in the country is located in the Ingleside, with several extension campuses.",
"Map of hotel and USF-University of San Francisco. Smoke-free hotel-pet friendly. Free Internet in room. Most Recent Guest Review. I got a room upgrade and was on the 25th floor."
],
"url": [
"https://en.wikipedia.org/wiki/List_of_colleges_and_universities_in_San_Francisco",
"http://hotelguides.com/colleges/california/university-san-francisco.html",
"https://www.usfca.edu/directions/campus-map",
"https://www.expedia.com/San-Francisco-State-University-Hotels.0-l502583-0.Travel-Guide-Filter-Hotels",
"http://www.travelmath.com/cities-near/University+of+San+Francisco",
"https://en.wikipedia.org/wiki/List_of_colleges_and_universities_in_San_Francisco",
"https://www.expedia.com/San-Francisco-State-University-Hotels.0-l502583-0.Travel-Guide-Filter-Hotels",
"https://www.expedia.com/San-Francisco-State-University-Hotels.0-l502583-0.Travel-Guide-Filter-Hotels",
"https://en.wikipedia.org/wiki/List_of_colleges_and_universities_in_San_Francisco",
"http://hotelguides.com/colleges/california/university-san-francisco.html"
]
} | what college is closest to san francisco university | 597,095 | PERSON | [] |
[
"Yes,it is name."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0
],
"passage_text": [
"[ 2 syll. fer-ney, fe-rn-ey ] The baby girl name Ferney is pronounced as FER-Niy- †. Ferney is mainly used in English and its language of origin is also English. Ferney is a variant form of the English name Fern. Ferney is not popular as a baby girl name. It is not in the top 1000 names. Baby names that sound like Ferney include Ferni, Faran, Faren, Farin, Faron, Farran, Farren, Farrin, Farron, Farryn, Faryn, Fernand, Fernande, Ferran, Ferryn, Frannie (English), Franny (English), Frumah (Yiddish), Fyrne, and Fabrienne.",
"Popularity of the Name. The name Ferney is ranked on the 63,049th position of the most used names. It means that this name is rarely used. We estimate that there are at least 1900 persons in the world having this name which is around 0.001% of the population. The name Ferney has six characters.",
"Ferney was first noted in 14th-century Burgundian registers as Fernex.. Four centuries later, however, Voltaire changed the x to a y due to the excessive number of towns in the region with names ending in x, such as Maconnex, Saconnex, Gex, Versonnex, Ornex. During Voltaire's reign over Ferney in the second part of the 18th century, the town saw rapid expansion.",
"Ferney-Voltaire is a commune in the Ain department in eastern France. It lies between the Jura mountains and the Swiss border and forms part of the metropolitan area of Geneva.",
"Ferney Park. Ferney Park is a football stadium in Ballinamallard, County Fermanagh, Northern Ireland. It is the home stadium of Ballinamallard United. It was first used by Ballinamallard United in 1975, when the club was founded.",
"Popularity of the Name. The name Fernie is ranked on the 18,603rd position of the most used names. It means that this name is rarely used. We estimate that there are at least 11600 persons in the world having this name which is around 0.001% of the population. The name Fernie has six characters."
],
"url": [
"http://www.babynamespedia.com/meaning/Ferney",
"https://themeaningofthename.com/ferney/",
"https://en.wikipedia.org/wiki/Ferney-Voltaire",
"https://en.wikipedia.org/wiki/Ferney-Voltaire",
"https://en.wikipedia.org/wiki/Ferney_Park",
"https://themeaningofthename.com/fernie/"
]
} | is ferney a name | 410,041 | DESCRIPTION | [] |
[
"Wound specialist"
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Tweet. Wound specialists are health care professionals who have been trained in the care and treatment of all types of wounds, acute and chronic. Among the most commonly treated wounds are those sustained from an acute injury, surgical wounds, diabetic wounds and pressure sores. Additionally, health care professionals are needed to help the estimated 5 million Americans who suffer from wounds that will not heal.",
"70 Practical Plastic Surgery for Nonsurgeons. Care of the External Wound The amount of injury at the entrance and exit (if present) sites is relatedto the caliber of the bullet, the angle at which the bullet traverses the tis-sues, the distance from the gun, and even the type of bullet.",
"Wound care professionals are usually called to care when it has been determined that the wound in question is not healing the way it should. Care in the context of to care for is defined as take thought for, provide for, look after.. In general, the word care means a lot more than looking after.",
"The collagen becomes more organized to make the tissue stronger. At this stage, the wound can resist normal stress, but is still not as strong as uninjured skin. Finally, new skin cells are produced across the surface of the wound, restoring the protective barrier between the body and the environment. This phase begins with the injury itself. The wound may bleed, the blood vessels narrow, clots form and various chemicals are released to begin the healing process. Specialized cells clear the wound of debris over the course of several days. New skin cells and blood vessels form.",
"The evaluation for underlying injury related to gun-shot wounds in an extremity also is discussed. A plastic surgeon isoften called to help manage such injuries.The evaluation of a patient with chest, abdomen, or head/neck gun-shot wounds is beyond the scope of this text.",
"From the same eDoctors team that brings you VeinDirectory, VEIN magazine and WoundCareCenters, we proudly introduce Wound Care Therapies.",
"68 Practical Plastic Surgery for Nonsurgeons Radiographs Especially when the gunshot wound is in an extremity, a radiograph isindicated to rule out an underlying fracture and to determine whetherthe bullet remains in the tissues.",
"Choosing the right doctor. In this age of specialization, it is wise to find a doctor with appropriate credentials, and expertise in the areas of your interest. The objective is to find a doctor who is technically up to date, and who cares about your suffering and the suffering of your family. If the doctor does not have special expertise and appropriate credentials in head injury, find someone who does.",
"Doctors also attain certification through the American Academy of Wound Management to become a Certified Wound Specialist Physician (CWSP). A primary care physician is often the referring doctor and is instrumental in coordinating communication and therapy among the team of wound care specialists.",
"You will want to find someone who will trust you and help you to identify and manage your own impairments. Not every doctor is willing to allow you this kind of freedom and support. Before anything else is settled, tell the doctor specifically what you want. If the doctor is unwilling to cooperate with you, keep looking until you find the right one for you."
],
"url": [
"http://www.woundcarecenters.org/article/living-with-wounds/wound-specialists-how-they-are-different",
"http://practicalplasticsurgery.org/docs/Practical_07.pdf",
"http://floridawoundcaredoctors.com/wound%20care.html",
"http://floridawoundcaredoctors.com/wound%20care.html",
"http://practicalplasticsurgery.org/docs/Practical_07.pdf",
"http://www.woundcarecenters.org/#!",
"http://practicalplasticsurgery.org/docs/Practical_07.pdf",
"http://www.headinjury.com/doctorfind.htm",
"http://www.woundcarecenters.org/article/living-with-wounds/wound-specialists-how-they-are-different",
"http://www.headinjury.com/doctorfind.htm"
]
} | .what is a doctor called that deals in wounds? | 411 | PERSON | [
"A doctor that deals in wounds is called wound specialist."
] |
[
"386 calories per 100g (1cut)."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"Pork jowl is a different cut (it comes from the jowl - the piggie's double chin), but it's just as delicious as the belly! It's even fattier, though. 1 ounce belly has 147 calories, 15 grams fat, 3 grams protein. 1 ounce jowl has 185 calories, 20 grams fat, 2 grams protein.",
"Pork belly is high in fat and calories, so make it as a special-occasion dish and avoid putting it on your menu on a regular basis. Each ounce of pork belly contains 145 calories, but a recommended serving of meat is 3 ounces, making a total of 435 calories. Dietary guidelines are based on maintaining weight on a typical 2,000-calorie diet for the average person, but daily caloric needs vary depending on gender, age and level of physical activity.",
"Calories per Ingredient. Here are the foods from our food nutrition database that were used for the nutrition calculations of this recipe. Calories per serving of Braised Pork Belly. 468 calories of Pork Belly, (3.20 oz) 80 calories of Fortune Fried Tofu - 5 Pouches, (0.80 oz) 78 calories of Hard Boiled Egg, (1 large)",
"Name Brand - Roasted Pork Belly (Cooked) *Percent Daily Values are based on a 2000 calorie diet. Your daily values may be higher or lower depending on your calorie needs.",
"Calories in belly pork. I'm trying to closely monitor my intake and keep an eye on what I'm eating. I used ************, but there was too much missing info, so I've gone back to the USDA database which while it has a smaller list, is comprehensive. However, I'm getting very contradictory results for belly pork from a variety of sources.",
"There are 661 calories in 1 serving of Korean Pork Belly Barbecue. Calorie breakdown: 78% fat, 1% carbs, 21% protein.",
"* Percent Daily Values are based on a 2,000 calorie diet. Your daily values may be higher or lower depending on your calorie needs.",
"There are 14.8 grams of fat in an ounce of pork belly before it is cooked, which is 23 percent of your recommended daily total intake of fat. Of that total fat content, 5.4 grams consist of saturated fat, which is 27 percent of your recommended daily intake.",
"The calories in Pork Belly per 100g(1cut ) is 386 calories. Pork Belly is calculated to be 386Cal per 100 grams making 80Cal equivalent to 20.73g with 34.6g of mostly fat、14.2g of protein、0.1g of carbohydrates in 100g while being rich in vitamins and minerals such as Vitamin B1 and Niacin. Basic Nutrition. Fatty Acids.",
"Generic - Pork Belly, Lean and Fat, Cooked. *Percent Daily Values are based on a 2000 calorie diet. Your daily values may be higher or lower depending on your calorie needs."
],
"url": [
"http://lowcarbfriends.com/bbs/showthread.php?t=764189",
"http://www.livestrong.com/article/554723-how-fattening-is-pork-belly/",
"https://recipes.sparkpeople.com/recipe-calories.asp?recipe=2014816",
"http://www.myfitnesspal.com/food/calories/name-brand-roasted-pork-belly-cooked-367071214?v2=false",
"http://lowcarbfriends.com/bbs/showthread.php?t=764189",
"https://www.fatsecret.com/calories-nutrition/generic/korean-pork-belly-barbecue",
"https://www.fitbit.com/foods/Pork+Belly+Raw/10828",
"http://www.livestrong.com/article/554723-how-fattening-is-pork-belly/",
"http://slism.com/calorie/111129/",
"http://www.myfitnesspal.com/food/calories/generic-pork-belly-lean-and-fat-cooked-296099476?v2=false"
]
} | calories in pork belly | 60,772 | NUMERIC | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Wiktionary (0.00 / 0 votes) Rate this definition: carbonation (Noun). The state of having carbon dioxide gas dissolved in a liquid. Soda pop is basically sugar water with a little bit of flavoring and added carbonation. carbonation (Noun). The amount or level of dissolved carbon dioxide remaining in solution.",
"Carbonation is the process of dissolving carbon dioxide in liquid. The process usually involves carbon dioxide under high pressure. When the pressure is reduced, the carbon dioxide is released from the solution as small bubbles, which causes the solution to fizz. This effect is seen in carbonated soft drinks.",
"For the music venue in Montreal, see Club Soda (Montreal) . A glass of sparkling water. Carbonated water (also known as club soda, soda water, sparkling water, seltzer water, or fizzy water) is water into which carbon dioxide gas under pressure has been dissolved. Some of these have additives such as sodium (seltzer water is almost always composed of water and carbon dioxide with no other additives).",
"carbonated drink. A UK term of art for a carbonated beverage available for purchase in 170 cc to 2-litre cans or bottles in developed countries as well as the United States, which have been targeted as a major culprit in the rise of obesity worldwide due to generally high sugar content.",
"THE SURVEY. Name and email address are optional. Hometown and state/province are also optional, but strongly encouraged. However, a valid zip or postal code is critical, because our software uses a database of zip codes and their latitudes and longitudes to plot the data on the map. Currently the project is limited to English-speaking North America.",
"Carbonated water is a diluent mixed with alcoholic beverages where it is used to top-off the drink and provide a degree of 'fizz'. Adding soda water to 'short' drinks such as spirits dilutes them and makes them 'long' not to be confused with long drinks such as those made with vermouth.",
"› a drink of any type: Hot beverages include tea, coffee, and hot chocolate. We do not sell alcoholic beverages. (Definition of beverage from the Cambridge Advanced Learner’s Dictionary & Thesaurus © Cambridge University Press).",
"ABOUT. The Pop vs Soda Page is a web-based project to plot the regional variations in the use of the terms Pop and Soda to describe carbonated soft drinks. You can help by filling out the survey!",
"This process, known as carbonation, is a process that causes the water to become effervescent. Most carbonated water is sold in ready to drink bottles as mineral water and carbonated beverages such as soft drinks. However it is rather easy to prepare at home with soda makers.",
"beverage noun [C]. › a drink that is produced to sell to people: the alcoholic beverage, tobacco, and gambling industries The agency regulates and controls the sale of all beverages exceeding 16% alcohol. (Definition of beverage from the Cambridge Business English Dictionary © Cambridge University Press)."
],
"url": [
"http://www.definitions.net/definition/carbonation",
"http://www.definitions.net/definition/carbonation",
"https://en.wikipedia.org/wiki/Carbonated_water",
"http://medical-dictionary.thefreedictionary.com/Carbonated+drink",
"http://popvssoda.com/",
"https://en.wikipedia.org/wiki/Carbonated_water",
"http://dictionary.cambridge.org/dictionary/english/beverage",
"http://popvssoda.com/",
"https://en.wikipedia.org/wiki/Carbonated_water",
"http://dictionary.cambridge.org/dictionary/english/beverage"
]
} | what is carbonated beverage mean | 727,781 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"A seller's permit also allows you to issue a resale certificate to your suppliers when making purchases for resale. Issuing a resale certificate allows you to purchase items that you intend to sell without payment of tax. As a construction contractor, you are not required to hold a seller's permit if:",
"The maximum interest the law allows an individual to collect on a tax certificate is 18% per annum, simple interest. minimum interest received by the purchaser is 5% unless bid at zero [Florida Statutes 197.472(2)]. at zero percent, no interest will ever be paid on the face amount. issue date.",
"What is a 'Tax Lien Certificate'. A tax lien certificate is a certificate of claim against a property that has a lien placed upon it as a result of unpaid property taxes. Tax lien certificates are generally sold to investors through an auction process.",
"The successful bidder must pay, in addition to the bid amount, a county transfer tax of $0.55 per $500 of the sale price. There is a one-year statute of limitations to bring an action to overturn a tax sale. Title companies will generally not issue title insurance until after the statute of limitations has expired.",
"Tax Lien Foreclosure The sale of a property resulting from the property owner's failure ... Lien The legal right of a creditor to sell the collateral property ... Federal Tax Lien A federally authorized lien against any and all assets of a taxpayer ... Prior Lien A lien that is recorded prior to any other claims.",
"All vendors wishing to participate in the competitive bid process and. receive purchase orders from the State of West Virginia exceeding $2,500 in aggregate across all state agencies. are required to complete the Vendor Registration and Disclosure Statement (WV‐1 form) and pay a $125.00. annual fee.",
"The maximum interest the law allows an individual to collect on a tax certificate is 18% per annum, simple interest. The. minimum interest received by the purchaser is 5% unless bid at zero [Florida Statutes 197.472(2)]. On certificates issued. at zero percent, no interest will ever be paid on the face amount.",
"The owner of a tax-defaulted property has the right to redeem the property up until 5:00 p.m. or the close of business on the last business day prior to the tax sale. The minimum bid amount set by law is the amount to redeem the property plus the costs incurred by the county.",
"CERTIFICATION APPLICATION. Before a vendor is eligible to sell goods and/or services to the State of West Virginia, the West Virginia Code. §5A‐3‐12 requires all vendors to have on file with the West Virginia Purchasing Division a completed Vendor. Registration and Disclosure Statement.",
"Local tax is a portion of the state tax that is allocated to the local city or county. Local tax is part of the overall state rate, and you don't owe anything extra, however, you will need to allocate the local tax on your sales and use tax return based on your job location."
],
"url": [
"https://www.boe.ca.gov/industry/construction.html",
"http://www.brevardtaxcollector.com/wp-content/uploads/TaxSaleBrochure.pdf",
"http://www.investopedia.com/terms/t/taxliencertificate.asp",
"http://www.sco.ca.gov/ardtax_tcs_pubauction_bidderinfo.html",
"http://www.investopedia.com/terms/t/taxliencertificate.asp",
"http://www.state.wv.us/admin/purchase/vrc/wv1.pdf",
"http://www.brevardtaxcollector.com/wp-content/uploads/TaxSaleBrochure.pdf",
"http://www.sco.ca.gov/ardtax_tcs_pubauction_bidderinfo.html",
"http://www.state.wv.us/admin/purchase/vrc/wv1.pdf",
"https://www.boe.ca.gov/industry/construction.html"
]
} | how to gather a bid certificate | 360,467 | DESCRIPTION | [] |
[
"In the freezer they’ll last 1-2 months."
] | {
"is_selected": [
0,
0,
0,
0,
1,
0,
0,
0,
0,
0
],
"passage_text": [
"Sealed, prepackaged, fresh pork cuts can be kept in the refrigerator 2 to 4 days; sealed ground pork will keep in the refrigerator for 1 to 2 days. If you do plan on keeping fresh pork longer than 2 to 3 days before cooking it, store it well-wrapped in the freezer.",
"Red meat and pork can remain in the refrigerator up to 5 days and can be frozen for 4-12 months. Leftover cooked meat will last 3-4 days in the refrigerator and 2-6 months in the freezer. Ground meats (beef, veal, pork, or poultry) can be refrigerated for 1-2 days and frozen for 3-4 months.",
"Ground meats (beef, veal, pork, or poultry) can be refrigerated for 1-2 days and frozen for 3-4 months. Lunchmeats and hot dogs will last two weeks in the refrigerator unopened and should be eaten within 3-5 days of opening (hot dogs can go a couple of days longer).",
"Lunchmeats and hot dogs will last two weeks in the refrigerator unopened and should be eaten within 3-5 days of opening (hot dogs can go a couple of days longer). In the freezer they’ll last 1-2 months. Bacon is safe to eat for up to a week in the fridge—but raw sausage should be eaten within two days.",
"In the freezer they’ll last 1-2 months. Bacon is safe to eat for up to a week in the fridge—but raw sausage should be eaten within two days. Both can be frozen for a month, and some sausage will freeze for twice as long.",
"In the freezer they’ll last 1-2 months. Bacon is safe to eat for up to a week in the fridge—but raw sausage should be eaten within two days. Both can be frozen for a month, and some sausage will freeze for twice as long. Eggs can be refrigerated for up to a month raw but no more than a week hard-boiled.",
"Sealed, pre-packed fresh pork cuts can be kept in the refrigerator 2 to 4 days; sealed ground pork will keep in the refrigerator for 1 to 2 days. If you do plan on keeping the raw, fresh pork longer than 2 to 3 days before cooking it, store it well-wrapped in the freezer.",
"Before you put meat in the freezer, you should always write the date on it -- that way you don't have to question how long it's been frozen. And, believe it or not, some meats can last in the freezer for up to one year. 1 Cooked poultry -- 4 months. 2 Uncooked poultry parts -- 9 months.",
"Before you put meat in the freezer, you should always write the date on it -- that way you don't have to question how long it's been frozen. And, believe it or not, some meats can last in the freezer for up to one year. 1 Cooked poultry -- 4 months. 2 Uncooked poultry parts -- 9 months. 3 Uncooked whole poultry -- 12 months.",
"Sealed, prepackaged, fresh pork cuts can be kept in the refrigerator 2 to 4 days; sealed ground pork will keep in the refrigerator for 1 to 2 days."
],
"url": [
"http://goodnaturepork.com/faqs",
"http://www.rd.com/health/healthy-eating/how-long-can-you-store-meat-in-the-fridge-or-freezer/",
"http://www.rd.com/health/healthy-eating/how-long-can-you-store-meat-in-the-fridge-or-freezer/",
"http://www.rd.com/health/healthy-eating/how-long-can-you-store-meat-in-the-fridge-or-freezer/",
"http://www.rd.com/health/healthy-eating/how-long-can-you-store-meat-in-the-fridge-or-freezer/",
"http://www.rd.com/health/healthy-eating/how-long-can-you-store-meat-in-the-fridge-or-freezer/",
"http://www.porkbeinspired.com/pork-cooking-tips/buying-handling-storing/",
"http://www.huffingtonpost.com/2012/03/20/freezing-meat_n_1367941.html",
"http://www.huffingtonpost.com/2012/03/20/freezing-meat_n_1367941.html",
"http://goodnaturepork.com/faqs"
]
} | how long can you keep pork sausages in the freezer | 243,239 | NUMERIC | [
"You can keep pork sausages for 1 to 2 months in the freezer."
] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"The 2 main cardiovascular causes include CHF and venous insufficiency. Usually, the edema is symmetrical over both ankles in patients with CHF. If CHF patients are bedridden, the edema appears over the sacral area. Edema of venous insufficiency may be associated with hyperpigmentation of the skin due to venous stasis.",
"Alzheimer's disease. a brain disease that cripples the brain's nerve cells over time and destroys memory and learning. It usually starts in late middle age or old age and gets worse over time. Symptoms include loss of memory, confusion, problems in thinking, and changes in language, behavior, and personality.",
"a form of complementary and alternative medicine that involves inserting thin needles through the skin at specific points on the body to control pain and other symptoms.",
"Pallor, as shown below, of the skin and mucous membranes is loss of the normal red or pink hue when a drop in the hemoglobin level occurs to less than 8-10 g/dL. Pallor may be difficult to identify in patients with CHF or subcutaneous edema, low skin blood flow, or dark-colored skin.",
"Knowledge of many of the skin manifestations in the setting of cardiac diseases has become very important and is immensely helpful for proper diagnosis and treatment of patients with cardiovascular disorders. For excellent patient education resources, visit eMedicineHealth's Heart Health Center and Cholesterol Center.",
"For some people, an inability to absorb iron may be the cause. Treatment for iron deficiency anaemia includes adding iron-rich foods to the diet and may also mean taking iron supplements for up to 12 months under medical supervision. Don’t take iron supplements unless advised by your doctor.",
"removal of part or all of a body part, except for organs in the body. It usually takes place during surgery in a hospital operating room. It is done because of injury to the body part or problems from diabetes, hardening of the arteries, or any other illness that impairs blood circulation.",
"a yellowish staining of the skin and whites of the eyes due to increased bilirubin (a bile pigment) levels in the blood. Jaundice can be an indicator of red blood cells rupturing (hemolysis), or disease of the liver or gallbladder.",
"For example, hydrogen, magnesium, lead, and uranium are all chemical elements. Trace elements are chemical elements that are required in very small (trace) amounts in the diet to maintain health. For example, copper, selenium, and iodine are considered trace elements.",
"Histamine is released by immune cells during an allergic reaction and also during infection with viruses that cause the common cold. The interaction of histamine with the mucus membranes of the eyes and nose results in watery eyes and the runny nose often accompanying allergies and colds."
],
"url": [
"http://emedicine.medscape.com/article/1094269-overview",
"https://www.womenshealth.gov/glossary/",
"https://www.womenshealth.gov/glossary/",
"http://emedicine.medscape.com/article/1094269-overview",
"http://emedicine.medscape.com/article/1094269-overview",
"https://www.betterhealth.vic.gov.au/health/conditionsandtreatments/iron-deficiency-adults",
"https://www.womenshealth.gov/glossary/",
"http://lpi.oregonstate.edu/mic/glossary",
"http://lpi.oregonstate.edu/mic/glossary",
"http://lpi.oregonstate.edu/mic/glossary"
]
} | the genetic condition _____ causes decreased absorption of a trace mineral and results in growth failure and red, scaly skin (especially around the scalp, eyes, and feet) in infants. | 516,204 | DESCRIPTION | [] |
[
"Foods to lower cholesterol are Beans, Grains, Soups, Sauces, Oats, quinoa, barley, Oatmeal, salmon, walnuts, almonds and olive oil."
