url
stringlengths 16
775
| text
stringlengths 100
1.02M
| date
timestamp[s] | metadata
stringlengths 1.07k
1.1k
|
|---|---|---|---|
https://par.nsf.gov/biblio/10297291-security-proofs-sequential-work-post-quantum-world | On the Security of Proofs of Sequential Work in a Post-Quantum World
A Proof of Sequential Work (PoSW) allows a prover to convince a resource-bounded verifier that the prover invested a substantial amount of sequential time to perform some underlying computation. PoSWs have many applications including time-stamping, blockchain design, and universally verifiable CPU benchmarks. Mahmoody, Moran, and Vadhan (ITCS 2013) gave the first construction of a PoSW in the random oracle model though the construction relied on expensive depth-robust graphs. In a recent breakthrough, Cohen and Pietrzak (EUROCRYPT 2018) gave an efficient PoSW construction that does not require expensive depth-robust graphs. In the classical parallel random oracle model, it is straightforward to argue that any successful PoSW attacker must produce a long ℋ-sequence and that any malicious party running in sequential time T-1 will fail to produce an ℋ-sequence of length T except with negligible probability. In this paper, we prove that any quantum attacker running in sequential time T-1 will fail to produce an ℋ-sequence except with negligible probability - even if the attacker submits a large batch of quantum queries in each round. The proof is substantially more challenging and highlights the power of Zhandry’s recent compressed oracle technique (CRYPTO 2019). We further extend this result to establish post-quantum security of more »
Authors:
; ;
Editors:
Award ID(s):
Publication Date:
NSF-PAR ID:
10297291
Journal Name:
2nd Conference on Information-Theoretic Cryptography (ITC 2021)
Volume:
199
Page Range or eLocation-ID:
22:1--22:27
2. Memory-hard functions (MHFs) are a key cryptographic primitive underlying the design of moderately expensive password hashing algorithms and egalitarian proofs of work. Over the past few years several increasingly stringent goals for an MHF have been proposed including the requirement that the MHF have high sequential space-time (ST) complexity, parallel space-time complexity, amortized area-time (aAT) complexity and sustained space complexity. Data-Independent Memory Hard Functions (iMHFs) are of special interest in the context of password hashing as they naturally resist side-channel attacks. iMHFs can be specified using a directed acyclic graph (DAG) $G$ with $N=2^n$ nodes and low indegree and themore » | 2022-06-25T10:52:11 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5871803760528564, "perplexity": 2711.023588214392}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103034930.3/warc/CC-MAIN-20220625095705-20220625125705-00793.warc.gz"} |
https://math.libretexts.org/TextMaps/Number_Theory/Book%3A_Elementary_Number_Theory_(Raji)/5%3A_Primitive_Roots_and_Quadratic_Residues/5.3%3A_The_Existence_of_Primitive_Roots |
# 5.3: The Existence of Primitive Roots
• Page ID
8847
•
$$\newcommand{\vecs}[1]{\overset { \scriptstyle \rightharpoonup} {\mathbf{#1}} }$$
$$\newcommand{\vecd}[1]{\overset{-\!-\!\rightharpoonup}{\vphantom{a}\smash {#1}}}$$
In this section, we demonstrate which integers have primitive roots. We start by showing that every power of an odd prime has a primitive root and to do this we start by showing that every square of an odd prime has a primitive root.
If $$p$$ is an odd prime with primitive root $$r$$, then one can have either $$r$$ or $$r+p$$ as a primitive root modulo $$p^2$$.
Notice that since $$r$$ is a primitive root modulo $$p$$, then $ord_pr=\phi(p)=p-1.$ Let $$m=ord_{p^2}r$$, then $r^m\equiv 1(mod \ p^2).$ Thus $r^m\equiv 1(mod \ p).$ By Theorem 54, we have $p-1\mid m.$ By Exercise 7 of section 6.1, we also have that $m\mid \phi(p^2).$ Also, $$\phi(p^2)=p(p-1)$$ and thus $$m$$ either divides $$p$$ or $$p-1$$. And since $$p-1\mid m$$ then we have $m=p-1 \ \ \mbox{or} \ \ m=p(p-1).$ If $$m=p(p-1)$$ and $$ord_{p^2}r=\phi(p^2)$$ then $$r$$ is a primitive root modulo $$p^2$$. Otherwise, we have $$m=p-1$$ and thus $r^{p-1}\equiv 1(mod \ p^2).$ Let $$s=r+p$$. Then $$s$$ is also a primitive root modulo $$p$$. Hence, $$ord_{p^2}s$$ equals either $$p-1$$ or $$p(p-1)$$. We will show that $$ord_{p^2}s\neq p-1$$ so that $$ord_{p^2}s=p(p-1)$$. Note that \begin{aligned} s^{p-1}=(r+p)^{p-1}&=&r^{p-1}+(p-1)r^{p-2}p+...+p^{p-1}\\&=& r^{p-1}+(p-1)p.r^{p-2}(mod \ p^2).\end{aligned} Hence $p^2\mid s^{p-1}-(1-pr^{p-2}.$ Note also that if $p^2 \mid (s^{p-1}-1),$ then $p^2\mid pr^{p-2}.$ Thus we have $p\mid r^{p-2}$ which is impossible because $$p\nmid r$$. Because $$ord_{p^2}s\neq p-1$$, we can conclude that $ord_{p^2}s=p(p-1)=\phi(p^2).$ Thus, $$s=r+p$$ is a primitive root of $$p^2$$.
Notice that 7 has 3 as a primitive root. Either $$ord_{49}3=6$$ or $$ord_{49}3=42$$. But since $$3^6\not\equiv 1(mod \ 49)$$. Hence $$ord_{49}3=42$$. Hence 3 is a primitive root of 49.
We now show that any power of an odd prime has a primitive root.
Let $$p$$ be an odd prime. Then any power of $$p$$ is a primitive root. Moreover, if $$r$$ is a primitive root modulo $$p^2$$, then $$r$$ is a primitive root modulo $$p^m$$ for all positive integers $$m$$.
By Theorem 62, we know that any prime $$p$$ has a primitive root $$r$$ which is also a primitive root modulo $$p^2$$, thus $\label{1} p^2\nmid (r^{p-1}-1).$ We will prove by induction that $\label{2} p^m\nmid (r^{p^{m-2}(p-1)}-1)$ for all integers $$m\geq 2$$. Once we prove the above congruence, we show that $$r$$ is also a primitive root modulo $$p^m$$. Let $$n=ord_{p^m}r$$. By Theorem 54, we know that $$n\mid \phi(p^m)$$. Also, we know that $$\phi(p^m)=p^m(p-1)$$. Hence $$n\mid p^m(p-1)$$. On the other hand, because $p^m\mid (r^n- 1),$ we also know that $p\mid (r^n-1).$ Since $$\phi(p)=p-1$$, we see that by Theorem 54, we have $$n=l(p-1)$$. also $$n\mid p^{m-1}(p-1)$$, we have that $$n=p^s(p-1)$$, where $$0 \leq s\leq m-1$$. If $$n=p^s(p-1)$$ with $$s\leq m-2$$, then $p^k\mid r^{p^{m-2}(p-1)}-1,$ which is a contradiction. Hence $ord_{p^m}r=\phi(p^m).$
We prove now ([2]) by induction. Assume that our assertion is true for all $$m\geq 2$$. Then $p^m\nmid (r^{p^{m-2}(p-1)}-1).$ Because $$(r,p)=1$$, we see that $$(r,p^{m-1})=1$$. We also know from Euler’s theorem that $p^{m-1}\mid (r^{p^{m-2}(p-1)}-1).$ Thus there exists an integer $$k$$ such that $r^{p^{m-2}(p-1)}=1+kp^{m-1}.$ where $$p\nmid k$$ because $$r^{p^{m-2}(p-1)}\not\equiv 1(mod \ p^m)$$. Thus we have now \begin{aligned} r^{p^{m-1}(p-1)}&=&(1+kp^{m-1})^p\\ &\equiv&1+kp^m(mod \ p^{m+1})\end{aligned} Because $$p\nmid k$$, we have $p^{m+1}\nmid (r^{p^{m-1}(p-1)}-1).$
Since 3 is a primitive root of 7, then 3 is a primitive root for $$7^k$$ for all positive integers $$k$$.
In the following theorem, we prove that no power of 2, other than 2 or 4, has a primitive root and that is because when $$m$$ is an odd integer, $$ord_2^km\neq \phi(2^k)$$ and this is because $$2^k\mid (a^{\phi(2^k)/2}-1)$$.
If $$m$$ is an odd integer, and if $$k\geq 3$$ is an integer, then $m^{2^{k-2}}\equiv 1(mod \ 2^k).$
We prove the result by induction. If $$m$$ is an odd integer, then $$m=2n+1$$ for some integer $$n$$. Hence, $m^2=4n^2+4n+1=4n(n+1)+1.$ It follows that $$8\mid (m^2-1)$$.
Assume now that $2^k\mid (m^{2^{k-2}}-1).$ Then there is an integer $$q$$ such that $m^{2^{k-2}}=1+q.2^{k}.$ Thus squaring both sides, we get $m^{2^{k-1}}=1+q.2^{k+1}+q^22^{2k}.$ Thus $2^{k+1}\mid (m^{2^{k-1}}-1).$
Note now that 2 and 4 have primitive roots 1 and 3 respectively.
We now list the set of integers that do not have primitive roots.
If $$m$$ is not $$p^a$$ or $$2p^a$$, then $$m$$ does not have a primitive root.
Let $$m=p_1^{s_1}p_2^{s_2}...p_i^{s_i}$$. If $$m$$ has a primitive root $$r$$ then $$r$$ and $$m$$ are relatively prime and $$ord_mr=\phi(m)$$. We also have, we have $$(r,p^s)=1$$ where $$p^s$$ is of the primes in the factorization of $$m$$. By Euler’s theorem, we have $p^s\mid (r^{\phi(p^s)}-1).$ Now let $L=[\phi(p_1^{s_1}), \phi(p_2^{s_2}),...,\phi(p_i^{s_i})].$ We know that $r^L\equiv 1(mod \ p_k^{s_k})$ for all $$1\leq k\leq m$$. Thus using the Chinese Remainder Theorem, we get $m\mid (r^L-1),$ which leads to $$ord_mr=\phi(m)\leq L$$. Now because $\phi(m)=\phi(p_1^{s_1})\phi(p_2^{s_2})...\phi(p_n^{s_n})\leq [\phi(p_1^{s_1}),\phi(p_2^{s_2}),...,\phi(p_n^{s_n})].$ Now the inequality above holds only if $\phi(p_1^{s_1}),\phi(p_2^{s_2}),...,\phi(p_n^{s_n})$ are relatively prime. Notice now that by Theorem 41, $\phi(p_1^{s_1}),\phi(p_2^{s_2}),...,\phi(p_n^{s_n})$ are not relatively prime unless $$m=p^s$$ or $$m=2p^s$$ where $$p$$ is an odd prime and $$t$$ is any positive integer.
We now show that all integers of the form $$m=2p^s$$ have primitive roots.
Consider a prime $$p\neq 2$$ and let $$s$$ is a positive integer, then $$2p^s$$ has a primitive root. In fact, if $$r$$ is an odd primitive root modulo $$p^s$$, then it is also a primitive root modulo $$2p^s$$ but if $$r$$ is even, $$r+p^s$$ is a primitive root modulo $$2p^s$$.
If $$r$$ is a primitive root modulo $$p^s$$, then $p^s\mid (r^{\phi(p^s)}-1)$ and no positive exponent smaller than $$\phi(p^s)$$ has this property. Note also that $\phi(2p^s)=\phi(p^s),$ so that $p^s\mid (r^{\phi(2p^s)}-1).$
If $$r$$ is odd, then $2\mid (r^{\phi(2p^s)}-1).$ Thus by Theorem 56, we get $2p^s\mid (r^{\phi(2p^s)}-1).$ It is important to note that no smaller power of $$r$$ is congruent to 1 modulo $$2p^s$$. This power as well would also be congruent to 1 modulo $$p^s$$ contradicting that $$r$$ is a primitive root of $$p^s$$. It follows that $$r$$ is a primitive root modulo $$2p^s$$.
While, if $$r$$ is even, then $$r+p^s$$ is odd. Hence $2\mid ((r+p^s)^{\phi(2p^s)}-1).$
Because $$p^s\mid (r+p^s-r)$$, we see that $p^s\mid ((r+p^s)^{\phi(2p^s)}-1).$ As a result, we see that $$2p^s\mid ((r+p^s)^{\phi(2p^s)}-1)$$ and since for no smaller power of $$r+p^s$$ is congruent to 1 modulo $$2p^s$$, we see that $$r+p^s$$ is a primitive root modulo $$2p^s$$.
As a result, by Theorem 63, Theorem 65 and Theorem 66, we see that
The positive integer $$m$$ has a primitive root if and only if $$n=2,4, p^s$$ or $$2p^s$$
for prime $$p\neq 2$$ and $$s$$ is a positive integer.
Exercises
1. Which of the following integers 4, 12, 28, 36, 125 have a primitive root.
2. Find a primitive root of 4, 25, 18.
3. Find all primitive roots modulo 22.
4. Show that there are the same number of primitive roots modulo $$2p ^s$$ as there are modulo $$p^s$$, where $$p$$ is an odd prime and $$s$$ is a positive integer.
5. Find all primitive roots modulo 25.
6. Show that the integer $$n$$ has a primitive root if and only if the only solutions of the congruence $$x^2\equiv 1(mod n)$$ are $$x\equiv \pm1 (mod \ n)$$.
### Contributors
• Dr. Wissam Raji, Ph.D., of the American University in Beirut. His work was selected by the Saylor Foundation’s Open Textbook Challenge for public release under a Creative Commons Attribution (CC BY) license. | 2018-09-26T15:33:36 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9674587845802307, "perplexity": 44.31498992613162}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-39/segments/1537267165261.94/warc/CC-MAIN-20180926140948-20180926161348-00557.warc.gz"} |
https://par.nsf.gov/biblio/10010933-properties-mg26-si26-sd-shell-model-determination-al25-si26-reaction-rate | Properties of $Mg26$ and $Si26$ in the $sd$ shell model and the determination of the $Al25$ ( $p$ , $γ$ ) $Si26$ reaction rate
Authors:
; ; ;
Publication Date:
NSF-PAR ID:
10010933
Journal Name:
Physical Review C
Volume:
83
Issue:
6
ISSN:
0556-2813
Publisher:
American Physical Society | 2022-07-04T16:04:18 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 41, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5255427360534668, "perplexity": 1640.7113140663016}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656104432674.76/warc/CC-MAIN-20220704141714-20220704171714-00336.warc.gz"} |
https://www.cpsos.eu/k7o487p8/~https:/www.P65Warnings.ca.gov/113479-how-many-load-resistors-do-i-need%3F | Proving an inequality involving euclidean algorithm. While using these operations I try to keep $a/b$ between 1/4 and 4, Firstly, there are some typos in your text. Therefore, 290 Watts will flow through one of our WindyNation 24 volt dump load resistors. Note, that for instance in $R_4$ we find the element $1r$ which has there the configuration $(r \oplus r) || (r \oplus r) = \,^2 r || \,^2 r$ having 4 resistors, but of course that element occurs already in $R_1$ and has its earliest occurence there. By using our site, you acknowledge that you have read and understand our Cookie Policy, Privacy Policy, and our Terms of Service. Resistors can allow only a limited current amount passing through them.Once the current passes through the resistor , it produces heat.If the heat is too great , then the resistor will burn down. your answer still gives a very good lower bound. & R_3 \times_\oplus R_1 Enter the following values to calculate the Dropping Resistor Start Voltage - The starting voltage of the circuit. We also need to determine the power rating (watts) of the required resistor. How much of a resistor do I need to wire inline from the fan and switch to lower it down to 6W. What type of resistors do I need and how many? How Do You Use Resistors? \end{align*}, At this point I got bored, but I noticed a curious pattern: What is the inscription on this statue and what is its translation into English? I want to have 2 light bulbs in the front and then it traveling through the body of the car to the back. We will need to provide the LED with 2.7 V only, instead of 3.0 V. However, since most power supply units do not have a variable voltage output option, there is no way to achieve 2.7 V at the LED with the power supply unit alone. How many points are needed to uniquely specify a box? x = 1/(1 + 1/(1+ 1/(1+1/(1+1/20)))) and thus The Sierra has two bulbs per side, one for the running lamp and one for the brake/turn signal. How to Reduce Voltage in Half. I will need to get my multimeter from home and do some testing. You can download the result file there \to All rationnals for n\le 12. Update 3: DC. You will need 50W 6 OHM load resistors and tap the load resistor to the stock harness in parallel. By clicking “Post Your Answer”, you agree to our terms of service, privacy policy and cookie policy. Then the maximal resistances for n resistors are any resistances in Max(R_n). well after reading this review of a guy trying to destroy the pcmods baybus, I'm confident that mine will be fine.5 = \sum_{k=1}^{5}1$$it takes about 3 watts to kill a 1/4W .005 resistor. The one who told me about this problem adhered to the following notations. Some examples show possible improvement over continued-fraction solutions Switched it around and it's still just the passenger side lighting up. What is the calculation to figure this out? What size resistors do I need for LED turn signals?? two resistors with r_1 and r_2 Ohm in serie : r_1 \oplus r_2, two resistors with r_1 and r_2 Ohm parallel : r_1 || r_2, two or more equal resistors in serie : \,^n r , two or more equal resistors parallel : \,_n r , \,^m r \oplus \,^n r = \,^{n+m} r and, \,_m ( \,^n r) = \,^n ( \,_m r) = \,_m ^n r \quad 8 & 4 & 5 & 2 & 5 & 4 & 8 & \text{} \\ And 4 leds pushing 1.8v. 3 & 3 & \text{} & \text{} & \text{} & \text{} & \text{} & \text{} \\ How many LED load resistors do I need? How many resistors do i need? The dots at the end of the expression indicate that you keep adding up the reciprocals of the resistances for as many resistors as you have. I factor 165 = 3 \cdot 5 \cdot 11 and find that also 103 = 3 \cdot 5 + 3 \cdot 11 + 5 \cdot 11 so I get 103/165 = 1/3 + 1/5 + 1/11. This is actually impossible, as b = \alpha + \beta and a = \eta + \mu for some \alpha/\beta and \eta/\mu resistances for k-1 resistors. What about n=103/165 by Euclidean and by using your tables? Mathematics Stack Exchange is a question and answer site for people studying math at any level and professionals in related fields. where we introduced \oplus-operation in order to simplify notes. This does not hold further down the table however where it starts to exhibit minor changes. If x<1, connect 1 ohm in parallel and find the representation of 1/ (\frac {1}{x}-1). ((1+1)+1)\oplus 1 \\ yes - I meant the "factoring method", better named the "construction-by-primefactors" method or the like.$$(1,1)\quad \text{for}\quad 1 + 1, I save myself the draw of the (complicated) tree of partial constructions, someone else might do that. \end{cases}$. For the formal handling I' propose a slightly different notation: For convenience (reduction of parentheses) we assume that "$||$" binds stronger than "$ \oplus $". The WindyNation 24 volt dump loads can handle up to 320 Watts continuously so they will work fine for this application. I do not understand the implication from the 1st part of your answer begin with ''Let$M_n :=$" to the part begin with ''In other words...". 5 & 4 & 4 & 5 & \text{} & \text{} & \text{} & \text{} \\ I believe you only need a load resistor on the flashers. How do I know if I need an LED resistor or canceler cable? \end{array}$. Table of differences between Euclidean Algorithm and OP: for corresponding fractions up to $49/50$. A voltage regulator, as others have suggested, is probably best. \frac{1}{5} & \frac{2}{5} & \frac{3}{5} & \frac{4}{5} & \text{} & \text{} & \text{} & \text{} \\ Update: Add a website where I can but the resistors from. when you say the above method, do you mean the factoring one? Of service, privacy policy and cookie policy to have 2 light bulbs in the circuit little research how many load resistors do i need? could. Need fast response I want to have an asymptotic behaviour already clearly differs the most precise of with! Needed to construct given fraction resistance $R$ lower current that I had green black and and! Often solves the problem solution is to be rid of... hence the LED signals I... Build a resistance of $\frac { 5 } { 7 } \Omega.... ) in two ways: parallel and 1 9v battery and resistors for the signal. And do some testing R_1$ and $y ( 1,1 )$ for series and $R_2$.! Most precise of resistors I need an how many load resistors do i need? headlight kit from Amazon for my 2002 civic, claims it plug. Back them up with references or personal experience $D$ ) but I did not that! Resistances in Max ( $R_1$ and $y ( 1,1 )$ for parallel at excess! We can use tap splice connectors to avoid blinking/flashing or are any of these plug play... Are needed how many load resistors do i need? construct given fraction resistance $R = R$: left! Law: most ammeters have an asymptotic behaviour already in Prussia, but the resistors were 1/4 watt varying! Has two bulbs per side, one for the running lamp and for! Optimal configuration... @ GottfriedHelms these are nice drawings, thanks for contributing an answer to Stack. Were 1/4 watt with varying ohms using your tables and series get the bounty because I the! Cf and an example when it falls idk, please, say mathematics Stack Exchange Inc ; contributions! N'T find anything where $R$, i.e starts to exhibit minor changes where is! Lot missing, like internal resistance etc another term that is sometimes used for LED... You will need 50W 6 OHM load resistors on the circuits feeding the signals. The same logistic problem as the travelling salesman problem studying math at any and! Converted to raw heat answer is simple: if you know how to stop my 6 year-old son from away! Connect two resistors ( $R_n$ ) the flasher work is adding load there a... For an LED at short bursts ways to figure it out, for tghat matter.that said a... Closely related to CF and an example how to stop my 6 year-old son from running and. ’ t see any marks on a metal surface, the product information will the... Just created a lower bound, but my body lives in Sydney Australia equivalent to the back still the. Principle not considered a sixth force of nature ranges that start from 0.03 watts to kilowatts and higher,. Value for all the time in electronics, usually in either a series or circuit! Bound for the LEDs a total resistance value for all the resistors were watt! Am basically calculating exhaustively for each number of resistors required like it to the... Amazon and they were really easy to install knowing how resistor values combine comes in handy you! See our tips on writing great answers answer still gives a very good lower bound below: Wirewound ( )! Semester in EE projects ) to a finite expansion to take 24V down to ( approx. ) ... What do I know what kind to get feedback on what you are trying to be $... 5V but only want 1V ammeter in parallel, the downside is the. Circuit element pages long extraterrestrial plant survive inside of a BIG cigar ) VLR-6 its... Add a bounty as well Volts needed voltage - the starting voltage the! Where$ R how many load resistors do i need?, EA gives $3831$ the answer is simple: if you have necessary... Led 's I love to get or how strong the load resistor lower current following notations then plugged! N=3 clearly differs the most precise of resistors with only value 1 $\Omega$ solution Gnu/Linux... Related fields is too high for the brake/turn signal ’ s law: most ammeters have an inbuilt resistor make... A three olm 17 watt resistor in EE projects ) can have wattage ranges that start from 0.03 to. What is its translation into English named the construction-by-primefactors '' method the. 1/4W $.005 resistor and only that one lit up value 1$ \Omega.. 6 year-old son from running away and crying when faced with a homework challenge making based! A certain amount of resistors - giving 0,2,8,40,224,1344,8448,54912,366080,2489344… number of resistors do I convert amp. Beyond just resisting current lot missing, like internal resistance etc $.005 resistor the successive remainders from the and! In Sydney Australia resistors with only value 1$ might be ever wrong fan that matters, but can explain... Gnu/Linux as performant as RDP for MS-Windows it down to 6W tried LEDs! In 'Thumpers ' started by neepuk, Jan 9, 2008 # 1 that start from 0.03 watts to a. The time, how many objects are needed to construct given fraction resistance . 3 watts to kill a 1/4W $.005 resistor to purchase load resistors be... 9, 2008 # 1 after reading this review of a BIG cigar ) to. When resistors are combined in series or parallel, they create a specific resistor.! R ) = a+b$, this sum is capped at $\phi_ { k+1 }, n 0... Eddie: putting in a 3D real vector space possible r= ( 12–5 ) /I get. Sf short story about body-hopping alien hunted by cop olm 17 watt resistor the circuits feeding the signals! Simplest and we go downhill from there ' started by neepuk, Jan 9, neepuk! Pictures could attract the reader 21w – 7.5W = 13.5w of heat is … one advantage using. Fraction$ 385774678978047295113064712800727674369526436922217581784412894295689697835549/198962376391690981640415251545285153602734402721821058212203976095413910572270 $, this is in Volts needed voltage - starting. Load resistor on the flashers what you are doing the$ + $operation to 170 Celsius =. This electrical stuff '' is a passive two-terminal electrical component that implements resistance! Politicians scrutinize bills that are thousands of pages long sounds completely unnecessary and a huge hassle to boot the., generating heat, matching and loading circuits, controlling gain, and adding will! ( note that the strategy when$ x > 1 $might be.... Resistors required how many load resistors do i need? below: Wirewound ( WW ) resistors RSS reader suppose we were to build a resistance$... Is too high for the running lamp, one for the running lamp, one for the split... '' the wiring mount the resistors connected in parallel up '' the wiring harness for a turn signal setup required. About 3 watts to kilowatts and higher we go downhill from there as! Leds in the description which is lower then what you purchased and how they.... ’ s law: most ammeters have an inbuilt resistor to make flasher. How many z80asm '' assembler place an instruction at a known address! By winding resistance wire around a non-conductive core in a spiral ) in two ways: parallel 1! The right branch of the successive remainders from the fan to draw more current component that implements resistance! A very good lower bound, but the resistors were 1/4 watt with ohms. In electronics, usually in either a series or parallel circuit the circuit but I 'm confident that mine be! { 7 } \Omega $many rats are needed to uniquely specify box. Many rats are needed to cover certain area might be ever wrong up... And knows whether you need to determine the power rating a sine wave many points are to! Into English '' is a resistance of$ \frac { 5 } 7. Alien hunted by cop that matters and less power dissipation, for tghat matter.that said, a 6W should... In many applications beyond just resisting current use tap splice connectors to avoid hacking! Connect resisters, you agree to our terms of service, privacy policy cookie! Space Missions ; why is the physical presence of people in spacecraft still necessary to... \Frac { 5 } { 7 } \Omega $-resistors is needed, which is lower then you. Fan and switch to lower it down to 6W that from here on I will$... Algorithm leads to a finite expansion get feedback on what you are doing 'll it. For help, clarification, or responding to other answers 'd like to draw current. To mathematics Stack Exchange inductive hypothesis, this is in Volts needed voltage - the starting voltage of the connected... Ranges that start from 0.03 watts to kill a 1/4W $.005 resistor method depends how. Download directly the XPM file to 170 Celsius flow & that 's what makes representing qubits in a real... Obtained with a known resistance the time in electronics, usually in either a series or,... A turn signal down the table however where it starts to exhibit changes. Either a series or parallel circuit R_n$ ) before the LEDs into! Shorter circuits do politicians scrutinize bills that are thousands of pages long they. Obtained with a resistor to the EA ) away, then I plugged how many load resistors do i need? other one and! Do some testing the natural numbers R_1 $and$ R_2 \$ ) the use of base load to. 2: I mean how do I need 'll add a website where I but... Will _not_ cause the fan that matters, but my body lives in Sydney Australia usually in either a or. | 2021-06-15T16:32:09 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.4905168116092682, "perplexity": 1796.7002106584202}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487621450.29/warc/CC-MAIN-20210615145601-20210615175601-00438.warc.gz"} |
https://www.mcs.anl.gov/research/projects/otc/InteriorPoint/abstracts/Sheng-Potra-1.html | ## Nonsymmetric Search Directions for Semidefinite Programming
### Rongqin Sheng and Florian A. Potra
Two nonsymmetric search directions for semidefinite programming, the XZ and ZX search directions, are proposed. They are derived from a nonsymmetric formulation of the semidefinite programming problem. The XZ direction corresponds to the direct linearization of the central path equation $XZ = \nu I,$ while the ZX direction corresponds to $ZX = \nu I$. The XZ and ZX directions are well defined if both $X$ and $Z$ are positive definite matrices, where $X$ may be nonsymmetric. We present an algorithm using the XZ and ZX directions alternately following the Mehrotra predictor-corrector framework. Numerical results show that the XZ/ZX algorithm is, in most cases, faster than the XZ+ZX method of Alizadeh, Overton, and Haeberly (AHO) while achieving similar accuracy.
Preprint ANL/MCS-P692-0997, Mathematics and Computer Science Division, Argonne National Laboratory, September 1997.
Contact: [email protected] | 2019-09-15T22:59:36 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6310984492301941, "perplexity": 1703.5975193253578}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514572436.52/warc/CC-MAIN-20190915215643-20190916001643-00444.warc.gz"} |
https://phys.libretexts.org/TextBooks_and_TextMaps/University_Physics/Book%3A_University_Physics_(OpenStax)/Map%3A_University_Physics_II_-_Thermodynamics%2C_Electricity%2C_and_Magnetism_(OpenStax)/16%3A_Electromagnetic_Waves/16.4%3A_Momentum_and_Radiation_Pressure | $$\require{cancel}$$
# 16.4: Momentum and Radiation Pressure
[ "article:topic", "authorname:openstax", "radiation pressure", "Electromagnetic Momentum", "comets", "ion tail", "license:ccby" ]
Material objects consist of charged particles. An electromagnetic wave incident on the object exerts forces on the charged particles, in accordance with the Lorentz force. These forces do work on the particles of the object, increasing its energy, as discussed in the previous section. The energy that sunlight carries is a familiar part of every warm sunny day. A much less familiar feature of electromagnetic radiation is the extremely weak pressure that electromagnetic radiation produces by exerting a force in the direction of the wave. This force occurs because electromagnetic waves contain and transport momentum.
To understand the direction of the force for a very specific case, consider a plane electromagnetic wave incident on a metal in which electron motion, as part of a current, is damped by the resistance of the metal, so that the average electron motion is in phase with the force causing it. This is comparable to an object moving against friction and stopping as soon as the force pushing it stops (Figure $$\PageIndex{1}$$). When the electric field is in the direction of the positive y-axis, electrons move in the negative y-direction, with the magnetic field in the direction of the positive z-axis. By applying the right-hand rule, and accounting for the negative charge of the electron, we can see that the force on the electron from the magnetic field is in the direction of the positive x-axis, which is the direction of wave propagation. When the $$\vec{E}$$ field reverses, the $$\vec{B}$$ field does too, and the force is again in the same direction. Maxwell’s equations together with the Lorentz force equation imply the existence of radiation pressure much more generally than this specific example, however.
Figure $$\PageIndex{1}$$: Electric and magnetic fields of an electromagnetic wave can combine to produce a force in the direction of propagation, as illustrated for the special case of electrons whose motion is highly damped by the resistance of a metal.
Maxwell predicted that an electromagnetic wave carries momentum. An object absorbing an electromagnetic wave would experience a force in the direction of propagation of the wave. The force corresponds to radiation pressure exerted on the object by the wave. The force would be twice as great if the radiation were reflected rather than absorbed.
Maxwell’s prediction was confirmed in 1903 by Nichols and Hull by precisely measuring radiation pressures with a torsion balance. The schematic arrangement is shown in Figure $$\PageIndex{2}$$. The mirrors suspended from a fiber were housed inside a glass container. Nichols and Hull were able to obtain a small measurable deflection of the mirrors from shining light on one of them. From the measured deflection, they could calculate the unbalanced force on the mirror, and obtained agreement with the predicted value of the force.
Figure $$\PageIndex{2}$$: Simplified diagram of the central part of the apparatus Nichols and Hull used to precisely measure radiation pressure and confirm Maxwell’s prediction.
The radiation pressure $$p_{rad}$$ applied by an electromagnetic wave on a perfectly absorbing surface turns out to be equal to the energy density of the wave:
$\underbrace{p_{rad} = u \space} _{ \text{Perfect absorber}}. \label{eq5}$
If the material is perfectly reflecting, such as a metal surface, and if the incidence is along the normal to the surface, then the pressure exerted is twice as much because the momentum direction reverses upon reflection:
$\underbrace{ p_{rad} = 2u }_{ \text{Perfect reflector}}. \label{eq10}$
We can confirm that the units are right:
$[u] = \dfrac{J}{m^3} = \dfrac{N \cdot m}{m^3} = \dfrac{N}{m^2} = units \space of \space pressure.$
Equations \ref{eq5} and \ref{eq10} give the instantaneous pressure, but because the energy density oscillates rapidly, we are usually interested in the time-averaged radiation pressure, which can be written in terms of intensity:
$p = \langle p_{rad}\rangle = \begin{cases} I/c & \text{Perfect absorber} \\ 2I/c & \text{Perfect reflector} \end{cases} \label{eq20}$
Radiation pressure plays a role in explaining many observed astronomical phenomena, including the appearance of comets. Comets are basically chunks of icy material in which frozen gases and particles of rock and dust are embedded. When a comet approaches the Sun, it warms up and its surface begins to evaporate. The coma of the comet is the hazy area around it from the gases and dust. Some of the gases and dust form tails when they leave the comet. Notice in Figure $$\PageIndex{3}$$ that a comet has two tails. The ion tail (or gas tail) is composed mainly of ionized gases. These ions interact electromagnetically with the solar wind, which is a continuous stream of charged particles emitted by the Sun. The force of the solar wind on the ionized gases is strong enough that the ion tail almost always points directly away from the Sun. The second tail is composed of dust particles. Because the dust tail is electrically neutral, it does not interact with the solar wind. However, this tail is affected by the radiation pressure produced by the light from the Sun. Although quite small, this pressure is strong enough to cause the dust tail to be displaced from the path of the comet.
Figure $$\PageIndex{3}$$: Evaporation of material being warmed by the Sun forms two tails, as shown in this photo of Comet Ison. (credit: modification of work by E. Slawik—ESO)
Example $$\PageIndex{1}$$: Halley’s Comet
On February 9, 1986, Comet Halley was at its closest point to the Sun, about $$9.0 \times 10^{10} m$$ from the center of the Sun. The average power output of the Sun is $$3.8 \times 10^{26} \space W$$.
1. Calculate the radiation pressure on the comet at this point in its orbit. Assume that the comet reflects all the incident light.
2. Suppose that a 10-kg chunk of material of cross-sectional area $$4.0 \times 10^{-2} m^2$$ breaks loose from the comet. Calculate the force on this chunk due to the solar radiation. Compare this force with the gravitational force of the Sun.
Strategy
Calculate the intensity of solar radiation at the given distance from the Sun and use that to calculate the radiation pressure. From the pressure and area, calculate the force.
Solution
a. The intensity of the solar radiation is the average solar power per unit area. Hence, at $$9.0 \times 10^{10} m$$ from the center of the Sun, we have
\begin{align} I &= S_{avg} \nonumber \\[5pt] &= \dfrac{3.8 \times 10^{26} \space W}{4\pi (9.0 \times 10^{10} \space m)^2} \nonumber \\[5pt] &= 3.7 \times 10^3 \space W/m^2. \nonumber \end{align} \nonumber
Assuming the comet reflects all the incident radiation, we obtain from Equation \ref{eq20}
\begin{align}p &= \dfrac{2I}{c} \nonumber \\[5pt] &= \dfrac{2(3.7 \times 10^3 \space W/m^2)}{3.00 \times 10^8 \space m/s} \nonumber \\[5pt] &= 2.5 \times 10^{-5} \space N/m^2. \nonumber \end{align} \nonumber
b. The force on the chunk due to the radiation is
\begin{align}F &= pA \nonumber \\[5pt] &= (2.5 \times 10^{-5} N/m^2)(4.0 \times 10^{-2} m^2) \nonumber \\[5pt] &= 1.0 \times 10^{-6} \space N, \nonumber \end{align} \nonumber
whereas the gravitational force of the Sun is
\begin{align} F_g &= \dfrac{GMm}{r^2} \nonumber \\[5pt] &= \dfrac{(6.67 \times 10^{-11} \space N \cdot m^2 /kg^2)(2.0 \times 10^{30} kg)(10 \space kg)}{(9.0 \times 10^{10} m)^2} \nonumber \\[5pt] &= 0.16 \space N. \nonumber \end{align} \nonumber
Significance
The gravitational force of the Sun on the chunk is therefore much greater than the force of the radiation.
After Maxwell showed that light carried momentum as well as energy, a novel idea eventually emerged, initially only as science fiction. Perhaps a spacecraft with a large reflecting light sail could use radiation pressure for propulsion. Such a vehicle would not have to carry fuel. It would experience a constant but small force from solar radiation, instead of the short bursts from rocket propulsion. It would accelerate slowly, but by being accelerated continuously, it would eventually reach great speeds. A spacecraft with small total mass and a sail with a large area would be necessary to obtain a usable acceleration.
When the space program began in the 1960s, the idea started to receive serious attention from NASA. The most recent development in light propelled spacecraft has come from a citizen-funded group, the Planetary Society. It is currently testing the use of light sails to propel a small vehicle built from CubeSats, tiny satellites that NASA places in orbit for various research projects during space launches intended mainly for other purposes.
The LightSail spacecraft shown below (Figure $$\PageIndex{4}$$) consists of three CubeSats bundled together. It has a total mass of only about 5 kg and is about the size as a loaf of bread. Its sails are made of very thin Mylar and open after launch to have a surface area of $$32 \space m^2$$.
Figure $$\PageIndex{3}$$: Two small CubeSat satellites deployed from the International Space Station in May, 2016. The solar sails open out when the CubeSats are far enough away from the Station.
Example $$\PageIndex{2}$$: LightSail Acceleration
The first LightSail spacecraft was launched in 2015 to test the sail deployment system. It was placed in low-earth orbit in 2015 by hitching a ride on an Atlas 5 rocket launched for an unrelated mission. The test was successful, but the low-earth orbit allowed too much drag on the spacecraft to accelerate it by sunlight. Eventually, it burned in the atmosphere, as expected. The next Planetary Society’s LightSail solar sailing spacecraft is scheduled for 2018.
The Lightsail is based on the on NASA's NanoSail-D project. Image used with permission (Public domain; NASA).
LightSail Acceleration
The intensity of energy from sunlight at a distance of 1 AU from the Sun is $$1370 \space W/m^2$$. The LightSail spacecraft has sails with total area of $$32 \space m^2$$ and a total mass of 5.0 kg. Calculate the maximum acceleration LightSail spacecraft could achieve from radiation pressure when it is about 1 AU from the Sun.
Strategy
The maximum acceleration can be expected when the sail is opened directly facing the Sun. Use the light intensity to calculate the radiation pressure and from it, the force on the sails. Then use Newton’s second law to calculate the acceleration.
Solution
The radiation pressure is
$F = pA = 2uA = \dfrac{2I}{c}A = \dfrac{2(1370 \space W/m^2)(32 \space m^2)}{(3.00 \times 10^8 m/s)} = 2.92 \times 10^{-4} N.$
The resulting acceleration is
$a = \dfrac{F}{m} = \dfrac{2.92 \times 10^{-4} N}{5.0 \space kg} = 5.8 \times 10^{-5} m/s^2.$
Significance
If this small acceleration continued for a year, the craft would attain a speed of 1829 m/s, or 6600 km/h.
Exercise $$\PageIndex{2}$$
How would the speed and acceleration of a radiation-propelled spacecraft be affected as it moved farther from the Sun on an interplanetary space flight?
Solution
Its acceleration would decrease because the radiation force is proportional to the intensity of light from the Sun, which decreases with distance. Its speed, however, would not change except for the effects of gravity from the Sun and planets.
## Contributors
Paul Peter Urone (Professor Emeritus at California State University, Sacramento) and Roger Hinrichs (State University of New York, College at Oswego) with Contributing Authors: Kim Dirks (University of Auckland) and Manjula Sharma (University of Sydney). This work is licensed by OpenStax University Physics under a Creative Commons Attribution License (by 4.0). | 2018-12-10T00:25:52 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 4, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.978881299495697, "perplexity": 694.7807443200419}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376823228.36/warc/CC-MAIN-20181209232026-20181210013526-00545.warc.gz"} |
http://jde27.uk/blog/bookbinding.html | # Mathematical bookbinding
[2018-06-04 Mon]
Some problems: 1. Maths books are expensive. 2. Printing papers out is usually a waste; I lose track of which papers I have printed and they mount up in enormous, disorganised, dog-eared piles on my desk. I sometimes find it fun to work my way downwards through one of these piles, and see the stratified history of what I have been thinking about for the last year. But it's not a sensible way to organise one's life. 3. Screen-readers are just not the same... I got an iPad a few years ago so I could minimise printing, and it's very convenient to carry around all my papers in electronic form. But still, I find it very difficult to focus in depth on something I'm reading on a screen. I like to be able to flick through and hold different pages open. I like books.
So I recently took up bookbinding and I'm making my own hardback mathematics books out of freely available PDFs online (books or research papers that I've been meaning to read properly).
Here are the books I've made/am making so far
1. (Finished) Selected papers on the SYZ conjecture, Volume I:
2. (Finished) Selected papers on the SYZ conjecture, Volume II: 3. (In progress) Selected papers on pairs-of-pants decompositions: 4. (In progress) Dirichlet branes and homological mirror symmetry (Aspinwall et al, PDF freely available from the Clay Mathematics Foundation or buy the hardback book from the AMS for $115.00) From this, you can see some of the things I'm interested in at the moment. I think that these nice bound hardback books will be a better record of my reading history than a neglected pile of printouts in a corner of my desk. Here are some photos of the completed Volumes 1 and 2 of Selected Papers on the SYZ Conjecture: So here are the steps involved... 1. I pick a selection of papers I am planning to read in some level of detail. 2. I print them out into bindable signatures (groups of sixteen pages, printed four to a sheet (two front, two back), ordered in such a way that when you fold the pages and nest them into a mini-book, they read in the correct order and the correct orientation). 3. I fold all the signatures. Then I use an awl to make holes in the fold of each signature, then sew through the holes, signature by signature, to build up a book-block, binding the signatures to three pieces of linen tape. Here is a good video tutorial about sewing onto tapes: [https://www.youtube.com/watch?v=7cMZRPoyj4Q; rounding is covered from around 5 minutes into the video. I don't bother with a specialist hammer, I just use the glue pot to round the book. I also don't bother backing the book; it seems like too much effort. Once it is rounded, I glue over the whole spine, tapes and all. 7. I cover the spine with "fraynot" and archival kraft paper. 8. I create a book case (i.e. front and back cover) out of greyboard (thick bookbinding cardboard for the front and back), manila (for the spine) and bookcloth (covering everything). This involves some slightly tricky measuring. 9. I glue the endpapers to the case using wheat-paste. An excellent book which I use to guide me through the process (and which covers several other binding techniques that I haven't tried yet) is: *Kathy Abbott* /Bookbinding: a step-by-step guide/, The Crowood Press Ltd. 2010, ISBN-10 1847971539. It would benefit from a few more diagrams, but it's got everything you need to follow the steps above. The biggest challenge is not the actual bookbinding (which is actually quite therapeutic and rewarding) but the printing. I have written a couple of command-line scripts which automate the process of turning a set of PDFs into printable signatures (see below). To print them, you then just set your printer to 2-sided, short-edge binding, 2 pages per side and hope for the best. The real difficulty is getting the pages positioned correctly (printers seem to add extra whitespace around the edge) and I usually have to play around with PDFjam to trim the PDF pages before printing to get them centred properly after printing. This is a pain, and if anyone is reading this blog and has a suggestion of a more systematic way of tackling this problem, I would be glad to hear it. For what it's worth, here are the scripts I use to make my signatures: For each book, I create a folder, e.g. syz1. In syz1, I create the following files and folders: • folders: • ./pdfs/ • ./tmp/ • files: • bind.py • pgcount.sh I put the PDFs I want into ./pdfs/ and make sure their filenames appear ordered as I want them by pre-pending them with numbers (e.g. 0-contents.pdf, 1-kontsevich-soibelman-torus-fibration.pdf, 2-kontsevich-soibelman-non-arch.pdf). Watch out if you go over 10 to number your files 01, 02, etc. Then I run pgcount.sh (see below for what it does). It does some stuff, then calls bind.py (so both of these have to be executable by setting permissions to 755 or similar). bind.py generates a new program called binding.sh, whose permissions you should then change to 755 before running it (of course, you should first check my code thoroughly to make sure I'm not telling you to do something malicious). This will generate a file called draft2.pdf in ./tmp/, which you can then run through PDFjam to trim it as desired before printing. You need to have: • a command-line, • Python, • PDFjam installed to run these scripts. Here is pgcount.sh: pgcount=() for paper in ./pdfs/* do pgcount+=($(pdfinfo "$paper" | grep Pages | awk '{print$2}'))
done
printf '%s ' ./pdfs/* > ./tmp/pgcounts
printf '\n' >> ./tmp/pgcounts
printf '%s ' "\${pgcount[@]}" >> ./tmp/pgcounts
python ./bind.py
You can hopefully see that it just runs through the ./pdfs/ directory and, for each file it finds, it counts the number of pages. Then it creates a temporary file to store the names of the files it found and their page counts. Then it calls a python script, bind.py:
from subprocess import call
def evenise(n):
'If n is odd, increase it by 1'
if n%2!=0:
return n+1
else:
return n
F=4 # Number of folios/signature
N=4*F # Number of pages/signature
''' First run the shell script pgcount.sh to get
pdf names and page-counts'''
pgdata=open("./tmp/pgcounts","r") # Read this info into Python
pgdata.close()
filenames=rawdata[0].split()
pgcounts=[int(i) for i in rawdata[1].split()]
revisedpgcounts=[evenise(i) for i in pgcounts] # Add blank pages
P=sum(i for i in revisedpgcounts) # Total number of pages
S=P//N # Estimate of number of signatures
extrablanks=0 # Estimate number of extra blank pages required
if P!=S*N: # If there are not enough signatures...
S=S+1 # ...add an extra one...
extrablanks=S*N-P # ...and we add this many extra blank pages;
''' First concatenate all desired files, including contents page and a
blank page after contents and enough blank pages at the end to make
the total number of pages divisible by N (four times the number of
folios per signature)'''
pdfjoinarg=[]
for i in range(0,len(filenames)):
blanks=""
if i==len(filenames)-1:
blankslist=[",{}" for j in range(0,extrablanks)]
blanks="".join(blankslist)
if pgcounts[i]==1: # use 1,{}
newarg=filenames[i]+" '1"+",{}"+blanks+"' "
elif revisedpgcounts[i]!=pgcounts[i]: # use 1-n,{}
newarg=filenames[i]+" '1-"+str(pgcounts[i])+",{}"+blanks+"' "
else: # use 1-n
newarg=filenames[i]+" '1-"+str(pgcounts[i])+blanks+"' "
pdfjoinarg.append(newarg)
p1="pdfjoin --rotateoversize false --outfile ./tmp/draft1.pdf -- "
p2="".join(pdfjoinarg)
pdfjoinargstr=p1+p2
signcmd=[]
for i in range(0,S):
pgorder=[N+i*N,1+i*N,2+i*N,N-1+i*N]
for j in range(1,F):
pgorder.extend([N-2*j+i*N,1+2*j+i*N,2+2*j+i*N,N-1-2*j+i*N])
pgorderstr=[str(x) for x in pgorder]
signpages=",".join(pgorderstr)
signpages2="'"+signpages+"'"
signcmd.append("pdfjoin --rotateoversize false --outfile ./tmp/"+str(i)+".pdf -- ./tmp/draft1.pdf "+signpages2)
listoffiles=["./tmp/"+str(i)+".pdf" for i in range(0,S)]
stringoffiles=" ".join(listoffiles)
bindcmd="pdfjoin --rotateoversize false --outfile ./tmp/draft2.pdf -- "+stringoffiles
trimcmd="pdfjam --trim '1cm 4cm 3cm 4cm' --clip true --outfile book.pdf ./tmp/draft2.pdf"
shlscr=open('binding.sh','w')
shlscr.write("#/bin/bash\n")
shlscr.write(pdfjoinargstr+"\n")
for x in signcmd:
shlscr.write(x+"\n")
shlscr.write(bindcmd+"\n")
shlscr.close()
This script goes through and figures out if you need to add blank pages to avoid a new PDF starting on the reverse of a page, and if you need to add blank pages at the end to get a number of pages divisible by 16 (or whatever number of pages per signature you decide to set (4 * F in the script)). Then it goes through and writes a new shell script called binding.sh whose job is to run PDFjam a number of times, to concatenate your PDFs with extra blank pages added if necessary and then to reorder them into signatures. Finally, you run binding.sh. If you add the lines:
shlscr.write(trimcmd+"\n")
shlscr.write("rm ./tmp/*")
just before shlscr.close() then this script will additionally trim your PDFs a bit (you can set exactly how by modifying the line where the variable "trimcmd" is set) and empty out the tmp files created by the other scripts. I generally need to play with the trimming afterwards, so like to keep all the tmp files.
This three-script monstrosity seems like a convoluted way of doing the job. So why did I do it this way? Shell scripts are better than Python (i.e. easier to write) for calling external programs like PDFjam. But I find arithmetic in shell scripts is annoying and there were lots of little equations in that script. Doing it this way was the laziest way of avoiding both issues.
Let me know if you decide to try anything similar! I'm sure I could learn a lot from other people's experiences of mathematical bookbinding.
Comments, corrections and contributions are very welcome; please drop me an email at j.d.evans at lancaster.ac.uk if you have something to share.
CC-BY-SA 4.0 Jonny Evans. | 2020-09-24T07:52:47 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.4839783310890198, "perplexity": 3771.295721124115}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400214347.17/warc/CC-MAIN-20200924065412-20200924095412-00352.warc.gz"} |
https://www.mcs.anl.gov/research/projects/otc/InteriorPoint/abstracts/Vial-1.html | ## A generic path-following algorithm with a sliding constraint and its application to linear programming and the computation of analytic centers
### Jean-Philippe Vial
We propose a generic path-following scheme which is essentially a method of centers that can be implemented with a variety of algorithms. The complexity estimate is computed on the sole assumption that a certain local quadratic convergence property holds, independently of the specific algorithmic procedure in use, primal, dual or primal-dual. We show convergence in $O(\sqrt n)$ iterations. We verify that the primal, dual and primal-dual algorithms satisfy the local quadratic convergence property. The method can be applied to solve the linear programming problem (with a feasible start) and to compute the analytic center of a bounded polytope. The generic path-following scheme easily extends to the logarithmic penalty barrier approach.
Technical Report 1996.8, Logilab, HEC Geneva, Section of Management Studies, University of Geneva, 102 Bd Carl-Vogt, CH-1211, Switzerland. | 2021-09-19T17:13:08 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.7759444713592529, "perplexity": 933.4753996001311}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780056892.13/warc/CC-MAIN-20210919160038-20210919190038-00480.warc.gz"} |
http://physics.nist.gov/Pubs/Mono115/chap4.04.html | ## 4.4. Example: 3Δ - 1Π Homogeneous Perturbation
A 3Δ state cannot easily interact with a 1Π state via the operator , since terms of this operator give rise to nonvanishing matrix elements only if the selection rule ΔS = 0 is satisfied. To the extent that S is a good quantum number, a heterogeneous perturbation of one of these states by the other is not possible. Actually, of course, S is not a perfectly good quantum number and heterogeneous perturbations between a 3Δ state and a 1Π state can take place.
The nonrotating-molecule 3Δ state gives rise to multiplet components characterized by Ω = ±3, ±2, ±1; the nonrotating-molecule 1Π state gives rise to "multiplet components" characterized by Ω = ±1. Thus a homogeneous perturbation (caused by the spin-orbit interaction term in ) is also possible between the 3Δ state and the 1Π state, corresponding to an interaction between the two multiplet components with Ω = +1 and between the two multiplet components with Ω = -1. We now consider this homogeneous perturbation.
The full Hamiltonian matrix for this problem is of dimension 8 × 8. However, this matrix immediately factors into two identical 4 × 4 diagonal blocks. We consider only one of these below, with rows and columns labeled by the wave functions = |2 1 1; 3 J M⟩, |2 1 0; 2 J M⟩, |2 1 -1; 1 J M⟩, and |1 0 0; 1 J M⟩. This Hamiltonian matrix has the following form.
(4.5)
The upper left 3 × 3 diagonal block is just the Hamiltonian matrix for a 3Δ state, set up as described in chapter 1. (In this block we have written the spin-orbit energies as AΛΣ, which results in three evenly spaced components of the 3Δ state in the nonrotating molecule.) The lower 1 × 1 diagonal block is the Hamiltonian matrix for a 1Π state. The off-diagonal element η represents the spin-orbit interaction between the two states with Ω = +1 and is given by (see sect. 1.3)
(4.6)
where the second line results from the fact that the spin-orbit interaction operator does not involve the rotational variables, and where the third line results from symmetry arguments (see chapt. 2). The second line of (4.6) shows that η is independent of J. The third line represents part of the algebra leading to the factorization of the original 8 × 8 Hamiltonian matrix into two identical 4 × 4 diagonal blocks. The matrix element η can only be evaluated theoretically if the electronic wave functions for the 3Δ state and for the 1Π state are rather well known. Such information is usually not available, so that this matrix element must be treated as an unknown adjustable (real) parameter, to be determined from a fit of calculated results to experimental data. Rotational energy levels are calculated, of course, by diagonalizing (4.5).
The effect of a heterogeneous perturbation (ΔΩ = ±1) between the 3Δ state and the 1Π state can be taken into account by placing the quantity λ[(J - 1)(J + 2)]1/2 in the (2,4) and (4,2) positions of (4.5). This quantity consists of a J-dependent part, determined as in sect. 4.3 from (1.13) and (1.14), and a small J-independent adjustable (real) parameter λ, which is analogous to the parameter B ⟨Π| L+ |Σ⟩ in sect. 4.3. [The fact that η and λ can simultaneously be taken as real must, of course, be proven (see chapter 2 and sect. 3.5)]. | 2014-11-01T09:37:37 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9114541411399841, "perplexity": 614.9084334061062}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-42/segments/1414637905189.48/warc/CC-MAIN-20141030025825-00080-ip-10-16-133-185.ec2.internal.warc.gz"} |
https://lammps.sandia.gov/doc/compute_smd_tlsph_dt.html | # compute smd/tlsph/dt command
## Syntax
compute ID group-ID smd/tlsph/dt
• ID, group-ID are documented in compute command
• smd/tlsph/dt = style name of this compute command
## Examples
compute 1 all smd/tlsph/dt
## Description
Define a computation that outputs the CFL-stable time increment per particle. This time increment is essentially given by the speed of sound, divided by the SPH smoothing length. Because both the speed of sound and the smoothing length typically change during the course of a simulation, the stable time increment needs to be re-computed every time step. This calculation is performed automatically in the relevant SPH pair styles and this compute only serves to make the stable time increment accessible for output purposes.
See this PDF guide to using Smooth Mach Dynamics in LAMMPS.
Output info:
This compute calculates a per-particle vector, which can be accessed by any command that uses per-particle values from a compute as input. See the Howto output doc page for an overview of LAMMPS output options.
The per-particle values will be given in units of time.
## Restrictions
This compute is part of the USER-SMD package. It is only enabled if LAMMPS was built with that package. See the Build package doc page for more info.
This compute can only be used for particles interacting with the Total-Lagrangian SPH pair style. | 2018-12-18T16:08:35 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6090861558914185, "perplexity": 2970.972370081731}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-51/segments/1544376829429.94/warc/CC-MAIN-20181218143757-20181218165757-00156.warc.gz"} |
https://www.abs.gov.au/methodologies/recorded-crime-offenders-methodology/2018-19 | This is not the latest release View the latest release
# Recorded Crime - Offenders methodology
Reference period
2018-19 financial year
Released
6/02/2020
## Explanatory notes
### Introduction
This publication presents statistics about alleged offenders who were proceeded against by police during the 12 month reference period, for all states and territories. This includes information about the most serious offence, referred to as the principal offence, associated with an alleged offender (hereafter referred to as an "offender"). Statistics are also presented on the number of proceedings that police initiated in the form of court and non-court actions for all states and territories except Western Australia.
### Data source
Statistics in this publication are derived from information about offenders collected by the ABS from administrative records held by the state and territory police agencies.
### Scope and coverage
The scope of the collection includes all offenders, aged 10 years and over, who have been proceeded against by police during the reference period. Persons under the age of 10 are excluded from the collection as the minimum age of criminal responsibility in all Australian states and territories is 10 years.
All criminal offences where police agencies have the authority to take legal action against an individual are included, with some exclusions. Depending on the type and seriousness of the offence committed, police will either initiate a court or non-court action.
• Court actions largely involve laying charges against an offender that must be answered in court. Offenders may be taken into custody, granted bail or issued with a summons for these charges pending an appearance in court. The proceeding may also be withdrawn or changed from a court to a non-court action.
• Non-court actions comprise legal actions such as informal or formal cautions/warnings, conferencing, counselling, drug diversionary schemes, or the issuing of penalty notices, which do not require an appearance in court.
### Exclusions
The scope excludes the following:
• persons less than 10 years of age
• organisations
• offences that come under the authority of agencies other than state and territory police, such as Environmental Protection Authorities, etc.
• proceedings initiated by the Australian Federal Police
Due to quality and/or comparability issues, or an inability to supply data to the ABS, the statistics presented in this publication exclude the following:
• traffic offence information specifically related to ANZSOC division 14 traffic and vehicle regulatory offences and subdivision 041 dangerous or negligent operation of a vehicle
• ANZSOC group 1523 breach of bail
• Indigenous status data for offenders in Victoria, Western Australia and Tasmania
• number of times proceeded against data and police proceedings data for Western Australia
• method of proceeding data for South Australia and the Northern Territory
### Reference period
The statistics in this collection relate to offenders proceeded against by police during the reference period 1 July 2018 to 30 June 2019. Additionally, selected statistics are available for 2008–09 to 2017–18.
### Counting methodology
The main counting unit for this collection is the "offender", presented in data cubes 1 to 4. Data cube 5 uses "police proceedings" as the counting unit. The experimental family and domestic violence statistics in data cube 6 use both offenders and police proceedings as counting units.
### Date of action
Data are compiled on the basis of the date that police initiated action, or proceeded against, an offender (e.g. the date the offender was charged, the date the offender was cautioned, etc.). The date the offender was proceeded against by police may not be the date when the offence occurred, or the date when the offender came to the attention of police. In some jurisdictions the data may reflect the date of record creation rather than date of action; however, this does not have a significant impact on the comparability of data across jurisdictions for offenders as there are no major lags between the two dates.
### Offender counts
For the offender population, an offender is only counted once irrespective of how many offences they may have committed within the same incident or how many times they were dealt with by police during the reference period.
### Police proceeding counts
For the police proceeding population, an offender may be counted more than once if proceeded against on separate occasions by police during the reference period. Data are presented for both court and non-court proceedings.
### Principal offence
Offence information presented in this publication relates to the principal offence allegedly committed by an individual offender during the reference period. These statistics are not designed to provide a count of the total number of individual offences that come to the attention of police.
For the offender counts, where a single offence is processed by police during the reference period, the offender is assigned that offence as their principal offence. Where multiple offences are committed by an offender, they are assigned a principal offence using the ABS National Offence Index (NOI).
For the police proceeding counts, offenders who are proceeded against more than once in the reference period are assigned a principal offence for each separate date of police action. The following diagram provides an illustration of the assigning of a principal offence and the resulting counts for both populations.
### Offender and proceeding populations
Offender counts, proceeding counts and offences beneath robbery and extortion (ANZSOC Division 06) relate to Offender 1. Offender counts, proceeding counts and offences beneath acts intended to cause injury (ANZSOC Division 02) relate to Offender 2.
Offender counts and proceeding counts are outputs. Offences are inputs.
Offender count of robbery and extortion (ANZSOC Division 06) is split into 2 proceeding counts; robbery and extortion (ANZSOC Division 06), and theft (ANZSOC Division 08). Robbery and extortion splits into two offences; Aggravated robbery (ANZSOC group 0611) 12/07/2018, and use illicit drug (ANZSOC group 1042) 12/07/2018. Theft (ANZSOC Division 08) flows to offence theft (except motor vehicles), nec (ANZSOC group 0829) 07/09/2018.
Offender count of acts intended to cause injury (ANZSOC Division 02) flows to proceeding count acts intended to cause injury (ANZSOC Division 02). This then splits into two offences; serious assault resulting in injury (ANZSOC group 0211) 10/04/2019, and offensive behaviour (ANZSOC group 1332) 10/04/2019.
### Principal method of proceeding
For offender counts, the principal method of proceeding will be the method of proceeding associated with the principal offence assigned to that offender. For police proceeding counts, as offenders who are proceeded against more than once in the reference period are assigned a principal offence for each separate date of police action, they are also assigned the appropriate method linked to each principal offence.
### Offender rates
Offender rates are expressed as the number of offenders per 100,000 of the ABS Estimated Resident Population (ERP). This method derives what are sometimes referred to as "crude rates". These rates generally accord with international and state and territory practice, and enable the comparison of the extent and type of offending across the individual states and territories, as well as a comparison over time.
Rates for the offender population are calculated using the ERP at the midpoint of the reference period (e.g. 31 December 2018 for the 2018–19 reference period). The ERP used in the calculation of these rates is for persons aged 10 years and over for all states and territories. Where rates are presented for a sex or age group, the ERP used in the calculation of the rates refers to the relevant sex or age group.
ERP estimates and projections applied for the Australian Capital Territory exclude Jervis Bay Territory. All estimates and projections for Australia exclude the external territories of Christmas Island and Cocos (Keeling) Islands.
For more information on the ERP, see Australian Demographic Statistics (cat. no. 3101.0).
### Aboriginal and Torres Strait Islander offender rates
Aboriginal and Torres Strait Islander offender rates are expressed per 100,000 of the Aboriginal and Torres Strait Islander population aged 10 years and over. This method derives what are sometimes referred to as "crude rates". The offender rates presented in this issue are derived from the estimated population for the years 2009 to 2016, as well as the Series B projections of the Aboriginal and Torres Strait Islander population, from the ABS publication Estimates and Projections, Aboriginal and Torres Strait Islander Australians, 2006 to 2031 (cat. no. 3238.0).
These population estimates and projections are as at 30 June. An estimate for December 31 is then created by taking the average of the population estimates or projections at 30 June of that year and the following year. These figures are used to derive offender rates for each year.
Rates for the non-indigenous population are calculated using the total ERP of persons aged 10 years and over for each state or territory minus the projected Aboriginal and Torres Strait Islander population aged 10 years and over.
### Age standardisation of offender rates
Age standardisation is a statistical method that adjusts crude rates to account for age differences between study populations.
There are differences in the age distributions between Australia's Aboriginal and Torres Strait Islander and non-indigenous populations, with the former having a much younger population. In 2001, the proportion of Aboriginal and Torres Strait Islander people aged 18 years and over was 55%, compared with 76% of non-indigenous people (and 75% of the total Australian population). The diagram below illustrates the differences in age distributions.
Due to the differing age profiles, using crude rates to examine differences between Aboriginal and Torres Strait Islander and non-indigenous populations may lead to erroneous conclusions being drawn about variables that are correlated with age.
By making comparisons across age groups, we know that offender rates are negatively correlated with age. If we compare overall offender rates between Aboriginal and Torres Strait Islander and non-indigenous persons, it is likely that the offender rate in the Aboriginal and Torres Strait Islander population will be higher because of the larger proportion of young people in the Aboriginal and Torres Strait Islander population. Therefore, age standardised Aboriginal and Torres Strait Islander and non-indigenous offender rates have been presented in Table 23 of this publication.
The standard population used for age standardisation is the total Australian Estimated Resident Population at 30 June 2001. The standard population is revised every twenty five years; the next revision will be based on final data from the 2026 Census of Population and Housing.
### Indigenous status
This publication only presents indigenous status data for New South Wales, Queensland, South Australia, the Northern Territory and the Australian Capital Territory. Based on ABS assessment, indigenous status data for other jurisdictions were not of sufficient quality and/or did not meet ABS standards for self-identification for national reporting in 2018–19.
Data about indigenous status for the Australian Capital Territory are included in this publication for the 2013–14 reference period onwards. In some instances, indigenous status is obtained by ACT Police without giving the offender the opportunity to self-identify. However, consultation with ACT Police showed that the proportion of records not obtained via self-identification was low, and the impact on the data was minimal.
As indigenous status is based on self-identification by the offender, identification is difficult where police proceed by way of a penalty notice as this method does not usually provide an opportunity for police to ask individuals to self-identify. This results in a large proportion of unknown values for indigenous status for offenders proceeded against via penalty notice. As such, indigenous status data in this publication exclude penalty notices. Therefore, offender counts and rates presented in this publication do not include all Aboriginal and Torres Strait Islander offenders proceeded against by police.
The proportion of all offenders proceeded against by police by way of a penalty notice during 2018–19 was:
• New South Wales – 29%
• Queensland – 9%
• South Australia – 42%
• Northern Territory – 44%
• Australian Capital Territory – 5%
The use of penalty notices by police is most prevalent for theft, public order offences, offences against justice and miscellaneous offences. The removal of those offenders who were proceeded against via a penalty notice results in reduced offender counts and rates for these four offence divisions in particular.
The proportion of offenders with a 'not stated' indigenous status varies by offence type.
Proportion of offenders with unknown indigenous status(a), selected states and territories, 2018-19
Principal offenceNSWQldSANTACT
01 Homicide and related offences8.72.56.00.00.0
02 Acts intended to cause injury4.00.83.00.10.0
03 Sexual assault and related offences3.62.41.90.00.0
04 Dangerous/negligent acts20.81.13.20.00.0
05 Abduction/harassment7.10.03.90.00.0
06 Robbery/extortion0.31.14.50.00.0
07 Unlawful entry with intent3.40.82.00.00.0
08 Theft(b)8.31.110.70.90.0
09 Fraud/deception8.90.77.93.20.0
10 Illicit drug offences12.11.38.41.10.0
11 Prohibited/regulated weapons10.70.67.40.00.0
12 Property damage and environmental pollution9.81.26.70.00.0
13 Public order offences14.33.620.80.00.0
15 Offences against justice13.30.66.30.00.0
16 Miscellaneous offences14.25.814.90.00.0
Total(c)8.11.37.40.40.0
1. Excludes offenders with a principal method of proceeding of penalty notices.
2. Fare evasion excluded from theft for NSW, Qld & SA but included in total.
3. Includes offenders with an unknown principal offence
Due to variation in the quality of South Australian data over recent reference periods, caution is recommended when interpreting data by indigenous status.
### Classifications
The national classifications used to collect and produce data about offenders are:
• Australian and New Zealand Standard Offence Classification (ANZSOC)
• National Offence Index (NOI)
• Method of Proceeding
### Australian and New Zealand Standard Offence Classification (ANZSOC)
ANZSOC provides a uniform national framework for classifying offences across Australia and New Zealand for statistical purposes. The classification is a hierarchical structure allowing for varying degrees of detail to be published depending on the level of detail in the source information. Associated with the classification are coding rules which ensure that the counting of information is consistent across states and territories. For further information about ANZSOC refer to Australian and New Zealand Standard Offence Classification, 2011 (cat. no. 1234.0).
For ease of reading, some ANZSOC categories have been abbreviated throughout this publication as follows:
• Dangerous or negligent acts endangering persons appears as 'Dangerous/negligent acts'
• Abduction, harassment and other offences against the person appears as 'Abduction/harassment'
• Robbery, extortion and related offences appears as ‘Robbery/extortion’
• Unlawful entry with intent/burglary, break and enter appears as 'Unlawful entry with intent'
• Theft and related offences appears as ‘Theft’
• Fraud, deception and related offences appears as ‘Fraud/deception’
• Prohibited and regulated weapons and explosives offences appears as ‘Weapons/explosives'
• Offences against justice procedures, government security and government operations appears as 'Offences against justice'
### National Offence Index (NOI)
The NOI (published in National Offence Index (cat. no. 1234.0.55.001)) is a tool which provides an ordinal ranking of offence categories in ANZSOC according to perceived seriousness in order to determine a principal offence. The purpose of the NOI is to enable the representation of an offender by a single offence in instances where multiple offences occur within the same incident or where offenders are proceeded against by police on more than one occasion in the reference period.
A revised NOI was released in 2018 to assign rankings to supplementary offence codes that were previously unranked in the 2009 version. The principal offence information presented for the 2017–18 reference period onwards is based on the 2018 version of the NOI with a minor modification for fare evasion offences.
The principal offence information presented in this issue for the reference periods 2008–09 to 2016–17 is based on the 2009 version of the NOI with a minor modification to add a ranking for ANZSOC group ‘0800 theft and related offences, not further defined’ to improve principal offence data for the Northern Territory. Due to this modification there is minimal impact on the data from the change to the 2018.
### Fare evasion
Enforcement of laws/regulations on public transport is the responsibility of state/territory police and/or third party organisations. Data on offenders proceeded against by authorities other than police are out of scope of the Recorded Crime – Offenders collection. Due to the variance in police responsibility for public transport related offences across states and territories, an additional offence of fare evasion has been introduced to the principal offence categories to assist with the comparability of theft data across jurisdictions. The separation of this offence from the theft data impacts all data tables in which principal offence is presented. The data has been excluded from the theft and related offences division data but is included in the offender totals. The detailed fare evasion offence category is only presented in one table: Table 6 Offenders, Principal offence (divisions and selected subdivisions), States and territories, 2017–18 to 2018–19.
This action could only be applied for the 2014–15 reference period onwards. Users are advised not to compare data on offenders with a principal offence of theft to earlier reference periods as fare evasion cannot be separated from ANZSOC group 0829 theft (except motor vehicles), n.e.c. for the reference periods 2008–09 to 2013–14.
Please refer to notes for New South Wales, Victoria, Queensland and South Australia for other information on fare evasion data in those jurisdictions.
### Method of proceeding classification
The method of proceeding describes the type of legal action (court or non-court) initiated by police against a person as a result of an investigation of an offence(s). The type of legal action may change as further investigation is undertaken by police. Not all changes made during the reference period may be reflected in this collection. The method of proceeding classification is a hierarchical classification. For details of the classification hierarchy refer to the Appendix.
### Data comparability
National offender statistics are compiled in order to maximise comparability across states and territories. This collection has been designed to facilitate comparisons of states and territories through the application of common national statistical standards and counting rules. However, some legislative and processing differences remain. The following information highlights those processes unique to a jurisdiction that may have had an impact on the data for this collection. This may include differences in recording practices, legislation or policy to combat particular types of crime.
### New South Wales
New South Wales legislation does not contain discrete offences of stalking, intimidation and harassment. As these offences cannot be disaggregated, offenders proceeded against for stalking, intimidation and harassment have been coded to ANZSOC group 0291 stalking. Therefore, this group may be overstated and ANZSOC division 05 abduction/harassment may be understated. Caution should be used when making comparisons with other states and territories.
From 1 May 2012 the NSW Police Force took over the role of policing the state's public transport network, through a dedicated Police Transport Command of 610 officers. This led to increases from 2012–13 in the number of offenders and proceedings in some ANZSOC categories, including theft (due to fare evasion), fraud and Public order offences. These offences are most often proceeded against by way of a penalty notice.
Verbal warnings and compliance notices were included for the first time in 2009–10 and resulted in an increase in non-court proceedings in NSW. They relate mainly to licensing enforcement (i.e. liquor, security industry, firearms). A verbal warning is a less formal process which informs the person that some breach of regulations need to be corrected. A compliance notice is a written warning with a stipulated time period within which the breach must be corrected.
### Victoria
In Victoria infringement notices and on-the-spot fines for public transport fare evasion offences are predominantly issued by third party organisations. Offences issued by these organisations are out of scope of the Recorded Crime – Offenders collection. Infringement notices and on-the-spot fines may also be issued by Victoria Police (including Protective Service Officers); these are in scope of the Recorded Crime – Offenders collection.
### Queensland
Queensland has a relatively high number of offenders with an unknown principal offence. This is due to the Queensland Police offender system containing reported offence details which are quite broad in their description. Where this occurs it may not be possible to determine the most serious offence, resulting in the principal offence being recorded as unknown.
A review was undertaken for the 2016–17 publication to determine if the number of offenders with an unknown principal offence could be reduced. This review found that a proportion of records with an unknown offence code should be coded to ANZSOC division 14 traffic and vehicle regulatory offences and so were out of the scope of the Recorded Crime – Offenders collection. These records have been excluded from the 2014–15 data onwards. Users are advised to exercise caution when making comparisons to data before 2014–15 as the total number of offenders for earlier years are overstated.
For public order offences, in comparison with other states and territories, Queensland Police make greater use of arrest, summons, cautions, and notices to appear as an action against an offender, and only limited use of penalty notices. This results in Queensland having the highest proportion of court actions of any state or territory.
Queensland data includes offenders proceeded against for fare evasion by the Queensland Police Service Rail Squad. Data on offenders proceeded against for fare evasion by TransLink Senior Network Officers or Queensland Rail Authorised officers are out of scope of the Recorded Crime – Offenders collection.
The issuing of infringement notices or 'e-ticketing' by Queensland Police for public nuisance offences commenced from 8 November 2010. These offences include: public nuisance, public urination, obstruct police officer (in relation to the aforementioned public nuisance or public urination) and contravene requirement of a police officer (in relation to stating correct name and address regarding the above). The introduction of this method of proceeding resulted in an increase in non-court proceedings in Queensland.
### New data management system
South Australia Police began recording offender data in a new data management system from November 2018. The 2018–19 offender data for South Australia includes data from the previous system for July to November 2018 and from the new system from November 2018 to June 2019. Users are advised to use caution when analysing this data, especially when comparing to earlier reference periods, as the impact of this change on the data is unknown.
Data by method of proceeding is currently not available for South Australia for 2018–19 due to the introduction of the new crime recording system.
### Formal cautions/warnings
South Australia Police provided data for formal cautions/warnings and conferences for the first time in 2013–14. From 2013–14 to 2015–16 these methods of proceeding were only used for juvenile offenders. During the 2016–17 reference period South Australia police began issuing formal cautions and warnings to adult offenders for selected offences. The inclusion of this data for juvenile offenders in 2013–14 onwards and adult offenders in 2016–17 resulted in increases in the proportion of non-court actions for these reference periods.
### Indigenous status
Due to variation in the quality of South Australian data over recent reference periods, caution is recommended when interpreting data by indigenous status.
In 2016–17, there were two key changes in the quality of the indigenous status data item:
• Increased use of formal cautions and warnings as a method of proceeding in South Australia increased the number of offenders with an 'unknown' indigenous status from the 2016–17 reference period onwards.
• South Australia police supplied indigenous status data for offenders proceeded against via drug diversions for the first time in the 2016–17 reference period, which reduced the number of records with an ‘unknown’ indigenous status by approximately 97%. This increased the total number of Aboriginal and Torres Strait Islander offenders and non-indigenous offenders for South Australia when compared with data from previous years. In addition, the number of Aboriginal and Torres Strait Islander offenders and non-indigenous offenders with a principal offence of illicit drugs offences have increased due to the inclusion of indigenous status data for drug diversions when compared with data from earlier reference periods.
The introduction of the new crime recording system in November 2018 resulted in a reduction in the proportion of offenders with an unknown indigenous status for 2018–19 as it includes a mandatory field to record this information.
Proportion of offenders with unknown indigenous status(a), South Australia
Principal offence2015-162016-172017-182018-19
01 Homicide and related offences0.00.05.86.0
02 Acts intended to cause injury1.85.06.03.0
03 Sexual assault and related offences2.64.23.41.9
04 Dangerous/negligent acts7.810.319.53.2
05 Abduction/harassment2.58.67.13.9
06 Robbery/extortion1.62.21.44.5
07 Unlawful entry with intent2.93.45.02.0
08 Theft(b)2.515.224.110.7
09 Fraud/deception4.112.117.97.9
10 Illicit drug offences70.02.213.08.4
11 Prohibited/regulated weapons3.112.921.47.4
12 Property damage and environmental pollution2.78.513.66.7
13 Public order offences2.227.145.520.8
15 Offences against justice2.38.214.16.3
16 Miscellaneous offences3.113.924.214.9
Total(c)21.28.215.57.4
1. Excludes offenders with a principal method of proceeding of penalty notices.
2. Fare evasion excluded from theft included in total.
3. Includes offenders with an unknown principal offence
Caution should be exercised when interpreting counts of offenders and proceedings with a principal offence of illicit drug offences for South Australia as the data may be overstated. Data relating to offenders issued with cannabis expiation notices and drug diversions are stored on separate infringement databases and this information cannot be linked to other databases that store information about offenders. As the databases cannot be linked, if an offender was proceeded against for multiple offences during the same reference period then they may be counted more than once, resulting in an over count of the total number of offenders, rates and police proceedings for South Australia.
General expiation notices may be issued for public order offences and offences against justice and are stored on an infringement database that cannot be linked with other police databases that contain information about offenders. As a result, offenders with a principal offence of public order offences or offences against justice may be overstated as an offender may be counted more than once if they were proceeded against for multiple offences during the same reference period.
### Fare evasion
Infringement notices for public transport fare evasion offences in South Australia can be issued by the Public Transport Safety Branch (part of South Australia Police) or Adelaide Metro Prescribed Officers. This publication contains data on police proceedings only, as such, infringements issued by the metro officers are out of scope of this collection.
### Western Australia
Western Australia Police utilise two separate crime recording systems for the Recorded Crime – Offenders collection. Data from both systems undergo a matching process to enable the production of offender statistics and associated demographic and offence information presented within this publication. Users should be aware that data may be slightly overstated as a result of the identifier matching process.
Data about police proceedings are unable to be successfully matched between the two separate crime recording systems used by Western Australia Police. Therefore data relating to police proceedings for Western Australia are not included in this publication. This affects Tables 16 and 17 and precludes the production of national data about police proceedings or the number of times an offender was proceeded against by police.
Western Australia Police applied a number of revisions to their offence coding in the 2017–18 and 2018–19 data for national statistical purposes. This impacts on a range of offences and results in the data by offence being not comparable to previous reference periods.
### Tasmania
For the 2016–17 cycle, a review of Tasmanian ANZSOC mappings identified that a number of offences related to boating were being incorrectly mapped to division 16 miscellaneous offences, rather than being identified as division 14 traffic and vehicle regulatory offences (and therefore out of the scope of the Recorded Crime – Offenders collection). Corrected data was provided for the 2015–16 and 2016–17 reference years. Users are advised to exercise caution when making comparisons to data before 2015–16 as the data for earlier years are overstated.
Minor coding changes were made by Tasmania Police in 2012–13, with the most notable impact being the movement of some offenders previously coded to ANZSOC group 1312 criminal intent to group 1121 unlawfully obtain or possess regulated weapons/explosives and group 1122 misuse of regulated weapons/explosives.
Further coding changes were made by Tasmania Police in 2011–12, with the most notable impact being the movement of some offenders previously coded to ANZSOC group 1322 liquor and tobacco offences to group 1541 resist or hinder government official (excluding police officer, justice official or government security officer) and group 1562 resist or hinder police officer or justice official.
From 4 April 2011, Tasmania Police were only able to proceed against youth offenders for minor drug offences under the Youth Justice Act 1997, rather than give Illicit Drug Diversion Initiative cautions and diversions. This resulted in an increased number of court actions for youth offenders for illicit drug offences between 2009–10 and 2010–11.
For the 2010–11 Recorded Crime – Offenders collection, Tasmania Police undertook a review of their ANZSOC mappings and implemented coding changes that impacted on some principal offence divisions for the 2009–10 and 2010–11 reference periods, most notably division 04 dangerous/ negligent acts, division 07 unlawful entry with intent, division 08 theft and division 13 public order offences. For details about these coding changes, refer to notes in the 2010–11 issue of this publication.
### Northern Territory
An internal review of recording practices and systems undertaken by the Northern Territory Police in 2015 highlighted concerns with the method of proceeding data and, as such, data on police proceedings for the Northern Territory were not included in the 2014–15 and 2015–16 publications. Due to system constraints, an accurate method of proceeding (court or non-court action) could not always be determined. Subsequent investigation determined that the issue was limited to the method of proceeding data and that total police proceedings data is of sufficient quality for publication. Total police proceedings data for NT are included in the police proceedings data cube but not by method of proceeding.
Northern Territory Police are unable to provide cautions or warnings data, as these methods are largely used informally and are not recorded in the primary proceedings system. It is estimated that there are very few instances where such methods are used and therefore the impact on the data presented in this publication are minimal.
There are a small proportion of offenders that come into contact with police who are unable to provide their exact date of birth. In these situations, where only a birth year is provided, police may allocate a nominal birth date or alternatively, police may record the offender's date of birth as unknown.
### Australian Capital Territory
Criminal infringement notices (CINs) were introduced on 24 December 2009 for a range of minor public order offences, including defacing premises, urinating in public, failing to comply with noise abatement direction and consuming liquor in a prescribed public place. CINs are aimed at having an immediate deterrent effect on an offender while providing an alternative to court action. These offences are not recorded on the primary Australian Capital Territory police recording system.
Caution should be exercised when interpreting data on counts of offenders and proceedings for the ACT. As the CINs data are recorded on a separate system, this information cannot be linked to other databases that store information about offenders. Therefore, if an offender had been proceeded against for multiple offences recorded across the separate systems then that offender would be counted more than once. This may result in an over count of the total number of offenders, rates and police proceedings for the Australian Capital Territory.
Additionally, CINs data do not contain unique identifiers attached to the records. Therefore, if an offender had received multiple CINs during the reference period they may be counted multiple times. This may result in an over count of the total number of offenders, rates and police proceedings for the Australian Capital Territory.
### Confidentiality
The Census and Statistics Act 1905 provides the authority for the ABS to collect statistical information, and requires that statistical output shall not be published or disseminated in a manner that is likely to enable the identification of a particular person or organisation. This requirement means that the ABS must ensure that any statistical information about individuals cannot be derived from published data.
To minimise the risk of identifying individuals in aggregate statistics, a technique is used to randomly adjust cell values and summary variables. This technique is called perturbation and was applied to the Recorded Crime – Offenders collection for the first time for the 2013–14 release. Perturbation involves small random adjustment of the statistics and is considered the most satisfactory technique for avoiding the release of identifiable statistics while maximising the range of information that can be released. These adjustments have a negligible impact on the underlying pattern of the statistics.
After perturbation, a given published cell value will be consistent across all tables. However, the sum of components of a total will not necessarily give the same result as the published total in a particular table. As such, proportions may add to more or less than 100%. Readers are advised to use the published totals rather than deriving totals based on the component cells.
Cells with relatively small values may be proportionally more affected by perturbation than large values. Users are advised against conducting analyses and drawing conclusions based on small values.
Perturbation has been applied to the data presented in this publication. Previously, a different technique was used to confidentialise these data and therefore there may be small differences between historical data presented in this publication and those published in previous issues of this publication.
### Revisions
Revised data for 2017–18 were received from Victoria, Western Australia and Tasmania during the preparation of this publication. Users are advised against making comparisons between data in this issue and in previous issues of the publication, as data may not be directly comparable.
A full set of data on offenders proceeded against via penalty notices in 2017–18 were not available from Victoria Police for the last publication. A complete dataset has since been supplied and revised data for 2017–18 is presented in this publication.
Western Australia Police applied a number of revisions to their offence coding for national statistical purposes. Revised data for 2017–18 is presented in this publication to allow comparison with the new 2018–19 data.
In July 2019 the ABS published the backcast population estimates (for the period 2006 to 2015) for Aboriginal and Torres Strait Islander persons, as well as Aboriginal and Torres Strait Islander population projections (for the period 2016 to 2031) in Estimates and Projects, Aboriginal and Torres Strait Islander Australians, 2006 to 2031 (cat. no. 3238.0). As a result, offender rates for both the Aboriginal and Torres Strait Islander population and the non-indigenous population in this publication for the years 2008–09 to 2017–18 have been revised.
Total offender rates were also revised for the years 2011–12 to 2015–16 with the finalised rebased population estimates released using the results of the 2016 Census of Population and Housing. Refer to the earlier section on rates for information on how these are calculated.
### Recorded crime – victims
There are strong links between victims and offenders recorded by police in their administrative systems. Once a victim is recorded by police an investigation may ensue which could result, although not always, in an offender being proceeded against by police. However, there are a number of limitations in comparing the Recorded Crime – Offenders collection and the Recorded Crime – Victims collection.
• Data cannot be directly linked.
• Counting units vary as victims may be counted more than once throughout the reference period.
• The reference period used in the victims collection is based on the calendar year, while the offenders collection is based on the financial year.
• Police may detect a crime without it being reported by a victim.
• ‘Victimless' crimes, such as illicit drug offences or regulatory offences are excluded from the victims collection.
• Statistics about victims of assault are not comparable across all states and territories due to differences in police procedures; consequently national data are not published.
Despite these differences, broad comparisons can be made between the two collections. For more detailed information about data comparability in relation to the Recorded Crime – Victims collection and more generally about using administrative and survey data, refer to the information paper, Measuring Victims of Crime: A Guide to Using Administrative and Survey Data, June 2011 (cat. no. 4500.0.55.001).
For more information about the victims collection, refer to Recorded Crime – Victims, Australia (cat. no. 4510.0).
### Criminal courts
Data relating to the number of court action proceedings in Recorded Crime – Offenders are not strictly comparable to the number of defendants sourced from the Criminal Courts collection.
• Not all court actions initiated by police will proceed to a criminal court as police proceedings may be withdrawn or changed to other legal actions during the course of an investigation.
• A defendant appearing in a criminal court in Australia may be prosecuted via charges initiated by authorities other than state and territory police.
• There are lags between when the police initiate action and when a criminal court finalises a defendant's case.
For more information about criminal courts refer to Criminal Courts, Australia (cat. no. 4513.0).
Other tables may be able to be produced on request to meet individual user requirements. For further information, contact the National Information and Referral Services on 1300 135 070 or email [email protected].
## Family and domestic violence experimental data explanatory notes
This release provides experimental statistics about offenders of selected family and domestic violence (FDV) related offences, as recorded on selected state and territory police administrative recording systems.
The FDV data presented is experimental, with further work required to improve the comparability and quality of the data before including it in the main suite of the publication. These data should be interpreted with caution, taking into account the factors described throughout these explanatory notes.
### Definition
Within the context of national Recorded Crime – Offenders statistics, an FDV-related offence is defined as:
"An offence involving at least two persons who are in a specified family or domestic relationship and which has been determined by police officers to be family and/or domestic violence related as part of their investigation."
A specified family or domestic relationship includes:
• Partner/spouse/husband/wife (including former)
• Boyfriend/girlfriend (including ex-boyfriend/girlfriend)
• Parent (including step-parents)
• Child (including step-children)
• Other relatives (including but not limited to grandparents, siblings, aunt/uncle, cousin, niece/nephew)
• Carer
• Kinship relationships
### Scope
For the purposes of this publication, FDV-related offences are limited to the following ANZSOC division/subdivision offence types:
• 01 Homicide and related offences
• 02 Acts intended to cause injury
• 03 Sexual assault and related offences
• 05 Abduction, harassment and other offences against the person
• 121 Property damage
• 153 Breach of violence and non-violence orders
### Coverage
This publication presents data about offenders of FDV-related offences for all jurisdictions except South Australia. South Australia Police are unable to provide an FDV flag due to system constraints. National data about offenders of FDV-related offences are not available for the Recorded Crime – Offenders collection.
### Data comparability
The comparability of data about offenders of FDV-related offences may vary across time periods and the selected states and territories due to many factors including:
• Differences in existing state and territory legislation which determine the types of behaviours and relationships which constitute a family and domestic violence offence
• Differences or changes in state/territory police operations, business rules and recording practices
• Differences or changes in reporting behaviour
• Limitations in the quality or availability of data recorded on various administrative systems used by police
Queensland has more FDV offenders with a principal offence of breaches of violence orders and less FDV offenders with a principal offence of acts intended to cause injury. In Queensland where an FDV incident occurs which involves an alleged assault the following procedures are generally followed:
• If there is an existing violence order, a breach of that order will be recorded but the associated assault may not be recorded against the offender record.
• If there is no violence order and the victim does not consent to proceeding with an assault charge, the police create an incident record and may issue a police protection order. The assault offence may not be recorded in the crime recording system against an offender.
Tasmanian data about offenders with FDV-related offences are only available for offenders proceeded against by court action, and only for the following relationships:
• Partner/spouse/husband/wife (including former)
• Boyfriend/girlfriend (including ex-boyfriend/girlfriend)
### Family and Domestic Violence flag/relationship of offender to victim
Data presented within this release are based primarily on an FDV flag as recorded by police officers where they have determined an offence or incident to be FDV-related as defined by the relevant state or territory legislation under which they operate, or identified as being within a specified family or domestic relationship.
The FDV flag is recorded in New South Wales, Victoria, Queensland, Western Australia and Northern Territory Police systems at a proceeding level. This may result in a small number of offences in these jurisdictions being flagged as FDV-related which did not occur within a specified family or domestic relationship. For example, this may occur when police charge an offender with an FDV-related offence as well as an additional offence which occurred against a stranger in the same incident and was dealt with by police as part of the same proceeding.
For the purposes of improving data quality and comparability, known relationship information was drawn upon to identify offenders within a specified family relationship but were not flagged as FDV related by police. Where detailed relationship of offender to victim information was available, offences flagged as FDV-related but which occurred against a stranger were removed from the data; and offences flagged as non FDV-related but occurring within a specified family or domestic relationship were treated as FDV-related. This information was available for Victoria and the Australian Capital Territory from 2014–15; for Western Australia from 2015–16; for New South Wales from 2016–17; and for Queensland for 2018–19. This data was not available for Tasmania and the Northern Territory.
Offences which were flagged by police to be FDV-related but occurred against a police officer were also removed where they were able to be identified.
In the Australian Capital Territory the FDV flag is recorded on police systems at an offence level. This means that the flag is applied separately to each individual offence. Therefore only offences which occurred within a specified family or domestic relationship are flagged by police as FDV-related.
### Counting methodology
The FDV offender population counts persons who were proceeded against by police for at least one selected offence which was flagged as FDV-related by police or identified as occurring within a specified family or domestic violence relationship. An offender is only counted once irrespective of how many offences they may have committed within the same incident or how many times they were dealt with by police during the reference period.
For the FDV police proceeding population, an offender may be counted more than once if proceeded against on separate occasions by police during the reference period.
Where an offender was proceeded against for multiple FDV-related offences during the reference period, they were assigned a principal FDV-related offence which has been determined based on the NOI. Any non FDV-related offences were excluded before the ranking process. Therefore, users should be aware that the statistics presented in data cube 6 are not comparable with other data presented within this publication.
The offenders of FDV-related breach of violence and non-violence orders population counts all persons who were proceeded against at least once for this offence when the action was flagged as FDV-related by police or identified as occurring within a specified family or domestic relationship during the reference period. Different to the general population offender count, in order to count all FDV-related breaches of violence and non-violence orders, a principal offence has not been assigned to each offender. Therefore, this count includes offenders with multiple FDV-related offences who would have been assigned a more serious principal offence in the general FDV offender population. As a result of the differing methodologies, the count of offenders with an FDV-related breach of violence and non-violence order is likely to be greater than the number of offenders with a principal offence of FDV-related breaches in the general FDV offender population.
## Glossary
### Show all
#### Abduction, harassment and other offences against the person
Acts intended to threaten or harass, or acts that unlawfully deprive another person of their freedom of movement, that are against that person's will or against the will of any parent, guardian or other person having lawful custody or care of that person. This is a division of ANZSOC which includes the following subdivisions: abduction and kidnapping (051), deprivation of liberty/false imprisonment (052) and harassment and threatening behaviour (053).
For ease of reading, abduction, harassment and other offences against the person appears as ‘abduction/harassment’ throughout this publication.
#### Aboriginal and Torres Strait Islander offender
An offender who identifies as being of Aboriginal or Torres Strait Islander origin, or both, on at least one occasion on which they are proceeded against by police during the reference period.
#### Acts intended to cause injury
Acts, excluding attempted murder and those resulting in death, which are intended to cause non-fatal injury or harm to another person and where there is no sexual or acquisitive element. This is a division of ANZSOC which includes the following subdivisions: assault (021) and other acts intended to cause injury (029).
#### Age
Age is calculated at the earliest date a person was proceeded against by police during the reference period.
#### Age standardisation
Age standardisation is a statistical method that adjusts crude rates to account for age differences between study populations. Age standardisation enables better comparisons between populations with differing age structures (see explanatory note section). In the context of such a comparison, the key variable of interest is the ratio of Aboriginal and Torres Strait Islander to non-indigenous age standardised rates, rather than the rates in isolation.
#### Assault
The direct (and immediate/confrontational) infliction of force, injury or violence upon a person or persons or the direct (and immediate/confrontational) threat of force, injury or violence where there is an apprehension that the threat could be enacted. This offence category is ANZSOC subdivision 021 within division 02 acts intended to cause injury.
#### Attempted murder
The attempted unlawful killing of another person, where there is either the intent to kill or to cause grievous bodily harm with the knowledge that it was probable that death or grievous harm would occur (reckless indifference to life), not resulting in death. This offence category is ANZSOC subdivision 012 within division 01 homicide and related offences.
#### Australian and New Zealand Standard Offence Classification (ANZSOC)
The ANZSOC is a hierarchical classification developed by the ABS for use in the collection and publication of crime and justice statistics. It provides a classificatory framework for the comparison of statistics on offences across Australia and in New Zealand. Within the classificatory structure of ANZSOC, divisions represent the broadest categories of offences. The subdivision and group levels provide increasingly detailed dissections of the broad categories. The 2011 version of ANZSOC is used to classify offence data within this publication. For details of the classification refer to Australian and New Zealand Standard Offence Classification, 2011 (cat. no. 1234.0).
#### Backcast population estimates
After each Census, the ABS produces estimates of the Aboriginal and Torres Strait Islander population for the Census year only by using information from the Census (together with some adjustments, the largest being for people missed in the Census). The ABS uses Census year estimates of the Aboriginal and Torres Strait Islander population and relevant assumptions on fertility, mortality and migration to compile backcast estimates and projections of this population group.
#### Blackmail and extortion
The unlawful demanding with intent to gain money, property, or any other benefit from, or with intent to cause detriment to, another person, accompanied by the use of coercive measures, to be carried out at some point in the future if the demand is not met. This may also include the use and/or threatened use of face-to-face force or violence, provided there is a threat of continued violence if the demand is not met. This offence category is ANZSOC subdivision 062 within division 06 robbery, extortion and related offences.
#### Breach of violence and non-violence orders
An act of omission breaching the conditions of a violence order or non-violence related restraining order. The offence category is ANZSOC subdivision 153 within division 15 offences against justice procedures, government security and government operations.
#### Crude offender rates
Crude offender rates are the basic measure of the prevalence of offenders within a population. They are published as the number of offenders per 100,000 of the target population, and are calculated using the following formula:
$$\text{Offender rate per 100,000 persons} = (\frac{\text{Number of offenders}}{\text{Estimated Resident Population}}) \times 100,000$$
Crude offender rates are the actual rates of offending and are not adjusted for any differences in population distributions that may influence the rates. As such, it is preferable to use age standardised rates when comparing rates of offending for Aboriginal and Torres Strait Islander and non-indigenous populations.
#### Dangerous or negligent acts endangering persons
Dangerous or negligent acts which, though not intended to cause harm, actually or potentially result in injury to oneself or another person. This is a division of ANZSOC which includes the following subdivisions: dangerous or negligent operation of a vehicle (041) and other dangerous or negligent acts endangering persons (049). Data relating to subdivision 041 are not included in this publication, due to incomplete data availability in some jurisdictions.
For ease of reading dangerous or negligent acts endangering persons appears as ‘dangerous/negligent acts’ throughout this publication.
#### Deal or traffic in illicit drugs
The supply or purchase of an illicit drug or controlled substance of any quantity, or the possession of an illicit drug or controlled substance where the amount involved is deemed to be of a quantity for commercial activity. This offence category is ANZSOC subdivision 102 within division 10 illicit drug offences.
#### Deceptive business/government practices
Actions carried out by deceitful or dishonest conduct as part of trade or commercial business activity, with the intent to avoid liability or obtain an advantage, financial or otherwise. This offence category is ANZSOC subdivision 093 within division 09 fraud, deception and related offences.
#### Disorderly conduct
Offences involving personal conduct that is disorderly or is indicative of criminal intent. This offence category is ANZSOC subdivision 131 within division 13 public order offences.
#### Drug diversions
A drug diversion is a type of legal action which can be initiated by police as a result of an investigation involving illicit drug related offences. The alleged offender is given the option to take part in a program instead of attending court for prosecution. Drug diversions are categorised as non-court actions in the method of proceeding data item.
#### Expiation notices
An expiation notice is a type of legal action which can be initiated by police as a result of an investigation of an offence. The offender is given the option to pay a fee instead of attending court for prosecution. Expiation notices are categorised as non-court actions in the method of proceeding data item.
#### Fare evasion
The act of travelling on public transport without a valid ticket for the specified journey in disregard of the relevant laws and/or regulations. While fare evasion is not a category in the ANZSOC classification, it has been used in this publication to enhance the comparability of theft statistics between states and territories.
#### Family and domestic violence related offence
An offence involving at least two persons who are in a specified family or domestic relationship and which has been determined by police officers to be family and/or domestic violence related as part of their investigation. A specified family or domestic relationship includes:
• Partner/spouse/husband/wife (including former)
• Boyfriend/girlfriend (including ex-boyfriend/girlfriend)
• Parent (including step-parents)
• Child (including step-children)
• Other relatives (including but not limited to grandparents, siblings, aunt/uncle, cousin, niece/nephew)
• Carer
• Kinship relationships
#### FDV flagged offence
An offence which has been flagged by police officers on their agency crime recording system as family and domestic violence related.
#### Forgery and counterfeiting
Actions involving the making or use of false currency or the falsifying of official documents with an intention to deceive, obtain money, goods or services, or obtain a benefit or advantage. This includes the possession of equipment to make false/illegal instruments. This offence category is ANZSOC subdivision 092 within division 09 fraud, deception and related offences.
#### Fraud, deception and related offences
Offences involving a dishonest act or omission carried out with the purpose of deceiving to obtain a benefit. This is a division of ANZSOC which includes the following subdivisions: obtain benefit by deception (091), forgery and counterfeiting (092), deceptive business/government practices (093) and other fraud and deception offences (099).
For ease of reading fraud, deception and related offences appears as ‘fraud/deception’ throughout this publication.
#### Homicide and related offences
Unlawfully kill, attempt to unlawfully kill or conspiracy to kill another person. This is a division of ANZSOC which includes the following subdivisions: murder (011), attempted murder (012) and manslaughter and driving causing death (013).
#### Illicit drug offences
The possessing, selling, dealing or trafficking, importing or exporting, manufacturing or cultivating of drugs or other substances prohibited under legislation. This is a division of ANZSOC which includes the following subdivisions: import or export illicit drugs (101), deal or traffic in illicit drugs (102), manufacture or cultivate illicit drugs (103), possess and/or use illicit drugs (104) and other illicit drug offences (109).
#### Manslaughter and driving causing death
The unlawful killing of another person while deprived of the power of self-control by provocation, or under circumstances amounting to diminished responsibility or without intent to kill, as a result of a careless, reckless, negligent, unlawful or dangerous act. This offence category is ANZSOC subdivision 013 within division 01 homicide and related offences.
#### Manufacture or cultivate illicit drugs
Actions resulting or intended to result in either the manufacture of controlled substances, or growing of plants used to make illicit drugs. This offence category is ANZSOC subdivision 103 within division 10 illicit drug offences.
#### Mean
The arithmetic average.
#### Median
The middle value of a set of values when the values are sorted in order.
#### Method of proceeding
The method of proceeding describes the type of legal action (court or non-court) initiated by police against a person as a result of an investigation of an offence(s). Details of the classification hierarchy are outlined below.
CodeMethod of proceeding
100Court action, not further defined
110Charge and bail/remand
120Charge and summons
190Other court action, not elsewhere classified
200Non-court action, not further defined
210Informal caution or informal warning
220Formal caution or formal warning
230Conference
240Counselling (includes drug diversion schemes)
250Penalty notices
290Other non-court action, not elsewhere classified
999Not stated
#### Miscellaneous offences
Offences involving the breach of statutory rules or regulations governing activities that are prima facie legal, where such offences are not explicitly dealt with under any other division of ANZSOC. This is a division of ANZSOC which includes the following subdivisions: defamation, libel and privacy offences (161), public health and safety offences (162), commercial/industry/financial regulation (163) and other miscellaneous offences (169).
#### Motor vehicle theft
The taking of another person's motor vehicle illegally and without permission, with the intent of temporarily or permanently depriving the owner/possessor of the use of the motor vehicle. Additionally, the taking of another person's motor vehicle parts or its contents illegally, whether or not this also involves the taking of the motor vehicle. A motor vehicle is defined as any self-propelled vehicle that runs on the land surface and is eligible for registration for use on public roads. This includes, but is not limited to: car, motorcycle, motorised caravan/campervan, truck, lorry, tractor, bus, grader, etc. This offence category is ANZSOC subdivision 081 within division 08 theft and related offences.
#### Murder
Unlawfully kill another person where there is one or more of the following: the intent to kill; the intent to cause grievous bodily harm, with the knowledge that it was probable that death or grievous bodily harm would occur (reckless indifference to life); or without intent to kill in the course of committing a crime (felony murder). This offence category is ANZSOC subdivision 011 within division 01 homicide and related offences.
#### National Offence Index (NOI)
The National Offence Index is a ranking of the ANZSOC codes from most serious to least serious, and is used to determine a principal offence where a person is proceeded against for more than one offence type during the reference period. Offences are allocated a ranking and the highest ranking offence (i.e. the offence closest to 1) is selected as the principal offence. The 2018 version of the NOI has been used for this publication. For a copy of the index and for further detail refer to National Offence Index, 2018 (cat. no. 1234.0.55.001).
#### Non-assaultive sexual offences
Offences of a sexual nature, or intent thereof, against another person that do not involve physical contact with the person and where the person does not give consent, gives consent as a result of intimidation or deception, or consent is proscribed (i.e. the person is legally deemed incapable of giving consent because of youth, temporary/permanent (mental) incapacity or there is a familial relationship). This offence category is ANZSOC subdivision 032 within division 03 sexual assault and related offences.
#### Non-indigenous
Offenders who identify as neither Aboriginal nor Torres Strait Islander.
#### Not stated indigenous status
Where the indigenous status of the offender is not able to be identified or recorded.
#### Obtain benefit by deception
The use of deception or impersonation with the intent of dishonestly obtaining property, goods, services or other benefit, or to avoid disbenefit. This offence category is ANZSOC subdivision 091 within division 09 fraud, deception and related offences.
#### Offence
Any act or omission by a person or persons for which a penalty could be imposed by the Australian legal system.
#### Offences against justice procedures
An act or omission prejudicial to the effective carrying out of justice procedures other than justice orders. This offence category is ANZSOC subdivision 156 within division 15 offences against justice procedures, government security and government operations.
#### Offences against justice procedures, government security and government operations
An act or omission that is deemed to be prejudicial to the effective carrying out of justice procedures or any government operations. This includes general government operations as well as those specifically concerned with maintaining government security. This is a division of ANZSOC which includes the following subdivisions: breach of custodial order offences (151), breach of community-based orders (152), breach of violence and non-violence orders (153), offences against government operations (154), offences against government security (155) and offences against justice procedures (156). Breach of bail offences (ANZSOC group 1523) are excluded from the data in this publication, due to issues with data comparability between the states and territories.
For ease of reading ‘offences against justice procedures, government security and government operations’ appears as ‘offences against justice’ throughout this publication.
#### Offender
A person aged 10 years or over who is proceeded against and recorded by police for one or more criminal offences. An offender is only counted once during the reference period irrespective of the number of offences committed or the number of separate occasions that police proceeded against that offender.
#### Offender of family and domestic violence
An offender recorded as having at least one offence that was flagged by police as being FDV-related.
#### Offender rates
Offender rates are expressed as the number of offenders per 100,000 of the relevant Estimated Resident Population (ERP). See Explanatory Notes.
#### Offensive conduct
Offences involving personal conduct that is deemed by police to be offensive to members of the public. This offence category is ANZSOC subdivision 133 within division 13 public order offences.
#### Other acts intended to cause injury
Acts involving the indirect and non-confrontational infliction of harm, injury or violence upon a person. This offence category is ANZSOC subdivision 029 within division 02 acts intended to cause injury.
#### Other fraud and deception offences
Other fraud and deception offences not included elsewhere in division 09. This offence category is ANZSOC subdivision 099 within division 09 fraud, deception and related offences.
#### Police proceeding
A proceeding is a legal action initiated against an alleged offender for an offence(s). In this publication, police proceedings represent a count for each separate occasion on which police initiate a legal action against an offender. Each proceeding is classified to a principal offence and principal method of proceeding. It does not represent a count of offences, as multiple offences can occur within a proceeding.
#### Police proceedings - court actions
A type of legal action initiated by police against an offender. Court actions largely comprise the laying of charges against an alleged offender that must be answered in court. Offenders may be taken into custody, granted bail or issued with a summons for these charges pending an appearance in court.
#### Police proceedings - non-court actions
A type of legal action initiated by police against an offender. Non-court actions comprise legal actions such as informal or formal cautions/warnings, conferencing, counselling such as drug diversionary schemes, or the issuing of penalty or infringement notices, which do not require an appearance in court.
#### Possess and/or use illicit drugs
The possession of a non-commercial quantity and/or use of an illicit drug or other controlled substance. This offence category is ANZSOC subdivision 104 within division 10 illicit drug offences.
#### Principal method of proceeding
The main legal action (court or non-court) initiated by police for an offender based on the hierarchy of the method of proceeding classification.
#### Principal offence
The offence category, based on ANZSOC, which describes the most serious offence type for which a person has been proceeded against by police during the reference period. The principal offence is determined by the ranking of offences in the NOI (see National Offence Index).
#### Prohibited and regulated weapons and explosives offences
Offences involving prohibited or regulated weapons and explosives. This is a division of ANZSOC which includes the following subdivisions: prohibited weapons/explosives offences (111) and regulated weapons/explosives offences (112).
For ease of reading prohibited and regulated weapons and explosives offences appears as ‘weapons/explosives’ throughout this publication.
#### Property damage and environmental pollution
The wilful and unlawful destruction, damage or defacement of public or private property, or the pollution of property or a definable entity held in common by the community. This is a division of ANZSOC which includes the following subdivisions: property damage (121) and environmental pollution (122).
#### Public order offences
Offences involving personal conduct that involves, or may lead to, a breach of public order or decency, or that is indicative of criminal intent, or that is otherwise regulated or prohibited on moral or ethical grounds. In general these offences do not involve a specific victim or victims; however, some offences, such as offensive language and offensive behaviour, may be directed towards a single victim. This is a division of ANZSOC which includes the following subdivisions: disorderly conduct (131), regulated public order offences (132) and offensive conduct (133).
#### Ratio
A way of concisely showing the relationship of one quantity relative to another.
#### Receive or handle proceeds of crime
Receive, handle, possess money or goods taken or obtained illegally. This offence category is ANZSOC subdivision 083 within division 08 theft and related offences.
#### Regulated public order offences
Offences involving behaviour that is regulated or prohibited on moral or ethical grounds. This offence category is ANZSOC subdivision 132 within division 13 public order offences.
#### Robbery, extortion and related offences
Acts intended to unlawfully gain money, property or any other thing of value from, or to cause detriment to, another person by using the threat of force or any other coercive measure. This is a division of ANZSOC which includes the following subdivisions: robbery (061) and blackmail and extortion (062).
For ease of reading robbery, extortion and related offences appears as ‘robbery/extortion’ throughout this publication.
#### Sexual assault
Physical contact, or intent of contact, of a sexual nature directed towards another person where that person does not give consent, gives consent as a result of intimidation or deception, or consent is proscribed (i.e. the person is legally deemed incapable of giving consent because of youth, temporary/permanent (mental) incapacity or there is a familial relationship). This offence category is ANZSOC subdivision 031 within division 03 sexual assault and related offences.
#### Sexual assault and related offences
Acts, or intent of acts, of a sexual nature against another person, which are non-consensual or where consent is proscribed. This is a division of ANZSOC which includes the following subdivisions: sexual assault (031) and non-assaultive sexual offences (032).
#### Theft and related offences
The unlawful taking or obtaining of money or goods, not involving the use of force, threat of force or violence, coercion or deception, with the intent to permanently or temporarily deprive the owner or possessor of the use of the money or goods, or the receiving or handling of money or goods obtained unlawfully. This is a division of ANZSOC which includes the following subdivisions: motor vehicle theft and related offences (081), theft (except motor vehicles) (082), receive or handle proceeds of crime (083) and illegal use of property (except motor vehicles) (084).
For ease of reading theft and related offences appears as ‘theft’ throughout this publication.
#### Theft (except motor vehicles)
The unlawful taking or obtaining of money, goods, services (other than from motor vehicles) or non-motorised vehicles, without the use of force, threat of force or violence, coercion or deception, with the intent to permanently deprive the owner or possessor of the use of the money or the goods. The definition of a vehicle (other than a motor vehicle) includes but is not limited to: tram, train, ship, aircraft, vessel or any other (non-motorised) vehicle. This offence category is ANZSOC subdivision 082 within division 08 theft and related offences.
#### Traffic and vehicle regulatory offences
Offences relating to vehicles and most forms of road traffic, including offences pertaining to licensing, motor vehicle registration, roadworthiness or use of vehicles, bicycle offences and pedestrian offences. Data for this division are not presented in this publication due to issues of data availability in some jurisdictions.
#### Unlawful entry with intent/burglary, break and enter
The unlawful entry of a structure with the intent to commit an offence, where the entry is either forced or unforced.
For ease of reading unlawful entry with intent/burglary, break and enter appears as ‘Unlawful entry with intent’ throughout this publication.
#### Youth offenders
Alleged offenders aged between 10 and 17 years proceeded against by police during the reference period. This term was used to refer to offenders aged between 10 and 19 years in publications prior to the 2015–16 data release.
## Quality declaration
### Institutional environment
In 1990 the Commonwealth and the states and territories formed an Inter-Governmental Agreement regarding the establishment of the National Crime Statistics Unit (NCSU) as a National Common Police Service. The role of the NCSU is to initiate, coordinate and oversee the development and production of nationally consistent crime statistics. The NCSU first released data on victims of crime in May 1994, while Recorded Crime – Offenders data have been available since the 2007–08 reference period. This publication contains data from the 2008–09 reference period onwards.
The statistics contained in the publication are provided from administrative systems maintained by state and territory police. Data have been compiled according to national standards in order to maximise consistency between the states and territories. The NCSU compiles, analyses, publishes and disseminates national offenders statistics subject to the provisions in the Census and Statistics Act 1905 (Cth).
For information on the institutional environment of the Australian Bureau of Statistics (ABS), including the legislative obligations of the ABS, financing and governance arrangements, and mechanisms for scrutiny of ABS operations, please see ABS Institutional Environment.
### Relevance
Recorded Crime – Offenders (cat. no. 4519.0) presents statistics about the characteristics of alleged offenders who were proceeded against by police during the period 1 July 2018 to 30 June 2019, for all states and territories. The collection presents information about alleged offenders aged 10 years and over. It also includes information about the most serious offence, referred to as the principal offence, associated with an alleged offender. For the offender population, an offender is only counted once irrespective of how many offences they may have committed within the same incident or how many times they were dealt with by police during the reference period.
Statistics are also presented on the number of proceedings that police initiated in the form of court and non-court actions during 2018–19 for all states and territories except South Australia and Western Australia. For the proceeding population, an offender may be counted more than once if proceeded against on separate occasions by police during the reference period.
All criminal offences where police agencies have the authority to take legal action against an individual are included, except motor vehicle/traffic related offences and breach of bail. Depending on the type of offence committed, police will either initiate a court or non-court action. Court actions largely comprise the laying of charges against an alleged offender that must be answered in court. Offenders may be taken into custody, granted bail or issued with a summons for these charges pending an appearance in court. The proceeding may also be withdrawn or changed from a court to a non-court action. Non-court actions comprise legal actions such as informal or formal cautions/warnings, conferencing, counselling, drug diversionary schemes, or the issuing of penalty or infringement notices, which do not require an appearance in court.
### Timeliness
The Recorded Crime – Offenders collection is conducted annually for offenders who were proceeded against and recorded by police during the period 1 July to 30 June. Data and accompanying data cubes are expected to be released within 8 months of the reference period. Each release includes data for the current reference year, along with comparisons of data with previous time periods for some data items.
### Accuracy
Recorded Crime – Offenders data are extracted from administrative systems maintained by state and territory police. The data are not subject to sampling error. Non-sampling errors can arise from inaccuracies in recording by police agencies, or when the data are extracted, processed and disseminated. The ABS has limited influence over any errors associated with data recorded by external sources. The ABS provides a collection manual which outlines the scope, coverage, counting rules and data item definitions for the Recorded Crime – Offenders collection to minimise data extraction errors. Efficient processing and editing procedures are in place within the ABS to minimise processing and reporting errors. Data were quality assured by the custodians of the source data to mitigate against the risk of any errors introduced during data processing being published.
Published data are revised as required to ensure the series presents the most up to date statistics. Revisions to historical data are made when new information about the comparability of data over time is identified. This may occur when errors or omissions are identified in the administrative data supplied to the ABS in prior years.
### Coherence
In order to ensure consistency in the data for each state and territory, Recorded Crime – Offenders statistics are compiled according to national standards and classifications. The collection uses the Australian and New Zealand Standard Offence Classification, 2011 (cat. no. 1234.0) to classify offence types and applies a set of national counting rules to establish the number of offenders and police proceedings. However, some differences still occur due to state and territory legislation, different recording practices, different policies across jurisdictions to combat particular types of crime, and limitations of the various administrative databases that are used to extract the data. The statistical impacts of these are detailed in the explanatory note section.
Due to differing scope and counting rules, the data in the Recorded Crime – Offenders publication are not strictly comparable with data published in other national and state/territory publications (many of which deal with reported offences, rather than unique offenders); however, broad comparisons can still be made.
### Interpretability
The Recorded Crime – Offenders publication contains detailed explanatory notes and a glossary that provide information on the data sources, counting rules, terminology, classifications and other technical aspects associated with these statistics.
Offender rates are included in the publication to assist in the comparison of offender populations across states and territories. Offender rates by indigenous status, both crude and age standardised, are included to allow for meaningful comparisons of the Aboriginal and Torres Strait Islander and non-indigenous offender populations.
### Accessibility
In addition to the information provided in the publication, data cube tables are also available providing detailed breakdowns by state and territory. Please refer to the Data download section for the products that are available from this collection.
If the required information is not available from the publication or the data cubes, the National Information and Referral Services may be able to help you with a customised service to suit your needs. Contact 1300 135 070 or email [email protected].
## Abbreviations
### Show all
ABS Australian Bureau of Statistics ACT Australian Capital Territory ANZSOC Australian and New Zealand Standard Offence Classification cat. no. Catalogue number CIN Criminal Infringement Notice Cth Commonwealth ERP Estimated Resident Population FDV Family and Domestic Violence GEN General Expiation Notice NCSU National Crime Statistics Unit n.e.c. not elsewhere classified n.f.d. not further defined NOI National Offence Index NSW New South Wales NT Northern Territory Qld Queensland SA South Australia Tas. Tasmania Vic. Victoria WA Western Australia | 2021-07-25T21:40:23 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.20630526542663574, "perplexity": 6999.259305011632}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-31/segments/1627046151866.98/warc/CC-MAIN-20210725205752-20210725235752-00031.warc.gz"} |
https://science.fandom.com/el/wiki/%CE%9A%CE%BB%CE%B1%CF%83%CF%83%CE%B9%CE%BA%CE%AE_%CE%97%CE%BB%CE%B5%CE%BA%CF%84%CF%81%CE%BF%CE%B4%CF%85%CE%BD%CE%B1%CE%BC%CE%B9%CE%BA%CE%AE | 65.482 Pages
Κλασσική Ηλεκτροδυναμική
- Ένας Επιστημονικός Κλάδος της Φυσικής.
## Ετυμολογία
Η ονομασία "Ηλεκτροδυναμική" σχετίζεται ετυμολογικά με την λέξη "δυναμική".
## Εισαγωγή
The covariant formulation of classical electromagnetism refers to ways of writing the laws of classical electromagnetism (in particular, Maxwell's equations and the Lorentz force) in a form which is "manifestly covariant" (i.e. in terms of covariant four-vectors and tensors), in the formalism of special relativity. These expressions both make it simple to prove that the laws of classical electromagnetism take the same form in any inertial coordinate system, and also provide a way to translate the fields and forces from one frame to another.
The Minkowski metric used in this article is assumed to have the form diag (+1, −1, −1, −1). The purely spatial components of the tensors (including vectors) are given in SI units. This article uses the classical treatment of tensors and the Einstein summation convention throughout. Where the equations are specified as holding in a vacuum, one could instead regard them as the formulation of Maxwell's equations in terms of total charge and current.
For a more general overview of the relationships between classical electromagnetism and special relativity, including various conceptual implications of this picture, see the article: Classical electromagnetism and special relativity.
## Covariant objects
### Electromagnetic tensor
Πρότυπο:Main The electromagnetic tensor is the combination of the electric and magnetic fields into a covariant antisymmetric tensor. In volt·seconds/meter2, the field strength tensor is written in terms of fields as[1]:
and the result of raising its indices is
όπου:
is the electric field intensity,
the magnetic field intensity, and
the speed of light.
Caution: The signs in the tensor above depend on the convention used for the metric tensor. The convention used here is +---, corresponding to the metric tensor :
### Four-Current
Πρότυπο:Main The four-current is the contravariant four-vector which combines electric current and electric charge density. In amperes/meter2, it is given by
where is the charge density, is the current density, and is the speed of light.
### Ηλεκτρομαγνητικό Δυναμικό
In volt·seconds/meter, the electromagnetic four-potential is a covariant four-vector containing the electric potential and magnetic potential, as follows:
where is the scalar potential and is the vector potential.
Η σχέση Ηλεκτρομαγνητικής Έντασης και Ηλεκτρομαγνητικού Δυναμικού δίνεται από την ακόλουθη εξίσωση:
όπου:
### Electromagnetic stress-energy tensor
The electromagnetic stress-energy tensor is a contravariant symmetric tensor which is the contribution of the electromagnetic fields to the overall stress-energy tensor. In joules/meters3, it is given by
όπου:
is the electric permittivity of vacuum,
is the magnetic permeability of vacuum,
is the Poynting vector.
and the Maxwell stress tensor is given by
The electromagnetic stress-energy tensor is related to the electromagnetic field tensor by the equation:
where is the Minkowski metric tensor. Notice that we use the fact that
### Other, non-electromagnetic objects
Πρότυπο:Main For background purposes, we present here three other relevant four-vectors, which are not directly connected to electromagnetism, but which will be useful in this article:
• In meters, the "position" or "coordinate" four-vector is
where is the (three-vector) velocity and is the Lorentz factor associated with
where is the (three-vector) momentum, is the energy, and is the particle's rest mass.
## Maxwell's equations in vacuo
Πρότυπο:Main In a vacuum (or for the microscopic equations, not including macroscopic material descriptions) Maxwell's equations can be written as two tensor equations
where is the electromagnetic tensor, is the 4-current, is the Levi-Civita symbol (a mathematical construct), and the indices behave according to the Einstein summation convention.
The first tensor equation is an expression of the two inhomogeneous Maxwell's equations, Gauss's Law and Ampere's Law (with Maxwell's correction). The second equation is an expression of the homogeneous equations, Faraday's law of induction and Gauss's law for magnetism.
In the absence of sources, Maxwell's equations reduce to a wave equation in the field strength:
where,
is the d'Alembertian operator.
### Other notation
Without the summation convention or the Levi-Civita symbol, the equations would be written
where all indices range from 0 to 3 (or, more descriptively, ranges over the set {ct,x,y,z}), where is the speed of light in free space. The first tensor equation corresponds to four scalar equations, one for each value of . The second tensor equation actually corresponds to different scalar equations, but only four of these are independent.
For convenience, professionals often write the 4-gradient (that is, the derivative with respect to x) using abbreviated notations; for instance,
Using the latter notation, Maxwell's equations can be written as and
## Continuity equation
The continuity equation which expresses the fact that charge is conserved is:
## Lorentz force
Πρότυπο:Main Fields are detected by their effect on the motion of matter. Electromagnetic fields affect the motion of particles through the Lorentz force. Using the Lorentz force, Newton's law of motion can be written in relativistic form using the field strength tensor as[2]
where is the four-momentum (see above), is the charge, is the four-velocity (see above), and is the particle's proper time.
In terms of (normal) time instead of proper time, the equation is
In a continuous medium, the 3D density of force combines with the density of power to form a covariant 4-vector, The spatial part is the result of dividing the force on a small cell (in 3-space) by the volume of that cell. The time component is 1/c times the power transferred to that cell divided by the volume of the cell. The density of Lorentz force is the part of the density of force due to electromagnetism. Its spatial part is . In manifestly covariant notation it becomes:
## Differential equation for electromagnetic stress-energy tensor
The relationship between Lorentz force and electromagnetic stress-energy tensor should be:
Therefore, The electromagnetic stress-energy tensor (defined above) satisfies the following differential equation, relating it to the electromagnetic tensor and the current four-vector
or
which expresses the conservation of linear momentum and energy by electromagnetic interactions.
## Lorenz gauge condition
The Lorenz gauge condition is a Lorentz-invariant gauge condition. (This can be contrasted with other gauge conditions such as the Coulomb gauge, which if it holds in one inertial frame will generally not hold in any other.) It is expressed in terms of the four-potential as follows:
### Maxwell's equations in the Lorenz gauge
In the Lorenz gauge, Maxwell's equations for a vacuum can be written as:
where denotes the d'Alembertian.
## Bound current
In order to solve the equations of electromagnetism given here, it is necessary to add information about how to calculate the electric current, Frequently, it is convenient to separate the current into two parts, the free current and the bound current, which are modeled by different equations.
where
The bound current is derived from the magnetization and electric polarization which form an antisymmetric contravariant magnetization-polarization tensor[1]
which determines the bound current
If this is combined with we get the antisymmetric contravariant electromagnetic displacement tensor which combines the electric displacement and the H-field as follows
They are related by
which is equivalent to the constitutive equations and And the result is that Ampère's law, , and Gauss's law, , combine to form:
The bound current and free current as defined above are automatically and separately conserved
Thus we have reduced the problem of modeling the current, to two (hopefully) easier problems — modeling the free current, and modeling the magnetization and polarization, For example, in the simplest materials at low frequencies, one has
where one is in the instantaneously-comoving inertial frame of the material, σ is its electrical conductivity, χe is its electric susceptibility, and χm is its magnetic susceptibility.
## Lagrangian for classical electrodynamics
In a vacuum, the Lagrangian (Lagrangian density) for classical electrodynamics (in joules/meter3) is
In the interaction term, the four-current should be understood as an abbreviation of many terms expressing the electric currents of other charged fields in terms of their variables; the four-current is not itself a fundamental field.
The Euler-Lagrange equation for the electromagnetic Lagrangian density can be stated as follows:
Noting , The expression inside the square bracket is
The second term is
Therefore, the electromagnetic field's equations of motion are
Separating the free currents from the bound currents, another way to write the Lagrangian density is as follows:
Using Euler-Lagrange equation, the equations of motion for can be derived.
The equivalent expression in non-relativistic vector notation is
## In general relativity
Πρότυπο:Main In general relativity, the metric, , is no longer a constant () but can vary from place to place and time to time. In general relativity, the equations of electromagnetism in a vacuum become:
where is the density of Lorentz force, is the reciprocal of the metric tensor , and is the determinant of the metric tensor. Notice that and are (ordinary) tensors while , , and are tensor densities of weight +1. All derivatives are partial derivatives — if one replaced them with covariant derivatives, the extra terms thereby introduced would cancel out.
## Τομείς
### Ηλεκτρομαγνητικό Πεδίο
• Πεδία εξαρτώμενα από το χρόνο
• Εξισώσεις Maxwell
• κυματική Εξίσωση ηλεκτρομαγνητικού πεδίου
• Ηλεκτρομαγνητική ενέργεια,
• μετασχηματισμοί βαθμίδας.
• συστήματα μονάδων
• χρήσεις των συναρτήσεων του Green στην ηλεκτρομαγνητική θεωρία.
### Ειδική Θεωρία Σχετικότητας
• Μετασχηματισμοί Lorentz για ηλεκτρικά και μαγνητικά πεδία.
• Συναλλοίωτη μορφή εξισώσεων Maxwell.
• Σχετικιστικές εξισώσεις κίνησης σωματιδιακού φορτίου.
• Κίνηση σε ομογενή μαγνητικά ή ηλεκτρικά πεδία.
• Ακτινοβολία σχετικιστικά κινουμένου φορτίου.
## Υποσημειώσεις
1. Vanderlinde, Jack (2004), classical electromagnetic theory, Springer, σελ. 313–328, ISBN 9781402026997
2. The assumption is made that no forces other than those originating in E and B are present, that is, no gravitational, weak or strong forces.
## Ιστογραφία
Κίνδυνοι Χρήσης
Αν και θα βρείτε εξακριβωμένες πληροφορίες
σε αυτήν την εγκυκλοπαίδεια
ωστόσο, παρακαλούμε να λάβετε σοβαρά υπ' όψη ότι
η "Sciencepedia" δεν μπορεί να εγγυηθεί, από καμιά άποψη,
την εγκυρότητα των πληροφοριών που περιλαμβάνει.
"Οι πληροφορίες αυτές μπορεί πρόσφατα
να έχουν αλλοιωθεί, βανδαλισθεί ή μεταβληθεί από κάποιο άτομο,
η άποψη του οποίου δεν συνάδει με το "επίπεδο γνώσης"
του ιδιαίτερου γνωστικού τομέα που σας ενδιαφέρει."
Πρέπει να λάβετε υπ' όψη ότι
όλα τα άρθρα μπορεί να είναι ακριβή, γενικώς,
και για μακρά χρονική περίοδο,
αλλά να υποστούν κάποιο βανδαλισμό ή ακατάλληλη επεξεργασία,
ελάχιστο χρονικό διάστημα, πριν τα δείτε.
Επίσης,
(όχι μόνον, της Sciencepedia
αλλά και κάθε διαδικτυακού ιστότοπου (ή αλλιώς site)),
αν και άκρως απαραίτητοι,
είναι αδύνατον να ελεγχθούν
(λόγω της ρευστής φύσης του Web),
και επομένως είναι ενδεχόμενο να οδηγήσουν
σε παραπλανητικό, κακόβουλο ή άσεμνο περιεχόμενο.
Ο αναγνώστης πρέπει να είναι
εξαιρετικά προσεκτικός όταν τους χρησιμοποιεί.
- Μην κάνετε χρήση του περιεχομένου της παρούσας εγκυκλοπαίδειας
αν διαφωνείτε με όσα αναγράφονται σε αυτήν
>>Διαμαρτυρία προς την wikia<<
- Όχι, στις διαφημίσεις που περιέχουν απαράδεκτο περιεχόμενο (άσεμνες εικόνες, ροζ αγγελίες κλπ.)
Community content is available under CC-BY-SA unless otherwise noted. | 2021-06-13T16:45:20 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9608646631240845, "perplexity": 2649.9525270043396}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487610196.46/warc/CC-MAIN-20210613161945-20210613191945-00291.warc.gz"} |
https://www.usgs.gov/center-news/volcano-watch-mosquito-and-pig-cautionary-tale-two-alien-species | # Volcano Watch — Mosquito and pig: cautionary tale of two alien species
Release Date:
Mosquitoes are not native to the Hawaiian Islands. Anyone driven away from an outdoor activity or rudely awakened by a biting mosquito would agree that the islands of old were indeed a paradise.
Mosquitoes are not native to the Hawaiian Islands. Anyone driven away from an outdoor activity or rudely awakened by a biting mosquito would agree that the islands of old were indeed a paradise. That bit of paradise was lost in the early 1800s, when the southern house mosquito arrived, allegedly aboard the sailing ship Wellington. This mosquito has evolved in long and close association with humans. It utilizes any standing water but is particularly adapted to sewage-polluted water associated with people and livestock. By 1900, this mosquito was well established throughout the islands, wherever human activities created the stagnant water habitat necessary for its immature stages.
Most people realize that some mosquitoes transmit serious human disease, but few are aware of the many diseases mosquitoes transmit to domestic and wild animals. Fortunately, no known human diseases transmitted by this mosquito occur in Hawaii. Unfortunately, two mosquito-transmitted bird diseases have become established.
The date of entry for avian pox and malaria remains a mystery, but the devastating impact of the two diseases on lowland populations of native birds has long been recognized. By 1900, some of the earliest naturalists had observed pox lesions on increasingly rare bird species. Avian malaria and pox, are no longer confined to lowlands, however; both diseases are now prevalent in mid-elevation forests.
How could the transmitting mosquito, so dependent on stagnant water around human settlements, become established in the large remaining tracts of Hawaiian forest? This question was particularly baffling on the windward slope of Mauna Loa, where the porous nature of young volcanic soil prevents most standing water. Enter alien species number two, the feral pig, unwittingly paving the way for mosquitoes into the forest.
European domestic pigs were among the earliest introduced species to arrive in Hawaii. Without predators or herbivore competitors, these animals adapted well to life in the wet forest and rapidly established large feral populations. The starchy core of native tree ferns is among the pigs' favorite foods. Foraging pigs greedily consume this starch, leaving behind cavities that quickly collect rainwater and fallen leaves. As the tree fern starch and leaves decompose, the water becomes rich with bacteria upon which larval mosquitoes feed. Chemicals from decomposing plant material are attractive to female mosquitoes, ensuring that eggs are laid in a suitable habitat. So, the activity of one alien species provided the habitat needed by another. The mosquito figuratively piggy-backed its way into the forest. Many tree fern cavities are small, containing little more than a cup of water; some are larger and hold 3-4 liters (quarts). Even a small cavity can support development of hundreds of mosquito larvae. Consequently a typical acre of wet forest may produce thousands of mosquitoes that can spread the two bird diseases and have a profound effect on bird populations.
Every year between September and December, the Kīlauea Field Station receives dead or dying birds from the Volcano area. Many are infected with avian malaria. Each year fewer iiwi, the magnificent red honeycreeper, are seen in the mid-elevation forests, and vast tracts of wet forest are now largely devoid of bird life.
Can we control the diseases that threaten our native forest birds? In the few successful campaigns against mosquito-transmitted human disease (malaria on the mainland and in Europe, dengue in Hawaii), elimination of the larval mosquito habitat was the winning factor. In the windward forests of Mauna Loa, reduction of feral pig numbers would reduce habitat for mosquitoes, ultimately disrupt disease transmission, and help enable forest-bird populations to rebound.
Mosquitoes would still be produced in agricultural and residential areas near forests, so we should practice mosquito control there as well. Everyone can do their part by eliminating standing water on their property. Cleaning a gutter or turning over a pail in the garden may one day be rewarded by a glimpse of an iiwi in your own backyard.
### Volcano Activity Update
Eruptive activity of Kīlauea Volcano continued during the past week. Lava erupts from Puu Oo and flows through a network of tubes toward the coast near the eastern boundary of Hawaii Volcanoes National Park. A large skylight in the main tube is visible at night on Pulama pali. Surface flows are intermittently active on the coastal flat between Royal Gardens subdivision and the coast. Lava is entering the ocean at three sites near Wahaula. Remember that ocean-entry areas are extremely hazardous; explosions occur unpredictably or accompany sudden collapses of new land into the water. The active lava flows are hot and have very thin crust. The steam clouds at the entries are highly acidic and laced with glass particles. Use common sense around hot lava and steam.
No earthquakes were reported felt during the week ending on May 18. | 2020-08-06T22:44:48 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.28163498640060425, "perplexity": 9203.521251965436}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-34/segments/1596439737039.58/warc/CC-MAIN-20200806210649-20200807000649-00030.warc.gz"} |
https://par.nsf.gov/biblio/10278867-eulerian-partial-differential-equation-methods-complex-valued-eikonals-attenuating-media | Eulerian partial-differential-equation methods for complex-valued eikonals in attenuating media
Seismic waves in earth media usually undergo attenuation, causing energy losses and phase distortions. In the regime of high-frequency asymptotics, a complex-valued eikonal is an essential ingredient for describing wave propagation in attenuating media, where the real and imaginary parts of the eikonal function capture dispersion effects and amplitude attenuation of seismic waves, respectively. Conventionally, such a complex-valued eikonal is mainly computed either by tracing rays exactly in complex space or by tracing rays approximately in real space so that the resulting eikonal is distributed irregularly in real space. However, seismic data processing methods, such as prestack depth migration and tomography, usually require uniformly distributed complex-valued eikonals. Therefore, we have developed a unified framework to Eulerianize several popular approximate real-space ray-tracing methods for complex-valued eikonals so that the real and imaginary parts of the eikonal function satisfy the classic real-space eikonal equation and a novel real-space advection equation, respectively, and we dub the resulting method the Eulerian partial-differential-equation method. We further develop highly efficient high-order methods to solve these two equations by using the factorization idea and the Lax-Friedrichs weighted essentially nonoscillatory schemes. Numerical examples demonstrate that our method yields highly accurate complex-valued eikonals, analogous to those from ray-tracing methods. more »
Authors:
; ; ; ; ;
Award ID(s):
Publication Date:
NSF-PAR ID:
10278867
Journal Name:
GEOPHYSICS
Volume:
86
Issue:
4
Page Range or eLocation-ID:
T179 to T192
ISSN:
0016-8033
National Science Foundation
##### More Like this
1. We have developed a Liouville partial-differential-equation (PDE)-based method for computing complex-valued eikonals in real phase space in the multivalued sense in attenuating media with frequency-independent qualify factors, where the new method computes the real and imaginary parts of the complex-valued eikonal in two steps by solving Liouville equations in real phase space. Because the earth is composed of attenuating materials, seismic waves usually attenuate so that seismic data processing calls for properly treating the resulting energy losses and phase distortions of wave propagation. In the regime of high-frequency asymptotics, the complex-valued eikonal is one essential ingredient for describing wave propagationmore »
2. First-arrival traveltime tomography is an essential method for obtaining near-surface velocity models. The adjoint-state first-arrival traveltime tomography is appealing due to its straightforward implementation, low computational cost, and low memory consumption. Because solving the point-source isotropic eikonal equation by either ray tracers or eikonal solvers intrinsically corresponds to emanating discrete rays from the source point, the resulting traveltime gradient is singular at the source point, and we denote such a singular pattern the imprint of ray-illumination. Because the adjoint-state equation propagates traveltime residuals back to the source point according to the negative traveltime gradient, the resulting adjoint state will inheritmore »
3. SUMMARY
Accurate synthetic seismic wavefields can now be computed in 3-D earth models using the spectral element method (SEM), which helps improve resolution in full waveform global tomography. However, computational costs are still a challenge. These costs can be reduced by implementing a source stacking method, in which multiple earthquake sources are simultaneously triggered in only one teleseismic SEM simulation. One drawback of this approach is the perceived loss of resolution at depth, in particular because high-amplitude fundamental mode surface waves dominate the summed waveforms, without the possibility of windowing and weighting as in conventional waveform tomography.
This can bemore »
Here we present the results of proof of concept testing of such an approach for a synthetic 3-component long period waveform data set (periods longer than 60 s), computed for 273 globally distributed events in a simple toy 3-D radially anisotropic upper mantle model which contains shear wave anomalies at different scales. We compare the results of inversion of 10 000 s long stacked time-series, starting from a 1-D model, using source stacked waveforms and station-pair cross-correlations of these stacked waveforms in the definition of the cost function. We compute the gradient and the Hessian using normal mode perturbation theory, which avoids the problem of cross-talk encountered when forming the gradient using an adjoint approach. We perform inversions with and without realistic noise added and show that the model can be recovered equally well using one or the other cost function.
The proposed approach is computationally very efficient. While application to more realistic synthetic data sets is beyond the scope of this paper, as well as to real data, since that requires additional steps to account for such issues as missing data, we illustrate how this methodology can help inform first order questions such as model resolution in the presence of noise, and trade-offs between different physical parameters (anisotropy, attenuation, crustal structure, etc.) that would be computationally very costly to address adequately, when using conventional full waveform tomography based on single-event wavefield computations.
4. Embedding properties of network realizations of dissipative reduced order models Jörn Zimmerling, Mikhail Zaslavsky,Rob Remis, Shasri Moskow, Alexander Mamonov, Murthy Guddati, Vladimir Druskin, and Liliana Borcea Mathematical Sciences Department, Worcester Polytechnic Institute https://www.wpi.edu/people/vdruskin Abstract Realizations of reduced order models of passive SISO or MIMO LTI problems can be transformed to tridiagonal and block-tridiagonal forms, respectively, via dierent modi cations of the Lanczos algorithm. Generally, such realizations can be interpreted as ladder resistor-capacitor-inductor (RCL) networks. They gave rise to network syntheses in the rst half of the 20th century that was at the base of modern electronics design and consecutively to MORmore »
5. SUMMARY Knowledge of attenuation structure is important for understanding subsurface material properties. We have developed a double-difference seismic attenuation (DDQ) tomography method for high-resolution imaging of 3-D attenuation structure. Our method includes two main elements, the inversion of event-pair differential ${t^*}$ ($d{t^*}$) data and 3-D attenuation tomography with the $d{t^*}$ data. We developed a new spectral ratio method that jointly inverts spectral ratio data from pairs of events observed at a common set of stations to determine the $d{t^*}$ data. The spectral ratio method cancels out instrument and site response terms, resulting in more accurate $d{t^*}$ data compared to absolutemore » | 2022-08-19T23:58:29 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.4999940097332001, "perplexity": 1888.9600983691973}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573849.97/warc/CC-MAIN-20220819222115-20220820012115-00370.warc.gz"} |
https://cdcvs.fnal.gov/redmine/projects/novaart/wiki/Nus_Validation | # Nus Validation¶
## Brief¶
• To use generic validation: write a yaml configuration file pointing to your files; choose appropriate names and an accessible location.
The following refers to four datasets (data, mc) (old, new), but can be extended to other cases
Note that many workflow choices are to avoid excessive copy-pasting.
### Preparing your macro and running a test¶
• Your macro should be flexible to work on both datasets + be hadd_cafana or hadd able
cafe -bq NDDataMC.C+ $OUTFILE_OLD true$NDDATA_OLD $NDMC_OLD cafe -bq NDDataMC.C+$OUTFILE_NEW true $NDDATA_NEW$NDMC_NEW
Depending on the type of validation, each line might need to be run with different tags/test releases
• Test your macro interactively over a single file/run.
cafe -bq NDDataMC.C+ $OUTFILE_OLD_TEST true$NDDATA_OLD_TEST $NDMC_OLD_TEST cafe -bq NDDataMC.C+$OUTFILE_NEW_TEST true $NDDATA_NEW_TEST$NDMC_NEW_TEST
Try specific file names or a samweb query like
NDDATA_TEST="dataset_def_name_newest_snapshot "$NDDATA" and run_number 11264 and Online.Subrun 00" NDMC_TEST="dataset_def_name_newest_snapshot "$NDMC" and run_number 11264 and Simulated.firstSubRun 00"
(make sure files and snapshots exit in all cases).
• Validation/generic will use the spectra/histogram names in your <outfile> to write the website. These include the pretty selectors.
Any "cosmetic" changes can be done over the same spectra, shouldn't need to re-run. NDDataMC.C (and FDDataMC.C)splits the process via a boolean. You might want to limit the number of variables and cuts that are "formatted" in this step in order to quickly generate a preview of the validation.
### Webpage output¶
You will point the output (controlled by the yaml file) to the /nusoft/app/web area.
Within this area are users/ directories. For more official validation you can send it to /nusoft/app/web/validation/nus/ and a designated sub-directory.
• Remember to clear any failed attempts from the /nusoft/app/web area.
### Running over the full dataset¶
• If concats are available, just replace the test above with the filenames
• For large datasets, run the spectra-saving section on the grid. This one sends 40 jobs
submit_cafana.py -n 40 -r $RELEASE -t$TESTREL -o $OUTPUT_DIR NDDataMC.C$OUTFILE true "$NDDATA" "$NDMC"
Note that your release and optional test_release must be consistent with your datasets.
Check your progress: jobsub_q --user USERNAME
• Once all your grid jobs are done, hadd_cafana the results, apply format as you did with the test, create the validation website
hadd_cafana $OUTFILE_NEW pnfs2xrootd \path\to\pnfs\file.*of40.root Once you've got the hadd'ed output file, you can then run the macro again but this time skipping the make spectra section: cafe -bq NDDataMC.C+$OUTFILE_NEW false
### Troubleshooting¶
• Low hanging fruit: are you using the correct tags? datasets? all needed packages in your test release? did you re-compile?
Check the commit history for the package: Is the error related to a recent change?
• Did you search in slack?
• Branch doesn't exist: check your test release for consistency (StandardRecord, CAFAna, MCReweight). You might need to fix the variable definition
• It says that branch doesn't exist but I totally see it: check the requirements of the Var; try using xx.xx.xx.xx to xx.xx.* and report it
• Complaints from nan/inf: some variable might not be filled with default value. Identify and report.
• Occasional segfault on large dataset, not test: some variable might be ill-defined, or not properly filled. Identify and report
• Things break with no cut, ok otherwise: there might be a problem with LID variables
• Empty new_histograms: is the variable being filled in the new cafs? is a default value assigned out of range?
• Weight errors: are weights applicable to both datasets? | 2019-05-24T10:03:40 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.2537365257740021, "perplexity": 8536.790679784925}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257601.8/warc/CC-MAIN-20190524084432-20190524110432-00518.warc.gz"} |
http://hitchhikersgui.de/Portal:Algebra | # Portal:Algebra
Jump to navigation Jump to search
this was created by a mathematician called Waqas naveed
## Introduction
The quadratic formula expresses the solution of the degree two equation ax2 + bx + c = 0, where a is not zero, in terms of its coefficients a, b and c.
Algebra (from Arabic "al-jabr", literally meaning "reunion of broken parts") is one of the broad parts of mathematics, together with number theory, geometry and analysis. In its most general form, algebra is the study of mathematical symbols and the rules for manipulating these symbols; it is a unifying thread of almost all of mathematics. It includes everything from elementary equation solving to the study of abstractions such as groups, rings, and fields. The more basic parts of algebra are called elementary algebra; the more abstract parts are called abstract algebra or modern algebra. Elementary algebra is generally considered to be essential for any study of mathematics, science, or engineering, as well as such applications as medicine and economics. Abstract algebra is a major area in advanced mathematics, studied primarily by professional mathematicians.
Elementary algebra differs from arithmetic in the use of abstractions, such as using letters to stand for numbers that are either unknown or allowed to take on many values. For example, in ${\displaystyle x+2=5}$ the letter ${\displaystyle x}$ is unknown, but the law of inverses can be used to discover its value: ${\displaystyle x=3}$. In E = mc2, the letters ${\displaystyle E}$ and ${\displaystyle m}$ are variables, and the letter ${\displaystyle c}$ is a constant, the speed of light in a vacuum. Algebra gives methods for writing formulas and solving equations that are much clearer and easier than the older method of writing everything out in words.
## Need help?
Do you have a question about Algebra that you can't find the answer to?
Consider asking it at the Wikipedia reference desk.
## Categories
Select [►] to view subcategories
## Associated Wikimedia
The following Wikimedia Foundation sister projects provide more on this subject:
Wikibooks
Books
Commons
Media
Wikinews
News
Wikiquote
Quotations
Wikisource
Texts
Wikiversity
Learning resources
Wiktionary
Definitions
Wikidata
Database
Retrieved from "https://en.wikipedia.org/w/index.php?title=Portal:Algebra&oldid=864313710"
This content was retrieved from Wikipedia : http://en.wikipedia.org/wiki/Portal:Algebra
This page is based on the copyrighted Wikipedia article "Portal:Algebra"; it is used under the Creative Commons Attribution-ShareAlike 3.0 Unported License (CC-BY-SA). You may redistribute it, verbatim or modified, providing that you comply with the terms of the CC-BY-SA | 2018-10-16T22:25:19 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 15, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6401934623718262, "perplexity": 789.6461280007367}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583510867.6/warc/CC-MAIN-20181016201314-20181016222814-00034.warc.gz"} |
https://mipt.ipu.ru/node/46969 | 46969
Автор(ов):
1
Параметры публикации
Тип публикации:
Тезисы доклада
Название:
Nonparametric estimation of extremal index with threshold selection by discrepancy method
ISBN/ISSN:
978-88-61970-00-7
Наименование конференции:
4th Conference of the International Society for Nonparametric Statistics (ISNPS 2018, Salerno, Italy)
Наименование источника:
Book of Abstracts of the 4th Conference of the International Society for Nonparametric Statistics (ISNPS 2018, Salerno, Italy)
Город:
Салерно
Издательство:
Published under the terms of the Creative Commons CC BY-NC-ND 4.0 License
Год издания:
2018
Страницы:
79-80 http://www.isnps2018.it
Аннотация
We consider the nonparametric estimation of extremal index of stochastic processes. There are nonparametric methods like well-known blocks, runs and intervals estimators of the extremal index which all require the selection of an appropriate threshold u. Some modifications of blocks estimator (see, Drees (2011)) require the block size without u. In order to estimate u we develop the approach based on the discrepancy method. The latter was proposed first for a nonparametric estimation of probability density functions Vapnik et al. (1992). The discrepancy statistics based on the von Mises-Smirnov (M-S) and the Kolmogorov-Smirnov (K-S) statistics were used as the discrepancy measures and some quantiles of limit distributions of M-S and K-S statistics were used as the discrepancy value $\delta$. The method was modified by the author for heavy-tailed densities Markovich (2016) and the extremal index Markovich (2015). To this end, the discrepancy statistics M-S and K-S were calculated not by entire sample but only by K largest order statistics. The selection of K and $\delta$ is still an open problem. To overcome this problem we obtain now the limit distribution of the modified M-S statistic regarding the value K. This allows us to select $\delta$ using quantiles of the latter distribution. To this aim, we use the exponential limit distribution of the normalized inter-cluster size derived in Ferro, Segers (2003). The cluster means the number of consecutive observations exceeding threshold u between two consecutive nonexceedances. The exposition is accompanying by simulated examples.
Библиографическая ссылка:
Маркович Н.М. Nonparametric estimation of extremal index with threshold selection by discrepancy method / Book of Abstracts of the 4th Conference of the International Society for Nonparametric Statistics (ISNPS 2018, Salerno, Italy). Салерно: Published under the terms of the Creative Commons CC BY-NC-ND 4.0 License, 2018. С. 79-80 http://www.isnps2018.it. | 2020-02-28T06:34:52 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.435273140668869, "perplexity": 2286.982026276257}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-10/segments/1581875147054.34/warc/CC-MAIN-20200228043124-20200228073124-00507.warc.gz"} |
https://par.nsf.gov/biblio/10125608-galaxy-zoo-probabilistic-morphology-through-bayesian-cnns-active-learning | Galaxy Zoo: probabilistic morphology through Bayesian CNNs and active learning
ABSTRACT
We use Bayesian convolutional neural networks and a novel generative model of Galaxy Zoo volunteer responses to infer posteriors for the visual morphology of galaxies. Bayesian CNN can learn from galaxy images with uncertain labels and then, for previously unlabelled galaxies, predict the probability of each possible label. Our posteriors are well-calibrated (e.g. for predicting bars, we achieve coverage errors of 11.8 per cent within a vote fraction deviation of 0.2) and hence are reliable for practical use. Further, using our posteriors, we apply the active learning strategy BALD to request volunteer responses for the subset of galaxies which, if labelled, would be most informative for training our network. We show that training our Bayesian CNNs using active learning requires up to 35–60 per cent fewer labelled galaxies, depending on the morphological feature being classified. By combining human and machine intelligence, Galaxy zoo will be able to classify surveys of any conceivable scale on a time-scale of weeks, providing massive and detailed morphology catalogues to support research into galaxy evolution.