] | {
"is_selected": [
0,
1,
0,
1,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"can improve your cholesterol values. 10 Tips to Help Reduce Your Cholesterol Levels 1. Eat plenty of vegetables and fruits - 7 servings or more each day 2. Eat whole grain foods rich in soluble fibre – oats, psyllium and barley 3. Include 2 Omega 3 rich fish meals per week – salmon, trout, sardines 4.",
"Oatmeal, salmon, walnuts, almonds and olive oil are among the foods used to lower cholesterol, according to Mayo Clinic. Foods containing plant stanols or sterols have also been shown to reduce... Oatmeal, salmon, walnuts, almonds and olive oil are among the foods used to lower cholesterol, according to Mayo Clinic. Foods containing plant stanols or sterols have also been shown to reduce...",
"FOODS TO USE. MEATS, FISH Choose lean meats (chicken, turkey, veal, and nonfatty cuts of beef. with excess fat trimmed). (One serving = 3 oz of cooked meat.) Also, fresh or frozen. fish and canned fish packed in water. Meats and fish should be broiled (pan or oven) or. baked on a rack.",
"Beans, Grains, Soups, and Sauces: Beans and whole grains offer fiber to help lower your cholesterol. Barley; Beans, canned, reduced-sodium: assorted cans of beans such as black, garbanzo, kidney, navy, and pinto; Beans, dried: Choose your favorite beans. Broth, reduced-sodium chicken, beef, or vegetable",
"LOWERING CHOLESTEROL & REVERSING HEART DISEASE: AVOID THE FOLLOWING FOODS! Spices & herbs, no salt added. Look for no salt or sodium in the Ingredients List.",
"LDL CHOLESTEROL. Think—Lazy. Bad LDL cholesterol deposits excess cholesterol and fat molecules into your blood (rather than to your liver), leading it to build up in your arteries. When your arteries become blocked—what's known as atherosclerosis—it puts you at higher risk for heart attacks and stroke.",
"Saturated fat and cholesterol in the food you eat make your blood cholesterol level go up. Saturated fat is the main culprit, but cholesterol in foods also matters. Reducing the amount of. saturated fat and cholesterol in your diet helps lower your blood cholesterol level.",
"The reverse is true, too — changing what foods you eat can lower your cholesterol and improve the armada of fats floating through your bloodstream. Doing this requires a two-pronged strategy: Add foods that lower LDL, the harmful cholesterol-carrying particle that contributes to artery-clogging atherosclerosis. At the same time, cut back on foods that boost LDL.",
"Naturally cholesterol-free and low-fat, fruits and vegetables are the foundation of a good diet. Whole grains: Oats, quinoa, barley, and whole wheat offer up fiber, complex carbohydrates, and protein.",
"got 10 cholesterol-lowering foods you should grab next time you're at the grocery store. Bonus: Lowering your bad (LDL) cholesterol can make your RealAge 3.3 years younger if you're a man, 0.6 years younger if you're a woman! Almonds Almonds are pretty hardworking nuts when it comes to lowering your cholesterol. First,"
],
"url": [
"http://cvtoolbox.com/downloads/diets/high_cholesterol_eating_plan_2010.pdf",
"https://www.reference.com/health/foods-lower-cholesterol-1fbca9da6879bde9",
"http://yourdockares.com/Forms/low_cholesterol_guidelines.pdf",
"https://www.webmd.com/cholesterol-management/heart-healthy-kitchen",
"https://www.pritikin.com/pdf/2015/shopping-list-for-lowering-high-cholesterol.pdf",
"http://www.eatthis.com/foods-to-lower-cholesterol/",
"http://www.nhlbi.nih.gov/files/docs/public/heart/wyntk.pdf",
"https://www.health.harvard.edu/heart-health/11-foods-that-lower-cholesterol",
"https://www.webmd.com/cholesterol-management/heart-health-foods-to-buy-foods-to-avoid",
"https://www.palmbeachstate.edu/wellnesscenter/Documents/lake_worth/foodstolowercholesterol.pdf"
]
} | list of foods to lower cholesterol pdf | 1,174,089 | ENTITY | [] |
[
"The Jive label cd is you are by charlie wilson on."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
1
],
"passage_text": [
"You Are CD music Product Description You Are album for sale by Charlie Wilson was released Oct 12, 2010 on the Jive label. You Are CD music contains a single disc with 1 songs.",
"You Are CD music Charlie, you killin' me! Glad to see you back on top! Always loved your voice my brotha! -Listen Y'all, This track is HOTT!!! Did I hear Face and Fox holdin' you down on backgrounds?!?!! AND Did I hear a B3! -Listen to that organ y'all!!! This joint is SYCK!!! By studio325west (Philadelphia, PA)",
"2 days ago. Turn up the volume, close your eyes, and let the music take over your soul https://t.co/VGEAwiYgcu. 3 days ago. Sometimes a little dancing is all you need to get through the day https://t.co/tZqAawnF2L.",
"Charlie Wilson's official music video for 'You Are'. Click to listen to Charlie Wilson on Spotify: http://smarturl.it/CharWSpot?IQid=Cha... As featured on Just Charlie. Click to buy the track or album via iTunes: http://smarturl.it/CharWJCiTunes?IQid... Google Play: http://smarturl.it/CharWURplay?IQid=C...",
"Charlie Wilson - You Are music MP3 album at CD Universe, enjoy top rated service and worldwide shipping.",
"Charlie Wilson's official music video for 'You Are'. Click to listen to Charlie Wilson on Spotify: http://smarturl.it/CharWSpot?IQid=CharWUR As featured on J... Skip navigation",
"Read news and listen to new music from Charlie Wilson. Charlie Wilson new songs, news, editorials, and albums on DJBooth. Read news and listen to new music from Charlie Wilson.",
"Feelin’ blessed right now! Thank you for all of the support🙏 https://t.co/e2HN6gzZba",
"Today marks the 5th anniversary of my album ‘Love, Charlie’! Thank you everyone who’s continued to support me all t… https://t.co/lM81T3XQxq",
"You Are CD music Product Description. You Are album for sale by Charlie Wilson was released Oct 12, 2010 on the Jive label. You Are CD music contains a single disc with 1 songs. Charlie Wilson - You Are Album Track Listing"
],
"url": [
"http://www.cduniverse.com/productinfo.asp?pid=8348649",
"http://www.cduniverse.com/productinfo.asp?pid=8348649",
"http://www.charliewilsonmusic.com/music/",
"https://www.youtube.com/watch?v=nOcBMh3p-AM",
"http://www.cduniverse.com/productinfo.asp?pid=8348649",
"https://www.youtube.com/watch?v=nOcBMh3p-AM",
"http://djbooth.net/artists/charlie-wilson",
"http://www.charliewilsonmusic.com/music/",
"http://www.charliewilsonmusic.com/music/",
"http://www.cduniverse.com/productinfo.asp?pid=8348649"
]
} | what cd is you are by charlie wilson on | 594,034 | ENTITY | [] |
[
"First two stages."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Transmission of the bacteria usually occurs during vaginal, anal, or oral sex. The syphilis bacteria are passed from person to person through direct contact with: The open sore (chancre) that appears during the primary stage.",
"An incubation period is the time between exposure to a disease and the first symptom. A skin sore called a chancre is usually the first symptom of sexually transmitted syphilis. A chancre appears between 3 weeks to 3 months after a person has been infected with syphilis.",
"The last stage of infection is tertiary syphilis. Approximately 15 to 30 percent of people who don’t receive treatment for syphilis will enter this stage. Tertiary syphilis can occur years or decades after you’re initially infected. Tertiary syphilis can be life-threatening.",
"Transmission of the bacteria usually occurs during vaginal, anal, or oral sex. 1 The open sore (chancre) that appears during the primary stage. Mucous membrane or other sores during the secondary stage and sometimes during the latent stage.",
"A pregnant woman with syphilis can pass the infection through the placenta and infect her baby any time during pregnancy or delivery (congenital syphilis). Syphilis cannot be spread through casual contact with toilet seats, door knobs, swimming pools, hot tubs, bathtubs, shared clothing, or eating utensils.",
"Syphilis is most infectious in the first two stages. When syphilis is in the hidden, or latent, stage, the disease remains active but often with no symptoms and is not contagious to others. Tertiary syphilis is the most destructive to your health.",
"Syphilis is a sexually transmitted infection caused by a type of bacteria known as Treponema pallidum. According to the Centers for Disease Control and Prevention (CDC), in 2013, more than 56,400 cases of syphilis were reported in the United States.",
"The primary stage of syphilis occurs about three to four weeks after you’re infected with the bacteria. It begins with a small, round sore called a chancre. A chancre is painless, but it’s highly infectious.",
"A person with syphilis can easily pass the infection (is contagious) to physically intimate partners when primary- or secondary-stage sores are present. But the person may be contagious for years, off and on, and is always contagious whenever an open sore or skin rash from syphilis is present.",
"A diagnosis of an STD implies that the individual engaged in unprotected sexual intercourse. Several STDs are largely asymptomatic, so it is wise to test for a variety of typical STDs when the patient admits to or shows signs of engaging in such risky behavior."
],
"url": [
"http://www.webmd.com/sexual-conditions/tc/syphilis-cause",
"http://www.webmd.com/sexual-conditions/tc/syphilis-cause",
"http://www.healthline.com/health/std/syphilis",
"http://www.webmd.com/sexual-conditions/tc/syphilis-cause",
"http://www.webmd.com/sexual-conditions/tc/syphilis-cause",
"http://www.healthline.com/health/std/syphilis",
"http://www.healthline.com/health/std/syphilis",
"http://www.healthline.com/health/std/syphilis",
"http://www.webmd.com/sexual-conditions/tc/syphilis-cause",
"https://quizlet.com/21831061/micro-chapter-25-flash-cards/"
]
} | most infectious stage of syphilis | 458,197 | ENTITY | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Then, make steady on-time payments with a secured card and keep charges below 10% of your credit line. And after a year of on-time payments, consider asking your issuer for an unsecured credit card. A credit-builder loan is the installment loan version of a secured credit card.",
"Too many inquiries will hurt your credit. Furthermore, most lenders will not increase your limit every three months. Therefore, you have actually lowered your score (due to the inquiry), which unfortunately makes it harder to get credit. Improving your score is not a one stop fits all recipe.",
"Best advice get a secured credit card or 2. Use once and pay it off immediately and never use again. Do not close accounts, clear all balances. Learn to budget and stick to it. I went from 520 to 714 in 18 months and have 3 major credit cards and 4 local gas and store cards. It takes time and patience but it works.",
"Just make sure the issuer reports to the credit bureaus. Otherwise, your efforts will be for naught. Another way to build up your credit is to piggyback on someone else's credit card account. Ask a family member or your spouse to consider adding you as an authorized user on their credit card. An authorized user is not responsible for the balance, but benefits from the cardholder's payment history on that account.",
"1. Get a Credit Card. We know, we know: Getting a credit card sounds like the quickest way to wind up making purchases you can’t actually afford. But, remember, the best way to improve a credit score is to make on-time payments on any financing.",
"After the dust settles, restart your credit. It's also important to know how to fix your credit using new credit accounts. A secured credit card is typically the first and only type of credit available to someone with a badly blemished credit history. These cards require a security deposit, usually a minimum of $500, to activate it.",
"Keep balances low on credit cards and other revolving credit. High outstanding debt can affect a credit score. Pay off debt rather than moving it around. The most effective way to improve your credit scores in this area is by paying down your revolving (credit cards) debt. In fact, owing the same amount but having fewer open accounts may lower your scores.",
"Pay your bills on time. Prioritize and schedule your monthly payments, making sure to pay at least the minimum payment on time every month on all your accounts. Your payment history makes up approximately 35% of your credit score, so making timely payments is an important way to improve your credit score. It’s a good idea to have your credit card bill paid automatically on the due date, using automatic payments.",
"The truth is, of you have a bank account and. bills, then you have a credit score, and your. credit score matters more than you might. think. Your credit score may be called many. things, including a credit risk rating, a FICO. score, a credit rating, a FICO rating, or a credit. risk score. All these terms refer to the same. thing: the three–digit number that lets lenders. get an idea of how likely you are to repay your. bills.",
"Thanks for your patience. 1 4 years ago I bought a house and at that time my credit score was something like 750. 3 years ago I paid off and cancelled my credit cards, then I paid off my house. 2 Hi Guys, I met a Credit Counsellor, and looking at my credit report, she suggested me to open a Loan account in a Credit Union."
],
"url": [
"https://www.credit.com/credit-scores/improve-credit-score-without-debt/",
"https://www.creditkarma.com/question/how-can-i-raise-my-credit-score-100-points-in-6-months",
"https://www.creditkarma.com/question/how-can-i-raise-my-credit-score-100-points-in-6-months",
"http://www.bankrate.com/finance/debt/fix-credit-after-catastrophe-1.aspx",
"https://www.credit.com/credit-scores/improve-credit-score-without-debt/",
"http://www.bankrate.com/finance/debt/fix-credit-after-catastrophe-1.aspx",
"http://www.myfico.com/credit-education/improve-your-credit-score/",
"https://www.wellsfargo.com/goals-credit/smarter-credit/credit-101/good-credit-habits",
"http://carrollbiz.org/SBDC/resources/ImprovingYourCreditScore.pdf",
"https://www.credit.com/credit-scores/improve-credit-score-without-debt/"
]
} | ways to improve your credit after non payment | 542,317 | DESCRIPTION | [] |
[
"Yes, it is organic acid."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"The salts of Glycolic Acid (Ammonium Glycolate, Sodium Glycolate), the salts of Lactic Acid (Ammonium Lactate, Calcium Lactate, Potassiu Lactate, Sodium Lactate, TEA-Lactate) and the esters of Lactic Acid (Methyl Lactate, Ethyl Lactate, Butyl Lactate, Lauryl Lactate, Myristyl Lactate, Cetyl Lactate) may also be used in cosmetics and personal care ...",
"Sodium Lactate. Description. Sodium Lactate is sodium salt of lactic acid. It is also called monosodium salt and lactic acid sodium salt. This substance is produced by fermentation of sugar from beets or corn. The resulting lactic acid is then neutralized to produce a compound with the formula NaC3H5O3.",
"While sodium lactate and sodium acetate concentrations of 1%. were sufficient to control C. perfringens germination and outgrowth (<1.0 log. 10 CFU/g growth) following 15 h chill rates, higher concentrations were required for 18 and 21 h chill rates. Ional at 1% concentration was effective in inhibiting.",
"The following functions have been reported for Glycolic Acid, Lactic Acid and their salts and esters. Buffering agent - Ammonium Lactate, Potassium Lactate, Sodium Lactate. Cosmetic astringent - Calcium Lactate.",
"Sodium Lactate. Sodium Lactate is sodium salt of lactic acid. It is also called monosodium salt and lactic acid sodium salt. This substance is produced by fermentation of sugar from beets or corn. The resulting lactic acid is then neutralized to produce a compound with the formula NaC3H5O3.",
"SODIUM LACTATE Hazard Summary. CAS Number: Photosensitizer, with potential to increase risk of sunburn and skin cancer by intensifying UV exposures in deep skin layers. Skin sensitizer - can instigate immune system response that can include itching, burning, scaling, hives, and blistering of skin. Penetration enhancer: alter(s) skin structure, allowing other chemicals to penetrate deeper into the skin, increasing the amounts of other chemicals that reach the bloodstream.",
"Sodium Lactate. Product Data Sheet. Sodium Lactate - Sodium Lactate is a liquid salt that is naturally derived from the natural fermentation of sugars found in corn and beets. In food, Sodium Lactate may be used as a preservative, acting as an inhibitor of bacteria growth. In CP soap, Sodium Lactate helps to produce a harder bar of soap that lasts longer in the shower. Because Sodium Lactate is a salt, it is a natural humectant, providing moisture.",
"Inhibition of Clostridium perfringens germination and outgrowth by salts of organic acids such as sodium lactate, sodium acetate, buffered sodium citrate and buffered sodium citrate supplemented with sodium diacetate was evaluated. during continuous chilling of ground turkey.",
"The Food and Drug Administration (FDA) includes Lactic Acid, Calcium Lactate, Potassium Lactate and Sodium Lactate on its list of substances considered Generally Recognized As Safe (GRAS) as direct food additives.",
"SODIUM LACTATE Hazard Summary. Photosensitizer, with potential to increase risk of sunburn and skin cancer by intensifying UV exposures in deep skin layers. Skin sensitizer - can instigate immune system response that can include itching, burning, scaling, hives, and blistering of skin."
],
"url": [
"http://www.cosmeticsinfo.org/ingredient/sodium-lactate",
"http://www.naturalwellbeing.com/learning-center/Sodium_Lactate/",
"https://naldc.nal.usda.gov/download/22805/PDF",
"http://www.cosmeticsinfo.org/ingredient/sodium-lactate",
"http://www.naturalwellbeing.com/learning-center/Sodium_Lactate/",
"http://www.natural-skincare-authority.com/SODIUM-LACTATE.html",
"https://www.brambleberry.com/Sodium-Lactate-P5127.aspx",
"https://naldc.nal.usda.gov/download/22805/PDF",
"http://www.cosmeticsinfo.org/ingredient/sodium-lactate",
"http://www.natural-skincare-authority.com/SODIUM-LACTATE.html"
]
} | is sodium lactate organic | 424,133 | DESCRIPTION | [] |
[
"They are actually hyperirritable spots in muscle or fascial tissue [bands or sheets of connective tissue] known as myofascial trigger points, says Charleston."
] | {
"is_selected": [
0,
0,
1,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"All this stress has my muscles in knots!. If you have ever uttered a phrase like this, you were probably right. What causes muscle knots and how can you relieve them? Read on for advice from Tim Charleston, PT, DPT, a physical therapist at Piedmont. Muscle knots are actually hyperirritable spots in muscle or fascial tissue [bands or sheets of connective tissue] known as myofascial trigger points, says Charleston.",
"Hot spots for tightness are the neck, shoulders, and back. Clenching your muscles out of stress or anxiety can create knots, or they can develop due to an injury, poor posture, or even long periods of inactivity. RELATED: The Best Post-Workout Stretches. Massage is in fact one of the best ways to release the tension.",
"What are muscle knots? Muscle knots are actually hyperirritable spots in muscle or fascial tissue [bands or sheets of connective tissue] known as myofascial trigger points, says Charleston. Knots are comprised of tense muscle fibers.",
"Ah, there it is: that awful twinge of pain in your shoulder or neck that doesn't seem to go away, no matter what you do. Almost everyone has felt this at some point. Your friends tell you stress will only make it worse — but that's not exactly something you can control when a muscle knot is getting out of control.",
"These little, irritating bubbles are caused by chronic myofascial pain, which is felt in particularly sensitive trigger points in the body. When this kind of pain doesn't go away, the muscle can swell and harden into a bump (or knot). Although there's no scientific consensus on why these knots form, we know they tend to show up after the muscle is injured or strained due to repetitive motions. And, they often occur in the shoulders, back, or neck.",
"Research suggests myofascial trigger points may be quagmires of irritating molecules. What is the chemistry of a muscle knot? (For that matter, what’s a muscle knot?) Specifically, what’s the toxicity of the tissue fluids in and around them? The science of myofascial trigger points (TPs) has been dominated for years by the theory of a poisonous feedback loop, a vicious cycle.",
"The idea is that knots generate a lot of tissue fluid pollution, waste products of muscle cells that are metabolically “revving” with intense contraction … and those “exhaust” molecules are then accumulating, causing pain and other symptoms, and irritating the TP even more.",
"This is called a metabolic energy crisis, and it’s why I’ve been informally calling trigger points “sick muscle” syndrome for years now. Over-simplified diagram of the energy crisis hypothesis, which occurs in a tiny patch of muscle. Right or wrong, it’s been kicking around for a decades now.",
"Q: What is a muscle knot, and can massages get rid of them? It's not entirely clear what causes muscle knots—but your muscles don't literally get twisted and tied. Experts think that these muscle adhesions (also called myofascial trigger points) likely result from repeated tension and overuse in a specific area. Hot spots for tightness are the neck, shoulders, and back. Clenching your muscles out of stress or anxiety can create knots, or they can develop due to an injury, poor posture, or even long periods of inactivity. Massage is in fact one of the best ways to release the tension.",
"One current knot-science thought is that the fibers that make up your muscle tissue contract in response to some extra calcium in the area. This inflammation causes targeted swelling, soreness, weakness, and (of course) pain when you touch the affected trigger zones."
],
"url": [
"http://www.piedmont.org/living-better/what-causes-muscle-knots",
"http://www.health.com/mind-body/muscle-knot",
"http://www.piedmont.org/living-better/what-causes-muscle-knots",
"http://www.refinery29.com/2014/11/77415/muscle-knot-facts",
"http://www.refinery29.com/2014/11/77415/muscle-knot-facts",
"https://www.painscience.com/articles/toxic-trigger-points.php",
"https://www.painscience.com/articles/toxic-trigger-points.php",
"https://www.painscience.com/articles/toxic-trigger-points.php",
"http://www.health.com/mind-body/muscle-knot",
"http://www.refinery29.com/2014/11/77415/muscle-knot-facts"
]
} | what is a muscle knot | 691,863 | DESCRIPTION | [
"A muscle knot are the sensitive points all over your body, but mostly on the back and neck that are particularly sensitive to irritation."
] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Sure, turkey burger is leaner than ground beef. But that doesn't always mean a turkey burger is a healthy choice. Pay particular attention to what type of ground turkey it is (turkey breast is the most lean) and the toppings.",
"An equivalent tax on fries might be 50 cents per serving; a quarter extra for a doughnut. (We have experts who can figure out how “bad” a food should be to qualify, and what the rate should be; right now they’re busy calculating ethanol subsidies. Diet sodas would not be taxed.) Simply put: taxes would reduce consumption of unhealthful foods and generate billions of dollars annually. That money could be used to subsidize the purchase of staple foods like seasonal greens, vegetables, whole grains, dried legumes and fruit.",
"A healthy diet doesn’t have to be boring. Some foods that may seem like guilty pleasures can be good for you. What matters is how you prepare them and how often they’re on your table. Take pasta: It’s low in fat and salt and keeps you satisfied longer, so you’re less likely to snack or overeat. But watch what you put on it.",
"Although some smoothies made with simple, whole-food ingredients can be healthy, don't get fooled into thinking anything with the name smoothie is good for you. Some smoothies are made with lots of added sugars, high-calorie ingredients like chocolate syrup, or even use full-fat ice cream as a base.",
"How “good vs bad” can be bad for you. Deciding what’s good and what’s bad. Of course, every decision we make is based on something. Sometimes, we place food in a category because we heard or read something about it. The thought process can go like this: X contains a lot of fiber, fiber is good, X is good.",
"Bad news foods. It really is a shame. Some of the best-tasting foods are actually some of the worst in terms of fat and calories. But it can be hard to avoid them, especially in places—like malls—where nutrition information usually isn’t available. So we did the work for you; take a look at a list of foods you should skip—or pick—at a mall, restaurant, or grocery store.",
"McDonald's, Burger King, Wendy's, Taco Bell -- which one are you craving today? It's pretty likely that you have a favorite fast food chain and that you love many of the tasty options offered at these restaurants. It's hard to miss them. As of 2012, there were 263,944 fast food restaurants in America with a combined revenue of well over $100 billion.",
"Too bad you're eating a lot more than just eggs: David DiSalvo, a writer at Forbes, decided to really look into the eggs in popular fast food breakfast sandwiches. What he discovered was that their eggs are really a strange concoction that includes eggs and premium egg blend..",
"The terms “good” and “bad” most often strictly refer to health. But food is and should be more than just fuel. For most people, food has the potential to increase the quality of life and therefore happiness! When you eat food only for the health benefits, you might be missing out on overall happiness.",
"With rolled oats, nuts, and dried fruits, granola seems so healthy. What is misleading though is how much sugar and extra calories are lurking in granola. A bowl of this stuff can easily contain 500 or more calories—and that's without the milk! Indulge smartly by choosing high-fiber varieties with low sugar."
],
"url": [
"http://www.shape.com/healthy-eating/diet-tips/50-seemingly-healthy-foods-are-bad-you",
"http://www.nytimes.com/2011/07/24/opinion/sunday/24bittman.html",
"http://www.webmd.com/food-recipes/ss/slideshow-surprisingly-healthy-foods",
"http://www.shape.com/healthy-eating/diet-tips/50-seemingly-healthy-foods-are-bad-you",
"http://www.health-foodie.com/2010/03/good-food-vs-bad-food/",
"http://www.health.com/health/gallery/0,,20307363,00.html",
"http://www.huffingtonpost.com/2013/11/20/fast-food-truths_n_4296243.html",
"http://www.huffingtonpost.com/2013/11/20/fast-food-truths_n_4296243.html",
"http://www.health-foodie.com/2010/03/good-food-vs-bad-food/",
"http://www.shape.com/healthy-eating/diet-tips/50-seemingly-healthy-foods-are-bad-you"
]
} | what is bad food | 722,014 | DESCRIPTION | [] |
[
"Dallas County",
"Dallas"
] | {
"is_selected": [
0,
0,
0,
0,
1,
0,
0,
0,
0,
0
],
"passage_text": [
"At the Garland Detention Center there are two ways to locate an inmate, in-person at 1900 W. State Street Garland, TX and over the telephone at 972-485-4890. Where Is The Jail Located: The Garland Detention Center is located at 1900 West State Street, in close proximity to the Forest Lane and State Street intersection.",
"Garland, TX, is a city located in the eastern part of Texas. Cities Neighboring Garland, TX. The following Cities are next to Garland, TX: Dallas is 11.3 miles southwest of Garland, TX. Richardson is 6.2 miles northwest of Garland, TX.",
"Garland, TX is in the eastern part of Texas in the west south central United States. Is In Garland, TX These Counties: Rockwall County, Dallas County, Collin County. Neighboring Cities to Garland, TX: Dallas, Richardson, Rowlett, Wylie, Sachse.",
"The Garland Detention Center is a 24-hour, seven-day-a-week operation for the temporary confinement of pre-trial individuals involved in the judicial process, as well as those individuals serving time assessed on misdemeanor Garland Municipal Court cases.",
"Homefacts City Report. Garland is located in Dallas County, TX. The population is 233,623, making Garland the 2nd largest city in Dallas County. There are 67 public schools in Garland with an average Homefacts rating of B-. The total crime rate for Garland is moderate, and there are 358 registered sex offenders residing in the city.",
"Garland, TX. Sponsored Topics. Garland is a city in the U.S. state of Texas. It is an inner suburb northeast of Dallas and is a major part of the Dallas-Fort Worth Metroplex. It is located almost entirely within Dallas County except for small portions in Collin County.",
"Upon being released, an inmate can be picked up at 1900 West State Street Garland, TX. However, most inmates will be transferred to Dallas County Jail. The Garland Detention Center Or Garland Jail is a holding facility and the majority of inmates are transferred to the Dallas County Jail within 72 hours.",
"Not to be confused with Dallam County, Texas. Dallas County is a county in the U.S. state of Texas. As of the 2010 census, the population was 2,368,139. It is Texas' second-most populous county and the ninth-most populous in the United States. Its county seat is Dallas, which is also Texas' third-largest city and the ninth-largest city in the United States.",
"Garland, Texas. Garland is a city in the U.S. state of Texas. It is a large city northeast of Dallas and is a part of the Dallas–Fort Worth metroplex, as well as a suburb of Dallas. It is located almost entirely within Dallas County, except a small portion located in Collin and Rockwall Counties.",
"Upon being released, an inmate can be picked up at 1900 West State Street Garland, TX. However, most inmates will be transferred to Dallas County Jail. Jail Tips: The Garland Detention Center Or Garland Jail is a holding facility and the majority of inmates are transferred to the Dallas County Jail within 72 hours."
],
"url": [
"http://jailstuff.org/find-a-jail-real/texas/garland-detention-center-jail/",
"https://www.maptechnica.com/city-map/Garland/TX/4829000",
"https://www.maptechnica.com/city-map/Garland/TX/4829000",
"http://www.ci.garland.tx.us/gov/lq/safety/police/unit/support/detention.asp",
"http://www.homefacts.com/city/Texas/Dallas-County/Garland.html",
"https://www.mapquest.com/us/tx/garland-282039710",
"http://jailstuff.org/find-a-jail-real/texas/garland-detention-center-jail/",
"https://en.wikipedia.org/wiki/Dallas_County,_Texas",
"https://en.wikipedia.org/wiki/Garland,_Texas",
"http://jailstuff.org/find-a-jail-real/texas/garland-detention-center-jail/"
]
} | what county is garland,tx in | 606,368 | LOCATION | [
"Garland is in Dallas County, Texas."
] |
[
"Lots with 1-25 spots need 1 handicap space; 26-50 spots need 2 handicap spaces; 51-75 spots need 3 handicap spaces; and 76-100 spots need 4 handicap spaces."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"(plan drawing showing an accessible parking space for cars with a 96 inch wide designated parking space, a 60 inch wide min. marked access aisle and the following notes). Sign with the international symbol of accessibility mounted high enough so it can be seen while a vehicle is parked in the space.",
"If a lot only has 1 handicap space, that space will also be designated as van accessible. SIZE OF SPACES. The ADA provides the governing regulations for the width and height of handicap spaces. Each handicap space must be 8 feet wide and the van accessible spaces must have 98 inches of height clearance.",
"Accessible Parking Spaces. ADA access signs need to be posted at properly designated accessible parking spaces. To meet ADA requirements, handicapped parking space should be conveniently large enough for the vehicle to be parked.",
"The no parking space between handicap spaces must be 5 feet wide and the spaces next to or between two van accessible spaces must be 8 feet wide to accommodate the loading and unloading of wheel chairs and walkers.",
"ADA access signs need to be posted at properly designated accessible parking spaces. To meet ADA requirements, handicapped parking space should be conveniently large enough for the vehicle to be parked.",
"Standard Accessible (std.) parking space is 8 foot minimum + 5 foot access aisle. * One in every 8 accessible parking spaces must be a van accessible space with an 8 foot wide access aisle. IMPORTANT NOTE: These are the minimum requirements of the ADA.",
"1 Standard vehicle parking space (Cars) must have a 5 feet wide access aisle adjacent to parking space. 2 Regulations allow two adjacent parking spaces to share a common access aisle. 3 Parking spaces and access aisles shall be in level with surface slopes not exceeding 1:50 (2%) in all directions.",
"Accessible parking spaces for cars have at least a 60-inch-wide access aisle located adjacent to the designated parking space. The access aisle is just wide enough to permit a person using a wheelchair to enter or exit the car. These parking spaces are identified with a sign and located on level ground.",
"The number of parking spaces to be reserved for handicap vehicles and vans is calculated based on the number of spots in a parking lot. Lots with 1-25 spots need 1 handicap space; 26-50 spots need 2 handicap spaces; 51-75 spots need 3 handicap spaces; and 76-100 spots need 4 handicap spaces.",
"Minimum number of Handicap Parking Spaces required. The amount of accessible parking spaces that must be provided is determined by the total number of spaces present in each parking lot. It is important to note that ADA provides the central set of guidelines."
],
"url": [
"http://www.ada.gov/restripe.htm",
"http://thelawdictionary.org/article/what-are-laws-for-handicap-parking-spaces/",
"http://www.myparkingsign.com/MPS/article_ADA-Handicapped-Parking-Rules.aspx",
"http://thelawdictionary.org/article/what-are-laws-for-handicap-parking-spaces/",
"http://www.myparkingsign.com/MPS/article_ADA-Handicapped-Parking-Rules.aspx",
"http://www.adaptiveaccess.com/handicap_parking.php",
"http://www.myparkingsign.com/MPS/article_ADA-Handicapped-Parking-Rules.aspx",
"http://www.ada.gov/restripe.htm",
"http://thelawdictionary.org/article/what-are-laws-for-handicap-parking-spaces/",
"http://www.myparkingsign.com/MPS/article_ADA-Handicapped-Parking-Rules.aspx"
]
} | parking requirements for handicap spaces | 471,834 | DESCRIPTION | [
"The parking requirements for handicap spaces are: Lots with 1 to 25 spots need 1 handicap space; 26 to 50 spots need 2 handicap spaces; 51 to 75 spots need 3 handicap spaces; and 76 to100 spots need 4 handicap spaces."