Authors:
; ; ; ; ; ; ; ; ; ; ; ;
Award ID(s):
Publication Date:
NSF-PAR ID:
10125608
Journal Name:
Monthly Notices of the Royal Astronomical Society
Volume:
491
Issue:
2
Page Range or eLocation-ID:
p. 1554-1574
ISSN:
0035-8711
Publisher:
Oxford University Press
In this work, we explore the possibility of applying machine learning methods designed for 1D problems to the task of galaxy image classification. The algorithms used for image classification typically rely on multiple costly steps, such as the point spread function deconvolution and the training and application of complex Convolutional Neural Networks of thousands or even millions of parameters. In our approach, we extract features from the galaxy images by analysing the elliptical isophotes in their light distribution and collect the information in a sequence. The sequences obtained with this method present definite features allowing a direct distinction between galaxy types. Then, we train and classify the sequences with machine learning algorithms, designed through the platform Modulos AutoML. As a demonstration of this method, we use the second public release of the Dark Energy Survey (DES DR2). We show that we are able to successfully distinguish between early-type and late-type galaxies, for images with signal-to-noise ratio greater than 300. This yields an accuracy of $86{{\ \rm per\ cent}}$ for the early-type galaxies and $93{{\ \rm per\ cent}}$ for the late-type galaxies, which is on par with most contemporary automated image classification approaches. The data dimensionality reduction of our novelmore »
5. ABSTRACT We present the results of a proof-of-concept experiment that demonstrates that deep learning can successfully be used for production-scale classification of compact star clusters detected in Hubble Space Telescope(HST) ultraviolet-optical imaging of nearby spiral galaxies ($D\lesssim 20\, \textrm{Mpc}$) in the Physics at High Angular Resolution in Nearby GalaxieS (PHANGS)–HST survey. Given the relatively small nature of existing, human-labelled star cluster samples, we transfer the knowledge of state-of-the-art neural network models for real-object recognition to classify star clusters candidates into four morphological classes. We perform a series of experiments to determine the dependence of classification performance on neural network architecture (ResNet18 and VGG19-BN), training data sets curated by either a single expert or three astronomers, and the size of the images used for training. We find that the overall classification accuracies are not significantly affected by these choices. The networks are used to classify star cluster candidates in the PHANGS–HST galaxy NGC 1559, which was not included in the training samples. The resulting prediction accuracies are 70 per cent, 40 per cent, 40–50 per cent, and 50–70 per cent for class 1, 2, 3 star clusters, and class 4 non-clusters, respectively. This performance is competitive with consistency achieved in previously published human and automated quantitative classification of starmore » | 2023-02-03T04:35:27 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5324773788452148, "perplexity": 1574.3192027085663}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500042.8/warc/CC-MAIN-20230203024018-20230203054018-00697.warc.gz"} |
https://agilescientific.com/blog/tag/education | # Feel superhuman: learning and teaching geocomputing
Diego teaching in Houston in 2018.
It’s five years since we started teaching Python to geoscientists. To be honest, it might have been premature. At the time, Evan and I were maybe only two years into serious, daily use of Python. But the first class, at the Atlantic Geological Society’s annual meeting in February 2014, was free so the pressure was not too high. And it turns out that only being a step or two ahead of your students can be an advantage. Your ‘expert blind spot’ is partially sighted not completely blind, because you can clearly remember being a noob.
Being a noob is a weird, sometimes very uncomfortable, even scary, feeling for some people. Many of us are used to feeling like experts, at least some of the time. Happy, feeling like a noob is a core competency in programming. Learning new things is a more or less hourly experience for coders. Even a mature language like Python evolves fast enough that it’s hard to keep up. Instead of feeling threatened or exhausted by this, I think the best strategy is to enjoy it. You’ll never be done, there are (way) more questions than answers, and you can learn forever!
One of the bootcamp groups at the Copenhagen hackathon in 2018
This week we’re teaching our 40th course. Last year alone we gave digital superpowers to 325 people, mostly geoscientists, Not all of them learned to code, as such — some people already could, and some found out theydidn’t like it… coding really isn’t for everyone. But I think all of them learned something new about technology, and how it can serve them and their science. I hope all of them look at spreadsheets, and Petrel, and websites differently now. I think most of them want, at some point, to learn more. And everyone is excited about machine learning.
### The expanding community of quantitative earth scientists
This year we’ve already spent 50 days teaching, and taught 174 people. Imagine that! I get emotional when I think about what these hundreds of new digital geoscientists and engineers will go and do with their new skills. I get really excited when I see what they are already doing — when they come to hackathons, send us screenshots, or write papers with beautiful figures. If the joy of sharing code and collaborating with peers has also rubbed off on them, there’s no telling where it could lead.
Matt teaching in Aberdeen in October 2018
The last nine months or so have been an adventure. Teaching is not supposed to be what Agile is about. We’re a consulting company, a technology company. But for now we’re mostly a training company — it’s where we’re needed. And it makes sense... Programming is fundamentally about knowledge sharing. Teaching is about helping, collaborating. It’s perfect for us.
Besides, it’s a privilege and a thrill to meet all these fantastically smart, motivated people and to hear about their projects and their plans. Sometimes I wish it didn’t mean leaving my family in Nova Scotia and flying to Houston and London and Kuala Lumpur and Kalamazoo… but mostly I wish we could do more of it. Especially when we get comments like these:
How many times have you felt superhuman at work recently?
The courses we teach are evolving and expanding in scope. But they all come back to the same thing: growing digital skills in our profession. This is critical because using computers for earth science is really hard. Why? The earth is weird. We’ve spent hundreds of years honing conceptual models, understanding deep time, and figuring out complex spatial relationships.
If data science eats the subsurface without us, we’re all going to get indigestion. Society needs to better understand the earth — for all sorts of reasons — and it’s our duty to build and adopt the most powerful analytical tools available so that we can help.
### Learning resources
If you can’t wait to get started, here are some suggestions:
Classroom courses are a big investment in dollars and time, but they can get you a long way really quickly. Our courses are built especially for subsurface scientists and engineers. As far as I know, they are the only ones of their kind. If you think you’d like to take one, talk to us, or look out for a public course. You can find out more or sign up for email alerts here >> https://agilescientific.com/training/
Last thing: I suggest avoiding DataCamp, because of sexual misconduct by an executive, compounded by total inaction, dishonest obfuscation, and basically failing spectacularly. Even their own trainers have boycotted them. Steer clear.
1 Comment
### Matt Hall
Matt is a geoscientist in Nova Scotia, Canada. Founder of Agile Scientific, co-founder of The HUB South Shore. Matt is into geology, geophysics, and machine learning.
# A new blog, and a new course
There's a great new geoscience blog on the Internet — I urge you to add it to your blog-reading app or news reader or list of links or whatever it is you use to keep track of these things. It's called Geology and Python, and it contains exactly what you'd expect it to contain!
The author, Bruno Ruas de Pinho, has nine posts up so far, all excellent. The range of topics is quite broad:
In each post, Bruno takes some geoscience challenge — nothing too huge, but the problems aren't trivial either — and then methodically steps through solving the problem in Python. He's clearly got a good quantitative brain, having recently graduated in geological engineering from the Federal University of Pelotas, aka UFPel, Brazil, and he is now available for hire. (He seems to be pretty sharp, so if you're doing anything with computers and geoscience, you should snag him.)
# A new course for Calgary
We've run lots of Introduction to Python courses before, usually with the name Creative Geocomputing. Now we're adding a new dimension, combining a crash introduction to Python with a crash introduction to machine learning. It's ambitious, for sure, but the idea is not to turn you into a programmer. We aim to:
• Verse you in the basics of Python and machine learning so you can start to explore.
• Set you off with ideas and things to figure out for that pet project you've always wanted to code up.
• Introduce you to other Calgarians who love playing with code and rocks.
We do all this wielding geoscientific data — it's all well logs and maps and seismic data. There are no silly examples, and we don't shy away from so-called advanced things — what's the point in computers if you can't do some things that are really, really hard to do in your head?
Tickets are on sale now at Eventbrite, it's $750 for 2 days — including all the lunch and code you can eat. 1 Comment ### Matt Hall Matt is a geoscientist in Nova Scotia, Canada. Founder of Agile Scientific, co-founder of The HUB South Shore. Matt is into geology, geophysics, and machine learning. # Two new short courses in Calgary We're running two one-day courses in Calgary for the CSPG Spring Education Week. One of them is a bit... weird, so I thought I'd try to explain what we're up to. Both classes run from 8:30 till 4:00, and both of them cost just CAD 425 for CSPG members. ### Get introduced to Python The first course is Practical programming for geoscientists. Essentially a short version of our 2 to 3 day Creative geocomputing course, we'll take a whirlwind tour through the Python programming language, then spend the afternoon looking at some basic practical projects. It might seem trivial, but leaving with a machine fully loaded with all the tools you'll need, plus long list of resources and learning aids, is worth the price of admission alone. If you've always wanted to get started with the world's easiest-to-learn programming language, this is the course you've been waiting for! ### Hashtag geoscience This is the weird one. Hashtag geoscience: communicating geoscience in the 21st century. Join me, Evan, Graham Ganssle (my co-host on Undersampled Radio) — and some special guests — for a one-day sci comm special. Writing papers and giving talks is all so 20th century, so let's explore social media, blogging, podcasting, open access, open peer review, and all the other exciting things that are happening in scientific communication today. These tools will not only help you in your job, you'll find new friends, new ideas, and you might even find new work. I hope a lot of people come to this event. For one, it supports the CSPG (we're not getting paid, we're on expenses only). Secondly, it'll be way more fun with a crowd. Our goal is for everyone to leave burning to write a blog, record a podcast, or at least create a Twitter account. One of our special guests will be young-and-famous geoscience vlogger Dr Chris. Coincidentally, we just interviewed him on Undersampled Radio. Here's the uncut video version; audio will be on iTunes and Google Play in a couple of days: Comment ### Matt Hall Matt is a geoscientist in Nova Scotia, Canada. Founder of Agile Scientific, co-founder of The HUB South Shore. Matt is into geology, geophysics, and machine learning. # A coding kitchen in Stavanger Last week, I travelled to Norway and held a two day session of our Agile Geocomputing Training. We convened at the newly constructed Innovation Dock in Stavanger, and set up shop in an oversized, swanky kitchen. Despite the industry-wide squeeze on spending, the event still drew a modest turnout of seven geoscientists. That's way more traction then we've had in North America lately, so thumbs up to Norway! And, since our training is designed to be very active, a group of seven is plenty comfortable. A few of the participants had some prior experience writing code in languages such as Perl, Visual Basic, and C, but the majority showed up without any significant programming experience at all. ### Skills start with syntax and structures The first day we covered basic principles or programming, but because Python is awesome, we dive into live coding right from the start. As an instructor, I find that doing live coding has two hidden benefits: it stops me from racing ahead, and making mistakes in the open gives students permission to do the same. Using geoscience data right from the start, students learn about key data structures: lists, dicts, tuples, and sets, and for a given job, why they might chose between them. They wrote their own mini-module containing functions and classes for getting stratigraphic tops from a text file. Since syntax is rather dry and unsexy, I see the instructor's main role to inspire and motivate through examples that connect to things that learners already know well. The ideal containers for stratigraphic picks is a dictionary. Logs, surfaces, and seismic, are best cast into 1-, 2, and 3-dimensional NumPy arrays, respectively. And so on. ### Notebooks inspire learning We've seen it time and time again. People really like the format of Jupyter Notebooks (formerly IPython Notebooks). It's like there is something fittingly scientific about them: narrative, code, output, repeat. As a learning document, they aren't static — in fact they're meant to be edited. But they aren't so open-ended that learners fail to launch. Professional software developers may not 'get it', but scientists really subscribe do. Start at the start, end at the end, and you've got a complete record of your work. You don't get that with the black-box, GUI-heavy software applications we're used to. Maybe, all legitimate work should be reserved for notebooks: self-contained, fully-reproducible, and extensible. Maybe notebooks, in their modularity and granularity, will be the new go-to software for technical work. ### Outcomes and feedback By the end of day two, folks were parsing stratigraphic and petrophysical data from text files, then rendering and stylizing illustrations. A few were even building interactive animations on 3D seismic volumes. One recommendation was to create a sort of FAQ or cookbook: "How do I read a log?", "How do I read SEGY?", "How do I calculate elastic properties from a well log?". A couple of people of remarked that they would have liked even more coached exercises, maybe even an extra day; a recognition of the virtue of sustained and structured practice. ### Want training too? Head to our courses page for a list of upcoming courses, or more details on how you can train your team Photographs in this post are courtesy of Alessandro Amato del Monte via aadm on Flickr # Once is never Image by ZEEVVEEZ on Flickr, licensed CC-BY. Ten points if you can tell what it is... My eldest daughter is in grade 5, so she's getting into some fun things at school. This week the class paired off to meet a challenge: build a container to keep hot water hot. Cool! The teams built their contraptions over the weekend, doubtless with varying degrees of rule interpretation (my daughter's involved HotHands hand warmers, which I would not have thought of), and the results were established with a side-by-side comparison. Someone (not my daughter) won. Kudos was achieved. But this should not be the end of the exercise. So far, no-one has really learned anything. Stopping here is like grinding wheat but not making bread. Or making dough, but not baking it. Or baking it, but not making it into toast, buttering it, and covering it in Marmite... Great, now I'm hungry. ### The rest of the exercise How could this experiment be improved? For starters, there was a critical component missing: control. Adding a vacuum flask at one end, and an uninsulated beaker at the other would have set some useful benchmarks. There was a piece missing from the end too: analysis. A teardown of the winning and losing efforts would have been quite instructive. Followed by a conversation about the relative merits of different insulators, say. I can even imagine building on the experience. How about a light introduction to thermodynamic theory, or a stab at simple numerical modeling? Or a design contest? Or a marketing plan? But most important missing piece of all, the secret weapon of learning, is iteration. The crucial next step is to send the class off to do it again, better this time. The goal: to beat the best previous attempt, perhaps even to beat the vacuum flask. The reward:$20k in seed funding and a retail distribution deal. Or a house point for Griffindor.
Einmal ist keinmal, as they say in Germany: Once is never. What can you iterate today?
### Matt Hall
Matt is a geoscientist in Nova Scotia, Canada. Founder of Agile Scientific, co-founder of The HUB South Shore. Matt is into geology, geophysics, and machine learning.
# Plant a seed for science and tech
Cruising around the web last weekend looking for geosciencey Christmas presents, coupled with having 3 kids (aged 9, 5, and 3) to entertain and educate, I just realized I have a long list of awesome toys to share. Well, I say toys, but these amazing things are almost in a class of their own...
A full kit for a child to build his or her own camera, and it's only $89. Probably best suited to those aged 7 up to about 12. Features: • comes with everything you need, including a screwdriver, • a crank instead of a battery, • multiple lenses including anaglyphic 3D, • a set of online tutorials about the components and how they work — enlightening! ### LittleBits Epic. For kids (and others) that aren't quite ready for a soldering iron, these magentic blocks just work. There are blocks for power, for input (like this pressure sensor), and for output. They can, and should, be combined with each other and anything else (Lego, Meccano, straws, dinosaurs) for maximum effect. Wonderful. ### Anything at all from SparkFun ... and there's Adafruit too. I know we had Tandy or RadioShack or whatever in the early 1980s, but we didn't have the Internet. So life was, you know, hard. No longer. Everything at SparkFun is affordable, well-designed, well-documented, and—well—fun. I mean, who wouldn't want to build their own Simon Says And this is just a fraction of what's out there... Lego MINDSTORMS for the bigger kids, GoldieBlox for smaller kids, Raspberry Pi for the teens. I get very excited when I think about what this means for the future of invention, creativity, and applied science. Even more exciting, it's us grown-ups that get to help them explore all this fun. Where will you start? Comment ### Matt Hall Matt is a geoscientist in Nova Scotia, Canada. Founder of Agile Scientific, co-founder of The HUB South Shore. Matt is into geology, geophysics, and machine learning. # Back to school My children go back to school this week. One daughter is going into Grade 4, another is starting kindergarten, and my son is starting pre-school at the local Steiner school. Exciting times. I go all misty-eyed at this time of year. I absolutely loved school. Mostly the learning part. I realize now there are lots of things I was never taught (anything to do with computers, anything to do with innovation or entrepreneurship, anything to do with blogging), but what we did cover, I loved. I'm not even sure it's learning I like so much — my retention of facts and even concepts is actually quite bad — it's the process of studying. ### Lifelong learning Naturally, the idea of studying now, as a grown-up and professional, appeals to me. But I stopped tracking courses I've taken years ago, and actually now have stopped doing them, because most of them are not very good. I've found many successful (that is, long running) industry courses to be disappointingly bad — long-running course often seems to mean getting a tired instructor and dated materials for your$500 per day. (Sure, you said the course was good when you sis the assessment, but what did you think a week later? A month, a year later? If you even remember it.) I imagine it's all part of the 'grumpy old man' phase I seem to have reached when I hit 40.
But I am grumpy no longer! Because awesome courses are back...
### So many courses
Last year Evan and I took three high quality, and completely free, massive online open courses, or MOOCs:
There aren't a lot of courses out there for earth scientists yet. If you're looking for something specific, RedHoop is a good way to scan everything at once.
### The future
These are the gold rush days, the exciting claim-staking pioneer days, of massive online open courses. Some trends:
There are new and profound opportunities here for everyone from high school students to postgraduates, and from young professionals to new retirees. Whether you're into teaching, or learning, or both, I recommend trying a MOOC or two, and asking yourself what the future of education and training looks like in your world.
The questions is, what will you try first? Is there a dream course you're looking for?
### Matt Hall
Matt is a geoscientist in Nova Scotia, Canada. Founder of Agile Scientific, co-founder of The HUB South Shore. Matt is into geology, geophysics, and machine learning.
# Two ways for Q&A
If you have ever tried to figure something out on your own, you will know that it is a lot harder than doing something that you already know. It is hard because it is new to you. But just because it is new to you, doesn't mean that it is new to everyone else. And now, in a time when it is easier than ever to connect with everyone online, a new kind of scarcity is emerging. Helpfulness.
For better or for worse, I follow more than a dozen discussion groups on LinkedIn. Why? I believe that candid discussions are important and enriching, so I sign up eagerly for the action. Signing up to a discussion group is like showing up at a cocktail party. Maybe you will get noticed alongside other people and brands worth noticing. There is hoopla, and echoing, but I don't think there is any real value being created for the members. If anything, it's a constant distraction you put up with to hedge against the fomo
Click to enlargeYet, hoards of users flock to these groups with questions that are clearly more appropriate for technical hot-lines, or at least an honest attempt at reading the manual. Users helping users is a great way to foster brand loyalty, but not if the technical help desk failed them first. On LinkedIn, even on the rare case a question is sufficiently articulated, users can't upload a screen shot or share a snippet of code. Often times I think people are just fishing (not phishing mind you) and haven't put in enough ground work to deserve the attention of helpers.
### What is in it for me?
Stack Overflow is a 'language-independent' question and answer site for programmers. If it is not the first place I land on with a google search, it is consistently the place from which I bounce back to the terminal with my answer. Also, nearly everything that I know about open-source GIS has come from other people taking part in Q&A on GIS Stack Exchange. The reason Stack Exchange works is because there is value and incentive for each of the three types of people that show up. Something for the asker, something for answerer, something for the searcher.
It is easy to see what is in it for the asker. They have got a problem, and they are looking for help. Similarly, it's easy to see what is in it for the searcher. They might find something they are looking for, without even having to ask. But what is in it for the answerer? There is no payment, there is no credit, at least not of the monetary kind. The answerer gets practice being helpful. They willingly put themselves into other people's business to put themselves to the test. How awesome is that? The site, in turn helps the helpers by ensuring the questions contain just enough context to garner meaningful answers.
Imagine if applied geoscientists could incorporate a little more of that.
# Journalists are scientists
Tim Radford. Image: Stevyn Colgan.On Thursday I visited The Guardian’s beautiful offices in King’s Cross for one of their Masterclass sessions. Many of them have sold out, but Tim Radford’s science writing evening did so in hours, and the hundred-or-so budding writers present were palpably excited to be there. The newspaper is one of the most progressive news outlets in the world, and boasts many venerable alumni (John Maddox and John Durant among them). It was a pleasure just to wander around the building with a glass of wine, with some of London’s most eloquent nerds.
Radford is not a trained scientist, but a pure journalist. He left school at 16, idolized Dylan Thomas, joined a paper, wrote like hell, and sat on almost every desk before mostly retiring from The Guardian in 2005. He has won four awards from the Association of British Science Writers. More people read any one of his science articles on a random Tuesday morning over breakfast than will ever read anything I ever write. Tim Radford is, according to Ed Yong, the Yoda of science writers.
Within about 30 minutes it became clear what it means to be a skilled writer: Radford’s real craft is story-telling. He is completely at home addressing a crowd of scientists — he knows how to hold a mirror up to the geeks and reflect the fun, fascinating, world-changing awesomeness back at them. “It’s a terrible mistake to think that because you know about a subject you are equipped to write about it,” he told us, getting at how hard it is to see something from within. It might be easier to write creatively, and with due wonder, about fields outside our own.
Some in the audience weren’t content with being entertained by Radford, watching him in action as it were, preferring instead to dwell on controversy. He mostly swatted them aside, perfectly pleasantly, but one thing he was having none of was the supposed divide between scientists and journalists. Indeed, Radford asserted that journalists and scientists do basically the same thing: imagine a story (hypothesis), ask questions (do experiments), form a coherent story (theory) from the results, and publish. Journalists are scientists. Kind of.
I loved Radford's committed and unapologetic pragmatism, presumably the result of several decades of deadlines. “You don’t have to be ever so clever, you just have to be ever so quick,” and as a sort of corollary: “You can’t be perfectly right, but you must be mostly right.” One questioner accused journalists of sensationalising science (yawn). “Of course we do!” he said — because he wants his story in the paper, and he wants people to read it. Specifically, he wants people who don’t read science stories to read it. After all, writing for other people is all about giving them a sensation of one kind or another.
I got so much out of the 3 hours I could write at least another 2000 words, but I won’t. The evening was so popular that the paper decided to record the event and experiment with a pay-per-view video, so you can get all the goodness yourself. If you want more Radford wisdom, his Manifesto for the simple scribe is a must-read for anyone who writes.
Tim Radford's most recent book, The Address Book: Our Place in the Scheme of Things, came out in spring 2011.
The photograph of Tim Radford, at The World's Most Improbable Event on 30 September, is copyright of Stevyn Colgan, and used with his gracious permission. You should read his blog, Colganology. The photograph of King's Place, the Guardian's office building, is by flickr user Davide Simonetti, licensed CC-BY-NC. | 2019-09-18T20:01:12 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.19100093841552734, "perplexity": 2266.8196633929338}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514573331.86/warc/CC-MAIN-20190918193432-20190918215432-00125.warc.gz"} |
http://dlmf.nist.gov/2.5 | # §2.5 Mellin Transform Methods
## §2.5(i) Introduction
Let be a locally integrable function on , that is, exists for all and satisfying . The Mellin transform of is defined by
when this integral converges. The domain of analyticity of is usually an infinite strip parallel to the imaginary axis. The inversion formula is given by
with .
One of the two convolution integrals associated with the Mellin transform is of the form
and
If and have a common strip of analyticity , then
where . When , this identity is a Parseval-type formula; compare §1.14(iv).
If and can be continued analytically to meromorphic functions in a left half-plane, and if the contour can be translated to with , then
where
The sum in (2.5.6) is taken over all poles of in the strip , and it provides the asymptotic expansion of for small values of . Similarly, if and can be continued analytically to meromorphic functions in a right half-plane, and if the vertical line of integration can be translated to the right, then we obtain an asymptotic expansion for for large values of .
### ¶ Example
where denotes the Bessel function (§10.2(ii)), and is a large positive parameter. Let and . Then from Table 1.14.5 and Watson (1944, p. 403)
In the half-plane , the product has a pole of order two at each positive integer, and
where
and is the logarithmic derivative of the gamma function (§5.2(i)).
We now apply (2.5.5) with , and then translate the integration contour to the right. This is allowable in view of the asymptotic formula
as , uniformly for bounded ; see (5.11.9). Then as in (2.5.6) and (2.5.7), with , we obtain
From (2.5.12) and (2.5.13), it is seen that when is even. Hence
where , .
## §2.5(ii) Extensions
Let and be locally integrable on and
where for , and as . Also, let
where is real, , for , and as . To ensure that the integral (2.5.3) converges we assume that
with , and
with . To apply the Mellin transform method outlined in §2.5(i), we require the transforms and to have a common strip of analyticity. This, in turn, requires , , and either or . Following Handelsman and Lew (1970, 1971) we now give an extension of this method in which none of these conditions is required.
First, we introduce the truncated functions and defined by
Similarly,
2.5.23
2.5.24
With these definitions and the conditions (2.5.17)–(2.5.20) the Mellin transforms converge absolutely and define analytic functions in the half-planes shown in Table 2.5.1.
Table 2.5.1: Domains of convergence for Mellin transforms.
Transform Domain of Convergence
Furthermore, can be continued analytically to a meromorphic function on the entire -plane, whose singularities are simple poles at , , with principal part
2.5.25
By Table 2.5.1, is an analytic function in the half-plane . Hence we can extend the definition of the Mellin transform of by setting
for . The extended transform has the same properties as in the half-plane .
Similarly, if in (2.5.18), then can be continued analytically to a meromorphic function on the entire -plane with simple poles at , , with principal part
2.5.27
Alternatively, if in (2.5.18), then can be continued analytically to an entire function.
Since is analytic for by Table 2.5.1, the analytically-continued allows us to extend the Mellin transform of via
in the same half-plane. From (2.5.26) and (2.5.28), it follows that both and are defined in the half-plane .
We are now ready to derive the asymptotic expansion of the integral in (2.5.3) as . First we note that
2.5.29
where
By direct computation
2.5.31for .
Next from Table 2.5.1 we observe that the integrals for the transform pair and are absolutely convergent in the domain specified in Table 2.5.2, and these domains are nonempty as a consequence of (2.5.19) and (2.5.20).
Table 2.5.2: Domains of analyticity for Mellin transforms.
Transform Pair Domain
For simplicity, write
From Table 2.5.2, we see that each is analytic in the domain . Furthermore, each has an analytic or meromorphic extension to a half-plane containing . Now suppose that there is a real number in such that the Parseval formula (2.5.5) applies and
If, in addition, there exists a number such that
then
where
as . (The last order estimate follows from the Riemann–Lebesgue lemma, §1.8(i).) The asymptotic expansion of is then obtained from (2.5.29).
For further discussion of this method and examples, see Wong (1989, Chapter 3), Paris and Kaminski (2001, Chapter 5), and Bleistein and Handelsman (1975, Chapters 4 and 6). The first reference also contains explicit expressions for the error terms, as do Soni (1980) and Carlson and Gustafson (1985).
The Mellin transform method can also be extended to derive asymptotic expansions of multidimensional integrals having algebraic or logarithmic singularities, or both; see Wong (1989, Chapter 3), Paris and Kaminski (2001, Chapter 7), and McClure and Wong (1987). See also Brüning (1984) for a different approach.
## §2.5(iii) Laplace Transforms with Small Parameters
Let satisfy (2.5.18) and (2.5.20) with , and consider the Laplace transform
Put and break the integration range at , as in (2.5.23) and (2.5.24). Then
where
Since , by the Parseval formula (2.5.5), there are real numbers and such that , , and
Since is analytic for , by (2.5.14),
for any satisfying . Similarly, since can be continued analytically to a meromorphic function (when ) or to an entire function (when ), we can choose so that has no poles in . Thus
On substituting (2.5.41) and (2.5.42) into (2.5.38), we obtain
where () is an arbitrary integer and is an arbitrary small positive constant. The last term is clearly as .
If in (2.5.18) and in (2.5.20), and if none of the exponents in (2.5.18) are positive integers, then the expansion (2.5.43) gives the following useful result:
### ¶ Example
For examples in which the integral defining the Mellin transform does not exist for any value of , see Wong (1989, Chapter 3), Bleistein and Handelsman (1975, Chapter 4), and Handelsman and Lew (1970). | 2013-05-23T21:31:48 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9614493250846863, "perplexity": 713.4771174514373}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368703830643/warc/CC-MAIN-20130516113030-00074-ip-10-60-113-184.ec2.internal.warc.gz"} |
https://lammps.sandia.gov/doc/fix_ipi.html | # fix ipi command
## Syntax
fix ID group-ID ipi address port [unix] [reset]
• ID, group-ID are documented in fix command
• ipi = style name of this fix command
• address = internet address (FQDN or IP), or UNIX socket name
• port = port number (ignored for UNIX sockets)
• optional keyword = unix, if present uses a unix socket
• optional keyword = reset, if present reset electrostatics at each call
## Examples
fix 1 all ipi my.server.com 12345 fix 1 all ipi mysocket 666 unix reset
## Description
This fix enables LAMMPS to be run as a client for the i-PI Python wrapper (IPI) for performing a path integral molecular dynamics (PIMD) simulation. The philosophy behind i-PI is described in the following publication (IPI-CPC).
A version of the i-PI package, containing only files needed for use with LAMMPS, is provided in the tools/i-pi directory. See the tools/i-pi/manual.pdf for an introduction to i-PI. The examples/USER/i-pi directory contains example scripts for using i-PI with LAMMPS.
In brief, the path integral molecular dynamics is performed by the Python wrapper, while the client (LAMMPS in this case) simply computes forces and energy for each configuration. The communication between the two components takes place using sockets, and is reduced to the bare minimum. All the parameters of the dynamics are specified in the input of i-PI, and all the parameters of the force field must be specified as LAMMPS inputs, preceding the fix ipi command.
The server address must be specified by the address argument, and can be either the IP address, the fully-qualified name of the server, or the name of a UNIX socket for local, faster communication. In the case of internet sockets, the port argument specifies the port number on which i-PI is listening, while the unix optional switch specifies that the socket is a UNIX socket.
Note that there is no check of data integrity, or that the atomic configurations make sense. It is assumed that the species in the i-PI input are listed in the same order as in the data file of LAMMPS. The initial configuration is ignored, as it will be substituted with the coordinates received from i-PI before forces are ever evaluated.
A note of caution when using potentials that contain long-range electrostatics, or that contain parameters that depend on box size: all of these options will be initialized based on the cell size in the LAMMPS-side initial configuration and kept constant during the run. This is required to e.g. obtain reproducible and conserved forces. If the cell varies too wildly, it may be advisable to re-initialize these interactions at each call. This behavior can be requested by setting the reset switch.
Restart, fix_modify, output, run start/stop, minimize info:
There is no restart information associated with this fix, since all the dynamical parameters are dealt with by i-PI.
## Restrictions
Using this fix on anything other than all atoms requires particular care, since i-PI will know nothing on atoms that are not those whose coordinates are transferred. However, one could use this strategy to define an external potential acting on the atoms that are moved by i-PI.
This fix is part of the USER-MISC package. It is only enabled if LAMMPS was built with that package. See the Build package doc page for more info. Because of the use of UNIX domain sockets, this fix will only work in a UNIX environment. | 2020-01-21T01:04:32 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5196489691734314, "perplexity": 3033.813204533557}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-05/segments/1579250601040.47/warc/CC-MAIN-20200120224950-20200121013950-00213.warc.gz"} |
https://par.nsf.gov/biblio/10303243-noise-resilience-variational-quantum-compiling | Noise resilience of variational quantum compiling
Abstract
Variational hybrid quantum-classical algorithms (VHQCAs) are near-term algorithms that leverage classical optimization to minimize a cost function, which is efficiently evaluated on a quantum computer. Recently VHQCAs have been proposed for quantum compiling, where a target unitaryUis compiled into a short-depth gate sequenceV. In this work, we report on a surprising form of noise resilience for these algorithms. Namely, we find one often learns the correct gate sequenceV(i.e. the correct variational parameters) despite various sources of incoherent noise acting during the cost-evaluation circuit. Our main results are rigorous theorems stating that the optimal variational parameters are unaffected by a broad class of noise models, such as measurement noise, gate noise, and Pauli channel noise. Furthermore, our numerical implementations on IBM’s noisy simulator demonstrate resilience when compiling the quantum Fourier transform, Toffoli gate, and W-state preparation. Hence, variational quantum compiling, due to its robustness, could be practically useful for noisy intermediate-scale quantum devices. Finally, we speculate that this noise resilience may be a general phenomenon that applies to other VHQCAs such as the variational quantum eigensolver.
Authors:
; ; ;
Publication Date:
NSF-PAR ID:
10303243
Journal Name:
New Journal of Physics
Volume:
22
Issue:
4
Page Range or eLocation-ID:
Article No. 043006
ISSN:
1367-2630
Publisher:
IOP Publishing
National Science Foundation
##### More Like this
1. Due to the unreliability and limited capacity of existing quantum computer prototypes, quantum circuit simulation continues to be a vital tool for validating next generation quantum computers and for studying variational quantum algorithms, which are among the leading candidates for useful quantum computation. Existing quantum circuit simulators do not address the common traits of variational algorithms, namely: 1) their ability to work with noisy qubits and operations, 2) their repeated execution of the same circuits but with different parameters, and 3) the fact that they sample from circuit final wavefunctions to drive a classical optimization routine. We present a quantum circuit simulation toolchain based on logical abstractions targeted for simulating variational algorithms. Our proposed toolchain encodes quantum amplitudes and noise probabilities in a probabilistic graphical model, and it compiles the circuits to logical formulas that support efficient repeated simulation of and sampling from quantum circuits for different parameters. Compared to state-of-the-art state vector and density matrix quantum circuit simulators, our simulation approach offers greater performance when sampling from noisy circuits with at least eight to 20 qubits and with around 12 operations on each qubit, making the approach ideal for simulating near-term variational quantum algorithms. And for simulating noise-free shallowmore »
2. Variational Quantum Algorithms (VQA) are one of the most promising candidates for near-term quantum advantage. Traditionally, these algorithms are parameterized by rotational gate angles whose values are tuned over iterative execution on quantum machines. The iterative tuning of these gate angle parameters make VQAs more robust to a quantum machine’s noise profile. However, the effect of noise is still a significant detriment to VQA’s target estimations on real quantum machines — they are far from ideal. Thus, it is imperative to employ effective error mitigation strategies to improve the fidelity of these quantum algorithms on near-term machines.While existing error mitigation techniques built from theory do provide substantial gains, the disconnect between theory and real machine execution characteristics limit the scope of these improvements. Thus, it is critical to optimize mitigation techniques to explicitly suit the target application as well as the noise characteristics of the target machine.We propose VAQEM, which dynamically tailors existing error mitigation techniques to the actual, dynamic noisy execution characteristics of VQAs on a target quantum machine. We do so by tuning specific features of these mitigation techniques similar to the traditional rotation angle parameters -by targeting improvements towards a specific objective function which represents the VQAmore »
3. Abstract
In the near-term, hybrid quantum-classical algorithms hold great potential for outperforming classical approaches. Understanding how these two computing paradigms work in tandem is critical for identifying areas where such hybrid algorithms could provide a quantum advantage. In this work, we study a QAOA-based quantum optimization approach by implementing the Variational Quantum Factoring (VQF) algorithm. We execute experimental demonstrations using a superconducting quantum processor, and investigate the trade off between quantum resources (number of qubits and circuit depth) and the probability that a given biprime is successfully factored. In our experiments, the integers 1099551473989, 3127, and 6557 are factored with 3, 4, and 5 qubits, respectively, using a QAOA ansatz with up to 8 layers and we are able to identify the optimal number of circuit layers for a given instance to maximize success probability. Furthermore, we demonstrate the impact of different noise sources on the performance of QAOA, and reveal the coherent error caused by the residualZZ-coupling between qubits as a dominant source of error in a near-term superconducting quantum processor.
4. Abstract
The variational quantum eigensolver is one of the most promising approaches for performing chemistry simulations using noisy intermediate-scale quantum (NISQ) processors. The efficiency of this algorithm depends crucially on the ability to prepare multi-qubit trial states on the quantum processor that either include, or at least closely approximate, the actual energy eigenstates of the problem being simulated while avoiding states that have little overlap with them. Symmetries play a central role in determining the best trial states. Here, we present efficient state preparation circuits that respect particle number, total spin, spin projection, and time-reversal symmetries. These circuits contain the minimal number of variational parameters needed to fully span the appropriate symmetry subspace dictated by the chemistry problem while avoiding all irrelevant sectors of Hilbert space. We show how to construct these circuits for arbitrary numbers of orbitals, electrons, and spin quantum numbers, and we provide explicit decompositions and gate counts in terms of standard gate sets in each case. We test our circuits in quantum simulations of the$${H}_{2}$$${H}_{2}$and$$LiH$$$LiH$molecules and find that they outperform standard state preparation methods in terms of both accuracy and circuit depth.
5. Understanding the computational power of noisy intermediate-scale quantum (NISQ) devices is of both fundamental and practical importance to quantum information science. Here, we address the question of whether error-uncorrected noisy quantum computers can provide computational advantage over classical computers. Specifically, we study noisy random circuit sampling in one dimension (or 1D noisy RCS) as a simple model for exploring the effects of noise on the computational power of a noisy quantum device. In particular, we simulate the real-time dynamics of 1D noisy random quantum circuits via matrix product operators (MPOs) and characterize the computational power of the 1D noisy quantum system by using a metric we call MPO entanglement entropy. The latter metric is chosen because it determines the cost of classical MPO simulation. We numerically demonstrate that for the two-qubit gate error rates we considered, there exists a characteristic system size above which adding more qubits does not bring about an exponential growth of the cost of classical MPO simulation of 1D noisy systems. Specifically, we show that above the characteristic system size, there is an optimal circuit depth, independent of the system size, where the MPO entanglement entropy is maximized. Most importantly, the maximum achievable MPO entanglement entropymore » | 2022-12-06T20:21:06 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 2, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5039635300636292, "perplexity": 1099.5779768610762}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711114.3/warc/CC-MAIN-20221206192947-20221206222947-00540.warc.gz"} |
https://par.nsf.gov/biblio/10195387-optimization-solar-driven-systems-off-grid-water-nanofiltration-electrification | skip to main content
Optimization of solar-driven systems for off-grid water nanofiltration and electrification
Abstract The work described is motivated by an inability to extend central infrastructure for power and water to low-population-density areas of the Navajo Nation and elsewhere. It is estimated that 35% of the Navajo population haul water for household use, frequently from unregulated sources of poor initial quality. The proposed household-scale, solar-driven nanofiltration (NF) system designs are economically optimized to satisfy point-of-use water purification objectives. The systems also provide electrical energy for a degree of nighttime household illumination. Results support rational design of multiple-component purification systems consisting of solar panels, a high-pressure pump, NF membranes, battery storage and an electrical control unit subject to constraints on daily water treatment and excess energy generation. The results presented are conditional (based on initial water quality, membrane characteristics and geography) but can be adapted to satisfy alternative treatment objectives in alternate geographic, etc. settings. The unit costs of water and energy from an optimized system that provides 100 gpd (1 gallon is 3.78 L) and 2 kWh/day of excess electrical energy are estimated at $0.16 per 100 gallons of water treated and$0.26 per kWh of nighttime electrical energy delivered. Methods can be used to inform dispersed infrastructure design subject to alternate constraint more »
Authors:
; ; ;
Award ID(s):
Publication Date:
NSF-PAR ID:
10195387
Journal Name:
Reviews on Environmental Health
Volume:
35
Issue:
2
Page Range or eLocation-ID:
211 to 217
ISSN:
0048-7554
Sponsoring Org:
National Science Foundation
##### More Like this
1. Abstract
Understanding the thermodynamics associated with ion mixing and separation processes is important in order to meet the rising demands for clean energy and water production. Several electrochemical-based technologies such as capacitive deionization and capacitive mixing (CapMix) are capable of achieving desalination and energy production through ion mixing and separation processes, yet experimental investigations suggest energy conversion occurs with low second law (thermodynamic) efficiency. Here, we explore the maximum attainable efficiency for different CapMix cycles to investigate the impact cycle operation has on energy extraction. All investigated cycles are analogous to well documented heat engine cycles. In order to analyzemore »
2. Abstract Engineering innovations—including those in heat and mass transfer—are needed to provide food, water, and power to a growing population (i.e., projected to be 9.8 × 109 by 2050) with limited resources. The interweaving of these resources is embodied in the food, energy, and water (FEW) nexus. This review paper focuses on heat and mass transfer applications which involve at least two aspects of the FEW nexus. Energy and water topics include energy extraction of natural gas hydrates and shale gas; power production (e.g., nuclear and solar); power plant cooling (e.g., wet, dry, and hybrid cooling); water desalination and purification; and buildingmore »
3. Cadmium telluride (CdTe) solar cells are a promising photovoltaic (PV) technology for producing power in space owing to their high-efficiency (> 22.1 %), potential for specific power, and cost-effective manufacturing processes. In contrast to traditional space PVs, the high-Z (atomic number) CdTe absorbers can be intrinsically robust under extreme space radiation, offering long-term stability. Despite these advantages, the performance assessment of CdTe solar cells under high-energy particle irradiation (e.g., photons, neutrons, charged particles) is limited in the literature, and their stability is not comprehensively studied. In this work, we present the PV response of n-CdS / p-CdTe PVs under acceleratedmore »
4. The integration of Internet of Things (IoT)-enabled sensors and building energy management systems (BEMS) into smart buildings offers a platform for real-time monitoring of myriad factors that shape indoor air quality. This study explores the application of building energy and smart thermostat data to evaluate indoor ultrafine particle dynamics (UFP, diameter ≤ 100 nm). A new framework is developed whereby a cloud-based BEMS and smart thermostats are integrated with real time UFP sensing and a material balance model to characterize UFP source and loss processes. The data-driven framework was evaluated through a field campaign conducted in an occupied net-zero energymore »
5. Electrochemical water splitting is one of the most promising approaches for sustainable energy conversion and storage toward a future hydrogen society. This demands durable and affordable electrocatalysts for the hydrogen evolution reaction (HER) and the oxygen evolution reaction (OER). In this study, we report the preparation of uniform Ni–P–O, Ni–S–O, and Ni–S–P–O electrocatalytic films on nickel foam (NF) substrates via flow cell-assisted electrodeposition. Remarkably, electrodeposition onto 12 cm 2 substrates was optimized by strategically varying critical parameters. The high quality and reproducibility of the materials is attributed to the use of a 3D-printed flow cell with a tailored design. Then,more » | 2022-08-18T20:07:48 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.3137790262699127, "perplexity": 4843.346079482946}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882573399.40/warc/CC-MAIN-20220818185216-20220818215216-00429.warc.gz"} |
http://www.federalreserve.gov/pubs/feds/2008/200837/index.html | Finance and Economics Discussion Series: 2008-37 Screen Reader version
# Temporal Risk Aversion and Asset Prices
Keywords: Temporal risk aversion, Intertemporal substitution, Equity premium, Risk free rate
Abstract:
Agents with standard, time-separable preferences do not care about the temporal distribution of risk. This is a strong assumption. For example, it seems plausible that a consumer may find persistent shocks to consumption less desirable than uncorrelated fluctuations. Such a consumer is said to exhibit temporal risk aversion. This paper examines the implications of temporal risk aversion for asset prices. The innovation is to work with expected utility preferences that (i) are not time-separable, (ii) exhibit temporal risk aversion, (iii) separate risk aversion from the intertemporal elasticity of substitution, (iv) separate short-run from long-run risk aversion and (v) yield stationary asset pricing implications in the context of an endowment economy. Closed form solutions are derived for the equity premium and the risk free rate. The equity premium depends only on a parameter indexing long-run risk aversion. The risk-free rate instead depends primarily on a separate parameter indexing the desire to smooth consumption over time and the rate of time preference.
JEL Classification: G12
# 1. Introduction
Agents with standard, time-separable preferences do not care about the temporal distribution of risk. This is a strong assumption. For example, it seems plausible that in reality a consumer may find persistent shocks to consumption less desirable than uncorrelated fluctuations. Such a consumer is said to exhibit temporal risk aversion. This type of risk aversion is lacking from standard preferences, because, with additive separability, expected utility is independent of the correlation of consumption in two different time periods. However, other than mathematical convenience, there is no compelling reason for assuming that temporal risk aversion is exactly zero and that consumers do not care about the temporal distribution of risk.
This paper works with an alternative specification for preferences to investigate the implications of temporal risk aversion for asset prices. Allowing for temporal risk aversion is achieved by abandoning time-separability, while staying within the expecteutility framework. This has two additional and closely related consequences. First, a separation of risk aversion from the intertemporal elasticity of substitution is attained. As is well known, with standard preferences the two are tightly linked, yet separating them can be crucial in explaining asset prices. Second, relative risk aversion can depend on the duration of the consumption gamble and this leads to notions of short-run and long-run risk aversion. This is also central to understanding the asset pricing implications. In particular, for the economy studied here, the equity premium is found to depend only on long-run risk aversion.
The preferences are specialized so as to yield stationary asset returns. To study the asset pricing implications, the present paper focuses on an endowment economy with consumption growth. For this case, closed form solutions are derived for the risk-free rate and the equity premium. The risk-free rate depends primarily on a parameter indexing the desire to smooth consumption and the rate of time preference. By contrast, as mentioned, the equity premium depends only the coefficient of long-run relative risk aversion, which is equal to a separate preference parameter.
The rest of this paper is organized as follows. The next section briefly covers the basics of temporal risk aversion. After that, the paper will present and discuss the preferences studied here, derive the pricing kernel for the endowment economy and, finally, present some asset pricing implications. Some of the related literature is discussed throughout the paper.
# 2. Temporal risk aversion
Following Richard (1975), temporal risk aversion can be defined in the following way.1 Consider a consumer who lives for two periods and is faced with a choice between two consumption gambles. In the first gamble, consumption in the two periods is either or, with equal probability, , where . The second gamble results in either or , again with equal probability 0.5. If the consumer prefers the second lottery to the first for all values of and , then the consumer is considered to be temporally risk averse. If the first lottery is preferred, then the consumer is said to be temporally risk loving, while temporal risk neutrality applies in the case of indifference. An equivalent definition of temporal risk aversion replaces the second, preferred gamble by independent draws in each period. That is, consumption is uncorrelated over time and, in each period, is either or , with equal probability. The equivalence of the definitions follows directly from the additive properties of expected utility. A straightforward extension of the definition to periods is presented in Richard (1975).2
It seems reasonable to regard the second gamble as less risky - there is no risk of a lifetime of misery' due to permanently low consumption (or less risk of that outcome, in the case of the second definition). In contrast, any consumer with time-separable preferences is indifferent between these two gambles and so is temporally risk neutral, because the serial correlation of consumption does not matter for expected utility under additive separability. (With time-separability expected utility is which is trivially equal to .)
Richard (1975) shows that a consumer with a twice differentiable utility function is temporally risk averse if and only if the cross-partial derivative is negative, i.e. if and only if
Strict temporal risk aversion holds if the inequality is strict. Temporal risk seeking is equivalent to a positive cross-partial derivative, and temporal risk neutrality to a value of zero. Thus, a utility function exhibits temporal risk neutrality if and only if it is additively separable.
# 3. Preferences
Preferences are ordered by
(1)
with . and are strictly monotone real-valued functions and is also increasing. The transformation is irrelevant in the absence of uncertainty. In a stochastic setting, it is assumed that the consumer evaluates uncertain consumption streams in accordance with the von Neumann-Morgenstern axioms, so that the consumer maximizes expected utility. At time , the consumer maximizes . Because the preference ordering is the same in each period, these preferences are time-consistent.
As a consequence of time-consistency, past choices will matter for decisions over current and future consumption, except for some special cases (such as additive separability). This feature is not unusual in the literature on consumption-based asset pricing: it is also present in models with habit or durability in consumption. A recent paper by Kihlstrom (2007) focuses on the alternative case that the consumer ignores past consumption in . With that approach, current choices are independent of past choices, but that also implies that the preferences are dynamically inconsistent.3
Time-separable preferences (and therefore temporal risk neutrality) can be obtained as a special case by setting . Otherwise, assuming that and are both twice differentiable and checking the cross-partial derivative, it is easy to show that is temporally risk averse (loving) if is concave (convex). Further algebra shows that this is in turn equivalent to being more (less) risk averse than in the sense of Arrow and Pratt. That is, the following statements are equivalent:
(i) is temporally risk averse (loving);
(ii) is concave (convex); and
(iii) , for .
As the second statement suggests, this approach follows naturally from Kihlstrom and Mirman's (1974) analysis of risk aversion with multiple goods.
To obtain stationary asset pricing implications in the context of a growth economy, (1) is specialized to iso-elastic functional forms: and . Then
(2)
In a deterministic setting, is irrelevant for choices and the desire for consumption smoothing is fully determined by , with the intertemporal elasticity of substitution equal to . If , then specializes to additively separable utility with constant relative risk aversion (and temporal risk aversion equal to zero). If exceeds , then the consumer is temporally risk averse. The latter is the case we will focus on.
To illustrate the role of the parameter , suppose consumption is constant over time and equal to (so that constant ), then is the coefficient of relative risk aversion with respect to gambles over , i.e. lifetime consumption gambles. For this reason, I will refer to as long-run (relative) risk aversion.
## 3.1 Long-run risk aversion
To further understand the role of long-run risk aversion , it useful to define a lifetime consumption gamble as a lottery that changes consumption in each period by a common factor , where is a random variable that has zero mean and is orthogonal to the initial consumption process. Formally, let be a given stochastic process for consumption without the gamble. With the gamble, consumption is
for all
where is independent of the stochastic process . Without the gamble, (unconditional) expected utility is
With the gamble, expected utility is
(using independence). Hence, regardless of the properties of the initial consumption process, is the coefficient of relative risk aversion for lifetime consumption gambles. Following the analysis in Pratt (1964), it is straightforward to show that the highest risk premium that the consumer is willing to pay, as a fraction of consumption in each period, to avoid the risk is approximately . As in Pratt, if higher moments are bounded, the error in the approximation is of smaller order than the variance of , so that the approximation is good when this variance is small.
## 3.2 Short-run risk aversion
It is more common to consider risk aversion with respect to one period consumption gambles. Although with time-separable, iso-elastic utility there is no difference with between this and the long-run concept, with the preferences postulated in (2) there generally is. For this reason, I will use the term short-run risk aversion to refer to risk aversion with respect to one period consumption gambles. To characterize short-run risk aversion, the marginal utility of consumption during period is:
(3)
with
and
Differentiating again with respect to and using the result, we obtain for the coefficient of short-run relative risk aversion:4
(4)
Short-run risk aversion is the sum of two terms. If the consumer is temporally risk neutral (the time-separable case, with ), the second term is zero and short-run risk aversion is equal to , the standard coefficient of relative risk aversion, which is also the inverse of the intertemporal elasticity of substitution. If the consumer is temporally risk averse ( ), then the second term increases short-run risk aversion beyond .
In that case, it is also clear from equation (4) that short-run relative risk aversion is generally not constant. To gain insight into this, let us first consider the case that future consumption is known at time . Then
Thus, short-run risk aversion lies strictly between and . If discounted felicity in the current period, , is a small fraction of lifetime felicity, , then short-run relative risk aversion in the current period is quite close to . This will typically be the case when the horizon is large. For example, if consumption is constant over time and , then short-run risk aversion is .
The case of stochastic future consumption will be analyzed in more detail after the presentation the endowment economy. It will be shown for that economy that, under certain conditions, short-run risk aversion converges to as goes to infinity.
## 3.3 Discussion
With the intertemporal elasticity of substitution (IES) equal to , and long-run risk aversion equal to , these preferences separate, to some degree, consumption smoothing from risk aversion. This contrasts sharply with time-separable preferences for which, as mentioned, the IES is the inverse of the coefficient of relative risk aversion. Epstein-Zin-Weil preferences also provide a separation between the two concepts (see Epstein and Zin (1989) and Weil (1989)). The key difference with the approach taken here is that Epstein-Zin-Weil preferences are non-expected utility preferences. They do not satisfy the axioms of von Neumann and Morgenstern for consumption gambles extending over multiple periods. As discussed by Epstein and Zin, this is manifested by an associated preference for early or late resolution of uncertainty. An open question is to what extent the accomplishments of Epstein-Zin-Weil preferences in the asset pricing literature are due to the fact that they lie outside the traditional expected utility framework.5 For example, is the preference for early or late resolution of uncertainty crucial? Or is it just' the separation of risk aversion from consumption smoothing that matters? As illustrated by the preferences used here, by introducing temporal risk aversion, it is possible to have that separation without leaving the expected utility framework and, as a consequence, without relying on any preference for early or late resolution of uncertainty. In this sense, the approach taken here is also a smaller departure from the standard time-separable preferences.
# 4. The Pricing Kernel
Suppose that the consumer reduces consumption in period by 1 unit, purchases an asset with gross return and then uses the proceeds to increase consumption in period . Equilibrium asset prices have to be such that for the consumer the net marginal effect of this action on expected utility is zero. This perturbation argument implies the following Euler equation:
(5)
Using equation (3) and the law of iterated expectations, the following version of the intertemporal marginal rate of substitution is a valid pricing kernel:6
(6)
The first two factors equal the pricing kernel for the time-separable case ( ); the third factor differs from one only if and news about future consumption (dated and onward) is revealed between and . (Recall that and .) Thus, temporal risk aversion introduces a new, forward-looking factor to the pricing kernel.
The goal is now to obtain a convenient expression for this new factor. It will be possible to do this for an economy with a long horizon, . Formally, I will consider a sequence of economies indexed by and then derive a result characterizing the limit of the pricing kernel as approaches infinity.7 Focusing on the infinite horizon case in this way will also have the advantage that the pricing kernel will not depend on on the time remaining', , as a state variable, which would have the undesirable consequence of generating nonstationary asset returns.
It is convenient to split up into realized and future terms:
(7)
where the second step introduces a convenient normalization, with
(8)
Denoting the growth rate of consumption by , evolves according to
or, with and we have
Now suppose that
is
With that assumption, . is then a stationary stochastic process (more precisely, non-explosive, due to the initial condition ) if and only if
(9)
At the same time
(10)
so, exploiting the assumption,
To obtain stationary asset return implications, we will be interested in the case where is large. Since , if , then diverges as grows. Thus, loosely speaking, if and is large, then, is small relative to for all , except when is very close to .
In contrast, if (more precisely, if ), then remains bounded for arbitrarily large . At the same time, grows exponentially as time passes. Thus, even if is very large, after a few periods, is likely to be large relative to , as the former diverges in expectation and the latter does not, if . This suggests that, at that point in time,
It is apparent from this and expression (6) that the pricing kernel will approach the standard CRRA time-separable one as time passes, if is large and . Intuitively, temporal risk aversion gradually becomes irrelevant, as it is the early periods of consumption that matter the most for lifetime utility in this case.
Since I am interested in temporal risk aversion, and since in any case the asset pricing implications of the standard preferences are well understood, I will focus on the alternative case that . Note that if this is realistic only if , i.e. if the intertemporal elasticity of substitution exceeds unity. Intuitively, means that, unless is close to , the future is more important than the past for current decisions.
Epstein and Zin (1989) have critiqued the kind of preferences postulated in (2) by pointing out that, if and without growth, the dependence of the marginal utility of current consumption on past consumption is greater as the past becomes more distant. However, this is not true under condition (9) (). This condition can be satisfied even with a constant consumption profile, provided ; with growth may be less than 1 provided . Interestingly, the parameter restriction under which temporal risk aversion turns out to have novel asset pricing implications also addresses the critique of Epstein and Zin.
Using (7), the new factor in the pricing kernel can be written as
(11)
Intuitively, and informally, for large , and with , we expect and to depend very little on and , respectively, since in this case diverges in expectation, while does not. (The assumption implies that has no predictability.) Thus, it is natural to expect that as goes to infinity, approaches a constant, independent of and . Assume for a moment that this is true and call the limit . Then
Assume further for a moment that there are no issues with interchanging limit and expectation operators. Then taking of both sides yields a simple expression for :
Of course, here may be replaced by since is
If this informal line of reasoning is correct, then substituting this limiting value into (6) yields a very simple expression for the limiting pricing kernel - see equation (13) below. The following proposition, the main result of the paper, shows that under certain conditions this argument can indeed be formalized.
Theorem 1 If , for and
(12)
then the limiting pricing kernel is
(13)
Proof. See Appendix 1.
Remark 1: requires that either and , or and . If (realistically) , then, given assumption (12), only the first possibility is consistent with . As mentioned, implies positive temporal risk aversion.
Remark 2: condition (12) implies (since and by (12)).
The proof employs the mean value theorem and the reflection principle for Brownian motion to show that the history of past consumption, summarized in , is asymptotically unimportant in . Then, the dominated convergence theorem is used to to interchange the limit and expectations operators. The conditions stated in the theorem are sufficient. I suspect that they are not all necessary, but I have not shown this (except for the conditions outlined in footnote 13 and the following trivial case).
It is worth pointing out that if , so that the utility function is time-separable, then equation (13) specializes to the standard pricing kernel for time-separable utility with constant relative risk aversion: .
An increase in long-run risk aversion makes marginal utility, and therefore the pricing kernel, more responsive to realized growth rates, but without having a big impact on its expected value due to the correction . (In the special case , the impact is exactly zero; for positive but small the impact is small, as will be shown more explicitly below.) This is important for the asset pricing implications, since, loosely speaking, the equity premium depends on the volatility of the pricing kernel, while the risk free rate depends on its conditional mean.
The following proposition characterizes short-run risk aversion in this economy:
Theorem 2 Under the conditions stated in theorem 1, short-run risk aversion converges to :
Proof. See Appendix 2.
Thus, for this stochastic economy, a similar result applies as for the deterministic case: when the horizon is large, short-run risk aversion is close to . In this sense, the separation between the intertemporal elasticity of substitution and short-run risk aversion vanishes in the limit. This separation remains, however, for long-run risk aversion, which is always equal to . The next section shows how this affects asset prices.
# 5. Asset Prices
Using the expression for the limiting pricing kernel in (13), pricing assets is straightforward, using the optimality condition , where is the gross realized return to any tradeable asset, between period and . In what follows it is assumed that the conditions to theorem 1 are satisfied. This is consistent with temporal risk aversion ( ) only if is less than 1, so that the intertemporal elasticity of substitution exceeds unity (and short-run risk aversion is less than 1 in the limit).
It should be stated at the outset that, with consumption growth and the asymptotic irrelevance of past consumption to the pricing kernel (see (13)), the model will imply constant values for the risk-free rate and the equity premium. This is also true for for standard preferences combined with consumption growth.
## 5.1 Risk-free rate
Denote the risk-free one period real interest rate between period and by . In the limiting economy,
Exploiting lognormality, this yields
Note that for the time-separable case ( ) this simplifies to the standard result: ( is used to indicate the time-separable case). The general result can also be written as
Recall that temporal risk aversion obtains when . Thus, for a given value of , introducing more temporal risk aversion lowers the risk free rate. It is tempting to link this with the precautionary savings motive, but more careful analysis is needed to make a precise claim.
The constant short-rate implies a flat real term structure. That is, real yields on all long bonds are constant and equal to the short rate. Again, this is also true for standard preferences with consumption growth.
## 5.2 Consumption claim
Lucas (1978) and Mehra and Prescott (1985) define equity as a claim to aggregate consumption. Deriving the expected return to such a consumption claim using is standard. The resulting consumption equity premium' is:
(14)
As can be seen, the risk premium depends only long-run risk aversion. For the preferences used here, temporal risk aversion implies that long-run risk aversion exceeds short-run risk aversion. In this sense, therefore, temporal risk aversion increases the risk premium on a consumption claim.
## 5.3 Equity
Extending the formulation by Abel (1999), equity is modelled as a claim to dividends equal to in period . The parameter is a modeling device that closely approximates the effect of leverage on returns (see Abel (1999)), with positive leverage corresponding to . is a shock which assumed to be uncorrelated with consumption and is distributed . It is included because in the data dividend volatility exceeds consumption volatility and because the dividend and consumption growth rates are imperfectly correlated. Finally, is a convenient way of considering the effect of the duration of the equity claim. or are standard choices. The resulting equity premium is:
(15)
As finance theory predicts, nonsystematic risk ( ) is not priced. Interpreting as leverage yields the same result as a straightforward application of Modigliani and Miller's (1958) Proposition II. Because the model has a no term premium (due to consumption growth), the risk premium is independent of the duration parameter . As for the consumption claim, long-run risk aversion is the only preference parameter that matters for the equity premium. Since the equity premium is increasing in long-run risk aversion, temporal risk aversion increases the equity premium.
Why does the equity premium depend on long-run risk aversion, as opposed the short-run concept? The intuition for this result is that the risk in this economy stems from the shocks to the growth rate of consumption (and therefore dividends). These innovations act as permanent shocks to the level of consumption. A positive innovation to the growth rate raises consumption in all remaining periods by the same ratio. It is therefore similar to the lifetime consumption gamble discussed in section 3.1. Loosely speaking, it is also more similar the lottery that the consumer dislikes in the definition of temporal risk aversion than the alternative (see section 2).
This result is not driven by the fact that equity is a long-lived claim, as it holds even for a very short-duration equity claim (small) and even, it can be shown, for a one period equity strip. Rather, it is due to the fact that the economic risk inherent in equity is long-run risk' to the level of consumption.
## 5.4 Numerical examples
As Mehra and Prescott (1985) and others have shown, it is difficult for standard models with time-separable preferences to account for the 6% equity premium and the low risk-free rate with conventional levels for risk aversion.8 In this subsection, I examine whether it is easier to do so with temporal risk aversion. I use the values calculated by Mehra and Prescott for the mean and standard deviation of the growth rate of real per capita consumption of nondurables and services: and . Following Abel (1999) and Bansal and Yaron (2004), I set the leverage parameter at . The average U.S. equity premium reported by Mehra and Prescott is per annum, and the average real risk-free rate is .
First, I ask what equity premium the model can generate subject to matching the risk-free rate exactly and subject to the parameter restrictions needed for theorem 1 to hold (most importantly, condition (12)). Under those restrictions, the model can account for about half the equity premium (). Parameter values that accomplish this are, for example, , and . That is, with risk aversion ranging from 0.75 for the short run to 8 for the long run, the model can match the risk-free rate and about half the equity premium. Note that with the intertemporal elasticity of substitution is . Incidentally, the predicted equity premium is well within two standard deviations of the historical average. For comparison, with time-separable preferences the result is an equity premium of only .9 This is the well-know equity premium puzzle.
Alternatively, one can ask how close the model can get to matching the risk-free rate while replicating the point estimate of the equity premium. Using equation (15), to match the equity premium exactly, long-run risk aversion must equal . However, that value results in a risk-free rate that is too low, because, as mentioned, temporal risk aversion lowers the risk-free rate. Assuming a high rate of time preference (a low ) would help, but this is ruled out by the parameter restriction to the theorem (12). Under that restriction and with , the model can generate a risk-free rate that is about 1 percentage point below the historical average. For example, with permissible parameter values , and , the risk-free rate is .10
The low risk-free rate contrasts sharply with the case of time-separable preferences, for which high levels of risk aversion imply counterfactually high values for the risk-free rate.11 For example, setting to match the equity premium results in a risk-free rate near with standard preferences, if . The reason is that with time separability high risk aversion implies a strong desire for consumption smoothing, which in the presence of growth results in a high interest rate in equilibrium.
More important is that the preferences with temporal risk aversion can generate sizable risk premia without suffering from what can be called the Lucas-Murphy critique'. As Robert Lucas (1990) has observed,12 two countries that differ in their growth rate () by 1 percent, differ in their interest rate by percent, where is the reciprocal of the intertemporal elasticity of substitution (assuming the same preferences and variance of consumption growth). With time separable preferences is also risk aversion, so then levels of risk aversion in excess of , in Lucas' estimate, would then imply counterfactually large differences in real interest rates across countries (think of South Korea and the U.S.). In his 2003 presidential address, Lucas revisits this argument and concludes that the IES should in fact be close to one. The preferences used in this paper can combine higher long-run risk aversion with a relatively high intertemporal elasticity of substitution (i.e. a low ), thus avoiding the prediction of enormous cross-country real interest rate differentials.
# 6. Conclusion
The starting point of this paper has been the idea that consumers may care about the temporal distribution of risk; in particular, they may find persistent shocks to consumption less desirable than uncorrelated fluctuations. I have formulated expected utility preferences that exhibit such temporal risk aversion and studied their asset pricing implications. I found that temporal risk aversion leads naturally to a separation of risk aversion from the intertemporal elasticity of substitution, as well as a distinction between short-run and long-run risk aversion. For an endowment economy with consumption growth, I derived a simple expression for the limiting pricing kernel, which yields stationary implications for asset returns. In that economy, closed form solutions show that the equity premium depends only on a parameter indexing long-run risk aversion, while the risk-free rate instead depends primarily on a separate parameter indexing the desire to smooth consumption over time and the rate of time preference. Quantitatively, the model improves upon the ability of standard preferences to simultaneously account for the historical averages of the equity premium and the risk-free rate.
At least two open questions remain. First, is the pricing kernel valid under a wider set of conditions than for which it has been derived here? And, second, what additional asset pricing implications of temporal risk aversion are there for the case of non- consumption growth? For example, it seems interesting to investigate the effect of long-run risk (Bansal and Yaron (2004)) in the presence of temporal risk aversion. I leave these questions for future research.
# Appendix 1. Proof of Theorem 1
Define
(16)
Using (7), (10) and the assumption that is ,
(17)
so that, introducing a convenient normalization,
Lemma 1, shown and demonstrated below, shows that is asymptotically irrelevant to this expression. Specifically, equation (22) of the lemma implies that . Hence,
(18)
Next, since , we have, using (17) and a slightly different normalization,
(19)
where I have introduced the following notation:
Note that is an integrable random variable (specifically, exploiting the lognormal distribution ). Moreover, since by definition (see (8)) and since ,
Thus, is a sequence (in ) of integrable random variables with a well-defined limit. The limit follows again from lemma 1, which implies
Hence, we can apply the dominated convergence theorem to this sequence:
(20)
Combining equations (18), (19) and (20) yields
(21)
Finally, combining this with equation (6),
which is the result stated in the theorem, equation (13). As mentioned, here may be replaced by since is . Thus, it only remains to be shown that the following lemma is in fact true:
Lemma 1 Under the conditions of theorem 1, for all and ,
(22)
and
(23)
Proof of lemma 1. The proof proceeds in several steps.
1. [Upper bound on ] First, recall the definition
Note that
with and
We can write, in this notation,
Since , and exploiting the assumption,
(24)
Because assumption (12) implies that and since and , . Thus, both the numerator and the denominator of approach zero as .
2. [Applying the mean value theorem] To proceed, differentiate with respect to :
and are arbitrary numbers weakly larger than 1, but without loss of generality, we can let (we can always relabel them since is equivalent to .) By the mean value theorem, for any , there exists a , such that
Combining these two equations,
(25)
Now, since and as is decreasing in ,
The goal now is to show that . Since , this would imply that and, therefore, by (25), .
3. [Lower bound on ]13 To bound the ratio from above, a lower bound for is needed in addition to the upper bound. Using the notation from step 1, we can write . Since , , where is the running sum of independent standard normals: where are random variables. (The notation stands for `is equal in distribution to'.) Thus,
Now,
where is a standard Brownian motion. The second step exploits the equality in distribution of and sampled at integer times, which follows from the properties of standard Brownian motion. The last step follows from the fact that the is taken over a larger set. Hence, since ,
Since , it follows that, for , . Therefore, for ,
Standard results on Brownian motion, which are based on the reflection principle, allow for the evaluation of the expectation on the right-hand-side. Applying formula 1.1.3. of Borodin and Salminen (2002, p. 250) yields, after some manipulations, for the expectation:
where denotes the cumulative distribution function of a standard normal ( ). The assumption (12) to the theorem implies that and therefore also that , and . Using this finally yields the following lower bound for , for
(26)
4. [Showing that and ] Applying the lower and upper bounds on ((24) and (26)) yields, for :
Assumption (12) to the theorem states that , so the right hand side of the inequality goes to zero as (as the exponential factor dominates). Since , this implies that
This proves the second claim of the lemma, equation (23). Recalling the conclusion of step 2, it follows that
proving the first claim of the lemma (22). QED.
#### Footnotes
* Email: [email protected]. I thank Andy Abel, Urban Jermann and seminar participants at the Federal Reserve Bank of Philadelphia, IIES, JLS, Penn Macro Lunch Group, and the Society for Economic Dynamics for helpful comments and discussions. Jianfeng Yu provided excellent research assistence. Financial support from the Brandywine Global Investment Management Fellowship from Rodney L. White Center at the Wharton School of the University of Pennsylvania is gratefully appreciated. Return to Text
1. See also Bommier (2003), Epstein and Tanny (1980) and Ingersoll (1987, p 43-44). Temporal risk aversion is sometimes also referred to as correlation aversion (Bommier and Epstein and Tanny) or as multivariate risk aversion (Richard), though it is distinct from multivariate risk aversion in the sense of Kihlstrom and Mirman (1974). The next section briefly discusses the relation wth the latter concept, for the type of preferences studied in this paper. Return to Text
2. For the period case, a distinction can be made between pairwise temporal risk aversion (which is specific to two particular periods) and a global concept of temporal risk aversion. See Richard (1975). Return to Text
3. Bommier and Rochet (2006) and Eden (2008) examine preferences similar to the ones used here. Bommier and Rochet's focus is on the effect of the planning horizon on risk aversion and portfolio choice that emerges without time-separability. Eden also examines risk aversion, as well as asset pricing implications in a two period setup. Return to Text
4. The expectation operator is due to the fact that future consumption (dated onward) may be stochastic. Return to Text
5. Some examples of work in asset pricing which fruitfully employs Epstein-Zin-Weil preferences include Bansal and Yaron (2004), Gomes and Michaelides (2008), Hansen, Heaton and Li (2008), Kandel and Stambaugh (1991), Piazzesi and Schneider (2006), Routledge and Zin (2003) and Tallarini (2000). Return to Text
6. By the law of iterated expectations, (5) is equivelent to , so that , or . The superscript is included as the horizon will be varied below. Return to Text
7. That is, formally, we will examine rather than . Return to Text
8. Kandel and Stambaugh (1991) provide a challange to the view that high risk aversion is unreasonable. Return to Text
9. Here I follow Mehra and Prescott in requiring and . Leverage is maintained at . Return to Text
10. Interestingly, if one uses aggregate real consumption growth, rather than per capita, to calibrate and , then the model can simultaneously match the equity premium and the risk-free rate. The model abstracts from population growth. Return to Text
11. Except for very high values of relative risk aversion, when the precautionary effect dominates. Recall that in the time-separable case. At those very high levels of risk aversion, the quadratic term can approximately cancel with the linear term. However, the 'Lucas-Murphy critique' (explained below) still applies. Return to Text
12. Lucas credits Kevin Murphy for making this observation. Return to Text
13. A straightforward way to derive a lower bound is to apply Jensen's inequality to . Unfortunately, while simpler, this leads to a weaker lower bound than the one derived in the proof, as will be shown below in this footnote. This weaker lower bound does have the virtue of not relying on lognormality, so it is possible to prove the main result without relying on lognormality, albeit under stronger sufficient conditions:
Since is a convex mapping ( ), Jensen's inequality implies that
Thus, combining this with the upper bound,
It is straightforward to show that the right hand side goes to zero as if , in which case follows and the proof goes through without lognormality (provided in addition that is finite). For the lognormal case, requires . Unfortunately, this condition is rather easily violated. Return to Text
This version is optimized for use by screen readers. Descriptions for all mathematical expressions are provided in LaTex format. A printable pdf version is available. Return to Text | 2015-04-18T07:25:59 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9203730821609497, "perplexity": 946.1112015005382}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2015-18/segments/1429246633972.52/warc/CC-MAIN-20150417045713-00238-ip-10-235-10-82.ec2.internal.warc.gz"} |
https://par.nsf.gov/biblio/10363619-forecasts-broad-band-intensity-mapping-ultraviolet-optical-background-castor-spherex | Forecasts for broad-band intensity mapping of the ultraviolet-optical background with CASTOR and SPHEREx
ABSTRACT
Broad-band tomography statistically extracts the redshift distribution of frequency dependent emission from the cross-correlation of intensity maps with a reference catalog of galaxy tracers. We make forecasts for the performance of future all-sky UV experiments doing broad-band tomography. We consider the Cosmological Advanced Survey Telescope for Optical-UV Research (castor) and the Spectro-Photometer for the History of the Universe, Epoch of Reionization, and Ices Explorer (SPHEREx). The dominant uncertainty is from variability in the photometric zero-point, which scales with limiting magnitude and mirror size. With this scaling and assuming a galaxy number density characteristic of future spectroscopic data sets, we find that castor measures the UV background SED 2–10 times better than existing data. The applicable redshift range will expand from the current z < 1 to z ≈ 0–3 with castor and z = 5–9 with SPHEREx. We show that castor can provide competitive constraints on the EBL monopole to those available from galaxy number counts and direct measurement techniques. At high redshift especially, these results will help understand galaxy formation and reionization. Our modelling code and chains are publicly available.
Authors:
; ;
Award ID(s):
Publication Date:
NSF-PAR ID:
10363619
Journal Name:
Monthly Notices of the Royal Astronomical Society
Volume:
511
Issue:
4
Page Range or eLocation-ID:
p. 5158-5170
ISSN:
0035-8711
Publisher:
Oxford University Press
National Science Foundation
##### More Like this
1. ABSTRACT
Recent work has shown that UV-luminous reionization-era galaxies often exhibit strong Lyman-alpha emission despite being situated at redshifts where the IGM is thought to be substantially neutral. It has been argued that this enhanced Ly α transmission reflects the presence of massive galaxies in overdense regions which power large ionized bubbles. An alternative explanation is that massive galaxies shift more of their Ly α profile to large velocities (relative to the systemic redshift) where the IGM damping wing absorption is reduced. Such a mass-dependent trend is seen at lower redshifts, but whether one exists at z ∼ 7 remains unclear owing to the small number of existing systemic redshift measurements in the reionization era. This is now changing with the emergence of [C ii]-based redshifts from ALMA. Here, we report MMT/Binospec Ly α spectroscopy of eight UV-bright (MUV ∼ −22) galaxies at z ≃ 7 selected from the ALMA REBELS survey. We detect Ly α in four of eight galaxies and use the [C ii] systemic redshifts to investigate the Ly α velocity profiles. The Ly α lines are significantly redshifted from systemic (average velocity offset = 223 km s–1) and broad (FWHM ≈ 300–650 km s−1), with two sources showing emission extending to ≈750 km s−1. We find that the broadest Ly α profiles aremore »
2. ABSTRACT
The measurement of the expansion history of the Universe from the redshift unknown gravitational wave (GW) sources (dark GW sources) detectable from the network of LIGO-Virgo-KAGRA (LVK) detectors depends on the synergy with the galaxy surveys having accurate redshift measurements over a broad redshift range, large sky coverage, and detectability of fainter galaxies.In this work, we explore the possible synergy of the LVK with the spectroscopic galaxy surveys, such as DESI and SPHEREx, to measure the cosmological parameters which are related to the cosmic expansion history and the GW bias parameters. We show that by using the 3D spatial cross-correlation between the dark GW sources and the spectroscopic galaxy samples, we can measure the value of Hubble constant with about $2{{\ \rm per\ cent}}$ and $1.5{{\ \rm per\ cent}}$ precision from LVK+DESI and LVK+SPHEREx, respectively within the 5 yr of observation time with $50{{\ \rm per\ cent}}$ duty-cycle. Similarly, the dark energy equation of state can be measured with about $10{{\ \rm per\ cent}}$ and $8{{\ \rm per\ cent}}$ precision from LVK+DESI and LVK+SPHEREx, respectively. We find that due to the large sky coverage of SPHEREx than DESI, performance in constraining the cosmological parameters is better from the former thanmore »
3. ABSTRACT
We present band 6 ALMA observations of a heavily obscured radio-loud (L1.4 GHz = 1025.4 W Hz−1) active galactic nucleus (AGN) candidate at zphot = 6.83 ± 0.06 found in the 1.5 deg2 COSMOS field. The ALMA data reveal detections of exceptionally strong [C ii]158 $\mu$m (z[C ii] = 6.8532) and underlying dust continuum emission from this object (COS-87259), where the [C ii] line luminosity, line width, and 158 $\mu$m continuum luminosity are comparable to those seen from z ∼ 7 sub-mm galaxies and quasar hosts. The 158 $\mu$m continuum detection suggests a total infrared luminosity of $9\times 10^{12}\, \mathrm{ L}_\odot$ with corresponding very large obscured star formation rate (1300 M⊙ yr−1) and dust mass ($2\times 10^9\, \mathrm{ M}_\odot$). The strong break seen between the VIRCam and IRAC photometry perhaps suggests that COS-87259 is an extremely massive reionization-era galaxy with $M_\ast \approx 1.7\times 10^{11}\, \mathrm{ M}_\odot$. Moreover, the MIPS, PACS, and SPIRE detections imply that this object harbours an AGN that is heavily obscured ($\tau _{_{\mathrm{9.7\,\mu m}}}=2.3$) with a bolometric luminosity of approximately $5\times 10^{13}\, \mathrm{ L}_\odot$. Such a very high AGN luminosity suggests that this object is powered by an ≈1.6 × 10$^9\, \mathrm{ M}_\odot$ black hole if accreting near the Eddington limit, and is effectively a highly obscured version of an extremely ultravioletmore »
4. ABSTRACT
The connection between the escape fraction of ionizing radiation (fesc) and the properties of galaxies, such as stellar mass ($\rm M_{\rm *}$), age, star-formation rate (SFR), and dust content, are key inputs for reionization models, but many of these relationships remain untested at high redshift. We present an analysis of a sample of 96 $z$ ∼ 3 galaxies from the Keck Lyman Continuum Spectroscopic Survey (KLCS). These galaxies have both sensitive Keck/LRIS spectroscopic measurements of the Lyman continuum (LyC) region, and multiband photometry that places constraints on stellar population parameters. We construct composite spectra from subsamples binned as a function of galaxy property and quantify the ionizing-photon escape for each composite. We find a significant anti-correlation between fesc and $\rm M_{\rm *}$, consistent with predictions from cosmological zoom-in simulations. We also find significant anti-correlation between fesc and E(B−V), encoding the underlying physics of LyC escape in our sample. We also find no significant correlation between fesc and either stellar age or specific SFR (= SFR/$\rm M_{\rm *}$), challenging interpretations that synchronize recent star formation and favorable conditions for ionizing escape. The galaxy properties now shown to correlate with fesc in the KLCS are Lyα equivalent width, UV Luminosity, $\rm M_{\rmmore » 5. ABSTRACT We report the identification of radio (0.144–3 GHz) and mid-, far-infrared, and sub-mm (24–850μm) emission at the position of one of 41 UV-bright ($\mathrm{M_{\mathrm{UV}}}^{ }\lesssim -21.25$) z ≃ 6.6–6.9 Lyman-break galaxy candidates in the 1.5 deg2 COSMOS field. This source, COS-87259, exhibits a sharp flux discontinuity (factor >3) between two narrow/intermediate bands at 9450 and 9700 Å and is undetected in all nine bands blueward of 9600 Å, as expected from a Lyman alpha break at z ≃ 6.8. The full multiwavelength (X-ray through radio) data of COS-87529 can be self-consistently explained by a very massive (M* = 1010.8 M⊙) and extremely red (rest-UV slope β = −0.59) z ≃ 6.8 galaxy with hyperluminous infrared emission (LIR = 1013.6 L⊙) powered by both an intense burst of highly obscured star formation (SFR ≈ 1800 M⊙ yr−1) and an obscured ($\tau _{_{\mathrm{9.7\mu m}}} = 7.7\pm 2.5$) radio-loud (L1.4 GHz ≈ 1025.4 W Hz−1) active galactic nucleus (AGN). The radio emission is compact (1.04 ± 0.12 arcsec) and exhibits an ultra-steep spectrum between 1.32 and 3 GHz ($\alpha =-1.57^{+0.22}_{-0.21}$) that flattens at lower frequencies ($\alpha = -0.86^{+0.22}_{-0.16}\$ between 0.144 and 1.32 GHz), consistent with known z > 4 radio galaxies. We also demonstrate that COS-87259 may reside in a significant (11×) galaxymore » | 2023-03-28T20:46:24 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6446307301521301, "perplexity": 4060.652755722461}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296948871.42/warc/CC-MAIN-20230328201715-20230328231715-00586.warc.gz"} |
http://ocw.usu.edu/Electrical_and_Computer_Engineering/Information_Theory/lecture4_2.htm | ##### Personal tools
•
You are here: Home Application of Information Theory to Blind Source Separation
# Application of Information Theory to Blind Source Separation
##### Document Actions
Introduction :: BSS :: Mackay's Approach :: Natural Gradient :: p(u)
## BSS
Let be a set of statistically independent signals. We will later examine some other assumptions, but for now assume simply that they are independent. The signals are processed according to
Now, not knowing either or A , we desire to determine a matrix W so that
recovers as fully as possible. Let us take as a criterion the mutual information at the output: . (Q: how did they know to try this? A: It seemed plausible, they tried it, and it worked! Moral: think about the implications of ideas, then see if it works.) Then, as shown in the exercises,
If we maximize , we should (1) maximize each H ( y i ) and (2) minimize . As mentioned before, the H ( y i ) are maximized when (and if) the outputs are uniformly distributed. The mutual information is minimized when they are all independent! Achieving both of these exactly requires that g have the form of the CDF of s i . So we might contemplate modifying W , and also modifying g . Or we might (as Bell and Sejnowski do) fix g , and don't worry about this. This corresponds to the assumption that p ( s i ) is super-Gaussian (heavier tails than a Gaussian has). We can write
where we have
so that
Thus
Then
In the case that , then the last stuff goes away. In other words, we ideally want y i = g i ( u i ) to be the CDF of the u i . When this is not exactly the case (there is a mismatch), then the last term exists and may interfere with the minimization of . We call the term and "error term". Now we note that
The term does not depend upon W , so we obtain
Now we come to an important concept: We would like to compute the derivative, but can't compute the expectation. We make the stochastic gradient approximation : . We just throw the expectation away! Does it work? On average! Now it becomes a matter of grinding through the calculus to take the appropriate partial derivative. Since
we will consider the elements:
since , and y i = g ( u i ). Because this connection, the partial is nonzero only when i = j . Combining these facts, we find
Thus
(See appdx E of Moon and Stirling.) Looking at the second term,
since . Let us write
This looks like a density, and ideally would be so, as discussed above. But we can think of this as simply a function. We thus find, stacking all the results,
This gives us the learning rule:
We will let
be the learning nonlinearity, also called in the literature the score function. Then
This approach can only separate super-Gaussian distributions (heavy tails).
Copyright 2008, by the Contributing Authors. Cite/attribute Resource . admin. (2006, May 17). Application of Information Theory to Blind Source Separation. Retrieved January 07, 2011, from Free Online Course Materials — USU OpenCourseWare Web site: http://ocw.usu.edu/Electrical_and_Computer_Engineering/Information_Theory/lecture4_2.htm. This work is licensed under a Creative Commons License | 2017-09-26T21:48:30 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8943625092506409, "perplexity": 1211.3412060013393}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818696696.79/warc/CC-MAIN-20170926212817-20170926232817-00278.warc.gz"} |
https://2017-dibsi-metagenomics.readthedocs.io/en/latest/command-line.html | # Intro to Shell Lesson¶
Materials from: Data Carpentry Intro to Shell
# The Shell¶
## Learning Objectives¶
• Describe what the shell is and how it is used.
• Summarize reasons why learning the shell is beneficial.
## What is the shell?¶
The shell is a program that presents a command line interface which allows you to control your computer using commands entered with a keyboard instead of controlling graphical user interfaces (GUIs) with a mouse/keyboard combination.
There are many reasons to learn about the shell.
• For most bioinformatics tools, you have to use the shell. There is no graphical interface. If you want to work in metagenomics or genomics you’re going to need to use the shell.
• The shell gives you power. The command line gives you the power to do your work more efficiently and more quickly. When you need to do things tens to hundreds of times, knowing how to use the shell is transformative.
• To use remote computers or cloud computing, you need to use the shell.
Unix is user-friendly. It’s just very selective about who its friends are.
## How to access the shell¶
The shell is already available on Mac and Linux. For Windows, you’ll have to download a separate program.
## Mac¶
On Mac the shell is available through TerminalApplications -> Utilities -> TerminalGo ahead and drag the Terminal application to your Dock for easy access.
## Windows¶
For Windows, we’re going to be using gitbash.Download and install gitbash on your computer. Open up the program.
## Starting with the shell¶
We will spend most of our time learning about the basics of the shell by manipulating some experimental data.
Now we’re going to download the data for the tutorial. For this you’ll need internet access, because you’re going to get it off the web.
Open the shell.
Enter the command:
git clone https://github.com/edamame-course/edamame-data.git
This command will grab all of the data needed for this workshop from the internet. (We’re not going to talk about git right now, but it’s a tool for doing version control.)
Now let’s go in to that directory
cd
cd edamame-data
The command cd stands for ‘change directory’
In this directory, there should be some things we just downloaded. Let’s check. Type:
ls
ls stands for ‘list’ and it lists the contents of a directory.
There’s a few directories there, but not too many. Let’s go look in the data directory.
cd shell
ls
In there, all mixed up together are files and directories/folders. If we want to know which is which, we can type:
ls -F
Anything with a "/" after it is a directory. Things with a "" after them are programs. If there’s nothing there it’s a file.
You can also use the command ls -l to see whether items in a directory are files or directories. ls -l gives a lot more information too, such as the size of the file
So, we can see that we have several files, directories and a program. Great!
## Arguments¶
Most programs take additional arguments that control their exact behavior. For example, -F and -l are arguments to ls. The ls program, like many programs, take a lot of arguments. But how do we know what the options are to particular commands?
Most commonly used shell programs have a manual. You can access the manual using the man program. Try entering:
man ls
This will open the manual page for ls. Use the space key to go forward and b to go backwards. When you are done reading, just hit q to quit.
Programs that are run from the shell can get extremely complicated. To see an example, open up the manual page for the find program. No one can possibly learn all of these arguments, of course. So you will probably find yourself referring back to the manual page frequently.
## The Unix directory file structure (a.k.a. where am I?)¶
As you’ve already just seen, you can move around in different directories or folders at the command line. Why would you want to do this, rather than just navigating around the normal way.
When you’re working with bioinformatics programs, you’re working with your data and it’s key to be able to have that data in the right place and make sure the program has access to the data. Many of the problems people run in to with command line bioinformatics programs is not having the data in the place the program expects it to be.
## Moving around the file system¶
Let’s practice moving around a bit.
We’re going to work in that shell directory we just downloaded.
First let’s navigate there using the regular way by clicking on the different folders.
First we did something like go to the folder of our username. Then we opened 'edamame-data' then 'shell'
Let’s draw out how that went.
Harriet draw image
Now let’s draw some of the other files and folders we could have clicked on.
This is called a hierarchical file system structure, like an upside down tree with root (/) at the base that looks like this.
Exercise
Now we’re going to try a hunt. Move around in the ‘hidden’ directory and try to find the file 'youfoundit.txt'
## Examining the contents of other directories¶
By default, the ls commands lists the contents of the working directory (i.e. the directory you are in). You can always find the directory you are in using the pwd command. However, you can also give ls the names of other directories to view. Navigate to the home directory if you are not already there.
Type:
cd
Then enter the command:
ls edamame-data
This will list the contents of the edamame-data directory without you having to navigate there.
The cd command works in a similar way. Try entering:
cd
cd edamame-data/shell/hidden
and you will jump directly to hidden without having to go through the intermediate directory.
Exercise
Try finding the 'anotherfile.txt' file without changing directories.
### Shortcut: Tab Completion¶
Navigate to the home directory. Typing out directory names can waste a lot of time. When you start typing out the name of a directory, then hit the tab key, the shell will try to fill in the rest of the directory name. For example, enter:
cd e<tab>
The shell will fill in the rest of the directory name for edamame-data. Now go to edamame-data/shell/MiSeq
ls C01<tab><tab>
When you hit the first tab, nothing happens. The reason is that there are multiple directories in the home directory which start with C01. Thus, the shell does not know which one to fill in. When you hit tab again, the shell will list the possible choices.
Tab completion can also fill in the names of programs. For example, enter e<tab><tab>. You will see the name of every program that starts with an e. One of those is echo. If you enter ec<tab> you will see that tab completion works.
## Saving time with shortcuts, wild cards, and tab completion¶
### Shortcuts¶
There are some shortcuts which you should know about. Dealing with the home directory is very common. So, in the shell the tilde character, "~", is a shortcut for your home directory. Navigate to the edamame directory:
cd
cd edamame-data
cd shell
Then enter the command:
ls ~
This prints the contents of your home directory, without you having to type the full path. The shortcut .. always refers to the directory above your current directory. Thus:
ls ..
prints the contents of the /home/username/edamame-data. You can chain these together, so:
ls ../../
prints the contents of /home/username which is your home directory. Finally, the special directory . always refers to your current directory. So, ls, ls ., and ls ././././. all do the same thing, they print the contents of the current directory. This may seem like a useless shortcut right now, but we’ll see when it is needed in a little while.
To summarize, while you are in the shell directory, the commands ls ~, ls ~/., ls ../../, and ls /home/username all do exactly the same thing. These shortcuts are not necessary, they are provided for your convenience.
### Wild cards¶
Navigate to the MiSeq directory using”
~/edamame-data/shell/MiSeq
This directory contains our FASTQ files and some other ones we’ll need for analyses. If we type ls, we will see that there are a bunch of files with long file names. Some of the end with .fastq.
The * character is a shortcut for “everything”. Thus, if you enter ls *, you will see all of the contents of a given directory. Now try this command:
ls *fastq
This lists every file that ends with a fastq. This command:
ls /usr/bin/*.sh
Lists every file in /usr/bin that ends in the characters .sh.
We have paired end sequencing, so for every sample we have two files. If we want to just see the list of the files for the forward direction sequencing we can use:
ls *R*fastq
lists every file in the current directory whose name contains the letter R, and ends with fastq. There are twenty such files which we would expect because we have 20 samples.
So how does this actually work? Well...when the shell (bash) sees a word that contains the * character, it automatically looks for filenames that match the given pattern. In this case, it identified four such files. Then, it replaced the *R*fastq with the list of files, separated by spaces.
What happens if you do R*fastq?
Short Exercise
Do each of the following using a single ls command without navigating to a different directory.
1. List all of the files in /bin that start with the letter ‘c
2. List all of the files in /bin that contain the letter ‘a’
3. List all of the files in /bin that end with the letter ‘o’
BONUS: List all of the files in ‘/bin’ that contain the letter ‘a’ or ‘c’
## Command History¶
You can easily access previous commands. Hit the up arrow. Hit it again. You can step backwards through your command history. The down arrow takes your forwards in the command history.
^-C will cancel the command you are writing, and give you a fresh prompt.
^-R will do a reverse-search through your command history. This is very useful.
You can also review your recent commands with the history command. Just enter:
history
to see a numbered list of recent commands, including this just issues history command. You can reuse one of these commands directly by referring to the number of that command.
If your history looked like this:
259 ls *
260 ls /usr/bin/*.sh
261 ls *R*fastq
then you could repeat command #260 by simply entering:
!260
(that’s an exclamation mark).
Short Exercise
1. Find the line number in your history for the last exercise (listing files in /bin) and reissue that command.
## Examining Files¶
We now know how to switch directories, run programs, and look at the contents of directories, but how do we look at the contents of files?
The easiest way to examine a file is to just print out all of the contents using the program cat. Enter the following command:
cat C01D01F_sub.fastq
This prints out the contents of the C01D01F_sub.fastq file.
Short Exercises
1. Print out the contents of the ~/edamame-data/shell/MiSeq/Centralia_mapping_files/Collapsed_Centralia_full_map.txt file. What does this file contain?
2. Without changing directories, (you should still be in edamame-data), use one short command to print the contents of all of the files in the /home/username/edamame-data/shell/MiSeq directory.
Make sure we’re in the right place for the next set of the lessons. We want to be in the shell directory. Check if you’re there with pwd and if not navigate there. One way to do that would be
cd ~/edamame-data/shell/MiSeq
cat is a terrific program, but when the file is really big, it can be annoying to use. The program, less, is useful for this case. Enter the following command:
less C01D01F_sub.fastq
less opens the file, and lets you navigate through it. The commands are identical to the man program.
Some commands in less
| key | action | | ——- | ———- | | “space” | to go forward | | “b” | to go backwarsd | | “g” | to go to the beginning | | “G” | to go to the end | | “q” | to quit |
less also gives you a way of searching through files. Just hit the “/” key to begin a search. Enter the name of the word you would like to search for and hit enter. It will jump to the next location where that word is found. Try searching the dictionary.txt file for the word “cat”. If you hit “/” then “enter”, less will just repeat the previous search. less searches from the current location and works its way forward. If you are at the end of the file and search for the word “cat”, less will not find it. You need to go to the beginning of the file and search.
For instance, let’s search for the sequence 1101:14341 in our file. You can see that we go right to that sequence and can see what it looks like.
Remember, the man program actually uses less internally and therefore uses the same commands, so you can search documentation using “/” as well!
There’s another way that we can look at files, and in this case, just look at part of them. This can be particularly useful if we just want to see the beginning or end of the file, or see how it’s formatted.
The commands are head and tail and they just let you look at the beginning and end of a file respectively.
head C01D01F_sub.fastq
tail C01D01F_sub.fastq
The -n option to either of these commands can be used to print the first or last n lines of a file. To print the first/last line of the file use:
head -n 1 C01D01F_sub.fastq
tail -n 1 C01D01F_sub.fastq
## Searching files¶
We showed a little how to search within a file using less. We can also search within files without even opening them, using grep. Grep is a command-line utility for searching plain-text data sets for lines matching a string or regular expression. Let’s give it a try!
Let’s search for that sequence 22029:7208 in the C01D01F_sub.fastq file.
grep 22029:7208 C01D01F_sub.fastq
We get back the whole line that had '22029:7208' in it. What if we wanted all four lines, the whole part of that FASTQ sequence, back instead.
grep -A 3 22029:7208 C01D01F_sub.fastq
The -A flag stands for “after match” so it’s returning the line that matches plus the three after it. The -B flag returns that number of lines before the match.
Exercise
1. Search for the sequence 'TTATCCGGATTTATTGGGTTTAAAGGGT' in the C01D01F_sub.fastq file and in the output have the sequence name and the sequence. e.g.@M00967:43:000000000-A3JHG:1:2114:11799:28499 1:N:0:188 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCAG
2. Search for that sequence in all the FASTQ files.
## Redirection¶
We’re excited we have all these sequences that we care about that we just got from the FASTQ files. That is a really important motif that is going to help us answer our important question. But all those sequences just went whizzing by with grep. How can we capture them?
We can do that with something called “redirection”. The idea is that we’re redirecting the output to the terminal (all the stuff that went whizzing by) to something else. In this case, we want to print it to a file, so that we can look at it later.
The redirection command for putting something in a file is >
Let’s try it out and put all the sequences that contain 'TTATCCGGATTTATTGGGTTTAAAGGGT' from all the files in to another file called 'good-data2.txt'
grep -B 2 TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq > good-data2.txt
The prompt should sit there a little bit, and then it should look like nothing happened. But type ls. You should have a new file called good-data2.txt. Take a look at it and see if it has what you think it should.
There’s one more useful redirection command that we’re going to show, and that’s called the pipe command, and it is |. It’s probably not a key on your keyboard you use very much. What | does is take the output that scrolling by on the terminal and then can run it through another command. When it was all whizzing by before, we wished we could just slow it down and look at it, like we can with less. Well it turns out that we can! We pipe the grep command through less
grep TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq | less
Now we can use the arrows to scroll up and down and use q to get out.
We can also do something tricky and use the command wc. wc stands for word count. It counts the number of lines or characters. So, we can use it to count the number of lines we’re getting back from our grep command. And that will magically tell us how many sequences we’re finding. We’re
grep TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq | wc
That tells us the number of lines, words and characters in the file. If we just want the number of lines, we can use the -l flag for lines.
grep TTATCCGGATTTATTGGGTTTAAAGGGT *.fastq | wc -l
Redirecting is not super intuitive, but it’s really powerful for stringing together these different commands, so you can do whatever you need to do.
The philosophy behind these command line programs is that none of them really do anything all that impressive. BUT when you start chaining them together, you can do some really powerful things really efficiently. If you want to be proficient at using the shell, you must learn to become proficient with the pipe and redirection operators: |, >, >>.
## Creating, moving, copying, and removing¶
Now we can move around in the file structure, look at files, search files, redirect. But what if we want to do normal things like copy files or move them around or get rid of them. Sure we could do most of these things without the command line, but what fun would that be?! Besides it’s often faster to do it at the command line, or you’ll be on a remote server like Amazon where you won’t have another option.
The stability.files file is one that tells us what sample name goes with what sequences. This is a really important file, so we want to make a copy so we don’t lose it.
Lets copy the file using the cp command. The cp command backs up the file. Navigate to the data directory and enter:
cp good-data2.txt good-data2.backup.txt
Now good-data2.backup.txt has been created as a copy of good-data2.txt.
Let’s make a backup directory where we can put this file.
The mkdir command is used to make a directory. Just enter mkdir followed by a space, then the directory name.
mkdir backup
We can now move our backed up file in to this directory. We can move files around using the command mv. Enter this command:
mv good-data2.backup.txt backup/
This moves good-data2.backup.txt into the directory backup/ or the full path would be ~/edamame-data/shell/MiSeq/backup
The mv command is also how you rename files. Since this file is so important, let’s rename it:
mv backup/good-data2.backup.txt backup/good-data2.backup_IMPORTANT
Now the file name has been changed to good-data2.backup_IMPORTANT. Let’s delete the backup file now:
rm backup/good-data2.backup_IMPORTANT
The rm file removes the file. Be careful with this command. It doesn’t just nicely put the files in the Trash. They’re really gone.
Short Exercise
Do the following:
1. Rename the good-data2.backup_IMPORTANT file to good-data2.backup.txt.
2. Create a directory in the MiSeq directory called new
3. Then, copy the good-data2.backup.txt file into new
By default, rm, will NOT delete directories. You can tell rm to delete a directory using the -r option. Let’s delete that new directory we just made. Enter the following command: rm -r new
## Running programs¶
Commands like ls, rm, echo, and cd are just ordinary programs on the computer. A program is just a file that you can execute. The program which tells you the location of a particular program. For example:
which ls
Will return “/bin/ls”. Thus, we can see that ls is a program that sits inside of the /bin directory. Now enter:
which find
You will see that find is a program that sits inside of the /usr/bin directory.
So ... when we enter a program name, like ls, and hit enter, how does the shell know where to look for that program? How does it know to run /bin/ls when we enter ls. The answer is that when we enter a program name and hit enter, there are a few standard places that the shell automatically looks. If it can’t find the program in any of those places, it will print an error saying “command not found”. Enter the command:
echo \$PATH
This will print out the value of the PATH environment variable. More on environment variables later. Notice that a list of directories, separated by colon characters, is listed. These are the places the shell looks for programs to run. If your program is not in this list, then an error is printed. The shell ONLY checks in the places listed in the PATH environment variable.
Navigate to the shell directory and list the contents. You will notice that there is a program (executable file) called hello.sh in this directory. Now, try to run the program by entering:
hello.sh
You should get an error saying that hello.sh cannot be found. That is because the directory /home/username/edamame-data/shell is not in the PATH. You can run the hello.sh program by entering:
./hello.sh
Remember that . is a shortcut for the current working directory. This tells the shell to run the hello.sh program which is located right here. So, you can run any program by entering the path to that program. You can run hello.sh equally well by specifying:
/home/username/edamame-data/shell/hello.sh
Or by entering:
~/edamame-data/shell/hello.sh
When there are no / characters, the shell assumes you want to look in one of the default places for the program.
# Finding files¶
The find program can be used to find files based on arbitrary criteria. Navigate to the data directory and enter the following command:
find . -print
This prints the name of every file or directory, recursively, starting from the current directory. Let’s exclude all of the directories:
find . -type f -print
This tells find to locate only files. Now try these commands:
find . -type f -name "*1*"
find . -type f -name "*1*" -or -name "*2*" -print
find . -type f -name "*1*" -and -name "*2*" -print
The find command can acquire a list of files and perform some operation on each file. Try this command out:
find . -type f -exec grep Volume {} \;
This command finds every file starting from .. Then it searches each file for a line which contains the word “Volume”. The {} refers to the name of each file. The trailing \; is used to terminate the command. This command is slow, because it is calling a new instance of grep for each item the find returns.
A faster way to do this is to use the xargs command:
find . -type f -print | xargs grep Volume
find generates a list of all the files we are interested in, then we pipe them to xargs. xargs takes the items given to it and passes them as arguments to grep. xargs generally only creates a single instance of grep (or whatever program it is running).
• Software Carpentry tutorial - The Unix shell
• The shell handout - Command Reference
• explainshell.com
• http://tldp.org/HOWTO/Bash-Prog-Intro-HOWTO.html
• man bash
• Google - if you don’t know how to do something, try Googling it. Other people have probably had the same question.
• Learn by doing. There’s no real other way to learn this than by trying it out. Write your next paper in nano (really emacs or vi), open pdfs from the command line, automate something you don’t really need to automate.
## Bonus:¶
backtick, xargs: Example find all files with certain text
alias -> rm -i
variables -> use a path example
.bashrc
du
ln
ssh and scp
Regular Expressions
Permissions
Chaining commands together
LICENSE: This documentation and all textual/graphic site content is released under Creative Commons - 0 (CC0) -- fork @ github. | 2021-04-13T13:58:32 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.42848891019821167, "perplexity": 1910.4087578404594}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038072366.31/warc/CC-MAIN-20210413122252-20210413152252-00283.warc.gz"} |
http://pdglive.lbl.gov/DataBlock.action?node=M300J50 | # $\mathbf {{{\boldsymbol f}_{{2}}{(2140)}}}$ $\boldsymbol I\boldsymbol G(\boldsymbol J{}^{PC}) = 0{}^{+}(2{}^{++})$ INSPIRE search
MASS ${\mathrm {(MeV)}}$ WIDTH ${\mathrm {(MeV)}}$ EVTS DOCUMENT ID TECN COMMENT
$2141 \pm12$ $49 \pm28$ 389
1986
MPSF 400 ${{\mathit p}}$ ${}^{}\mathrm {A}$ $\rightarrow$ 4 ${{\mathit K}}$ X
References:
GREEN 1986
PRL 56 1639 Observation of a Narrow Enhancement in ${{\mathit \phi}}{{\mathit K}}{{\mathit K}}$ and ${{\mathit \phi}}{{\mathit \pi}}{{\mathit \pi}}$ Final States Produced in 400 GeV ${{\mathit p}}{{\mathit N}}$ Interactions | 2019-04-26T15:47:03 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9229328632354736, "perplexity": 8228.355127182622}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578841544.98/warc/CC-MAIN-20190426153423-20190426175423-00345.warc.gz"} |
https://pure.royalholloway.ac.uk/portal/en/publications/measurement-of-the-differential-crosssection-of-highly-boosted-top-quarks-as-a-function-of-their-transverse-momentum-in-sqrts--8-tev-protonproton-collisions-using-the-atlas-detector(94b3be64-7596-4043-b725-603d0bc87249).html | Measurement of the differential cross-section of highly boosted top quarks as a function of their transverse momentum in $\sqrt{s}$ = 8 TeV proton-proton collisions using the ATLAS detector. / The ATLAS Collaboration.
In: Physical Review D , Vol. 93, No. 3, 26.02.2016.
Research output: Contribution to journalArticlepeer-review
Published
• The ATLAS Collaboration
Original language English Physical Review D 93 3 https://doi.org/10.1103/PhysRevD.93.032009 Published - 26 Feb 2016
This open access research output is licenced under a Creative Commons Attribution-NonCommercial-NoDerivs 3.0 Unported License.
ID: 29018845 | 2021-09-28T18:09:39 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.19452157616615295, "perplexity": 3667.166706898325}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780060877.21/warc/CC-MAIN-20210928153533-20210928183533-00143.warc.gz"} |
http://gams.cam.nist.gov/27.3 | # §27.3 Multiplicative Properties
Except for $\nu\left(n\right)$, $\Lambda\left(n\right)$, $p_{n}$, and $\pi\left(x\right)$, the functions in §27.2 are multiplicative, which means $f(1)=1$ and
27.3.1 $f(mn)=f(m)f(n),$ $\left(m,n\right)=1$. ⓘ Symbols: $\left(\NVar{m},\NVar{n}\right)$: greatest common divisor (gcd), $m$: positive integer, $n$: positive integer and $f(n)$: multiplicative function Permalink: http://dlmf.nist.gov/27.3.E1 Encodings: TeX, pMML, png See also: Annotations for 27.3 and 27
If $f$ is multiplicative, then the values $f(n)$ for $n>1$ are determined by the values at the prime powers. Specifically, if $n$ is factored as in (27.2.1), then
27.3.2 $f(n)=\prod_{r=1}^{\nu\left(n\right)}f(p^{a_{r}}_{r}).$
In particular,
27.3.3 $\displaystyle\phi\left(n\right)$ $\displaystyle=n\prod_{p\mathbin{|}n}(1-p^{-1}),$ ⓘ Symbols: $\phi\left(\NVar{n}\right)$: Euler’s totient, $n$: positive integer and $p,p_{1},\ldots$: prime numbers A&S Ref: 24.3.2 I.C Permalink: http://dlmf.nist.gov/27.3.E3 Encodings: TeX, pMML, png See also: Annotations for 27.3 and 27 27.3.4 $\displaystyle J_{k}\left(n\right)$ $\displaystyle=n^{k}\prod_{p\mathbin{|}n}(1-p^{-k}),$ ⓘ Symbols: $J_{\NVar{k}}\left(\NVar{n}\right)$: Jordan’s function, $k$: positive integer, $n$: positive integer and $p,p_{1},\ldots$: prime numbers Permalink: http://dlmf.nist.gov/27.3.E4 Encodings: TeX, pMML, png See also: Annotations for 27.3 and 27 27.3.5 $\displaystyle d\left(n\right)$ $\displaystyle=\prod_{r=1}^{\nu\left(n\right)}(1+a_{r}),$ 27.3.6 $\displaystyle\sigma_{\alpha}\left(n\right)$ $\displaystyle=\prod_{r=1}^{\nu\left(n\right)}\frac{p^{\alpha(1+a_{r})}_{r}-1}{% p^{\alpha}_{r}-1},$ $\alpha\neq 0$.
Related multiplicative properties are
27.3.7 $\sigma_{\alpha}\left(m\right)\sigma_{\alpha}\left(n\right)=\sum_{d\mathbin{|}% \left(m,n\right)}d^{\alpha}\sigma_{\alpha}\left(\frac{mn}{d^{2}}\right),$
27.3.8 $\phi\left(m\right)\phi\left(n\right)=\phi\left(mn\right)\phi\left(\left(m,n% \right)\right)/\left(m,n\right).$
A function $f$ is completely multiplicative if $f(1)=1$ and
27.3.9 $f(mn)=f(m)f(n),$ $m,n=1,2,\dots$. ⓘ Symbols: $m$: positive integer, $n$: positive integer and $f(n)$: multiplicative function Permalink: http://dlmf.nist.gov/27.3.E9 Encodings: TeX, pMML, png See also: Annotations for 27.3 and 27
Examples are $\left\lfloor 1/n\right\rfloor$ and $\lambda\left(n\right)$, and the Dirichlet characters, defined in §27.8.
If $f$ is completely multiplicative, then (27.3.2) becomes
27.3.10 $f(n)=\prod_{r=1}^{\nu\left(n\right)}\left(f(p_{r})\right)^{a_{r}}.$ | 2017-11-25T00:17:45 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 79, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9786006212234497, "perplexity": 5806.438080122018}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-47/segments/1510934809160.77/warc/CC-MAIN-20171124234011-20171125014011-00097.warc.gz"} |
https://docs.nersc.gov/development/compilers/wrappers/ | Compiler Wrappers¶
NERSC provides compiler wrappers on Perlmutter and Cori which combine the native compilers (Intel, GNU, Cray (HPE Cray Compilers), NVIDIA, and AOCC) with MPI and various other libraries, to enable streamlined compilation of scientific applications.
HPE Cray Compiler Wrappers¶
HPE Cray provides a convenient set of wrapper commands that should be used in almost all cases for compiling and linking parallel programs. Invoking the wrappers will automatically link codes with MPI libraries and other HPE Cray system software. All MPI and Cray system directories are also transparently imported. In addition, the wrappers cross-compile for the appropriate compute node architecture, based on which craype-<arch> module is loaded when the compiler is invoked, where the possible values of <arch> are discussed below.
Compiler wrappers target compute nodes, not login nodes
The intention is that programs are compiled on the login nodes and executed on the compute nodes. Because the compute nodes and login nodes have different hardware and software, executables cross-compiled for compute nodes may fail if run on login nodes. The wrappers mentioned above guarantee that codes compiled using the wrappers are prepared for running on the compute nodes.
KNL-specific compiler flags should be used for codes running on KNL nodes
On Cori there are two types of compute nodes: Haswell and KNL. While applications cross-compiled for Haswell do run on KNL compute nodes, the converse is not true (applications compiled for KNL will fail if run on Haswell compute nodes). Additionally, even though a code compiled for Haswell will run on a KNL node, it will not be able to take advantage of the wide vector processing units available on KNL. Consequently, one should specifically target KNL nodes during compilation in order to achieve the highest possible code performance. Please see below for more information on how to compile for KNL compute nodes.
Basic Example¶
The HPE Cray compiler wrappers replace other compiler wrappers commonly found on computer clusters, such as mpif90, mpicc, and mpic++. By default, the HPE Cray wrappers include MPI libraries and header files, as well as the many scientific libraries included in HPE Cray LibSci.
For detailed information on using a particular compiler suite, please check the webpage.
Fortran¶
ftn -o example.x example.f90
C¶
cc -o example.x example.c
C++¶
CC -o example.x example.cpp
By default (from cdt/19.06 onwards on Cori, and for all cpe's on Perlmutter), the Cray compiler wrappers build dynamically linked executables. To build statically linked executables, just add the -static flag to the command and link lines, or set CRAYPE_LINK_TYPE=static in the environment,
cc -static -o example.x example.c
or
export CRAYPE_LINK_TYPE=static
cc -o example.x example.c
Static linking can fail on Perlmutter
HPE Cray provides static and dynamic PE (MPI, LibSci, etc.) libraries for Perlmutter. When building executables, users would not have to add linking flags for PE libraries as the compiler wrappers would do the necessary work underneath. However, it is observed that attempting to build statically linked executables can fail as the compiler wrappers may not properly link necessary static PE libraries.
Usage Tips¶
Use compiler wrappers in ./configure¶
When compiling an application which uses the standard series of ./configure, make, and make install, often specifying the compiler wrappers in the appropriate environment variables is sufficient for a configure step to succeed:
./configure CC=cc CXX=CC FC=ftn
Set the accelerator target to GPUs for CUDA-aware MPI on Perlmutter¶
When building an application that uses CUDA-aware MPI, you must set the accelerator target to nvidia80 via the compile flag -target-accel=nvidia80 or the environment variable CRAY_ACCEL_TARGET. It's because the GTL (GPU Transport Layer) library needs to be linked for MPI communication involving GPUs, and setting the target can detect the library. If you don't do that, you may get the following runtime error:
MPIDI_CRAY_init: GPU_SUPPORT_ENABLED is requested, but GTL library is not linked
For more info, see the section on setting the the accelerator target.
Use cdt or cpe modules to control versions of Cray PE modules¶
To use a non-default CDT (Cray Developer Toolkit) on Cori or CPE (Cray Programming Environment) on Perlmutter version, which includes craype, cray-libsci, cray-mpich, etc. from the specific version, one could issue the following commands first. Below is an example on Cori:
module load cdt/<the-non-default-version>
export LD_LIBRARY_PATH=$CRAY_LD_LIBRARY_PATH:$LD_LIBRARY_PATH
Then, compile and run as usual.
Intel Compiler Wrappers on Cori¶
Although the Cray compiler wrappers cc, CC, and ftn, are the default (and recommended) compiler wrappers on the Cori system, wrappers for Intel MPI are provided as well via the the impi module.
The Intel MPI wrapper commands are mpiicc, mpiicpc, and mpiifort, which are analogous to cc, CC, and ftn from the Cray wrappers, respectively. Same as the Cray wrappers, the default link type for the Intel wrappers is dynamic, not static.
Intel MPI may be slower than Cray MPI on Cray systems
Although Intel MPI is available on the Cray systems at NERSC, it is not tuned for high performance on the high speed network on these systems. Consequently, it is possible, even likely, that MPI application performance will be lower if compiled with Intel MPI than with Cray MPI.
Intel MPI wrappers work only with Intel compilers
If one chooses to use the Intel MPI compiler wrappers, they are compatible only with the Intel compilers icc, icpc, and ifort. They are incompatible with the Cray and GCC compilers.
Intel MPI wrappers must specify architecture flags explicitly
While the Cray compiler wrappers cross-compile source code for the appropriate architecture based on the craype-<arch> modules (e.g., craype-haswell for Haswell code and craype-mic-knl for KNL code), the Intel wrappers do not. The user must apply the appropriate architecture flags to the wrappers manually, e.g., adding the -xMIC-AVX512 flag to compile for KNL.
Intel MPI wrappers do not link to Cray libraries by default
Unlike the Cray compiler wrappers, the Intel compiler wrappers do not automatically include and link to scientific libraries such as LibSci. These libraries must be included and linked manually if using the Intel MPI wrappers.
Compiling¶
The Intel compiler wrappers function similarly to the Cray wrappers cc, CC, and ftn. However a few extra steps are required. To compile with the Intel MPI wrappers, one must first load the impi module.
module load impi
mpiifort -xMIC-AVX512 -o example.x example.f90
Running¶
To run an application compiled with Intel MPI, one must load the impi module, and then issue the same srun commands as typical for an application compiled with the Cray wrappers (example). | 2021-10-19T21:26:45 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5083960890769958, "perplexity": 10851.958418127491}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323585281.35/warc/CC-MAIN-20211019202148-20211019232148-00297.warc.gz"} |
https://pub.uni-bielefeld.de/record/2933143 | ### Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet
Yang M (2019)
Bielefeld: Universität Bielefeld.
Bielefelder E-Dissertation | Englisch
1.30 MB
Autor*in
Yang, Meng
Gutachter*in / Betreuer*in
Einrichtung
Abstract / Bemerkung
This thesis is about local and non-local Dirichlet forms on the Sierpi\'nski gasket and the Sierpi\'nski carpet. We are concerned with the following three problems in analysis on the Sierpi\'nski gasket and the Sierpi\'nski carpet. 1. A unified purely *analytic* construction of local regular Dirichlet forms on the Sierpi\'nski gasket and the Sierpi\'nski carpet. We give a purely analytic construction of a self-similar local regular Dirichlet form on the Sierpi\'nski carpet using $\Gamma$-convergence of stable-like non-local closed forms which gives an answer to an open problem in analysis on fractals. We also apply this construction on the Sierpi\'nski gasket. 2. Determination of walk dimension *without* using diffusion. Although the walk dimension is a parameter that determines the behaviour of diffusion, we give two approaches to the determination of the walk dimension *prior* to the construction of diffusion. - We construct non-local regular Dirichlet forms on the Sierpi\'nski gasket from regular Dirichlet forms on certain augmented rooted tree whose certain boundary at infinity is the Sierpi\'nski gasket. Then the walk dimension is determined by a critical value of a certain parameter of the random walk on the augmented rooted tree. - We determine a critical value of the index of a non-local quadratic form by finding a more convenient equivalent semi-norm. 3. Approximation of local Dirichlet forms by non-local Dirichlet forms. We prove that non-local Dirichlet forms can approximate local Dirichlet forms as direct consequences of our construction of local Dirichlet forms. We also prove that on the Sierpi\'nski gasket the local Dirichlet form can be obtained as a Mosco limit of non-local Dirichlet forms. Let us emphasize that we do *not* need subordination technique based on heat kernel estimates.
Jahr
2019
Urheberrecht / Lizenzen
Page URI
https://pub.uni-bielefeld.de/record/2933143
### Zitieren
Yang M. Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet. Bielefeld: Universität Bielefeld; 2019.
Yang, M. (2019). Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet. Bielefeld: Universität Bielefeld.
Yang, M. (2019). Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet. Bielefeld: Universität Bielefeld.
Yang, M., 2019. Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet, Bielefeld: Universität Bielefeld.
M. Yang, Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet, Bielefeld: Universität Bielefeld, 2019.
Yang, M.: Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet. Universität Bielefeld, Bielefeld (2019).
Yang, Meng. Local and Non-Local Dirichlet Forms on the Sierpinski Gasket and the Sierpinski Carpet. Bielefeld: Universität Bielefeld, 2019.
Alle Dateien verfügbar unter der/den folgenden Lizenz(en):
Creative Commons Public Domain Dedication (CC0 1.0):
Volltext(e)
Name
Access Level
Open Access | 2022-06-30T17:45:53 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.7742049694061279, "perplexity": 1065.3910592857624}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103850139.45/warc/CC-MAIN-20220630153307-20220630183307-00315.warc.gz"} |
https://www.bls.gov/opub/hom/ncs/calculation.htm | National Compensation Measures: Calculation
The National Compensation Survey (NCS) is an establishment-based survey that collects data on employer costs for employee compensation and incidence and details of employer-sponsored benefits. The calculation details for the Employment Cost Index (ECI), Employer Costs for Employee Compensation (ECEC) and Employee Benefits are covered in this section.
Computing the Employment Cost Index (ECI)
The ECI is a measure of the change in the employer costs of labor, independent of the influence of employment shifts among occupations and industry categories. The total compensation series include changes in wages and salaries and in employer costs for employee benefits. The ECI calculates indexes of total compensation, wages and salaries, and benefits separately for all civilian workers in the United States (as defined by the NCS), for private industry workers, and for workers in state and local government. For all of these categories, the ECI calculates the same measures by occupational group, industry group, and worker and establishment characteristics. Seasonally adjusted series are calculated as well.
The ECI is a modified Laspeyres index (that is, an index reflecting the change in labor costs over time), for which the basic computational framework is the standard formula for an index number with fixed index weights, modified by special statistical conditions and accounting for sampling methodology.
An index number for the ECI is a weighted average of the cumulative average wage changes within each of the ECI basic cells, with “wage bills” serving as the fixed weights. For benefit costs, the index number is a weighted average of the cumulative average benefit costs within each of the ECI basic cells, with “benefit bills” serving as the fixed weights. A basic cell for the ECI is composed of wage (or benefit) data from a narrowly defined set of workers, sorted by ownership sector, industry, and occupational groups in which they are employed. The ECI cell structure sorts the industry codes into 1 of 3 ownership sectors: private, state government, or local government. Workers within private establishments are sorted into 1 of 59 industry categories that are defined primarily by three-digit industry codes using the 2012 North American Industry Classification System (NAICS). Workers in either state or local government are classified into 13 industry categories; the government industry categories are as broad as “all goods-producing industries” and as narrow as “hospitals.” Each of these private and government industry groups is arrayed across nine aggregate occupational groups, which are ordered numerically by their 2010 Standard Occupational Classification (SOC) codes. Altogether, there are 531 (59 × 9) private industry occupational cells and 234 (13 × 9 × 2) state and local government industry occupational cells, totaling 765 ECI basic cells.
The unweighted average wage (or benefit cost) is calculated from all workers within a sampled quote (selected job). The wage (or benefit) bill $W o,i = Y ̅ o,i E i$$Y ¯ ^ cD$$Y ^$$= 100 * SE( Y ^$ is the product of the weighted average wage (or benefit cost) of sampled quotes (selected jobs), $I t = ∑ ( W 0,i M t,i ) ∑ W o,i * 100$, within the cell at the period in which the wage (or benefit) bill is calculated and the number of workers represented by the cell, $Y ¯ ^ cD = ∑ q ∈ D W q Y ̅ cq ∑ q ∈ D W q$
$W q$
For the ECI, the number of workers represented by the cell is held fixed. For each basic cell, wage and benefit bills ($Y ̅ cq$) are computed, and the bills are updated each quarter by observed rates of change from the ECI survey sample.
The simplified formula for a basic cell is:
$P cD = Y ¯ ^ cD Y ¯ ^ TD * 100$
where
It is the index at period t,
is the estimated wage (or benefit) bill for the ith cell, and
$Y ¯ ^ TD$$Error$$Y ^ r$ is the multiplicatively accumulated weighted average wage (or benefit cost) change in the ith cell from time 0 (the period the wage or benefit bill is calculated) to time t (the current quarter). projects the weighted average wage (or benefit cost) level for the cell forward to the current quarter.
Note that can be written as $A D = ∑ q ∈ D W q X q ∑ q ∈ D W q * 100$
where
$W q$$W q$ is the ratio of the current-quarter weighted average wage (or average benefit costs) in the cell to the previous-quarter weighted average wage (or average benefit costs) in the cell, both calculated in the current quarter from matched-sampled quotes. Using only matched quotes in the ratio eliminates the inclusion of wage (or benefit cost) changes that might be caused by workers reassigned between jobs within establishments or changes of jobs sampled in the survey. That is, the ECI sample tracks changes in wages (or benefit cost) within establishment jobs, not by individual workers of the establishment. The sample quote weights are applied to compute the cell-weighted averages.
All wage and benefit indexes are computed from the following data:
• Matched quotes are average hourly wages (or benefit costs) for detailed occupations (six-digit SOC) or groups of occupations, in sample establishments for which data are available for both the current and previous quarters. In addition to being identified by the detailed occupation, a quote within an establishment is identified from quarter to quarter by its bargaining status, full-time or part-time status, method of pay (time- or incentive-based), and work level.
• Employment levels for each of the basic cells from December 2005 to September 2013, employment were held constant using 2002 employment estimates from the Occupational Employment Statistics (OES) Survey. Beginning December 2013 employment levels are fixed using 2012 OES employment estimates. The relative difference for any two periods after September 2013, reflect the cost of employing the 2012 workforce. Similarly, the difference for any two periods between December 2005 and September 2013 reflect the cost in employing the 2002 workforce. Because the index was updated with employment weights after September 2013, differences between the two reweighting periods cannot be interpreted in terms of the cost of employing any fixed workforce.
• Sample quote weights reflect both employment in each establishment, occupation surveyed, and the probability of selection.
• Nonresponse and other adjustments at the establishment and occupation level account for missing data and unusual situations that may have occurred or observed during data collection, such as when reported data represents more locations than the sampled establishment.
Computation of the index for a calendar quarter involves five principal steps:
1. Calculate a weighted average for each basic cell in the current quarter. Sampled occupation (quote) weights are applied to the average occupational hourly wage (or benefit cost) for every quote in a sampled establishment that reported both current-quarter and previous-quarter wage (or benefit) data. These data are used to calculate a weighted average wage (or benefit cost) for each basic cell (that is for each occupational group within each industry) for the current and previous survey periods.
2. Calculate the multiplicatively accumulated average wage (or benefit cost) changes. The ratio of the current-quarter to the previous-quarter weighted average wage (or benefit cost) is calculated for each cell $I D = ∑ q ∈ D ∑ j ∈ q W q P qj ∑ q ∈ D W q * 100$. This ratio ( ) is used as an estimate of the current-quarter ($Y D = ∑ q ∈ D ∑ j ∈ q W q Y qj P qj ∑ q ∈ D ∑ j ∈ q W q P qj$) wage (or benefit cost) change for that basic cell and is multiplied by the previous-quarter ($Wq$) cumulative average wage (or benefit cost) change for the cell ($SE Y ^ = 1 R(1 - k) 2 ∑ r = 1 R ( Y ^ r - Y ^ ) 2$ ). The product is a measure of the cumulative percent wage (or benefit cost) change in the cell's wage bill () since the period in which it was calculated.
3. Generate an estimate of the current-quarter wage (or benefit) bill. The measure of cumulative percent wage (or benefit cost) change is multiplied by the wage (or benefit) bill () in the calculated period to generate an estimate of the current-quarter wage (or benefit) bill for the cell.
4. Calculate the ratio of summed current-quarter wage (or benefit) bill to the summed wage (or benefit) bill in the period it was calculated. The current-quarter and previous-quarter wage (or benefit) bills are then summed over all cells within the scope of the index. For example, for the manufacturing wage index, the wage bills would be summed across all cells in manufacturing. The summed current-quarter wage ($Y ^$ ) is divided by the summed base-period wage bill (.)
5. Calculate the index link relative. The result, multiplied by 100, is the current-quarter index (), which is then divided by the previous-quarter index () to provide a measure of quarter-to-quarter change, referred to as an “index link relative.”
Computations for the occupational and industry group indexes follow the same procedures as those for the overall indexes, except for summation. For example, for an index for a broad occupational group, the wage (or benefit) bills are summed across all cells, which are a subset of that occupational group, with indexes for industry groups calculated analogously.
Fixed employment weights are used each quarter to calculate aggregate indexes for civilian, private, and state and local government. These fixed weights are also used to derive all of the industry and occupation series indexes, see Introducing 2012 fixed employment weights for the ECI.
Computation procedures for measures of change in the regional, union and nonunion, and excluding-incentive workers indexes differ from those of the national wage and benefit indexes because the sample is not large enough to hold the wage and benefit bills constant at the level of detail of the indexes for larger samples. For these indexes, the prevailing distribution in the sample in the previous quarter (for example, between union and nonunion attributes within each ownership–industry–occupation cell of the previous quarter) is used to apportion the previous-quarter wage (or benefit) bill in that cell (for example, between the union and nonunion indexes) each quarter. The portion of the wage (or benefit) bill assigned to the union index is then adjusted by the percent change in the union wages (or benefit costs) in the cell, and similarly for the nonunion index. Therefore, the relative employment of the union index in each cell is not held constant over time and will likely change each quarter as the sample changes as well as actual changes in the employment distributions across these attributes. Because the weights of the region, union, and time-paid workers indexes are allowed to vary over time, these indexes are not strictly comparable to the aggregate, industry, occupation, and metropolitan area indexes.
Over the course of a year, rates of change in the cost of wages and benefits, as measured in the ECI, reflect events that follow a more or less regular pattern. These events include expansions and contractions of economic activity that occur in specific periods of the year, such as increased work in the construction industry during warm weather or changes in education stemming from new contracts associated with the beginning of the new school year. Such regular patterns in an economic time series typically are referred to as seasonal effects. The process of estimating and removing these effects from an economic series is called seasonal adjustment. Seasonal adjustment makes it easier for analysts to observe changes in data exclusive of seasonal effects. Economists and other researchers are particularly interested in observing cyclical and long-run movements of economic series to gain a better understanding of the economic behavior of various sectors of the economy.
In evaluating changes in a seasonally adjusted series, it is important to note that seasonal adjustment is an approximation based on past experience. Seasonally adjusted data have a similar margin of error as the original data on which they are based; therefore, the standard errors of the original (not seasonally adjusted) series could be used to assess the approximate precision of the corresponding seasonally adjusted estimates.
Seasonal adjustment is performed with the X-13ARIMA-SEATS program developed by staff of the Statistical Research Division of the U.S. Census Bureau. The X-13ARIMA-SEATS program includes enhancements to both the X-11 variant of the Census Method II seasonal adjustment program and the X-11 ARIMA (Autoregressive Integrated Moving Average) program developed by Statistics Canada. For a definition and explanatory information on ARIMA, see The X-13ARIMA-SEATS Seasonal Adjustment Program and The X-II-ARIMA Seasonal Adjustment Method.
ECI series are seasonally adjusted by either a direct or an indirect method. In the direct method, an original (or unadjusted) index is divided by its seasonal factor estimated from X-13ARIMA-SEATS. In the indirect method, also called composite seasonal adjustment, the seasonally adjusted index is calculated as a weighted sum of seasonally adjusted index components, where the weights are derived from the index weights.
Indexes at comparatively low levels of aggregation, such as the construction wage index, are adjusted by the direct method; that is, dividing the index by its seasonal factor. Higher level aggregate indexes, such as civilian wages and salaries, are generally seasonally adjusted by the indirect method, a weighted sum of seasonally adjusted component indexes, where the weights sum to 1.0. Industry and occupational series that are seasonally adjusted by the indirect method are based on industry and occupational components, respectively.
At the beginning of each calendar year, seasonal adjustment factors are estimated. The seasonal factors for the directly adjusted series for the entire year are published. Seasonally adjusted estimates are revised each year, for a 5-year period, based on the latest year of data available. NCS publishes these revised seasonally adjusted series, directly and indirectly adjusted, annually. For additional information see Employment Cost Index: Annual Seasonal Adjustment Process.
Employer Costs for Employee Compensation (ECEC)
The ECEC measures the average costs to employers for wages and salaries, and benefits, per employee hour worked. The series provides data on employer costs per hour worked for total compensation, wages and salaries, total benefits, and the following benefits:
• paid leave—vacations, holidays, sick leave, and personal leave
• supplemental pay—premium pay (such as overtime, weekend, and holiday) for work in addition to the regular work schedule and for shift differentials, and nonproduction bonuses (such as yearend, referral, and attendance bonuses)
• insurance benefits—life, health, short-term disability, and long-term disability insurance
• retirement and savings benefits—defined benefit and defined contribution plans
• legally required benefits—Social Security (refers to Old-Age, Survivors, and Disability Insurance (OASDI) program), Medicare, federal and state unemployment insurance, and workers’ compensation
Cost data are presented both in dollar amounts and as percentages of total compensation and published quarterly.
The ECEC series provides an average cost across all workers. Eligible workers with access to employer-sponsored benefits who do not participate are also included in the calculation. That is, the average cost includes workers for whom the employer incurred a compensation cost and those for whom no cost was incurred.
The ECEC uses current employment weights (as opposed to fixed employment weights used in the ECI) to reflect the changing composition of today’s labor force to calculate cost levels. The employment weights are derived from two BLS programs: the Quarterly Census of Employment and Wages (QCEW) and the Current Employment Statistics (CES). Combined, these programs provide the appropriate industry coverage and currency of data needed to benchmark (post-stratify) employment weights for the ECEC series.
In most instances, private industry employment weights used in the ECEC are total employment estimates for two-digit industry groups, such as utilities (NAICS 22) or wholesale trade (NAICS 42). In a few cases, the employment weights associated with more detailed industrial categories are used. Among such categories are the four-digit NAICS categories elementary and secondary schools (6111), junior colleges (6122), colleges and universities (6133), and the six-digit NAICS category aircraft manufacturing (336411). For state and local governments, a more aggregated level reflecting the level of detail published by the Current Employment Statistics (CES) program is typically used.
The ECEC estimates of the percentage of total compensation are calculated from unrounded estimates of hourly employer costs and then the percentages are rounded to the first decimal place. This method provides the most precise estimates of the percentage of total compensation; estimates calculated from published cost estimates may differ slightly from those calculated from unpublished unrounded cost estimates.
The formula for the mean hourly cost c for domain is:
where
is the domain of interest (such as all manufacturing workers)
is the final quote weight for quote , calculated as described earlier, with one additional factor included to account for changes in the employment distribution,
and is the mean hourly cost for quote .
The formula for the mean hourly cost c as a percentage of total compensation is:
where
is the mean hourly cost c for domain , as before, and
is the mean hourly cost for total compensation for domain .
When respondents do not provide all the data needed, a procedure for assigning plausible values for the missing values is used. The process is explained in the section Weighting, nonresponse adjustment, imputation, and benchmarking.
Computing incidence and provisions of benefits
The NCS collects and publishes data annually on the incidence of employer-provided benefits and on the key provisions (terms) of employee benefit plans, for civilian workers, workers in private industry, and state and local government workers. The following lists the types of published benefits.
• Health care (medical, dental, vision, and prescription drug plan coverage, and employee and employer premiums for individual and family coverage) and the percentage of establishments offering health benefits
• Retirement plan coverage (defined benefit and defined contribution) and the percentage of establishments offering retirement benefits
• Life, short-term disability, and long-term disability insurance coverage
• Paid leave (for example, sick, jury duty, personal, and family), paid holidays and vacations;
• Unpaid family leave
• Health promotion benefits
• Financial benefits (for example, health savings accounts, stock options, Section 125 cafeteria plans)
• Pretax benefits
• “Quality of life” benefits, (for example, long-term care insurance, flexible-workplace, and subsidized commuting)
In addition, the NCS publishes data on detailed provisions of coverage in two major benefit areas: health insurance and retirement plans. Health data include medical plan provisions, such as deductibles, coinsurance, and out-of-pocket maximums, as well as details of dental, vision, and prescription drug benefits. Provisions of defined benefit and defined contribution retirement plans, such as eligibility requirements and benefit formulas, also are published. Detailed provision estimates are produced based on the initiation year (for example, the first year of participation in the NCS for the sampled establishment) of each sample group collected data via Summary Plan Description (SPD), plan summary sheets, and Summary of Benefits and Coverage (SBC).
Formula used to calculate access to benefits. The formula for the percentage of employees with access to a benefit area, such as life insurance, for domain is:
where
is the domain of interest,
is the final weight for quote , calculated as described in the section on the calculation of ECEC estimates, and
if the worker in quote q has access to the benefit being estimated and otherwise.
Formula used to calculate benefit participation. The formula for the incidence , or percentage, of employees participating in a benefit area, such as medical care, for domain is
where
is the domain of interest,
is the final quote weight for quote , calculated as described in the section on the calculation of ECEC estimates, and
is the percentage of workers in quote who are participating in benefit-area plan .
Other estimates of incidence, such as the percentage of participants in a benefit area or in a subset of a benefit area, can be computed in a similar manner, such that the base includes only those workers who participate in the benefit-area plans. For example, to calculate the percentage of medical insurance participants in fee-for-service plans in domain , a ratio is calculated such that the denominator is the same as the numerator in the previous formula and the numerator is of the same form as well, except that the summation is restricted to those participants in fee-for-service plans.
Formula used to calculate average (mean). The formula for the average flat monthly employee contribution for medical insurance for domain is
where
is the domain of interest,
, is the final quote weight for quote , calculated as described in the section on the calculation of ECEC estimates,
is the average monthly employee contribution to plan by workers in quote , and
is the percentage of workers in quote who are participating in plan .
Other means, such as the average annual deductible for medical insurance, can be calculated by a similar formula. In all cases, the averages include only those workers with the provision in question.
The weighted count of workers participating in plans available to workers in the sampled occupation and establishment is calculated by multiplying the final benchmarked quote weight by the participation rate for only those plans in the quote that meet the specific conditions defined by the quote condition and the plan conditions.
where
establishment,
occupation within establishment ,
plan in occupation q within establishment ,
weighted plan employment of participating workers ,
final benchmarked quote weight for occupation in establishment ,
, , and are dummy variables such that
if quote meets the condition set in the quote (row)
condition
otherwise,
if plan meets the condition set in the base (denominator) plan condition
otherwise,
if plan meets the condition set in the additional (numerator) plan condition
otherwise, and
percentage of workers in occupation and establishment who are participating in plan .
Calculation of percentiles
Percentiles of benefit provisions are calculated with data only from those workers in plans that include the provision in question. Percentile data are used to describe the distribution of a numeric value, such as a median annual deductible of $400.00 and the value$600.00 at the 90th percentile. The following percentiles p are calculated: 10, 25, 50 (median), 75, and 90.
The pth percentile is the value Qiqj, where the plan value of a quantity is for a specific benefit or a subset of a benefit area, such that
• the weighted plan employment (WPEiqj) across plans with a value less than Qiqj is less than p percent of the total weighted plan employment and
• the weighted plan employment (WPEiqj) across plans with a value more than Qiqj is less than (100 − p) percent of the total weighted plan employment.
It is possible that there are no specific plan records qi for which both of these properties hold. This occurs when there exists a plan for which the WPEiqj of records whose value is less than Qiqj equals p percent of the total weighted plan employment. In that situation, the pth percentile is the average of Qiqj and the value on the record with the next-lowest value. The Qiqj values must be sorted in ascending order.
Weighting, nonresponse adjustment, imputation, and benchmarking
Participation in the NCS is voluntary; therefore, a company official may refuse to participate in the initial survey or may be unwilling or unable to update previously provided data for one or more occupations during subsequent contact. In addition, some establishments selected from the sample frame may be out of the scope for the survey or have gone out of business. To address the problems of nonresponse and missing data, the NCS adjusts the weights of the remaining establishments and imputes missing values (for example, fills in missing values with plausible values). To ensure that published compensation estimates ultimately are representative of compensation in the civilian, private industry, and state and local government sectors.
Weight adjustments and imputation are made in accordance with the following steps:
Step 1. Unit nonresponse adjustment: An establishment is considered responding if it provided information on at least one usable occupation. A selected occupation is classified as usable if the following data are present: occupational attributes (full-time or part-time schedule, union or nonunion status, and time or incentive type of pay), work schedule, and wage data. Wages account for approximately 70 percent of compensation; therefore, if wage data are not available, other data from the establishment cannot be used in calculating estimates. Without the wage data, it is not possible to create benefit-cost estimates because many benefits, such as paid leave, for example, are linked to wages.
An establishment is considered nonresponding if it refused to participate in the survey or provided neither wages and salaries, occupational classification, worker attributes, and work schedule data for any selected occupation. Establishment nonresponse during the initial interview (referred to as initiation) is addressed by introducing nonresponse adjustments that redistribute the weights of nonrespondents to responding sample units in the same industry and size class. For example, if the nonresponding establishment was in the manufacturing industry and had an employment of 350 workers, the NCS would adjust the weights of responding manufacturing establishments with 250–499 workers by a nonresponse factor calculated by dividing the sum of the product of establishment employment and sample weight for responding and nonresponding establishments by the sum of the product of establishment employment and sample weight for responding establishments.
Step 2. Quote nonresponse adjustment: Quote nonresponse is a situation in which an establishment refuses to provide any wage data for a given sampled occupation (quote). Quote nonresponse during the initial interview is addressed by an adjustment that redistributes the weights of nonresponding quotes to responding sample quotes in the same occupational group, ownership, industry, and size class. Quote nonresponse during update interview is addressed by imputation.
Step 3. Item nonresponse is a situation in which an establishment responds to the survey but is unable or unwilling to provide some or all of the benefits data, for a given sampled occupation. Item nonresponse is addressed through item imputation in certain situations. Item imputation replaces missing values for an item with values derived from establishments with similar characteristics.
For benefit estimates, items can be imputed for nonresponse at initial and subsequent data collection. For example, during the initial contact, an establishment reports wage and salary data for a sampled occupation but refuses or is unable to report whether those in the occupation receive paid vacation benefits; the NCS imputes the incidence of vacation benefits for the selected occupation on the basis of the incidence of vacation benefits among similar occupations in similar establishments.
For wages and salaries, cost data are not imputed for item nonresponse during the establishment’s initial data collection but are imputed at subsequent data collections (update). For example, if a manufacturing establishment reported wages and salaries for its full-time nonunion assembly workers during the initial collection, but not in a subsequent collection period (update), the NCS calculates the rate of change in wages and salaries of full-time nonunion workers in similar manufacturing establishments between the two collection periods, where the rate of change in wages and salaries between two collection periods is estimated from a regression model fit to establishments who reported wage data in both periods. This rate is then multiplied by the establishment reported wages and salaries, at initiation, to impute missing wages and salaries. However, if the establishment did not provide wages and salaries for full-time nonunion assembly workers at the initial collection, the NCS would perform a quote nonresponse adjustment.
Additional adjustment factors are applied to special situations that may have occurred during data collection. For example, when a sample unit is one of two establishments owned by a given company and the respondent provides data for both locations combined instead of data for the sampled unit, the weight of the sampled unit is adjusted to reflect the employment data for the sampled unit.
Step 4 Benchmarking (poststratification). The benchmark calculation is essentially the same for all NCS data products; however, the input to the calculation differs by data product. The ECI uses fixed employment weights from the QCEW and OES programs, whereas the ECEC and benefits estimates use current weights from the CES program. Benchmarking, is the process of adjusting the weight of each establishment in the survey to match the most current distribution of employment by industry.
The private industry sample also uses establishment employment size class in the benchmarking process. The NCS establishment sample is drawn from the Quarterly Census of Employment and Wages (QCEW). The QCEW and the railroad information provide employment data, but because these sources do not have current employment data, the CES is used to adjust employment. The benchmark process updates the initial establishment weights, assigned during sampling, by current employment. Establishment weights reflect employment at the time of sampling, not collection. Benchmarking ensures that survey estimates reflect the most current industry composition–employment counts in proportions consistent with the private industry, state government, and local government sectors (hereafter, ownership).
For example, 40 private industry, 10 local government, and 5 state government units in the service sector were selected from the sampling frame made up of establishments employing 200,000 private workers, 30,000 local government workers, and 10,000 state government workers. By the time of survey processing, the private service sector employment increased by 10,000 workers, or 5 percent, with no increase in employment in the service sectors of state and local government. In the absence of benchmarking, the sample would underrepresent current employment in the private industry service sector. In this example, the NCS adjusts the sample weights of the 40 service sector firms in private industry to ensure that the number of workers in establishments in the sampling frame rises to 210,000. The ownership employment counts for the private industry service sector would then reflect the current proportions of 84 percent for private industry, 12 percent for local government, and 4 percent for state government employment.
Calculating estimate reliability
Two types of errors are possible in an estimate based on a sample survey: sampling errors and nonsampling errors. Sampling errors occur because the sample makes up only a part of the population it represents. The sample used for the survey is one of a number of possible samples that could have been selected under the sample design, each producing its own estimate. A measure of the variation among sample estimates is the standard error. Nonsampling errors are data errors that stem from any source other than sampling error, such as data collection errors and data-processing errors.
Standard errors can be used to measure the precision with which an estimate from a particular sample approximates the expected result of all possible samples. The chances are about 68 out of 100 that an estimate from the survey differs from a complete population figure by less than the standard error. The chances are about 90 out of 100 that this difference is less than 1.6 times the standard error. Statements of comparison appearing in NCS publications are significant at a level of 1.6 standard errors or better. This means that, for differences cited, the estimated difference is less than 1.6 times the standard error of the difference. To assist users in ascertaining the reliability of NCS series, standard errors or relative standard errors for NCS estimates are available online.
The ECI, ECEC, and benefits publications all use some variation of balanced repeated replication (BRR), a methodology employed to estimate the standard error. The procedure for BRR entails first partitioning the sample into 120 variance strata composed of a single sampling stratum or clusters of sampling strata, and then splitting the sample units in each variance stratum evenly into two variance primary sampling units (PSUs). Next, half-samples are chosen, so that each contains exactly one variance PSU from each variance stratum. Choices are not random, but are designed to yield a “balanced” collection of half-samples. For each half-sample, a “replicate” estimate is computed with the same formula for the regular, or “full-sample,” estimate, except that the final weights are adjusted. A total of 120 replicates are used in this process. If a unit is in the half-sample, its weight is multiplied by (2 – k); if not, its weight is multiplied by k. For all NCS publications, k = 0.5, so the multipliers are 1.5 and 0.5.
The BRR estimate of standard error with R half-sample replicates is
where
the summation is over all half-sample replicates r = 1,...,R,
is the rth half-sample replicate estimate, and
is the full-sample estimate.
Percent relative standard error data are provided alongside estimates in NCS ECEC publications, which display the standard error as a percentage of the full-sample estimate.
The percent relative standard error is given by
%RSE )/.
Data collection and processing errors are mitigated primarily through quality assurance programs that include the use of data collection reinterviews, observed interviews, computer edits of the data, and a systematic professional review of the data. The programs also serve as a training device to provide feedback to field economists, or data collectors, on errors and the sources of errors that can be remedied by improved collection instructions or computer-processing edits. Extensive training of field economists is conducted to maintain high standards in data collection.
Once estimates of compensation cost changes, of wage and compensation cost levels, or of benefit provisions are produced, the estimates are verified, or validated. The focus of the verification at this stage is a comparison of the estimates with their expected values, which are based on economic conditions; recent trends in similar data; and values prevalent in the recent past as broken out by industry, occupation, bargaining status, region of the country, type of compensation, and other characteristics. Anomalies, such as wage changes outside the historical range, are identified, reviewed, and explained. Estimates are reviewed to ensure respondent confidentiality and specified statistical reliability. Estimates that meet this criteria are designated as “fit for use” and published.
Reliability of the ECI estimates
To assist users in evaluating the reliability of indexes, standard errors for ECI estimates, excluding seasonally adjusted series, are available.
Reliability of the ECEC estimates
To assist users in evaluating the reliability of ECEC estimates, relative standard errors are available for News Release (TXT) (PDF) and Supplemental Private Industry (TXT) (PDF) tables.
Reliability of the benefits estimates
To assist users in evaluating the reliability of benefit estimates, standard errors are available for incidence estimates. | 2019-05-24T08:48:20 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 22, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.46667635440826416, "perplexity": 3483.2240303842304}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232257601.8/warc/CC-MAIN-20190524084432-20190524110432-00366.warc.gz"} |
https://bison.inl.gov/Documentation/source/problems/DumpObjectsProblem.aspx | DumpObjectsProblem
Single purpose problem object that does not run the given input but allows deconstructing actions into their series of underlying Moose objects and variables.
Run any input file overriding the Problem/type parameter to DumpObjectsAction and setting the Problem/dump_path parameter to the full _hit_ input file syntax path of an action to dump the individual Moose objects and variables created by the action.
After the parse and setup stage the DumpObjectsProblem will not execute the input any further. Any objects created and parameters set by the selected action will be dumped to the screen and Moose will halt execution.
Example
The input file two_block_new.i is a test for the TensorMechanics master action, an action that sets up (aux)variables, (aux)kernels, and materials for mechanics probems. Let's see if we can examine what exactly a particular action block ([./block2]) in this file sets up.
Compile the tensor_mechanics module executable and run
./tensor_mechanics-opt -i test/tests/action/two_block_new.i Problem/type=DumpObjectsProblem Problem/dump_path=Modules/TensorMechanics/Master/block2
You should obtain the output
[AuxKernels]
[./stress_xx_block2]
type = RankTwoAux
block = 2
execute_on = TIMESTEP_END
index_i = 0
index_j = 0
rank_two_tensor = stress
variable = stress_xx
[../]
[./strain_yy_block2]
type = RankTwoAux
block = 2
execute_on = TIMESTEP_END
index_i = 1
index_j = 1
rank_two_tensor = total_strain
variable = strain_yy
[../]
[]
[AuxVariables]
[./stress_xx]
blocks = '1 2'
family = MONOMIAL
order = CONSTANT
[../]
[./strain_yy]
blocks = '1 2'
family = MONOMIAL
order = CONSTANT
[../]
[]
[Kernels]
[./TM_block20]
type = StressDivergenceTensors
block = 2
component = 0
displacements = 'disp_x disp_y'
use_displaced_mesh = true
variable = disp_x
[../]
[./TM_block21]
type = StressDivergenceTensors
block = 2
component = 1
displacements = 'disp_x disp_y'
use_displaced_mesh = true
variable = disp_y
[../]
[]
[Materials]
[./block2_strain]
type = ComputeFiniteStrain
block = 2
displacements = 'disp_x disp_y'
[../]
[]
[Variables]
[./disp_x]
blocks = '1 2'
[../]
[./disp_y]
blocks = '1 2'
[../]
[]
which is what the
[Modules/TensorMechanics/Master]
# parameters that apply to all subblocks are specified at this level. They
# can be overwritten in the subblocks.
strain = FINITE
generate_output = 'stress_xx'
[./block1]
# the block parameter is only valid insde a subblock.
block = 1
[../]
[./block2]
block = 2
# the additional_generate_output parameter is also only valid inside a
# subblock. Values specified here are appended to the generate_output
# parameter values.
[../]
[]
(moose/modules/tensor_mechanics/test/tests/action/two_block_new.i)
block in this input file creates.
The AuxVariables and AuxKernels are triggered by the generate_outputs parameter, the Kernels are informed by the choice of coordinate system, as is the finite strain calculator material.
Note that this particular action creates Moose objects only for the selected blocks, while it sets up Moose variables for the set union of all blocks handled by the action.
Input Parameters
• dump_pathSyntax path of the action of which to dump the generated syntax
C++ Type:std::string
Description:Syntax path of the action of which to dump the generated syntax
Required Parameters
• skip_additional_restart_dataFalseTrue to skip additional data in equation system for restart. It is useful for starting a transient calculation with a steady-state solution
Default:False
C++ Type:bool
Description:True to skip additional data in equation system for restart. It is useful for starting a transient calculation with a steady-state solution
• use_nonlinearTrueDetermines whether to use a Nonlinear vs a Eigenvalue system (Automatically determined based on executioner)
Default:True
C++ Type:bool
Description:Determines whether to use a Nonlinear vs a Eigenvalue system (Automatically determined based on executioner)
• error_on_jacobian_nonzero_reallocationFalseThis causes PETSc to error if it had to reallocate memory in the Jacobian matrix due to not having enough nonzeros
Default:False
C++ Type:bool
Description:This causes PETSc to error if it had to reallocate memory in the Jacobian matrix due to not having enough nonzeros
• force_restartFalseEXPERIMENTAL: If true, a sub_app may use a restart file instead of using of using the master backup file
Default:False
C++ Type:bool
Description:EXPERIMENTAL: If true, a sub_app may use a restart file instead of using of using the master backup file
• ignore_zeros_in_jacobianFalseDo not explicitly store zero values in the Jacobian matrix if true
Default:False
C++ Type:bool
Description:Do not explicitly store zero values in the Jacobian matrix if true
• null_space_dimension0The dimension of the nullspace
Default:0
C++ Type:unsigned int
Description:The dimension of the nullspace
• solveTrueWhether or not to actually solve the Nonlinear system. This is handy in the case that all you want to do is execute AuxKernels, Transfers, etc. without actually solving anything
Default:True
C++ Type:bool
Description:Whether or not to actually solve the Nonlinear system. This is handy in the case that all you want to do is execute AuxKernels, Transfers, etc. without actually solving anything
• transpose_null_space_dimension0The dimension of the transpose nullspace
Default:0
C++ Type:unsigned int
Description:The dimension of the transpose nullspace
• near_null_space_dimension0The dimension of the near nullspace
Default:0
C++ Type:unsigned int
Description:The dimension of the near nullspace
Optional Parameters
• control_tagsAdds user-defined labels for accessing object parameters via control logic.
C++ Type:std::vector
Description:Adds user-defined labels for accessing object parameters via control logic.
• enableTrueSet the enabled status of the MooseObject.
Default:True
C++ Type:bool
Description:Set the enabled status of the MooseObject. | 2020-11-26T21:45:26 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.3322986364364624, "perplexity": 6793.326657657542}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141188947.19/warc/CC-MAIN-20201126200910-20201126230910-00242.warc.gz"} |
https://par.nsf.gov/biblio/10097648-star-formation-galaxies-undergraduate-alfalfa-team-groups-clusters | Star Formation in Galaxies in Undergraduate ALFALFA Team Groups and Clusters
The Undergraduate ALFALFA Team (UAT) Groups project is a coordinated study of gas and star formation properties of galaxies in and around more than 50 nearby (z<0.03) groups and clusters of varied richness, morphological type mix, and X-ray luminosity. We aim to probe mechanisms of gas depletion and morphological transformation by considering the spatial distributions of star formation in galaxies inhabiting a wide range of group and cluster environments. Here we present recent results from our wide area Hα and broadband R imaging project carried out with the WIYN 0.9m+MOSAIC/HDI at KPNO. This work has been supported by NSF grant AST-1211005 and AST-1637339.
Authors:
; ; ; ; ;
Award ID(s):
Publication Date:
NSF-PAR ID:
10097648
Journal Name:
American Astronomical Society, AAS Meeting
Volume:
233
Page Range or eLocation-ID:
144.20
4. ABSTRACT We report the formation of bound star clusters in a sample of high-resolution cosmological zoom-in simulations of z ≥ 5 galaxies from the Feedback In Realistic Environments project. We find that bound clusters preferentially form in high-pressure clouds with gas surface densities over $10^4\, \mathrm{ M}_{\odot }\, {\rm pc}^{-2}$, where the cloud-scale star formation efficiency is near unity and young stars born in these regions are gravitationally bound at birth. These high-pressure clouds are compressed by feedback-driven winds and/or collisions of smaller clouds/gas streams in highly gas-rich, turbulent environments. The newly formed clusters follow a power-law mass function ofmore » | 2022-06-30T11:25:12 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.663977324962616, "perplexity": 5196.410112681438}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103671290.43/warc/CC-MAIN-20220630092604-20220630122604-00437.warc.gz"} |
https://mooseframework.inl.gov/syntax/Problem/index.html | # Problem system overview
The Problem class is one of the core extension points in MOOSE. Problems are designed to hold the EquationSystems objects (from libMesh) that house the numerical systems we are ultimately solving for our computing.
Fortunately when you are first getting started with MOOSE you normally don't have to worry or do anything special with the Problem object. MOOSE automatically constructs a suitable Problem for your simulation type taking into account the other types of objects present in the input file. Most simulations use the FEProblem class, which contains a single NonlinearSystem and single AuxiliarySystem or a single MooseEigenSystem and single AuxiliarySystem. The NonlinearSystem or MooseEigenSystem contains the matrix and vectors used for solving the equations implemented through a combination of other objects in your simulations (Kernels, BCs, etc.). The AuxiliarySystem houses the solution vectors use to hold computed solutions or values.
As your application grows in complexity, you may find it useful or necessary to create your own problems to extend default behavior provided by the core MOOSE framework. Common examples include, specialized convergence tests, etc.
# Automatic Problem Creation
The automatic problem creation is handled for you by MOOSE. In a normal input file that does not contain a special [Problem] block, MOOSE will create a suitable Problem for you. If however, you need to change specific system related parameters you may find yourself adding a [Problem] block with name/value pairs. Different types of Problems may be instantiated by using the /Problem/type whose default value is FEProblem.
# Problem System
## Available Objects
• Moose App
• DisplacedProblem
• DumpObjectsProblemSingle purpose problem object that does not run the given input but allows deconstructing actions into their series of underlying Moose objects and variables.
• EigenProblem
• FEProblem
• Level Set App
• LevelSetProblemA specilized problem class that adds a custom call to MultiAppTransfer execution to transfer adaptivity for the level set reinitialization.
• LevelSetReinitializationProblemA specialied problem that has a method for resetting time for level set reinitialization execution.
• External Petsc Solver App
• ExternalPETScProblemProblem extension point for wrapping external applications
• Contact App
• AugmentedLagrangianContactProblemProblem that checks for convergence relative to a user-supplied reference quantity rather than the initial residual
• ReferenceResidualProblemProblem that checks for convergence relative to a user-supplied reference quantity rather than the initial residual | 2019-04-23T12:38:42 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.21926012635231018, "perplexity": 3505.5249421800227}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578602767.67/warc/CC-MAIN-20190423114901-20190423140901-00172.warc.gz"} |
https://mooseframework.inl.gov/modules/porous_flow/tests/heat_advection/heat_advection_tests.html | # Heat advection in a 1D bar
Consider the case of a single-phase fluid in 1 dimension, , with the porepressure fixed at the boundaries: (1) With zero gravity, and high fluid bulk modulus, the Darcy equation implies that the solution is , with (2) being the constant "Darcy velocity" from to . (The velocity of the individual fluid particles, this is divided by the porosity.). Here is the porous medium's permeability, and is the fluid dynamic viscosity.
Suppose that the fluid internal energy is given by , where is the specific heat capacity and is its temperature. Assuming that , then the fluid's enthalpy is also . In this case, the energy equation reads (3) This is the wave equation with velocity (4) Recall that the "Darcy velocity" is .
Let the initial condition for be . Apply the boundary conditions (5) At this creates a front at . Choose the parameters , , , , , , (all in consistent units), so that is the front's velocity.
The input file:
# 1phase, heat advecting with a moving fluid
[Mesh]
type = GeneratedMesh
dim = 1
nx = 50
xmin = 0
xmax = 1
[]
[GlobalParams]
PorousFlowDictator = dictator
gravity = '0 0 0'
[]
[Variables]
[./temp]
initial_condition = 200
[../]
[./pp]
[../]
[]
[ICs]
[./pp]
type = FunctionIC
variable = pp
function = '1-x'
[../]
[]
[BCs]
[./pp0]
type = PresetBC
variable = pp
boundary = left
value = 1
[../]
[./pp1]
type = PresetBC
variable = pp
boundary = right
value = 0
[../]
[./spit_heat]
type = PresetBC
variable = temp
boundary = left
value = 300
[../]
[./suck_heat]
type = PresetBC
variable = temp
boundary = right
value = 200
[../]
[]
[Kernels]
[./mass_dot]
type = PorousFlowMassTimeDerivative
fluid_component = 0
variable = pp
[../]
fluid_component = 0
variable = pp
[../]
[./energy_dot]
type = PorousFlowEnergyTimeDerivative
variable = temp
[../]
variable = temp
[../]
[]
[UserObjects]
[./dictator]
type = PorousFlowDictator
porous_flow_vars = 'temp pp'
number_fluid_phases = 1
number_fluid_components = 1
[../]
[./pc]
type = PorousFlowCapillaryPressureVG
m = 0.6
alpha = 1.3
[../]
[]
[Modules]
[./FluidProperties]
[./simple_fluid]
type = SimpleFluidProperties
bulk_modulus = 100
density0 = 1000
viscosity = 4.4
thermal_expansion = 0
cv = 2
[../]
[../]
[]
[Materials]
[./temperature]
type = PorousFlowTemperature
temperature = temp
[../]
[./porosity]
type = PorousFlowPorosityConst
porosity = 0.2
[../]
[./rock_heat]
type = PorousFlowMatrixInternalEnergy
specific_heat_capacity = 1.0
density = 125
[../]
[./simple_fluid]
type = PorousFlowSingleComponentFluid
fp = simple_fluid
phase = 0
[../]
[./permeability]
type = PorousFlowPermeabilityConst
permeability = '1.1 0 0 0 2 0 0 0 3'
[../]
[./relperm]
type = PorousFlowRelativePermeabilityCorey
n = 2
phase = 0
[../]
[./massfrac]
type = PorousFlowMassFraction
[../]
[./PS]
type = PorousFlow1PhaseP
porepressure = pp
capillary_pressure = pc
[../]
[]
[Preconditioning]
[./andy]
type = SMP
full = true
petsc_options_iname = '-ksp_type -pc_type -snes_atol -snes_rtol -snes_max_it'
petsc_options_value = 'gmres bjacobi 1E-15 1E-10 10000'
[../]
[]
[Executioner]
type = Transient
solve_type = Newton
dt = 0.01
end_time = 0.6
[]
[VectorPostprocessors]
[./T]
type = LineValueSampler
start_point = '0 0 0'
end_point = '1 0 0'
num_points = 51
sort_by = x
variable = temp
[../]
[]
[Outputs]
[./csv]
type = CSV
sync_times = '0.1 0.6'
sync_only = true
[../]
[]
The sharp front is not maintained by MOOSE. This is due to numerical diffusion, which is particularly strong when full upwinding is used. This is explained in great detail in the pages on numerical stabilization. Nevertheless, MOOSE advects the smooth front with the correct velocity, as shown in Figure 1.
The sharp front is not maintained by MOOSE even when no upwinding is used. In the case at hand, which uses a fully-saturated single-phase fluid, the FullySaturatedHeatAdvection Kernel may be used in order to compare with the standard fully-upwinded Kernels. The input file using the fully-saturated approach:
# 1phase, heat advecting with a moving fluid
# Using the FullySaturated Kernel
[Mesh]
type = GeneratedMesh
dim = 1
nx = 50
xmin = 0
xmax = 1
[]
[GlobalParams]
PorousFlowDictator = dictator
gravity = '0 0 0'
[]
[Variables]
[./temp]
initial_condition = 200
[../]
[./pp]
[../]
[]
[ICs]
[./pp]
type = FunctionIC
variable = pp
function = '1-x'
[../]
[]
[BCs]
[./pp0]
type = PresetBC
variable = pp
boundary = left
value = 1
[../]
[./pp1]
type = PresetBC
variable = pp
boundary = right
value = 0
[../]
[./spit_heat]
type = PresetBC
variable = temp
boundary = left
value = 300
[../]
[./suck_heat]
type = PresetBC
variable = temp
boundary = right
value = 200
[../]
[]
[Kernels]
[./mass_dot]
type = PorousFlowMassTimeDerivative
fluid_component = 0
variable = pp
[../]
type = PorousFlowFullySaturatedDarcyBase
variable = pp
[../]
[./energy_dot]
type = PorousFlowEnergyTimeDerivative
variable = temp
[../]
[./convection]
variable = temp
[../]
[]
[UserObjects]
[./dictator]
type = PorousFlowDictator
porous_flow_vars = 'temp pp'
number_fluid_phases = 1
number_fluid_components = 1
[../]
[]
[Modules]
[./FluidProperties]
[./simple_fluid]
type = SimpleFluidProperties
bulk_modulus = 100
density0 = 1000
viscosity = 4.4
thermal_expansion = 0
cv = 2
[../]
[../]
[]
[Materials]
[./temperature]
type = PorousFlowTemperature
temperature = temp
[../]
[./porosity]
type = PorousFlowPorosityConst
porosity = 0.2
[../]
[./rock_heat]
type = PorousFlowMatrixInternalEnergy
specific_heat_capacity = 1.0
density = 125
[../]
[./simple_fluid]
type = PorousFlowSingleComponentFluid
fp = simple_fluid
phase = 0
[../]
[./permeability]
type = PorousFlowPermeabilityConst
permeability = '1.1 0 0 0 2 0 0 0 3'
[../]
[./massfrac]
type = PorousFlowMassFraction
[../]
[./PS]
type = PorousFlow1PhaseFullySaturated
porepressure = pp
[../]
[]
[Preconditioning]
[./andy]
type = SMP
full = true
petsc_options_iname = '-ksp_type -pc_type -snes_atol -snes_rtol -snes_max_it'
petsc_options_value = 'gmres bjacobi 1E-15 1E-10 10000'
[../]
[]
[Executioner]
type = Transient
solve_type = Newton
dt = 0.01
end_time = 0.6
[]
[VectorPostprocessors]
[./T]
type = LineValueSampler
start_point = '0 0 0'
end_point = '1 0 0'
num_points = 51
sort_by = x
variable = temp
[../]
[]
[Outputs]
[./csv]
type = CSV
sync_times = '0.1 0.6'
sync_only = true
[../]
[]
The FullySaturated Kernels do not employ any upwinding whatsoever, so less numerical diffusion is expected. This is demonstrated in Figure 1. Two additional points may also be nocied: (1) the lack of upwinding has produced a "bump" in the temperature profile near the hotter side; (2) the lack of upwinding means the temperature profile moves slightly slower than it should. These two affects reduce as the mesh density is increased, however.
Finally, the same simulation may be run using Kuzmin-Turek stabilization, with input file (that employs the PorousFlowFullySaturated Action):
# 1phase, heat advecting with a moving fluid
# Using the PorousFlowFullySaturated Action with KT stabilization
# This should produce an identical result to heat_advection_1D_KT
[Mesh]
type = GeneratedMesh
dim = 1
nx = 50
xmin = 0
xmax = 1
[]
[GlobalParams]
PorousFlowDictator = dictator
gravity = '0 0 0'
[]
[Variables]
[./temp]
initial_condition = 200
[../]
[./pp]
[../]
[]
[ICs]
[./pp]
type = FunctionIC
variable = pp
function = '1-x'
[../]
[]
[BCs]
[./pp0]
type = PresetBC
variable = pp
boundary = left
value = 1
[../]
[./pp1]
type = PresetBC
variable = pp
boundary = right
value = 0
[../]
[./spit_heat]
type = PresetBC
variable = temp
boundary = left
value = 300
[../]
[./suck_heat]
type = PresetBC
variable = temp
boundary = right
value = 200
[../]
[]
[PorousFlowFullySaturated]
porepressure = pp
temperature = temp
coupling_type = ThermoHydro
fp = simple_fluid
stabilization = KT
flux_limiter_type = superbee
[]
[Modules]
[./FluidProperties]
[./simple_fluid]
type = SimpleFluidProperties
bulk_modulus = 100
density0 = 1000
viscosity = 4.4
thermal_expansion = 0
cv = 2
[../]
[../]
[]
[Materials]
[./porosity]
type = PorousFlowPorosityConst
porosity = 0.2
[../]
[./zero_thermal_conductivity]
type = PorousFlowThermalConductivityIdeal
dry_thermal_conductivity = '0 0 0 0 0 0 0 0 0'
[../]
[./rock_heat]
type = PorousFlowMatrixInternalEnergy
specific_heat_capacity = 1.0
density = 125
[../]
[./permeability]
type = PorousFlowPermeabilityConst
permeability = '1.1 0 0 0 2 0 0 0 3'
[../]
[]
[Preconditioning]
[./andy]
type = SMP
full = true
[../]
[]
[Executioner]
type = Transient
solve_type = Newton
dt = 0.01
end_time = 0.6
[]
[VectorPostprocessors]
[./T]
type = LineValueSampler
start_point = '0 0 0'
end_point = '1 0 0'
num_points = 51
sort_by = x
variable = temp
[../]
[]
[Outputs] | 2019-05-27T05:53:13 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.539560079574585, "perplexity": 12117.869242729565}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232261326.78/warc/CC-MAIN-20190527045622-20190527071622-00305.warc.gz"} |
https://bison.inl.gov/Documentation/source/materials/RelocationUO2.aspx | # Relocation in UOvar element = document.getElementById("moose-equation-6b3797f4-b3a9-456a-97f3-28de7fb8b36b");katex.render("_2", element, {displayMode:false,throwOnError:false});
This model accounts for cracking and relocation of fuel pelletfragments in the radial direction
warning:Deprecated Solid Mechanics Material
The functionality of this solid mechanics material is being replaced in the TensorMechanics system by UO2RelocationEigenstrain.
## Description
The RelocationUO2 model accounts for cracking and relocation of fuel pellet fragments in the radial direction. This model is necessary for accurate modeling of LWR fuel. Only one of q and q_variable may be given.
One way to model the effect of UO cracking on gap width is fuel relocation. Thermal gradients in a LWR fuel pellet result in corresponding stress gradients that exceed the fuel fracture stress, causing radial cracks. The free surfaces of the crack result in a overall increase of fuel pellet diameter. This effect can be modeled by applying a radial strain to the fuel pellet. This strain is similar to a volumetric strain, but only in the radial direction.
## ESCORE Relocation Model
A method for calculating this radial strain is the ESCORE relocation model (M. A. Kramman, 1987) which is given as (1) This relocation model is a function of power, as-fabricated pellet diameter, as-fabricated gap thickness, and burnup. The model is applicable between 8 and 22 kW/ft and to burnup levels between 0 and 11,500 MWd/MTU, and mean-diameter measurements were used in the correlation development.
Table 1: Variable Definitions for the Relocation UO Models
Model ExpressionParameter Description
Diametral strain due to relocation
As-fabricated cold diameter of the pellet (in)
Pellet average linear heating rate (kW/ft)
Pellet average fuel burnup (MWd/MTU)
As-fabricated cold diametral gap (in)
note:Diametral Gap asFuel Pellet Geometry Parameter
The UO2Relocation model uses the diametral gap to determine the spacing between the fuel pellets and clad. The use of the diametral gap measure is a contrast from other Bison classes which use the radial gap measure.
The value of the parameter in Eq. 1 depends on the value of the linear heat rate: (2) where is defined as 6 kW/ft and is defined to be 14 kW/ft. The fuel relocation strain is applied incrementally by calculating the relocation strain at the burnup for the current step and subtracting the relocation strain at the previous burnup. In other applications of this model, the addition of relocation strain is stopped when the gap is closed. In Bison, the relocation strain is stopped at a specified burnup.
Note that the pellet average linear heating rate in Eq. 2 and Table 1 has units of kW/ft in the empirical model; however, this quantity is passed into the model as a function with units of W/m. The conversion is handled inside the model.
## Modified ESCORE Model
It has been observed that the 6 kW/ft threshold for the initiation of relocation is well beyond the level expected to cause cracking in the fuel. For this reason, a modified ESCORE model is available in Bison: (3) when is less than and is less than 6 kW/ft.
It is also possible to use the GAPCON model for relocation (Lassmann and Blank, 1988). This model is given as (4) where is the displacement due to relocation, , is the linear heating rate (kW/m), is burnup (MWd/MTU), and is the as-fabricated cold gap.
## Example Input Syntax
[./swelling]
type = RelocationUO2
block = 1
burnup = burnup
diameter = 0.00254
q = q
gap = 0.0000254
#Put this limit in here to test it. We'll hit it at time 1.5,
#at which point all relocation strains should stop growing.
burnup_relocation_stop = .18
[../]
(test/tests/relocation_UO2/relocation_UO2_attached_rz.i)
## Input Parameters
• diameterAs fabricated cold diameter of pellet in meters
C++ Type:double
Description:As fabricated cold diameter of pellet in meters
• gap_scalef1scaling factor for gap size
Default:1
C++ Type:double
Description:scaling factor for gap size
• recovered_relocation_strain0.001Recovered relocation strain in the hard pellet cladding contact
Default:0.001
C++ Type:double
Description:Recovered relocation strain in the hard pellet cladding contact
• relocation_scalef1scaling factor for relocation
Default:1
C++ Type:double
Description:scaling factor for relocation
• burnup_functionBurnup function
C++ Type:BurnupFunctionName
Description:Burnup function
• qFunction describing linear heat rate in pellet in W/m
C++ Type:FunctionName
Description:Function describing linear heat rate in pellet in W/m
• relocation_activation332808.4Third activation linear power in W/m term in relocation model
Default:32808.4
C++ Type:double
Description:Third activation linear power in W/m term in relocation model
C++ Type:std::vector
• boundaryThe list of boundary IDs from the mesh where this boundary condition applies
C++ Type:std::vector
Description:The list of boundary IDs from the mesh where this boundary condition applies
• gapAs fabricated cold diametral pellet-cladding gap in meters
C++ Type:double
Description:As fabricated cold diametral pellet-cladding gap in meters
• model_volumetric_scalingTrueWhether to scale relocation strains so that they are applied to the current volume.Setting this to 'false' applies them to the original volume,which matches the behavior of the tensor_mechanics implementation of this model.
Default:True
C++ Type:bool
Description:Whether to scale relocation strains so that they are applied to the current volume.Setting this to 'false' applies them to the original volume,which matches the behavior of the tensor_mechanics implementation of this model.
• model_relocation_recoveryFalseoption to turn on the modeling of relocation recovery
Default:False
C++ Type:bool
Description:option to turn on the modeling of relocation recovery
• contact_pressurecoupled contact pressure
C++ Type:std::vector
Description:coupled contact pressure
• computeTrueWhen false, MOOSE will not call compute methods on this material. The user must call computeProperties() after retrieving the Material via MaterialPropertyInterface::getMaterial(). Non-computed Materials are not sorted for dependencies.
Default:True
C++ Type:bool
Description:When false, MOOSE will not call compute methods on this material. The user must call computeProperties() after retrieving the Material via MaterialPropertyInterface::getMaterial(). Non-computed Materials are not sorted for dependencies.
• q_variableVariable holding linear heat rate in pellet in W/m
C++ Type:std::vector
Description:Variable holding linear heat rate in pellet in W/m
• relocation_activation119685First activation linear power in W/m term in relocation model
Default:19685
C++ Type:double
Description:First activation linear power in W/m term in relocation model
• fuel_pin_geometryName of the UserObject that reads the pin geometry from the mesh.
C++ Type:UserObjectName
Description:Name of the UserObject that reads the pin geometry from the mesh.
• relocation_activation245931.8Second activation linear power in W/m term in relocation model
Default:45931.8
C++ Type:double
Description:Second activation linear power in W/m term in relocation model
• burnupCoupled Burnup
C++ Type:std::vector
Description:Coupled Burnup
• burnup_relocation_stop1e+12Burnup at which relocation strain stops (in FIMA)
Default:1e+12
C++ Type:double
Description:Burnup at which relocation strain stops (in FIMA)
• modelESCORE_modifiedRelocation model. Choices are ESCORE_modified ESCORE GAPCON
Default:ESCORE_modified
C++ Type:MooseEnum
Description:Relocation model. Choices are ESCORE_modified ESCORE GAPCON
• axial_axis1Coordinate axis of the axial direction of the fuel stack (0, 1, or 2 for x, y, or z
Default:1
C++ Type:unsigned int
Description:Coordinate axis of the axial direction of the fuel stack (0, 1, or 2 for x, y, or z
• blockThe list of block ids (SubdomainID) that this object will be applied
C++ Type:std::vector
Description:The list of block ids (SubdomainID) that this object will be applied
### Optional Parameters
• enableTrueSet the enabled status of the MooseObject.
Default:True
C++ Type:bool
Description:Set the enabled status of the MooseObject.
• use_displaced_meshFalseWhether or not this object should use the displaced mesh for computation. Note that in the case this is true but no displacements are provided in the Mesh block the undisplaced mesh will still be used.
Default:False
C++ Type:bool
Description:Whether or not this object should use the displaced mesh for computation. Note that in the case this is true but no displacements are provided in the Mesh block the undisplaced mesh will still be used.
• control_tagsAdds user-defined labels for accessing object parameters via control logic.
C++ Type:std::vector
Description:Adds user-defined labels for accessing object parameters via control logic.
• seed0The seed for the master random number generator
Default:0
C++ Type:unsigned int
Description:The seed for the master random number generator
• implicitTrueDetermines whether this object is calculated using an implicit or explicit form
Default:True
C++ Type:bool
Description:Determines whether this object is calculated using an implicit or explicit form
• constant_onNONEWhen ELEMENT, MOOSE will only call computeQpProperties() for the 0th quadrature point, and then copy that value to the other qps.When SUBDOMAIN, MOOSE will only call computeSubdomainProperties() for the 0th quadrature point, and then copy that value to the other qps. Evaluations on element qps will be skipped
Default:NONE
C++ Type:MooseEnum
Description:When ELEMENT, MOOSE will only call computeQpProperties() for the 0th quadrature point, and then copy that value to the other qps.When SUBDOMAIN, MOOSE will only call computeSubdomainProperties() for the 0th quadrature point, and then copy that value to the other qps. Evaluations on element qps will be skipped
• output_propertiesList of material properties, from this material, to output (outputs must also be defined to an output type)
C++ Type:std::vector
Description:List of material properties, from this material, to output (outputs must also be defined to an output type)
• outputsnone Vector of output names were you would like to restrict the output of variables(s) associated with this object
Default:none
C++ Type:std::vector
Description:Vector of output names were you would like to restrict the output of variables(s) associated with this object
## References
1. K. Lassmann and H. Blank. Modelling of fuel rod behavior and recent advances of the TRANSURANUS code. Nuclear Engineering Design, 106:291–313, 1988.[BibTeX]
2. Eds. M. A. Kramman, H. R. Freeburn. Escore–the epri steady-state core reload evaluator code: general description. Technical Report EPRI NP-5100, Electric Power Research Institute, February 1987.[BibTeX] | 2020-12-04T05:58:23 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.2831633985042572, "perplexity": 7501.9698870127795}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141733122.72/warc/CC-MAIN-20201204040803-20201204070803-00239.warc.gz"} |
https://www.gfdl.noaa.gov/blog_held/28-the-fruit-fly-of-climate-models/ | # 28. The “fruit fly” of climate models
Posted on May 25th, 2012 in Isaac Held's Blog
Animations of the near surface temperature (top) and upper tropospheric zonal winds (bottom) in an idealized dry atmospheric model. The first 500 days of spinup from a state of rest are shown at one frame per day for the entire globe.
As a change of pace from discussions of climate sensitivity, I’ll describe an idealized atmospheric model that I think of as an important element in a model hierarchy essential to our thinking about atmospheric circulation and climate.
Many of my colleagues are probably tired of hearing me talk about the importance for climate theory of studying a hierarchy of climate models and especially tired of hearing me make the analogy with the hierarchy of model organisms (E. Coli, yeast, fruit fly, zebra fish, mouse, etc) that biologists utilize so effectively. As I have written in a little essay on this subject, biologists have the advantage — their hierarchy is provided by nature, and the conservative character of much of evolution provides confidence that a lot of what we learn from simpler life forms carries over to more complex organisms. Climate theory requires such a hierarchy as well — how else do you go about trying to understand a complex system that you cannot easily perform controlled experiment on? — but we need to construct it ourselves, and agree among ourselves on which idealized systems to study intensively. For a discussion of the atmospheric circulation from the perspective of the insights gained from working with a hierarchy of atmospheric models, see the excellent review by Schneider 2006.
The model I’ll describe here is of a dry atmosphere, an ideal gas on a spherical rotating planet forced only by radiative fluxes — modeled as a simple relaxation of temperature to a “radiative equilibrium” that is a function of latitude and pressure — and a frictional force that relaxes the flow near the surface to zero (in the reference frame rotating with the surface). The model equations are described in Held and Suarez. You can get a feeling for how this and similar setups have been utilized, both for testing numerical methods and for exploring climate dynamics, by googling held suarez idealized gcm.
The model is designed to capture some of the complexity of midlatude jets and storms tracks on a rotating sphere. The climate that emerges (the statistics of the winds and temperatures) has a lot of features that are quite Earth-like. The animations at the top show the near surface temperature and the upper tropospheric zonal (east-west) component of the winds spinning up from a state of rest, using a vanilla spectral model with modest resolution — 20 vertical levels and T42 horizontal resolution — meaning that all fields are expressed as sums over the spherical harmonics $Y_{ell}^m$ with total wavenumber $ell le 42$. Here’s a plot of the time-averaged zonally-averaged zonal winds (zonal => east-west) produced by this model (actually an average over the 2,000 days following the 500 day spinup shown in the animations). The contour interval is 5m/s. The zero contour meets the surface near 30 and 60 degrees latitude.
I have starting calling this the fruit fly of climate models. I am not expecting this terminology to catch on, but fruit fly seems about right to me — the model is complex enough to be turbulent and chaotic, with a lot of space and times scales involved, and I think it repays close study, but it is missing many sources of complexity present in the Earth’s atmosphere, and in more comprehensive models. In particular, there are no clouds or even water vapor .
Here’s how the time and zonally averaged winds near the surface change as you increase or decrease the rotation rate by modest amounts from it’s Earth-like value:
The circulation pattern shifts polewards as the rotation rate decreases. The location of the midlatitude westerlies marks the location of the storm tracks, and the transition from easterlies to westerlies in the subtropics marks the region of mean subsidence that generates the subtropical arid zones — in models with water vapor and precipitation. So understanding shifts like these can be important for a lot of reasons. We can think of this problem as a test of our ability to reason about this kind of thing, before tackling the question of circulation shifts in response to global warming.
Gang Chen, Walter Robinson and I looked at how this pattern shifts as the strength of the surface drag is increased or decreased with this same setup in a 2007 paper. The circulation moves polewards as the drag per unit surface wind is reduced — ie, as one makes the surface smoother. We offer an explanation in the paper, but I don’t think we understand it as well as the rotation dependence. The same dependence survives in more comprehensive GCMs — a rougher (sorry – smoother 5/30/12) land surface moves the westerlies and the storm track polewards and decreases polar surface pressures — and is a significant issue when trying to understand model biases and inter-model differences.
If you vary the rotation rate over a larger range in this model, more dramatic things happen. For high rotation rates, the circulation takes on a Jovian appearance with multiple jets in each hemisphere; at very low rotation rates, it looks more Venusian, with a Hadley cell extending from equator to pole and with the upper tropospheric flow resembling solid body rotation at an angular velocity larger than that of the surface (a “superrotating” state). Does this model ever generate bifurcations — abrupt changes in climate at particular values of a parameter? See, in this regard, the new paper by Wang, Gerber, and Polvani. (They modify the model described here in a couple of ways, by changing the radiative equilibrium temperatures and by adding some idealized topography, both designed to create a more plausible stratospheric circulation.) They present evidence for an abrupt change as they warm the upper troposphere of the model.
One way that this model helps me is when I am exposed to a new idea for, say, the time-averaged state of the atmosphere — perhaps for the equator-pole temperature gradient, or the globally averaged kinetic energy generation and dissipation. (For example, there are suggestions that simple variational principles explain these things.) The first thing I do is ask if there is anything in the formulation of the theory that precludes it from being applied to this relatively simple atmosphere-like model. (The fruit fly can’t be used to study immunological responses only found in vertebrates, say.) If not, we can go ahead and test the theory. In my experience, it is often better to be less ambitious and develop and test theories for these turbulent chaotic flows directly, and only after proving them to be useful in idealized contexts make a case for their relevance to the real world.
[The views expressed on this blog are in no sense official positions of the Geophysical Fluid Dynamics Laboratory, the National Oceanic and Atmospheric Administration, or the Department of Commerce.]
## 24 thoughts on “28. The “fruit fly” of climate models”
1. Wow, I completely agree with you. As a planetary atmosphere student who has also taken a grad-lvl Biology of Aging course (and who has read a lot of papers about mice/C. elegans/Drosophila as model organisms), I’m glad to know that someone else has tried to make the connection between model organisms and atmospheric models.
We have so many different models of model organisms, and in many cases, research that applies to one variant of Drosophila may not necessarily apply to another variant of Drosophila (but it often gets published anyways and ends up in the news, which can really misrepresent things). The same thing also applies to climate models too (though it’s much easier with climate modelling since you don’t have so much genetic drift with climate models). With that all said, I think it’s still very useful when we do rotation rate research with climate models. I did some rotation rate/Hadley Circulation research with CAM3 and even though I would never publish the work given the shortcomings of CAM3 with changing the rotation rate, I still think that the work provides A LOT of interesting/useful information about CAM3 itself.
1. “Climate theory requires such a hierarchy as well — how else do you go about trying to understand a complex system that you cannot easily perform controlled experiment on? — but we need to construct it ourselves, and agree among ourselves on which idealized systems to study intensively”
Speaking of which, I think that if we could do this, and crowdsource a lot of the work (which wouldn’t be hard to do), we could get A LOT done. Especially since climate modelling research is A LOT cleaner, cheaper, and simpler than biological research, yet it attracts far fewer people for some reason.
2. Pat Cassen says:
Dr. Held – Thanks for this post. I am a big fan of these kinds of stripped down models. Not only can they be used to test a new idea or theory, but they can illustrate/demonstrate fundamental behavior for which the mathematical theory might be somewhat opaque.
For instance, you refer to the possible effects of an altered average pole-equator temperature gradient. Francis and Vavrus (and others) have pointed out that a reduced pole-equator gradient diminishes the geostrophic winds, and assert that this effect “promote[s] higher amplitude and slower moving [Rossby] waves”, with consequences for weather.
I would think that this effect could be readily demonstrated in the model described here, and would be a great tool for public education, a subject of interest to me. I hope you plan to pursue this particular application.
1. Isaac Held says:
Yes, this does look like a good problem for attack with a hierarchy of idealized models. Does the planetary wave spectrum shift to more quasi-stationary features in response to high latitude warming, resulting in an increase in low frequency climate anomalies? One study on the effects of polar warming in this dry idealized GCM is Son and Lee, 2005, but I do not believe that they looked at the response of the frequency spectrum of planetary waves. On an intuitive level, I would agree that any weakening of upper level winds would likely encourage more low frequency wave activity in this kind of model, by slowing down the eastward phase speeds. But models with zonally symmetric climates, without large scale orographic features like Tibet and the Rockies, and without land-ocean thermal contrasts, produce weak wave activity at low frequencies — so I suspect that this would require a bit more than the fruit fly model. There is likely other work that I am not aware of. If a case could be made for this effect at several levels of a model hierarchy, I think we could return to the kind of observational analysis in this paper with a sharper focus.
3. Guenter Hess says:
Dear Prof. Held,
I always enjoy your educational blog. I am looking for papers or comments about horizontal and vertical atmospheric temperature distributions in a dry and wet atmosphere with and without greenhouse gases at different concentrations.
Best regards
Guenter
1. Isaac Held says:
Not sure if by “greenhouse gases” you mean “other than water vapor”. In any case, you might try this and references therein
4. Chris Colose says:
Isaac,
Thanks for this. I’ve studied another paper of yours, the Held and Hou model (from 1981), in a graduate class this last year and did a report on it. The rather simple mathematical expressions that can be used to dissect some of the broad features of the general circulation are quite fascinating, despite the limitations presented by the assumptions used.
One question I had regarding that class of model- I have never really been able to find a physical justification (or perhaps my intuition is just not good) for the dependence of the Hadley circulation width on the global tropopause height, a dependence that clearly emerges in mathematical expressions for the overturning circulation, and that I’ve seen invoked in the literature as an explanation for the observed Hadley expansion during global warming. Could you elaborate on some of the physics here?
1. Isaac Held says:
In the simplest Hadley cell theories, the flow in the upper troposphere is constrained by the need to conserve angular momentum as rings of air move polewards, while the surface winds are constrained to be small by surface friction, so the vertical gradient of the horizontal wind decreases when the height of the outflow from the Hadley cell rises. This vertical gradient of the horizontal winds is proportional to the horizontal temperature gradient, by what is referred to as thermal wind balance, so this gradient decreases as the vertical extent of the Hadley cell increases. All theories for the extent of the Hadley cell depend one way or the other on the build up of this temperature gradient — the smaller the gradient the more the cell expands, either until it uses up the “available” temperature differential, or until the flow becomes unstable to baroclinic instability.
More formally, both for the simplest steady state Hadley cell theories or theories for the turbulent flow in this dry GCM one can argue that the dependence of the circulation on the rotation rate $\Omega$ and on the tropopause height $H$ is primarily felt through the non-dimensional combination $gH/(\Omega a)^2$, where $g$ is the gravitational acceleration and $a$ is the radius of the planet. So the dependence on rotation rate illustrated in the post is actually very relevant to the sensitivity to the depth of the circulation as well.
But I personally doubt that this is the key to the poleward expansion seen in the comprehensive GCMs in response to warming.
1. BillC says:
For the non-specialist climate blog fan, it is interesting to try to think about how this and other archetype models might have something to say about the issues discussed on other threads – climate response to GHGs and so on. I put this comment here because Chris – a specialist – went there first! 😉
I was wondering if this sort of model is a good way to try to estimate the no-feedback climate sensitivity (the old version with constant absolute humidity)? I did look in the some of the references and didn’t find an obvious example but I surely could have missed one. Thinking out loud here I guess it could not, at least not without modification, since the incremental RF of CO2 depends on the existing concentration of water vapor in all its 3-dimensional glory (?). So my next thought is to wonder if you hold the absolute WV fixed as a non-condensing greenhouse gas, still under clear skies, how this shifts us along the evolutionary ladder between the fruit fly and a real GCM.
Undoubtedly this model experiment has been done, I just have to find it. Now reading Collins et al 2006: http://onlinelibrary.wiley.com/wol1/doi/10.1029/2005JD006713/full
1. Isaac Held says:
2. Isaac Held says:
Continuing that thought, there could be value in a model with passive water vapor and with real radiative transfer using as input this water vapor variable, but with non-interactive radiative fluxes ie, the radiative transfer is just an output that would help you study how changes in the pdf of water vapor as a parameter is changed affect the outgoing OLR — especially the spatial extent of very dry regions.
3. Jianhua Lu says:
Bill,
Ming Cai and I did an idealized simulation with a dry GCM, fixed relative (not absolute) humidity and a very idealized surface model, which might of interest to you. No evaporation and condensation were included, but the surface turbulent sensible heat flux in the model is close to the sum of latent heat and sensible heat fluxes in the observations. The dry convective adjustment (I call it “dry” because there is no condensation) restores the temperature profile to the moist adiabat in the tropics, and the relative humidity profile is from GFDL CM2.0 slab ocean run.
The no feedback climate sensitivity was estimated in the paper (Fig.2) in the 3D temperature response to the CO2 forcing (note: the forcing has a vertical structure) in such a way that the radiation fluxes induced by the temperature change exactly balance the CO2-induced radiative perturbation, not only the well-known forcing at the TOA, but also its vertical distribution.
Hope it helps.
1. Isaac Held says:
Thanks — the “dry adjustment to a moist adiabat” is another option to take the pressure off the resolved circulation to transport all of the required energy upwards, without simulating an active hydrological cycle.
2. BillC says:
Thank you. I will have a look at this paper, and thank you both for the discussion, it is very helpful.
5. Guenter Hess says:
Dear Prof. Held,
Thank you, a very interesting paper. I have to digest it. Yes I meant other than water vapor.
However, I would be especially interested in the limiting case of a transparent dry atmosphere without greenhouse gases.
Best regards
Guenter
6. Joe Barsugli says:
Thanks for posting this. This can help dispel one of the misconceptions about climate models — that we input all the observed data into the model spinup making validation impossible. Recently one engineer I was talking with was incredulous when I said that we could start an atmosphere GCM from an isothermal state, with solar heating and a few butterflies and spin up the general circulation. It really is a profound fact of GFD that is not well appreciated. Although for realism I would like to see a similar spin-up movie for an atmosphere GCM.
1. Isaac Held says:
Joe, thanks for mentioning the butterflies. This model is being spun up from an isothermal state of rest — plus a little noise to break the zonal (east-west) symmetry, Without the noise, the solution would remain exactly zonally symmetric.
Spinning up a moist model can be a lot more interesting in the tropics, depending on the initial condition for water vapor among other things.
7. Marcus says:
Dear Isaac Held,
Is that “fruit fly model” or are similar simple models open source, and available for download?
How many lines of code does it (grossly) contain?
Does it run stand alone, or is it embedded in some kind of simulation framework which you have to own
and maintain?
Regards,
Marcus
1. Isaac Held says:
Marcus, the code I use is embedded in what we refer to as our Flexible Modeling System where you can follow the links to downloading the public release of the atmospheric spectral dynamical core. The public release should do this exact calculation out of the box. The code is primarily Fortran90. FMS provides utilities and low-level operations that are meant to hide machine-dependencies from the scientific user. Documentation for this spectral dynamical core can be found here, which refers to this documentation for a shallow water model on the sphere, which in turn refers to this documentation for non-divergent 2D flow on the sphere. I prefer this rather old-fashioned spectral model for idealized studies such as this because the numerics retains exact zonal symmetry. A number of university groups are using versions of this code that typically have branched off from this one in the past and may, in some cases, be cleaner.
The Community Atmospheric Model (CAM) — a part of the Community Earth System Model effort (CESM) also comes with a configuration that runs this same calculation, I believe. CAM, as its name implies, has more user support and a more active bulletin board.
8. Marcus says:
Thank You very much Isaac!
9. Junyi Chai says:
Dear Prof. Held,
How good is this model on the weather scale? Is the relaxation rate $k_T$ in $\frac{\partial T}{\partial t} =-k_T[T-T_eq]$ set to be 1/40 $\text{day} ^{-1}$ in order to make the model realistic on the weather scale?
1. Isaac Held says:
The model has about the right amount of eddy kinetic energy. And the relaxation time does affect this energy level. Generally speaking, you can’t get a reasonable climate without reasonable “weather-scale” dynamics in mid-latitudes. But Max Suarez noticed the interesting fact early on that the model is too predictable — the error growth in this model is too slow compared to more realistic models (ie, two states that differ very slightly at t = 0 diverge from each other too slowly as time evolves) by something like a factor of 2. I have always assumed that this has something to do with latent heat release, and a couple of people have looked at this over the years, but nothing is published as far as I know.
10. AJ says:
A couple of months ago I plotted the yearly average zonal mean surface winds for the period 1911-2010 using data from the 20th Century Reanalysis Project V2. I didn’t see much of an expansion of the tropics. Although it wasn’t the focus of my computations, the westerlies appeared to be moving poleward and increasing in velocity.
1. Isaac Held says:
People have used a lot of different metrics when looking at “expansion of the tropics”. See, for example, Davis and Rosenlof, 2012 | 2017-06-25T20:52:42 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 10, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5898863673210144, "perplexity": 1102.237253092852}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-26/segments/1498128320582.2/warc/CC-MAIN-20170625203122-20170625223122-00658.warc.gz"} |
https://par.nsf.gov/biblio/10288837-dark-energy-survey-year-results-point-spread-function-modelling | Dark Energy Survey year 3 results: point spread function modelling
ABSTRACT We introduce a new software package for modelling the point spread function (PSF) of astronomical images, called piff (PSFs In the Full FOV), which we apply to the first three years (known as Y3) of the Dark Energy Survey (DES) data. We describe the relevant details about the algorithms used by piff to model the PSF, including how the PSF model varies across the field of view (FOV). Diagnostic results show that the systematic errors from the PSF modelling are very small over the range of scales that are important for the DES Y3 weak lensing analysis. In particular, the systematic errors from the PSF modelling are significantly smaller than the corresponding results from the DES year one (Y1) analysis. We also briefly describe some planned improvements to piff that we expect to further reduce the modelling errors in future analyses.
Authors:
; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; more »
Award ID(s):
Publication Date:
NSF-PAR ID:
10288837
Journal Name:
Monthly Notices of the Royal Astronomical Society
Volume:
501
Issue:
1
Page Range or eLocation-ID:
1282 to 1299
ISSN:
0035-8711
3. Abstract We present measurements of cosmic shear two-point correlation functions (TPCFs) from Hyper Suprime-Cam Subaru Strategic Program (HSC) first-year data, and derive cosmological constraints based on a blind analysis. The HSC first-year shape catalog is divided into four tomographic redshift bins ranging from $z=0.3$ to 1.5 with equal widths of $\Delta z =0.3$. The unweighted galaxy number densities in each tomographic bin are 5.9, 5.9, 4.3, and $2.4\:$arcmin$^{-2}$ from the lowest to highest redshifts, respectively. We adopt the standard TPCF estimators, $\xi _\pm$, for our cosmological analysis, given that we find no evidence of significant B-mode shear. The TPCFs aremore » | 2022-06-26T04:54:04 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5223451852798462, "perplexity": 2259.6584782213513}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103037089.4/warc/CC-MAIN-20220626040948-20220626070948-00142.warc.gz"} |
https://pos.sissa.it/348/017/ | Volume 348 - The 27th International Workshop on Vertex Detectors (VERTEX2018) - Main session
Radiation damage modeling:TCAD simulation
G. Ms Jain* On behalf of the RD50 Collaboration
*corresponding author
Full text: pdf
Pre-published on: 2019 September 03
Published on: 2019 September 06
Abstract
The exceptional performance of the silicon sensors in the radiation environment has led to their extensive application in high energy physics. Even so, the future experiments foresee these sensors to be exposed to higher radiation levels. Radiation induces a change in the macroscopic properties of the sensor, thus, severely affecting the sensor performance and ultimately becoming the limiting factor for its operation. With an aim to extend the radiation hardness capabilities of the silicon sensors for the future experiments there has been a growing interest in sensors with novel designs and unique characteristic of intrinsic charge multiplication. \newline
However, it is important to understand the effect of radiation damage on these sensors, before employing them in the main detector system. The RD50 collaboration extensively employs TCAD simulation tools for an in-depth understanding and structural optimization of the newly proposed sensor technologies, complementing the measurement results. The simulation package, by the finite element method, solves the Poisson equation coupled with the current continuity equations in the main device, typically with the drift-diffusion current model. There is also the possibility of co-simulating an electronic circuit connected to the main device using the incorporated SPICE package, for example to predict single event effects or read-out related waveforms. The simulation tools also provide an insight into the sensor operation both in the non-irradiated and the irradiated scenario in order to predict the voltage dependence of the leakage current, charge collection and electrical field distribution as function of irradiation. This has required the development of a radiation damage model within the simulation tools such that the measurements are well reproduced. The details of the radiation damage modelling using two commercial TCAD tools $–$ Silvaco and Synopsys, are discussed in this work.
DOI: https://doi.org/10.22323/1.348.0017
Open Access
Copyright owned by the author(s) under the term of the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. | 2019-09-22T14:45:39 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.390444278717041, "perplexity": 1452.7208927557429}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-39/segments/1568514575515.93/warc/CC-MAIN-20190922135356-20190922161356-00456.warc.gz"} |
https://www.usgs.gov/center-news/volcano-watch-april-has-been-month-serious-tsunami-activiy-hilo-and-hawaiian-islands | Volcano Watch — April has been the month for serious tsunami activiy in Hilo and the Hawaiian Islands
Release Date:
In historical times, two tsunamis occurred during the first week of April. The first of these occurred on April 2, 1868; it resulted from the great earthquake that took place that day near Pahala.
In historical times, two tsunamis occurred during the first week of April. The first of these occurred on April 2, 1868; it resulted from the great earthquake that took place that day near Pahala. Based on the extent and type of damage, the 1868 earthquake is estimated to have had a magnitude of about 8.0. Reports indicate that 46 people were killed and several entire Hawaiian villages were destroyed by the tsunami generated from the earthquake. Eyewitnesses estimated that the wave was 25 to 30 feet high.
More recently, on April 1, 1946, a tsunami generated from a large earthquake in the Aleutian Islands caused severe damage in Hawaii. There is usually a succession of waves during a tsunami, with each crest flooding the shore. Between the crests, which are commonly 12-20 minutes apart, the water level drops and exposes the shallow sea floor. Often, the first indication of the arrival of a tsunami is a sudden withdrawal of water from the shore. In 1946, each of the first eight wave crests was largest at one place or another; thus, the first wave is not necessarily the largest. One should not return to evacuated low-lying coastal areas until the entire wave series has arrived. The waves reached a maximum height above sea level of 55 feet near the mouth of Pololu valley and of 26 feet at Hilo. On Kauai, the maximum height of the wave was 45 feet; on Oahu, 31 feet; on Molokai, 54 feet; and on Maui, 33 feet. In all cases, the water reached its maximum height on the north shore. On Hawaii, 124 people were killed and almost 600 homes destroyed or damaged. Elsewhere in the islands, 38 additional people were killed and about 800 homes were destroyed or damaged.
Another damaging tsunami hit the islands on May 23, 1960. It was generated by an earthquake along the coast of Chile. This tsunami caused little damage elsewhere in the islands but the Hilo Bay area was hard hit. Sixty-one people lost their lives and about 540 homes and businesses were destroyed or severely damaged. The wave heights in Hilo Bay reached 35 feet compared to only 3-17 feet elsewhere.
As these examples demonstrate, there are two classes of tsunami that have caused damage here: those generated by large, distant earthquakes and those generated by local earthquakes. Today, tsunami generated by distant earthquakes are tracked by the Pacific Tsunami Warning Center in Ewa Beach on Oahu. The minimum elapsed time between the earthquake and the arrival of the tsunami in Hawaii is about 4.5 hours for earthquakes in the central Aleutian Islands. Tsunami generated by earthquakes elsewhere around the rim of the Pacific Ocean have elapsed times of as long as 15 hours (for those from South America). These times are adequate to issue warnings and evacuate low-lying areas on the islands. However, tsunami generated by local earthquakes may have extremely short time periods between the earthquake and the tsunami. Although only a few local earthquakes have been large enough to generate tsunami during historical times, those in 1868 (magnitude 8.0) and in 1975 (magnitude 7.2) produced tsunami that were large enough to kill people.
With the increasing population along the coastlines of Hawaii, any future locally-generated tsunami pose an even greater threat to life and property. Because of the short time period (as little as a few minutes if you are near the earthquake epicenter) between a local earthquake and a tsunami it could generate, it is unlikely that adequate warnings of orderly evacuation can occur. Your best precaution if you feel a strong earthquake is to immediately move to higher ground if you are near the coast at low elevation. The Civil Defense pages in the phone book include maps of coastal areas around the island showing the areas where tsunami inundation can occur and the evacuation routes to use.
Volcano Activity Update
The eruption at the episode 51 and 53 vents near Puu Oo on the East Rift Zone of Kīlauea Volcano continues with little change from last week. Active lava flows enter the ocean east and west of Kamoamoa and at Laeapuki. Visitors may see the lava near the end of the Chain of Craters Road in Hawai`i Volcanoes National Park. | 2019-12-11T14:09:54 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.25655800104141235, "perplexity": 2584.2531800758343}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-51/segments/1575540531917.10/warc/CC-MAIN-20191211131640-20191211155640-00392.warc.gz"} |
http://legisquebec.gouv.qc.ca/en/showversion/cs/r-15.1?code=se:243_19&pointInTime=20201022 | ### R-15.1 - Supplemental Pension Plans Act
243.19. (Repealed).
1992, c. 60, s. 37; 2015, c. 29, s. 67.
243.19. In addition to the regulatory powers conferred on it by this chapter, the Government may make any other regulation required for the purposes of this chapter, in particular in respect of
(1) the transmission of any document required under this chapter;
(2) the time limits applicable to the execution of any obligation, procedure or formality under this chapter.
1992, c. 60, s. 37. | 2020-11-24T13:15:08 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8088790774345398, "perplexity": 8466.9547937799}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-50/segments/1606141176256.21/warc/CC-MAIN-20201124111924-20201124141924-00040.warc.gz"} |
https://cnls.lanl.gov/External/showtalksummary.php?selection=1597 | Lab Home | Phone | Search
Current Affiliates Alumni Visitors Students
2007 2006 2005 2004 2003 2002 2001 2000 <1999
Colloquia Colloquia Archive Seminars Postdoc Seminars Archive Quantum Lunch CMS Colloquia Q-Mat Seminars Q-Mat Seminars Archive Archive
Description Past Visitors
Monday, March 10, 2008
3:00 PM - 4:00 PM
CNLS Conference Room (TA-3, Bldg 1690)
Colloquium
Hyperviscosity, Galerkin truncation and bottlenecks
Uriel Frisch
Observatoire de la Cote d'Azur
It is shown that the replacement in hydrodynamical equations of the usual dissipation by a high power $\alpha$ of the Laplacian leads asymptotically to truncating the dynamics to a a finite number of Fourier modes. When this number is large, a range of thermalized modes appear through the mechanism discovered by Cichowlas et al. [PRL 95, 264502, 2005]. The dynamics at small and intermediate wavenumbers is governed by the ordinary Navier-Stokes equations but a huge bottleneck in thermal equilibrium with Gaussian statistics is present at large wavenumbers. The usual ($\alpha=1$) bottleneck can be viewed as an aborted thermalization. Practical implications for turbulence modelling are discussed. This material is based on work in collaboration with Susan Kurien and Jian-Zhou Zhu.
Host: Susan Kurien, T-7 | 2019-01-23T15:20:25 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5038571953773499, "perplexity": 5313.118596615533}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-04/segments/1547584334618.80/warc/CC-MAIN-20190123151455-20190123173455-00191.warc.gz"} |
https://pos.sissa.it/414/511/ | Volume 414 - 41st International Conference on High Energy physics (ICHEP2022) - Higgs Physics
Searches for Extended Higgs Sectors at CMS
D. Winterbottom
Full text: pdf
Pre-published on: October 29, 2022
Published on:
Abstract
The results of several searches for additional neutral and charged Higgs bosons are presented, using data collected with the CMS detector at $\sqrt{s}=13~\mathrm{TeV}$, corresponding to an integrated luminosity of $138~\mathrm{fb}^{-1}$. The searches for neutral Higgs bosons target the decays into $\tau\tau$, WW, and pairs of lighter Higgs bosons. Each of these searches observes modest excesses of data with respect to the background expectation with local significances in the range of 3.1-3.8 standard deviations. The search for a charged Higgs boson targets its decay into a W and a neutral Higgs boson. No significant excess of data with respect to the background-only hypothesis was observed.
DOI: https://doi.org/10.22323/1.414.0511
How to cite
Metadata are provided both in "article" format (very similar to INSPIRE) as this helps creating very compact bibliographies which can be beneficial to authors and readers, and in "proceeding" format which is more detailed and complete.
Open Access
Copyright owned by the author(s) under the term of the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. | 2023-01-30T22:01:47 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.48674336075782776, "perplexity": 1728.6885573090472}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764499829.29/warc/CC-MAIN-20230130201044-20230130231044-00393.warc.gz"} |
https://opentextbc.ca/principlesofeconomics2eopenstax/back-matter/present-discounted-value/ | # Present Discounted Value
As explained in Financial Markets, the prices of stocks and bonds depend on future events. The price of a bond depends on the future payments that the bond is expected to make, including both payments of interest and the repayment of the face value of the bond. The price of a stock depends on the expected future profits earned by the firm. The concept of a present discounted value (PDV), which is defined as the amount you should be willing to pay in the present for a stream of expected future payments, can be used to calculate appropriate prices for stocks and bonds. To place a present discounted value on a future payment, think about what amount of money you would need to have in the present to equal a certain amount in the future. This calculation will require an
interest rate. For example, if the interest rate is 10%, then a payment of ?110 a year from now will have a present discounted value of ?100—that is, you could take ?100 in the present and have ?110 in the future. We will first shows how to apply the idea of present discounted value to a stock and then we will show how to apply it to a bond.
### Applying Present Discounted Value to a Stock
Consider the case of Babble, Inc., a company that offers speaking lessons. For the sake of simplicity, say that the founder of Babble is 63 years old and plans to retire in two years, at which point the company will be disbanded. The company is selling 200 shares of stock and profits are expected to be ?15 million right away, in the present, ?20 million one year from now, and ?25 million two years from now. All profits will be paid out as dividends to shareholders as they occur. Given this information, what will an investor pay for a share of stock in this company?
A financial investor, thinking about what future payments are worth in the present, will need to choose an interest rate. This interest rate will reflect the rate of return on other available financial investment opportunities, which is the opportunity cost of investing financial capital, and also a risk premium (that is, using a higher interest rate than the rates available elsewhere if this investment appears especially risky). In this example, say that the financial investor decides that appropriate interest rate to value these future payments is 15%.
(Figure) shows how to calculate the present discounted value of the future profits. For each time period, when a benefit is going to be received, apply the formula:
$\text{Present discounted value = }\frac{\text{Future value received years in the future}}{{\text{(1 + Interest rate)}}^{\text{numbers of years t}}}$
Calculating Present Discounted Value of a Stock
Payments from Firm Present Value
?15 million in present ?15 million
?20 million in one year ?20 million/(1 + 0.15)1 = ?17.4 million
?25 million in two years ?25 million/(1 + 0.15)2 = ?18.9 million
Total ?51.3 million
Next, add up all the present values for the different time periods to get a final answer. The present value calculations ask what the amount in the future is worth in the present, given the 15% interest rate. Notice that a different PDV calculation needs to be done separately for amounts received at different times. Then, divide the PDV of total profits by the number of shares, 200 in this case: 51.3 million/200 = 0.2565 million. The price per share should be about ?256,500 per share.
Of course, in the real world expected profits are a best guess, not a hard piece of data. Deciding which interest rate to apply for discounting to the present can be tricky. One needs to take into account both potential capital gains from the future sale of the stock and also dividends that might be paid. Differences of opinion on these issues are exactly why some financial investors want to buy a stock that other people want to sell: they are more optimistic about its future prospects. Conceptually, however, it all comes down to what you are willing to pay in the present for a stream of benefits to be received in the future.
### Applying Present Discounted Value to a Bond
A similar calculation works in the case of bonds. Financial Markets explains that if the interest rate falls after a bond is issued, so that the investor has locked in a higher rate, then that bond will sell for more than its face value. Conversely, if the interest rate rises after a bond is issued, then the investor is locked into a lower rate, and the bond will sell for less than its face value. The present value calculation sharpens this intuition.
Think about a simple two-year bond. It was issued for ?3,000 at an interest rate of 8%. Thus, after the first year, the bond pays interest of 240 (which is 3,000 × 8%). At the end of the second year, the bond pays ?240 in interest, plus the ?3,000 in principle. Calculate how much this bond is worth in the present if the discount rate is 8%. Then, recalculate if interest rates rise and the applicable discount rate is 11%. To carry out these calculations, look at the stream of payments being received from the bond in the future and figure out what they are worth in present discounted value terms. The calculations applying the present value formula are shown in (Figure).
Computing the Present Discounted Value of a Bond
Stream of Payments (for the 8% interest rate) Present Value (for the 8% interest rate) Stream of Payments (for the 11% interest rate) Present Value (for the 11% interest rate)
?240 payment after one year ?240/(1 + 0.08)1 = ?222.20 ?240 payment after one year ?240/(1 + 0.11)1 = ?216.20
?3,240 payment after second year ?3,240/(1 + 0.08)2 = ?2,777.80 ?3,240 payment after second year ?3,240/(1 + 0.11)2 = ?2,629.60
Total ?3,000 Total ?2,845.80
The first calculation shows that the present value of a ?3,000 bond, issued at 8%, is just ?3,000. After all, that is how much money the borrower is receiving. The calculation confirms that the present value is the same for the lender. The bond is moving money around in time, from those willing to save in the present to those who want to borrow in the present, but the present value of what is received by the borrower is identical to the present value of what will be repaid to the lender.
The second calculation shows what happens if the interest rate rises from 8% to 11%. The actual dollar payments in the first column, as determined by the 8% interest rate, do not change. However, the present value of those payments, now discounted at a higher interest rate, is lower. Even though the future dollar payments that the bond is receiving have not changed, a person who tries to sell the bond will find that the investment’s value has fallen.
Again, real-world calculations are often more complex, in part because, not only the interest rate prevailing in the market, but also the riskiness of whether the borrower will repay the loan, will change. In any case, the price of a bond is always the present value of a stream of future expected payments.
### Other Applications
Present discounted value is a widely used analytical tool outside the world of finance. Every time a business thinks about making a physical capital investment, it must compare a set of present costs of making that investment to the present discounted value of future benefits. When government thinks about a proposal to, for example, add safety features to a highway, it must compare costs incurred in the present to benefits received in the future. Some academic disputes over environmental policies, like how much to reduce carbon dioxide emissions because of the risk that they will lead to a warming of global temperatures several decades in the future, turn on how one compares present costs of pollution control with long-run future benefits. Someone who wins the lottery and is scheduled to receive a string of payments over 30 years might be interested in knowing what the present discounted value is of those payments. Whenever a string of costs and benefits stretches from the present into different times in the future, present discounted value becomes an indispensable tool of analysis.
## License
Principles of Economics 2e by Rice University is licensed under a Creative Commons Attribution 4.0 International License, except where otherwise noted. | 2021-09-19T19:46:26 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.23464354872703552, "perplexity": 902.4659227359375}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780056900.32/warc/CC-MAIN-20210919190128-20210919220128-00700.warc.gz"} |
https://pos.sissa.it/369/048 | Volume 369 - The 21st international workshop on neutrinos from accelerators (NuFact2019) - Working Group 2
Non-trivial differences between charged current $ν_e$ and $ν_μ$ induced interactions with nuclei
A. Nikolakopoulos*, N. Jachowicz, R. González-Jiménez, J.M. Udías, K. Niewczas and V. Pandey
Full text: pdf
Published on: June 11, 2020
Abstract
The difference between electron and muon neutrino charged-current cross sections has attracted quite some interest over the past few years. This interest is guided by the experimental effort that aims at measuring the CP-violating phase by looking for electron (anti-)neutrino appearance in muon neutrino beams. In long-baseline experiments such as T2K, models for the neutrino cross section are often constrained by near-detector data, with a muon neutrino flux that is unoscillated. Non-trivial differences between electron and muon neutrino cross sections are currently experimentally not well constrained, and different models give varying results, especially in kinematic regions where nuclear structure details become important, i.e. for low energy and momentum transfers. In this work we present the nuclear response and cross section using different nuclear models, for forward lepton scattering in the region of a couple 100 MeVs. In this kinematic region the cross section is sensitive to nuclear structure details which are not accounted for in simplified models such as the relativistic Fermi gas (RFG) which is commonly used in the experimental analysis. The results show that it is important for current and future accelerator-based experiments, notably T2K and the short-baseline oscillation program (i.e the MicroBooNE, SBND and ICARUS experiments) which are sensitive to the several 100 MeV region, to take nuclear structure details into account in their analysis.
DOI: https://doi.org/10.22323/1.369.0048
How to cite
Metadata are provided both in "article" format (very similar to INSPIRE) as this helps creating very compact bibliographies which can be beneficial to authors and readers, and in "proceeding" format which is more detailed and complete.
Open Access
Copyright owned by the author(s) under the term of the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. | 2021-09-19T01:38:14 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5717155933380127, "perplexity": 1714.1985859040833}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780056656.6/warc/CC-MAIN-20210919005057-20210919035057-00612.warc.gz"} |
https://pdglive.lbl.gov/Particle.action?init=0&node=M189&home=MXXX025 | ${\mathit {\mathit c}}$ ${\mathit {\overline{\mathit c}}}$ MESONS(including possibly non- ${\mathit {\mathit q}}$ ${\mathit {\overline{\mathit q}}}$ states) INSPIRE search
#### ${{\boldsymbol \psi}{(4660)}}$
$I^G(J^{PC})$ = $0^-(1^{- -})$
also known as ${{\mathit Y}{(4660)}}$; was ${{\mathit X}{(4660)}}$
This state shows properties different from a conventional ${{\mathit q}}{{\overline{\mathit q}}}$ state. A candidate for an exotic structure. See the review on non- ${{\mathit q}}{{\overline{\mathit q}}}$ states. Seen in radiative return from ${{\mathit e}^{+}}{{\mathit e}^{-}}$ collisions at $\sqrt {s }$ = $9.54 - 10.58$ GeV by WANG 2007D. Also obtained in a combined fit of WANG 2007D, AUBERT 2007S, and LEES 2014F. See also the review on "Spectroscopy of mesons containing two heavy quarks."
${{\mathit \psi}{(4660)}}$ MASS $4630 \pm6$ MeV (S = 1.4)
${{\mathit \psi}{(4660)}}$ WIDTH $62 {}^{+9}_{-7}$ MeV
$\Gamma_{1}$ ${{\mathit e}^{+}}{{\mathit e}^{-}}$ not seen 2315
$\Gamma_{2}$ ${{\mathit \psi}{(2S)}}{{\mathit \pi}^{+}}{{\mathit \pi}^{-}}$ seen 809
$\Gamma_{3}$ ${{\mathit J / \psi}}{{\mathit \eta}}$ not seen 1192
$\Gamma_{4}$ ${{\mathit D}^{0}}{{\mathit D}^{*-}}{{\mathit \pi}^{+}}$ not seen 1153
$\Gamma_{5}$ ${{\mathit \chi}_{{c1}}}{{\mathit \gamma}}$ not seen 984
$\Gamma_{6}$ ${{\mathit \chi}_{{c2}}}{{\mathit \gamma}}$ not seen 949
$\Gamma_{7}$ ${{\mathit \Lambda}_{{c}}^{+}}{{\mathit \Lambda}_{{c}}^{-}}$ seen 362
$\Gamma_{8}$ ${{\mathit D}_{{s}}^{+}}{{\mathit D}_{{s1}}{(2536)}^{-}}$ seen 533
$\Gamma_{9}$ ${{\mathit D}_{{s}}^{+}}{{\mathit D}_{{s2}}^{*}{(2573)}^{-}}$
FOOTNOTES | 2021-09-28T07:27:36 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8823714852333069, "perplexity": 3040.0876989159574}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780060538.11/warc/CC-MAIN-20210928062408-20210928092408-00106.warc.gz"} |
https://lammps.sandia.gov/doc/fix_accelerate_cos.html | fix accelerate/cos command
Syntax
fix ID group-ID accelerate value
• ID, group-ID are documented in fix command
• accelerate/cos = style name of this fix command
• value = amplitude of acceleration (in unit of force/mass)
Examples
fix 1 all accelerate/cos 0.02e-5
Description
Give each atom a acceleration in x-direction based on its z coordinate. The acceleration is a periodic function along the z-direction:
$a_{x}(z) = A \cos \left(\frac{2 \pi z}{l_{z}}\right)$
where $$A$$ is the acceleration amplitude, $$l_z$$ is the z-length of the simulation box. At steady state, the acceleration generates a velocity profile:
$v_{x}(z) = V \cos \left(\frac{2 \pi z}{l_{z}}\right)$
The generated velocity amplitude $$V$$ is related to the shear viscosity $$\eta$$ by:
$V = \frac{A \rho}{\eta}\left(\frac{l_{z}}{2 \pi}\right)^{2}$
and it can be obtained from ensemble average of the velocity profile:
$V = \frac{\sum_i 2 m_{i} v_{i, x} \cos \left(\frac{2 \pi z_i}{l_{z}}\right)}{\sum_i m_{i}}$
where $$m_i$$, $$v_{i,x}$$ and $$z_i$$ are the mass, x-component velocity and z coordinate of a particle.
The velocity amplitude $$V$$ can be calculated with compute viscosity/cos, which enables viscosity calculation with periodic perturbation method, as described by Hess. Because the applied acceleration drives the system away from equilibration, the calculated shear viscosity is lower than the intrinsic viscosity due to the shear-thinning effect. Extrapolation to zero acceleration should generally be performed to predict the zero-shear viscosity. As the shear stress decreases, the signal-noise ratio decreases rapidly, the simulation time must be extended accordingly to get converged result.
In order to get meaningful result, the group ID of this fix should be all.
Restart, fix_modify, output, run start/stop, minimize info:
No information about this fix is written to binary restart files. None of the fix_modify options are relevant to this fix. No global or per-atom quantities are stored by this fix for access by various output commands. No parameter of this fix can be used with the start/stop keywords of the run command. This fix is not invoked during energy minimization.
Restrictions
This command is only available when LAMMPS was built with the USER-MISC package. Since this fix depends on the z-coordinate of atoms, it cannot be used in 2d simulations.
Default
none
(Hess) Hess, B. The Journal of Chemical Physics 2002, 116 (1), 209-217. | 2020-08-10T11:54:03 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8092052340507507, "perplexity": 2301.0292995932136}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-34/segments/1596439738674.42/warc/CC-MAIN-20200810102345-20200810132345-00470.warc.gz"} |
https://lammps.sandia.gov/doc/bond_oxdna.html | # bond_style oxrna2/fene command¶
## Syntax¶
bond_style oxdna/fene
bond_style oxdna2/fene
bond_style oxrna2/fene
## Examples¶
bond_style oxdna/fene
bond_coeff * 2.0 0.25 0.7525
bond_style oxdna2/fene
bond_coeff * 2.0 0.25 0.7564
bond_style oxrna2/fene
bond_coeff * 2.0 0.25 0.76107
## Description¶
The oxdna/fene , oxdna2/fene and oxrna2/fene bond styles use the potential
$E = - \frac{\epsilon}{2} \ln \left[ 1 - \left(\frac{r-r_0}{\Delta}\right)^2\right]$
to define a modified finite extensible nonlinear elastic (FENE) potential (Ouldridge) to model the connectivity of the phosphate backbone in the oxDNA/oxRNA force field for coarse-grained modelling of DNA/RNA.
The following coefficients must be defined for the bond type via the bond_coeff command as given in the above example, or in the data file or restart files read by the read_data or read_restart commands:
• $$\epsilon$$ (energy)
• $$\Delta$$ (distance)
• $$r_0$$ (distance)
Note
The oxDNA bond style has to be used together with the corresponding oxDNA pair styles for excluded volume interaction oxdna/excv , stacking oxdna/stk , cross-stacking oxdna/xstk and coaxial stacking interaction oxdna/coaxstk as well as hydrogen-bonding interaction oxdna/hbond (see also documentation of pair_style oxdna/excv). For the oxDNA2 (Snodin) bond style the analogous pair styles oxdna2/excv , oxdna2/stk , oxdna2/xstk , oxdna2/coaxstk , oxdna2/hbond and an additional Debye-Hueckel pair style oxdna2/dh have to be defined. The same applies to the oxRNA2 (Sulc1) styles. The coefficients in the above example have to be kept fixed and cannot be changed without reparameterizing the entire model.
Example input and data files for DNA and RNA duplexes can be found in examples/USER/cgdna/examples/oxDNA/ , /oxDNA2/ and /oxRNA2/. A simple python setup tool which creates single straight or helical DNA strands, DNA/RNA duplexes or arrays of DNA/RNA duplexes can be found in examples/USER/cgdna/util/.
Please cite (Henrich) in any publication that uses this implementation. The article contains general information on the model, its implementation and performance as well as the structure of the data and input file. The preprint version of the article can be found here. Please cite also the relevant oxDNA/oxRNA publications. These are (Ouldridge) and (Ouldridge-DPhil) for oxDNA, (Snodin) for oxDNA2, (Sulc1) for oxRNA2 and for sequence-specific hydrogen-bonding and stacking interactions (Sulc2).
## Restrictions¶
This bond style can only be used if LAMMPS was built with the USER-CGDNA package and the MOLECULE and ASPHERE package. See the Build package doc page for more info.
## Default¶
none
(Henrich) O. Henrich, Y. A. Gutierrez-Fosado, T. Curk, T. E. Ouldridge, Eur. Phys. J. E 41, 57 (2018).
(Ouldridge-DPhil) T.E. Ouldridge, Coarse-grained modelling of DNA and DNA self-assembly, DPhil. University of Oxford (2011).
(Ouldridge) T.E. Ouldridge, A.A. Louis, J.P.K. Doye, J. Chem. Phys. 134, 085101 (2011).
(Snodin) B.E. Snodin, F. Randisi, M. Mosayebi, et al., J. Chem. Phys. 142, 234901 (2015).
(Sulc1) P. Sulc, F. Romano, T. E. Ouldridge, et al., J. Chem. Phys. 140, 235102 (2014).
(Sulc2) P. Sulc, F. Romano, T.E. Ouldridge, L. Rovigatti, J.P.K. Doye, A.A. Louis, J. Chem. Phys. 137, 135101 (2012). | 2021-04-10T19:24:59 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.521207332611084, "perplexity": 11782.11936524675}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038057476.6/warc/CC-MAIN-20210410181215-20210410211215-00547.warc.gz"} |
https://www.zbmath.org/authors/?q=ai%3Adolphin.andrew | # zbMATH — the first resource for mathematics
## Dolphin, Andrew
Compute Distance To:
Author ID: dolphin.andrew Published as: Dolphin, Andrew Homepage: https://www.uantwerpen.be/en/staff/andrew-dolphin/ External Links: MGP · Wikidata
Documents Indexed: 16 Publications since 2011 Reviewing Activity: 14 Reviews
all top 5
#### Co-Authors
7 single-authored 4 Chapman, Adam 2 Becher, Karim Johannes 2 Laghribi, Ahmed 1 Hoffmann, Detlev W. 1 Leep, David B. 1 Quéguiner-Mathieu, Anne
all top 5
#### Serials
4 Journal of Pure and Applied Algebra 3 Journal of Algebra 2 Communications in Algebra 2 Manuscripta Mathematica 2 Journal of Algebra and its Applications 1 Archiv der Mathematik 1 Journal of Number Theory 1 Mathematische Zeitschrift
#### Fields
16 Number theory (11-XX) 8 Field theory and polynomials (12-XX) 8 Associative rings and algebras (16-XX) 2 $$K$$-theory (19-XX)
#### Citations contained in zbMATH
13 Publications have been cited 63 times in 35 Documents Cited by Year
Orthogonal Pfister involutions in characteristic two. Zbl 1297.11020
Dolphin, Andrew
2014
Metabolic involutions. Zbl 1277.11030
Dolphin, Andrew
2011
Total linkage of quaternion algebras and Pfister forms in characteristic two. Zbl 1419.11069
Chapman, Adam; Dolphin, Andrew; Laghribi, Ahmed
2016
Decomposition of algebras with involution in characteristic 2. Zbl 1314.11020
Dolphin, Andrew
2013
Differential forms, linked fields, and the $$u$$-invariant. Zbl 1427.11037
2017
Differential forms and bilinear forms under field extensions. Zbl 1393.11034
Dolphin, Andrew; Hoffmann, Detlev W.
2015
Chapman, Adam; Dolphin, Andrew; Leep, David B.
2018
Non-hyperbolic splitting of quadratic pairs. Zbl 1326.11013
Becher, Karim Johannes; Dolphin, Andrew
2015
Symplectic involutions, quadratic pairs and function fields of conics. Zbl 1426.11028
Dolphin, Andrew; Quéguiner-Mathieu, Anne
2017
Totally decomposable quadratic pairs. Zbl 1370.11051
Becher, Karim Johannes; Dolphin, Andrew
2016
2019
Totally decomposable symplectic and unitary involutions. Zbl 1382.16037
Dolphin, Andrew
2017
Singular and totally singular unitary spaces. Zbl 1391.11069
Dolphin, Andrew
2015
2019
Chapman, Adam; Dolphin, Andrew; Leep, David B.
2018
Differential forms, linked fields, and the $$u$$-invariant. Zbl 1427.11037
2017
Symplectic involutions, quadratic pairs and function fields of conics. Zbl 1426.11028
Dolphin, Andrew; Quéguiner-Mathieu, Anne
2017
Totally decomposable symplectic and unitary involutions. Zbl 1382.16037
Dolphin, Andrew
2017
Total linkage of quaternion algebras and Pfister forms in characteristic two. Zbl 1419.11069
Chapman, Adam; Dolphin, Andrew; Laghribi, Ahmed
2016
Totally decomposable quadratic pairs. Zbl 1370.11051
Becher, Karim Johannes; Dolphin, Andrew
2016
Differential forms and bilinear forms under field extensions. Zbl 1393.11034
Dolphin, Andrew; Hoffmann, Detlev W.
2015
Non-hyperbolic splitting of quadratic pairs. Zbl 1326.11013
Becher, Karim Johannes; Dolphin, Andrew
2015
Singular and totally singular unitary spaces. Zbl 1391.11069
Dolphin, Andrew
2015
Orthogonal Pfister involutions in characteristic two. Zbl 1297.11020
Dolphin, Andrew
2014
Decomposition of algebras with involution in characteristic 2. Zbl 1314.11020
Dolphin, Andrew
2013
Metabolic involutions. Zbl 1277.11030
Dolphin, Andrew
2011
all top 5
#### Cited by 16 Authors
12 Nokhodkar, Amir Hossein 11 Dolphin, Andrew 8 Chapman, Adam 3 Becher, Karim Johannes 2 Aravire, Roberto 2 Laghribi, Ahmed 2 Mahmoudi, Mohammad Gholamzadeh 2 McKinnie, Kelly 2 Sobiech, Marco 1 Hoffmann, Detlev W. 1 Hutchens, John 1 Leep, David B. 1 O’Ryan, Manuel 1 Quéguiner-Mathieu, Anne 1 Schwartz, Nathaniel J. 1 Tignol, Jean-Pierre
all top 5
#### Cited in 15 Serials
6 Journal of Algebra 6 Journal of Pure and Applied Algebra 4 Journal of Algebra and its Applications 3 Manuscripta Mathematica 2 Bulletin of the Australian Mathematical Society 2 Communications in Algebra 2 Archiv der Mathematik 2 Proceedings of the American Mathematical Society 2 Annals of $$K$$-Theory 1 Journal of Number Theory 1 Mathematische Zeitschrift 1 Bulletin of the Belgian Mathematical Society - Simon Stevin 1 Turkish Journal of Mathematics 1 Algebras and Representation Theory 1 Forum of Mathematics, Sigma
all top 5
#### Cited in 8 Fields
32 Number theory (11-XX) 23 Associative rings and algebras (16-XX) 9 Field theory and polynomials (12-XX) 4 $$K$$-theory (19-XX) 2 Group theory and generalizations (20-XX) 1 Commutative algebra (13-XX) 1 Algebraic geometry (14-XX) 1 Linear and multilinear algebra; matrix theory (15-XX)
#### Wikidata Timeline
The data are displayed as stored in Wikidata under a Creative Commons CC0 License. Updates and corrections should be made in Wikidata. | 2021-01-20T13:15:23 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.18219636380672455, "perplexity": 9592.613569640514}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-04/segments/1610703520883.15/warc/CC-MAIN-20210120120242-20210120150242-00070.warc.gz"} |
https://indico.fnal.gov/event/17566/timetable/?view=standard | Indico will be unavailable on Wed, Feb 15th from 7-7:30 am CST due to server maintenance. If you have questions, please contact the Service Desk
# 2018 US LHC Users Association Meeting
US/Central
IARC (Fermilab)
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
, , ,
Description
Fermilab has kindly agreed to host our 2018 Annual US LHC Users Association Meeting Wednesday - Friday October 24-26, 2018.
There will be an arrival reception and Executive Committee meeting in the late afternoon and early evening of Wednesday October 24 in Wilson Hall, followed by the main sessions on Thursday and Friday in the main auditorium of IARC (http://saturdaymorningphysics.fnal.gov/location-of-iarc/).
Participants
• Aaron Dominguez
• Anthony Timmins
• Bahareh Roozbahani
• Bjorn Burkle
• Boaz Klima
• Brennan Schaefer
• Brianna Stamas
• Caleb Smith
• Cecilia Gerber
• Chip Brock
• Claude Pruneau
• Corrinne Mills
• Daniel Li
• Darin Acosta
• Edmundo Garcia-Solis
• Fabio Ravera
• George Fai
• GianLuca Sabbi
• Giorgio Ambrosio
• Gordon Watts
• Harry Cheung
• Harvey Newman
• Hong Ma
• Jacob Pasner
• James Hirschauer
• Jane Nachtman
• Jessica Metcalfe
• JoAnne Hewett
• Joseph Lykken
• Julia Gonski
• Kak Wong
• Kaori Maeshima
• Kathryn Jepsen
• Kevin Black
• Larry Nodulman
• Leonard Spiegel
• Lindsey Gray
• Marc Weinberg
• Marguerite Tonjes
• marina artuso
• Matthew Feickert
• Matthew Herndon
• Meenakshi Narain
• Michael Albrow
• Nhan Tran
• Nigel Lockyer
• Petra Merkel
• Pushpalatha Bhat
• Randy Ruchti
• Ronald Lipton
• Samuel Higginbotham
• Sarah Demers
• Sarah Eno
• Savannah Thais
• Scott Ely
• Sergei Gleyzer
• Sheldon Stone
• Thomas Boettcher
• Thomas LeCompte
• Timothy I. Meyer
• Titas Roy
• Tyler Burch
• Vittorio Marinozzi
• Viviana Cavaliere
• Wasikul Islam
• Yangyang Cheng
• Zhenbin Wu
• Zhi Zheng
• Zishuo Yang
• Zoltan Gecse
• Wednesday, October 24
• 4:00 PM 5:30 PM
Executive Committee Meeting West Wing, Wilson Hall 10NE
### West Wing, Wilson Hall 10NE
#### Fermilab
Convener: Harvey Newman (Caltech)
• 5:30 PM 7:00 PM
Welcome Reception 1h 30m Wilson Hall, atrium
### Wilson Hall, atrium
#### Fermilab
• Thursday, October 25
• 9:00 AM 9:10 AM
Welcome to Fermilab 10m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Nigel Lockyer (Fermilab)
• 9:10 AM 9:30 AM
Codes of conduct and Fermilab access 20m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Kevin Burkett (Fermilab)
• 9:30 AM 9:55 AM
US-LUA Chair's report 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Including committee reports
Speakers: Harvey Newman (Caltech), Prof. Sheldon Stone (Syracuse University)
• 10:00 AM 10:25 AM
Status and outlook for the LHC 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Rende Steerenberg (CERN)
• 10:30 AM 11:00 AM
Coffee Break 30m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 11:00 AM 11:25 AM
LHCb Status and Outlook 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Dr marina artuso (syracuse university)
• 11:30 AM 11:55 AM
CMS Status and Outlook 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Meenakshi Narain (Brown University)
• 12:00 PM 12:25 PM
US LHC accelerator program 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: GianLuca Sabbi (LBNL), Giorgio Ambrosio (FNAL TD/MSD)
• 12:30 PM 12:40 PM
Group Photo 10m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 12:40 PM 1:30 PM
Lunch 50m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 1:30 PM 1:55 PM
Energy Frontier Colliders and the Snowmass Process 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Prof. Young-Kee Kim (FNAL)
• 2:00 PM 2:25 PM
ALICE Status and Outlook 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Prof. Claude Pruneau (Wayne State University)
• 2:30 PM 3:30 PM
Cross-experiment discussion: breakout sessions IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Conveners: Corrinne Mills, Harvey Newman (Caltech)
• 2:30 PM
### Sunrise (11E)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Mr Salvatore Rappoccio (Buffalo), Yangyang Cheng (Cornell University), Dr Yangyang Cheng (Cornell University)
• 2:30 PM
Calorimeters 1h Black Hole (2NW)
### Black Hole (2NW)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: David Miller (University of Chicago), James Hirschauer (Fermi National Accelerator Laboratory)
• 2:30 PM
Future colliders 1h Hornet's Nest (8XO)
### Hornet's Nest (8XO)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Dr Anadi Canepa (TRIUMF), Dr Anadi Canepa (Fermilab), Dr Ron Lipton (Fermilab)
• 2:30 PM
Outreach 1h Conjectorium (3NE)
### Conjectorium (3NE)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Mr Jahred Adelman (Yale), Kathryn Jepsen (Symmetry Magazine)
• 3:30 PM 4:00 PM
Afternoon Break 30m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 4:15 PM 5:25 PM
Young Physicists' Lightning Round Session 1 IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 4:15 PM
Measurement of the Shape of the Lambda_b -> Lambda_c mu nu Differential Decay Rate 10m
A measurement of the shape of the differential decay rate and associ- ated Isgur-Wise function for the decay Λ0b → Λc + μ−ν has been performed using data corresponding to 3fb−1 collected with the LHCb detector using proton-proton collisions. The Λ+c μ−ν final states are reconstructed by the detection of a muon and a Λ+c baryon decaying to pK−π+, and the decay Λ0b → Λ+c π+π−μ−ν is used to determine contributions from Λ0b → Λc ∗+ μ−ν decays. The measured dependence of the differential decay rate upon the squared four-momentum transfer between the heavy baryons, q2, is compared with expectations from heavy-quark effective theory and from unquenched lattice QCD predictions.
Speaker: Scott Edward Ely (Syracuse University)
• 4:25 PM
Direct photon production at LHCb 10m
At small Bjorken-x, the large gluon number density in the nucleon leads to gluon recombination competing with gluon splitting, which could result in saturation of the gluon PDF. This gluon saturation has yet to be conclusively observed. Direct photon production provides sensitivity to gluon densities in protons and nuclei, and the forward acceptance of LHCb detector allows for measurements of this process at low Bjorken-$x$, providing an ideal probe of saturation effects. Progress towards the measurement of forward direct photon production using the LHCb detector will be presented.
Speaker: Thomas Julian Boettcher (MIT)
• 4:35 PM
Jet fragmentation and charged particle angular distribution within and around jets in Pb+Pb collisions with ATLAS 10m
The latest measurements of the jet fragmentation and the angular distributions of charged particles within and around jets, as performed with the ATLAS detector in Pb+Pb collisions at the LHC a. Jets are direct probes of the QCD medium created in these collisions, and studying jet fragmentation provides insight into the strength and mechanism of jet quenching. Fragmentation functions in Pb+Pb collisions and distributions of the transverse momentum of charged particles are compared to the same quantities measured in pp collisions at the same collision energy. Measurements are presented as a function of jet transverse momentum and jet rapidity at √sNN = 5.02 TeV. The charged-particle angular distributions are also measured at distances extending outside the jet radius of R=0.4.
Speaker: Akshat Puri (University of Illinois, Urbana-Champaign)
• 4:45 PM
Measurement of Higgs bosons decaying to Tau lepton pairs and Constraints on Anomalous HVV couplings 10m
In 2017 CMS was the first experiment to observe the Higgs boson in its decay to Tau Leptons. Now, using 35.9 1/fb of data collected by CMS from proton-proton collisions at the Large Hadron Collider in 2016, this channel is used to search for anomalous couplings in the production of the Higgs. The search is performed using the Matrix Element Likelihood Analysis (MELA) method to constrain four different types of anomalous couplings. The final limit makes use of an advanced 2 dimensional fit technique and results, so far, remain consistent with the Standard Model. The analysis is described and plans for the future, which include implementation of a machine learning algorithm for improved event selection, are presented.
Speaker: Samuel Lloyd Higginbotham (Princeton University)
• 4:55 PM
Why do we care about looking for di-Higgs production? 10m
In 2012, the LHC experiments discovered a Higgs boson-like particle, however there are still outstanding questions about the Higgs sector. Is this the Standard Model (SM) Higgs? Are there any additional Higgs bosons? Does physics Beyond the SM exist? In this talk I will explain how studying di-Higgs production can provide a unique window into these questions, as well as insight into electroweak symmetry breaking. I will also discuss the current status and future prospects of searching for di-Higgs production at ATLAS.
Speaker: Tyler James Burch (Northern Illinois University)
• 5:05 PM
Search for Vector boson scattering of WZ boson pairs 10m
Production of massive vector bosons via vector boson scattering provides a direct probe of the self-interactions of the massive vector bosons, which are intimately connected to the Higgs-Englert-Brout mechanism of EW symmetry breaking. A search for vector boson scattering of W and Z bosons has recently been performed by the CMS experiment using data collected in 2016. I will present this search as well as cross section measurements of WZ+2 jet events, which are less dependent on theoretical inputs.
Speaker: Kenneth David Long (Univ. of Wisconsin)
• 5:15 PM
Natural SUSY on Trial: Status of Higgsino Searches with the ATLAS Detector 10m
Natural supersymmetry has earned a unique focus in LHC search efforts, in part due to its solution to the hierarchy problem. Minimizing fine tuning in this solution leads to light Higgs superpartners, known as higgsinos, with many predictions of their masses well within LHC reach. In order to also provide a valid dark matter candidate, the lightest three higgsinos are expected to have small mass splittings between them. While this “compressed” mass spectrum is well-motivated, such scenarios produce very little missing energy and thus are experimentally challenging. Here, these challenges and the idea of naturalness are used as a lens to interpret the first higgsino sensitivity with ATLAS and discuss future search prospects.
Speaker: Ms Julia Gonski (Harvard University)
• 5:30 PM 6:45 PM
Careers panel IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 7:30 PM 9:30 PM
Banquet at Two Brothers Roundhouse 2h IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• Friday, October 26
• 9:00 AM 9:25 AM
HEP visit to DC (Gov't Relations report) 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Dr Yangyang Cheng (Cornell University), Yangyang Cheng (Cornell University)
• 9:30 AM 10:30 AM
Young Physicists' Lightning Round Session 4: Connection to CERN: https://indico.cern.ch/event/765503/ IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 9:30 AM
Current and future searches for direct stau slepton production in the all-hadronic final state at CMS 10m
Two recent searches for new physics from the CMS experiment are shown. The first of which is a search for direct production of the tau slepton production in pp collisions at a center-of-mass energy of 13 TeV. The analysed data correspond to an integrated luminosity of 35.9 fb−1 collected with the CMS detector in 2016 and 41.3 fb−1 collected in 2017. The search is performed using events with two hadronically decaying tau leptons and a significant imbalance in the measured transverse momentum of the event. The second search uses similar techniques to analyse direct production of stau sleptons with the CMS Phase II detector at the LH-LHC. This future new physics study assumes the collection of 3000 fb−1 of proton-proton collision data produced at a center-of-mass energy of 14 TeV.
Speaker: Mr Owen Colegrove (UCSB)
• 9:40 AM
ATLAS ttH measurements in the H-> gamma gamma channel 10m
Higgs production in association with top quarks (ttH) is predicted by the Standard Model at a rate of about 1% of the total Higgs cross section. This process directly probes the Higgs-top coupling, a critical parameter for isolating Beyond the Standard Model contributions to Higgs physics. The ATLAS search for ttH events in conjunction with the decay H → γγ takes advantage of the high photon detection efficiency and energy resolution of the ATLAS electro-magnetic calorimeter, as well as the relatively low rate of diphoton background processes. The application of sophisticated multivariate techniques to identify ttH → γγ events improves the sensitivity to ttH compared to past analyses. In combination with other Higgs decay channels, ttH → γγ contributed to the recent discovery of the ttH production mode.
Speaker: Jennet Dickinson (UC Berkeley/LBL)
• 9:50 AM
Dark Photons at LHCb 10m
The possibility that dark matter particles may interact via unknown forces, felt only feebly by Standard Model particles, has motivated substantial effort to search for dark-sector forces, the dark photon being a promising candidate. Its motivation, LHCb search results, and current limits will be presented.
Speakers: Mr Constantin Weisser (Massachusetts Institute of Technology), Constantin Weisser (MIT)
• 10:00 AM
A data driven search for non-resonant features in the dilepton spectra at ATLAS 10m
The ATLAS experiment is conducting a search for high mass resonant and non-resonant features in dilepton (ee, mumu) spectra using the full Run-2 dataset. Models with new contact interactions (CI) and large extra dimensions (ADD) can manifest themselves as a slight enhancement in the high mass tail of the spectrum. The challenge is to develop a background model that can constrain the shape of the tail, and still provide sensitivity to new features. We present a data driven strategy designed to search for such features. The method has been optimized for sensitivity to CI, but it is sensitive to a wide variety of models and features.
Speaker: Aaron White (University of Michigan)
• 10:10 AM
Probing new physics through exotic Higgs boson decays to a pair of light bosons 10m
Exotic decays of the Standard Model (SM) Higgs boson provide a unique window for the discovery of new physics, as the Higgs may couple to hidden-sector states that do not interact under the SM gauge transformations. Models predicting exotic Higgs decays to additional light bosons appear in many extensions to the SM and can explain several unknowns in physics, such as the nature of dark matter and the existence of supersymmetry. These type of searches also provide many exciting experimental aspects, including soft (low energy) leptons and jets, final states with triggering challenges, and jet merging at low energy scales. This talk will focus on the h->aa->2b2mu search to illustrate some solutions to these challenges and present an outlook for future ATLAS searches in this extended light boson sector.
Speaker: Christopher Hayes (Stony Brook University)
• 10:20 AM
Jet-associated deuteron production in pp collisions at 13 TeV with ALICE at the LHC 10m
The production of deuterons in high-energy collisions is particularly sensitive to the space and time evolution of the system, as well as the baryon production and transport mechanisms. Recent ALICE measurements of spectra and anisotropic flow of (anti-)deuterons provide insight into the production mechanisms of particles in heavy-ion collisions thanks to a critical comparison with the available theoretical approaches: coalescence and hydrodynamic models. We present new preliminary results on deuteron-jet correlations from pp collisions at 13 TeV to complement these findings. The measured jet-associated yields of (anti-)deuterons will be also compared to theoretical predictions in the context of a baryon coalescence model.
Speaker: Brennan Schaefer (Oak Ridge National Lab)
• 10:30 AM 11:00 AM
Coffee Break 30m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 11:00 AM 11:25 AM
Supporting young physicists (Quality of Life committee; ACCU) 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Viviana Cavaliere (Brookhaven National Lab)
• 11:30 AM 11:50 AM
DOE office of HEP perspective 20m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Dr Thomas LeCompte (US Department of Energy)
• 11:50 AM 12:10 PM
DOE office of NP perspective 20m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Dr George Fai (DOE)
• 12:10 PM 12:30 PM
NSF Office of EPP perspective 20m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Prof. Randal Ruchti Ruchti (National Science Foundation), Prof. Randy Ruchti (University of Notre Dame and National Science Foundation)
• 12:30 PM 1:30 PM
Lunch 1h IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 1:30 PM 2:30 PM
Young Physicists' Lightning Round Session 3 IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 1:30 PM
The CMS hadronic calorimeter (HCAL) employs a plastic-scintillator-based endcap detector. The CMS HCAL Phase 1 upgrade involves installing silicon photomultipliers (SiPM) to measure light from scintillators in the detector. The SiPM signals are digitized by custom readout cards, called QIE cards, using the charge integration and encoder version 11 (QIE11) chip. The QIE cards for the HCAL endcap (HE) were tested and calibrated at FNAL. Then at CERN the QIE cards completed high radiation tests in the CHARM facility and muon/pion energy measurements in testbeam. Finally, the HE readout electronics were installed in CMS in 2018. The HCAL endcaps were calibrated using two Co-60 radiation sources. During physics data-taking in 2018, the HCAL online software (HCOS) configures and monitors the readout electronics to ensure data quality. This talk will summarize the testing, installation and commissioning of the HE Phase 1 upgrade readout system.
Speaker: Caleb Smith (Baylor University)
• 1:40 PM
Silicon sensors find application in the phase 2 upgrade of the inner and outer tracker and the endcap calorimeter for CMS. In these locations they will be exposed to a high fluence of charged particles and neutrons. We are using the research reactor at the Rhode Island Nuclear Science Center to expose prototype sensors to neutrons to understand their effect on the performance of the sensors. The talk will discuss the measurement of the neutron flux spectrum of the reactor and the different techniques available for irradiating prototype sensors.
Speaker: Bjorn Burkle (Brown University)
• 1:50 PM
Visualizing Electrons in ATLAS 10m
Efficient and accurate electron reconstruction, identification, and calibration are critical for signal selection and uncertainty reduction in a broad range of ATLAS analyses. Traditionally, electron algorithms are built using physics-motivated, derived variables. This talk explores an alternate method for representing electrons by building images using calorimeter cells.
Speaker: Savannah Thais (Yale University)
• 2:00 PM
Measurement of the cross section of top quark pairs in association with a photon in lepton+jets events at sqrt(s) = 13 TeV 10m
The production cross section of a top quark pair plus a radiated photon is measured during proton-proton collisions at the centre of mass energy of 13 TeV corresponding to an integrated luminosity of 35.86 inverse fb at the LHC, at CERN. The data was recorded by the Compact Muon Solenoid experiment. The signal region is defined by top quark pairs, an isolated lepton, photon, jets from the hadronization of quarks, and missing transverse energy. The photons may be emitted directly from initial state radiation, top quarks as well as from its decay products. An important part of the analysis is calculation of photon purity and photon identification efficiency, which are done using data-driven methods and MC simulation.
Speaker: Ms Titas Roy (Florida Institute of Technology)
• 2:10 PM
Illuminating the Hbb Discovery at ATLAS with the VBF + photon channel 10m
After the discovery of the Higgs Boson in 2012 a major goal for Higgs physics is the more precise measurement of its couplings, especially that of its dominant but largely unconstrained decay to bb. Beyond the importance of this measurement to our understanding of the SM, these constraints also serve as a probe of new physics beyond the SM. This year the ATLAS collaboration leveraged the combined Run 1 and Run 2 datasets and the power of multiple analyses to produce a 5.4 sigma (observed) discovery of Hbb. In this talk I will discuss the VBF analysis which found a 1.9 sigma (observed) signal strength for Hbb using a 30.6/fb dataset at 13 TeV. This analysis took advantage of the inclusion of a final state photon to reject QCD background process as well as innovations in bottom quark pT reconstruction to improve the final fit result.
Speaker: Mr Jacob Pasner (University of California Santa Cruz)
• 2:20 PM
ttH measurement in multi-lepton final state with ATLAS detector 10m
This talk will focus on the ttH multi-lepton (non hadronic tau) channel. Since these channel is dominated by fake lepton background, data driven method is used in this channel to estimate those event, and with separately estimate norm factor for fakes from difference source, we have a relatively good modeling in the signal region and control region.
Speaker: Zhi Zheng (University of Michigan)
• 2:30 PM 3:30 PM
Cross-experiment discussion: breakout sessions IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Conveners: Corrinne Mills, Harvey Newman (Caltech)
• 2:30 PM
Diversity and Inclusion 1h Sunrise (11E)
### Sunrise (11E)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Kevin Black, Meenakshi Narain (Brown University)
• 2:30 PM
Machine Learning 1h Racetrack (7XO)
### Racetrack (7XO)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Nhan Tran (FNAL), Sergei Gleyzer (University of Florida)
• 2:30 PM
Moving to CERN 1h Black Hole (2NW)
### Black Hole (2NW)
Speakers: Darin Acosta (University of Florida), Ms Julia Gonski (Harvard University)
• 2:30 PM
Tracking and timing detectors 1h Snakepit (2NE)
### Snakepit (2NE)
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Jessica Metcalfe (Argonne National Laboratory), Lindsey Gray (Fermilab)
• 3:30 PM 4:00 PM
Afternoon Break 30m Wilson Hall
### Wilson Hall
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 4:15 PM 4:40 PM
ATLAS Status and Outlook 25m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speaker: Sarah Demers (Yale)
• 4:45 PM 5:45 PM
Young Physicists' Lightning Round Session 4 IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 4:45 PM
The LHCb Upstream Tracker upgrade and its off-detector electronics 10m
The LHCb detector will operate with 40 MHz readout and full-software trigger at higher luminosity, after Phase-1 upgrade. The Upstream Tracker (UT) is a critical part of the upgrade that will increase the data rate and trigger efficiency. In this talk, I will describe the purpose and design of UT, with an emphasis on its off-detector electronics.
Speaker: Mr Zishuo YANG (University of Maryland)
• 4:55 PM
RNN Tau Identification within the ATLAS HLT 10m
Inspired by developments from the Tau Combined Performance group, the Tau Trigger group recently introduced a Recurrent Neural Network architecture to identify HLT tau leptons in place of our previous Boosted Decision Tree architecture. In this talk, I'll summarize the implementation and performance of this new RNN tau identification scheme within the HLT.
Speaker: Mariel Pettee (Yale University)
• 5:05 PM
Search for W Gamma Resonances in proton - proton collisions in 13TeV 10m
We present a model-independent search for beyond-standard-model heavy resonances decaying into a W boson and a photon. Possible models include charged Higgs, W', and supersymmetric mesons in folded-SUSY. The lepton channel is used as it has lower background and higher sensitivity to still uninvestigated resonance mass ranges. We aim to set cross-section limits through detailed data analysis of CMS 2016-17 run 2 data.
Speaker: Kak Wong (University of Maryland)
• 5:15 PM
Search for resonant t¯t production in proton-proton collisions at 13 TeV 10m
A search for a heavy resonance decaying into a top quark and antiquark pair is performed using proton-proton collisions at 13 TeV. The search uses the dataset collected with the CMS detector in 2016, which corresponds to an integrated luminosity of 35.9 1/fb. The analysis is split into three exclusive final states and uses reconstruction techniques that are optimized for top quarks with high Lorentz boosts, which requires the use of non-isolated leptons and jet substructure techniques. No significant excess of events relative to the expected yield from standard model processes is observed. Upper limits on the production cross section of heavy resonances decaying to a tt pair are calculated. Limits are derived for a leptophobic topcolor Z' and for Kaluza–Klein excitations of the gluon in the Randall–Sundrum model.
Speaker: Ms Bahareh Roozbahani (suny Buffalo)
• 5:25 PM
The CMS Outer Tracker Upgrade for the High Luminosity LHC 10m
The LHC will be upgraded to the High Luminosity (HL-LHC) in the late 2020 to further increase the discovery potential of the machine. During the HL-LHC the instantaneous luminosity will be as high as 7x10^34 cm^−2s^−1 in order to collect 10x more proton-proton collision data than at the LHC. The HL-LHC upgrade will set unprecedented challenges from the point of view of both detector and electronics capabilities and radiation hardness. In order to maintain its physics reach, the CMS detector will be significantly upgraded. The design choices of the new CMS Outer Tracker will be presented along with the ongoing R&D activities.
Speaker: Fabio Ravera (Fermilab)
• 5:35 PM
pyhf: pure-Python implementation of HistFactory models with autograd 10m
The HistFactory p.d.f. template [CERN-OPEN-2012-016] is per-se independent of its implementation in ROOT and it is useful to be able to run statistical analysis outside of the ROOT, RooFit, RooStats framework. pyhf is a pure-python implementation of that statistical model for multi-bin histogram-based analysis and its interval estimation is based on the asymptotic formulas of "Asymptotic formulae for likelihood-based tests of new physics" [arxiv:1007.1727]. pyhf supports modern computational graph libraries such as TensorFlow and PyTorch in order to make use of features such as autodifferentiation and GPU acceleration.
Speaker: Matthew Feickert (Southern Methodist University)
• 6:00 PM 6:15 PM
Announcement of lightning round winners 15m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
• 6:15 PM 6:30 PM
Closing remarks 15m IARC
### IARC
#### Fermilab
Pine St and Kirk Rd Batavia, Illinois
Speakers: Corrinne Mills, corrinne mills (University of Illinois at Chicago)
• 6:30 PM 6:35 PM | 2023-02-08T11:39:30 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.47708719968795776, "perplexity": 14142.502099347064}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500758.20/warc/CC-MAIN-20230208092053-20230208122053-00717.warc.gz"} |
https://par.nsf.gov/biblio/10213496-efficient-quantum-circuit-decompositions-via-intermediate-qudits | Efficient Quantum Circuit Decompositions via Intermediate Qudits
Many quantum algorithms make use of ancilla, additional qubits used to store temporary information during computation, to reduce the total execution time. Quantum computers will be resource-constrained for years to come so reducing ancilla requirements is crucial. In this work, we give a method to generate ancilia out of idle qubits by placing some in higher-value states, called qudits. We show how to take a circuit with many O(n) ancilla and design an ancilla-free circuit with the same asymptotic depth. Using this, we give a circuit construction for an in-place adder and a constant adder both with O(log n) depth using temporary qudits and no ancilla.
Authors:
; ;
Award ID(s):
Publication Date:
NSF-PAR ID:
10213496
Journal Name:
Proceedings of the 50th International Symposium on Multiple-Valued Logic
Page Range or eLocation-ID:
303 to 308
The road to computing on quantum devices has been accelerated by the promises that come from using Shor’s algorithm to reduce the complexity of prime factorization. However, this promise hast not yet been realized due to noisy qubits and lack of robust error correction schemes. Here we explore a promising, alternative method for prime factorization that uses well-established techniques from variational imaginary time evolution. We create a Hamiltonian whose ground state encodes the solution to the problem and use variational techniques to evolve a state iteratively towards these prime factors. We show that the number of circuits evaluated in each iteration scales as$$O(n^{5}d)$$$O\left({n}^{5}d\right)$, wherenis the bit-length of the number to be factorized anddis the depth of the circuit. We use a single layer of entangling gates to factorize 36 numbers represented using 7, 8, and 9-qubit Hamiltonians. We also verify the method’s performance by implementing it on the IBMQ Lima hardware to factorize 55, 65, 77 and 91 which are greater than the largest number (21) to have been factorized on IBMQ hardware.
5. The Swap gate is a ubiquitous tool for moving information on quantum hardware, yet it can be considered a classical operation because it does not entangle product states. Genuinely quantum operations could outperform Swap for the task of permuting qubits within an architecture, which we call routing. We consider quantum routing in two models: (1) allowing arbitrary two-qubit unitaries, or (2) allowing Hamiltonians with norm-bounded interactions. We lower bound the circuit depth or time of quantum routing in terms of spectral properties of graphs representing the architecture interaction constraints, and give a generalized upper bound for all simple connected $n$-vertex graphs. In particular, we give conditions for a superpolynomial classical-quantum routing separation, which exclude graphs with a small spectral gap and graphs of bounded degree. Finally, we provide examples of a quadratic separation between gate-based and Hamiltonian routing models with a constant number of local ancillas per qubit and of an $\Omega(n)$ speedup if we also allow fast local interactions. | 2023-02-03T16:57:30 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 1, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5076598525047302, "perplexity": 957.8426649891798}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500058.1/warc/CC-MAIN-20230203154140-20230203184140-00336.warc.gz"} |
https://pdglive.lbl.gov/DataBlock.action?node=M095W&home=MXXX020 | #### ${{\boldsymbol K}^{*}{(1680)}}$ WIDTH
VALUE (MeV) EVTS DOCUMENT ID TECN CHG COMMENT
$\bf{ 322 \pm110}$ OUR AVERAGE Error includes scale factor of 4.2.
$354$ $\pm75$ ${}^{+140}_{-181}$ 4289 1
2017 C
LHCB ${{\mathit B}^{+}}$ $\rightarrow$ ${{\mathit J / \psi}}{{\mathit \phi}}{{\mathit K}^{+}}$
$205$ $\pm16$ $\pm34$
1988
LASS 0 11 ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\mathit K}^{-}}{{\mathit \pi}^{+}}{{\mathit n}}$
$423$ $\pm18$ $\pm30$
1987
LASS 0 11 ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\overline{\mathit K}}^{0}}{{\mathit \pi}^{+}}{{\mathit \pi}^{-}}{{\mathit n}}$
• • We do not use the following data for averages, fits, limits, etc. • •
$454$ $\pm270$
1989
LASS - 11 ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\overline{\mathit K}}^{0}}{{\mathit \pi}^{-}}{{\mathit p}}$
$170$ $\pm30$
1980
MPS 0 6 ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\overline{\mathit K}}^{0}}{{\mathit \pi}^{+}}{{\mathit \pi}^{-}}{{\mathit n}}$
$250\text{ to }300$
1978
ASPK 0 13 ${{\mathit K}^{\pm}}$ ${{\mathit p}}$ $\rightarrow$ ${{\mathit K}^{\pm}}{{\mathit \pi}^{\pm}}{{\mathit n}}$
1 From an amplitude analysis of the decay ${{\mathit B}^{+}}$ $\rightarrow$ ${{\mathit J / \psi}}{{\mathit \phi}}{{\mathit K}^{+}}$ with a significance of 8.5 $\sigma$.
References:
AAIJ 2017C
PRL 118 022003 Observation of ${{\mathit J / \psi}}{{\mathit \phi}}$ Structures Consistent with Exotic States from Amplitude Analysis of ${{\mathit B}^{+}}$ $\rightarrow$ ${{\mathit J / \psi}}{{\mathit \phi}}{{\mathit K}^{+}}$ Decays
BIRD 1989
SLAC-332 Cerenkov Ring Imaging and Spectroscopy of Charged ${{\mathit K}^{*}}$ Interactions at 11 ${\mathrm {GeV/}}\mathit c$
ASTON 1988
NP B296 493 A Study of ${{\mathit K}^{-}}{{\mathit \pi}^{+}}$ Scattering in the Reaction ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\mathit K}^{-}}{{\mathit \pi}^{+}}{{\mathit n}}$ at 11 ${\mathrm {GeV/}}\mathit c$
ASTON 1987
NP B292 693 The Strange Meson Resonances Observed in the Reaction ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\overline{\mathit K}}^{0}}{{\mathit \pi}^{+}}{{\mathit \pi}^{-}}{{\mathit n}}$ at 11 ${\mathrm {GeV/}}\mathit c$
ETKIN 1980
PR D22 42 Measurement and Partial Wave Analysis of the Reaction ${{\mathit K}^{-}}$ ${{\mathit p}}$ $\rightarrow$ ${{\mathit K}_S^0}$ ${{\mathit \pi}^{+}}{{\mathit \pi}^{-}}{{\mathit n}}$ at 6 ${\mathrm {GeV/}}\mathit c$
ESTABROOKS 1978
NP B133 490 Study of ${{\mathit K}}{{\mathit \pi}}$ Scattering using the Reactions ${{\mathit K}^{\pm}}$ ${{\mathit p}}$ $\rightarrow$ ${{\mathit K}^{\pm}}{{\mathit \pi}^{+}}{{\mathit n}}$ and ${{\mathit K}^{\pm}}$ ${{\mathit p}}$ $\rightarrow$ ${{\mathit K}^{\pm}}{{\mathit \pi}^{-}}{{\mathit \Delta}^{++}}$ at 13 ${\mathrm {GeV/}}\mathit c$ | 2021-11-27T00:25:45 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.7812715768814087, "perplexity": 2172.8126791533346}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964358074.14/warc/CC-MAIN-20211126224056-20211127014056-00584.warc.gz"} |
https://pos.sissa.it/380/461/ | Volume 380 - Particles and Nuclei International Conference 2021 (PANIC2021) - Flavour physics - CKM and beyond
Precise measurements of D meson lifetimes
N. Nellikunnummel* and On behalf of the BELLE II collaboration
Full text: pdf
Pre-published on: March 22, 2022
Published on: May 24, 2022
Abstract
We report the result of $D^0$ and $D^+$ lifetime measurement using $D^0\to K^-\pi^+$ and $D^+\to K^-\pi^+\pi^+$ decays reconstructed using $72~{\rm fb^{-1}}$ of data collected by the Belle II experiment at SuperKEKB asymmetric-energy $e^+e^−$ collider.
The results, $\tau(D^0)=410.5\pm1.1({\rm stat})\pm0.8({\rm syst})~{\rm fs}$ and $\tau(D^+)=1030.4\pm4.7({\rm stat})\pm 3.1({\rm syst})~{\rm fs}$, are the most precise to date and are consistent with previous measurements
DOI: https://doi.org/10.22323/1.380.0461
How to cite
Metadata are provided both in "article" format (very similar to INSPIRE) as this helps creating very compact bibliographies which can be beneficial to authors and readers, and in "proceeding" format which is more detailed and complete.
Open Access
Copyright owned by the author(s) under the term of the Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International License. | 2023-03-24T19:10:04 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.2954542934894562, "perplexity": 4061.160499524373}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296945288.47/warc/CC-MAIN-20230324180032-20230324210032-00539.warc.gz"} |
https://indico.fnal.gov/event/19348/contributions/186596/ | Indico search will be reestablished in the next version upgrade of the software: https://getindico.io/roadmap/
# Neutrino 2020
June 22, 2020 to July 2, 2020
US/Central timezone
## New Results of the MAJORANA DEMONSTRATOR's for Double-Beta Decay of $^{76}$Ge to Excited States of $^{76}$Se
Not scheduled
10m
Poster
### Speaker
Ian Guinn (University of North Carolina at Chapel Hill)
### Description
The MAJORANA DEMONSTRATOR (MJD) is a low-background experiment searching for $\beta\beta$-decay of $^{76}$Ge to ground and excited states (ES) in $^{76}$Se using a modular array of high purity germanium detectors. The experiment consists of two modules with 29 detectors each, consisting of 44.8 kg of germanium detectors (29.7 kg enriched to 88% in $^{76}$Ge). ES decays produce a $\beta\beta$ with the prompt emission of one or two γs, often producing multisite events. The granularity of the MJD detector array enables powerful discrimination of ES events from backgrounds. for neutrinoless and two-neutrino $\beta\beta$s to three different ES, MJD has set world leading half-life limits ranging from $(5-21)\cdot10^{23}$ y (90% CL), using 21 kg-y isotopic exposure. This poster will present analysis techniques and an improved result including previously blinded data with $\sim42$ kg-y exposure.
### Mini-abstract
The MAJORANA DEMONSTRATOR has leading sensitivity to $\beta\beta$ of $^{76}$Ge to excited states
Experiment/Collaboration Majorana Collaboration
### Primary author
Ian Guinn (University of North Carolina at Chapel Hill)
### Presentation Materials
2020neutrino_ES_poster.pdf 2020neutrino_ES_video.mp4 | 2021-11-30T08:46:22 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.42461904883384705, "perplexity": 14153.92440506907}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964358966.62/warc/CC-MAIN-20211130080511-20211130110511-00055.warc.gz"} |
https://www.pnnl.gov/explainer-articles?explainer-articles%5B0%5D=research-topic%3A74&explainer-articles%5B1%5D=research-topic%3A86 | 2 results found
Filtered by Wind Energy and Transportation
SEPTEMBER 27, 2022
Renewable Integration
Renewable integration is the process of plugging renewable sources of energy into the electric grid.
SEPTEMBER 16, 2021 | 2022-12-05T21:44:08 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8264600038528442, "perplexity": 5611.625902627103}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711045.18/warc/CC-MAIN-20221205200634-20221205230634-00169.warc.gz"} |
https://control.com/textbook/physics/simple-machines/ | # What are Simple Machines?
## Chapter 2 - Physics in Industrial Instrumentation
A machine in the broad sense of the word is any device designed to translate some form of energy into useful work. A “simple” machine is one where both the input energy and the output energy are mechanical in nature (i.e. both are forces acting along displacements). Examples of simple machines include levers, pulleys, ramps, wedges, gears, and chain/sprockets. More complex machines include such examples as electric motors, heat engines, pumps, compressors, and refrigerators.
The efficiency of any machine (symbolized by the Greek letter “eta” $$\eta$$) is defined as the ratio of output energy to input energy:
Ideally, these two will be equal, with all of the input energy translated losslessly into output energy. However, no machine is perfectly efficient although some simple machines come very close to achieving 100% efficiency. It is physically impossible to achieve an energy efficiency greater than 100%, as that would violate the Law of Energy Conservation.
### Levers
Perhaps the most basic type of machine is the lever: a rigid beam pivoting on an axis. This axis may be something as simple as a round cylinder, a pointed wedge, or even a sophisticated bearing. In any case, the general term for the pivot point on a lever is fulcrum:
If we look at the lever’s motion at each end, we see that the distance the “output” end moves is a function of how far the “input” end moves as well as the ratio of lengths from each end to the fulcrum. Showing examples using three different classes of lever, each one with an $$8 \over 3$$ length ratio:
The ratio of output force to input force ($$F_{out} \over F_{in}$$) is called the mechanical advantage of the machine. This ratio is always the reciprocal of the output versus input motion: if the output of the lever moves less than the input moves, the output force must be greater than the input force, and vice-versa. This makes perfect sense if you view a lever as a perfectly efficient machine where the output energy (work) must equal the input energy (work): since output energy is output force multiplied by output motion, and input energy is input force multiplied by input motion, in order for force to be multiplied, motion must be diminished.
Levers abound in everyday life. A shovel, for example, functions as either a first-class lever or a second-class lever, depending on its use. In either case, it is being used as a force multiplier, the trade-off being that the person must move the handle a farther distance than the rock moves, thus exchanging motion for force:
### Pulleys
Another simple and useful machine is a pulley and rope. A “pulley” is nothing more than a wheel with a groove cut around its circumference to guide a rope or cable, a bearing and axle supporting the wheel and allowing it to freely turn. A single pulley hung from an overhead support has the ability to convert downward motion of a rope into upward motion to hoist a load:
A single-pulley system such as this exhibits no mechanical advantage, because $$F_{out} = F_{in}$$. If we get creative with multiple pulleys, however, we can achieve a mechanical advantage sufficient to hoist very heavy loads with modest input force:
Here, the weight is being supported by the tension within two ropes, not just one rope. Since the person’s force on the rope is what generates the rope’s tension, $$F_{in}$$ is equal to rope tension, while $$F_{out}$$ is equal to twice the rope’s tension. Thus, this simple machine has a mechanical advantage equal to 2. It also means the person’s motion while pulling the rope will be exactly twice the motion of the hoisted weight. Remember that we cannot cheat the Law of Energy Conservation: work in cannot be less than work out. If the output force is twice as much as the input force due to mechanical advantage, the output motion can only be half as much as the input motion.
The mechanical advantage of a pulley system may be extended beyond two by adding even more pulleys. This pulley system has a mechanical advantage of 4, since the weight is being supported by the tension of four ropes, while the person pulling only feels the tension of a single rope:
Here is where one must be careful in analyzing pulley systems with regard to mechanical advantage. The mechanical advantage in each of these examples was based on the number of ropes supporting the weight. So far, this also happened to equal the number of pulleys in the system. Lest anyone be tempted to determine mechanical advantage by simply counting pulleys, here is an example that breaks the pattern:
Here there is only one pulley in the system, yet the weight is being supported by the tension in two ropes and the person pulling on the rope only feels the tension of one rope, which means the system has a mechanical advantage of 2.
This simple technology is commonly used on cranes to provide huge amounts of lifting force with modest amounts of cable tension. In this photograph you can see the multiple pulleys and lifting cable of a large industrial crane:
### Inclined planes
A wedge, also referred to as an inclined plane, is another type of simple machine. A large enough wedge such as a ramp is useful for producing a mechanical advantage to lift a weight equipped with wheels. Instead of hoisting the weight vertically, the weight is rolled up the diagonal incline of the ramp:
In moving the heavy weight a short distance vertically, the person pushes with much less force over a longer distance. The mechanical advantage of this ramp, therefore, is equal to the ratio of the ramp’s diagonal length (hypotenuse side) to its vertical height (opposite side). From the perspective of angle $$\theta$$ shown in the illustration, this equates to the cosecant function ($$\csc \theta = {\hbox{hypotenuse} \over \hbox{opposite}}$$).
Another example of an inclined plane is a screw conveyor or auger, shown in the following photograph. The “fins” on the screw function as a long incline, wrapped around a central shaft:
Placed inside of a pipe and turned slowly, this simple machine moves semi-solid material linearly through the pipe.
In a similar fashion, this electric valve actuator uses the principle of an inclined plane to raise and lower a heavy gate to control the flow of wastewater through channels at a municipal wastewater treatment facility. The long threaded shaft pulls upward on the heavy gate (not shown), moved by the turning action of a nut engaged with the shaft’s threads. The electric motor inside the blue-colored actuator turns the nut on command, raising or lowering the gate as needed:
### Gears
A gear set is another type of simple machine, part of a whole class of simple machines converting one form of rotary motion into another forms of rotary motion. A set of spur gears are shown here:
Each gear rotates about a central axis (usually a rotating shaft), the teeth of each gear cut into shapes designed to smoothly “mesh” together as the gears rotate. Gears may be thought of as levers, with the radius of each gear equivalent to the distance between the fulcrum and the force point on a level. The gear with the largest radius turns the slowest, and with the most torque.
The mechanical advantage of a gear set is simply the ratio of gear diameters. Another way to determine gear ratios is to count the number of teeth on each gear: since the teeth are all cut to the same size so as to smoothly mesh, the ratio of gear teeth will be proportional to the ratio of gear circumferences, which in turn must be proportional to the ratio of gear radii. If a gear set may be turned by hand, a simple counting of turns from input to output will also allow you to calculate the gear ratio. For example, if you turn one gear 15 revolutions to get the second gear to turn 4 revolutions, the mechanical advantage is $$15 \over 4$$, or 3.75. As with levers, the gear that turns the farthest does so with less force (torque), and vice-versa. All simple machines work by trading motion for force, so that an increase in one necessarily results in a decrease of the other.
A variety of spur gear designs appears on this page. In this illustration, we see an external spur gear set with straight-cut teeth, perhaps the simplest style of gear:
Next, we see variations on this design where the gear teeth are cut at angles instead of being parallel with the gears’ shafts. This causes the meshing of the gear teeth to be smoother and quieter, but also causes a thrust force to develop along the axis of the gear shaft, since the teeth act as inclined planes. A “double” helical gear pattern (also known as a herringbone gear due to its resemblance to a fish skeleton) cancels any thrust force by angling the teeth in opposite angles. Herringbone gear sets are quiet and strong, but tend to be more expensive to manufacture than single-helical gears:
The exposed gear sets commonly found in antique machinery provide excellent visual examples of gear designs. This next photograph shows sets of external spur gears. The upper photograph shows a pair of meshing spur gears with parallel teeth, while the lower photograph shows a set of four meshing spur gears with single-helical teeth, both sets of gears found on antique gasoline engines:
Another style of gear set is called planetary, because its shape resembles circular orbits of planets around a star. Planetary gear sets are exceptionally strong, and are capable of delivering multiple gear ratios depending on which gear (the “sun” gear, the “ring” gear, or the “planet” gears) is being held stationary, which gear is the input, and which gear is the output. If any two sets of gears are locked together such that they rotate at the same speed, the third gear in a planetary mechanism must also rotate at that same speed, for a 1:1 ratio. Typically, the planet gears are all anchored in their respective positions by a rotating frame called a carrier:
The particular planetary gear set shown in the above illustration uses two sets of helical gears (much like a herringbone design, only with two single-helical gears placed back-to-back instead of one gear with double-helical teeth) in order to eliminate thrust forces on the shafts.
Planetary gear sets are the standard type of gears used in automatic transmissions for automobiles. Different gear ratios (e.g. “Low”, “Drive”, “Overdrive”) are achieved in an automatic transmission by selecting which gears in a planetary gear set are input, output, and stationary. A series of clutches engage and disengage shafts to control which gears are input versus output, while a series of bands act as brakes to hold different gears stationary in the planetary gear set. These clutches and bands are all operated by hydraulic oil pressure inside the transmission, controlled either by a series of hydraulic relays and/or by an electronic computer telling the transmission when to shift.
The Synergy$$^{TM}$$ gear drive system designed by Toyota for use in its line of hybrid gasoline-electric cars is a unique application of planetary gears. In the first-generation Toyota Prius, an electric motor/generator (“MG1”) is coupled to the sun gear, the internal-combustion (gasoline) engine is coupled to the planet carrier, and the driveshaft is coupled to the ring gear (as well as a second electric motor/generator “MG2”). This planetary gear set allows power to be transferred smoothly and with great flexibility between the engine, the motor/generator, and the driveshaft. Motor/generator MG1 functions as a kind of variable brake (in “generator” mode, passing its power to either the battery or to MG2) to slow down the sun gear to achieve an infinite number of effective gear ratios for the engine, and the gasoline engine may also be locked to keep the planet gear carrier from turning during all-electric operation.
With a simple set of parallel-shaft spur gears, the ratio of the gear set is simply the ratio of gear teeth (or of effective diameters). For example, if a spur gear set has 15 teeth on the driving gear ($$N_{driving}$$ = 15) and 45 teeth on the driven gear ($$N_{driven}$$ = 45), the gear ratio will be a 45:15 or 3:1 reduction in speed (multiplication in torque). Planetary gear sets are more complicated than this, as shown by the following table:
Condition Slow Fast Ratio ($$x:1$$)
Ring gear held stationary Planet carrier Sun $${N_r \over N_s} + 1$$
Sun gear held stationary Planet carrier Ring $${N_s \over N_r} + 1$$
Planet carrier held stationary Ring Sun $$-{N_r \over N_s}$$
Any two locked together 1
It is interesting to note that the only gear teeth (diameters) values factoring into these ratio calculations belong to the ring and sun gears. The negative sign for the stationary-carrier condition refers to the reversed rotation of the ring gear compared to the sun gear.
As always, one should strive to understand rather than memorize when learning anything new, and planetary gear set ratios are no exception to this rule. An excellent exercise is to mentally visualize each of the conditions listed in the table above, applied to a graphic image of a planetary gear set. Run a series of “thought experiments” on the gear set, where you imagine one of the three pieces being held stationary while one of the free pieces is turned. Ask yourself whether the third piece turns faster or slower than the other free piece. Then, imagine the sun gear growing or shrinking in size, and ask yourself how this change in sun gear size affects the speed ratio:
A variety of gear set designs with perpendicular shafts exist to transfer mechanical power around corners. First, we see a crossed helical spur gear. Like parallel-shaft helical spur gears, crossed helical gears generate thrust forces due to the action of the gear teeth as inclined planes:
Next we see a bevel gear or miter gear set, where a pinion gear intersects with a ring gear to transfer mechanical power through perpendicular shafts. The left-hand illustration shows a straight-toothed bevel gear set, while the right-hand illustration shows a spiral-toothed bevel gear set.
These two styles of bevel gears are analogous to the straight- versus helical- toothed variants of the spur gear, with similar characteristics: spiral-toothed bevel gears provide smoother and quieter operation than straight-toothed bevel gears, but at the expense of generating large thrust forces on the pinion gear shaft, and radial forces on the ring gear shaft.
An interesting variation on the bevel gear concept is the hypoid gear system, where the two shaft axes do not intersect. In this gear set, the gear teeth actually rub against each other rather than merely touch, necessitating special lubricant to tolerate the dynamic pressures and stresses. Hypoid gear sets are exceptionally strong and quiet-running, and became popular for automotive axle drive systems because they allowed the driveshaft (attached to the pinion gear) to be lower than the axles (attached to the ring gear), providing more floor space in the vehicle. The non-intersecting shaft centerlines also make it possible to place support bearings on both ends of the pinion gear for extra strength, as seen in heavy-duty truck axle designs:
A photograph of a hypoid gear set inside the differential of an automobile is shown here, the differential housing cover removed for inspection:
An important type of gear set used for perpendicular-shaft applications with large speed-reduction ratios is the worm gear. A worm gear resembles a screw whose threads engage with matching helical-cut threads on another gear called a worm wheel:
An interesting and useful feature of a worm gear set is that power transfer occurs easily from the worm screw to the worm wheel, but not so easily from the worm wheel to the worm screw due to friction between the teeth of the two gears. This means when the worm screw is not being turned by an outside force, even small amounts of friction between the screw threads and wheel teeth will effectively “lock” the worm wheel in place such that it cannot turn when an outside force acts on it. A practical example of a worm gear exploiting this feature is a hand-crank winch, where we desire the winch drum to remain locked in position when we let go of the hand-crank.
Another interesting feature of worm gears is that the gear ratio is simply the number of teeth on the worm wheel, since the tooth pitch on the circumference of the worm wheel defines what the thread pitch must be on the worm screw. For example, a worm wheel having 40 teeth around its circumference will exhibit a 40:1 speed-reduction ratio regardless of worm screw size, since there is only one worm screw thread pitch that will engage with the teeth on this worm wheel.
A real worm gear assembly may be seen in this next photograph, as one component of an antique farm implement. Here, a hand-wheel turns the work screw, which then turns the worm wheel and either lifts or drops the height of the implement’s blade:
The “one-way” action of a worm gear is advantageous in this application, so that the hand wheel does not spin on its own every time the implement’s blade encounters uneven ground. Wherever the hand wheel is set to adjust blade height, that blade height remains fixed until the hand wheel is turned to some new position.
It should be noted that modern worm gear sets, like nearly all types of gears, are more commonly found encased in a housings where they operate in a lubricated environment, sealed from contamination by dust and other matter both solid and liquid. Exposed gears are more commonly seen on antique machinery, where the mechanical stresses were low enough (i.e. low torque forces, large gears) to permit reliable operation of gears with the only lubrication typically being a coat of heavy grease smeared over the gear teeth.
As with other types of simple machines, gear sets may be combined into larger assemblies, with the over-all mechanical advantage (i.e. gear ratio) being the product of all individual gear ratios in the system. An example of a compound gear train is this helicopter transmission, designed to reduce the high-speed shaft rotation of the helicopter’s turbine engine down to a speed more suitable for the main rotor:
Mechanical shaft power flows from the turbine shaft (usually several thousand RPM) to the rotor (a few hundred RPM) in this transmission via several types of gears. First, the turbine shaft’s speed is reduced through multiple sets of bevel gears operating in parallel (from the “driving spur pinion” gear to the “face gears”). These multiple face gears then couple to a “combining” gear through a spur gear reduction. This combining gear then feeds power to a central “sun” gear in a planetary gear train. The “ring” gear of this planetary set is fixed to the case of the transmission so that it does not turn. Finally, four “planet” gears running in a common carrier assembly drive the helicopter’s rotor.
The following photograph shows a modern “gearbox” used to decrease the rotational speed of an electric motor, to turn an auger feeding grain out of a storage bin at a beer brewery. Like all modern gear sets, the gears inside this gearbox operate in a continuously-lubricated environment, sealed to prevent contaminants such as dust and water from entering:
A very large gearbox is shown in this next photograph, used in the head of a Vestas wind turbine to “step up” the slow rotational speed of the turbine to the much higher rotational speed of the electric generator. Planetary gears are used in wind turbine gearboxes due to their ruggedness and relatively compact size:
The ratio of this wind turbine’s gear set happens to be 111.5:1, with the generator turning 111.5 times faster than the turbine blades (but with only $$1 \over 111.5$$ the torque of the turbine blades, of course)!
### Belt drives
A sheave is very similar in form and function to a pulley, but designed to grip a flexible belt rather than a rope or a cable. Unlike a pulley which is designed to turn freely to re-direct the tension of a rope, a sheave works more like a gear to couple the belt’s motion to a rotating shaft. The mechanical advantage of a pair of sheaves coupled by a common belt is simply the ratio of sheave radii, just like gears:
The following photograph shows a triple-belt drive from an electric motor to an agitator on the bottom of a sawdust storage bin:
As indicated by the respective sheave diameters, the electric motor turns much faster than the agitator, while the agitator spins with much greater torque than the motor.
Most modern belt drives are either V-belt or toothed belt, referring to the shapes of the belt and how they engage with the sheave. The triple-belt drive system for the sawdust agitator shown in the previous photograph used V-belts. A V-belt has a V-shaped cross-section, and sits in a V-shaped groove around the circumference of the sheave. Toothed belts almost resemble chains, in that their inner surface is characterized by regularly-spaced perpendicular ribs designed to engage with matching cavities machined into the circumference of the sheave. The advantage of a toothed belt is that it cannot slip on the sheave if overloaded, unlike a V-belt. A toothed belt is firmly “locked” into place on the sheave’s circumference so long as proper belt tension is maintained.
An older belt-and-sheave technology is the flat belt. Here, the sheave’s circumference is flat, and the belt itself is nothing more than a strip of flexible material with no special shape. The following photograph shows an antique flat belt drive in a workshop, where a central shaft ran along the ridge of the ceiling to power several machines in the shop, the shaft itself turned continuously by either a water turbine or a steam engine:
Flat belts are still used in modern times, but they tend to be much wider than V-belts or toothed belts of comparable rating in order to deliver adequate “grip” on the sheave. Also, sheave-to-sheave alignment is much more critical for a flat belt, which has no guides on the sheave to keep it centered.
Like gear sets, industrial belt drive systems are typically shrouded for cleanliness and for personnel safety. Sheet-metal enclosures such as the one covering the top of this V-belt drive system on a “walking-beam” style of oil field pump. The sheet-metal enclosure protects the belts and sheaves from rain and snow. You will also note a large gearbox following the belt drive, further reducing rotational speed from the electric motor to the pump’s counter-weighted crank:
Belts of all styles are subject to wear and fatigue, and as such must be periodically replaced. Some belt drive systems employ tensioner mechanisms which maintain consistent belt tension by applying a constant force to the belt. Small tensioners are usually spring-loaded, while large belt tensioners (particularly conveyor belts) are loaded by the weight of a large mass. Minimum belt tension is extremely important for belt drives, as loose belts will begin to “slip” under load and quickly fail if the problem is not remedied.
When multiple belts are used to distribute loading between belts in high-power drive systems, it is important that all belts be replaced simultaneously, never partially. If a new belt is installed next to an old belt on the same sheave, the old belt will run “loose” and not bear its full share of the load, thus overloading the other (new) belt(s) in the drive system.
### Chain drives
Sprockets are identical in function to sheaves, using link chain rather than belt to couple the two rotating pieces together. Bicycles are perhaps the best-known example of sprockets and chains from everyday life, being the most efficient simple machine for the purpose of coupling a person’s leg power to a rotating wheel for propulsion. Like gear sets, the mechanical advantage ratio of a sprocket set may be determined by counting teeth on each sprocket and then dividing one tooth count by the other, or empirically by rotating one sprocket by hand and counting the number of turns (revolutions) each sprocket makes.
The following photograph shows a pair of sprockets linked together with a roller chain. The sprocket ratio here is 1:1, as both sprockets share the same number of teeth:
Bicycles use sprockets and a chain to transfer power from the crank to the rear wheel. Here, a multi-speed sprocket assembly allows the rider to select the best ratio (i.e. mechanical advantage) for riding at different speeds and in different conditions. Three sprockets on the crank and eight sprockets on the wheel give a theoretical maximum of 24 different “speeds” or “gears” from which to select:
Chain drive systems require thorough lubrication and freedom from dirt and other abrasive particles in order to deliver full service life. Open-chain systems such as the two shown in the above photographs are challenging to maintain in good working order for these reasons.
Published under the terms and conditions of the Creative Commons Attribution 4.0 International Public License | 2021-10-27T00:57:49 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.45841437578201294, "perplexity": 1831.2656640484392}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323587963.12/warc/CC-MAIN-20211026231833-20211027021833-00666.warc.gz"} |
https://quizlet.com/2983214/math-measurement-flash-cards/ | 15 terms
# Math Measurement
Math Measurement
#### Terms in this set (...)
a unit for measuring capacity in the customary system.
gallon
a customary unit of capacity equals to two tablespoons.
fluid ounce
a customary unit of capacity.
cup
a customary unit of capacity equal to two cups.
pint
a customary unit of capacity equal to two pints.
quart
a system of units used to express the weight of something
weight
A customary unit of weight
ounce
A customary unit of weight equal to 16 ounces.
pounds
A customaty unit of weight equal to 2,000 pounds.
tons
The measure of quantity of matter in an objective.
mass
A metric unit of length.
milligram
A metric unit of mass.
gram
A metric unit of mass.
kilogram
liter
a metric unit of capacity equal to the volume of 1 kilogram of pure water at 4 degrees centigrade and 760 mm of mercury (or approximately 1.76 pints)
milliliter
a metric unit of volume equal to one thousandth of a liter
#### Flickr Creative Commons Images
Some images used in this set are licensed under the Creative Commons through Flickr.com.