] |
[
"Yes, Celebrating Inti Raymi in Ecuador."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"As South America experts, we've always been committed to making our South America holidays affordable, so take a look at our new bargain offers... One of the undoubted highlights of South America, holidays at the spectacular Iguazu Falls can link in perfectly with our other destinations in South America ...",
"Inti Raymi, or the “Festival of the Sun,” falls on June 21 or 22, the date of the southern hemisphere’s winter solstice, the shortest day of the year.",
"The most important Andean Festival in March is Pawkar Raymi and Mushuk nina, or indigenous new year. Andean festivities have an intimate connection with the Sun and its movement in the sky. Holy week is celebrated between March and April. It’s one of the most important celebrations in the Catholic religion in Ecuador.",
"The name Inti Raymi comes from the Quechua language: inti means “sun” and raymi means “festival.” The largest festival takes place in Cuzco, Peru, the ancient capital of the Incan civilization and empire. In Cuzco, Inti Raymi has grown into a major tourist attraction. Thousands of people visit the city to enjoy the performances by folkloric groups and to watch the theatrical presentation of the Incan ceremony, the focal point of the celebration.",
"About This Festival. Everfest's Take: Inti Raymi, or “Festival of the Sun,” has historic roots in the now defunct Inca Empire. The festival was a celebration of the winter solstice, signifying the transition to longer days. After a long absence following the fall of the Inca Empire, the festival was rebooted in 1944 and has grown into a large annual celebration occurring every June near Sacsayhuaman in Peru.",
"In Quechua Inti means Sun and Raymi celebration. Inti Raymi is the celebration of the God Sun, the most venerated god in Inca religion. According to Inca tradition, Pachatutec, the first Inca, created the Inti Raymi to celebrate the winter solstice which marked the first day of the New Year in the Inca calendar. The winter solstice begins on June 21st but according to the Incas, the sun stays in the same place until the 24th when it finally rises.",
"February-March: The Pawkar Raymi and Mushuk runa or the indigenous new year celebration party of the Andean and Amazonian communities is celebrated since the beginning of February to March 21.",
"Tailormade Bolivia Holidays. Bolivia is one of the most interesting but challenging countries in South America, but holidays to Bolivia reward adventurous travellers with some of the continent's most spectacular scenery as well as a uniquely vibrant indigenous culture...",
"Celebrating Inti Raymi in Ecuador. Inti Raymi is the Inca Festival of the Sun and, as the northern part of the Inca Empire, it was celebrated in Ecuador for centuries. What many people don't know is that it is still celebrated today, so if you want to see this ancient Inca ritual, head to Otavalo in June...",
"The solstices are celebrated with the Inti Raymi, June 21, and Capac Raymi, December 22; the equinoxes are celebrated with the Pawcar Raymi, March 20 and Quilla Raymi, September 22."
],
"url": [
"http://www.realworldholidays.co.uk/events/intiraymiecuador.aspx",
"http://www.classzone.com/books/en_espanol_shared/ML1/ML_1_Inti_Raymi/ml_1_inti_raymi.html",
"http://quitoadventure.com/ecuador-culture-people/festivals-holidays-ecuador/march-april.html",
"http://www.classzone.com/books/en_espanol_shared/ML1/ML_1_Inti_Raymi/ml_1_inti_raymi.html",
"https://www.everfest.com/e/inti-raymi-cusco-peru",
"http://www.discover-peru.org/inti-raymi/",
"http://quitoadventure.com/ecuador-culture-people/festivals-holidays-ecuador/march-april.html",
"http://www.realworldholidays.co.uk/events/intiraymiecuador.aspx",
"http://www.realworldholidays.co.uk/events/intiraymiecuador.aspx",
"http://quitoadventure.com/ecuador-culture-people/festivals-holidays-ecuador/march-april.html"
]
} | does ecuador celebrate inti raymi | 165,843 | DESCRIPTION | [] |
[
"The salary of the Home Depot stock associate is from $13 to $14."
] | {
"is_selected": [
0,
1,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Go to Human Resources (HR) Associate at The Home Depot Inc. salaries » Go to all Human Resources (HR) Associate salaries » Human Resources (HR) Coordinator (6)",
"Inventory Associate salaries at The Home Depot can range from $13-$14. This estimate is based upon 1 The Home Depot Inventory Associate salary report(s) provided by employees or estimated based upon statistical methods. See all Inventory Associate salaries to learn how this stacks up in the market.",
"Go to Customer Service Sales Associate at The Home Depot Inc. salaries » Go to all Customer Service Sales Associate salaries » Customer Service Specialist (73)",
"©2016 Home Depot Product Authority, LLC. All Rights Reserved. Use of this site is subject to certain Terms of Use which constitute a legal agreement between you and The Home Depot U.S.A., Inc.",
"Email: [email protected]. IR Coordinator: 770-384-2871. For all other inquiries including Customer Care issues please call The Home Depot Store Support Center at 1-770-433-8211, or toll free 1-800-654-0688.",
"For general employee stock plan inquiries, please contact: For questions regarding your Computershare account, please contact Computershare at: Employees can elect to receive Proxy Materials, Annual Reports and other stockholder communications electronically.",
"Go to Laborer, Freight, Stock, Material Mover, Hand at The Home Depot Inc. salaries » Go to all Laborer, Freight, Stock, Material Mover, Hand salaries » Lead Cashier (2)",
"The Home Depot Inc. - Median Hourly Rate by Job - Get a free salary comparison based on job title, skills, experience and education. Accurate, reliable salary and compensation comparisons for United States",
"The Home Depot Salary; Inventory Associate - Hourly: $11.58/hr: Inventory Associate - Hourly: $13.69/hr: Inventory Associate - Hourly: $12.71/hr",
"Average hourly pay for The Home Depot Inventory Associate: $13. The Home Depot hourly pay trends based on hourly pay posted anonymously by The Home Depot employees. Flag"
],
"url": [
"https://www.payscale.com/research/US/Employer=The_Home_Depot_Inc./Hourly_Rate/by_Job",
"https://www.glassdoor.ca/Hourly-Pay/The-Home-Depot-Inventory-Associate-Hourly-Pay-E655_D_KO15,34.htm",
"https://www.payscale.com/research/US/Employer=The_Home_Depot_Inc./Hourly_Rate/by_Job",
"http://ir.homedepot.com/shareholder-services/employee-stock-plan-contact",
"http://ir.homedepot.com/shareholder-services/employee-stock-plan-contact",
"http://ir.homedepot.com/shareholder-services/employee-stock-plan-contact",
"https://www.payscale.com/research/US/Employer=The_Home_Depot_Inc./Hourly_Rate/by_Job",
"https://www.payscale.com/research/US/Employer=The_Home_Depot_Inc./Hourly_Rate/by_Job",
"https://www.glassdoor.ca/Hourly-Pay/The-Home-Depot-Inventory-Associate-Hourly-Pay-E655_D_KO15,34.htm",
"https://www.glassdoor.ca/Hourly-Pay/The-Home-Depot-Inventory-Associate-Hourly-Pay-E655_D_KO15,34.htm"
]
} | how much home depot stock associate | 320,264 | NUMERIC | [] |
[
"The list of geographic features of ancient Egypt includes the Nile River that runs down the middle of Egypt, the arid desert to the east and west, the fertile Nile Valley and Delta, and the cataracts of the Nile."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
1,
0,
0,
0
],
"passage_text": [
"One of Egypt's defining characteristics is the Nile River and its delta. Without the benefit of the Nile River's waters, Egypt might have become as empty as the other regions of North Africa covered by the Sahara Desert.",
" Activity 1: Explore the geographical features of Egypt with the interactive map on the British Museum website by clicking on the following link http://www.ancientegypt.co.uk/geography/explore/fea.html",
"The Giza Necropolis is Egypt's most iconic man-made physical characteristic, with its pyramids and the Great Sphinx representing a huge tourist attraction. A much more recent man-made physical feature is the Suez Canal, which is considered the most important component of Middle Eastern maritime transport. Opened to shipping in 1869 after 10 years of construction work, Egypt's artificial waterway traversing the Isthmus of Suez connects the Mediterranean Sea with the Red Sea.",
"The geography of the area influenced where the Ancient Egyptians built most of their civilization. The geography also affected the materials the civilization used to build things, and it kept the... The geography of the area influenced where the Ancient Egyptians built most of their civilization. The geography also affected the materials the civilization used to build things, and it kept the civilization relatively safe from invasion.",
"Physical & Human Characteristics There are many characteristics to Ancient Egypt, whether its the climate, wildlife, or religion. here are some of the physical and human characteristics of Ancient Egypt. Physical - The soil is very fertile on the banks of the Nile River. Both sides of Ancient and Current Egypt were surrounded by desert, mainly to protect them from neighboring hostile tribes and/or civilizations. The Nile River was used for fishing, travel, and recreation. Human - Polytheism, the belief in many gods and goddesses, was the main religion.",
"These borders isolated and protected Egypt but its location was at a crossroads for people, ideas and influence. Activity 1: Explore the geographical features of Egypt with the interactive map on the British Museum website by clicking on the following link- http://www.ancientegypt.co.uk/geography/explore/fea.html Answer the following questions: 1.",
"Natural features Of ancient egypt Some of the natural features of ancient Egypt include the Nile River that runs down the middle of Egypt, the arid desert to the east and west, the fertile Nile Valley and Delta, and the cataracts of the Nile",
"The majority of Egypt's landmass is a flat and featureless desert which supports only minimal vegetation. In the upper eastern corner of the North African country, the mountainous Sinai Peninsula... The majority of Egypt's landmass is a flat and featureless desert which supports only minimal vegetation. In the upper eastern corner of the North African country, the mountainous Sinai Peninsula borders Israel and is separated from the rest of the African landmass by the Suez Canal.",
"Where is Egypt located? A: Egypt is a located in the eastern part of North Africa and at the southwest corner of Asia. Because of its geographical location, it is called a transconti... Full Answer >",
"Quick Answer. The geography of the area influenced where the Ancient Egyptians built most of their civilization. The geography also affected the materials the civilization used to build things, and it kept the civilization relatively safe from invasion. Continue Reading."
],
"url": [
"https://www.reference.com/geography/physical-characteristics-egypt-9713c68fcb06b2c8",
"https://ancientegypt8.weebly.com/geography-of-ancient-egypt.html",
"https://www.reference.com/geography/physical-characteristics-egypt-9713c68fcb06b2c8",
"https://www.reference.com/geography/did-geography-affect-ancient-egypt-34788ea6010c910f",
"https://schmidtancientegypt.weebly.com/physical--human-characteristics.html",
"https://ancientegypt8.weebly.com/geography-of-ancient-egypt.html",
"https://ancientegypt8.weebly.com/geography-of-ancient-egypt.html",
"https://www.reference.com/geography/physical-characteristics-egypt-9713c68fcb06b2c8",
"https://www.reference.com/geography/physical-characteristics-egypt-9713c68fcb06b2c8",
"https://www.reference.com/geography/did-geography-affect-ancient-egypt-34788ea6010c910f"
]
} | list of geographic features of ancient egypt | 1,174,088 | DESCRIPTION | [] |
[
"The civil engineer is the person who designs the foundations, develops the structural scheme, sizes structural members, designs wastewater and stormwater systems etc while civil engineering technicians provide technical support to civil engineers on construction projects."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
1,
0
],
"passage_text": [
"Key Differences Between Civil and Construction Engineering. A civil engineer designs, maintains, plans, constructs, and operates infrastructures while taking care of environmental and public health, as well as refining existing buildings that have been neglected.",
"And construction management is a contractor is a concentration within civil engineering. It focuses on contracts, site management, estimates etc. It wouldn't have the same level of technical classes such as finite element analysis etc.",
"They both require different set of degrees for different job profiles and engineering careers. In a nutshell we can say that all construction engineers (site engineers) are civil engineers but not all civil engineers are site engineers. Here is a snapshot of some of the key differences between the two lines of work:",
"Engineers design equipment and systems. They have B.S., M.S., or Ph.D. in Electrical, Mechanical, Civil or other engineering fields. Many engineers also have degrees in engineering technology such as B.T, B.E.T, or B.S.E.T plus some engineering certification. The main difference between the B.T. graduate and the engineering graduate is that, the B.T. graduate usually takes courses that are more practical and hands-on than engineering courses.",
"In general, technicians have a two year degree such as A.A.S, or A.S.E.T. Technicians with an associate degree can transfer to a bachelor of technology program and complete the bachelor's degree in another two years.",
"The civil engineer. The civil engineer is the person who designs the foundations, develops the structural scheme, sizes structural members, designs wastewater and stormwater systems etc…. This person will almost always have completed a real engineering course and will either be licensed or be on the way to be licensed.",
"What is the difference between the two? I have worked as a carpenter for many years and tired of going nowhere. I was thinking about taking classes to become a civil engineering technician, but I am not sure if that is the same thing as a carpenter labor? I would hate to spend thousands of dollars to do the same job.",
"Difference Between Technician and Technologist. Technician vs Technologist. The interest to find the difference between technician and technologist arises due to the appearing similarity in the two terms and because both, the technician and Technologist, are involved in the development and innovation of new and existing technology.",
"Civil engineering technician. Civil engineering technicians provide technical support to civil engineers on construction projects. Salary: £14,000 to £45,000 average per year. Hours: 40 per week.",
"The salary of a civil engineer depends on his designation. However, on an average they can make upto $79, 000 per annum. A project engineer can make as high as $133, 000 per annum. The complete list of pay packages can be obtained online. Salaries of site engineers, too, vary according to their post and designation."
],
"url": [
"http://thecollegepeople.com/2015/03/key-differences-between-civil-and-construction-engineering/",
"https://www.quora.com/What-are-the-differences-between-civil-engineering-and-construction-engineering",
"http://thecollegepeople.com/2015/03/key-differences-between-civil-and-construction-engineering/",
"http://www.canton.edu/csoet/elec/technician.html",
"http://www.canton.edu/csoet/elec/technician.html",
"https://www.quora.com/What-are-the-differences-between-civil-engineering-and-construction-engineering",
"https://answers.yahoo.com/question/index?qid=20061005205423AAgkKIa",
"http://www.differencebetween.com/difference-between-technician-and-technologist/",
"https://nationalcareersservice.direct.gov.uk/job-profiles/civil-engineering-technician",
"http://thecollegepeople.com/2015/03/key-differences-between-civil-and-construction-engineering/"
]
} | difference between civil engineer and civil engineering technician | 146,793 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"When individuals build successful relationships, organizations benefit. Personal Skills for Professional Success —that’s the subtitle of our flagship book on etiquette, The Etiquette Advantage in Business, 3rd edition, and it’s why business etiquette training is so valuable for companies and for individuals.",
"Author of the New York Times bestseller Essential Manners for Men and co-author of The Etiquette Advantage in Business, 3rd edition, he writes a weekly question-and-answer business etiquette advice column, “Etiquette at Work,” that appears in the Boston Sunday Globe.",
"Etiquette (/ˈɛtɨkɛt/ or /ˈɛtɨkɪt/ , [e.ti.kɛt]) is a code of behavior that delineates expectations for social behavior according to contemporary conventional norms within a society, social class, or group.",
"If your business has a social media presence, it may only be a matter of time before someone issues a complaint online. Handling the situation in a mannerly fashion can take the sting out of negative feedback and lead to improved client relationships.",
"Courtesy Manners – demonstrate one’s ability to put the interests of others before oneself; to display self‐control and good intent for the purposes of being trusted in social interactions. Courtesy manners help to maximize the benefits of group living by regulating social interaction.",
"Whether you are aware of it or not, first impression do make a major difference in achieving business objectives. Business experts have preached the value of knowing proper business etiquette, including practicing good manners, for close to fifty years. In the United States, we live in a business casual world but many people forget the first word is still business.. As such, we have to mind our manners. Having good manners will help you regardless of the business you are in. Any time you make contact with a client or perspective client, you are making a mini-presentation of yourself, ultimately representing your company, service and/or products.",
"The etiquette of business is the set of written and unwritten rules of conduct that make social interactions run more smoothly. Office etiquette in particular applies to coworker interaction, excluding interactions with external contacts such as customers and suppliers.",
"Business etiquette can vary significantly in different countries, which is invariably related to their culture. For example: A notable difference between Chinese and Western business etiquette is conflict handling.",
"Etiquette in retail is sometimes summarized as The customer is always right.. There are always two sides to the case, of course, and it is a credit to good manners that there is scarcely ever any friction in stores and shops of the first class.",
"Whether it is in a meeting, in a communication, around a water cooler, on a business trip, at a business social mixer, or at an important business meal, personal skills make or break relationships. An individual’s professional success hinges on how well he or she can build strong relationships."
],
"url": [
"http://emilypost.com/business/seminars/",
"http://emilypost.com/business/seminars/",
"https://en.wikipedia.org/wiki/Etiquette",
"http://www.huffingtonpost.com/news/business-etiquette/",
"https://en.wikipedia.org/wiki/Etiquette",
"http://www.salesvantage.com/article/858/Business-Manners-an-Important-Ingredient-to-Success",
"https://en.wikipedia.org/wiki/Etiquette",
"https://en.wikipedia.org/wiki/Etiquette",
"https://en.wikipedia.org/wiki/Etiquette",
"http://emilypost.com/business/seminars/"
]
} | what are business manners | 555,937 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Buy3 recieve $2.00 off your purchase of 3 items - Minimum - shopping cart must total $29.97 or more. Buy4 recieve $3.00 off your purchase of 4 items - Minimum - shopping cart must total $39.96 or more. Image: Transition study guide PDF on Kindle! See our FAQ page for iPad & Kindle download instructions. PDF E-book Study Guides & Audio Review companions are available as digital download or on CDrom.",
"Over 3,800 colleges and universities allow you to earn part of your degree by testing out with credit by examination. Passing CLEP, DSST and/or ECE exams can help you to: Save Money - Save tuition money by testing out of classes using CLEP, DSST or ECE exams.",
"Excelsior College offers comprehensive study guides for these performance exams as well as a workshop to help you prepare for the CPNE. There's help studying for the CPNE. iStudySmart.com has a CPNE kit available at our bookstore.",
"If you have questions about the performance exams, call Excelsior College Admissions office at 1-888-647-2388 or click here to read about the exams on Excelsior's site.",
"The FCCA provides the opportunity for students to demonstrate their ability to apply nursing knowledge and make nursing judgments about patient care. The FCCA is delivered through the Excelsior College Learning Management System as 2 separate 8-week online assessments. Each assessment may be taken alone (one per term) OR both may be taken during the same term: FCCA #274A: Head-to-Toe Assessment and Nursing Process.",
"Nursing Performance Examinations. The Excelsior Nursing Performance Examinations (clinicals) measure a student's ability to perform the expected behaviors and skills as a new graduate registered nurse.",
"Clinical exams include a one-to-one evaluation by a trained examiner, real and simulated clinical situations and an objective assessment of your skills. The performance examination is taken at a Regional Performance Assessment Center (RPACs).",
"Focused Clinical Competencies Assessment® (FCCA) The Focused Clinical Competencies Assessment (FCCA) is a computer-delivered simulated clinical assessment that serves as a transition from the nursing theory exams/courses to the Clinical Performance in Nursing Examination (CPNE®).",
"Over 3,800 colleges and universities allow you to earn part of your degree by testing out with credit by examination. Passing CLEP, DSST and/or ECE exams can help you to: 1 Save Money - Save tuition money by testing out of classes using CLEP, DSST or ECE exams. Save Time - Study at your own pace. You schedule and you set the rate at which you work. You determine when you're ready to take your CLEP, DSST, or ECE exam.",
"Passing CLEP, DSST and/or ECE exams can help you to: 1 Save Money - Save tuition money by testing out of classes using CLEP, DSST or ECE exams. 2 Save Time - Study at your own pace. Be Confident - iStudySmart.com in-depth CLEP, DSST and ECE preparation courses cover every content area you'll see on test day."
],
"url": [
"http://www.studygroup101.com/studyguides.html",
"http://www.istudysmart.com/",
"https://www.istudysmart.com/content.asp?cid=61",
"https://www.istudysmart.com/content.asp?cid=61",
"http://www.excelsior.edu/exams/fcca",
"https://www.istudysmart.com/content.asp?cid=61",
"https://www.istudysmart.com/content.asp?cid=61",
"http://www.excelsior.edu/exams/fcca",
"http://www.istudysmart.com/",
"http://www.istudysmart.com/"
]
} | how to study for the fcca | 381,860 | DESCRIPTION | [] |
[
"Peas, beans, whole grains, potatoes, bread, cereals and pasta."
] | {
"is_selected": [
1,
0,
0,
0,
1,
0,
0,
0,
0,
0
],
"passage_text": [
"Heres how these important nutrients work: Carbohydrates, as the primary fuel source for the body, provide quick energy. Opt for complex carbs like peas, beans, whole grains, and vegetables, which also deliver the vitamins, minerals, and fiber important for overall health.",
"What you need is carbs, that's the bottom line. Then, protein and fat keep you satiated longer, so it's a win-win.. Clear out some space in your desk drawer or office fridge for these 8 snacks that pack a true energy punch: A fresh piece of fruit + a serving of almonds.",
"10 Foods That Will Give You Energy. Next time you're feeling that midday energy dip, don't pour yourself another cup of coffee or reach for a candy bar. Caffeine and sugar may give you an energy spike, but the crash that follows will leave you feeling even more tired than before. Instead, try these 10 foods to help naturally boost your energy and keep you alert all day, elevating your mood and making you more productive.",
"The key to beating the dreaded afternoon slump, Gans says, is being prepared with healthy snacks on-hand, specifically, foods with carbs for quick energy, and that are high in fiber, protein, and/or healthy fats to provide longer-lasting energy, without the jolt of caffeine.",
"Slow-burning starches give sustained energy. Starchy foods – also called carbohydrates – such as potatoes, bread, cereals and pasta are an important part of a healthy diet. They're a good source of energy and the main source of a range of nutrients. Starchy foods should make up just over a third of everything you eat.",
"(Find out 5 other things that make you tired, here.) Put down the coffee pot. There are other great options for an instant energy upgrade, says Keri Gans, Registered Dietitian/Nutritionist and author of The Small Change Diet—they just take a bit of know-how and planning ahead.",
"This fish is not only high in protein, but its high concentration of omega-3 fatty acids and vitamins B6, niacin (a.k.a. vitamin B3) and riboflavin (B2) help your body convert food into energy. Whats more, the omega-3s in the fatty fish benefit the heart and the brain.",
"The four food groups are: 1 fruit and vegetables. 2 potatoes, bread, rice, pasta and other starchy foods. 3 milk and dairy foods. beans, pulses, fish, eggs, meat and other non-dairy sources of protein.",
"Real food. Thats your ticket to all-day energy: A combination of carbohydrates, protein, and healthy fats provides the body with the nutrients and energy it needs, says QualityHealths Nutrition expert Alison Massey, RD, CDE, LDN, MS, Director of Diabetes Education at Mercy Medical Center in Baltimore.",
"Whole Grains. It’s common knowledge that consuming carbs will give you a quick energy boost, which makes them great before a long workout. But the pick-me-up from refined carbohydrates like white bread and white rice won’t last; within 30 minutes you’ll be feeling sluggish again."
],
"url": [
"https://www.qualityhealth.com/eating-nutrition-articles/10-foods-give-you-energy",
"http://www.womenshealthmag.com/food/good-energy-foods",
"http://www.businessinsider.com/10-foods-to-boost-energy-2013-9",
"http://www.womenshealthmag.com/food/good-energy-foods",
"http://www.nhs.uk/Livewell/tiredness-and-fatigue/Pages/energy-diet.aspx",
"http://www.womenshealthmag.com/food/good-energy-foods",
"https://www.qualityhealth.com/eating-nutrition-articles/10-foods-give-you-energy",
"http://www.nhs.uk/Livewell/tiredness-and-fatigue/Pages/energy-diet.aspx",
"https://www.qualityhealth.com/eating-nutrition-articles/10-foods-give-you-energy",
"http://ecosalon.com/20-foods-to-give-you-energy/"
]
} | what food gives the most energy | 660,366 | ENTITY | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Glomerular Filtration Rate(GFR). This test is a measure of how well the kidneys are removing wastes and excess fluid from the blood. It may be calculated from the serum creatinine level using your age, weight, gender and body size.Normal GFR can vary according to age (as you get older it can decrease). The normal value for GFR is 90 or above.lomerular Filtration Rate(GFR). This test is a measure of how well the kidneys are removing wastes and excess fluid from the blood. It may be calculated from the serum creatinine level using your age, weight, gender and body size.",
"DNA was extracted from the whole blood of patients. Primers for amplifying the RP2 exons 2–5 were used as previously reported. The sequences for the RP2 exon 1 forward and reverse primers were: 5′ CTTTGATTGGCTCAACAGGC and 5′ GTTCAAGAGAGTGCGGCAG, respectively. These primers amplified 447 bp PCR fragments. Mutations in the N-terminus of the X-linked retinitis pigmentosa protein RP2 interfere with the normal targeting of the protein to the plasma membrane.",
"Cc × cc. 1:1 phenotypic ratios in the progeny result from a cross of a heterozygote with a homozygous recessive. Because albino is recessive to all other alleles, the full color parent must have an albino allele, and the albino parent must be homozygous for the albino allele.hen a Chinese hamster with white spots is crossed with another hamster that has no spots, approximately ½ of the offspring have white spots and ½ have no spots. When two hamsters with white spots are crossed, 2/3 of the offspring possess white spots and 1/3 have no spots.",
"The X-linked forms of RP (XLRP) account for 10–20% of all RP cases. Two genes have been cloned for XLRP: Retinitis Pigmentosa GTPase Regulator (RPGR; OMIM 312610) and RP2 (OMIM 312600), which together account for over 80% of XLRP. Mutations in RP2 are reported to cause 7–10% of XLRP. Mutations in the N-terminus of the X-linked retinitis pigmentosa protein RP2 interfere with the normal targeting of the protein to the plasma membrane.",
"Before You Ride. Clean the outside of your shock with soap and water and wipe dry with a soft dry rag. Do not use a high pressure washer on your shock. Inspect entire exterior of shock for damage.The shock should not be used if any of the exterior parts appear to be damaged.ou can also view a Flash video on Setting Sag. To set sag: Measure sag, and compare it to the recommended sag setting shown in the Air Spring Setting Guidelines table below. Continue if the sag is not to specification. Locate the Schrader air valve on the shock and remove the air valve cap.",
"Tests Currently Offered. If the test you are interested in does not appear on this list, you can safely assume we do not offer it at this time. While that may change in the future, until such time that we do, we recommend you visit www.GeneTests.org for a list of laboratories that may be able to assist you now.ests Currently Offered. If the test you are interested in does not appear on this list, you can safely assume we do not offer it at this time. While that may change in the future, until such time that we do, we recommend you visit www.GeneTests.org for a list of laboratories that may be able to assist you now.",
"We propose that screening of RP2 should be prioritized in male patients presenting with an X-linked pedigree, high myopia, poor visual acuities, and early-onset macular atrophy. In addition, screening for RP2 mutations is appropriate in the rare male patients who fail CHM mutation screening.Consistent with the fundus findings in patient 933–2420 with an Arg118Cys mutation, Vorster et al noted a similar-like phenotype in a male patient with an Arg120stop mutation. Mutations in the N-terminus of the X-linked retinitis pigmentosa protein RP2 interfere with the normal targeting of the protein to the plasma membrane.",
"Levels of testosterone and growth hormone can be elevated to youthful balance. You’ve probably noticed a drop off in energy and strength, and you’re finding it hard to stay competitive in your job.You’re no longer getting optimum results from dieting, and disciplined workouts. You’ve notice a decline in your sex drive.evels of testosterone and growth hormone can be elevated to youthful balance. You’ve probably noticed a drop off in energy and strength, and you’re finding it hard to stay competitive in your job. You’re no longer getting optimum results from dieting, and disciplined workouts.",
"IMPORTANT NOTE: NIH does not independently verify information submitted to the GTR; it relies on submitters to provide information that is accurate and not misleading. NIH makes no endorsements of tests or laboratories listed in the GTR. GTR is not a substitute for medical advice.Patients and consumers with specific questions about a genetic test should contact a health care provider or a genetics professional.MPORTANT NOTE: NIH does not independently verify information submitted to the GTR; it relies on submitters to provide information that is accurate and not misleading. NIH makes no endorsements of tests or laboratories listed in the GTR. GTR is not a substitute for medical advice.",
"1 GTR Test ID Help Each Test is a specific, orderable test from a particular laboratory, and is assigned a unique GTR accession number.MPORTANT NOTE: NIH does not independently verify information submitted to the GTR; it relies on submitters to provide information that is accurate and not misleading. NIH makes no endorsements of tests or laboratories listed in the GTR. GTR is not a substitute for medical advice."
],
"url": [
"https://www.kidney.org/atoz/content/kidneytests",
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3392190/",
"http://ww2.biol.sc.edu/~awaldman/pierce_sm_chapter05.doc",
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3392190/",
"http://www.ridefox.com/fox_tech_center/owners_manuals/07/eng/rear_shocks/float_rp23.htm",
"https://www.carverlab.org/tests",
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3392190/",
"http://www.ghrp2.com/",
"http://www.ncbi.nlm.nih.gov/gtr/tests/506412/",
"http://www.ncbi.nlm.nih.gov/gtr/tests/506412/"
]
} | what blood test is rp2 | 579,175 | DESCRIPTION | [] |
[
"Lafayette County"
] | {
"is_selected": [
0,
0,
0,
1,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Lewisville is located at 33°21′38″N 93°34′46″W / 33.36056°N 93.57944°W / 33.36056; -93.57944 (33.360636, -93.579317). According to the United States Census Bureau, the town has a total area of 2.2 square miles (5.7 km 2), all of it land.",
"The median income for a household in the town was $26,719, and the median income for a family was $34,712. Males had a median income of $24,408 versus $16,850 for females. The per capita income for the city was $13,733.",
"Geography [edit]. According to the U.S. Census Bureau, the county has a total area of 545 square miles (1,410 km 2), of which 528 square miles (1,370 km 2) is land and 17 square miles (44 km 2) (3.1%) is water.",
"Lewisville is a town in Lafayette County, Arkansas, United States. The population was 1,285 at the 2000 census. The town is the county seat of Lafayette County.",
"[+] General Jury Duty Information. * 1 Not location specific. 2 How was I chosen? 3 What are the exemptions? 4 Go to our Jury Duty FAQ page for more on exceptions, requirements, pay, dress code, and other questions you might have.",
"Go Cougars! Welcome to the Lafayette County School District, located in Lewisville and Stamps, Arkansas! Lewisville, Arkansas is the home of the Lafayette County Elementary School and the LCSD Administration. Stamps, Arkansas is the home of the Lafayette County High School. The Lafayette County School District will not participate in the Public School Choice Act of 2013 for the 2015-2016 school year.",
"Notable locations in Lewisville: Lafayette County Sheriff's Office (A) , Lewisville Police Department (B) , Lafayette County Ambulance Service (C) , Lewisville Volunteer Fire Station (D) . Display/hide their locations on the map. Cemetery: Old Lewisville Cemetery (1) .",
"Lafayette County AR Jail is a County Jail used by the jurisdictions of Lafayette to confine inmates for short periods while awaiting trial or processing. As inmates are staying for only a short period, it has fewer amenities than a jail or prison.",
"Lafayette County /lɑːfeɪɛt/ is a county located in the U.S. state of Arkansas. As of the 2010 census, the population was 7,645, making it the third-least populous county in Arkansas. The county seat is Lewisville. Lafayette County was formed on October 15, 1827 and named in honor of Marquis de Lafayette, a French military hero of the American Revolutionary War.",
"Arkansas: 2.8%. According to our research of Arkansas and other state lists there were 5 registered sex offenders living in Lewisville, Arkansas as of October 05, 2015. The ratio of number of residents in Lewisville to the number of sex offenders is 251 to 1."
],
"url": [
"https://en.wikipedia.org/wiki/Lewisville,_Arkansas",
"https://en.wikipedia.org/wiki/Lewisville,_Arkansas",
"https://en.wikipedia.org/wiki/Lafayette_County,_Arkansas",
"https://en.wikipedia.org/wiki/Lewisville,_Arkansas",
"http://www.county-courthouse.com/ar/lewisville/arkansas-county-court",
"http://www.lcscougars.org/",
"http://www.city-data.com/city/Lewisville-Arkansas.html",
"https://www.inmateaid.com/prisons/lafayette-county-ar-jail",
"https://en.wikipedia.org/wiki/Lafayette_County,_Arkansas",
"http://www.city-data.com/city/Lewisville-Arkansas.html"
]
} | what county is lewisville arkansas in | 608,570 | LOCATION | [
"Lewisville is in Lafayette County, Arkansas. "
] |
[
"877-417-4551"
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"I joined Square in late November 2015. Until March 28, 2016 at 11;53 a.m. I was singing their praises. I once contacted hone support and got a call back within an hour or two. At 11:54 a.m.",
"If you want to use Square Cash with your Apple Watch, you need to enable the app on the device. Here’s how: 1 Open the Apple Watch app on your phone. Tap “My Watch” > “Cash” (Square Cash’s app icon) > toggle “Show App on Apple Watch” on.",
"I’m just a regular person trying to be helpful on the Internet. Square does have a customer support number. However, you do need to log in to reach a real person at Square. Here’s how to do it. 1 Locate your Square login credentials. 2 Go to this URL: Contact Us with Your Customer Code. Click the blue Sign In Button.",
"Cash lets you request payments for goods and services at the simple price of 2.75% per transaction. That’s it. It’s cheap for your business, and easy for your customers.",
"Trying to work with square.com . . they have no customer phone # to deal with clients (called 5 different phone #'s) and continue to get the same recording. I did order this item, they did a transaction on my bank account but have never received the little square and there is no way to contact them.",
"Note: I am not a Square employee, so please don’t complain to me. I’m just a regular person trying to be helpful on the Internet. Square does have a customer support number. However, you do need to log in to reach a real person at Square. Here’s how to do it. Locate your Square login credentials.",
"If you want to use Square Cash with your Apple Watch, you need to enable the app on the device. 1 Open the Apple Watch app on your phone. 2 Tap “My Watch” > “Cash” (Square Cash’s app icon) > toggle “Show App on Apple Watch” on. On your Apple Watch, tap the Cash icon and follow the prompt to open the Square Cash app.",
"Phone number for Square is 877-417-4551. Although, it seems to be a recorded message. I found a great alternative to Square that offers live 24/7 customer support with real human beings to speak with! Go to http://www.mobilecardreader.biz/.",
"I'm deleting my Square account and will do business with a company who actually cares about their customers. Square has worked well for me the last couple of years, until I had a problem with my account. I've asked web-support to supply me with a phone number, so I could actually talk to someone, but no luck. I figure if a company is reputable, they will offer phone support to their customers.",
"I did a little research, and Square actually does provide phone customer support. It's not available 24 hours a day or on weekends, but it is a number you can call to speak with a person. That number is: 1 (855) 700-6000. I found that number on the customer support page."
],
"url": [
"https://answers.yahoo.com/question/index?qid=20110907072434AAkMI1Z",
"https://www.gobankingrates.com/banking/pros-cons-new-square-cash-app-review/",
"https://www.quora.com/Why-doesnt-Square-have-a-customer-service-phone-number",
"https://cash.me/",
"https://answers.yahoo.com/question/index?qid=20110907072434AAkMI1Z",
"https://www.quora.com/Why-doesnt-Square-have-a-customer-service-phone-number",
"https://www.gobankingrates.com/banking/pros-cons-new-square-cash-app-review/",
"https://answers.yahoo.com/question/index?qid=20110907072434AAkMI1Z",
"https://answers.yahoo.com/question/index?qid=20110907072434AAkMI1Z",
"https://www.quora.com/Why-doesnt-Square-have-a-customer-service-phone-number"
]
} | square cash app customer service number | 501,972 | NUMERIC | [] |
[
"It is a term for any person, animal, or object thought to bring luck – colloquially includes anything used to represent a group with a common public identity, such as a school, professional sports team, society, military unit, or brand name."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Mascot. The term mascot – defined as a term for any person, animal, or object thought to bring luck – colloquially includes anything used to represent a group with a common public identity, such as a school, professional sports team, society, military unit, or brand name.eam mascots may take the form of a logo, person, live animal, inanimate object, or a costumed character, and often appear at team matches and other related events, sports mascots are often used as marketing tools for their teams to children.",
"mascot. 1 any person, animal, or thing supposed to bring good luck. 2 any person, animal, or thing adopted by a group, esp. by a sports team, as a symbol or for good luck: the team's mascot is a bear. any person, animal, or thing adopted by a group, esp. by a sports team, as a symbol or for good luck: the team's mascot is a bear.",
"mascot. a person, animal or thing supposed to bring good luck.ascot. n. 1. a person, animal, or thing considered to bring good luck. [C19: from French mascotte, from Provencal provençal mascotto, charm from masco]. witch",
"In short a mascot is a representative figure, a symbol and a communication tool for somebody/some organization. At its best the mascot personifies their values, communicates effectively and helps them stand out from the crowd.I go over this in more detail here.he following elaborates on qualities of a good mascot – things to aim for. 1 Connection to company profession and values. 2 Simplest thing is to have character do the job the company is best known for. 3 Then give the mascot personality, style and way of doing things that reflect the best things the company stands for.",
"mascot. n. 1. a person, animal, or thing considered to bring good luck.[C19: from French mascotte, from Provencal provençal mascotto, charm from masco]. witchascot. n. 1. a person, animal, or thing considered to bring good luck. [C19: from French mascotte, from Provencal provençal mascotto, charm from masco]. witch",
"A mascot is essentially a well designed cartoon character with strong connection to the company it represents. The following elaborates on qualities of a good mascot – things to aim for. 1 Connection to company profession and values.2 Simplest thing is to have character do the job the company is best known for.3 Then give the mascot personality, style and way of doing things that reflect the best things the company stands for.he following elaborates on qualities of a good mascot – things to aim for. 1 Connection to company profession and values. 2 Simplest thing is to have character do the job the company is best known for. 3 Then give the mascot personality, style and way of doing things that reflect the best things the company stands for.",
"Mascot is a suburb of Sydney, in the state of New South Wales, Australia. Mascot is located 7 kilometres south of the Sydney central business district and is the administrative centre of the City of Botany Bay.n 1920, Mascot was chosen as the site of a public airfield. Nigel Love was leasing 200 acres (0.81 km 2) from the Kensington Race club and in 1921 the Commonwealth Government purchased 161 acres (0.65 km 2) for this purpose.",
"Audran's operetta was so popular that it was translated into English as The Mascot, introducing into the English language a word for any animal, person, or object that brings good luck.The word with this definition was then incorporated into many other languages, although often in the French form mascotte. famous example of a band mascot is Eddie the Head of the English heavy metal band Iron Maiden. Eddie is a zombie-like creature which is personified in different forms on all of the band's albums, most of its singles and some of its promotional merchandise.",
"Noun. 1. mascot-a person or animal that is adopted by a team or other group as a symbolic figure. organism, being-a living thing that has (or can develop) the ability to act or function independently.ascot. n. 1. a person, animal, or thing considered to bring good luck. [C19: from French mascotte, from Provencal provençal mascotto, charm from masco]. witch",
"Many sports teams in the United States (U.S.) have official mascots, sometimes enacted by costumed humans or even live animals. One of the earliest was a taxidermy mount for the Chicago Cubs, in 1908, and later a live animal used in 1916 by the same team. famous example of a band mascot is Eddie the Head of the English heavy metal band Iron Maiden. Eddie is a zombie-like creature which is personified in different forms on all of the band's albums, most of its singles and some of its promotional merchandise."
],
"url": [
"http://www.definitions.net/definition/MASCOT",
"http://www.yourdictionary.com/mascot",
"http://www.thefreedictionary.com/mascot",
"http://www.cgmascot.com/design/mascot-design/",
"http://www.thefreedictionary.com/mascot",
"http://www.cgmascot.com/design/mascot-design/",
"https://en.wikipedia.org/wiki/Mascot,_New_South_Wales",
"https://en.wikipedia.org/wiki/Mascot",
"http://www.thefreedictionary.com/mascot",
"https://en.wikipedia.org/wiki/Mascot"
]
} | what is a mascot | 690,196 | ENTITY | [] |
[
"Yes"
] | {
"is_selected": [
0,
0,
1,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Grapefruit is a citrus fruit. People use the fruit, oil from the peel, and extracts from the seed as medicine. Grapefruit seed extract is processed from grapefruit seeds and pulp obtained as a byproduct from grapefruit juice production.Vegetable glycerin is added to the final product to reduce acidity and bitterness.ome people inhale grapefruit vapors to help the body retain water, for headache, stress, and depression. Grapefruit seed extract vapor has also been inhaled for the treatment of lung infections. In food and beverages, grapefruit is consumed as a fruit, juice, and is used as a flavoring component.",
"From Wikipedia, the free encyclopedia. Grapefruit seed extract (GSE), also known as citrus seed extract, is a liquid extract derived from the seeds, pulp, and white membranes of grapefruit.Self-made natural GSE processed in the laboratory without synthetic agents is prepared by grinding the grapefruit seed and juiceless pulp, then mixing with glycerin.here is evidence that the extract of citrus grapefruit seed has antioxidant properties. Analysis shows the constituents of the seed extract and pulp are flavonoids, ascorbic acid (commonly known as vitamin C), tocopherols, citric acid, limonoids, sterols, and minerals.",
"Grapefruit, as the fruit or juice, is generally recognized as safe by the FDA. However, grapefruit affects MANY other medicines. Before taking grapefruit, talk with your healthcare provider if you take any other medicines. Do not take grapefruit seed extract products that contain preservatives.These can cause serious side effects such as vomiting, seizures, collapse, and coma. Do not get grapefruit seed extract in your eyes or nose. Do not use it on your genitals or rectum. It can cause severe irritation.If you need emergency care, surgery, or dental work, tell the healthcare provider or dentist you are taking this medicine.o not get grapefruit seed extract in your eyes or nose. Do not use it on your genitals or rectum. It can cause severe irritation. If you need emergency care, surgery, or dental work, tell the healthcare provider or dentist you are taking this medicine.",
"Some people inhale grapefruit vapors to help the body retain water, for headache, stress, and depression. Grapefruit seed extract vapor has also been inhaled for the treatment of lung infections. In food and beverages, grapefruit is consumed as a fruit, juice, and is used as a flavoring component.In manufacturing, grapefruit oil and seed extract are used as a fragrance component in soaps and cosmetics; and as a household cleaner for fruits, vegetables, meats, kitchen surfaces, dishes, etc.ome people inhale grapefruit vapors to help the body retain water, for headache, stress, and depression. Grapefruit seed extract vapor has also been inhaled for the treatment of lung infections. In food and beverages, grapefruit is consumed as a fruit, juice, and is used as a flavoring component.",
"However, as a non-toxic, natural remedy, it had none of the side effects of the other treatments! Grapefruit seed extract has a great selection of vitamins that can both do wonders for your general health, and also help you through your treatment for Candida overgrowth.rapefruit seed extract is sold either as a liquid concentrate or in tablets. Both contain the vegetable glycerin, but the tablets will also contain a small amount of filler, such as organic brown rice protein.",
"False positive. However, in an email statement to NutraIngredients-USA, Carolyn Pruett from NutriBiotic, a leading manufacturing of grapefruit seed extract-containing products, dismissed the allegations that the products contain synthetic disinfectants like benzethonium chloride and triclosan.y Stephen DANIELLS Stephen DANIELLS, 07-Jun-2012. Claims by a leading grapefruit seed extract product manufacturer that the detection of synthetic disinfectants in some products is related to a ‘false positive’ interpretation of analytical data have been rejected by a leading analytical expert.",
"Some studies have shown that without these contaminants, a truly natural extract of grapefruit seed and pulp in ethanol or glycerin, had no antibacterial properties. However, GSE apologists claim that GSE can be effective without these contaminants.y personal opinion on it is that it is safer than other preservatives. However, if you prescribe to an organic mindset and lifestyle, you will want to avoid Grapefruit Seed Extract, for it is nothing other than a synthetic chemical.",
"Fortunately, there are some precautions you can take, and grapefruit seed extract is just one of the tools you’ll find to be helpful. Grapefruit seed extract is a totally natural, effective antimicrobial product.ortunately, there are some precautions you can take, and grapefruit seed extract is just one of the tools you’ll find to be helpful. Grapefruit seed extract is a totally natural, effective antimicrobial product.",
"My personal opinion on it is that it is safer than other preservatives. However, if you prescribe to an organic mindset and lifestyle, you will want to avoid Grapefruit Seed Extract, for it is nothing other than a synthetic chemical.Note: Grapefruit essential oil is natural, and not the same thing as Grapefruit Seed Extract.y personal opinion on it is that it is safer than other preservatives. However, if you prescribe to an organic mindset and lifestyle, you will want to avoid Grapefruit Seed Extract, for it is nothing other than a synthetic chemical.",
"Also known as GSE or citrus seed extract, grapefruit seed extract is a derivative of the seeds, pulp and white membranes of grapefruit. The liquid, when made naturally, is rendered by grinding the grapefruit seed and pulp until finely pulverized.Once this has been achieved, glycerin is added to the mixture.lso known as GSE or citrus seed extract, grapefruit seed extract is a derivative of the seeds, pulp and white membranes of grapefruit. The liquid, when made naturally, is rendered by grinding the grapefruit seed and pulp until finely pulverized."
],
"url": [
"http://www.webmd.com/vitamins-supplements/ingredientmono-946-GRAPEFRUIT.aspx?activeIngredientId=946&activeIngredientName=GRAPEFRUIT",
"https://en.wikipedia.org/wiki/Grapefruit_seed_extract",
"http://www.summitmedicalgroup.com/library/medications/pma_grapefruit/",
"http://www.webmd.com/vitamins-supplements/ingredientmono-946-GRAPEFRUIT.aspx?activeIngredientId=946&activeIngredientName=GRAPEFRUIT",
"http://www.thecandidadiet.com/grapefruitseed.htm",
"http://www.nutraingredients-usa.com/Suppliers2/Expert-dismisses-grapefruit-seed-extract-false-positive-explanation",
"http://chemicaloftheday.squarespace.com/most-controversial/2010/1/27/the-truth-about-grapefruit-seed-extract.html",
"http://www.drdavidwilliams.com/antibiotic-resistant-bacteria-solution/",
"http://chemicaloftheday.squarespace.com/most-controversial/2010/1/27/the-truth-about-grapefruit-seed-extract.html",
"http://www.earthclinic.com/supplements/grapefruit_seed_extract.html"
]
} | is grapefruit extract safe | 411,516 | DESCRIPTION | [
"Yes, grapefruit extract is safe."
] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Cooking time is generally 20 to 30 minutes, or until the chicken registers 165°F in the thickest part. Amazingly, all the chicken pieces wind up cooking at about the same rate — dark meat pieces cook a bit slower than white meat, but the thickness of the breast meat means everything finishes around the same time.",
"1 Bake for 20 to 30 minutes: The chicken is done when opaque all the way through and the meat registers at least 165°F in the thickest part. Broil for extra-crispy skin: If you'd like the skin to be a bit more crispy and golden, turn on the broiler for 2 to 3 minutes.",
"Directions. 1 Put some olive oil in the bottom of a 9X13 pan (just enough to put the drumsticks on 2 ). Add drumsticks (space enough apart so they aren't touching each other). 3 Sprinkle generously with pepper and garlic powder. 4 Bake at 375 for half an hour. Bake another half an hour (or until cooked til 160 degrees)).",
"When you roast chicken in a low oven to begin with, then turn up the heat at the end to brown it, the meat is falling-off-the-bone tender while the skin is crisp. Slow roasting is a technique chefs use. A whole leg consists of the thigh and drumstick in one piece. You can also roast all drumsticks or all thighs.",
"In the dish, arrange the legs skin sides up, packing them tightly. Sprinkle with olive oil, salt, pepper, and oregano. Cover the dish with foil. 3. Roast the legs for 1 hour or until they are tender and the skin shrinks from the ends of the drumsticks. 4. Turn the oven temperature up to 550.",
"1 Put some olive oil in the bottom of a 9X13 pan (just enough to put the drumsticks on 2 ). Add drumsticks (space enough apart so they aren't touching each other). 3 Sprinkle generously with pepper and garlic powder. Sprinkle lightly with salt. Bake at 375 for half an hour.",
"1 Preheat the oven to 400°F: Pat the chicken dry using paper towels and transfer to a mixing bowl. Toss the chicken with olive oil, salt, and pepper: Start with 1 tablespoon of olive oil and add more if needed to coat each piece. Sprinkle with salt and pepper and toss until the pieces are evenly seasoned.",
"Selecting a Chicken. Type: First (and obviously most important), look for a whole chicken. They are usually called “fryers” or “roasters” at your grocery store. Weight: For this recipe, you’ll need a chicken close to 4 pounds, and no smaller than 3. Adjust your cook time accordingly if you choose a smaller bird. Quality: When it comes to roasted chicken, you truly can’t go wrong. Just get the best-quality one within your budget.",
"1 Sprinkle lightly with salt. 2 Bake at 375 for half an hour. Turn drumsticks over and add more garlic powder, pepper and salt (same as before). Bake another half an hour (or until cooked til 160 degrees)).",
"1 Arrange the chicken on a baking sheet: Transfer the seasoned chicken pieces to a baking sheet and arrange them skin-up in a single layer with a bit of space between each piece. Bake for 20 to 30 minutes: The chicken is done when opaque all the way through and the meat registers at least 165°F in the thickest part."
],
"url": [
"http://www.thekitchn.com/how-to-cook-chicken-the-easiest-simplest-method-cooking-lessons-from-the-kitchn-216562",
"http://www.thekitchn.com/how-to-cook-chicken-the-easiest-simplest-method-cooking-lessons-from-the-kitchn-216562",
"http://www.food.com/recipe/simple-baked-chicken-drumsticks-443758",
"https://www.bostonglobe.com/lifestyle/food-dining/2015/01/20/recipe-for-slow-roasted-whole-chicken-legs/R9SChZULtewOV4XqI5ULVJ/story.html",
"https://www.bostonglobe.com/lifestyle/food-dining/2015/01/20/recipe-for-slow-roasted-whole-chicken-legs/R9SChZULtewOV4XqI5ULVJ/story.html",
"http://www.food.com/recipe/simple-baked-chicken-drumsticks-443758",
"http://www.thekitchn.com/how-to-cook-chicken-the-easiest-simplest-method-cooking-lessons-from-the-kitchn-216562",
"https://www.pillsbury.com/everyday-eats/dinner-tonight/chicken/how-to-roast-a-whole-chicken-you-can-do-it",
"http://www.food.com/recipe/simple-baked-chicken-drumsticks-443758",
"http://www.thekitchn.com/how-to-cook-chicken-the-easiest-simplest-method-cooking-lessons-from-the-kitchn-216562"
]
} | how long to oven roast chicken legs | 271,661 | NUMERIC | [] |
[
"Charlotte Bacon, Daniel Barden, Jesse Lewis were killed in shooting."
] | {
"is_selected": [
1,
0,
1,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Twenty children and six adults were killed during a shooting at Sandy Hook Elementary School in Newtown, Conn., in one of the deadliest school shootings in U.S. history. Charlotte Bacon. Charlotte Bacon, 6, was among the 20 students killed when a gunman opened fire at Sandy Hook Elementary School in Newtown, Conn. Daniel Barden. Daniel Barden, 7, was among the 20 students killed when a gunman opened fire at Sandy Hook Elementary School in Newtown, Conn.",
"Joann Ward, 30, and daughters Brooke Ward, 5, and Emily Garza, 7, were killed in Sunday's shooting, according to Rob Smith, Joann Ward's brother-in-law. She leaves behind her husband, Chris Ward, and two surviving children, Ryland and Rihanna Ward.",
"Jesse Lewis, 6, was among the 20 students killed when a gunman opened fire at Sandy Hook Elementary School in Newtown, Conn. This autumn 2011 photo was provided by the Jesse Lewis Choose Love Foundation shows.",
"Twenty children and six adults were killed during a shooting at Sandy Hook Elementary School in Newtown, Conn., in one of the deadliest school shootings in U.S. history. Charlotte Bacon (Credit: Facebook)",
"# Killed # Injured Operations; February 13, 2018: Missouri: Kansas City (Raytown) 6307 Ash Ave: 0: 1: View Incident; View Source; February 12, 2018: Alabama: Birmingham: 5001 Sugar Ray Dr: 0: 2: View Incident; View Source; February 11, 2018: Ohio: Cleveland: 6800 block of Guthrie Ave: 0: 1: View Incident; View Source; February 10, 2018: Missouri: Barnhart: 7218 Valley Dr: 2: 0: View Incident; View Source",
"The others in the family who died were Danny Holcombe, 36, Bryan and Karla Holcombe's son; Noah Holcombe, Danny's 17-month-old daughter; Crystal Holcombe, 36, the pregnant wife of Bryan and Karla's other son, John, who survived the shooting; and three of Crystal Holcombe's five children -- Emily, 11, Megan, 9, and Greg Hill, 13 -- to whom John Holcombe was stepfather.",
"Bowman's name had been released by authorities earlier in the day, along with the 13 other victims of the mass shooting Wednesday in San Bernardino. He was 46. Bowman was one of the earliest contributors to CREATE, a USC center that studies national security and terrorism, the director said in an email.",
"Sara and Dennis Johnson were members of the First Baptist Church in Sutherland Springs for 11 years. Dennis Johnson, 77, and his wife, Sara, 68, who were members of First Baptist, died in the shooting, said Kati Wall, one of the couple's six children. The Johnsons, who celebrated their 44th wedding anniversary on July 27, were expecting their fourth great-grandchild, according to a GoFundMe page set up by a relative.",
"This photo provided by the Wyatt family shows Allison Wyatt, 6, who was killed Friday, Dec. 14, 2012, when a gunman opened fire at Sandy Hook Elementary in Newtown, Conn., killing 20 children and six adults at the school.",
"Nancy J. Lanza, mother of shooter Adam Lanza, was found dead in her home Dec. 14, 2012. Police say she was killed by her son, who then opened fire in Sandy Hook Elementary School, killing 20 students and six teachers before killing himself. Jesse Lewis"
],
"url": [
"http://www.newsday.com/news/nation/newtown-shooting-victims-photos-1.4336461",
"https://www.cnn.com/2017/11/06/us/texas-church-shooting-victims-list/index.html",
"http://www.newsday.com/news/nation/newtown-shooting-victims-photos-1.4336461",
"http://www.newsday.com/news/nation/newtown-shooting-victims-photos-1.4336461",
"http://www.gunviolencearchive.org/reports/child-injured-killed",
"https://www.cnn.com/2017/11/06/us/texas-church-shooting-victims-list/index.html",
"http://www.latimes.com/local/lanow/la-me-ln-san-bernardino-shooting-victims-htmlstory.html",
"https://www.cnn.com/2017/11/06/us/texas-church-shooting-victims-list/index.html",
"http://www.newsday.com/news/nation/newtown-shooting-victims-photos-1.4336461",
"http://www.newsday.com/news/nation/newtown-shooting-victims-photos-1.4336461"
]
} | list of kids that were killed in shooting | 1,174,087 | PERSON | [] |
[
"GMFS stands for Greater Manchester Fire Service."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
1,
0
],
"passage_text": [
"Nov 3, 2009 at 12:53 PM #1. 03hizzoe New Member Posts: 0. Likes Received: 0. Joined: Nov 3, 2009. Location: Dallas Texas. Hey guys...I'm a newbie from Dallas Texas. I have a 2003 Tahoe on 24s. I keep seeing all over this site a couple abbreviations that I can't determine what they stand for. NNBS? OBS? Any other common abbreviations that will help me understand what everyone is talking about",
"All Acronyms. GMFS [Internet]; Dec 21, 2017 [cited 2017 Dec 21]. Available from: http://www.allacronyms.com/GMFS/monitoring. MHRA 'GMFS', All Acronyms, 21 December 2017, <http://www.allacronyms.com/GMFS/monitoring> [accessed 21 December 2017] Bluebook All Acronyms, GMFS (Dec. 21, 2017, 3:12 AM), available at http://www.allacronyms.com/GMFS/monitoring. CSE All Acronyms. GMFS [Internet]; December 21, 2017 [cited 2017 DEC 21]. Available from: http://www.allacronyms.com/GMFS/monitoring.",
"Gross Motor Function Classification System. The Gross Motor Function Classification System or GMFCS is a 5 level clinical classification system that describes the gross motor function of people with cerebral palsy on the basis of self-initiated movement abilities. Particular emphasis in creating and maintaining the GMFCS scale rests on evaluating sitting, walking, and wheeled mobility. Distinctions between levels are based on functional abilities; the need for walkers, crutches, wheelchairs, or canes / walking sticks; and to a much lesser",
"What does GMFU stand for? What does GMFU mean? This page is about the various possible meanings of the acronym, abbreviation, shorthand or slang term: GMFU. Filter by: Sort by:Popularity Alphabetically Category",
"3 definitions of GMFR. Meaning of GMFR. What does GMFR stand for? GMFR abbreviation. Define GMFR at AcronymFinder.com",
"1 meanings of GMFS acronym and GMFS abbreviation in Monitoring. Get the definition of GMFS in Monitoring by All Acronyms dictionary. Top Definition: Global Monitoring for Food Security In Monitoring.",
"New from Dallas...what does NNBS stand for? Discussion in 'Introduction' started by 03hizzoe, Nov 3, 2009. Hey guys...I'm a newbie from Dallas Texas. I have a 2003 Tahoe on 24s. I keep seeing all over this site a couple abbreviations that I can't determine what they stand for.",
"Founded in 1999, GMFS has approximately 250 employees. In 2016, GMFS originated approximately $2.1 billion in mortgage loans and at year end 2016 it services approximately $5.5 billion in loans – more about GMFS Equal Housing Lender. © 2017 GMFS, LLC. Upfront approval subject to satisfactory property review and no change in financial condition. Some products may not be available in all states. All loans subject to credit approval. All mortgages are originated by GMFS LLC at 7389 Florida Blvd. Suite 200A Baton Rouge, LA 70806. NMLS #64997. LA License 619. The retail division of GMFS LLC is Doing Business As “GMFS Mortgage”.",
"How is Greater Manchester Fire Service abbreviated? GMFS stands for Greater Manchester Fire Service. GMFS is defined as Greater Manchester Fire Service very rarely. GMFS stands for Greater Manchester Fire Service.",
"We are one of the fastest growing mortgage companies in the United States offering great mortgage financial solutions. Headquartered in Baton Rouge, Louisiana, GMFS originates residential mortgage loans, primarily in the southern states. Founded in 1999, GMFS has approximately 250 employees. In 2016, GMFS originated approximately $2.1 billion in mortgage loans and at year end 2016 it services approximately $5.5 billion in loans."