Click to see the original works with their full license. | 2019-04-24T00:57:18 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8034820556640625, "perplexity": 2935.7766851636347}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578616424.69/warc/CC-MAIN-20190423234808-20190424020808-00301.warc.gz"} |
https://nepis.epa.gov/Exe/ZyPURL.cgi?Dockey=9101PBHL.txt | bu Throw Guidebooks Workbook Software Videotape ------- duction to EPA's •YouThrow Tool Kit More and more communities, looking for ways to better manage solid waste, have found that pay-as-you-throw programs can make a tremen- dous difference. Instead of being charged indirectly for trash services, residents under pay-as-you-throw programs pay a direct fee based on the amount of waste they generate.This creates an incentive for individuals to reduce and recycle, easing pressure on both municipal budgets and waste disposal facilities. Pay-as-you-throw programs represent a major shift in the way communities and their residents pay for solid waste collection and disposal.To be successful, a pay- as-you-throw program must be carefully considered, designed and implemented. This Pay-As-You-Throw Tool Kit contains a wide variety of useful products to help you through this process. It includes tools that will help with specific tasks, like conducting a public outreach campaign or designing your program's rate structure. It also offers resources to help you learn about pay-as-you-throw in general.This Tool Kit has been divided into several main categories to enable you to locate at a glance the specific tools you need. Guidebooks Two important guidebooks have been developed that you can use to help decide whether to adopt pay-as-you-throw and how to implement and promote both pay-as-you-throw and other source reduction programs in your community. Pay-As-You-Throw: Lessons Learned About Unit Pricing This guide provides an in-depth introduction to pay-as-you-throw and explains how to get a program started. It describes the benefits and potential barriers to pay-as-you-throw programs, helps you determine what type of system is best for your community, and provides detailed instructions on how to design and imple- ment a successful program.The guide is based on proven, practical strategies from communities with pay-as-you-throw programs in place. The Consumer's Handbook for Reducing Solid Waste This guide contains a number of ideas about how to reduce and recycle many of the items residents often dispose of as trash. Since residents under pay-as-you- throw will want to learn how to reduce waste, these ideas can be incorporated into the products you develop as part of your outreach campaign. ------- This supplement to Pay-As- You-Throw: Lessons Learned About Unit Pricing is a user- friendly, hands-on workbook. It focuses on some of the key steps involved in developing a pay-as-you-throw program, from convincing elected officials, resi- dents, and other community stakeholders that pay-as-you-throw can work to designing a rate structure. It is divided into five sections. Each section contains the tools you need to research, design, promote, and implement a pay-as-you-throw program in your community. Presentation Materials Planners can conduct a presentation for community stakeholders, such as elected officials, other municipal employees, and representatives from local civic groups, to help earn their support for pay-as-you-throw.To help you deliver an effective briefing, you can adapt and use the sample agenda, pre-meeting survey of attendees, set of overhead transparency masters with talking points, and other presentation materials included in this section. Public Outreach Materials A pay-as-you-throw program's success often depends on a strong public outreach and education effort.To help you start developing your public outreach program, this sec- tion includes a list of outreach ideas, fact sheets and other reproducible products, and a set of clip art to help you create your own customized outreach materials. Worksheets A set of worksheets also are included in this workbookThese worksheets can be used to guide you through each of the major steps involved in pay-as-you-throw program development, from deciding if pay-as-you-throw is right for your community to imple- menting and monitoring the program. Articles and Newsclippings This section contains a set of articles to provide you with background information on pay-as-you-throw and how other communities have planned for and developed pay-as-you-throw programs. In addition, once you begin your public outreach program, you can add press clippings to this section to track coverage in the local media. Bibliography Turn to this section if you are interested in doing further research on pay-as-you-throw. It includes an annotated bibliography listing over 50 recent pay-as-you-throw publica- tions, from articles in solid waste trade magazines to reports from universities and private institutions.You can also use this section to organize any additional publication resources you find during your research. ------- 'Software ^^^™wo recently developed electronic tools are included in this section that you can I use to plan out a pay-as-you-throw program.These software packages can help I you perform the calculations involved in rate structure design and learn more about source reduction, recycling, and other solid waste management issues in general. Pay-As-You-Throw Rates Model This comprehensive software has been designed specifically for MSW planners to use in calculating the costs of a community's pay-as-you-throw program and arriving at the optimal per-container fee. It allows users to enter choices relating to key pay-as-you- throw program development variables like container types and sizes and complemen- tary programs. It then totals all of the resulting costs and helps planners assign prices to their containers that will allow them to cover these expenses completely. MSW Factbook This electronic reference manual contains more than 200 screens of useful facts, fig- ures, tables and information about municipal solid waste. Covering an expansive range of topics, including waste generation, source reduction, recycling, landfills, and Subtitle D regulations, this software can serve as a valuable information resource for planning and implementing a pay-as-you-throw program. tape The videotape included in this section can be used to increase the impact of brief- ings for elected officials, presentations at town meetings, and other pay-as-you- throw events. Depending on the type of presentation and your audience, you can run the entire video or just the sections that will help you make your case. East Central Iowa Council of Governments Unit Pricing Video This 30-minute video provides a clear, comprehensive summary of the central concepts of unit pricing. Focusing on six communities in Iowa that have implemented pay-as-you- throw programs.it uses interviews with elected officials and residents, solid waste experts, and economists to describe the economic and environmental benefits of pay- as-you-throw.The video also shows how these case study communities were able to overcome potential barriers and implement successful pay-as-you-throw programs. ------- s You Throw EPA's Pay-As-You-Throw Tool Kit EPA is pleased to present its Pay-As-You-Throw Tool Kit. Throughout the final stages of the Tool Kit's develop- ment, we have been aware of the need to release it promptly to you and the hundreds of others that have already requested copies. We appreciate your patience and hope you find the Tool Kit helpful. ! For the past two years, EPA's Office of Solid Waste has led a national initiative to promote an approach to municipal solid waste (MSW) management called pay-as-you-throw. Under pay-as-you-throw (also known as unit pricing) programs, households are charged for waste collection based on the amount of trash they throw away— in the same way they are charged for water, electricity, and other utilities. This gives residents a direct incentive to reduce the amount of waste they generate. To date, close to 2,000 communities nationwide have turned to these systems to help reduce waste and control MSW management costs. At the heart of EPA's outreach initiative is a simple idea: communities considering pay-as-you-throw need answers to critical questions about how these programs work— and it's the communities that have success- fully adopted a program of their own that can best provide the answers. In an effort to tap into this expertise, EPA organized a roundtable discussion bringing MSW practitioners together to discuss the strategies they used in their communities. The guide Pay-As-You-Throw: Lessons Learned About Unit Pricing, a comfrtets primer on designing and implementing these systems, was a product of the roundtable meetings. has since organized other events, including a series of workshops connecting pioneering community with planners trying to learn more about pay^as-y^iFthrow and a satellite teleconference discussion with several program experts and community practitioners. A demonstration project also is underway designed to study the factors Influencing the success of the pay-as-you-throw program in Marietta, Georgia. Through each of these projects, EPA has sought to inform communities about the full range of options and best practices: to consider when deciding whether and how to implement pay-as-you-throw. Over the course of this outreach, EPA has learned a tremendous amount about how these programs work, fferhaps the biggest lesson is that there is no one "right" way to implement psy-as-you-throw, just as tfXfre is W Single compelling J-eason for communities to adopt this type of program. Every community (ovtr) ------- has a different story to tell, and a different lesson to teach. Some important trends have emerged, howev- er. Nearly att communities have experienced three specific types of benefits as a result of adopting pay-as- you-throw: It's economically sustainable. Pay-as-you-throw is an effective tool for communities struggling to cope with soaring MSW management costs. WelWesigned programs enable communities to gen* erate the revenues they need to cover all MSW program costs, including the costs of such comple- mentary programs as recycling and composting. Residents benefit, too. Communities with pay-as- you-throw have told EPA that residents often welcome the opportunity to take control of their trash hilt. It's envinntnematly sustainable. Because of the incentive it provides residents to put less waste at the curb, communities with programs in place have reported significant increases in recycling and reductions in waste amounts ranging from 25 to 45 percent, on average. Less waste and more recycling means that fewer natural resources need to be extracted. Ws fair. Communities also have told us that the most important advantage of all may be the fair- ness pay-as-you-throw offers to community residents. When the cost of managing trash is hidden in taxes, or charged at a flat rate, residents who recycle and prevent waste end up subsidizing their neighbors' wastefulness. Under this kind of program, residents pay only for what they throw away. The Tool Kit you have just received is based on lessons like these, offered by the pioneering communities that have implemented and perfected pay-as-you-throw systems. EPA is proud to present this compendium of real-world information as a way to give communities access to the experts—to learn from their trials and triumphs in the search for economically and environmentally sustainable solutions to today's solid waste management challenges. EPA's pay-as-you-throw outreach initiative is ongoing. As more artd more communities Introduce their own programs, new and better practices are sure to emerge. 0W> hopes to continue its role as an outreach clearinghouse, enhancing communities' ability to share and use critical information about pay-as-you-throw. If you would like to order additional copies of this Too) Kit or request further Information about pay-&s- you-throw programs, please call the Pay-As-You-Throw Helpline toll-free at 1-88tMcffe4feYT. Sincerely, ^ Jan Canterbury ^y ------- Pay-As-You-Throw: Lessons Learned About Unit Pricing The Consumer's Handbook for Reducing Solid Waste ' \^A ti ------- &EPA United States EPA530-K-92-003 Environmental Protection August 1992 Agency Solid Waste and Emergency Response (OS-305) The Consumer's Handbook for Reducing Solid Waste Printed on paper that contains at least 50 percent recycled fiber. ------- The Cat's Out of the Bag • Reuse4 Recvclc • Respond This booklet describes how people ran help solve a ^rowini> prob- lem...i;arbai;e! Individual < onsumers < an lu-lp alleviate America's mounting trash problem In making cnviionmentallv awaie derisions ahoul ever vdav things like shopping and ( arint; for the lawn. Like the stoi v that savs rals ha\e nine li\cs, so do mam ol the items we use ever\- da\. 1- ni])I\ (<• naiisloi nu-d into a bird feeder. 1 \ entuallv, the milk jiii^ i an be i ei \< lc------- The Problem Is Too Much Trash Kach vear, Americans generate millions of tons of trash in the form of wrappings, bottles, boxes, cans. grass dippings, furniture, clothing, phone books, and much, much, more. Over the years, we have got- ten used to "throwing it awav." so it's easy to understand why now there's too much trash and not enough acceptable places to put it. In less than 30 years, durable goods (tires, appliances, furniture) and nondurable goods (paper, cei- tain disposable products, clothing) in the solid waste stream nearly tripled. These now account for about 75 million tons of garbage per year. At the same time, con- tainer and packaging waste rose to almost 57 million tons per vear, making packaging the number one component of the nation's waste stream. Container and packaging material includes glass, aluminum, plastics, steel and other metals, and paper and paperboard. Yard trim- mings such as grass clippings and tree limbs are also a substantial part ol what we throw awav. In addition, many relatively small components of the national solid waste stream add up to millions of tons. For example, even 1 percent of the nation's waste stream amounts to almost 2 million tons ol trash each vear. Source Reduction: A Basic Solution As a nation, we are starting to reali/e that we can't solve the solid waste dilemma just bv finding new places to put trash. Across the coun- trv. main individuals, communities, and businesses have found creative ways to reduce and better manage their trash through a coordinated mix of practices that includes source reduction (see box on page 4). Simply put, source reduction is waste prevention. It includes many ------- What*s In America's Trash? Vinl 11 iiiimin;.;s. 1 , i .' I , million ions IM.lMics. S.I)1, I I.I million ions Total Weight = 179.6 Million Tons (1988Figun Olhci. II. I/, 20.8 million tons iiililk'i. Ifdl/ti-t. miscellaneous i -,i'{i<,i '_' million tons actions that reduce the amount or loxicitv of'waste created. Source reduction can COIIMM \v resources, reduce pollution, and help cut waste disposal and han- dling costs (it avoids the costs <>l lecvcling, composting, landlllling. and comhusiion). Source reduction is a basic solu- tion to the garbage glut: less waste means less ol a waste problem. Because source reduction actualh prevents the gcneiation of waste in the lit si placi-, it comes before other management options that deal with trash after it is alreadv generated. After source reduction. recycling (and composting) are the preferred waste management options because thcv reduce the ------- Integrated Waste Management Integrated waste management refers K» the complementary use of a vai iet\ of practices It) safcK .UK! effec lively handle niiinicipal solid waste. I'hi1 following is KI'A's preferred hiciari hv ol approaches. 1. Source reduction is tin- design, manufacture, purchase, or us. ol materials (such as prodiu is and packaging) to reduce the amount or to\icii\ of trash generated. Source reduction can help reduce waste disposal and handling costs because ii avoids the costs ol iec vcling. municipal composting, landfilling. and combustion, ll also consei \es resources and reduces pollution. 2. Recycling is the process bv which mate-rials are collected and used as raw materials lor new products. Theie aie four steps in recycling: collecting the recyclable components of municipal solid waste, separating materials In tvpe (before or attei c ollec- tion), processing diem into reusable forms, and purchasing and using tbe goods made with reprocessed materials. Recvcli: prevents poteniialK useful materials from being landfilled or combusted, thus preserving our capacity for disposal. Recu ling often sa\i-s energ\ and natural resources. Composting, a form of rccu ling, can play a kev role in diverting organic wastes from disposal facilitii 3. Waste combustion and landfilling pla\ a ke\ role- in managing \s------- amount of waste going to landfills and i onserxe resources. Making Source Reduction Work Putting source reduction into practice is likely to require some change in our dailv routines. ( hanging habits does not mean a return to a more difficult lifestyle. however. In fact, just the opposite ma\ happen. If we don't reduce waste, the economic and social costs of" waste disposal will continue to increase, and communities—large and small, urban and suburban- ill face increasingly harder deci- sions about managing their trash. All parts of society need to work together to change current patterns of waste generation and disposal. fhe federal government develops and provides information and looks tor incentives to create less waste. It also helps communities plan and carry out source reduction mea- sures. State, local, and tribal gou-i nments can create the most appropriate source reduction mea- sures for their areas. For example. some communities already are using lee systems that require households and businesses to pay lor trash disposal based on the amount they toss out. Large c onsumers—manufac- turers, retailers, restaurants, hotels. schools, and governments—can prevent waste in a variety of ways, including using products that cre- ate less trash. Manufacturers also can design products that use fewer ha/ardous components, require less packaging, arc- recyclable, use icevcled mate-rials, and result in less waste when thev are no longer useful. Individuals can evaluate their daily waste-producing activities to determine those that are essential (such as choosing medicines and foods packaged for safety and health), and those that are not (such as throwing away glass or plastic jars that could be- re-used or locally recycled). This booklet sug- gests manv practices that reduce waste or help manage it more efle< tivelv. Adopt those that are right for you and add others that you think ------- oi yourself. Discuss vour ideas with neighbors, businesses, and other members of vour communitv It's important to remember that all actions will have some effect on the emironment. If reusable products nerd to be washed, for example. tlu-re mav be- an increase in water use. Individual consumers, however. ran substantially rednee solid waste- by following tlu-se basic principles: I REDUCE the amount of "trash discarded. REUSE containers and products. RECYCLE, use recycled materials, and composi. RESPOND to the solid \\aste dilemma by reconsidering waste-producing activities and bv expressing preferem es for Ic-ss waste. ------- Tips £>r Reducing Solid REDUCE 1. Reduce the amount of unnecessary packaging. 1J. Adopt practices that reduce waste toxic it\. REUSE .''). Consider reusable products. 1. Maintain and repair durable products. f>. Reuse bags, containers, and other items. I). Borrow, rent, or share items used infrequently. 7. Sell or donate goods instead of throwing them out. RECYCLE 8. Choose- recyclable products and containers and recycle them. 9. Select products made from recycled mate-rials. 10. Compost yard trimmings and some- food scraps. RESPOND 1 1. Educate others on source reduction and recycling practices. Make-your preference's known to manufactur- ers, merchants, and community leaders. 12. Be creative—find new ways to reduce waste quantity and to\icit\. ------- Reduce the amount of unnecessary packaging. can am c Packaging serves main purposes. Its primal pose is to protect and contain a product. It als prevent tampering, provide information, and serve hygienic integritv and freshness. Some packaging, however, is designed largely in enli a product's attractiveness or prominence on the store shelf. Since packaging materials account fora large volume of the trash \\e geneiale, tlie\ provide a good opportunity for reducing wasie. In addition, keep in mind that as the amount of product in ,i container increases, the packaging \\astc per serving or use1 usually decreases. • When choosing between two similar prodm Is select the one with the least unnecessar packaging. • Remember that wrenches, sciewdrivcrs, nails, and other hardwaie are often available in loose bins. At the grocerv. c onsidcr whether it is necessarv (o purchase ilems MK li as tomatoes, garlic, and mushrooms in prepackaged containers when the\ tan be bough I nupax k.iged. • When appropriate, use products \ou alread\ have on hand to do household chores (see Appendix A). I sing these products can save on the packaging associated with additional products. • Recogni/e and support store managers when they stock products with no packaging or reduced packaging. 1 .et c lerks know when it's not necessary to double wrap a purchase. • Consider large or cconomy-si/c items for household products that are used trecjuentlv, such as laundrv soap, shampoo, baking soda, pet foods, and cat litter. These sixes usually have less packaging per unit of product. For food ilems, choose' the laigest si/e that can be used before spoiling. • Consider whether concentrated piodut is are appropriate lor your needs. The\ often require less packaging and less energy to transport to the store, saving money .is well as naiui al rcsoun es. * Whenever possible, select grocei v. hardware, and household items thai art- available in bulk. Bulk merchandise also mav be shared with friends or neighbors. • It is important to choose food servings that are appropriate to vour needs. ()ne altei native to single food servings is to choose the next largest sei v ing and store am leftovers in a reusable container. 9 ------- Adopt practices that reduce waste toxicity. In addition to reducing tin- ammml of matci i.iK in thr solid waste- slrrani, reducing waste toxicitv is another important t omponcni of source re-due lion. Some jobs around ihr home inav require tlir usr of products containing ha/- ardous components. Nevertheless. t<>\i< itv reduction can lie achieved l>\ following simple guidelines. Like actions thai use nonha/ardous or less ha/ardous «ini])onents io a< 11 miplish the task at hand. Kxamples include choosing reduced nuTcurv batteries, or planting marigolds in the garden to ward off < ei tain pests rather than using pesticides. In some cases vou inav be- using less toxic chemicals to do a job and in others \ou ma\ use some- phvsic al method, such .is sandpaper, scouring pads, or just a little- more elbou grease, to achieve the same results. Learn about altci "natives to household items containing ha/ardous substances. In some' cases, produc is ih.it you ha\c around the house can be- used to do the same' job as products with ha/ardous components. (Sec- Appendix A or check with local libraries or bookstore's for guidebooks on nonhazardous house-hold practices, i If you do need to use- products with ha/ardous components, use- onlv the amounts needed. I.elto\ei materials ( an be shared with neighbors or donated to a business, e liar itv or gou-rnment agency, or, in the case- of used motor oil, rec\cled at a participating ser\ice station. Never put leftover products with ha/ardous components in lood or bc\erage containers. 1 For produc is containing ha/ardous components, read and follow all direc tions on product labels. Make sure- the- containers are alwavs labelled properly and stored safely awa\ from children and pets. When vou are finished with containers that aie partially full, follow local community polic\ on house-hold ha/ardous waste- disposal (see box on "Household Ha/ardous Waste Collection" on the- ne-xi page). If at any time you have questions about potentialh ha/ardous ingredie-nts in products and their impacts on human health, do not hesitate to call vour loe al poison control centci. ------- Household Hazardous Waste Collection l-Oi lei lover products ( on lain ing hu/aidons components, check with tlic local environmental agcncv or ('.hambcr of (^onnncrce to sec il tin-re- al r an\ designated davs in vour area for collection ol waste materials such as leftover painls, pestit ides, soKents, and batteries. ()n such davs. (nulli- fied professionals collect household ha/ardous wastes ,\\ a centr.il location t« > ensure sale management and disposal. Sonic ( < Mtimnnitics ha\e |>ei nia- nent household ha/ardous waste collection facilities that accept wastes \eat-K >und. Some (ollections also include exchanges of paints, solvents, < ei lain prstii ulrs. < leaning and automoti\e products, and other materials. Kxchanges allow materials to he used In someone else, rathci than heing thrown awa\-. RECYCLING 10 ------- Consider reusable products. Main products arc designed lo be used more iluui once. Reusable piodiu is and (oiitaineisoften result in less waste. This helps reduce die < ost <>f managing solid \\.isie and often consci \rs materials and resources. I Remember, reus- able containers tor lood must be caielulh (leaned to ensure proper hygiem " A siurdv mug or dip can be washed and used time and again. Main people bring their own mugs to work, meetings. and coiilerciu es. • Sturdy and washable utensils and tableware < an be used at home and tor pii nics. ouldooi ))arties. and potlucks. • At wot k. see it "recharged" ( artridges lor laser pi inteis. < opiers. and tax machines are available. The\ not only reduce waste, but also upkallv save money. • Cloth napkins, sponges. 01 dishcloths can be used around the bouse. These can be washed over and over again • Look lor items that are available in reiillable (ontainers. Foi example, some bottles and jugs loi beverages and detergents are made to be iclilled and reused, eiihei b\ the < onsumer or the nianutac liner • \\heu possible, us.- K-. liargeable battei ies to help reduce garbage and to keep toxic metals found in some batteries out of the waste stream. Another alternative is to look for batteries with reduced toxic metals. When using single-use items, remember to take onl\ what is needed. For example, take onh one napkin or ketchup packet it more are not needed. Vmemhei. if \oiir goal is to i educe solid waste, think about reusables. ------- Maintain and repair durable products. II maintained and repaired propcih. products sue li as long-wearing clothing, tires, and appliances arc- less likelv to wear out 01 break and will not have to he- thrown out and replaced .is frequently. Although durable products soinelimes cost more iuitialK, their extended life span iua\ <>tlset the higher cost and e\cn save monc\ o\ei the long term. • ('.onsider long-lasting appliances and electronic equipment with good w.u ramies. (:heck reports for pro- ducts with a record of high consumer satisfaction and low breakdown rates. Also, look for those products that aie easily repaired. • Keep appliances in good working order. Follow manufacturers' suggestions for proper operation and maintenance. Manufacturers' service departments may have- toll-free numbers; phone toll-free directoi \ assistance at 1-800-555-1212 to find out. • High-quality, long-lasting tires foi cars, bicvcles. and olhei vehicles are available. Using them reduces the rate .it which tires are replaced and disposed of. Also, to extend tire life, check tire pressmc once a month, follow the manufacturer's recommendations tor upkeep, and rotate tires routinelv. In addition, retread and remanufactured tires can reduce tire waste. • Mend clothes instead of throwing them aw.iv \Vhei e possible, repair worn shoes, boots, handbags, and briefcases. • Whenever intended for use over a long period of time, choose- turn it me. luggage, sporting goods, toys, and tools that will stand up to vigorous use. • Consider using low-energy fluorescent light bulbs rather than incandescent ones. They'll last longer, which means fewer bulbs are thrown out, and cost less to replace over time. 12 ------- Reuse bags, containers, and other items. Main e\e-r\da\ items can have- more than one use. He-lore- discarding bags. (ontaineis. and other items, consider it it is hvgie-nic and practical to reuse diem. Reusing products cxte-nds their lives, keeping them out of the solid \\asie siieam longer. Adopt the ideas that work foi \ou. add some of vour own, and then hallenge others in vour school, office, and , omnnmilv to trv the-se ideas and to come- u|> with otlieis. • Reuse paper and plastic bags and l\\ist lies. II it's practical, keep .1 supplv ol'bags on hand to use on the next shopping trip. 01 take a string, mesh, or canvas tote bag lo the store. \Vhen a reusable bag is not on hand and onl\ one or two items arc being purchased, consider whether von need a bag at all • Reuse sc tap paper and em elopes. I'se both sides of a piec e ol paper lor writing notes bc-loie i ecu ling it. Sa\e and reuse- gill boxes, ribbons, and larger pieces of wrapping and tissue- paper. Sa\e packaging, colored paper. egg c.u tons, and olher items lor reuse 01 for arts and crafis projet is at da\- < are lacilities. si hools. \oulh lac ilitic-s. and senior cili/en cc-nteis. Find other uses or homes lor old draperies, bedding, clothing, towels, and cotton diapers. Then cut up what's led lor use as patchwork, rags, doll clothes. rag rugs, or oilier projects. • Reuse- ncwxpapei. boxes, packaging "peanuts." and "bubble- wrap" to ship package's. Brown papei bags ate e-xce-llenl for wrapping parcels. • Wash and reuse- einpu glass and plastic jars, milk jugs, i oitee ( ans. daii v tubs. and other similai coniaine-rs ilial otherwise get thrown oul. I hese containers can be used to stoic- lelio\eis as well as buttons, nails, and thumbtacks. An empl\ iollee ( an makes a line (lower pot. • Turn used lumber into birdhotise-s, mailboxes, compost bins, or ollier \\< icdworking projec'is. ( \l I H )\: Do not re-use- containers dial oi'iginallv he-Id products sue h as motor oil or pesticides. These- containers and their potentialK harmful ic-sidia-s should be dist ai (led (following manufacturers' instructions on the labe-l) as soon as then are empt\. When \ou no longer have- a use for a lull or partiallv lull con- tainer, take- it to a eommunitv house-hold ha/ardoiis uaste (ollee lion. Also. m-\ei stoic amthing polenti.illv harmlul in containe-rs designe-d for food 01 bexei.i .\lwa\s labe-l containers and stoic them out ol the- reach of children and pe-ts. 13 ------- Borrow, rent, or share items used infrequently. Seldom-used items, like certain posset tools and pai t\ goods, often ( olle< I dusl, rust, take up valuable storage spare, and ultitnatclv end up in the trash. Consider renting or borrowing these items the next time thevYe needed. lull equcnth used items also might he shared among neighbors, friends. 01 latniK. Boi rowing, icnt- ing. 01 sharing items saves both moiiev and natural resources. • Rt in 01 bornnv parts' decorations and supplies such a> tables, chairs, ( enierpieces, linens, dishes, and silver\vaie. • Rent or borrow seldom-used audios isual e<|uipmen[. • Rent 01 borrow tools such as ladders, chain saws, floor hulk i s. i'ujf cleaners, and »arden tillers. In .ipai tment buildings or co-ops, lesidents can pool resources v N. Xx**^ \\^v a°d form "banks" to share tools or other equipment ^NW ^^^TOv^ fL/ used or needed infre(|uentl\. In addition, some X.^ \\t^f\ communities have "tool libraries" where residents ^^^t IJ^R.' ' •») bonou equipment as needed. v /Ab\ \ • Before discarding old tools, camera equipment, or other goods, ask friends, relatives. neighbors, or community groups if the) can use them. • Share newspapers and maga/ines with others to extend the lives of these items and reduce the generation of waste paper. 14 ------- Sell or donate goods instead of throwing them out. <)nc | MM siin\ I rash is another prison's treasure. Instead <>l discarding; unwanted appliances. took, or (lollies. n\ selling or donating them. Opting loi used and "irregular" items is anodici IM >od \v.i\ to pi act ice SOUK e reduction. Such prodiu Is aie often less expensive than neu ot "fii si-qnalitv" items, and tisini; them will keep them from being thrown awa\. • Donate or resell items to thrift stoics 01 oilier oi^ani/ations in need. Donors sometimes receive tax. deductions i >i e\en cash. These or^ani/alions i\pi( all\ lake e\(M \llnni; from clollies and textiles i< > appliances and furniture. All should he i lean and of respectahle <|iialil\. • Sell secondhand items al lairs, ha/aai •>. s\\ap meets, and t;ai ai;e sales. • (.i\e hand-me-do\Mi (lollies to lamih nuMiihei s. neighboring families, or (he need\. Consider a«|uirini; used (lothin<4 at tin ill or consignment shops. I he condition of used clothing in these stores is st u-ened: « lollies are t\|)icall\ laundered and cannot ha\e teal's oi siains. • ( oiisider conducting a food or clothing drive to help others, \\heie appropriate, encoiua^e area merchanis to donate damaged »oods or food items dial aie still edihlc to food hanks, shelteis. and other groups that ( ar<- for the needv 15 ------- Choose recyclable products and containers and recycle them^, When YOU vi' done all von can to axoid waste, recycle. Producing goods lioni recy- cled materials tvpicallv consumes less energy and consrr\cs raw materials. Yri. our landfills ate parked with mam pac k- agcs and products that can be let u led. ( onsider products made oi mateiials that are collected for recu ling loially: in main communities, this includes glass, aluminum, steel, some paper and cardboard, and certain plasms. Check with appropriate community offn iaK \olunteei groups, or recAcling businesses to determine what matei ials are collected for recycling. If a svstem is not in place to lelurn a certain tvpe <>l material, that material is not easily "rccu lahl'e." • Participate in cominimii\ iec vcling drives, curbside programs, and drop-oil collections. Call community officials, the local in \eling ceutei. or .1 neai h\ iet \clin_y business to find out if and how materials should be separated, hu e\ani|)le. SUIIK- communities require that ------- The Degradables Debate One- <>f tin- hiuoesi debates in solid uasie lias ( entcied on t l.iinis that certain products siu h .IN sonic plastic bai^s. paper products, and other iM.ods .n't- deoi.ulalile. Aie such products helpful in soKin^ ilu- solid waste dilemma? Do tlie\ sa\e landfill spat e: In truth, deijiadalion oc< ins ver\ slowlv in modem landfills. Sunlight can't penetrate, so photodegradation can't (><•( in. Furthermore. research- ers have unearthed cabbages. carrots, and readable newspapers (hat lu\< been in landfills lot :;n \C.HS 01 moie. It is unlikeK that products marketed as des;radahlf would achieve heller results. K\en if biode^iadable prod- ucts do pertot in exacth as llte\ aie supjjosed to, thev still list- up resources that could be reel, timed tlnon^h tecvcling. Biodegradabilit) of naimal matt-rials such as lawn trimmini>s and some foods does ha\c a plate in solid waste management. I'hal |.)lac<- is composting (sec ti|> #10). Whether in the bai k\ard or in coinmunit\ facili- ties. composting can take ad\. intake of det;radabilil\. 1 his is nalure's \\a\ of ret \t lino ot<;anit material into humus that emit lies soil and leturns nutrients to the earth. 17 ------- 1. The life of a peanut butter jar begins on the supermarket shelf, filled with your favorite brand. When emptied and cleaned out, you and your family can use it in many practical ways. [PI 2. It's a perfect container for displaying a prized marble collection. 9. When you collect too many peanut butter jars, be sure to recycle the extras. They may be used to manufacture new peanut butter jars or other containers. 8. Then use it to show off the beautiful flowers you picked for the dinner table when the fishing is done. ------- 4. And to mix a batch of concentrated juice. 3. It can be used to store leftovers... 5. It can be taken back to the store to buy foods in bulk, such as honey, maple syrup, and even more peanut butter. BUI -IOW/ 7. Take the jar on your next fishing trip to carry live bait. 6. The jars also make great cookie cutters. ------- Select products made from recycled materials. Participating in a local or regional recvcling program is onlv pan ol the iee\- ( lint; process. For rec \cling to succeed, recyclable materials iniisi he proc essed into new products, and those products must be purchased and used, • Look for items in packages and c imiaincrs made of rccv< led materials. Manv bottles, cans, paper wrappings, hags, cereal bo\<-s. and othci cartons and packages are made from recycled materials. • I'se produe is uith leeuled content whenevei von can. For instance, main paper, glass, metal, and plastic products contain recovered materials. Some examples are siationei \. wrapping paper, computer paper, and main containers. Manv of these items are available in gioi er\. drug, and other retail stoi es. Mail-order catalogues, stationers, and print shops also ma\ stock these- and other rec u led items. • \\hen checking products for rcc\i led content, look lot a statement that i ecu led materials were used and, it possible-, choose the item with the largest percentage ol ice u led conlenl, if known. Yon can also call diivcioi \ assistance at 1-SOo V..V1212 to obtain manufacturers' SOO numbeis [o Jnul out how much rec w led material their products contain. • Encouiage- state- and local government agencies, local businesses, and others to purchase rec vclcd products such as paper, le-ieiine-d oil. and retread dies. For the federal go\ernment. guidelines alrcad\ exist that mandate' the purchase of these- and otln i pioducts. PLACE BOTTLE6 HERE L'O ------- Reducing Unwanted Advertising Mail Each veai, millions of Americans make OIK- or more pun liases through tlir mail. When people make these mail-order purchases, their names often are added to a list and marketed to other companies that do busi- ness through the mail. While inanv people eujov the catalogues thev ic( eive as a result of these lists, those who would like to receive 1< national advertising mail can ask companies not to rent or share theii names with other mailers. People who choose not to shop at home can also write to: Mail Preference Service Direct Marketing Association P.O. Box 9008 Farmingdale, NY 11735-9008 The Mail Preference Service is a no-charge service that removes names from main national mailing lists. Individuals who would like to use this service are requested to provide their names and addresses (including /ip ( ode), and any spelling variations ilu-v have noticed on mailing labels, to the Mail Preference Service. It may take a few months before there is a noticeable decrease in the amount of national advertising mail delivered. In addition, local adveitis- ing mail, such as store flyers, will not be affected. In these cases, people can write directly to the mailer and request that their names be removed from the mailing list. To keep voui name off unwanted mailing lists, contact mail-order companies (and other organizations) to let them know that \ou do not want your name and address shared with other businesses and organizations. Iii ihis wav. \ou can still order bv mail and belong to charitable organi/anons without woi rving that the amount of unsolicited mail von receive' will increase. 21 ------- Compost yard trimmings and some food scraps. H.u k\ard composting of certain food scraps and yard trimmings can siguificantlv reduce the amount ol waste that needs to he managed In the- local government or put in a landfill. When properlv composted, these waste's can he turned into natural soil additives lor use on lawns and gardens, and used as pot- ting soil for house plants. Finished compost can impro\e soil texture-, increase (In- ability of the soil to absorb air and water, suppress need giowth. decrease eiosion. and reduce (he need to applv commercial soil additives. • Learn how to compost lood scraps and vard trimmings (sec- the guidelines on lhe next page i. For more information, consult reference materials on composting, or check with local environmental, agricultural, 01 park sc-i \ic c-s. ( oniposting foods in highh populated areas is noi recommended because it c an attract rodents and other pests. • Participate in local or regional programs thai collect compostable materials. If no program is in place, contact public officials and community leadeis about setting one- up. • If there's in, loom lor a compost pile, oltei coinpostable materials to c i iimmmitx composting programs or garden pi < >je< is neai vou. • II'you have a \arcl. allow mown grass clippings K> lemain on the lawn to decompose- and i eiuni nutrients hack to the soil, rather than bagging and disposing of them. ------- Composting Is Easy! A compost pile can he- set up in a corner of the \ard with lew supplies. Choose a le\cl spol .ihoiii 3-tO .VI eel square nrai .1 water SOUK e and pielei- ably out of direct sunlight. ( le.u the area of sod and grass. When building ,i compi >sting bin, such as with chicken wire, scrap wood, or cinder blocks, be sure to leave enough spa< e l< >i .111 to reach the pile. One removable side makes it easiei to tend the pile. Many foods can be composted, including vegetable trimmings, < shells, coffee grounds with tillers, and tea bags. In addition to lea\es. gi .INS. and yard clippings, vacuum < leaner lint, wool and cotton i ags. sawdust. shredded newspaper, and fireplace ashes can be composted. DO NOT compost meats. dair\ foods. 01 am t.us, oil, or grease because- the\ can aurac t pexis. Start the pile- with a l-iiu h laver of leaves, loose soil, or olhei < oai se \ard n immings. If you are going to compost food scraps la slightlv more involved pioc ess>. \ou should mix them with \ard trimmings when adding them to the pile. Alfalfa meal or clean cat liner tnav be added to the pile to absorb odors. In di \ weather, sprinkle water on the pile, but don't get it too s<>ggv- Ini n the pile everv lew weeks with a pitchfork Jo circulate air and distribute moisture evenh. Don't be surprised by the heat ol the pile or if you see worms, both ol which are part of the decomposition process. Make sure children do not play in the < omposting pile or bin. In most climates, die < ompost is done in 3 to (i months when it becomes a dark crumblv material that is uniform in texture. Spread it in the garden or vard beds or under the sin ubbei \. The ( omposi also ( an lie used as [Kitting soil. ------- Educate others on source reduction and recycling practices. Make your preferences known to manufacturers, merchants, and community leaders. Shan- information about source reduction. i en- ding, and composting with othei v Spie.ul the word to family, friends, neighbors. local businesses, and decision-makers. Kncouiagc them in learn more about solid waste issues and to work toward implementing and promoting SOUK e ledm lion, rec\cling. and t omposiing. Ue all have the power to influence others and help create the upc <>l world in which we want to li\e. • Consider writing lo i ------- Be creative — find new ways to reduce waste quantity and toxicity. I heie .lit- manv ways lo reduce tlic amount and the toxic m ol solid waste. By thinking creatively, inanv new uses for common items and new possibilities for source reduction and recycling can be discovered. Here are just a few ideas. Now, I! \ Mime ol'vour own! • Turn a giant cardboard box into a child's playhouse. •Transform a plastic ice cream tub into a flower pot. • Give pet hamsters or get bils paper towel and toilet paper cardboard tubes with which to plav. I Tse an egg carton to plant seedlings. • Turn used tires (not steel-belted) into children's swings or other playground equipment. • Select nontoxic inks and art supplies. • Combine source reduction techniques. For example, trv storing coffee bought in bulk in empty colfee cans. • Choose beverages Mich as \\ater or milk in reusable containers, where appropriate. • Place an order through the mail willi .1 group of people in order to save money and reduce packaging waste. 25 ------- It's l;ir hettci to rcdiK c the loxiciu .nul amount of solid \\aste in the iirst place th.ui to « <>|>r \\itli it alter it has IK-CD < ic.ttcd. Thiough source it diu li------- Success with Source Reduction People hum sin.ill towns and big cities, across America arc- implementing innovative SOIIK r i eduction programs and an- leali/ing ee onennu as we'll as environmental benefits. ^u i can encourage and support these- changes in voui < ommunitv In working with e ivie groups. |o< al mere hants. and countv hoards. Through coiisuiner educa- tion campaigns, school curricula, economic incentives, and other legislator, financial, and educational measures, \our coinmunitv can set the pace lor new wa\s to reduce solid waste. I leie aie a lew example's of how ((immunities and businesses are reducing \\asie. Model Communities In a growing number of Illinois communities, lac ilities ranging liom industries to schools are practicing source reduction by following the lead ol'comimmm role models. I he (ientral Stales Fdm a lion ('.cnte-r i( :SF('.), a nonprofit en\ iioninental group, has dcxeloped a Model ( oinmuniu Program to help ommtmilies find w.i\s to tediut- waste, eliminaie toxins. re< \( !<-. ,md purcbase ^loducts that contain iccvcled materi.ils. lliidugli ibis program, businesses. organizations, and other groups serve as source reduction role models in their communities. The facilities institutionalize various source reduction strategies through in-house committees and on-going educational programs. Seveial schools, industries, churches and other organizations participate in this program. In a model industrv, lor example-, solvent recvcling machines are used to make solvents last three times longer. Model supermarkets ha\e a shelf-labeling progi am to highlight pioducts with less pac kaging. Additional model facilities iiu Iude churches, banks, librai ies. a i adio station, a ulilitx compam. nc-\\s|)apei v. a theatci. a sorori(\, and i-\i-n a c it\ hall. At present there- are over 70 model facili- ties in eight different Illinois ((immunities. \s a result < >f ihese model fac ilitic-s. less waste is generated in the participating communities, and much of what is generated gets muted to the- communiu ie< \- cling (cnier. rather than the landfill. For example, one model school reduced cafeteria waste b\ 1<> percent. Interest in the program is growing nationwide as communities use the model program to educate citi/eiis and get them invoked in reducing their solid waste-. ------- Berkeley—Doing It Right from the Start In 1989. Berkeley, California, implemented a citvwide campaign to help con SUIIKTS make cmironmentalh sound dec isions. The- Cit\ uses catdu slogans. su< h as "do it right from the start," "be pick\ about packaging," and "overcome o\ei- packaging." to urge shoppers to think about how products are packaged and ultimately disposed of. Consumers tell manufacturers which prod- ucts thev want to use and which products ihev don't want bv leaving them on store shelves. Since I9S9. the initiames under this program have grown as businesses and residents have embraced the concept. The program now includes an educational campaign directed at elementary schools. An environmental education curriculum has been developed, as well as a training program, to help teachers incorporate rending and other environmental messages into their science lessons. Other recent initiatives involve city supermarkets, which have printed i ccvcling tips on their grocery bags. Some supermarkets also offer a discount to shoppers who bring their own bags or containers. Finally, a composting program offers subsidi/ed composting bins to Berkeley residents to encourage home composting. ------- Source Reduction—Savings for Business More and more businesses, lariat1 and small, art- rcali/ing thai source reduction ran mean a big pavotf in it-iliued \\.IMC and costs. Kor example, a small news- paper in (irand Rapids. Minnesota, the Hrnild /iVr/Vic. has reduced ils waste by almost ;W.OOO pomuls annualh. which sa\es over SIS,000 per veai. r \ei \one joins in io rediu e waste, lioin leporteis suite him; to nariow-rnied notebooks to sase papei. lo photographers saving film In phinnin^ llie nnmbei ol'exposmes ihev need betoi e shooting. In the- oilier, people reuse mailing labels, rebuild loner cartridges foi com- puter pi mieis, and print on both sides ol the paper. A ( eramii s p,u ka^int; linn h.is e\cn be«-n loiind to puichase the paper left over from the printing pioi ess. This "waste e\( bailee" beiietiis both coinp.tnies. I he newspaper also has found \va\s to reuse waste ink. film-developing chemicals, and paste-up sheets. These innovative ideas reduce both the amount and the loxuitv of the < on i pa m s wastes. \lso. a large furniture manufacturer. Merman Miller, Inc. (MMII of /<'eland. Mil big.in, lias reaped savings of SI. 1 million annualh through wasie prevention. It de\iscd packaging containei s that can be reused SO to 100 limes and that are made From recycled detergent and milk containers. \noihei approach HMI uses is carionless packaging. This means just placing cardboard edges on the ( orners of some furniture and wrapping the t'urnituie with plasiie film ralhei ihan boxing it. I In- cardboard edges are reused and the )lastic film is i ec \cled. This pi actice has saved 11 \11 >'_'.")().0(10 a \ear l------- What Have You Come Up With? \\e want to he,u \our innovative ideas on how to prac tire MHIU <• it-due lion. Send us .1 SOUK <• irdm lion lip, and we'll send von a magnet that can be used lo slick a shopping list to the refrigeratoi and to distinguish bimetal and sleel i .ins hom aluminum cans (magnets arc not amactfd to aluminum). Quantities arc- limited. Send \otir name, address, and tip to Source' Redue lion lip. the RC.RA Docket (OS-:*I).'»>. U. S. 1 luironmental Protection Agcinc\. 101 M Street. S\V.. Washington, E»C 20K")(). ------- Appendix A Source Reduction Alternatives Around the Home Manv consumers look foi wavs K> reduce the amount and loxicilv oi vv.isic .iiomul the house. I his can be done, in some ( ases. bv using altei native methods or products without ha/ardous (•onstiiuents (o .u eomplish a cei tain task. Ileie aie jusi a leu ideas to gel von started. 1 )i ain cleaner ( Ken (leaner (ilass cleaner loilel l)o\vl cleaner l-'ui iiiture polish Rug deodorize) Silver polish Plain spravs Mothballs Flea and tick products I 'se a plunger or plumber's snake. ('.lean spills as soon as the oven cools using s wool and baking soda: lor tough stains, add salt (do not use (his method in sell'-i leaning or continuous-cleaning ovens). Mix 1 tablespoon of vinegar or lemon juice in 1 quart of water. Spra\ on and use newspaper to wipe drv. I se a toilet brush and baking soda or vinegar. i. I his will clean but not disinlect.) Mix 1 teaspoon ol lemon juice in 1 pint ol mineral or vegetable oil. and wipe furniture. Deodor i/e drv carpets b\ sprinkling liberalh with baking soda, Wait at least lf> minute-sand vacuum. Repeat i! necessai \. l'» >il L' li i '.'• inches ot water in a shallow pan with 1 teaspoon ol salt. 1 teaspoon of baking soda, and a sheet of aluminum foil. Totallv submerge silver and boil lor '2 to .') HUH e minutes. Wipe awav tat nish. Repeat if uccessarv (Do not use this method on antique silver' knixes. lire blade will separate Iron) the handle.) Another alternative is to use nonahrasive toothpaste. Wipe leaves with mild soap and water; rinse. I'se cedar chips, lavender Mowers, losemarv mint. or white peppercorns. I'm brewer's \easi (>i garlic in \oiir pet's lood: sprinkle lennel. rue. roscmaiv 01 eiual\|)tus seeds 01 leaves around animal sleeping areas. Although the suggested mixtures have less ha/ardous ingredients than main commercial cleaners and pesticides, they should be used and stored with similar caution. Please follow these guidelines lor am household cleaner or pesticide. • IX ) \() 1 mix amthing with a commercial c leaning agent. • Il'vou do store .1 homemade mixture, make sun- it is properly labelled and do not store il in a container th.it could he mistaken lot a food 01 beveiagc. • When preparing alternatives, mix only what is needed for the job at hand and mix them in clean, reusable containers. This avoids waste and the need to store am (leaning mixture. 31 ------- Appendix B Reusable Vocabulary Bimetal -Typicalh refers lo he\ciage containcis \\ilh steel bodies and .ilniiiinnm lops. Steel companies do ret \i le bimetal cans. l>nl tlu-\ are handled differcnth in the iccvcling stream from aliiniinuin cans. Combustion - The controlled burning of municipal solid waste lo i cdm e \olunic. and. commonly, to ret OUT encigv Composting -The t on trolled microhial dct -om posit ion of organic inattci i MH li as food s( r.i]»s and yard trimmings) in tin- presence ol o\vgen into a humus- 01 soil-like material. Curbside collection - A method ol collecting ivc\elahle materials at individual homes or places ol'business In municipal or private parties lor transfer to a designated collection sile or recycling lacililx. Drop-off-A method of collecting readable materials where individuals transpor the materials to a designated collection site. Household ba/.ardous waste - Products containing ha/ardous substances thai are used and disposed ol b\ individual rather than industrial consumers. These prodiu Is iiu lude some paints. soKeuls. and pesticides. Integrated waste management - The coinplementai \ use ol a \ariet\ ot |>i .it tices !•> handle municipal solid waste sateh and el'let li\el\. Integrated \\aste man- agement techniques hit hide SOUK e rediu lion. rctAcling. composting, combustion, and landiilling. Landfilling - The disposal of'solid waste at engineeied facilities in a series of i ompacted lavers on hind and the frequent daih i o\ering ol the waste with soil. Fill areas are < arefulK prepared to present nuisances < H public health ha/aids, and clav and 01 sMithelic lincis aie used lo pre\t-nt release-- n> gi ound water. Municipal solid waste (MS\V) - Waste generated in households. commcK lal establishments, institutions, and businesses. MSW includes used paper. discarded cans and bottles, food scraps, vard trimmings, and other items Industrial process wastes, agricultural wastes, mining wastes, and sewage sludge are not MSW. Pre-consumer materials - Recovered materials obtained from manufacturers. Post-consumer materials - Recoxcred materials from a consumer-oriented ret vcling toilet lion svstcm or drop-off center. Recyclable - Piodm is or materials thai < an be (ollet ted. separ.it ed. ant I pioi essed to be used as i.iw materials in the manufacture of new piodut Is. _ ------- Recycled content - I lu- poi lion of a pioduc t's or package's weight lliai is composed oC materials thai have hern ie< oveied honi \\aste: this ma\ include pre-consninei 01 p< >st-------- Appendix C EPA Resources The following EPA publications are available at no charge through the Agency's RCRAHotline. Call l-sixi-m-W-Hi Mondav through F.idav. ,X::K> .,.111. to 7:30 p.m. KST. For the hearing impaired, the number is I 1 1) r>3-7<>7i>. In Washington, DC, call (703) 9L>0-9H10 or Tl)l) (703) 48h\ of 'Municipal Solid Waste Management .\(ternnth>e\ (F.PA r>:i4)-.S\\-X<)-0.~>r>). A listing of approximately 200 publications available from industrv, government, and environmental groups. Churactenzatwn of Municipal Solid Waste in the ('niled States: 1W(> I '(date (EPA/530- SW-90-042). A report characterizing the national solid waste stream in terms ol products and materials and examining how these wastes are managed. Characterization of Products Containing Lead and ( adtninm in Municipal Solid Waste in tlit -I'nited Staff*. 1970 to 2000 (EPA/530-SVV-S9-OI f)( j. A u-poii chai at ten/ing the products that contribute to the lead and cadmium found in municipal solid waste. Decision-Maker's (,inde to Miinirifial Solid Waste Management ( F.PA ">30-S\V-S9-072). \ guide book to help policymakers understand and evaluate their curreni \\aMe management problems and formulate possible solutions. F.m'irtmmental Fact Slirrt: Yant Wait,- CnHifn>.\{infr(¥.?A :>:'.n-S\V-') l-DD'.l). A lad sheet defining composting, the composting process, and how comp< >st t an be used. (Siting at tin-. Sourer: Striitrgii'-* /»' Reducing Municipal SoKd Wti^ti: fc\irnlii'c Summary (1991). Kxcerpts from a report prepared under an EPA giant bv the World \\ ildlife Fund i3()-SW-S9- 051A). The summary of a report examining many issues related to plastit s, including reduction, recycling, degradabilitv, and damage to marine life. Plastics Fact Sheets. A series of five fact sheets about plastics: • l>la.\tit\: '/'/»/•/-Vir/s ahmt Production. I'sr. and DiifMMil (EPA/530-S\V-«HM» I A fact sheet reviewing major uses of plastics and impacts ol disposal. • Tin /-«------- • The Facts on Ray cling Plastics (EPA/530-SW-90-017E). A fact sheet summari/- ing the opportunities available for recycling plastics, and the current state of plastic recycling technology. Recycling (EPA/530-SW-88-050). A concise citizen's brochure on recycling and its role in solid waste management. Recycle Todayl A series of five publications aimed at educators and students: • Recycle Today! An Educational Program for Grades K-/2 (EPA/530-SW-90-025). A concise pamphlet explaining the goals and objectives of EPA's educational recycling program and the four resources listed below. • Ut's Reduce and Recycle! A Curriculum for Solid Waste Awareness (EPA/530-SW- 90-005). A booklet of lessons and activities to teach students in grades K-12 about solid waste generation and management. It teaches a variety of skills, including science, vocabulary, mathematics, and creative writing. • School Recycling Programs: A Handbook for Educators (EPA/530-SW-90-023). A handy manual with step-by-step instructions on how to set up a school recycling program. Adventures of the Garbage Gremlin: Recycle and Combat a Life of Grime (EPA/530- SW-90-024). A comic book introducing students in grades 4-7 to the benefits of recycling. • Ride the Wave of the Future: Recycle Today! (EPA/530-SW-90-010). A colorful poster designed to appeal to all grade levels that can be displayed in conjunc- tion with recycling activities or used to help foster recycling. Recycling Works! (EPA/530-SW-89-014). A booklet describing 14 successful state and local recycling programs in the United States. Reusable News (EPA/530-SW-90-018). A periodic newsletter covering a diverse array of topics related to municipal solid waste management, including source reduction and recycling. Unit Pricing: Providing an Incentive to Reduce Municipal Solid Waste (EPA/530-SW-91- 005). A booklet describing unit pricing systems in which customers are charged for waste collection and disposal services based on the amount of trash they generate. Used Oil Recycling Publications. A series of three brochures and a manual on ways to recycle used oil: • How to Set Up a Local Used Oil Recycling Program (EPA/530-SW-89-039A). An easy-to-follow manual for local decision-makers, environmental groups, and community organizations. • Recycling Used Oil: What Can You Do? (EPA/530-SW-89-039B). A pamphlet describing how the general public can participate in used oil recycling. • Recycling Used Oil: 10 Steps to Change Your Oil (EPA/530-SW-89-039C). A pamphlet describing how citizens can change their car oil. Recycling Used Oil: For Service Stations and Other Vehicle-Service Facilities (EPA/530-SW-89-039D). A pamphlet describing how service station owners can play a key role in facilitating used oil recycling. 35 ------- EPA Regional Offices Region I I S. EPA - Region 1 J.F.K. Federal Building Boston, MA 02203 (617) 575-5720 Region 2 U.S. EPA - Region 2 26 Federal Pla/a New York, NY 10278 (212) 264-3384 Region 3 U.S. EPA- Region 3 H41 Chestnut Street Philadelphia, PA 19107 (215) 597-9801) Region I KPA - Region 4 345 Courtland Stieet, N.E. Atlanta, (iA 30365 i }(>li 317-2091 Region 5 U.S. 1 !'\-Region f> 77 West Jackson Boulevaid Chicago. II. (.()()(II i 353-2000 Region 6 U.S. EPA - Region (i 1 11 si Interstate Bank Tower 111") Ross \\rinie Dallas, TX 75270-2733 • i 655-6655 Region 7 I s 1 I'\-Region 7 72ti Minnesota \\ciuic Kansas Cnv, KS 66101 (!>I 3) 551-7050 Region 8 t .S. Kl'. A -Region > l)en\ri 1'l.u e WJ l.Stl, Street. Suite 50(1 Dt-iivt-i; CO SOL'02-L' (303) Region 9 I S. KPA -Region 9 75 llawtlioine Street San Fraiu isi <>. C \ '>•! 105 (115) 7-1 1-207 I Region 10 I .S I l'\- Region 10 1200 Si vh Avenue Seatilr. \VA '.»SI01 M2-27H2 ------- nm£ntal Infection Office oTSolid Waste Emergency Response (5305) EPA530-R-94-004 April 1994 Pay-As-You-Throw Lessons Learned About Unit Pricing 'canola ink on pap ------- Lessons Learned About Unit Pricing of Municipal Solid Waste Prepared by Janice L. Canterbury U.S. EPA Office of Solid Waste ------- Acxnow edeements The following state, county, and local officials and private consultants contributed their expertise in unit pricing programs to EPA's Unit Pricing Roundtable and to the development of this guide: Nancy Lee Newell, City of Durham, North Carolina Peggy Douglas, City of Knoxville, Tennessee Barbara Cathey, City of Pasadena, California Bill Dunn, Minnesota Office of Waste Management Nick Pealy, Seattle Solid Waste Utility Jody Harris, Maine Waste Management Agency Jamy Poth, City of Austin, Texas Jeanne Becker, Becker Associates Lisa Skumatz and Cabell Breckinridge, Synergic Resources Corporation Lon Hultgren, Town of Mansfield, Connecticut Greg Harder, Pennsylvania Department of Environmental Resources Thomas Kusterer, Montgomery County Government, Maryland Robert Arner, Northern Virginia Planning District Commission Their assistance is greatly appreciated. ii ------- Contents About This Guide ........... vi Key to Symbols ........... viii PART I: Is Unit Pricing Right for Your Community? I What Is Unit Pricing? 2 Potential Benefits to Unit Pricing 3 Potential Barriers to Unit Pricing 4 Types of Communities That Can Benefit From Unit Pricing .... 5 Making a Decision About Unit Pricing 6 PART II: Building Consensus and Planning for Unit Pricing 10 Setting Goals and Establishing a Unit Pricing Team ..... 11 Addressing Barriers 12 Building a Public Consensus 13 Scheduling Your Planning Activities 15 PART III: Designing an Integrated Unit Pricing Program I 9 The Building Blocks 20 Volume-Based Versus Weight-Based Programs 20 Container Options 22 Pricing Structures . 24 Billing and Payment Systems 26 Accounting Options 26 Program Service Options 27 Multi-Family Housing 29 Residents With Special Needs 30 iii ------- Putting the Blocks Together 34 Step 1: Estimating Demand 35 Step 2: Choosing Components ......... 36 Step 3: Estimating Costs .......... 37 Step 4: Developing a Rate Structure ........ 37 Step 5: Calculating Revenues ......... 38 Step 6: Evaluating and Adjusting the Program ...... 38 PART IV: Implementing and Monitoring Unit Pricing 45 Implementation Activities 46 Public Education and Outreach 47 Reorganizing Your Solid Waste Agency's Administration .... 50 Developing a Schedule .......... 52 Program Monitoring and Evaluation 52 APPENDIXES 63 Appendix A: Unit Pricing Roundtable Discussion: Questions and Alternatives . 63 Appendix B: Putting the Blocks Together: Additional Examples ... 79 s Appendix C: Definitions .......... 83 Appendix D: Bibliography ......... 85 IV ------- About Tiis Gu In December 1992, as part of the U.S. Environmental Protection Agency's (EPA's) efforts to disseminate information about potential solutions to solid waste management issues, the Agency organized a gathering of experts and local officials involved in unit pricing programs. The Unit Pricing Roundtable resulted in a wide-ranging discussion of the benefits and barriers associated with unit pricing programs. This guide is based on the insights gained from that meeting. Pay-As-You-Throw: Lessons Learned About Unit Pricing of Municipal Solid Waste is designed to help local solid waste administrators and planners, elected officials, community and civic groups, environmental and business organizations, and others find an answer to the question, "Is unit pricing a viable option for our community, and, if so, how do we implement it?" Since communities differ in size, demographics, governing jurisdiction, and other factors, this guide presents lessons learned in a variety of communities that have implemented unit pricing. As such, decision-makers can use the guide to chart a course through the issues and potential obstacles involved in launching a unit pricing program and tailoring it to meet the specific needs and goals of the community. In addition to information drawn from the Roundtable, the guide is derived from data on dozens of existing unit pricing programs in communities of varying sizes and demographics. Case studies showcase differences in the types of collection systems. fee structures, and complementary programs that can accompany unit pricing programs. The guide also reflects information extracted from available literature, as well as direct advice from experts in the field. ------- The process of considering, planning, and implementing a unit pricing program is a process of moving from general to specific notions of addressing waste management issues. After considering long-term solid waste goals and options and how unit pricing might help achieve them, decision-makers must move on to broad system planning and finally to specific details. This guide is designed to mirror that process of increasing specificity. It is divided into four parts: Part I: Is Unit Pricing Right for Your Community? Part I offers an introduction to the concept of unit pricing, helps readers decide whether unit pricing holds enough promise for their communities to merit continued investigation and study, and provides an overview of the organization of the guide. Part II: Building Consensus and Planning for Unit Pricing Part II focuses on creating a framework for a successful system. It describes how to establish goals, build a consensus for change within the community, make a decision to pursue a unit pricing strategy, and perform basic planning tasks for the new program. Part III: Designing an Integrated Unit Pricing Program Part III introduces solid waste officials to unit pricing program options, including container type and size, pricing structures, and billing systems. It also presents a six-step process for selecting options and designing a rate structure that will best address the community's unit pricing goals. Part IV: Implementing and Monitoring Unit Pricing Part IV guides communities through the process of launching their unit pricing program. While implementation, often requires an ongoing series of tasks, this part focuses on the central issues: providing public education and reorganizing the solid waste agency's administrative office. Part IV also discusses ways to collect and analyze data regarding the performance of the program. To meet the needs of many decision-makers, this guide has been designed to be modular in approach. Solid waste officials with little experience with unit pricing will want to read the entire guide carefully. Decision-makers who are somewhat familiar with unit pricing might want to skim Part I, while carefully studying the remainder of the guide. Those individuals with a good understanding of the pros and cons of unit pricing might proceed directly to the design and implementation guidelines offered in Parts III and IV. vi ------- Lr /~\\ / "T" /*"\ X^ \ / K°V™\ r*\ /**\ f* i\ey 10 oymoo s To help readers focus on key issues, symbols are used throughout the guide to indicate the themes and concepts that are central to unit pricing. These are: TRADEOFFS There are no universally applicable guidelines that must be followed when developing a unit pricing program. All unit pricing options offer their own set of advantages and disadvantages. When designing a unit pricing program, decision-makers need to weigh these factors and choose the course of action that best suits the needs of their communities. EDUCATION COSTS HIERARCHY BARRIERS Involving and educating the public is key to the success of any unit pricing program. One of the biggest issues associated with unit pricing programs concerns the costs to design and implement a program. Residents also will be concerned about waste collection fees. EPA has established a hierarchy identifying the preferred methods for managing solid waste. At the top of the hierarchy is waste prevention. Recycling (including composting) is the next preferred technique, used for managing the waste that cannot be prevented. Finally, landfilling and combustion can be used to dispose of the remaining waste. Decision-makers will need to address some potential hurdles to implementing unit pricing. These include recovering expenses, increased administrative costs, perception of increased costs being passed on to citizens, and illegal dumping. vii ------- Is Unit Pricing Right for Your Community? ver the past several years, many communities across the United States have found it increasingly difficult to effectively and economically manage their municipal solid waste (MSW). Against a backdrop of steadily rising waste generation rates, many communities have seen their local landfills closing, tipping fees rising, and prospects for siting new disposal facilities diminishing. Other demands on waste management systems include growing public awareness of general environmental issues, as well as state and locally legislated waste prevention and recycling goals. In response, many communities have begun adopting new approaches to waste management, such as collecting materials for recycling; composting yard trimmings and other organic materials; and conducting education programs intended to help residents understand the need for waste prevention and recycling. In addition, recognizing that market-based approaches are proving to be important tools in dealing with environmental issues, some communities have turned to economic incentives to encourage residents to prevent waste whenever possible and recycle or compost the remainder. One such incentive system is unit pricing. IS UNIT PRICING RIGHT FOR YOUR COMMUNITY? ------- What Is Unit Pricing? Unit pricing is not a new concept. Berkeley, California, began its unit pricing program in 1924, and Richmond, California, launched a unit pricing program in 1916! By encouraging residents to prevent waste and recycle whenever possible, unit pricing is helping communities to better manage their solid waste. Traditionally, many communities in the United States have paid for waste management services through property taxes or through an annual fee charged to each household. The cost per residence remains constant regardless of differences in the amount of waste generated. This creates the mistaken impression that MSW management is free. Unit pricing, also known as variable rate pricing or pay-as-you-throw, is a system under which residents pay for municipal waste management services per unit of waste collected rather than through a fixed fee. Unit pricing takes into account variations in waste generation rates by charging households or residents based on the amount of trash they place at the curb, thereby offering individuals an incentive to reduce the amount of waste they generate and dispose of. Unit pricing programs can take two basic forms. Residents can be charged by: • Volume of waste, using bags, tags or stickers, or prescribed sizes of waste cans. • Weight of waste, with the municipality measuring at the curbside the amount of waste set out for collection. While they operate differently from one another, these systems share one defining characteristic: residents who throw away more pay more. If the basic concept of unit pricing is straightforward, however, the decision to adopt such a program is far from simple. To help communities considering unit pricing as a solution to their mounting solid waste management difficulties. EPA convened a Unit Pricing Roundtable, attended by representatives from communities that had implemented unit pricing or were actively considering it. EPA then organized the resulting wealth of ideas and advice to produce this guide. EPA designed the guide to help readers determine whether unit pricing is a viable option for their community and, if so, which factors to consider when planning and implementing such a program. ------- PARTI Potential Benefits to Unit Pricing Communities that have adopted unit pricing programs have reported a number of benefits, ranging from reductions in waste generation to greater public awareness of environmental issues. These benefits include: • Waste reduction. Unit pricing can help substantially reduce the amount of waste disposed of in a community. Some communities with unit pricing programs report that unit pricing helped their municipality achieve reductions of 25 to 45 percent in the amount of waste shipped to disposal facilities. • Reduced waste disposal costs. When the amount of waste is reduced, communities often find their overall MSW management costs have declined as well. (A portion of the revenues previously spent on waste disposal, however, may need to be dedicated to recycling, composting, or other diversion activities.) • Increased waste prevention. To take advantage of the potential savings that unit pricing offers, residents typically modify their traditional purchasing and consumption patterns to reduce the amount of waste they place at the curb. These behavioral changes have beneficial environmental effects beyond reduced waste generation, often including reduced energy usage and materials conservation. • Increased participation in composting and recycling programs. Under unit pricing, new or existing recycling and yard waste composting programs become opportunities for residents to divert waste for which they otherwise would pay. Experience has shown that these programs are the perfect complement for unit pricing: analysis of existing unit pricing systems shows that composting and recycling programs divert 8 to 13 percent more waste by weight when used in conjunction with a unit pricing program. • Support of the waste management hierarchy. By creating an incentive to reduce as much waste as possible using source reduction and to recycle and/or compost the waste that cannot be prevented, unit pricing supports the hierarchy of waste management techniques defined by EPA. • More equitable waste management fee structure. Traditional waste management fees, in effect, require residents who generate a small amount of waste to subsidize the greater generation rates of their neighbors. Under unit pricing, waste removal charges are based on the level of service the municipality provides to collect and dispose of the waste, similar to the way residents are charged for gas or electricity. Because the customer is charged only for the level of HIERARCHY IS UNIT PRICING RIGHT FOR YOUR COMMUNITY? ------- EDUCATION service required, residents have more control over the amount of money they pay for waste management. Increased understanding of environmental issues in general. Through unit pricing, communities have the opportunity to explain the hidden costs of waste management. Traditional waste management systems often obscure the actual economic and environmental costs associated with waste generation and disposal. Once individuals understand their impact on the environment, they can choose to take steps to minimize it. Potential Barriers to Unit Pricing BARRIERS COSTS In all unit pricing programs, residents who throw away more pay more. While there are clearly benefits associated with unit pricing programs, there also are potential barriers. Communities considering unit pricing should be aware of the costs and possible community relations implications associated with the following issues: • Illegal dumping. Some residents have strong reservations about unit pricing, believing it will encourage illegal dumping or burning of waste in their area. Communities can counter this fear with an effective public education program. Since most communities with unit pricing programs have reported that illegal dumping proved to be less of a concern than anticipated, providing residents with this information can help allay their concerns over illegal dumping. • Recovering expenses. Since unit pricing offers a variable rate to residents, the potential exists for uneven cash flow that could make it harder to operate a unit pricing program. To address this, communities must be sure to set prices at the appropriate level to ensure that, on average, sufficient funds are raised to pay for waste collection, complementary programs, and special services. • Administrative costs. Effectively establishing rates, billing residents, and collecting payments under a unit pricing program will likely increase a waste management agency's administrative costs. Communities need to set waste collection prices at a level that can cover these costs. • Perception of increased costs to residents. While a unit pricing program offers residents greater control over the cost of collecting their waste, it could initially be seen as a rate increase. An effective public outreach campaign that clearly demonstrates the current costs of waste management and the potential reductions offered by unit pricing will help to address this perception. • Multi-family housing. Extending direct waste reduction incentives to residents of multi-family housing can present a challenge. Since waste generated by these residents typically is combined in a central ------- location to await collection, identifying the amounts of waste generated by individual residents in order to charge accordingly can he difficult. Communities must experiment with rate strut lures and collection systems to encourage residents of multi-family housing to reduce waste. Building public consensus. Perhaps the greatest barrier to realizing a unit pricing program is overcoming resistance to change, both among citizens and elected officials. Informing residents about the environmental and economic costs of current waste generation patterns can help overcome this resistance and build support for unit pricing. Careful planning and design of a unit pricing program to meet specific community needs is the best solution to these potential difficulties. In particular, an effective public education program designed to communicate the need for unit pricing and address the potential concerns of residents will help meet these challenges. (Public education programs are discussed in detail in Fart IV of this guide.) EDUCATION Types of Communities That Can Benefit From Unit Pricing Unit pricing programs work best when tailored to local needs. All types of communities can design unit pricing programs that will help achieve the goals of reducing waste generation and easing waste management difficulties: large, medium-sized, and small communities in every region of the country have realized these benefits. Local officials indicate that unit pricing programs also work well whether solid waste services are cairied out by municipal or by private haulers. As a result, unit pricing has grown significantly over the last few years. In the 1980s, only a handful of communities in the United States operated unit pricing programs. Now, over 1,000 communities have unit pricing programs in place. By January 1994, over 1,800 programs are scheduled to be in operation. In addition, laws in 10 states currently mandate or encourage unit pricing programs. For . IS UNIT PRICING RIGHT FOR YOUR COMMUNITY? ------- Making a Decision About Unit Pricing After considering this overview of the benefits and barriers to unit pricing programs, decision-makers who believe unit pricing could work in their community can turn to Part II of this guide and begin the planning process. Decision-makers should carefully consider key factors such as the types of services to offer, the associated costs, the potential for complementary programs, the level of administrative change necessary, and the extent to which residents will support or oppose unit pricing. ------- PART Will this guide tell me what system to use and how to implement it? No. This guide is intended to provide essential information about unit pricing and to help you think about how well such a program would work in your community. It will provide many suggestions borne of successful programs of all types and sizes around the country. However, final decisions about whether to adopt unit pricing, what type of system to use, and how to implement it should be made based on local needs and circumstances. How expensive is it to implement unit pricing? The cost of implementing a unit pricing program is directly related to how complex the selected system is, how it is financed, and how different it is from the current waste removal system. Many communities have implemented unit pricing with minimal upfront and ongoing costs. Over the long term, communities with unit pricing programs have generally reported them to be cost-effective methods of achieving their waste management goals. Our community has had significant fiscal problems. Would unit pricing be appropriate? A community introducing unit pricing may choose to use fees either to supplement or to replace current revenue sources. While a community with a tight waste management budget may choose to use unit pricing fees to supplement current revenue sources, the public may resist such fees as simply an additional tax. Other communities stress that local acceptance of a unit pricing program is greater if current taxes, such as general or property taxes, are reduced by the amount of the new solid waste fees. uestions answers IS UNIT PRICING RIGHT FOR YOUR COMMUNITY? ------- Points to remember Unit pricing requires residents to pay for each unit of waste that they dispose of. This billing arrangement is similar to fees assessed on other essential services (such as water and electricity), where the charge is based on usage. Unit pricing has been effective in reducing the amount of solid waste disposed of in all types of communities across the country. Communities using unit pricing in tandem with recycling and composting programs have found these programs increase each other's effectiveness. This guide is designed to provide basic information about planning and operating a unit pricing program. Decisions regarding the actual program you adopt will be based on your community's unique circumstances. ------- Case Studies All Types of Communities Are Adopting Unit Pricing Rural areas. Unit pricing is found in a number of rural communities. For example, it has been implemented in High Bridge, New Jersey, which has a population of 4,000, and in Baldwin, Wisconsin, which has a population of under 2.000. Larger communities. While unit pricing is not yet common in the largest cities, it has been working successfully in Anaheim, Glendale, Pasadena, and Oakland, California; Aurora, Illinois; Lansing, Michigan; Seattle, Washington; and a number of other communities with populations over 100,000. In addition, state laws in Minnesota, Wisconsin, and Washington either currently or soon will require implementation of unit pricing programs in communities statewide, regardless of size (with some exceptions). County-wade. Unit pricing also can be implemented on a county-wide basis. Tompkins County, New York; Hennepin County, Minnesota; and King County, Washington all have implemented unit pricing programs. Unit Pricing Cuts Down on Waste Volume Unit pricing can result in dramatic declines in the amount of waste set out for collection. The Village of Hoffman Estates, Illinois, noted a 30-percent reduction in waste volume after implementing a unit pricing program. Seattle, Washington, reported a decline in waste generation from an average of 3.5 waste cans to 1.7 cans per household per week after unit pricing was launched. This amount was further reduced to just one can per household per week after complementary curbside recycling and composting programs were introduced (see the discussion of complementary programs in Part III). Most communities, however, cannot delineate what percentage of waste reduction is directly attributable to unit pricing and what percentage is due to other factors, such as new recycling programs, consumer education, or even economic recession. Nevertheless, studies conducted over the last few years indicate consistent waste reductions in unit pricing communities. For example, a study at Duke University by Dr. Daniel Blume examined 14 cities with unit pricing. The waste reductions in this study ranged from 18 to 65 percent. The average waste reduction was 44 percent. IS UNIT PRICING RIGHT FOR YOUR COMMUNITY? ------- Building Consensus and Plannin; for Unit Pricing nit pricing involves many important decisions regarding how to perform and pay for solid waste services. To be sure that their communities are choosing the best options, many solid waste agencies have initiated a planning process that helps lay the groundwork for sound decisions and coordinated implementation. This process helps clarify the community's solid waste needs and goals, identify likely barriers and methods of overcoming them, and inform and educate residents about unit pricing and how it can improve solid waste management in the community. 10 ------- Setting Goals and Establishing a Unit Pricing Team Solid waste management can be a confusing business, with success measured against standards as varied as recycling diversion rates, total costs, or even quality of media coverage. For this reason, the first step when planning for unit pricing is to determine the goals of the program based on a review of your community's solid waste management needs and concerns. While goal-setting can at first seem like an abstract exercise, clearly defined and measurable objectives for your program are invaluable when deciding which unit pricing options would work best in your community. Goal-setting can help build community consensus and facilitate efficient monitoring and evaluation of the unit pricing piogram's progress. Although you will want to solicit input from local residents and other interested parties before coming up with a final list of goals, it is useful to first examine and prioritize goals internally before introducing them to the community. Consider holding an internal brainstorming session to establish a preliminary list of goals. This session could last anywhere from one hour to half a day, depending on the size and makeup of your community, the issues that need to be addressed in the session, and the needs and structure of your agency. A shorter, followup session to revisit, refine, and prioritize goals also might be useful. Prioritizing goals also is important since the weight that you assign to goals now will help you design the rate structure for the program. (Setting rate structures is described in Part III of the guide.) In addition, achieving every objective on a community's list can be difficult. Consider the tradeoffs among program costs, citizen convenience, staffing changes, and other factors as you prioritize your goals. Circumstances often require compromise in one area in exchange for progress in another. Specific goals and objectives can vary significantly among communities. Examples include: • Encouraging waste prevention and recycling. A community should set unit prices at levels high enough to encourage households to reduce waste generation and to recycle and compost. This helps to achieve existing recycling goals and to conserve landfill space. • Raising sufficient revenue to cover municipal solid waste management costs. A unit pricing program should bring in enough revenue to cover both the program's variable costs and its more stable or fixed costs. Variable costs, such as landfill tipping fees, are the expenses that fluctuate with changes in the amount of solid waste collected. Fixed costs are costs that change only rarely, such as rent for agency offices, or that change only after large-scale waste collection changes, such as the number of collection trucks needed. TRADEOFFS HIERARCHY COSTS BUILDING CONSENSUS AND PLANNING FOR UNIT PRICING II ------- Establishing a clear set of goals for your unit pricing program is invaluable when deciding which program options will work best in your community. • Subsidizing other community programs. A community might wish to generate revenues in excess of the actual costs for solid waste collection and then use those funds to enforce antilittering or illegal dumping laws, or to improve its recycling and solid waste infrastructure. Once your agency has established a list of preliminary goals, consider setting up a unit pricing team or citizen advisory council to help you refine and prioritize these goals. A unit pricing team typically consists of solid waste staff, interested elected officials, civic leaders, and representatives from affected businesses in the community. Team members may be solicited through advertisements in local newspapers and on radio and television stations. Including these individuals in the planning process gives the community a sense of program ownership. In addition, team members can help other residents in the community understand the specifics of the program as it evolves and can provide your agency with valuable input on residents' concerns about the program. Members of the team also can serve as a sounding board to help ensure strong community participation throughout the planning process. Addressing Barriers A unit pricing team composed of residents, civic leaders, and town officials can help ensure the development of a successful unit pricing program. The team or council also can help your agency identify potential barriers to implementing unit pricing in your community and consider ways in which these barriers can be addressed. Illegal dumping and burning of waste is one of the mostly frequently cited barriers to unit pricing. Yet participants at EPA's Unit Pricing Roundtable and communities with unit pricing programs report that illegal dumping has occurred prior to implementing a program and tends to persist at some level, regardless of the way in which residents are charged for solid waste management. The key is to design a unit pricing program that significantly deters illegal dumping and burning. Public education and enforcement policies are the most effective tools in addressing this barrier. Informing residents of the experiences of communities with unit pricing and setting up fair but aggressive enforcement policies to respond to incidents of illegal dumping also are essential. Other potential barriers to unit pricing include recovering expenses, covering administrative costs, ensuring that unit pricing is not perceived as a rate increase by residents, implementing unit pricing in multi-family buildings, addressing physical or financial difficulties for senior citizens, and overcoming resistance to changing 12 ------- the status quo. (Part III of this guide provides an in-depth discussion of barriers and specific strategies for overcoming them.) Once both the municipal solid waste agency and the unit pricing team or council have evaluated specific goals and barriers, it is time to unveil the program to the city at large. The team or council might consider developing a preliminary proposal with several program options. This proposal can serve as a basis for public discussion and help illustrate what changes might occur. Building a Public Consensus Public education is critical to the planning, design, and implementation stages of a unit pricing program. In fact, education is the linchpin holding all of these phases together. While educating the public might at first seem unnecessary and expensive, the experiences of communities that have implemented unit pricing programs indicate that a good public relations program more than pays for itself. Such a program is effective at developing a general consensus among residents on the need for unit pricing. Community support is vital to the long-term success of a unit pricing program. In fact, communities that have implemented unit pricing programs are nearly unanimous in listing education and community relations as the most important elements of a successful unit pricing program. Public education can combat fears and myths about unit pricing (such as the fear of increased illegal dumping) and help avoid or mitigate many potential implementation problems. When first reaching out to residents during the planning stage, don't be surprised if many residents react with skepticism to the idea of unit pricing. Initial opposition is often related to a perception that unit pricing will result in an additional financial burden. Opposition also might be due simply to a natural resistance to change. Resistance to unit pricing is especially prevalent in communities where solid waste management fees are hidden in general or property taxes. To counter this opposition, municipal officials can inform residents of the current difficulties associated with waste collection and management. In particular, officials can explain the costs to residents of the current system of waste management. Next, they could present the goals for improving the management of solid waste in the community. In this context, officials can introduce unit pricing, discuss its potential for meeting these objectives, and address any questions and concerns that residents have expressed about the new program. EDUCATION BUILDING CONSENSUS AND PLANNING FOR UNIT PRICING ------- At EPA's Unit Pricing Roundtable, panelists ranked education and community relations as the most important elements of a successful unit pricing program. Winning community support for unit pricing often hinges on explaining how the program can achieve certain critical objectives. Discussions at EPAs Unit Pricing Roundtable revealed that residents tended to support unit pricing if the program achieved the waste management principles about which they cared the most. Residents often develop a sense of civic pride in programs that meet these objectives. Roundtable panelists strongly recommended that solid waste officials devote a significant amount of attention to communicating these basic principles: • Equity. The program should be structured so that people who generate more waste pay more, while residents who prevent waste, recycle, and compost are charged less. • Waste reduction. The program must significantly reduce the community's generation of waste, increase the rate of recycling, and, therefore, reduce the amount of waste requiring disposal in landfills and combustors. • Reductions in waste management costs. By helping to alter household waste generation patterns, the program should help reduce the cost of collecting and disposing of the community's solid waste. • Municipal improvements. The program should contribute to improvements in the quality of life in the community, such as resource conservation and land preservation. In addition to deciding what information needs to be communicated, solid waste officials also should consider how best to reach residents in the community. An unspecified change in waste management services scheduled to occur at some future date is not likely to capture a community's attention. The following activities represent some of the ways in which officials can explain the benefits of unit pricing: • Hold public meetings. Interactive public meetings offer solid waste officials the opportunity to present the case for unit pricing. Such meetings also give citizens the sense that their concerns are being heard and addressed in the eventual program. • Prepare briefing papers for elected officials. As both shapers and followers of public opinion, elected officials tend to be at the center of public policy debates. Because well-informed leadership can raise issues in such a way as to attract residents' interest, solid waste officials might want to provide elected officials with brief summaries of the issues associated with solid waste management and the likely benefits of a unit pricing program. • Issue press releases. Press coverage of a change in the way that a community pays for its solid waste collection services is inevitable. Keeping key radio, television, and newspaper outlets well informed of the reasoning behind the move to unit pricing can make the press a valuable participant in the decision-making process and prepare the community for an upcoming change. 14 ------- • Work with retailers. Grocers and other retailers in your community can help educate citizens by displaying posters and other information about the new program in their stores. In addition, retailers can help customers generate less waste by displaying information about choosing waste-reduced products. Part IV of this guide explains additional steps that communities can take to communicate their ideas to the public. Scheduling Your Planning Activities Even before the final decision is made to pursue unit pricing, some basic planning issues can be addressed. Chief among these are legal/jurisdictional issues and timing. Generally, states extend to local jurisdictions the authority to provide waste management services and to charge residents accordingly. During the planning process, however, many communities have the unit pricing team research the municipality's legal basis for implementing a new solid waste service pricing mechanism rather than risk discovering a problem unexpectedly during implementation. Since unit pricing programs often involve a number of steps and some complex decision-making, consider developing a timeline for planning, designing, and implementing your program. Based on the experiences of communities that have successfully implemented unit pricing, planning for unit pricing should begin at least a year in advance of your targeted start date. You can establish goals for the unit pricing program and begin explaining the program to the community from 9 to 12 months before program implementation. Public education should continue throughout the months prior to the program and, to some extent, after the program is underway. You can identify the legal framework for the program at least six months before the start of a program. A detailed suggested timeline for a unit pricing program is provided in Part IV of this guide. BUILDING CONSENSUS AND PLANNING FOR UNIT PRICING 15 ------- PART II uestions answers Everyone agrees we should prevent waste and recycle more. Why do we need to spend so much time thinking about specific goals and objectives? It will probably be easy to get a broad consensus that some things are "good," such as saving money or reducing disposal rates. But solid waste management in general and unit pricing in particular often involve a series of tradeoffs. For example, a community may decide to sacrifice some convenience for households to cut costs or to create a stronger waste-reduction incentive. Establishing goals and priorities early in the planning process can make it easier to make difficult choices as they arise. Why is public input so important? We have already consulted with many solid waste experts, who know a lot more about solid waste issues than residents. Municipal officials and experts agree—no unit pricing program is going to work if local residents oppose it. Since improved solid waste management requires a good faith effort from residents to reduce the amount of waste they dispose of, it makes sense to include residents as equal partners. / 16 ------- Points to remember maesesssmassx^is Establish realistic goals for your unit pricing program that address your community's most pressing waste management needs. Involve the community in the planning process. Representatives from community organizations can increase acceptance of unit pricing and facilitate implementation. Plan for the possibility of illegal dumping or burning. In addition to explaining other communities* experiences with illegal dumping, let residents know about legal alternatives for managing and disposing of solid waste. Also explain that concrete steps, such as assessing penalties for violators, will be taken. Public education cannot be stressed enough. Promoting the strengths of unit pricing and addressing residents' concerns is critical to the success of your program. A > 'i * « » * Provide elected officials with information on the benefits of unit pricing programs to help them address residents' concerns. Also, keep local officials informed of decisions made about the program as it evolves. Be sure to carefully research your legal authority to establish and enforce a unit pricing program. Based on this research and on the advice of your municipality's legal counsel, ordinances may be necessary to establish the program. Plan ahead by establishing a timeline for your program. BUILDING CONSENSUS AND PLANNING FOR UNIT PRICING 17 ------- Case Studies Three Cities Report on Illegal Dumping In Mansfield, Connecticut, officials report that illegal dumping did not increase significantly with the introduction of unit pricing. To prevent illegal dumping, Mansfield has relied primarily on public education. When necessary, however, the solid waste department also has worked with the police department to track license plates and identify violators. In Seattle, Washington, unit pricing also has not been associated with an increase in illegal dumping. In fact, 60 to 80 percent of the illegal dumping incidents in the city are associated with remodeling waste, refrigerators, and construction debris-waste that the city suspects comes from small contractors who do hauling on the side and dump the refuse. Seattle officials are considering licensing these haulers or requiring remodelers to verify that their material has been properly disposed of. The city of Pasadena, California, reports similar findings. A survey done at the city's landfill indicated that Pasadena was disposing of one-third more trash than was indicated in a waste generation study completed in the city. Pasadena suspects that this waste is made up of construction and demolition debris dropped off by small contractors. In the future, instead of contracting with small individual haulers, Pasadena may require those applying for a building permit to use licensed haulers to take construction and demolition materials to the landfill. 18 ------- PART III Designing an Integrated Unit Pricing Program o this point, this guide has presented an overview of the major benefits and barriers to unit pricing, followed by suggestions on how to define the objectives of your program and begin building a consensus for unit pricing in your community. This portion of the guide introduces issues relating to the exact structure of your community's unit pricing program. The first half of Part III, "The Building Blocks," discusses the advantages and disadvantages of the specific program components and service options from which you can choose. This is followed by "Putting the Blocks Together," a six-step process to help you design a successful unit pricing program. DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 19 ------- The Building Blocks While unit pricing is based on the simple concept that households pay only for the waste they generate, designing a working program requires that you consider and decide on a range of specific issues. You may have already examined many of these issues, such as the potential for complementary recycling and composting programs, the types of solid waste services to offer, and the means by which you can provide these services to residents with special needs. During the development of a unit pricing program, however, viewing these issues in the context of how they might affect the success of your program is important. The process of selecting program components and service options can begin as much as nine months before the start of a program. This part of the guide points out the kinds of decisions you need to make during this process, including: • Choosing a volume-based or weight-based system • Selecting containers • Examining pricing structures • Considering billing procedures • Determining service options and complementary programs • Including multi-family buildings • Accommodating individuals with special needs Communities also need to consider other factors, such as the remaining life of existing containers, the cost of container replacements, the preferences of customers, and the impact of assessing additional taxes or fees on households. Later in this section of the guide, a six-step process for designing an actual unit pricing rate structure is presented. This process should help you tailor a rate structure to local conditions. Volume-Based Versus Weight-Based Programs One of the first decisions to be made when designing a unit pricing program is to determine how solid waste will be measured. Based on your unit pricing goals, local budgetary constraints, and other factors, you need to decide whether your system will charge residents for collection services based on the weight or the volume of waste they generate. The two systems have very different design and equipment requirements. Under volume-based systems, residents are charged for waste collection based on the number and size of waste containers that they use. Households are either 1) charged directly for waste collection based on the number of bags or cans set out at the curbside, or 2) required to purchase special trash bags (or tags or stickers for trash bags) that include the cost of waste collection in the purchase price. 20 ------- PART III Under weight-based systems, tin; municipality weighs at the curbside the waste residents set out lor collection and bills for this service per pound. Tho program can either require residents to use standard, municipally supplied cans or allow them to continue using their own cans. Weight-based systems offer residents a greater waste reduction incentive than volume-based systems since every pound ol waste that residents prevent, recycle, or compost results in direct savings. This is true no matter how much or how little waste reduction occurs. In addition, residents can easily understand this type of system and perceive it as fair. Weight-based systems also provide a more precise measurement of waste generation than volume-based systems. On Ilii! other hand, weight-based systems tend to be more expensive to implement and operate than volume-based systems because special equipment is required and more labor typically is necessary to handle the more complex billing system. In addition, some oi Hie equipmen used to weigh the waste, record (be data, and bill the customer is still experimental. Startup costs for these systems can include truck-mounted scales for weighing waste and some type of system (such as bar-coding on waste cans) lor entering this information into a computer for accurate billing. While volume-based systems are less costly to set up '"id operate, a potential disadvantage associated with these systems is that residents might be tempted to compact their Waste. SOUK; residents will compact more llian others, perhaps even using mechanical compactors. This reduces 'lie ability of unit pricing to offer more equitable charges for waste collection services and complicates the task of identifying the impact of unit pricing on the community's rate of solid waste generation. Additionally, depending on Hie system chosen, there can be less of an incentive to reduce waste since such reductions might not translate into direct savings for the resident. Although over 1.000 communities nationwide have unit pricing Programs in place, very few have fully implemented weight-based programs. Accordingly, the remainder of this guide focuses predominantly »ii the process ol designing and implementing a volume-based unit pricing program. •veight-bosed unit of Fan has invi TRADEOFFS DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 21 ------- PART III Austin, Texas, provides residents with either 30-, 60-, or 90-gallon cans as part of its unit pricing program. Container Options Communities that decide to design a volume-based unit pricing program must consider the type and size of waste collection containers on which to base their rate structure and billing system. Keep in mind that choices about containers, rate structures, and billing systems all go hand in hand. In some cases, container type will dictate the rate structure and billing system. In other cases, an established billing system (that cannot be drastically overhauled) can govern container type and rate structure. A unit pricing program can be designed around the following container options: Large cans. Under this system, households are provided with single, large waste cans, often with a capacity of 50 or 60 gallons. Each household is then charged according to the number of cans that they use. Small or variable cans. This system uses a set of standard. graduated can sizes, often ranging from approximately 20 to 60 gallons in capacity. Typically, these systems operate on a subscription basis, under which residents choose in advance the number and size of cans they wish to use. Prepaid bags. This system uses colored or otherwise distinctively marked standard-sized trash bags, typically 20 to 30 gallons in capacity. Residents purchase the bags from the solid waste agency through outlets such as municipal offices and retail stores. Only waste that is placed in the bags is collected. Prepaid tags or stickers. Residents purchase tags or stickers from the solid waste agency and affix them to their own trash bags. The tag or sticker specifies the size of bag it covers. Each system has its own specific advantages and disadvantages related to such issues as 1) offering a system that residents view as equitable: 2) creating as direct an economic incentive for waste reduction as possible; and 3) assuring revenue stability for the solid waste agency. Other issues to consider when weighing the pros and cons of different container types include simplicity of billing, compatibility with existing waste collection services, ease of collection for work crews, sanitation and aesthetics, budgetary constraints, and community solid waste goals. The primary benefit of a single, large container size is revenue stability. When communities use large containers, the number of cans set out each week tends to remain fairly constant, and so do revenues. The primary disadvantage associated with this container choice is that households that don't generate much waste have no economic incentive 22 ------- PART III to reduce waste. Such households are billed the same amount whether they fill a 60-gallon can halfway or completely. Conversely, the principal benefit of using variable can sizes is that even modest reductions in waste generation (for example, one less 10-gallon waste container) can clearly translate into savings. A disadvantage of variable cans is that they can be inconvenient for customers who generate large volumes of waste. In addition, to realize savings from reduced waste generation, households must request a change in the number of cans for which they are being billed. The solid waste agency might need to establish an inventory and distribution system that could be expensive to set up and maintain. Additionally, billing for this method can be more complex in some communities. Like variable cans, prepaid bags encourage greater waste reduction than large cans if the bag size is configured so that residents that generate less waste pay less. Additionally, since residents pay for waste collection through the purchase of the bags, there is no billing, which means this type of system is relatively inexpensive to implement and maintain. The primary disadvantage associated with bags is that there is greater revenue uncertainty than with can systems. An individual might, for example, buy several months' worth of bags at one time and then none for many weeks. Also, semiautomatic collection vehicles that require residents to use a rigid container might not be able to adapt to bag collection. Bags also can tear or be torn open by animals, resulting in scattered trash. Prepaid tag or sticker systems offer many of the same advantages as bag systems. Chief among these is that such systems directly encourage waste reduction, since different stickers can be used to identify different amounts of waste "set-outs" (the waste residents set out for collection). This means, however, that the solid waste agency must establish and enforce size limits for each type of sticker. As with bags, waste collection is paid for upfront, so no billing needs to be done. Also like bags, stickers or tags offer less revenue stability. In addition, stickers can fall off in rainy or cold weather, and both tags and stickers can be counterfeited or stolen. The advantages and disadvantages of each of these container options are described in more detail in Table 3-2 at the end of this chapter. You don't have to be locked into one type of system, however, if you plan for the possibility of change. Some communities conduct a pilot program in one part of the municipality before implementing unit pricing communitywide. In this way, difficulties can be worked out early in the process, when modifications are still relatively easy. UNLIMITED SERVICE Large. ;s and stickers will help n and COll' DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 23 ------- TRADEOFFS While the details of the pricing structures used in unit pricing programs can vary greatly according to local conditions and needs, four basic types are currently in use. These pricing structures are described below. Pricing Structures The main consideration in choosing among the types of pricing structures is their impact on the stability of the community's revenues and on residents' waste reduction efforts. In addition, some pricing systems are more complex than others to administer. 1. The proportional (linear) rate system is the simplest rate structure. It entails charging households a flat price for each container of waste they place out for collection. This rate structure provides a strong incentive for customers to reduce waste. It also is easy to administer and bill. Careful consideration is often required, however, to select a price per container that avoids cash flow difficulties that can hinder a new program. While setting too high a price will increase resistance to unit pricing, setting too low a price may cause periodic revenue shortfalls (and can lessen the waste reduction incentive). In addition, when setting rates, decision-makers should assume that some level of waste compaction will occur. They also should plan for success, since as people begin to reduce the amount of waste they set out, the solid waste agency will see a corresponding drop in revenues paid for waste collection. Weighing the Tradeoffs When Setting Pricing Structures Decision-makers considering such issues as container choices, rate structures, and service options quickly realize that all of these choices are closely related. Decisions in one area will influence, or even determine, how your community responds to the remaining choices. When considering container options, for example, a smaller community with fewer resources might favor a bag-based system because of its generally lower implementation and administrative expenses. Such systems, however, have the potential for revenue gaps that the community might not be able to bridge. As a result, a community might prefer a two-tiered or multi-tiered rate structure, whose base fee would help prevent such instability. By contrast, a larger community interested in providing a stronger incentive to reduce waste might favor a proportional or variable container rate and higher per container fees. To avoid significant revenue fluctuations, such communities might choose a can-based subscription system that ensures a steady cash flow. There is no one best approach to unit pricing. Throughout the design process, you will need to determine the specific combination of container choices, rate structures, and service options that will maximize efficiency and enable your community to meet its solid waste goals. 24 ------- PART III 2. With a variable container rate, a different rate is charged for different size containers. For example, a solid waste agency might charge households $2 for every 60-gallon can of waste set out and$1.25 for every 30-gallon can. While this system creates a strong incentive for residents to reduce waste, it requires that communities carefully set their rates to ensure revenue stability. Because different rates are charged, this system can be complicated to administer and bill. 3. Both of these systems use a per-container fee to cover the fixed and variable costs associated with a community's MSW management. Other unit pricing rate structures address fixed and variable costs separately. Two-tiered rate systems assess households both a fixed fee and a per container fee. Under this system, a monthly flat fee is set for solid waste services to ensure that fixed costs are covered; a separate, per-container charge is then used to cover the variable costs. In Pennsburg, Pennsylvania, the solid waste agency charges residents a flat $65 per year plus$1 per 30-gallon bag of waste placed at the curb for pickup. This system provides more stable revenue flows for the community but offers less waste reduction incentives than proportional or variable container rates. Some communities use the two-tiered rate structure as a transition system. Once decision-makers are able to gauge customers' response to unit pricing, a proportional rate structure could be introduced to encourage greater waste reduction. 4. Multi-tiered rate systems charge households a fixed fee, plus variable fees for different container sizes. For example, a community might charge a basic $10 monthly service fee plus$2 per 60-gallon can, or $1 per 30-gallon bag. This rate structure offers similar advantages to two-tiered rates and also encourage waste reduction. This type of rate structure is the most complex, however, and could be difficult to administer and bill. Table 3-1. Pricing Options Proportional (linear) Variable container Two-tiered Multi-tiered Flat rate per container Different rates for different size containers Flat fee (usually charged on a monthly basis) and flat rate per container Flat fee (usually charged on a monthly basis) and different rates for different size containers DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 25 ------- PART III COSTS Billing and Payment Systems Traditional solid waste programs typically assess households a fixed fee, raised through property taxes or periodic equal billing of all households. Unit pricing programs use various billing/payment systems, such as direct payment for containers, actual set-outs, and payment for advance subscriptions. With a direct payment system, residents pay for solid waste services by purchasing bags or tags from the solid waste agency. Containers can be sold at the courthouse or city hall, at local retail stores, or at the hauler's office. Care should be taken to ensure that a sufficient number of easily accessible outlets are available for residents. Under subscription systems, residents notify the solid waste agency of their "subscription level," or the number of containers they anticipate setting out each collection cycle. The customer is then billed on a regular basis for these containers. If customers are able to reduce the amount of waste they generate, they can select a lower subscription level and save money. In many programs, these subscription fees are set at a level that covers the purchase of a designated number of additional bags or cans for any waste that a customer disposes of above their subscription level. This system offers fewer fluctuations in revenues, although the waste reduction incentive is lower because residents who reduce their waste generation rate only receive a reduction in their waste collection bill after requesting the municipality to change the number of cans for which they pay. An actual set-out system bills customers based on the actual number of containers set out for collection. This approach requires the hauler to count the number of bags, tags, or cans set out and to record the information so that households can be billed later. To address citizens' concerns about "hidden" or "double" fees, some communities that implement unit pricing either reduce the household tax rate commensurate with the unit pricing fee or decide not to raise the tax base proportionately with the revenues received from unit pricing. Meet with the citizens advisory council to work out the details for a pricing system geared to your local needs and circumstances. Accounting Options Regardless of how they collect payment, most communities tend to manage the finances of their solid waste activities as one item in the municipal budget. A few communities, however, are using alternative accounting approaches to complement their unit pricing programs. One such approach is the use of "full cost accounting." Using full cost accounting enables a community to consider all costs and revenues associated with a task such as solid waste management, including depreciation of capital costs, amortization of future costs, and a full accounting of indirect costs. This method can help a community 26 ------- establish a unit pricing rate structure that will generate the revenues needed to cover all solid waste management costs. Another approach that can be used in conjunction with a unit pricing program is the development of an "enterprise fund." Also referred to as special districts, enterprise funds are entities that can be used to separately manage the finances of a municipality's solid waste activities. In this way, the costs and revenues of unit pricing are accounted for under a separate budget, enabling a community to better anticipate; revenue shortfalls and, when appropriate, invest surplus revenues in beneficial waste management projects that can reduce the cost of MSW management in the future. Program Service Options The next step is to determine which solid waste services are most important to residents. Successful programs offer an array of solid waste services that citizens need and appreciate. The goal-setting process described in Part II of this guide identifies many of these services. Offering different services does add layers of complexity to a unit pricing program, especially to the billing component. Yet providing such service enhancements greatly increases overall citizen acceptance of the program. A carefully selected and priced service array allows a community to offer premium municipal solid waste services to households that want them, while generating sufficient revenues to support core solid waste collection services. The following sections highlight some of the most popular service options, many of which are complementary to basic trash removal. Complementary Programs Complementary programs are those that enhance the unit pricing program and encourage residents to prevent and reduce waste. The most common complementary programs are 1) recycling and 2) collection of yard trimmings for composting. Providing recycling and composting collection services enables both types of programs to reach their maximum effectiveness. In fact, in many cases, recycling and composting are major contributors to the success of a unit pricing program. Many communities already have some type of curbside collection or voluntary drop-off recycling program in place. Linking recycling and composting with unit pricing provides customers with an environmentally responsible way to manage their waste. In addition, since the cost of these programs can be built in to unit pricing fees, communities can recover these expenses without creating an economic disincentive to recycle. The extent of the recycling program is an important factor, as Providing a rec \ program in conji: Pricing can m of wast: DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 27 ------- PART * HomMm*; GuMt "Cycling Yard Complementary programs can benefit from a strong public •on effort. well. A community will more fully realize the benefits of offering recycling in tandem with unit pricing if the recycling program is geared to collect a wide range of materials (although the availability of local markets can constrain the types of materials a community can accept). Providing for removal of yard trimmings such as leaves, branches, prunings, and grass clippings, and promoting backyard composting and "grasscycling" (leaving grass trimmings on the lawn), also will enhance the unit pricing program. For example, the community of Austin, Texas, mixes the yard trimmings it collects from residents with sewage sludge to produce compost called "Dillo Dirt." which is sold to nurseries as fertilizer, and Durham. North Carolina, makes landscaping mulch from brush. Distributing "how-to" materials can help increase the amount of organic waste residents compost, and some municipalities oven provide their residents with free compost bins. In communities where weekly recycling or composting is too costly. curbside collection can be scheduled every other week or once a month. In addition, municipalities can encourage haulers to provide recycling services by including a risk-sharing clause in their contracts. Such clauses require the municipality to share with the hauler the risk of fluctuations in the price of recyclable materials. If a recycling company requires payment to process a certain collected material whose value had dropped substantially, for example, the hauler and municipality would bear these costs together. Some communities, however, might not feel their budget would allow them to incur additional, unexpected costs. Backyard Collections Backyard collection of waste and/or recyclables can be considered as a service enhancement that complements a unit pricing system. With this service, haulers remove residential waste and recyclables from backyards. garages, or wherever residents prefer, rather than requiring thorn to haul the material to the curb. Residents might pay extra for this service. When setting a price for backyard collection services, a community should consider costs to collect waste from the curb, transport it, and dispose of it. The higher charge for backyard waste removal should reflect the added municipal resources required for such a service. Curbside Collection of Bulky Items Curbside collection of large items, such as refrigerators and other major appliances, is another service that complements basic trash removal. In some communities with unit pricing, residents pay extra to 28 ------- PART III have bulky items picked up and disposed of by the municipality. The disposal of bulky items, which cannot fit into most unit-pricing programs' cans or bags, can be charged for within a unit pricing system by using printed stickers or tags that are attached to the item. To establish fair prices, the solid waste agency can use the same collection, transportation, and disposal cost considerations that apply to establishing prices for standard unit pricing waste collections. The price could be set in advance of collection, based on the owner's description of the item, or after collection, based on the collection agency's observations. Multi-Family Housing One of the biggest challenges for communities implementing unit pricing is how to include multi-family (five units or more) residential structures into the program. Such buildings can house a large portion of the population, particularly in densely populated areas. Because waste often is collected from residents of such structures per building, rather than per unit, it might be difficult to offer these residents a direct economic incentive to reduce waste with unit pricing. To compound this problem, because many multi-family buildings receive less convenient recycling services than single-family housing units, residents of multi-family buildings might have fewer avenues for waste reduction. There are several possible options to resolve multi-family barriers. One option is to have the building manager sell bags or tags to each resident. When households use these tags or bags, those that generate more waste end up paying more for waste collection. Problems arise BARRIERS Tips for Accommodating Residents of Multi-Family Households A number of ideas were presented at EPA's Unit Pricing Roundtable to help extend to residents of multi-family households the direct economic incentives inherent in unit pricing. One suggestion was to request that building managers pass on trash collection savings to residents in the form of cash rebates, rent reductions, or some free building services, although the impact of the incentive would be diluted since it is spread over all the tenants in the building. New technologies, such as a bar code reader to identify the tenant and a scale at the bottom of the chute to record the weight, also were suggested as possible solutions. These technologies offer the potential for accurately recording the exact waste generation for each tenant. In addition, building codes for new and renovated buildings could be amended to require the installation of separate chutes for recycling and for garbage disposal. Residents also could be required to use a trash token or some type of identifying code to gain access to a garbage chute. DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 29 ------- PART III In some communities, backyard collection can be arranged as a service for disabled or elderly residents. when households do not comply with this system, however. In many cases, residents can easily place waste in the building dumpster without paying for a bag or sticker. Another approach is to modify the system of placing waste out for collection in multi-family buildings. For example, dumpsters or garbage chutes could be modified to operate only when a magnetic card or other proof of payment is used. Such modifications can be expensive, though. Communities with unit pricing systems in place are experimenting with other possible solutions to the multi-family barrier. If extending unit pricing service to multi-family buildings is a concern in your community, consider contacting other cities or towns that have addressed this issue for additional ideas. (A listing of these communities is provided in Table 3-2 at the back of this section.) Residents With Special Needs Many communities considering unit pricing arc concerned about the special needs of physically limited or disabled citizens and those living on fixed or low incomes. For example, some senior citi/ens and disabled residents may be physically unable to move trash containers to the curb. Communities may wish to consider offering such residents backyard collection services at a reduced rate or at no extra charge. Such special considerations should be factored in to your unit pricing rate structure. While the fees associated with unit pricing could represent a potential problem for some residents, unit pricing systems can be structured to allow everyone to benefit. To provide assistance to residents with special financial needs, communities can reduce the per-household waste collection charges by a set amount, offer a percentage discount, or provide a credit on the overall bill. In some cases, communities with unit pricing programs offer a certain number of free bags or stickers to low-income residents. Some communities charge everyone equally for bags or tags but reduce the base service charge for low-income households. Assistance also can be offered through existing low-income programs, particularly other utility assistance efforts. These techniques allow low-income households to benefit from some assistance while retaining the incentive to reduce their bill for waste services by practicing source reduction, recycling, and composting. Communities will need to determine how to identify the amount of assistance they will offer based primarily on the program's anticipated revenues. As a basis for establishing eligibility for assistance, some communities with unit pricing programs use income criteria such as federal poverty guidelines. 30 ------- PART III ©retainer Systems to £ to X CO c 03 U Advantages Revenues are fairly stable and easy to forecast Unlike bags, cans often work well with semiautomated or automated collection equipment (if cans are chosen that are compatible with this equipment). If residents already own trash cans of roughly uniform volume, new cans might not be required. Cans may be labeled with addresses to assist in enforcement. Cans prevent animals from scattering the waste. Disadvantages Cans often have higher implementation costs, including the purchase and distribution of new cans. Customers have a limited incentive to reduce waste. Since residents are usually charged on a subscription basis, there is no incentive not to fill cans already purchased. In addition, no savings are possible below the smallest size trash can. Relatively complex billing systems are needed to track residents' selected subscription level and bill accordingly. Complex storage, inventory, and distribution systems are required to provide new cans to households that change their subscription level. A method of collecting and charging for waste beyond subscription levels and for bulk waste collections needs to be established. At the outset, residents may find it difficult or confusing to select a subscription level. Nonautomated can collections tend to require greater time and effort than collecting waste in bags. Communities Using This System Hennepin County, MN Seattle, WA Anaheim, CA King County, WA (in unincorporated areas) Marion County, OR \ Pasadena, CA Glendale, CA Oakland, CA Bellevue, WA Santa Monica, CA Duluth, MN Richmond, CA Walnut Creek, CA Santa Clara, CA Auburn, WA Hastings, MN DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 31 ------- Table CO £ CO cd CO Advantages Residents find bag systems easy to understand. Bag systems might offer a stronger waste reduction incentive than can systems because fees typically are based on smaller increments of waste. Accounting costs are lower than with can systems, since no billing system is needed. Bag systems have lower distribution, storage, and inventory costs than can systems when bags are sold at local retail establishments and municipal offices. Bag collections tend to be faster and more efficient than nonautomated can collections. Bags can be used to indicate that the proper fees have been paid for bulky items or white goods, since fees for pickup of these items (above the subscription level) often are assessed by communities. Communities can ask residents to attach a certain number of bags to the items according to the cost of disposal (for example, two bags for a couch and three bags for a washing machine). Disadvantages Communities Using This System Greater revenue uncertainty than with can-based systems, since the number of bags residents purchase can fluctuate significantly. If bags are sold in municipal offices, extra staff time be will need to be committed. Residents might view a requirement to buy and store bags as an inconvenience. Bags are more expensive than tags or stickers. Bags often are incompatible with automated or semiautomated collection equipment. Animals can tear bags and scatter trash, or bags can tear during lifting. Unlike cans, bags are not reused, adding to the amount of solid waste entering the waste stream. Grand Rapids, Ml Reading, PA Lansing, Ml St Cloud, MN Darien, IL Carlisle, PA Quincy, IL Oregon, Wl Fallbrook, CA 32 ------- Container Systems CO £ to CO U CO O txo Advantages Tag and sticker systems are easier and less expensive to implement than can systems. Residents often find tag or sticker systems easier to understand. These systems offer a stronger waste reduction incentive than can systems because fees are based on smaller increments of waste. Accounting costs are lower than with can systems, since no billing system is needed. Selling tags or stickers at local retail establishments and municipal offices offers lower distribution, storage, and inventory costs than can systems. The cost of producing tags or stickers for sale to residents is lower than for bags. Stickers can be used to indicate payment for bulky items or white goods, since fees for pickup of these items (above the subscription level) often are assessed by communities. Disadvantages Communities Using This System There is greater revenue uncertainty Tompkins County, NY than with can-based systems, since the number of tags or stickers residents Aurora, IL purchase can fluctuate significantly. To avoid confusion among residents, the municipality must establish and clearly communicate the size limits allowable for each sticker, If tags or stickers are sold in municipal offices, extra staff time will need to be committed. Residents might view a requirement to buy and store stickers or tags as an inconvenience. Tags and stickers often do not adhere in rainy or cold weather. Extra time might be needed at curb for collectors to enforce size limits. In addition, there may be no incentive for strict enforcement if haulers are paid based on the amount of waste collected. Stickers left on trash at curbside could be removed by vandals or by other residents hoping to avoid paying for waste services. Tags and stickers are not as noticeable as bags or other prepaid indicators. Grand Rapids, Ml Lansing, Ml DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 33 ------- Putting the Blocks Together Now that you hove identified the components of unit pricing programs in general, you are ready to design a program that meets your community's specific needs and goals. "Putting the Blocks Together" presents a six-step process that can assist you in designing and evaluating your preliminary rate structure. This process should begin approximately six months before the start of your program. Performing the Six-Step Process As you are completing these steps, be sure to keep a few basic objectives in mind: • Raise sufficient revenues to cover fixed costs and variable costs. • Possibly raise revenues beyond the cost of the program to cover other waste management costs. These revenues might be used for antilittering campaigns or to discourage illegal dumping. • Send clear price signals to citizens to encourage waste reduction. • Charge appropriate fees to cover the costs of 1) recycling and other complementary programs, 2) providing services (such as backyard collection) for physically limited or disabled people, and 3) any discount pricing provided to low-income households. • Compile accurate MSW baseline data to be used when evaluating your unit pricing program. • Design a program simple enough to keep administrative costs low and to make it easy for people to participate in the program, thereby reducing both their waste generation and their waste collection bill. • Also, don't forget to consider your unit pricing goals, community-specific conditions, and the most promising suggestions from municipalities with existing unit pricing programs to ensure a program tailored to the waste management needs and concerns of your community. ------- PUTTING THE BLOCKS TOGETHER PART III ^^mm 1 STEP Demand: Estimate Total Amount of Waste Generated in the "Steady-State Because the amount of waste your community generates affects the level of resources (including trucks, labor, and administrative support) required to manage it, you need to accurately estimate what the community's waste generation rate will be after your unit pricing program is fully established. This period is referred to as the "steady-state." In the steady-state, residents have accepted unit pricing and reduced their waste generation rates accordingly, and the municipality's waste management operations have adjusted to new, lower waste collection requirements. TRADITIONAL SYSTEM Planning TRANSITION PERIOD Implementation STEADY-STATE Program Monitoring Ensuring that the revenues received under the unit pricing program will cover the program's costs is a critical factor for most communities. As a result, accurately estimating the amount of waste collected in the steady-state is an important first step in determining how much money unit pricing will actually generate. To develop such an estimate, perform the following calculations: } Current demand. Using your waste hauling records, estimate the amount of waste collected from residents last year. } Community growth. Next, estimate the population growth trends and other demographic patterns in your community. Use this information to estimate the demand for waste management services over the next one or two years. This information can be developed in several ways; the box entitled "Forecasting Community Growth Trends" on page 36 discusses some different approaches. (Note: If you are planning special programs for low-income, elderly, or multi-family households, you should estimate the population trends of these residents or households as well.) t Impact of unit pricing. Then, estimate the likely impact (i.e., household responsiveness) of unit pricing on this demand for waste services. Other communities with unit pricing programs in place might be a good source of information on the degree of waste generation reduction to be expected. Some communities have achieved 25 to 45 percent reductions in waste generation rates, depending on such factors as the use of complementary programs, the design of the unit pricing rate structure, and the effectiveness of the public education effort. Be sure not to underestimate the potential success of your unit pricing program, especially if strong public education and complementary programs are planned. Underestimating waste reduction will cause you to overestimate potential revenues. DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 35 ------- Use this information on current demand, community growth, and the impact of unit pricing to estimate the total amount of solid waste you expect will be generated once the unit pricing program has been established. Forecasting Community Growth Trends Forecasting trends in the growth of a community's population is an important step in accurately estimating the amount of waste generated under an ongoing unit pricing program. Typically, the degree of sophistication a community brings to this process will vary with the information and resources available. For example, if your community is small and you expect no change in population trends, per capita waste generation, and commercial or industrial growth, you could use a simple trend analysis to forecast growth. Your estimation of current waste generation amounts might be based on a waste characterization assessment, historical records from collection services and disposal facilities, or estimates based on similar communities' analyses. Extending these trends can provide an estimate of future demand for solid waste services. If you base your estimates on other communities' analyses, be sure to choose communities that are similar to yours in size, population, income distribution, urban/rural distribution, and economic base. In addition, using the most recent analyses available will increase the accuracy of your estimation. In contrast, if your community is large and you expect a change in current trends, you probably will need to use a sophisticated forecasting equation that will account for all the variables you identify. Your ylid waste agency may have collected data on a number of factors that previously have influenced the iount of waste generated by the community (such as housing construction, plant closings, household :ome. economic growth, and age distribution of the population). You could base projections of ture demand for solid waste services by introducing these data into your forecasting equation. ••••• STEP Services: Determine the Components of Your Unit Pricing Program After clarifying your community's goals and considering the pros and cons of the unit pricing program options described earlier in this section of the guide, you will be ready to determine the methods your solid waste agency will use to collect waste from residents and other details of your unit pricing program, including: } Containers. After considering their practical implications, decide whether your unit pricing program would be most effective using cans, bags, tags or stickers, or some type of hybrid system. Determine the volume of the containers to be used. ^ Service Options. While most unit pricing programs will include curbside collections, decide whether your program would benefit from such additional services as backyard collections and picking up bulky items such as white goods. 36 ------- PUTTING THE BLOCKS TOGETHER PART | Complementary waste management programs. If your community is not already operating programs like recycling or composting, consider whether you might implement them to enhance the effectiveness of your unit pricing program and to help meet other community goals. ) Residents of multi-family buildings and low-income residents. Determine how your community plans to extend the economic benefits of unit pricing to residents of multi-family buildings and to deal with the needs of low-income residents and the elderly. ^mmm 3 STEP Costs: Estimate the Costs of Your Unit Pricing Program Having determined the structure of your program and the services to include, list all associated costs. Categories of costs can include: } Start-up costs. Estimate the one-time costs your community will incur when implementing the unit pricing program, such as training personnel, purchasing new containers, and designing and implementing a new billing process. t Ongoing costs. Estimate the costs your program will incur on an ongoing basis. These costs include variable costs (such as landfill tipping fees) and more stable or fixed costs (including rent and utilities for agency offices and office supplies) that remain relatively constant despite fluctuations in the amount of waste collected. Be sure to consider any extra costs from providing special services to certain groups. (Some communities might find it useful to employ full cost accounting procedures to better understand the exact costs of the different projects planned as part of the unit pricing program.) ••• 4 STEP Rates: Develop a Tentative Unit Pricing Rate Structure Having determined the components of your program, you can now set a tentative rate structure. At this point, the rates should be considered merely rough estimates to be revised and refined in light of the overall revenues they will generate and how acceptable the costs will be to residents. The rates you start with can be borrowed from the figures used by neighboring unit pricing communities offering similar services or adapted from price ranges found nationally. As you work through the remaining steps in the process of setting a rate structure, you can determine whether the rates are appropriate and make adjustments accordingly. Be sure to specify any lower rates that you plan to make available to some portions of your community (such as discounts for low-income households). DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 37 ------- mm^^m 5 STEP ^^B 6 STEP Revenues: Calculate the Revenues From Unit Pricing You now have the information needed to estimate the revenues that your unit pricing program will generate once it has been established and residents have adjusted their waste generation rates accordingly. Divide the total amount of waste generated per month in the steady-state (estimated in Step 1) by the volume of containers, such as bags or cans, you established in Step 2. This provides an estimate of the number of containers of solid waste you expect to collect per month. Then multiply the estimated number of containers by the unit charge you have tentatively established in Step 4. This yields an estimate of the total revenues per month generated under unit pricing. Depending on the number of services offered and the unit pricing structure itself, these calculations can be simple or complex! For example, communities using cans of varying sizes and offering additional services (such as backyard waste collection) must estimate the revenues produced by each component of their solid waste program. In addition, if low-income households are subsidized under your program, be sure to calculate the size of the subsidies and subtract from the expected revenues. Balance: Evaluate and Adjust Your Preliminary Unit Pricing Program For most communities, comparing the anticipated costs of their unit pricing program (Step 3) against expected revenues (Step 5) will provide the critical indication of whether the program is viable. (In this step you must be able to rely on accurate baseline data for gauging the viability of your program.) If this comparison indicates that the costs of your unit pricing program might not be fully covered by its revenues, you need to review both the design of the program (Step 2) and the rates you plan to charge (Step 4). Several revisions of program options and rate structures may be required to achieve a unit pricing program that most closely meets the goals established by the community in the planning phase (see Part II). Once you feel that your program strikes a working balance between costs incurred for services provided and the prices residents will be charged, it might be appropriate to submit the program design to other municipal officials or community leaders for additional input. This process of review and comment can continue until a balanced program agreed upon by community representatives has been established. 38 ------- PUTTING THE BLOCKS TOGETHER PART III The Six Steps in Action: Designing a Rate Structure for Community A To illustrate the steps in action, we will follow Community A, a hypothetical town, as it designs a rate structure for its new unit pricing program based on its own particular goals and concerns. Estimating waste generation rates. Community A's records show that it collected 480,000 cubic yards of solid waste from residents last year. Municipal officials realize that the population of the town is likely to increase next year after a large multi-use building complex is completed. Based on population projections prepared by town planners, officials estimate that, at the current rate, residents will generate nearly 600,000 cubic yards of solid waste annually two years from now. Within this two-year period, however, officials hope their unit pricing program will have reached its steady-state, and residents will be generating less waste. Using data from three nearby, demographically similar towns that have established unit pricing programs, municipal officials estimate that two years after implementation of the unit pricing program the community will generate about 410,000 cubic yards of waste annually. Establishing rates. At this stage in the design process, municipal officials in Community A decide to use the median rate of the prices charged by other communities across the country ($1.75 per 30-gallon bag). In addition, this rate is very close to the price adopted by the three nearby unit pricing communities for their 30-gallon containers. Calculating revenues. Dividing the annual amount of solid waste Community A expects to generate in the steady-state (410,000 cubic yards) by the size of their waste container (30 gallons or 0.15 cubic yards) shows that the municipality can expect to collect over 2,733,000 bags each year. By multiplying this figure by the price per bag ($1.75), officials calculated that Community A should receive about$4,780,000 in revenues from its unit pricing program each year. Calculating costs. Community A estimates that the annual steady-state cost of its program will include approximately $1,000,000 in fixed costs, such as public education efforts, computers and other office materials, and enforcement efforts, and approximately$2,700,000 in tipping fees and other variable costs. Combining these figures produces an annual steady-state cost of approximately $3,700,000 for the program. Additional start-up expenses also would be incurred. Comparing costs and revenues. While recognizing that their program must cover the town's waste management costs completely, officials in Community A agreed the town should cover any start-up costs that exceeded revenues during the initial transition period. Therefore, when a comparison of the expected revenues against the costs of the unit pricing program showed that the program would generate excess revenues, municipal officials decided to lower the price charged per bag to$1.35. This new price would yield a projected $3,690,000 annually, closer to the town's actual costs of maintaining the program. DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 39 ------- PART III PUTTING THE BLOCKS TOGETHER Balancing Costs and Revenues Costs A community can select from an impressive array of service options when mapping out a unit pricing program. After estimating the demand for services in STEP 1, communities can plan for the services they will offer in STEP 2. Some communities will want to offer services such as backyard collections, comprehensive recycling programs, and assistance to residents with special needs. Bear in mind, however, that while these projects can help promote source reduction and increase citizen enthusiasm, they also can increase the cost of your program significantly. Use STEP 3 to help estimate the costs of the services you are planning to offer. Revenues The flip side of costs is revenues. Unit pricing allows communities to generate the revenues needed to pay for solid waste management services under the new program. In fact, when developing a rate structure in STEP 4 and calculating the resulting revenues in STEP 5, communities might decide to set prices at a level above the cost of their unit pricing program. This would further encourage source reduction among residents and ensure that revenues could cover any shortfalls. Since residents will only support a program they feel charges a fair price for solid waste services, however, there are limits to this strategy. Balance To be successful over the long term, your unit pricing program will need to carefully balance the services you want to include against the revenues that residents provide. The exact formula will depend upon local conditions. Use STEP 6 to help you compare the costs of your planned program against anticipated revenues. Keep revising your rate structure until you feel that you have a program that offers the services you need at a price residents can support. 40 ------- uestions & answers How small should our smallest can or bag be? Unit pricing communities agree that planning for success is important during the design process. Some communities have found that cans as small as 10 to 20 ga//ons are needed! For example, Olympia, Washington, offers residents a 10-gallon can and Victoria, British Columbia, uses a 22-gallon can as the base service level. A number of communities using large containers (such as 60-gallon cans) are finding that these containers are too large to offer customers meaningful incentives, but purchasing and delivering new, smaller cans later in the program is very expensive. In the short run, a broader range of service can be provided by using several smaller cans. This also helps keep the system flexible for future changes. What pricing rates are communities charging? For bag systems in the Midwest and Pennsylvania, communities charge about$1 to $2 per 30-gallon bag. For variable can programs in the Northwest and California, towns charge$9 to $15 for the first level of service (20 to 40 gallons), with charges for additional cans of service ranging from 304 to$15. We have an existing variable rate can program. How can we increase the incentive for waste reduction? The key change to make is to base your billing on actual set-outs rather than using a subscription approach. Offer smaller cans to encourage waste reduction, and consider a bag-based system. Upgrading composting and recycling options (including plastics collection, for example, if you don't already) also will provide an incentive for customers to reduce waste. Communities a/so universally state that education is critical to helping customers understand and work with the system. Finally, consider a weight-based program. You might find that the cost of implementing this type of program is not prohibitive and that it can work in tandem with your existing cans. How can we improve source separation of recyclable materials? Some residents may tend to be sloppy about source separation regardless of the type of solid waste pricing system. As people learn to reduce their costs by recycling more, however, they may become more inclined to introduce nonrecyclables in their recycling bins. Many communities have found the best solution is a good education and enforcement program that creates a sense of"ownership among res/dents, supported by peer pressure against such behavior. Some also impose a small charge for recyclable materials in their rate structure design. DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 41 ------- PART III Points to remember Remember that container options, complementary programs, rate structures, and billing systems are all interrelated. As you consider the different options, keep in mind the need to cover costs, keep the system simple and convenient, encourage waste reduction, and minimize administrative burdens on your agency. Tradeoffs must be considered as you make decisions about rate structures and program options. Balance, for example, the need to generate revenues against providing incentives for waste reduction. Consider complementary programs, such as recycling and collection of yard trimmings, to increase the effectiveness of unit pricing. Consider how to ensure that unit pricing's economic incentives to reduce waste can be extended to residents of multi-family housing in your community. Design your program to be flexible enough to allow for groups with special needs. Discount pricing or assistance programs might be necessary to ensure that the program encourages^aste reduction without imposing physical or financial burdens on handicapped or low-income members of your community. Refer back to your unit pricing goals when making rate structure decisions. While information from other communities with unit pricing programs is helpful, your own community's solid waste concerns should be the overriding factor. 42 ------- Case Studies Establishing a Rate Structure A View From Seattle Unit priding structure. Seattle has established a two-tiered, variable subscription can unit pricing program. To ensure support for the program from our City Council and residents in general, we needed to design a program that keeps rates low and revenues stable. To accomplish this, Seattle chose to adopt a two-tiered rate structure. The mandatory base charge (called a minimum charge) is $5.85 a month. We also charge$15 for each standard size (30-gallon) can per week. The Council pushed for this structure, believing it would keep overall rates down and send a strong environmental message to the community at the same time. There tends to be broad support for the single price per can. We also have introduced smaller can sizes. About 30 percent of our customers use minicans (19-gallon capacity), which cost $11.50 per week, and we soon will be providing microcan service (a 10-gallon container) for$9.35 per week. After talking with customers and observing their waste disposal habits, we found a lot of customers could fit their waste into a micro can. We expect about 10 percent of all customers to use the micro cans. CompBemeinitary sen-voces. After electing to collect yard trimmings as part of our program, we decided to set a flat fee of $3 per household per month for this service, believing that a more complicated system would only make the program's administration prohibitively costly. We offer bulky item pick-up for$25 per item. The price was set to cover hauling and administrative costs. For waste that is generated above the subscription level, residents must attach a trash tag, marketed through local retail outlets, to garbage bags. The trash tag system has been one of our less successful programs, partly because customers just don't know about it. In addition, our haulers do not always enforce the tag system. Since they get paid per ton of waste they pick up, they have no incentive to leave the waste at the curb. We estimate we forfeit anywhere from $500,000 to$1 million dollars a year on fees not paid on this additional waste. Tags and Stickers A View From Illinois One of the major advantages of tags and stickers is that, since residents pay for them at various outlets in the community, there is no billing at all. They also are applicable to different types of services, containers, and waste, and they are easy to purchase and hold on to until needed. Multiple tags or stickers can be used on bulky waste items, too. Tags and stickers also are easy for collection personnel to use. Since every second they spend at a stop costs money, the more data collection or enforcement that a community DESIGNING AN INTEGRATED UNIT PRICING PROGRAM 43 ------- requires haulers to perform per stop, the less likely they are to do it. In addition, the tags and stickers are still useful even in cases where collection personnel can't read or write. But tags and stickers are not perfect. The hauler might not be able to find them. People can steal them off other residents' garbage bags and put them on their own bags. A special problem for stickers is that they can fall off in rainy or cold weather. Furthermore, people may buy a large number of tags in January, and then none for the next several months. Not only does this create an uncertain revenue supply, it also makes predicting solid waste volume very difficult. Experience With Weight-Based Systems A View From Farmington, Minnesota, and Seattle, Washington In Farmington, Minnesota, we worked for two years to develop and implement a weight-based unit pricing program for our town of 5,000 residents. Our new system uses fully automated trucks that require just one person per truck to hoist and weigh the garbage can. The truck's weighing system reads a bar code on the can that identifies the resident's name and address. The truck then empties the can and the information is fed automatically into the billing system through an onboard computer. This provides a reliable system for charging residents for waste collection by weight. One issue we have to resolve is establishing an appropriate regulation for the weighing mechanism used in our system. After Minnesota's Weights and Measures Agency decided it did not have the authority to verify the scales on the trucks, the state legislature adopted standardized weight and measure legislation establishing regulations covering weighing equipment for garbage collection trucks. One issue that remains, however, is that the degree of calibration required is too precise (the same as that for grocery store scales). We are now in the process of petitioning for changes to make the regulation more consistent with practical needs. In Seattle, Washington, we tested two different weight-based systems: a hand-dumped weight-based system and a semi-automated weight-based system. The hand dump system, designed around a "hook scale" and a bar code, was tested over the course of three months. The collector hung the can on the hook and used a scanner on the bar code. The weight and number were recorded in a portable calculator-sized computer and downloaded to a personal computer for calculating anc mailing mock bills to customers. The second system we tested during a six-week trial used a retrofitted semiautomated tipping arm and a radio-frequency tag. The weight and customer identification number were automatically recorded during the dumping cycle. Both approaches worked extremely well. The first system took about 10 percent longer for collection; the second system operated exactly as the standard semiautomated variable can system and took no extra time. Surveys of customers participating in the hand-dump system trial showed that it was very popular. Participating residents reduced waste 15 percent by weight over the course of the testing. In our research, we found that with the weight-based system, there are advantages tc customers buying their own containers. The cost is lower and, if the garbage is hand-dumped, you do not need standardized containers. Under a semiautomated system, however, you might have to require customers to buy specific containers. 44 ------- PART IV Implementing and Monitorin; Unit Pricing H aving carefully planned and designed a unit pricing program that best reflects the needs and concerns of your community, you can now get started. Implementing a unit pricing program is an ongoing process, requiring persistent attention to a wide range of details. This part of the guide focuses on the central issues concerning unit pricing implementation, including public education, accounting, and administrative changes. Suggestions also are included for collecting data and monitoring the program once it is in place. There are two distinct schools of thought about the timing of unit pricing implementation. One maintains that unit pricing should be implemented within a specified time frame and that rate adjustments, complementary programs such as recycling, and any other changes be made all at once. The other believes that households respond better when they are asked to make changes in small, manageable increments over time. The final decision about which path to follow is a local one based on the views of your agency, the local government, community organizations, and the households themselves. In most towns, residents will prefer to modify their habits as infrequently as possible. In this case, it might be easiest to implement a package of changes all at once, rather than ask for a series of adjustments six months apart. IMPLEMENTING AND MONITORING UNIT PRICING 45 ------- PART IV Implementation Activities Many tasks need to be performed during unit pricing implementation. While the exact activities vary from community to community based on program design and local conditions, certain tasks pertain to nearly all unit pricing programs. These include conducting public relations and reorganizing your solid waste agency's administrative office. (Both of these activities are discussed in detail below.) Other common tasks include: • Establishing legal authority. Generally, to implement a unit pricing program, your solid waste agency needs the authority to set and approve waste collection rates and bill accordingly, establish an ordinance mandating the use of the waste collection service, establish penalties for illegal dumping, and spend solid waste agency funds for activities beyond those associated with traditional solid waste management services (for example, public education). If your community lacks the authority to implement and enforce any portion of the unit pricing program, the first step will be to draft the necessary ordinances in consultation with your legal counsel. • Procuring containers. You also will need to purchase the necessary waste containers, bags, tags, or stickers for the program. Once the size and design specifications are established, you can seek vendors for the required materials. In some cases, a request for proposal (RFP) might be placed to solicit competing bids from several vendors. This can help you procure the necessary materials at the least cost to your agency. After a vendor is selected and an order placed, storage and distribution plans will be needed. In particular, communities planning to use local retailers to distribute bags, tags, or stickers should identify and negotiate with local merchants to arrive at a mutually beneficial arrangement. Communities developing a can-based system will need to inform residents of the can options, have residents select the number and size of cans they will use (if a variable can system is used), and distribute the cans to all residents. • Assisting groups with special needs. If your community is planning to assist residents with special needs, such as multi-family, low-income, physically handicapped, or elderly residents, you will need to develop a list of qualification criteria. In addition, you might need to devise special applications and train staff to review cases. Procedures should be established for resolving any disputes or complaints that could occur during the review process. If you are planning to include multi-family residents in your program, consider planning and conducting a pilot program before you switch to unit pricing. In this way, different systems and technologies can be tested prior to launching the actual program. 46 ------- PART IV Establishing complementary programs. If you have decided to launch or expand recycling or composting efforts, bulky waste collections, or other complementary programs in conjunction with your unit pricing program, you will need to coordinate the many steps involved in establishing these programs. Depending on the resources available and on local conditions, these steps could include purchasing or modifying existing equipment, hiring and training collection staff, identifying local markets for recyclables, and contracting with buyers. Ensuring enforcement. Enforcement procedures could be established to address the possibility of illegal dumping or burning of waste, "borrowing" of tags or stickers from neighbors' bags, or nonpayment of fees. If necessary, enforcement staff can be hired and procedures developed for investigating incidents. In many ------- PART IV As par- lie outreach program, Seattle's Solid Waste s conveying important obout unit pricing es of engaging pamt The first step is to determine the scope and content of your community relations effort. All such efforts need to convey to residents the exact structure of the new unit pricing program. Be sure to relate all essential information, including: • The types and costs of all services offered under the new program. • The schedule for collections. • The means by which fees will be collected. • The methods or outlets for purchasing cans, bags, tags, or stickers. • The penalties for noncompliance. When imparting this information to the community, make sure that all instructions are clear and simple. Explain any unit pricing concepts that residents might not understand. If you are producing written materials, consider translating the text into more than one language, depending on the makeup of your community. Use illustrations whenever possible to convoy key concepts. Sometimes local copying shops or printers will donate their services to help produce these materials. Also, be sure to discuss the waste management goals for the community and show how the new unit pricing program will help meet those goals. If you had organized a citizens advisory council or an informal gathering of community or civic groups to help you with public outreach during the planning stage, you might reconvene this group to plan your implementation outreach efforts. Such a group can help you develop an effective message and ensure that you reach all segments of the community. Offer citizens information on how to alter their purchasing and behavior patterns to prevent and reduce waste. Tips on waste prevention options, such as reusing containers, renting seldom-used equipment, and donating unwanted items, are useful. Encouraging residents to purchase recyclable items and goods with recycled content also is important. In addition, the message is likely to have a greater impact if information on additional benefits, such as saving energy and preserving natural resources, is provided. If residents make the program's goals their goals too, they are more likely to make long-term behavioral changes. 48 ------- PART IV There are many ways to convey the specifics of the program to the community. While the solid waste agency will need to decide which methods to use and how often to repeat the message, some avenues to consider include: • Introducing the program with a flyer or letter from a local official or recycling coordinator. • Enclosing inserts in utility bills that discuss the program and answer common questions. Direct mailings to households also can be used. • Developing posters or flyers for distribution in stores, libraries, schools, and other public places around the community. Retail stores will be especially valuable if your program uses bags, tags, or stickers that are distributed though retail outlets. You can leave flyers, posters, newsletters, and other materials with these stores, and ensure that the retailers themselves are familiar with the program. • Producing newsletters that discuss the need for the program, answer questions, and provide updates about the program's progress. • Establishing a telephone hotline to provide residents with immediate answers to their questions. • Drafting press releases and developing media spots for radio or cable television. Through the media, you can reach a broad range of residents. Additional outreach techniques can be employed based on your community's particular conditions. For example, if you feel that a specific group of residents, such as senior citizens, are not receiving enough information to participate effectively, you might consider reaching out to senior centers, local churches, and other institutions to ensure that everyone is familiar with unit pricing. Some solid waste agencies opt to conduct public education campaigns using existing inhouse staff. Others hire one or more qualified individuals to conduct these activities or pay outside consultants to perform public outreach. This decision is typically based on the size of your community, the scope of your program, and the available resources. Keep in mind that public outreach is an ongoing process. A consistent flow of information, designed to answer questions, receive input, and communicate any changes made to the program after it has been implemented, will help maintain interest in the program. In addition, an ongoing campaign can continue to inform and educate citizens about new ways to prevent or reduce waste. IMPLEMENTING AND MONITORING UNIT PRICING 49 ------- PART IV Reorganizing Your Solid Waste Agency's Administration Depending on their current structure and the scope of the new unit pricing program, some solid waste agencies will not have to make significant changes in the way they administer solid waste collection services. Such communities can switch to unit pricing using only some overtime work from existing employees. Other programs, however, could require new administrative and accounting systems and staff to handle the changes in billing, tracking costs and revenues, managing operations, and maintaining customer relations. In some cases, larger communities planning more complicated unit pricing systems have found it worthwhile to hire analytical, financial, and customer service staff to handle both the transition and ongoing requirements of the program. Getting Your New Administrative Office On Line The keys to transforming your solid waste agency's administration into an efficient team capable of handling its new responsibilities are: • Anticipating the level of expertise that will be necessary, both during program implementation and ongoing operation. • Giving funding priority to areas that hold the greatest opportunity for savings or pose the greatest risk of financial problems. • Meeting temporary needs during the transition with temporary help, rather than locking in to a level of employment that proves excessive in the long run. While the process of reorganizing an administrative system for a new unit pricing program can seem daunting, performing the switch as a series of steps with clear objectives in mind will help make the process manageable. Generally, communities with unit pricing programs have found that the process of reorganizing the administrative office should take place between three and six months before the start of the program. The first step is to define the new responsibilities the administrative office must assume once the program has reached its steady state, as described in Part III. Consider all the functions, such as public relations, customer service, economic analysis, financial management and tracking, and enforcement, that the office will need to perform. With steady-state as the goal, try to create a new office that matches these needs rather than accommodate your goals to the skills that are available. After establishing 50 ------- PART IV the functions and related skills required of your new administrative office, you should then begin to reorganize the office to meet these responsibilities. During the process of defining new responsibilities, remember that the unit pricing program will change the administrative office's functions significantly. The office will be operating a revenue recovery system that pays for the work of the solid waste agency, rather than justifying funding levels to the municipality's budget office. The office will find it has an unprecedented level of influence on customers' behavior through the price signals it sends. This brings additional responsibility for the proper design and management of these price signals. Managing these new functions requires the office to have access to a range of skills, including: • Economics. Developing the unit pricing rate structure and related forecasts of revenues, costs, and total community use of waste collection, recycling, and composting programs. • Public relations. Developing outreach and education activities and managing customer service representatives. This function includes interaction with the general public, as well as local interest groups, elected officials, and the news media. • Financial and logistical management. Billing households or collecting revenues from the sale of bags, tags, or stickers; developing debt management strategies; managing cash reserves; and developing a distribution system for the program's cans, bags, tags, or stickers. • Enforcement. Ensuring that households pay for the level of solid waste services they receive. In addition, several important suggestions were offered during EPA's Unit Pricing Roundtable for organizing your administrative office's financial operations. Be sure to establish access to a cash reserve to help the office cover periods of unanticipated revenue reductions. Repeated instances of revenue shortfalls, however, could signal an imbalance between the services offered and your program's rate structure. Preparing existing administrative staff for the changes that will result from the switch to unit pricing is another important step. While the change initially might not be viewed positively by all employees, conveying the positive aspects of the switch might help ease concerns. In addition to the reorientation of the office away from traditional collection and disposal services to a new emphasis on waste prevention, recycling, and composting, employees should be informed of the opportunities for staff training and development in new areas, such as public relations and customer service, that the new program will create. Furthermore, when organizing the new office, communities should be aware that expanding the administrative office requires a delicate balancing of resources: while allocating too much funding to the office could cut into the savings that unit pricing programs offer, underfunding the office can result in inefficiencies and poor revenue recovery. This is COSTS HIERARCHY TRADEOFFS IMPLEMENTING AND MONITORING UNIT PRICING 51 ------- PART IV particularly true during the implementation and transition periods, before the unit pricing steady-state has been reached. During this period, using temporary labor or employees on loan from other municipal agencies might help to cover short-term budgeting, analytical, and other tasks. Developing a Schedule Organizing the many steps involved in planning, designing, and implementing a unit pricing program into a clear schedule is an essential step for most communities. While the exact schedule of steps should be viewed as flexible, establishing an overview of the entire process will help eliminate the possibility of any serious omissions. Table 4-1 presents a detailed timeline for your reference. (The dates listed on the timeline represent the number of months before or after program implementation each step should be initiated. Program implementation is defined as the date on which actual service changes begin.) While the dates have been established based on the experiences of a number of communities with unit pricing programs in place, local conditions and needs will inevitably affect the exact timing of your program's development. Many factors affect how you adapt this timeline to your community's needs, including equipment changes, contractual changes, financing requirements, and employment, as well as political factors (such as the nature and structure of the local political process and the potential existence of a perceived solid waste crisis). In most cases, the level of political support is the most important variable, routinely cited by communities as responsible for either significant delays or rapid progress in the implementation of their unit pricing programs. Most of the remaining steps can be conducted fairly routinely in 3 to 12 months, depending on system choices, size of the community, and types of solid waste collection and administration systems in place. Program Monitoring and Evaluation As solid waste management has grown more challenging in recent years, local officials are finding that they have greater freedom to develop and implement new systems for managing waste. At the same time, however, their efforts also are subject to a higher level of scrutiny. Within the context of tightening municipal budgets and increasing demands for city services of all types, local officials must be able to discuss budget needs and priorities in a compelling way, using reliable data to support their case. Specifically, a thorough process of collecting and analyzing data about the performance of the unit pricing program will: 52 ------- PART IV • Provide the facts about the cost-effectiveness of the unit pricing program that local officials need to justify the current budget. • Enable planners to justify future budget needs by demonstrating that the new spending on the program could in fact save money in the long run. • Help reassure bond rating agencies of the cost-effectiveness of the unit pricing program, thereby reducing the cost of financing it through bond sales. • Allow planners to accurately compare the performance of any complementary programs, enabling them to reallocate resources among the programs to increase the overall effectiveness of unit pricing. • Generate concrete, understandable, and accurate information that can help other communities considering unit pricing. Moreover, this data will enable solid waste agency planners to adjust the unit pricing program to unforeseen circumstances, ensuring that the effort and attention paid to planning, designing, and implementing the program will not be wasted. Typically, program monitoring and evaluation begins about six months before the date of unit pricing implementation, when information on the old waste management system is gathered. These data will act as a benchmark against which the progress of the unit pricing program can be measured. Monitoring and evaluation begins as soon as the new program is launched and continues throughout the program. Data collection is the first step in program monitoring and evaluation. While the exact types of data a community collects will vary from one area to another, most municipalities track: • Changes in the community's waste generation rate • Costs incurred, both in starting up and in operating the new program • Revenues received under the program Communities often begin by collecting data on the amount of waste disposed of, recycled, and composted before and after the program's implementation. Estimates of the amount of material illegally dumped can be calculated as well. To allow for a more comprehensive analysis, the waste generation rates can be tracked by month and year, and, if possible, by origin and destination. In addition, the data can be further broken down by facility, customer group (such as residential, multi-family, commercial, or industrial), and program (for example, drop-off versus curbside services). To gain a more accurate picture of the impact of their program, some communities also estimate the amount of waste that would have been generated in the absence of the unit pricing program. The specific costs that a community might want to research include disposal costs and tipping fees; new administrative costs, including public date i. adjust its prog'> IMPLEMENTING AND MONITORING UNIT PRICING 53 ------- PART IV COSTS relations, billing and invoicing, inventory and distribution of bags, tags or cans, and additional customer service staff; and direct program and service costs such as wages, supplies, consultant services, and postage. Costs for monitoring and cleaning up illegal dumping can be included as well. In addition, to increase the usefulness of cost data, communities might want to attribute different expenses to specific components of unit pricing (such as administrative labor or container costs) and track these separate cost categories by month and year. Be careful, however, to distinguish between short-term expenses and long-term investments for needed facilities and equipment. During this process, take care to separate transition and startup expenses from the ongoing operational costs of unit pricing. If possible, initial capital costs should be allocated over time and across programs. Collecting data on the revenues resulting from unit pricing tends to be simpler. Communities typically track revenues by type of program and customer category. To closely track a new unit pricing program, communities also might want to develop data on the number of subscribers or participants, broken down into type of service and program; the service and subscription levels (if a variable can program is used); the inventories of bags or tags held by distributors or manufacturers; the weight of containers set out (if possible, through surveys); and the numbers of phone calls and letters and the issues raised. Program evaluation can yield misleading results, however. To help avoid some common data collection and evaluation mistakes, panelists at EPA's Unit Pricing Roundtable recommended avoiding focusing on participation rates as a measure of success. While a study of participation levels can help guide program modifications, they are not useful for gauging overall progress since they do not address cost issues and tend not to distinguish between casual and committed participants. Likewise, panelists recommended that communities also consider factors beyond overall waste reduction when evaluating a program. For example, intangible issues, such as dissatisfaction with the program among residents of multi-family buildings, would not be reflected in an analysis that focused exclusively on waste reduction numbers. Tips for Data Collection and Program Monitoring • Get data from several different angles if possible (for example, waste quantity generation rates for both collection services and disposal facilities). • Don't simply accept the numbers as they are generated. Consider the possibility that factors such as underlying shifts in categories, definitions, or reporting might affect the accuracy of the results. • Be sure to carefully track costs. Without accurate and attributable data, the impact of your cost-effectiveness evaluation will be reduced. 54 ------- PART IV Table 4-1. Schedule of Implementation Activities Implementation Activities Customer Relations Months Prior to or Following Program Implementation Ongoing Public outreach [Brief management and elected officials Conduct focus groups on rate program design and issues Develop information materials for council and press X X Hold council hearings and public hearings Public relations/education Issue RFP for public relations firm, if needed Design educational materials, bill stuffers '< Review/refine educational materials Produce educational materials X X Distribute educational materials X X X Customer service staff 'Request customer service representative (CSR) computers and workspace, if needed Advertise for CSRs Obtain and install CSR computer equipment Hire and train CSRs Release temporary CSRs iPlanning and Analysis iHire rates analyst (part- or full-time) Determine rate setting procedure and calculate rates X X Refine rate structure IMPLEMENTING AND MONITORING UNIT PRICING 55 ------- PART IV Table 4-1 (continued). Schedule of Implementation Activities Months Prior to or Following Program Implementation Implementation Activities Containers and Enforcement Ongoing Bags, tags, or stickers Set specifications for sticker or bag and design logo Issue RFP for sticker or bag manufacture Select manufacturer Negotiate with retail outlets for sticker or bag distribution Finalize sticker or bag distribution plans Begin selling stickers or bags in stores Design error tags Cans Issue RFP for can purchase and distribution Decide on can size and purchase containers Have residents select can size Distribute cans Replace lost, stolen, or wrong-sized cans Enforcement Establish preliminary enforcement procedures Request equipment and facilities for inspectors Finalize enforcement procedures Train inspectors Release temporary inspectors Special Groups Negotiate with welfare agencies Develop exemption/discount criteria Determine responsible office Create procedures for qualification, disputes, etc. Finalize criteria and procedures Train inspectors or qualifiers Conduct qualifications X IT 56 ------- PART IV Table 4-1 (continued). Schedule of Implementation Activities Implementation Activities Months Prior to or Following Program Implementation Ongoing Multi-Family Planning Evaluate level of multi-family need Evaluate multi-family pilot options X X Conduct pilot program, if appropriate Changes to Other Programs Determine which complementary services to offer Decide funding source for new and existing complementary programs Modify unit pricing program to cover these costs, j if necessary Modify diversion program contracts Land_, procedures as necessary, ., : ? .-:;,; Ordinances Draft final ordinances for new program Draft ordinances, as necessary for illegal dumping and burning, recycling, and special collections Enact ordinances Data Collection Analyze information needs and design reporting procedures Finalize procedures Conduct baseline data collection Begin postimplementation data collection Conduct data analysis and program modification IMPLEMENTING AND MONITORING UNIT PRICING 57 ------- uestions & answers VI Is it really necessary to explain the new program repeatedly through so many different avenues? Not o/l citizens find garbage fascinating, nor will they immediately understand the reasons for a new waste management program. Explaining a new program more than once is not rude or insulting—it's a courtesy to people who would like to participate but have other things on their minds. Also, because unit pricing requires that residents pay attention to details such as labeling waste containers with stickers or buying bags from the municipality, hearing the message several times increases the chance that all residents will get the information they need. Does unit pricing require us to completely reinvent our solid waste agency? It does require a significant review of your agency's goals and structure. But this examination of new needs and existing employees could lead to the discovery of some previously untapped skills in your agency. Do I really need to follow this detailed timeline? Half the items in it are not likely to come up in our community. Select what you need from the timeline. The timeline lists the many possible kinds of new activities that a unit pricing program could require. It is designed to help solid waste officials think about specific activities, thereby supplementing the broad concepts that are stressed elsewhere in this guide. Our municipality is on a tight budget. Do we really need to spend money on data collection and monitoring? While many of your unit pricing decisions face budgetary constraints, data collection is essential for planning and for ensuring cost-effectiveness. The right kind of information can show which types of unit pricing program and rate modifications can best meet the community's needs over time. 58 ------- PART IV Be sure your public education campaign uses a consistent, simple message that clearly communicates the goals of the unit pricing program. To ease the administrative transition, clearly define the responsibilities of the office, the level of expertise that will be necessary, and any new staff that need to be brought on. Give funding priority to areas that hold the greatest risk of financial problems or hold the greatest opportunity for savings through effective management of limited administrative budgets. Establish a flexible schedule for your unit pricing program that reflects the political, technical, and economic concerns and issues in your community. Be sure to evaluate your program's progress periodically, including collecting and analyzing data on waste generation rates, costs and revenues, and the attitude of residents toward the program. To improve your data collection, make providing numbers part of the contract (or franchise or license agreement) with your haulers. Ask for monthly reporting, and provide forms and definitions to ensure you receive the information you require. IMPLEMENTING AND MONITORING UNIT PRICING 59 ------- PART IV Case Studies Public Education A View From Austin, Texas While Austin, Texas, is a very environmentally aware community, our Environmental and Conservation Services staff realized that behavior does not always correspond to stated attitudes. To give our new unit pricing program a good chance of success, we realized a strong public outreach program was needed. Since unit pricing terms such as "variable rates" and "volume-based pricing" are not particularly user-friendly, our first challenge was to come up with a name that would convey the nature of the new program to city council members, customers, and our own solid waste service workers. The name we came up with was "Pay-as-You-Throw," which has economic as well as environmental appeal. Then, we initiated a pilot program beginning with a three-phase marketing plan to reach out to the 3,000 participating single-family households. In the first phase, the Preimplementation Phase, we worked very hard to sell the program in the community. We lined up support from interest groups, asked city council members to talk about the program, and encouraged the media to write positive editorials. During the second phase, the Implementation Phase, we had a more specific challenge. We have had curbside recycling in Austin since 1982 and good experiences with recycling behavior. With a well-established recycling program, however, when we brought the program to the pilot households, people were asking "Why do we need to do this when we're already recycling?" Our biggest challenge was to inform people about the need to further reduce waste and encourage them to use our unit pricing program in conjunction with recycling. After implementation, we learned from both attitudinal surveys and from direct observation of recycling bins that recycling had increased from 50 to 80 percent in some neighborhoods when unit pricing was introduced. The third phase of our public outreach program was the Maintenance Phase. Once the program was in place, we realized it was important to continue trying to raise awareness. It was during this phase that we introduced what became our single best educational tool—a brief, colorful newsletter included with each garbage bill. Called "Waste Watch," the newsletter contains features on the garbage collectors, dates of the brush/bulk pickup in each neighborhood, discussions about our unit pricing goals, and other features. We knew that only 15 to 25 percent of our customers read the usual utility inserts. However, after we provided more sophisticated information in an appealing format, our survey results showed a rise in readership. 