],
"url": [
"http://www.gmfullsize.com/threads/new-from-dallas-what-does-nnbs-stand-for.173134/",
"https://www.allacronyms.com/GMFS/monitoring",
"https://en.wikipedia.org/wiki/GMFCS",
"http://www.abbreviations.com/GMFU",
"https://www.acronymfinder.com/GMFR.html",
"https://www.allacronyms.com/GMFS/monitoring",
"http://www.gmfullsize.com/threads/new-from-dallas-what-does-nnbs-stand-for.173134/",
"https://gmfspartners.com/",
"https://www.acronymattic.com/Greater-Manchester-Fire-Service-(GMFS).html",
"https://gmfspartners.com/"
]
} | what does gmfs stand for? | 638,329 | DESCRIPTION | [] |
[
"Personnel documents"
] | {
"is_selected": [
0,
0,
0,
0,
1,
0,
0,
0,
0,
0
],
"passage_text": [
"When you go to AKO you click on the Self Service link then go to OMPF link on the right hand side. You can also go to the HRC website and click on the My Record link then click on the Enlisted link then the link for Log into My Record Portal. Once you get that to load click on Active Record Then OPMF on the Right hand side towards the bottom of the list.",
"Improving the quality, accuracy, and consistency of OMPF contents throughout the Army Personnel locations. Providing the ability to maintain a detailed inventory of the active, inactive and transfer records. Providing a complete backup of the system, the personnel records, and related iPERMS data.",
"The Link To Request An Account May Be Accessed At Https://www. http://www.apd.army.mil/pdffiles/m600_8_104.pdf. Minnesota National Guard. After Your Photo Is Approved It Will Be Completed In Dapmis And Uploaded Into Iperms. We Cannot Reproduce Or Email Da Photos Until They Are Completed By Dapmis.",
"Interactive Personnel Electronic Records Management System (IPERMS) IPERMS is a record management system that is normally used by the army of the United States of America. The system is supported online hence its accessibility is very great. Great accessibility comes in where anyone who is authorized can access the system even if he/she is located at a far distance.",
"A list of common symbols, acronyms, and terminology is. provided as an attachment to the Introduction. DRAFT! 5/3/2006. 2. System Overview. iPERMS includes several subsystems, that follow the workfl ow for adding personnel documents to the system and for managing the documents. once they are in the system.",
"Record Input is the process of converting paper documents into digital images and associating the images with data. The image capture process. includes scanning, recognition, and release of data and images to the IQC server. Scan. Scanning converts paper records into digital images.",
"Below is the link to access your OMPF: you will need a CAC reader or simply use your AKO login. But keep in mind that sometimes all your files do not make it into your OMPF. If that is the case, you will need to contact your prior duty stations and hope they have a copy. This Site Might Help You.",
"dation, Verifi cation, and Quality Control subsystem). In IQC, the images are organized into documents, indexed, and released to Input Processing for. error checking, data transfer and storage, and placement into soldier records.",
"To add new or missing documents to your OMPF take them to your S1 or Unit Personnel Office. Have them transmit your documents to SRDC via iPERMS Web Upload. Your document should be on your OMPF within 72 hours of receipt. Review your OMPF often to ensure it is always updated and accurate.",
"For more information check out our What is IPERMS page. 1 What is IPERMS Army Interactive Personnel Electronic Records Management System (IPERMS) IPERMS is…. Interactive Personnel Electronic Records… You may have heard of the Interactive Personnel Electronic Records…."
],
"url": [
"https://answers.yahoo.com/question/index?qid=20090209124832AA3BAaW",
"http://www.ssi.army.mil/ncoa/AGS_SLC_ALC_REGS/iPERMS%20Intro%20Document.pdf",
"http://pdf-guides.blogspot.com/2012/02/iperms.html",
"http://akoarmymil.com/iperms/",
"http://www.ssi.army.mil/ncoa/AGS_SLC_ALC_REGS/iPERMS%20Intro%20Document.pdf",
"http://www.ssi.army.mil/ncoa/AGS_SLC_ALC_REGS/iPERMS%20Intro%20Document.pdf",
"https://answers.yahoo.com/question/index?qid=20090209124832AA3BAaW",
"http://www.ssi.army.mil/ncoa/AGS_SLC_ALC_REGS/iPERMS%20Intro%20Document.pdf",
"https://answers.yahoo.com/question/index?qid=20090209124832AA3BAaW",
"http://akoarmymil.com/iperms/"
]
} | what documents can be submitted into iperms | 627,431 | ENTITY | [] |
[
"No, Green olives doesn't contains protein."
] | {
"is_selected": [
0,
0,
0,
0,
1,
0,
0,
0,
0,
0
],
"passage_text": [
"Iron and Zinc. Olives are a good source of iron and zinc. They provide 3.3 mg of iron, or about 25 percent of the daily value, and 0.22 mg of zinc, or 17 percent of the daily value, in 1 cup of olives. Iron is essential for the hemoglobin in red blood cells.",
"Unlike many other oils, which are extracted from nuts and seeds, the olive is obtained from the olive berries and hence, carries large amounts of plant-derived anti-oxidants, phyto-sterols, and vitamins. Olive oil is recognized as one of the healthiest edible oils since it contains less saturated fats. Additionally, it composes linoleic (omega-6) and linolenic acid (omega-3) essential fatty acids at a recommended 8:1 ratio. The oil is high in calories. Its high-calorie content chiefly comes from its fats.",
"One tbsp. of olives contains 43 ug of the carotenoids. While the USDA does not have a recommended daily intake for lutein and zeaxanthin, recent studies have shown a health benefit with lutein and zeaxanthin supplementation at 10 mg and 2 mg per day, respectively.",
"Olive oil is rich in vitamin E. 100 g fresh extra-virgin oil contains 14.39 mcg (about 96% of RDA) of alpha-tocopherol. Vitamin E is a powerful lipid soluble antioxidant, required for maintaining the integrity of cell membrane of mucus membranes and skin through protecting it from harmful oxygen-free radicals.",
"Green Olives (4) (1 serving) calories: 25, fat: 0g, carbs: 0g, protein: 0g. 1 Calories, Fat, Protein, Fiber, & Carbs In Great American Bagel Bagels Asiago With Black & Green Olives. Calories In Devilled Eggs with Jalepeno Stuffed Green Olives. 54 calories, 4g fat, 2g carbs, 3g protein, 0g fiber.",
"1 170 calories, 12g fat, 1g carbs, 13g protein, 0g fiber. 2 Calories In Spaghetti with cauliflower, green olives and almonds. 433 calories, 26g fat, 41g carbs, 13g protein, 7g fiber. Calories In Bariatric Friendly Spinach Feta Won Tons with Green Olives (Serving 2 Won Tons)",
"1 Calories In Spaghetti with cauliflower, green olives and almonds. 433 calories, 26g fat, 41g carbs, 13g protein, 7g fiber. Calories In Bariatric Friendly Spinach Feta Won Tons with Green Olives (Serving 2 Won Tons) 92 calories, 2g fat, 10g carbs, 7g protein, 1g fiber.",
"Olives contain vitamin E, which acts as a potent lipid-soluble antioxidant to protect the cell membranes and other tissues from harmful free radicals. It also plays a role in red blood cell formation, helps the body use vitamin K and keeps the blood vessels from getting too constricted.",
"Relative to their size, olives contain a significant amount of calcium -- 7 mg per tablespoon. Calcium is vital for bone structure, blood clotting, nerve impulse transmission, muscle contraction and secretion of hormones. It also activates and stabilizes proteins and enzymes, optimizing their activities.",
"Olive oil nutrition facts. Chef's favorite, olive oil is one of the principal source of cooking edible oils employed all over the Mediterranean region since centuries. The oil, pressed from olive fruits, oftentimes is revered in many religious texts as a symbol of peace, prosperity, and good health."
],
"url": [
"http://www.livestrong.com/article/370210-what-vitamins-minerals-do-olives-have/",
"http://www.nutrition-and-you.com/olive-oil.html",
"http://www.livestrong.com/article/370210-what-vitamins-minerals-do-olives-have/",
"http://www.nutrition-and-you.com/olive-oil.html",
"http://www.sparkpeople.com/calories-in.asp?food=green+olives",
"http://www.sparkpeople.com/calories-in.asp?food=green+olives",
"http://www.sparkpeople.com/calories-in.asp?food=green+olives",
"http://www.livestrong.com/article/370210-what-vitamins-minerals-do-olives-have/",
"http://www.livestrong.com/article/370210-what-vitamins-minerals-do-olives-have/",
"http://www.nutrition-and-you.com/olive-oil.html"
]
} | do olives contain protein | 158,138 | DESCRIPTION | [] |
[
"Take a look at last year’s income tax return. Compare it to this year’s."
] | {
"is_selected": [
0,
1,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"As an example, if your underpayment is $500 and the interest rate is 3.30 percent, the interest you owe is $16.50, and the total amount you owe is $516.50. Step 3. Compound the daily interest by multiplying the amount you owe for the current day by the interest percentage and adding the result to the current daily balance. As an example, if your current daily balance is $516.50, the compounded interest is $17.04 and your new daily balance is $533.54.",
"The rate changes from-year-to-year and from quarter-to-quarter. The interest rate is short-term with a daily compounding interest. Yet, you will not have to pay an underpayment if the amount not paid does not exceed $1,000. A tax underpayment penalty is set by the government and sent to you. It is calculated on what are the current market interest rates. If you wish to calculate it on your own, take a look at last year’s income tax return. Compare it to this year’s.",
"The amount of credits to apply. The date to begin reducing the failure to pay penalty. The date to end reducing the failure to pay penalty. The reset button resets the calculator. Click to compute IRS penalties and interest. The IRS adjustment date is used to start calculating the accuracy-related penalty. The IRS adjustment amount is used to determine the amount of the accuracy-related penalty.",
"Generally, most taxpayers will avoid this penalty if they either owe less than $1,000 in tax after subtracting their withholding and estimated tax payments, or if they paid at least 90% of the tax for the current year or 100% of the tax shown on the return for the prior year, whichever is smaller.",
"If you do not pay your tax or you pay an insufficient amount of tax through withholding, you might also have to pay estimated taxes. If you did not pay enough tax throughout the year, either through withholding or by making estimated tax payments, you may have to pay a penalty for underpayment of estimated tax.",
"The return due date starts the failure to file penalty and interest on the failure to file penalty. The tax due date starts the failure to pay penalty and interest on tax owed. The date return submitted lets the calculator know when to stop calculating the failure to file penalty. The amount due per return determines the amount of penalties and interest, which are both a percentage of any underpayment. The notice date starts the computation of interest on the failure to pay penalty. The notice of intent to levy date is used to determine when to increase the failure to pay penalty.",
"Multiply the amount of the underpayment by the interest rate. Add the result to the underpayment balance to get the amount you owe for the current day. As an example, if your underpayment is $500 and the interest rate is 3.30 percent, the interest you owe is $16.50, and the total amount you owe is $516.50. Compound the daily interest by multiplying the amount you owe for the current day by the interest percentage and adding the result to the current daily balance.",
"Topic 306 - Penalty for Underpayment of Estimated Tax. The United States income tax system is a pay-as-you-go tax system, which means that you must pay income tax as you earn or receive your income during the year. You can do this either through withholding or by making estimated tax payments.",
"Generally, taxpayers should make estimated tax payments in four equal amounts to avoid a penalty. However, if you receive income unevenly during the year, you may be able to vary the amounts of the payments to avoid or lower the penalty by using the annualized installment method.",
"The penalty you will have to pay will equal the federal short-term interest rate plus five and one half percentage points (adjusted quarterly), but not less than 7.5%. The underpayment penalty applies if your 2015 withholding and estimated tax payments do not equal: 90% of the tax shown on your 2015 return."
],
"url": [
"http://finance.zacks.com/calculate-compound-daily-interest-tax-underpayment-3081.html",
"http://www.taxationlawfirms.com/resources/tax/tax-penalties/calculating-tax-underpayment-penalty",
"https://www.irscalculators.com/irs-penalty-calculator.php",
"https://www.irs.gov/taxtopics/tc306.html",
"https://www.irs.gov/taxtopics/tc306.html",
"https://www.irscalculators.com/irs-penalty-calculator.php",
"http://finance.zacks.com/calculate-compound-daily-interest-tax-underpayment-3081.html",
"https://www.irs.gov/taxtopics/tc306.html",
"https://www.irs.gov/taxtopics/tc306.html",
"https://www.tax.ny.gov/pit/file/interest_and_penalties.htm"
]
} | how to calculate underpayment penalty interest | 347,478 | DESCRIPTION | [
"To calculate underpayment penalty interest, take a look at last year’s income tax return and compare it to this year’s."
] |
[
"No"
] | {
"is_selected": [
1,
1,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"CyberTruth. BullGuard has just launch a new, free virus scanner for Windows PCs (Photo: BullGuard). SAN JOSE, CA -- If you use a Windows PC that's running slow and you suspect that it has been infected by malware, there's a new free tool you might want to try out.yberTruth. BullGuard has just launch a new, free virus scanner for Windows PCs (Photo: BullGuard). SAN JOSE, CA -- If you use a Windows PC that's running slow and you suspect that it has been infected by malware, there's a new free tool you might want to try out.",
"BullGuard virus removal is there to identify the virus and malware infections, along with the other vulnerabilities. It runs a full scan on the computer system to verify its health status and remove all the existing malicious programs found during the scan.Yogi provides a comprehensive suite of services to install BullGuard virus removal onyour computer system. If you need any technical assistance to install this program, call iYogi technical support, which is reliable and affordable.",
"View all 13 photos in gallery Good Lab Test Results BullGuard participates in testing with several of the independent labs that I follow. Of the last twelve tests by Virus Bulletin, BullGuard participated in 10 and received VB100 certification in all 10.AV-Test Institute rates antivirus products on protection, performance, and usability, with six points possible in each category. BullGuard earned 5.5 in all three, for a total of 16.5 points.Note, though, that Kaspersky Anti-Virus (2015) and Avira Free AntiVirus (2014) scored a perfect 18 of 18 possible points. BullGuard Antivirus (2015) Lab Tests Chart. The researchers at AV-Comparatives run a wide variety of antivirus tests.iew all 13 photos in gallery Good Lab Test Results BullGuard participates in testing with several of the independent labs that I follow. Of the last twelve tests by Virus Bulletin, BullGuard participated in 10 and received VB100 certification in all 10.",
"BullGuard Antivirus 2014 comes with an impenetrable protection system based on multiple defence layers. These make sure all online threats, including the newest types of viruses, spyware, phishing, rootkits, botnets, malicious links and spam, stay out of your system.Easy to use.rings the dark to the light. Malicious code often hides in websites. When you unwittingly click on a link your PC becomes infected and data is often stolen. BullGuard safe browsing warns you of hidden danger lurking in websites – so you’re always protected.",
"DISCOUNT: 20% OFF! BullGuard Antivirus provides a combination of security layers that can keep the most common threats at bay. The antivirus engine is complemented by an antispam module for your email and by a safe browsing component for defense against malicious code.ISCOUNT: 20% OFF! BullGuard Antivirus provides a combination of security layers that can keep the most common threats at bay. The antivirus engine is complemented by an antispam module for your email and by a safe browsing component for defense against malicious code.",
"Today BullGuard has released a free online antivirus scan that you can use to double-check your protection. It just takes a minute to run, and you don't have to disable or uninstall your existing antivirus solution.alan explained that consumers can use the online scan any time they suspect a problem, or simply to double-check their current protection. BullGuard Virus Scan will provide a summary of a system's security status in less than a minute, offering significant peace of mind, Balan concluded.",
"BullGuard Virus Scan is designed for use alongside existing protection, for a quick, painless security check. Hands On with BullGuard I installed the plug-in and ran a quick scan, to get a feel for the product.alan explained that consumers can use the online scan any time they suspect a problem, or simply to double-check their current protection. BullGuard Virus Scan will provide a summary of a system's security status in less than a minute, offering significant peace of mind, Balan concluded.",
"BullGuard was founded in 2002 by two Danish entrepreneurs, Morten Lund and Theis Soendergaard. Søndergaard their aim was to create a POWERFUL pc internet security suite that included all the security features necessary to protect the home and small business. user June 2011 - BullGuard’s Antivirus product was a top three (out of 43 products) with a result of 97.7% in the RAP (reactive and proactive) tests. 2 July 2012 to February 2013 - BullGuard Antivirus maintained a top position in the latest VB100 chart covering the RAP averages.",
"Bullguard is unusual in that they only offer protection for 1 PC. You will need to buy their more expensive Internet Security suite to get protection for more PCs. They do still offer 2 and 3 year subscriptions for a discounted price.ullguard indicates your system's protection status in the home screen showing a green check when your computer is safe and a gray stop sign when there is an issue.",
"We’ve been protecting people online since the Internet exploded in popularity. Whether it’s online banking, shopping, gaming or simply socialising, we’re looking out for you. And we’re quite good at it; according to independent test labs we provide the best antivirus protection there is.You can do your online thing with confidence that you’re fully protected. But we also provide more than internet security and antivirus software.We also offer a premium 24/7 protection suite, web-based identity and social media protection that works across all devices.ou can do your online thing with confidence that you’re fully protected. But we also provide more than internet security and antivirus software. We also offer a premium 24/7 protection suite, web-based identity and social media protection that works across all devices."
],
"url": [
"http://www.usatoday.com/story/cybertruth/2013/07/10/bullguards-free-virus-scanner-checks-pcs-swiftly/2507377/",
"http://www.install-antivirus.com/4730273/bullguard/bullguard-support.html",
"http://www.pcmag.com/article2/0,2817,2473078,00.asp",
"http://bullguard-antivirus.en.softonic.com/",
"http://www.softpedia.com/get/Antivirus/BullGuard-Antivirus.shtml",
"http://securitywatch.pcmag.com/free-downloads/313482-bullguard-releases-free-online-antivirus-scan",
"http://securitywatch.pcmag.com/free-downloads/313482-bullguard-releases-free-online-antivirus-scan",
"https://en.wikipedia.org/wiki/BullGuard",
"https://www.10bestonline.com/top_10_best_antivirus_reviews/Bullguard_review/",
"http://www.bullguard.com/"
]
} | is bullguard a virus | 404,985 | DESCRIPTION | [] |
[
"It is the order of the bytes in multi-byte data types, such as int or float."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Endianness is the order of the bytes in multi-byte data types, such as int or float. It may vary from processor to processor, and even from operating system to operating system. Bi-endianness: Some processors support multiple endian modes, even to the extent of allowing dynamically changing between big and little-endian.",
"A beginner introduction to Endianness. A long time ago, in a very remote island known as Lilliput, society was split into two factions: Big-Endians who opened their soft-boiled eggs at the larger end (the primitive way) and Little-Endians who broke their eggs at the smaller end.",
"Endian may refer to: 1 Endianness, the order of the bytes, comprising a digital word, in computer memory. 2 Endian Firewall, a Linux distribution of the South Tyrolean company Endian.",
"Endianness is only used when breaking something of large value, such as a word, into smaller parts. An order in which to store these parts in the system memory is then formed. It is not used when storing a value into a register that can hold all of it. In this case, all bits, right and left, are equally important.",
"Endianness is the order of the bytes in multi-byte data types, such as int or float. It may vary from processor to processor, and even from operating system to operating system. Detecting the correct endianness is difficult for several reasons:",
"Figure 1. Big-Endian: The most significant byte is stored at the lowest byte address. Whereas architectures that follow the Little-Endian rules will store it as depicted in Figure 2: Figure 2. Little-endian: Least significant byte is stored at the lowest byte address. The Intel x86 family and Digital Equipment Corporation architectures (PDP-11, VAX, Alpha) are representatives of Little-Endian, while the Sun SPARC, IBM 360/370, and Motorola 68000 and 88000 architectures are Big-Endians.",
"Endianness is the function of a system that details integer representation. It orders the way the numbers appear. Much like a spoken language, integers as part of codes must be translated onto paper. While some cultures read right to left and some read left to right, numbers in codes can also be arranged either from right to left or left to right.",
"Basic Memory Concepts. In order to understand the concept of big and little endian, you need to understand memory. Fortunately, we only need a very high level abstraction for memory. You don't need to know all the little details of how memory works. All you need to know about memory is that it's one large array.",
"What are these? Little and big endian are two ways of storing multibyte data-types ( int, float, etc). In little endian machines, last byte of binary representation of the multibyte data-type is stored first. On the other hand, in big endian machines, first byte of binary representation of the multibyte data-type is stored first.",
"Endianness refers to how hexadecimal data is ordered in machine language, the simplest, most understandable code that a computer can use. In computer coding, certain numbers, usually two bytes long (1 byte = 8 bits) that are called words, can be written or input in two ways: little-endian and big-endian. It depends on the data format and the way the computer reads the data."
],
"url": [
"https://sourceforge.net/p/predef/wiki/Endianness/",
"https://www.codeproject.com/articles/4804/basic-concepts-on-endianness",
"https://en.wikipedia.org/wiki/Endian",
"http://www.wisegeek.com/what-is-endianness.htm",
"https://sourceforge.net/p/predef/wiki/Endianness/",
"https://www.codeproject.com/articles/4804/basic-concepts-on-endianness",
"http://www.wisegeek.com/what-is-endianness.htm",
"https://www.cs.umd.edu/class/sum2003/cmsc311/Notes/Data/endian.html",
"http://www.geeksforgeeks.org/little-and-big-endian-mystery/",
"https://simple.wikipedia.org/wiki/Endianness"
]
} | what is endianness | 743,820 | DESCRIPTION | [] |
[
"The pairs of integers that have the same absolute value."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Integers are the counting numbers and their negative counterparts, and zero. Opposite integers are the pairs of integers that have the same absolute value, or, in other words, are the same distance from zero. 10 and -10 are opposite integers. 43 and -43 are opposite integers. It's just that simple.",
"6.NS.C.7c. Understand the absolute value of a rational number as its distance from 0 on the number line; interpret absolute value as magnitude for a positive or negative quantity in a real-world situation.",
"The opposite value. To find the opposite value of an integer you simply change it to negative if it is positive, or change it to positive if it is negative. This is the additive inverse. The opposite kind of number. There isn't really an opposite of an integer-there are many types of numbers that aren't integers. An integer is a 'whole number' - like 6, -5, or 1029687. Another type of number is a rational number, also known as a 'fraction' or 'decimal'. Examples would be 3.4, 5 1/2, -8.9925.",
"The opposite value To find the opposite value of an integer you simply change it to negative if it is positive, or change it to positive if it is negative. This is the additiv … e inverse. The opposite kind of number There isn't really an opposite of an integer-there are many types of numbers that aren't integers.",
"Another notation that you will see for opposite is another negative sign! The opposite of -4 can also be written as. So, Note: In the subtraction lesson, you'll be putting a + in with that answer: Try it: Find the opposite of 10. Find the opposite of -7.",
"1 It is neither positive nor negative. 2 The sign of an integer is either positive (+) or negative (-), except zero, which has no sign. 3 Two integers are opposites if they are each the same distance away from zero, but on opposite sides of the number line. 4 One will have a positive sign, the other a negative sign.",
"6.NS.C.6a. Recognize opposite signs of numbers as indicating locations on opposite sides of 0 on the number line; recognize that the opposite of the opposite of a number is the number itself, e.g., –(–3) = 3, and that 0 is its own opposite.",
"1 The sign of an integer is either positive (+) or negative (-), except zero, which has no sign. 2 Two integers are opposites if they are each the same distance away from zero, but on opposite sides of the number line. 3 One will have a positive sign, the other a negative sign.",
"1 The integer zero is neutral. 2 It is neither positive nor negative. 3 The sign of an integer is either positive (+) or negative (-), except zero, which has no sign. 4 Two integers are opposites if they are each the same distance away from zero, but on opposite sides of the number line.",
"1 This is indicated by the arrows. 2 Whole numbers greater than zero are called positive integers. 3 These numbers are to the right of zero on the number line. 4 Whole numbers less than zero are called negative integers."
],
"url": [
"http://www.answers.com/Q/What_are_opposite_integers",
"http://www.mathgames.com/skill/6.58-absolute-value-and-opposite-integers",
"http://www.answers.com/Q/What_is_the_opposite_of_an_integer",
"http://www.answers.com/Q/What_are_opposite_integers",
"http://www.coolmath.com/prealgebra/08-signed-numbers-integers/05-signed-numbers-integers-opposite-02",
"http://www.mathgoodies.com/lessons/vol5/intro_integers.html",
"http://www.mathgames.com/skill/6.58-absolute-value-and-opposite-integers",
"http://www.mathgoodies.com/lessons/vol5/intro_integers.html",
"http://www.mathgoodies.com/lessons/vol5/intro_integers.html",
"http://www.mathgoodies.com/lessons/vol5/intro_integers.html"
]
} | what is an integers opposite | 715,493 | DESCRIPTION | [] |
[
"Tides are commonly semi-diurnal (two high waters and two low waters each day), or diurnal (one tidal cycle per day)."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"Definition of tide for English Language Learners. : 1 the regular upward and downward movement of the level of the ocean that is caused by the pull of the Sun and the Moon on the Earth. : 2 the flow of the ocean's water as the tide rises or falls. : 3 the way in which something is changing or developing.",
"Diurnal inequality. The difference in height of the two high waters, or of the two low waters of each tidal day. Also, the difference in speed between the two flood tidal currents, or the two ebb currents of each tidal day. Diurnal inequality is sometimes called declinational inequality.",
"This glossary contains the list of terms and expressions (in French and in English) appearing on this WEB site, and the definitions for each of these terms. Also available in this glossary are lists of acronyms and their meaning in French and in English.",
"The Mediterranean - no tides and a great place to start sailing! You may come across the terms ‘tidal’ and ‘non-tidal’ with reference to RYA sailing certificates. Here’s some information about exactly what this means. I hope it will tell you a few things you didn’t know before ….",
"Definition of tide for Students. 1 1 : the rising and falling of the surface of the ocean caused twice daily by the attraction of the sun and the moon. 2 2 : something that rises and falls or rushes in a mass The tide of public opinion often changes.",
"Tidal phenomena are not limited to the oceans, but can occur in other systems whenever a gravitational field that varies in time and space is present. For example, the solid part of the Earth is affected by tides, though this is not as easily seen as the water tidal movements.",
"Primary constituents include the Earth's rotation, the position of the Moon and Sun relative to the Earth, the Moon's altitude (elevation) above the Earth's equator, and bathymetry. Variations with periods of less than half a day are called harmonic constituents.",
"Tides are commonly semi-diurnal (two high waters and two low waters each day), or diurnal (one tidal cycle per day). The two high waters on a given day are typically not the same height (the daily inequality); these are the higher high water and the lower high water in tide tables.",
"You may come across the terms ‘tidal’ and ‘non-tidal’ with reference to RYA sailing certificates. Here’s some information about exactly what this means. Most of the oceans of the world are subject to tides, which are caused by the combined effects of the gravitational forces exerted by the Sun and the Moon and the rotation of the Earth.",
"of, pertaining to, characterized by, or subject to tides: a tidal current. 2. dependent on the state of the tide as to time of departure: a tidal steamer. Origin of tidal."
],
"url": [
"https://www.merriam-webster.com/dictionary/tide",
"http://www.waterlevels.gc.ca/eng/info/glossary",
"http://www.waterlevels.gc.ca/eng/info/glossary",
"http://aegeansailingschool.com/sailing/tidal-or-non-tidal-whats-it-all-about/",
"https://www.merriam-webster.com/dictionary/tide",
"https://en.wikipedia.org/wiki/Tide",
"https://en.wikipedia.org/wiki/Tide",
"https://en.wikipedia.org/wiki/Tide",
"http://aegeansailingschool.com/sailing/tidal-or-non-tidal-whats-it-all-about/",
"http://www.dictionary.com/browse/tidal"
]
} | tidal day definition | 520,513 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"With the superbowl literally just around the corner we thought a list about some of the best NFL or American Football related movies and documentaries that are streaming on Netflix for you to watch before the big game with the Denvor Broncos and the Seattle Seahawks clashing in New York at the new MetLife stadium.",
"It stands to reason then, that football is front and center in a number of popular TV shows, whether directly or indirectly. Below are the six best TV shows related to American football that are available for streaming on Netflix.",
"It stands to reason then, that football is front and center in a number of popular TV shows, whether directly or indirectly. Below are the six best TV shows related to American football that are available for streaming on Netflix. Dhani Tackles the Globe.",
"Best on Netflix is the place to discover the best TV shows and movies available on Netflix. Find the newest releases of your favorite movies and TV shows available for streaming on Netflix today.",
"Watch TV shows & movies anytime, anywhere. Plans from $7.99 a month. Watch on your smart TV, game console, PC, Mac, mobile, tablet and more. TV shows & movies streamed instantly over the Internet.",
"Football is front and center in American popular culture. It stands to reason then, that football is front and center in a number of popular TV shows, whether directly or indirectly. Below are the six best TV shows related to American football that are available for streaming on Netflix. Dhani Tackles the Globe.",
"If that’s your plan, Netflix has you covered. With plenty of sports movies, the streaming service can keep you in front of your computer from now until kickoff. Check out which football flicks are currently available to stream on Netflix :",
"When the NFL and college football aren’t enough to scratch your football itch, here’s a ranking of the best football TV shows on Netflix.",
"If that’s your plan, Netflix has you covered. With plenty of sports movies, the streaming service can keep you in front of your computer from now until kickoff. Check out which football flicks are currently available to stream on Netflix : “Varsity Blues”.",
"With plenty of sports movies, the streaming service can keep you in front of your computer from now until kickoff. Check out which football flicks are currently available to stream on Netflix : “Varsity Blues”. Mox (James Van Der Beek) was a smart backup quarterback, and he was fine with that."
],
"url": [
"http://www.whats-on-netflix.com/top-lists/top-5-american-football-docsmovies-to-watch-before-the-superbowl/",
"http://www.instaflicka.com/2012/01/22/the-top-six-football-related-tv-shows-on-netflix-instant/",
"http://www.instaflicka.com/2012/01/22/the-top-six-football-related-tv-shows-on-netflix-instant/",
"http://www.bestonnetflix.com/genre/football-movies/g/12803",
"https://www.netflix.com/",
"http://www.instaflicka.com/2012/01/22/the-top-six-football-related-tv-shows-on-netflix-instant/",
"http://www.ibtimes.com/netflix-movies-list-11-football-films-documentaries-watch-super-bowl-xlix-1796402",
"http://netflixlife.com/2015/08/26/best-football-tv-shows-on-netflix/",
"http://www.ibtimes.com/netflix-movies-list-11-football-films-documentaries-watch-super-bowl-xlix-1796402",
"http://www.ibtimes.com/netflix-movies-list-11-football-films-documentaries-watch-super-bowl-xlix-1796402"
]
} | netflix series american football | 463,499 | ENTITY | [] |
[
"903"
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Latest news from Cameron, WV collected exclusively by city-data.com from local newspapers, TV, and radio stations. Ancestries: American (24.1%), German (15.7%), Irish (15.4%), English (11.3%), Scotch-Irish (2.3%), Italian (1.2%).",
"Cameron is located in Marshall County which is a county located in the U.S. state of West Virginia. It is part of the Wheeling, West Virginia Metropolitan Statistical Area. As of 2000, the population was 35,519. Its county seat is Moundsville.",
"Mayor Betty Scott. A small town with a population of 946 residents according to the 2010 census. Cameron is located in the Northern Panhandle of scenic West Virginia, Cameron is a growing family-based community rich in religious values, heritage and history.",
"According to our research of West Virginia and other state lists there were 9 registered sex offenders living in Cameron, West Virginia as of April 12, 2017. The ratio of number of residents in Cameron to the number of sex offenders is 103 to 1.",
"Cameron, West Virginia Census Data & Community Profile. Welcome to the heart of Cameron city data where you can quickly find the key Cameron detailed data and census information you need.",
"The 2016 Cameron, West Virginia, population is 903. There are 1,051 people per square mile (population density).",
"Cameron, West Virginia. Cameron is a city in Marshall County, West Virginia, United States. It is part of the Wheeling, West Virginia Metropolitan Statistical Area. The population was 946 at the 2010 census. Contents.",
"Nearby Towns. Cameron, WV » Community Life » Cameron WV Census Records - Community Information for Cameron. Welcome to the heart of Cameron city data where you can quickly find the key Cameron detailed data and census information you need.",
"Family in Cameron, West Virginia. The median age is 37.4. The US median is 37.4. 56.24% of people in Cameron, West Virginia, are married. 9.64% are divorced. The average household size is 2.58 people. 47.64% of people are married, with children. 6.69% have children, but are single.",
"For population 25 years and over in Cameron: 1 High school or higher: 81.0%. 2 Bachelor's degree or higher: 9.6%. 3 Graduate or professional degree: 3.2 4 %. Unemployed: 14. 5 0%. Mean travel time to work (commute): 37.6 minutes."
],
"url": [
"http://www.city-data.com/city/Cameron-West-Virginia.html",
"http://www.cameronwv.com/",
"http://www.cameronwv.com/",
"http://www.city-data.com/city/Cameron-West-Virginia.html",
"http://www.americantowns.com/wv/cameron/info",
"http://www.bestplaces.net/people/city/west_virginia/cameron",
"https://en.wikipedia.org/wiki/Cameron,_West_Virginia",
"http://www.americantowns.com/wv/cameron/info",
"http://www.bestplaces.net/people/city/west_virginia/cameron",
"http://www.city-data.com/city/Cameron-West-Virginia.html"
]
} | population of cameron wv | 477,393 | NUMERIC | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"You can also correspond with Amy B Souter through mail at her mailing address at 403 State Highway 110 N, , Whitehouse, Texas - 75791-3109 (mailing address contact number - 903-839-1000). Amy B Souter graduated from Texas Tech University Health Science Center School Of Medicine in 2011. Provider Profile Details:",
"Dr. Amy B. Witman is a physician based out of San Diego, California and her medical specialization is Internal Medicine. She practices in San Diego, California and has the professional credentials of M.D.. The NPI Number for Dr. Amy B. Witman is 1679670327 and she holds a License No. G77904 (California). Her current practice location address is 3811 Valley Centre Dr, , San Diego, California and she can be reached out via phone at 858-764-3345 and via fax at --.",
"How can I gain access to my Type 2 NPI? about The Administrative Simplification provisions of the Health Insurance Portability and Accountability Act of 1996 (HIPAA) mandated the adoption of standard unique identifiers for health care providers and health plans.",
"NPI Number 1356512933 has the Individual type of ownership and has been registered to the following primary business legal name (which is a provider name or healthcare organization name) — MS. AMY B KENNEDY AUDIOLOGIST. Records indicate that the provider gender is Female.",
"By submitting your comment, you agree to the following —. All reviews and comments undergo rigorous screening and must adhere to our strict guidelines of ethics. We do not condone anything that is slanderous, disparaging, derogatory, offensive, prejudicial, insulting or simply rude. We will remove any comments that do not follow or meet these guidelines.",
"NPI Number: 1356512933. Healthcare provider: MS. AMY B KENNEDY AUDIOLOGIST. Practice location address: 107 E WATTS ST ENTERPRISE, AL, 36330-2511",
"The NPI Number for Dr. Amy B. Witman is 1679670327 and she holds a License No. G77904 (California). Her current practice location address is 12395 El Camino Real Ste 115, , San Diego, California and she can be reached out via phone at 858-724-1313 and via fax at 858-724-1314.",
"There are currently no reviews for AMY B LOVSEY Be the first to post a comment or review. Read our reviews / comments about this provider to help you decide if they are right for you.",
"AMY B TRACHTER, PSY.D.,PH.D. is a clinical psychologist in New York, NY. The provider's NPI Number is 1184892986 with a scope of practice of psychologist",
"The enumeration date of this NPI Number is 03/21/2008. NPI Number information was last updated on 04/08/2009. The provider is physically located (Business Practice Location) at: 107 E WATTS ST ENTERPRISE, AL 36330-2511, US MS. AMY B KENNEDY AUDIOLOGIST can be reached at his practice location using the following numbers:"
],
"url": [
"http://npino.com/nurse/1881972727-amy-b-souter/",
"http://npino.com/npi/1679670327-dr.-amy-b.-witman/",
"https://nppes.cms.hhs.gov/",
"https://www.hipaaspace.com/Medical_Billing/Coding/National_Provider_Identifier/Codes/NPI_1356512933.aspx",
"https://npidb.org/doctors/physician_assistants/family_363lf0000x/1124251715.aspx",
"https://www.hipaaspace.com/Medical_Billing/Coding/National_Provider_Identifier/Codes/NPI_1356512933.aspx",
"http://npino.com/npi/1679670327-dr.-amy-b.-witman/",
"https://npidb.org/doctors/physician_assistants/family_363lf0000x/1124251715.aspx",
"https://healthprovidersdata.com/hipaa/codes/NPI-1184892986-amy-b-trachter-psyd-phd",
"https://www.hipaaspace.com/Medical_Billing/Coding/National_Provider_Identifier/Codes/NPI_1356512933.aspx"
]
} | amy b. lovsey npi number | 1,184,710 | NUMERIC | [] |
[
"A few common supplements for nerve pain include alpha-lipoic acid, acetyl-L-carnitine, fish oil, vitamin B12, oat straw extract and skullcap extract."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"A few common supplements for nerve pain include alpha-lipoic acid, acetyl-L-carnitine, fish oil, vitamin B12 (methylcobalamine), oat straw extract and skullcap extract. If your neuropathy was caused as a result of diabetes, the most effective treatment for stopping nerve damage is maintaining proper blood sugar levels.",
"There are a number of medications – both prescription and over-the-counter – that can help alleviate some of the symptoms of peripheral neuropathy. These include pain relievers, antidepressants, anti-seizure medications and capsaicin. Pain relievers generally help relieve pain by reducing inflammation caused by nerve damage. Anti-seizure medications and some antidepressants alter chemical processes in the brain that are related to pain.",
"Older anti-seizure drugs include: 1 Carbamazepine (Carbatrol, Tegretol) 2 Oxcarbazepine (Trileptal) 3 Phenytoin (Dilantin) 4 Valproic acid (Depakene)",
"Has a high potential for abuse. Has no currently accepted medical use in treatment in the United States. There is a lack of accepted safety for use under medical supervision. 2: Has a high potential for abuse. Has a currently accepted medical use in treatment in the United States or a currently accepted medical use with severe restrictions.",
"The most commonly used one is gabapentin (Neurontin), but there are others (see Medications for nerve pain). It takes four to six weeks for the full effect to kick in. Your doctor will start you on a low dose and gradually increase it.",
"Diseases or disorders and their related processes (such as inflammation) can be associated with peripheral neuropathy. 1 Metabolic and endocrine disorders impair the body’s ability to transform nutrients into energy and process waste products, and this can lead to nerve damage.",
"They are not formulated specifically as pain medications, though they can effectively treat certain types of chronic pain. Antidepressants are thought to control chronic pain in two ways. First, they may change the way pain is perceived from the spinal cord to the brain.",
"Not all types of antidepressants are useful as chronic pain medications. Tricyclic antidepressants (TCAs) such as amitriptyline, selective serotonin reuptake inhibitors (SSRIs) such as duloxetine and some others such as nefazodone are commonly used to treat both chronic pain syndromes and nerve pain.",
"Medications for Neuralgia. What is Neuralgia: Neuralgia is a sharp, shocking pain that follows the path of a nerve and is due to irritation or damage to the nerve. Medications to treat Neuralgia. The following list of medications are in some way related to, or used in the treatment of this condition.",
"The following types of antidepressants are often prescribed for neuropathic pain: 1 Tricyclic antidepressants treat diabetic neuropathy, post-herpetic neuralgia (shingles), and central post-stroke pain. These medications include amitriptyline (brand names Amitril, Elavil), imipramine (brand name Tofranil), nortriptyline (brand names Aventyl, Pamelor), and desipramine (brand name Norpramin)."
],
"url": [
"http://www.neuropathytreatmentgroup.com/7-common-treatments-for-nerve-pain/",
"http://www.neuropathytreatmentgroup.com/7-common-treatments-for-nerve-pain/",
"http://www.mayoclinic.org/diseases-conditions/peripheral-neuropathy/in-depth/pain-medications/ART-20045004?pg=2",
"https://www.drugs.com/condition/neuralgia.html",
"https://www.health.harvard.edu/pain/drugs-that-relieve-nerve-pain",
"https://www.ninds.nih.gov/Disorders/Patient-Caregiver-Education/Fact-Sheets/Peripheral-Neuropathy-Fact-Sheet",
"https://www.verywell.com/commonly-used-pain-medication-2564482",
"https://www.verywell.com/commonly-used-pain-medication-2564482",
"https://www.drugs.com/condition/neuralgia.html",
"https://www.spine-health.com/treatment/pain-management/medications-neuropathic-pain"
]
} | list of medications to treat nerve pain | 1,174,086 | ENTITY | [] |
[
"It means to love or admire (someone)very much.",
"Beloved One"
] | {
"is_selected": [
0,
1,
0,
0,
1,
0,
0,
0,
0,
0
],
"passage_text": [
"Search comprehensively and find the name meaning of Adora and its name origin or of any other name in our database. Also note the spelling and the pronunciation of the name Adora and check the initials of the name with your last name to discover how it looks and sounds.",
"Definition of adore for English Language Learners. : 1 to love or admire (someone) very much. : 2 to like or desire (something) very much : to take great pleasure in (something)",
"Name: Adora. Gender: Female. Usage: Adora, of Latin origin, is a popular first name. It is more often used as a girl (female) name. People having the name Adora are in general originating from United Kingdom, United States of America.",
"Definition of adore. adored. ; adoring. transitive verb. 1 : to worship or honor as a deity or as divine. 2 : to regard with loving admiration and devotion He adored his wife. 3 : to be very fond of adores pecan pie.",
"The Name Meaning > Girl Names > Adora. The meaning of the name “Adora” is: “Beloved One”. Additional information: Adora is Latin in origin, being the 3rd person singular, present tense of the late high Latin verb (from ad+orare, literally praying toward) adoro, adorare, adoravi, adoratus/a/um,which means to worship.",
"Origin of the name Dora: A short form of any of the various names containing the Greek element dōron (gift), Dora is also commonly bestowed as an independent given name. From A World of Baby Names by Teresa Norman.Buy the book.",
"adora. 1 third-person singular present indicative of. 2 second-person singular imperative of.",
"adora. 1 third-person singular present indicative form of adorar. 2 second-person singular imperative form of adorar.",
"Adora in song, story & screen: | Edit. Princess Adora is the name of the popular '80s cartoon character also known as She-Ra. Adora is one of the characters in The Little Mermaid. Adora is the title of a historical romance novel, based upon the life of Theodora Maria Cantakouzene (b.1332), Princess of Byzantium, by Bertrice Small.",
"Synonym Discussion of adore. revere, reverence, venerate, worship, adore mean to honor and admire profoundly and respectfully. revere stresses deference and tenderness of feeling a professor revered by her students."
],
"url": [
"http://www.thenamemeaning.com/adora/",
"https://www.merriam-webster.com/dictionary/adore",
"https://themeaningofthename.com/adora/",
"https://www.merriam-webster.com/dictionary/adore",
"http://www.thenamemeaning.com/adora/",
"http://www.babynamewizard.com/baby-name/girl/adora",
"https://en.wiktionary.org/wiki/adora",
"https://en.wiktionary.org/wiki/adora",
"http://www.babynamewizard.com/baby-name/girl/adora",
"https://www.merriam-webster.com/dictionary/adore"
]
} | adora meaning | 11,794 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"That would be reported as V72.11 - other hearing test, plus there would be the documentation for that particular procedure. So, stay away from the V codes. For those of you with paper and pencil, get ready. I have a document for you to look up on the CMS website.",
"Hearing aid service providers must provide hearing aids under the terms of the volume purchase contract. If the audiologist prescribes a non-contract hearing aid, the hearing aid service provider must obtain authorization by providing either: • Reasons the contract aids will not meet the recipient's needs; or.",
"HEARING AID PROCEDURES, EARMOLDS, AND ACCESSORIES. CPT/HCPCSDESCRIPTION FEE HCPCSDESCRIPTION FEE HCPCSDESCRIPTION FEE. 92590/V5010 Hearing Aid Eval, monaural V5014 Hearing Aid Reprogramming V5268 ALD, telephone. 92591/V5010 Hearing Aid Evaluation, binaural V5014 HA Repair, 6 month warranty V5270 ALD, TV. 92592/V5011 Hearing Aid Check, monaural V5014 HA Repair, 1 year warranty V5281 ALD, personal fm/dm system, mon. 92593/V5011 Hearing Aid Check, binaural V5014 HA Repair, In-house V5282. V5011 Fitting/Orientation of HA V5299 Earmold service V5283 ALD, neck loop receiver.",
" There are a number of combination codes that identify both the definitive diagnosis and. common symptoms of that diagnosis. (Source: 2014 Draft ICD-10-CM Official Guidelines for Coding and Reporting) The Top 25 Hearing Services ICD-9 to ICD-10 mappings start on the chart below. Top.",
"Hearing aids that do not prove satisfactory to a user are to be returned to the manufacturer within 90 days from the date the hearing aid is provided to the recipient at no cost to DHS/MHCP or the hearing aid dealer. Manufacturers will not process hearing aid orders unless all authorization requirements are met.",
"ICD-10 Codes Utilized by Audiologists. Introduction. Beginning with the first claim filed to all payers on or after October 1, 2015, the ICD-10 codes must. be utilized in box 21 A-L on the CMS 1500 claim form. Claims containing ICD-9 codes will be rejected. as of October 1, 2015.",
"No, 381.4 should not have been your primary diagnosis code in the first place. Your primary diagnosis code should have been 389.03 - conductive hearing loss middle ear or something comparable with that base upon what you found. A 381.4 could be a secondary diagnosis but not your primary.",
"Hearing aid batteries may not, at one time, be dispensed in a quantity that exceeds a 90-day supply. Hearing aid batteries may not be dispensed unless the recipient is in need of the batteries and requested them. Batteries may be dispensed on the same date as the hearing aid is dispensed.",
"Most ICD-10 audiology codes are 3-5 digits. As found in the ICD-9 coding system, there is no code. for normal hearing acuity. Several changes in audiology codes are notable in the transition from ICD-9-CM to ICD-10-CM.",
"If I found normal hearing sensitivity, my diagnosis has to be basically the presenting sign or symptom or concern and in our case, that concern was hearing and so I typically code 389.9 hearing loss and specify on the basis of what I was looking for by virtue of the patient's presenting concerns."
],
"url": [
"http://www.audiologyonline.com/ask-the-experts/coding-for-normal-hearing-and-241",
"http://www.dhs.state.mn.us/main/idcplg?IdcService=GET_DYNAMIC_CONVERSION&RevisionSelectionMethod=LatestReleased&dDocName=dhs16_146171",
"http://www.audiologist.org/_resources/documents/professionals/pqri/FeeBill-ADA2013.pdf",
"http://www.bcbsm.com/content/dam/public/Providers/Documents/help/faqs/icd10-tipsheet-hearing-audiology.pdf",
"http://www.dhs.state.mn.us/main/idcplg?IdcService=GET_DYNAMIC_CONVERSION&RevisionSelectionMethod=LatestReleased&dDocName=dhs16_146171",
"https://vestibular.org/sites/default/files/Cynthia/ICD_10_SuperbillTemplate_AAALetterhead.pdf",
"http://www.audiologyonline.com/ask-the-experts/coding-for-normal-hearing-and-241",
"http://www.dhs.state.mn.us/main/idcplg?IdcService=GET_DYNAMIC_CONVERSION&RevisionSelectionMethod=LatestReleased&dDocName=dhs16_146171",
"https://vestibular.org/sites/default/files/Cynthia/ICD_10_SuperbillTemplate_AAALetterhead.pdf",
"http://www.audiologyonline.com/ask-the-experts/coding-for-normal-hearing-and-241"
]
} | hearing aid batteries diagnosis code | 200,211 | NUMERIC | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Best Answer: Me gustas means I like you. When someone says Te quiero it can either mean, I want you, or I love you. Usually, I tell my hubby, Te quiero mucho Which would then mean, I want you alot, but in spanish it is understood as I love you very much.But if its sensual, and you say Te quiero. It means I want you.eport Abuse. te quiero means i like u te amo means i love u the difference from me gusta and te quiero is that me gusta is for like i like the food me gusta la comida or me gusta esta casa like i like the house or somthin but te quiero means i like u like as a person would say ilike u u know wat i mean.",
"Report Abuse. te quiero means i like u te amo means i love u the difference from me gusta and te quiero is that me gusta is for like i like the food me gusta la comida or me gusta esta casa like i like the house or somthin but te quiero means i like u like as a person would say ilike u u know wat i mean.eport Abuse. te quiero means i like u te amo means i love u the difference from me gusta and te quiero is that me gusta is for like i like the food me gusta la comida or me gusta esta casa like i like the house or somthin but te quiero means i like u like as a person would say ilike u u know wat i mean.",
"Also these phrases can be combine with the word -- mucho -- that in english will mean -- much -- and that will add more to the meanig of the phrase like for example: Te quiero mucho ------ that will mean ----------I love you a lot or ----------------------------------------...n the english language on the other hand you basically have one phrase (I Love You) that apply to everyone. The following are: Spanish --------------------------------------- English 1.",
"3. tequiero. Spanish texted frase meaning I like you like a friend the absence of the space between te and quiero makes the difference between the common frase te quiero meaning I like or love you like a g/f or b/f.. tequiero. Spanish texted frase meaning I like you like a friend the absence of the space between te and quiero makes the difference between the common frase te quiero meaning I like or love you like a g/f or b/f.",
"A literal translation of te quiero is I want you, but in actual use the meaning is I love you, or I like you.. Tu eres means you are..n the english language on the other hand you basically have one phrase (I Love You) that apply to everyone. The following are: Spanish --------------------------------------- English 1.",
"I translate like: The problem with this phrase is in english we use I love you for everything unlike spanish. I recomend listen a Jose Jose's song Amar y querer. In spanish querer does not mean the same as amar.f we want to say Me caes bien in English, we do this by adding a lot of extra (and often clumsy) words, or by completely rephrasing, to get away from the ambiguous I like you, and a possible romantic mis-interpretation: 1 I like you, as a friend. 2 You are a great friend. 3 You are a great person.",
"Garcilaso: Te quiero simply means I love you.. Of course it depends on the stress and the intonation, but to imply other connotations like in English I want you I think other verbs would be used, such as te deseo or the like.e amo, though it means literally I love you, is more rarely used. I would say, only when you're feeling specially romantic. I could translate I want you to Spanish in several ways, but I think the best one could be te quiero para mi mí or even quiero que seas-mio. mío a",
"Then somewhere between I like you and I love you is a big grey area in English, which is largely covered in Spanish with Te quiero.. In English, the moral equivalent to Te quiero would be things like: 1 Love ya! 2 ILY. (Acronym for I Love You, but very informal). 3 I love you.-- 4 But in contexts, situations, or said with a tone which indicates a playful/less serious intention.f we want to say Me caes bien in English, we do this by adding a lot of extra (and often clumsy) words, or by completely rephrasing, to get away from the ambiguous I like you, and a possible romantic mis-interpretation: 1 I like you, as a friend. 2 You are a great friend. 3 You are a great person.",
"Yo quiero significa I want...smth. Examples: Yo quiero cafe. / Café yo quiero. --------------------------------------... Trabajar if you want to Say i love someone you have to use the preposition. A: Examples yo quiero A. / Maria maría yo quiero a. mi familiaxamples: Yo quiero cafe. / Café yo quiero. --------------------------------------... Trabajar if you want to Say i love someone you have to use the preposition. A: Examples yo quiero A. / Maria maría yo quiero a. mi familia",
"Literally means I want you in spanish, but doesn't always mean that one wants you. While in English one can change from I like you to I love you, Spanish speakers usually has three transitions:1. Me gustas (I like you). 2.. tequiero. Spanish texted frase meaning I like you like a friend the absence of the space between te and quiero makes the difference between the common frase te quiero meaning I like or love you like a g/f or b/f."