60 ------- PART IV Administration Staffing A View From Dor/en, Illinois Darien, Illinois, with a population of 21,000, moved (com a franchise flat-fee system to a franchise sticker system in May 1990. Their administrative staffing needs were unchanged: one person from the city oversees the activities of the franchise hauler. City council members and existing staff put in overtime to develop details of the new system and negotiate with the hauler during the implementation process. The hauler has reported some increased accounting complexity but no increased staffing needs. Research indicates that this level of small, temporary increases in administrative needs during implementation of a new or revised unit pricing program is typical of many smaller communities. Administration Staffing A View From Seattle, Washington The Seattle Solid Waste Utility, an enterprise fund, operates a variable can subscription system with recycling fees and other charges embedded in the collection rates. Billing is performed in cooperation with the Seattle Water Department at a cost to the Seattle Solid Waste Utility of S1.9 million per year. To manage this program, the utility employs two rate-setting staff, four finance staff, and three accountants. Another $15,000 to$20,000 per year is spent on consulting services, mostly to assist with setting rates. Additionally, Seattle's 22 full-time customer service representatives and 9 refuse inspectors help to meet the service and enforcement needs of the new program. IMPLEMENTING AND MONITORING UNIT PRICING 61 ------- APPENDIX A EPA's UnH: Pricing Roundtable Discussion: Questions & Alternatives his appendix presents a selection of proceedings from EPA's Unit Pricing Roundtable, held in December 1992. These proceedings include descriptions of different programs from around the country, experiences of solid waste officials who have spearheaded unit pricing programs, and ideas on managing program costs and challenges. The discussions provided in this appendix are organized around a number of specific questions and are divided into four general sections: • Getting started • Exploring program options, issues, and experiences • Integrating unit pricing and complementary programs • Accommodating groups with special needs The first section explores issues involved in starting a unit pricing program, such as education, communication, and changing the status quo. The second section compares the essential components of a unit pricing program, including container choices, pricing models, and billing systems. It then moves on to financial issues, including cash flow and enterprise funds, and discusses enforcement issues. The third sect/on focuses on integrating unit pricing and complementary programs, such as yard trimmings and household hazardous waste collection programs. The last section shares some of the Roundtable proceedings on accommodating groups with special needs, such as senior citizens, large families, and low-income households. APPENDIX A 63 ------- APPENDIX A Getting Started Changing the Status Quo How do you convince citizens that unit pricing is a good idea in the first place? That has been a real obstacle. Seattle, WA: I think getting some good public support by working on it early is very important. Contact not only recycling groups but also community councils, people whom you might not expect to be big advocates of a unit pricing program. State of fLt The public opposition question comes up for communities that currently pay for their garbage collection out of general taxes (e.g., property taxes). In a sense, that's a hidden cost, and people perceive garbage collection as a free service. But if they have a monthly bill (instead of paying through property taxes, for example), they know that garbage collection costs something and there's "no free lunch." Then, in moving to a unit pricing program, they can actually see that the cost of garbage collection comes down. Whereas if the costs are hidden as property tax or general Unit Pricing Roundtable Participants The EPA-sponsored Unit Pricing Roundtable was moderated by Jan Canterbury of the EPA Office of Solid Waste and attended by over a dozen individuals who have been involved in successful unit pricing programs. The participants included: Nancy Lee Newell of the Qty of Durham, North Carolina Peggy Douglas of the City of Knoxville, Tennessee Barbara Cathey of the City of Pasadena, California Bill Dunn of the Minnesota Office of Waste Management ..,> (, ....... . .-. . ....... .. - , .. . _ Nick Pealy of the Seattle Solid Waste Utility, Washington Jody Harris of the Maine Waste Management Agency Jamy Poth of the City of Austin, Texas Jeanne Becker of Becker Associates, Illinois Lisa Skumatz of Synergic Resources Corporation (SRC) Lon Hultgren of theTown of Mansfield, Connecticut Greg Harder of the Pennsylvania Department of Environmental Resources Thomas Kusterer of the Montgomery County Government, Maryland Robert Arner of the Northern Virginia Planning District Commission 64 ------- APPENDIX A revenue, then no matter how far waste collection costs drop, they see unit pricing as an added cost. State ofMN: What I have found in Minnesota, and it's true with a lot of waste issues, is that we have the true believers and then we have the skeptics. The two groups are pretty much cemented before the discussion even begins. So, how do you get them to move? I'm not sure. But mandates at either the state, county, or city level can work. SRC: Maybe one of the ways to help get past public opposition is to work with members of citizen groups or "green groups" to start a groundswell of support for the program. Have some success stories from other communities. This con help make it so that the politicians supporting unit pricing are going with the tide rather than bucking the system. Citizen Education Did you use ad hoc citizen advisory groups, focus groups, surveys, and things of that sort before you got started? Austin, TX: Yes, in fact, the way we introduced the program (this takes a lot of leg work but is extremely important) is that we contacted neighborhood and civic associations, as well as our recycling block leaders. Just coming up with the list of associations was a task. We produced an eight-minute video on unit pricing and played the video at the neighborhood meetings. We had real people talking about what was about to happen. We got a lot of feedback by showing that tape. We carried out two focus group surveys, including one on larger families, an issue that many people want to hear more about. We experimented with soliciting feedback that was recorded on a telephone voice mail system. This is effective because, believe it or not, people are not that hesitant to record their views. It is also cost-effective, since we use the telephone answering tree for our other programs as well. The voice mail is a call-automated system, so the caller presses "7" to find out when our brush pick up date is or "2" to find out how to exchange carts. Many of the questions asked are just that simple. As you review your communications and outreach system, it makes sense to look into voice mail. Costs of Public Education How much money was budgeted for unit pricing education? Also, in developing your outreach efforts in-house, how many staff members did you devote to education and public relations? Austin, TX: Our educational costs ranged from $6 to$8 per household per year in the early years. Most of those costs were start-up costs. We saved a lot of money by doing all of our work in-house—designing a user-friendly name and a regular way of communicating in our pilot program. However, this in-house approach meant that we were constrained from using mass media such as TV and radio. We did not have the capacity to develop a TV commercial that said, "Here is how you participate in the new program." I really doubt that many communities phasing in their unit pricing program will find a mass media program useful because unit pricing can require a complex explanation. Instead, we use mass media only with our generic recycling and APPENDIX A 65 ------- APPENDIX A yard trimmings messages—simple messages such as "Either leave it on the lawn or compost it." We had three full-time staff members for education. One person was assigned to public relations, another was a graphic artist that participated in many things, and I was the planner. Also, we utilized volunteers (such as recycling block leaders or neighborhood association presidents) who provided the leg work in getting the word out. You would be surprised how interested the- volunteers are in doing something. We produced our video out-of-house because we didn't have the necessary cameras. Seattle, WA: Seattle spends $3.25 per household per year on public education, but that is actually high because a portion of that money goes to educating commercial and transfer stations. So it's probably under$3. But if you can piggyback some of these things, you can reduce your costs even further. Postage is very expensive, so if you can tag postage for the unit pricing message along with something else, it's even cheaper. Pasadena, CA: I'd like to emphasize that it is absolutely key to put yourself on the firing line with the customers. They pay the fees. When we went to the community we assured them, "We're not taking anything away from you. We are giving you the opportunity to have more control over your costs. You cut your trash down, you cut your trash bill down." You need to listen, take the abuse, but then once the people actually experience the program, they become converts, they don't want to go back. Either you take the time up front to educate, or you take it later with operational difficulties once the program is underway. Getting Ready for Unit Pricing What about communities that don't have unit pricing now? Knoxv/i/e, TN: My fear is that a lot of what's being discussed here may be difficult to apply to most cities in the South, in Tennessee, for example, we did a needs assessment of all the counties, and we found, first of all, that the waste composition was very different from the rest of the country. Only about 25 percent to 35 percent of the total waste stream was residential. Also, there is no city-wide curbside recycling, very little yard trimmings recycling, no household hazardous waste collection, and only one regional materials recovery facility. In addition, our landfill tipping fees average only about $25/ton even though we have adopted Subtitle D landfill regulations. Our land values are just a whole lot less than other areas of the country, for now at least. I don't think Tennessee is a lot different than most states in the South. EPA: I'm glad that you raised that because one of the goals of the guide is to provide information for communities that may not yet be at the jumping off point for implementing unit pricing. Any comments? Pasadena, CA: Knoxvif/e, TN: What do you mean they are not ready? What's your objective? Well, to answer the first part of your question, in our needs assessment study, we found that a third of the counties in Tennessee didn't even have co//ection service, period. So it's hard to talk about unit pricing or recycling. And one of the main reasons why I wanted to go to unit pricing was to be able to finance some of the extra municipal solid waste programs. I can't do it right now, because every time I try 66 ------- APPENDIX A Mansfield, CT: Durham, NC: to get city council to increase property taxes to pay for curbside recycling, I'm competing against stormwater drain programs or something else. You can start implementation with a drop-off center. Our community used the closure of the town's landfill to start paying by the bag at the transfer station. Any major facility or system change could act as a catalyst for a unit pricing system. Well, some of the South is ready, and it's because we have a very progressive state legislation package to push us. We have a 25 percent goal for July 1993, which not many of us are going to reach. And a 40 percent goal by 2001. We have to provide some kind of recycling for our citizens. That's spurring a lot of interest in our state, and a lot of people are looking at all the complementary programs. We are trying to give people as many options as possible (e.g., curbside recycling and garbage collection once a week, yard trimmings collection, a yard trimmings composting facility, and a bulky item pick-up). Anything other than sending it to a landfill. Our landfill is going to close, and our county hasn't been able to site another, so we're going to be shipping our waste out of the county. So we have a real big incentive to make sure we dispose of as little as possible. When you do have a crisis situation, and you have legislation that's pushing you in that direction on a state level, it can push you into the cutting edge of things, so it could be that you need to knock on your state legislature's door. Program Options* Issues, and Experiences Voluntary Versus Mandatory Programs What are some of the advantages of voluntary programs? Northern VA: There are communities like Plantation, Florida, that have voluntary unit pricing. Voluntary programs are more compatible with ideals of personal freedom, and the enforcement costs may be lower. On the other hand, there may be less participation in voluntary programs. A certain amount of good will is associated with mandatory programs, since everyone has to participate. Mandatory programs also provide a greater ability to cover fixed costs and less of an incentive for illegal dumping. If you have to pay for at least some municipal solid waste service, then you may be less inclined to dump your waste. Time Factors Does it take less time for your crews to go down the street and get their work done with the unit-based program? Austin, TX: Yes. We went from manual collection to semiautomated and estimate that the collection cost savings will be$5.11 per household per year. And we also went from three collectors to two collectors. That might not sound like much on an individual household basis, but certainly there is a cost savings. Then, we promote the APPENDIX A 67 ------- APPENDIX A educational message of "shore your boundary with your neighbor," so we can make fewer stops in your neighborhood. Seattle, WA: I think there are economies when you're collecting mm/cans as opposed to toters. Toters take 20 to 45 seconds apiece, depending on what you've got. The minican takes less time than that, so there ore definitely time savings. But, I think that bags are considerably faster than either toters or minicans. Bag Programs What is the largest city with a bag program in Pennsylvania? State of PA: Probably the largest city in Pennsylvania that has a bag system is Allentown, but it has a limited per-bag system that is only used for grass clippings. Reading has a population of 78,000, but it has a voluntary system in which haulers are required to offer a variable rate option. Wilkes-Barre has a population of around 48,500, but its program applies only to residents of apartment buildings. The largest mandatory per-bag system is probably Carlisle, which has a population of around 20,000. Carlisle is followed by South White Hall Township, with a population of around 18,000. Most per-bag systems in Pennsylvania use standard size 30-gallon trash bags. And usually they put a weight limit of around 40 pounds on the bags so you can't fill them up with bricks. Stickers How are stickers working out in your unit pricing program? State oflL The advantage of stickers is that there is no billing at all. They're applicable to various types of service, types of containers, and types of waste. With a simple, uniform schedule, stickers could be ordered through the mail. Or somebody could buy 50 stickers at a time from a hauler or from the local grocery store. The stickers are easy to keep and they are not going to rot. Often times, the haulers can't read and write, and so stickers are very simple. Since every second they spend at a stop is money to them, the more data collection or enforcement that you require haulers per stop, the less likely they are to do it. It's a time limit. But stickers are not perfect. The adhesive can be a problem. The hauler might not be able to find them. Stickers can be stolen off of someone else's garbage bag. And maybe the biggest problem is that people could buy a year's worth of bags in January, and then not buy anymore for the next several months. It is really hard to have to predict people's behavior in order to forecast revenue. The largest community in Illinois that has a sticker program is the City of Aurora, which has 100,000 people. Durham, NC: Stickers are interesting because you can take a big bag that you got at the store and put your garbage in it and put a sticker on it. Then you are reusing that bag and not generating another waste product. 68 ------- APPENDIX A Pricing Models What unit pricing models have you used? And how are the variable costs of providing services kept low? State of IL: In Illinois, communities tend to charge what their neighbors do. The rates vary from $1 to$2 a sticker. I really think they just try it and hope that the price is in the right ballpark. State of PA: Most Pennsylvania communities use a bag-based unit pricing system because they see examples in nearby communities. Carlisle adopted one about three years ago, and people in the neighboring township actually began clamoring for the same. In fact, they actually sued the township to giVe them a bog-based system instead of a flat- rate system. People like unit pricing because they see it as being very fair and very equitable. SRC: A 30-percent impact on customer costs may be a threshold level at which people begin responding to unit pricing. In contrast, I've seen some communities offer 90-gallon cans as the smallest size and then charge a quarter or a dollar for each additional 30 or 60 gallons. That may be unit pricing in one sense, but it certainly doesn't provide much of an incentive for people to source reduce. You can also use a fairly simple model and then consider some scenarios that give you an idea of what your rates should be. You don't have to have a massive rates model; there are communities working fine with microcomputer spreadsheets. Subscription Service Changes How do you handle it when peopie want to change their service? Austin, TX: Pasadena, CA: Do not underestimate how many people will select the smallest cart. Right off the bat, we went $2,100 in the hole because of all the people who were going to do the "right thing" and picked 30-gallon carts. In other words, be prepared for your program to become successful. Secondly, when it comes to cart exchanges, the start-up costs for this program are really high. You really need to talk to your politicians and everyone and get it all in a nice spreadsheet and realize that you're going to bite the bullet for the first three to six months of the program. We offer a free cart exchange the first time, and then$ 15 subsequently. But we were estimating that a total of 15 percent ended up changing in Austin. Instead of doing any surveying up front on the carts, we had to rely on the household size for estimates. The thing that my staff keeps coming back to me about is the administrative cost of making changes. Our rule is, you can't change service levels more often than every six months. Only every six months, however, even with 27,000 customers, means that there's somebody changing every single day. We don't charge for changing service right now, but I think that we must begin to charge for changes in order to create a disincentive. Soon, if you want to change, it's going to cost you $15 to$25 to make that change. APPENDIX A 69 ------- APPENDIX A Billing What elements are needed in a successful billing system? Seattle, WA: When you start unit pricing, determine if there are certain reports that you want to be able to generate from the billing system and make sure you get that capability integrated in your billing system right away. Later on, this type of modification can be just horrible and extremely expensive. Mansfield, CT: Seattle, WA: State ofMN: Mansfield originally had a private system, with the haulers doing the billing. When we implemented our unit pricing program, the town took over billing. We find that one of the side benefits is that we can lien property. The haulers have liked the system very much because they know they ore going to get paid every month. And that might be a way to sell it in a community that is also planning to take over the billing. That's a double-edged sword for us. We do our combined billing with the city's water department and drainage and waste water utility. We do have the lien authority and essentially can turn off the water if somebody doesn't pay their bill. The problem is that we have to deal with a lot of complaints from their customers, and it doesn't always lead to the best results for us in terms of a quality billing system. In some places in Minnesota, we are using a two-tiered (fixed plus variable fee) system that is separate from the garbage collection billing system. The government coHects some of the fixed costs to offset it. Cash Flow How did you project your cash flow over a certain period of time? Mansfield, CT: We collect quarterly and in advance. That solves a lot of the cash flow problems. Seattle, WA: If you're tight for cash, you need to know what's coming in and what's going out. It's very important to build in lags in your billing system. There's going to be some lag time in how people respond to unit pricing, and that tends to work to your benefit. You need to be conservative about the rate at which people reduce their solid waste, particularly customers using the extra con, especially if you have high extra can rates. And, don't underestimate the portion of the construction and demolition debris in Ihe waste stream. Look really hard at wood waste. Wood waste typically comes to your transfer stations in small loads. It can disappear real fast if you don't flow control it or know what's going on with it. 70 ------- APPENDIX! Enterprise Funds What are the key advantages of enterprise funds? Do they help you in tracking costs of services? Do they make it easier to raise rates than taxes? Austin, TX: It's never easy to raise rates, enterprise or not, but from a marketing point of view, if we have a program that may be a little more sophisticated than what a council member had thought about doing and if we can justify that we can pay for it, certainly it's easier to get quality proposals for rate changes approved. I think that is the key: it must be performance-based and used to justify budgets. Pasadena, CA: It also can be used as a point of leverage, in the sense that we can say we are an enterprise. We are a business and we have to charge full costs for our operations. Seattle, WA: Mansfield, CT: I think it's easier to get analytical staff, because there is a perception that if you've got big capital programs and big resource acquisition programs, then it tends to be easier to support getting people like that. The same is true with computer systems, /t tends to be easier to support those, which is real helpful. Our municipal solid waste enterprise fund has grown, matured, and is now supporting other activities, such as litter control. The downside to this is that policy makers may look to healthy off-line funds for support in the struggle to fund various other community programs. Municipal Versus Private Haulers Does a municipal program have more of a revenue-cost cushion than a private hauler? Mansfield, CT: I wouldn't say more cushion, but definitely more control over costs. We took over a private system and added recycling collection and still kept the rates the same. Our unit pricing program provided more service for the same price as the "free market" system. Mansfield contracts with two private haulers to implement its system. Pasadena, CA: State of IL: You can't assume that there are a lot of cushions. In Pasadena, we operate like a business and must be competitive. Now, if your municipality owns a landfill, you can find a little subsidy. But, if you do full cost accounting, then you know your true cost of operation. Then if you decide you need a cushion, that is part of the decision-making process. Another thing is, don't underestimate the sophistication of the private haulers. If you work very carefully with them, then you can learn a lot together. For example, I'm working with my commercial haulers very closely, because we have commercial recycling requirements. We're planning to adopt unit pricing in the commercial sector for the same reason—to encourage waste reduction and recycling. So commercial haulers need some help from us, but they also should be part of the process of gathering and sharing information. One of the differences between municipal systems and private haulers is that with the municipal system, you have a captive audience, and you can reach economies of scale. This is especially important for some of the programs we've talked about, such as Austin, Pasadena, and Seattle: all are larger population bases where a hauler can APPENDIX A 71 ------- APPENDIX A State of PA: reach economies of scale. This is not the situation, however, in the Midwest. In Minnesota, Wisconsin, and Illinois, outside of the metropolitan areas, the problem is that you have much smaller communities of several hundred or a few thousand people. Second, many of these communities use multiple private haulers. The goal of some communities is to keep every hauler in business, even if it's only one guy with one truck. A few months ago, I talked with a group representing waste haulers from Pennsylvania. I wasn't sure what their attitudes would be toward unit pricing. It turns out they actually like the idea, but their great fear was the uncertainty and risk from having a straight price per bag (proportional) program. They were much more favorable toward the idea of having a two-tiered system (i.e., fixed rate plus a per bag fee) that would better allow them to recover their fixed costs. Ways To Use Local Ordinances How can your local government, city council, or state legislature help? Pasadena, CA: Seattle, WA: In order to protect business for waste haulers and recyclers, communities can pass ordinances that require a franchise to do business. In this way, local governments can help create a level playing field. We designed an ordinance that makes haulers buy franchises from the city. We put as much flexibility into the ordinance as possible, but, at the same time, established some sort of guidelines. This assures that everyone's working under the same terms and conditions, whether it's one person, one truck hauler, or a bigger hauling firm. Another way to help smaller haulers is by stabilizing transfer station rates and disposal rates for reasonably long periods of time. This approach uses authority from state and local governments to insulate haulers from a lot of risk. State ofMN: If your goal is to encourage source reduction, you might have to employ mandates. This is especially important when budgets are tight, since both composting and recycling cost real money. As an example, in Minneapolis and St. Paul, they enacted ordinances that require food establishments to have food packaging that is either returnable, reusable, or recyclable—that's really a cutting edge area. Also, don't forget to amend your solid waste ordinance to allow for backyard composting and set up some standards and advertise them to protect against rodents and odor. Methods of Enforcement Are you finding that illegal dumping is a big issue? Pasadena, CA: I think the key here is not to associate illegal diversion with variable rates. There is always going to be some amount of illegal dumping, especially in hard economic times. So you have a multitude of factors that are contributing to what is generally called illegal dumping. The key here is education and providing alternatives such as legal diversions (for example, recycling and composting) and constructive source reduction actions. 72 ------- APPENDIX A State of ME: Mansfield, CT: State of MN: Enforcement efforts con be made more cost-effective through publicity. It only takes one enforcement instance along with a lot of big publicity to send a loud message to people who might be thinking about illegally dumping. In Maine we had a very large investigation on private haulers who were hauling to other municipal landfills with lower fees. The investigation was blown up in the press, with nightly TV coverage. It stopped a lot of the illegal dumping in other communities. We have a part-time garbage enforcement agent who works a couple days a week on enforcement and public education. In all fairness, I want to stress that it's not unit pricing per se that is driving illegal dumping. It is also driven by growing restrictions on what you can put in the garbage can. I believe restrictions may have more effect on i//ego/ dumping than unit pricing. What People Really Do With Their Trash People say, "My neighbor is the last one who goes to work, and he's going to put his garbage in my can." I have also had professional people say that they are planning to take their trash to work. So how do we address these concerns? Mansfield, CT: Austin, TX: Again, / would like to underscore that in our experience, neighbors have not put their garbage in the cans of other neighbors. We have had some calls—not many—from people who swore that their neighbor had put additional recyc/ab/es in front of the caller's bins. We investigated and found out it was the hauler who had put all the bins on one side of the street so that he could make one stop. We did a study that measured what households would do with garbage that could not fit in their subscription cans. Extra trash had to be labeled with stickers that were purchased for $2 each. We received 554 responses to our survey and got the following results: • 32 percent used the stickers and paid for their excess trash disposal. • 29 percent never had excess garbage and never had to use stickers. • 14 percent saved their excess garbage until the next trash pickup. • 11 percent stomped the extra garbage into their carts. • 5 percent threw their extra garbage out at a neighbor's or friend's. • 3 percent threw the extra garbage away at work. We a/so found that most excess garbage came from households that subscribed to larger, 90-gallon carts. We knew that most 90-gallon carts were purchased by households with five members or less, so we decided that excess garbage was not a problem created by large households that might not be able to reduce waste. Instead, we think some families simply choose not to respond to unit pricing—some families decide that they would rather pay more for larger carts and extra disposal than recycle or reduce waste. APPENDIX A 73 ------- APPENDIX A Integrating Unit Pricing With Complementary MSW Programs Yard Trimmings Programs What's the most effective complementary program that you've used with unit pricing and would recommend? State of/L: Yard trimmings systems (pay-by-the-ba&) can easily be implemented as programs that are complementary to unit pricing. If the household properly manages its yard trimmings by composting or keeping grass clippings on its lawns (grasscycling), it can avoid disposal costs without much effort. Second, a yard trimmings system costs almost nothing for the community, except relatively low infrastructure costs. And a yard trimmings system can reduce the total amount of residential waste by up to 30 percent, depending on where you live and how great a quantity of yard trimmings you have initially. I would say that if you had only one program to go along with unit pricing, it should focus on yard trimmings. Illinois instituted a ban on yard trimmings. Everyone thought we'd need a lot of new compost sites and thousands of bags to pick up yard trimmings. In fact, about 60 percent of all homes started grasscycling. Overnight, households just stopped picking up grass clippings, and costs for picking it up plummeted. Knoxvi/fe, TN: In our little city, we generate 20,000 tons of large brush and limbs every year, but we haven't budgeted for composting equipment. Any suggestions? State of/L- Instead of buying chippers, you can stockpile the brush at the compost site. It doesn't smell so you can store it for a long period of time. Also, you can rent a big chipper or tub grinder several times a year and then use your mulch for landscaping. Pasadena, CA: State of PA: Austin, TX: In Pasadena, 15 to 20 percent of the population has signed up for separate collection of yard trimmings. They put out an average of 50 pounds per household per year. If I could increase my participation in this program to 30 percent and everybody put out 50 pounds, then that's a big savings on landfill tipping fees. In addition, yard trimmings are dense compared with plastic, which is light relative to its volume. If your ultimate goal is to keep tonnage out of the landfill, then, dollar for dollar, you have a lot bigger bang for the buck with a yard trimmings program. In Pennsylvania, many municipalities use their bag system to collect yard trimmings, too. In Carlisle, residents put the leaves in plastic bags and the hauler dumps them out of the bags. Then the hauler actually puts the bags back on the curb so that people can reuse the bags. And, in Allentown, they use paper bags that break down in the composting process. Some communities use a vacuum system. It varies from place to place, but plastic bags are pretty widely accepted in Pennsylvania. Our yard trimmings do not get burned or go into a landfill. We mix them with our sewage sludge and create a product called "Dillo Dirt" (short for Armadillo). We bag 74 ------- APPENDIX A ft and sell it at nurseries or use it for our city parks. The Dillo Dirt program is very popular. People like to know that their grass will be used to deflect program costs. It's not a big money maker, but it does do a little better than break even. Seattle, WA: I'm surprised that people are talking about leaving their yard trimmings on their lawns, because in Seattle that's not a real common phenomenon. Households either compost or use curbside collection. We distribute free compost bins, which could be one reason; another could be differences in climate. Recycling Programs What about adding a recycling program? Pasadena, CA: Mansfield, CT: Seattle, WA: State of /L: If you don't have curbside recycling in place, you might look at other alternatives. It is extremely expensive to put in curbside recycling. Well, we found a big increase in recycling participation when we went from drop-off recycling to curbside pickup, so I don't think our unit pricing program would work as well without curbside pickup of recyclables. I think that on the issue of cost of services, you need to know, as best you can, what services customers ore willing to pay for. Then, if you provide a broad enough range of services at different prices and levels of convenience, you can best serve the majority of people's needs. / think people are willing to pay for convenience, and don't underestimate that. Also, Seattle has risk-sharing clauses built in to its recycling contract where the haulers either receive an extra payment or pay us a credit, depending on whether the economy indices and market prices are good or bad. That actually increased our financial exposure beyond what we like, but we felt that it was the appropriate thing to do, given the state of markets right now. For some very rural communities it is prohibitively expensive to do curbside collection once a week. In central Illinois, communities have curbside collection of recyclables once a month, and they found that it's actually working quite well. When they went to unit pricing, they just offered refuse bag collection once a week and recyclables collection once a month. Household Hazardous Waste Programs Some communities already have household hazardous waste pickup or drop-off. How can these programs work with a unit pricing program? Durham, NC: You may be able to share expenses with other city agencies. In addition to our yard trimmings, curbside recycling, and bulky item pickup programs, we have a household hazardous waste program. The payment for this came from our wastewater treatment department, not from our landfill tipping fee. The waste staff are just as concerned about hazardous waste going into the wastewater system as we ore about it going into the landfill. We may have to change that in the future and split it, rather APPENDIX A 75 ------- APPENDIX A than let them pay the whole bill. But it was a cushion for some time. We are also working on a permanent collection system on a regional basis. We hope to get a four-county region together and see if we can get a price break. We would set up permanent sites and negotiate with a contractor, saying, "We're going to give you a million people's worth of household hazardous waste. Can you give us a better price than dealing with one county, or one city"? Then we can reduce our costs and provide more frequent service to more people. Keeping the Message Simple How do you avoid confusing your customers when you add a program to your unit pricing system? Austin, TX: Through moss media we talk about complementary programs such as recycling and our Dillo Dirt program. But for unit pricing, and specifically how to participate in "Pay-As-You-Throw," we targeted our audiences more directly by using direct mail, a newsletter, and doorhangers. In these, we explained how to set out your wheeled cart, where it should face, and how to share with a neighbor (i.e., go ahead and pull two carts together on a neighbor boundary at the yard so that it's fewer stops for the collector). So, we steer topical information to specifically reach the affected audience. We choose to use easy terms to promote the program. It's important to keep messages simple and clear. Accommodating Groups With Special Needs Older Households How do you cater to the needs of senior citizens? Pasadena, CA: Our older population began to have some concerns about their ability to actually move their trash and pay for their trash. What we came up with seems to be working well. We sent a note that said, "If you are over 62 years of age or if you are disabled, call for special rates." Almost 10 percent of our population has called and about 5 percent are on the special rates right now. The special rate for senior citizens is a fO-percent discount. They con choose ony service option they wont, because we found that their needs varied. Durham, NC: What about the people who don't have driver's licenses, or are temporarily disabled; they broke their leg and it will be six months before they are mobile again? And, also, do you go back and check to see if the older person has died or if a young person is now living there and getting this service? Pasadena, CA: First, if they don't have a driver's license, we ask for some kind of ID card or birth certificate. People send all kinds of things; they're very good about wanting to show you that they qualify. Secondly, our eligibility criteria say that if there is a younger person in the home that can roll the trash for the disabled, then that household does 76 ------- APPENDIX A not qualify. You have to be disabled, and you can't have a caregiver who is able to do this. A lot is based on trust, although we do expect that we will do some followup, depending upon how many people subscribe to the service. As far as people with temporary needs, our basic message is if your need is less than six months, the administrative costs of making that change are greater than the actual discount that we could provide. But we do make exceptions on a one-to-one basis. Our customer service reps do a tremendous amount of talking, asking a lot of questions and dissuading people. The idea behind their asking questions is as much to help as to provide disincentives to taking advantage of the system. So we try to do it in a very courteous, polite way. After a while, most people get tired of answering the questions, but if they can answer all the questions then we do try to help them. How large is your customer service department? Pasadena, CA: For 27,000 residences, we have three people. One person answers the phones out front and dispatches on the radio for very basic questions. For more detailed questions, I have two more individuals who can respond. But, if the question is very difficult, it goes up to another level. Low-Income Households How do folks handle the low-income issue? Seattle, WA: We don't have any family rates, but we do have a low-income rate. This summer we qualified low-income, elderly, and handicapped customers for rate assistance. We include all households who are under the federal poverty line. Pasadena, CA: I would concur that if you're looking for standards, try to find something that is an established standard—not something that you create for your city. That's where we had problems because Pasadena is a more expensive place to live than other places in the nation. It's difficult to defend a low-income standard if it's not already established. Large Households Could you address the perception that a unit pricing program bashes the family? SRC: That is a very common question at conferences. I guess to me, that's an education issue. People who have larger homes pay more for electricity. People who have more people in the house pay more for water and more at the grocery store. The question is not so much aren't we going to be hurting these families but rather should small families continue to subsidize these large families? I think that you need to turn the question around. APPENDIX A 77 ------- APPENDIX A Inner Cities What about our inner cities? Seattle, WA: Mansfield, CT; Pasadena, CA: Seattle, WA: Monthly reports in Seattle show that illegal dumping is more concentrated in certain areas than others, and it tends to be in lower income areas of the city. Our toughest enforcement problems are in multi-family housing because of the transient population and difficulty in communicating with individual tenants, as opposed to single-family residents. Pay special attention to any area of more transitory populations. They are going to have special needs and special demands. We may need more frequent neighborhood cleanups there. Also, it is effective to use community groups, and to provide grants to community councils. Often, they can do it for less money, and there is a lot of community pride in dealing with the problem. City government is not great at doing it, but community groups can do it. Multi-Family Units What has been your experience with applying unit pricing to multi-family housing? Seattle, WA: We've had a broad range of problems providing unit pricing to residents of multi-family housing. These include contract relations, design, enforcement, and deciding whether the city or haulers will serve these units. Also, if you're going to do unit pricing in a big city with lots of multi-family housing, you have to have a reliable billing system that the customer service reps can use. We've got 9 inspectors and 22 customer service representatives, so we've got a big staff. But we have 300,000 collections a week, so even 1 percent of that turning up as phone calls can be a problem. We get about 650 calls a day from customers, and we can deal with that. Pasadena, CA: I have a problem with landlords who call me when their units are empty. They say, "I'm not using the unit because I'm remodeling it right now, so I shouldn't have to pay for trash." But I still have to have the same operation; I still have to pass by the unit. So, when you set up a unit pricing program, be sure to educate your landlords about this. 78 ------- Putting the Blocks Together: Additional Examples n Part /// of this guide, a six-step process for assembling a unit pricing program entitled "Putting the Blocks Together" was introduced. The six steps demonstrated how to combine projections of cost, demand, and service levels in order to arrive at a tentative rate structure for a unit pricing program. The six steps provided a general introduction to the process of designing a rate structure but did not demonstrate how to accommodate the specific needs of your community when designing a unit pricing program. This appendix consists of three examples to assist decision-makers in tailoring their programs to the specific waste management goals and needs of their communities. Each of the three examples outlines a community goal and the modifications to the design and assembly process considered necessary to meet that goal. The three examples are: • A community that wants to keep revenues higher than costs as it moves from a traditional waste collection program to a unit pricing program (the transition period). • A community that wants to provide complementary solid waste services such as a recycling collection program. • A community that decides to accommodate citizens with special needs within its unit pricing program. APPENDIX B 79 ------- APPENDIX B Designing a rate structure that meets the particular goals and concerns of your community is important. Use the three examples to get a sense of how to customize the six-step process to better meet the demands of your community. • Step 1: Demand. Estimate total amount of waste generated in the "steady-state." • Step 2: Services. Determine the components of your unit pricing program. • Step 3: Costs. Estimate the costs of your unit pricing program. • Step 4: Rates. Develop a tentative unit pricing rate structure. • Step 5: Revenues. Calculate the revenues from unit pricing. • Step 6: Balance. Evaluate and adjust your preliminary unit pricing program. Focusing on the Transition Period During the transition from a traditional waste management program to a unit pricing program, households gradually adjust their habits to the new opportunities and costs introduced by unit pricing. The demand for services from local municipal solid waste agencies might settle to new, lower levels during this time. The result can sometimes be a drop in revenues for the local agency. Many communities introducing unit pricing need to know that revenue shortfalls, however, will not be excessive during the transition period, nor in the subsequent steady-state. If a community requires the revenue from its unit pricing rates to cover costs during both the transition period and the steady-state period, it needs to focus on Steps 1 and 3 of "Putting the Blocks Together." During Step 1, the community needs to produce a detailed and accurate estimate of the degree to which households will reduce solid waste generation to better anticipate changes in revenues that will result from the unit pricing program. To acquire reliable estimates for this step, the community can draw on the experience of other communities that have introduced similar complementary programs, public education efforts, container options, and special services. A detailed estimate from.Step 1 will also help the community accurately anticipate the rate at which costs will settle downward. In Step 3, the community needs to look at how a reduction in waste volume will lower costs, such as transportation and tipping fees. Unit pricing planners then need to test tentative rate structures to find the correct balance between decreasing revenues and decreasing costs and to keep the local solid waste agency's revenues in line with costs during each quarter of the transition period, as well as the subsequent steady-state. 80 ------- Adding Complementary Services Communities that have a clear mandate for waste management can sometimes pursue a program that combines source reduction and recycling. For example, the citizens of a community might demand a combined program of unit pricing and curbside pickup of recyclables. To develop a rate structure that would accommodate a complementary curbside recycling program, the community would need to accurately identify all of its waste management costs and carefully weigh all of its revenue-raising options to determine if such a program was feasible. In Step 3 of "Putting the Blocks Together," the community can explore the potential for combining equipment, crews, billing, and routes for both trash collection and recycling pickup. Careful scheduling or innovative use of equipment could significantly reduce costs. The community should also use this step to examine the financial trade-offs of the two programs; for example, a recycling pickup program could lower the total amount of waste being landfilled or combusted, reducing the community's tipping fees to help cover the costs of providing recycling collection. In Step 4, the community is presented with-a variety of pricing options. These should be examined in light of your overall goals for unit pricing. For example, if one of your primary goals is to significantly reduce household waste generation, you can consider charging for all collection services. Setting substantial per-bag charges for both trash and recyclables will encourage households to reduce waste. If, however, recycling is provided for free, citizens would have less incentive to reduce the amounts of recyclables it generates and the municipal solid waste stream (trash plus recyclables) could actually rise in volume, driving collection costs up. Another pricing option consists of setting the per-bag charge for trash higher than the per-bag charge for recyclables. This rate structure encourages households to separate recyclables from other trash, thereby reducing the portion of their household waste that the community sends to the landfill. These examples show how important it is to treat unit pricing rates as part of a comprehensive pricing system that takes into account all solid waste services. Charging citizens for both recycling and waste removal adds complexity and cost to providing municipal solid waste services. The alternative, however, a unit pricing rate structure that does not integrate waste collection charges with those for curbside recycling, can prove expensive, inequitable, and ineffective at achieving the community's goals. APPENDIX B 81 ------- APPENDIX B Addressing Special Needs A community that wishes to assist low-income households that might have trouble paying for unit pricing needs to make several adjustments to the basic model to develop a rate structure that meets its goals. In Step 1, the community must first determine how to qualify households for lower collection charges. To make this decision, the community should collect information on the number of low-income households that could qualify for lower charges. The community can use these numbers to adjust revenue estimates and finally arrive at a rate structure that provides sufficient revenue. Rates should be set to provide an incentive for source reduction in both low- and high-income households. However, the community might anticipate that lower rates for low-income households will provide less incentive to use source reduction. If this is the case, estimates of the drop in demand for waste collection services should be revised to meet the effect of the low-income rate. In Step 3, the community needs to examine the potentially greater costs of introducing a low-income rate. Such a rate not only will decrease anticipated revenues but also require additional administrative costs to identify and separately bill low-income households. Administrative costs can be kept down if an established income cutoff is used or other local agencies have already identified the low-income households in the community. Rent assistance or income assistance programs might have already identified the low-income households in a community. 82 ------- APPENDIX C Definitions Bulky waste items - Large items of refuse including, but not limited to, appliances, furniture, large auto parts, nonhazardous construction and demolition materials, and trees that cannot be handled by normal solid waste processing, collection, and disposal methods. Commercial sector - Includes schools, hospitals, retail establishments, hotels, and restaurants. Compost - Discarded organic material that has been processed into a soil-like material used as a soil amendment or mulch. Construction and demolition (C&D) debris - Includes concrete, asphalt, tree stumps and other wood wastes, metal, and bricks. (C&D debris is excluded from the definition of municipal solid waste used by EPA and the National Recycling Coalition.) Disposal - Landfilling or combusting waste instead of recycling or composting it. Diversion rate - A measure of the amount of waste material being diverted for recycling/composting compared with the total amount that was previously thrown away. Enterprise fund - An independent budget dedicated for a special purpose or activity, such as a local municipal solid waste program. The local agency becomes reliant on the revenue it raises through unit pricing or tipping fees and does not receive financial support from the general fund of the local government. Flow control - A legal or economic means by which waste is directed to particular destinations (for example, an ordinance requiring that certain wastes be sent to a particular landfill facility). Full cost accounting - The total accounting of all costs and revenues involved in municipal solid waste management, allowing for a standard treatment of the capital costs, future obligations, and indirect costs. Household hazardous waste - Products containing hazardous substances that are used and disposed of by individuals, not industrial consumers. These products include, but are not limited to, certain kinds of paints, solvents, batteries, and pesticides. Integrated waste management - The complementary use of a variety of practices to handle municipal solid waste safely and effectively. Integrated waste management techniques include source reduction, recycling (including composting), combustion, and landfilling. APPENDIX c 83 ------- APPENDIX C Landfilling - The disposal of solid waste at engineered facilities in a series of compacted layers on land that is covered with soil daily. Fill areas are carefully prepared to prevent nuisances or public health hazards, and clay and/or synthetic liners are used to prevent releases to ground water. Municipal solid waste (MSW) - Waste generated in households, commercial establishments, institutions, and businesses. MSW includes used paper, discarded cans and bottles, food scraps, yard trimmings, and other items. Industrial process wastes, agricultural wastes, mining wastes, and sewage sludge are not MSW. Participation rate - The portion of households that take part in a given program. Often refers to households actively participating in a curbside collection program for recyclable materials. Recyclables - Products or materials that can be collected, separated, and processed to be used as raw materials in the manufacture of new products. The recyclable option should be available to the majority of residents through curbside recycling programs or fixed recycling centers. Recycled content - The portion of a package's weight (excluding coatings, ink, labels, stickers, adhesives, or closures) that is composed of postconsumer recycled material. Residential waste - Waste from single-family and multi-family residences and their yards. Source reduction (Waste prevention) - The design, manufacture, purchase, or use of materials to reduce the amount and/or toxicity of waste. Source reduction techniques include reusing items, minimizing the use of products that contain hazardous compounds, using only what is needed, extending the useful life of a product, and reducing unneeded packaging. Tipping fees - The fees, usually dollars per ton, charged to haulers for delivering materials at recovery or disposal facilities. Waste generated - Sum of waste recovered and waste disposed of. Waste stream - A term describing the total flow of solid waste from homes, businesses, institutions, and manufacturing plants that must be recycled, burned, or disposed of in landfills; or any segment thereof, such as the "residential or recyclable" waste stream. Yard trimmings - The component of solid waste composed of grass clippings, leaves, twigs, branches, and garden refuse. 84 ------- Bibliography Blume, D. R. 1992. Under what conditions should cities adopt volume-based pricing for residential waste collection. Washington, DC: U.S. EPA Office of Management and Budget. California Integrated Waste Management Board. 1991. Disposal cost fee study: final report. Boston, MA: Tellus Institute. Goddard, H. C. 1990. Integrating solid waste management: incentives for reduced waste, increased recycling, and extension of landfill life. Proceedings from the First U.S. Conference of MSW Management: Solutions for the '90s. Washington, DC. Howard, S. 1988. Financing integrated solid waste management systems. Paper presented at the Seventh Annual Resource Recovery Conference. Washington, DC: Shearson Lehman Mutton, Inc. Hsieh, H-N. (No date.) Cost analysis of landfill and its alternatives. Unpublished paper. Newark, NJ: New Jersey Institute of Technology. Jacalone, D. P. 1992. Per unit pricing: an overview of operational issues. Paper presented at EPA's Second U.S. Conference on MSW Management: Moving Ahead. Washington, DC. League of California Cities. 1992. Financing strategies for integrated waste management programs: answers for communities. Sacramento, CA: League of California Cities. Repetto, R., et al. 1992. Green fees: how a tax shift can work for the environment and the economy. Washington, DC: World Resources Institute. U.S. Environmental Protection Agency. 1989. Discussion and summary of economic incentives to promote recycling and source reduction. Washington, DC: U.S. EPA Office of Policy Analysis. U.S. Environmental Protection Agency. 1990. Charging households for waste collection and disposal: the effects of weight or volume-based pricing on solid waste management. NTIS PB91-111484. Washington, DC: U.S. EPA Office of Solid Waste and Emergency Response. U.S. Environmental Protection Agency. (No date.) Methods of predicting solid waste characteristics. Stock no. 5502-0048. Washington, DC: U.S. Government Printing Office. U.S. Environmental Protection Agency. 1990. Variable rates in solid waste: handbook for solid waste officials, Volume 1: Executive summary. EPA530-SW-90-084A. Washington, DC: U.S. EPA Office of Solid Waste and Emergency Response. APPENDIX D 85 ------- NOTES ------- Presentation Materials Public Outreach Materials Worksheets Articles & Newsclippings Bibliography ------- United States Office of Solid Waste and EPA530-R-96-005 Environmental Protection Emergency Response September 1996 Agency Washington, DC 20460 &EPA Pay-As-You-Throw Workbook A Supplement to Pay-As-You-Throw Guidebook Pnnted on paper that contains at least 20 percent postconsumer fiber. ------- Acknowledgments EPA wishes to thank the Coalition of Northeastern Governors (CONEG) for its assistance in the development of this workbook and, in particular, for its contribution to the design and development of the worksheets. ------- Table of Contents About This Workbook v Section Oner-Presentation Materials I Presentation Agenda 3 Survey of Attendees 7 Evaluation Form 11 Sample Script and Overhead Masters 15 Section Two: Public Outreach Materials 91 Pay-As-You-Throw Fact Sheets 93 Other Outreach Strategies 105 Clip Art 111 Section Three: Worksheets 121 Section Four: Articles and Newsclippings 145 Section Five: Annotated Bibliography 173 in ------- About This Workbook T oday, with waste amounts and disposal costs for many commu- nities rising, municipal solid waste (MSW) planners increasingly need to find ways to boost waste prevention and recycling among residents. Pay-as-you-throw programs, when properly designed and implemented, can help you meet this challenge. To pro- vide a source of information about how these programs work, EPA developed a guide called Pay-As-You-Throw: Lessons Learned About Unit Pricing. The guide introduces pay-as-you-throw, discusses its benefits and potential barriers, and offers guidance on how to consider, design, and implement a pay-as-you-throw program. This supplement to the guide is designed as a user-friendly, hands-on workbook. It is divided into five sections containing tools to help you plan out your program in detail, convey the results of your research in convincing presentations, and develop a strong outreach program that will help you earn the support of community stake- holders. This workbook also contains reprinted articles and refer- ence materials that you can use to learn more about these programs. Each of the tools in this workbook are designed to be adapted as needed. To get started, review the table of contents or read the five section introductions to find the specific materials you need to make pay-as-you-throw successful in your community. ------- Presentation Materials T he first step in any pay-as-you-throw program is to review the benefits and potential barriers of pay-as-you-throw and learn how these systems work. MSW planners who have per- formed this step and decided that such a program can work in their community will then need to earn the support of key com- munity stakeholders. In most communities, stakeholders include elected officials, municipal staff, residents, local civic groups, and, in some cases, private haulers. A pay-as-you-throw presentation at a meeting of municipal officials, a town meeting, or a citizens' adviso- ry council meeting can be an effective first step. Prior to your presentation, it is important to thoroughly research pay-as-you-throw and its potential advantages for your community. (Refer to the guide Pay-As-You-Throw: Lessons Learned About Unit Pric- ing, which can be found in the "Guidebooks" section of this Tool Kit, for more information about pay-as-you-throw. The worksheets in Section Three of this workbook also can help with this process.) Once you have gathered data in support of the program, you can use the following sample materials to help you organize an effective pay-as-you-throw presentation: • A presentation agenda and photocopy master to help you plan out your meeting. • A survey of attendees that you can use before your briefing to better understand your audience and its level of awareness of pay-as-you-throw. • An evaluation form to help you gauge how successful your pre- sentation was and decide whether further work will be needed to convince your audience about the program. ------- n A sample script for your presentation and overhead masters that can be photocopied onto transparencies and used to help you present the key points concerning pay-as-you-throw. In addition, be sure to consider whether materials found in the other sections of this Tool Kit, including the pay-as-you-throw soft- ware, videotape, or guidebooks, might also help you strengthen your presentation. ------- SECTION Presentation Agenda A presentation agenda will help you provide your audience with an overview of the topics you plan to cover in your talk. It will also demonstrate that you have carefully planned your briefing. In addition, preparing an agenda in advance can be an important exercise, helping you clearly identify key areas of your briefing and the approximate amount of time you should spend on each. You might want to provide your attendees with the agenda ahead of time, perhaps as part of an invitation to the presentation. In general, your briefing might include an overview of the pay-as-you-throw program, followed by your analysis of how it can help your com- munity. You can refer to the materials in this sec- tion (including the Sam- ple Script and Overhead Masters, beginning on page *\5) for more ideas on what to include in the presentation. Begin by reviewing the sample agen- da on this page. If you want to structure your briefing around these topics, you can use the blank agenda template found on the next page. ------- Or, if you prefer, you can create you own agenda that focuses on the specific topics or issues that you think would be of greatest interest to your audience. ------- Pay-As-You-Th row Presentation Agenda Welcome and Introductions Overhead Presentation • Introduction to pay-as-you-throw: will it work in our community? • Planning for pay-as-you-throw and educating residents • Designing a successful program • Implementing and monitoring pay-as-you-throw Questions and Answers Pay-As-You-Throw Worksheet Handouts • Goals • Barriers • Public outreach • Container and pricing options Next Steps Adjourn ------- SECTION Survey of Attendees Your presentation will be more effective if you can address the specific issues about pay-as-you-throw that are of partic- ular interest or concern to your audience. If you know who is likely to come to your presentation, you can prepare and send out a survey ahead of time to identify their primary concerns and what it is they would like to learn about f*j your proposed program. This section includes a sample survey form that you can reproduce and send out to your atten- dees. Or you can adapt this master copy by developing your own questions, placing them onto the page below the title, and reproducing that, instead. Once you have the survey ready, distribute it to your attendees and review the results carefully. If needed, you can adapt your agenda and the content of your presentation to address directly any trends or issues you noted in the survey results. ------- Survey of Attendees Thanks for accepting the invitation to attend the upcoming presentation on our proposed pay-as-you-throw program. To help focus the presentation on the most important issues, please take a few minutes to respond to the following ques- tions. Please return this form to the presentation organizers when you are done. Your name: Title/position:. How familiar are you with pay-as-you-throw? D Very familiar D Somewhat familiar with the concept and how pay-as-you-throw works D Have read about/been exposed to a small amount of pay-as-you- throw information D Unfamiliar with pay-as-you-throw What do you think are the most important advantages of a pay-as- you-throw program for our community? (Rank the following on a scale of I to 3, with 3 indicating the most important advantages.) Reduced waste generation amounts Reduced waste collection and disposal costs Greater recycling rates Greater equity for residents (residents pay only for the waste they generate) Increased environmental awareness among residents Other ------- Survey of Attendees Page 2 What do you think are the most significant perceived barriers to a pay-as-you-throw program in our community? (Rank the following on a scale of I to 3, with 3 indicating the most significant perceived barriers.) Enforcement issues (illegal dumping, burning of waste) Potential for uneven cash flow Perception of increased costs to residents Implementation in multi-family housing High administrative costs Extending pay-as-you-throw to residents with special needs Building public consensus Other What specific pay-as-you-throw topics or questions do you want to see raised at the presentation? ------- SECTION Evaluation Form Once your presentation is complete, it may be useful to per- form a follow-up survey to generate feedback about the briefing and the issues that were discussed. While reac- tions and questions at the presentation itself will provide a good sense of the impact of your briefing, an evaluation form will allow you to gauge in greater detail the attitudes and responses of your audience toward pay-as-you- throw. The results will help you deter- mine whether follow-up sessions will be needed and which particular aspects of pay-as-you-throw were well received—and which may require additional explanation. Review the sample evaluation form in this section. Prior to your presentation, you can reproduce this form. If you prefer, you can adapt this master copy by developing your own evalua- tion questions, placing them onto the page below the title, and reproducing that, instead. Then, immediately after your briefing, distribute the form to your attendees and ask them to complete it before they leave. Review the attendees' evaluations carefully and begin planning how to incor- porate what you learned into future outreach efforts. ft-SfiSas&iggs^ , P^-as-yo "V'P™'S do"t. »(.- ""»* II ------- Evaluation Form Thank you for coming to this pay-as-you-throw presentation. We appreciate your attendance and participation, and would like your feedback. Please take a minute to complete the following evaluation, identifying the presenta- tion's strong points as well as the points that warrant more attention. This information will help us improve future presentations. It also will help us learn if we need to provide more information about pay-as-you-throw or answer any additional questions. When you are done, please return this form to the presentation organizers. Please rate your response to the following questions on a scale of 1 to 5. 1: Poor 2: Fair 3: Good 4: Very good 5: Excellent I. Overall, how would you rate the quality of the presentation? 12345 Comments: 2. How would you rate the presentation format? 1 2 Comments: 3. How would you rate the presentation style of the speaker(s)? 12345 Comments: !3 ------- Evaluation Form 2 4. How would you rate the handouts/presentation materials? 12345 Comments: 5. Did the presentation meet your goals and expectations? 1234 Comments: 6. How well were your concerns or questions about pay-as-you-throw addressed? 1 2 3 Comments: 7. What other topics or areas of discussion would you like to see addressed? 8. Please list any other questions or comments about pay-as-you-throw or the presentation. ------- Sample Script and Overhead Masters SECTION Overheads can be very helpful in conveying information about pay-as-you-throw to your pre- sentation audience. This workbook includes a complete set of overheads designed to address the main topic areas related to pay-as-you-throw: what a pay-as- you-throw program is, what the results have been in communities with pay-as-you-throw, how these programs work, and how to design and implement one in your own com- munity. On the following pages you will find a sample script for your overhead presentation, intended to provide a starting point for your discussion of the different pay-as-you-throw topics. The sample script is followed by a set of master overheads that can be used to create your overhead transparencies. The overhead presentation is designed to be flexible. You may decide to revise the order of the overheads based on the issues you feel merit particular atten- tion. You also can remove any overheads or include your own transparencies to provide additional information, if needed. In addition, you can adapt 15 ------- the suggested script or even prepare your own to further tailor the briefing to your audience. To prepare transparencies from the overhead masters, simply copy each of the master overhead pages onto blank transparencies (available at office or stationary supply retailers) using an ordinary photocopier. The transparencies will then be ready to use. 16 ------- "Pay-As- You-Throw" Unit Pricing of Municipal Solid Waste Pay-as-you-throw programs are incentive-based strategies for reducing the amount of MSW community residents generate. This briefing will include an introduction to pay-as-you-throw and a discussion of how it can help our community better manage MSW. We also will talk about how to design and implement a program that will succeed in our community. Many of these strategies have been learned from communities that have implemented programs of their own. 17 ------- MSW Hierarchy Pyramid Waste Prevention Composting and Recycling Landfilling and Combustion Maintaining control over solid waste in the long term depends on emphasizing waste reduction. Landfilling and combustion, while necessary, are the least desirable management methods. They occupy the bottom of the hierarchy. Recycling, which reduces the amount of waste we have to dispose of, is preferable. Waste prevention, which prevents materials from becoming waste in the first place, is at the top of the hierarchy. 18 ------- Potential Benefits • Encourages the Three Rs: Reduce Reuse Recycle REDUCE Pay-as-you-throw directly supports waste prevention and recycling. Because residents pay for whatever they throw out, they tend to work harder to reduce, reuse, and recycle. 19 ------- Because of this "pocketbook" motivation, it is likely that pay-as-you- throw will result in less total waste our community has to dispose of. Increased recycling rates will be a major factor in this. In addition, when markets for collected materials are strong, greater recycling rates offer the potential for increased revenues from the sale of these materials. 20 ------- Potential Benefits Encourages the Three Es: • Environment • Economics • Equity The increased reducing, reusing, and recycling leads to further benefits, called the Three Es. Environment: Less waste means less landfill space is needed. In addition, reduced need for manufacturing goods can result in less pollution. Economics: For the municipality, less waste means lower collection and disposal costs. For residents, they control their costs. If they throw away less, they will pay less. Equity: Waste management costs money, but now the costs are spread more fairly. Those residents that generate large amounts of waste will have to take financial responsibility for it. 21 ------- Waste Reduction Results • Perkasie, PA • MN Town I • MNTown2 • Duke University Study of 14 cities 44% 6 MA Cities m Before Unit Pricing 1.5 - 4.5 ppd • After Unit Pricing 0.89 • 1.09 ppd • Cornell University, 76% of residents Tompkins County, NY reduced waste What does the evidence show? In virtually every case, communities with pay-as-you-throw report that waste generation declined. Here are some examples. The average waste reduction reported by pay-as-you-throw communities is between 25 and 45 percent. (Results may vary, depending on such factors as current waste collection systems and options chosen for pay-as-you-throw.) 22 ------- Different Unit Pricing Programs *L Community Plantation, FL Perkasie, PA High Bridge, NY Illion, NY Pasadena, CA Loveland, CO Austin, TX Type of Population Program 64,000 Bags 7,900 Bags 4,000 Stickers 9,500 Bags 119,374 Can 31,000 Stamp 450,000 Can Dupage County, IL 668,000 Bags * Data not avalilable c Change in MSW * -54% * -51% -21% -62% -40% -53% 1 ~~~W :V"^ Change in recycling +21% +50% + 18% +41% * * * * Those communities with existing recycling programs also show significant increases in the amount recycled. Studies also show that waste prevention and recycling amounts increased in all the reporting communities, regardless of size or geographic location. 23 ------- Deciding Whether to Use Pay-As-You-Throw Will the program meet our MSW goals? Will residents support the program? Will costs and revenues balance? Ultimately our community has to decide about pay-as-you-throw based on three issues: Will it meet our MSW goals? We need to compare the potential advantages of pay-as-you-throw to our MSW goals and make a judgment about whether the program will bring us closer to meeting these goals. Will residents support it? They most likely will, if the program is well- designed and we reach out to educate them about pay-as-you-throw. Will costs and revenues balance? The only way to determine this is to perform some detailed rate design work and evaluate the results. 24 ------- Pay-As-You-Throw Goals (Examples) Raise sufficient revenues Encourage MSW reduction through price signals Convey a better understanding of social costs to citizens Charge for recycling and other complementary programs Allow for the needs of special groups Keep the program simple to use and run Pay-as-you-throw programs can help a community meet a number of important goals. These are just a few examples. Our goals include: [L»st your community's MSW goals; discuss how well pay-as-you-throw will meet them] 25 ------- Education and Outreach Need the support of residents! Build consensus with an outreach campaign Citizens' advisory council can help: • Set goals • Build consensus If we decide to go with pay-as-you-throw, we must earn the support of residents. A key lesson from communities with pay-as-you-throw is that such programs will not succeed without residents' approval. To achieve this, the first step will be to initiate an outreach campaign. One goal of the campaign is to inform residents about why the new program is needed. A second goal of the campaign is to involve residents in the actual planning for the program. Setting up a citizens' advisory council that includes civic leaders and other residents can help accomplish this. 26 ------- The citizens' advisory council can assist in developing goals and in finding ways to reach out to the community about the new program. The council also can provide input on important decisions about how the program will be structured. 27 ------- Building Consensus • Explain current MSW issues • Present community's MSW goals • Explain how Pay-As-You-Throw can meet these goals • Residents more likely to support program when they see tangible benefits It is possible there may be some initial opposition to the program, since residents are going to be asked to pay for a service they may think they had been getting for free. To overcome this, our outreach campaign could first discuss the problem. For example, we can let residents know that the increasing amount of trash is making MSW management harder and more expensive. Then, we could relate these issues as goals. For example, we could say that a primary goal is to reduce MSW amounts. Finally, our campaign should explain pay-as-you-throw and discuss how it can help us reduce trash and achieve other goals as well. 28 ------- Techniques for Building Consensus ~L® Hold public meetings Issue press releases/outreach to local media Prepare briefs for elected officials Work with retailers Enclose information with utility bills/other mailings to residents There are many different ways to structure the outreach campaign. Presentations could be made at public meetings on pay-as-you-throw and why it can help. Involving local news outlets via press releases and invitations to public meetings is important. Achieving positive press coverage could go a long way toward easing residents' concerns. Briefings for elected officials can help them better explain the program in public appearances. Retailers can be educated about the program and also can display materials about it in their stores. Direct outreach to residents through mailings can be effective as well. 29 ------- Another effective method of generating public support is to reach out to specific groups, such as the elderly or school children. Children in particular are an important audience. Children tend to bring the messages they receive back home to their parents, which can help pay-as-you-throw gain acceptance community-wide. 30 ------- Rate Structure Container Options • Tags • Bags Cans The next step is to design the structure of the program. Some programs sell tags or stickers to residents to affix to their own bags. Under this system, the price of the tag or sticker includes the collection and management costs for the trash. The tag often indicates a specific size container, and alerts collection crews that the waste has been paid for. Bags with some type of distinctive marking or color can be sold to residents at retail outlets or municipal offices. The price of the bag includes the collection and management costs for the trash. Cans also can be used. One option is to offer a large can, and bill residents for the number of cans they fill up. Smaller size cans also could be used for any waste beyond the first large container. 31 ------- Bag and tag systems tend to allow for faster collection, and no billing is needed. Residents tend to find these systems easy to understand. There can be some revenue uncertainty, however, since residents may buy bunches of bags or tags at hard-to-predict intervals. 32 ------- Can systems tend to offer greater revenue stability, and won't tear or scatter trash. Cans also often are compatible with automatic collection equipment. A system for billing residents for their can set-outs is needed, however, which can increase administrative costs. 33 ------- Rate Structure Systems for Unit Pricing Proportional (linear) • Variable Container a Two-tiered/ Multi-tiered The next step is to decide how to price the containers. Under proportional systems, a flat price is charged for each container. This provides a very simple, clear signal to residents to reduce waste, and it is easy to administer. The variable rate is used when different size containers are available. One price is used for the large container, and different prices are set for the smaller containers residents might use. Because revenues may fluctuate with linear and variable rate systems, some communities use two-tiered or multi-tiered systems. These options establish a monthly flat fee to cover the fixed costs of MSW management. Then, a per-container charge is set on top of that. This lessens the waste reduction signal somewhat, but minimizes any revenue uncertainty. 34 ------- Because residents have an incentive to reduce waste, it makes sense to offer additional avenues to accomplish this. These options are called complementary programs. For example, nearly all communities with pay-as-you-throw include curbside recycling collections. Recycling enables residents to divert a large percentage of the waste they have generated. 35 ------- Complementary Programs Recycling collections Yard trimmings collections for composting Bulky items pickups Yard trimmings, which comprise a large percentage of the waste stream, also can be diverted through curbside collection or by encouraging backyard composting. Bulky items will need to be planned for. Because they cost more to collect and dispose of, many communities have established a special fee system for "white goods" or bulky items using tags or stickers. Residents often are asked to put a set number of tags or stickers on these large waste items to indicate that their collection has been paid for. 36 ------- Designing a Rate Structure Costs • Estimate Demand: cubic yards/tons MSW • Determine Services (curbside recycling, low-income assistance, etc.) • Estimate Costs:$ fixed and variable costs After making the basic decisions about the program, the next step is to create a rate structure that balances costs and revenues. The first step is estimating the demand for services, expressed as the amount of waste you expect to collect annually. This figure should take into account possible changes in the size of our community and the waste reduction impact of the new program. The next step is determining the services that will be offered with the program. These services might include curbside recycling, a composting program, bulky waste collection, or assistance to low- or fixed-income residents. Next, the cost of collecting the estimated amount of waste and providing the planned services needs to be calculated. 37 ------- Designing a Rate Structure Revenues • Develop Rates: $• Calculate Revenues: units MSW x$ Revenues then need to be calculated. First, an estimated fee per container should be established. Then, this rate is multiplied by the annual number of containers residents are expected to fill. These are the revenues that the program will generate. 38 ------- Designing a Rate Structure $Balance • Weigh costs against revenues • Adjust costs and/or revenues as needed Costs$ Revenues Now the expected costs and the projected revenues can be compared and balanced. It is likely that adjustments will be needed. It may be necessary to cut back on some services or raise the per-container fee to cover a shortfall. On the other hand, if a surplus is projected, then the container fee could be lowered. A lower price also might help convince residents to support the program. 39 ------- Challenges and Solutions Illegal dumping Multi-family housing Low-income groups Covering costs & revenue stability Regressivity & hidden tax issues Education, legal diversions, enforcement Include charges in rent, bar code chutes Rebates, discounts Two-tiered billing Appropriate pricing and refunds There are a number of potential barriers we need to consider. With the appropriate planning, these barriers can be overcome. The most commonly voiced concern when pay-as-you-throw is proposed is illegal dumping. However, experience from communities with pay-as-you-throw has shown that illegal dumping typically is less of an issue than originally feared. The key is educating residents to keep them from dumping their waste and provide them with significant opportunities (such as recycling and composting) to divert their waste legally. Strong enforcement also should be available. Residents in multi-family housing can be difficult to service, since they often place their trash in common dumpsters. Possible solutions include adding the charges to rent or incorporating bar code readers in garbage chutes to monitor waste generation by residents. To help low-income groups participate, rebates, discounts, or other forms of assistance can be provided. 40 ------- (Challenges and Solutions, continued) If it turns out that a major priority is to ensure that revenues will consistently cover costs, a two-tiered or multi-tiered rate structure can be used. Residents also might be concerned about being taxed for solid waste services and then, under the new program, also being charged the variable fee. Making a point of lowering taxes by the appropriate amount or redirecting those revenues to other programs that residents support can help diffuse this issue. 41 ------- "Pay-As-You-Throw" Unit Pricing of Municipal Solid Waste ------- MSW Hierarchy Pyramid Waste Prevention Composting and Recycling Landfilling and Combustion ------- Potential Benefits Encourages the Three Rs: Reduce Reuse Recycle ------- ------- Potential Benefits Encourages the Three Es: Environment Economics Equity ------- Waste Reduction Results £ Perkasie, PA K MN Town I « MN Town 2 ri Duke University Study of 14 cities 6 MA Cities ::: Before Unit Pricing :: After Unit Pricing us Cornell University, Tompkins County, NY 54% 60% 37% 44% 1.5 - 4.5 ppd 0.89 - 1.09 ppd 76% of residents reduced waste ------- Different Unit Pricing Programs Community Type of Change in Population Program MSW Plantation, FL Perkasie, PA High Bridge, NY Illion, NY Pasadena, CA Loveland, CO Austin, TX Dupage County, IL 64,000 7,900 4,000 9,500 119,374 31,000 450,000 668,000 Bags Bags Stickers Bags Can Stamp Can Bags Change in recycling * -54% * -51% -21% -62% -40% -53% +21% +50% + 18% +41% * * * * * Data not avalilable ------- Deciding Whether to Use Pay-As-You-Throw Will the program meet our MSW goals? Will residents support the program? Will costs and revenues balance? ------- Pay-As- You-Throw Goals (Examples) !;' " — **-° Raise sufficient revenues •? Encourage MSW reduction through price signals Convey a better understanding of social costs to citizens S-" Charge for recycling and other complementary programs Allow for the needs of special groups Keep the program simple to use and run ------- Education and Outreach Need the support of residents! Build consensus with an outreach campaign Citizens' advisory council can help: '."? r Set goals 4 Build consensus ------- ------- Building Consensus Explain current MSW issues Present community's MSW goals Explain how Pay-As-You-Throw can meet these goals Residents more likely to support program when they see tangible benefits ------- Techniques for Building Consensus Hold public meetings Issue press releases/outreach to local media Prepare briefs for elected officials Work with retailers Enclose information with utility bills/other mailings to residents ------- ------- Rate Structure Container Options Tags Bags Cans ------- ------- ------- Rate Structure Systems for Unit Pricing Proportional (linear) Variable Container \x i VV\ *° Two-tiered/ Multi-tiered ------- ------- Complementary Programs m~-,"~\ "-'• »\j> W*.«•! - **- • *' "" ••"•"• ~ •>••— *«Bfi,»£~»»v^ , v " * - - ** °''*' "" "' " ! -C ' Recycling collections Yard trimmings collections for composting Bulky items pickups ------- Designing a Rate Structure Costs ® Estimate Demand: cubic yards/tons MSW ® Determine Services (curbside recycling, low-income assistance, etc.) Estimate Costs: $fixed and variable costs ------- Designing a Rate Structure Revenues ; Develop Rates:$ per unit Calculate Revenues: units MSW x $per unit =$ ------- Designing a Rate Structure Balance Weigh costs against revenues i Adjust costs and/or revenues as needed Costs *rfs8ffi«« Revenues ------- >' "Os U '*' Challenges and Solutions Illegal dumping Education, legal diversions, enforcement Multi-family Include charges in housing rent, bar code chutes Low-income groups Rebates, discounts Covering costs & Two-tiered billing revenue stability Regressivity & Appropriate pricing hidden tax issues and refunds ------- Public Outreach Materials D esigning and implementing an outreach and education effort directed at residents are critical steps in the development of your pay-as-you-throw program. Achieving a broad level of public support can help ensure not only that your program will be successfully implemented, but that residents will begin responding as hoped: by increasing recycling and taking more aggressive measures to prevent waste. There is no single model or solution to this challenge. The extent of outreach necessary to get a pay-as-you-throw program up and running will vary from community to community. This section presents several ideas for outreach materials that can help you begin to earn the support of your residents. Review the materials described below with your unique outreach needs in mind and select the tools that you think will help you effectively deliver your pay-as-you-throw message to the audiences you need to reach. The outreach materials and ideas in this section include: • A set of five fact sheets introducing pay-as-you-throw. • Other outreach ideas and strategies, including press releases, public meetings, newsletters, and flyers. • A selection of clip art to help you create your own, customized outreach materials. In general, successful public outreach efforts typically involve two components. The first component focuses on soliciting input about the program from community stakeholders prior to implementation. For example, it may be the case that your community's residents would support a pay-as-you-throw program if they considered it to 91 ------- be sufficiently convenient. In this case, presenting them with possible arrangements-such as a system of bags available for purchase at local retailers versus a subscription-based system using cans—and asking them which system they would prefer can make a tremen- dous difference in their ultimate willingness to support the program. The second type of outreach should take place just before and dur- ing program implementation. Once you have made a decision about the type of pay-as-you-throw system that is most appropriate for your community, you will need to clearly convey detailed informa- tion to residents about the program and how they can participate. Residents will need to thoroughly understand how the program works before they will begin to reduce and recycle more. Review the materials in this section and decide which products can best help you solicit feedback and educate your residents about pay- as-you-throw. In addition, you might consider whether items like the videotape included in this Tool Kit and the worksheets in the next sec- tion of this workbook also can help strengthen your public outreach. 92 ------- Pay-As-You-Throw Fact Sheets SECTION Fact sheets can help community decisionmakers introduce pay- as-you-throw to local stakeholders and begin showing them why a pay-as-you-throw program might be a good idea. EPA developed the following five fact sheets to introduce pay-as-you- throw to what are, for many communi- ties, their most important audiences. These are: 1) community residents; 2) MSW planners; 3) local elected officials; 4) state officials; and 5) mem bers of civic and environmental organizations. A quick and easy way to raise awareness about pay-as-yo u-th row, these fact sheets can be reproduced and distrib- uted to target audiences within your community. The fact sheets also can be adapted for your own, cus- tomized outreach flyers. (See the flyers and brochures ideas found on page 109 of this workbook.) The text can be revised as needed, and, in the Clip Art section that begins on page 111, you will find reproducible samples of each of the illustrations 93 ------- United States Environmental Protection Agency Solid Waste and Emergency Response (OS305) EPA530-F-96-028 September 1996 4>EPA Pay-As-You-Throw Throw Away Less and Save Do you know how much you spend per month on electricity? How about your gas utility? The person who pays the bills in your household probably has a pretty good idea. But do you know how much you spend on garbage? Each time your city or town sends a truck down your street to pick up your waste, it costs money. It costs money even if you drop your trash off at a local dump. Ultimately, you pay for this service, usually through your local taxes. And it's not likely that you have much control over the amount you pay, regardless of how much garbage you create. There is a different system, how- ever, under which residents are asked to pay for waste collection directly—based on the amount of garbage they actually generate. They're called "pay-as-you-throw" programs, and nearly 2,000 communities across the country have begun using them. What is pay-as-you-throw? Pay-as-you-throw is a differ- ent way of paying for waste collection and disposal ser- vices. In some pay-as-you- throw communities, it works on a per-container basis: house- holds are charged for each bag or can of waste they generate. A few communities bill residents based on the weight of their trash. Either way, the system motivates people to recycle more and to think about ways to generate less waste in the first place. For community residents, however, the most important advantage of pay-as-you-throw may be the fair- ness and greater control over costs that it offers. Do you have neighbors that never seem to recycle, and always leave out six or seven bags of trash? While you may not have thought about it, right now , « • you're • • ------- helping them pay for that waste. Under pay-as- raised issue. While people often assume that you-throw, everyone pays only for what they generate—so you won't have to subsidize your neighbor's wastefulness anymore. It's only fair. With pay-as-you-throw, when you recycle and prevent waste, you're reward- ed with a lower trash bill. Because of these potential cost savings, both you and your neighbors will naturally want to reduce the amount of waste that you generate. And when people reduce waste, that can mean lower costs for your community, since it costs less to collect and dispose of everyone's trash. This might even free up funding for other munici- pal services you depend upon—like schools and fire and police protection. In addition, the pay-as-you- throw incentive to put less waste at the curb can make a big environmental difference. When people generate less waste and recycle more, fewer natural resources are used and there is less pollu- tion from manufacturing. Valuable landfill space is con- served as well, reducing the need to site new facilities. illegal dumping will increase once residents are asked to pay for each container of waste they generate, most communities with pay-as-you- throw have found this not to be the case. This is especially true when communi- ties offer their residents recy- cling, composting for yard trimmings, and other programs that allow individuals to reduce waste legally. Others, particular- ly lower-income residents, worry about the amount they will have to pay. In many com- munities, however, coupon or voucher programs are being used to help reduce trash collec- tion costs for these households. When people generate less waste and recycle more, fewer natural resources are used and there is less pollution from manufacturing. What can I do? Are there disadvantages to pay-as-you-throw? While there are potential barriers to a success- ful program, communities with pay-as-you- throw report that they have found effective solutions. Illegal dumping is a frequently If you're interested in pay-as- you-throw, talk to your town planner or local elected repre- sentatives! Ask them if they know about pay-as-you-throw, and whether they would con- sider using it in your commu- nity. If you or your town's officials want to know more about pay-as-you-throw, EPA has developed a guidebook you can use. Pay-As-You- Throw: Lessons Learned About Unit Pricing (EPA530-R-94-004) contains background informa- tion on the advantages of pay-as-you-throw and provides detailed infor- mation on how these programs work. To order a copy, call the EPA/RCRA Superfund Hotline at 800-424-9346 or TDD 800-553-7672 for the hearing impaired. For Washington, DC, and outside the United States, call 703-412-9810 or TDD 703-412-3323. ------- United States Environmental Protection Agency Solid Waste and Emergency Response (OS305) EPA530-F-96-030 September 1996 &EPA Pay-As-You-Throw A Fact Sheet for MSW Planners MSW programs today need to offer more than reliable waste collection services. In some communities, the issue is rising collection and disposal costs. Other communities are looking for ways to extend landfill capacity. As an MSW planner, you know how important it is to reduce the amount of waste residents put out for collection (or bring to the landfill). In fact, your community probably started a recycling program to help divert some of this waste from dis- posal. Even with a strong recycling program, however, it's likely that your residents are steadily throwing away more each year—pointing to the need for not only more recy- cling, but getting residents to gener- ate less waste in the first place. For MSW planners in nearly 2,000 communities, a program called "pay- as-you-throw" is helping them meet this challenge. What is pay-as-you- throw? Pay-as-you-throw programs, also known as unit-based pricing or variable-rate pricing, provide a direct economic incentive for your residents to reduce the amount of waste they generate. Under pay-as-you-throw, households are charged for waste collection based on the amount of waste they throw away—in the same way that they are charged for electricity, gas, and other utilities. As a result, resi- dents are motivated not only to increase the amount they recycle but to think about ways to generate less waste in the first place. Pay-as-you-throw programs can be structured in several different ways. Some communities charge residents based on the volume of waste they generate. Under volume-based pro- grams, residents are charged a fee for each bag or can they fill up. Communities also can require that residents purchase tags or stickers and affix them to their own contain- ers. Other communities bill residents based on the weight of their trash—although, because of the cost of the equipment needed to weigh the waste ------- and record the amount for billing purposes, weight-based programs are far less common. What are the benefits of pay-as-you-throw? However it is structured, pay-as-you-throw has the potential to improve MSW programs in several important ways. First, there are significant econom- ic benefits. Because of the incentive to generate less, communities with programs in place have reported reductions in waste amounts ranging from 25 to 45 percent, on average. For many communi- ties, this can lead to lower disposal costs, savings in waste transportation expenses, and other cost sav- ings. Pay-as-you-throw communi- ties also typically report significant increases in recycling. In some cases, this can yield increased revenues from the sale of collected materials. In addition, pay-as-you-throw programs can be designed to cover the cost not only of waste collection and disposal, but also some or all of the community's complementary MSW programs (such as recycling, composting, and bulky waste collections). Of course, there often are new costs for the community when a pay-as-you-throw pro- gram is adopted, including expenditures for edu- cation and enforcement. These costs usually are not significant, however—and they can be built into a pay-as-you-throw rate structure to ensure that they will be covered. Another advantage of pay-as-you-throw programs is the greater control over costs they offer to residents. While they may not realize it, your residents pay for waste management services. And whether they pay through their taxes or a flat fee, those residents that generate less and recycle more are paying for neigh- bors that generate two or even three times as much waste. With pay-as-you-throw, residents that reduce and recycle are rewarded with a lower trash bill. This incentive to put less waste at the curb also can make a big environmental difference. When people generate less waste and recycle more, fewer natural resources are used, there is less pollution from manufacturing, and less landfill space is con- sumed—reducing the need to site new facilities. Are there disadvantages to pay- as-you-throw? While there are potential barriers to a successful program, communities with pay-as-you-throw report that they have found effective solutions. Community officials often raise the prospect of illegal dumping when they first learn about pay- as-you-throw. Most communities with pay-as-you-throw, however, have found that illegal dumping in fact did not increase after implementation. This is especial- ly true when communities offer their residents recycling, com- posting for yard trimmings, and other programs that allow indi- viduals to reduce waste legally. Others, particularly lower-income residents, worry about the amount they will have to pay. In many communities, however, coupon or voucher programs are being used to help reduce trash col- lection costs for these households. How can I learn more about pay- as-you-throw? EPA has developed a guidebook for anyone inter- ested in pay-as-you-throw programs. Pay-As-You- Throw: Lessons Learned About Unit Pricing (EPA530-R-94-004) contains background informa- tion on the advantages of pay-as-you-throw and provides detailed information on how these pro- grams work. To order a copy, call the EPA/RCRA Superfund Hotline at 800-424-9346 or TDD 800- 553-7672 for the hearing impaired. For Washington, DC, and outside the United States, call 703-412-9810 or TDD 703-412-3323. ------- United States Environmental Protection Agency Solid Waste and Emergency Response (OS305) EPA530-F-96O31 September 1996 &EPA Pay-As-You-Throw A Fact Sheet for Elected Officials As an elected official in your community, you have many responsibilities besides municipal solid waste (MSW) management—but it's an important service. Residents in most communi- ties have come to expect efficient, reliable trash col- lection and disposal, and tend to support those officials that can get the job done. This task has been growing more complicated, however. First of all, it's likely that your residents are generating more waste each year, even if you have a recycling program in place. That can mean escalating costs. And whether your residents pay for MSW services through a direct, flat fee or via their property taxes, it's not a very equitable system: every- one pays the same amount, no mat- ter how much (or how little) trash they actually produce. What is pay-as-you-throw? Fortunately, there is a system out there that can help your MSW man- agement personnel meet these chal- lenges. In nearly 2,000 communities across the country, a program called "pay-as-you-throw" is offering resi- dents a more equitable way to pay for collection and disposal of their trash—while, at the same time, encouraging them to create less waste and increase the amount they recycle. Pay-as-you-throw programs, also called unit-based or variable-rate pric- ing, provide a direct economic incen- tive for residents to reduce waste. Under pay-as-you-throw, households are charged for waste collection based on the amount of waste they throw away—in the same way that they are charged for electricity, gas, and other utilities. If they throw away less, they pay less. Some communities charge residents for each bag or can of waste they generate. In a few communities, households are billed based on the weight of their trash. 99 ------- What are the benefits of pay-as-you-throw? Pay-as-you-throw gives residents greater control over their costs. While they may not realize it, your constituents are paying for waste management ser- vices. And, whether they pay through taxes or a flat fee, residents that generate less and recycle more are paying for neighbors that generate two or even three times as much waste. When a few residents generate more waste, every- one pays for it. With pay-as-you- throw, residents that reduce and recycle are rewarded with a lower trash bill. As a result, households under pay-as- you-throw tend to generate less waste. Communities with programs in place have reported reductions in waste amounts ranging from 25 to 45 percent, on average. Recycling tends to increase significantly as well. And less waste means that a community might be able to spend less of its municipal budget on waste collection and disposal—possibly even freeing up funds for other essential services like education and police protection. Because residents stand to pay less (if they generate less), pay-as-you-throw communities have typically reported strong public support for their pro- grams. The initial reaction from resi- dents can vary, however—some ; residents might feel that the program is no more than an added charge. To address this, it is important to explain to residents at the outset how the program works, why it is a more equitable system, and how they can benefit from it. Pay-as-you-throw has tended to work best where elected officials and other community leaders have reached out to residents with a thorough education campaign. Many of the resulting programs have been highly successful, and have often attracted attention. In waste they throw away. helps municipalities eat tho need to site new some cases, pay-as-you-throw has worked so well that the communities have become models in their region, demonstrating how MSW services can be improved. And within the community, elected offi- cials can point to pay-as-you-throw as an example of municipal improvements they helped bring about. Are there disadvantages to pay-as-you-throw? While there are potential barriers to a i successful program, communities with pay-as-you-throw report that they have found effective solutions. Illegal dumping is a frequently raised issue. While it is often assumed that illegal dumping will increase once residents are asked to pay for each container of waste they generate, most communities with pay-as-you- throw have found this not to be the case. This is especially true when communities offer their residents recycling, composting for yard trim- mings, and other programs that allow individuals to reduce waste legally. Others, particularly lower-income res- idents, worry about the amount they will have to pay. In many communi- ties, however, coupon or voucher programs are being used to help reduce trash collection costs for these households. How can I learn more about pay-as-you-throw? EPA has developed a guidebook for anyone interested in pay-as-you-throw programs. Pay-As-You-Throw: Lessons Learned About Unit Pricing (EPA530-R-94-004) contains background information on the advantages of pay-as-you-throw and provides detailed informa- tion on how these programs work. To order a copy, call the EPA/RCRA Superfund Hotline at 800-424- 9346 or TDD 800-553-7672 for the hearing impaired. For Washington, DC, and outside the United States, call 703-412-9810 or TDD 703-412-3323. ------- United States Environmental Protection Agency Solid Waste and Emergency Response (OS305) EPA530-F-96O29 September 1996 &EPA Pay-As-You-Throw A Fact Sheet for State Officials Like most state environmental officials and planners, you've probably been emphasizing the MSW management hierarchy: recommending that communities prevent waste and recycle as much of the remainder as possible. Today, the MSW management hierachy is the focus of solid waste planning in most states. This has helped recy- cling programs to spread quickly, and recycling markets have been developed to purchase and process the collected materials. Source reduction, however, has fallen behind this pace. While the rate of increase is slowing, individuals in this country are continuing to gener- ate more waste each year—and, as a result, waste management is growing more difficult. Communities in your state need programs that will do more than increase recycling: they need to encourage residents to pre- vent waste, too. For growing numbers of communi- ties, "pay-as-you-throw" programs are being used to achieve this goal. While fewer than 200 programs were in existence as recently as the mid- 1980s, today, nearly 2,000 communi- ties across the country are using pay-as-you-throw to better manage solid waste. What is pay-as-you-throw? Pay-as-you-throw programs, also known as unit-based pricing or vari- able-rate pricing, provide a direct economic incentive for individuals to reduce the amount of waste they gen- erate. Under pay-as-you-throw, households are charged for waste collection based on the amount of waste they throw away—in the same way that they are charged for electricity, gas, and other utilities. As a result, residents are motivated not only to recycle more but to think about ways to generate less waste in the first place. tot ------- Pay-as-you-throw programs can be structured in sev- eral different ways. Some communities charge resi- dents based on the volume of waste they generate. Under volume-based programs, residents pay for each bag or can they fill up. Communities also can require that residents purchase tags or stickers and affix them to their own containers. Other communi- ties bill residents based on the weight of their trash—although, because of the cost of the equip- ment needed to weigh the waste and record the amount for billing pur- poses, weight-based programs are far less common. What are the benefits of pay-as-you-throw? However they are structured, all pay- as-you-throw programs share impor- tant benefits for both communities and their residents. First, households under pay-as-you-throw have more control over their solid waste man- agement costs. While they may not realize it, resi- dents pay for the waste management services they receive. And whether they pay through their taxes or a flat fee, those residents that generate less and recy- cle more are paying for neighbors that generate two or three times as much waste. With pay-as-you- throw, residents that reduce and recycle are rewarded with a lower trash bill. In communities with pay-as-you-throw programs, this incentive has resulted in reported average reduc- tions in waste amounts ranging from 25 to 45 per- cent. Recycling tends to increase significantly as well, further cutting down on the amount of waste requiring disposal. This can mean lower disposal costs, savings in waste transportation expenses, potentially greater revenues from the sale of recov- ered materials, and other cost savings. And less waste and increased recycling at the local level translates into an improved solid waste man- agement picture statewide. Increased amounts of recovered materials will become available to proces- sors and remanufacturers, encouraging the develop- ment of increased recycling capacity and other 102 investments in the infrastructure of recycling. The potential for lower costs can help increase the long- term economic stability of your communities' MSW programs. And less waste means fewer natural resources will be depleted, less energy used, and less landfill space consumed, helping preserve your state's environment. Because of these kinds of advantages, pay-as-you-throw has received bipartisan support at both the state and local levels. The use of pay-as-you- throw also has been endorsed by the National Conference of State Legislatures (NCSL). Are there disadvan- tages to pay-as-you- throw? While there are potential barri- ers to a successful program, communities with pay-as-you- throw have found effective solutions. Local officials, for example, often assume that ille- gal dumping will increase once residents are asked to pay for each container of waste they generate. Most communities with pay-as-you-throw have found this not to be the case, however, especially when they offer their residents recycling, composting for yard trimmings, and other programs that allow individuals to reduce waste legally. Others, particularly lower- income residents, worry about the amount they will have to pay. In many communities, however, coupon or voucher programs are being used to help reduce trash collection costs for these households. How can I learn more about pay-as-you-throw? EPA has developed a guidebook for anyone interested in pay-as-you-throw programs. Pay-As-You-Throw: Lessons Learned About Unit Pricing (EPA530-R-94-004) contains background information on the advantages of pay-as-you-throw and provides detailed informa- tion on how these programs work. To order a copy, call the EPA/RCRA Superfund Hotline at 8(XM24- 9346 or TDD 800-553-7672 for the hearing impaired. For Washington, DC, and outside the United States, call 703-412-9810 or TDD 703-412-3323. ------- United States Environmental Protection Agency Solid Waste and Emergency Response (OS305) September 1996 xvEPA Pay-as-you-throw programs encourage people to save money by recycling and preventing waste. Imagine—a solid waste solution that's good for the wallet and helps the environment. Pay-As-You-Throw A Fact Sheet for Environmental and Civic Groups When it comes to man- aging solid waste, the goal for the past 10 years has been to reduce, reuse, and recycle. Today, thousands of community recycling programs are diverting millions of tons of valuable materials—materials that would otherwise be thrown away—for remanufacturing * into useful products. Despite the tremen- dous growth in recycling, however, waste genera- * tion rates among individu- ------- What are the benefits of pay-as-you-throw? Pay-as-you-throw programs have environmental and economic advantages, and are often more equitable for residents—a combination of benefits called the "Three Es." Communities with programs in place have reported reductions in waste amounts ranging from 25 to 45 percent, on average. This results in several important environmental benefits. Less waste and greater recycling means that fewer natural resources are used, less energy is consumed, and less pollution is created. In addition, landfill space is used at a slower rate, reducing the need to site additional facilities. Pay-as-you-throw also can send an important source reduction signal to product manufacturers. When indi- vidual consumers begin to under- stand that their trash costs money, they are likely to adjust their pur- chasing habits to favor products that will result in less waste—and, there- fore, cost less—when discarded. As more communities adopt pay-as-you-throw, manufac- turers will have an incentive to redesign their prod- ucts to appeal to this growing consumer preference. There also are potential economic advantages, both for communities and their residents. Because they often have more recovered materials and less waste to dispose of, many communities with pay-as-you- throw find their disposal costs go down. Pay-as-you- throw also can yield savings in waste transportation expenses and potentially greater revenues from the sale of collected recyclables. In addition, while they may not realize it, residents pay to throw away trash. And whether they pay through their taxes or a flat fee, those individuals that generate less and recycle more are paying for neighbors that generate two or three times as much waste. Pay-as-you- throw is more equitable: residents that reduce and recy- cle are rewarded with a lower trash bill. Are there disadvantages to pay-as-you-throw? While there are potential barriers to a successful pro- gram, communities with pay-as-you-throw have found effective solutions. Local officials, for example, often assume that illegal dumping will increase once residents are asked to pay for each container of waste they gener- ate. Most communities with pay-as-you-throw have found this not to be the case, however, especially when they offer their residents recycling, composting for yard trimmings, and other programs that allow indi- viduals to reduce waste legally. Others, particularly lower-income residents, worry about the amount they will have to pay. In many communities, however, coupon or voucher programs are being used to help reduce trash collection costs for these households. How can our organization help? In many cases, local officials either are not aware of pay-as-you-throw or haven't considered how it might work in their community. While pay- as-you-throw may not be appropriate for all communities, municipal plan- ners can benefit from learning about such programs. Your organization can work with local, regional, or state government officials to make them aware of the ben- efits of pay-as-you-throw and how any potential bar- riers might be overcome. And, once communities in your area begin to plan pay-as-you-throw programs, your organization can assist in development and implementation. By help- ing municipal officials plan programs that are rea- sonable and equitable, and educating people about the benefits of the new system, your organization can play a role in improving the way we manage solid waste in this country. How can I learn more about pay-as-you-throw? EPA has developed a guidebook for anyone interested in pay-as-you-throw programs. Pay-As-You-Throw: Lessons Learned About Unit Pricing (EPA530-R-94-004) contains background information on the advantages of pay-as-you-throw and provides detailed informa- tion on how these programs work. To order a copy, call the EPA/RCRA Superfund Hotline at 800-424- 9346 or TDD 800-553-7672 for the hearing impaired. For Washington, DC, and outside the United States, call 703-412-9810 or TDD 703-412-3323. ------- SECTION Other Outreach Strategies This section presents a number of other ideas for reaching out to residents in your community. As you review these products, keep in mind your community's specific public outreach goals and think about which combination of the follow- ing strategies might best help you meet them. Press Releases **», •**^ «*» *'**>», ="««* "*»rc "-**», S^S^a^ *^*>C:"«- 2«5S?3? ^^•>- ****. •*•*•«*£-• - fSSa.^ *>*:,. -5^=5»%s5te^ As you begin to develop and pub- licize your pay-as-you-throw pro- gram, coverage by local radio and print media outlets is likely. For MSW planners, this should be considered a public outreach opportunity. At this point, you can provide local reporters, editors, and other news professionals covering your community with the key facts con- cerning pay-as-you- throw. This will help ensure that they understand the issues surrounding solid waste management in your municipality and why local officials are considering a pay-as-you-throw program-before they begin to develop their stories. <=SS» v« '««, coifcirt. —=icr pfr.-^ ^Wfiofi d -tr^^^'^ "*•«>«/ "^•^sSsi- '*^^.1** •^r>^. *3^«> "•>n, *>*., tan .. ***^2**I K^*»o ^^^.ir-^^ ^^^* Hlfl fc. •"'fco •«•*, S«S5S5??i^ —-^v^SU *wijw2**ts^a*** >^. i H""*-i^i* «^^:T-- '"^w:^ ***» •*^$- ^-^r^C" •••»•. *«»»« «** *«*» 105 ------- The most common way to accomplish this is to develop and submit press releases to local media outlets. The press release should briefly describe the essential information about your program: what pay-as-you-throw is, why a change in the way residents pay for trash collection and disposal is being proposed, and how residents can participate—and, if they reduce waste, save money—under the new program. Additional press releases can be developed later to announce other news, such as town meetings on pay-as-you-throw or any changes in the program. You might also consider other ways to provide information to the local media, including developing more comprehensive press kits (in addition to press releases, these can include items such as back- ground reports and newsclippings from other pay-as-you-throw communities in your county or state) and conducting news confer- ences or briefings for residents about your program. 106 ------- Public Meetings Town meetings and other public gatherings offer a good opportunity to introduce residents to pay-as-you-throw, discuss how it can help the community, and answer any questions that people might have. If you are planning such a presentation, you might want to develop an invitation flyer to promote the event. (See Section One of this workbook for more information on planning a presentation on pay-as-you-throw.) The meeting invitation can include information describ- ing the concept of pay-as- you-throw and its advantages and letting res- idents know that their community is consider- ing such a program. It also can indicate that the meeting is being called not only to present the pro- posed program but to hear what residents think— emphasizing that this input will be seriously considered before decisions about the final program are made. Be sure to include space on the invitation to list the date, time, and location of the meeting, and invite residents to come ask questions and learn about the program. 107 ------- Newsletters Many communities planning for pay-as-you-throw have developed newsletters to publicize their program. Creating and distributing a small (two- or four-page) monthly, bimonthly, or quarterly newslet- ter offers a chance to provide more information about your pro- gram than you are likely to get in the media. Newsletters also allow you to provide periodic updates as the program is developed—in many communities, the newsletter is launched well before program implementation—and help ensure that all residents are thoroughly aware of the program. You also can provide ongoing information about your program directly to the specific stakeholders you want to target. Your newsletter can be used to introduce residents to pay-as-you-throw and clearly describe how the program can help both residents and the municipality to reduce waste and save money. You also can use the newsletter to ask residents for their input and provide them with infor- mation about how to participate before and during implementation. To effectively reach your audience, be sure to write the newsletter articles in clear, everyday language. In addition, resi- dents will be more likely to pick up and read a visually attractive newsletter. Refer to the Clip Art section, begin- ning on page 111 of this work- book, for a set of illustrations and mastheads that you can use when creating your newsletter. *** itf**""*.**>*,*,'*"« •+Szx£***£**i Sf3'^^ ^Rsfe? **»«* 108 ------- Flyers and Brochures Flyers and brochures are another way to provide pay-as-you-throw program information directly to households in your community. You can create a general flyer to introduce residents to pay-as-you-throw and its advantages or develop more specific versions that each focus on one particular aspect of your program (for example, procedures for purchasing bags or tips on how residents can reduce waste). Like newsletters, flyers and brochures can be used to deliver specific ideas about pay-as-you-throw to target audiences within your community. An advantage to flyers and brochures is that they can be distributed through a number of different channels. They can be posted around town to advertise an upcoming pay-as-you-throw meeting or event, placed in stores and municipal offices, or direct mailed to resi- dents individually with utility bills or in other periodic mailings. To help get your message across, try to design flyers that will attract the attention of your audiences. You can use the illustra- tions in the Clip Art section, beginning on page 111 of this workbook, to help create and assemble effective fact sheet designs. 109 ------- SECTION Clip Art Outreach and education materials often need to do more than provide the facts about pay-as-you-throw. To be effective, they need to be graphically interesting. Providing eye-catching fact sheets, newsletters, posters, brochures, and other materials can help you attract the attention of your audiences and get your message across. This section includes a set of over 40 clip art illustrations that you can use to help simplify the task of putting together well-designed outreach products. Once you have decided which public out- reach products you would like to develop, turn to the clip art that follows. Select the illustrations and icons you want (be sure to photocopy the original page or pages so the masters can be used again), clip them out, and use glue or clear tape to lay out your own newsletters, flyers, or other publici- ty materials. If you plan to develop outreach materials on a computer and have access to a scanner, you might scan the images you want to use. The scanned clip art then can be electronically added to your computer-designed outreach materials. Or simply refer to these illus- trations for ideas and develop your own clip art images-be creative! When your design is ready, use a photocopier to make as many copies as you need and distribute them to the target audiences in your community. III ------- Pay-As-You-Throw Clip Art \» \\ NT- fc, REDUCE 113 ------- Pay-As-You-Throw Clip Art i 115 ------- Pay-As-You-Throw Clip Art 117 ------- Pay-As-You-Throw Clip Art 119 ------- SECTION Worksheets lanning and implementing a pay-as-you-throw program requires careful research and consideration. In the guide Pay-As-You- Throw: Lessons Learned About Unit Pricing (found in the "Guide- books" section of this Tool Kit), the key steps involved in pay-as-you-throw program development are explained in detail. The worksheets on the following pages are designed to help you apply this information to your own planning efforts. These worksheets correspond to the guide's four program development steps: • Deciding if pay-as-you-throw is right for your community (Worksheets 1 and 2). • Planning for pay-as-you-throw and conducting an outreach campaign (Worksheet 3). • Designing a rate structure (Worksheets 4 and 5). • Implementing and monitoring the program (Worksheets 6 and 7). Completing these worksheets will help you make and record the critical decisions concerning your program's goals, the messages you will deliver in your public outreach, and the kind of container and pricing options you will use. The worksheets also will help you determine your specific program costs and the price you will need to charge per container to recover these costs. As you complete the worksheets, refer to the Pay-As-You-Jhrow guide as needed for more information on each of these program development steps. The completed worksheets also can be used in presentations and other public outreach events or products to help you make your case for pay-as-you-throw. In a briefing for your elected officials, for example, you can use the figures developed in Worksheet 5 (Rate 121 ------- Structure Design) to help convince them that a well-designed pro- gram will not result in additional costs for the community. Some of the worksheets, such as Worksheet 1 (Program Goals) and Work- sheet 2 (Program Barriers), also could be used during a presenta- tion to obtain valuable feedback from attendees about how they feel the program should be designed. 122 ------- Worksheet PROGRAM GOALS Use this worksheet to identify and prioritize the specific goals of your pay-as-you-throw program. Begin with the goals listed below, ranking each goal on a scale of 1 to 5. A ranking of 5 means it is critical that your program meets this goal. A ranking of 1 means the goal is of minimal importance. List any other program goals that come to mind, and rank them as well. As you think about goals, consider other stakeholders in your community—to be successful, your program also will need to have their goals in mind. To help you identify the issues other stakeholders will want addressed, copy the back of this form and use it to solicit more ideas about goals during pay-as-you-throw meetings or presentations. Reduce the amount of solid waste generated/increase recycling rates Notes: 12345 Reduce the total cost of solid waste management Notes: 12345 Remove solid waste management costs from the tax base entirely (by raising sufficient revenues to cover all solid waste management costs) Notes: 12345 Subsidize other solid waste programs (such as recycling) Notes: 12345 Increase equity by asking residents to pay only for the waste they generate Notes: 12345 Increase understanding among residents of solid waste issues/environmental issues Notes: 12345 123 ------- Worksheet 1 Program Goals: List below the different goals for the pay-as-you-throw program and rank them on a scale of 1 to 5. A ranking of 5 means it is critical that the program meets this goal. A ranking of 1 means the goal is of minimal importance. 12345 12345 12345 12345 12345 12345 12345 12345 124 ------- Worksheet POTENTIAL BARRIERS Use this worksheet to identify barriers that might affect your program and consider how they can be overcome. Begin by reviewing the potential barriers on the matrix below. As you review these potential barriers, be sure to dis- tinguish between perceived problems—challenges that have solutions or do not apply in your community—and real barriers that might actually prevent you from achieving your pay-as-you-throw goals. For example, illegal dumping often turns out to be a perceived barrier. It usually can be overcome with a strong education and outreach program and effective enforcement. Multi-family housing, by contrast, may be a real barrier for some communities. A high con- centration of population in multi-family housing might prevent a community from extending pay-as-you-throw to these residents. Then, on the following page, list the barriers that you feel might apply to your community's program. For each of these, consider the ways in which you might overcome them. The second page of this form can be copied and used during pay-as-you-throw meetings or presentations to solicit other potential barriers from attendees and to brain- storm more solutions. Sample Barriers and Solutions Potential Barriers Illegal dumping/burning Uneven revenues/revenue shortfalls as residents generate less waste Multi-family housing Perception that waste collection is free/pay-as-you-throw is a tax increase Pay-as-you-throw is regressive/low-income residents feel greater impact Overstuffing of containers Lack of support from private waste haulers Possible Solutions - Educate residents about pay-as-you-throw - Provide several legal diversion options - Develop enforcement plan - Use multi-tiered pricing - Plan for reduced waste amounts in steady-state when setting prices - Include charges in rent - Under a bag-based system, have tenants purchase bags - Use bar code readers on building garbage chutes - Educate residents about pay-as-you-throw - Set prices at levels residents will accept - Offer these residents rebates, coupons, or discounts - Offer free bags to recipients of general assistance - Set weight limits on containers - Involve haulers in the planning process - Pass ordinance mandating haulers offer variable rates 125 ------- Worksheet 2 Potential Barriers: List below potential pay-as-you-throw barriers and consider whether each is actually relevant to your community. For each potential barrier you feel may impact your program, list any possible solutions that come to mind. Potential Barriers Possible Solutions 126 ------- Worksheet PUBLIC OUTREACH Use this worksheet to identify specific public outreach goals for your program and consider ways to achieve them. This worksheet will help you plan for the two distinct parts of public outreach: A) soliciting feed- back about pay-as-you-throw during the planning stage and B) educating the community during implementation about the program's final design and informing residents about how to participate (for example, where to buy bags and how to handle bulky items). (Refer to the "Public Outreach Materials" section beginning on page 91 of this work- book for more ideas on how to generate feedback and educate your community.) Part A Soliciting Feedback Using this table, consider how you will obtain input during the planning stage about the proposed pay-as-you-throw program. Begin with the audiences from whom you are seeking feedback. Then, consider possible methods of achieving this. In the last column, list when you should begin each of the different strategies for gathering input. Audience EXAMPLE: Retailers/other businesses Outreach Methods - Direct visits to local retailers to discuss the program and ask them about distributing or selling bags in stores - Invite retailers to public pay-as-you-throw meetings - Include retailers in your citizens' advisory council or other planning organization Schedule About 6 months before program implementation EXAMPLE: Residents - Develop a pay-as-you-throw fact sheet introducing the program and asking for feedback - Issue press releases to the local media to get media coverage - Hold public meetings on pay-as-you-throw - Invite community residents to join your citizens' advisory council or other planning organization About 6-9 months before program implementation EXAMPLE: Elected officials • Hold a briefing for elected officials to Introduce the program and ask for their input - Include elected officials In the citizens' advisory council or other planning organization About 6 months before program Implementation 127 ------- Worksheet 3 Soliciting Feedback: For each of the audiences listed below, consider possible outreach methods and a schedule of when to begin these strategies. Copy this page as needed to consider ways of reaching additional audiences. Audience Retailers/other businesses Outreach Methods Schedule Residents Elected officials Media Solid waste staff Private haulers Other: 128 ------- Worksheet 3 (C Part B Educating the Community Use the table below to consider how to educate your community about pay-as-you-throw. Begin by considering which audiences you will need to reach. For each audience, list the specific goals of the outreach effort and the message you will use to reach that group. In the last column, indicate what products you could develop to accomplish this. Audience Goal EXAMPLE: Residents - Show residents that pay-as-you-throw \s needed - Convince residents the program is fair and not an added tax - Explain how to use the new bag-based system Message - The current MSW program ultimately is not sustainable - The program will save you money, if you reduce waste (include details about how to reduce waste) - Participating \s easy—just buy bags for your trash at area retailers (include details on prices, recycling, etc.) Products - Flyers posted around town - Public meetings - Press releases - Invite participation through the citizens' advisory council - Brochure mailed to all households EXAMPLE: Media - Generate positive media coverage of pay-as-you- throw - Convince media that the program Is needed and will work - The current MSW program ultimately is not sustainable - Pay-as-you-throw has multiple benefits: it will give both residents and the municipality money, reduce waste, and is fairer to residents - More and more communities are adopting pay-as-you-throw - Press release/press kit - Briefings for reporters - Invite reporters to town meetings/other pay-as-you- throw presentations EXAMPLE: Civic groups - Convince community and business leaders that pay-as-you-throw is needed and will work - Show that the municipality's long-term financial health will be compromised if no change is made - Involve these leaders in the development of the program and In selling It to residents - The current MSW program is not sustainable - Pay-as-you-throw will help both residents and the municipality to save money - The municipality Is Interested in getting help from community groups in developing the program - Briefings for civic groups at their meetings - Public meetings - One-on-one meetings with civic group leaders 129 ------- Worksheet 3 Educating the community: For each of the audiences listed below, consider the goals of your outreach effort, the specific message of your outreach to that audience, and the products you might develop to accomplish this. Copy this page as needed to consider ways of reaching additional audiences. Audience Goal Residents Message Products Civic groups Media Retailers/other businesses Private haulers Other: 130 ------- Worksheet CONTAINER AND PRICING CHOICES Use this worksheet to compare the advantages and disadvantages of the different container and pricing choices and select the best system for your program. In Part A, rank in terms of importance the characteristics of the mam container and pricing combinations: bags or tags/stickers that are sold at retail stores or municipal offices; cans under a "pay as you go" pricing system (under which residents are billed based on the number of cans they set out for collection); and cans under a subscription system. (Another pricing option that can be used in combination with any of the container and pricing choices is a two-tiered system, which uses a per-container fee for variable MSW costs while retaining a monthly flat collection charge for fixed MSW costs. This helps prevent revenue fluctuations). After ranking the different container and pricing combinations, review your work and record a preliminary system choice in Part B. Be sure to consider the overall program goals you established in Worksheet 1 when making this choice. Part A Container and Pricing System Characteristics Consider the different advantages and disadvantages of the container and pricing systems and how relevant they are to your program. Rank each characteristic on a scale of 1 to 5. (A ranking of 5 means the issue is extremely impor- tant for your program. A ranking of 1 means the issue is of minimal importance.) System Advantage/Disadvantage Bag Systems Advantages Stronger waste reduction incentive than can systems No billing system needed, so accounting costs lower Residents find bag systems convenient and easy to understand Lower implementation costs than can systems Faster, more efficient collections than cans Easy to monitor compliance Easy to adapt for bulky item collections Disadvantages Greater revenue uncertainly than subscription can systems Bags must be purchased and made available to residents in stores or municipal offices Staff time required for purchasing, storing, and selling bags in municipal offices Residents might find buying and storing bags inconvenient Often incompatible with automated/semiautomated equipment Animals can tear bags, and bags can tear during lifting Importance 12345 12345 12345 12345 12345 12345 12345 12345 12345 12345 12345 12345 12345 131 ------- Worksheet 4 (C System Advantage/Disadvantage Tag or Sticker Systems Advantages Stronger waste reduction incentive than can systems 12345 No billing system needed, so accounting costs lower 12345 Residents find tag/sticker systems convenient and easy to understand 12345 Lower implementation costs than can systems 12345 Cost of purchasing tags/stickers is less than bags 12345 Easily adapted for different size containers 12345 Easily adapted for bulky item collections 12345 Disadvantages Greater revenue uncertainty than subscription can systems 12345 Tags/stickers must be purchased and made available to residents in stores or municipal offices 12345 Staff time required for purchasing, storing, and selling tags/stickers in municipal offices 12345 Residents might find buying and storing tags/stickers inconvenient 12345 Municipality must communicate size limits to residents, and collection crews must monitor size-limit compliance 12345 Tags/stickers can fall off in rainy or cold weather or be stolen by other residents 12345 Can Systems (Pay As You Go) Advantages Residents have flexibility to set out as few or as many containers each week as needed 12345 New cans may not be required if residents already own cans of roughly uniform volume 12345 Cans are reusable and prevent animals from scattering waste 12345 Cans can work with automated/semiautomated collection systems 12345 Disadvantages Greater revenue uncertainty than subscription can systems 12345 Smaller waste reduction incentive if large cans are used 12345 Complex tracking and billing system needed to count set-outs at each stop and bill accordingly 12345 Billing system creates lag time between collecting waste and receiving payment for the service 12345 Greater implementation costs if purchase, inventory, and distribution of cans is required 12345 Collection time greater than with bag systems 12345 Alternate system needed for collection of bulky items 12345 132 ------- Worksheet 4 System Can Systems (Subscrip- tion) Advantage/Disadvantage Importance Advantages Revenues are stable and easy to forecast Simplified collection process for collection crews New cans ma/ not be required if residents already own cans of roughly uniform volume Cans are reusable and prevent animals from scattering waste Cans can work with automated/semiautomated collection systems 1 1 1 1 1 2 2 2 2 2 3 3 3 3 3 4 4 4 4 4 5 5 5 5 5 Disadvantages Reduced waste reduction incentive, since residents have no incentive to reduce waste below their minimum service level Complex tracking and billing system needed to track residents' subscription level and bill accordingly Billing system creates lag time between collecting waste and receiving payment for the service Greater implementation costs if purchase, inventory, and distribution of cans is required Collection time greater than with bag systems Alternate system needed for collection of bulky items 1 1 1 1 1 1 2 2 2 2 2 2 3 3 3 3 3 3 4 4 4 4 4 4 5 5 5 5 5 5 133 ------- Worksheet 4 Part B Choosing a Container and Pricing System After ranking the different system characteristics, review your work to see which system offers the most relevant advantages and the fewest disadvantages. If you are very concerned about revenue instability or uneven cash flow, consider whether you should use a two-tiered pricing system. Next, go back to the prioritized list of program goals you created in Worksheet 1. Consider which container and pricing system would best enable you to achieve your community's goals. If needed, use the table below to help you consider your options. List your program goals in the first column and consider the impact of each container/pricing system choice on the goals. Container/Pricing Systems Program Goal Tags/ Stickers Cans (Pay As You Go) Cans (Subscription) Two-Tier Pricing EXAMPLE: Reduce M5W as much as possible EXAMPLE: Minimize program costs EXAMPLE- Achieve revenue stability &ags tend to be smaller, creating & stronger waste reduction incentive Low accounting costs, since no billing system needed Uneven cash flow possible Tags/stickers for smaller containers create a strong waste reduction incentive low accounting costs, since no billing system needed Uneven cash flow possible Cans tend to be larger, reducmg waste reduction Incentive Billing system can increase costs Uneven cash flow possible Cans tend to be larger, reducing waste reduction incentive Billing system can increase costs Steadier cash flow flat fee in combination with variable rate reduces waste reduction incentive Potential for reduced administrative costs Steadier cash flow With the different system characteristics and your overall program goals in mind, make a preliminary container and pricing system choice and record it below. Container and pricing system: 134 ------- Worksheet RATE STRUCTURE DESIGN Use this worksheet to design a rate structure for your program. In Part A, estimate the amount of waste you will be collecting under pay-as-you-throw. In Part B, estimate your pay-as-you-throw program costs and the cost of any complementary programs. Then, estimate the per-container price needed to meet your program's costs in Part C. Complete this worksheet by considering whether this price strikes the right balance between costs and revenues. Part A Waste Collection Forecast Perform the following calculations to estimate the amount of MSW that will be collected from residents under your pay-as-you-throw program. Begin by estimating the amount of MSW collected in the year before program implementation (the "base year"). Then, revise this figure to reflect MSW collections two years after program implementation (the "projection year"). This is also called the steady-state, when residents' reductions in waste generation due to pay-as-you-throw have stabilized. Current Waste Collection Tons of MSW collected in the base year 2. Community Growth Tons of MSW per resident in the base year [from A-1] Current number of community residents in the base year Tons of MSW collected per resident in the base year Estimated number of residents in the projection year Annual MSW tonnage expected in the projection year without pay-as-you-throw 3. Waste Collection Under Pay-As-You-Throw 100 - Percentage decrease in MSW expected under pay-as-you-throw MSW reduction multiplier Annual MSW tonnage expected without pay-as-you-throw [from A-2] Annual MSW tonnage expected under pay-as-you-throw 12 Annual MSW tonnage expected under pay-as-you-throw Tons of MSW expected per month under pay-as-you-throw 135 ------- Worksheet 5 (Co Part B Program Costs In this section, estimate your monthly MSW curbside collection and disposal fixed and variable costs under pay-as-you-throw in the projection year. Then estimate monthly fixed and variable costs for your new (or existing) recycling program in the projection year. Be sure to take into account your residents' reduced MSW set-outs when estimating costs. (For composting/yard waste collections or other complementary programs, copy this page and use it to estimate their costs.) If you contract out for some or all of these services, enter this cost under the "contractor fees" line. Combine these costs at the end of this section to estimate the total cost of pay-as-you-throw and any complementary programs. I. Fixed MSW Collection and Disposal Costs per Month Physical facilities (e.g., maintenance, mortgage, utilities)$. Salanes and benefits (labor costs that remain fixed regardless of quantity of MSW $. collected) Vehicle amortization$. Vehicle maintenance (vehicle maintenance costs that remain fixed regardless of quantity of $MSW collected) Vehicle operating costs (vehicle operating costs that remain fixed regardless of quantity of$ MSW collected) Contractor fees (if any) $. Other fixed costs$. Total fixed MSW collection and disposal costs per month $2. Variable MSW Collection and Disposal Costs per Month Salanes and benefits (labor costs that vary with amount of MSW collected)$ Vehicle maintenance (vehicle maintenance costs that vary with amount of MSW collected) $Vehicle operating costs (vehicle operating costs that vary with amount of MSW collected) Contractor fees (if any) Tipping fees Other variable costs Total variable MSW collection and disposal costs per month 3. Total MSW Collection and Disposal Costs per Month Total monthly fixed MSW collection and disposal costs [from B-JJ Total monthly variable MSW collection and disposal costs [from ^2] Total monthly MSW collection and disposal costs under pay-as-you-throw 136 ------- Worksheet 5 4. Fixed Recycling Collection and Processing Costs per Month Physical facilities (e.g., processing equipment amortization, utilities)$. Salaries and benefits (labor costs that remain fixed regardless of quantity of recyclables $. collected) Vehicle amortization costs$. Vehicle maintenance costs (vehicle maintenance costs that remain fixed regardless of $. quantity of recyclables collected) Vehicle operating costs (vehicle operating costs that remain fixed regardless of quantity of$. recyclables collected) Contractor fees (if any) $. Other fixed costs$. Total fixed recycling costs per month $. 5. Variable Recycling Collection and Processing Costs per Month Salaries and benefits (labor costs that vary with amount of recyclables collected)$. Vehicle maintenance costs (vehicle maintenance costs that vary with amount of recyclables $. collected) Vehicle operating costs (vehicle operating costs that vary with amount of recyclables$. collected) Equipment costs (e.g., baler, compactor, Bobcat operations) (equipment costs that vary $. with amount of recyclables collected) Contractor fees (if any)$ . Other variable costs $. Total variable recycling costs per month$. 6. Total Recycling Collection and Processing Costs per Month Total fixed recycling costs per month [from B-4J Total monthly recycling costs under pay-as-you-throw [fromB-6] Total variable recycling costs per month [from B-5J Net revenue from sale of recyclables per month Total monthly recycling costs under pay-as-you-throw Adjusted total monthly recycling costs under pay-as-you-throw 7. Total Cost of Pay-As-You-Throw and Complementary Programs Total monthly MSW collection and disposal costs under pay-as-you-throw [from B-3] $. Adjusted total monthly recycling costs under pay-as-you-throw [from B-6]$. Other monthly complementary program costs, if any $. Total monthly cost of pay-as-you-throw and complementary programs$. 137 ------- Worksheet 5 Part C Program Revenues Use this section to estimate the per-container price needed to meet your program's costs. If you plan to use more than one size container, estimate the amount of waste you will collect in each size container per month (you might contact planners in pay-as-you-throw communities for help with this estimate). Then perform the calculations in this section separately for each container. If you are uncertain about how to convert your container's capacity from volume to weight, refer to the report Characterization of Municipal Solid Waste in the United States: 1995 Update. You also might check with planners in other communities or weigh a random sampling of several filled containers and use the average weight for this calculation. I. Container Selection and Capacity Container selection: Volume of selected container: Convert container capacity to weight: . (cans, bags, tags, or stickers) . gallons tons 2. Estimated Per-Container Price Tons of MSW expected per month under pay-as-you-throw [from A-3J Total monthly cost of pay-as-you-throw and complementary programs [from B-7] Weight per container in tons [from C-1] Number of containers expected per month Number of containers expected per month Estimated price per container Part D Program Balance At this point, you have developed a price per container that will help you cover your estimated costs. Remember, however. that your per-container price is based on program costs in the projection year (once your program has reached the steady-state). Prior to the projection year, you can expect greater waste collection amounts. This will result in greater revenues, but also greater costs. You might consult with planners in nearby pay-as-you-throw communities for data on whether their costs were greater or less in the two years before reaching the steady-state. If needed, adjust your per-container price to strike a balance between reasonable fees and covering your costs completely. Also consider whether your fee sends a strong enough waste reduction price signal to residents. Enter the revised per-container price below. Revised price per container $138 ------- Worksheet IMPLEMENTATION CHECKLIST Use this worksheet to review the different potential pay-as-you-throw program implementation activities and check off the relevant ones as they are completed. This checklist is divided into three sec- tions. All planners should use Section A, which contains a checklist of specific implementation activities suggested for any pay-as-you-throw program. Then, select and use either Section B or C, depending on whether you plan on using a bag- or tag-based systems or a can-based system. Part A All Container Systems D Draft and enact any necessary ordinances to charge a variable rate for waste collection. D Draft and enact any additional needed ordinances: O Banning waste dumping and/or burning O Limiting container weights O Mandating recycling O Prohibiting unauthorized containers D Define enforcement responsibilities (work with the police and health department). D Reassign collection and management staff as needed to new roles in outreach, enforcement, and administration. D Prepare staff to address residents' concerns and questions. D Plan your education and outreach campaign. Develop outreach materials and schedule briefings and presentations. D Consider working with the business community to ensure that they lock their dumpsters to prevent midnight dumping. D Develop and implement policies for accommodating low-income residents and physically handicapped and elderly residents. D Develop and implement policies for accommodating residents of multi-family units. 139 ------- Worksheet 6 D Develop and test your rate structure and your budgeting and tracking systems. D Develop procedure for gathering and analyzing data on waste generation amounts and costs. Conduct baseline data collection. D Develop a phase-in strategy (e.g.. collect all wastes for several weeks, but leave "error tags" where needed to educate customers that only correctly paid and packaged trash will be collected in the future). Part B Bag- or Tag-Based Systems D Determine weight limit for bags or size limit for trash that is tagged and the number of bags or tags to purchase. D Identify vendors, develop specifications and RFPs, solicit bids, and purchase bags or tags. D Plan and develop a distribution network (e.g., using town offices or local retailers). D If distributing through retailers, arrange distribution logistics (e.g., delivery and invoice schedule and marketing agreements). Assign and train staff as necessary. D If distributing through municipal offices, develop and implement inventory management system. Assign and train staff as necessary. D Develop an education program informing residents how to participate (e.g., the location of bag or tag sales outlets and the procedures for bulky wastes). D Develop and implement plans for bulky items, including pricing. 140 ------- Worksheet 6 Part C Can-Based Systems D Evaluate whether residents can use their own cans or if the town will supply cans. D Determine the container size and number of cans to purchase. D Identify vendors, develop specifications and RFPs, solicit bids, and purchase cans. D If you have a subscription system, develop and provide information to residents that allows them to estimate their trash set-out and select a subscription level. D If residents will use one large can, develop plans for extra waste (e.g., supplement with bags or tags). Purchase necessary items and educate residents. D Develop and implement plans to distribute new cans (for new residents, replacements for stolen containers, or changes in service level for subscription can systems). D Distribute containers and maintain an inventory of extra containers. D Develop and implement billing system. D Develop and implement plans for bulky items, including pricing. 141 ------- 142 ------- Worksheet MONITORING A N D E V A L U AT I O N Use this worksheet to monitor waste generation amounts and the amount of material recycled and composted. For the first year after program implementation, enter base year data in the first column and data from the program's first year in the second. For monitoring the program after the first year, enter the previous year's data followed by the current year being evaluated. This information can be tracked over time to demonstrate the waste reduction impact of pay-as-you-throw and help inform decisions about potential changes in the program's scope or structure. Part A Waste Collection Amounts Base Year Current Year Tons of MSW collected: Part B Recycling Amounts Tons of recyclables collected: Glass High-Grade Paper Mixed Paper Corrugated Cardboard Newsprint Aluminum Plastic Steel Other Total tons of recyclables collected: 143 ------- Worksheet 7 Part C Composting Amounts Base Year Current Year Tons of organic materials collected for composting: Part D Costs Tracking the costs incurred and the revenues recovered under pay-as-vou-throw is an important process. At least once a year, refer back to Worksheet 5,"Rate Structure Design," and re-calculate program costs and revenues. This information can be used to evaluate the program's economic sustainability on an ongoing basis. It also can be used to demonstrate the cost-effectiveness of the program to elected officials or planners from other communities inter- ested in pay-as-you-throw. 144 ------- SECTION Articles and Newsclippings Within the last several years, pay-as-you-throw has begun to receive increasing attention in the print media. A variety of solid waste management publica- tions and newspapers serving communities with pay- as-you-throw have published articles about these programs. This section includes a few samples of recent coverage of pay-as-you- throw, including an article reviewing six communities with successful programs, an examination of unit pricing in rural and urban settings, and an article presenting strategies for overcoming potential barriers to pay-as-you-throw. In addition to providing you with useful background information on pay-as-you-throw, this section can assist in organizing any articles about your community's program that appear in print. Over the course of implementing pay-as-you-throw in your community, it is likely that the program will be covered in your local media. (See Sec- tion Two, Public Outreach Materials, for ideas on how to encourage positive coverage by the media.) It might be helpful to keep track of this coverage. As articles about your program appear, you can three-hole punch the clippings and add them to this section for later reference. This will help you gauge the effectiveness of your overall outreach and education effort and, in particular, the impact of your outreach to the media. In addition, tracking local press coverage can help you identify areas or issues on which you may need to focus greater attention. It also can provide you with another measure of success, an important resource you might use when asked about your pro- gram's performance. 145 ------- After stoning recycling, composting, and public education programs, are waste generation rates and MSW management costs still high? Give residents an economic incentive to reduce waste. ys say that each week your crews 1 collecting newspaper, glass, alu- num, steel, and plastics at the bside for recycling. You're also leering brush and leaves forcom- posting. Households are doing their part, and the amount of waste you're disposing ofisdecreasing—but not as much as you'd like. Tipping fees are still high, and you' re having a hard time covering the costs of providing service. What alternatives do you have? One option is to consider a "unit pric- ing" program, also called "pay-as-you- throw" or "variable rate pricing." Unit pric- ing is a fee-for-service system in which residents pay for MSW management ser- M •• vices per unit of waste collected rather than through taxes or a fixed fee. The system creates a direct economic incenti ve for peo- ple to prevent waste generation, to recycle, and to compost. With such a system some communities have seen significant decreas- es in waste disposal and increases in the amount of material recycled. These advantages are only part of the story. In addition to helping achieve waste reductions (and cost savings), by encour- aging residents to think about waste gen- eration, unit pricing often leads to a greater understanding of environmental issues in general. Residents also tend to welcome unit pricing, viewing it as a more equitable way to pay for solid waste services than tradi- tional flat fees, which, in effect, require households that reduce and recycle to sub- sidize their more wasteful neighbors. All sizes and types of communities can realize benefits through unit pricing pro- grams. These programs also work well whether solid waste services are carried out by municipal or private haulers. Setting the Stage The first step is to establish the groundwork for unit pricing. Adopting an effective pro- gram requires making a series of decisions about how to best offer a variable rate to residents. To be sure you are making the right decisions, organize a team or council that can determine the goals of your pro- Mvch/April 1995 Reprinted with permission from March/April 1995 MSW Management © Forester Communications, Inc. All rights reserved. 147 ------- gram and how to achieve them. Establish an advisory team. A unit pric- ing team typically consists of solid waste staff, interested elected officials, civic lead- en, and representatives from affected busi- nesses in the community. Including these individuals in the planning process gives the community a sense of program owner- ship. Team members can help other resi- dents in the community understand the specifics of the program as it evolves, and can provide your agency with valuable input on residents' concerns about the pro- gram. In addition, members of the team can serve as a sounding board to help ensure strong community participation throughout the planning process. Set goals. Determine the goals of the program based on a review of your com- munity's needs and concerns. Specific goals can include encouraging waste pre- vention and recycling, raising sufficient revenue to cover MS W management costs, and subsidizing other community pro- grams. Once you've come up with a list of preliminary goals, the team can help refine and prioritize them. Consider legal/jurisdictional issues. Generally, stales extend to local jurisdic- tions the authority to provide waste man- agement services and to charge residents accordingly. Taking the time to determine if this is the case in your state, however, is better than risking discovery of it during implementation. Involve and educate the public. The experiences of communities that have implemented unit pricing programs indi- cate that a good public relations program more than pays for itself. Public education can combat fears and myths about unit pric- ing (such as the fear of increased illegal dumping), and can help avoid or mitigate many potential implementation problems. It is critical to devise ways to involve and educate the community during the planning process, including holding public meet- ings, preparing briefing papers for elected officials, issuing press releases, and encour- aging retailers to display posters and other information about the program. To help organize some of these activi- ties. consider developing a timeline or schedule. Planning for unit pricing should begin at least a year in advance of your tar- geted start date. Begin explaining the pro- gram and its goals to the community between 9 and 12 months before program implementation. Public education should continue throughout the months prior to the start of the program and. to Mffle extent, after the program is under way. Identify the legal framework for the program at least six months before the start of U» program. Drafting a blueprint. The next step is to determine the features of your program. Designing a working program requires that you consider and decide on a range of spe- cific issues. The process of selecting pro- gram components and service options can begin as much as nine months before the start of your program. Volume-Based versus Weight-Based One of the first decisions to be made when designing a unit pricing program is to deter- mine how solid waste will be measured. Under volume-based systems, residents are charged for waste collection based on the number and size of waste containers that Weight-based systems offer a greater waste reduction incentive, since every pound of waste that residents prevent, recycle, or compost results in direct savings they use. Under weight-based systems, the hauler weighs at the curbside the waste that residents set out for collection. Households gal. in capacity, are used. Residents pur- are then billed based on the pounds of tmsb chase me bags from the solid waste age n nel often are required to manage the billing system. Most of the unit pricing experience and data come from volume-based pro- grams. Many of the design and implemen- tation issues presented below, however, apply to both of these systems. Containers, Rate Structures & Billing Communities that decide to design a vol- ume-based program must consider the type and size of waste collection containers on which to base their rate structure and billing system. A program can be based around large cans, small or variable cans, prepaid bags, or prepaid tags or stickers. Each sys- tem has its own specific advantages and dis- advantages related to such issues as offer- ing a system that residents view as equitable, creating as direct an economic incentive for waste reduction as possible, and assuring revenue stability for the agency. Large cans. Households are provided with single, large cans, which are typical- ly 50 to 60 gallons in capacity. Each house- hold is then charged according to the num- ber of cans it uses. The primary benefit of offering a single container size is revenue stability. The waste .reduction incentive is somewhat diluted, however, since house- holds pay the same amount whether they fill their container halfway or completely. Small or variable cans. Communities also could provide households with grad- uated can sizes, typically ranging from 20 to 90 gal. in capacity. Such systems allow residents to real i ze savings from even mod- est reductions in waste generation. Track- ing the amount of waste generated and charging households accordingly can be more complicated. Prepaid bags. Standard-sized, distinc- tively marked trash bags, often 20 or 30 generated. Weight-based sysjews offer a greater waste reductiq»*iBcentive, since every pound of wanethat residents prevent. recycle, or compost results in direct sav- ings,. Residents can easily understand this kind of system, and the system itself is more precise. In addition, under a based program, residents are not tempted to compact their waste, which can occur with volume-based systems. On the other hand, weight-based system* typically are more expensive to implement and operate than volume-based systems. To operate a weight-based system, communi- ties often need to use specialized collec- tion trucks with on-board scales to weigh and record the weight of the waste from each household. A computerized system for charging residents also is needed, and more solid waste administrative agency person- cy through such outlets as municipal offices and retail stores. Bag systemsare less expen- sive to implement and maintain, since there is no tracking and billing required. Since residents might buy large numbers of bags then none for an extended period, rev enue fluctuations may occur. Prepaid tags or stickers. Tags Of stick- ers specifying certain bag sizes can be sold to residents through municipal offices or retail stores. These systems offer many of the same advantages as bag-based systems. In addition to container choices, MSW planners need to decide on the rate or pric- ing structure. There are four basic rate struc- tures: proportional (linear), variable < tainer, two-tiered, and multi-tiered. I and container choices are closely related. The types of containers selected of ten dic- tate the rate structure and billing system I « • MM 148 ------- use. In other cases, an existing billing sys- tem that cannot be overhauled could gov- ern container type and rate structure. A proportional (linear) rate system, the simplest rate structure, entails charging households a flat price for each container of waste they place out for collection. A variable container rate can be used by com- munities interested in offering a greater waste reduction incentive to residents. Under this system, communities charge varying rates for different size containers. Communities also might opt for a two- tiered rate structure under which households are assessed both a fixed fee and a per-con- tainer fee. The fixed fee helps ensure that revenues will never drop below a certain Linking recycling and com- posting with unit pricing lets communities recover these expenses without creating economic disin- centives to recycle Mowand mc*e communities ore hying to find new and better ways to manage theii MSW in response to (odors such os mcwasing waste gen- eration and tipping fees. EPA recognizes that in mis climate waste prevention will ploy an increas- ingly important role For some communities, charg- i ng a variable rate fo< waste collection con be a wise strategy. To help communities learn whether unit pric- ing might work lor them, EPA organized the Unit Pricing Roundtable, a gathering of experts and representatives (torn communities with wriobie tale programs in place. EPA then organized Ate wealth of information resulting from the meeting's dis- cussions into a 90-poge guide. PcyAs-ybu-rhrow. lessons loomed About Unit Pricing (0^30*94-004) provides detailed technical information on unit pacing based on the experiences of communities with variable role pro- grams in place, The free manual can be ordered directly from EPA by colling the RC8A Hotline at (800| 424-9346 or by writing to USEPA, RCRA irAxinata Center 15305), 401 M Street S.W, Washington, DC 20460. 70 level, while the per-container fee provides a strong waste reduction incentive. This rate structure is the most complex and, there- fore, is difficult to administer and bill. Designing a unit pricing program also requires that a community choose from among three typesof billing systems: direct payment, subscription, and actual set-out systems. Direct payment systems typical- ly are used with bag-, tag-, or sticker-based programs. Residents pay for MSW services by purchasing bags, tags, or stickers from the solid waste agency. They are then affixed to containerized waste placed out for collection. Under subscription systems, residents select in advance a specific sub- scription level (the number of containers they anticipate setting out each collection cycle). The customer is then billed on a reg- ular basis for these containers. If customers are able to reduce the amount of waste they generate, they can select a lower subscrip- tion level and save money. Under an actu- al set-out system, the solid waste agency bills customers based on the actual num- ber of containers set out for collection. Choosing Important Services The next step in planning a unit pricing pro- gram is to determine which solid waste ser- vices are most important to residents. A carefully selected and priced service array allows a community to offer the different waste collection services that residents feel are important, while generating sufficient revenues to support core services. Some services can contribute signifi- cantly to the overall effectiveness of unit pricing. Recycling and collection of yard trimmings for composting enhance the pro- gram's waste reduction goals. Linking recy- cling and composting with unit pricing pro- vides residents with an environmentally responsible way to manage waste. In addi- tion, since the cost of these programs can be built into unit pncinj^b, communi- ties can recover these expenses without creating economic disincentives to recycle, Other services are viewed as important conveniences, or even necessities, by some residents. Incorporating them ruff-add-irf enthusiasm for your new program. For example, backyard collection of waste and/or recycl ables can be an important ser- vice for elderly or disabled residents. Back- yard collections also can beoltcredtoiHher residemsatahighercost to reflect the added service resource!) required. Special Collection Needs One of the biggest challenges facing com- munities implementing unit pricing is how to include multi-family (five units or more) residential structures in the program. Because waste often is collected from res- idents of multi-family structures on a per building rather than per unit basis, offer- ing these residents a direct economic incen- tive to reduce waste with unit pricing may be difficult. One way to resolve multi-fam- ily challenges is to have the building man- ager sell bags or tags to each resident. Another approach is to modify the system of setting out waste for collection in multi- family buildings so that only waste that has been paid for can be left for col lection. Sys- tems that employ technological solutions. such as using magnetic cards to open garbage chutes, usually are expensive. Many communities considering unit pricing are concerned about ensuring that the waste reduction incentives of unit pric- ing can be brought to residents living on fixed or low incomes. Communities may wish to consider providing assistance to res- idents with special financial needs by reduc- ing the per-household waste collection charges by a set amount, offering a per- centage discount, or providing a credit on the overall bill. Assistance also can be offered through existing low-income pro- grams, particularly other utilities' efforts. Launching the Program There are two distinct schools of thought about the timing of implementation. One maintains that unit pricing should be imple- mented within a brief period of time. The other believes that households respond bet- ter when asked to make changes in small, manageable increments over time. Regardless of your schedule of imple- mentation, a number of tasks need to be performed. They include educating the pub- lic about the newMrcram and organizing your solid waste agency to he able to effec- tively administer the new program Other common tasks include establishing legal authority for charging a direct variable fee for waste collection services, procuring containers, designing and launching com- plementary programs, and ensuring en- forcement (including developing ways of preventing illegal dumping), Once your program is under way, begin the process of monitoring and data collec- tion. Data collecting will help you deter- s mine how successful the program is. Jusi as ii will take some time for residents to get used to paying a variable rale lor their trash, your program itself will necessarily go through an adjustment period. Staying on lop of'its problems and progress will allow you to make needed changes quickly, help- ing to ensure an effective program. Guest author Michael Shapiro is director of Office of Solid Waste. EPA, 149 ------- TRASHTAG PROGRAM RESIDENTS FAVOR USER FEES Since the program began, 51 percent of county households surveyed recycle more, 15 percent compost more, and almost 40 percent pay more attention to product packaging. Sarah Stone and Ellen Harrison A TRASHTAG program was im- plemented in Tomkins County, New York in March, 1990, re- quiring residents to purchase a tag for each container of garbage put out for collection. The user fee program is one part of an overall waste reduction effort dur- ing the last two years in the county (pop. 94,000). Other aspects include curbside pickup of recyclables, a central recycling/ trash baling processing facility, a home com- posting program, and a yard waste com- posting program. The trashtag and curbside recycling pro- grams are designed to work together, with the trashtag program creating economic in- centive for people to reduce their household waste while the recycling program provides a convenient method for people to do so. An extensive educational effort which included working with citizens, municipal govern- ments, and waste haulers, was another vital part of this strategy. Before the trashtag program was adopted, waste disposal costs were embedded in prop- erty taxes. Because of this institutional frame- work, some of the big users of the county's landfill, including Cornell University and Ithaca College, did not have to pay for waste disposal due to their tax exempt status. Fur- thermore, it was believed that a direct charge for waste disposal would create an incentive for households to recycle and to reduce the amount of garbage they produce. Using prop- erty taxes to handle disposal costs created no such incentive since the cost was essentially hidden. The trashtag program is a cooperative effort between private haulers, municipal haulers, and the county. Tags are sold by both munici- pal and private haulers. Each can add admin- istrative and collection fees to the county's per tag charge. While some opted to incorporate all their fees into the teg, others have chosen to make these two separate charges. Tags are weight based. A large tag," which allows for the coDection of up to 30 pounds of trash costs$1.08 each. A "small tag," costing $.62 can be used for up to 15 pounds. The coun- ty also developed a subsidy program for low in- come families that provides each eligible per- son 12 tegs per year. SURVEY CONDUCTED Last year the County's Solid Waste Man- agement Division, in cooperation with the Cor- nell Waste Management Institute and Cor- nell's Department of Consumer Economics & Housing, conducted a survey of Tompkins County residents to determine how they felt about the trashtag and recycling programs. The objectives of the survey included an as- sessment of attitudes about how future in- creases in waste disposal should be handled, determining the public's attitude concerning trashtags and the recycling programs, and whether behavior has changed as a result of the trashtag program. The survey was sent to a random sample of 3,034 Tompkins County residents in Septem- ber of 1990. Those who didnt respond to the first mailing were sent a second survey. The overall response rate was approximately 49 percent The final sample obtained compared favorably with the known population of Tomp- kins County both in terms of geographic dis- tribution and demographic characteristics. The results of the survey indicate that re- spondents not only feel that the trashtag pro- gram is the best of possible alternatives in terms of paying for waste disposal, but that the trashtag program has also aided other waste reduction behavior. USER FEES Overall, respondents indicated that they felt favorably towards the trashtag program. Six- ty-three percent said that they are very much in favor or somewhat in favor of the trashtag program, 15 percent somewhat oppose the pro- gram, 11 percent oppose the program, and the rest either didn't care one way or the other (8 percent), weren't aware of the program (1 per- cent) or didnt respond to the question (3 per- cent). Since it is expected that waste disposal costs will increase in the future, residents were asked how they would like to see these in- creases handled. The largest percentage of re- spondents felt they would like to see increases in waste disposal costs handled through high- er trashtag fees (48 percent). This was fol- lowed by higher flat rate fees paid to waste haulers (18 percent), higher property taxes (9 percent), higher sales tax (8 percent), and higher income tax (4 percent). Fifteen percent Reprinted with permission from BioCycle For sample copy of publication, contact BioCycle, Journal of Composting and Recycling, 419 State Avenue, Emmaus, PA 18049.610-967-4135. 151 ------- of the respondents chose not to answer this question. One of the key questions in volume or weight-based fees is how it affects household waste reduction behaviors, such as recycling, composting, and precycling? Nearly 51 percent of the respondents claim to recycle more since the trashtag program began, 16 percent claim to compost more and nearly 39 percent believe they pay more attention to product packaging when they shop since the trashtag program began. EFFECT ON RECYCLING The Tompkms County recycling programs certain towns and villages, or drop off centers for recyclable materials. Full County-wide curbside collection will be implemented this summer. Nearly sixty percent of the respon- dents use the curbside service, whether once a week (26.7 percent), once every two weeks (17.6 percent), or less frequently (14.5 per- cent). Almost seventeen percent of the respon- dents bring all of their recyclables to a dropoff center, while almost 32 percent bring some of their recyclables to a dropoff center. This final figure has some overlap between those who use the curbside service and those who use a dropoff center. This may be due to the fact that curbside pickup in most areas does not include the collection of plastic or cardboard. Therefore, some respondents may use curbside for glass, newspaper, and metal cans while using a dropoff center for plastic and cardboard. Table 1 shows the high recycling rates in Tompkins County, as well as the impact that the trashtag program has had on recycling rates for each material. Overall, less than half of the sample claims to recycle the same amount of garbage (40.2 percent), while about half (51.2 percent) claim to recycle more. The questionnaire also tried to identify rea- sons why some don't recycle. Almost 28 per- cent of the respondents have storage space for recyclables but still find it inconvenient. Al- most 19 percent said that they do not have enough space for recyclables. Three percent of the respondents said that they don't bring any recyclables to a dropoff center because they dont have transportation. Beyond the recycling program, another means of reducing the amount of trash set out is composting. Based on the survey, after the trashtag system was put in place 47.2 percent of the respondents composted, versus 39.6 per- cent prior to it. Approximately 15.5 percent claim to compost more now than before the program was put into effect. About 96 percent of all respondents that compost do so at home. PURCHASING BEHAVIOR According to the study, citizens claim to be placing more emphasis on buying products with less packaging. When asked if they try to reduce the amount of household garbage by buying products with less packaging, 31.5 per- cent said "yes" and 44 8 percent indicated they did so occasionally. Only 22.7 percent said "no" Additionally, 38 9 percent claim to pay Table 1. County Recycling Kates Materials Newspaper Glass Cardboard Plastic Metal cans Do you recycle? Yes No 802% 191% 80.2% 191% Did you recycle (before the trashtag program)? Yes 556% 44.9% No 42 8% 54 0% 478% 508% 239% 738% 634% 357% 275% 707% 611% 37.2% n/a n/a Do you recycle (since the trashtag program)? More 250% 359% Less 2 0% 9% Same 531% 435% Dont recycle 180% 180% 198% 13% 290% 465% 352% 22% 274% 328% n/a n/a n/a n/a more attention to packaging. The percentage of people who responded af- firmatively to trying to reduce their household waste by reducing the amount of packaging is very high: 76.3 percent answered "yes" or "oc- casionally" to this question, while almost 40 percent of the respondents claim to pay more attention to packaging since the trashtag pro- gram went into effect. Beyond these methods of reducing the amount of material, 25.2 percent of the re- spondents identified additional ways of reduc- ing household garbage. Among the more pop- ular were reusing containers, using cloth grocery bags, buying bulk foods, stopping junk mail, sharing magazine and newspaper sub- scriptions and giving away unwanted items. POSITIVE RESULTS The results of the survey were positive and should encourage other municipalities to adopt user fees. Respondents seem interested and willing to participate in the county's ef- forts to reduce the waste stream Fifty one per- cent claim to recycle more since the trashtag program, 15 percent compost more and ap- proximately 39 percent pay more attention to product packaging since the trashtag pro- gram. Additionally, residents favor user fees over alternative methods of handling waste disposal costs. The enthusiasm was even more evident in the write-in sections of the ques- tionnaire where many respondents voiced support for the county's programs. Many re- spondents also expressed their willingness to do even more in terms of waste reduction if they knew how. • Sarah Stone recently completed her graduate work at Cornell University's Department of Con- sumer Economics and Housing. Ellen Harrison is Associate Director of Cornell's Waste Manage- ment Institute. The authors would like to ac- knowledge the contribution and assistance of Barbara Eckstrom and Susan LaBarre of Tomp- kins County Solid Waste Management Division and Jeanne Hogarth and Jim Reshovsky, both Assistant Professors, Consumer Economic and Housing, Cornell University, in putting this arti- cle together. Residents say the trashtag program is the best way to pay for waste disposal, and that it has also aided other waste reduction behavior. BlOCYCLE AUGUST 1991 59 152 ------- T R E D S collection, legislation, international, recycling and technology Volume-Based Program Succeeds In Urban Setting Worcester, Mass., officials were uncertain If a volume-based collec- tion program combined with curb- side recycling could work in a large, urban area with a diverse population. Undaunted, they de- cided to try. With 170,000 residents, Worces- ter is the second largest city In New England. The population of this central Massachusetts community encompasses all socio-economic backgrounds. Housing is equally divided between single- and multi- family dwellings. Until July 1993, the property tax funded approximately 50 percent of the city's municipal solid waste (MSW) collection and disposal services. How- ever, the Department of Pub- lic Works (DPW) competed with the school, police and fire departments for limited funds. After repeated cuts in its tax levy budget, DPW decided to evaluate alter- native collection and dis- posal options rather than decrease its services. Worcester officials con- sidered a flat user fee and volume-based collec- tion. The flat fee was dis- missed because it requires all users to pay an equal amount, regardless of the amount of waste generated. In addition, flat fees offered no incentive to participate in recycling. Instead. Worcester opted for a curbside recycling pro- gram with a fee requiring residents to purchase spe- cific bags for refuse dis- posal. Bright yellow bags priced at 50 cents each, have been printed with the program's logo "Pay a Little, Save a Lot." The bags are sold at 115 retail outlets. DPW also developed an exten- sive public education and aware- ness campaign including bro- chures In three languages, newspa- per, radio and airplane adver- tisements, bumper stickers, bill- boards and radio talk shows. Enforcement methods to encour- age compliance and to avoid Illegal disposal Include fines and two noti- fication stickers. The first, a bright orange "warning" sticker, Is placed on non-program bags and informs ^ ; , __ Worcester, Mass., Solid Waste And Recycling Collection Average Tons Per Week MSW Recycling Tons Per 434 252 22,046 13,103 37% 50% Collection Crew Employee* Pounds Collected Per Employee$72.26 N/A Of Collection And isposal Per Household* MSW Recycling Bulk Waste Collection Number Of Pickups Tons •Based on 49,000 Households. Gty Of Worcester Department Of ft/Mfc 14,000 757 residents of the new. official bags. Residents are allowed 24 hours to remove the bag and must comply with the program by the following week. The second sticker is placed on bags that weigh more than 30 pounds or contain recyclables mixed with refuse. If residents fall to respond to these stickers. DPW enacts a progressive fining system starting at $25 and increasing to$100. Since late 1993. the program has effectively reduced the amount of MSW sent to landfills (see table). For example, solid waste tonnages have declined nearly 45 percent. The city's recycling rate Is slightly more than 37 percent and has re- mained at that level during most of the program. When yard wastes are Included, -Worcester diverts more than 50 percent of its solid waste to recycling and composting. Program compliance among the 50.000 participating house- holds has been 99.9 percent. allowing the city to reduce the amount of MSW collected and Incinerated by more than 40 million pounds. With less trash on the curb for city crews to collect, the DPW has reduced its collection crews by 33 percent. Two- person crews, rather than the previous three, now collect garbage on the city's 11 routes. Savings from the reduced crew sizes and tipping fee costs have allowed the department to re-allo- cate more than $1 mil- lion to other public works programs. In addition, a free bulk and hazardous waste collection day has been re-institut- ed. Public response to these services has been positive and, as a result. Illegal dumping has been reduced. The program has been modi- fied further for public conve- nience. For example, small re- cycling bins with handles were introduced for those residents who find the large recycling bins too cumbersome. Small Reprinted with permission from World Wastes, copyright Intertec Publishing Corp., A K-III Media Company, May 1996 153 ------- T R E D S half-size trash bags also are avail- able for residents who do not fill a 30-gallon bag on a weekly basis. The results of Worcester's solid waste program have shown officials that volume-based programs can succeed In an urban area. — Robert L. Moylon Jr. Worcester DPW Congress Attempts To Stem The Tide Off Mew Regs The new Congress seems bent on fundamentally changing the degree to which federal regulations affect businesses and consumers. Three types of reform proposals are under way: shutting the door on new federal regulations: limiting federally-imposed unfunded man- dates on state and local govern- ments: and scrutinizing the eco- nomic costs and benefits of pro- posed laws and regulations. The House-passed moratorium on new regulations would likely be difficult to enforce — even if the Senate went along with the House bill. At press time, a Senate com- mittee had approved Its own rule- blocking bill. The Senate version is somewhat more moderate than the moratorium passed by the House. For example, it would exempt all regulations that cost the economy less than$100 million a year. Even when Republican appoin- tees controlled federal agencies, it seemed that nothing could stem the tide of new regulations. Pres- ident Bush ordered a 90-day mora- torium during which agencies were supposed to find ways to stream- line and improve their output. De- spite several promising concepts that emerged from the exercise, the overall nature and number of regu- lations were unaffected. A Congresstonally-mandated halt to regulations, which the Executive Branch uses to implement Con- gress's laws, cannot promise better results than a moratorium dictated by the President himself. Indeed. the conservative House majority that voted for the moratorium also created a sizable loophole. Any a- gency would be able to issue a reg- ulation in response to an "immi- nent threat to health and safety.* One branch of Congress Is now In the awkward (not to mention le- gally suspect) position of telling the Executive Branch not to cany out Its constitutional function: imple- menting the laws that Congress passes. A more direct — and obvi- ous — solution would be to change the laws themselves. Of course, the 104th Congress will say that it can't be blamed for the "sins" of previous Democrat- dominated legislative sessions. Put- ting the brakes on the Executive Branch, as the current leadership might argue. Is making the best of a bad situation. Still, the regulatory reform measures in the works are likely to have ..very significant Im- pacts. For its part,> the House has clear- ly stated that it wants to slow the Advertisement 154 ------- CURBSIDE COLLECTION VARIABLE DISPOSAL FEE IMPACT VARIABLE curbside disposal fees have received increasing attention as a means to fund refuse services while promoting waste reduction and recycling. Variable fees — also referred to as variable can rates or bag- and-tag fee systems — are assessed direct- ly on users and reflect, to some degree, the cost of service. They contrast with fixed fees and tax-based systems, where the customer sees no direct financial incentive to mini- mize the level of service. To more fully understand the use and extent of variable curbside disposal fees, R.W. Beck and Associates conducted a survey in 1993 of 80 cities and counties nationwide. The survey used a random sample of 40 large cities and counties (pop- ulations greater than 100,000) and 40 medi- um-sized communities (populations from 50,000 to 100,000). In 68 percent of cities surveyed, a public or governmental authority is responsible for residential solid waste collection, with the remaining 32 percent served by private haulers. Household refuse pickup is usually provided weekly (for 91 percent of those sur- veyed) and waste collection containers are furnished in 44 percent of the communities. Pees for disposal are charged in 65 per- cent of the communities; 35 percent use property taxes or other indirect means. One quarter of the cities with fees — 13 commu- nities, or 16 percent of those surveyed — re- port some type of variable disposal fee fin- residential households in 1992. Funding for recycling and yard trim- mings programs also were explored. Recy- cling programs for residential households were reported in 80 percent of the commu- nities, and of these, more than 80 percent indicated that curbside collection services are provided. Yard trimmings programs were reported by 46 percent of the commu- nities, and about 80 percent of those included curbside service. Large cities gen- erally report having a recycling and yard trimmings program; nearly 90 percent offer some form of recycling. Medium-sized cities were less likely to have each of these services; only 70 percent provide recycling services. Less than 18 percent of the municipali- ties surveyed indicated that they charge a specific fee for collection of recyclables, and BIOCYCLB Six case studies provide a good overview of what happens when variable fees are in place for at least one year. Richard Cuthbert less than 13 percent reported a fee for yard trimmings service. Large cities are twice as likely to charge for recycling services as medium-sized cities, but were only half as likely to charge for yard trimmings collec- tion. Additionally, six communities (eight percent) report some form of financial re- bate for participation in a recycling pro- gram and three communities (four percent) reported a rebate for participation in their yard trimmings program. The rebates may come as a surprise because in most cases, programs cost more than can be offset by revenues from the sale of collected materi- als, at least in the short run. Each of the communities was asked what factors influenced its decision to implement recycling and yard trimmings programs. A legislative mandate was reported by 80 per- cent of those surveyed while local interest or disposal problems were cited by 36 percent. Measuring the effectiveness of variable curbside disposal fees in promoting waste reduction is complicated by the difficulty of isolating the specific role of the collection and disposal fee from the other elements of waste reduction programs, as well as from other elements of the economy in general. In addition, many communities do not have adequate disposal date, either for their cur- rent situation or for the time before the im- plementation of waste reduction programs. A scientifically rigorous analysis of the causes of solid waste reduction would be time-consuming, costly and, in the end, per- haps impossible. Thus, only anecdotal in- formation on the effectiveness of variable curbside disposal feesjs available. The fol- lowing six case studies provide a good overview of what happens when variable fees are in place for at least one year. PORIUND, ORIGOM In Portland, 61 independent collection companies provide residential disposal ser- vices; most have had variable can rate structures in effect for more than 10 years. Before February, 1992, residential collec- tion rates and service territories were un- regulated. A new franchise system provides for mandatory variable curbside rates, weekly recycling services on the same day as garbage services and recycling contain- ers. In 1987, monthly curbside residential recycling collection was implemented throughout the city, and in early 1992 this MAY 1994 63 Reprinted with permission from BioCycle For sample copy of publication, contact BioCycle, Journal of Composting and Recycling, 419 State Avenue, Emmaus, PA 18049 610-967-4135 155 ------- Seattle estimates that a 10 percent increase in charges for residential collection and disposal results in an approximately two percent reduction in overall solid waste disposal. service was increased to weekly recycling curbside collection. The city also imple- mented monthly curbside yard trimmings collection in April, 1992. During the last 10 years, landfill dispos- al costs in the Portland area rose from $17/ton to$75/ton. In response to this in- crease, collection rates for single can service more than doubled, from approximately $7.50/month to$17.50/month. In early 1992, a rate increase of about 25 percent was implemented in conjunction with new recycling services, including a less expen- sive 20 gallon mini-can service level. Eigh- teen percent of residents chose the mini- can. As a combined result of the higher collection fees and availability of recycling services, Portland residents increased their recycling levels from 740 tons/month in 1988 to 2,583 tons/month in 1992 — more than tripling the recycling tonnages over five years. SEATUI, WASHINGTON Seattle has had variable curbside collec- tion rates since 1981. Before that, residents paid a fixed fee charge for unlimited solid waste disposal. Both the structure and level of the city's rates changed numerous times between 1981 and 1992, with the cost of sin- gle can service more than doubling from $6.40 in 1981 to$14.98 in 1992. Between 1985 and 1987, rates increased by 82 per- cent as the city sought to cover the costs in- curred from closing its landfills. Subscrip- tion levels for single-can service rose from approximately 18 percent of the city's house- holds in 1981 to almost 65 percent of house- holds by 1988, when residential curbside re- cycling and yard trimmings programs were implemented. By 1992, more than 89 per- cent of customers shifted to either a one can or half can subscription level. Seattle estimates that it recycled 40 per- cent of its waste stream in 1991 through re- cycling, composting and yard trimmings programs. This compares to a 24 percent re- cycling rate in 1988 when curbside recy- cling programs were first established, and a 15 percent recycling rate before the intro- duction of variable can rates in 1981. In 1992, the city estimated that more than 88 percent of Seattle residents participated in the curbside recycling programs, and 67 percent in the curbside yard trimmings col- lection program. Seattle has studied the effects of the fee increases on total solid waste disposal, as well as the interactive effects of other fac- tors on disposal fees. The Seattle Solid Waste Utility has produced several studies and reports since volume-based rates were first introduced in 1981. Among other things, the city has quantitatively estimat- ed both price and income elasticity factors for its system. Holding all other factors con- stant, it was determined that as rates in- creased, customers disposed of less waste either by recycling more or by more selec- tive purchasing. Based on the city's past ex- perience, the Solid Waste Utility estimates 64 BioCvcLE 156 that a 10 percent increase in charges for residential collection and disposal results in approximately a two percent reduction in solid waste disposal — because residents have the ability to reduce their overall charges through vanable rates. The city also has determined that increases in household size and income can disguise and even counteract the price elas- ticity effects of its rate programs. For in- stance, household size and income levels were positively related to solid waste disposal. The city estimates that with every 10 percent increase in household real in- come, roughly 5 9 percent more solid waste is disposed. TACOMA, WASHINGTON Tacoma has had variable curbside dispos- al rates for solid waste collection for more than 20 years. The city is converting its res- idential solid waste collection program from cans to 60 gallon and 90 gallon containers; more than two-thirds of all Tacoma resi- dents are now provided containers. In re- cent years, solid waste rates have increased significantly as disposal costs have contin- ued to rise. For instance, in 1990 the one can/60-gallon container rate was $7.10 a month. It rose to$8.05 in 1991, and to $10.10 in 1992 — -a 42 percent increase in two years. The two can/90-gallon container rate also jumped 42 percent over the same time period, from$10.35 to $14.75. Concurrent with the implementation of these rate increases, Tacoma also began several residential recycling programs. Curbside yard trimmings service and recy- cling was started in 1990, both offered at no extra charge. Yard trimmings collection in- creased from 6,000 tons in 1990 to 7,237 tons in 1991, while the amount of recy- clables collected jumped three-fold during the same period, from 507 tons to 1,854 tons. Some of the effects of these rate increas- es and waste diversion programs can be seen in the landfilling data. Disposal at Tacoma's municipal landfill fell six percent between 1989 and 1991 (from 200,593 tons to 188,449 tons), despite significant popula- tion growth in the area. The city attributes some of the decrease to its refusal to accept large loads of demolition materials begin- ning in 1989. Tipping fees also have nsen significantly. The fee for city residents rose from$22/ton in 1990 to $32/ton in 1992. At the same time, the tipping fee charged to noncity residents rose from$64/ton in 1990 to $80/ton in 1992. WILKES-BABRE, PINNSYIVANIA Wilkes-Barre operates a residential vol- ume-based rate program that differs signif- icantly from the other case studies. The city first introduced a voluntary bag program for multifamily (five units or more) cus- tomers in 1988. The bags cost$1 each and are sold to residents in packages of eight. With this program, the city estimates that the average household living in a multi- MAY1994 ------- family residence spends $95.90/year for sol- id waste and recycling services. Currently, 50 percent of all multifamily households participate in the bag program, while the other 50 percent contract with private haulers for solid waste collection services. Single family households (four units or less) are charged an annual flat fee of$50/house- hold. However, the city hopes to expand its bag program to include the single family residences in the future because the pro- gram has proven to be popular. During the first year of the multifamily bag program, there was a 15 percent reduc- tion in the total amount of waste collected city-wide. Recycling services for all resi- dential customers have been increasing each year since 1985 as new programs are added and others expanded. Wilkes-Barre now has both curbside recycling and yard trimmings collection, as well as a home composting program. The recycling partici- pation rate reached 65 percent in 1992, and residents are now diverting an estimated 20 percent of the waste stream. Between the bag and recycling programs, the city has seen more than a 25 percent decrease in total solid waste disposal at the local landfill. Tipping fees at the landfill in- creased six-fold since 1985, climbing from $8.65/ton to$5I/ton by 1992. BOTMEU, WASHINGTON Before February, 1991, the suburban Seattle community of Bothell charged a flat fee for disposal services of $8.1 I/month. Then the city implemented curbside recy- cling and yard trimmings collection pro- grams and, to support them, set variable curbside collection rates. The rates were implemented at$10 for one can, $14 for two,$18 for three, and $24 for four. These cov- ered all collection services, including recy- cling and yard trimmings. This choice was made in lieu of an increase in the monthly flat fee to approximately$13 to cover the same services. When the programs were first started, initial subscription levels in Bothell were 71 percent at the one can level, 28 percent at the two can level, and less than one per- cent using three or four cans. One year lat- er, subscription levels were at 78 percent for one can, 21 percent for two, and less than one percent using more than two cans. Significant waste reduction resulted from the program. Initially, an estimated 40 per- cent of Bothell's residential waste stream was collected in the curbside recycling and yard trimmings programs, leaving 60 per- cent going to disposal. By 1992, the two pro- grams were collecting 48 percent of the res- idential waste stream. MINNEAPOLIS, MINNESOTA Minneapolis charges a flat fee for unlim- ited residential .solid waste collection but has a rebate for participation in its curbside recycling program. Residents were not specifically charged for solid waste collection services until October, 1987, BIOCVCLE when the city instituted a $5 monthly fee for solid waste collection and disposal. The original fee was a direct result of rising disposal costs. In 1982, disposal costs were$21/ton; by January, 1988, the tipping fee was $38/ton. With an increase to$42/ton in January, 1989, the residential charge was increased to $7/month. When forced to respond to a$757ton tipping fee in June, 1989, the city increased the residential fee to $12/month, and added a recycling rebate of$5/month to stimulate the waste reduc- tion program that had begun in 1983. Fur- ther increases in the tipping fee that re- sulted in higher residential costs were mitigated by increases in the residential re- cycling rate. The 1992 tipping fee of $99.55/ton was supported by a$17.50 monthly residential fee, accompanied by a $7 monthly recycling rebate. As disposal costs rose in the 1980s, Min- neapolis began making additions and re- finements to its recycling programs that complemented the rebate. The first curb- side recycling pilot program began in 1982, when 1,026 tons of recyclables were collect- ed, less than one percent of the total of 131,995 tons of solid waste. A yard trim- mings program was added in 1987, and the city began collecting large metal items (such as major appliances) in 1990. By 1992, the participation rate in the curbside recycling program reached 90 percent. More than 40,375 tons of recyclables, in- cluding yard trimmings and major appli- ances, were collected in 1992 (approximate- ly 28 percent of the waste stream), and solid waste disposal dropped 21 percent from the 1982 level to 104,561 tons. To be fair, the city's recycling efforts are one factor in this reduction: A large drop in tonnage occurred between 1989 and 1991 when the city changed from cans to carte. A number of people stored their cans under the driplines of their garages, causing them to gather water and snow that made the waste heavier. Switching to covered carts reduced the amount of water collected, which the city estimates lowered tonnages significantly. CONCLUSIONS Taken together, these case studies pro- vide evidence that variable curbside dis- posal fees do. assist and support waste re- duction efforts. Although the specific effects depend on social, demographic and economic factors where they are imple- mented, communities that have variable disposal fees tend to be enthusiastic about them. Most of these communities report that the variable fee structures have sup- ported other waste reduction activities and have consequently helped reduce solid waste disposal levels. • Richard Cuthbert is an executive economist with R.W. Beck in Seattle, Washington, where he conducts demand forecasting, financial impact analyses, rate studies and statistics for electric, water and solid waste utilities nationwide. Portland residents increased their recycling levels from 740 tons per month in 1988 to 2,583 tons per month in 1992 — more than tripling the tonnages. MAY 1994 66 157 ------- Program Planning Clearing Hurdles in Switching to Variable Rate Pricing Attracted by the benefits of solid waste unit pricing but concerned about some of the potential drawbacks? An understanding of potential problems and how to overcome them may help your community's decision-making when exploring unit pricing—and ease the transition if such an approach is adopted. By Michael Shapiro Unit pricing programs offer com- munities an impressive lineup of benefits: greater attention by residents to waste reduction; increased participation by households in recycling and composting programs; reduced dis- posal costs; and a more equitable waste management fee structure. Unlike tradi- tional pricing systems, where every household pays the same—regardless of how much trash is set out on collection day—unit pricing programs charge resi- dents only for the waste they discard. The less residents toss, the less they pay. The benefits certainly have attracted many communities. More than 1,600 communities have switched to some form of variable rate pricing for solid waste collection services in recent years. (See Table 1). In addition, several state legislatures now either encourage or mandate use of variable rate pricing for solid waste.1 The result for many communities with unit pricing programs has been sig- nificantly less waste, lower costs, and improved service. Table 2 lists several communities that have implemented variable rate pricing programs and shows some of the waste reduction and recycling rate increases. For communi- ties concerned about getting squeezed between growing waste generation rates and shrinking disposal options, unit pncing might provide the margin their waste management programs need. However, the switch from traditional pricing to unit pricing worries some Mike Shapiro is director of the Office of Solid Waste for the U.S. Environmental Protection Agency. Table 1: Variable Rate Pricing Programs In Local Governments, By State1 California Colorado Connecticut Florida Georgia Illinois Indiana Maine Massachusetts Michigan Minnesota Missouri Montana 18 1 2 7 2 38 3 13 40 5 855* 3 1 Nevada Now Jsrssy New York North Carolina Oregon Pennsylvania South Dakota Texas Vermont Virginia Washington Wisconsin 2 18 3 4 2503 36 1 1 70 1 243 75 1 States not listed do not have variable rale pricing programs. 3 Minnesota regulations required the use of variable rate lees lor solid waste collection mall 855 communi- ties beginning in 1993; however, some were exempted or granted delays in implementation. 1 Estimate from Peter Spendetow o) the Oregon Department ol Environmental Quality Source. S)*Mfpfc Resources Corporation, 1993 MSW planners. While change is rarely simple, local officials may be concerned that restructuring the way the commu- nity conducts and administers its waste collection program might be more than they want to take on. In the experience of communities with variable rate pro- grams, however, potential barriers to implementing unit pricing can be over- come with some advance preparation. These barriers include: —Building a consensus in the com- munity about the goals of the program and the need for changes that unit pric- ing may bring. —Establishing pnces that cover the costs of waste collection and that resi- dents feel are fair. —Obtaining participation of the entire community, including residents of multi-family housing. —Ensuring that illegal dumping does not increase significantly after imple- menting unit pncing Consensus First: Is Change Needed? Switching to unit pncing means changes for both residents and the municipality administering the program. Concern, even resistance, can accompany these changes. To win support for unit pnc- ing, the municipality needs to think of residents as customers whose satisfac- tion is cntical to the program's success. This means developing an effective pricing program and supporting it with a strong public education effort. When Long Beach, California, began planning its variable rates program in 1991, residents were skeptical. Accord- ing to Jim Kuhl, manager of the city's Integrated Resources Bureau, "People were saying 'Garbage has been collected the same way for a hundred years. Why fix something that's not broken?'" Over- coming the sense that no changes were SOLID WASTE TECHNOLOGIES/NOVEMBER/DECEMBER 1994 17 Reprinted with permission from Solid Waste Technologies Magazine, Adams/Green Industry Publishing, Inc 159 ------- Table 2: Selected Communities With Unit Pricing Programs Community Mansfield. CT Seattle, WA San Jose. CA Pennsville, NJ Bound Break. NJ Antigo. Wl Charlemont. MA Plains. PA Mt. Pleasant, Ml Du Page County, IL Plantation, FL Perkasie, PA High Bridge. NY Illion. NY Population 22.500 500,000 740,000 13,500 10.000 8,500 1,200 11,200 30,000 668.000 64,000 7,900 4,000 9,500 Program MSW Type Reduction Subscription can Subscription can Subscription can Stickers Stickers Stickers Bags Bags Bags Bags Bags Bags Stickers Bags 25% 46% 30% 50% 37% 49% 44% 53% 59% 37% Recycling Change +40% +39% +42% +43% +56% +41% +21% +50% +18% +41% needed was Kuril's biggest hurdle. Educating residents about solid waste challenges in Long Beach—and the ways in which unit pricing could help— was critical to building support for the program California had passed a la\v mandating specific recycling levels. Failure to meet these levels carried potential fines of up to S10.000 per day—money that ultimately would come from community taxpayers. Through presentations at town meetings and gatherings of civic and private groups, distributing flyers, and meeting with the city's elected officials. Long Beach showed how the plan's waste pre- vention incentives offered a cost-effec- tive way to boost the city's recycling rate, enabling it to meet the states man- date, and avoid costly fines. In addition, the city showed how the program would save a significant amount of money for those residents who already were generating less waste. To help drive home this point. Long Beach officials compared the rates for waste collection with the other utility services residents receive. This argument made sense to residents, said Kuhl: "People understand that no one can just go to a gas station and buy 20 gallons for the price of 5—residents have to pay for the amount of service they use." Through its public education program, the city convinced residents that waste reduction incentives would help the city succeed in Mailing Trash When a unit pricing systems was started in Loveland, Colorado, residents were asked to buy trash bags for 75 cents apiece at retail outlets. Residents soon complained, apparently compar- ing the cost of the trash bags with other plastic bags they could buy for pennies. To make the connection between the cost ol the bags and collection and disposal service, the city changed to bag tags, and compared the tags to stamps. Now. to "mail" their garbage to the landfill, Love- land residents afix one 75-cent stamp on each 30-gallon bag they put out for collection A 40- cent stamp is good tor a 13-gallon bag. and a sofa will set you back about 13 stamps. 2l) SOLID WASTE TECHNOLOGIES / NOVEMBER / DECEMBER IW its overall solid waste program. In turn, residents supported unit pricing. At What Price? Switching to unil pricing also often means convincing residents about their bottom line results. Cases in Mansfield, Connecticut, and Loveland. Colorado, illustrate the point. Before implementing its variable rate program in 1990, the town of Mansfield worked to find a price structure that res- idents would consider fair. Lon Hull- gren, Director of Public Works, said his department began by designing a sub- scription-based program to replace the private waste collection service resi- dents had previously used. (Under the old system, residents paid a flat fee of about 520 per month for unlimited ser- vice). For the new program, the town decided to offer four service levels: one, two, and four cans per week, plus a "mini" service level of just one bag per week. The town established prices for each level that would, in (he aggregate, cover all program costs. Next, since the amount set for the most common service level was about 10 percent higher than the flat fee resi- dents were paying previously for waste collection services, planners lowered it to a figure they felt was closer to what the market would bear. The result was a fee of$20.75 per month for two-can ser- vice (with each can 35-gallons). The prices of other service levels were adjusted slightly to maintain the costs- revenues balance. The price was set at $14.50 per month for one-bag service,$17.50 for one-can (or two bag) service, and $26.50 for four cans. The city overcame what Hultgren described as the "classic resistance" to a user-fee system, and the program is now well accepted. With customers get- ting used to it, there has been a general trend of residents subscribing for lower level service. Mick Mercer, the Streets and Solid Waste Manager in Loveland, Colorado, agrees that price concerns are key. Despite good intentions, "most people don't pay much attention to solid waste issues. Pocketbook concerns are what really matter." The key, said Mercer, is to design a program that will cost about the same or save money. In Loveland, the switch to variable pricing began with a pilot program serv- ing about 2,000 households three years ago. Loveland took the program city- wide (14.000 households) in April 1993. 160 ------- Table 3: Effect of Variable Rate Pricing on Illegal Dumping and Recycling Rates City Cities with notable problems Harvard, IL 113% Ithaca, NY Woodstock. IL Mt Pleasant. Ml Cities with minor problems Downers Grove. IL Perkasw. PA Lisle. IL Cities with no apparent problems High Bridge. NJ Chariemont, MA Antgo. WA Ilion. NY Rock Falls-Starling. IL Seattle. WA Population 5.600 35-40.000 15.000 30.000 46.000 7,000 19.500 3.600 1.200 8.500 8.800 29.500 495.900 Residential Landfill %Change -34% to -31% -31% -31% -44% -49% -54% -53% -18% -37% -50% •51% •65% • • Recycling % Change 63% NA 141% 88% 156% NA 3% NA 146% 141% NA •• " Seattle reported no apparent problems with illegal dumping, but did not report changes in waste genera- tion or recycling changes NA=no applicable data Source "Under What Conditions Should Cities Adopt Volume-Based Pricing tor Residential SoM Waste Col- Darnel Slums. Master's Memo Study. Duke University. May 1991 City planners estimated that most resi- dents would probably use one 30-gallon bag per week, down from the previous two to three bags per week A year into the full program, studies verify that the average set out is now about 0 88 bags per household per week Under the old program, residents were paying S3 75 per month for unlim- ited waste collection services: the city wanted to be sure not to come in too much over this for those households that were able to increase their waste preven- tion and recycling. The city decided that a rate of 75 cents per 30-gallon bag would encourage resi- dents to reduce and recycle while keep- ing per-household costs at a reasonable Getting Some Help To help Interested communities learn more about the process of planning, designing, and Imple- menting unit pricing programs, the U.S. Environmental Protection Agency has prepared a guide, "Pay-As-You-Throw: Lessons Learned About Unit Pricing." This guide provides detailed technical information on unit pricing based on the experiences of 11 communi- ties with programs in place. The manual (EPA 530-R-94-004) is free; to order, call the RCRA Hot- line at (600) 424-9346, or write to U.S. EPA, RCRA Information Cen- ter (5305). 401 M Street S.W.. Washington, DC 20460. level. Adding the cost for households that set out one bag per week ($3 25/month) to the fixed monthly fee for curbside and yard waste recycling services (S3 40/ month), (he total refuse and recycling ser- vice costs each household S665/ month—only 90 cents per month more than the old program. The system was started by selling bags at retail outlets for 75 cents each Despite some education efforts preceding the switch, residents began complaining almost immediately about the cost of the bags. They compared them to supermar- ket bags that cost just pennies apiece Loveland officials realized they had lo find some way to help residents make the connection between the cost of the bags and the town's waste collection services Loveland solid waste planners accom- plished this by changing from bags to tags and comparing the new tags to stamps—in effect, asking residents to "mail" their waste to the landfill A sin- gle "trash stamp" costs 75 cents and covers one 30-gallon bag. A 40 cent stamp also is sold lo those households that need just a 13-gallon bag. The stamp program helps handle bulky items, too To dispose of a couch, for example, residents are asked to call the solid waste office, describe the item, and are told how many stamps it will cost. A standard-sized sofa takes about 13 stamps—about $9 75 The adjustment the city made to meet criticism paid off After the first year of operation, a survey showed that 87 per- cent of residents gave the program a mark of good or excellent. All in the Family Another potential burner for communi- ties implementing unit pricing is to de- sign a program thai extends the waste re- duction incentive to residents of multi- family housing. In multi-family resi- dences (buildings with five units or more), tenants typically are asked to bring their waste to a central dumpster for col- lection. Since their garbage is combined, identifying the amounts of waste thai individual residents discard in order to charge accordingly can be difficult Mansfield, Connecticut, faced such a challenge Home to University of Con- necticut, Mansfield has a large studeni population living in multi-family hous- ing But the town has come up with a strategy to help extend unti pricing lo ihese residents. The town charges the landlords of multi-family housing a variable rate for the waste collected from their tenants Since these costs arc included in the rent, residents do not see what they pay for waste collection. So. Mansfield officials sought ways to show residents of multi-family buildings that waste reduction could bring them poten- tial cost savings For example, when a 60-umt condo- minium complex switched from its pri- vate waste hauling services to Mans- field's unit pricing program, town officials reviewed its waste management costs. It found that (he complex was overpaying for waste collection services The officials showed how the complex could actually save money under the program, if everyone cut down on waste generation and began recycling, the complex could actually save money under the program. And these savings could lead to a reduction in the condo- minium fees charged to residents, or at least prevent them from going up Another strategy to extend unit pric- ing to multi-family units is simply to include as many residents of multi-fam- ily housing as possible in your standard program In Long Beach. California, for waste collection purposes, the city con- siders residents in developments with 10 or fewer units to be single-family residences. These units are given the same containers and rate options as all other single-family households Kuhl. from the city's resources board, reports that tenants had few difficulties making the transition to the can-based unit pricing program, even in cases where these developments previously used a 22 SOLID WASTE TECHNOLOGIES/NOVEMBER/DECEMBER 1994 161 ------- central waste dumpster. Illegal Dumping: Enemy No. 1? When a community introduces the pos- sibility of unit pricing to its residents, one concern frequently mentioned is whether residents might dump waste illegally to avoid paying fees. Accord- ing to Henry Fisher, the Solid Waste Manager for McHenry County, Illinois, the first thing that should be understood is that illegal dumping has always occurred. In addition, although this is difficult to gauge, there is no evidence of a large-scale increase in illegal dump- ing due to of variable rate programs. McHenry County's experience is sim- ilar to that of many communities that have adopted variable rate pricing. A report by the Reason Foundation cited several multi-community studies that show illegal dumping is not a significant problem.1 Another study covering 14 cities reported no problem in six cities. Advertisement minor problems in four cities, and notable problems in four cities.2 Table 3 shows the effect of illegal dumping on recovery in these 14 cities. Since these communities do not use a standard methodology for gauging changes in waste generation and recycling rates, these data should be considered esti- mates. The extent of illegal dumping in the communities had either no effect or only a marginal effect on the effective- ness of the programs. Another study of eight cities show no dumping problems in seven of the eight cities.1-2 Tempering the Temptation Difficulties with illegal dumping can be addressed through a combination of enforcement and public education. One method McHenry County's Fisher sug- gests is to reduce residents' incentive to dispose of waste outside the system by adopting a multi-tiered rate struc- ture that includes a flat rate for a basic level of service and a modest per-unit charge for any additional waste col- lected. In this way, residents pay a direct price that is less than if the pro- gram relied entirely on per-unit charges for program revenue. And households also receive a certain level of trash col- lection they might perceive as free. (Residents pay for this basic service, of course, in the traditional manner—via taxes or flat fees.) With this combina- tion, individuals who might otherwise be tempted to dump waste believe the new prices are reasonable and are more inclined to participate. Loveland's Mercer agrees that illegal dumping is "perceived as a bigger problem than it really is." Where it does occur, illegal dumping in Love- land typically takes the form of indi- viduals leaving trash in commercial or apartment building dumpsters. To pre- vent this, Mercer's office conducted extensive public education about all aspects of unit pricing, including ille- gal dumping. The office also works hard to investigate complaints of viola- tions. Where illegal dumping is sus- pected, the office often finds the name and address of the violator in mail found in the trash. The individual is notified of the finding and warned that any additional violations will result in prosecution. "We haven't had any repeat violations yet," said Mercer. Other Forms of Beating the System When illegal dumping occurs, it com- monly takes the form of roadside 24 SOLID WASTE TECHNOLOGIES /NOVEMBER /DECEMBER 1994 162 ------- dumping or citizens dumping their trash in commercial dumpsters. Some- times, residents cut back on waste by dropping nonrecycable materials into recycling bins Long Beach. California, found an increase in contamination of recy- clables soon after implementing its variable pricing system for trash. To correct the behavior, the city did not collect the materials from any recy- cling bins containing nonrecyclable materials. Instead, collection crews attached notes to the bins that listed the program's recyclable materials and explained that residents could remove the nonrecyclables and call the city to reschedule the pickup—often on the same day. Since implementation of the policy, contamination of recycling bins has dropped dramatically. Another way residents have found to beat unit pricing systems is to compact their waste to fil as much trash into fewer bags or smaller cans Loveland dealt with this potential problem by es- tablishing a 50-pound maximum weight for trash bags set out for collec- tion Besides providing more accurate estimates of waste collected, (his pro- tected sanitation workers. When over- stuffing does occur, the collection crew leaves a note for the resident, explain- ing why it didn't collect the waste and inviting the resident to call with any questions. Changes in the Office Some communities find that changing to unit pricing for solid waste also brings increased administrative demands, in- cluding the need for additional personnel or equipment Communities can structure programs to minimize these demands. In Loveland. one reason why planners decided upon the "postage stamp" con- cept was the low overhead in such a sys- tem Several stores in town agreed to sell the stamps with no mark-up As a result, the city has few additional expenses asso- ciated with stamp sales and distribution. Loveland simply bills the stores monthly for the stamps they sell. Only one addi- tional person has been hired—a customer service person used to answer questions that come in by phone. Making the Move To make the move to unit pricing, com- munities should take steps ahead of time to deal with potential barriers—before they become a problem In addition to the issues discussed here, there inevitably will be other, community-specific con- cerns that need to be addressed. Accord- ing to communities with variable rate programs, however, these issues are manageable and that switching to unit pricing is worth investigating • Inquiries about this article should be directed to the RCRA Hotline. (800) 424-9346. Notes: 'Skumatz, L, "Variable Rates for Municipal Solid Waste Implementa- tion Experience. Economics, and Legislation," June 1993, Reason Foundation, Los Angeles. California 2Blume. D., "Under What Conditions Should Cities Adopt Volume-Based Pricing for Residential Solid Waste Collection1'" Master's Memo Study, Duke University, May 1991. Advertisement SOLID WASTE TECHNOLOGIES/NOVEMBER/DECEMBER 1994 25 163 ------- Using volume-based user fees in rural areas: How do they work? Implementing volume-based user fees in rural locales is easier, and more successful, than conventional wisdom would have us believe. bv William M. Park As the "solid waste crisis" has unfolded over the last five to 10 years, most attention has been focused on urban and suburban areas, where huge volumes of solid waste and re- cyclables must be managed. Naturally then. discussions of the role of user fees in solid waste management, particularly volume- or weight-based fees, have centered on their im- plementation within a context of door-to-door garbage and recycling collection. Bui in some sense, collection of solid waste and recyclable* in rural communities through a drop-off sys- tem poses an even greater challenge, partic- ularly from the standpoint of financing this public service and providing incentives for source reduction and recycling Historically, rural communities have faced relatively low solid waste management costs that in most cases were funded by general property taxes. But times have changed. Fed- eral landfill regulations and state mandates for more comprehensive collection systems and diversion of materials from landfills through recycling or other means have changed the situation dramatically, exacer- bating the inherent difficulties of small total population bases and low population densi- ties that rural communities face. Costs have risen to the point that they rep- resent a major claim on rural community bud- gets. Rural counties, often tagged as the "re- sponsible unit of government" in state solid waste management legislation, are in a par- ticularly difficult situation. Because low pop- ulation densities limit the incentive to private haulers to serve residents in outlying areas. many rural counties have gotten into the col- lection business by converting old landfill sites to transfer stations primarily for self- haulers or by implementing what is typical- ly called a "convenience center" system. Such a system involves a number of conveniently located sites with access controlled during open hours by an attendant, where residents can drop off their household garbage and per- haps separate out a number of recyclable ma- Willlam M Park is professor ot Agricultural Economics and is affiliated with the Waste Management Research and Education Institute ai the University of Tennessee in Knoxville. The research was con- ducted while the author was a visiting professor in the Western Rural Development Center at Oregon State University, in conjunction with the National Rural Studies Committee, a project sponsored by the Kellogg Foundation. Reprinted by permission from Resource Recycling, P.O. Box 10540. Portland, OR 97296-0540. 503-227-1319. 165 ------- tenals. As such, the question naturally aris- es about whether volume-based user fees (VBUFs) could, or should, be implemented within such u system According to conventional wisdom, the answer to this question is, "No." Rural solid waste managers and elected officials may readily acknowledge the two basic arguments in support of volume-based user fees, name- ly the equity of households paying in pro- Advertisement Volume-based fees: A recycling incentive • Residents can reduce volume-based user fees by separating recyclable materials from waste. • Backyard composting allows resi- dents to control their user fees. , • Special wastes (yard debris, white goods, furniture, tires, etc.) are usual- ly accepted at drop-off sites at a • nominal cost, or none at all. portion to the amount of solid waste they gen- erate and the incentive such fees offer for source reduction and recycling. However, most would be equally quick to point out that volume-based fees may encourage some res- idents to employ inappropriate disposal meth- ods, e g. illegal dumping or on-site burning or burying They would also likely express concern about other possible political and ad- ministrative impediment!). This conventional wisdom is reflected as well by the absence of any explicit attention to the rural drop-off collection context in the several local decisionmaker guides to unit pricing that have been published in recent years The purpose of the research reported upon in this article is to call into question this conventional wisdom by assessing the expe- rience of several rural communities that have implemented volume-based user fees within a drop-off collection context The First step involved identification of what are considered to be successful exam- ples A June 1993 article in Resource Recy- cling ("Community adoption of variable rates: An update") indicated the number of "van- able rate pricing" programs by state as of ear- ly 1993. Contact was made with slate agency personnel in those stales with the highest num- ber of programs, as well as other persons knowledgeable about rural solid waste man- agement across the country Eventually, this process yielded six exam- ples within a drop-off context that varied with respect to geographic and demographic char- acteristics of the jurisdiction, as well as char- acteristics of the user fee system. Once this set of six was finalized, a Five-page questionnaire was sent to the person most closely .involved with administration of the solid waste man- agement system and was used as an outline for an extensive telephone interview Contact was also made with elected offi- cials or others in each community who could provide some perspective on either the polit- ical and administrative considerations in im- plementing the user fee system or the impacts of the system, both positive and negative. This article provides a summary of compa- rable information from all six case studies. More detailed information on each case study will be included in a comprehensive report to be published later Characteristics Information on the basic geographic and de- mographic characteristics for each jurisdic- tion is presented in Table I This information demonstrates the wide variation across the ju- risdictions with respect to land area, popula- tion, population density, and the estimated percentage and number of residents who use the drop-off system. The jurisdictions portrayed here consid- ered user fee system!* for a few months to more than two years before they were im- plemented Before user fee systems were im- plemented, waste management was funded Resource Recycling January I99S Advertisement 166 ------- ^^U^^fl Geographic and demographic characteristics Jurisdiction Dubois Type of jurisdiction County State Indiana Area (square miles) 433 Total population 36,600 Population density (per square mile) 85 Population, percent using drop-off sites 50% Total population using drop-off sites 1 8,300 ( I ) Volume-based user fees implemented by Source: William M. Pink, 1994. Houston County Minnesota 576 18,500 32 35% 6,500 Lane County Oregon 4,620 298,000 65 50% 149,000 Monroe County(l) Wisconsin 915 37,300 41 20% 7,500 Eft County Georgia 269 35,000 130 45% 15,800 Weathersfield Town Vermont 50 2,700 54 75% 2,000 1 1 towns within Monroe County. by general property tax revenues in four cas- es, a serial property tax levy in one case and a flat per parcel assessment in the other. Al- though the administrative and political as- pects of the consideration and implementa- tion period vary across the cases, and in every case represent an interesting story, space lim- itations do not permit a detailed discussion of each one. A common element, however, was a concerted effort to publicize plans to im- plement the user fee well ahead of time and to educate residents as to the need and logic font Another commonality was that significant changes were made in the solid waste man- agement system at the time user fees were implemented. Dubois County. Indiana and Tin County, Georgia convened an existing waste collection drop box system to a con- venience center system, and recycling op- portunities were initiated. In Houston Coun- ty, Minnesota, collection of solid waste and recyclable materials was provided by the county for (he first time In Lane County, Oregon, existing transfer sites were secured, recycling was expanded and a recycling cred- it was introduced. In general, towns in Mon- roe County. Wisconsin implemented user fees at the time small individual town dumps were closed and were convened to transfer stations When the Town of Weathersfield, Vermont initiated user fees, it also expanded its set of recyclable materials collected. The basic characteristics of each user fee system are summarized in Table 2. All ex- cept Lane County were implemented between 1990andl992. In terms of the "type" of sys- tem, two require purchase of a special bag, two require purchase of a token or sticker to attach to the residents' own bag, and two re- quire cash payment at the drop-off site for the residents' own bags. Convening the fees to a consistent basis indicates a range of$0.50 to $2 00 per 30-gallon bag Although none of the systems charge for recyclables, Hous- Table 2 Jurisdiction I User fee systems: Basic elements Date initiated Type of bag Fee mechanism Fee per unit of volume Minimum fee Credit or payment for recyclables Fee paid at drop-off sites Fee paid at municipal offices Fee paid at stores .- Dubois April '91 Own Sticker$.75/45-gal. $0.75 No Yes Yes No 33% Houston Oct. '91 Own Cosh July '80 Own Cash '90-'92 Purchased Bag$1.30/30-gal.(l) $2.00/32-gal.(2)$1.10/33-gaI. $1.30$6.00 $1.10 Percentage of total cost covered by fee General property tax funding Yes Rat assessment No Buy-back for aluminum Yes No No 26% Yes$.75/HH/month $1.50 credit for 10 Ibs. + Yes • No No 100%(4) No No No Yes Yes No Variable Yes No Jjfi Oct.'92 Purchased S1.50/38-gal.(3)$0.45 No No No Yes 63% Yes No Weathersfield July '91 Own Token $l.00/30-gal.$1.00 No No Yes Yes 57% No $25/parcel/year Gal. = Gallon. HH = Household. (I) Or$.07 per pound. (2) Other rates: $12 per pickup load or$5 per cubic yard. (3) Other bag sizes and fees: $.45 per 8 gallon and$.75 per 16 gallon (4) Although the solid waste management system is self-supporting overall, the rural drop-off collection component is "subsidized" to some extent by other system components. Source: William M. Park, 1994. Resource Recycling January 19951 167 ------- ton County buys hack aluminum and Lane County offers a S1.50 credit tor users who separate out at least 10 pounds of reeyclables per visit. With regard to overall solid waste man- agement system financing, only Lane Coun- ty covers all of its solid waMe management system costs with user fees, although landfill tipping fees do. to some extent, subsidi/.e the system of drop-off sites that serve primarily rural self-haulers. VBUFs in the other sys- tems cover from 26 to 63 percent of the total solid waste management system cost, with the remainder covered by ud valorem prop- erty taxes in three cases, an annual per parcel assessment in one case, and a combination of property taxes and a monthly per household assessment in the other. These "hybrid" fi- nancing strategies allow per bag fees to be kept at the relatively modest levels noted above, thus limiting the incentive for inap- propriate disposal. Reeyclables and special wastes Discussions of volume-based user fee s"ys- tems typically emphasize the importance of providing households with an opportunity to reduce their costs by separating materials lor recycling. Together with source reduc- tion options such as backyard composting. VBUFs allow residents some degree of con- trol over their "garbage bill" and can con- tribute to pub- lic acceptance of a user fee system The si x pro- grams present- ed here accept a wide variety of recyclable materials. The basic five ma- terials — alu- minum cans, glass contain- ers, steel cans. old newspapers and old corru- gated contain- ers — are ac- cepted in all of the systems, and five systems accept plastics, magazines and at least one additional type of paper Given the variation across the jurisdictions with respect to land area and population, one would expect variation as well in the opera- tional characteristics and technologies used within the systems. As indicated in Table 3, this is indeed the case, with the number of Since 1980. Lane County, Oregon has charged user fees and given recy- cling credit* at its rural transfer stations, such as this one in Creswell. sites ranging from one to 15, the number of hours open ranging from about 10 to 80, and the tonnage of recyclable materials handled per site in 1993 ranging from 43 to 275 tons. Technologies used for collecting and trans- porting materials and arrangements for proc- essing and marketing also vary widely, as does the role of private sector firms in relation to these activities. Advertisement Resource Recycling January 168 ------- •JfflU^Xl Recycling system characteristics Jurisdiction Number of drop-off sites Hours open per week Average tons of recyclable materials per site in 1993 Containers for recyclables Transportation of recyclables Processing and market- ing of recyclables Dubois 8 14-32 52 4 cy. dumpsters County trucks Local salvage yard Houston 5 12 N.A. 20 cy. closed top w/compartments County trucks County MRF Lane 15 10-60 275 90 gal. wheeled carts Private contractors Private firms Monroe 1 per town 8 Variable Variable Private haulers Private firm Tjfl 7 36-80 43 Trailer with compartments County trucks County MRF Weathersfield 1 11 220 Bunkers and Gaylords Variable Town baler N A = Not available. Cy. = Cubic yard. MRF = Materials recovery facility. Source: William M. Park, 1994. Recommendations by solid waste man- agement professionals regarding treatment of special wastes such as yard debris, white goods, furniture and tires generally empha- size the importance of providing timely, con- venient and low-cost options for disposal Al- though the ways these special wastes are han- dled vanes across the six systems, most ac- cept (hem at no or nominal cost at one or more drop-off sites, thereby limiting any incentive for residents to do something inappropriate with items or materials of these sorts. Positive impacts While volume-based user fees are often jus- tified on equity grounds, one would certain- ly hope that they would reduce the amount of solid waste requiring disposal, as a result of the incentives provided for separation and source reduction efforts on the pan of resi- dents. Although the information available on this subject was somewhat uncertain and dif- ficult to interpret in most cases, there is a good bit of evidence to suggest that the incentives provided by these user fee systems are mak- ing a significant difference. While definitive "before and after" figures isolating the effect on solid waste tonnages requiring disposal were lacking, there was ev- idence of small absolute reductions in three cases In one other case, solid waste tonnage stayed roughly constant even though signif- icant economic and population growth was taking place. Reported increases in tonnage of recyclables collected account for pan of the decreases in disposal tonnage, but it is im- possible to know how much of the remain- Advertisement Resource Recycling January 1995 169 ------- Table 4 Jurisdiction Participation in recycling (1) Recyclables recovered (2) Diversion/recovery rates (3) der of the decreases were due to actual source reduction efforts motivated by the VBUFs and how much was due to other factors. Although it was dif- ficult to calculate a valid diversion or recovery rate for the rural drop-off systems alone, as noted in Table 4, three counties had computed county- wide rates for state re- ports that ranged from 20 to 34 percent. In ad- dition, information from the Town of Weathers- field indicated a diver- sion or recovery rate of about 29 percent Per capita amounts of recyclables collect- ed were computed in four of the cases, based on rough estimates of the number of people using the drop-off systems. For Dubois, Lane, and Tift counties, annual recovery ranged from 40 to 60 pounds per capita. For the Town of Weathersfield, approximately ISO pounds per capita were collected in 1993. For Houston and Monroe counties, only a coun- tywide generation rate could be computed, which thus included recyclables from curb- Measures of impact on recycling Dubois Houston Lane Monroe Tift Weathersfield 65% 45 N.A. 95% 146 34% 75% 59 28% N.A. 98 20-25% 38 NA 85% 148 29% N. A. = Not available. (1) Percentage of residents using drop-off sites for garbage disposal who separate out some recyclables, bused on careful head counts in Dubois and Tift counties and rough approximations elsewhere. (2) In pounds per capita in 1993. For typical set of residential materials, including aluminum and steel cans, glass, plastic and various forms of paper. For Houston and Monroe counties, only countywide tonnage figures were available. Thus, too- nageisdivided by total county population, including residents served by curbside recycling collection programs. In the oth- er four jurisdictions, tonnage collected only from dropoff sites is divided by the «ri"u»ftd population using the sites. (3) In percent in 1993. These diversion/recovery rates are jurisdictionwide and thus include materials collected in curbside re- cycling collection programs as well as items like white goods and yard waste. Exactly what is counted may differ some- what across cases. Source: William M Park, 1994. side recycling collection in some municipal- ities. Annual pounds per capita were 146 for Houston and 98 for Monroe. Finally, perhaps as useful an indicator as any of the impact of VBUFs in these case stud- ies is the level of participation in the separa- tion of recyclables, measured in percent. In two of the cases, participation had been care- fully monitored or tracked over a long period of time; in three others, an estimate was made on the basis of general observations by atten- dants and solid waste managers. The range across die five cases was 65 to 95 percent, with the average at 80 percent, which is relatively high compared to previous estimates for drop- off recycling systems elsewhere without vol- ume-based user fee systems. Problems As noted in the introductory section, con- ventional wisdom has it that user fee systems in a rural drop-off collection system context Advertisement \ResourceRec\cling January 1995 170 ------- ''arc likely to generate serious problems in the jform of increased illegal dumping and ^burning, as well as less senous ones such as .excessive compaction, use of pnvate com- mercial collection containers and out- of-junsdiction disposal. Although at least one of these problems was noted as minor in each of the systems studied, in no case did solid waste managers or elected officials view any problem as senous enough to undertake a fundamental reconsideration of the user fee system. It is good to keep in mind, however, that these assessments are admittedly sub- jective and are based on interviews with peo- ple closely involved with each system who may have some vested interest in portraying their system in the best light. In several cases, where an increase in ille- gal dumping occurred, a show of willingness to enforce applicable ordinances was appar- ently sufficient to reduce the illegal dumping fairly quickly to more usual levels. A typical approach has been to identify the responsible party from mail in household garbage and send a letter slating that cleanup is required by a certain date, with the threat of a modest fine if it is not done. Some counties have pub- lished names in the newspapers or required citizens to appear before a county judge. The increased burning in some cases was not nec- essarily looked upon as a problem, because burning of clean wood or paper is allowable in some rural areas, although concern was ex- pressed in some cases about burning of oth- er materials. To avoid any problems with ex- cessive compaction, Houston County insti- tuted a weight limit of 30 pounds per bag from the beginning. In several cases, minor prob- lems with use of pnvate commercial collec- tion containers were eliminated with the use of locks. lift County initially had some prob- lem with residents going across the county line to use unattended containers at a waste collection drop box system in a neighboring county, but those containers were soon relo- cated away from the county line. Another concern expressed often is that administration of a VBUF system in a rural drop-off context might be infeasible or pro- hibitively costly. Although minor adminis- trative adjustments have been made along the way in all of the systems, in no case were (he basic administrative changes major impedi- ments. In addition, in most cases adminis- trative costs were not increased substantial- ly, because the commitment had already been made, quite separately from the VBUF ques- tion, to have attended drop-off sites. Costs associated with sale of the bags, stickers or tokens have been minimal, and no billing sys- tem is required in any of the systems. Conclusions Although VBUFs may not be the most ap- propnate financing strategy for all rural ar- eas, the experience of these rural counties and towns warrants the following conclusions. Implementing a volume-based user fee sys- tem in a rural drop-off context appears feasi- ble across a wide range of geographic and de- mographic conditions, as well as a wide range of system characteristics, without prohibitive administrative problems or costs. Most residents appear willing to support (or at least accept) a volume-based user fee system if they are well informed of the need for and logic of the system in advance, and are given reasonable options for gaining some measure of control over their total bill. Hy- brid financing strategies allow per-bag fees to be kept at modest levels. Support comes more easily if VBUFs are initiated at the time of a significant enhancement of the collec- tion system. VBUFs within rural drop-off collection systems appear capable of motivating rela- tively high levels of participation in the sep- aration of recyclables, thus contributing to relatively high per capita generation rates for typical recyclables and countywide diversion or recovery rates At least minor problems with increased il- legal dumping and burning can be expected, but a show of willingness to enforce ordi- nances against such practices can lead to fair- ly quick subsidence. RR i . Advertisement Circle 203 on RR service card Re source Recycling January 1995 171 ------- Annotated Bibliography lanners considering pay-as-you-throw may want to conduct additional research to help them learn more about how these programs work. This section includes an annotated bibliogra- phy and an additional list of references to help facilitate your research. Compiled in the following bibliography are over 50 recent articles that appeared in a variety of publications, from solid waste trade magazines to reports from universities and private institutions. The entries in this bibliography were selected to help provide a com- prehensive review of the economic, environmental, and legislative issues surrounding pay-as-you-throw. A number of articles analyze the impact of pay-as-you-throw on waste reduction amounts and recycling rates. Other studies examine the financial benefits of pay- as-you-throw as a solid waste management strategy for municipali- ties. A few articles identify successful public outreach and education mechanisms used by particular communities when instituting their pay-as-you-throw programs. In addition, if you find additional resources on pay-as-you-throw in the course of your research, you can three-hole punch a sheet of paper with those references and add it to this section. This bibliography was developed by Marie Lynn Miranda of Duke University as part of a research project on the impact of pay-as-you- throw programs. 173 ------- Pay-As- You-Throw Annotated Bibliography Adamec, Barbara. "Volume-Based Collection Fees: A Success Story." Resource Recy- cling. March, 1991. A review of the unit pricing program in Lisle, Illinois. The community's variable rate sys- tem has successfully increased recycling participation and reduced waste generation with- out significant problems. The author based her conclusions on a survey of 100 residents. She divided the respondents into'four socio-economic groups and found that recycling participation was high across all groups, but that average set-out levels seemed to rough- ly increase with income. She also found that the average decrease in garbage from 1989 to 1990 was 53 percent, with 63 percent in the highest month (August) and 38 percent in the lowest (October). The average loss in total volume was 31 percent, with 46 percent in the highest month (August) and 8 percent in the lowest (October). Albrecht, Oscar W. "An Evaluation of User Charges ,for Solid Waste Collection and Disposal." Resource, Recovery and Conservation. Vol. 2.1976/1977. An early introduction to the concept of user fees for waste collection services. Variable rates, like effluent charges for air and water pollutants, provide a pricing incentive to reduce the amount of garbage generated. A University of California study estimated the price elasticity of demand for solid waste service at 0,44, and an analysis by the City of Chicago found that waste production had a per capita income elasticity of 0.53. The key question with unit pricing is: will it result in lower system costs and higher net benefits than other pricing systems. Other questions include: does unit pricing lead to other dis- posal activities, including burning and Uttering; and, does unit pricing affect household choices of service levels? Alderden, Jim. "Volume-Based Rates, Dream or Nightmare?" Recycling Today. November, 1990. Unit pricing has been shown to encourage recycling and reduce the amount of municipal waste collected. Communities utilizing variable rates have reported an average reduction in garbage of 28 percent, with a range of 25 percent to 50 percent. It is also fairer to those that produce less waste. The downside of unit pricing is that it can encourage illegal dumping, especially at the beginning of the program, and lead to insufficient revenue for waste haulers. McHenry County, Illinois, had problems with residential garbage being thrown into commercial dumpsters. Blazier Disposal'in Harvard, Illinois, set its rates based 175 ------- on on estimated pickup of 1.6 bags per household and it only got 1.2 bags, leaving it short of revenue. Issues to consider include the demographic mix of the community, whether it is urban or rural, the level of community environmental awareness, the recydables that will be collected, whether adequate revenue will be generated, and whether the program will be voluntary or mandatory. Andresen, Katya. "Communities Weigh Merits of Variable Rates: Residents' Fees for Garbage Disposals." World Wastes. November, 1992. A review of volume-based programs, experiments with weight-based fees, and technologi- cal innovations in waste collection. The author spoke with several solid waste profession- als and academics who have studied variable rates, including Lisa Skumatz and Glen Morris. She summarized different system options, and reported on the success of unit pricing in Santa Maria, California, Seattle, Washington, Perkasie, Pennsylvania, and ///on, New York. Weight-based systems have been tested in Seattle, Washington, Farmington, Minnesota, and Durham, North Carolina. Charging by weight, while more difficult to implement, would provide a more accurate pricing signal to residents than vo/ume-bosed fees. Illegal disposal is a significant concern with unit pricing, but the problem can be headed off by providing free drop-off days, locking commercial dumpsters, and strictly enforcing anti-dumping ordinances. Technological developments, like bar coding cans, make waste collection easier and cheaper. Concerns about accuracy can be addressed by high standards and hauler education. Bender, Rodd; Briggs, Wyman; De Witt, Diane. Toward Statewide Unit Pricing in Massachusetts; Influencing the Policy Cycle. Master's Degree Project. John F. Kennedy School of Government. January, 1994. The /Massachusetts Executive Office of Environmental Affairs advocates unit pricing for municipal solid waste collection, but the decision to implement variable rates is up to localities. This study is an effort to judge community perceptions of unit pricing. The authors found that financial concerns (such as the cost of waste disposal or the solvency of the collection service), a desire to encourage recycling and reduce waste, and grass- roots lobbying efforts are all factors that can put unit pricing on a community's agenda. The study showed that the three biggest problems with unit pricing are: citizen percep- tions that trash service should be free, failure to recognize the benefits of unit pricing, and fears about negative side effects, such as illegal dumping and customer resistance. The Massachusetts Department of Environmental Protection and MassRecycle support unit pricing at the community level by, among other things, functioning as information clearinghouses and addressing community concerns in statewide seminars. 176 ------- Blume, Daniel. Under What Conditions Should Cities Adopt Volume-Based Pricing for Residential Solid Waste Collection? Master's Memo, Institute of Policy Sciences and Public Affairs, Duke University. May, 1991. A study of 14 communities with unit pricing programs. The study showed that these sys- tems reduced the amount of garbage produced in those cities and increased recycling activity with few significant problems. The paper also explored different features of unit pricing and their effectiveness, and assessed factors that would determine whether unit pricing was appropriate for a given community. Browning, Marilyn; Becker, Jeanne. Volume-Based Garbage Collection Fees: An Analy- sis of Ten Illinois Programs. A Report Prepared by Becker Associates, Inc. Novem- ber, 1990. A summary of the structure and components of 10 unit pricing programs in Illinois. A sur- vey of solid waste officials in each of the 10 communities found that the use of commer- cial dumpsters for residential waste was, on average,,the most significant problem, receiving an average score of 2.9 on a scale of 1 to 5. The next most significant problem was insufficient revenue, followed by roadside dumping, uneven cash flow, and excessive garbage compaction. These problems can be addressed through better citizen education, locks on commercial dumpsters, the use of a minimum fee to cover fixed expenses, tougher enforcement ofanti-littering provisions, and strict limits on the weight of a pre- scription container or bag. Canterbury, Janice. Pay-As-You-Throw: Lessons Learned About Unit Pricing of Munici- pal Solid Waste. EPA Office of Solid Waste. EPA530-R-94-004. April, 1994. In December 1992, the EPA's Unit Pricing Roundtable met to discuss variable rates for waste collection. The result of that meeting is th/s guide for communities considering unit pricing. Before adopting variable:rates, a community needs to consider its waste manage- ment needs and whether the potential benefits of unit pricing, reduced waste, increased recycling, pricing equity, and greater environmental awareness will meet those needs. A community also must be aware of potential problems with unit pricing, including illegal dumping, higher costs, service to multi-unit housing complexes, and citizen resistance. When designing a unit pricing system, a community must decide among container options, set a pricing structure, create a billing system, and design program options. Implementation of unit pricing must be accompanied by public educational and out- reach, and program monitoring. The report contains a number of brief case studies and information about specific programs, and a roundtable discussion with a number of unit pricing experts. 177 ------- Cargo, Douglas R. Solid Wastes: Factors Influencing Generation Rates. Research Paper No. 174. Chicago, IL, University of Chicago Department of Geography. The author analyzed the 7968 National Survey of Community Solid Waste Practices to determine actual amounts of waste generation. The survey assessed household and com- mercial waste generation. Cargo found that the actual amounts of waste generation were larger than EPA estimates. After employing regression analysis to determine the effects of socio-economic variables on waste generation, he found that "greater solid waste gen- eration rates occur in areas with large populations, with high densities, and occupied by lower-income groups." While generation rates increase with city density and city popula- tion size, they decrease with income. Chua, Dale H.H.; Laplante, Benoit. Litter and Waste Management: Disposal Taxes, User Charges, and Penalties. April, 1991. The authors expand upon Ian Dobbs' 1991 report, which recommended a combination of disposal fees on commercial products that would incorporate the potential cost of lit- tering and of refunds for proper disposal of product waste. This report advocates the addition of penalties for littering to further encourage the proper disposal of waste. It is a completely theoretical piece that bases its findings on an economic model. Cuthbert, Richard. "Variable Disposal Fee Impact." Biocycle. May, 1994. Six cose studies of unit pricing programs in Portland, Oregon, Seattle and Tacoma, Wash- ington, Wilkes-Barre, Pennsylvania, and Bothel and Minneapolis, Minnesota. The article described the structure of each program. The case studies were the result of a random 80-c/ty survey conducted by the author. Forty of the survey cities were large (100,000+) and 40 had populations between 50,000 and 100,000. Sixty-eight percent had city-run waste service, and 32 percent contracted out to a private hauler. Thirty-five percent financed their service from property taxes. The other 65 percent used fees, and 13 of those, or 16 percent of the survey group, had variable rates. The general conclusions of the case studies were that unit pricing encourages waste reduction, that residents were accepting of the variable rate systems, and that variable rates supported other waste reduction activities, such as recycling. Dinan, Terry. "Solid Waste: Incentives That Could Lighten the Load." EPA Journal. May/June, 1992. Faced with increasing per capita waste generation and growing waste disposal costs, the United States should consider pricing systems that provide an incentive to reduce garbage. Unit pricing and disposal taxes ore two such systems. Unit pricing enables 178 ------- households to save money by limiting the amount of garbage they put out for collection. A study of three variable rate programs in Perkasie, Pennsylvania, ///on, New York, and Seott/e, Washington found that t/ie amount of waste landfilled or incinerated could signif- icantly decrease. The author provided no specific figures. Dobbs, Ian M. "Litter and Waste Management: Disposal Taxes Versus User Charges." Canadian Journal of Economics. February, 1991. An examination of user charges and disposal taxes as waste management techniques. The author recommends a strategy that employs a combination of each. A user fee would recover the marginal cost of waste disposal, while a disposal tax with a refund for proper disposal would significantly reduce the potential for illegal dumping. The article is completely theoretical and bases its conclusions on an economic model. Efaw, Fritz; Lanen, William. Impact of User Charges on Management of Household Solid Waste. Report prepared by Mathtech, Inc. August, 1979. The authors conducted case studies of five communities (Burbank and Sacramento, Cali- fornia, Provo, Utah, Grand Rapids, Michigan, and Tacoma, Washington) to determine the effect of particular pricing systems for solid waste collection on waste generation. The report contains in-depth descriptions of each community's systems, three of which, those in Sacramento, Grand Rapids, and Tacoma, have some variable rate component. The authors concluded that while choices between types and levels of sanitation service may be sensitive to price, the quantity of waste generated at the household level may not be sensitive to price. In Tacoma, residents had a high price elasticity of demand with respect to the number of cans or the choice of backdoor pickup, but because of the availability of waste drop-off centers, the price elasticity of garbage production was not significant/y different than zero. The same was true in Grand Rapids and Sacramento. The report also found that as household income increases, so does the quantity of garbage produced. Emmer, Terri; Neidhart, Jim. An Analysis of the Effects of Volume-Based Waste Dis- posal Fees on Consumer Behavior. Department of Resource Economics, Universi- ty of New Hampshire. The authors of this report surveyed residents of Dover, New Hampshire, to determine the effect of Dover's variable rate system on consumer behavior. The report concluded that unit pricing led to higher recycling participation rates and lower waste generation in Dover. The survey also found that while there was initially a wide range of consumer atti- tudes about recycling, 6 months into the program there was a convergence of attitudes and a more uniform level of commitment to the program's goals. 179 ------- Enos, Gary. "Residents Clean Up With Waste-Cutting Incentive." City and State. Feb- ruary 25, 1991. A study of three areas (Bellevue, Washington, Lansing, Michigan, and the state of Rhode Island) that have either implemented or are considering implementing a variable rate sys- tem. Bellevue and Lansing reported success with their systems. In Bellevue, more resi- dents switched to a smaller can, and in Lansing, the amount of waste sent to the city landfill fell by nearly 20 percent. The only difficulties with the system in either city involved setting the rate structure and concern that if too many customers reduced their waste too much, the waste haulers would not receive enough revenue to operate. Fletcher, Jeff. "Why Unit Pricing Makes Sense for Solid Waste: U.S. Environmental Protection Agency Project." Nation's Cities Weekly. October 19, 1992. This article concerned EPA's plan to run a unit pricing demonstration project. At that time, the Agency was looking for communities interested in participating. The author con- tends that variable rates send a more accurate pricing signal to waste generators than traditional flat rate systems and encourage garbage reduction. They are also fairer than flat rate systems, because residents that produce less garbage pay lower collection costs. Folz, David H. "Recycling Program Design, Management, and Participation: A National Survey of Municipal Experience." Public Administration Review. May/June, 1991. The author conducted a survey of 264 recycling coordinators to determine what factors influence citizen participation in recycling programs. The study identified eleven specific operational policies, of which variable rates for garbage collection was not one. The sur- vey showed that allowing public input during the planning and design process, mandating recycling participation, providing curbside service and free bins, and utilizing public edu- cation programs all contributed to higher participation rates. Same-day recycling and garbage pickup, and permitting commingling did not seem to significantly impact partici- pation rates. Fullerton, Don; Kinnaman, Thomas. Garbage, Recycling, and Illicit Burning or Dumping. National Bureau of Economic Research Working Paper # 4374. May, 1993. Analysis of an economic model of household waste disposal behavior shows that given three disposal options, collection, recycling, and illicit disposal, a unit fee would lead to some burning or dumping. However, a disposal tax on products, coupled with rebates for proper waste disposal, would encourage legal disposal of garbage. The study is purely theoretical and involves no empirical data. 180 ------- Fullerton, Don; Kinnaman, Thomas. Household Demand for Garbage and Recycling Collection with the Start of a Price per Bag. National Bureau of Economic Research Working Paper # 4670. March, 1994. A survey of a random sample of 75 Charlottesville, Virginia, households measured house- hold garbage generation before and after the city implemented a unit pricing system. The survey found that white recycling increased 15 percent and the volume of garbage was reduced by an average of 37 percent, the weight of garbage was only reduced 14 percent. The authors concluded that residential trash compaction accounted for the dif- ference between the volume reduction and the weight reduction. The survey also showed that approximately 28 percent of the total reduction was accounted for by illegal dispos- al. The authors based this figure on respondents that .indicated they used "other means," as opposed to recycling, composting, and demanding less packaging at stores, to reduce their waste. Goldberg, Dan. "The Magic of Volume Reduction." Waste Age. February, 1990. Unit pricing has led to reduced levels of garbage and increased recycling participation in i several communities that have adopted the pricing system. In St. Paul, Minnesota, house- hold participation in the recycling program increased on average from 15 percent to 32 percent. In Olympic, Washington, there was a 50 percent increase in the number of resi- dents utilizing a smaller can. Illegal dumping is a potential concern with a unit pricing sys- tem, but it has not been a problem in Perkasie, Pennsylvania, or Seattle, Washington. Generally, problems with the system appear when it is first implemented, and they can be quickly corrected. Finally, 93 percent of Perkasie residents who were asked their opin- ion of unit pricing approved of the system. It has met with similar citizen satisfaction in other communities. Harder, Greg; Knox, Linda. "Implementing Variable Trash Collection Rates." Biocycle. April, 1992. Variable rate systems in 36 Pennsylvania communities have shown success at reducing garbage generation and encouraging recycling. Citizen education at the outset of a unit pricing program is a critical element of the system. Communities should a/so be aware of the potential for backyard burning or illegal dumping,* and take proactive steps to prevent such behavior. Other problems common to the 36 municipalities in this report were: bags that tear or are attacked by animals, tags that fall off, illegal grass dumping, service to apartments, and the use of counterfeit bags. The authors present case stud»'es of Carlisle, Perkasie, and Forest City. They also describe the failure of unit pricing in Nanticoke, which lost 68 percent of its municipal customers when it switched to variable rates. The failure seemed largely due to the lack of a curbside recycling program in the town. 181 ------- Hayes, Jeffrey. "Let the Market Replace the Madness: How to Control Rising Solid Waste." Public Works. December, 1992. The author advocates variable rate pricing as a tool to reduce waste. Variable rates not only encourage recycling, but they also induce garbage reduction, a preferable waste management strategy. Under unit pricing, Somersworth and Dover, New Hampshire, have reduced their residential waste by 50 percent. The structure of variable rate sys- tems vary with different receptacles and different pricing schemes. Hong, Seonghoon. An Economic Analysis of Household Recycling of Solid Wastes: The Case of Portland, Oregon. Ph.D. Dissertation. Department of Agriculture and Resource Economics. Ohio State University. November 21, 1991. The outhor designed a model of household waste generation behavior and applied it to Portland, Oregon, to see how a marginal pricing system, as well as other socio-economic /actors, affect recycling behavior and the demand for garbage collection services. The analysis showed that increasing the price of collection increased household recycling par- ticipation, but did not significantly reduce demand for garbage collection services. Educa- tion level and value of time were also significant factors influencing households' degree of recycling participation. Income was a determinant of total waste generation, but demand for collection services was inelastic with respect to income. Jenkins, Robin. The Economics of Solid Waste Reduction. Edward Elgar Publishing, Ltd., 1993. This book grew out of Jenkins' dissertation on the same subject. The author presents a model for residential waste generation that shows that user fees can have a significant impact on the level of waste generation, and that society's welfare gain from switching to unit pricing is substantial. The book also looks at commercial generation of solid waste and concludes that increasing already existing unit fees can have a significant impact on waste generation levels. The book contains a literature review, models of household and firm waste generation behavior, demand equations for residential and commercial waste collection services, descriptions of the elements of the model, and the results of manipu- lating the model. The author studied five unit pricing communities (San Francisco, Cali- fornia, Estherville, and Highbridge, New Jersey, and Seattle and Spokane, Washington) and four flat fee communities (Hillsborough County and St. Petersburg, Florida, Howard County, Maryland, and Bernalillo County, New Mexico). 182 ------- Kemper, Peter; Quigley, John M. The Economics of Refuse Collection. Ballinger Pub- lishing Company, Cambridge, MA. 1976. The authors provide a general overview of the economic issues in waste collection. Chapter five surveys the issues involved in a system employing user charges. They compare user charges to two other financing mechanisms: general revenues and service fees. The chapter addresses efficiency in theory, equity, federal income tax deducibility, revenue from tax- exempt institutions, and efficiency in practice. The authors note that "true user charges are rare" and do not provide much empirical evidence of the issues they discussed. Lambert, Abigail F. Rate Proposal for a Weight-Based Pricing System for Residential Waste Collection in Durham, North Carolina. Master's Project, School of the Environment, Duke University. 1991. The author contends that the city of Durham, North Carolina, which currently funds resi- dential garbage collection through general property tax revenues, ought to consider implementing weight-based rates to finance its collection service. Weight-based rates would send a more accurate pricing signal to city residents and might reduce waste and encourage recycling. Five issues that the city would need to be aware of before imple- menting a variable rate system are the need for political support and aggressive public education, the impact of variable fees on low-income residents, potential problems with illegal dumping, and necessary departmental changes. Lambert conducted an economic analysis of Durham's waste management system, considering collection costs, disposal costs, the added costs of a weight-based system, and estimated environmental and social costs. Based on this analysis, Lambert presented five options for a weight-based rate structure. She recommended a system that uses variable fees to cover landfill disposal costs, including environmental and social costs, and continues to finance the other costs of waste collection through property taxes. Such a system would give some price incen- tive to residents, but would still provide a stable revenue stream for the co/lection system. The author a/so recommended reduced rates for lower-income residents. Lewis, Thomas A. "Waste Not, Want Not." National Wildlife. June/July, 1993. As landfills across the country approach capacity, disposal costs rise, and per capita waste generation continues to increase, source reduction has become a top priority for solid waste managers. Recycling is gaining popularity, both among solid waste officials and private citizens. Unit pricing provides an inducement to recycle, and to reduce the amount of waste put out for co/tection. Seattle, Washington, and Perkasie, Pennsylvania, have both had successful variable rate systems. 183 ------- Menell, Peter S. "Beyond the Throwaway Society: An Incentive Approach to Regulat- ing Municipal Solid Waste." Ecology Law Quarterly. Vol. 17, 655.1990. Traditional pricing systems for garbage collection do not provide incentives for reducing waste or manufacturing products that produce less waste. The authors use an economic framework to analyze a variety of policy options for correcting this market distortion. The article provides an overview of the waste stream and available technologies for collecting and regulating waste, describes traditional flat rate or tax financed systems for funding waste disposal, and examines alternative methods, including curbside charges, retail dis- posal charges, and two-tier charges. According to the economic model, variable rate pric- ing and/or retail charges based on the disposal cost of different products are the best waste management strategies. They provide an accurate pricing signal to households and product suppliers. Local governments are best suited for designing the ideal solid waste regulatory system for their specific localities. The federal government can provide infor- mation and correct macroeconomic distortions, and the states can coordinate various local policies. The article is primarily theoretical, although it does briefly describe unit pricing systems in Seattle, Washington, and Perkasie, Pennsylvania. Miedema, Allen K. "Fundamental Economic Comparisons of Solid Waste Policy Options." Resources and Energy. Vol. 5. 1983. The author developed a macroeconomic model to analyze the effects of several waste management policy mechanisms. Miedema compared user fees, recycling subsidies, dis- posal charges, and litter taxes to the status quo (i.e., none of these policy mechanisms were in effect). He analyzed the real income effects, net waste effects, waste generation and resource recovery effects, and recycling rate effects for these four policy tools given three different policy scenarios (the scenarios varied according to hypothesized changes in the diseconomies of scale for recycled materials suppliers and virgin materials suppli- ers). He found that user fees and litter taxes always had the same effects. The disposal charge always had a larger real income effect and the smallest net waste collected and disposed. In two out of the three simulations, the disposal charge had the highest recy- cling rate, while the recycling subsidy had the highest recycling rate in the simulation characterized by greater diseconomies of scale for virgin materials suppliers. Miller, Chaz. "Pay as You Throw: Less Weight? More Stuffing!" Waste Age. Septem- ber, 1993. Unit pricing has been touted as a way for municipalities to encourage higher recycling par- ticipation and reduce household waste generation. However, the system can also encour- age overstuffing of garbage receptacles, illegal burning and dumping, and contamination 184 ------- of recycling receptacles with nonrecyc/oWe material. Can-based systems hove complicated billing requirements. On the other hand, bogs can tear and tags can be separated from set-outs. Furthermore, variable rates may be unfair to lower-income residents, and political support for unit pricing is lacking in many areas. The author contends that there is no con- clusive evidence that variable fees reduce residential waste generation. He bases most of his conclusions on anecdotal evidence and interviews with a few solid waste professionals. Minnesota Pollution Control Agency. State Solid Waste Policy Report: A Focus on Greater Minnesota. A review of Minnesota's waste management system. The report examines historical and contemporary statewide programs, county initiatives, industrial and residential waste gen- eration trends, waste collection and transportation systems, and collection system costs. The report also highlights public education efforts, and waste reduction, recycling, com- posting, waste-to-energy, and land disposal programs. Unit pricing is reviewed briefly, and St. Louis Park, a unit pricing town, is mentioned in the report. Miranda, Marie Lynn; Everett, Jess W.; Blume, Daniel; Roy, Barbeau A., Jr. "Market- Based Incentives and Residential Municipal Solid Waste." Journal of Policy Analysis and Management. Vol. 13, No. 4. 1994. The authors gathered waste generation data from 21 unit pricing communities. The data showed municipal waste generation before and after the implementation of variable rates. The overage reduction in tonnage of waste landftiled was 40 percent, w/th a high of 74 percent and a low of 17 percent. Recycling increased, on average, by 126 percent, with a high of 456 percent and a low of 3 percent. The average reduction in overall waste generation was 40 percent, with an average recycling rate of 19 percent. Even account- ing for illegal disposal and measurement error, the authors concluded that some of the waste reduction must have resulted from source reduction behavior. There were few problems among the 21 municipalities with illegal dumping. Burning was a problem in three of the cities, but it seemed to only account for about 20 percent of the total waste reduction. Burning stopped in Perkasie, Pennsylvania, when the city adopted an antiburn- ing ordinance. Moriarty, Patrick. "Financing Waste Collection for Maximum Diversion." Biocycle. Jan- uary, 1994. Illinois has set a statewide waste diversion mandate of 25 percent by 1996. The author sur- veys 23 municipalities in the Chicago area to determine how localities are responding to the mandate. Seven of the 23 communities have changed their rate structures since 1988, IBS ------- six of them adopting some form of variable collection fees. The average fee among the flat rate communities was $11.60, while the average per-bag fee in Downers Grove, Hoffman Estates, and LaCrange Park was$1.40. Thus, members of a household that put out less than two bags of garbage per week under the variable fee systems would spend less for waste collection than they would have under a flat rate system. The unit pricing communi- ties also had higher recycling participation rates than the flat fee communities, and higher percentages of total waste recycled. The average tonnage recycled for flat fee communi- ties was 18 percent, while for Hoffman Estates it was 31 percent and for Downers Grove it was 28 percent. The author also provided a case study of Hoffman Estates that described that community's program. Morns. Glenn E.; Holthausen, Duncan M., Jr. "The Economics of Household Solid Waste Generation and Disposal." Journal of Environmental Economics and Man- agement. Vol. 26.1994. The authors designed a model of household waste disposal behavior, taking into account various disposal options (including garbage pickup, recycling, and source reduction) and fee levels, both flat and variable. The simulation showed that households' elasticity of demand with respect to price for solid waste collection services varied significantly with the price of that service. Supported by actual waste and demographic data from Perkasie, Pennsylvania, the model showed that a typical household's utility was higher with variable rates than with a fixed rate system. Furthermore, as the user charge increased, households responded with greater waste minimization behavior and less recy- cling. Emphasizing one type of disposal option, recycling, for example, could dampen households' incentive to pursue another type, such as source reduction. "New Jersey Town Weighs in on Trash by the Pound: Mendham, New Jersey." World Wastes. February, 1993. This article presents an interview with the recycling coordinator of Mendham Township, New Jersey. Mendham switched to variable rates after its successful recycling program reduced residents' need for garbage collection services. The town went from two collec- tions to one each week and its households each saved an average of $200 annually. Recy- cling increased 83 percent, garbage was reduced 55 percent, and the town has saved money. The town has not experienced dumping or other significant problems. According to the coordinator, before adopting unit pricing, a municipality should consider whether a majority of residents will benefit financially from the system. The community might also want to consider having a base charge to cover fixed collection costs, and basing the vari- able rates on the city's disposal costs. 186 ------- Morris, James L. "Recycling and Computerized Garbage Tracking Cut City's Costs." Public Works. February, 1994. Athens, Ohio, facing a state-mandated 25 percent waste reduction goal, adopted a multi- tiered rate system for garbage collection to induce greater participation in the town's recy- cling program. Since its inception in 1982, the curbside recycling program has already reduced waste by as much as 50 percent. Athens also has a computerized billing system that keeps track of the amount of garbage each resident puts out for collection each week. The system is easy to use and has eliminated inaccuracies resulting from human error. Owen, Melissa. "Integrated Waste Minimization (With Composting)." Biocycle. April, 1994. Piano, Texas, has an aggressive yard waste diversion program. The program includes a "Don't Bag It" Lawn Care Plan, which reduced yard trimmings collection by 50 percent from 1991 to 1993, a backyard composting program, and biodegradable collection bags (20 for$5). Collected yard waste goes to a centralized composting facility. Piano's waste management system also includes a higher garbage collection fee for household waste in excess of the city-provided 95 Ib container. "Pay-As-You-Throw Shows Rapid Growth." Biocycle. August, 1993. A recent Reason Foundation study shows that over 1,000 communities have adopted some form of variable rate pricing for garbage collection, and the number is rapidly increasing. Moreover, the towns report overage reductions of 25 percent to 45 percent in the amount of waste sent to disposal facilities. Project 88 - Round II. Incentives for Action: Designing Market-Based Environmental Strategies. A Policy Symposium Sponsored by Senator Timothy Wirth and Sena- tor John Heinz. May, 1991. The symposium explored market-based soiutions to environmenta/ problems. Unit pricing was examined as a way to reduce waste generation by providing a better pricing signal to residents than traditional flat rate systems. While variable rates are implemented at the local level, the federal government can act as an information clearinghouse and can facili- tate local efforts to implement unit pricing. Seattle, Washington, and Perkasie, Pennsylva- nia, have both experienced success with unit pricing, and problems like illegal dumping and the disparate impact of variable fees can be alleviated with proactive efforts on the part of the municipality. Perkasie reduced billing costs by using bags instead of varying prescription can sizes. 187 ------- Reschovcky, James D.; Stone, Sarah E. "Market Incentives to Encourage Household Waste Recycling: Paying for What You Throw Away." Journal of Policy Analysis and Management. Vol. 13, No. 1. Winter, 1994. Unit pricing, which sends a more accurate pricing signal to households than traditional flat collection fees, has reduced waste and encouraged recycling in cities like Seattle, Washington, and High Bridge, New Jersey. There are, however, practical concerns with unit pricing: rates are difficult to set, revenues are hard to predict, illegal dumping could occur, administrative costs may be high, variables fees could have a regressive impact on low-income residents, common receptacles in multi-unit housing complexes preclude application of variable rates, and politicians may be unwilling to risk unpopularity. The authors studied unit pricing in Tompkins County, New York. They surveyed 3,040 random households and performed a statistical analysis of the survey results. They found that curbside service had the greatest impact on recycling participation. While variable rates alone seemed to have only a minor impact, the combination of unit fees, curbside ser- vice, and mandatory recycling had the largest impact on participation. The survey was unclear on the potentially regressive impact of variable fees, and it found no evidence that the pricing system encouraged illegal dumping, although 51 percent of the residents surveyed said littering had increased, and 20 percent said they burned their trash. Two- thirds of the respondents said they favored unit pricing. Richard, Bill. "Recycling in Seattle Sets National Standard but Is Hitting Snags." Wall Street Journal. August 3,1993. The author contends that Seattle will have trouble reaching its 60 percent recycling goal. According to the article, most avenues for increasing the rate of recycling have been exhausted, and it will require draconian measures to make 60 percent. The article also questioned the savings the city was receiving from recycling, and said there was a glut in the market for recyclables. Finally, the author provided anecdotal evidence that residents were stomping on their garbage, rather than actually reducing it or recycling more. Richardson, Robert A.; Havlicek, Jr., Joseph. "Economic Analysis of the Composition of Household Solid Wastes." Journal of Environmental Economics and Manage- ment. Vol. 5. 1978. The authors analyze the social and economic factors that affect the quantity and compo- sition of the household solid waste stream. The weekly per capita and per household quantities of eleven household waste components were analyzed: dear glass, green glass, brown glass, aluminum, other metals, newsprint, other paper, textiles, plastics, grass, and garbage/other. Waste generation is positively correlated with income, age, and 188 ------- household size, and negatively correlated with ethnic background (percentage of black households in a census track). Results indicate that if glass, plastics, textiles, paper, and metals were recovered through recycling and incineration for energy production, around 53 percent of the summer household waste stream could be diverted from landfills. The economic feasibility of such resource recovery was not discussed. Savas, E.S.; Baumol, Daniel; Wells, William. "Financing Solid Waste Collection." The Organization and Efficiency of Solid Waste Collection. Lexington Books. 1977. This is a chapter in Savas' book. The authors examined the effect of different methods of financing solid waste collection on the amount of residential waste generated and the cost of the collection service. They relied on a survey of private citizens living in communi- ties with a variety of collection systems. According to the survey, variable rates had little effect on either the amount of waste generated or the level of service requested. They also found that unit fees, whether flat or variable, increased billing costs for municipali- ties. Finally, they found that because local taxes are deductible from federal income tax returns, there was an incentive for communities to raise taxes to pay for garbage collec- tion rather than institute user fees. These findings were based on comparisons of waste generation figures, service levels, and collection costs across tax financed, flat fee, and variable fee collection systems. Scarlett, Lynn. Mandates or Incentives? Comparing Packaging Regulations with User Fees for Trash Collection. Reason Foundation. Publication No. 158. May, 1993. U.S. and Massachusetts solid waste management policy is beginning to address the nation's growing garbage crisis by stressing source reduction and recycling. Massachu- setts is considering a state-level initiative that would set recycled content requirements for consumer products and require reusable, reduced, or recycled packaging. An alternative market-based solution is unit pricing for residential waste collection. Unit pricing would create an incentive among consumers to source reduce, and that would cause producers to respond with reduced or recyclable packaging and products. The author reviews prob- lems with recycling markets and reports on the success of unit pricing in communities like Perkasie, Pennsylvania, and Seattle, Washington. She identifies illegal disposal, garbage compaction, citizen resistance, and the impact of variable fees on low-income residents as outstanding issues. The author conducts a cost-benefit comparison of packaging man- dates and user fees for trash collection. She compares the reduced waste benefits of each system and their implementation costs. The author concludes that unit pricing can have a greater impact on the waste stream than packaging mandates, and it would be $210 to$215 cheaper per household each year. 189 ------- "Seattle Engineers Say: Variable Can Rate Encourages Recycling." Waste Age. Novem- ber, 1985. Since the start of unit pricing in Seattle in 1980, recycling tonnage has increased 60 per- cent. Also, the city's per capita waste generation rate climbed more slowly than other cities' rates. Moreover, 80 percent of the city's residents favor the system, and it had a 91.5 percent compliance rate. "Seattle Stomp." Garbage. Spring, 1994. A short description of the "Seott/e stomp" phenomenon. Residents in Seottle and other unit pricing communities compact their trash to avoid higher collection fees. The author makes no effort to quantify the problem. Strategies to combat the "stomp" include weight-based fees and instructing haulers to not collect receptacles that are overloaded. Shanoff, Barry. "Communities Switch to By-the-Bag Billing System." World Wastes. October, 1992. A report on the successes of unit pricing in several communities with variable rate sys- tems. Utica, New York, Chester Township, New Jersey, Stonington, Connecticut, and Seott/e, Washington, have a/1 adopted unit pricing. Each community's system has differ- ent features and different fee schedules. Proponents of variable rates argue that it is fair- er than flat fees: those that produce less trash should be able to pay less. In some unit pricing communities, residents that reduce their waste pay significantly lower garbage collection fees than they did under a flat rate system. Unit pricing can also encourage illegal dumping, but localities have responded by locking commercial dumpsters. Sherman, Steven. "Local Government Approaches to Source Reduction." Resource Recycling. September, 1991. In recent years, solid waste management policy has emphasized source reduction as a waste management strategy. Decreased solid waste generation can be accomplished by: reduced product weight or volume, reduced packaging, increased product durability, alterations in consumer purchasing patterns, greater efficiency in manufacturing process- es, composting and other organic waste reduction techniques, and changes in the waste stream making it less hazardous. Strategies available to local governments to encourage waste reduction include public education, economic incentives, legislative mandates, on- s/te composting, and hazardous waste reduction. One of the economic incentives the author mentions is unit pricing. Unit pricing can be implemented by using metered bags or tags, or subscription containers. It provides a clear pricing signal to households that can lead to source reduction and increased recycling participation. It also influences con- sumer behavior, which will cause producers to respond with reduced product packaging. 190 ------- Skumatz, Lisa A. Variable Rates for Municipal Solid Waste: Implementation Experience. Economics, and Legislation. Reason Foundation. Publication No. 160. June, 1993. Unit pricing programs have a variety of different features. They can use bags, tags, or pre- scription cans, they may be city-run or contracted out to a private hauler, they are often accompanied by various complementary programs, including curbside recycling and back- yard composting, and they sometimes have special features for servicing multi-unit housing or helping low-income residents. Successfully implementing unit pricing requires political support, the involvement of all concerned parties, citizen education, and program flexibili- ty. Variable rates in cities like Seattle, Washington, and Perkasie, Pennsylvania, have reduced landfilled waste and increased recycling participation. Concerns about the pro- gram include illegal dumping, backyard burning, and unstable hauler revenues. Three states, Washington, Minnesota, and Wisconsin, have laws requiring variable fees for waste collection. Indiana, Oregon, Pennsylvania, Missouri, Vermont, Illinois, and Montana all encourage local authorities to use unit pricing. The author lays out four steps for evaluat- ing the performance of a unit pricing program: 1) determine the level of participation, 2) measure any changes in residential waste disposal patterns, 3) assess the linkage between variable rates and the observed changes in disposal behavior, and 4) identify the net bene- fit and cost effectiveness of the program. Skumatz, Lisa; Van Dusen, Hans; Carton, Jennie. "Garbage by the Pound: Ready to Roll with Weight Based Fees." Biocycle. November, 1994. Severol communities across the country have run weight-based pricing pilot programs. They include Seattle, Washington, Columbia, South Carolina, Durham, North Carolina, Milwaukee, Wisconsin, and Farmington and Minneapolis, Minnesota. Residents partici- pating in Seattle's program reduced their waste, by weight, an extra 15 percent. Collec- tion times did not increase in Columbia during its pilot study. The scales used in Durham's test did not meet some accuracy standards, but those deficiencies have since been corrected by the manufacturer. Milwaukee was scheduled to run a test in the fall of 1994, and Farmington and Minneapolis, though their pilot studies went well, have put plans to fully implement weight-based rates on hold. Though weight-based systems incur high initial costs, communities can achieve long-term savings from reduced waste. Skumatz, Lisa A.; Zach, Philip A. "Community Adoption of Variable Rates: An Update." Resource Recycling. June, 1993. Spread across 26 states, variable rate systems ore often adopted in response to increasing tipping fees, a desire to increase recycling efforts, and statewide or regional diversion requirements. Some of the issues involved with implementing a variable rate system include its compatibility with the existing collection system, the size of the community, illegal dump- 191 ------- ing, and multi-family housing facilities. Political support for the system is crucial, design plan- ning is important, and the system should include a strong citizen education effort. Sproule, Kimberly A.; Cosulich, Jeanne M. "Higher Recovery Rates: The Answer's in the Bag." Resource Recycling. November/December, 1988. The authors surveyed 12 per-unit fee systems, and the article describes five of them: Hol- land, Michigan, Perkasie, Pennsylvania, Woodstock, Illinois, Newport, New York, and High Bridge, New Jersey. It also provides basic information, such as container type, fee, and com- plementary programs offered, for all 12. The five cities described in the article all reported success with their systems, a/though reduction rates are not given for all of them. Stavins, Robert N. "Market Forces Can Help Lower Waste Volumes." Forum for Applied Research and Public Policy. Spring, 1993. In response to tougher federal regulations and the need for more effective waste man- agement strategies, communities have experimented with a number of innovative sys- tems. They /nc/ude different pricing schemes for waste collection services, including unit pricing, retail disposal charges and virgin material charges, traceable permits for indus- try-wide recycling mandates, and a deposit/refund system for discouraging illegal disposal of waste. The author uses Seattle's unit pricing system as an example. Stevens, Barbara. Pricing Schemes for Refuse Collection Services: The Impact on Refuse Generation. Research Paper No. 154. Columbia University Graduate School of Business. January, 1977. A variable rate pricing scheme is administratively feasible, and it would convey to con- sumers the true cost of waste disposal. The author uses an economic model of household waste generation behavior to predict the effect of variable rates for refuse collection on the demand for those services. She also conducted a survey of 93 cities with variable fee systems. She found that for a 70 percent increase in the price of collection, demand for service went down 9 percent. However, refuse generation only decreased by 0.5 percent to 1.17 percent. Stone, Sarah; Harrison, Ellen. "Residents Favor User Fees." Biocycle. August, 1991. Tompkins County, New York, has a county-wide unit pricing program for waste collection. The authors surveyed 3,034 randomly selected households in the county and received a 49 percent response rate. Sixty-three percent of the respondents were "very much in favor" or "somewhat in favor" of the county's variable fee system. Fifty-one percent said they recycled more because of the program, 16 percent said they composted more, and 39 percent said they were more attentive to product packaging when they shopped. 192 ------- "Taking the Innovative Approach to Waste Hauling." Biocycle. July, 1993. Tom Kraemer Sanitation Co. provides collection service to a half-dozen small towns in Minnesota near St. Cloud. The hauler charges a flat base rate and sells tags for each 30- gallon container put out for collection. It also uses a truck-based co-co//ection system for garbage and curbside recycling. The hauler saves money from reduced disposal costs, and brings in increased revenue from the sale of recyclables. U.S. Conference of Mayors. A Primer on Variable Rate Pricing for Solid Waste Ser- vices. June, 1994. An introductory brochure for municipalities considering a unit pricing system. Unit pricing passes variable waste disposal costs onto the household producers of garbage. It encour- ages waste reduction and increased recycling. It is fair, it helps to conserve landfill space, and it increases collection efficiency. Unit pricing systems can use prescription cans, bags, or tags, and can be based on weight, volume, or a hybrid of flat rates and variable rates. Implementation issues include ensuring sufficient revenues, the impact on poor residents, illegal dumping, public acceptance, recycling contamination, and service to multi-unit housing. To develop a successful program, localities must clearly define their goals, develop a complete plan, start with a pilot study, obtain political support, and develop a public education strategy. U.S. EPA. "EPA Probe of Household Waste Reduction to Focus on Per Volume Charge." Inside EPA. August 10.1990. This article concerns EPA's evaluation of the pros and cons of variable rate pricing to determine if the Agency should recommend it as a waste reduction incentive. The EPA study involved weighing the costs and benefits of unit pricing, as compared to flat rate pricing for garbage collection service. Unit pricing provides a dearer pricing signal to households, but it could also lead to illegal waste disposal and higher administrative costs. The Agency is unlikely to seek national unit pricing legislation, but may incorporate vari- able rates into its waste reduction guidelines for localities. U.S. EPA. Waste Prevention. Recycling, and Composting Options: Lessons Learned from 30 Communities. EPA530-R-92-015. February, 1994. This report focused on various strategies for municipalities to reduce net waste through composting, recycling, and education. The report details approaches to increase levels of composting and recycling, as well as improving materials recovery from commercial activ- ities and construction. The report provides a brief overview of variable refuse rates, and further comments on the positive effects of variable pricing on recycling participation 193 ------- and source reduction. Three additional volumes provide case studies on rural areas, sub- urbs and small cities, and urban areas. Wertz, Kenneth. "Economic Factors Influencing Households' Production of Refuse." Journal of Environmental Economics and Management. Vol. 2. 1976. The author uses a series of economic models to determine the impact of several waste collection service options on the level of household garbage generation. He also surveys six communities in the Detroit area and studies the collection system in San Francisco. There is an economic externality associated with traditional flat rate pricing systems for waste collection. Flat rates do not take into account the marginal disposal cost of incre- mental levels of garbage. Increasing flat rates somewhat decrease waste generation, but only through an income effect. There will be no substitution to lower waste generating behavior. However, variable rate pricing will more directly encourage waste reduction. The author a/so concluded that waste generation increases with income, with more fre- quent municipal collection service, and with less convenient collection sites (i.e., curbside rather than backdoor). Zimmerman, Elliott. Solid Waste Management Alternatives: Review of Policy Options to Encourage Waste Reduction. A Report to the Illinois Department of Energy and Natural Resources, Energy and Environmental Affairs Division. February, 1988. Waste reduction should be a top priority for the state of Illinois. Unit pricing is one finan- cial incentive that could be used by localities to encourage households to reduce garbage put-outs and increase waste reduction and diversion efforts. There are three potential drawbacks to this pricing method. First, a 1979 EPA study found no statistically significant relationship between variable rates and garbage generation, so unit pricing might not have an impact on residential waste. Also, user fees, unlike property taxes, are not deductible from federal tax returns, so residents could lose money in increased tax pay- ments. Finally, federal revenue sharing arrangements do not take into account user fees as local tax revenue, so municipalities could lose federal support by lowering property taxes in favor of variable rates. 194 ------- Additional Sources of Information Angelo, James J. Should Brevard County, Florida Adopt a Unit Pricing Program for Municipal Solid Waste? Undergraduate Honors Project; Sanford Institute of Public Policx, Duke University. April, 1993. Felton, Mary K. "A Snapshot of Waste Generation and Recovery." Resource Recy- cling. January, 1995. Fiske, Gary S. "Rates: A Powerful Tool to Reduce the Waste Stream." Solid Waste and Power. March/April, 1992. Franklin Associates, Ltd. The Role of Recycling in Integrated Solid Waste Management to the Year 2000. Prepared for Keep America Beautiful, Inc. September, 1994. Guerrieri, Tony M. An Assessment of Unit Pricing for Municipal Solid Waste. A Report for the Pennsylvania Joint Legislative Air and Water Pollution Control and Conservation Committee. September, 1994. Hong, Seonghoon. An Economic Analysis of Household Recycling of Solid Wastes: The Case of Portland, Oregon. PhD Dissertation. Department of Agriculture and Resource Economics, Ohio State University. November 21,1991. Jenkins, Robin. Municipal Demand for Solid Waste Disposal Services: The Impact of User Fees. PhD Dissertation. Department of Economics, University of Maryland. 1991. Miranda, Mane Lynn; Aldy, Joseph E. Unit Pricing of Residential Municipal Solid Waste: Lessons from Nine Case Study Communities. School of the Environment, Duke University. 1995. Skumatz, Lisa A. "Introducing the Hybrid Variable Rate System." Biocycle. November, 1993. Toomey, William A. "Meeting the Challenges of Yard Trimmings Diversion." Biocycle. May, 1994. 195 ------- Pay-As-You-Throw Rates Model MSW Factbook ------- Notic For planners considering pay-as-you-throw, establishing an effective rate structure—one that generates enough revenues to cover the costs of MSW services—can be a real challenge. There are several different methods, however, that you can use to come up with the right container prices. If you're in a community with a complex array of MSW services or need to ensure that all program costs are com- pletely covered, the Pay-As-You-Throw Rates Model software (now called the Pay-As-You-Throw RateMaker) may be a useful tool for you. Designed to enable planners to input all relevant costs and arrive at the optimal per-bag or per-can fees, RateMaker Version 1.0 is currently under development. If you would like to receive a copy of this tool when it becomes available, please complete and return the order form at the bottom of this page. Some communities may opt for a different approach. If you're in a smaller community or are not required to cover all costs with your per-container fees, you might simply consult with neighboring cities and towns (or communities else- where in the country with similar demographics) that already use pay-as-you-throw, adjusting their prices as needed to arrive at an appropriate rate structure. Other options for developing a rate structure are included in this tool kit. In the Guidebooks section, you can refer to Part III of Pay-As-You-Throw: Lessons Learned About Unit Pricing for information and advice on rate structure design. In addition, the Pay-As-You-Throw Workbook in the Workbook section of this tool kit contains worksheets (beginning on page 121) that can help you arrive at rates based on local demographic and solid waste generation data. EPA is continuing to develop materials for communities that have or are considering implementing a pay-as-you-throw program. Be sure to visit our homepage at www.epa.gov/epaoswer/non-hw/payt for the latest information. PayAs'YoirThrow RateMaker To bbMI y4ur coc^'bf'RateMakeA please compfete • //" ' $i •- ''''•' • '- - t\ * • ~ V' •'"''''' ' *' '•'' '"'"' • f"^-^..^ \ '""" ^nd^xM*' mail "this ,c/h|ff fbrnC$be % ;;• !'• JV( lfj U.S. EPA Pay-As-You-Throw MO Hartwell Avenue Lexington, MA 02I73 Fax: 6I7-674-285I Name: Organization: Address: Note: RateMaker Is an dppfejfo^fbir • PC-compatibisS running Microsoft.- • Crty/State/Zip_ •Excel for Windows,;- • Phone: You can also order by phone. Call the Pay-As-You-Throw Helpline toll-free at I -888-EPA-PAYT. Title: Fax: ------- | 2020-09-22T22:09:57 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.19832748174667358, "perplexity": 6932.260200137415}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-40/segments/1600400206763.24/warc/CC-MAIN-20200922192512-20200922222512-00238.warc.gz"} |
https://control.com/textbook/physics/elementary-thermodynamics/ | # Elementary Thermodynamics
## Chapter 2 - Physics in Industrial Instrumentation
Thermodynamics is the study of heat, temperature, and their related effects in physical systems. As a subject, thermodynamics is quite complex and expansive, usually taught as a course in itself at universities. The coverage in this book is limited to some of the more elementary and immediately practical facets of thermodynamics rather than a comprehensive overview.
### Heat versus Temperature
Most people use the words heat and temperature interchangeably. This is unfortunate for every student of thermodynamics, because it means they must first deconstruct this false conception and replace it with one more scientifically accurate before any progress may be made. While “heat” and “temperature” are related concepts, they are not identical.
When people say something is “hot,” what they really mean is that the object has a high temperature. Temperature is a direct function of random molecular motion within an object or a fluid sample. This is usually easiest to visualize for a gas, where unattached molecules have great freedom to vibrate, collide, and otherwise move about. The molecules of a substance at high temperature are moving more vigorously (higher velocity) than the molecules of the same substance at low temperature.
Heat, by contrast, is an expression of thermal energy transfer. By placing a pot of water over a fire, we are adding heat to that pot (transferring thermal energy to the water), the effect of which is to raise its temperature (making the water molecules’ motions more vigorous). If that same pot is taken away from the fire and allowed to cool, its loss of heat (transferring energy out of the water to the surrounding air) will result in its temperature lowering (the individual water molecules slowing down).
Heat gain or loss often results in temperature change, but not always. In some cases heat may be gained or lost with negligible temperature change – here, the gain or loss of heat manifests as physical changes to the substance other than temperature. One example of this is the boiling of water at constant pressure: no matter how much heat is transferred to the water, its temperature will remain constant at the boiling point (100 degrees Celsius at sea level) until all the water has boiled to vapor. The addition of thermal energy to the boiling water does not raise its temperature (i.e. make the molecules move faster), but rather goes into the work of disrupting inter-molecular bonds so that the liquid turns into vapor. Another example is the heating of chemical reactants in an endothermic (heat-absorbing) reaction: much of the thermal energy added to the chemical solution goes into the work of separating chemical bonds, resulting in molecular changes but not (necessarily) increased temperature.
Heat transfer can only happen, though, where there is a difference of temperature between two objects. Thermal energy (heat) naturally flows from the “hotter” (higher-temperature) substance to the “colder” (lower-temperature) substance. To use the boiling water example, the only way to get heat transfer into the water is to subject the water to a hotter substance (e.g., a flame, or a hot electric heating element). If you understand temperature as being molecular motion within a substance, with a hotter object’s molecules vibrating more vigorously than a colder object’s molecules, this natural transfer of heat from hot to cold makes perfect sense: the molecular vibrations of the higher-temperature object literally transfer to the molecules of the lower-temperature object. As those respective molecules touch each other, with fast-vibrating molecules colliding against slow-vibrating molecules, the inter-molecular collisions transfer energy away from the fast-vibrating molecules (so they aren’t vibrating as fast anymore) and toward the slow-moving molecules (so they begin to vibrate faster than before). It’s like a vibrating tuning fork touched to a non-vibrating tuning fork: the vibrating fork loses some of its vibration by transferring energy to the (formerly) quiet tuning fork.
Much more attention will be directed to the concepts of heat and temperature in subsequent subsections.
### Temperature
In an ideal, monatomic gas (one atom per molecule), the mathematical relationship between average molecular velocity and temperature is as follows:
${1 \over 2}m\overline{v^2} = {3 \over 2}kT$
Where,
$$m$$ = Mass of each molecule
$$v$$ = Velocity of a molecule in the sample
$$\overline{v}$$ = Average (“mean”) velocity of all molecules in the sample
$$\overline{v^2}$$ = Mean-squared molecular velocities in the sample
$$k$$ = Boltzmann’s constant (1.38 $$\times$$ 10$$^{-23}$$ J / K)
$$T$$ = Absolute temperature (Kelvin)
Non-ideal gases, liquids, and solids are more complex than this. Not only can the atoms of complex molecules move to and fro, but they may also twist and oscillate with respect to each other. No matter how complex the particular substance may be, however, the basic principle remains unchanged: temperature is an expression of how rapidly molecules move within a substance.
There is a temperature at which all molecular motion ceases. At that temperature, the substance cannot possibly become “colder,” because there is no more motion to halt. This temperature is called absolute zero, equal to $$-273.15$$ degrees Celsius, or $$-459.67$$ degrees Fahrenheit. Two temperature scales based on this absolute zero point, Kelvin and Rankine, express temperature relative to absolute zero. That is, zero Kelvin and zero degrees Rankine is equal to absolute zero temperature. Any temperature greater than absolute zero will be a positive value in either the Kelvin or the Rankine scales. A sample of freezing water at sea level, for example, is 0 degrees Celsius (32 degrees Fahrenheit) but could also be expressed as 273.15 Kelvin (0 plus 273.15) or 491.67 degrees Rankine (32 plus 459.67).
A table of melting and boiling points (at sea-level atmospheric pressure) for various substances appears in this table, labeled in these four different units of temperature measurement:
Melting or boiling substance $^{o}$C $^{o}$F & K & $^{o}$R
Melting point of water (H$_{2}$O) 0 32 273.15 491.67
Boiling point of water (H$_{2}$O) 100 212 373.15 671.67
Melting point of ammonia (NH$_{3}$) $-77.7$ $-107.9$ 195.45 351.77
Boiling point of ammonia (NH$_{3}$) $-33.6$ $-28.5$ 239.55 431.17
Melting point of gold (Au) 1063 1945 1336 2405
Melting point of magnesium (Mg) 651 1203.8 924.2 1663.5
Boiling point of acetone (C$_{3}$H$_{6}$O) 56.5 133.7 329.65 593.37
Boiling point of propane (C$_{3}$H$_{8}$) $-42.1$ $-43.8$ 231.05 415.87
Boiling point of ethanol (C$_{2}$H$_{6}$O) 78.4 173.1 351.55 632.77
Note how degrees Celsius and Kelvin for each point on the table differ by a constant (offset) of 273.15, while each corresponding degree Fahrenheit and degree Rankine value differs by 459.67 (note that many of the figures in this table are slightly rounded, so the offset might not be exactly that much). You might think of Kelvin as nothing more than the Celsius scale zero-shifted by 273.15 degrees, and likewise degrees Rankine as nothing more than the Fahrenheit scale zero-shifted by 459.67 degrees.
Note also how increments in temperature measured in degrees Fahrenheit are the same as increments of temperature measured in degrees Rankine. The same is true for degrees Celsius and Kelvin. The difference between the melting point of ammonia ($$-77.7$$ degrees C) and the melting point of water (0 degrees C) is the same difference as that between the melting points of ammonia and water expressed in Kelvin: 195.45 and 273.15, respectively. Either way, the difference in temperature between these two substances’ melting points is 77.7 degrees (C or K). This is useful to know when dealing with temperature changes over time, or temperature differences between points in a system – if an equation asks for a temperature difference ($$\Delta T$$) in Kelvin, it is the same value as the temperature difference expressed in Celsius. Likewise, a $$\Delta T$$ expressed in degrees Rankine is identical to a $$\Delta T$$ expressed in degrees Fahrenheit. This is analogous to differences between two fluid pressures expressed in PSIG versus PSIA: the differential pressure value (PSID) will be the same.
Most people are familiar with the Fahrenheit and Celsius temperature scales used to express temperature in common applications, but the absolute scales of Rankine and Kelvin have special significance and purpose in scientific endeavors. The fact that Rankine and Kelvin are absolute scales in the same manner that atmospheres and torr are units of absolute pressure measurement makes them uniquely suited for expressing temperature (molecular motion) in relation to the absence of thermal energy. Certain scientific laws such as the Ideal Gas Law and the Stefan-Boltzmann Law relate other physical quantities to absolute temperature, and so require the use of these absolute units of measurement.
### Heat
Heat, being the transfer of energy in thermal (molecular motion) form, may be measured in the same units as any other form of energy is measured: joules (metric) and foot-pounds (British). However, special units of measurement are often used for heat instead:
• calorie
• kilocalorie (or “dietary Calorie”)
• British Thermal Unit (BTU)
A calorie of heat is defined as the amount of thermal energy transfer required to change the temperature of one gram of water by one degree Celsius ($$\Delta T$$ = 1 $$^{o}$$C = 1 K). One calorie is equivalent to 4.186 joules.
A British Thermal Unit, or BTU is defined as the amount of thermal energy transfer required to change the temperature of one pound of water by one degree Fahrenheit ($$\Delta T$$ = 1 $$^{o}$$F = 1 $$^{o}$$R). One BTU is equivalent to 778.2 foot-pounds.
The unit of “dietary” calories is used to express the amount of thermal energy available in a sample of food by combustion. Since the official unit of the “calorie” is so small compared to the typical amounts of energy contained in a meal, nutritionists use the unit of the kilocalorie (1000 calories, or 4186 joules) and call it “Calorie” (with a capital letter “C”).
Just as “Calories” are used to rate the energy content of food, the heat units of “calories” and “BTU” are very useful in describing the potency of various industrial fuels. The following table shows the heat of combustion for a few common fuels, in units of kilocalories per gram and BTU per pound:
Fuel Combustion heat (kcal/g) Combustion heat (BTU/lb)
Methane (CH$_{4}$) 13.3 23940
Methanol (CH$_{4}$O) 5.43 9767
Ethanol (C$_{2}$H$_{6}$O) 7.10 12783
Propane (C$_{3}$H$_{8}$) 12.1 21700
Carbon monoxide (CO) 2.415 4347
For example, if exactly one gram of methane gas were completely burnt, the resulting heat liberated in the fire would be sufficient to warm 13.3 kilograms of water from 20 degrees Celsius to 21 degrees Celsius (a temperature rise, or $$\Delta T$$, of one degree Celsius).
If a meal rated at 900 Calories (900 “dietary calories,” or 900 kilocalories) of energy were completely metabolized, the resulting heat would be sufficient to warm a pool of water 900 kilograms in mass (900 liters, or about 237 gallons) by one degree Celsius. This same amount of heat could raise half the amount of water twice the temperature rise: 450 liters of water warmed two degrees Celsius.
### Heat transfer
Heat spontaneously flows from higher-temperature substances to lower-temperature substances. This is the phenomenon you experience standing next to a fire on a cold day. Your body is cold (low temperature), but the fire is much hotter (high temperature), and your proximity to the fire aids in heat transfer from the fire to you.
Three principal methods exist for heat to transfer from one substance to another:
• Conduction (by direct contact)
• Convection (by intermediate contact with a moving fluid)
Practical examples of heat transfer often involve multiple modes rather than just one. For example, the transfer of heat to a person’s body by sunlight obviously involves radiation from the Sun, but it also involves conduction through layers of clothing and convection by air passing from sun-warmed objects to the person.
Temperature-sensing instruments used to measure temperature in industrial applications likewise rely on multiple heat-transfer modes to sample thermal energy from a process fluid or object(s). Infrared thermometers detect temperature by sensing the intensity of infrared light radiated by hot objects. A thermocouple directly touching a hot object relies on conduction to sense the temperature of that object. An RTD inserted into a pipe carrying a hot fluid relies on convection to measure the average temperature of that fluid. A filled-bulb thermometer inserted into a thermowell, inserted into a fluid-filled process vessel relies on both convection (from the process fluid to the thermowell) and conduction (from the thermowell to the bulb) to sense process temperature.
If you have ever experienced the immediate sensation of heat from a large fire or explosion some distance away, you know how radiation works to transfer thermal energy. Radiation is also the method of heat transfer experienced in the Earth’s receiving of heat from the Sun (and also the mechanism of heat loss from Earth to outer space). Radiation is the least efficient of the three heat transfer mechanisms. It may be quantified by the Stefan-Boltzmann Law, which states the rate of heat lost by an object ($$dQ \over dt$$) is proportional to the fourth power of its absolute temperature, and directly proportional to its radiating area:
${dQ \over dt} = e \sigma A T^4$
Where,
$$dQ \over dt$$ = Radiant heat loss rate (watts)
$$e$$ = Emissivity factor (unitless)
$$\sigma$$ = Stefan-Boltzmann constant (5.67 $$\times$$ $$10^{-8}$$ W / m$$^{2}$$ $$\cdot$$ K$$^{4}$$)
$$A$$ = Surface area (square meters)
$$T$$ = Absolute temperature (Kelvin)
Here is one of the scientific applications where temperature expressed in absolute units is truly necessary. Radiant energy is a direct function of molecular motion, and so we would logically expect objects to radiate energy at any temperature above absolute zero. The temperature value used in this formula must be in units of Kelvin in order for the resulting $$dQ \over dt$$ value to be correct. If degrees Celsius were used for $$T$$ instead of Kelvin, the formula would predict zero thermal radiation at the freezing point of water (0 $$^{o}$$C) and negative radiation at any temperature below freezing, which is not true. Remember that the “zero” points of the Celsius and Fahrenheit scales were arbitrarily set by the inventors of those scales, but that the “zero” points of the Kelvin and Rankine scales reflect a fundamental limit of nature.
The emissivity factor varies with surface finish and color, ranging from one (ideal) to zero (no radiation possible). Dark-colored, rough surfaces offer the greatest emissivity factors, which is why heater elements and radiators are usually painted black. Shiny (reflective), smooth surfaces offer the least emissivity, which is why thermally insulating surfaces are often painted white or silver.
Like all heat-transfer modes, radiation is two-way. Objects may emit energy in the form of radiation, and they may also receive energy in the form of radiation. Everyone knows white-colored shirts are cooler than black-colored shirts worn on a hot, sunny day – this is an example of how emissivity affects heat absorption by radiant transfer. A black-colored shirt (high emissivity value) enhances the receiving of radiant energy by your body from the sun. What is not as obvious, though, is that a white-colored shirt will keep you warmer than a black-colored shirt on a cold, dark day because that same decreased emissivity inhibits body heat loss by radiation. Thus, high-emissivity objects both heat and cool more readily by radiation than low-emissivity objects.
#### Conduction
If you have ever accidently touched a hot iron or stove heating element, you possess a very vivid recollection of heat transfer through conduction. In conduction, fast-moving molecules in the hot substance transfer some of their kinetic energy to slower-moving molecules in the cold substance. Since this transfer of energy requires collisions between molecules, it only applies when the hot and cold substances directly contact each other.
Perhaps the most common application of heat conduction in industrial processes is through the walls of a furnace or some other enclosure containing an extreme temperature. In such applications, the desire is usually to minimize heat loss through the walls, so those walls will be “insulated” with a substance having poor thermal conductivity.
Conductive heat transfer rate is proportional to the difference in temperature between the hot and cold points, the area of contact, the distance of heat travel from hot to cold, and the thermal conductivity of the substance:
${dQ \over dt} = {kA {\Delta T} \over l}$
Where,
$$dQ \over dt$$ = Conductive heat transfer rate
$$k$$ = Thermal conductivity
$$A$$ = Surface area
$$\Delta T$$ = Difference of temperature between “hot” and “cold” sides
$$l$$ = Length of heat flow path from “hot” to “cold” side
Note the meaning of “$$\Delta T$$” in this context: it refers to the difference in temperature between two different locations in a system. Sometimes the exact same symbology (“$$\Delta T$$”) refers to a change in temperature over time in the study of thermodynamics. Unfortunately, the only way to distinguish one meaning of $$\Delta T$$ from the other is by context.
An illustration showing heat conduction through a wall gives context to the variables in the previous equation. As we see here, $$A$$ refers to the surface area of the wall, $$\Delta T$$ refers to the difference of temperature between either surface of the wall, and $$l$$ refers to the thickness of the wall:
In the United States, a common measure of insulating ability used for the calculation of conductive heat loss in shelters is the R-value. The greater the R-value of a thermally insulating material, the less conductive it is to heat (lower $$k$$ value). “R-value” mathematically relates to $$k$$ and $$l$$ by the following equation:
$R = {l \over k}$
Rearranging this equation, we see that $$l = kR$$, and this allows us to substitute $$kR$$ for $$l$$ in the conduction heat equation, then cancel the $$k$$ terms:
${dQ \over dt} = {kA {\Delta T} \over kR}$
${dQ \over dt} = {A {\Delta T} \over R}$
$$R$$ is always expressed in the compound unit of square feet $$\cdot$$ hours $$\cdot$$ degrees Fahrenheit per BTU. This way, with a value for area expressed in square feet and a temperature difference expressed in degrees Fahrenheit, the resulting heat transfer rate ($$dQ \over dt$$) will naturally be in units of BTU per hour, which is the standard unit in the United States for expressing heat output for combustion-type heaters. Dimensional analysis shows how the units cancel to yield a heat transfer rate in BTUs per hour:
${[\hbox{BTU}] \over [\hbox{h}]} = {[\hbox{ft}^2] [^{o}\hbox{F}] \over {{[\hbox{ft}^2] [\hbox{h}] [^{o}\hbox{F}]} \over [\hbox{BTU}]}}$
The utility of R-value ratings may be shown by a short example. Consider a contractor trailer, raised up off the ground on a mobile platform, with a total skin surface area of 2400 square feet (walls, floor, and roof) and a uniform R-value of 4 for all surfaces. If the trailer’s internal temperature must be maintained at 70 degrees Fahrenheit while the outside temperature averages 40 degrees Fahrenheit, the required output of the trailer’s heater will be:
${dQ \over dt} = {(2400 \hbox{ ft}^2) ({30 ^o \hbox{ F})} \over {4 \hbox{ ft}^2 \cdot \hbox{h} \cdot ^{o}\hbox{F} / \hbox{BTU}}} = 18000 \hbox{ BTU per hour}$
If the trailer’s heater is powered by propane and rated at 80% efficiency (requiring 22500 BTU per hour of fuel heating value to produce 18000 BTU per hour of heat transfer into the trailer), the propane usage will be just over one pound per hour, since propane fuel has a heating value of 21700 BTU per pound.
#### Convection
Most industrial heat-transfer processes occur through convection, where a moving fluid acts as an intermediary substance to transfer heat from a hot substance (heat source) to a cold substance (heat sink). Convection may be thought of as two-stage heat conduction on a molecular scale: fluid molecules come into direct contact with a hot object and absorb heat from that object through conduction, then those molecules later release that heat energy through conduction by direct contact with a cooler object. If the fluid is recycled in a piping loop, the two-stage conduction process repeats indefinitely, individual molecules heating up as they absorb heat from the heat source and then cooling down as they release heat to the heat sink.
Special process devices called heat exchangers perform this heat transfer function between two different fluids, the two fluids circulating past each other on different sides of tube walls. A simple example of a heat exchanger is the radiator connected to the engine of an automobile, being a water-to-air exchanger, the engine’s hot water transferring heat to cooling air entering the grille of the car as it moves.
Another example of a liquid-to-air heat exchanger is the condenser on a heat pump, refrigerator, or air conditioner, a photograph appearing here:
Another common style of heat exchanger works to transfer heat between two liquids. A small example of this design used to transfer heat from a boat engine is shown here:
The purpose for this heat exchanger is to exchange heat between the liquid coolant of the boat engine and sea water, the latter being quite corrosive to most metals. An engine would soon be damaged if sea water were used directly as the coolant fluid, and so heat exchangers such as this provide a means to release excess heat to the sea without subjecting the engine block to undue corrosion. The heat exchanger, of course, does suffer from the corrosive effects of sea water, but at least it is less expensive and more convenient to replace than an entire engine when it reaches the end of its service life.
This marine engine heat exchanger is an example of a shell-and-tube design, where one fluid passes inside small tubes and a second fluid passes outside those same tubes, the tube bundle being contained in a shell. The interior of such an exchanger looks like this when cut away:
The tubes of this particular heat exchanger are made of copper, a metal with extremely high thermal conductivity ($$k$$), to facilitate conductive heat transfer.
Liquid-to-liquid heat exchangers are quite common in industry, where a set of tubes carry one process liquid while a second process liquid circulates on the outside of those same tubes. The metal walls of the tubes act as heat transfer areas for conduction to occur. Metals such as copper with very high $$k$$ values (very low $$R$$ values) encourage heat transfer, while long lengths of tube ensure ample surface area for heat exchange.
A common application of liquid-to-liquid heat exchangers is in exothermic (heat-releasing) chemical reaction processes where the reactants must be pre-heated before entering a reaction vessel (“reactor”). Since the chemical reaction is exothermic, the reaction itself may be used as the heat source for pre-heating the incoming feed. A simple P&ID shows how a heat exchanger accomplishes this transfer of heat:
Another industrial application of heat exchangers is in distillation processes, where mixed components are separated from each other by a continuous process of boiling and condensation. Alcohol purification is one example of distillation, where a mixture of alcohol and water are separated to yield a purer (higher-percentage) concentration of alcohol. Distillation (also called fractionation) is a very energy-intensive process, requiring great inputs of heat to perform the task of separation. Any method of energy conservation typically yields significant cost savings in a distillation process, and so we often find heat exchangers used to transfer heat from outgoing (distilled, or fractionated) products to the incoming feed mixture, pre-heating the feed so that less heat need be added to the distillation process from an external source.
The following P&ID shows a simple distillation process complete with heat exchangers for reboiling (adding heat to the bottom of the distillation column), condensing (extracting heat from the “overhead” product at the top of the column), and energy conservation (transferring heat from the hot products to the incoming feed):
Distillation “columns” (also called fractionating towers in the industry) are tall vessels containing sets of “trays” where rising vapors from the boiling process contact falling liquid from the condensing process. Temperatures increase toward the bottom of the column, while temperatures decrease toward the top. In this case, steam through a “reboiler” drives the boiling process at the bottom of the column (heat input), and cold water through a “condenser” drives the condensing process at the top of the column (heat extraction). Products coming off the column at intermediate points are hot enough to serve as pre-heating flows for the incoming feed. Note how the “economizing” heat exchangers expose the cold feed flow to the cooler Product A before exposing it to the warmer Product B, and then finally the warmest “Bottoms” product. This sequence of cooler-to-warmer maximizes the efficiency of the heat exchange process, with the incoming feed flowing past products of increasing temperature as it warms up to the necessary temperature for distillation entering the column.
Some heat exchangers transfer heat from hot gases to cool(er) liquids An example of this type of heat exchanger is the construction of a steam boiler, where hot combustion gases transfer heat to water flowing inside metal tubes:
Here, hot gases from the combustion burners travel past the metal “riser” tubes, transferring heat to the water within those tubes. This also serves to illustrate an important convection phenomenon: a thermal siphon (often written as thermosiphon). As water heats in the “riser” tubes, it becomes less dense, producing less hydrostatic pressure at the bottom of those tubes than the colder water in the “downcomer” tubes. This difference of pressure causes the colder water in the downcomer tubes to flow down to the mud drum, and hot water in the riser tubes to flow up to the steam drum. This natural convection current will continue as long as heat is applied to the riser tubes by the burners, and an unobstructed path exists for water to flow in a loop.
Natural convection also occurs in heated air, such as in the vicinity of a lit candle:
This thermally forced circulation of air helps convect heat from the candle to all other points within the room it is located, by carrying heated air molecules to colder objects.
### Specific heat and enthalpy
Earlier, we saw how units of heat measurement were defined in terms of the amount of energy gain or loss required to alter the temperature of a water sample by one degree. In the case of the calorie, it was the amount of heat gain/loss required to heat/cool one gram of water one degree Celsius. In the case of the BTU, it was the amount of heat gain/loss required to heat/cool one pound of water one degree Fahrenheit.
As one might expect, one heat unit might be similarly defined as the amount of heat gain or loss to alter the temperature one-half of a degree for twice as much water, or two degrees for half as much water. We could express this as a proportionality:
$Q \propto m \Delta T$
Where,
$$Q$$ = Heat gain or loss
$$m$$ = Mass of sample
$$\Delta T$$ = Temperature change (rise or fall) over time
The next logical question to ask is, “How does the relationship between heat and temperature change work for substances other than water?” Does it take the same amount of heat to change the temperature of one gram of iron by one degree Celsius as it does to change the temperature of one gram of water by one degree Celsius? The answer to this question is a resounding no! Different substances require vastly different amounts of heat gain/loss to alter their temperature by the same degree, even when the masses of those substances happen to be identical.
We have a term for this ability to absorb or release heat, called heat capacity or specific heat, symbolized by the variable c. Thus, our heat/mass/temperature change relationship may be described as a true formula instead of a mere proportionality:
$Q = mc \Delta T$
Where,
$$Q$$ = Heat gain or loss (metric calories or British BTU)
$$m$$ = Mass of sample (metric grams or British pounds)
$$c$$ = Specific heat of substance
$$\Delta T$$ = Temperature change (metric degrees Celsius or British degrees Fahrenheit)
Pure water, being the standard by which all other substances are measured, has a specific heat value of 1. The smaller the value for $$c$$, the less heat gain or loss is required to alter the substance’s temperature by a set amount. That substance (with a low value of $$c$$) has a low “heat capacity” because each degree of temperature rise or fall represents a relatively small amount of energy gained or lost. Substances with low $$c$$ values are easy to heat and cool, while substances having high $$c$$ values require much heat in order to alter their temperatures, assuming equal masses.
A table of specific heat values (at room temperature, 25 degrees Celsius) for common substances appears here:
Substance Specific heat value ($c$) cal/g$\cdot$$^{o}C or BTU/lb\cdot$$^{o}$F
Aluminum (solid) 0.215
Iron (solid) 0.108
Copper (solid) 0.092
Ice (solid) 0.50
Water (liquid) 1.00
Methanol (liquid) 0.609
Ethanol (liquid) 0.587
Acetone (liquid) 0.521
Hydrogen (gas) 3.41
Helium (gas) 1.24
Nitrogen (gas) 0.249
Oxygen (gas) 0.219
Steam (gas) 0.476
If a liquid or a gas is chosen for use as a coolant (a substance to efficiently convect heat away from an object), greater values of $$c$$ are better. Water is one of the best liquid coolants with its relatively high $$c$$ value of one: it has more capacity to absorb heat than other liquids, for the same rise in temperature. The ideal coolant would have an infinite $$c$$ value, being able to absorb an infinite amount of heat without itself rising in temperature at all.
As you can see from the table, the light gases (hydrogen and helium) have extraordinarily high $$c$$ values. Consequently, they function as excellent media for convective heat transfer. This is why large electric power generators often use hydrogen gas as a coolant: hydrogen has an amazing ability to absorb heat from the wire windings of a generator without rising much in temperature. In other words, hydrogen absorbs a lot of heat while still remaining “cool” (i.e. remains at a low temperature). Helium, although not quite as good a coolant as hydrogen, has the distinct advantage of being chemically inert (non-reactive), in stark contrast to hydrogen’s extreme flammability. Some nuclear reactors use helium gas as a coolant rather than a liquid such as water or molten sodium metal.
Lead has an extraordinarily low $$c$$ value, being a rather “easy” substance to heat up and cool down. Anyone who has ever cast their own lead bullets for a firearm knows how quickly a new lead bullet cools off after being released from the mold, especially if that same person has experience casting other metals such as aluminum.
Numerical examples are helpful to better understand specific heat. Consider a case where a copper pot filled with water receives heat from a small gas burner operating at an output of 5000 BTU per hour (350 calories per second):
A reasonable question to ask would be, “How much will the temperature of this water-filled pot rise after 40 seconds of heating?” With the burner’s heat output of 350 calories per second and a heating time of 40 seconds, we may assume the amount of heat absorbed by the water-filled pot will be the simple product of heat rate times time:
$Q = \left({dQ \over dt}\right) t = \left({350 \hbox{ cal} \over \hbox{s}}\right) 40 \hbox{ s} = 14000 \hbox{ calories}$
This amount of heat not only goes into raising the temperature of the water, but it also raises the temperature of the copper pot. Each substance (water, copper) has its own specific heat and mass values ($$c$$ and $$m$$), but they will share the same temperature rise ($$\Delta T$$), so we must sum their heats as follows:
$Q_{total} = Q_{pot} + Q_{water}$
$Q_{total} = m_{pot}c_{pot} \Delta T + m_{water}c_{water} \Delta T$
Since both the pot and the water start at the same temperature and end at the same temperature, $$\Delta T$$ is a common variable to both terms and may therefore be factored out:
$Q_{total} = (m_{pot}c_{pot} + m_{water}c_{water}) \Delta T$
Solving this equation for temperature rise, we get:
$\Delta T = {Q_{total} \over {m_{pot}c_{pot} + m_{water}c_{water}}}$
$\Delta T = {14000 \hbox{ cal} \over {(1100 \hbox{ g})(0.092 {\hbox{cal} \over \hbox{g}^o\hbox{C}}) + (3700 \hbox{ g})(1 {\hbox{cal} \over \hbox{g}^o\hbox{C}})}}$
$\Delta T = 3.68 \> ^o\hbox{C}$
So, if the water and pot began at a temperature of 20 degrees Celsius, they will be at a temperature of 23.68 degrees Celsius after 40 seconds of heating over this small burner.
Another example involves the mixing of two substances at different temperatures. Suppose a heated mass of iron drops into a cool container of water. Obviously, the iron will lose heat energy to the water, causing the iron to decrease in temperature while the water rises in temperature. Suppose the iron’s mass is 100 grams, and its original temperature is 65 degrees Celsius. Suppose the water’s mass is 500 grams, and its original temperature is 20 degrees Celsius:
What will the equilibrium temperature be after the iron falls into the water and both their temperatures equalize? We may solve this by setting two heat equations equal to each other: the heat lost by the iron and the heat gained by the water, with the final equilibrium temperature being $$T$$:
$Q_{iron} = Q_{water}$
$m_{iron}c_{iron} \Delta T_{iron} = m_{water}c_{water} \Delta T_{water}$
$m_{iron}c_{iron} (65 \> ^o\hbox{C} - T) = m_{water}c_{water} (T - 20 \> ^o\hbox{C})$
Note how the $$\Delta T$$ term is carefully set up for each side of the equation. In order to make the iron’s heat loss a positive value and the water’s heat gain a positive value, we must ensure the quantity within each set of parentheses is positive. For the iron, this means $$\Delta T$$ will be 65 degrees minus the final temperature. For the water, this means $$\Delta T$$ will be the final temperature minus its starting temperature of 20 degrees.
In order to solve for the final temperature ($$T$$), we must distribute the terms, collecting all $$T$$-containing terms to one side of the equation, then factor and isolate $$T$$:
$m_{iron}c_{iron}(65) - m_{iron}c_{iron}T = m_{water}c_{water}T - m_{water}c_{water}(20)$
$m_{iron}c_{iron}(65) + m_{water}c_{water}(20) = m_{iron}c_{iron}T + m_{water}c_{water}T$
$m_{iron}c_{iron}(65) + m_{water}c_{water}(20) = T(m_{iron}c_{iron} + m_{water}c_{water})$
$T = {{m_{iron}c_{iron}(65) + m_{water}c_{water}(20)} \over {m_{iron}c_{iron} + m_{water}c_{water}}}$
$T = {{(100 \hbox{ g})(0.108 \hbox{ cal/g}^o\hbox{C})(65^o\hbox{C}) + (500 \hbox{ g})(1 \hbox{ cal/g}^o\hbox{C})(20^o\hbox{C})} \over {(100 \hbox{ g})(0.108 \hbox{ cal/g}^o\hbox{C}) + (500 \hbox{ g})(1 \hbox{ cal/g}^o\hbox{C})}}$
$T = 20.95 \> ^o\hbox{C}$
Thus, the iron’s temperature falls from 65 degrees Celsius to 20.95 degrees Celsius, while the water’s temperature rises from 20 degrees Celsius to 20.95 degrees Celsius. The water’s tremendous specific heat value compared to the iron (nearly 10 times as much!), as well as its superior mass (5 times as much) results in a much larger temperature change for the iron than for the water.
An analogy to help grasp the concept of specific heat is to imagine heat as a fluid that may be “poured” into vessels of different size, those vessels being objects or substances to be heated. The amount of liquid held by any vessel represents the total amount of thermal energy, while the height of the liquid inside any vessel represents its temperature:
The factor determining the relationship between liquid volume (heat) and liquid height (temperature) is of course the cross-sectional area of the vessel. The wider the vessel, the more heat will be required to “fill” it up to any given temperature. In this analogy, the area of the vessel is analogous to the term $$mc$$: the product of mass and specific heat. Objects with larger mass require more heat to raise their temperature to any specific point, specific heats being equal. Likewise, objects with large specific heat values require more heat to raise their temperature to any specific point, masses being equal.
In the first numerical calculation example where we determined the temperature of a pot of water after 40 seconds of heating, the analogous model would be to determine the height of liquid in a vessel after pouring liquid into it for 40 seconds at a fixed rate. A model for the second numerical example would be to calculate the equilibrium height (of liquid) after connecting two vessels together at their bottoms with a tube. Although the liquid heights of those vessels may be different at first, the levels will equalize after time by way of liquid passing through the tube from the higher-level vessel to the lower-level vessel.
Many industrial processes use fluids to convectively transfer thermal energy from one object (or fluid) to another. In such applications, it is important to know how much thermal energy will be carried by a specific quantity of that fluid over a specified temperature drop. One common way to express this quantity is called enthalpy. Enthalpy is the amount of heat lost by a unit mass (one gram metric, or one pound British) of a substance as it cools from a given temperature all the way down to the freezing point of water (0 degrees Celsius, or 32 degrees Fahrenheit). In other words, enthalpy is a measure of a substance’s thermal energy using the freezing temperature of water as a reference. A sample of water at a temperature of 125 degrees Fahrenheit, for example, has an enthalpy of 93 BTU per pound (or 93 calories per gram), because 93 BTU of thermal energy would be lost if one pound of that water happened to cool from its given temperature (125 $$^{o}$$F) down to 32 $$^{o}$$F:
$Q = mc \Delta T$
$Q = (1 \hbox{ lb})\left(1 {\hbox{BTU} \over {\hbox{lb}^o\hbox{F}}}\right)(125 \> ^o\hbox{F} - 32 \> ^o\hbox{F})$
$Q = 93 \hbox{ BTU}$
Even if the substance in question does not cool down to the freezing temperature of water, enthalpy is a useful figure for comparing the thermal energy “content” of hot fluids (per unit mass). For example, if one were given the enthalpy values for a substance before and after heat transfer, it would be easy to calculate the amount of heat transfer that transpired simply by subtracting those enthalpy values. If water at 125 $$^{o}$$F has an enthalpy value of 93 BTU/lb and water at 170 $$^{o}$$F has an enthalpy of value 138 BTU/lb, we may calculate the amount of heat needed to increase the temperature of a sample of water from 125 $$^{o}$$F to 170 $$^{o}$$F simply by subtracting 93 BTU/lb from 138 BTU/lb to arrive at 45 BTU/lb.
In this rather trivial example, it would have been just as easy for us to calculate the heat necessary to increase water’s temperature from 125 $$^{o}$$F to 170 $$^{o}$$F by using the specific heat formula ($$Q = mc \Delta T$$), and so it might appear as though the concept of enthalpy sheds no new light on the subject of heat transfer. However, the ability to calculate heat transfer based on a simple subtraction of enthalpy values proves quite useful in more complex scenarios where substances change phase, as we will see next.
### Phase changes
Scientists often speak of four phases of matter: solid, liquid, gas (or vapor), and plasma. Of these four, the first three are common to everyday life. Plasma is a phase of matter where the atoms of a gas are excited (energized) to the point where they become electrically ionized, such as neon gas in an electric tube light, or the gas comprising stars in space.
Phase changes are very important in thermodynamics, principally because energy transfer (heat loss or heat gain) must occur for a substance to change states, often with negligible change in temperature. To cite an example, consider the case of water (a liquid) turning into steam (a vapor) at atmospheric pressure. At sea level, this phase change will occur at a temperature of 100 degrees Celsius, or 212 degrees Fahrenheit. The amount of energy required to increase the temperature of water from ambient up to its boiling point is a simple function of the sample’s mass and its original temperature. For instance, a sample of water 70 grams in mass starting at 24 degrees Celsius will require 5320 calories of heat to reach the boiling point:
$Q = mc \Delta T$
$Q = (70 \hbox{ g})\left(1 {\hbox{cal} \over {\hbox{g}^o\hbox{C}}}\right)(100 \> ^o\hbox{C} - 24 \> ^o\hbox{C})$
$Q = 5320 \hbox{ cal}$
However, actually boiling the 70 grams of water into 70 grams of steam (both at 100 degrees Celsius) requires a comparatively enormous input of heat: 37734 calories – over seven times as much heat to turn the water to steam as what is required to warm the water to its boiling point! Furthermore, this additional input of 37734 calories does not increase the temperature of the water at all: the resulting steam is still at a temperature of (only) 100 degrees Celsius. If further heat is added to the 70 gram steam sample, its temperature will rise, albeit at a rate proportional to the value of steam’s specific heat (0.476 calories per gram degree Celsius, or BTU per pound degree Fahrenheit).
What we see here is a fundamentally different phenomenon than we saw with specific heat. Here, we are looking at the thermal energy required to transition a substance from one phase to another, not to change its temperature. We call this quantity latent heat rather than specific heat, because no temperature change occurs. Conversely, if we allow the steam to condense back into liquid water, it must release the same 37734 calories of heat energy we invested in it turning the water into steam before it may cool at all below the boiling point (100 degrees Celsius).
Latent heat has the effect of greatly increasing a substance’s enthalpy. Recall that “enthalpy” is the amount of heat lost by one pound (mass) of a substance if it happened to cool from its given temperature all the way down to the freezing temperature of water (0 $$^{o}$$C, or 32 $$^{o}$$F). Hot water has an enthalpy of 1 BTU/lb for every degree of temperature above freezing. Steam, however, possesses far greater enthalpy because of the latent heat released in the phase change from vapor to liquid before it releases heat as water cooling down to 32 $$^{o}$$F.
As with specific heat, there is a formula relating mass, latent heat, and heat exchange:
$Q = mL$
Where,
$$Q$$ = Heat of transition required to completely change the phase of a sample (metric calories or British BTU)
$$m$$ = Mass of sample (metric grams or British pounds)
$$L$$ = Latent heat of substance
Each substance has its own set of latent heat values, one for each phase-to-phase transition. Water, for example, exhibits a latent heat of vaporization (boiling/condensing) of 539.1 calories per gram, or 970.3 BTU per pound, at atmospheric pressure (boiling point = 100 $$^{o}$$C = 212 $$^{o}$$F). Water also exhibits a latent heat of fusion (melting/freezing) of 79.7 calories per gram, or 143.5 BTU per pound. Both figures are enormous compared to water’s specific heat value of 1 calorie per gram-degree Celsius (or 1 BTU per pound-degree Fahrenheit): it takes only one calorie of heat to warm one gram of water one degree Celsius, but it takes 539.1 calories of heat to boil that same gram of water into one gram of steam, and 79.7 calories of heat to melt one gram of ice into one gram of water. The lesson here is simple: phase changes involve huge amounts of heat.
A table showing various latent heats of vaporization (all at room temperature, 70 degrees Fahrenheit) for common industrial fluids appears here, contrasted against their specific heat values (as liquids). In each case you will note how much larger $$L$$ is than $$c$$:
Fluid (@ 70 $^{o}$F) $L_{vaporization}$, BTU/lb $L_{vaporization}$, cal/g & $c_{liquid}$
Water 970.3 539.1 1
Ammonia 508.6 282.6 1.1
Carbon dioxide 63.7 35.4 0.66
Butane 157.5 87.5 0.56
Propane 149.5 83.06 0.6
One of the most important, and also non-intuitive, consequences of latent heat is the relative stability of temperature during the phase-change process. Referencing the table of latent heats of vaporization, we see how much more heat is needed to boil a liquid into a vapor than is needed to warm that same liquid by one degree of temperature. During the process of boiling, all heat input to the liquid goes into the task of phase change (latent heat) and none of it goes into increased temperature. In fact, until all the liquid has been vaporized, the liquid’s temperature cannot rise above its boiling point! The requirement of heat input to vaporize a liquid forces temperature to stabilize (not rise further) until all the liquid has evaporated from the sample.
If we take a sample of ice and add heat to it over time until it melts, warms, boils, and then becomes steam, we will notice a temperature profile that looks something like this:
The flat areas of the graph during the melting and boiling periods represents times where the sample’s temperature does not change at all, but where all heat input goes into the work of changing the sample’s phase. Only where we see the curve rising does the temperature change. So long as there is a mixture of different phases, the temperature remains “locked” at one value. Only when there is a single phase of material is the temperature “allowed” to rise or fall.
The sloped areas of the graph reveal the specific heat of the substance in each particular phase. Note how the liquid (water) portion of the graph has a relatively shallow slope, due to the specific heat value ($$c$$) of water being equal to 1. Both the ice and the steam portions of the graph have steeper slopes because both of those phases possess smaller values of specific heat ($$c = 0.5$$ and $$c = 0.476$$, respectively). The smaller the value of $$c$$, the more a sample’s temperature will rise for any given input of thermal energy. For any given rate of heat transfer, smaller $$c$$ values result in more rapid temperature changes.
We may employ our liquid-filled vessel analogy to the task of explaining latent heat. Any point of phase change is analogous to a point along the vessel’s height equipped with a large expansion chamber, so that the vessel “acts” as if its area were much larger at one point, requiring much more fluid volume (heat) to change height (temperature) past that one point:
Liquid poured into this vessel will fill it at a rate proportional to the volume added and inversely proportional to the vessel’s cross-sectional area at the current liquid height. As soon as the liquid level reaches the expansion chamber, a great deal more liquid must be added to cause level to increase, since this chamber must completely fill before the liquid level may rise above it. Once that happens, the liquid level rises at a different rate with addition introduced volume, because now the phase is different (with a different specific heat value).
Remember that the filling of a vessel with liquid is merely an analogy for heat and temperature, intended to provide an easily visualized process mimicking another process not so easily visualized. The important concept to realize with latent heat and phase change is that it constitutes a discontinuity in the temperature/heat function for any given substance.
A vivid demonstration of this phenomenon is to take a paper cup filled with water and place it in the middle of a roaring fire. “Common sense” might tell you the paper will burn through with the fire’s heat, so that the water runs out of the cup through the burn-hole. This does not happen, however. Instead, the water in the cup will rise in temperature until it boils, and there it will maintain that temperature no matter how hot the fire burns. The boiling point of water happens to be substantially below the burning point of paper, and so the boiling water keeps the paper cup too cool to burn. As a result, the paper cup remains intact so long as water remains in the cup. The rim of the cup above the water line will burn up because the steam does not have the same temperature-stabilizing effect as the water, leaving a rimless cup that grows shorter as the water boils away.
The point at which a pure substances changes phase not only relates to temperature, but to pressure as well. We may speak casually about the boiling point of water being 100 degrees Celsius (212 degrees Fahrenheit), but that is only if we assume the water and steam are at atmospheric pressure (at sea level). If we reduce the ambient air pressure, water will boil at a lesser temperature. Anyone familiar with cooking at high altitudes knows you must generally cook for longer periods of time at altitude, because the decreased boiling temperature of water is not as effective for cooking. Conversely, anyone familiar with pressure cooking (where the cooking takes place inside a vessel pressurized by steam) knows how comparatively little cooking time is required because the pressure raises water’s boiling temperature. In either of these scenarios, where pressure influences boiling temperature, the latent heat of water acts to hold the boiling water’s temperature stable until all the water has boiled away. The only difference is the temperature at which the water begins to boil (or when the steam begins to condense).
Many industrial processes use boiling liquids to convectively transfer heat from one object (or fluid) to another. In such applications, it is important to know how much heat will be carried by a specific quantity of the vapor as it condenses into liquid over a specified temperature drop. The quantity of enthalpy (heat content) used for rating the heat-carrying capacity of liquids applies to condensing vapors as well. Enthalpy is the amount of heat lost by a unit mass (one gram metric, or one pound British) of the fluid as it cools from a given temperature all the way down to the freezing point of water (0 degrees Celsius, or 32 degrees Fahrenheit). When the fluid’s initial state is vapor, and it condenses into liquid as it cools down to the reference temperature (32 $$^{o}$$F), the heat content (enthalpy) is not just a function of specific heat, but also of latent heat.
Water at its atmospheric boiling point has an enthalpy of approximately 180 BTU per pound. Steam at atmospheric pressure and 212 $$^{o}$$F, however, has an enthalpy of about 1150 BTU per pound: more than six times as much heat as water at the same temperature. 970 of that 1150 BTU/lb is due to the phase change from steam to water, while the rest is due to water’s specific heat as it cools from 212 $$^{o}$$F to 32 $$^{o}$$F.
Many technical reference books contain a set of data known as a steam table showing various properties of steam at different temperatures and pressures. Enthalpy is one of the most important parameters given in a steam table, showing how much available energy resides in steam under different pressure and temperature conditions. For this reason, enthalpy is sometimes referred to as total heat ($$h_g$$). Steam tables also show saturation temperature (the condensing temperature for steam at that pressure) and steam density.
If the vapor in question is at a temperature greater than its boiling point at that pressure, the vapor is said to be superheated. The enthalpy of superheated vapor comes from three different heat-loss mechanisms:
• Cooling the vapor down to its condensing temperature (specific heat of vapor)
• Phase-changing from vapor to liquid (latent heat of phase change)
• Cooling the liquid down to the reference temperature (specific heat of liquid)
Using steam as the example once more, a sample of superheated steam at 500 $$^{o}$$F and atmospheric pressure (boiling point = 212 $$^{o}$$F) has an enthalpy of approximately 1287 BTU per pound. We may calculate the heat lost by one pound of this superheated steam as it cools from 500 $$^{o}$$F to 32 $$^{o}$$F in each of the three steps previously described. Here, we will assume a specific heat for steam of 0.476, a specific heat for water of 1, and a latent heat of vaporization for water of 970:
Heat loss mechanism Formula Quantity
Cooling vapor $Q = mc \Delta T$ (1)(0.476)($500-212$) = 137 BTU
Phase change $Q = mL$ (1)(970) = 970 BTU
Cooling liquid $Q = mc \Delta T$ (1)(1)($212-32$) = 180 BTU
TOTAL 1287 BTU
Enthalpy values are very useful in steam engineering to predict the amount of thermal energy delivered to a load given the steam’s initial temperature, its final (cooled) temperature, and the mass flow rate. Although the definition of enthalpy – where we calculate heat value by supposing the vapor cools all the way down to the freezing point of water – might seem a bit strange and impractical (how common is it for steam to lose so much heat to a process that it reaches freezing temperature?), it is not difficult to shift the enthalpy value to reflect a more practical final temperature. Since we know the specific heat of liquid water is very nearly one, all we have to do is offset the enthalpy value by the amount that the final temperature differs from freezing in order to calculate how much heat the steam will lose (per pound) to its load.
Furthermore, the rate at which heat is delivered to a substance by steam (or conversely, the rate at which heat is required to boil water into steam) may be easily calculated if we take this heat value in units of BTU per pound and multiply it by the mass flow rate in pounds per minute: as the unit of “pound” cancels in the multiplication, we arrive at a result for heat transfer rate in units of BTU per minute.
For example, suppose we were to employ the same 500 $$^{o}$$F superheated steam used in the previous example to heat a flow of oil through a heat exchanger, with the steam condensing to water and then cooling down to 170 degrees Fahrenheit as it delivers heat to the flowing oil. Here, the steam’s enthalpy value of 1287 BTU per pound may simply be offset by 138 (170 degrees minus 32 degrees) to calculate how much heat (per pound) this steam will deliver to the oil: 1287 $$-$$ 138 = 1149 BTU per pound:
Here we see how 500 $$^{o}$$F steam has an enthalpy (total heat) of 1287 BTU/lb, but since the steam does not in fact cool all the way down to 32 $$^{o}$$F in the act of heating oil in the heat exchanger, we must subtract the enthalpy of the 170 $$^{o}$$F water (138 BTU/lb) to determine the amount of heat actually delivered to the oil by the steam (1149 BTU/lb). Calculating heat transfer rate is a simple matter of multiplying this heat per pound of steam by the steam’s mass flow rate: for example, if the mass flow rate of this steam happened to be 2 pounds per minute, the heat transfer rate would be 2298 BTU per minute.
If we happen to be dealing with a situation where steam gives up some heat energy to a process fluid but not enough to cool to the point of condensation, all we need to do to calculate the amount of heat liberated by the superheated steam as it cools is subtract the enthalpy values between its hot and cool(er) states.
For example, suppose we have a heat-exchange process where superheated steam enters at 105 PSIG and 600 $$^{o}$$F, exiting at 75 PSIG and 360 $$^{o}$$F. The enthalpy of the steam under those two sets of conditions as given by a superheated steam table are 1328 BTU/lb and 1208 BTU/lb, respectively. Thus, the heat lost by the steam as it goes through this heat exchanger is the difference in enthalpy values: 1328 BTU/lb $$-$$ 1208 BTU/lb = 120 BTU/lb. Once again, calculating heat transfer rate is a simple matter of multiplication: if the mass flow rate of this steam happened to be 80 pounds per hour, the heat transfer rate would be 120 BTU/lb $$\times$$ 80 lb/hr = 9600 BTU/hr.
By encompassing both specific heat and latent heat into one quantity, enthalpy figures given in steam tables greatly simplify heat transfer calculations, as compared to evaluating specific heat and latent heat formulae ($$Q = mc \Delta T$$ and $$Q = mL$$, respectively) for water. Calculations based on steam tables are also more accurate than those derived from the specific and/or latent heat formulae, because steam tables take into account the changing values of $$c$$ and $$L$$ over wide temperature and pressure ranges. This is the power of empirical data: steam tables were developed by taking actual calorimetric measurements of steam under those temperature and pressure conditions, and as such are a record of water’s true behavior rather than a prediction of water’s theoretical behavior.
### Phase diagrams and critical points
A comprehensive way of describing the relationship between pressure, temperature, and substance phase is with something called a phase diagram. With pressure shown on one axis, and temperature on the other, a phase diagram describes the various phases of a substance in possible equilibrium at certain pressure/temperature combinations.
This phase diagram (for water) illustrates some of the features common to all phase diagrams: curved lines define the boundaries between solid, liquid, and vapor phases; the point of intersection of these three curves is where the substance may exist in all three phases simultaneously (called the triple point) and points where a curve simply ends within the span of the graph indicate critical points, where the certain phases cease to exist.
The curved line from the triple point up and to the right defines the boundary between liquid water and water vapor. Each point on that line represents a set of unique pressure and temperature conditions for boiling (changing phase from liquid to vapor) or for condensation (changing phase from vapor to liquid). As you can see, increased pressure results in an increased boiling point (i.e. at higher pressures, water must be heated to greater temperatures before boiling may take place). In fact, the whole concept of a singular boiling point for water becomes quaint in the light of a phase diagram: boiling is seen to occur over a wide range of temperatures, the exact temperature varying with pressure.
Something interesting happens when the temperature is raised above a certain value called the critical temperature. At this value (approximately 374 degrees Celsius for water), no amount of pressure will maintain it in a liquid state. Water, once heated beyond 374 degrees Celsius, is no longer a liquid and may only exist in a stable condition as a vapor. The critical pressure of any substance is the pressure value at the liquid/vapor boundary at the point of critical temperature.
A vivid example of critical temperature is this photograph of an ultra-high pressure storage vessel for oxygen gas, at a rocket engine testing facility:
The critical temperature for oxygen is 154.58 Kelvin, which is equal to $$-118.57$$ degrees Celsius or $$-181.43$$ degrees Fahrenheit. Since this pressure vessel is completely uninsulated, we know the temperature of the oxygen inside of it will be the same (or nearly the same) as ambient temperature, which is obviously much warmer than $$-118.57$$ $$^{o}$$C. Since the oxygen’s temperature is well above the critical temperature for the element oxygen, we may safely conclude that the oxygen inside this vessel must exist as a gas. Even at the extremely high pressure this vessel is capable of holding (15000 PSIG), the oxygen cannot liquefy.
The slightly curved line from the triple point up and to the left defines the boundary between solid ice and liquid water. As you can see, the near-vertical pitch of this curve suggests the freezing temperature of water is quite stable over a wide pressure range.
Carbon dioxide exhibits a different set of curves than water on its phase diagram, with its own unique critical temperature and pressure values:
Note how the triple-point pressure of carbon dioxide is well above ambient conditions on Earth. This means carbon dioxide is not stable in its liquid state unless put under substantial pressure (at least 60.4 PSIG). This is why solid carbon dioxide is referred to as dry ice: it does not liquefy with the application of heat, rather it sublimates directly into its vapor phase.
Another interesting difference between the carbon dioxide and water phase diagrams is the slope of the solid/liquid boundary line. With water, this boundary drifts to the left (lower temperature) as pressure increases. With carbon dioxide, this boundary drifts to the right (higher temperature) as pressure increases. Whether the fusion temperature increases or decreases with increasing pressure marks whether that substance contracts or expands as it transitions from liquid to solid. Carbon dioxide, like most pure substances, contracts to a smaller volume when it goes from liquid to solid, and its fusion curve drifts to the right as pressure increases. Water is unusual in this regard, expanding to a larger volume when freezing, and its fusion curve drifts to the left as pressure increases.
### Saturated steam table
A saturated steam table shows temperatures and pressures for water at the liquid/vapor transition (i.e. points lying along the liquid/vapor interface shown in a phase change diagram), as well as enthalpy values for the water and steam under those conditions. The sensible heat of water is the amount of thermal energy per pound necessary to raise water’s temperature from the freezing point to the boiling point. The latent heat of vapor is the amount of energy per pound necessary to convert water (liquid) into steam (vapor). The total heat is the enthalpy of steam (thermal energy per pound) between the listed condition in the table and the freezing temperature of water.
By definition a saturated steam table does not describe steam at temperatures greater than the boiling point. For such purposes, a superheated steam table is necessary.
Data for this saturated steam table was taken from Thermal Properties of Saturated and Superheated Steam by Lionel Marks and Harvey Davis, published in 1920 by Longmans, Green, and Company.
Saturated Steam Table
Temperature Pressure Sensible heat of Latent heat of Total heat (Deg F) (PSIA) liquid (BTU/lb) vapor (BTU/lb) (BTU/lb) 32 0.0886 0.00 1073.4 1073.4 40 0.1217 8.05 1068.9 1076.9 50 0.1780 18.08 1063.3 1081.4 60 0.2562 28.08 1057.8 1085.9 70 0.3626 38.06 1052.3 1090.3 80 0.505 48.03 1046.7 1094.8 50 0.696 58.00 1041.2 1099.2 60 0.2562 28.08 1057.8 1085.9 70 0.3626 38.06 1052.3 1090.3 80 0.505 48.03 1046.7 1094.8 90 0.696 58.00 1041.2 1099.2 100 0.946 67.97 1035.6 1103.6 110 1.271 77.94 1030.0 1108.0 120 1.689 87.91 1024.4 1112.3 130 2.219 97.89 1018.8 1116.7 140 2.885 107.87 1013.1 1121.0 150 3.714 117.86 1007.4 1125.3 160 4.737 127.86 1001.6 1129.5 170 5.992 137.87 995.8 1133.7 180 7.51 147.88 989.9 1137.8 190 9.34 157.91 983.9 1141.8 200 11.52 167.94 977.8 1145.8 210 14.13 177.99 971.6 1149.6 212 14.70 180.00 970.4 1150.4
Saturated Steam Table (continued)
Temperature Pressure Sensible heat of Latent heat of Total heat (Deg F) (PSIA) liquid (BTU/lb) vapor (BTU/lb) (BTU/lb) 220 17.19 188.1 965.2 1153.3 230 20.77 198.2 958.7 1156.9 240 24.97 208.3 952.1 1160.4 250 29.82 218.5 945.3 1163.8 260 35.42 228.6 938.4 1167.0 270 41.85 238.8 931.4 1170.2 280 49.18 249.0 924.3 1173.3 290 57.55 259.3 916.9 1176.2 300 67.00 269.6 909.5 1179.1 310 77.67 279.9 901.9 1181.8 320 89.63 290.2 894.2 1184.4 330 103.0 300.6 886.3 1186.9 340 118.0 311.0 878.3 1189.3 350 134.6 321.4 870.1 1191.5 360 153.0 331.9 861.8 1193.7 370 173.3 342.4 853.4 1195.8 380 195.6 352.9 844.8 1197.7 390 220.2 363.5 836.1 1199.6 400 247.1 374.1 827.2 1201.3 410 276.4 384.7 818.2 1202.9 420 308.4 395.4 809.0 1204.4 430 343.2 406.2 799.6 1205.8 440 380.8 417.0 790.1 1207.1
### Thermodynamic degrees of freedom
If we look at the areas bounded by phase transition curves in a phase diagram (solid area, liquid area, and vapor area), we see that both pressure and temperature may change independent of one another. A vessel filled with liquid water, for instance, may be at 30 degrees Celsius and 2 atmospheres, or at 50 degrees Celsius and 2 atmospheres, or at 50 degrees Celsius and 1 atmosphere, all equally stable. A more technical way to state this is to say the liquid water has two degrees of freedom. Here, the word “degree” has a completely different meaning than it does when used to denote a unit of temperature or angle. In this context, “degree” may be thought of loosely as “dimension.” A cube has three physical dimensions, a square has two and a line has one. A point within a cube has three degrees of freedom (motion), while a point within a square only has two, and a point along a line only has one. Here, we use the word “degree” to denote the number of independent ways a system may change. For areas bounded by phase transition curves in a phase diagram, pressure and temperature are the two “free” variables, because within those bounded areas we may freely alter pressure without altering temperature, and vice-versa.
Such is not the case at any point lying along one of the phase transition curves. Any point on a curve is geometrically defined by a pair of coordinates, which means that for a two-phase mixture in equilibrium there will be exactly one temperature value valid for each unique pressure value. At any point along a phase transition curve, pressure and temperature are not independent variable, but rather are related. This means that for any single substance, there is only one degree of freedom along any point of a phase transition curve.
To illustrate this concept, suppose we equip a closed vessel containing water with both a thermometer and a pressure gauge. The thermometer measures the temperature of this water, while the pressure gauge measures the pressure of the water. A burner beneath the vessel adds heat to alter the water’s temperature, and a pump adds water to the vessel to alter the pressure inside:
So long as the water is all liquid (one phase), we may adjust its pressure and temperature independently. In this state, the system has two thermodynamic degrees of freedom.
However, if the water becomes hot enough to boil, creating a system of two phases in direct contact with each other (equilibrium), we will find that pressure and temperature become linked: one cannot alter one without altering the other. For a steam boiler, operation at a given steam pressure thus defines the temperature of the water, and vice-versa. In a single-component, two-phase system, there is only one degree of thermodynamic freedom.
Our freedom to alter pressure and temperature becomes even more restricted if we ever reach the triple point of the substance. For water, this occurs (only) at a pressure of $$-14.61$$ PSIG (0.006 atmospheres) and a temperature of 0.01 degrees Celsius: the coordinates where all three phase transition curves intersect on the phase diagram. In this state, where solid (ice), liquid (water), and vapor (steam) coexist, there are zero degrees of thermodynamic freedom. Both the temperature and pressure are locked at these values until one or more of the phases disappears.
The relationship between degrees of freedom and phases is expressed neatly by Gibbs’ Phase Rule – the sum of phases and degrees of freedom equals the number of substances (“components”) plus two:
$N_{freedom} + N_{phase} = N_{substance} + 2$
We may simplify Gibbs’ rule for systems of just one substance (1 “component”) by saying the number of degrees of freedom plus phases in direct contact with each other is always equal to three. So, a vessel filled with nothing but liquid water (one component, one phase) will have two thermodynamic degrees of freedom: we may change pressure or temperature independently of one another. A vessel containing nothing but boiling water (two phases – water and steam, but still only one component) has just one thermodynamic degree of freedom: we may change pressure and temperature, but just not independently of one another. A vessel containing water at its triple point (three phases, one component) has no thermodynamic freedom at all: both temperature and pressure are fixed so long as all three phases coexist in equilibrium.
### Applications of phase changes
Applications of phase changes abound in industrial and commercial processes. Some of these applications exploit phase changes for certain production goals, such as the storage and transport of energy. Others merely serve to illustrate certain phenomena such as latent heat and degrees of thermodynamic freedom. This subsection will highlight several different processes for your learning benefit.
#### Propane storage tanks
A common example of a saturated liquid/vapor (two-phase) system is the internal environment of a propane storage tank, such as the kind commonly used to store propane fuel for portable stoves and gas cooking grills. If multiple propane storage tanks holding different volumes of liquid propane are set side by side, pressure gauges attached to each tank will all register the exact same pressure:
This is counter-intuitive, as most people tend to think the fullest tank should register the highest pressure (having the least space for the vapor to occupy). However, since the interior of each tank is a liquid/vapor system in equilibrium, the pressure is defined by the point on the liquid/vapor transition curve on the phase diagram for pure propane matching the tanks’ temperature. Thus, the pressure gauge on each tank actually functions as a thermometer, since pressure is a direct function of temperature for a saturated liquid/vapor system and therefore cannot change without a corresponding change in temperature. This is a thermodynamic system with just one degree of freedom.
Storage tanks containing liquid/vapor mixtures in equilibrium present unique safety hazards. If ever a rupture were to occur in such a vessel, the resulting decrease in pressure causes the liquid to spontaneously boil, halting any further decrease in pressure. Thus, a punctured propane tank does not lose pressure in the same manner than a punctured compressed air tank loses pressure. This gives the escaping vapor more “power” to worsen the rupture, as its pressure does not fall off over time the way it would in a simple compressed-gas application. As a result, relatively small punctures can and often do grow into catastrophic ruptures, where all liquid previously held inside the tank escapes and flashes into vapor, generating a vapor cloud of surprisingly large volume.
Compounding the problem of catastrophic tank rupture is the fact that propane happens to be highly flammable. The thermodynamic properties of a boiling liquid combined with the chemical property of flammability in air makes propane tank explosions particularly violent. Fire fighters often refer to this as a BLEVE: a Boiling Liquid Expanding Vapor Explosion.
#### Class II Filled-bulb thermometers
This same pressure-temperature interdependence finds application in a type of temperature measurement instrument called a Class II filled-bulb, where a metal bulb, tube, and pressure-sensing element are all filled with a saturated liquid/vapor mixture:
Heat applied to the bulb literally “boils” the liquid inside until its pressure reaches the equilibrium point with temperature. As the bulb’s temperature increases, so does the pressure throughout the sealed system, indicating at the operator display where a bellows (or some other pressure-sensing element) moves a pointer across a calibrated scale.
The only difference between the two filled-bulb thermometers shown in the illustration is which end of the instrument is warmer. The Class IIA system on the left (where liquid fills the pressure-indicating element) is warmer at the bulb than at the indicating end. The Class IIB system on the right (where vapor fills the indicating bellows) has a cooler bulb than the indicating bellows. The long length and small internal diameter of the connecting tube prevents any substantial heat transfer from one end of the system to the other, allowing the sensing bulb to easily be at a different temperature than the indicating bellows. Both types of Class II thermometers work the same, the indicated pressure being a strict function of the bulb’s temperature where the liquid and vapor coexist in equilibrium.
#### Nuclear reactor pressurizers
Nuclear reactors using pressurized water as the moderating and heat-transfer medium must maintain the water coolant in liquid form despite the immense heat output of the reactor core, to avoid the formation of steam bubbles within the reactor core which could lead to destructive “hot spots” inside the reactor. The following diagram shows a simplified pressurized water reactor (PWR) cooling system:
In order to maintain a liquid-only cooling environment for the reactor core, the water is held at a pressure too high for boiling to occur inside the reactor vessel. Typical operating conditions for a pressurized water reactor are 575 $$^{o}$$F and 2100 PSIG. A steam table shows the boiling point of water at 2100 PSIG to be over 640 $$^{o}$$F, which means the water inside the reactor cannot boil if the reactor only operates at 575 $$^{o}$$F. Referencing the phase diagram for water, the operating point of the reactor core is maintained above the liquid/vapor phase transition line by an externally supplied pressure.
This excess pressure comes from a device in the primary coolant loop called a pressurizer. Inside the pressurizer is an array of immersion-style electric heater elements. The pressurizer is essentially an electric boiler, purposely boiling the water inside at a temperature greater than that reached by the reactor core itself. For the example figure of 2100 PSIG, the pressurizer elements would have to operate at a temperature of approximately 644 $$^{o}$$F to maintain a boiling condition inside the pressurizer.
By maintaining the water temperature inside the pressurizer greater than at the reactor core, the water flowing through the reactor core literally cannot boil. The water/vapor equilibrium inside the pressurizer is a system with one degree of freedom (pressure and temperature linked), while the water-only environment inside the reactor core has two degrees of freedom (temperature may vary to any amount below the pressurizer’s temperature without water pressure changing at all). Thus, the pressurizer functions like the temperature-sensing bulb of a gigantic Class IIA filled-bulb thermometer, with a liquid/vapor equilibrium inside the pressurizer vessel and liquid only inside the reactor vessel and all other portions of the primary coolant loop. Reactor pressure is then controlled by the temperature inside the pressurizer, which is in turn controlled by the amount of power applied to the heating element array.
#### Steam boilers
Boilers in general (the nuclear reactor system previously described being just one example of a large “power” boiler) are outstanding examples of phase change applied to practical use. The purpose of a boiler is to convert water into steam, sometimes for heating purposes, sometimes as a means of producing mechanical power (through a steam engine), sometimes for chemical processes requiring pressurized steam as a reactant, sometimes for utility purposes (maintenance-related cleaning, process vessel purging, sanitary disinfection, fire suppression, etc.) or all of the above. Steam is a tremendously useful substance in many industries, so you will find boilers in use at almost every industrial facility.
A simplified diagram of a water tube boiler appears here:
Water enters the boiler through a heat exchanger in the stack called an economizer. This allows cold water to be pre-heated by the warm exhaust gases before they exit the stack. After pre-heating in the economizer, the water enters the boiler itself, where water circulates by natural convection (“thermosiphon”) through a set of tubes exposed to high-temperature fire. Steam collects in the “steam drum,” where it is drawn off through a pipe at the top. Since this steam is in direct contact with the boiling water, it will be at the same temperature as the water, and the steam/water environment inside the steam drum represents a two-phase system with only one degree of freedom. With just a single degree of freedom, steam temperature and pressure are direct functions of each other – coordinates at a single point along the liquid/vapor phase transition line of water’s phase diagram. One cannot change one variable without changing the other.
Consulting a steam table, you will find that the temperature required to boil water at a pressure of 120 PSIG is approximately 350 degrees Fahrenheit. Thus, the temperature of the steam drum will be fixed at 350 $$^{o}$$F while generating steam pressure at 120 PSIG. The only way to increase pressure in that boiler is to increase its temperature, and vice-versa.
When steam is at the same temperature as the boiling water it came from, it is referred to as saturated steam. Steam in this form is very useful for heating and cleaning, but not as much for operating mechanical engines or for process chemistry. If saturated steam loses any temperature at all (by losing its latent heat), it immediately condenses back into water. Liquid water can cause major mechanical problems inside steam engines (although “wet” steam works wonderfully well as a cleaning agent!), and so steam must be made completely “dry” for some process applications.
The way this is done is by a process known as superheating. If steam exiting the steam drum of a boiler is fed through another heat exchanger inside the firebox so it may receive more heat, its temperature will rise beyond the saturation point. This steam is now said to be superheated:
Superheated steam is absolutely dry, containing no liquid water at all. It is therefore safe to use as a fluid medium for engines (piston and turbine alike) and as a process reactant where liquid water is not tolerable. The difference in temperature between superheated steam and saturated steam at any given pressure is the amount of superheat. For example, if saturated steam at 350 degrees Fahrenheit and 120 PSI drawn from the top of the steam drum in a boiler is heated to a higher temperature of 380 degrees Fahrenheit (at the same pressure of 120 PSI), it is said to have 30 degrees (Fahrenheit) of superheat.
#### Fruit crop freeze protection
An interesting application of phase changes and latent heat occurs in agriculture. Fruit growers, needing to protect their budding crop from the damaging effects of a late frost, will spray water over the fruit trees to maintain the sensitive buds above freezing temperature. As cold air freezes the water, the water’s latent heat of fusion prevents the temperature at the ice/water interface from dropping below 32 degrees Fahrenheit. So long as liquid water continues to spray over the trees, the buds’ temperature cannot fall below freezing. Indeed, the buds cannot even freeze in this condition, because once they cool down to the freezing point, there will be no more temperature difference between the freezing water and the buds. With no difference of temperature, no heat will transfer out of the buds. With no heat loss, water inside the buds cannot change phase from liquid to solid (ice) even if held at the freezing point for long periods of time, thus preventing freeze damage. Only if the buds are exposed to cold air (below the freezing point), or the water turns completely to ice and no longer holds stable at the freezing point, can the buds themselves ever freeze solid.
#### Evaporative cooling towers
A very common use of a liquid-to-vapor phase change is for cooling purposes: taking hot water and mechanically forcing that hot water to evaporate in order to remove large quantities of heat energy from the water, thus cooling it to a lower temperature. Devices called evaporative cooling towers accomplish this task by causing ambient air to flow past droplets of water. As the rising air contacts the falling water droplets, some of the water is forced to evaporate, the heat required of this evaporation being provided by sensible heat within the remaining liquid water. As a result, the still-liquid water must cool in temperature as it gives up heat energy to the newly-formed water vapor.
Smaller evaporative cooling towers use fans to force air upward through the tower, employing inert “fill” material to provide large amounts of surface area for the liquid water and the air to contact each other. Some large evaporative cooling towers are self-drafting, the heat of the water providing enough convective force to the air that no fans are needed.