],
"url": [
"https://answers.yahoo.com/question/index?qid=20090813220508AA2PALl",
"https://answers.yahoo.com/question/index?qid=20090813220508AA2PALl",
"https://sg.answers.yahoo.com/question/index?qid=20070623084542AAWz594",
"http://www.urbandictionary.com/define.php?term=Te%20quiero",
"https://sg.answers.yahoo.com/question/index?qid=20070623084542AAWz594",
"http://spanish.stackexchange.com/questions/4659/what-does-it-mean-when-a-girl-says-te-quiero-in-this-context",
"http://spanish.about.com/od/usingparticularverbs/a/verbsforlove.htm",
"http://spanish.stackexchange.com/questions/4659/what-does-it-mean-when-a-girl-says-te-quiero-in-this-context",
"https://sg.answers.yahoo.com/question/index?qid=20070718111101AAL8huY",
"http://www.urbandictionary.com/define.php?term=Te%20quiero"
]
} | what does aqimero mean | 632,341 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"How to Use Skype on an iPhone. Four Methods: To make a Video Call To make a Voice Call To send an Instant Message To send an SMS. Make use of your Skype account for video and voice calls, instant messaging and more, even when you’re not at your computer.All you need is the Skype app for iPhone and an Internet connection and you’re all set.Ad.ake use of your Skype account for video and voice calls, instant messaging and more, even when you’re not at your computer. All you need is the Skype app for iPhone and an Internet connection and you’re all set.",
"All you need to do is: 1 Get Skype – Download Skype to your iPhone or iPod touch. 2 Join Skype-Get a free account to enjoy instant messages and free calls and video calls with your friends.3 Sign in to Skype – Sign in and add your friends as contacts, then call, video call and instant message with them, wherever you are.ownloading the latest version of Skype. Skype on your iPhone or iPod touch is free to download, just like Skype on your computer. To get Skype for your iPhone or iPod touch: 1 Open the App Store on your iPhone. 2 Search for the Skype app.",
"To create a new Skype account on your iPhone or iPod touch: 1 Start Skype. 2 Tap Create Account. 3 Read the Skype Terms of Use and tap I agree. 4 In the Create Account window, enter the required personal details, choose your Skype Name and tap Create Account.ownloading the latest version of Skype. Skype on your iPhone or iPod touch is free to download, just like Skype on your computer. To get Skype for your iPhone or iPod touch: 1 Open the App Store on your iPhone. 2 Search for the Skype app.",
"Downloading the latest version of Skype. Skype on your iPhone or iPod touch is free to download, just like Skype on your computer. To get Skype for your iPhone or iPod touch: 1 Open the App Store on your iPhone. 2 Search for the Skype app.ownloading the latest version of Skype. Skype on your iPhone or iPod touch is free to download, just like Skype on your computer. To get Skype for your iPhone or iPod touch: 1 Open the App Store on your iPhone. 2 Search for the Skype app.",
"Skype for iPhone now lets you save and delete photos; gets avatar, people, and chat improvements. Emil Protalinski. Tags: iPhone, Microsoft, Skype. Skype today updated its iPhone app with a slew of new features and improvements based on user suggestions.You can download the new version now directly from Apple’s App Store. First off, the app now lets you save photos you received in chat to your camera roll as well as delete sent photos from a chat.kype today updated its iPhone app with a slew of new features and improvements based on user suggestions. You can download the new version now directly from Apple’s App Store. First off, the app now lets you save photos you received in chat to your camera roll as well as delete sent photos from a chat.",
"In this post, I will show you how to resize a picture on your iPhone using Image Resizer+ …. Step 1: Download Image Resizer+ from the App Store (other options are provided below, but Image Resizer+ is my favorite).Step 2: Launch the app, and tap on the “Photos” option.n this post, I will show you how to resize a picture on your iPhone using Image Resizer+ …. Step 1: Download Image Resizer+ from the App Store (other options are provided below, but Image Resizer+ is my favorite).",
"Introducing the brand new Skype for iPhone – simpler than ever with an even more powerful search. Stay in touch with free video calls, voice calls and messaging on Skype. Features: · Find all of your friends and family in an instant-search for friends, groups, conversations or new contacts on Skype.With over 300 million people using Skype, you’re bound to bump into someone you know. Call your world for free-Free voice and video calls let you talk to your heart’s content with all your friends and family on Skype.",
"· Call your world for free-Free voice and video calls let you talk to your heart’s content with all your friends and family on Skype.· Make low cost calls to mobiles and landlines-Keep in touch with anyone even if they’re not on Skype, with low cost calls to mobiles and landlines. Call your world for free-Free voice and video calls let you talk to your heart’s content with all your friends and family on Skype.",
"Click those and you will exit full-screen mode. Skype should work fine on your iPad-just make sure you have the iPad version installed rather than the iPhone version. Although the iPhone version will work, it probably won't rotate the screen to fill landscape mode when you turn the iPad, whereas the iPad version will.Level 1 (0 points).lick those and you will exit full-screen mode. Skype should work fine on your iPad-just make sure you have the iPad version installed rather than the iPhone version. Although the iPhone version will work, it probably won't rotate the screen to fill landscape mode when you turn the iPad, whereas the iPad version will.",
"You'll probably want to start with tapping to add a profile picture. The menu offers you choice between taking a photo with iPhone's camera or choosing the existing picture. That's very nice of Skype;) We'll choose to choose existing photo and we're redirected to our albums, from where we can choose a nice pic. Step 5.nd Profile has all your profile information and your Skype account settings. You can tap any field here to change your info like we're doing now. Here About Me field is one important field where you can enter your company website, you Facebook account and your self-description. Step 14."
],
"url": [
"http://www.wikihow.com/Use-Skype-on-an-iPhone",
"https://support.skype.com/en/faq/FA12129/getting-started-with-skype-iphone",
"https://support.skype.com/en/faq/FA12129/getting-started-with-skype-iphone",
"https://support.skype.com/en/faq/FA12129/getting-started-with-skype-iphone",
"http://venturebeat.com/2014/10/30/skype-for-iphone-now-lets-you-save-and-delete-photos-gets-avatar-people-and-chat-improvements/",
"http://www.idownloadblog.com/2014/02/16/how-to-resize-picture-iphone/",
"https://itunes.apple.com/us/app/skype-for-iphone/id304878510?mt%3D8",
"https://itunes.apple.com/us/app/skype-for-iphone/id304878510?mt%3D8",
"https://discussions.apple.com/thread/5657495?start=0&tstart=0",
"http://www.youtube.com/watch?v=BE-6O4TLIZw"
]
} | iphone skype enlarge profile picture | 398,146 | DESCRIPTION | [] |
[
"“The straw that stirs the drink” is an old newspaper colloquialism, derived from politics, applied to very successful columnists. It means a commentator with a large following, one whom even the opposition reads."
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"Shortly after his arrival, Jackson alienated Thurman Munson by bragging that I'm the straw that stirs the drink.. That verbal dagger opened a wound in the Yankee captain that never completely healed. Now Munson is gone, killed last summer in the crash of his private jet.",
"Growth is the straw that stirs the drink.. 2009 Dec. 31, Michael Avila, Top 10 ‘geek’ movies of the decade, NBC News (retrieved 19 Oct 2012): [T]ake a bow, pop culture enthusiasts. You are now the straws that stir the drink. Geeks rule! 2010 March 15, Josh Levine, The Turbulent Times of Formula One, Time: [H]e's still the straw that stirs the drink. Ecclestone alone makes the big TV, sponsorship and track deals that keep F1's cash gushing.",
"straw that stirs the drink (plural straws that stir the drink) (idiomatic, almost always preceded by the) The person who stimulates or inspires a group; the major factor affecting a trend or set of developments. 1977 May 26, Dave Anderson, Reggie's woes, Star-News (North Carolina, USA), p. 7D (retrieved 19 Oct 2012): Reggie Jackson .",
"Martinez Jackson was a single father, and theirs was one of the few black families in Wyncote. Jackson graduated from Cheltenham High in 1964, where he excelled in football, basketball, baseball, and track and field. A tailback in football, he injured his knee in an early season game in his junior year.",
"Trump’s airstrike on Syria delivers another blow to Obama’s legacy. With apologies to noted philosopher Reggie Jackson, Barack Obama is the straw that stirs the drink. But sometimes, he stirs it bad. In 2008, Obama took the Democratic Party to new highs. Six years later, he took it to the toilet.",
"Wanted: A Straw to Stir the Drink. “The straw that stirs the drink” is an old newspaper colloquialism, derived from politics, applied to very successful columnists. It means a commentator with a large following, one whom even the opposition reads. (It’s heard in baseball circles, too.",
"Reggie denies 'straw that stirs the drink' comment. Reggie Jackson insists in his new autobiography that he never disparaged Thurman Munson in an attention-grabbing Sport magazine report 36 years ago, a claim the author immediately denied. Post to Facebook.",
"Reggie denies 'straw that stirs the drink' comment. Story Highlights. NEW YORK (AP) — Reggie Jackson insists in his new autobiography that he never disparaged Thurman Munson in an attention-grabbing Sport magazine report 36 years ago, a claim the author immediately denied.",
"Reginald Martinez Reggie Jackson (born May 18, 1946) is an American former professional baseball right fielder who played 21 seasons for the Kansas City / Oakland Athletics, Baltimore Orioles, New York Yankees, and California Angels of Major League Baseball (MLB). Jackson was inducted into the National Baseball Hall of Fame in 1993.",
"And now Reggie Jackson indeed is the straw that stirs the drink, the 6- foot, 205-pound slugger that stirs the crowd whenever he swaggers out of the on-deck circle and stomps up to swing his black bat. Once it was fashionable at Yankee Stadium to boo him."
],
"url": [
"http://www.nytimes.com/specials/baseball/yankees/nyy-rotb-jackson.html",
"https://en.wiktionary.org/wiki/straw_that_stirs_the_drink",
"https://en.wiktionary.org/wiki/straw_that_stirs_the_drink",
"https://en.wikipedia.org/wiki/Reggie_Jackson",
"http://nypost.com/2014/11/06/obama-is-straw-that-stirs-the-drink-bad/",
"http://www.economicprincipals.com/issues/2013.10.13/1544.html",
"https://www.usatoday.com/story/sports/mlb/2013/10/12/reggie-jackson-new-autobiography-denies-straw-that-stirs-the-drink-comment/2973839/",
"https://www.usatoday.com/story/sports/mlb/2013/10/12/reggie-jackson-new-autobiography-denies-straw-that-stirs-the-drink-comment/2973839/",
"https://en.wikipedia.org/wiki/Reggie_Jackson",
"http://www.nytimes.com/specials/baseball/yankees/nyy-rotb-jackson.html"
]
} | the straw that stirs the drink | 518,952 | ENTITY | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"In the fifth grade, he was found to have epilepsy. In the seventh grade, he started sniffing glue. He began spending nights at cemeteries. When he was 12, Richard’s cousin Miguel Ramirez returned from the Vietnam War, and they began spending time together.",
"Richard Ramirez, a former altar boy who grew into a maniacal serial killer known as the Night Stalker, died in California today at the age of 53.",
"Ramirez was born Ricardo Leyva Munoz Muñoz ramirez In El, Paso, texas On february, 29. 1960 his, Father Julian Tapia, ramirez was born In, Camargo. mexico",
"Background Edit. Ramirez was born Ricardo Leyva Munoz Muñoz ramirez In El, Paso, texas On february, 29. 1960 his, Father Julian Tapia, ramirez was born In, Camargo. Mexico he Met'richard s, Mother-colorado Born Mercedes, munoz muñoz there when they were both fourteen. years old",
"His father, Julian Tapia Ramirez, was born in Camargo, Mexico. He met Richard's mother, Colorado-born Mercedes Munoz, muñoz there when they were both fourteen years. old",
"Cops had to intervene to prevent the mob from beating Ramirez to death. Ramirez was eventually convicted of 13 murders and 11 sexual assaults. Though he was sentenced to die at his trial, California's turtle-ish appeals process allowed the case to drag on. In 1996, Ramirez married Doreen Lioy, an obsessed fan who wrote him dozens of letters while he was in jail. Lioy had promised to commit suicide when Ramirez was finally executed.",
"We've all got the power in our hands to kill, but most people are afraid to use it. The ones who aren't afraid, control life itself.. Richard Ramirez (born Ricardo Leyva Munoz Muñoz), ramirez.a.k. A The Night , stalker was An american serial killer and. rapist",
"LOS ANGELES Richard Ramirez, the notorious serial killer known as the Night Stalker, died early Friday in a hospital, a state official said. Play Video U.S. Richard Ramirez, the Night Stalker, dead at 53 Richard Ramirez, the serial killer known as the Night Stalker, died in prison at the age of 53. The Department of Corrections and Rehabilitatio... Ramirez, 53, passed away this morning, San Quentin State Prison spokesman Lt. Sam Robinson told The Associated Press. No other details were released.",
"Take a look at the age of death of serial killers who have died in prison (not due to execution)— even those who were not murdered due to violence have had relatively short lives. Few of them seem to live into their 60s or 70s.",
"Continue reading the main story. Richard Ramirez, who claimed to be inspired by Satan when he killed at least 14 people in the “Night Stalker” attacks that terrorized California in 1985, died on Friday in a hospital in Greenbrae, Calif. He was 53."
],
"url": [
"http://www.nytimes.com/2013/06/08/us/night-stalker-killer-richard-ramirez-dies-at-53.html",
"http://gawker.com/richard-ramirez-infamous-night-stalker-serial-killer-511927305",
"http://criminalminds.wikia.com/wiki/Richard_Ramirez",
"http://criminalminds.wikia.com/wiki/Richard_Ramirez",
"http://criminalminds.wikia.com/wiki/Richard_Ramirez",
"http://gawker.com/richard-ramirez-infamous-night-stalker-serial-killer-511927305",
"http://criminalminds.wikia.com/wiki/Richard_Ramirez",
"http://www.cbsnews.com/news/night-stalker-serial-killer-richard-ramirez-dies/",
"http://gawker.com/richard-ramirez-infamous-night-stalker-serial-killer-511927305",
"http://www.nytimes.com/2013/06/08/us/night-stalker-killer-richard-ramirez-dies-at-53.html"
]
} | how did richard ramirez die? | 214,482 | DESCRIPTION | [] |
[
"A virus"
] | {
"is_selected": [
0,
0,
0,
0,
0,
1,
0,
0,
0,
0
],
"passage_text": [
"I have a similar problem. I have the same problem, Mouse develops a mind of its own , moves all over the place, opens and closes files and programs, I tried all of the things you did to no avail., Problem started two weeks after connection to Broadband.",
"There are a few other things to look for as well. Hi Leo, I have what I'd describe as a 'migrating cursor' or 'insertion point' when using MS Word and also Windows Live Mail. I can be merrily typing away when suddenly the cursor jumps to a new location like on another line. I have Windows 7 and MS Office 2010.",
"These are more likely causes than the Internet service. Help from a reader: Over the past several years, I have replaced three hard drives, and none of them was defective. Here's why: I had disabled both floppy and CD boot options in the setup routine in order to speed up booting from the hard drive.",
"Page 1 of 3 1 2 3 Next >. OK here my problem. for the last few weeks my mouse has started to jump around the screen getting worse the longer i stay on the computer. no matter what programs i'm running or if i'm on the net or not. and it gets to the stage where the mouse just goes completely CRAZY.",
"Here are the usual causes (of course, I can't tell if any of these apply to you since I'm not sitting at the computer.): 1. If the monitor is a cathode ray tube type (the old-fashioned picture tube) monitor, it could be sitting too close to an electrical device that's causing problems.",
"· Even if you have the most up-to-date drivers and operating system, a virus infestation can cause any number of problems within your computer and display. A virus can alter the way your monitor communicates with the mouse, graphics card or motherboard, which can in turn cause screen issues such as jumping. Run a virus scan to find and remove any hidden invaders that may be causing your screen issues.",
"Adjusting the touchpad. In your mouse configuration (in Control Panel, in the Mouse section): If you've got the correct drivers for your laptop's hardware installed; You may be able to turn off the track pad or mouse pad completely.",
"A mouse jumping around, especially on a laptop, is often the touchpad somehow being touched. There are a few other things to look for as well. by Leo A. Notenboom, © 2012. Hi Leo, I have what I'd describe as a 'migrating cursor' or 'insertion point' when using MS Word and also Windows Live Mail. I can be merrily typing away when suddenly the cursor jumps to a new location like on another line.",
"Several causes possible for screen image jump. November 08, 2007|By BILL HUSTED | BILL HUSTED,The Atlanta Journal-Constitution. I am having a sporadic problem with my monitor screen image fluttering ... jumping up, back down, sometimes in rapid-fire succession. Tech support contact with Dell has not led to a solution, which makes me wonder if the problem is with my Internet provider (BellSouth) instead.",
"· In some cases, a jumpy screen is caused by a malfunctioning mouse. Many computer mice offer a scroll wheel in between the two selection buttons on the front, which helps scroll without the use of the scroll bar on the right of the screen."
],
"url": [
"http://www.techspot.com/community/topics/mouse-problem-jumping-around.13555/",
"http://ask-leo.com/could_my_mouse_trackpad_be_causing_my_cursor_to_jump_around_the_screen.html",
"http://articles.baltimoresun.com/2007-11-08/business/0711080066_1_reader-monitor-boot",
"http://www.techspot.com/community/topics/mouse-problem-jumping-around.13555/",
"http://articles.baltimoresun.com/2007-11-08/business/0711080066_1_reader-monitor-boot",
"http://forum.wisecleaner.com/index.php?/topic/6066-why-does-my-screen-jump-up-down/",
"http://ask-leo.com/could_my_mouse_trackpad_be_causing_my_cursor_to_jump_around_the_screen.html",
"http://ask-leo.com/could_my_mouse_trackpad_be_causing_my_cursor_to_jump_around_the_screen.html",
"http://articles.baltimoresun.com/2007-11-08/business/0711080066_1_reader-monitor-boot",
"http://forum.wisecleaner.com/index.php?/topic/6066-why-does-my-screen-jump-up-down/"
]
} | what causes the arrow to bounce all over the screen | 592,520 | DESCRIPTION | [
"A virus cause the arrow to bounce all over the screen."
] |
[
"Low income per capita, famine, and disease."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Malthus states that population increase is detrimental to a nation’s economy due to a variety of problems caused by the growth. For example, overpopulation and population growth places a tremendous amount of pressure on natural resources, which result in a chain reaction of problems as the nation grows.he increase in demand for food leads to a decrease in natural resources, which are needed for a nation to survive. Other negative effects of population growth and, specifically, overpopulation include poverty caused by low income per capita, famine, and disease.",
"Negative Population Growth, Inc. (NPG) is a national non-profit membership organization. NPG’s primary purpose is to educate American citizens and legislators regarding the damaging effects of population growth.mmigration (as it relates to population growth) is simply about numbers – not race, ethnicity, skin color, or nation of origin. It is not racist to question what continued population growth will mean for America’s resources and environment. NPG strongly condemns racism in all its forms.",
"And Americans have the biggest Affluence footprint per person of any people in the world. Any population growth in the United States, then, is growth of these big Affluence footprints, making U.S. population growth more harmful to the world than population growth anywhere else.oreign-born residents are now 40% of the total of the population, according to new United States Census Bureau figures. In 1990, foreign-born residents were only 28%. The new figures come from a 15,417-household survey taken in 1999 by the Census Bureau. Without immigration, NYC's population would be shrinking.",
"The population of the US is a little over 300 million and the current population growth rate is a little under 1% per year which means that the population of the US is increasing by about 3 million people per year.he U.S. population constitutes only 5% of world population, but consumes 24% of world's energy. The U.S. is losing 400,000 acres of rural land per year, while urbanized land area increased between 1969 and 1990 at twice the rate of population growth in the same time period.",
"The increase in demand for food leads to a decrease in natural resources, which are needed for a nation to survive. Other negative effects of population growth and, specifically, overpopulation include poverty caused by low income per capita, famine, and disease.India is a prime example of Thomas Malthus’ theory of population growth and its effect on the economy.India is a country plagued by poverty primarily caused by overpopulation. Inhabited by over nine hundred billion people, India has a population of three hundred million under the poverty line.he increase in demand for food leads to a decrease in natural resources, which are needed for a nation to survive. Other negative effects of population growth and, specifically, overpopulation include poverty caused by low income per capita, famine, and disease.",
"In a word, it is immigration. That is because new immigrants and their U.S.- born children currently account for 75 to 80 percent of our annual population growth. And, that share of population growth due to immigration has been rising along with the rising number of new immigrants.The Pew Hispanic Center researchers estimated in 2008 that given current trends 82 percent of population growth from 2005 to 2050 will result from immigrants and their descendents.ommon sense tells us that there are limits to sustainable population growth just as there is a limit to the land area of our country. The U.S. population is now 307 million residents with an annual average growth rate of 0.975 percent.",
"In the US, much of the impact is a result of growing population and faster-growing development of land. Between 1990 and 2000, the U.S. population grew by 33 million people, the greatest increase the country has ever seen. Future growth is predicted to add 27 million people each decade for the next 30 years.he U.S. population constitutes only 5% of world population, but consumes 24% of world's energy. The U.S. is losing 400,000 acres of rural land per year, while urbanized land area increased between 1969 and 1990 at twice the rate of population growth in the same time period.",
"Overpopulation occurs when a population of a species exceeds the carrying capacity of its ecological niche. Overpopulation is a function of the number of individuals compared to the relevant resources, such as the water and essential nutrients they need to survive.It can result from an increase in births, a decline in mortality rates, an increase in immigration, or an unsustainable biome and depletion of resources.verpopulation is a function of the number of individuals compared to the relevant resources, such as the water and essential nutrients they need to survive.",
"Studies have shown that over 80% of U.S. population growth between 2005 and 2050 will be a direct result of immigration – legal, illegal, and the U.S.-born children of immigrants. That rate is expected to be even higher in the years to come.mmigration (as it relates to population growth) is simply about numbers – not race, ethnicity, skin color, or nation of origin. It is not racist to question what continued population growth will mean for America’s resources and environment. NPG strongly condemns racism in all its forms.",
"By the 1970s, American women were averaging fewer babies and the US was well-positioned to transition from a growing to a stable population. Without post- 1970 immigration, the U.S. population would have leveled off below 250 million in the first few decades of this century.oreign-born residents are now 40% of the total of the population, according to new United States Census Bureau figures. In 1990, foreign-born residents were only 28%. The new figures come from a 15,417-household survey taken in 1999 by the Census Bureau. Without immigration, NYC's population would be shrinking."
],
"url": [
"http://pages.cs.wisc.edu/~dluu/ps/rkothare99.pdf",
"http://www.npg.org/about-us/f-a-q.html",
"http://www.overpopulation.org/immigration.html",
"http://www.overpopulation.org/USpopulation.html",
"http://pages.cs.wisc.edu/~dluu/ps/rkothare99.pdf",
"http://www.fairus.org/issue/the-united-states-is-already-overpopulated",
"http://www.overpopulation.org/USpopulation.html",
"https://en.wikipedia.org/wiki/Overpopulation",
"http://www.npg.org/about-us/f-a-q.html",
"http://www.overpopulation.org/immigration.html"
]
} | how does overpopulation affect US CITIZENS | 227,145 | DESCRIPTION | [] |
[
"A blue hosta, for example, looks great planted among pink and purple flowers.The leaf color of a gold hosta becomes more intense when it is echoed by yellow flowers or contrasted with purple flowers."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
1,
0,
0
],
"passage_text": [
"Few other groups of plants have the same variety of foliage hues, which is important because foliage is the backbone of the landscape. Hosta leaves range in color from light buttery yellow to deep forest green to powdery blue, and a host of variegated forms are also available.he more heat to which a hosta is exposed, the faster the color change occurs. Plants changing the fastest seem to be those grown in a greenhouse in pots on elevated benches. Similarly, plants grown in southern gardens progress through the changes faster than hostas in northern gardens.",
"There are hostas as large as 4 feet tall and 7 feet across, and others that are rock garden size, only 4 inches high. Since gardeners grow hosta more for their foliage than their flowers, leaf color is of primary importance.Plain green is a thing of the past. Leaves are now blue, blue green, chartreuse, gold, or variegated. Stems and petioles are burgundy.lue hostas. The blue hostas are particularly popular, not just for their color, but for the corrugated texture of their leaves that makes them undesirable to slugs. The blue color is actually a waxy bloom that can be rubbed off.",
"Few other groups of plants have the same variety of foliage hues, which is important because foliage is the backbone of the landscape. Hosta leaves range in color from light buttery yellow to deep forest green to powdery blue, and a host of variegated forms are also available.imilarly, plants grown in southern gardens progress through the changes faster than hostas in northern gardens. Hostas go through three main types of color changes. 1 Viridescent color change --The root word of viridescent means green, so a viridescent hosta becomes more green as the season progresses.",
"Hosta (/ˈhɒstə/ , syn. Funkia) is a genus of plants commonly known as hostas, plantain lilies (particularly in Britain) and occasionally by the Japanese name giboshi. Hostas are widely cultivated as shade-tolerant foliage plants.unkia) is a genus of plants commonly known as hostas, plantain lilies (particularly in Britain) and occasionally by the Japanese name giboshi. Hostas are widely cultivated as shade-tolerant foliage plants.",
"Variegation in hosta plants is manifested in a couple of different ways. Foliage is termed medio variegated when the lighter color (white, a lighter green, or yellow) occurs in the center of the leaf.For example, Hosta 'Undulata Variegata' (zones 3-8) is white in the middle and green at the edges.ostas With Gold (Yellow) Leaves. Hosta plants with gold leaves should be planted in full sun to bring out their color fully. That color can range from a true gold to a chartreuse, depending on variety, location in the yard, geographical region, etc.",
"Hosta or hostas are the most popular, low maintenance, shade tolerant plant in North America! Hostas come in a wide variety of sizes, shapes, colors, and are quite disease and pest free.NOTE, the pictures on are site are often of mature plants.osta or hostas are the most popular, low maintenance, shade tolerant plant in North America! Hostas come in a wide variety of sizes, shapes, colors, and are quite disease and pest free.",
"Hostas (Starters). Hosta or hostas are the most popular, low maintenance, shade tolerant plant in North America! Hostas come in a wide variety of sizes, shapes, colors, and are quite disease and pest free. NOTE, the pictures on are site are often of mature plants.osta or hostas are the most popular, low maintenance, shade tolerant plant in North America! Hostas come in a wide variety of sizes, shapes, colors, and are quite disease and pest free.",
"Color has a magical way of tying plants together so that the eye flows from one to the next. An unremarkable, solid-colored hosta suddenly becomes beautiful because its color is enriched by a neighboring plant. A blue hosta, for example, looks great planted among pink and purple flowers.The leaf color of a gold hosta becomes more intense when it is echoed by yellow flowers or contrasted with purple flowers. Even if a plant has just a small splash of the color you want to echo, it will be effective.olor has a magical way of tying plants together so that the eye flows from one to the next. An unremarkable, solid-colored hosta suddenly becomes beautiful because its color is enriched by a neighboring plant. A blue hosta, for example, looks great planted among pink and purple flowers.",
"By contrast, when the lighter color occurs on the edge of their foliage, hosta plants are said to be marginally variegated.. One example is H. 'Francee.' Another is the related H. 'Patriot,' grown in zones 3-8.ostas With Gold (Yellow) Leaves. Hosta plants with gold leaves should be planted in full sun to bring out their color fully. That color can range from a true gold to a chartreuse, depending on variety, location in the yard, geographical region, etc.",
"They produce a lavender bloom in early summer. By contrast, when the lighter color occurs on the edge of their foliage, hosta plants are said to be marginally variegated.. One example is H. 'Francee.' Another is the related H. 'Patriot,' grown in zones 3-8. Its leaves are green in the center and white on the edges.ostas With Gold (Yellow) Leaves. Hosta plants with gold leaves should be planted in full sun to bring out their color fully. That color can range from a true gold to a chartreuse, depending on variety, location in the yard, geographical region, etc."
],
"url": [
"http://www.ebay.com/gds/The-Amazing-Color-Changing-Hosta-/10000000001416864/g.html",
"http://www.chicagobotanic.org/plantinfo/hosta",
"http://www.perennialresource.com/articles/169_Hosta-Color-Changes.aspx",
"https://en.wikipedia.org/wiki/Hostas",
"http://landscaping.about.com/od/plantsforshadyareas/a/hosta_plants.htm",
"https://www.hostasdirect.com/buy-hostas/",
"https://www.hostasdirect.com/buy-hostas/",
"http://www.finegardening.com/designing-hostas",
"http://landscaping.about.com/od/plantsforshadyareas/a/hosta_plants.htm",
"http://landscaping.about.com/od/plantsforshadyareas/a/hosta_plants.htm"
]
} | what are the colours of hosta flowers | 568,338 | ENTITY | [] |
[
"Man-made equipment that orbits around the earth or the moon."