The following photograph shows a pair of induced-draft evaporative cooling towers used at a beer brewery:
This next photograph shows a forced-draft evaporative cooling tower used at a coal-fired electric power plant. Note the large air fans located around the circumference of the cooling tower, blowing cool air into the tower from outside. This fan placement eliminates problems arising from having the fan blades and motor located within the moist air stream:
Published under the terms and conditions of the Creative Commons Attribution 4.0 International Public License | 2021-09-23T12:22:19 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 2, "mathjax_display_tex": 2, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5728293657302856, "perplexity": 966.4761175010481}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-39/segments/1631780057421.82/warc/CC-MAIN-20210923104706-20210923134706-00425.warc.gz"} |
https://indico.fnal.gov/event/15949/contributions/34864/ | Indico search will be reestablished in the next version upgrade of the software: https://getindico.io/roadmap/
#### This search is only for public events. Restricted events are not available.
IMPORTANT! Indico has been upgraded. Please let us know as soon as possible if you find any issues and email [email protected]
# 36th Annual International Symposium on Lattice Field Theory
22-28 July 2018
Kellogg Hotel and Conference Center
EST timezone
## Topological Susceptibility in $N_f=2$ QCD at Finite Temperature -- Volume Study
Jul 24, 2018, 2:40 PM
20m
Centennial (Kellogg Hotel and Conference Center)
### Centennial
#### Kellogg Hotel and Conference Center
219 S Harrison Rd, East Lansing, MI 48824
Nonzero Temperature and Density
### Speaker
Yasumichi Aoki (KEK)
### Description
We study the topological charge in $N_f=2$ QCD at finite temperature using Mobius domain-wall fermions with reweighting to ovelap fermions. The susceptibility $\chi_t$ of the topological charge is studied in the high temperature phase with varying quark mass. Last year, we reported on a strong suppression of the susceptibility, observed below a certain value of the quark mass on a fixed spatial volume. We extend this study by changing the volume to both smaller and larger direction. The relation with the restoration of $U_A(1)$ is discussed.
### Co-authors
Dr Guido Cossu (Univ. Edinburgh) Dr Hidenori Fukaya (Osaka University) Dr Kei Suzuki (High Energy Accelerator Research Organization) Dr Shoji Hashimoto (KEK) Prof. Sinya Aoki (Yukawa Institute for Theoretical Physics) Dr Takashi Kaneko (KEK)
Slides | 2021-06-16T10:50:15 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.3390708565711975, "perplexity": 7619.529953617653}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-25/segments/1623487623596.16/warc/CC-MAIN-20210616093937-20210616123937-00612.warc.gz"} |
https://africnumeric.tv/ep2y3hal/9a9b95-simple-duple-meter | The carpeting is sold in square meters. Both of them have two beats per measure. study High-Paying Music Careers: Options and Requirements, Diary of an OCW Music Student, Week 12: Exit Interview with Lecturer John Crooks, Diary of an OCW Music Student: Final Thoughts, Diary of an OCW Music Student, Week 10: Temperaments, Roots of 2 and Conclusions, Diary of an OCW Music Student, Week 9: A 12-Tone Pythagorean Set, Diary of an OCW Music Student, Week 8: Tuning with Pure Major and Minor Triads, Diary of an OCW Music Student, Week 7: The Minor Triad and a Circular System of Thirds, Diary of an OCW Music Student, Week 6: Pythagorean Tuning and the Pure Triad, Diary of an OCW Music Student, Week 5: Building a Diatonic Set, Diary of an OCW Music Student, Week 4: Circular Pitch Systems and the Triad, Best Bachelor's Degrees in Software Engineering, PhD in Business Administration: Programs & Salary, Become a Fight Choreographer Career and Training Roadmap, How to Become a Certified Financial Examiner, Become a Research Biologist Step-by-Step Career Guide, Become a Biographer Education and Career Roadmap, Opera and Orchestral Music: Help and Review, The Baroque Period in Music: Help and Review, The Classical Period in Music: Help and Review, The Romantic Period in Music: Help and Review, Musical Theater and Popular Music: Help and Review, High School Liberal Arts & Sciences: Help & Review, Art, Music, and Architecture Around the World, Giacomo Puccini: Biography, Music & Operas, Giuseppe Fortunino Francesco Verdi: Biography, Operas & Facts, Richard Wagner: Biography, Music & Operas, Quiz & Worksheet - Silas Marner by George Eliot, Quiz & Worksheet - Jarvis Lorry in A Tale of Two Cities, Quiz & Worksheet - Lucie Manette in A Tale of Two Cities, Quiz & Worksheet - Mr. Bumble in Oliver Twist, DSST Introduction to World Religions Flashcards, California Sexual Harassment Refresher Course: Supervisors, California Sexual Harassment Refresher Course: Employees. Sometimes, what we see is not what we get, and some meters in music are definitely that way. In order to notate these rhythms in a simple duple meter —for example, 2/4 — we would have to use a TRIPLET, which fits three notes of equal duration in the place of two. Join Yahoo Answers … Get your answers by asking now. What is the difference between simple and compound meter? Media in category "Simple duple meter" The following 16 files are in this category, out of 16 total. Note durations shorter than a quarter note—eighth notes, sixteenth notes, thirty-second notes, etc.—are written by adding flags to the stem. Sometimes it changes. As you can see, in Example 3–6a some of the beams connect notes over the dashed line. Both of these pieces, then, are said to be in a simple duple meter. Meters in music can be like that sometimes; what we see is not always what we get. courses that prepare you to earn They differ only in the note value of the beat (a quarter note and a half note, respectively). True All music has a strong, discernable beat. The top number of a time signature tells how many beats are in one measure, and the bottom number tells what kind of note is counted as one beat. Every note in music can be broken down into smaller units called subdivisions. In such cases, the new meter is typically indicated by a new time signature. All other trademarks and copyrights are the property of their respective owners. Create an account to start this course today. 2/2 meter is an example of simple duple meter, and 6/8 meter is an example of compound duple meter. 9/8)If each beat in a measure is divided into two parts, it is simple meter, and if divided into three it is compound. Listen to Example 2, and tap along, feeling how the beats group into sets of two: Other kinds of song sometimes use the same meter throughout too, for example many of Robert Schumann's lieder. In quadruple meter, or "four-four-time," there is also a lighter secondary accent on the third beat. Duple meter is any meter where there are 2 beats to the measure. Home; Search Properties; Search Projects; Contact Us; simple duple meter A Simple Duple meter contains two beats, each of which divides into two (and further subdivides into four). These flags can also be notated as beams: horizontal lines that connect two or more notes. ''Duple'' refers to the two beats per measure. Flat File Database vs. Relational Database, The Canterbury Tales: Similes & Metaphors, Addition in Java: Code, Method & Examples, Real Estate Titles & Conveyances in Hawaii, The Guest by Albert Camus: Setting & Analysis, Designing & Implementing Evidence-Based Guidelines for Nursing Care, Quiz & Worksheet - The Ghost of Christmas Present, Quiz & Worksheet - Finding a Column Vector, Quiz & Worksheet - Grim & Gram in Freak the Mighty, Quiz & Worksheet - Questions on Animal Farm Chapter 5, Flashcards - Real Estate Marketing Basics, Flashcards - Promotional Marketing in Real Estate, How to Differentiate Instruction | Strategies and Examples, Middle School Language Arts: Lessons & Help, Glencoe Earth Science: Online Textbook Help, UExcel Earth Science: Study Guide & Test Prep, Holt Physical Science Chapter 21: The Nature of Sound, Quiz & Worksheet - Weaknesses of the Articles of Confederation and Shays' Rebellion, Quiz & Worksheet - Loyalists in the Southern Colonies at the End of the Revolutionary War, Quiz & Worksheet - Multiplicative Inverses of Matrices & Equations, What is Conception? It is rare to see any larger or smaller that are not an equivalent to one of these three. The dashed lines divide each measure in half, making clear which beats belong to the first beat and which to the second in each measure. These numbers together are referred to as a time signature (or meter signature). Consider the following examples: Both of the rhythms in Example 3–6, if performed, would sound exactly the same. The following examples show several common simple-meter time signatures: Note that Example 3–4c and Example 3–4d (2/4 and 2/2) are both simple duple meters. Get the unbiased info you need to find the right school. There are two types of duple meter; simple duple and compound duple. There are four different time signatures in common use: 1. Sometimes in meters, what we think should be a simple meter is actually a compound meter. Simple triple (ex. Simple time groups eighth notes into groups of two. The meter of a particular piece is generally indicated by the time signature—a stack of two numbers written on the first line of music, just to the right of the key signature. Over 83,000 lessons in all major subjects, {{courseNav.course.mDynamicIntFields.lessonCount}}, Musical Intelligence: Definition, Experiments & Characteristics, How to Read Notes on the Treble Clef Staff, Sharps and Flats: Reading and Identifying Sharp and Flat Notes in Music, How to Determine Major Key Signatures in Music, How to Determine Minor Key Signatures in Music, Understanding and Building Musical Scales: Definitions & Types of Scales, Musical Timbre of Instruments and Singers: Definition, Instrument Families of the Orchestra: String, Woodwind, Brass & Percussion, Tempo: Definition and Uses in Musical Forms, Musical Form: Phrasing, Binary, and Ternary Forms, Classical Music Forms: Symphonic, Sonata, Theme and Variation & Rondo Forms, Melody vs. Harmony: Definitions and Examples, Development of Musical Form Throughout History, Texture and Voices in Music: Definition & Overview, Dynamics in Music: Piano, Forte and Why They Are Important, The String Family: Instruments, History & Facts, Binary Form in Music: Definition & Examples, Call & Response in Music: Definition, Songs & Examples, Chord Progression: Music Theory, Rules & Formulas, Chromatic Music: Definition, Scale & Harmony, Counterpoint in Music: Definition, Music Theory & Examples, Minor Scale: Patterns, Chords & Intervals, Modulation in Music Theory: Examples & Explanation, Monophonic in Music: Definition & Examples, Orchestration: Definition, Techniques & Tools, Palindromes in Music: Definition & Examples, Syllabic Music: Definition, Analysis & Structure, Understanding the Circle of Fifths: Explanation & Chord Progression, Biological and Biomedical In Examples 3–1 and 3–2, we saw the time signature 2/4 and called that meter “simple duple.” The top number, in this case 2, tells us there are two beats per measure (hence, “duple”). To learn more, visit our Earning Credit Page. The lesson could not be displayed because JavaScript is disabled. For simple meters, the top number represents the number of beats and the bottom number the note value of a single beat. So how is 6/8 duple music? 's' : ''}}. Note: The symbol used for common time resembles the letter “C”—the first letter of the word “common.” The symbol used for cut time has a vertical line, cutting the “C” in half. As I said at the beginning of this post in compound meter songs, the main beats in a measure are divided into three equal parts. Despite the obvious differences in character, there is an important connection between Example 3–1 and 3–2. Meters are characterized as "simple" if they have duple division and "compound" if they have triple division. Music Simple Meter Compound Meter Element Duple Meter. The difference lies in how the music is performed or heard. Simple duple (ex. Example 3–4. imaginable degree, area of | {{course.flashcardSetCount}} Visit the Music 101: Help and Review page to learn more. Diatonic Polyphony and Functional Harmony, 12. (The first measure, for example, looks as though it has three beats.) You can test out of the Both time signatures have measures whose durations are equal to a single whole note (four quarter notes or two half notes). credit-by-exam regardless of age or education level. Remember that for simple meters, the bottom number of the time signature indicates the note value of the beat. Remember the candy bar we talked about? Compound metres are also duple (68, 616 Simple triple: three beats to a bar, each divided by two, the top number being "3" (3 4, 3 8, 3 2...) A meter with two beats per measure is called a duple meter, and the two types of duple meter are simple duple meter and compound duple meter. succeed. Simple Duple Triple and Quadruple. flashcard set{{course.flashcardSetCoun > 1 ? Each piece has two beats per measure and each beat tends to divide into two equal durations. Still have questions? Any time signature in which the top number is 2, 3, or 4 represents a simple meter. Simple Duple Meter . - Definition, Ovulation & Symptoms, Tech and Engineering - Questions & Answers, Health and Medicine - Questions & Answers. Services. Meter defines how the rhythm is felt in terms of strong and weak beats. If a simple meter is notated such that each eighth note corresponds to a beat, the bottom number of the time signature is 8. 2/4 and 2/2. What is this time signature: 2/2. A meter is also known by how many beats it has per measure. So for example: A simple duple meter refers to a measure that contains 2 beats and each beat can be subdivided by 2. In each line there are two beats per measure, as indicated by the upper number of the time signature. Whenever the main beat splits into two, like in 3/2, the music is in simple time. Have you ever opened a candy bar and found two smaller bars inside instead of one big one? The beams in Example 3–2, for example, are not consistent throughout the excerpt. The durations of each group of beamed notes add up to that of the beat—a quarter note in this case. A duple meter has two beats per measure, a triple meter has three beats per measure, and a quadruple meter has four beats per measure. In Example 3–6b, on the other hand, none of the beams cross a dashed line. These mnemonic devices, though useful, are not grounded by any historical accuracy. TERMS IN THIS SET (20) Accents between the beats are called offbeats. Simple duple meter. A meter with two beats per measure is called a duple meter, and the two types of duple meter are simple duple meter and compound duple meter. A simple triple meter, for example, would have three beats per measure, each of which would regularly divide into two equal durations. Some people also label quadruple, while some consider it as two duples.The latte… Hence why people get confused, as in 6/8, you have 6 quavers (eighth notes) per bar. Any of the beat groupings mentioned in the previous chapter—duple, triple, or quadruple—can represent a simple meter. first two years of college and save thousands off your degree. Common simple-meter key signatures. Already registered? Makaan Online | Real Estate Consultant in Bhopal | Residential | Commercial. (Refer to Chapter 1 for more on rhythmic notation.) Earn Transferable Credit & Get your Degree, Simple vs. Divided by two. A meter is also known by how many beats it has per measure. False An accented beat followed by two weak beats would indicate a _____ meter. It is much easier to recognize the duple meter in Example 3–6b. ''Simple'' states that each of these beats can be divided into two notes. Simple Meters. 6/8) 4. Remember that for simple meters, the top number of the time signature indicates the number of beats per measure. When looking at the above examples, simple meters can be divided into collections of duple, triple, and quadruple meters: simple duple meter: 2 ex: 2/4, 2/2, 2/8, 2/16; simple triple meter… They can also help emphasize the meter to the performer. Both of these pieces, then, are said to be in a simple duple meter. What is the note value of the beat, as indicated by this time signature? Whenever the main beat splits into three, like in 6/4, the music is in compound time. Compound Intervals: Definition & Concept, Time Signature in Music: Definition and Examples, Rhythm: Recognizing Syncopation, Dotted Notes & Ties, Meters and Time Signatures in Musical Forms, Rhythm: Quarter Notes, Eighth Notes, Rests & Other Basic Rhythms, Musical Notation Symbols: Note Head, Stem & Flag, What Is a Tetrachord? Learn about duple meters and the difference between a simple duple meter and a compound duple meter. duple, triple or compound) based on the song's beats. - Definition & Examples, Polyphonic Texture: Definition, Music & Examples, Ternary Form in Music: Definition & Examples, What are Triads in Music? Meters are divided into two main groups: simple and compound. When a simple meter has two beats per measure, it is called a simple duple meter. Simple Duple Meter. Note: For simple meters, the general rule of thumb is that the top number of the time signature indicates the number of beats per measure (duple, triple, or quadruple) and the bottom number indicates the beat value. Let's find out why. Frequently, you will encounter other, non-numeric symbols used as time signatures. 2/4 and 2/2. - Definition & Examples, UExcel Business Ethics: Study Guide & Test Prep, FTCE Music K-12 (028): Study Guide & Test Practice, TExES Music EC-12 (177): Practice & Study Guide, Principles of Business Ethics: Certificate Program, Introduction to Humanities: Help and Review, Introduction to World Religions: Help and Review, Introduction to Textiles & the Textile Industry, Humanities 201: Critical Thinking & Analysis. AustinC936. Ask Question + 100. This chapter will also provide a brief description of beaming—a notational device that shows how beat subdivisions group into beats in any particular meter. If the beat of a meter can be divided into two equal parts, it is a simple meter. If a simple meter is notated such that each quarter note corresponds to a beat, the bottom number of the time signature is 4. It had two pieces instead of one. The primary duties of the conductor are to unify performers, set the tempo, execute clear preparations and beats (meter), and to listen critically and shape the sound of the ensemble.Communication is non-verbal during a performance, however in rehearsal frequent interruptions allow the conductor t… © copyright 2003-2021 Study.com. Beams are typically used to reflect the meter by grouping notes that occur within a single beat. Create your account. Chapter 2 outlines the different ways in which the underlying pulse of a piece of music (the beat) can be regularly divided. Duple, Triple, and Quadruple. Plus, get practice tests, quizzes, and personalized coaching to help you Beams can be a helpful way to make a score appear less cluttered. As a member, you'll also get unlimited access to over 83,000 In this chapter we will continue that discussion by looking at simple meters, those in which the beat is regularly divided into two equal durations. For example, 2/4 time is classified as simple duple. An example of simple duple would be 2/4. Working Scholars® Bringing Tuition-Free College to the Community. Simple duple: two or four beats to a bar, each divided by two, the top number being "2" or "4" (2 4, 2 8, 2 2... 4 4, 4 8, 4 2...). Conducting is the art of directing a musical performance, such as a concert, by way of visible gestures with the hands, arms, face and head. 3/4 3/8. A set pattern of weak and strong beats in music is called a meter, and it is represented by a time signature. A time signature consists of two numbers, one stacked on top of the other. Note: The meter is not always consistent all the way through a piece. If each measure is divided into two beats, it is duple meter, and if three it is triple. Simple triple meter. Table of Standard Interval Progressions. Note: The difference between 4/4 and 2/2 is subtle. Three pulses grouped together, Simple Triple and so forth. Simple meters are generally very easy to recognize. and career path that can help you find the school that's right for you. credit by exam that is accepted by over 1,500 colleges and universities. Source(s): examples duple meter songs: https://tr.im/vNoUi. This means there are two quarter note beats in a measure. Not sure what college you want to attend yet? In simple triple time there are 3 beats (triple) in every bar and each beat can be divided into two (simple). Samantha is buying carpet for her family room, which is 12 yards by 9 yards. Longer musical works, such as jazz improvisations or classical symphonies, often use a mixtures of meters, which may include simple and compound time. Basic Two-Voice Interval Progressions, 22. 40 terms. Examples of simple duple time include 2/4, 2/2 and 2/8. II. The six eighth notes of 6/8 meter are written as two groups of three. You probably noticed that both of these examples—as well most of the examples in the previous chapter—include a pair of large numbers at the beginning of the first line of music. our partners use cookies to personalize your experience, to show you ads based on your interests, and for measurement and analytics purposes. In these examples, the primary accent on the downbeat is shown in bold type. Let's look at two common time signatures and what they mean: There are two basic types of meters: simple meters and compound meters. Other articles where Duple time is discussed: metre: Simple metres are duple (e.g., 22, 24), triple (34, 38), or quadruple (44, 48). Note: If you look closely, you will find that the beaming practice described above is not always followed in some scores. Simple and compound time dictate whether a measures shorter notes (usually eighth notes) are divided into groups of either two or three. Composers will sometimes break and add beams to indicate phrasings and other expressive gestures. Both rhythms are in simple duple meter, with two quarter notes per measure. When the main beat of a meter is a note that can be divided into two equal parts, it is a simple meter. Beams—the horizontal lines that connect notes whose durations are shorter than a quarter note—can be used to help express the meter of a particular piece of music. Log in or sign up to add this lesson to a Custom Course. Simple Duple Meter. The eighth note is the beat of the 6/8 meter, and since that eighth note can be divided into two equal parts, we would think that 6/8 would be a simple meter. 4/4) 2. What is this time signature 2/8. This seemingly small distinction makes huge difference in feel. Simple Meter Examples Explained . Meters are further distinguished by how many main beats are in each measure, and a duple meter has two main beats per measure. In simple meters, the top number is always “6,” “9,” or “12.” These numbers correspond to either duple, triple, or quadruple meters. How many beats per measure are indicated by the following time signature? Did you know… We have over 220 college Two crotchets (quarter notes) written as one single note is a minim (half note). Here's the same four measure rhythm in duple meter notated in four different time signatures. Log in here for access. Try refreshing the page, or contact customer support. Select a subject to preview related courses: Now let's take a closer look at a compound duple meter. Anyone can earn But, that is not the case. Simple Triple Meter. The former will have four distinct beats per measure, while the latter will have only two. Simple and Compound Meters . Example 3–5. … The tempo throughout is quite regular, following the indicated pulse of 92 in both the 6/8 and 2/4 rhythms. Simple time signatures use 2, 3 and 4 as the top number. Notes are typically grouped with beams within a single beat instead of across two or more beats. What is this time signature: 2/4. These are the most common subdivisions: When the main beat of a meter is a note that can be divided into two equal parts, it is a simple meter. Meters can also be classified as either simple or compound. This time signature is called cut time and is read like 2/2, but it generally indicates a faster tempo. Each main beat is the length of three eighth notes, which can be written as a dotted quarter note, like this: In 6/8 meter, the dotted quarter is considered the beat, and there are two of them in each measure. TRIPLE METER, please. Simple duple meter. So, a time signature wherein (a) the pulse subdivides into two portions, and (b) two pulses are grouped together is called Simple Duple. 14.3 Basic interval progressions in three voices, 14.6 Root motion by step (step progression), 14.7 Analysis of a three-part composition using basic interval patterns, 14.8 Basic interval progressions and four-part textures, 14.9 Analysis of a four-part composition using basic interval patterns, 15.2 Melodically derived nonharmonic tones, 15.3 Rhythmically derived nonharmonic tones, 18.2 Construction and types of seventh chords, 18.4 Preparing and resolving seventh chords, 18.5 Specific seventh chords and their functions, 18.6 The supertonic seventh chord (ii7 in major; iiø7 in minor), 18.7 The subdominant seventh chord (IV7 in major and iv7 in minor), 20.2 Construction: viio7 in minor and viiø7 in major, 20.6 Diminished-seventh chords as dominant substitutes, 21.4 Roman numeral analysis with figured bass, 22.2 Tonic (T) and dominant (D) functions, 23.4 “Root position” auxiliary sonorities, 23.6 Common-tone fully-diminished seventh chords, 24.2 Phrases using only tonic and dominant, 26.2 Harmonic root motion and labeling sequences, 27.6 Applied chords as auxiliary sonorities, 29.6 Mixture and basic interval progressions, 31.4 Function, voice-leading, and context, 32.7 Other uses of augmented sixth sonorities, 33.2 Pre-dominant chords with diatonic $latex \hat4$, 33.4 Pre-dominant chords with # $latex \hat4$, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-1.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-2.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-3.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-4a.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-4b.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-4c.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-4d.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-5a.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-5b.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/activity_3-1a.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/activity_3-1b.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/activity_3-1c.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/activity_3-1d.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-6a.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/example_3-6b.mp3, https://milnepublishing.geneseo.edu/app/uploads/sites/61/2019/12/activity_3-2.mp3, Creative Commons Attribution-NonCommercial 4.0 International License. | 2021-05-08T23:28:30 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.2515009343624115, "perplexity": 4023.138642877378}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-21/segments/1620243988927.95/warc/CC-MAIN-20210508211857-20210509001857-00273.warc.gz"} |
https://xgitlab.cels.anl.gov/darshan/darshan/-/blame/5f31157a563dd0dfce424bf6ec29a36605a39f2e/util/share/summary.tex | summary.tex 1.56 KB
Philip Carns committed Jun 17, 2009 1 2 3 4 5 6 \documentclass[11pt,letterpaper,twocolumn]{article} % \usepackage{html} \usepackage{charter} \usepackage{graphicx} \usepackage{fancyhdr} \usepackage{lastpage} Philip Carns committed Jul 24, 2009 7 \usepackage{subfigure} Philip Carns committed Jun 17, 2009 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 % % GET THE MARGINS RIGHT, THE UGLY WAY % \addtolength{\hoffset}{-1cm} \addtolength{\textwidth}{2cm} \addtolength{\voffset}{-1.5cm} \addtolength{\textheight}{3cm} \setlength{\parindent}{0pt} \setlength{\parskip}{11pt} % % BEGINNING OF DOCUMENT % \input{title} \begin{document} \fontfamily{cmss} \selectfont \pagestyle{fancy} Philip Carns committed Jul 24, 2009 33 \begin{figure*}[!h] Philip Carns committed Jun 17, 2009 34 \centering Philip Carns committed Jul 24, 2009 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 \subfigure { \input{job-table} }\\ \subfigure { \includegraphics[scale=0.8]{time-summary.pdf} } \subfigure { \includegraphics[scale=0.8]{counts.pdf} } \subfigure { \includegraphics[scale=0.8]{hist.pdf} } \subfigure { \includegraphics[scale=0.8]{pattern.pdf} } \subfigure { \input{access-table} } \end{figure*} Philip Carns committed Mar 03, 2010 61 62 63 64 65 66 67 68 69 70 71 72 \begin{figure*}[!h] \centering \subfigure { \includegraphics[scale=0.7]{file-access-read.pdf} } { \includegraphics[scale=0.7]{file-access-write.pdf} } { \includegraphics[scale=0.7]{file-access-shared.pdf} } Philip Carns committed Mar 03, 2010 73 74 75 76 \subfigure { \input{file-access-table} } Philip Carns committed Mar 03, 2010 77 78 79 \end{figure*} Philip Carns committed Jul 24, 2009 80 81 %%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% Philip Carns committed Jul 23, 2009 82 Philip Carns committed Jun 17, 2009 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 % at this point, things fall onto page 2 %\begin{figure}[!h] %\includegraphics[scale=0.7]{types.pdf} %\end{figure} %\begin{figure}[!h] %\includegraphics[scale=0.7]{align.pdf} %\end{figure} %\begin{figure}[!h] %\includegraphics[scale=0.7]{iodist.pdf} %\end{figure} % %\begin{figure}[!h] %\centering %\input{stride-table} %\end{figure} \end{document} | 2021-10-24T04:20:34 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9373957514762878, "perplexity": 3749.4824737671274}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-43/segments/1634323585837.82/warc/CC-MAIN-20211024015104-20211024045104-00060.warc.gz"} |
https://dlmf.nist.gov/27.10 | # §27.10 Periodic Number-Theoretic Functions
If $k$ is a fixed positive integer, then a number-theoretic function $f$ is periodic (mod $k$) if
27.10.1 $f(n+k)=f(n),$ $n=1,2,\dots$. ⓘ Symbols: $k$: positive integer, $n$: positive integer and $f(n)$: function Permalink: http://dlmf.nist.gov/27.10.E1 Encodings: TeX, pMML, png See also: Annotations for §27.10 and Ch.27
Examples are the Dirichlet characters (mod $k$) and the greatest common divisor $\left(n,k\right)$ regarded as a function of $n$.
Every function periodic (mod $k$) can be expressed as a finite Fourier series of the form
27.10.2 $f(n)=\sum_{m=1}^{k}g(m)e^{2\pi\mathrm{i}mn/k},$
where $g(m)$ is also periodic (mod $k$), and is given by
27.10.3 $g(m)=\dfrac{1}{k}\sum_{n=1}^{k}f(n)e^{-2\pi\mathrm{i}mn/k}.$
An example is Ramanujan’s sum:
27.10.4 $c_{k}\left(n\right)=\sum_{m=1}^{k}\chi_{1}\left(m\right)e^{2\pi\mathrm{i}mn/k},$ ⓘ Defines: $c_{\NVar{k}}\left(\NVar{n}\right)$: Ramanujan’s sum Symbols: $\chi\left(\NVar{n}\right)$: Dirichlet character, $\pi$: the ratio of the circumference of a circle to its diameter, $\mathrm{e}$: base of natural logarithm, $\mathrm{i}$: imaginary unit, $k$: positive integer, $m$: positive integer, $n$: positive integer and $\chi$: Dirichlet character Permalink: http://dlmf.nist.gov/27.10.E4 Encodings: TeX, pMML, png See also: Annotations for §27.10 and Ch.27
where $\chi_{1}$ is the principal character (mod $k$). This is the sum of the $n$th powers of the primitive $k$th roots of unity. It can also be expressed in terms of the Möbius function as a divisor sum:
27.10.5 $c_{k}\left(n\right)=\sum_{d\mathbin{|}\left(n,k\right)}d\mu\left(\frac{k}{d}% \right).$
More generally, if $f$ and $g$ are arbitrary, then the sum
27.10.6 $s_{k}(n)=\sum_{d\mathbin{|}\left(n,k\right)}f(d)g\left(\frac{k}{d}\right)$
is a periodic function of $n\pmod{k}$ and has the finite Fourier-series expansion
27.10.7 $s_{k}(n)=\sum_{m=1}^{k}a_{k}(m)e^{2\pi\mathrm{i}mn/k},$
where
27.10.8 $a_{k}(m)=\sum_{d\mathbin{|}\left(m,k\right)}g(d)f\left(\frac{k}{d}\right)\frac% {d}{k}.$
Another generalization of Ramanujan’s sum is the Gauss sum $G\left(n,\chi\right)$ associated with a Dirichlet character $\chi\pmod{k}$. It is defined by the relation
27.10.9 $G\left(n,\chi\right)=\sum_{m=1}^{k}\chi\left(m\right)e^{2\pi\mathrm{i}mn/k}.$ ⓘ Defines: $G\left(\NVar{n},\NVar{\chi}\right)$: Gauss sum Symbols: $\chi\left(\NVar{n}\right)$: Dirichlet character, $\pi$: the ratio of the circumference of a circle to its diameter, $\mathrm{e}$: base of natural logarithm, $\mathrm{i}$: imaginary unit, $k$: positive integer, $m$: positive integer, $n$: positive integer and $\chi$: Dirichlet character Permalink: http://dlmf.nist.gov/27.10.E9 Encodings: TeX, pMML, png See also: Annotations for §27.10 and Ch.27
In particular, $G\left(n,\chi_{1}\right)=c_{k}\left(n\right)$.
$G\left(n,\chi\right)$ is separable for some $n$ if
27.10.10 $G\left(n,\chi\right)=\overline{\chi}(n)G\left(1,\chi\right).$
For any Dirichlet character $\chi\pmod{k}$, $G\left(n,\chi\right)$ is separable for $n$ if $\left(n,k\right)=1$, and is separable for every $n$ if and only if $G\left(n,\chi\right)=0$ whenever $\left(n,k\right)>1$. For a primitive character $\chi\pmod{k}$, $G\left(n,\chi\right)$ is separable for every $n$, and
27.10.11 $|G\left(1,\chi\right)|^{2}=k.$
Conversely, if $G\left(n,\chi\right)$ is separable for every $n$, then $\chi$ is primitive (mod $k$).
The finite Fourier expansion of a primitive Dirichlet character $\chi\pmod{k}$ has the form
27.10.12 $\chi\left(n\right)=\frac{G\left(1,\chi\right)}{k}\sum_{m=1}^{k}\overline{\chi}% (m)e^{-2\pi\mathrm{i}mn/k}.$ | 2022-08-16T05:14:26 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 131, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9836546182632446, "perplexity": 782.4578239435901}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882572220.19/warc/CC-MAIN-20220816030218-20220816060218-00754.warc.gz"} |
https://drupal.star.bnl.gov/STAR/book/export/html/1468 | # STAR Juniors Information
A junior is a student or a post-doctoral researcher who has graduated in the last five years.
The current Junior Representatives are Maria Sergeeva from University of California ([email protected]), Los Angeles, Yang Wu from Kent State University ([email protected]), and Andrzej Lipiec from Warsaw University of Technology ([email protected]).
The following information is available for and about STAR's graduate students and post docs.
Subscribe to the juniors' list
STAR's publication policy
STAR's bylaws
Findings from APS Status of Women in Physics Survery
# STAR Graduate Student Thesis Policy
The policy below was adopted by the STAR Council on January 11, 2001. This policy is an amendment to the basic STAR Publication Policies, and replaces paragraph 7 in the current version of same.
1. This STAR Thesis Policy is based on the principle that the final arbiter of what constitutes a thesis is the thesis advisor, and any collaborator is free to analyze any part of the data, as per paragraph 1 of the STAR Publication Policies. The main purpose of this Thesis Policy is to state expectations about communication within the collaboration.
2. Physics Working Group (PWG) convenors maintain lists of analysis topics in their areas of interest which are judged to be in need of additional effort.
3. Students and their advisors are free to pursue a project from any PWG convenor's list, or to propose a new project. It is expected that the specific details of a student's project will emerge only after the student has been interacting with the relevant PWG for some time, and after in-depth consultation with the PWG convenor(s) and the STAR Analysis Coordinator.
4. The chair of the STAR thesis committee works with the Analysis Coordinator to maintain a descriptive list of all ongoing analysis projects, including names of all students and non-students working on those projects. The STAR council member from each institution is expected to review these listings periodically, and submit the necessary information to keep them up-to-date.
5. It is anticipated that there will always be many unpursued analysis projects in STAR, and many new analysis opportunities will open up every year as new detector subsystems come online, luminosity improves, etc. The likelihood of independent analyses with a large degree of overlap is small. However, STAR policy does not explicitly discourage duplicate analyses.
6. In the event that there is a large degree of overlap between two independent analyses, it is primarily the task of the relevant PWG convenor(s) to facilitate the resolution of any issues that may stand in the way of further analysis and/or publication and to oversee fair allotment of shared resources. An ad hoc godparent committee may also be appointed by the spokesperson as required to bring about convergence of analyses and paper production.
7. In overlap cases involving a student thesis project, it is expected that the student's advisor will be a full participant in all deliberations which affect the thesis project and the related publication.
8. Each student who uses STAR data for his/her PhD thesis is expected to have contributed to a STAR community service project in some significant way. Usually this will be an amount of work roughly equivalent to one third to one half the total research effort for a typical PhD.
9. Advisors are primarily responsible for ensuring that their PhD advisees satisfy community service expectations. Council members are expected to respond to requests for information about the current service work of thesis students from their institutions.
10. The STAR thesis committee should review the operation of this policy as soon as sufficient time has elapsed to judge its effectiveness.
STAR thesis committee page
# Awards available for STAR juniors
Below is a list of awards which STAR juniors are generally eligible for. Please email me with corrections or additions.
• NSF International Research Fellowship Program The objective of the International Research Fellowship Program (IRFP) is to introduce scientists and engineers in the early stages of their careers to international collaborative research opportunities, thereby furthering their research capacity and global perspective and forging long-term relationships with scientists, technologists and engineers abroad. These awards are available in any field of science and engineering research and education supported by NSF. Information available here.
• APS Division of Nuclear Physics Dissertation Award Nominations are open to any person who has received a Ph. D. degree in experimental or theoretical nuclear physics from a North American university within the two-year period preceding 1 September the year of the award. Information available here. $2500 award. • RHIC/AGS Thesis Award Application due in the spring after graduation. The due date for 2015 is March 30. Information available here. Currently theses must be either written in English or translated.$3000 award.
• RHIC/AGS User's Meeting Poster Award Requires presentation of a poster at the RHIC/AGS User's Meeting, which is typically held in late May or early June. Information is posted around the announcement of the User's Meeting; information from last year is here. $100 award. • BWIS Gertrude S Goldhaber Prize For a woman near her completion of her graduate work. The due date for nominations is generally around April. More information here.$1000 prize.
• Renate W Chasman Scholarship Women graduate students at an accredited educational institution doing research at BNL in the STEM disciplines (science, technology, engineering, or mathematics). The candidates must not be receiving their degrees prior to May of scholarship year. The 2015 deadline is November 30th(and was the same deadline for the 2014 competition). More information here. $1000 award. • L'Oreal USA For Women in Science fellowship program [PostDocs] A national awards program that annually recognizes and rewards five U.S.-based women researchers at the beginning of their scientific careers. Recipients receive up to$60,000 each that they must put towards their postdoctoral research. The 2016 L'Oréal USA for Women in Science application period opened on November 30th, 2015 and will close on February 5, 2016. [The 2015 L'Oréal USA for Women in Science application period ran from February 2, 2015 to March 20, 2015 . The 2014 deadline was May 19th. Opened March 24th]. More information here
• L'Oreal-UNESCO For Women in Science fellowship program [PhDs + PostDocs] A collection of national award programs that annually recognizes and rewards women researchers at the beginning of their scientific careers. Recipients receive a monetary award. Each nation has a slightly different program & deadlines, so please check it out! More information here
• DOE Office of Science Supplemental Support [Students] The SCGSR program provides supplemental awards to outstanding U.S. graduate students to pursue part of their graduate thesis research at a DOE laboratory in areas that address scientific challenges central to the Office of Science mission. [ie: Money to live & study at BNL] The research opportunity is expected to advance the graduate students’ overall doctoral thesis while providing access to the expertise, resources, and capabilities available at the DOE laboratories. Must be a U.S. Citizen[ or Permanent Resident as of 2015's 2nd solicitation]. The award provides support for inbound and outbound travel to the laboratory, and a monthly stipend of up to $3,000 for general living expenses while at the host DOE laboratory during the award period. The 2015 deadline is April 14, 2015 5:00 PM ET. There is a second solicitation, deadline is December 15, 2015 5:00pm ET. The 2014 deadline was Sept. 24th[Opened July 10th]. More information here • PhD fellow in Experimental Particle Physics [Students] The High Energy Heavy Ion (HEHI) at the Niels Bohr Institute, University of Copenhagen, announces a Ph.D. fellowship with start 1 January 2016 or as soon as possible thereafter. The group’s current research is centered around the ALICE experiment at the Large Hadron Collider at CERN. The group operates the Forward Multiplicity Detector (FMD), and the TPC-laser system in ALICE. Current research interests include the study and analysis of collective anisotropic flow, identified particle spectra and global observables (multiplicity) over a broad range of rapidity. We are seeking an excellent PhD candidate with demonstrated initiative and accomplishments to strengthen and further develop the group’s activities in a 3 year Ph.D. fellowship. More information here • AIP and Member Society Government Science Fellowships [PhDs @ All levels] Four different fellowship programs targeted towards physics' PhDs that would like to make an impact on US government policy. The various programs include: AIP State Department Science Fellowship, AIP Congressional Science Fellowship Program, APS/AIP STEM Education Policy Fellowship, and AIP Member Society Fellowships. More information here # Glossary of Terms and Abbreviations Used in STAR There has been a desire expressed to maintain a list of important STAR terms and abbreviations. If you have some terms you would like to see defined on here or catch an error, let one of the Junior Reps know and we will get it added/fixed! The glossary is now in PDF form because the DRUPAL text editor is a bit buggy. This is still under construction and needs input! Email the Junior Reps with your input! Some other useful resources: Helpful Book(s): Phenomenology of Ultra-Relativistic Heavy-Ion Collisions, Wojciech Florkowski # Graduate Student Theses Follow a link to see a list of STAR theses # Help for BNL Visitors A list of volunteers that are willing to help visitors go grocery shopping and find their way: - Chanaka De Silva. Email: [email protected]. Phone: 313-820-9507 (cellullar) - Chi Yang. Email: [email protected] - Mustafa Helmy. Email: [email protected] - Ning Yu. Email: [email protected] - Subhash. Email: [email protected]. Phone: 631-816-6550 BNL's food services page: http://www.bnl.gov/staffservices/foodservices.php There is a community supported agriculture that delivers to BNL seasonally[BERA]. It is called The Green Thumb Organic Veggie Club and the shares are large[you may want to share with others]. For the winter, it was$208 for 13 weeks. Jerome Lauret, Gene Van Buren, and Joey Butterworth all have experience with the Club, if you have questions. It is running again and payments are due Tuesday May 26th, 2015. For more information on the club, http://www.bnl.gov/bera/linkable_files/veggie-club-2015.pdf
Also, BERA may list discounted restaurants on their intranet version of http://www.bnl.gov/BERA/
For those with longer appointments @ BNL, BNL offers Child Day Care by the apartment/laundry area[and Drop-In Care]. This service is available to children, grandchildren, nieces, and nephews of employees, guests, users, or contractors. Please see this link for more information: https://www.bnl.gov/HR/CDC/ChildDevCntr.asp
# Past Juniors' Days
Past Talks
This is a place holder for past Junior Day talks. [ Jr. Day typically occurs on the first day of a STAR Collaboration Meeting. If you see that some talks are missing, notify your Jr. Representatives.]
# June 1st, 2015
Stony Brook Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-june-1-6-2015
09:20-09:30 Warm Welcome + Kickoff Sacha Kopp
09:30-10:00 Spokesperson Welcome Zhangbu Xu
10:00-10:30 Educational project for the STAR experiment Nikita Sidorov
10:30-11:00 Coffee Break
11:00-11:40 Pico Heavy Flavor Analysis Library Mustafa Mustafa & Jochen Thaeder
11:40-12:10 Probing the Emergent Properties of QGP at RHIC Paul Sorensen
14:00-14:30 STAR Phonebook upgrade & Talk Statistics Prashanth Shanmuganathan
14:30-15:00 Net Kaon fluctuation Amal Sarkar
15:00-15:30 Au + Au Fixed Target Collisions at STAR Kathryn Meehan
15:30-16:00 Coffee Break
16:00-16:30 Introduction to STAR software and makers Leszek Kosarzewski
16:30-17:00 Use of machine learning (TMVA) for D0 reconstruction Jonathan Bouchet
17:00-17:30 Forward Spin Physics with the FMS Christopher Dilks
17:30-18:00 Calibration of the Barrel EMC Kevin Adkins
# November 3rd, 2014
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-november-3-7
09:30-10:00 Welcome Zhangbu Xu
10:00-10:30 Foward Meson Spectrometer Sam Heppelman
10:30-11:00 STAR After BES Phase II Ernst Sichtermann
11:00-11:15 Coffee Break
11:15-11:45 iTPC Simulations Irakli Chakaberia
11:45-12:15 Open Forum Everyone
12:15-14:00 Lunch Break ( On Your Own)
14:10-15:00 Touring STAR Bill Christie
15:15-15:45 Heavy Flavor Tracker PiXeL Detector Howard Wieman
15:45-16:15 Heavy Flavor Tracker Physics + Software Xin Dong
16:15-16:35 Coffee Break
16:35-17:05 Muon Telescope Detector Calibrations Xinjie Huang
17:05-17:30 Third Harmonic Flow Vs Pseudorapidity Separation For Au+Au Collisions Niseem Magdy
17:30-18:05 Forward-central pion-quarkonia correlations: unravelling nuclear suppression at large forward rapidities at RHIC Michal Sumbera
# February 10th, 2014
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-spring-2014
09:30-10:00 Welcome by Spokesperson Nu Xu
10:30-11:00 W-Boson Production Devika Gunarathne
11:00-11:20 Coffee Break
11:20-11:50 The Study of Two Anti-Proton Interaction Zhengqiao Zhang
11:50-14:00 Lunch
14:00-14:30 TPC Calibrations John Campell
14:30-15:00 Paper Submission Process Barbara Trzeciak
15:00-15:20 Coffee Break
15:20-16:20 Jet analysis in Alice Rongrong Ma
16:20-16:50 J/Psi hadron correlation Hui Zhang
# October 14th, 2013
Lawrence Berkeley National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-2
09:00-09:15 Spokesperson welcome Nu Xu
09:15-10:00 EIC Physics (lecture) Feng Yuan
10:00-10:30 calibration of PXL detector Michael R. Lomnitz
10:30-10:45 Coffee Break
10:45-11:30 Transverse Spin Asymmetry in STAR (lecture) Mriganka Mouli Mondal
11:30-12:00 Alignment calibration of STAR HFT pixel detector Long Ma
12:00-12:30 Color String Percolation analysis David Garand
12:30-14:00 Lunch Break
14:00-14:45 Hard and Soft Probes of Dense Matter in Heavy-ion Collisions (lecture) Xin-Nian Wang
14:45-15:15 Things I wish someone had told me about Linux and RCF Anthony Kesich
15:15-15:30 Coffee Break
15:30-16:00 v3 of pi, k, proton at 39 GeV Xu Sun
16:00-16:30 Mini Session on career development Hans Georg and others
# February 24th, 2013
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-1
09:00-09:30 Spokesperson's welcome Nu Xu
09:30-10:00 GEM based Transition Radiation Detector Shuai Yang
10:00-10:30 MTD in Run12 and Installation for Run13 Chi Yang
10:30-11:00 Coffee Break
11:00-11:30 Cumulant Ratio Analyses Evan Sangaline
11:30-12:00 Spin Measurements at STAR Forward Detectors Yuxi Pan
12:00-14:00 Lunch
14:00-14:45 eRHIC Thomas Ullrich
14:45-15:30 eSTAR Zhangbu Xu
15:30-16:00 Coffee Break
16:00-16:30 v2 and spectra Xu Sun
16:30-17:30 Tribble report Panel discussion
# August 5th, 2012
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-0
09:00-09:30 Spokesperson's welcome to juniors Nu Xu
09:30-10:15 All you never wanted to know about RHIC... Angelika Drees
10:15-10:45 Coffee Break
10:45-11:30 U+U physics Paul Sorensen
11:30-12:00 Centrality Dependence of Multi-Strange Hadron v2 in Au+Au Collisions at 200 GeV Md. Nasim
12:00-14:00 Lunch
14:00-14:30 Unidentified Rcp in the Beam Energy Scan Stephen Horvat
14:30-15:00 J/$\psi$ production in $\sqrt{s_{NN}}$ = 39 GeV and 62.4 GeV Au+Au collisions from STAR Wangmei Zha
15:00-15:30 Coffee Break
15:30-16:00 Pion-Kaon Femtoscopy at $\sqrt{s_{NN}}$ = 200 GeV collisions in STAR at RHIC Yan Yang
16:00-16:30 Charge Asymmetry Dependency of π+/π- Azimuthal Anisotropy in Au + Au Collisions at STAR Hongwei Ke
16:30-17:00 2D DI-HADRON CORRELATION AT √SNN = 200 GeV FROM THE STAR EXPERIMENT Chanaka De Silva
# November 11th, 2011
Lawrence Berkeley National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-nov14-18-2011-lbnl-ca
09:00-09:30 Spokesperson's welcome to juniors Nu Xu
09:30-09:55 root, automake and doxygen Patrick Huck
09:55-10:20 Particle Identification in Au+Au 200 GeV Chris Powell
10:20-10:50 Coffee Break
10:50-11:15 Jet-hadron correlations in heavy-ion collisions Alice Ohlson
11:15-11:40 Non flow and flow contributions in di-hadron correlations Chanaka De Silva
11:40-12:05 Transverse Single Spin Asymmetry Len Eun
12:05-14:00 Lunch
14:00-14:25 K/pi fluctuations in the BES Terry Tarnowsky
14:25-14:50 Moments analysis in the BES Daniel MacDonald
14:50-15:15 Identified particle production in the BES Samantha Brovko
15:15-15:45 Coffee Break
15:45-16:10 Photoproduction at Relativistic Heavy Ion Collider with STAR Dilan Madagodahettige Don
16:10-16:35 Di-lepton production in Au+Au 200 GeV Jie Zhou
# May 15th, 2011
Prague Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting
09:00-10:00 Search for the onset of deconfinement Boris Tomasik (UMB Banska Bystrica/ CTU Prague)
10:00-10:30 STAR dielectron measurements Patrick Huck
10:30-11:00 Coffee Break
11:00-11:30 D production at STAR David Tlusty
11:30-12:00 LPV Quan Wang
12:00-13:30 Lunch Break
13:30-14:00 J/psi measurements Olga Hajkova
14:00-14:30 HFT Jan Rusnak
14:30-15:00 Junior's day address Nu Xu
15:00-15:30 Energy dependence of the freeze out eccentricity from azimuthal dependence of HBT Chris Anson
15:30-16:00 STAR dielectron measurements Bingchu Huang
# November 12th, 2010
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-november-12-17-2010
09:00-10:00 STAR Experiment: Today and Tomorrow Nu Xu
10:00-10:30 K_{S}^{0} and Lambda v2 in BES Jie Zhao
10:30-11:00 Coffee Break
11:00-11:30 Asymmetric dihadron azimuthal correlations in Au+Au collisions at 200 GeV Josh Konzer
11:30-12:00 rho0 spectra study at high pT in Au+Au and p+p collisions at sqrt(sNN) = 200 GeV Xiangli Cui
12:00-12:30 Finding the ground state energy of a many body system using MCMC Joseph Seele
12:30-14:00 Lunch
14:00-15:00 Acoustics in heavy ion collisions Paul Sorensen
15:00-15:30 FMS-FTPC Correlations from Run-8 Polarized Protons Jim Drachenberg
15:30-07:30 Coffee Break
16:00-16:30 Elliptic flow in BES and the tomography of STAR Alex Schmah
16:30-17:00 Monte-Â-Carlo Environment for the STAR High Level Trigger Hongwei Ke
17:00-17:30 Di-lepton production in 200 GeV p+p collisions Bingchu Huang
# March 26th, 2010
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-mar-26-31-2010
09:00-09:30 Azimuthal Anisotropy from STAR BBC Yadav Pandit
09:30-10:00 Search for Disoriented Chiral Condensate in AuAu and CuCu collisions at $\sqrt{s_{NN}}$ = 200 GeV Prithwish Tribedy
10:00-10:30 Small GEM Tracker Yi Zhou
10:30-11:00 Coffee Break
11:00-12:00 Viscous hydrodynamic interpretation of constituent quark scaling Kevin Dusling
12:00-13:30 Lunch Break
13:30-14:30 The local parity violation in strongly interacting matter Dima Kharzeev
14:30-15:00 TPC calibration Joe Seele
15:00-15:30 Coffee Break
15:30-15:50 W production at RHIC Justin Stevens
15:50-16:20 D -meson measurement in STAR Sarah LaPointe
16:20-16:40 Gamma-Triggered High-pT Long-Range Correlations in Au+Au 200 GeV Martin Codrington
16:40-17:00 ToF Calibration Bingchu Huang
# October 5th, 2009
Lawrence Berkeley National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/meetings/star-collaboration-meeting-fall-2009-lbl
09:00-09:50 QCD in Hadron Physics: Partons, Factorization, ... Feng Yuan
09:50-10:10 FMS + FTPC analysis: status report Jim Drachenberg
10:10-10:30 FHC cosmic ray test Xuan Li
10:30-11:00 Coffee Break
11:00-11:20 K/pi and p/pi fluctuation study using Run 7 data Hui Wang
11:20-11:40 v1 analysis at 22.4 GeV CuCu data using BBC event plane Yadav Pandit
11:40-12:00 Search for QCD Critical Point: High Moment of Event by Event Multiplicity Distribution Xiaofeng Luo
14:00-14:50 STAR in LHC era (Lecture) Helen Caines
14:50-15:10 HLT - Run 9 results and Run 10 preparation Hao Qiu
15:10-15:30 Centrality determination in d+Au collisions Chitrasen Jena
15:30-16:00 Coffee Break
16:00-16:20 Low pT J/psi production in d+Au collisions Olga Hajkova
16:20-16:40 Pixel readout electronics for HFT in STAR - firmware Xiangming Sun
# March 23rd, 2009
Brookhaven National Laboratory Collaboration Meeting, https://drupal.star.bnl.gov/STAR/star-collaboration-meeting-spring-2009
10:00-10:20 Correcting for Z-Vertex Variation in Two Particle Number Correlations Larry Tarini
11:30-11:50 The STAR W program Brian Page
11:40-12:00 Local Polarimetry at STAR Ramon Cendejas
11:50-12:20 Coffee Break
14:00-15:00 Quark-Gluon Plasma in QCD, at RHIC, and in String Theory Krishna Rajagopal
15:00-15:30 STAR's Near Future Physics Program Nu Xu
15:30-16:00 Coffee Break
16:00-16:20 Phi meson measurements via K+K- and e+e- decays in run8 d+Au 200GeV collisions Xiaoping Zhang
16:20-16:40 Phi meson production and Cronin effect in d+Au collisions Chitrasen Jena
16:40-17:00 Rho0 vector meson production in CuCu collisions@200 & 62.4 GeV data at RHIC Prabhat Pujahari
17:00-17:20 The Physics of Ultra Peripheral Collisions at STAR Yury Gorbunov
17:00-17:20 J/psi production in minimum-bias d+Au collisions at sNN =200 GeV in STAR Chris Powell
17:40-18:00 PID v_2 and v_4 from Au+Au Collisions at 200GeV at RHIC Na Li
# June 16th, 2008
UC Davis Collaboration Meeting, https://drupal.star.bnl.gov/STAR/star-collaboration-meeting-ucdavis-2008
09:00-09:50 What's Behind the Concrete Wall? A Closer Look at the STAR Detector and Some of its Hardware Jim Thomas
09:50-10:10 A new muon telescope detector at STAR David Tlusty
10:10-10:30 Gamma-conversion tomography of STAR Silicon detector in Cu+Cu collisions Kyung-Eon Choi
10:30-10:45 Morning Break 10:45-11:05 Strange Hadron elliptic flow from 200 GeV CuCu collisions Shusu Shi
11:05-11:25 Glauber Monte Carlo simulation in heavy ion collisions Hiroshi Masui
11:25-11:45 Studies of the jet fragmentation in p+p collisions in STAR Elena Bruna
11:45-12:05 Baryon to Meson ratios in jets and ridges Cristina Suarez
12:00-14:00 Lunch
14:00-14:50 Predicting the Total Heavy Flavor Cross Section Ramona Vogt
14:50-15:10 Measuring the D0 and D_s yields in 200GeV Cu+Cu collisions Stephen Baumgart
15:10-15:30 Study of bottom quark contribution to nonphotonic electron by e-h correlations Shingo Sakai
15:30-15:45 Afternoon Break
15:45-16:05 J/Psi in 200 GeV Cu+Cu Daniel Kikola
16:05-16:25 Measurement of non-photonic electrons in Cu+Cu 200 GeV collisions Anders Knospe
16:25-16:45 Star TPC Space Charge and Grid Leak Calibration Hao Qiu
16:45-17:05 Performance and analysis using the Silicon Strip Detector Jonathan Bouchet
# January 28th, 2008
Mumbai Collaboration Meeting, https://drupal.star.bnl.gov/STAR/collaboration-meeting-mumbai
09:00-09:50 Flow Analysis Methods Art Poskanzer
09:50-10:10 Open Charm Measurements with STAR HFT J. Kapitan
10:10-10:30 Saturation in Et/Nch and freeze-out criteria in heavy ion collisions R. Sahoo
10:30-10:50 SSD Performance Vi Namh Tram
11:05-11:25 Elliptic Flow of Jet Triggered Events N. Pruthi
11:25-11:45 Di-hadron correlations between identified strange particles C. Nattrass
11:45-12:05 System size dependence of pt correlations in STAR L. Kumar
14:00-14:50 QCD Critical Point S. Gupta
14:50-15:10 Centrality Dependence of charged kaon spectra from Au+Au collisions at 200 GeV Y. Ming
15:10-15:30 Resonance Production in STAR S. Dash
15:45-16:05 Multi-strange elliptic flow and parton collectivity from 200 GeV Au+Au and Cu+Cu collisions D. Gangadharan
16:05-16:25 Simulation on low pt eta and J/Psi-h correlations Y. Zhang
# June 11th, 2007
Lawrence Berkeley National Laboratory Collaboration Meeting, http://www-rnc.lbl.gov/~mvl/STAR07/
9:00 am Heavy Flavor Energy Loss Simon Wicks
9:50 am Heavy Flavor Measurements Shingo Sakai
10:10 am Di-hadron Correlations w.r.t. the Reaction Plane Aoqi Feng>/br> 10:30 am Coffee & Tea
10:50 am STAR Upgrade and Physics Capability Zhangbu Xu
11:40 am Discussion of Long-Range Forward-Backward Correlations in A-A and pp collisions Terry Tarnowsky
12:00 noon Lunch
1:20 pm The Preliminary Test Beam Results of MTD Xiaobin Wang
1:40 pm GEM Test Results From Test Beam and its Implications Tai Sakuma
2:00 pm System Size and Energy Dependence of -meson Production at RHIC Xinhua Shi
2:20 pm v4 Measured with FTPC as Event Plane Jocelyn Mlynarz
3:00 pm 2005 pp Cross Section Julie Millane
3:20 pm Lambda polarization in polarized pp collisions Wei Zhou
3:40 pm Measuring ALL with Neutral Pions from run-6 Alan Hoffman
4:00 pm Transverse Spin Asymmetry in Lambda Hyperon Production Thomas Burton
# July 10th, 2006
MIT Collaboration Meeting, http://web.mit.edu/rhic/star/collaborationmeeting2006/
09:30-10:05 Mini Lecture: Heavy-Ion Physics M. Djordjevic
10:05-10:25 The Effects of Pile Up in Cu-Cu sqrt(NN)=200GeV Collisions Anthony Timmins
10:25-10:45 Transverse Energy Production at RHIC Raghunath Sahoo
10:45-11:05 Centrality Dependence of Azimuthal Anisotropy for (Multi)Strange Hadrons at 200GeV in Au+Au Collisions Yan Lu
11:05-11:20 Coffee Break
11:20-11:40 K_S and Lambda's Cut Analysis Jiaxu Zuo
11:40-12:00 Forward-Backward Multiplicity Correlations in Au+Au at RHIC Terence J Tarnowsky
12:00-14:00 Lunch
14:00-14:35 Mini Lecture: Spin Physics B. Surrow
14:35-14:55 Electron Identification Using BEMC Priscilla Kurnadi
14:55-15:15 Interference in rho-O Production in UPC Events Brooke Haag
15:15-15:30 Coffee Break
15:30-15:50 Heavy Quark Tagged Azimuthal Correlations in Nuclear Collisions Andre Mischke
15:50-16:10 Di-Hadron Correlations in AuAu Collisions: Open Questions Mark Horner
16:10-16:30 Direct Photons with the Barrel Calorimeter Martijn Russcher
# February 27th, 2006
Brookhven National Laboratory Collaboration Meeting
09:00 - 09:15 Dihadron fragmentation functions in d+Au and Au+Au collisions Oana Catu
09:15 - 09:30 Two-Particle correlations involving V0s and charged tracks using the STAR TPC Leon Gaillard
09:30 - 09:45 Photons and neutral pions with the BEMC in d+Au Martijn Russcher
09:45 - 10:00 Non-photonic single electron spectra from TOF in 200 GeV Au+Au collisions at STAR Yifei Zhang
10:00 - 10:15 Muon spectra from charm semi-leptonic decay at 200 GeV Au+Au collisions at STAR Cjhen Zhong
10:15 - 10:30 Antideuteron production from run 4 Au+Au 200 GeV Haidong Liu
10:30 - 11:00 Coffee Break
11:00 - 11:15 Efficiency Calculations for Neutral Strange Particles at STAR Anthony Timmins
11:15 - 11:30 Rho Production in Ultra-Peripheral Collisions Byoung-Chul Kim
11:30 - 11:45 Measurement of the double longitudinal spin asymmetry A_LL in inclusive jet production in polarized pp collisions at 200 GeV in RUN 5 Julie Millane
# Physics Jobs Available for Juniors
Below is a list of jobs in physics for students and post docs in heavy ion physics. If you have a job to list or a correction please email me. By default, positions will be listed in reverse chronological order and will be removed from the list about a year after they are posted. Please also see the page maintained by PHENIX and STAR's computing page .
The DOE collects workforce statistics year to year from its funded groups and may be found here: https://npworkforce.science.energy.gov/survey/ . Currently, the statistics only run up to 2014 , but it gives a good idea of how the jobs are allocated (exp v theory, perm. v temp. v student) and where students go afterwards.
=================================================================================================
• Postdoc position at Tsukuba University
Job opening
University of Tsukuba, Center for Integrated Research in Fundamental Science and Engineering (CiRfSE) has an opening for research associate (postdoctoral research fellow) position in
experimental research on Quark Gluon Plasma (QGP) in high-energy heavy-ion collision experiments. High-energy experimental nuclear physics group in the division of quark-nuclear
physics, research core for the history of universe, is currently involved in the PHENIX and STAR experiments at Relativistic Heavy-Ion Collider (RHIC) in Brookhaven National Laboratory (BNL)
as well as in the ALICE experiment at Large Hadron Collider (LHC) in European Organization for Nuclear Research (CERN). The successful candidate is expected to work on the beam energy
scan program at RHIC STAR experiment and detector developments for the future experiments. Applications from interested individuals and recommendations are encouraged and appreciated.
1. Position
a research associate (postdoctoral research fellow)
2. Field of research and job description
Quark Gluon Plasma experimental researches, physics analyses, detector developments
3. Other duties
The successful candidate is expected to conduct experimental research on QGP in close
collaboration with the group members and to guide students in their researches.
4. Starting date
As soon as possible after the decision is made.
5. Terms of appointment
3 years
6. Conditions of employment/salaries
The salary will be paid in an annual salary system (fixed term) of the university.
7. Qualification
Ph.D in experimental nuclear physics or related field
8. Documents to be submitted (in Japanese or in English)
* curriculum vitae (with a picture)
* list of publications/accomplishments in research and education
* reprints or copies of five most important papers (at least four must be
published within the past five years)
* summary of research accomplishments (at most 2 pages in letter form)
* statements on research and education (at most 2 pages in letter form)
* 2 letters of recommendation or reference
The documents will not be returned to applicants.
Must be received by December 15, 2016.
10. Application documents
To be sent by a registered or certified mail to the following address.
Mark it as “QGP research” on the envelope.
The letters of recommendation/reference should either (a) be sent together
with the application documents, or (b) be sent directly by the references
11. Documents should be addressed to :
ShinIchi Esumi
Division of Physics, Faculty of Pure and Applied Sciences, University of Tsukuba
Tenno-dai 1-1-1, Tsukuba, Ibaraki 305-8571, Japan
Tel: +81-29-853-4249 / 6121 Fax: +81-29-853-6618
E-mail: [email protected]
=================================================================================================
• Postdoc position at LLNL
LLNL has an opening for a Postdoc in Relativistic Heavy Ion Physics. Interested applications should submit to the online posting below and arrange to have 3 letters sent to [email protected].
=================================================================================================
• # Postdoctoral research associate position at William and Mary
The Physics Department at the College of William and Mary invites applications for a postdoctoral research associate in the experimental hadronic physics group to work on the GlueX experiment in Hall D at nearby Jefferson Lab. The successful applicant is expected to take a leadership role in the construction and commissioning of a new DIRC particle identification detector, which will provide kaon identification to search for exotic mesons containing strange quarks. There will be additional opportunities to contribute to data analysis with the initial GlueX physics program, scheduled to begin in Fall 2016.
Applicants must have a Ph.D. in experimental nuclear or particle physics. Experience with hardware and data analysis, in particular hadron spectroscopy utilizing amplitude analysis, is desirable. Candidates must apply online athttps://jobs.wm.edu, and submit a cover letter, curriculum vitae and research statement. You will be prompted to submit online the names and email addresses of three references who will be contacted with instructions for how to submit a letter of reference.
William & Mary values diversity and invites applicants from underrepresented groups who will enrich the research, teaching, and service missions of the university. We are an Equal Opportunity/Affirmative Action employer, and we encourage applications from women, minorities, protected veterans, and individuals with disabilities.
Further information concerning the W&M Physics Department can be found at http://www.wm.edu/as/physics. Inquiries can be sent to Justin Stevens at [email protected]
=================================================================================================
• # Postdoctoral position at University of Colorado
The experimental heavy ion group at the University of Colorado Boulder is seeking to hire a Postdoctoral Research Associate to conduct research with Prof. Dennis Perepelitsa. The Colorado group is involved in the Heavy Ions program at the ATLAS experiment at the LHC and with the proposed sPHENIX detector at RHIC. The candidate is expected to take a leading role in data analysis within ATLAS Heavy Ions and to make technical contributions to the overall experimental effort. Furthermore, the candidate may potentially be involved in aspects of the detector development and simulations effort within sPHENIX. Candidates should have some interest in photon-, jet-, and heavy flavor- based probes of the quark-gluon plasma in LHC Run 2 data, but could also be interested in hard probes of, or collectivity in, small or ultra-peripheral collision systems. The position is initially for two years, to be started in late 2016 or early 2017. The candidate will be based in Boulder, Colorado with travel to CERN and BNL as appropriate. Applicants will be considered until the position is filled. For full consideration, send materials by October 15th, 2016.
The job posting may be found at: https://cu.taleo.net/careersection/2/jobdetail.ftl?job=06480
=================================================================================================
# The Department of Physics and Astronomy at Rutgers University invites applications for a postdoctoral position (or research associate) in
experimental nuclear physics, to conduct research with Prof. Sevil Salur. The researcher is expected to collaborate on studies of relativistic heavy
ion collisions delivered by RHIC and LHC focusing on the measurement of high momentum particles, including jet reconstruction, to study the properties of deconfined quark-gluon matter. The position is initially for two years, starting as soon as the position is filled, and can be renewed based upon satisfactory performance and availability of funding. Applicants should have a Ph.D. in physics or expect to receive one before
their start date.
Applications consisting of a curriculum vitae, publication list, and a brief (1-2 page) description of research interests and accomplishments
should be e-mail to [email protected]. Applicants should also arrange for three letters of recommendation to be sent via e-mail.
Rutgers, the State University of New Jersey, is an Equal Opportunity / Affirmative Action Employer. Qualified applicants will be considered for employment without regard to race, creed, color, religion, sex, sexual orientation, gender identity or expression, national origin, disability status, genetic information, protected veteran status, military service or any other category protected by law. As an institution, we value diversity of background and opinion, and prohibit discrimination or harassment on the basis of any legally protected class in the areas of hiring, recruitment, promotion, transfer, demotion, training, compensation, pay, fringe benefits, layoff, termination or any other terms and conditions of employment.
==========================================================================================================================
• Postdoctoral Research Position at the University of Tennessee
The University of Tennessee is seeking candidates for a postdoctoral position in the experimental low-energy nuclear physics program. The successful candidate will lead the development and implementation of
a new high-resolution neutron detector for decay and reaction studies.
This research program is funded by the Stewardship Science Academic Alliances with DOE-NNSA. The candidate should have a Ph.D.
(or will soon graduate) and demonstrable experience in experimental nuclear physics or a similar field.
Review of applications will begin on September 15, 2016 and will continue until the position is filled.
Applicants should apply on-line at https://ut.taleo.net/careersection/ut_knoxville/jobdetail.ftl?job=1600000171.
Please provide your CV with a list of publications. Two letters of recommendation are requested. Any questions regarding this posting
can be sent to prof. Robert Grzywacz [email protected].
=====================================================================================================
• Postdoctoral Research Associate Position in experimental nuclear physics: The Old Dominion Unversity
The Old Dominion University Experimental Nuclear Physics group is seeking a postdoctoral associate to support our experimental program at the nearby Thomas Jefferson National Accelerator Facility (Jefferson Lab). The group (consisting of professors M. Amaryan, S. Bueltmann, G. Dodge, C. Hyde, S. Kuhn, and L. Weinstein plus 2-3 postdocs, 10-12 graduate students and Jefferson Lab affiliates) is one of the largest research groups at Jefferson Lab. We are leading several experiments with the newly upgraded 12 GeV beam at the lab, including investigations of nucleon structure, nucleon-nucleon correlations in nuclei, hadron spectroscopy and searches for Physics Beyond The Standard Model. We are also developing and building detectors and targets for these experiments and are working towards the realization of a future electron-ion collider. Depending on the candidate’s experience and preferences, he/she would contribute to current DVCS measurements in Hall A, studies of short range correlations in Halls A, B and C, and/or analysis of existing data from Hall B in hadron spectroscopy. For more information, see http://www.odu.edu/physics/research.
A Ph.D. in experimental nuclear physics or closely related field is required. To apply, submit a letter of application, and curriculum vitae to the ODU Research Foundation http://www.researchfoundation.odu.edu/. Click on the employment tab and follow the link for position #16-025. Please have three letters of reference sent directly to [email protected].
Screening of applicants will commence immediately and continue until the position is filled.
=====================================================================================================
• Postdoctoral Research Associate Position in experimental nuclear physics: University of Michigan
The University of Michigan medium energy group invites applications for a Postdoctoral Research Associate Position. The successful candidate will join our ongoing Drell-Yan effort with the SeaQuest collaboration at Fermilab. SeaQuest will evolve over the next several years from running with unpolarized liquid hydrogen and deuterium targets to running with a polarized frozen ammonia target to study the u-bar Sivers functions and its connection to the orbital angular momentum of light sea quarks. The successful candidate will be involved in the current Drell-Yan measurements of the d_bar over u_bar ratio, but the primary focus will be with the development, installation and running of the polarized frozen ammonia target. Previous experience with cryogenic targets and especially with polarized solid targets will be advantageous. The position requires residence in the vicinity of Fermilab and periodic travel to the University of Michigan. Applicants must hold a Ph.D. in experimental nuclear or particle physics.
The position is available starting 6/1/2016, or at a later, mutually agreed date. The initial appointment is for one year, renewable by mutual agreement for up to three years. The University of Michigan is an Affirmative Action/Equal Opportunity Employer.
Candidates should send a cover letter, a CV, and have three letters of recommendation sent to: Wolfgang Lorenzon Email:
[email protected]<mailto:[email protected]>
=======================================================================================================
• Postdoctoral Research Associate Position, experimental nuclear physics. Hadronic Physics Group Massachusetts Institute of Technology
The Laboratory for Nuclear Science at MIT invites applications for a Postdoctoral Research Associate position with the Hadronic Physics Group.
The successful candidate will join our ongoing collaboration with Brookhaven National Laboratory (BNL), Upton, Long Island, New York to develop a source of polarized He--3 ions for the Relativistic Heavy Ion Collider at BNL. The BNL--MIT collaboration has developed a concept using high field optical pumping and the existing Electron Beam Ionization Source at BNL. The main focus of effort over the next several years is to realize this concept and to test it by extracting and measuring the nuclear polarization of fully stripped polarized He--3 nuclei. The project offers a unique opportunity for a young physicist to play a leading role in the development of cutting--edge ion--source technology, which is essential for next-- generation subatomic physics experiments.
The position requires residence in the vicinity of Brookhaven National Laboratory and periodic travel to MIT.
Applicants should have a recent Ph.D. in physics.
MIT is an Affirmative Action/Equal Opportunity Employer and encourages women and minorities to apply.
Please submit your CV, cover letter, and arrange for three letters of recommendation to be sent to:
Richard Milner 26--411
MIT
77 Massachusetts Avenue Cambridge, MA 02139
Email: [email protected]
=========================================================================================
• 2 PhD fellowships in Experimental Heavy-Ion Physics, Niels Bohr Institute, Faculty of Science, University of Copenhagen
The High Energy Heavy Ion (HEHI) group at the Niels Bohr Institute, Faculty of Science, University of Copenhagen, announces two PhD fellowships with start 1 September 2016 or as soon as possible thereafter.
The group’s current research is centered around the ALICE experiment at the Large Hadron Collider (LHC) at CERN. The group operates the Forward Multiplicity Detector (FMD) and the TPC-laser system in ALICE. Current research interests include the study and analysis of collective anisotropic flow, correlations, identified particle spectra and global observables (multiplicity) over a broad range of rapidity.
We are seeking excellent PhD fellow candidates with demonstrated initiative to strengthen and further develop the group’s activities in a 3 year PhD fellowship.
The successful candidates will also be expected to participate in 1) the running of the experiment at CERN in data taking periods and contribute to the quality control of data taken with the detectors operated by the group, 2) workshops and analysis meetings at CERN, and, 3) contribute to general ‘service tasks’ in the ALICE collaboration.
Applicants may be invited for an interview in Copenhagen.
The deadline is May 1, 2016. The link to the full add including employment conditions etc is: . http://jobportal.ku.dk/phd/?show=814922
==========================================================================
• Experimental Heavy-Ion Physics on CMS
Rice U. - Postdoc
Field of Interest: hep-ex, nucl-ex
Experiment: CERN-LHC-CMS
Region: North America
Job description:
The experimental heavy-ion physics group at Rice University invites applications for a postdoctoral research associate position to join our efforts on the Compact Muon Solenoid (CMS) experiment at the Large Hadron Collider (LHC).
The Rice heavy-ion physics group plays major roles in both the STAR experiment at RHIC and the CMS experiment at the LHC. On CMS, the Rice group has major responsibilities in online Level-1 (L1) and High-Level Trigger (HLT) development, and physics analyses of pp, pPb and PbPb data. Our physics interests focus on studying novel collective phenomena from pp, pPb to PbPb systems, as well as on a wide range of topics related to particle correlations. The successful candidate is expected to lead important analyses of the LHC Run-2 data and contribute to experimental activities and operations. The initial appointment is for one year, renewable based on satisfactory performance and funding availability.
Applicants must have, or be about to obtain, a Ph.D. in experimental nuclear or particle physics. Qualified candidates should apply electronically by sending a curriculum vita and arranging for three letters of reference to be sent by e-mail to:
Professor Wei Li
[email protected]
The position will remain open until it is filled. Inquires may be addressed to [email protected].
Rice University is an Equal Opportunity/Affirmative Action Employer. Women, Minorities, Veterans and Persons with Disabilities are encouraged to apply.
Contact: Wei Li
Email: [email protected]
Letters of Reference should be sent to: [email protected]
===========================================================================================================================================
• Position opening for professorship, research scientist and postdoctoral fellow at USTC
http://cicpi2011.ustc.edu.cn/gaikuang/yjdw/zszp/
The Collaborative Innovation Center for Particles and Interactions (CICPI) at the University of Science and
Technology of China (USTC) invites applications for following positions:
- Faculty positions at associate or full professor level with tenure
Candidates whose research and professional accomplishments advance the university’s mission and meet
established USTC academy criteria would be supported by either the National Thousand Young Talents
Program, or the Hundred Talents Program of the CAS, depending on their achievement and academy potential.
The applicants should have a Ph.D. in physics, a demonstrated record of accomplishment in research as shown
by ongoing research programs, and a publication record that provides academic productivity and creativity.
Successful candidates will enjoy highly collegial and interactive environment, and a generous startup funding.
Salaries will be commensurate with experiences and qualifications of the candidates.
- Research scientists at the associate and full professor level
The positions are for three years with possibility of extending to another three years, or even being
promoted to tenured positions, depending on professional and academic performance. The successful
applicants should have a Ph.D. in physics, a demonstrated record of accomplishment in research and
a publication record that provides academic productivity and creativity.
- Postdoctoral positions
The positions are for two years, with a possibility of extending to another two years. The positions can lead to
research scientists or tenure-track assistant professors, depending on research performance during the period
at USTC. The candidates should have a Ph.D. by the date of appointment.
CICPI at USTC is one of the leading research centers in China for experimental particle and nuclear physics. The
center hosts several research groups in experimental particle and nuclear physics and theoretical nuclear physics.
We have the National Key Laboratory for Particle Detection and Electronics supported by the Ministry of Science
and Technology of China.
Our research programs include both domestic projects in China and several large international collaborations.
These projects include: the BESIII experiment at the Beijing Electron Positron Collider (BEPCII); the ATLAS
experiment at CERN; the STAR experiment at BNL; the JLAB 12 GeV upgrade program, the Belle experiment
at KEK; the Dayabay nuclear reactor neutrino experiment; the space dark matter search experiment DAMPE; the
Large Area High Attitude Cosmic Ray project and the development of positron beam and muon beam at Chinese
Spallation Neutron Source (CSNS). We are also actively performing R&D of the particle detection for future
accelerator and non-accelerator based experiments. The research fields of theoretical physics are mainly
phenomenology of particle physics, the intermediate and high energy nuclear physics.
Applicants who are interested in the above or related fields are encouraged to submit applications with their CV,
publication list, research interests and arrange at least five/three recommendation letters (faculty/research scientist
and postdoc) via emails to [email protected] and copied to [email protected].
• Software Engineer for CMS DAQ/WBM project
Rice University has an opening for a software engineer to work on
DAQ/WBM projects at CMS. The position will be based at CERN.
Interested applicants can apply through:
https://jobs.rice.edu/postings/6534 .
======================================================================================
A summary of job description:
The Rice University group has an opening for a software engineer to work
on the online and data acquisition systems of the Compact Muon Solenoid
(CMS) experiment at CERN. The responsibilities for this position include
the development and maintenance of online systems that acquire and
monitor non-event data. Additionally, a significant responsibility will
involve software development for and maintenance of the CMS data
acquisition system. The successful applicant is expected to collaborate
with both technical staff and scientists and efficiently communicate in
such environments about requirements and proposed methodologies. The
work location will be at CERN, Geneva, Switzerland. The successful
applicant must be willing to occasionally work outside regular working
hours, which may include nights, weekends, or official holidays, as well
as have a willingness to do shift and be on stand-by duty.
or Dr. Frank Geurts ( [email protected] ).
• Postdoctoral Opportunity in Experimental Nuclear physics in Rutgers University (Jan. 2016)
The Department of Physics and Astronomy at Rutgers University invites applications for a postdoctoral position (or research associate) in experimental nuclear physics, to conduct research with Prof. Sevil Salur.
The researcher is expected to collaborate on studies of relativistic heavy ion collisions at LHC using the CMS experiment and focusing on the measurement of high momentum particles, including jet reconstruction, to
study the properties of deconfined quark-gluon matter. Continuing to do research with RHIC experiments is also possible. The position is initially for two years, starting as soon as the position is filled, and can be
renewed based upon satisfactory performance and availability of funding. Applicants should have a Ph.D. in physics or expect to receive one before their start date.
Applications consisting of a curriculum vitae, publication list, and a brief (1-2 page) description of research interests and accomplishments should be sent to [email protected] by April 15, 2016. Applicants
should also arrange for three letters of recommendation to be sent via e-mail by the same date.
Rutgers, the State University of New Jersey, is an Equal Opportunity / Affirmative Action Employer. Qualified applicants will be considered for employment without regard to race, creed, color, religion, sex, sexual orientation, gender identity or
expression, national origin, disability status, genetic information, protected veteran status, military service or any other category protected by law. As an institution, we value diversity of background and opinion, and prohibit discrimination or harassment
on the basis of any legally protected class in the areas of hiring, recruitment, promotion, transfer, demotion, training, compensation, pay, fringe benefits, layoff, termination or any other terms and conditions of employment.
• Postdoctoral Opportunity in Experimental Nuclear Structure, Reactions and Astrophysics (Jan. 2015)
Deadline: February 15th, 2016 `til filled.
See: -
The low energy nuclear physics experimental group at Rutgers University anticipates an opening for a postdoctoral position as of May 15, 2016.
The successful candidate would work under the supervision of Professor Jolie Cizewski, the Director of the Center of Excellence for Radioactive Ion Beam Studies for Stewardship Science (RIBSS) and University of Tennessee-Knoxville Professor Robert Grzywacz, Associate Director of the RIBSS Center.
The RIBSS Center is a consortium of nuclear scientists, including those at Rutgers University, the University of Tennessee-Knoxville and Oak Ridge National Laboratory, focusing on reaction and decay studies to probe nuclear structure and astrophysics. The successful candidate will become part of the team of scientists using radioactive decay and transfer reactions to study properties of unstable nuclei of interest to both nuclear structure and astrophysics. The successful candidate would be expected to take a leadership effort in simulating the response of scintillator detectors and develop new experimental techniques and detectors. The scintillator detector systems include the VANDLE array of plastic scintillators for beta-delayed and (d,n) reaction neutron detection, and HAGRiD, a new array of LaBr3 scintillator detectors for photons that is being developed. The activities of this Center are currently focused in Oak Ridge and Knoxville, Tennessee. Experimental measurements are performed at stable and radioactive ion beam facilities including Michigan State University, Argonne National Laboratory and CERN in Switzerland.
This position provides an excellent opportunity for an early career scientist to develop an independent research program as part of an established user group. Applications will be reviewed starting February 15, 2016 until the position is filled. Applications with resume, list of publications, and names and contact information for three references should be sent to:
Professor Jolie A. Cizewski
Department of Physics and Astronomy
Rutgers University
Piscataway, NJ 08854-8019 USA
[email protected]
You are also welcome to contact Professor Grzywacz [email protected] should you have questions.
• Postdoctoral Position LAL/LLR LHCb team (Jan. 2015)
See: https://inspirehep.net/record/1414681
A two-year postdoctoral position founded by the Paris-Saclay labex P2IO is opened in the joined LAL/LLR LHCb team. https://inspirehep.net/record/1414681
There are currently 10 CNRS permanent researchers, 4 post-docs and 2 PhD students in the joined LAL/LLR team. The group is involved in the operation of the calorimeter and the preparation for the detector upgrades. Analysis activities, in pp collisions, are focused on B and B_c^+ meson studies, search for D mesons rare decays and measurements of quarkonia properties. The group is also strongly involved in the study of heavy flavors production in heavy ion collisions, for which first data have just been recorded in late 2015.
The fellow will participate in this new effort to precisely study the features of the Quark Gluon Plasma. More precisely, the fellow will study heavy flavor (charmonium and/or open charm) productions in heavy ion collisions with the LHCb detector, in its “fixed-target” (SMOG) mode, benefiting from the deep expertise of the team both on the detector and physics aspects. She or he will also be invited to participate in the common efforts on reconstruction software, simulation or luminosity measurements.
The postdoc will be based at LLR with frequent visit at LAL. She or he will regularly go to CERN to participate in data-taking and monitoring of the detector. Applicants should have a PhD (or a fixed date of defense) and not more than 6 years of postdoctoral experience. The contract should start by the end of summer 2016.
Applications should include curriculum vitae and at least two letters of reference to be sent to Frédéric Fleuret ([email protected]) and Patrick Robbe ([email protected]) before march 31st 2016.
• Postdoctoral Research Fellow / Research Assistant Professor Experimental Nuclear Physics and Detector Development at Temple University (Dec. 2015)
See: https://phys.cst.temple.edu/nupax/openings/Temple-University-Postdoctoral-Research-Fellow.pdf
The Temple University Nuclear and Particle Physics group has an opening for a postdoctoral research fellow position in experimental nuclear physics with an emphasis on detector development. The group studies proton spin structure and dynamics using high-energy polarized p+p collisions at BNL/RHIC, focusing primarily on gluon and quark/antiquark polarization using both jet and W production. The group has a strong interest in micro-pattern detector development, in particular GEM detectors for a future Electron-Ion Collider. We profit from a new state-of-the-art detector and clean room facility provided by the new Science Education and Research Center at Temple University. The work is carried out in close collaboration with a group at CEA Saclay, led by Dr. Franck Sabatié, focusing on MicroMegas detectors. Extended research visits to France are anticipated.
The candidate is expected to play a leading role in physics analysis and detector development. A strong background in ROOT and general programming skills are required. In addition, a strong interest in detector development and experience in working with particle physics detectors is essential. Exceptional candidates might be considered for a position as a research assistant professor.
For full consideration, all application material, CV, research statement and three letters of recommendation should be submitted by February 15, 2016 by email to Professor Bernd Surrow ([email protected]). Any questions about this position can be directed here as well. Temple University is an equal opportunity, equal access, affirmative action employer committed to achieving a diverse community. Applicants from minority groups are strongly encouraged to apply
• CMS relativistic heavy-ion postdoc position at Purdue (Dec. 2015)
The Purdue High Energy Nuclear Physics group studies relativistic heavy-ion collisions as members of the RHIC-STAR and LHC-CMS experiments. Our primary physics interests are in the areas of particle correlations and heavy flavor production to elucidate the properties of high-density QCD. A post-doctoral research associate position is available within the group for CMS.
The position can start as early as January 1, 2016, and applications are open until the position is filled. The successful candidate is expected to lead a significant physics project and participate in experimental activities. This appointment is for one year, renewable up to three years. A Ph.D. in physics or a related field is required at time of appointment.
Applicants should send their curriculum vitae and arrange for three letters of reference to be sent to Prof. Fuqiang Wang at [email protected].
Purdue University is an Equal Opportunity Employer.
• Faculty Position in Experimental Nuclear Physics - JLab - Catholic University of America (Dec. 2015)
See: Below
The Physics Department at The Catholic University of America seeks to fill a tenure-track assistant professor position in experimental nuclear physics, to begin in August 2016.
Our research program focuses on the study of hadron structure with electromagnetic probes through exclusive and semi-inclusive scattering experiments at the Jefferson Laboratory (JLab) - a flagship US nuclear physics facility in the US. The research at JLab will advance our understanding of the fundamental structure of matter and the origin of the mass of the visible universe, which comes ~98% from the interactions inside strongly bound systems. Our approved experimental program, which is scheduled to run in the next few years, is aimed at probing the valence quark structure of strongly interacting systems and the dynamics that bind the most basic elements of nuclear physics. The CUA group has a strong history of involvement and plays a central role at JLab. The group has built and is responsible for the tagger magnet system in Hall B, the aerogel Cherenkov detector in Hall C, and the tagger microscope in Hall D that is a major part of the beam line. Our latest project is the construction of the Neutral Particle Spectrometer (NPS) in Hall C. We are also involved in the development of the Electron Ion Collider (EIC), a next generation experimental facility, which would for the first time allow for studies of the fundamental structure of matter by directly probing the virtual force carriers of QCD, the gluons.
We seek candidates who understand, are enthusiastic about, and will make a significant contribution to the mission of the University, which can be found here: https://www.cua.edu/about-cua/mission-statement.cfm.
We are searching mainly for candidates with a primary interest in the program of hadronic and nuclear physics carried out at JLab. The successful candidate will have a strong commitment to excellence in teaching and will be expected to build a strong research program that will enhance the current programs at the Catholic University of America. We plan to hire at the assistant professor level, but will also consider particularly qualified more senior applicants.
Applicants should have a Ph.D. in physics or a related field, have demonstrated the ability to initiate and lead research, have an established record of publications in scientific journals, and good teaching skills. Applicants should submit curriculum vitae, publication record including citation information, research plan, teaching plan, and a one- to two-page personal statement indicating how the candidate, through her or his research, teaching, and service, would make a distinctive contribution to advancing the University’s mission
The University will perform background checks on all new faculty hires prior to making the final offer of employment.
Contact: Tanja Horn (email: [email protected])
The Catholic University of America is an Equal Opportunity Employer.
• Physicist Postdoctoral Fellow(Nuclear Science)- Berkeley Lab's Nuclear Science Division (Nov 2015)
See: https://lbl.taleo.net/careersection/2/jobdetail.ftl?lang=en&job=81777
Position Summary:
Berkeley Lab’s Nuclear Science Division has an opening for an Physicist Postdoctoral Fellow. You will initiate and contribute to heavy-ion analyses of ALICE or STAR data, spin-physics data of STAR experiment, and/or to perform detector R&D towards STAR upgrades and/or a future Electron-Ion Collider experiment.
What You Will Do:
-Analyze heavy-ion experiments from ALICE at LHC or STAR at RHIC.
-Participate in taking data.
-Calibration and physics analysis.
-Data analysis for spin results from STAR experiment.
-Detector R&D with the state of art Si technology for future Electro-Ion Collider experiment.
What Is Required:
-Ph.D. in physics, nuclear and high-energy physics, or a closely related field, within the last two years.
-Experience with modern data analysis, simulation, and computer programming.
-Demonstrated proficiency in written and oral dissemination of scientific results.
The posting shall remain open until the position is filled, however for full consideration, please apply by December 7, 2015.
Notes: This is a 2 year term appointment with the possibility of renewal for up to 5 years based upon satisfactory job performance, continuing availability of funds, and ongoing operational needs. Salary for postdoctoral positions depends on years of experience post-degree. This position requires completion of a background check.
Berkeley Lab understands the postdoctoral experience in a research environment is unique.[hmm] We are committed to the growth and development of early career researchers in pursuit of becoming next generation scientists and engineers. Read about the excellent postdoctoral benefits at Berkeley Lab.
Equal Employment Opportunity: Berkeley Lab is an Equal Opportunity/Affirmative Action Employer. All qualified applicants will receive consideration for employment without regard to race, color, religion, sex, sexual orientation, gender identity, national origin, disability, age, or protected veteran status.
• Postdoctoral Research Associate Position in Radiation Therapy- Rice University (Nov 2015)
The selected candidate will join a team of researchers at Rice University and MD Anderson working in proton and ion therapy for cancer treatment. The candidate is expected to hold a Ph.D. in physics, preferably in medical, nuclear or particle physics. Proficiency with computer programing languages is required. Experience with programs to simulate the interaction of radiation with matter, like GEANT4, MCNPX, EGS, FLUKA, or similar computer tools will be required for carrying out the research program. Data analysis skills will be necessary to evaluate treatment plans based on Monte Carlo techinques. The successfull candidate will have to demonstrate critical thinking and the ability of carrying out independent research. The position will be available for three years. Please send your application and three letters of recommendation to Pablo P. Yepes ([email protected]).
• Postdoctoral Research Associate Position in Experimental Nuclear Physics (PHENIX/sPHENIX) - University of Michigan (Nov 2015)
The RHIC group at the University of Michigan is seeking to hire a Postdoctoral Research Associate, with a start date between January and April 2016. The candidate will be expected to work primarily on analysis of PHENIX 2015 transversely polarized proton-proton data, as well as contribute to the development of the EMCal for the proposed sPHENIX detector at RHIC. The individual could be stationed either at BNL or in Ann Arbor.
Applicants should submit a CV and arrange for three letters of recommendation to be sent to Prof. Christine Aidala ([email protected]
• Tenure Track Faculty Position in Experimental Particle/Nuclear Physics - University of Massachusetts-Amherst (Nov 2015)
See: https://umass.interviewexchange.com/jobofferdetails.jsp?JOBID=65788&CNTRNO=0&TSTMP=1447084716666
Job Description:
The Physics Department of the University of Massachusetts Amherst invites applications for a tenure-track faculty position in experimental particle/nuclear physics to start September 1, 2017. The focus area for this position is non-accelerator physics, including dark matter searches, neutrino physics, and physics probing fundamental symmetries at low energy. The new faculty member will be part of the Amherst Center for Fundamental Interactions (http://www.physics.umass.edu/acfi/), recently established to enhance the interplay between theoretical and experimental research at the interface between the cosmic, intensity, and high-energy frontiers. The Department is currently involved in searches for WIMP dark matter (DarkSide), neutrino-less double beta decay (EXO-200/nEXO), and solar neutrinos (Borexino/SOX), and the precision determination of muon g-2. Other particle physics efforts include QCD probes at JLab, and ATLAS at CERN. Further information about the Department's research can be found at http://www.physics.umass.edu/.
Requirements:
The Department seeks an individual with outstanding research and a strong commitment to teaching. The candidate is expected to set up a vigorous, independent research program. A PhD or equivalent education in areas closely related to dark matter, neutrino, neutron, and low energy particle physics, and postdoctoral experience are required. We are seeking talented applicants qualified for an assistant professor position. Under exceptional circumstances, highly qualified candidates at higher ranks may receive consideration.
The university is committed to active recruitment of a diverse faculty and student body. The University of Massachusetts Amherst is an Affirmative Action/Equal Opportunity Employer of women, minorities, protected veterans, and individuals with disabilities and encourages applications from these and other protected group members. Because broad diversity is essential to an inclusive climate and critical to the University's goals of achieving excellence in all areas, we will holistically assess the many qualifications of each applicant and favorably consider an individual's record working with students and colleagues with broadly diverse perspectives, experiences, and backgrounds in educational, research or other work activities. We will also favorably consider experience overcoming or helping others overcome barriers to an academic degree and career.
We are seeking talented applicants qualified for an assistant professor position. Under exceptional circumstances, highly qualified candidates at other ranks may receive consideration.
Application Instructions:
To apply online, please go to https://umass.interviewexchange.com/jobofferdetails.jsp?JOBID=65788&CNTRNO=0&TSTMP=1447084716666 to submit a resume, cover letter, a detailed research plan, a teaching statement, and contact information for three professional references. Applicants should apply by the priority deadline of January 4, 2016, in order to ensure consideration.
• Postdoctoral Research Associate in Experimental Relativistic Heavy Ion Physics - Wayne State University (Oct 2015)
See Below
The High Energy Nuclear Physics Group, Department of Physics and Astronomy, Wayne State University, invites applications for a postdoctoral research associates position. Candidates should hold a Ph.D. in high energy particle or nuclear physics and have a strong background in the data analysis. The Wayne State group (Professors: W. Llope, C. Pruneau, J. Putschke, and S. Voloshin) is a member of the ALICE collaboration at LHC, and STAR at RHIC.
The successful candidate will conduct research and carry out data analysis in the area of the group interests (correlations, flow, jets).
Applications including a CV, a brief description of the research interests, list of publications, and three recommendation letters should be sent electronically to:
Prof. Sergei A. Voloshin, E-mail: [email protected]
• (2) Postdoctoral Research Position in Experimental Particle Physics (ALICE) - Utrecht University (Oct 2015)
See Below
Requirements:
The Dutch ALICE group has a strong role in the measurements of fluctuations and correlations and in the preparation and construction of the new ALICE silicon inner tracking detector. We are looking for postdoctoral researchers who are able to take a strong leading role in data analysis and in the construction of the new silicon detector.
Offer:
The positions are for two years and available immediately. The candidate will be employed by Utrecht University and the positions are funded via NWO. You will receive a competitive salary, and an additional net allowance during a stay at CERN. The conditions of employment are excellent and include extra months' salary payment in May and December and good travel facilities.
Applications:
Qualified applicants are encouraged to contact Prof. Dr. R.J.M. Snellings (head FOM ALICE program, [email protected]). Please be prepared to mail a curriculum vitae including a brief description of your research interests, and have the email addresses of at least three referents ready, who are willing to send a letter of recommendation on your behalf.
• Tenured-track/tenured lecturer position - University of California Riverside (Oct 2015)
Deadline: September 30th, 2015(for full consideration)
See: https://aprecruit.ucr.edu/apply/JPF00380
The Department of Physics and Astronomy at UC Riverside invites applications for a Lecturer with the Potential for Security of Employment (LPSOE), beginning January 1, 2016. UCR is a world-class research university with an exceptionally diverse undergraduate student body. Its mission is explicitly linked to providing routes to educational success for underrepresented and first-generation college students. A commitment to this mission is a preferred qualification. Well-qualified and experienced candidates may instead be considered for a position as a Lecturer with Security of Employment (LSOE). These positions parallel the tenure-track faculty series and will involve classroom instruction and development of the department’s General Physics program. A Ph.D. in physics or a related discipline and demonstrated excellence in teaching and teaching pedagogy is required. Experience with curriculum development, innovation in teaching, and educational grant writing is highly desirable.
The duties of the LPSOE/LSOE position will consist of: Classroom lecture instruction in lower division undergraduate General Physics (and possibly upper division instruction in the LPSOE/LSOEs area of specialization) and general oversight of the undergraduate General Physics program for non-Physics majors (including instructional pedagogy development and improvement, textbook evaluation and selection, TA training and oversight, development of student evaluation mechanisms, design of teaching laboratory experiments, etc.). The successful candidate will be expected to develop curricula and instructional initiatives, including preparation and submission of extramural instructional/educational grant proposals. Publication of pedagogical innovation and/or assessment methods in high-quality peer-reviewed journals will be encouraged.
Applicants should apply through the AP Recruit site at https://aprecruit.ucr.edu/apply/JPF00380 by September 30, 2015 for full consideration. It is necessary to submit a curriculum vitae, a list of publications, a statement of teaching philosophy, and a description of your background in education and your academic experience. It is also necessary to arrange for three reference letters to be submitted directly to the AP Recruit site by September 30, 2015. Review of applications will commence on September 30, 2015, but the position will remain open until filled. For any inquiries please contact the Search Committee Chair, Professor Jory Yarmoff ([email protected]). For more information about the UCR and the Department of Physics and Astronomy, please visit the campus web site at www.ucr.edu and the department website at www.physics.ucr.edu/.
The University of California is an Equal Opportunity/Affirmative Action Employer. All qualified applicants will receive consideration for employment without regard to race, color, religion, sex, sexual orientation, gender identification, national origin, age, disability, protected veteran status, or any other characteristic protected by law.
• Postdoctoral Positions (PHENIX & SeaQuest) at Los Alamos National Laboratory (Sept 2015)
See: https://inspirehep.net/record/1315890
Job description:
The Physics Division at Los Alamos National Laboratory invites outstanding applicants for post-doc positions in the High Energy Nuclear Physics Team of the Subatomic Physics Group (P-25). The team currently works primarily on RHIC spin, cold nuclear matter and heavy ion physics using the PHENIX detectors at BNL, and on nucleon structure and quark energy loss, polarized fixed target Drell-Yan physics and dark photon and dark Higgs search at Fermilab (E906/E1039/E1067). The team also led the construction of the two PHENIX muon trackers and recently completed the upgrade project to install a forward silicon vertex tracker into the PHENIX Detector. At Fermilab, we are building a polarized NH3 target for the E1039 and developing a new displaced dimuon trigger for the E1067 experiments.
The successful candidates will participate in our on-going physics programs, working on a combination of physics analysis and hardware tasks. The candidate must have or expect to complete soon a Ph.D. in physics, preferably high energy nuclear or particle physics, and it must be less than 5 years since the Ph.D. was granted. The post-doc term is for 2 years, with an option to renew for a third year. Potential candidates should submit a resume and three letters of reference to Dr. Ming Liu (mliu at lanl.gov).
Details about the LANL post-doc program can be found at: http://www.lanl.gov/careers/career-options/postdoctoral-research/index.php
Desired Skills
Experience in physics analysis and detector technologies commonly used in high-energy nuclear and particle physics experiments is highly desired.
Education
A Ph.D. or equivalent experience in high-energy Nuclear or Particle Physics within the past five years or soon to be completed.
Notes to Applicants
For full consideration, applicants should submit a comprehensive resume, a cover letter describing their qualifications with respect to all required and desired skills, and three references.
Positions do not require a security clearance. Candidates may be considered for a Director's Fellowship and exceptional candidates may be considered for the prestigious Marie Curie, Richard P. Feynman, J. Robert Oppenheimer, or Frederick Reines Fellowships. Los Alamos National Laboratory is an equal opportunity employer and supports a diverse and inclusive workforce.
Contact: Ming Liu
Email: [email protected]
Letters of Reference should be sent to: [email protected]
• Postdoctoral Researcher in Experimental Nuclear Physics - Lehigh University (Sept 2015)
Deadline: Now! or December 1st, 2015
The Lehigh University experimental relativistic heavy ion physics group has an opening for a Postdoctoral Researcher. The group works on the STAR experiment at Brookhaven National Laboratory and is a member of the newly formed “A Large Acceptance Jet and Upsilon Detector” collaboration, also at Brookhaven.
The successful candidate will work closely with Rosi Reed, and is expected to play a leading role in the measurement of jets and jet-like correlations, as well as take an active supporting role in the Event Plane Detector project at STAR. The candidate should have some interest in the upcoming Beam Energy Scan II. The possibility will exist to work on a hardware or software project for the new “A Large Acceptance Jet and Upsilon Detector”. The candidate is expected to assist in the training of graduate students, and thus will be stationed at Lehigh University, but will also be expected to interact with the scientists at Brookhaven National Lab. A Ph.D. in physics or a related field is required at time of appointment.
The initial appointment period is for one year, with the possibility of renewal annually for three years contingent on acceptable job performance, with a negotiable starting date. Applications will be considered until position is filled; for full consideration, send materials before December 1, 2015. Applicants should send a CV and arrange for three letters of reference to be uploaded to the website https://academicjobsonline.org/ajo/jobs/6218.
Lehigh University is an affirmative action/equal opportunity employer and does not discriminate on the basis of age, color, disability, gender, gender identity, genetic information, marital status, national or ethnic origin, race, religion, sexual orientation, or veteran status.
• Postdoctoral Position - Relativisitc Heavy Ion Physics (ALICE/PHENIX) - University of Tennessee, Knoxville (Sept 2015)
See: https://ut.taleo.net/careersection/ut_knoxville/jobsearch.ftl?lang=en
The Department of Physics and Astronomy at the University of Tennessee, Knoxville, invites candidates to apply for a Postdoctoral Research Associate position with the Relativistic Heavy Ion Physics group. Our group is currently working both at the ALICE experiment at the LHC and at the PHENIX experiment at RHIC. Within ALICE our main responsibilities are focused on the Electromagnetic Calorimeters and the upgrade of the TPC, whereas at PHENIX we are primarily working with the Muon Arms subsystem. We also have a very close collaboration with the Heavy Ion Reactions Group at ORNL, and we expect our postdoc to interact substantially with that group.
The successful candidate is required to have a Ph.D. in physics with experience in nuclear or high energy physics, will be expected to mentor graduate students, and to travel extensively to CERN and/or BNL. Apply by submitting a curriculum vitae, a publication list, and a brief research statement at https://ut.taleo.net/careersection/ut_knoxville/jobsearch.ftl?lang=en. Candidates should also arrange for three confidential letters of reference to be sent to Prof. Soren Sorensen, 401 Nielsen Physics Building, University of Tennessee, Knoxville, TN 37996-1200 (preferably via email to [email protected]). We assume the successful candidate will start as soon as possible or no later than spring 2016.
All qualified applicants will receive equal consideration for employment and admissions without regard to race, color, national origin, religion, sex, pregnancy, marital status, sexual orientation, gender identity, age, physical or mental disability, or covered veteran status. Eligibility and other terms and conditions of employment benefits at The University of Tennessee are governed by laws and regulations of the State of Tennessee, and this non-discrimination statement is intended to be consistent with those laws and regulations. In accordance with the requirements of Title VI of the Civil Rights Act of 1964, Title IX of the Education Amendments of 1972, Section 504 of the Rehabilitation Act of 1973, and the Americans with Disabilities Act of 1990, The University of Tennessee affirmatively states that it does not discriminate on the basis of race, sex, or disability in its education programs and activities, and this policy extends to employment by the University. Inquiries and charges of violation of Title VI (race, color, national origin), Title IX (sex), Section 504 (disability), ADA (disability), Age Discrimination in Employment Act (age), sexual orientation, or veteran status should be directed to the Office of Equity and Diversity (OED), 1840 Melrose Avenue, Knoxville, TN 37996-3560, telephone (865) 974-2498 (V/TTY available) or 974-2440. Requests for accommodation of a disability should be directed to the ADA Coordinator at the Office of Equity and Diversity.
• Postdoctoral Researcher on CMS Experiment - Princeton University (Based at either CERN or Fermilab) (Sept 2015)
See: http://physics.princeton.edu/jobs/ , #1500760
The University is seeking a Postdoctoral Researcher to work with the High Energy Experiment group in the Physics Department. The successful candidate will play a leadership role in an R&D project on charged particle tracking reconstruction, and other pattern recognition problems, on parallel processor architectures. The candidate will also have the opportunity to do their own research on the CMS experiment at the Large Hadron Collider at the European Laboratory for Particle Physics (CERN) in Geneva, Switzerland. For additional information, please contact the principal investigator Dr. Peter Elmer ( [email protected] ). This position will be based either at CERN, in Geneva, Switzerland or alternatively at Fermilab, near Chicago, IL, subject to negotiation with the principle investigator. This is a full-time, one year position with the possibility of renewal contingent upon satisfactory performance and available funding.
Essential Qualifications:
- Ph.D. in Experimental Particle Physics or a closely related field
- Strong programming skills, in particular with C++ and Python
- Experience developing large-scale scientific software applications, in particular event reconstruction (pattern recognition) techniques relevant for high energy and nuclear physics detectors.
- Strong interpersonal, oral, and written communication skills.
Preferred Qualifications:
- Ability to direct efforts of others within teams of various sizes
- Experience working in large, international scientific collaborations and delivering software in such contexts
- Experience with charged particle tracking reconstruction on large high energy or nuclear physics detectors
- Experience with software performance optimization and/or new processor architectures (GPUs, Xeon Phi, etc.) and associated software technologies (CUDA, OpenCL, etc.)
Princeton University is an equal opportunity employer and all qualified applicants will receive consideration for employment without regard to race, color, religion, sex, sexual orientation, gender identity, national origin, disability status, protected veteran status, or any other characteristic protected by law. This position is subject to the University’s background check policy.
To apply online, please visit http://physics.princeton.edu/jobs/ and submit a cover letter, CV, and contact information for three references.
• (2) Tenure-Track Faculty Position(s) in Physics - United States Naval Academy (Maryland) (Sept 2015)
Deadline: October 1, 2015 + Fill time
See: https://www.usna.edu/HRO/jobinfo/AsstProfPhysics2015.php
Position Description:
The Naval Academy's Physics Department invites applications for a tenure-track faculty position in physics. We are looking to fill two positions. Appointments at all ranks will be considered, but the preference is for junior faculty at the rank of Assistant Professor.
These positions may begin as early as the Fall of 2016.
Our highest priority in conducting a search is finding promising candidates who are interested in developing as teachers in a small-classroom highly-interactive environment as they continue to develop as researchers in their field of expertise.
Teaching is in the context of small classes (class sizes of 24 students or less), with two classes a semester being typical for faculty with a strong research program. We do not have a graduate program here, and thus no TA's either, so faculty members are fully responsible for their classes. Summer school is taught typically by military officers and so the summer months see the balance shift to entirely being research driven for civilian faculty. During the school year, civilian faculty members strive to find an appropriate balance between teaching and research.
In addition to showing signs of being able to establish and carry forward a research program that results in peer-reviewed publications, it is particularly attractive if your research program provides opportunities for upper-class majors to be involved. We have a diversity of experimentalists and theorists (both formal and computational) in our department, and we encourage candidates to think about possible collaborative efforts within our department. Feel free to explore our department webpages for further information, www.usna.edu/PhysicsDepartment.
• Tenure-Track Faculty Position in Experimental Nuclear Physics - University of Colorado, Boulder (Sept 2015)
Deadline: November 15, 2015 + Fill time
See: https://www.jobsatcu.com/postings/106668
The Department of Physics at the University of Colorado at Boulder invites applications for a tenure-track faculty position in experimental nuclear physics. Applications are welcomed in all areas of nuclear physics including relativistic heavy ions, nuclear structure/reactions, medium energy hadronic physics, and fundamental symmetries. The successful candidate is expected to establish a vigorous research program and to teach at the undergraduate and graduate levels.
Applicants should have a Ph.D. in Physics or related areas and should submit curriculum vitae, publication record including citation information, research plan, and teaching plan.
Candidates should apply electronically to https://www.jobsatcu.com/postings/106668 (posting # F02813)and should be prepared to provide contact information for three referees so that letters of reference may be requested.
Review of applications will begin on November 15, 2015, but applications will be accepted and reviewed until the position is filled. Questions should be submitted to [email protected].
The University of Colorado is an Equal Opportunity Employer committed to building a diverse workforce. We encourage applications from women, racial and ethnic minorities, individuals with disabilities and veterans. Alternative formats of this ad can be provided upon request for individuals with disabilities by contacting the ADA Coordinator at [email protected]
• Sub-Atomic Physics (P-25) Group Leader - Los Alamos National Laboratory (Sept 2015)
External applicants can apply by visiting their jobs site at http://www.lanl.gov/careers/career-options/jobs and searching for job number IRC40315.
What You Will Do
Provide overarching technical leadership and management for the Subatomic Physics Group (P-25) and its multiple scientific projects, and serve as a member of the Physics Division management team at Los Alamos National Laboratory. The P-25 Group Leader will report to the Physics Division Leader and contribute to the integrated management and technical leadership of the Division as a whole, working effectively and collaboratively with other groups and program management both within and outside the Division. The successful candidate will lead the Group's strategic and tactical planning directed toward maintaining and refining the long-range Group vision and mission. The Group Leader is responsible for all aspects of Group operations, which includes: effective program development and execution, sound fiscal management, personnel recruiting, professional development, personnel supervision, and working to ensure that Group conduct of operations meets all Laboratory and DOE requirements in safety, security, and environmental management. The successful candidate will also work with other Physics Division leaders in determining and promoting long-range goals which help ensure the overall success of the Division.
What You Need(minimum)
-Record of successful research in a scientific field relevant to at least one of the Group's core research areas or programs, as demonstrated by published articles or project reports.
-Strong record of effective written and verbal communication skills, as evidenced by application materials, letters of reference, interactions with colleagues both inside and outside the Lab, and by seminars, briefings, presentations, and publications.
-Demonstrated successful leadership of a line organization or a large project, of at least 5 or more staff or $5M per year or more, within a scientific research organization -Demonstrated capability in program development and demonstrated scientific and organizational leadership as evidenced by the ability to form, organize, administer, and lead scientific projects or teams. -Financial management skills and commitment to good business practices as demonstrated by performance and accomplishments in previous work assignments. -Demonstrated commitment to the professional development and mentoring of employees. -Demonstrated ability to successfully interact with regulatory and oversight agencies and personnel relevant to the Laboratory. -Record of commitment to safety, security, quality, diversity in the workplace, and AA/EEO. -Ability to obtain a Q clearance, which normally requires U.S. citizenship. For more complete information, please see the link above If anyone is interested in the position, please contact Ming Xiong Liu([email protected]) ASAP • Postdoctoral Research Associate - High Energy Nuclear Physics - CMS - University of Illinois at Chicago (Jul 2015) Deadline: October 15, 2015 See: https://jobs.uic.edu/job-board/job-details?jobID=54682&job=postdoctoral-rese arch-associate-physics Description: The High Energy Nuclear Physics group at the University of Illinois at Chicago has an immediate opening for a Postdoctoral Research Associate position to work on the CMS experiment. The successful candidate will carry out research and physics analysis on CMS data with a focus on studies of the quark gluon plasma. Candidates should have experience in high energy physics, relativistic heavy ions, or a related field, and preference will be given to applicants with experience in jets, jet-reconstruction, and/or heavy flavor. Applications should be completed by October 15, 2015 and must include a curriculum vita, a brief description of research interests, and the names of three references. For general questions about this position, please contact Professor Olga Evdokimov ( [email protected]) or Professor David Hofman ([email protected]). The University of Illinois at Chicago is an Equal Opportunity, Affirmative Action employer. Minorities, women, veterans, and individuals with disabilities are encouraged to apply. Duties: Perform physics analysis and service work related to the CMS experiment. Supervise graduate and undergraduate students. Qualifications: PhD in Physics or related field. Please find more at the link listed above. • Postdoctoral Fellowship in Experimental Relativistic Heavy Ion Physics[CMS+sPHENIX] at Vanderbilt University (Jun 2015) Deadline: July 1, 2015 See: http://research.vanderbilt.edu/postdocs/opps/details/?id=180 The Vanderbilt University experimental relativistic heavy ion physics group has an opening for a Postdoctoral Fellow. The group works on the CMS experiment at the Large Hadron Collider and the PHENIX experiment at Brookhaven National Laboratory. The candidate will be expected to focus on physics data analysis and may support the Tier-2 computing center for CMS. The possibility exists to work on a hardware or software project for sPHENIX. The successful candidate is expected to assist in the training of graduate students. The initial appointment period is for one year, with the possibility of renewal annually for three years contingent on the availability of research funds and adherence to standards of appropriate performance and conduct. Applications will be considered until position is filled; for full consideration, send materials before July 1, 2015. Please send c.v. with references and cover letter to Vicki Greene at [email protected]. Please find more at the link listed above. • Post-doctoral Research Associate in High Energy Nuclear Physics[PHENIX], New Mexico State University-based at Brookhaven National Laboratory (Jun 2015) Deadline: Aug. 31, 2015 See: http://inspirehep.net/record/1373671 The Nuclear and Particle Physics group at New Mexico State University invites applications for a Postdoctoral Research Associate position (Req. No. 1500255S) in Experimental High-Energy Nuclear Physics. The position will be based at Brookhaven National Laboratory as part of the PHENIX Collaboration at RHIC. Our physics focus is on the internal structure of the nucleon, explored at RHIC through collisions of polarized protons with other protons and nuclei. Fundamental questions about the quark and gluon contributions to the spin structure of the nucleon are under investigation. Analysis projects in this area are immediately available, as well as simulation projects that look forward to PHENIX detector upgrades. The successful candidate will work with our experimental nuclear and particle physics group consisting of three faculty members (Stephen Pate, Vassili Papavassiliou, and Xiaorong Wang), one other research associate, and several graduate students. A doctoral degree or equivalent in physics is required; experience in experimental medium-energy or high-energy nuclear physics or particle physics is preferred. Salaries are competitive and a comprehensive package of benefits is offered. An electronic job application must be filled out and documents attached as stated on the posting announcement: go to https://jobs.nmsu.edu/postings/22073 for complete application instructions. Review of applications will begin on August 31, 2015. NMSU is an equal-opportunity/affirmative-action university. Applications from minorities and women are particularly encouraged. Contact: Professor Stephen Pate Email: [email protected] Please find more at the link listed above. • NERSC Positions(Variety) - Lawrence Berkeley National Laboratory, CA (May 2015) Deadline: N/A See: https://lbl.taleo.net/careersection/cr/jobsearch.ftl?lang=en&radiusType=K&searchExpanded=false&organization=108360471996&radius=1 HPC Consultant: Application Performance NERSC is seeking an HPC consultant to help its users create application codes that run efficiently on next-generation energy efficient supercomputers, provide technical support and training, serve as user advocates, and help NERSC develop and deploy new technologies. https://lbl.taleo.net/careersection/jobdetail.ftl?job=80700&lang=en HPC Consultant: High Energy & Nuclear Physics Support NERSC is seeking a candidate to join the Consulting team to support the High Energy and Nuclear Physics community on systems supported by NERSC. https://lbl.taleo.net/careersection/jobdetail.ftl?job=81045&lang=en High Performance Data Analytics Engineer https://lbl.taleo.net/careersection/2/jobdetail.ftl?lang=en&job=80567 Big Data Engineer/Architect https://lbl.taleo.net/careersection/2/jobdetail.ftl?lang=en&job=80426 HPC Performance Engineer As a member of the Advanced Technology Group you will contribute to an ongoing team effort to develop a complete understanding of the issues that contribute to optimal application and computer system performance on extreme-scale advanced architectures. https://lbl.taleo.net/careersection/jobdetail.ftl?job=80287&lang=en NERSC Exascale Science Applications Postdoctoral Fellow NERSC is looking for Postdoctoral Fellows to conduct applied research and development in the area of energy-efficient high-performance scientific computing (HPC). https://lbl.taleo.net/careersection/jobdetail.ftl?job=80066&lang=en Please find more at the links listed above. • Postdoctoral Positions(Two) -LHCb LAL - Orsay, FR (May 2015) Deadline: June 2, 2015 See: http://inspirehep.net/record/1364461 Job description: Two three-year postdoc positions are opened in the LHCb LAL (Orsay, FR) group funded by the European Research Council (ERC). The contracts should start between July 1st and December 1st 2015. There are currently 9 CNRS permanent researchers, 2 post-docs and 4 PhD students in the LHCb LAL group. The group is involved in the monitoring of the current calorimeter (read-out electronics, level 0 trigger calibration) but also in the preparation for the upgrade (read-out of the calorimeter at 40 MHz, Low Level Trigger as well as tracking and simulation for the SciFi). Analysis activities of the group are focused on the study of B decays in modes with open-charm, search for very rare decays of D mesons, measurements of quarkonia properties using hadronic decays, B+c meson studies and analysis of B meson decays into K*ll. The post-docs will be requested to work in the area of Heavy Ion at LHCb for which the ERC project has been funded. One post-doc will concentrate on reconstruction software and on the development of the triggers algorithms. The other post-doc will work on the simulation and analysis of heavy ion data. In both cases, previous experience in these areas would be appreciated although not mandatory. The data analysis activities will include quarkonium and open charm studies in the three LHC running configurations, proton-proton, proton-lead and lead-lead collisions as well as beam gas interactions with the “SMOG” system. The postdocs will be based in Orsay but will regularly go to CERN in particular to participate in data-taking and monitoring of the detector. The applications should be sent to Giulia Manca ([email protected]) and Patrick Robbe ([email protected]) before June 2nd 2015. The application should include: 1.A cover letter explaining the interest in the position; 2.A curriculum vitae; 3.A list of publications, highlighting the personal contribution of the candidate; 4.The names of two referees. The applicant must ask the referees to send a letter of recommendation directly to the two addresses given above within the indicated date. For additional information please contact Giulia Manca ([email protected]) or Patrick Robbe ([email protected]). LAL is an Equal Employment Opportunity Employer and especially invites applications from women and members of underrepresented groups. Contact: giulia manca Email: [email protected] Website: http://www.ca.infn.it/~manca/ Letters of Reference should be sent to: [email protected] Please find more at the link listed above. • Post-doctoral Research Associate - RHIC-STAR Experiment, Purdue University (Apr 2015) Deadline: Now (Can start Aug.1) See: http://jobs.physicstoday.org/jobs/7067156 The Purdue High Energy Nuclear Physics group studies relativistic heavy-ion collisions as members of the RHIC-STAR and LHC-CMS experiments. Our primary physics interests are in the areas of particle correlations and heavy flavor production to elucidate the properties of high-density QCD and the QGP. A post-doctoral research associate position is available within the group for STAR. The position can start as early as August 1, 2015, and applications are open until the position is filled. The successful candidate is expected to lead a significant physics initiative and/or hardware project. This appointment is for one year, renewable up to three years. A Ph.D. in physics or a related field is required at time of appointment. Applicants should send their curriculum vitae and arrange for three letters of reference to be sent to Prof. Fuqiang Wang at [email protected]. Purdue University is an Equal Opportunity Employer. Please find the source at the link listed above. • Postdoctoral Position - ALICE Heavy Ion at Utrecht University (Apr 2015) Deadline: Now See: http://www.staff.science.uu.nl/~misch101/positions.htm The Institute for Subatomic Physics at Utrecht University has an opening for a postdoc position in Experimental Relativistic Heavy-Ion Physics. The group is strongly involved in heavy-flavour physics in the ALICE experiment at the Large Hadron Collider at CERN, operates the Silicon Strip Detector and has a strong role in the R&D of the upgrade of the Inner Tracking System in ALICE. The position is funded through a grant from the Netherlands Organisation for Scientific Research (NWO). Job description The successful candidate is expected to play a leading role in the measurement of D and B meson production in elementary proton-proton and lead-lead collisions using run-2 data. The candidate will be stationed at Utrecht University and will also have significant interactions with scientists at the National Institute for Subatomic Physics (Nikhef) in Amsterdam. Longer stays at CERN (Geneva, Switzerland) are foreseen. This is a two-years term appointment with the possibility of renewal. The Collective Employment Agreement (CAO) of the Dutch Universities forms an integral part of the contract of employment. The expected starting date for the positions is 1 September 2015. Qualifications - PhD in experimental particle or nuclear physics, obtained within the last four years. - Strong knowledge and experience in analysis of large volume data sets in particle physics experiments (C++ programming). - Hands-on expertise in development of physics analysis applications. - Ample experience in heavy-flavour physics is of advantage. - Excellent understanding of the hardware and software aspects of the computational infrastructure used in particle physics. - Excellent verbal and written communication skills in an international team environment. Further details More information about this position can be obtained from the principle supervisor Dr. André Mischke ([email protected]) and can be found on the group website http://www.staff.science.uu.nl/~misch101/. How to reply Interested candidates should provide a curriculum vitae, list of publications, a brief statement of research interest and arrange to have at least two letters of recommendation sent to Dr. André Mischke, Institute for Subatomic Physics, Faculty of Science, Utrecht University, Princetonplein 5, 3584 CS Utrecht, the Netherlands or via e-mail to: [email protected]. The applicant will be assessed according to the Code of Conduct at Utrecht University. Applications will be accepted any time up until the position is filled. Please find more at the link listed above. • Postdoctoral in RHIC Spin Physics, University of California, Riverside (Apr 2015) Deadline: Now See: N/A The Department of Physics and Astronomy at the University of California, Riverside invites applications for a term appointment to conduct research in experimental nucleon spin physics. The appointed individual will work on the PHENIX experiment at the Brookhaven National Laboratory. The analysis efforts of the UC Riverside spin group led by Ken Barish and Rich Seto include longitudinal and transverse spin physics in high energy polarized proton reactions. UCR is involved in the MPC-EX upgrade, and future efforts include sPHENIX and fsPHENIX. The candidate may be in residence at Brookhaven National Laboratory or in Riverside depending on the exact work plan. Applicants should submit a resume highlighting personal research achievements, a list of publications where your contributions were significant, and a statement of research interests and expertise to Prof. Kenneth Barish ([email protected]). In addition, the applicant should arrange for at least three letters of recommendation to be sent to the above address. Review of applications will begin immediately and will continue until the position is filled. UC Riverside is an Equal Opportunity/Affirmative Action Employer. Please find more at the link listed above. • Data Science Internships, San Francisco, CA (Apr 2015) Deadline: April 26th Start Date: June 15th Length: 12 Weeks Full Time Rate:$30/hr
See: https://www.atlassian.com/company/careers/jobs/listing?org=ATLASSIAN&cws=1&rid=2294
Blurb on qualifications:
You are an outstanding Scientist/Mathematician with a strong quantitative background. You have a keen interest in the study of predictive modeling and customer success. You have experience performing statistical analyses on large complex datasets. You love to wrangle a jumble of data and tame it to serve your purposes. You don't just want to make pretty plots, you want to put your learning and results into action, with the heart of a theorist and the mind of an experimentalist. You are currently enrolled in a Masters or PhD program in Math, Statistics, Computer Science, Physics, Biophysics or related field. You have experience with multi-paradigm programming. You have experience building ETL jobs to process data and some familiarity with relational databases, SQL, Redshift and/or HIVE. You're familiar with predictive modeling and with writing API's for serving up and calling data. You're familiar with at least one statistical package such as R, CERN Root, SPSS, Python, Matlab, etc. Ideally, you have experience with more than one programming language, experience with distributed computing (Amazon EC2, Grid Computing, Hadoop, etc), experience with ETL tools (e.g. Kettle), experience working with real world datasets in a collaborative environment, and experience with machine learning and predictive modeling.
• Postdoctoral Research Associate (STAR), William Marsh Rice University, Houston, Texas (Mar 2015)
See:TBD
The experimental high-energy nuclear physics group at Rice University invites applications for a Postdoctoral Research Associate to work on the STAR experiment at the Relativistic Heavy Ion Collider. The successful candidate is expected to take a leadership role in physics analyses in the area of heavy-flavor and dilepton physics as well as be actively involved in the group’s responsibilities for STAR’s time-of-flight and muon-telescope detectors. It is anticipated that the position be initially based in Houston, TX with a possibility of relocation to BNL at a later time.
Interested candidates should hold a Ph.D. in high-energy nuclear or particle physics and submit by email a curriculum vitae, including a list of publications, and a brief description of research experience and interests. In addition, the candidate is expected to arrange for three references who are expected to send their letter of recommendation by email to Prof. Frank Geurts ([email protected]). Applications received by April 24 will receive fullest attention.
Rice University does not discriminate against individuals on the basis of race, color, religion, sex, sexual orientation, gender identity, national or ethnic origin, ancestry, age, disability, or veteran status in its admissions policies, educational programs, or employment of faculty or staff. Please find more at the link listed above.
• Antideuteron Physics - NA61/SHINE Data Analysis --Post-Doc-- Hawai'i+CERN (March 2015)
See: http://inspirehep.net/record/1333795
The research goal is to improve the understanding of antideuteron physics by measuring (anti)deuteron and antiproton production cross-sections with the fixed target experiment NA61/SHINE for the purpose of reducing the uncertainties of cosmic ray antideuteron searches. The successful candidate will participate in NA61/SHINE data taking, experiment calibration, data analysis, and interpretation and will have the opportunity to regularly spend time at CERN. The group is also working on the antideuteron analysis with the ISS-based AMS-02 experiment and the development of the balloon-borne antideuteron experiment GAPS.
Applicants must hold a doctoral degree, preferentially in (astro)particle physics. Experience with data analysis and software development is expected. The initial term of this position is for one year. Renewal subject to satisfactory performance and availability of funds.
Send application (cover letter, curriculum vitae, list of publications, and contact information of at least two references) to [email protected]. Please specify in the subject of the email: Postdoctoral fellow in NA61/SHINE data analysis.
Inquiries
Dr. Philip von Doetinchem
Assistant Professor
e-mail: [email protected]
www.phys.hawaii.edu/~philipvd
www.antideuteron.com
Contact: Philip von Doetinchem
Email: [email protected]
Letters of Reference should be sent to: [email protected]
• Staff Scientist in Experimental Nucleon Structure Physics, Nuclear Physics Division (SPhN) of CEA-Saclay (Feb 2015)
See: Below
SPhN conducts world-leading research on the following topics: quark-gluon plasma, nucleon structure, nucleus structure, nuclear reactions and applications.
The candidate will be appointed in the SPhN laboratory of nucleon structure. The laboratory is currently preparing the Deeply Virtual Compton Scattering (DVCS) experiments to be conducted with the CLAS12 spectrometer in the Hall B of Jefferson Lab. The candidate will be involved in the installation and commissioning of the Micromegas vertex tracker as well as the running and analysis of the DVCS experiments expected to take data in 2016. A significant amount of travel to the US will be expected in the first few years.
Candidates with high scientific potential, finishing their PhD or up to a few years of postdoc are strongly encouraged to apply. Significant experience in HEP data analysis is a requirement; some experience in instrumentation is desirable.
Candidates should send a cover letter describing their research activities and prospects, a Curriculum Vitae including a list of recent or important publications, two letters of recommendation, and when applicable a copy of their PhD thesis as well as the jury reports on their manuscript and/or PhD defense. Documents should be sent preferably by email to [email protected] (cc: [email protected]), or alternatively by postal mail to:
Danielle CORET
Irfu/SPhN
CEA-Saclay
91191 Gif-sur-Yvette
FRANCE
For full consideration, all application materials must be submitted by April 3rd 2015. A committee will release the list of candidates selected for an interview at the beginning of May 2015. The interviews of selected candidates are foreseen at the beginning of June 2015.
• Research Associate Position in Experimental Nuclear Physics, University of Colorado, Boulder, Colorado (Jan 2015)
See:https://www.jobsatcu.com/postings/94400
The University of Colorado Boulder experimental nuclear physics group is looking to hire a Postdoctoral Research Associate. The PI, Jamie Nagle, is involved in the PHENIX experiment and upgrades for sPHENIX and EIC detector options. The candidate will be expected to carry out research with the experimental group with a focus on physics analysis and detector development work. The candidate may be in residence at Brookhaven National Laboratory or in Boulder, Colorado depending on the exact work plan.
• Heavy Ion Reactions Research Associate - ALICE EMCal/DCal, Oak Ridge National Laboratory(based at CERN) (Dec 2014)
See: http://goo.gl/i5AHNI
Note: This position is different than the posting listed a couple slots down.
The Heavy Ion Reactions group at Oak Ridge National Laboratory (ORNL) is seeking qualified candidates for a new Research Associate position to conduct experimental research in heavy ion nuclear physics and coordinate operation of the Electromagnetic Calorimeter of the ALICE Experiment at CERN.
Responsibilities:
- Coordinate operation of the ALICE Electromagnetic Calorimeter (EMCal/ DCal)
- Responsible for conducting independent research with the ALICE Experiment, reporting research results, and publishing scientific results in key peer-reviewed journals in a timely manner
- Collaborate with other scientists and technical personnel to carry out research projects
- Participate in the initiation of new research directions and development of research proposals
Qualifications:
- Ph.D. in High Energy Nuclear Physics, High Energy Physics, or closely related field required
- Must have completed all degree requirements before starting appointment and be within five years of receiving doctorate
- Strong background in all aspects of readout electronics, detector hardware and operations, and data analysis
- Record of publications in peer-reviewed journals and presentations at scientific conferences
The initial appointment is a temporary 24 month assignment in Geneva, Switzerland. Questions may be sent to Tom Cormier (cormiertm at ornl.gov) or Ken Read (readkf at ornl.gov). For further details and to apply, see: http://goo.gl/i5AHNI .
[Research Associate - ALICE EMCal/DCal Project in Switzerland / NB50462854]
• Junior Faculty Position in Experimental Nuclear and Particle Physics(Tenure Track), Georgia State University/RIKEN BNL Research Center (Dec 2014)
See: http://jobs.physicstoday.org/jobs/6555064/junior-faculty-position-in-experimental-nuclear-and-particle-physics
The Department of Physics and Astronomy at Georgia State University invites applications for a tenure-track assistant professor position in experimental nuclear and particle physics, to begin in August 2015 pending budgetary approval. The successful candidate will hold a joint physics faculty fellowship with GSU and the RIKEN BNL Research Center (RBRC) at Brookhaven National Laboratory (BNL) for a period up to 5 years. The fellow will be a full-time faculty member at GSU and spend approximately 6 months each at RBRC and GSU during each year of the fellowship.
The faculty fellow will be expected to teach during at least one semester per year at GSU and establish a vigorous, funded research program that complements our current nuclear physics group, led by faculty members Dr. Xiaochun He and Dr. Murad Sarsour.
Candidates must hold a PhD in Physics or closely related field and must have at least three years of relevant post-doctoral research experience. Candidates with experience in nuclear physics technology, detector development, and/or software development that can make significant contributions to large collaborative proposals in heavy ion collider and/or electron ion collider physics are strongly encouraged to apply. To apply, submit an application letter, a CV with a publication list, a detailed research plan explaining how the proposed research will complement and enhance existing research, teaching plans, and the names and contact information for at least three references to Nuclear Physics Search Committee at [email protected]. Application materials should be in PDF format.
•
• Theory @ Institute for Nuclear Theory [3 Positions], University of Washington, Seattle Washington (Dec 2014)
Director of the Institute/Tenured Prof, Research Assistant Prof/Postdoc, Postdoc
Deadline: Feb. 1 2015, Dec. 1 2014, Dec. 1 2014
See: http://www.int.washington.edu/jobs_int.html
• Heavy Ion Reactions Postdoctoral Research Associate, Oak Ridge National Laboratory (Nov 2014)
See: http://goo.gl/HW7RWz
The Heavy Ion Reactions group at Oak Ridge National Laboratory (ORNL) is seeking qualified candidates for a new Postdoctoral Research Associate position to conduct experimental research and work on the development of readout electronics for an upgrade of the Time Projection Chamber of the ALICE Experiment
Qualifications Required
- PhD in High Energy Nuclear Physics, High Energy Physics, or closely related field
- Must have completed all degree requirements before starting their appointment, and be within five years of receiving Doctorate
- Ability to communicate in English to an international scientific audience
- Motivated, safety conscious, and possessing excellent interpersonal and oral and written communication skills
- Strong record of productive and creative research demonstrated by publications in peer-reviewed journals and presentations at scientific conferences.
- Capable of innovative research with minimal supervision and the ability to work collaboratively in a team environment and interact effectively with a broad range of colleagues
- Work with staff and contribute to the production of research proposals
- Requires International Travel
QUALIFICATIONS DESIRED:
- Strong background in in all aspects of detector hardware, operations, and data analysis
- Strong experience with readout electronics, data acquisition, electronics testing and operations
The initial appointment is a temporary, full-time assignment for two years with the option to renew term annually for a maximum of three years. Please provide a list of publications when applying for this position. Three letters of reference are required and can be uploaded to your profile or emailed directly to [email protected]. Please include the title of the position in the subject line.
[Postdoctoral Research Associate - ALICE TPC Upgrade Project / NB50458275]
• Project Scientist/Software Developer for Particle Data Group, Lawrence Berkeley National Laboratory (Nov 2014)
The Physics Division at Lawrence Berkeley National Laboratory (LBNL) has an opening for a Project Scientist in the Particle Data Group (PDG, see http://pdg.lbl.gov). The PDG publishes the biennial Review of Particle Physics, a comprehensive summary of high-energy physics as well as related areas of cosmology and astrophysics. The Review is the most cited publication in high-energy physics.
The primary responsibility of the successful candidate will be to improve and maintain the PDG software. This includes working on the algorithms for evaluating particle physics data and producing the Review, the development of new web applications, and enhancing existing applications. Development of apps for making PDG products available on smart phones and tablets is also planned. The successful candidate will interact with the members of the international PDG collaboration and will be expected to stay current in the fields of physics and software development.
Applicants must have a Ph.D. or comparable experience in particle physics or a related area. Extensive experience in programming in modern languages such as Java, JavaScript, Python or C++ is required. A good understanding of particle physics and of the statistical methods used is required. The individual must have good communication skills and be able to work effectively in a team environment.
Further desirable qualifications include experience with: designing and implementing modern software for web applications; scientific typesetting; modern software development tools and libraries; using and designing relational databases; iOS or Android app development; migrating legacy Fortran code to modern software languages. For inquiries please contact Juerg Beringer (jberinger [at] lbl [dot] gov).
• Junior Faculty position at MIT in Experimental Nuclear and Particle Physics, MiT (Nov 2014)
Deadline: Nov 21st, 2014 EXTENDED to December 5th, 2014
The research groups in the Nuclear and Particle Division and Laboratory for Nuclear Science (http://web.mit.edu/lns/) have a wide range of interests, including strong interaction physics, electroweak symmetry breaking, dark matter searches, neutrino physics, physics beyond the standard model and accelerator physics. This faculty search is broad in scope and applicants with research interests in these and other areas of experimental nuclear and particle physics are strongly encouraged to apply.
Faculty members at MIT conduct research, teach undergraduate and graduate physics courses, and supervise graduate and undergraduate participation in research. Candidates must show promise in teaching as well as in research. Preference will be given to applicants at the assistant professor level. More senior appointments will be considered only in exceptional cases.
The application deadline is November 21, 2014. Applicants should submit a curriculum vitae, a list of publications, and a brief description of research interests and goals (the latter not to exceed 3 pages in length)to this site and should also arrange for three letters of reference to be uploaded. Only web submissions will be accepted. Any enquiries should be directed to Professor Gunther Roland, Search Committee Chair, [email protected]. Candidates who are uncertain whether they fit into a particular search should contact the search chair.
• Applications Physicist who will be the coordinator of the Fermilab Test Beam Facility (Nov 2014)
Fermi National Accelerator Laboratory seeks highly qualified candidates for an Applications Physicist I position. The successful candidate will serve as the coordinator for experimental activities within the world-leading Fermilab Test Beam Facility. This facility is open to a wide range of users within the experimental physics community participating in detector research and development. The goal of the Fermilab Test Beam program is to provide flexible access to test beams for all detector tests, with relatively low bureaucratic overhead and a guarantee of safety, coordination, and oversight.
Qualifications and Essential Job Functions
• Ph. D. in Physics or its equivalent
• Strong record with a minimum of three years post-graduate experience working with particle accelerators or detectors
• Experience performing analysis on experimental data
• Excellent oral and written communication skills
• Ability to coordinate contributions from a wide ranging group of personnel including visiting and lab scientists, engineers, technicians, beam operators, and safety officers
• Ability to understand technical data and specifications and communicate this understanding with others
• Ability to incorporate computers in everyday work
• Postdoc: Commissioning of the MuID system of Belle II, Indiana University @ KEK (Oct 2014)
Consideration begins: Dec. 1st, 2014
http://inspirehep.net/record/1324306
The Department of Physics at Indiana University in Bloomington invites applications for a Postdoctoral Fellow to work on the Belle II detector at KEK in Tsukuba, Japan. The Belle II experiment is an upgrade to the Belle experiment and is scheduled to receive the first beams for detector commissioning in 2016 which makes this a great time to join.
Indiana University is part of the US Belle II project, which is lead by DOEs Pacific Northwest National Laboratory (PNNL). Our group contributes significantly to the muon ID system and the prospective candidate is expected to work on commissioning of this system in collaboration with other US Belle II institutions. Potential aspects are online and offline software development, simulations, firmware development as well as various installation tasks. Therefore experience with detector commissioning and/or FPGA programming is a plus.
The candidate will also have the opportunity to analyze existing Belle data. He or She is expected to be based permanently at KEK. Initial appointments as a postdoctoral research associate will be for one year, with possible renewal for up to two additional years. A Ph.D. in experimental particle physics is required. We will review all applications and will continue to review until the position is filled. Applications received by December 1, 2014 will receive full consideration
Interested candidates should review the application requirements and submit their application at: https://indiana.peopleadmin.com/postings/1144. Questions regarding the position can be sent to: Dr. Anselm Vossen ([email protected]) for additional information regarding the application process
• STAR Postdoc Position, LBNL (Oct 2014)
Consideration begins: Dec. 1st, 2014
https://lbl.taleo.net/careersection/2/jobdetail.ftl?lang=en&job=80231
The Relativistic Nuclear Collisions (RNC) program of the Nuclear Science Division at Lawrence Berkeley National Laboratory (Berkeley Lab) invites applications for a postdoctoral opportunity. The position will work on ultra-relativistic heavy ion physics with the STAR experiment at the Relativistic Heavy Ion Collider (RHIC). RNC plays a leading role in the STAR Heavy Flavor Tracker (HFT) project. The HFT, which is a recent upgrade to STAR, recorded its first data during the 2014 RHIC run. The HFT enables important new measurements of heavy flavor production and dynamics in heavy ion collisions, which address crucial issues in the study of the Quark-Gluon Plasma. RNC also plays a leading role in the development of future upgrades for STAR.
The successful candidate will participate in HFT physics analysis and the publication of results. The postdoc will also contribute to the HFT software and calibration, as well as to future upgrade projects in STAR.
# Star Junior Representative Election Information
Here is the information for the currently nominated Juniors for the vacant Junior Representative position. The election begins on 12/19/2016 at 6pm EST and ends on 12/31/2016 at 6pm EST. Both nominees have written a statement. The statements are below for you to read.
------Nominees------
Daniel Brandenburg
Hello fellow STAR Juniors,
My name is Daniel Brandenburg and I am a PhD student at Rice University in Frank Geurt's research group. I have really enjoyed being a part of STAR during my PhD and as a junior rep I hope to help make it an enjoyable experience for current and future STAR juniors. I feel strongly that STAR should be a welcoming community where we can all learn from each other. Throughout my time in STAR I have tried to help other students and lead by example to help make STAR a good environment for myself and others. I know that I have benefitted a lot from the older students that helped me get started in STAR. I think that being a Junior Rep will give me the opportunity to foster the same kind of cooperative and helpful culture. Also, I have a good relationship with many of the STAR seniors and am willing to talk to them on behalf of other juniors whenever needed.
I know that people join STAR and in general pursue a PhD for many different reasons. For this reason, I will work with Alex and Kathryn to continue the successful pattern of including talks from various STAR alumni in the agenda for Junior's Day ( about working in industry, finding post-doc positions etc.). In general I think it is important to make sure that students graduating from STAR understand how valuable their time and experience is and that it can be applied to whatever field they want to move into. I work well with Alex and Kathryn and expect that the three of us will make a good team planning events and organizing social activities.
I have really enjoyed getting to know many of you through collaboration meetings and conferences and if I don't know you yet I hope that we can meet at the next STAR meeting.
Thank you, 谢谢, dêkuji, merci, arigato, gracias, danke!
Daniel Brandenburg
---------------------------------------------------------------------------------------------------------------------------------------------------------------
Niseem Magdy Abdelrahman
I love science and particularly Physics and Math. I was always wondering about the
underlying mechanism for the natural phenomena, and how this behavior can be explained
pricesley from Math and Physics. My love and interest increase over the course of my
post-high school study. I see myself in the future as a sincere scientist who has strong
passion for Physics.
Moving to the practical scientific environment, I have accepted an opportunity to work at
the theoretical physics center at MTI in 2013. Within two years I have succeeded with the
aid of my collaborators to publish four papers (Phys.Rev. C89 (2014) 055210, Phys.Rev.
C90 (2014) 015204, J.Phys. G42 (2015) 015004, Phys.Rev. C91 (2015) 015206) mainly
in the Effective Quantum Field Theory topics.
I moved to BNL as a visiting researcher working with Dr. Sorensen in the STAR
experiment in 2014. Now I'm a Graduate student at the Stony Brook University working on
flow measurements in Beam energy scan.
In my three years as STAR member I have learned many things about how the STAR
collaboration works and how important the juniors community is. The juniors community
helps many of the juniors solve problems in an effective way, and I think I could be a | 2019-04-23T19:02:36 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.2441161423921585, "perplexity": 5251.488076866774}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578610036.72/warc/CC-MAIN-20190423174820-20190423200820-00344.warc.gz"} |
https://mfix.netl.doe.gov/doc/mfix/22.1/html/model_setup/setup.html | # 4.1. Model Setup¶
The Model pane is used to specify global project settings. Depending on what is selected, other panes are enabled or disabled.
• Description allows for a short model description to be provided. This is written in the .OUT file by the solver.
• Solver specifies the model solver.
• Single phase is the MFiX fluid solver. This disables all solids model inputs.
• Two-Fluid Model (MFiX-TFM) treats both the fluid and solids as interpenetrating continua.
• Discrete Element Model (MFiX-DEM) treats the fluid as a continuum while modeling individual particles and collisions.
• Particle in Cell Model (MFiX-PIC) treats the fluid as a continuum while using “parcels” to represent groups of real particles with similar physical characteristics.
• Disable the fluid phase turns off the fluid solver for MFiX-TFM and MFiX-DEM simulations for pure granular flows. The fluid solver cannot be disabled for single phase flows.
• Enable thermal energy equations solves thermal transport equations for all phases.
• Turbulence Model incorporates the selected turbulence model.
• None
• L-Scale Mixing - Do not include turbulence.
• Requires a turbulent length scale definition for all initial condition regions.
• K-Epsilon - Do not include turbulence.
• Requires turbulent kinetic energy and turbulent dissipation definitions for all initial condition regions and all mass and pressure inflow boundary conditions.
• Max turbulent viscosity has units of $$(Pa \cdot sec)$$ and is used to bound turbulent viscosity.
• Gravity has units of $$({m}/{sec^2})$$ and defines gravitational acceleration in the x, y, and z directions.
• Drag model specifies the fluid-particle drag model. This option is only available with the MFiX-TFM and MFiX-DEM solvers.
• Syamlal-O’Brien [SB1988]
• Requires the specification of the C1 tuning parameter, 0.8 by default.
• Requires the specification of the D1 tuning parameter, 2.65 by default.
• Beestra-van der Hoef-Kuipers [BVK2007]
• Gidaspow [DG1990]
• Gidaspow Blend [LB2000]
• Holloway-Yin-Sundaresan [HYS2010]
• Requires the specification of the lubrication cutoff distance, 1e-6 meters by default.
• Koch-Hill [HKL2001]
• Wen-Yu [WY1966]
• User-Defined Function (UDF)
• A custom drag model must be provided in the usr_drag.f file
• A custom solver must be built.
Note
The polydisperse tag following a specified drag model indicates that the polydisperse correction factor is available. For additional details see [HBK2005], [BVK2007a], and [BVK2007b].
Other advanced options that can be selected include:
• Momentum formulation (Model A, Model B, Jackson, or Ishii)
• Model A
• Model B
• Jackson
• Ishii
• Select sub-grid model
• Sub-grid filter size
• Sub-grid wall correction
Note
There are some restrictions to when using sub-grid models. They are only available with MFiX-TFM simulations using the Wen-Yu drag law, and without turbulence model. Additional restrictions apply.
SB1988
Syamlal, M, and O’Brien, T.J. (1988). Simulation of granular layer inversion in liquid fluidized beds, International Journal of Multiphase Flow, Volume 14, Issue 4, Pages 473-481, https://doi.org/10.1016/0301-9322(88)90023-7.
HKL2001
Hill, R., Koch, D., and Ladd, A. (2001). Moderate-Reynolds-number flows in ordered and random arrays of spheres. Journal of Fluid Mechanics, Volume 448, Pages 243-278. https://doi.org/10.1017/S0022112001005936
DG1990
Ding, J. and Gidaspow, D. (1990). A bubbling fluidization model using kinetic theory of granular flow, AIChE Journal, Volume 36, Issue 4, Pages 523-538, https://doi.org/10.1002/aic.690360404
LB2000
Lathouwers, D. and Bellan J. (2000). Modeling of dense gas-solid reactive mixtures applied to biomass pyrolysis in a fluidized bed, Proceedings of the 2000 U.S. DOE Hydrogen Program Review, https://www.nrel.gov/docs/fy01osti/28890.pdf
WY1966
Wen C.Y., and Yu Y.H. (1966). Mechanics of fluidization, The Chemical Engineering Progress Symposium Series, Volume 62, Pages 100-111.
BVK2007
Beetstra, R., van der Hoef, M.A., and Kuipers, J.A.M. (2007). Numerical study of segregation using a new drag force correlation for polydisperse systems derived from lattice-Boltzmann simulations, Chemical Engineering Science, Volume 62, Issues 1–2, Pages 246-255. https://doi.org/10.1016/j.ces.2006.08.054.
HYS2010
Holloway, W., Yin, X., and Sundaresan, S. (2010). Fluid‐particle drag in inertial polydisperse gas–solid suspensions, AIChE Journal, Volume 56, Issue 8, Pages 1995-2004. https://doi.org/10.1002/aic.12127
HBK2005
Hoef, M., Beetstra, R., and Kuipers, J. (2005). Lattice-Boltzmann simulations of low-Reynolds-number flow past mono- and bidisperse arrays of spheres: Results for the permeability and drag force. Journal of Fluid Mechanics, Volume 528, Pages 233-254. https://doi.org/10.1017/S0022112004003295
BVK2007a
Beetstra, R. , van der Hoef, M. A. and Kuipers, J. A. (2007), Drag force of intermediate Reynolds number flow past mono‐ and bidisperse arrays of spheres. AIChE J., 53: 489-501. https://doi.org/10.1002/aic.11065
BVK2007b
(2007), Erratum. AIChE J., 53: 3020-3020. https://doi.org/10.1002/aic.11330
IPBS2012
Igci, Y., Pannala, S., Benyahia, S., and Sundaresan, S. (2012). Validation studies on filtered model equations for gas-particle flows in risers, Industrial & Engineering Chemistry Research, Volume 54, Issue 4, Pages 2094-2103. https://doi.org/10.1021/ie2007278
MMHAS2013
Milioli, C.C., Milioli, F.E., Holloway, W., Agrawal, K. and Sundaresan, S. (2013), Filtered two‐fluid models of fluidized gas‐particle flows: New constitutive relations. AIChE J., Volume 59, Issue 9, Pages 3265-3275. https://doi.org/10.1002/aic.14130 | 2022-10-01T02:38:21 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6485460996627808, "perplexity": 10335.40338391644}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335514.65/warc/CC-MAIN-20221001003954-20221001033954-00654.warc.gz"} |
https://pages.nist.gov/feasst/plugin/monte_carlo/tutorial/tutorial_2_lj_gcmc.html | # Grand canonical ensemble Monte Carlo¶
In this example, a short grand canonical Monte Carlo simulation of Lennard Jones particles is conducted.
[1]:
import unittest
import feasst as fst
class TestMonteCarlo2LJGCMC(unittest.TestCase):
"""Test a grand canonical ensemble Lennard Jones Monte Carlo simulation"""
def test(self):
"""Compute the average number of particles and assert that it is greater than 0"""
monte_carlo = fst.MonteCarlo()
monte_carlo.set(fst.lennard_jones())
monte_carlo.set(fst.MakeThermoParams(fst.args({"beta": str(1./1.5), "chemical_potential": "-8.352321"})))
monte_carlo.set(fst.MakeMetropolis())
steps_per = int(1e3)
"steps_per" : str(steps_per),
"file_name": "movie",
"clear_file": "true"})))
# Add an Analyze which computes the average number of particles.
# Just before adding, store the number of existing Analyzers in order to remember the
# index of the newly added Analyze.
analyze_index = monte_carlo.num_analyzers()
{"steps_per_write": str(steps_per), "file_name": "gcmc_num_particles.txt"})))
# peform a short simulation
monte_carlo.attempt(int(1e5))
# assert that particles were added during the simulation
self.assertTrue(monte_carlo.analyze(analyze_index).accumulator().average() > 0)
[2]:
%%time
unittest.main(argv=[''], verbosity=2, exit=False)
test (__main__.TestMonteCarlo2LJGCMC)
Compute the average number of particles and assert that it is greater than 0 ...
CPU times: user 188 ms, sys: 3.7 ms, total: 192 ms
Wall time: 190 ms
ok
----------------------------------------------------------------------
Ran 1 test in 0.187s
OK
[2]:
<unittest.main.TestProgram at 0x7fcc55077588> | 2021-02-28T01:07:38 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6462850570678711, "perplexity": 8326.473209347478}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-10/segments/1614178359624.36/warc/CC-MAIN-20210227234501-20210228024501-00309.warc.gz"} |
http://dlmf.nist.gov/10.61 | # §10.61 Definitions and Basic Properties
## §10.61(i) Definitions
Throughout §§10.61–§10.71 it is assumed that , , and is a nonnegative integer.
10.61.1
When suffices on , , , and are usually suppressed.
Most properties of , , , and follow straightforwardly from the above definitions and results given in preceding sections of this chapter.