] | {
"is_selected": [
1,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Definitions for Satelliteˈsæt lˌaɪt. satellite, artificial satellite, orbiter(noun) man-made equipment that orbits around the earth or the moon. satellite, planet(noun) a person who follows or serves another. satellite(adj)",
"Freebase(0.00 / 0 votes)Rate this definition: Satellite. In the context of spaceflight, a satellite is an object which has been placed into orbit by human endeavor. Such objects are sometimes called artificial satellites to distinguish them from natural satellites such as the Moon.",
"No moons of moons (natural satellites that orbit a natural satellite of a planet) are currently known as of 2016. In most cases, the tidal effects of the planet would make such a system unstable.",
"Jersey alone, though the biggest of them all, is a planet without a satellite. It was not quite high enough for the satellite, and the velocity was too low. If so, could he have concluded it to be the satellite of a satellite! Orso, as a liberal, did not care to converse with a satellite of the Government.",
"An object launched to orbit Earth or another celestial body. Satellites are used for research, communications, weather information, and navigation. The first artificial Earth satellite was Sputnik 1, launched by the Soviet Union in October 1957; the first successful American satellite was launched in January 1958.",
"A natural satellite or moon is a astronomical object that orbits a planet or minor planet. In the Solar System there are 173 known natural satellites which orbit within 6 planetary satellite systems. In addition, several other objects are known to have satellites, including three IAU-listed dwarf planets: Pluto, Haumea, and Eris. As of January 2012, over 200 minor-planet moons have been discovered.",
"1540s, follower or attendant of a superior person, from Middle French satellite (14c.), from Latin satellitem (nominative satelles) attendant, companion, courtier, accomplice, assistant, perhaps from Etruscan satnal (Klein), or a compound of roots *satro- full, enough + *leit- to go (Tucker); cf.",
"Many authors define satellite or natural satellite as orbiting some planet or minor planet, synonymous with moon -- by such a definition all natural satellites are moons, but Earth and other planets are not satellites.",
"Freebase(0.00 / 0 votes)Rate this definition: In the context of spaceflight, a satellite is an object which has been placed into orbit by human endeavor. Such objects are sometimes called artificial satellites to distinguish them from natural satellites such as the Moon.",
"English follow, which is constructed of similar roots. Meaning planet that revolves about a larger one first attested 1660s, in reference to the moons of Jupiter, from Latin satellites, which was used in this sense 1610s by German astronomer Johannes Kepler (1571-1630)."
],
"url": [
"http://www.definitions.net/definition/Satellite",
"http://www.definitions.net/definition/Satellite",
"https://en.wikipedia.org/wiki/Natural_satellite",
"http://www.dictionary.com/browse/satellite",
"http://www.dictionary.com/browse/satellite",
"https://en.wikipedia.org/wiki/Natural_satellite",
"http://www.dictionary.com/browse/satellite",
"https://en.wikipedia.org/wiki/Natural_satellite",
"http://www.definitions.net/definition/Satellite",
"http://www.dictionary.com/browse/satellite"
]
} | man-made satellite definition | 444,980 | PERSON | [
"Man made equipment that orbits around the earth or the moon is called man made satellite."
] |
[
"The list of mid century designers are 1. George Nelson. 2 Edward Wormley. 3 Eero Saarinen. 4 Harry Bertoia. 5 Arne Jacobsen. 6 Charles Eames and his wife Ray Eames."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
1
],
"passage_text": [
"New methods of construction and new materials such as plastic, dramatically influenced later Mid-Century Modern designers. Plastic was used for its own qualities rather than to imitate wooden furniture.",
"Charles was an architect with a passion for modern design and furnishings. Ray was an artist, designer, and filmmaker who shared her husbands passions. Together they created some of the most iconic mid-century modern furniture pieces of the 20th century. The Eames Lounge Chair and Ottoman are highly recognized pieces for modern design. Eames’ exploration and innovative work with moulding and shaping plywood was used in this design and executed beautifully.",
"All of the above designers are some of my favorite 20th century mid-century modern furniture masters. They not only created pieces for the sake of the design, but also as an answer to the issues that were facing their time, like each design was a piece of their own personal revolution.",
"The enduring popularity of the Mid-Century Modern style is based on many factors. It gave us clean lines, gentle organic curves, a love for different materials and designers that are idolized even today. While there is some disagreement about when the period started, it roughly lasted from the mid-1930s to mid-1960s.",
"Influential Mid-Century Modern Furniture Designers Furniture design has evolved throughout the centuries as different materials became available and as professionals or tradesmen in charge of designing the furniture in that time period changed.",
"Mid-Century Modern Designers. There are several Mid-century Modern designers of note, and pieces designed by them have continued to inspire designers who came after them. Furniture pieces inspired by their designs, as well as copies are greatly sought after.",
"Some retailers where you can find Mid-Century Modern furniture or furniture that is inspired by it: 1 Herman Miller. 2 Knoll. 3 Vitra. 4 Design Within Reach or DWR. 5 2Modern. 6 Room and Board. 7 Crate and Barrel. 8 Restoration Hardware.",
"Artists, illustrators & designers working in the mid-century modern style, c. 1945-70, credited for album cover designs & artwork. I recommend viewing their discography pages in the large covers format. See Volume Two: http://www.discogs.com/lists/mid-century-graphic-designers-illustrators-art-directors-vol-2/201795 See Volume Three: https://www.discogs.com/lists/mid-century-graphic-designers-illustrators-art-directors-volume-3/272538 See also my list of notable uncredited designs: http://www.discogs.com/lists/notable-uncredited-mid-century-design/200681",
"Below are some of the best-known designers of this period. 1 This is by no means an exhaustive list: 2 George Nelson. 3 Edward Wormley. 4 Eero Saarinen. 5 Harry Bertoia. 6 Arne Jacobsen. 7 Charles Eames and his wife Ray Eames.",
"Knoll is another company known for its classic furniture mid-century modern pieces. Below are some of the best-known designers of this period. This is by no means an exhaustive list: 1 George Nelson. 2 Edward Wormley. 3 Eero Saarinen. 4 Harry Bertoia. 5 Arne Jacobsen. 6 Charles Eames and his wife Ray Eames."
],
"url": [
"https://www.thespruce.com/things-you-should-know-about-mid-century-1391827",
"https://www.furniturefashion.com/influential_mid-century_modern_furniture_designers/",
"https://www.furniturefashion.com/influential_mid-century_modern_furniture_designers/",
"https://www.thespruce.com/things-you-should-know-about-mid-century-1391827",
"https://www.furniturefashion.com/influential_mid-century_modern_furniture_designers/",
"https://www.thespruce.com/things-you-should-know-about-mid-century-1391827",
"https://www.thespruce.com/things-you-should-know-about-mid-century-1391827",
"https://www.discogs.com/lists/mid-century-graphic-designers-illustrators-art-directors/196212",
"https://www.thespruce.com/things-you-should-know-about-mid-century-1391827",
"https://www.thespruce.com/things-you-should-know-about-mid-century-1391827"
]
} | list of mid century designers | 1,174,085 | PERSON | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Apple’s brand new iOS 8.1.3 update for iPhone, iPad and iPod touch is now live and it predictably brings bug fixes for lingering iOS 8 problems to owners of the company’s mobile devices.ow to Fix iOS 8.1.3 App Issues. As we’ve noted in our early iOS 8.1.3 reviews, app performance remains strong after the iOS 8.1.3 release. That said, there’s always a chance that some users will encounter difficulties with apps after making the move. iPhone and iPad users can’t rely on iOS updates for app fixes.",
"This doesn’t come as a surprise either. iPhone and iPad users often complain about battery life problems in the aftermath of an iOS update and iOS 8.1.3 is no different. Fortunately, there are number of fixes to try if battery life on iOS 8.1.3 starts going downhill.ow to Fix iOS 8.1.3 App Issues. As we’ve noted in our early iOS 8.1.3 reviews, app performance remains strong after the iOS 8.1.3 release. That said, there’s always a chance that some users will encounter difficulties with apps after making the move. iPhone and iPad users can’t rely on iOS updates for app fixes.",
"It’s an important update for the iPhone, iPad and iPod touch and one that many users have already installed. Advertisement. Incremental updates like iOS 8.1.3 always have the potential to have a huge impact on iPhone or iPad performance, both positive and negative.here Are Fixes for iOS 8.1.3 Problems. If you do stumble upon an iOS 8.1.3 problem, note that there are probably some fixes out there for that problem. We recently put together a list of common iOS 8.1.3 problems and fixes for those issues.",
"Apple's iOS 8.1.3 update is now available for the iPhone, and it fixes one of the issues many iPhone owners complained about when iOS 8 was initially released.9to5Mac first noticed that the update was released. The new update reduces the amount of storage required to install software updates on the iPhone.pple's iOS 8.1.3 update is now available for the iPhone, and it fixes one of the issues many iPhone owners complained about when iOS 8 was initially released.",
"This DFU mode solves update problems from iOS 6 to iOS 7 or 7.1 for: iPhone 4, 4S, 5, 5C, 5S, iPad 1 2 3 4 Air and iPad Mini, Mini Retina. This solves various error messages. It does not obviously solve all errors.It is however your LAST software solution.his DFU mode solves update problems from iOS 6 to iOS 7 or 7.1 for: iPhone 4, 4S, 5, 5C, 5S, iPad 1 2 3 4 Air and iPad Mini, Mini Retina. This solves various error messages. It does not obviously solve all errors.",
"With iOS 8.1.3 problems swirling, we want to take a look at everything you need to know about these issues. This roundup offers a look at the issues themselves, potential fixes, and a look at what the future of iOS 8 for iPhone, iPad, iPod touch looks like.here Are Fixes for iOS 8.1.3 Problems. If you do stumble upon an iOS 8.1.3 problem, note that there are probably some fixes out there for that problem. We recently put together a list of common iOS 8.1.3 problems and fixes for those issues.",
"Apple today has unexpectedly released the new iPhone 3.1.3 firmware for iPhone 3G/3GS and iPod touch. This is not the same version which runs on the newly announced Apple iPad (OS 3.2). To update to iPhone OS 3.1.3 Firmware, all you will have to do is to connect your iPhone with your computer via usb and start iTunes.ote: Do not update your iPhone to OS 3.1.3 yet if your phone is currently jailbroken or unlocked on firmware 3.1.2. Wait for the new jailbreaking and unlocking tools before updating your device or you may loose the capability to jailbreak or unlock your device in the future. You have been warned!",
"Today Apple has released the iPhone 3.1.3 update for iPhone and iPod Touch users. This update does not really add anything new, but it does fix important bugs so iPhone and iPod Touch users should update.The iPhone 3.1.3 software update includes the following: 1. Connect your iPhone or iPod Touch to your PC.. Launch the iTunes application and click the Check for updates button. 3. iTunes will show you the above window saying: iTunes will update your iPhone to iPhone 3.1.3 software and will verify the update with Apple . Click on the Update button.",
"There are no guaranteed fixes for iOS Wi-Fi issues though there are some things that iPhone and iPad users on iOS 8.1.3 can try should connectivity start acting up after getting the update on board.ow to Fix iOS 8.1.3 App Issues. As we’ve noted in our early iOS 8.1.3 reviews, app performance remains strong after the iOS 8.1.3 release. That said, there’s always a chance that some users will encounter difficulties with apps after making the move. iPhone and iPad users can’t rely on iOS updates for app fixes.",
"The Apple Watch release date is now confirmed for sometime in April. iPhone and iPad users dealing with iOS 8 problems were hopeful that iOS 8.1.3 would arrive and finally, after tons of rumor and speculation, Apple pushed out the update to users around the world.here Are Fixes for iOS 8.1.3 Problems. If you do stumble upon an iOS 8.1.3 problem, note that there are probably some fixes out there for that problem. We recently put together a list of common iOS 8.1.3 problems and fixes for those issues."
],
"url": [
"http://www.gottabemobile.com/2015/01/28/ios-8-1-3-problems-fixes/",
"http://www.gottabemobile.com/2015/01/28/ios-8-1-3-problems-fixes/",
"http://www.gottabemobile.com/2015/01/29/ios-8-1-3-problems-iphone-ipad/",
"http://www.businessinsider.com/apple-ios-813-iphone-update-release-2015-1",
"http://www.youtube.com/watch?v=NEsP_fwinho",
"http://www.gottabemobile.com/2015/01/29/ios-8-1-3-problems-iphone-ipad/",
"http://www.redmondpie.com/download-iphone-os-3.1.3-firmware-9140418/",
"http://www.quickpwn.com/2010/02/iphone-3-1-3-itunes-update.html",
"http://www.gottabemobile.com/2015/01/28/ios-8-1-3-problems-fixes/",
"http://www.gottabemobile.com/2015/01/29/ios-8-1-3-problems-iphone-ipad/"
]
} | is there a problem with ios9.3.1 iphone update | 428,432 | DESCRIPTION | [] |
[
"Having or showing no mercy: pitiless.",
"Having or showing no mercy."
] | {
"is_selected": [
0,
1,
1,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Full Definition of MERCILESS. : having or showing no mercy: pitiless. — mer·ci·less·ly adverb. — mer·ci·less·ness noun.",
"Full Definition of MERCILESS. : having or showing no mercy: pitiless.",
"Full Definition of MERCILESS. : having or showing no mercy: pitiless. — mer·ci·less·ly adverb. — mer·ci·less·ness noun. See merciless defined for English-language learners.",
"The answer may seem obvious, but the use of this word can lead to confusion. In the UK and Ireland the word traditionally meant the number 1,000,000,000,000 (a million millions), which is called a trillion in the United States. A billion in the United States is considerably.",
"In the UK and Ireland the word traditionally meant the number 1,000,000,000,000 (a million millions), which is called a trillion in the United States. A billion in the United States is considerably.",
"How many is a billion? The answer may seem obvious, but the use of this word can lead to confusion. In the UK and Ireland the word traditionally meant the number 1,000,000,000,000 (a million millions), which is called a trillion in the United States.",
"This is the British English definition of merciless. View American English definition of merciless. Change your default dictionary to American English. View the pronunciation for merciless.",
"The answer may seem obvious, but the use of this word can lead to confusion. In the UK and Ireland the word traditionally meant the number 1,000,000,000,000 (a million millions), which is called a trillion in the United States.",
"Such perfidious Treachery in the merciless perpetrators of the Deed will shock your gentle nature Dearest Marianne as much as it then affected the Delicate sensibility of Edward, Sophia, your Laura, and of Augustus himself.",
"90% of the time, speakers of English use just 7,500 words in speech and writing. These words appear in red, and are graded with stars. One-star words are frequent, two-star words are more frequent, and three-star words are the most frequent."
],
"url": [
"http://www.merriam-webster.com/dictionary/merciless",
"http://www.merriam-webster.com/dictionary/merciless",
"http://www.merriam-webster.com/dictionary/merciless",
"http://dictionary.cambridge.org/dictionary/english/merciless",
"http://dictionary.cambridge.org/dictionary/english/merciless",
"http://dictionary.cambridge.org/dictionary/english/merciless",
"http://www.macmillandictionary.com/dictionary/british/merciless",
"http://dictionary.cambridge.org/dictionary/english/merciless",
"http://www.thefreedictionary.com/merciless",
"http://www.macmillandictionary.com/dictionary/british/merciless"
]
} | mercilless define | 452,760 | DESCRIPTION | [
"Mercilless is having or showing no mercy: pitiless."
] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"The Cupertino, Calif., electronics giant said it has determined that a very small percentage of iPhone 5 devices may suddenly experience shorter battery life or need to be charged more frequently.. Apple will replace the batteries in those devices, sold between September 2012 and January 2013, for free.",
"Along with the suction cup I used some Command adhesive strips to hold the bottom of the phone to a workbench as they easily pull/stretch away when you need to remove them! Suction cup pictured here is the older version (with ring). I have one from my previous battery replacement on iPhone 5 and used that instead.",
"Apple will replace your defective iPhone 5 battery for free. A small percentage of iPhone 5 devices sold between September 2012 and January 2013 have faulty batteries that drain quickly, the electronics giant says. Some batteries in the iPhone 5 are defective. If you find your iPhone 5 runs out of juice too quickly, Apple has a fix.",
"How Much Does a Car Battery Cost? Depending on the make and model of the vehicle, expect to pay about $50-$120 for a typical car battery and $90-$200 or more for a premium battery with a longer warranty and better cold-weather performance, or one for a luxury vehicle.",
"Replacement bracelets are often more expensive and can range from $50 to $75 for a basic steel bracelet all the way up to $1,000, while gold and platinum bracelets can cost thousands of dollars depending on quality and weight.",
"Battery Cable End Replacement. Your battery cable ends connect your battery cables to your battery’s terminal posts. Jiffy Lube® technicians visually inspect the battery cable ends and replace as needed, based upon their condition. Please note: Not all Jiffy Lube® service centers offer Battery Maintenance & Replacement Services. You can’t Leave Worry Behind® unless you know you have a healthy vehicle battery. A vehicle battery has a bunch of important functions, like storing energy and providing power to the starter, ignition system, fuel system and pretty much every other electrical component during start-up.",
"Step 12. 1 Use a plastic opening tool to gently pry the battery connector up from its socket on the logic board. 2 Take care to only pry up on the battery connector, and not the socket on the logic board. If you pry up on the logic board socket, you may break the connector entirely.",
"Pricing on a battery change ranges from as low as about $8 to $10 to upwards of $30 to $50 to reseal and pressure test a water resistant timepiece after switching out the battery. Some complicated watches that are hybrid quartz and chronograph mechanical movements can cost $50 to $100 for a battery change.",
"If you feel comfortable supporting the display carefully while peeling the battery out of the iPhone, you can skip the display removal and go directly to the battery removal steps. For optimal performance, calibrate your newly installed battery: Drain it below 10%, and then charge it uninterrupted to 100%.",
"The cost of the replacement can range from $30 for an acrylic up to $150 or more for a replacement sapphire crystal from a fine Swiss manufacturer. Other Watch Repairs. There are other minor fixes such as the replacement of the crown, changing the dial, replacing the hands, etc."
],
"url": [
"https://www.cnet.com/news/apple-will-replace-your-defective-iphone-5-battery-for-free/",
"https://www.ifixit.com/Guide/iPhone+6+Battery+Replacement/29363",
"https://www.cnet.com/news/apple-will-replace-your-defective-iphone-5-battery-for-free/",
"http://cars.costhelper.com/car-battery.html",
"http://blog.longsjewelers.com/watches/watch-repair-cost",
"https://www.jiffylube.com/auto-services/car-battery-replacement",
"https://www.ifixit.com/Guide/iPhone+6+Battery+Replacement/29363",
"http://blog.longsjewelers.com/watches/watch-repair-cost",
"https://www.ifixit.com/Guide/iPhone+6+Battery+Replacement/29363",
"http://blog.longsjewelers.com/watches/watch-repair-cost"
]
} | how much to get battery replaced | 329,063 | NUMERIC | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"1 Make sure that your chair is at the right position to help prevent back problems in the future. 2 A way to stop eyestrain is the 20, 20, 20 rule. Every 20 minutes look at something 20 feet (6.1 m) away for 20 seconds. If your wrist hurts frequently while typing try the Dvorak keyboard setup.",
"Ergonomic Computer Workstation Set-Up Advice. How to reduce the risk of long term injury at your desk. Most of us spend hours at our desk every day. Bad habits and incorrect posture can lead to short-term pains and aches that can turn into long-term injuries. There are a number of useful tips you should follow to avoid this by maintaining good posture at your workstation.",
"How to Sit at a Computer. Sitting at a computer for long periods of time can take a toll on your body. By not sitting with the correct posture, it is easy to end up with back pain, neck pain, knee pains, and a tingling of the hands and fingers. Here are some tips on maintaining good ergonomics and staying comfortable at your desk during the day.",
"1 Work surface depth should allow you to: 2 View the monitor at a distance of at least 20 inches (50 cm). Position the monitor to achieve the appropriate viewing angle, which is generally directly in front of you.",
"Center the monitor directly in front of you, above your keyboard. Position the top of the monitor approximately 2-3” above your seated eye level. If you wear bifocals, lower the monitor to a comfortable reading level. Sit at least an arm's length away from the screen and adjust the distance for your vision.",
"Desk Quick Tips. 1 Desk surface should allow you to place the monitor directly in front of you, at least 20 inches away. 2 Avoid storing items, such as a CPU, under desks. Desks should be able to accommodate a variety of working postures.",
"1 Desk surface should allow you to place the monitor directly in front of you, at least 20 inches away. 2 Avoid storing items, such as a CPU, under desks. Desks should be able to accommodate a variety of working postures.",
"1 Desk or Work Surface Areas. 2 Areas Under the Desk or Work Surface. 3 Desk surface should allow you to place the monitor directly in front of you, at least 20 inches away. 4 Avoid storing items, such as a CPU, under desks. Desks should be able to accommodate a variety of working postures.",
"Ergonomic Computer Workstation Set-Up Advice. Most of us spend hours at our desk every day. Bad habits and incorrect posture can lead to short-term pains and aches that can turn into long-term injuries. There are a number of useful tips you should follow to avoid this by maintaining good posture at your workstation.",
"How to Sit at a Computer. Community Q&A. Sitting at a computer for long periods of time can take a toll on your body. By not sitting with the correct posture, it is easy to end up with back pain, neck pain, knee pains, and a tingling of the hands and fingers."
],
"url": [
"http://www.wikihow.com/Sit-at-a-Computer",
"http://www.posturite.co.uk/posture-learning-resources/ergonomic-workstation-setup",
"http://www.wikihow.com/Sit-at-a-Computer",
"https://www.osha.gov/SLTC/etools/computerworkstations/components_desk.html",
"http://www.wikihow.com/Sit-at-a-Computer",
"https://www.osha.gov/SLTC/etools/computerworkstations/components_desk.html",
"https://www.osha.gov/SLTC/etools/computerworkstations/components_desk.html",
"https://www.osha.gov/SLTC/etools/computerworkstations/components_desk.html",
"http://www.posturite.co.uk/posture-learning-resources/ergonomic-workstation-setup",
"http://www.wikihow.com/Sit-at-a-Computer"
]
} | how to sit ergonomically at a desk | 380,272 | DESCRIPTION | [] |
[
"No Answer Present."
] | {
"is_selected": [
0,
0,
0,
0,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"If the price of the stock goes up. Typically, in a margin account, you pay only a portion of the purchase price of the stock, but you receive 100% of the net profit. For example, you buy $10,000 worth of marginable stock when the federal margin requirement is 50%.",
"The amount available for withdrawal is subject to the preservation of $2,000 equity and the lesser of the SMA balance (see Glossary) or maintenance excess in the account.For example, assume you open an account with $20,000 in cash and purchase $30,000 worth of a marginable security priced at $20 per share.",
"For Fixed Rate Capital Securities (FRCS) which trade in shares, the minimum investment is $25 which is equal to one share. For Certificates of Deposit (CDs), the minimum investment is $1,000 or $5,000 for some callable CDs.",
"Example: any day in which day trading occurs. Once identified as a pattern Assuming there are no other marginable securities in the account, an investor with a $4,000 credit balance purchased 1,000 shares of a marginable stock when it was trading at $5 per share, creating a $1,000 debit.",
"The lowest number of securities, the quantity, for an initial investment in a fixed-income offering (e.g., bond offering) through Fidelity. For most fixed-income securities offered through Fidelity, new issue and secondary offerings, the minimum increment is one bond. One bond is equal to $1,000.",
"Typically, in a margin account, you pay only a portion of the purchase price of the stock, but you take 100% of the loss. As in the example cited above, you buy $10,000 worth of marginable stock when Regulation T is 50%. You would deposit $5,000 in your margin account and the broker would loan you $5,000.",
"For Fixed Rate Capital Securities (FRCS) which trade in shares, the minimum increment is one share. One share is equal to $25. For Certificates of Deposit (CDs), the minimum increment is a dollar amount which is $1,000 or $5,000 for some callable CDs.",
"If the price of a security that has been sold short falls below $5 per share, the maintenance requirement is 100% of the market value with a minimum requirement of $2.50 per share.11. SMA is a separate margin account maintained by the brokerage firm.",
"1 A decline in the value of securities that are purchased on margin may require you to provide additional funds to the firm that has made the loan to avoid the forced sale of those securities or other securities in your account.",
"MACD is derived by dividing one moving average by another. It is based on the point spread difference between 2 exponential moving averages of the closing price. The basic MACD trading rule is to sell when the MACD falls below its signal line and to buy when the MACD rises above its signal line."
],
"url": [
"https://www.tdameritrade.com/retail-en_us/resources/pdf/AMTD086.pdf",
"https://www.tdameritrade.com/retail-en_us/resources/pdf/AMTD086.pdf",
"https://scs.fidelity.com/webxpress/help/topics/help_definition_m.shtml",
"https://www.tdameritrade.com/retail-en_us/resources/pdf/AMTD086.pdf",
"https://scs.fidelity.com/webxpress/help/topics/help_definition_m.shtml",
"https://www.tdameritrade.com/retail-en_us/resources/pdf/AMTD086.pdf",
"https://scs.fidelity.com/webxpress/help/topics/help_definition_m.shtml",
"https://www.tdameritrade.com/retail-en_us/resources/pdf/AMTD086.pdf",
"http://www.finra.org/investors/purchasing-margin-risks-involved-trading-margin-account",
"https://scs.fidelity.com/webxpress/help/topics/help_definition_m.shtml"
]
} | marginable security definition | 445,318 | DESCRIPTION | [] |
[
"Yes,Syfy has yet to cancel Dominion."
] | {
"is_selected": [
0,
0,
0,
1,
0,
0,
0,
0,
0,
0
],
"passage_text": [
"Rising out of the ashes of this long battle are newly fortified cities which protect human survivors. The city of Vega is a glistening empire that has been formed from the ruins of what was once Las Vegas. Two houses vie for control and the stage is set for political upheaval and a dangerous power shift. Abandoned by his father at a young age, Alex Lannon (Christopher Egan) became a soldier.",
"This cancellation was not about the ratings. If it was, Defiance should definitely be cancelled next because it was tied with Dominion at the end of the season with an average demo of 0.25. 12 Monkeys aired earlier this year before summer with an ending average demo of 0.25. Renewed for a s2. I do happen to like this show.",
"Eric Wald and Dean White are co-writing the pilot and will serve as executive producers, along with Brad Luff, Nate Hopper and Rd Robb. Scott Stewart (Syfy’s “Dominion”) will direct the pilot, and Emily Whitesell (MTV’s “Finding Carter”) will serve as showrunner.",
"Dominion Season 2 premiered July 9, 2015. Syfy has yet to cancel or renew Dominion for Season 3. Stay tuned to this continually updated page to be the first to know when Syfy renews or cancels the Angel-bearing supernatural series. Based on characters from the 2010 hit theatrical film Legion, Dominion is an epic supernatural drama set in the year 25 A.E.",
"British actor Luke Allen-Gale (Dominion) has been cast as the male lead opposite Aussie Laura Brent in the CW genre-themed drama pilot Transylvania. Also cast in the pilot, from CBS TV Studios, is Canadian actor Evan Stern.",
"Emily Whitesell (Finding Carter) will serve as showrunner while Scott Stewart (Dominion) will direct the pilot from a script by Eric Wald and Dean White. Wald, White, Brad Luff, Nate Hopper and Rd Robb will executive produce.",
"TV show dates: June 19, 2014 — October 1, 2015. Series status: Cancelled. Performers include: Christopher Egan, Tom Wisdom, Carl Beukes, Alan Dale, Roxanne McKee, Anthony Head, Luke Allen-Gale, Shivani Ghai, and Rosalind Halstead.",
"TV show description: This supernatural drama is set in the near future, some 25 years after “The Extinction War” — when an army of lower angels, assembled by the archangel Gabriel, waged war against mankind. The archangel Michael, turning against his own kind, chose to side with humanity.",
"Anthony Stewart Head has been cast as James Lahue, opposite his daughter, Daisy Head's Grace Atwood, in Freeform's upcoming Guilt TV series. This veteran of Buffy the Vampire Slayer, Merlin, and the recently cancelled Dominion TV show, will play the Atwood girls' wealthy stepfather. The cast of Guilt also includes Billy Zane, Emily Tremain, Cristian Solimeno, Naomi Ryan, Kevin Ryan, Zachary Fall, Simona Brown, and Sam Cassidy.",
"Looks like Lucifer won’t be coming to Dominion after all. Syfy has cancelled the supernatural series, based on the 2010 film Legion and starring Christopher Eagan, after two seasons, our sister site Deadline reports."
],
"url": [
"http://tvseriesfinale.com/tv-show/dominion/",
"http://tvline.com/2015/10/13/dominion-cancelled-season-3-syfy/",
"http://www.imdb.com/title/tt3079768/news",
"http://seriable.com/dominion-cancelled-renewed-season-3/",
"http://www.imdb.com/title/tt3079768/news",
"http://www.imdb.com/title/tt3079768/news",
"http://tvseriesfinale.com/tv-show/dominion/",
"http://tvseriesfinale.com/tv-show/dominion/",
"http://www.imdb.com/title/tt3079768/news",
"http://tvline.com/2015/10/13/dominion-cancelled-season-3-syfy/"
]
} | was dominion cancelled | 539,901 | DESCRIPTION | [] |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.