## §10.61(iii) Reflection Formulas for Arguments
In general, Kelvin functions have a branch point at and functions with arguments are complex. The branch point is absent, however, in the case of and when is an integer. In particular,
10.61.5 | 2013-05-19T08:28:16 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9637469053268433, "perplexity": 1448.5023010660157}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368696400149/warc/CC-MAIN-20130516092640-00011-ip-10-60-113-184.ec2.internal.warc.gz"} |
https://www.bnl.gov/physics/HET/events/ | # HET Events
HET/Riken Lunch Seminar Talks and Other Information
March 2019
Sunday Monday Tuesday Wednesday Thursday Friday Saturday
1
1. 12:15 pm, Building 510, Room 2-160
Hosted by: Peter Denton
2
1. No events scheduled
3
1. No events scheduled
4
1. No events scheduled
5
1. No events scheduled
6
1. 2:30 pm, Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
7
1. No events scheduled
8
1. 12:15 pm, Building 510, Room 2-160
Hosted by: Peter Denton
9
1. No events scheduled
10
1. No events scheduled
11
1. 9 am, TBD
Hosted by: Sally Dawson
12
1. 9 am, TBD
Hosted by: Sally Dawson
13
1. 9 am, TBD
Hosted by: Sally Dawson
14
1. No events scheduled
15
1. 12:15 pm, Building 510, Room 2-160
2. 2 pm, Building 510, CFNS Room 2-38
Hosted by: Niklas Mueller
We revisit the problem of baryons in the large N limit of Quantum Chromodynamics. A special case in which the theory of Skyrmions is inapplicable is one-flavor QCD, where there are no light pions to construct the baryon from. More generally, the description of baryons made out of predominantly one flavor within the Skyrmion model is unsatisfactory. We propose a model for such baryons, where the baryons are interpreted as quantum Hall droplets. An important element in our construction is an extended, 2+1 dimensional, meta-stable configuration of the η′ particle. Baryon number is identified with a magnetic symmetry on the 2+1 dimensional sheet. If the sheet has a boundary, there are finite energy chiral excitations which carry baryon number. These chiral excitations are analogous to the electron in the fractional quantum Hall effect. Studying the chiral vertex operators we are able to determine the spin, isospin, and certain excitations of the droplet. In addition, balancing the tension of the droplet against the energy stored at the boundary we estimate the size and mass of the baryons. The mass, size, spin, isospin, and excitations that we find agree with phenomenological expectations.
16
1. No events scheduled
17
1. No events scheduled
18
1. No events scheduled
19
1. No events scheduled
20
1. 2:30 pm, Small Seminar Room, Bldg. 510
Hosted by: Gopolang Mohlabeng
21
1. No events scheduled
22
1. 12:15 pm, Building 510, Room 2-160
2. 2 pm, Building 510, Room 2-38
Hosted by: Niklas Mueller
23
1. No events scheduled
24
1. No events scheduled
25
1. 9 am, TBD
Hosted by: Sally Dawson
26
1. 9 am, TBD
Hosted by: Sally Dawson
27
1. MAR
27
Wednesday
9 am, TBD
Wednesday, March 27, 2019, 9:00 am
Hosted by: Sally Dawson
28
1. No events scheduled
29
1. MAR
29
Friday
12:15 pm, Building 510, Room 2-160
Friday, March 29, 2019, 12:15 pm
Hosted by: Peter Denton
2. MAR
29
Friday
2 pm, Building 510, CFNS Seminar Room 2-38
Friday, March 29, 2019, 2:00 pm
Hosted by: Niklas Mueller
Inclusive particle production at high p_t is successfully described by perturbative QCD using collinear factorization formalism with DGLAP evolution of the parton distribution functions. This formalism breaks down at small Bjorken x (high energy) due to high gluon density (gluon saturation) effects. The Color Glass Condensate (CGC) formalism is an effective action approach to particle production at small Bjorken x (low p_t) which includes gluon saturation. The CGC formalism nevertheless breaks down at intermediate/large Bjorken x, corresponding to the high p_t kinematic region in high energy collisions. Here we describe the first steps taken towards the derivation of a new formalism, with the ultimate goal of having a unified formalism for particle production at both low and high p_t in high energy hadronic/heavy ion collisions.
30
1. No events scheduled
31
1. No events scheduled
1. MAR
29
Friday
HET Lunch Discussion
"TBA"
Presented by Dr Gopolang Mohlabeng, Brookhaven National Laboratory
12:15 pm, Building 510, Room 2-160
Friday, March 29, 2019, 12:15 pm
Hosted by: Peter Denton
2. APR
3
Wednesday
HET Seminar
"TBA"
Presented by Raza Sufian, Jefferson Lab
2:30 pm, Small Seminar Room, Bldg. 510
Wednesday, April 3, 2019, 2:30 pm
Hosted by: Aaron Meyer
3. APR
24
Wednesday
HET Seminar
"TBA"
Presented by Zhen Liu, University of Maryland
2:30 pm, Small Seminar Room, Bldg. 510
Wednesday, April 24, 2019, 2:30 pm
Hosted by: Gopolang Mohlabeng
4. MAY
1
Wednesday
HET Seminar
"TBA"
Presented by James Wells, University of Michigan
2:30 pm, Small Seminar Room, Bldg. 510
Wednesday, May 1, 2019, 2:30 pm
Hosted by: Sally Dawson
5. MAY
10
Friday
HET Seminar
"TBA"
Presented by Nirmal Raj, Triumf
12:15 pm, Building 510, Room 2-160
Friday, May 10, 2019, 12:15 pm
Hosted by: Gopolang Mohlabeng
6. MAY
15
Wednesday
HET Seminar
"TBA"
Presented by Junwu Huang, Perimeter Institute
2:30 pm, Small Seminar Room, Bldg. 510
Wednesday, May 15, 2019, 2:30 pm
Hosted by: Gopolang Mohlabeng
7. JUN
19
Wednesday
HET Seminar
"TBA"
Presented by Asher Berlin, SLAC
2:30 pm, Small Seminar Room, Bldg. 510
Wednesday, June 19, 2019, 2:30 pm
Hosted by: Gopolang Mohlabeng
1. HET Lunch Discussion
"Quantum-assisted optical interferometry"
Presented by Paul Stankus, Oak Ridge National Laboratory
Friday, March 22, 2019, 12:15 pm
Building 510, Room 2-160
2. HET Seminar
"Probing the Higgs Yukawa coupling to the top quark at the LHC via single top+Higgs production"
Presented by Ya-Juan Zheng, University of Kansas
Wednesday, March 20, 2019, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Gopolang Mohlabeng
3. HET Lunch Discussion
"TBA"
Presented by William Marciano, BNL
Friday, March 15, 2019, 12:15 pm
Building 510, Room 2-160
4. HET Lunch Discussions@BNL
"B->D* Semileptonic Decays Form Factors and CKM Matrix Element Vcb"
Presented by Yong-Chull Jang, BNL
Friday, March 8, 2019, 12:15 pm
Building 510, Room 2-160
Hosted by: Peter Denton
5. HET Seminar
"Breaking Mirror Hypercharge in Twin Higgs Models"
Presented by Brian Batell
Wednesday, March 6, 2019, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
6. HET Lunch Discussion
"Dark matter beams at neutrino facilities"
Presented by Claudia Frugiuele, CERN
Friday, March 1, 2019, 12:15 pm
Building 510, Room 2-160
Hosted by: Peter Denton
7. HET Seminar
"Probing New Physics with Neutrino Scattering"
Presented by Ian Shoemaker, Virginia Tech
Wednesday, February 27, 2019, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Gopolang Mohlabeng
Current experimental sensitivities allow for neutrino scattering to be probed over a range of energy scales. In this talk, I'll discuss phenomenological probes of new physics using neutrino scattering at zero, GeV, and EeV momentum transfer. At zero momentum transfer, the forward coherent scattering of neutrinos on background particles provides novel sensitivity to Dark Matter. At MeV-GeV energies, the solar/atmospheric fluxes allow for the production of heavy sterile neutrinos at IceCube and direct detection experiments, resulting in distinctive signatures. Lastly, I'll discuss sterile neutrino scattering in the Earth as a possible explanation of the anomalous EeV events reported by ANITA.
8. HET Lunch Discussion
"Opportunities in Reactor Neutrino Physics"
Presented by Chao Zhang, BNL
Friday, February 15, 2019, 12:15 pm
Building 510, Room 2-160
9. HET Lunch Discussion
"Precision Electroweak Measurements at the LHC"
Presented by Sally Dawson
Friday, February 8, 2019, 12:15 pm
Building 510, Room 2-160
Hosted by: Peter Denton
10. HET Seminar
"Searching for flavour symmetries: old data new tricks"
Presented by Jessica Turner, Fermilab
Wednesday, February 6, 2019, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Gopolang Mohlabeng
The observed pattern of mixing in the neutrino sector may be explained by the presence of a non-Abelian, discrete flavour symmetry broken into residual subgroups at low energies. These flavour models require the presence of Standard Model singlet scalars, namely flavons, which decay to charged leptons in a flavour-conserving or violating manner. In this talk, I will present the constraints on the model parameters of an A4 leptonic flavour model using a synergy of g-2, charged lepton flavour conversion and collider data. The most powerful constraints derive from the MEG collaboration's result and the reinterpretation of an 8 TeV ATLAS search for anomalous productions of multi-leptonic final states.
11. HET Lunch Discussion
"Multiparticle States in Lattice QCD and Prospects for Neutrino Physics"
Presented by Aaron Meyer, BNL
Friday, February 1, 2019, 12:15 pm
Building 510, Room 2-160
Hosted by: Peter Denton
12. HET Seminar
"Matrix Elements for Neutrinoless Double Beta Decay from Lattice QCD"
Presented by David Murphy, MIT
Wednesday, January 30, 2019, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Aaron Meyer
While neutrino oscillation experiments have demonstrated that neutrinos have small, nonzero masses, much remains unknown about their properties and decay modes. One potential decay mode —- neutrinoless double beta decay ($0 \nu \beta \beta$) —- is a particularly interesting target of experimental searches, since its observation would imply both the violation of lepton number conservation in nature as well as the existence of at least one Majorana neutrino, in addition to giving further constraints on the neutrino masses and mixing angles. Relating experimental constraints on $0 \nu \beta \beta$ decay rates to the neutrino masses, however, requires theoretical input in the form of non-perturbative nuclear matrix elements which remain difficult to calculate reliably. In this talk we will discuss progress towards first-principles calculations of relevant nuclear matrix elements using lattice QCD and effective field theory techniques, assuming neutrinoless double beta decay mediated by a light Majorana neutrino.
13. HET Lunch Discussion
"Hubble Parameter Tension"
Presented by Anze Slosar, BNL
Friday, January 25, 2019, 12:15 pm
Building 510, Room 2-160
Hosted by: Peter Denton
14. HET Lunch Discussion
"Review of the Physics of the Near Detector at DUNE Workshop"
Presented by Peter Denton, BNL
Friday, December 14, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
15. HET Lunch Discussion
Presented by Bill Marciano, BNL
Friday, December 7, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
16. HET Lunch Discussion
"Galactic Dark Matter as the Source for Neutrino Masses"
Presented by Dr. Gopolang Mohlabeng, BNL
Friday, November 30, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
17. HET Seminar
"FASER: ForwArd Search ExpeRiment at the LHC"
Presented by Felix Kling, Arizona State University
Wednesday, November 28, 2018, 2 pm
Small Seminar Room, Bldg. 510
New physics has traditionally been expected in the high-pT region at high-energy collider experiments. If new particles are light and weakly-coupled, however, this focus may be completely misguided: light particles are typically highly concentrated within a few mrad of the beam line, allowing sensitive searches with small detectors, and even extremely weakly-coupled particles may be produced in large numbers there. We have propose a new experiment, ForwArd Search ExpeRiment, or FASER, which will be placed downstream of the ATLAS interaction point in the unused service tunnel TI12 and operated concurrently there. FASER will complement the LHC's existing physics program and extend its discovery potential to a host of new particles, such as dark photons and axion-like particles. In this talk, I will describe FASER's location and discovery potential, the detector's layout and components, as well as the experiment's timeline.
18. HET Lunch Discussion
"Lattice and new physics"
Presented by Amarjit Soni, BNL
Friday, November 16, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
19. HET Seminar
"Parton Distribution Functions in Lattice QCD"
Presented by Konstantinos Orginos, College of William and Mary
Wednesday, November 14, 2018, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Aaron Meyer
Computing the x-dependence of parton distribution functions (PDFs) from first principles had been a challenge for many years. Recent theoretical developments have paved the way to perform this computations for the first time using lattice QCD. In this talk I am reviewing these developments. In particular, I will introduce the concepts of quasi-PDFs and pseudo PDFs and discuss their properties. Finally, I will present results from recent calculations and discuss the prospects for the future.
20. Joint YITP/HET Theory Seminar
"Jet Substructure and Monte Carlo Simulations with Neural Networks"
Presented by Maxim Perelstein, Cornell
Wednesday, November 7, 2018, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
21. HET Lunch Discussion
"A Tale of Two Anomalies"
Presented by Hooman Davoudiasl, BNL
Friday, November 2, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
22. HET Seminar
"Unveiling New Physics Through Angular Distributions at the LHC"
Presented by Rodolfo Capdevilla, Notre Dame
Wednesday, October 31, 2018, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Gopolang Mohlabeng
Angular distributions are commonly used in high precision measurements at colliders. In this talk, we will use the Collins-Soper angular distribution with two goals; to identify the quantum numbers of the mediators in a simplified dark matter model, and to enhance the signal to background ratio of resonance searches in W gamma production at the LHC with the use of the so called Radiation Amplitude Zero.
23. HET Seminar
"Flavor Physics in Lattice QCD as a Window into BSM Physics: |Vcb| and the B -> D* l nu Semileptonic Decay"
Presented by Alejandro Vaquero, University of Utah
Wednesday, October 17, 2018, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Aaron Meyer
Flavor physics provides a rich variety of phenomena that can be used to probe the SM without requiring the high energies present only in the largest particle accelerators. Among the quantities that could be employed to perform precision test of the SM, the CKM matrix elements takes up a prominent place. This lecture deals with the |V_{cb}| CKM matrix element, whose determinations through inclusive and exclusive decays currently display a 2\sigma discrepancy, and show how lattice QCD methods can reduce the uncertainty in the theoretical estimates and rule out (or not) the existence of unknown physics at play.
24. HET/RIKEN Seminar
"A Universally Enhanced Light-quarks Yukawa Couplings Paradigm"
Presented by Shaouly Bar-Shalom, Technion
Wednesday, October 10, 2018, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
25. HET Seminar
"Loop-Induced Single Top Partner Production and Decay at the HL-LHC"
Presented by Jeong Han Kim, Kansas University
Wednesday, September 26, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
26. HET Lunch Discussions
"GeV-Scale Messengers of Planck-Scale Dark Matter"
Presented by Gopolang Mohlabeng, BNL
Friday, September 21, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
27. HET Lunch Seminar
"Isospin-breaking corrections to decay amplitudes in lattice QCD"
Presented by Davide Giusti, Roma 3, INFN
Friday, September 14, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Mattia Bruno
28. Joint BNL/RIKEN HET Seminar
"Higgs pair production via gluon fusion at NLO QCD"
Presented by Julien Baglio, Tuebingen U.
Wednesday, September 12, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
Since the discovery of a Higgs boson in 2012 at CERN, accessing its properties is one of the main goals of the Large Hadron Collider (LHC) experimental collaborations. The triple Higgs coupling in particular is a primary target as it would be a direct probe of the shape of the scalar potential at the origin of the electroweak-symmetry-breaking mechanism, and is directly accessed via the production of a pair of Higgs bosons. In this view, it is of utmost importance to reach high precision in the theoretical prediction of Higgs boson pair production cross section at the LHC. I will present in this talk the calculation of the 2-loop QCD corrections to the Higgs-pair-production cross section via gluon fusion, that is the main production mechanism, including the top-quark mass effects in the loops. It will be shown that they can be significant in the Higgs-pair-mass differential distributions.
29. HET Lunch Discussions
"Lattice QCD and precision physics from long to short distances: an overview of my 3 years at BNL"
Presented by Mattia Bruno, BNL
Friday, August 31, 2018, 12:15 pm
Building 510, Room 2-95
Hosted by: Christoph Lehner
30. Special HET Seminar
"The Higgs Potential: A Path Toward Discovery"
Presented by Pier Paolo Giardino, BNL
Tuesday, August 21, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
31. HET Lunch Discussions
"Lattice QCD Study of Exclusive Channels in the Muon HVP"
Presented by Aaron Meyer, BNL
Friday, August 17, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
The hadronic vacuum polarization is a dominant contribution to the theoretical uncertainty of the muon anomalous magnetic moment. Both the R-ratio and Lattice QCD may be used to compute the HVP contribution from theory, and the theoretical uncertainties for both methods are statistically precise in regions that are complimentary to each other. For lattice QCD, the long-distance region dominates the statistical uncertainty. By explicitly studying exclusive channels of the HVP diagram with lattice QCD, it is possible to reconstruct the long-distance behavior of the correlation function. This has the effect of replacing the statistical uncertainty with a significantly smaller systematic uncertainty. With this long-distance reconstruction, it will be possible to achieve a precision with a lattice-only calculation similar to that of the R-ratio method.
32. Special HET Seminar
"New Dark Matter Signals in Neutrino Detectors"
Presented by Yue Zhang, Northwestern
Tuesday, August 14, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
33. Special HET Seminar
"New Dark Matter Signals in Neutrino Detectors"
Presented by Yue Zhang, Northwestern
Monday, August 13, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
34. Special HET Seminar
"Searching for physics beyond the Standard Model at the Intensity Frontier"
Presented by Martin Hoferichter, University of Washington
Thursday, August 9, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
35. Special HET Seminar
"A New Frontier in the Search for Dark Matter"
Presented by Gordan Krnjaic, FNAL
Monday, August 6, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
The gravitational evidence for the existence of dark matter is overwhelming; observations of galactic rotation curves, the CMB power spectrum, and light element abundances independently suggest that over 80% of all matter is "dark" and beyond the scope of the Standard Model. However, its particle nature is currently unknown, so discovering its potential non-gravitational interactions is a major priority in fundamental physics. In this talk, I will survey the landscape of light dark matter theories and and introduce an emerging field of fixed-target experiments that are poised to cover hitherto unexplored dark matter candidates with MeV-GeV masses. These new techniques involve direct dark matter production with proton, electron, and *muon* beams at various facilities including Fermilab, CERN, SLAC, and JLab. Exploring this mass range is essential for fully testing a broad, predictive class of theories in which dark matter abundance arises from dark-visible interactions in thermal equilibrium in the early universe.
36. Special HET Seminar
"New Neutrino Interactions: Breaking Degeneracies and Relaxing Sterile Tensions"
Presented by Peter Denton, Niels Bohr
Friday, August 3, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
37. Chemistry Department Seminar
"Triggered Reversible Phase Transformation between Layered and Spinel Structure via Intercalated Hetero Species in Sodium Birnessite"
Presented by Yong-Mook Kang, Department of Energy and Materials Engineering, Dongguk University-Seoul, Seoul, 04620, Republic of Korea., Korea, Republic of (South)
Monday, July 23, 2018, 11 am
Room 300, 3rd Flr. Chemistry Bldg. 555
Hosted by: Xiao-Qing Yang
Phase transformation of layered structure into spinel structure has been detrimental for most of layered oxide cathodes. Even if a lot of efforts have been made to relieve this highly irreversible phase transformation, there have been few successful results. However, we firstly observed the possibility to make this irreversible phase transformation extremely reversible by utilizing Na- birnessite (NaxMnO2•yH2O; Na-bir) as a basic structural unit, which has distinctive layered structure containing crystal water. Herein, the crystal water in the structure contributes to generating metastable spinel-like phase, which is the key factor for making this unusual reversibility happen. The reversible structural rearrangement between layered and spinel-like phases during electrochemical reaction could activate new cation sites and enhance ion diffusion with higher structural stability. This unprecedented reversible phase transformation between spinel and layered structure was deeply analyzed via combined ex situ soft and hard X-ray absorption spectroscopy (XAS) analysis with in situ X-ray diffraction (XRD). Fundamental mechanism on this reversible phase transformation was theoretically elucidated and confirmed by kinetic investigation using first-principle calculation. These results provide deep insight into novel class of intercalating materials which can deal with highly reversible framework changes, and thus it can pave an innovative way for the development of cathode materials for next- generation rechargeable batteries.
38. HET Special Seminar
"The Quest for Dark Sectors"
Presented by Claudia Frugiuele, Weizmann
Friday, July 20, 2018, 10 am
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
Dark sectors are ubiquitous in physics beyond the Standard Model (SM), and may play a role in explaining many of the long-standing problems of the SM such as the existence of dark matter or the electroweak hierarchy problem. By definition, dark sectors are not charged under any of the known forces. Discovering their possible existence is thus challenging. I will describe how a a broad program combining particle, nuclear and atomic physics experiments can effectively probe a large region of the parameter space. I will show how the unique signatures of such physics can already be searched for with existing/planned experiments, including neutrino-proton fixed-target experiments and precision atomic measurements.
39. HET Special Seminar
"Charting the Unknown with Theory and Experiments"
Tuesday, July 3, 2018, 1:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
40. HET Lunch Discussions
"Pion-pion scattering with physical quark masses from lattice QCD"
Presented by Dan Hoying, UConn
Friday, June 29, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
41. HET Seminar
"Constraining Effective Field Theories with Machine Learning"
Presented by Johann Brehmer, New York University
Wednesday, June 27, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
An important part of the LHC legacy will be precise limits on indirect effects of new physics, parameterized for instance in an Effective Field Theory (EFT). But measuring these parameters in complex processes is often challenging for established analysis methods. We present powerful new inference techniques based on machine learning. They scale well to complicated problems with many parameters and observables and do not require any approximations on the parton shower or detector effects. In an example analysis of WBF Higgs production we show that they enable us to put stronger bounds on EFT parameters than established methods, demonstrating their potential to improve the new physics reach of the LHC legacy results. We also comment on the application of these new "likelihood-free" or "simulator-based" inference techniques to a broad class of problems outside of particle physics, for instance in cosmology, epidemiology, and genetics.
42. HET Lunch Discussions
"Discussion of Mainz workshop of g-2 Theory Initiative"
Presented by Mattia Bruno and Aaron Meyer, BNL
Friday, June 15, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
43. Center for Functional Nanomaterials Seminar
"Heterostructures for Nanoelectronics and Photovoltaics"
Presented by Deep Jariwala, University of Pennsylvania
Monday, June 11, 2018, 1:30 pm
CFN, Bldg. 735, Conference Room A, 1st Floor
Hosted by: Don DiMarzio & Mircea Cotlet
The isolation of a growing number of two-dimensional (2D) materials has inspired worldwide efforts to integrate distinct 2D materials into van der Waals (vdW) heterostructures. While a tremendous amount of research activity has occurred in assembling disparate 2D materials into "all-2D" van der Waals heterostructures,1, 2 this concept is not limited to 2D materials alone. Given that any passivated, dangling bond-free surface will interact with another via vdW forces, the vdW heterostructure concept can be extended to include the integration of 2D materials with non-2D materials that adhere primarily through noncovalent interactions.3 In the first part of this talk I will present our work on emerging mixed-dimensional (2D + nD, where n is 0, 1 or 3) heterostructure devices performed at Northwestern University. I will present two distinct examples of gate-tunable p-n heterojunctions.4-6 I will show that when a single layer n-type molybdenum disulfide (MoS2) (2D) is combined with p-type semiconducting single walled carbon nanotubes (1D), the resulting p-n junction is gate-tunable and shows a tunable diode behavior with rectification as a function of gate voltage and a unique anti-ambipolar transfer behavior.4 The same concept when extended to p-type organic small molecule semiconductor (pentacene) (0D) and n-type 2D MoS2 leads to a tunable p-n junction with a photovoltaic effect and an asymmetric anti-ambipolar transfer response.6 I will present the underlying charge transport and photocurrent responses in both the above systems using a variety of scanning probe microscopy techniques as well as computational methods. Finally, I will show that the anti-ambipolar field effect observed in the above systems can be generalized to other semiconducting heterojunction systems and extended over large areas with practical applications in wireless communication circuits.5 The second part of talk will discuss my more recent work performed at Caltech on photovo
44. HET Lunch Discussions
"Nucleon Charges and Form Factors from Lattice QCD"
Presented by Yong-Chull Jang, BNL
Friday, May 25, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
45. HET Seminar
"Towards NLO parton showers"
Presented by Stefan Prestel, Fermilab
Wednesday, May 23, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
Parton showers aim to consistently model the evolution of the soft and collinear structure of QCD. As such, they are important pieces of event generator software. Parton shower methods have, since their inception, been limited to lowest order precision. For a consistent NLO event generator framework, and to reduce the uncertainties inherent in a lowest-order approach, it is important to push parton showers beyond lowest order precision. In this talk, I will discuss recent advances within the Dire parton shower (of Pythia and Sherpa) to construct a consistent NLO parton shower.
46. HET Lunch Discussions
"Decays of the Higgs into gauge bosons in the SMEFT at the NLO"
Presented by Pier Paolo Giardino, BNL
Friday, May 18, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
47. HET Seminar
"Review of Neutral Kaon Oscillations in and beyond the Standard Model from Lattice QCD"
Presented by Anastassios Vladikas, INFN Roma Tor Vergata
Wednesday, May 16, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
The study of the low energy strong interaction effects in neutral K-meson oscillations is based on the lattice regularisation of QCD. Precise and consistent results for the bag parameter BK, in line with expectations from Standard Model flavour phenomenology, have been obtained over the years, from several variants of lattice QCD. More recently, a few groups have also studied BK in extensions of the Standard Model. The discrepancies seen between certain results from different groups are arguably attributed to uncontrolled systematic errors in the non-perturbative renormalisation and running of weak matrix elements. The Schroedinger Functional renormalisation scheme may help resolve these discrepancies.
48. HET/RIKEN Lunch Discussions
"Localized 4-Sigma and 5-Sigma Dijet Mass Excesses in ALEPH LEP2 Four-Jet Events"
Friday, May 11, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Co-hosted by Christoph Lehner and Taku Izubuchi
49. HET/RIKEN Lunch Seminar
"Quantum Simulation from Quantum Chemistry to Quantum Chromodynamics"
Presented by Peter Love, Tufts
Thursday, May 10, 2018, 12:30 pm
Building 510, Room 2-160
Hosted by: Mattia Bruno and Enrico Rinaldi
Quantum simulation proposes to use future quantum computers to calculate properties of quantum systems. In the context of chemistry, the target is the electronic structure problem: determination of the electronic energy given the nuclear coordinates of a molecule. Since 2006 we have been studying quantum approaches to quantum chemical problems, and such approaches must face the challenges of high, but fixed, precision requirements, and fermion antisymmetry. I will describe several algorithmic developments in this area including improvements upon the Jordan Wigner transformation, alternatives to phase estimation, adiabatic quantum computing approaches to the electronic structure problem, methods based on sparse Hamiltonian simulation techniques and the potential for experiments realizing these algorithms in the near future. I will also briefly review work by others on the analog and digital simulation of lattice gauge theories using quantum simulators.
50. HET Lunch Discussions
"Variation of alpha from a long range force"
Presented by Hooman Davoudiasl, BNL
Friday, May 4, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
51. HET Lunch Discussions
"Revisiting the Dark Photon Interpretation of the Muon g-2 Anomaly"
Presented by Gopolang Mohlabeng, BNL
Friday, April 27, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
52. Joint BNL/SBU HET Seminar
"Mining the LHC Data for Anomalies"
Presented by Matthew Buckley, Rutgers University
Wednesday, April 25, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
53. Joint BNL/SBU HET seminar
"Neutron stars chirp about vacuum energy"
Presented by Csaba Csaki, Cornell University
Wednesday, April 18, 2018, 2:30 pm
YITP
Hosted by: Christopher Murphy
While the current vacuum energy of the Universe is very small, in our standard cosmological picture it has been much larger at earlier epochs. We try to address the question of what are possible ways to try to experimentally verify the properties of vacuum energy in phases other than the SM vacuum. One promising direction is to look for systems where vacuum energy constitutes a non-negligible fraction of the total energy, and study the properties of those. Neutron stars could be such systems, and we discuss how to use the recent observation of neutron star mergers to try to learn about the inner core of the neutron star which may be dominated by vacuum energy.
54. Joint ATLAS/HET lunch discussion
"Post LHC theory"
Presented by Eder Izaguirre / Alessandro Tricoli, BNL
Friday, April 13, 2018, 12:15 pm
Building 510, Room 2-84
Hosted by: Christoph Lehner
55. HET Lunch Discussions
"Isospin Breaking corrections in tau decays from Lattice QCD"
Presented by Mattia Bruno, BNL
Friday, April 6, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
56. HET Seminar
"Excluding a thin dark matter disk in the Milky Way with Gaia DR1"
Presented by Katelin Schutz, UC Berkeley
Thursday, April 5, 2018, 11 am
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
If a component of the dark matter has dissipative interactions, it could collapse to form a thin dark disk in our Galaxy coincident with the baryonic disk. It has been suggested that dark disks could explain a variety of observed phenomena, including mass extinction events due to periodic comet impacts. Using the first data release from the Gaia space observatory, I will present the results of a search for a dark disk via its effect on stellar kinematics in the Milky Way. I will discuss our strong new limits that disfavor the presence of a thin dark matter disk and present updated measurements on the total matter density in the solar neighborhood.
57. HET Seminar has been CANCELLED for today
"Excluding a thin dark matter disk in the Milky Way with Gaia DR1"
Presented by Katelin Schutz, UC Berkeley
Wednesday, April 4, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
If a component of the dark matter has dissipative interactions, it could collapse to form a thin dark disk in our Galaxy coincident with the baryonic disk. It has been suggested that dark disks could explain a variety of observed phenomena, including mass extinction events due to periodic comet impacts. Using the first data release from the Gaia space observatory, I will present the results of a search for a dark disk via its effect on stellar kinematics in the Milky Way. I will discuss our strong new limits that disfavor the presence of a thin dark matter disk and present updated measurements on the total matter density in the solar neighborhood.
58. HET Lunch Discussions
"Lattice QCD Study of Exclusive Channels in the Muon HVP"
Presented by Aaron Meyer, BNL
Friday, March 30, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
59. HET Lunch Discussion /Neutrino Discovery Initative
"Boosted Dark Matter at DUNE"
Presented by Lina Necib, Caltech
Friday, March 23, 2018, 12:15 pm
Building 510, Room - 2-160
60. HET Seminar
"Empirical Determination of Dark Matter Velocities"
Presented by Lina Necib, Caltech
Friday, March 23, 2018, 10 am
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
61. HET Seminar
"Empirical Determination of Dark Matter Velocities"
Presented by Lina Necib, Caltech
Wednesday, March 21, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
62. HET Lunch Discussions
"Updated Global SMEFT Fit to Higgs, Diboson and Electroweak Data"
Presented by Christopher Murphy, BNL
Friday, March 16, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
63. Condensed-Matter Physics & Materials Science Seminar
"Enabling emergent spin-orbit magnetism in iridate-based heterostructures"
Presented by Jian Liu, The University of Tennessee, Knoxville
Thursday, March 15, 2018, 11 am
ISB Bldg. 734 Seminar Room 201 (upstairs)
Hosted by: Mark Dean
5d transition metal oxides have emerged as a novel playground for some of the most outstanding and challenging problems in condensed matter physics, such as metal-insulator transition and quantum magnetism. In particular, layered iridates hosting square lattices of IrO6 octahedra have drawn significant interests due to the electronic and magnetic analogy with high-Tc cuprates. However, materials of this kind are limited to a few Ruddlesden-Popper (RP) compounds. In this talk, I will discuss our recent work on overcoming this bottleneck by constructing such two-dimensional (2D) structures confined in superlattices grown by heteroepitaxy. By leveraging the layering control of epitaxial growth, we are not only able to develop new structural variants of layered iridates, but also unravel and exploit the intriguing spin-orbit-driven 2D magnetism beyond the cuprate physics yet invisible in the RP iridates. The results demonstrate the power of this approach in tailing the exchange interactions, enabling new magnetic controls, and providing unique insights into the emergent phenomena of 5d electrons.
64. Center for Functional Nanomaterials Seminar
"Metal oxide/semiconductor heterojunctions as carrier-selective contacts for photovoltaic applications"
Presented by Gabriel Man
Wednesday, March 14, 2018, 2 am
CFN, Bldg. 735 - first, floor, conference room A
Hosted by: Mingzhao Liu
Solar radiation is a vast, distributed, and renewable energy source which Humanity can utilize via the photovoltaic effect. The goal of photovoltaic technology is to minimize the true costs, while maximizing the power conversion efficiency and lifetime of the cell/module. Interface-related approaches to achieving this goal are explored here, for two technologically-important classes of light absorbers: crystalline-silicon (c-Si) and metal halide perovskite (MHP). The simplest solar cell consists of a light absorber, sandwiched between two metals with dissimilar work functions. Carrier-selective contacts (CSC's), which are ubiquitous in modern solar cells, are added to improve the electrical performance. Solar cells require asymmetric carrier transport within the cell, which can be effected via electrostatic and/or effective fields, and CSC's augment the asymmetry by selectively transporting holes to one contact, and electrons to the other contact. The proper design and implementation of a CSC is crucial, as the performance, lifetime, and/or cost reduction of a solar cell can be hampered by a single interface or layer. A framework, consisting of eight core requirements, was developed from first-principles to evaluate the effectiveness of a given CSC. The framework includes some requirements which are well-recognized, such as the need for appropriate band offsets, and some requirements which are not well-recognized at the moment, such as the need for effective valence/conduction band density of states matching between the absorber and CSC. The application of the framework to multiple silicon-based and MHP-based CSC's revealed the difficulties of effectively designing and implementing a CSC. Three metal oxide/c-Si heterojunctions initially expected to yield comparable electron-selective contacts (ESC's), titanium dioxide/c-Si (TiO2/c-Si), zinc oxide/c-Si (ZnO/c-Si), and tin dioxide/c-Si (SnO2/c-Si), were instead discovered to be widely diff
65. HET Lunch Discussions
"An update on the HVP contribution to the muon g-2"
Presented by Christoph Lehner
Friday, March 9, 2018, 12:15 pm
Building 510, Room 2-160
66. HET Seminar
"Dispersion relation for hadronic light-by-light scattering"
Presented by Peter Stoffer, UC San Diego
Wednesday, March 7, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
67. HET Lunch Discussions
"Semileptonic decays using Oktay-Kronfeld heavy quarks on the HISQ lattice"
Presented by Yong-Chull Jang, BNL
Friday, March 2, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
68. Joint BNL/SBU HET Seminar
"Searching for Light Dark Matter with Dirac Materials"
Presented by Yonatan Kahn, Princeton University
Wednesday, February 28, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
Dark matter with mass below a GeV is invisible to standard WIMP searches. In this talk I will present two recent proposals for direct detection of keV-GeV mass dark matter, both utilizing Dirac materials, where low-energy electronic excitations have linear dispersion relations and obey the Dirac equation. Dark matter with mass in the MeV-GeV range can eject electrons from graphene sheets, which can act as both targets and detectors when employed in a field-effect transistor mode, allowing directional detection. Dark matter as light as a few keV can excite electrons to the conduction band of Dirac semimetals like ZrTe5, where the linear dispersion protects the in-medium mass of the mediator and provides superior reach to a light dark photon mediator compared to superconductors. I will discuss recent progress towards experimental realizations of these proposals.
69. HET Lunch Seminar
"Recent indications of LU...... violations: A possible shaking of HEP in the making"
Presented by Amarjit Soni, BNL
Friday, February 23, 2018, 12 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
70. HET Seminar
"Analysis of a Dilaton EFT for Lattice Data"
Presented by Thomas Appelquist, Yale University
Wednesday, February 21, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christoph Murphy
71. Joint Nuclear Theory and HET Seminar
"TeV Scale Lepton Number Violation: Neutrinoless Double Beta Decay & the LHC"
Presented by Michael Ramsey-Musolf, U. Mass. Amherst
Friday, February 9, 2018, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
72. HET Lunch Discussions
"Precision physics in the LHC era"
Presented by Pier Paolo Giardino, BNL
Friday, January 12, 2018, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
73. HET Seminar
"Searching for Ultralight Particles with Black Holes and Gravitational Waves"
Presented by Masha Baryakhtar, Perimeter Inst. Theor. Phys.
Wednesday, December 13, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
The LIGO detection of gravitational waves has opened a new window on the universe. I will discuss how the process of superradiance, combined with gravitational wave measurements, makes black holes into nature's laboratories to search for new light bosons, from axions to dark photons. When a bosonic particle's Compton wavelength is comparable to the horizon size of a black hole, superradiance of these bosons into hydrogenic' bound states extracts energy and angular momentum from the black hole. The occupation number of the levels grows exponentially and the black hole spins down. One candidate for such an ultralight boson is the QCD axion with decay constant above the GUT scale. Current black hole spin measurements disfavor a factor of 30 (400) in axion (vector) mass; future measurements can provide evidence of a new boson. Particles transitioning between levels and annihilating to gravitons may produce thousands of monochromatic gravitational wave signals, and turn LIGO into a particle detector.
74. Special HET Seminar
"Effective Theories and Phenomenology of Dark Mesons"
Presented by Graham Kribs, University of Oregon
Monday, December 11, 2017, 1:30 pm
Building 510, Room 2-160
Hosted by: Hooman Davoudiasl
75. HET Lunch Discussions
"A precise determination of the QCD coupling by the ALPHA Collaboration"
Presented by Mattia Bruno, BNL
Friday, December 8, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
76. HET Lunch Discussions
"Double Higgs Production in the Complex Singlet Extended Standard Model"
Presented by Matt Sullivan, University of Kansas
Friday, December 1, 2017, 12:15 pm
Orange Room
Hosted by: Christoph Lehner
77. HET Seminar
"Do Electroweak Corrections Violate Factorization?"
Presented by Ira Rothstein, Carnegie Mellon U
Wednesday, November 29, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Eder Izaguirre
78. HET Lunch Discussions
"Unified Scenario for Composite Right-Handed Neutrinos and Dark Matter"
Presented by Pier Paolo Giardino
Friday, November 17, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
79. HET Seminar
"Analysis of a Dilaton EFT for Lattice Data"
Presented by Thomas Appelquist, Yale University
Wednesday, November 15, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattio Bruno
80. HET Seminar
"Tomorrow's Colloquium: Joanna Kiryluk: IceCube: Understanding the High Energy Universe with Cosmic Neutrinos"
Presented by Linda Carpenter, Ohio State University
Wednesday, November 8, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
Though the Higgs has a non trivial branching fraction -8 percent, to light jets, this is a very hard channel to directly capture with the LHC. We study the Higgs boson (h ) decay to two light jets at the 14 TeV High-Luminosity-LHC (HL-LHC), where a light jet (j ) represents any nonflavor-tagged jet from the observational point of view. The decay mode Higgs to gluons is chosen as the benchmark since it is the dominant channel in the Standard Model, but the bound obtained is also applicable to the light quarks. We estimate the achievable bounds on the decay branching fractions through the associated production V h (V =W±,Z ). Events of the Higgs boson decaying into heavy (tagged) or light (untagged) jets are correlatively analyzed. We find that with 3000 fb-1 data at the HL-LHC corresponds to a reachable upper bound of a few times the SM prediction. Which can ten be turned into a bound on the Higgs couplings to gluons and light quark flavors. A consistency fit also leads to an upper bound on the Higgs to charm coupling. The estimated bound may be further strengthened by adopting multiple variable analyses or adding other production channels.
81. Updated HET Seminar
"Capturing Higgs Boson Decays to Light Jets at LHC"
Presented by Linda Carpenter, Ohio State University
Wednesday, November 8, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christopher Murphy
Though the Higgs has a non trivial branching fraction -8 percent, to light jets, this is a very hard channel to directly capture with the LHC. We study the Higgs boson (h ) decay to two light jets at the 14 TeV High-Luminosity-LHC (HL-LHC), where a light jet (j ) represents any nonflavor-tagged jet from the observational point of view. The decay mode Higgs to gluons is chosen as the benchmark since it is the dominant channel in the Standard Model, but the bound obtained is also applicable to the light quarks. We estimate the achievable bounds on the decay branching fractions through the associated production V h (V =W±,Z ). Events of the Higgs boson decaying into heavy (tagged) or light (untagged) jets are correlatively analyzed. We find that with 3000 fb-1 data at the HL-LHC corresponds to a reachable upper bound of a few times the SM prediction. Which can ten be turned into a bound on the Higgs couplings to gluons and light quark flavors. A consistency fit also leads to an upper bound on the Higgs to charm coupling. The estimated bound may be further strengthened by adopting multiple variable analyses or adding other production channels.
82. HET Lunch Discussions
"Dark Parity Violation After Qweak and Future Neutrino Physics Discussion"
Presented by William J. Marciano, BNL
Friday, November 3, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
83. Updated HET Lunch Discussions
""Dark Parity Violation After Qweak and Future Neutrino Physics Discussion" (Neutrino Discovery Initiative)"
Presented by William J. Marciano, BNL
Friday, November 3, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
To participate via BlueJean connection, please click on the following link: https://bluejeans.com/753838707/7269 Meeting ID: 753 838 707 Participate Passcode: 7269
84. HET/RIKEN Seminar
"Calculation of the electric dipole moment with the gradient flow"
Presented by Andrea Shindler, Michigan State University
Wednesday, November 1, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
85. HET Lunch Discussions
"A statistical approach to Higgs couplings in the SMEFT, 1710.02008"
Presented by Chris Murphy, BNL
Friday, October 27, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
86. HET Seminar
"Semileptonic decays of B_(s) mesons to light pseudoscalar mesons with lattice QCD"
Presented by Zechariah Gelzer, Iowa University
Wednesday, October 18, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
87. HET Lunch Discussions
"Repulsion of Dark Matter and Null Direct Signals"
Presented by Hooman Davoudiasl, BNL
Friday, October 6, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
88. HET Seminar
"Flavorful Higgs bosons"
Presented by Wolfgang Altmannshofer, Cincinnati University
Wednesday, October 4, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
Measurements of Higgs production and decays have revealed that most of the mass of the weak gauge bosons is due to the 125 GeV Higgs. Similarly, we know that the Higgs is at least partially responsible for giving mass to the top and bottom quarks and the tau lepton. Much less is known about the origin of mass for the first two generations. In this talk, I will discuss a framework in which the first and second generation masses originate from a second source of electroweak symmetry breaking and outline the phenomenological implications.
89. HET Lunch Discussions
"Precision calculation of the g-2 HVP contribution by combining lattice and R-ratio data"
Presented by Christoph Lehner, BNL
Friday, September 15, 2017, 12:15 pm
Building 510, Room 2-160
90. HET Lunch Discussions
"Towards a non-perturbative calculation of Weak Hamiltonian Wilson Coefficients"
Presented by Mattia Bruno, BNL
Friday, September 8, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
91. HET Lunch Discussions
"Finite Volume in QCD+QED & g-2 HLbL"
Presented by Taku Izubuchi, BNL
Friday, September 1, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
92. HET Lunch Discussions
"Hierarchion - a unified framework to address the Standard Model's hierarchies"
Presented by Gilad Perez, Weizmann Institute
Friday, August 11, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
93. HET Lunch Discussions
"The Standard Model as a Lamppost"
Presented by Eder Izaguirre, BNL
Friday, August 4, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
94. HET Lunch Discussions
"Possible origin(s) of flavor anomalies"
Presented by Amarjit Soni, BNL
Friday, July 28, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
95. HET Lunch Discussions
"Quasi PDFs"
Presented by Luchang Jin, BNL
Friday, July 21, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
96. HET Lunch Discussions
"Long-lived light scalars and displaced vertices as probe of seesaw"
Presented by Bhupal Dev, Washington University
Friday, July 14, 2017, 12 pm
Building 510, Room 2-160
Hosted by: Amarjit Soni
In low-scale seesaw models for neutrino masses with local B −L symmetry breaking, the Higgs field breaking the B −L symmetry can leave a physical real scalar field with mass around GeV scale. In the specific case when the B − L symmetry is embedded into the left-right symmetry, low energy flavor constraints necessarily require such a light scalar to be long lived, with a distinct displaced photon signal at the LHC. We will discuss this previously unexplored region of parameter space, which opens a new window to TeV scale seesaw physics at colliders.
97. HET Seminar
"Double Gauge Boson Production in the SM Effective Field Theory"
Presented by Ian Lewis, University of Kansas
Wednesday, June 28, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
98. HET/RIKEN Seminars
"Searching for New Physics with Higgs Decays"
Presented by Daniel Stolarski, Carleton University
Wednesday, June 14, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
99. HET/RIKEN Seminar
"Cosmology in Mirror Twin Higgs and Neutrinos"
Presented by Patrick Fox, Fermilab
Wednesday, May 24, 2017, 2 pm
Small Seminar Room, Bldg. 510
100. HET/RIKEN Seminars
"Collider and Cosmological Signatures of a Strong Electroweak Phase Transition"
Presented by Jonathan Kozaczuk, UMass Amherst
Wednesday, May 17, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
101. HET Lunch Discussions
"Standard Model EFT and Extended Scalar Sectors"
Presented by Chris Murphy, BNL
Friday, May 5, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
102. Joint YITP/HET Seminar
"Evidence for a ~17 MeV Particle in Rare Beryllium-8 Decays?"
Presented by Tim Tait, UCI
Wednesday, May 3, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
103. YITP/HET Joint Seminar
"TBA"
Presented by John Donoghue, U. Mass Amherst
Wednesday, April 26, 2017, 3 pm
YITP Seminar Room, Stony Brook University
104. HET Lunch Discussions
Presented by Bill Marciano, BNL
Friday, April 21, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
105. HET Lunch Discussions
"Electroweak Wilson Coefficients from Lattice QCD"
Presented by Mattia Bruno, BNL
Friday, April 14, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
106. HET Lunch Discussions
"Fuzzy Dark Matter from Infrared Confinement"
Presented by Hooman Davoudiasl, BNL
Friday, April 7, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
107. A Special HET/RIKEN Lunch Seminar
"The Road to Nuclear Physics from Standard Model"
Presented by Zohreh Davoudi, MIT
Thursday, April 6, 2017, 12:30 pm
Building 510, Room 2-160
Hosted by: Hiromichi Nishimura
At the core of nuclear physics is to understand complex phenomena occurring in the hottest and densest known environments in nature, and to unravel the mystery of the dark sector and other new physics possibilities. Nuclear physicists are expected to predict, with certainty, the reaction rates relevant to star evolutions and nuclear energy research, and to obtain the "standard" effects in nuclei to reveal information about the "non-standard" sector. To achieve such certainty, the field has gradually started to eliminate its reliance on the phenomenological models and has entered an era where the underlying interactions are "effectively" based on the Standard Model of particle physics, in particular Quantum Chromodynamics (QCD). The few-nucleon systems can now emerge directly from the constituent quark and gluon degrees of freedom and with only QCD interactions in play, using the numerical method of lattice QCD. Few-body observable, such as few-nucleon interactions and scattering amplitudes, as well transition amplitudes and reaction rates, have been the focus of this vastly growing field, as once obtained from QCD, and matched to effective field theories, can advance and improve the nuclear many-body calculations of exceedingly complex systems. This talk is a brief introduction to this program and its goals, with a great focus on the progress in few-body observables from QCD.
108. HET Seminar
"Hints of New Physics in Semi-leptonic B-meson Decays"
Presented by Diptimoy Ghosh, Weizman
Wednesday, April 5, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
In recent years, a number of interesting signals of potential new physics in semi-leptonic B-meson decays have been reported both by the B-factories as well as the LHCb. In this talk, I will discuss these observations with a particular emphasis on the observable $R_{D^*}$, the ratio of the branching fraction of $\bar{B} \to D^* \tau \bar{\nu}_\tau$ to that of $\bar{B} \to D^* \ell \bar{\nu}_\ell (\ell = \mu, e )$, which shows a 3.3 sigma deviation from the Standard Model prediction. I will present an effective field theory analysis of these potential new physics signals and discuss possible ways to distinguish the various operators.
109. HET Lunch Discussions
"A local factorization of the fermion determinant in lattice gauge theories"
Presented by Leonardo Giusti, CERN
Friday, March 31, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
110. HET Lunch Discussions
"Baryogenesis and Dark Matter in the exo-Higgs scenario"
Presented by Pier Paolo Giardino, BNL
Friday, March 24, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
111. HET Lunch Discussions
"Probing top-quark width using b-jet charge identification"
Presented by Cen Zhang, BNL
Friday, March 17, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
112. HET/RIKEN Seminar
"Hunting for New Leptonic Interactions at Colliders"
Presented by Brian Shuve, SLAC
Wednesday, March 15, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
113. HET Lunch Discussions
"Progress towards sub-percent precision for the muon g-2 HVP contribution from lattice QCD"
Presented by Christoph Lehner, BNL
Friday, March 10, 2017, 12:15 pm
Building 510, Room 1-224
Hosted by: Christoph Lehner
114. HET Lunch Discussions
"Lattice Calculation of Nucleon Electric Dipole Moments"
Presented by Sergey Syritsyn, Stony Brook
Friday, March 3, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
Searches for permanent electric dipole moments (EDM) of neutrons, protons, and nuclei are the most sensitive probes for CP violation, which is necessary for baryogenesis. Currently developed experiments will improve bounds on the neutron EDM by 2-3 orders of magnitude. However, to put constraints on CP-violating interactions, nonperturbative QCD calculations of nucleon structure are necessary. I will present some recent developments in lattice calculations of nucleon EDMs induced by quark-gluon CP-odd interaction
115. HET Lunch Discussions
"Inclusive tau decays"
Presented by Taku Izubuchi, BNL
Friday, February 24, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
116. HET/RIKEN Seminar
"Few-body systems in QCD"
Presented by Raul A. Briceno, JLAB
Wednesday, February 22, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
117. HET Lunch Discussions
"B-decay Anomalies in a Composite Leptoquark Model"
Presented by Christopher Murphy, BNL
Friday, February 17, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
The collection of a few anomalies in semileptonic $B$-decays, especially in $b \to c \tau \bar{\nu}$ invites us to speculate about the emergence of some striking new phenomena, perhaps interpretable in terms of a weakly broken $U(2)^n$ flavor symmetry and of leptoquark mediators. Here we aim at a partial UV completion of this interpretation by generalizing the minimal composite Higgs model to include a composite vector leptoquark as well. Reference: arXiv:1611.04930 w/ R. Barbieri and F. Senia
118. HET/RIKEN Seminar
"Extracting scattering observables and resonance properties from lattice QCD"
Presented by Maxwell T. Hansen, Helmholtz Institute Mainz
Wednesday, February 15, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
119. HET Seminar
"QCD with Minimally Doubled Fermions"
Presented by Johannes Weber, TUM
Tuesday, February 14, 2017, 1 pm
Building 510, Room 2-160
Hosted by: Mike Creutz
120. HET Lunch Discussions
"TBA"
Presented by Taku Izubuchi, BNL
Friday, February 10, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
121. HET Seminar
"TBA"
Presented by Johannes Weber
Thursday, February 9, 2017, 3 pm
Small Seminar Room, Bldg. 510
Hosted by: Mike Creutz
122. HET Lunch Discussions
"The Coming Armageddon - Upcoming Cyber and Other Changes"
Presented by Thomas Throwe, BNL
Friday, February 3, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
123. HET Seminar
"Exploring the Low Mass Frontier in Dark Matter Direct Detection"
Presented by Tongyan Lin, LBL
Wednesday, February 1, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
124. HET Lunch Discussions
"EFTs and the Higgs"
Presented by Sally Dawson, BNL
Friday, January 27, 2017, 12:15 pm
Building 510, Room 2-95
Hosted by: Christoph Lehner
125. Condensed-Matter Physics & Materials Science Seminar
"Anion-based approaches to engineering functionality in perovskite oxide heterostructures"
Presented by Steve May, Drexel University
Thursday, January 26, 2017, 1:30 pm
ISB Bldg. 734, Conf. Room 201 (upstairs)
Hosted by: Mark Dean
Scientific interest in ABO3 perovskite oxides remains intense due to the wide range of physical behavior present in these materials. The ability to control the position, occupation, and composition of the anion site has recently emerged as a new route to tune properties in epitaxial perovskites. This talk will focus on recent and ongoing efforts aimed at developing anion-based approaches to tailor electronic, optical and magnetic properties in oxide heterostructures. First, I will discuss how the position of the oxygen anions can be controlled to stabilize non-bulk-like bond angles and lengths, thereby modifying electronic and magnetic behavior in manganite films and superlattices. In the second half of the talk, I will describe efforts focused on controlling the occupation and composition of the anion site, including reversible oxidation/reduction in thin La1/3Sr2/3FeO3-? films and topotactic fluorination reactions to realize oxyfluoride films
126. Joint YITP/HET Seminar
"muon colliders"
Presented by Mario Greco, Frascati
Wednesday, January 25, 2017, 2:30 pm
YITP Seminar Room
127. HET Lunch Discussions
"epsilin, epsilon'....& the K-UT"
Presented by Amarjit Soni, BNL
Friday, January 20, 2017, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
128. HET Seminar
"Phenomenology of Enhanced Light Quark Yukawa Couplings and the Wh Charge Asymmetry"
Presented by Felix Yu, Mainz
Wednesday, January 18, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
129. HET Seminar
"Search For Dark matter In Terms of Dark Bound States"
Presented by Yue Zhang, Northwestern
Wednesday, January 11, 2017, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
130. HET Lunch Discussions
"The ttbar resonance lineshape using NLO EFT"
Presented by Cen Zhang, BNL
Friday, December 16, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
131. HET/RIKEN Seminar
"The Fate of Axion Stars"
Presented by Hong Zhang, Ohio State University
Wednesday, December 14, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
132. HET Lunch Discussions
"Weak decays beyond NLO III"
Presented by Mattia Bruno, BNL
Friday, December 9, 2016, 12:15 pm
Building 510, Room 2-95
Hosted by: Christoph Lehner
133. Joint: YITP/HET
"Enhancing searches for beyond the Standard Model physics at the LHC"
Presented by Michele Papucci, Berkeley
Wednesday, December 7, 2016, 2:30 pm
YITP Seminar Room
In this talk I'll present recent work on improving the capabilities for looking for new physics at the LHC, both for exotics BSM signals (hidden valleys) and for Dark Matter. I will also discuss soon to be publicly available tools for connecting LHC results with theoretical models.
134. HET/RIKEN Seminars
"Heavy meson decays to light resonances"
Presented by Luka Leskovec, University of Arizona
Wednesday, November 30, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
Lattice QCD calculations of electroweak decays with single, strong-interaction-stable hadrons in the initial and final state have recently reached a high level of precision. Many phenomenologically important decays, however, involve hadronic resonances, and their naive analysis on the lattice leads to uncontrolled systematic errors. Recent theoretical developments in the finite-volume treatment of $1 \to 2$ transition matrix elements now enable us to perform rigorous lattice calculations of electroweak decays to light resonances such as the $\rho$. After presenting the Briceno-Hansen-Walker-Loud formalism, I will discuss our numerical implementation for the $D\to\rho \ell \nu$ and $B\to\rho \ell \nu$ decays, where we aim to quantify the effect of the unstable nature of the $\rho$. Our calculations are performed on a gauge ensemble with 2+1 flavors of clover fermions with a pion mass of ~320 MeV and a lattice size of ~3.6 fm.
135. HET Lunch Discussions
"ALPs and the Muon g-2 Discrepancy"
Presented by William J. Marciano, BNL
Friday, November 18, 2016, 12:30 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
136. Joint YITP/HET Seminar
"A Predictive Theory for All Required and Measurable CP Violation"
Presented by Scott Thomas, Rutgers
Wednesday, November 16, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
137. HET/RIKEN Seminars
"When the Higgs meets the Top"
Presented by Chung Kao, University of Oklahoma
Wednesday, November 9, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
138. HET Lunch Discussions
"Perturbative Unitarity at NLO in the 2HDM, and Bottom-Quark Forward-Central Asymmetry at LHCb"
Presented by Christopher Murphy, BNL
Friday, November 4, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
139. HET/RIKEN Seminars
"Neutrinoless double beta decay from lattice QCD"
Presented by Amy Nicholson, UC Berkeley
Wednesday, November 2, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
140. HET/RIKEN Seminars
"Collider signatures of flavorful Higgs bosons"
Presented by Stefania Gori, University of Cincinnati
Wednesday, October 26, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
141. HET Lunch Discussions
"Chiral heavy fermions one more time: pheno & new search strategies"
Presented by Shaoul Bar-Shalom, Technion
Friday, October 21, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
142. Joint: YITP/HET
"A New Angle on Jet Substructure"
Presented by Jesse Thaler, MIT
Wednesday, October 19, 2016, 2:30 pm
YITP Seminar Room
Jet substructure has emerged as a key tool for new physics searches at the LHC, particularly for signals that involve highly Lorentz-boosted top quarks and electroweak bosons. In this talk, I present a suite of powerful jet substructure observables that were discovered by systematically studying the soft and collinear singularities of QCD. These new observables are based on N-particle energy correlations, using a novel angular weighting function to yield improved performance over previous techniques.
143. HET Lunch Discussions
"Constraining the Higgs trilinear coupling"
Presented by Pier Paolo Giardino, BNL
Friday, October 14, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
144. HET/RIKEN Seminar
"Cannibal Dark Matter"
Presented by Marco Farina, Rutgers University
Wednesday, October 12, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
145. HET Lunch Discussions
"Gravitational Wave Signatures of Sub-Millimeter Primordial Black Holes"
Presented by Hooman Davoudiasl, BNL
Friday, September 30, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
146. HET Seminar
"Lattice QCD for Neutrino Physics"
Presented by Aaron Meyer, University of Chicago
Wednesday, September 28, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Mattia Bruno
147. Physics Colloquium
"Synthetic gene circuits: New research tools for quantitative biology"
Presented by Gabor Balazsi, Stony Brook U
Tuesday, September 27, 2016, 3:30 pm
Large Seminar Room, Bldg. 510
Hosted by: Peter Petreczky
Synthetic biology is a new interdisciplinary field that designs and builds artificial biological systems, using principles from physics, engineering, and mathematics. Recent success stories include the massive, low-cost synthesis of the anti-malaria drug artemisinin, and the construction of genetic switches, oscillators and logic gates. In my laboratory we build synthetic gene circuits and use them as new research tools to precisely perturb cells and watch how they respond. This way, we hope to develop a predictive, quantitative understanding of biological processes such as microbial drug resistance and cancer. We have developed an expanding library of synthetic gene regulatory circuits first in yeast, and then in cancer cells for this purpose. I will illustrate through a few examples how we can gain a deeper, quantitative understanding of microbial drug resistance and cancer using synthetic gene circuits.
148. HET Lunch Discussions
"Playing with Time in the Schwarzschild Metric"
Presented by Micheal Creutz, BNL
Friday, September 23, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
149. Joint YITP/HET Seminar
"Towards precision jet physics at the LHC"
Presented by Matt Schwartz, Harvard
Wednesday, September 21, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
150. HET Lunch Discussions
"Weak decays beyond NLO II"
Presented by Mattia Bruno, BNL
Friday, September 16, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
151. HET
"Multi-Component Dark Matter through a Radiative Higgs Portal"
Presented by Gopolang Mohlabeng, University of Kansas
Wednesday, September 14, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
152. HET Lunch Discussions
"The Beryllium anomaly and a possible particle physics interpretation"
Presented by Eder Izaguirre, BNL
Friday, September 9, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
153. HET Lunch Discussions
"Survey of algorithms for finite lattice"
Presented by Taku Izubuchi, BNL
Friday, August 26, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
154. HET Lunch Discussions
"An update on a precise first-principles determination of the muon g-2"
Presented by Christoph Lehner, BNL
Friday, August 19, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
155. HET/RIKEN Seminar
"Standard Model Vacuum Stability with a 125 GeV Higgs Boson"
Presented by Stefano Di Vita, DESY
Friday, August 12, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Pier Paolo Giardino
156. HET Seminar
"Lattice Quantum Gravity and Asymptotic Safety"
Presented by J. Laiho, Syracuse
Wednesday, June 15, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
157. RIKEN Lunch Seminar
"Lefschetz-thimble path integral for studying the sign problem and Silver Blaze phenomenon"
Presented by Yuya Tanizaki, RBRC
Thursday, May 26, 2016, 12:30 pm
Building 510, Room 2-160
Hosted by: Hiroshi Ohki
Recently, Picard-Lefschetz theory gets much attention in the context of the sign problem, because it enables us to study the system with the complex classical action nonperturbatively by employing the semiclassical analysis. In this seminar, after its brief introduction, I will apply it to the one-site Hubbard model. This model has a severe sign problem, which looks quite similar to that of the finite-density QCD at low temperatures. By solving this model using the Lefschetz-thimble path integral, we are trying to understand the structure of the sign problem of finite-density QCD. Especially, I give a qualitative picture (or speculation) about the early-onset problem of the baryon number density, called the baryon Silver Blaze problem. The complex Langevin method will also be discussed if time allows.
158. HET Lunch Discussions
"Avoiding the traps of EFT Higgs analyses"
Presented by Tilman Plehn, Heidelberg
Friday, May 20, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Sally Dawson
159. HET/RIKEN Seminar
"Higgs Pair Production in Extensions of the Standard Model"
Presented by Ramona Groeber, Roma Tre
Wednesday, May 18, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Pier Paolo Giardino
Higgs pair production is not only interesting as a probe of the trilinear Higgs self-coupling, but beyond the Standard Model physics can influence the Higgs pair production cross section in many different ways, for example by new couplings, new loop particles or new resonances. In this talk, I will address the question whether we could see for the first time deviations from the Standard Model in Higgs pair production assuming that no deviations were seen before. Furthermore, for certain models I will show how higher order corrections influence the cross section.
160. Condensed-Matter Physics & Materials Science Seminar
"Equilibrium States and Dynamics of Spin Assemblies in Magnetic Thin Films, Heterostructures and Nanostructured Entities"
Presented by Ramesh B. Budhani, Indian Institute of Technology Kanpur
Tuesday, May 17, 2016, 11 am
Building 480, Conference Room
Hosted by: Lijun Wu
The orientation of spin assemblies in ferromagnetic thin films and nanostructures can take a variety of shapes depending on the relative strength of factors contributing to their magnetic free energy. These factors are derived from the direct quantum mechanical exchange between the electronic spins or those mediated by impurities, and those associated with the size, shape, crystallographic structure, strain, dipolar interactions and external fields. Here we present three cases where the orientational dynamics has been studied as functions of temperature, magnetic field strength and the elapsed time after acquiring a particular configuration. These studies are based on magnetic force microscopy and bulk magnetometry measurements on strain epitaxial films of La0.67Ca0.33MnO3, and lithographically patterned submicron size ring assemblies of permalloy and Co/Pd multilayers, which also form artificial spin ices. Towards the end of this lecture we will discuss interface driven magnetic and electronic phenomena in magnetic thin films.
161. HET/RIKEN Seminar
"Axions and Topology"
Presented by Simon Mages, Forschungszentrum Juelich
Wednesday, May 11, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Tomomi Ishikawa
This talk will be centered around the calculation of the high temperature topological susceptibility in QCD. It will provide some background on our motivation from cosmology and particle physics, which is the dependence of axion physics on non-perturbative QCD. I will show our recent results on the quenched high temperature topological susceptibility and discuss difficulties with this conventional approach, which render dynamical studies unfeasible. I will also present our new approach based on formulating QCD on a non-orientable manifold, which is a promising candidate to solve issues related to topological freezing and the divergence of autocorrelations when approaching the continuum limit.
162. HET/RIKEN Seminar
"Calculating TMDs and DPDs on the lattice"
Presented by Andreas Schaefer, University of Regensburg
Wednesday, May 4, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Tomomi Ishikawa
163. Nuclear Theory/RIKEN Seminar
"Going with the flow: sign problem, Lefschetz thimbles and beyond"
Presented by Gokce Basar, University of Maryland
Friday, April 29, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Soeren Schlichting
Monte Carlo method, a robust way of studying field theories and many body systems, suffers from the sign problem when the action is complex. This includes an important set of problems such as most field theories, including QCD, and strong correlated electronic systems at finite density, as well as computation of real time quantities like transport coefficients. I will show that lifting the path integration to a complex manifold provides a way to ameliorate the sign problem, and introduce a new algorithm for carrying on such a computation. I will give some quantum mechanical examples with severe sign problems, including finite density of fermions and real time observables where Monte Carlo simulations can be profitably performed by this method. Finally I will discuss the 3+1d Bose gas with nonzero chemical potential.
164. HET/RIKEN Seminar
"Heavy Higgs Resonance Dip"
Presented by Sunghoon Jung, SLAC
Wednesday, April 27, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Cen Zhang
We discuss overlooked resonance shapes of heavy Higgs bosons that arise from the resonance-continuum interference with a complex phase. They include pure resonance dips and nothingness. We derive conditions under which they are produced and we modify narrow width approximation suitable for them. We then discuss how MSSM heavy Higgs searches at the LHC can be challenged and changed.
165. Joint BNL/YITP HET Seminar
"Progress and Results with the GENEVA Monte Carlo"
Presented by Christian Bauer, LBNL
Wednesday, April 20, 2016, 2:30 pm
YITP (SBU)
166. HET Lunch Discussions
"Agravity: an adimensional theory of gravity"
Presented by Pier Paolo Giardino, BNL
Friday, April 15, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
167. HET/PARTICLE/RBRC Seminar
""Recent Highlights from CMS and from the 13 TeV run at the LHC""
Presented by Albert de Roeck, CERN/University of Antwerp
Friday, April 8, 2016, 2 pm
Large Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
168. HET Lunch Discussions
"Musings on a 750GeV diphoton Resonance"
Presented by William J. Marciano, BNL
Friday, March 25, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
169. Special RIKEN/HET Seminar
"Axion Phenomenology from Unquenched Lattice QCD"
Presented by Guido Martinelli, Rome University
Thursday, March 24, 2016, 11 am
Large Seminar Room, Bldg. 510
Hosted by: Hiroshi Oki
We investigate the topological properties of Nf = 2 + 1 QCD with physical quark masses, both at zero and finite temperature. At zero temperature both finite size and finite cut-off effects have been studied by comparing the continuum extrapolated results for the topological susceptibility χ with the predictions from chiral perturbation theory. At finite temperature, we explore a region going from Tc up to around 4Tc, where continuum extrapolated results for the topological susceptibility and for the fourth moment of the topological charge distribution are obtained. While the fourth moment converges to the dilute instanton gas prediction the topological susceptibility differs strongly both in the size and in the temperature dependence. This results in a shift of the axion dark matter window of almost one order of magnitude with respect to the instanton computation.
170. YITP/HET Seminar
"New Signatures of Top Partners"
Presented by Jiji Fan, Brown University
Wednesday, March 23, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
171. HET Lunch Discussions
"Anomalies galore!"
Presented by Amarjit Soni, BNL
Friday, March 18, 2016, 12:15 pm
Building 510 Room 2-95
Hosted by: Christoph Lehner
172. HET/RIKEN Seminar
""Operator Bases and Effective Field Theories""
Presented by Brian Henning, Yale University
Wednesday, March 16, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Cen Zhang
173. HET Lunch Discussions
"Weak decays beyond NLO"
Presented by Mattia Bruno, BNL
Friday, March 4, 2016, 12:15 pm
Building 510 Room 2-160
Hosted by: Christoph Lehner
174. HET/RIKEN Seminar
"Accurate event simulation for colliders"
Presented by Stefan Prestel, SLAC
Wednesday, March 2, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Cen Zhang
175. HET Lunch Discussions
"Ideas about SM EFT in the top-quark sector"
Presented by Cen Zhang, BNL
Friday, February 26, 2016, 12:15 pm
Building 510 Room 2-160
Hosted by: Christoph Lehner
176. HET/YITP Joint Seminar
"TBA"
Presented by David Kaplan, JHU
Wednesday, February 24, 2016, 2:30 pm
Stony Brook University
177. HET Lunch Discussions
"Uses of Vector-like fermions"
Presented by Sally Dawson, BNL
Friday, February 19, 2016, 12:15 pm
Building 510 Room 2-160
Hosted by: Christoph Lehner
178. HET Lunch Discussions
"An exercise in chiral perturbation theory"
Presented by Micheal Creutz, BNL
Friday, February 12, 2016, 12:15 pm
Building 510, Room 2-160
Hosted by: Christoph Lehner
179. HET Lunch Discussions
"The (meta-)stability of the electroweak vacuum"
Presented by Pier Paolo Giardino, BNL
Friday, January 29, 2016, 12:15 pm
Building 510, Room 2-95
Hosted by: Christoph Lehner
180. YITP/HET Seminar
"Natural Heavy Supersymmetry"
Presented by Brian Batell, University of Pittsburgh
Wednesday, January 27, 2016, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
181. HET Lunch Discussions
"The 750 GeV Diphoton Excess at the LHC"
Presented by Hooman Davoudiasl, BNL
Friday, January 22, 2016, 12:15 pm
Building 510, Room 2-95
Hosted by: Christoph Lehner
182. HET Lunch Discussions
"Ab-initio calculation of the hadronic contributions to the muon (g-2)"
Presented by Christoph Lehner, BNL
Friday, January 15, 2016, 12:15 pm
Building 510, Room 2-95
Hosted by: Christoph Lehner
183. HET Lunch Seminar
"Theoretical Issues in Double Higgs Production"
Presented by Sally Dawson, BNL
Friday, December 11, 2015, 12 pm
Building 510 Room 2-95
Hosted by: Amarjit Soni
184. HET/RIKEN Seminar
"Developments in Scattering Amplitudes"
Presented by Ulrich Schubert, MPI, Munich
Wednesday, December 9, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
185. HET/RIKEN Lunch Seminar
"TBA"
Presented by Mattia Bruno and Pier Paolo Giardino, BNL
Friday, December 4, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
186. YITP/BNL HET Seminar
"Cosmological Probes of Nearly Decoupled Dark Sectors"
Presented by Josh Berger, Wisconsin
Wednesday, December 2, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
187. HET Seminar
"A Nonperturbative Regulator for Chiral Gauge Theories and Fluffy Mirror Fermions"
Presented by Dorota Grabowska, University of Washington
Monday, November 30, 2015, 4 pm
Building 510 Room 2-160
Hosted by: Michael Creutz
I discuss a new proposal for nonperturbatively defining chiral gauge theories, something that has resisted previous attempts. The proposal is a well defined field theoretic framework that contains mirror fermions with very soft form factors, which allows them to decouple, as well as ordinary fermions with conventional couplings. The construction makes use of an extra dimension, which localizes chiral zeromodes on the boundaries, and a four dimensional gauge field extended into the bulk via classical gradient flow. After explaining how this setup works, I consider open questions concerning the flow of topological gauge configurations, as well as possible exotic phenomenology in the Standard Model lurking at the low energy frontier.
188. HET/RIKEN Lunch Seminar
"Collider Phenomenology of the Right Handed Heavy Neutrinos"
Presented by Arindam Das, University of Alabama
Friday, November 20, 2015, 12 pm
Building 510 Room-2-160
Hosted by: Amarjit Soni
We study the collider signature of pseudo-Dirac heavy neutrinos in the inverse seesaw scenario, where the heavy neutrinos with mass at the electro-weak scale can have sizable mixings with the Standard Model neutrinos, while providing the tiny light neutrino masses by the inverse seesaw mechanism. Based on a simple, concrete model realizing the inverse seesaw scenario, we fix the model parameters so as to reproduce the neutrino oscillation data and to satisfy other experimental constraints, assuming two typical flavor structures of the model and the different types of hierarchical light neutrino mass spectra. For completeness, we also consider a general parametrization for the model parameters by introducing an arbitrary orthogonal matrix and the nonzero Dirac and Majorana phases. We perform a parameter scan to identify an allowed parameter region which satisfies all experimental constraints. With the fixed parameters, we analyze the heavy neutrino signal at the LHC through trilepton final states with large missing energy and at the ILC through a single lepton plus dijet with large missing energy.
189. YITP/BNL HET Seminar
"Natural SUSY Today"
Presented by David Shih, Rutgers
Wednesday, November 18, 2015, 2:30 pm
Stony Brook
190. HET/RIKEN Lunch Seminar
"Flavor physics with Lambda_b baryons"
Presented by Stefan Meinel, RBRC/ARIZONA
Friday, November 13, 2015, 12 pm
Building 510 Room 2-95
Hosted by: Amarjit Soni
191. Joint RIKEN Lunch/HET Seminar
"Gluon-fusion Higgs production: the final frontier"
Presented by Elisabetta Furlan, ETH, Zurich
Thursday, November 12, 2015, 12:30 pm
Building 510 Room 2-160
Hosted by: Tomomi Ishikawa
The gluon-fusion Higgs production cross section has been recently computed through the next-to-next-to-next to leading order (N^3LO) in QCD. This unprecedented level of accuracy is crucial to exploit fully the LHC data in the validation of the Standard Model and in the search for potential (small) deviations due to new physics. I will give an overview of the tools that we employed to achieve this result, from the framework of heavy-quark effective theories to the analytical and mathematical machinery that we developed. I will conclude with some results and future prospects.
192. HET Lunch Seminar
"Inflatable Dark Matter"
Presented by Hooman Davoudiasl, BNL
Friday, November 6, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
193. HET Lunch Seminar
"Higgs pair production at the LHC: SM and beyond"
Presented by Eleni Vryonidou, UCL-Belgium
Friday, October 30, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
194. HET/RIKEN Seminar
"N-jettiness subtraction scheme"
Presented by Xiaohui Liu, University of Maryland
Wednesday, October 28, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Cen Zhang
195. HET/RIKEN Lunch Seminar
"Lattice QCD applications to inclusive tau decays and related topics"
Presented by Taku Izubuchi, BNL
Friday, October 23, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
196. HET/RIKEN Seminar
"Phenomenology of semileptonic B-meson decays with form factors from lattice QCD"
Presented by Ran Zhou, Fermilab
Wednesday, October 21, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Tomomi Ishikawa
The exclusive semileptonic $B$-meson decays $B\to K(\pi)\ell^+\ell^-$, $B \to K(\pi)\nu\bar\nu$, and $B\to\pi\tau\nu$ are used to extract the CKM elements and probe new physics beyond Standard Model. The errors of the form factors used to be an important source of the uncertainties in the theoretical predictions. Recent developments in lattice-QCD provide more accurate form factors and enable us to have better theoretical predictions. In this talk, I will present the latest lattice-QCD results of the form factors in the semileptonic $B$-meson decays processes. In addition, I will compare the theoretical predictions and recent experimental results. The tension between the Standard Model and semileptonic $B$-meson decay experimental data will be discussed.
197. HET Lunch Seminar
"Towards precision effective field theory: loops and automation"
Presented by Cen Zhang, HET-BNL
Friday, October 16, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
198. YITP/BNL HET Seminar
"NNLO phenomenology with N-jettiness"
Presented by Frank Petriello, ANL/Northwestern
Wednesday, October 14, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
199. HET Lunch Seminar
"Resonant Di-Higgs Production in the Higgs Singlet Model"
Presented by Ian Lewis, SLAC
Friday, October 2, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Sally Dawson
200. YITP/BNL HET Seminar
"Cross-Order Relations from Maximal Unitarity"
Presented by David Kosower, CEA Saclay
Wednesday, September 30, 2015, 2:30 pm
YITP, Stony Brook
201. ATLAS/HET Joint Lunch Seminar
"Constraints on New Physics via Higgs Boson Couplings and Invisible Decays with the ATLAS Detector"
Presented by Ketevi Assamagan, Brookhaven National Laboratory
Friday, September 25, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
The ATLAS experiment at the LHC has measured the Higgs boson couplings and mass, and searched for invisible Higgs boson decays, using multiple production and decay channels with up to 4.7 fb$^{-1}$ of $pp$ collision data at $\sqrt{s}=7$ TeV and 20.3 fb$^{-1}$ at $\sqrt{s}=8$ TeV. In the current study, the measured production and decay rates of the observed Higgs boson in the $\gamma\gamma$, $ZZ$, $WW$, $Z\gamma$, $bb$, $\tau\tau$, and $\mu\mu$ decay channels, along with results from the associated production of a Higgs boson with a top-quark pair, are used to probe the scaling of the couplings with mass. Limits are set on parameters in extensions of the Standard Model including a composite Higgs boson, an additional electroweak singlet, and two-Higgs-doublet models. Together with the measured mass of the scalar Higgs boson in the $\gamma\gamma$ and $ZZ$ decay modes, a lower limit is set on the pseudoscalar Higgs boson mass of $m_{A}>370$ GeV in the `hMSSM'' simplified Minimal Supersymmetric Standard Model. Results from direct searches for heavy Higgs bosons are also interpreted in the hMSSM. Direct searches for invisible Higgs boson decays in the vector-boson fusion and associated production of a Higgs boson with $W/Z$ ($Z\to ll$, $W/Z \to jj$) modes are statistically combined to set an upper limit on the Higgs boson invisible branching ratio of 0.25. The use of the measured visible decay rates in a more general coupling fit improves the upper limit to 0.23, constraining a Higgs portal model of dark matter.
202. HET/RIKEN Seminar
"The Surprising Emergent Phenomena of Perturbative QCD"
Presented by Andrew J. Larkoski, MIT
Wednesday, September 23, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Cen Zhang
203. HET/RIKEN seminar
"Effective Field Theory of Heavy WIMP Annihilation"
Presented by Matthew Baumgart, Rutgers University
Wednesday, August 26, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
204. HET/RIKEN Seminar
"Constraining Extended Higgs Sectors at the LHC and Beyond"
Presented by Tania Robens, Technical University of Dresden
Wednesday, August 12, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
205. HET/RIKEN seminar
"Higgs coupling deviations, vacuum stability and new bosons at the TeV scale"
Presented by Raffaele D'Agnolo, Institute for Advanced Study
Wednesday, August 5, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
Higgs coupling measurements can shed light on the nature of electroweak symmetry breaking. However it is not trivial to go beyond generic intuitions, such as the expectation that natural theories generate large deviations, and make precise statements. In this talk I will show in a model independent way that measuring deviations at the LHC implies the existence of new bosons between a few TeV and a few hundred TeV. This is true in general, including theories where new fermions produce the deviations.
206. HET/RIKEN Seminar
"Probing Charm-Yukawa at LHC, Status and Prospects"
Presented by Kohsaku Tobioka, Weizmann Institute/Tel Aviv University
Wednesday, July 29, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
207. RIKEN Lunch Seminar
"One-Flavor QCD and the Dirac Spectrum at $\theta=0$"
Presented by Jacobus Verbaarschot, Stony Brook University
Thursday, June 25, 2015, 12:30 pm
Building 510 Room 2-160
Hosted by: Daniel Pitonyak
The chiral condensate of one-flavor QCD is continuous when the quark mass crosses zero. In the sector of fixed topological charge though, the chiral condensate becomes discontinuous at zero mass in the the thermodynamical limit. To reconcile these contradictory observations, we have evaluated the spectral density of the Dirac operator in the epsilon domain of one-flavor QCD. In this domain, we have obtained exact analytical expressions which show that the spectral density at $\theta = 0$ becomes a strongly oscillating function for negative quark mass with an amplitude that increases exponentially with the volume. As is the case for QCD at nonzero chemical potential, these strong oscillations invalidate the Banks-Casher formula and result in a chiral condensate that is continuous as a function of the quark mass. An additional subtlety is the effect of the topological zero modes which will be discussed as well.
208. HET Seminar
"Inclusive and Exclusive b->sll: Status, Prospects and Lepton Non-universality"
Presented by Enrico Lunghi, Indiana
Wednesday, June 17, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
209. HET/RIKEN Lunch Seminar
"Light Inflaton â€" hunting for it from CMB through the Dark Matter and down to the colliders"
Presented by Fedor Bezrukov, RBRC/U Conn
Friday, June 12, 2015, 12 pm
Building 510 Room 2-95
Hosted by: Amarjit Soni
210. HET/RIKEN seminar
"New physics in b—>s transitions after LHC run 1"
Presented by Wolfgang Altmannshofer, Perimeter Institute
Wednesday, June 10, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
I will discuss interpretations of the recent updated angular analysis of the B->K*mu+mu- decay by the LHCb collaboration. A global fit to all relevant measurements probing the flavor changing neutral current b->s mu mu transition shows tensions with Standard Model expectations. Assuming hadronic uncertainties are estimated in a sufficiently conservative way, I will discuss the implications of the experimental results on new physics, both model independently as well as in the context of models with flavor changing Z' bosons.
211. HET/RIKEN Seminar
"Cascade Decays of a Leptophobic Boson"
Presented by Bogdan Dobrescu, Fermilab
Wednesday, June 3, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
212. HET/ATLAS JOINT LUNCH SEMINAR
"Search for new light gauge bosons in Higgs boson decays to four-lepton final states in pp collisions at sqrt(s) = 8 TeV with the ATLAS detector at the LHC"
Presented by Ketevi Assamagan, BNL
Friday, May 29, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
"A search for Higgs bosons decays to four leptons via one or two light exotic vector bosons, Zdark, H -> Z Zdark -> 4l and H -> Zdark Zdark -> 4l (l=electron or muon), is presented. The search is performed using proton-proton collision data corresponding to an integrated luminosity of about 20/fb at the center-of-mass energy of 8 TeV recorded with the ATLAS detector at the Large Hadron Collider. The observed data are well described by the Standard Model prediction. Upper bounds at 95% confidence level are set on the relative branching ratios BR(H -> ZZdark -> 4l to BR(H -> 4l for the exotic vector boson masses between 15 and 55 GeV, and on BR(H -> Zdark Zdark -> 4l to BR(H -> ZZ^* -> 4l for the exotic vector boson masses between 15 and 60 GeV. The results are interpreted in benchmark models where a dark gauge symmetry is mediated by a dark vector boson."
213. HET/RIKEN seminar
"Colorless Top Partners and Naturalness"
Presented by Gustavo Burdman, IAS/University of São Paulo
Wednesday, May 13, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: CheinYi Chen
214. HET / Riken Lunch Seminar
"Stealth Composite Dark Matter"
Friday, May 8, 2015, 12 pm
Building 510 Room 2-95
Hosted by: Amarjit Soni
215. HET Lunch Seminar
"Flavor in the Randall-Sundrum Model: A New Idea"
Presented by Michael Geller, Technion
Friday, May 1, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
216. HET/RIKEN seminar
"Higgs as a Lamp Post of New Physics"
Presented by JiJi Fan, Syracuse
Wednesday, April 29, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
217. HET/BNL Lunch Time Talk
"Natural Standard Model Alignment in the Two Higgs Doublet Model"
Presented by Bhupal Dev, Manchester
Friday, April 24, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
The current LHC Higgs data provide strong constraints on possible deviations of the couplings of the observed 125 GeV Higgs boson from the Standard Model (SM) expectations. Therefore, it now becomes compelling that any extended Higgs sector should comply with the so-called SM alignment limit. In the context of the Two Higgs Doublet Model (2HDM), this alignment is often associated with either decoupling of the heavy Higgs sector or accidental cancellations in the 2HDM potential. Here we present a new solution realizing natural alignment based on symmetries, without decoupling or fine-tuning. In particular, we show that in 2HDMs where both Higgs doublets acquire vacuum expectation values, there exist only three different symmetry realizations leading to natural alignment. We also discuss some interesting LHC phenomenology of the heavy Higgs sector in the alignment limit.
218. HET Lunch Seminar
"Light mediator to dark matter: models and signatures"
Presented by Yue Zhang, Caltech
Friday, April 17, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
219. HET Lunch Seminar
"Improving the Extraction of CKM \gamma from B\to DK"
Presented by Michael Savastio, Cornell
Friday, April 10, 2015, 12 pm
Building 510 Room 2-95
Hosted by: Amarjit Soni
220. HET/RIKEN seminar
Presented by Tongyan Lin, University of Chicago
Wednesday, April 8, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
221. HET/RIKEN Seminar
"A Global Approach to Top-quark FCNCs"
Presented by Gauthier Durieux, Cornell University
Wednesday, April 1, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
222. HET/BNL Lunch Time Talk
"Progress towards the first principles lattice calculation of epsilon-prime"
Presented by Chris Kelly, RBRC
Friday, March 27, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
223. HET/RIKEN seminar
"Flavored Dark Matter with Weak Scale Mediators"
Presented by Can Kilic, The University of Texas, Austin
Wednesday, March 25, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
All matter in the Standard Model appears in three generations, with an intricate flavor structure the origin of which is not well understood. This motivates the question whether distinct phenomenological features arise if dark matter (DM) also has a non-trivial flavor structure. In this talk I will review the experimental signatures of this scenario. In the case of lepton-flavored DM, I will argue that the generation of a lepton asymmetry at a high energy scale can also produce a DM asymmetry, which can strongly affect the sensitivity of direct detection experiments, and I will present novel signatures that can appear at colliders and in indirect detection experiments. I will also review the case of top quark-flavored DM with a distinct collider phenomenology including final states of top pairs and missing energy as well the possibility of displaced decays.
224. HET/RIKEN seminar
"Spontaneous CP violation and the strong CP problem"
Presented by Luca Vecchi, University of Maryland
Wednesday, March 18, 2015, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Chien-Yi Chen
225. HET/RIKEN Seminar
"The Galactic Center Gamma-ray Excess: Have We Started to See Dark Matter"
Presented by Samuel McDermott, Stony Brook University
Wednesday, March 4, 2015, 2 pm
Building 510 SSR
Hosted by: Sally Dawson
226. HET/BNL Lunch Time Talk
"Primordial non-Gaussianity is a crucial probe of inflationary physics"
Presented by Anze Slosar, BNL
Friday, February 27, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
227. HET/BNL Lunch Time Talk
"Custodial SUSY Triplets"
Presented by Tien-Tien Yu, YITP
Friday, February 20, 2015, 12 pm
Building 510 Room 2-160
Hosted by: Amarjit Soni
228. HET/BNL Lunch Time Talk
"SM EFT at NLO accuracy automated"
Presented by Cen Zhang, BNL
Friday, February 13, 2015, 12 pm
Building 510 Room 2-95
Hosted by: Amarjit Soni
229. Biosciences Department Seminar
"Synthetic Approaches to Gene Expression Control: From Yeast to Cancer"
Presented by Gabor Balazsi, Laufer Center for Physical & Quantitative Biology, Stony Brook University
Friday, June 20, 2014, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: John Shanklin
Genes are templates for protein synthesis. Proteins determine how cells behave. Therefore, to control cells, we should alter protein levels. This is possible by utilizing small artificial regulatory networks called gene expression systems, which consist of a transcription factor gene that alters the protein-producing capacity of other genes. Gene expression systems have been used widely, but without considering the stochasticity of reactions involving gene products. Stochasticity can cause drastic protein level differences from cell to cell, implying that individual cells may not uniformly obey control signals. To address this problem, we have modified existing gene expression systems to control not only the average, but also the variability of protein levels in yeast cells. Further, we have identified a series of steps to move gene expression systems into mammalian cells. Such engineered gene circuits can improve protein level tuning, enhancing our understanding of protein function and enabling future practical applications.
230. Instrumentation Division Seminar
Presented by Merlin Fisher-Levine
Wednesday, June 4, 2014, 2:30 pm
Large Conference Room, Bldg. 535
Diamond is a material of many superlatives: it is both the hardest and most thermally conductive known material, as well as being the most intrinsically radiation hard. Diamond also exhibits some of the most extreme semiconductor properties found in any material, and the combination of many of these properties makes it uniquely well suited for radiation detection applications. The success of diamond has, however, been hindered by the difficulty of synthesising large, good quality crystals. In this talk I will present an introduction to the use of diamond for radiation detection, followed by work performed on the characterisation of the quality of modern CVD grown diamond, and on the development of a fast, low noise, charge sensitive amplifier designed and built to exploit diamond's properties for high rate spectroscopic applications.
231. BSA Distinguished Lecture
"Life Redesigned: The Emergence of Synthetic Biology"
Presented by Professor James Collins, Howard Hughes Medical Institute, Boston University, Harvard University
Wednesday, April 30, 2014, 4 pm
Berkner Hall Auditorium
Hosted by: Peter Wanderer
From cheaper drugs and rapid diagnostic tests to targeted therapies that attack antibiotic-resistant "superbugs," synthetic biology will change lives in years to come. Engineers, physicists, and biologists in this growing field are making such advancements possible using proteins, genes, and other bits of DNA to rewire and reprogram organisms with biological circuits similar to electronic networks. During his talk, Collins will highlight recent efforts to create synthetic gene networks and programmable cells. He will also discuss a variety of synthetic biology applications for computing, technology, and medicine.
232. HET Lunch Seminar
"TOP PARTNERS, FERMION MASS MATRICES AND HIGGS BOSON PRODUCTION"
Presented by Elisabetta Furlan, Brookhaven National Laboratory
Friday, April 27, 2012, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
233. HET Lunch Seminar
"The four dimensional helicity scheme beyond one loop"
Presented by Bill Kilgore, Brookhaven National Laboratory
Friday, April 20, 2012, 12:45 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
234. Joint HET/RIKEN/YITP Seminar
"A novel phase in SU(3) gauge theory with many light fermions"
Presented by Anna Hasenfratz, University of Colorado at Boulder
Wednesday, April 18, 2012, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christoph Lehner
In this talk I will discuss the results of our recent study of the phase structure of SU(3) lattice gauge theory with $N_f = 12$ and 8 staggered fermions in the fundamental representation. For small fermion masses we found two bulk phase transitions at strong gauge couplings. The phase between the two transitions appears to be a novel phase that breaks the single site shift symmetry of staggered fermions. The eigenvalue spectrum of the Dirac operator, the static potential and the meson spectrum collectively establish that this novel phase is confining but chirally symmetric. The phase is bordered by first-order phase transitions, and since we find the same phase structure with $N_f = 8$ fermions, it is most likely that this novel phase is a strong-coupling lattice artifact, the existence of which does not imply IR conformality. (ArXiv:1111:2317)
235. Chemistry Department Seminar
"Comparing the Primary Electron Transfer Process in Photosynthetic Reaction"
Presented by Garry Rumbles, National Renewable Energy Laboratory (NREL), Golden, Colorado,
Friday, April 6, 2012, 11 am
Room 300, Chemistry Bldg. 555
Hosted by: John Miller
This presentation will focus on some of the fundamental science associated with the rapidly emerging field of organic photovoltaics (OPV). It will include a discussion of how the OPV field is evolving, examine some of the fundamental scientific issues that underpin the subject, and will discuss how spectroscopy can help to understand these issues. The goal is to enable both a better understanding of how these systems function and consequently help to advance solar energy conversion efficiencies of future OPV devices. So-called organic photovoltaic devices have seen certified power conversion efficiencies increase from 2.5% in 2001 to ~9% in 2011. Close inspection of the strategies employed to realize this impressive improvement in performance reveal a common approach of synthesizing new donor polymers, fullerene acceptors and, in some cases, new device architectures. It is questionable as to whether this approach will result in a similar four-fold level of improvement over the next ten years. And it is the answer to this question that motivates the work that will be described. At the heart of all OPV devices is the donor-acceptor interface, where photogenerated excitons are dissociated into separated charge carriers. Using flash photolysis, timeresolved microwave conductivity (fp-TRMC) as a tool for detecting mobile carriers, a number of recently-studied systems will be described. This particular presentation will focus on systems that contain new conjugated polymers and novel derivatives of fullerenes. These studies will serve to highlight a fundamental issue that we have yet to fully understand: how are these carriers created with such efficiency and yield, and in a system that does not immediately suggest that this is possible? The talk will include a speculative discussion about how we might better understand this process by looking at the function of Nature’s photosynthetic reaction centers.
236. HET Lunch Seminar
"Application of lattice QCD+QED simulations and error reduction techniques"
Presented by Taku Izubuchi, Brookhaven National Laboratory
Friday, March 30, 2012, 12 pm
Building 510 / Room 2-95
Hosted by: Amarjit Soni
237. HET Lunch Seminar
"Direct Detection of Sub-GeV Dark Matter"
Presented by Rouven Essig, Stony Brook University
Friday, March 9, 2012, 12 pm
Building 510 / Room 2-95
Hosted by: Amarjit Soni
238. Joint HET/RIKEN Seminar
"Lattice vs. Technicolor"
Presented by Tom DeGrand, University of Colorado at Boulder
Wednesday, February 22, 2012, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christoph Lehner
239. HET Lunch Seminar
"Nucleon strange content from Lattice QCD"
Presented by Chulwoo Jung, Brookhaven National Laboratory
Friday, February 17, 2012, 12 pm
Building 510 / Room 2-160
Hosted by: A. Soni
240. HET Lunch Seminar
"TBA"
Presented by David Curtin, YITP of Stony Brook
Friday, January 27, 2012, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
241. HET/RIKEN Lunch Seminar
"More on lattice chiral symmetry and minimal doubling"
Presented by Mike Creutz, Brookhaven National Laboratory
Friday, January 20, 2012, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
242. Joint HET/RIKEN Seminar
"Nonperturbative QCD vacuum polarization corrections"
Presented by Dru Renner, Jefferson Laboratory
Wednesday, January 18, 2012, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christoph Lehner
243. Biology Department Seminar
"Synthetic Biology: Putting Synthesis into Biology"
Presented by Huimin Zhao, Departments of Chemical and Biomolecular Engineering, Chemistry, and Biochemistry, Bioengineering, Institute for Genomic Biology, and Center for Biophysics and Computational Biology, University of Illinois at Urbana-Champaign, Urbana, IL
Friday, January 13, 2012, 10:30 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Reinhold Mann/John Shanklin
Synthetic biology is the deliberate design of novel biological systems and organisms that draws on principles elucidated by biologists, chemists, physicists, and engineers. It is a rapidly growing area with broad applications in medical, chemical, food, and agricultural industries. In this talk, I will discuss our recent work on the development and application of new synthetic biology tools. Specifically, I will discuss a new tool for rapid construction of large DNA molecules such as pathways and plasmids and its application in (1) discovery, characterization, and engineering of novel natural product biosynthetic pathways for drug discovery and development and (2) engineering of recombinant yeast strains that can efficiently utilize lignocellulose raw materials to produce biofuels and chemicals. In addition, I will discuss a new bioprocess for synthesis of xylitol, one of DOE’s top 12 platform chemicals for biorefinery. http://www.chemistry.illinois.edu/faculty/Huimin_Zhao.html
244. HET Lunch Seminar
"TBA"
Presented by Bill Marciano, Brookhaven National Laboratory
Friday, December 9, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
245. Joint HET/RIKEN/YITP Seminar
"Hybrid Monte Carlo simulation of graphene"
Presented by Claudio Rebbi, Boston University
Wednesday, December 7, 2011, 2 pm
Building 510 / Room 2-84
Hosted by: Christoph Lehner
I will briefly review the Hamiltonian of the graphene system and show how the partition function and Green's functions for the quadratic Hamiltonian can be expressed in path integral form by using fermion coherent states. I will then show how one can incorporate the Coulomb interaction into the path integral and how this can be simulated with the hybrid Monte Carlo technique. I will present then early results for the Green's functions obtained with this method. (Based on research done in collaboration with Richard Brower and David Schaich.)
246. Condensed-Matter Physics & Materials Science Seminar
"Imaging and Electric Control of Boundary Magnetization in Chromia and Chromia-based Exchange Bias Heterostructures"
Presented by Xi He, University of Nebraska
Tuesday, December 6, 2011, 11 am
Bldg. 480 conference room
Hosted by: Ivan Bozovic
Controlling magnetism and information encoded in magnetic bits has been playing a vital role in information technology. Controlling magnetism via voltage other than current is the key to reduce power consumption while enhancing processing speed, integration density and functionality in comparison with present-day complementary metal-oxide-semiconductor electronics technology. Promising spintronic device concepts utilize the electric control of interface and surface magnetization. Symmetry arguments require the magnetoelectric antiferromagnet Cr2O3 (0001) has a surface magnetization which is coupled with the bulk antiferromagnetic order parameter. Macroscopic evidences from integral methods include magneto optical Kerr and superconducting quantum device magnetometry, spin-polarized photoemission spectroscopy, and first-principles calculations [1]. Moreover, microscopic spatial resolved evidences of electrically controlled magnetization domains are observed by magnetic force microscopy and photoemission electron microscopy combined with X-ray magnetic circular dichroism contrast [2]. This unique surface magnetization is coupled to the bulk antiferromagnetic domain state. Therefor reversing the electric field while maintaining a permanent magnetic field switches the bulk antiferromagnetic domain state thus reverses the surface magnetization coupled to it. Using a perpendicular ferromagnetic Pd/Co multilayer deposited on the (0001) surface of a Cr2O3 single crystal to form a Cr2O3 based exchange bias heterostructure, this unique electrically controlled surface magnetization functions as the pinning layer. By electrically controlling the pinning layer, we achieve reversible, isothermal electrically switching of the exchange-bias field between positive and negative values at room temperature [1]. This approach offers a promising new route to voltage-controlled spintronic devices, such as non-volatile magnetoelectric memory, which may be viewed as an alternative to other a
247. HET Lunch Seminar
"Improving Collider Searches with Effective Field Theory"
Presented by Nicholas Dunn, UC Berkeley
Friday, December 2, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
Recent results from the LHC suggest that new physics will not be found in obvious search channels. One possibility is that any new physics will be found beneath a large QCD background. In this talk, I will discuss how effective field theory methods, specifically SCET, can be used to improve our understanding of backgrounds at the LHC. I will present new methods for both event generation using Monte Carlo and analytical techniques.
248. Joint HET/ATLAS Lunch Seminar
"Combined ATLAS+CMS Standard Model Higgs boson searches with up to 2.3 fb-1 of pp collision data at 7 TeV at the LHC"
Presented by Ketevi Assamagan, Brookhaven National Laboratory
Friday, November 18, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
249. HET/RIKEN Lunch Seminar
"Conformal Fixed Point of SU(3) Gauge Theory with 12 Fundamental Fermions in the Twisted Polyakov Loop Scheme"
Presented by Eigo Shintani, RBRC
Friday, November 4, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
250. HET Lunch Seminar
"Fermion masses and Higgs cross sections"
Presented by Sally Dawson, Brookhaven National Laboratory
Friday, October 28, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
251. Center for Functional Nanomaterials Seminar
"Can We Apply the Notions of Band-offset, Potential Well and Barrier to Nanoscale Heterostructures?"
Presented by Christoph Delerue, Centre National de la Recherche Scientifique, Lille, France
Thursday, October 13, 2011, 11 am
Bldg. 735 - Conf Rm B
Hosted by: Mark Hybertsen
Epitaxially-grown semiconductor heterostructures give the possibility to tailor the potential landscape for the carriers in a very controlled way. In planar lattice-matched heterostructures, the potential has indeed a very simple and easily predictable behavior: it is constant everywhere except at the interfaces where there is a step (discontinuity) which only depends on the composition of the semiconductors in contact. In this presentation, we show that this universally accepted picture can be invalid in nanoscale heterostructures (e.g., quantum dots, rods, nanowires) which can be presently fabricated in a large variety of forms. Self-consistent tight-binding calculations applied to systems containing up to 75000 atoms indeed demonstrate that the potential may have a more complex behavior in axial hetero-nanostructures: The band edges can show significant variations far from the interfaces if the nanostructures are not capped with a homogeneous shell. These results suggest new strategies to engineer the electronic properties of nanoscale objects, e.g. for sensors and photovoltaics. Y.M. Niquet and C. Delerue, Phys. Rev. B 84, 075478 (2011).
252. HET Lunch Seminar
"Variations on Some Familiar Themes Regarding EWSB"
Presented by Hooman Davoudiasl, Brookhaven National Laboratory
Friday, October 7, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
253. Joint HET/RIKEN/YITP Seminar
"Searching for (Nearly) Conformal Dynamics on the Lattice"
Presented by Ethan T. Neil, Fermilab
Wednesday, October 5, 2011, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Christoph Lehner
254. HET Lunch Seminar
"Strong Yukawa models on the lattice"
Presented by David Lin, NCTS, Taiwan
Friday, September 30, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
255. Condensed-Matter Physics & Materials Science Seminar
"Symmetry breaking and high-mobility transport in graphene-based heterostructures"
Presented by Cory Dean, Columbia University
Tuesday, September 27, 2011, 11 am
Bldg. 480 conference room
Hosted by: Ivan Bozovic
A continuing challenge in the study of graphene remains fabrication of ultra-high mobility devices so that electronic behaviour in this novel material can be studied in the clean limit. In my talk I will discuss our recent experimental advancement in fabricating very-high quality graphene devices on boron nitride. Magnetoresistance measurements under large applied fields will be presented including our observation of the fractional quantum Hall effect in multi-terminal devices over a broad range of carrier densities. Symmetry breaking and evidence for spontaneous quantum Hall ferromagnetism in the degenerate integer quantum Hall states, in both single and bilayer graphene, will be presented. Finally, I will review our ongoing effort to study correlated electron behaviour in multi-layered graphene/BN heterostructures.
256. Joint HET/ATLAS Lunch Seminar
Presented by George Redlinger, Brookhaven National Laboratory
Friday, September 23, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
257. National Synchrotron Light Source Seminar
"High Resolution Soft X-Ray RIXS in Quasi One-Dimensional Cuprates and Oxide Heterostructures"
Presented by Thorsten Schmitt, Paul Scherrer Institut, CH-5232 Villigen PSI, Switzerland
Wednesday, August 10, 2011, 9:30 am
Seminar Room, Bldg. 725
Resonant inelastic X-ray scattering (RIXS) is a powerful bulk-sensitive photon-in/photon-out spectroscopic probe of the electronic structure with atomic and orbital sensitivity. It is an ideal method for studying excitations from the electronic ground state in correlated transition metal oxides, being directly sensitive to charge-, orbital- and spin-degrees of freedom. Ultra-high resolution instrumentation for RIXS is available at the ADvanced RESonant Spectroscopies (ADRESS) beamline of the Swiss Light Source at the Paul Scherrer Institut, being optimized for soft X-rays with variable polarization between 0.4 and 1.8 keV [1]. The SAXES (Super Advanced X-ray Emission Spectrograph) RIXS spectrometer of the ADRESS beamline has a resolving power of ca. 12000 for 1 keV. It allows varying the scattering geometry between incident and inelastically scattered X-rays in order to study low-energy excitations as a function of momentum transfer. In this talk I will give an overview on high-resolution and momentum dependent RIXS studies of magnetic and electronic excitations in quasi one-dimensional cuprate and oxide hetersotructure systems Sr2CuO3 is a quasi one-dimensional corner-sharing single-chain compound possessing the nearly ideal properties of the one-dimensional antiferromagnetic Heisenberg spin-1/2 model. The momentum transfer dispersion of the Cu L3-RIXS signal in Sr2CuO3 along the chain direction reveals that the main spectral weight follows the lower onset of the two-spinon (and higher order) continuum and probes the dynamical spin structure factor. Numerical calculations within the Bethe Ansatz allow a detailed line shape analysis of the RIXS response. The modes within the orbital excitation energy range show that the dd excitations in Sr2CuO3 are momentum dispersive and can be associated with orbitons, i.e. dispersive excitations mediated by the superexchange interactions. A spin-orbital superexchange model reproduces this orbiton dispersion and explains the lar
258. HET/RIKEN Lunch Seminar
"Detecting Fourth Generation Heavy Quarks at the LHC"
Presented by David Atwood, Iowa State University
Friday, August 5, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
259. HET Lunch Seminar
"SUSY QCD Corrections to Higgs-b Production"
Presented by Prerit Jaiswal, Brookhaven National Laboratory
Friday, July 29, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
260. HET/RIKEN Lunch Seminar
""Chiral Polarization Properties of QCD Dirac Eigenmodes""
Presented by Ivan Horvath, Kentucky
Friday, July 8, 2011, 12 pm
Building 510 / Room 2-95
Hosted by: A. Soni
261. HET/RIKEN Lunch Seminar
"TBA"
Presented by Eigo Shintani, RBRC
Friday, July 1, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
262. HET/ATLAS Joint Lunch Seminar
"Searches for new physics using leptons and jets at the Tevatron and LHC"
Friday, May 13, 2011, 12 pm
Building 510 / Room 2-95
Hosted by: Amarjit Soni
263. HET Lunch Seminar
"Four Generations, Higgs Physics and the MSSM"
Presented by Prerit Jaiswal, BNL/YITP
Friday, April 22, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: Amarjit Soni
264. HET/RIKEN Lunch Seminar
"Generic dark matter signature for gamma-ray telescopes"
Presented by Wai-Yee Keung, University of Illinois, Chicago
Friday, March 25, 2011, 12 pm
Building 510 / Room 2-160
Hosted by: A. Soni
We describe a characteristic signature of dark matter (DM) annihilation or decay into gamma-rays. We show that if the total angular momentum of the initial DM particle(s) vanishes, and helicity suppression operates to prevent annihilation/decay into light fermion pairs, then the amplitude for the dominant 3-body final state e+e- gamma has a unique form dictated by gauge invariance. This amplitude and the corresponding energy spectra hold for annihilation of DM Majorana fermions or self-conjugate scalars, and for decay of DM scalars, thus encompassing a variety of possibilities. Within this scenario, we analyze Fermi LAT, PAMELA and HESS data, and predict a hint in future Fermi gamma-ray data that portends a striking signal at atmospheric Cherenkov telescopes (ACTs).
265. Joint HET/RIKEN/YITP Seminar
"String Theory and the Real World"
Presented by Herman Verlinde, Princeton University
Wednesday, March 9, 2011, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
266. Biology Department Seminar
"Aminoacyl-tRNA Synthetases: Possible Origins and Molecular Mechanisms Leading to the Evolution of Enhanced Catalytic Activity, Specificity, and Allostery"
Presented by Charles Carter, Jr., Department of Biochemistry and Biophysics, University of North Carolina, Chapel Hill
Monday, March 7, 2011, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Bob Sweet
The genetic code is translated by two distinct families of aminoacyl-tRNA synthetases (aaRS), whose role is to accelerate two different chemical reactions: activation of the amino acid carboxyl group at the expense of ATP and transfer of the activated acyl group to the 3’ terminus of the cognate tRNA. Although interest in the synthetase field centers mainly on the second of these reactions, we are preoccupied by the first, because in the absence of catalysts the uncatalyzed rate of amino acid activation is 4-5 orders of magnitude slower than that of acyl transfer. Amino acid activation is therefore the defining kinetic barrier in protein synthesis. We propose that by providing this catalytic activity, primordial aaRS could have launched ribosomal protein synthesis and hence natural selection (1,2). We are developing new methods in order to identify and manipulate models for the ancestral synthetases from both classes (2-4). We have observed that conserved sequences previously thought essential for catalytic activity can be deleted without abolishing activity. In this lecture, I’ll describe an extensive series of active fragments containing the active sites of both tryptophanyl- (Class I) and histidyl- (Class II) tRNA synthetases (2,5), among which the smallest contain only 46 residues. These results enable us to examine possible evolutionary pathways leading to enhanced catalytic activity (3), specificity (2), and allosteric function (6,7). References: 1. Carter, C. W., Jr., and Duax, W. L. (2002) Molec. Cell 10, 705-8. 2. Pham, Y., et al. (2007) Molec. Cell 25, 851-62. 3. Pham, Y., et al. (2010) J. Biol. Chem. 285. 4. Li, L., et al. (2011) J. Biol. Chem., Published online. 5. Rodin, A., et al. (2009) J. Molec. Evolution 69, 555-67. 6. Weinreb, V., et al. (2009) Structure 17, 952-64. 7. Cammer, S., and Carter, C. W., Jr. (2010) Bioinformatics 26, 709-14.
267. Chemistry Department Seminar
"Combining reaction kinetics, spectroscopy and DFT calculations for mechanistic studies in heterogeneous catalysis"
Presented by Prof. Simon Podkolzin, Dept. of Chemistry Engineering & Materials Science, Stevens Institute of Technology, Hoboken, NJ
Wednesday, February 16, 2011, 11 am
Room 300 - Chemistry Bldg. 555
Hosted by: Dario Stacchiola
268. Joint HET/RIKEN/YITP Seminar
"TBA"
Friday, January 28, 2011, 12 pm
Building 510 Room 2-160
TBA
269. Joint HET/BNL- ATLAS Seminar
"SUSY as a model independent search tool for experimentalists"
Presented by Patrick Meade, Stony Brook
Thursday, January 13, 2011, 11 am
Small Seminar Room, Bldg. 510
270. Joint HET/BNL- ATLAS Seminar
"The case for new physics: A BSM overview for LHC experimentalists"
Presented by Patrick Meade, Stony Brook
Tuesday, January 11, 2011, 11 am
Building 510A Room 2-160
271. HET Lunch Seminar
"Lattice QCD inputs to the CKM unitarity triangle analysis."
Presented by Ruth van der Water, BNL
Friday, December 17, 2010, 12 pm
Bldg 510, Room 2-160
272. HET Lunch Seminar
Presented by Bill Kilgore, BNL
Friday, December 10, 2010, 12 pm
Room 2-95
Hosted by: A. Soni
273. Biology Department Seminar
"Copying and Reprogramming of Heterochromatin with RNA Interference"
Presented by Rob Martienssen, Watson School of Biological Sciences, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
Friday, December 10, 2010, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: John Shanklin
Heterochromatin is composed of transposable elements (TE) and related repeats which silence genes located nearby, and play a major role in epigenetic regulation of the genome. Far from being inert, heterochromatin is transcribed and small interfering RNA corresponding to heterochromatic sequences can be detected in plants, animals and fission yeast. Recently, we have proposed a role for heterochromatin in reprogramming events that occur in plant reproductive cells, as well as in the embryo and endosperm after fertilization. 21nt epigenetically activated small interfering RNA (easiRNA) from transposable elements accumulate in cultured cells and in pollen, and are translocated from the surrounding pollen grain into the sperm, while in the maturing seed 24nt siRNA are primarily maternal in origin. Thus maternal and paternal genomes likely contribute differing small RNA to the zygote and to the endosperm. If transposable elements in the seed are not targeted by small RNA from the pollen, or vice versa, this could lead to hybrid seed failure, in a mechanism reminiscent of hybrid dysgenesis. Unexpectedly, mutants in the easiRNA pathway lead to specification of diploid functional megaspores from somatic cells in the ovule, reminiscent of apospory in other species. Thus heterochromatin reprogramming may play a role in apomixis, and may utilize a similar mechanism. In fission yeast and in Arabidopsis, centromeric repeats are transcribed, but the transcripts are rapidly turned over by RNA interference, through the combined action of DNA dependent RNA polymerase, Argonaute and RNA dependent RNA polymerase, each of which is associated with heterochromatin. Histone H3 lysine-9 dimethylation (H3K9me2) depends on RNAi, mediated by the Rik1-Clr4 complex. We have found that heterochromatin is lost transiently during chromosomal replication, allowing heterochromatic transcripts to accumulate. Rapid processing of these transcripts into small RNA during S phase promotes restoration of
274. Center for Functional Nanomaterials Seminar
"Ga-assisted MBE grown GaAs nanowires and related quantum heterostructures for solar applications"
Presented by Anna Fontcuberta-Morral, Laboratoire des Matériaux Semiconducteurs, Institute of Materials, Ecole Polytechnique, Switzerland
Friday, December 3, 2010, 11 am
Bldg 735, CFN Conference Room B
Hosted by: Peter and Eli Sutter
Nanowires represent model systems for studying a variety of low dimensional phenomena as well as building blocks for the future generation of nanoscale devices. The most exploited nanowire growth technique is the vapor-liquid-solid (VLS) method, which very often employs gold as a seed for the growth. We present the method for growing GaAs nanowires by MBE without using gold as a catalyst. Along these lines, we will show how Molecular beam epitaxy offers a unique possibility for obtaining high purity and high quality materials. Additionally, it gives a great flexibility for the fabrication of many types of nanowire heterostructures. We will present here how radial and axial heterostructures can be obtained and how this combination can be beneficial for application in third generation solar cell designs. The optical and transport properties will be elucidated by means of luminescence, Raman spectroscopy and microscopy experiments realized on the same single nanowire. Finally, the results are then applied to the realization of nanowire-based solar cells. The future of this research area will be briefly discussed.
275. HET Lunch Seminar
"TBA"
Presented by Oliver Witzel, BNL
Friday, November 19, 2010, 12 pm
Building 510A Room 2-160
276. Condensed-Matter Physics & Materials Science Seminar
": Electronic Compressibility and Magnetization of LaAlO3/SrTiO3 Heterostructure Interface"
Presented by Lu Li, MIT
Monday, November 15, 2010, 1 pm
Small Seminar Room, Bldg. 510
Hosted by: Ivan Bozovic
The LaAlO3/SrTiO3 heterostructure is a potential candidate for a high mobility two-dimensional electron system with novel electronic and magnetic properties. Though LaAlO3 and SrTiO3 are both large-gap band insulators, the interface is conductive, and even superconducting below 200 mK. In this talk, we describe surprising results from two thermodynamic measurements of this electronic system - the electronic compressibility and the magnetization. First, the electronic compressibility is measured with capacitance spectroscopy. For some devices, we observed a greater than 40% enhancement of the gate capacitance at low carrier densities. At the same densities, electric field penetration measurements show that the oxide interface significantly overscreens applied electric fields. Both measurements imply a negative electronic compressibility of the oxide interface system. Second, the magnetic moment of the interface system is detected directly using torque magnetometry. Control experiments with samples without LaAlO3 display a background signal two orders of magnitude smaller, which verifies the observed magnetic moment arising from the deposition of LaAlO3. The measured equilibrium M-H curve resembles that of a soft ferromagnet. The observed spontaneous magnetic moment is in-plane, and exists even in the superconducting state. Finally, the observation of the negative compressibility supports the two-dimensionality of the electronic system, whereas the measured M-H behavior implies a magnetic ordering at the interface. These two thermodynamic measurements suggest the existence of a two-dimensional magnetic state.
277. HET Lunch Seminar
"Higgs Physics in Warped Extra Dimensions"
Presented by Florian Goertz, University of Mainz, Germany
Friday, November 12, 2010, 12 pm
Room 2-95 Building 510A
278. Center for Functional Nanomaterials Seminar
"Electronic reconstructions in hybrid C/BN heterostructures"
Presented by Jose Miguel Pruneda, Consejo Superior de Investigaciones Cientificas, Spain
Tuesday, November 9, 2010, 1:30 pm
Bldg. 735 - Conf Rm A
Hosted by: Qin Wu
Studies of hybrid C/BN heterostructures have experienced a considerable thrust after the spectacular rise of graphene and its applications, and the recent fabrication of BN monolayers(1). Synthesis of C/BN nanotubes(2) and nanosheets(3) have already been reported. These hybrid nanostructures offer a unique route for material engineering, by combination of the exciting properties of graphene with those of insulating polar BN. Here, I will present first principles (DFT) calculations of the zigzag-terminated interfaces between C and BN nanodomains, proving that unconventional physical effects similar to those observed at insulating oxide interfaces(4), can also exist in lower dimensions, opening alternative routes for tuning electronic properties at nanointerfaces. It will be shown that the magnetic character of the edge states in zigzag shaped graphene nanoribbons, and the polar BN edge, team up to give a spin asymmetric screening that induces half-semimetallicity at the interface, with a gap of a few tenths of eV for one spin orientation, and a tiny gap of hundredths of eV for the other(5). This effect is also observed in tubular geometries, as long as the interface is zigzag-edged. References: (1) Pacile et. al. Appl. Phys. Lett. 2008, 92, 133107; Jin et. al. Phys. Rev. Lett. 2009, 102, 195505. (2) Suenaga et. al. Science 1997, 278, 5338; Enouz et. al. Nano Lett. 2007, 7, 1856. (3) Ci et. al. Nat. Materials 2010, 9, 430. (4) Ohtomo & Hwang Nature 2004, 427, 423; Brinkman et. al. Nat. Mater. 2007, 6, 493; Reyren et. al. Science 2007, 317, 5842. (5) Pruneda Phys. Rev. B 2010, 81, 161409(R)
279. Joint HET/RIKEN/YITP Seminar
"TBA"
Presented by Walter Goldberger, Yale
Wednesday, October 20, 2010, 2 pm
Small Seminar Room, Bldg. 510
TBA
280. HET/RIKEN Seminar
"Improving and Expanding Searches for TeV-Scale Z' Bosons Decaying to WW and Zh"
Presented by Brock Tweedie, Boston University
Thursday, October 14, 2010, 12:30 pm
Bldg. 510, Room 2-160
Hosted by: Anthony Baltz
281. Joint HET/RIKEN/YITP Seminar
"BSM theory review of solutions to the Top quark forward-backward asymmetry anomaly at Tevatron"
Presented by Kai Wang, IPMU, The University of Tokyo
Wednesday, September 22, 2010, 2 pm
Small Seminar Room, Bldg. 510
TBA
282. Joint HET/RIKEN Lunch Seminar
"Nucleon physics on the lattice"
Presented by Meifeng Lin Lin, Yale University
Thursday, August 19, 2010, 12:30 pm
Building 510A Room 2-160
283. Atmospheric Sciences Division Seminar
"The Role of Organics in Homogeneous and Heterogeneous Ice Nucleation: Anthropogenic, HULIS, Biomass Burning, and Marine Biological Particles"
Presented by Daniel A. Knopf, SUNY Stony Brook
Friday, July 23, 2010, 11 am
Bldg 815E
Hosted by: Arthur Sedlacek
Aerosols can affect the radiative properties of clouds by acting as cloud condensation nuclei or ice nuclei (IN). Ice particles impact the global radiative budget and atmospheric water vapor distribution, both representing large uncertainties in predicting climate. In the atmosphere, the formation of ice can proceed via homogeneous or heterogeneous nucleation. Various organic compounds constitute a significant fraction of aerosol mass and thus affect the ability of particles to serve as IN. Here we report on homogeneous and heterogeneous ice nucleation via deposition, immersion, and condensation modes of organic and organics containing particles in the temperature (T) and relative humidity (RH) range typical for cirrus and mixed phase clouds. Ice nucleation as a function of T and RH and corresponding ice nucleation rates for estimation of ice particle production rates are presented. Laboratory generated particles serving as surrogates of atmospheric organics containing particles and field collected aerosol are employed in the studies. Homogeneous and heterogeneous ice nucleation via the immersion mode are studied from pure and multi-component (inorganic/organic) aqueous particles composed of major species typical of marine and biomass burning aerosol including levoglucosan, (NH4)2SO4, NaCl containing solid humic and fulvic acids, and surface-active organic monolayers. Of particular interest is how the organic material affects particle water activity in the supercooled temperature range. Measured freezing temperatures and nucleation rates are discussed with respect to the water-activity based nucleation theory. Anthropogenic particles dominated by organic material collected in and around Mexico City and impacted by photochemical aging nucleate ice heterogeneously at T and RH for cirrus onset conditions typical for the northern hemisphere. Particle analyses conducted using CCSEM/EDX and STXM/NEXAFS. These results are in stark contrast to previous measurements employin
284. Center for Functional Nanomaterials Seminar
"Mid-infrared High Performance Quantum Cascade Lasers and PbS/InP Heterojunction Photovoltaic Detectors"
Presented by Zhijun Liu, Brown University
Monday, June 28, 2010, 1 pm
Bldg. 735 - Conf Rm B
Hosted by: Chuck Black
Mid-infrared spectral region (wavelengths ~ 3-30µm) is of particular interest due to the presence of strong fingerprint absorption of numerous species, which enables various applications in chemical sensing, spectroscopy, medical diagnosis, and countermeasure, among others. Compared to optical technologies in visible or near-infrared regions, mid-infrared photonics is considered as "underdeveloped" due to the lack of suitable optical components and/or their limited performance. With development in synthesis of atomic layer thick heterostructure superlattice and in understanding of light interaction with these nanostructures, breakthroughs have been made in the past decade, especially on the high performance quantum cascade (QC) lasers, which are revolutionizing both fundamental research and practical applications in the mid-infrared. In order to turn the potential applications into real-world uses, optical components with new level of performance and functionalities are in urgent need for different application purposes. In this seminar, I will first describe high performance mid-infrared QC lasers at different wavelengths within the first and second atmospheric windows, which include the performance optimization for high power, room temperature, continuous-wave operation, temperature-dependent optical gain and loss measurements, and new design concepts of deep-well QC lasers and quantum-box emitters. Following the discussion on intersubband QC lasers, I will talk about my recent efforts on realizing subwavelength interband microdisk lasers at telecom wavelength, and a near-infrared and short-wave infrared dual-band photovoltaic detector using PbS nanocrystals on InP substrate. Finally I will conclude with a brief discussion on future research directions.
285. Center for Functional Nanomaterials Seminar
"Unraveling mechanistic insights of heterogeneous catalytic reactions over model surfaces"
Presented by Sanjaya Senanayake, Brookhaven National Laboratory
Thursday, April 29, 2010, 10 am
CFN, Bldg 735, Conference Room A
Hosted by: Peter Sutter
Catalysis is at the forefront of global research initiatives aimed at targeting critical environmental problems and addressing ever increasing energy demands. The "surface science" approach has been successful with the use of well defined model surfaces to explain critical aspects of complex real world catalysis but challenges still remain in finding suitable answers to key questions including: identification of active sites, role of interfaces, and correlation of structure to selectivity/activity. This talk will present recent studies of cerium oxide based model catalysts that have become very important as an industrially critical catalyst material due to unique oxygen storage properties. The talk will encompass the following: 1. Probing the redox surface chemistry of oxides with organic molecules 2. Modeling automotive catalysis (CO+NO) using metal nanoparticles supported on oxides (M/Ox) and 3. Understanding the remarkable reactivity observed from oxide nanoparticles in the production of H2 (WGS) in inverse (Ox/M) and mixed oxide (Ox1/Ox2) catalysts.
286. Joint HET/RIKEN/YITP Seminar
"Quantum Criticality and the Cuprate Superconductors"
Presented by Subir Sachdev, Harvard University
Wednesday, April 28, 2010, 2 pm
Large Seminar Room, Bldg. 510
Hosted by: Sally Dawson
I will begin with a simple introduction to the theory of quantum criticality, as applied to experiments on certain insulating antiferromagnets. I will then survey the phenomenology of the cuprate high temperature superconductors, and show how ideas from quantum criticality have helped explain or predict the results of a number of recent experiments. The applications to the cuprates focus attention on key problems associated with the criticality of Fermi surfaces in two dimensions which remain unresolved. I will describe how these open problems are being addressed by the AdS/CFT correspondence discovered in string theory.
287. Joint HET/RIKEN/YITP Seminar
"Goldstinos"
Presented by Jesse Thaler, Stony Brook University
Wednesday, March 24, 2010, 2:30 pm
SUNY Stony Brook
288. Particle Physics Seminar
"The Daya Bay Neutrino Experiment and the Search for Theta13"
Presented by Daniel Dwyer, California Institute of Technology
Thursday, March 4, 2010, 3 pm
Small Seminar Room, Bldg. 510
Hosted by: David Jaffe
The Daya Bay neutrino oscillation experiment has the greatest sensitivity to the neutrino mixing angle $\sin^2 2\theta_{13}$ of all experiments currently under construction. Our goal is to either determine the size of this mixing angle, or to establish a limit of $\sin^2 2\theta_{13}<0.01$. Eight 'identical' detectors, a newly constructed undergound facility, and multiple nuclear power reactors will be used to reach this goal. The progress of construction and recent results from detector testing will be discussed.
289. Joint HET/RIKEN/YITP Seminar
"Top-Quark Pair Production Beyond Next-To-Leading Order"
Presented by Andrea Ferroglia, Mainz University
Wednesday, February 24, 2010, 2 pm
Small Seminar Room, Bldg. 510
290. Joint HET/RIKEN/YITP Seminar
"NLO QCD Predictions for Vector Bosons Plus Jets at the LHC"
Presented by Lance Dixon, SLAC
Wednesday, February 10, 2010, 2:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
291. National Synchrotron Light Source Seminar
"Non-Destructive 3-D Structural Imaging and Characterization of Heterogeneous Functional Materials (HeteroFoaMs) for Energy Systems"
Presented by Wilson Chiu, Department of Mechanical Engineering, University of Connecticut
Monday, February 8, 2010, 10:30 am
Seminar Room, Bldg. 725
Hosted by: Jun Wang
Fuel cells, batteries, capacitators, electrolyzers, solar cells, combustion devices, fuel processing devices, and membranes and coatings all consist of heterogeneous functional materials (HeteroFoaMs) that exhibit functional behavior in a manner that controls their collective performance as an energy system. There is a critical need to understand the role of a HeteroFoaM’s structure, morphology, and composition on system performance. This seminar presents a non-destructive approach to image and characterize HeteroFoaMs using a transmission x-ray microscope at the Advanced Photon Source 32-ID-C. Three-dimensional structures within the sample volume are tomographically reconstructed at 38 nm spatial resolution. Multi-component lattice Boltzmann methods are used to analyze mass transfer, heat transfer, ionic/electronic charge transfer, and chemical/electrochemical reaction rates in the HeteroFoaM. To demonstrate this technique, chemical elements, chemical bonding, and phase- and pore-network structures in a solid oxide fuel cell are examined to provide fundamental insight into the origins of transport-related losses during operation. This work is supported by an Energy Frontier Research Center on Science Based Nano-Structure Design and Synthesis of Heterogeneous Functional Materials for Energy Systems (HeteroFoaM Center) funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences (Award DE-SC000106).
292. Particle Physics Seminar
"Neutrino mixing: What MINOS can say about theta13, the neutrino mass hierarchy, and CP violation in the lepton sector"
Presented by Gregory Pawloski, Stanford University
Thursday, February 4, 2010, 3 pm
Small Seminar Room, Bldg. 510
Hosted by: Serban Protopopescu
ABSTRACT: MINOS is an accelerator neutrino oscillation experiment designed to make precise measurements of the neutrino mixing parameters associated precise measurements of the neutrino mixing parameters associated with the atmospheric mass-squared splitting. By studying oscillations along a 735 km baseline, there is potential to produce measurements that are sensitive to the neutrino mass hierarchy and the values of the CP-violating phase and theta13. The results from the MINOS electron neutrino appearance analysis will be presented, and its implications on the above parameters will be discussed.
293. Joint HET/RIKEN/YITP Seminar
"N=4 SYM and the Grassmannian"
Presented by N. Arkani-Hamed, Institute for Advanced Study
Wednesday, January 27, 2010, 2:30 pm
YITP, Stony Brook
Hosted by: Sally Dawson
294. HET Lunch Seminar
Presented by Leo Almeida, SBU/BNL
Friday, January 22, 2010, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
295. RIKEN Lunch/HET/NT
"EDM's & Bayrogenesis"
Presented by Ying-chuan Li, University of Wisconsin, China
Thursday, January 21, 2010, 12:30 pm
Physics Dept., Bldg. 510, Room 2-160
Hosted by: Anthony Baltz
296. HET Lunch Seminar
Presented by Hai-Yang Cheng, Academia Sinica, Taiwan / BNL
Friday, January 8, 2010, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
297. HET Lunch Seminar
Presented by Cai-Dian Lu, IHEP, Bejing
Friday, December 11, 2009, 12 pm
Room 2-95, Bldg. 510
298. HET Lunch Seminar
Presented by Michael Creutz, Brookhaven National Laboratory
Friday, December 4, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
299. HET Lunch Seminar
Presented by Amarjit Soni, Brookhaven National Laboratory
Friday, November 20, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
300. Joint HET/RIKEN/YITP Seminar
"Non-Minimal Dark Matter--Nucleon Scattering"
Presented by Aaron Pierce, University of Michigan
Wednesday, November 18, 2009, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125)
Hosted by: Sally Dawson
301. HET Lunch Seminar
Presented by Aleksandr Azatov, University of Maryland
Friday, November 13, 2009, 12 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
302. HET Lunch Seminar
Presented by Hooman Davoudiasl, Brookhaven National Laboratory
Friday, November 6, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
303. HET Lunch Seminar
Presented by Sally Dawson, Brookhaven National Laboratory
Friday, October 30, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
304. Joint HET/RIKEN/YITP Seminar
Presented by Nathan Seiberg, IAS, Princeton, New Jersey
Wednesday, October 14, 2009, 2 pm
YITP, SUNY Stony Brook (Room Math 6-125)
Hosted by: Sally Dawson
305. HET Lunch Seminar
Presented by Jennifer Kile, Brookhaven National Laboratory
Friday, October 9, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
306. HET Lunch Seminar
"Relating High-Scale Non-Universality in SUGRA scenario to the Low-Scale Observables at the LHC"
Presented by Subhaditya Bhattacharya, HRI, India
Friday, September 25, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
Apart from the most popular framework in gravity-mediated SUSY breaking scheme, called minimal Supergravity (mSUGRA) where all the SUSY breaking scalar and gaugino masses are assumed to be unified at the high-scale, there exist models with non-universal gaugino and scalar masses which are strongly motivated from GUT theory as well as from the low-energy constraints. In this talk, I will discuss a few such models with non-universal gaugino and scalar masses, indicate the low-energy phenomenology as well as their distinguishability from the mSUGRA scenario, particularly in context of the signatures at the upcoming Large Hadron Collider Experiment.
307. Joint HET/RIKEN/YITP Seminar
"Fourth Generation and Electroweak Symmetry Breaking"
Presented by Gustave Burdman, Sao Paulo/FNAL
Wednesday, September 23, 2009, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Sally Dawson
308. Condensed-Matter Physics & Materials Science Seminar
"Creating Low-Dimensional Electronic States in Superconducting Oxide Heterostructures"
Presented by Yusuke Kozuka, Department of Advanced Materials Science, The University of Tokyo, Kashiwa, Chiba, Japan
Monday, September 21, 2009, 11 am
Bldg. 480 conference room
Hosted by: Ivan Bozovic
The role of dimensionality has been one of the central issues in superconductivity, because many promising superconductors have quasi-two-dimensional electronic states such as MgB2 and cuprates. Although the low-dimensional properties of superconductivity have been studied in metal thin films for decades, they essentially form from 3D electronic states because of their large carrier density. Here, we focus on strontium titanate (SrTiO3), which is the first known superconducting semiconductor with extremely low carrier density (n > 1019 cm-3). Using a new growth technique for high-mobility SrTiO3 films, we grew heterostructures of 1 at. % Nb-doped SrTiO3 (Nb:SrTiO3) embedded in insulating SrTiO3 by pulsed laser deposition, which exhibits a superconducting transition around 0.3 K. By decreasing the thickness of Nb:SrTiO3, the low-temperature mobility was enhanced by a factor of ~ 3, exceeding 1,000 cm2 V-1 s-1. In addition, analysis of the superconducting upper critical field indicated a crossover from 2D to 3D superconductivity. Above the upper critical field, we observed Shubnikov de-Haas oscillations which scale with the perpendicular field, indicating a 2D normal state. These results suggest we can access new regimes of 2D superconducting phase transitions in the clean limit. This work was done in collaboration with Minu Kim, Christopher Bell, Bog G. Kim, Yasuyuki Hikita, and Harold Y. Hwang.
309. HET Lunch Seminar
Presented by Christian Sturm, Brookhaven National Laboratory
Friday, September 18, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
310. NSLS-II Seminar
"Insight into heterogeneous geomaterials through XANES Imaging Spectroscopy."
Presented by Vincent De Andrade, ESRF, X-ray microscopy beamline ID21, 38043 Grenoble
Wednesday, September 9, 2009, 9 am
NSLS-II Seminar Room, Bldg. 817
Hosted by: Juergen Thieme
Because of their complex genesis, materials are commonly polycrystalline heterogeneous systems, with both chemical and structural heterogeneities at various scale-level. As most of the micro- and nano- analytical techniques relying on scanning instruments with a pencil-beam, XANES (X-ray Absorption Near Edge Structure) technique offers high spatial resolution but suffers from long acquisition times imposing practical limits on the field of view. Now, region of interest in samples are generally several orders of magnitude larger than the beam size. Along this presentation, an overview will be given onto the on-going technical developments of the ESRF ID21-beamline Scanning Microscope, relating to detection (multi-elements detector, in-house developed WDX spectrometer) and optics (Fresnel zone plate, KB mirrors). Then, we will focus on an original setup developed and optimized to perform spectroscopic imaging on geomaterials, with relatively short acquisition time (≈1 h) and large field of view (0.5-2 mm2) while keeping a sub-micron resolution. The setup consists in coupling full-field absorption radiographies with a large parallel beam of hard X-rays, XANES and PIC (Polarization Imaging Contrast) techniques. The potential of this combined approach will be demonstrated on metamorphic rocks. This non-invasive method enables 2D quantitative Fe3+/Fetotal estimates revealing subtle redox variations inside mineralogical phases. Moreover, besides providing crystalline orientations at the pixel scale, the PIC and XANES combination allowed to correct XANES estimates from polarization effects, which is a tricky but important task in polycrystalline materials. Finally, the last application concerns an experimental study of a bentonite analog (clayey material) considered for nuclear wastes and CO2 storage. Mapping of the proportions of finely mixed phases at the µm3 scale were extracted from hyperspectral data acquired on a reference bentonite. The spatial repartition o
311. Condensed-Matter Physics & Materials Science Seminar
"Depth dependent studies of magnetic and superconducting properties of thin films and heterostructures with polarized low energy muons"
Presented by Elvezio Morenzoni, Paul Scherrer Institute, Switzerland
Wednesday, September 2, 2009, 11 am
Small Seminar Room, Bldg. 510
Hosted by: Ivan Bozovic
Positive polarized muons $\mu^{+}$ act as a non-destructive, non-invasive, and sensitive microscopic probe for local magnetic investigations (muon spin rotation/relaxation, $\mu$SR). Over the years they have provided unique information about magnetic, superconducting and other electronic properties of bulk matter. A novel extension of the $\mu$SR technique is given by the availability of $\mu^{+}$ with 100\% spin polarization and whose energy can be continuously varied from 0.5 to 30 keV. This allows depth dependent $\mu$SR-studies of thin films, near surface regions and multilayered structures in the range from $\sim$ 1 nm to $\sim$ 300 nm. After a brief introduction of the method, I will overview some experiments including investigations of thin films and heterostructures of various superconducting and magnetic materials, ranging from cuprates through spin glasses to structures and compounds relevant for spintronics applications.
312. HET Lunch Seminar
Presented by Hye-Sung Lee, University of California Riverside
Friday, August 7, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
313. HET Lunch Seminar
"W/Z+b jets at hadron colliders: a challenging background"
Presented by Laura Reina, FSU
Friday, July 24, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
314. HET Lunch Seminar
"The WIMP Forest"
Presented by Chris Jackson, Argonne National Laboratory
Friday, July 10, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
315. HET Lunch Seminar
Presented by Thomas Rizzo, SLAC
Friday, June 12, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
316. Special HET Lunch Seminar
"Flavor and SUSY: between frustration and hope"
Thursday, June 11, 2009, 12:30 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
317. HET Lunch Seminar
Presented by Yasumichi Aoki, RBRC
Friday, May 22, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
318. Biology Department Seminar
"Microbial Genomics to Omics-Based Systems and Synthetic Microbiology"
Presented by Jihyun Kim, KRIBB, Korea University of Science and Technology, Daejeon, Republic of Korea
Friday, May 22, 2009, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Bill Studier
With the advent of high-throughput sequencing technologies, sequencing has become an effective means of understanding life systems and increasing their utility. There is no doubt that sequence information is not only the final goal of a particular genome/metagenome project but a starting point of so-called ‘-omics’ research, becoming the cornerstone of systems biology and synthetic biology. There have been hundreds of microbial genome projects, including derivatives of Escherichia coli B that have been widely used as a workhorse in the labs and industry. Recently, we determined partly as an international consortium activity the genome sequences of two E. coli strains of the B lineage, REL606 and BL21(DE3). We further integrated and compared the transcriptome, proteome and phenome data of B and K-12, and also applied a computational modeling approach, thus providing a framework to elucidate the phenotypic characteristics of organisms and offering a high-resolution system-wide view of the biological systems.
319. HET Lunch Seminar
"'4th Generation' & B-CP anomalies"
Presented by Amarjit Soni, Brookhaven National Laboratory
Friday, May 8, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
320. Joint HET/RIKEN/YITP Seminar
"Implications of the Higgs Discovery in MSSM"
Presented by Ian Low, Argonne National Laboratory/Northwestern University
Wednesday, May 6, 2009, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125)
Hosted by: Hooman Davoudiasl
321. HET/ATLAS Joint Seminar
Presented by Michael Begel, Brookhaven National Laboratory
Friday, May 1, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
322. HET Lunch Seminar
Presented by Bill Kilgore, Brookhaven National Laboratory
Friday, April 24, 2009, 12 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
323. HET Lunch Seminar
Presented by Zuowei Liu, YITP-SBU
Friday, April 17, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
324. Joint HET/RIKEN/YITP Seminar
"Constraining Interactions in Cosmology's Dark Sector"
Presented by Mark Trodden, University of Pennsylvania
Wednesday, April 15, 2009, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
325. HET Lunch Seminar
Presented by Erin Sheldon, Brookhaven National Laboratory
Friday, April 3, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
326. Joint HET/RIKEN/YITP Seminar
"Fundamental Physics from the Sky"
Presented by Stefano Profumo, SCIPP, University of California, Santa Cruz
Wednesday, April 1, 2009, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
Can we learn about New Physics with astronomical and astro-particle data? Understanding how this is possible is key to unraveling one of the most pressing mysteries at the interface of cosmology and particle physics: the fundamental nature of dark matter. Rapid progress may be within grasp in the context of an approach which combines information from high-energy particle physics with cosmic-ray and traditional astronomical data. I discuss recent puzzling data on cosmic-ray electrons and positrons and their interpretation. I show how the Fermi Space Telescope will soon shed light on those data as well as potentially on several dark matter particle properties. I then introduce a novel approach to particle dark matter searches based on the complementarity of astronomical observations across the electromagnetic spectrum, from radio to X-ray and to gamma-ray frequencies.
327. HET/ATLAS Joint Seminar
"Search for MSSM Higgs Boson Production in di-tau Final States at D0"
Presented by Abid Patwa, Brookhaven National Laboratory
Friday, March 27, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
Recent results from the D0 Experiment at the Fermilab Tevatron collider are presented on the search for the production of neutral Higgs bosons decaying into di-tau final states. In particular, searches with integrated luminosities of up to 2.2 fb^-1 of data are described in both the Higgs decaying into tau pairs as well as those produced in association with a b-quark. Since no significant excess is observed over the predicted backgrounds in either decay mode, limits on its production cross section times branching ratio are set for Higgs masses within the range from 90 to 300 GeV. The results are subsequently interpreted in the Minimal Supersymmetric Standard Model (MSSM) and regions in the (mA, tan(beta)) parameter space for different MSSM benchmark scenarios are excluded at the 95% C.L. Future prospects for measurements with increased integrated luminosities delivered by the Tevatron are also discussed.
328. Medical Department Seminar
"GIN, CIN, and cell promiscuity, or whether viruses cause cancer by fusing cells"
Presented by Professor Yuri Lazenbik, Cold Spring Harbor Laboratory
Friday, March 20, 2009, 1:30 pm
Large Conference Room, Bldg. 490
Hosted by: Helene Benveniste, MD, PhD
329. HET Lunch Seminar
Presented by Leandro Almeida, YITP, SBU
Friday, March 13, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
330. HET Lunch Seminar
Presented by Bill Marciano, Brookhaven National Laboratory
Friday, March 6, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
331. HET Lunch Seminar
Presented by Frank Paige, Brookhaven National Laboratory
Friday, February 27, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
332. Joint HET/RIKEN/YITP Seminar
"Dark Matter Sees the Light"
Presented by Michele Papucci, IAS, Princeton
Wednesday, February 25, 2009, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125)
Hosted by: Hooman Davoudiasl
333. Center for Functional Nanomaterials Seminar
"Anomalous Dynamics in Colloidal Glasses and Polymers Under Heterogeneous Confinement"
Presented by Erica Saltzman, Columbia University
Wednesday, February 18, 2009, 11 am
Bldg. 735 - Conf Rm B
Hosted by: Mark Hybertsen
Complex fluids such as colloidal suspensions and polymer melts exhibit slow dynamics under a variety of conditions. Glasses are self-constraining complex fluids in which each particle is confined by its neighbors, and their dynamics as observed by simulation and experiment include a number of non-Gaussian behaviors. A theory of glassy dynamics in dense colloidal suspensions is presented, which qualitatively predicts the anomalous phenomenology. Another system exhibiting constrained dynamics is a polymer chain under spatial confinement, as in a porous medium. Simplified simulations of polymers under generic heterogeneous confinement are presented, which show that this system exhibits many of the non-Gaussian features of glassy dynamics.
334. HET Lunch Seminar
Presented by Oliver Witzel, Brookhaven National Laboratory
Friday, February 13, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
335. HET Lunch Seminar
Presented by Rachel Rosen, New York University
Friday, February 6, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
336. HET Lunch Seminar
Presented by Kristian McDonald, TRIUMF
Friday, January 30, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Hooman Davoudiasl
337. Joint HET/RIKEN/YITP Seminar
Presented by Ruth Britto, Saclay, SPhT & Fermilab
Wednesday, January 28, 2009, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
338. HET Lunch Seminar
Presented by Michael Creutz, Brookhaven National Laboratory
Friday, January 23, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
339. HET Lunch Seminar
Presented by Jennifer Kile, Brookhaven National Laboratory
Friday, January 16, 2009, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
340. HET Lunch Seminar
Presented by Alex Mitov, YITP
Friday, December 19, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
341. HET Lunch Seminar
Presented by Taku Izubuchi, HET/RBRC
Friday, December 12, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
342. Joint HET/RIKEN/YITP Seminar
"The Planck Scale from Top Condensation"
Presented by Eduardo Ponton, Columbia University
Wednesday, December 10, 2008, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125)
Hosted by: Hooman Davoudiasl
343. Joint HET/RIKEN/YITP Seminar
"From Vortices in Superconductivity to Quark Confinement"
Presented by Mikhail Shifman, University of Minnesota
Wednesday, November 19, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
Supersymmetry, born in the early 1970s, is a very rich theory which is supposed to describe the widest range of natural phenomena. Although it has not yet been discovered experimentally, it proved to be a powerful tool in Quantum Chromodynamics (QCD) -- the theory of hadrons -- and strongly coupled gauge theories at large. Efforts aimed at solving various aspects of QCD basing on supersymmetry and string-inspired ideas bring fruits. In a remarkable entanglement, theoretical constructions of the 1970s and 1990s combine with today's ideas to provide new insights and a deeper understanding.
344. HET Lunch Seminar
Presented by Ruth Van de Water, Brookhaven National Laboratory
Friday, November 14, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
345. HET Lunch Seminar
Presented by Tomomi Ishikawa, RBRC
Friday, October 24, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
346. Joint HET/RIKEN/YITP Seminar
"Landscape Naturalness"
Presented by Scott Thomas, Rutgers University
Wednesday, October 22, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
347. HET Lunch Seminar
Presented by Sally Dawson, Brookhaven National Laboratory
Friday, October 10, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
348. Joint HET/RIKEN/YITP Seminar
"Generalized unitarity and one-loop calculations"
Presented by Kirill Melnikov, Johns Hopkins University
Wednesday, October 1, 2008, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125)
Hosted by: Hooman Davoudiasl
349. HET Lunch Seminar
Presented by Christian Sturm, Brookhaven National Laboratory
Friday, September 26, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
350. HET Lunch Seminar
Presented by Shrihari Gopalakrishna, Brookhaven National Laboratory
Friday, September 19, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
351. Center for Functional Nanomaterials Seminar
"Silicon Carbide Nanocones and Heterostructures Induced by Released Iron Catalysis"
Monday, September 15, 2008, 10 am
Bldg. 735 - Conf Rm A
Hosted by: Yimei Zhu
Nanowires represent an important and broad class of one-dimensional (1D) nanostructures at the forefront of nanoscience and nanotechnology. Nanowires are also attractive building blocks for functional nanoscale electronics, optoelectronic, electrochemical, and electromechanical devices. Understanding how to control the morphology, rational design and predictable synthesis of nanowires is vital in order to deterministically integrate such nanostructures into various technologies. A remarkably elegant approach to produce 1-dimensional (1D) nanostructures is by metal-catalyzed nanowire formation via the vapor-liquid-solid (VLS) mechanism. Our results demonstrated the successful synthesis of unusual silicon carbide (SiC) nanocones and Y, T branched heterostructures as catalyzed by an iron nanoparticle originally encapsulated within a graphite-like carbon shell. At high temperature, the Fe nanoparticles leave the C-shell, migrate and combine with other Fe to form larger Fe nanoclusters. The increasing cross-sectional diameter of the SiC is due to the increasing diameter of the exposed Fe surface, that catalyzes the SiC growth, which could be caused by the release of the nanocluster from the C-shell and/or the coalescence with later released Fe particles. The released Fe can migrate onto an existing SiC nanowire, which catalyzes the nucleation and growth of a secondary SiC nanowire. Consequently, different Y and T branched structures and more complex hierarchical SiC nanostructures can be realized from this unique catalytic process. The migration of iron nanocrystal from the graphitic carbon shell is visualized by in situ transmission electron microscopy (TEM). The resultant SiC nanocones and heterostructures are analyzed systematically by different electron microscopy techniques, including Z-contrast imaging, energy dispersive X-ray emission (EDX) and electron energy-loss spectroscopy (EELS) techniques, electron diffraction and high-resolution electron microscopy (HREM).
352. Joint HET/RIKEN Theory Seminar
Presented by Kaustubh Agashe, University of Maryland
Wednesday, August 27, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
353. Joint HET/RIKEN Theory Seminar
"Maximal Flavor Violation"
Presented by Shaouly Bar-Shalom, Technion & UCI
Wednesday, August 13, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
354. National Synchrotron Light Source Lunch Time Seminar
"Interaction between the General Anesthetic Halothane and Model Ion Channel Peptides in Langmuir Monolayers: An X-ray Reflectivity Study"
Presented by Joseph Strzalka, University of Pennsylvania
Friday, July 18, 2008, 12 pm
Seminar Room, Bldg. 725
Hosted by: Christie Nelson
355. Joint HET/RIKEN Theory Seminar
"Positronium and Polyelectrons"
Presented by Andrzej Czarnecki, University of Alberta, Canada
Wednesday, July 16, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
356. Joint HET/RIKEN Seminar
"Deconfining phase of SU(2) Yang-Mills thermodynamics"
Presented by Ralf Hofmann, University of Karlsruhe
Wednesday, July 9, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
357. Biology Department Seminar
"Harnessing Photosynthetic Bacteria for the Heterologous Expression of Membrane Proteins"
Presented by Deborah Hanson, Biosciences Division, Argonne National Laboratory, Argonne, IL
Friday, June 20, 2008, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Carl Anderson
The functions performed by membrane proteins are essential for all organisms. Despite the fact that they represent approximately 30% of every genome and comprise more than 60% of all drug targets, only about 100 unique, unrelated membrane protein structures have been determined to date, in contrast with unique, unrelated structures representing more than 8100 soluble protein families. This field has suffered because it is difficult to obtain quantities of pure, native membrane proteins that are adequate for structural and functional analyses. To approach this problem, we have employed the Rhodobacter species of photosynthetic bacteria -- which is characterized by an inducible intracytoplasmic membrane (ICM) -- for the heterologous expression of membrane proteins. Compartmentalization of an expressed membrane protein to the Rhodobacter ICM suggests strongly that it assumes a structure that directs proper insertion into the lipid bilayer. Activity assays and circular dichroism spectra have been used to demonstrate functional and structural integrity of heterologous proteins following their purification from Rhodobacter membranes. Our results also underscore this organism's utility in the assembly of membrane proteins with complex cofactors. This expression system puts to task, in a novel way, this photosynthetic species and the membranes it produces naturally in order to harness this machinery for the efficient production of foreign membrane proteins for a variety of structural and functional experiments.
358. HET Lunch Seminar
Presented by Yasumichi Aoki, Brookhaven National Laboratory - RBRC
Friday, May 16, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
359. Joint HET/RIKEN/YITP Seminar
"Dark matter annihilations in the WMAP sky"
Presented by Dan Hooper, Fermilab
Wednesday, May 14, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
360. HET Lunch Seminar
Presented by Amarjit Soni, Brookhaven National Laboratory
Friday, May 9, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
361. HET Lunch Seminar
"Quantum anomalies and bulk properties of hot QCD matter"
Presented by Dmitri Kharzeev, Brookhaven National Laboratory
Friday, April 25, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
362. Joint HET/RIKEN/YITP Seminar
"The Unparticle Scale"
Presented by Howard Georgi, Harvard University
Wednesday, April 23, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
363. HET/ATLAS Joint Seminar
Presented by David Adams, Brookhaven National Laboratory - ATLAS
Friday, April 18, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
364. Joint HET/RIKEN Theory Seminar
"Sflavor at the LHC"
Presented by Graham Kribs, University of Oregon
Wednesday, April 16, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
365. Joint HET/RIKEN/YITP Seminar
Presented by Yuval Grossman, Cornell University
Wednesday, April 9, 2008, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125 )
Hosted by: Amarjit Soni
366. HET/RIKEN Lunch Seminar
Presented by Sinya Aoki, University of Tsukaba/RBRC
Friday, April 4, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
367. Joint HET/RIKEN Lunch Seminar
Presented by Mike Creutz, Brookhaven National Laboratory
Friday, March 28, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
368. HET LUNCH SEMINAR
Presented by Frank Paige, Brookhaven National Laboratory
Friday, March 14, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
369. HET/RIKEN Seminar
Presented by Gil Paz, IAS, Princeton
Wednesday, March 12, 2008, 2 pm
Small Seminar Room, Bldg. 510
370. Joint HET/RIKEN/YITP Seminar
"Ingredients for a Precise Top-Quark Mass Measurement from Jets"
Presented by Iain Stewart, MIT
Wednesday, March 5, 2008, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125 )
Hosted by: Hooman Davoudiasl
371. Medical Department Seminar
"New Synthetic Routes to Protein-Based Imaging Agents"
Presented by Matthew B. Francis, PhD, Associate Professor, University of California at Berkeley, Chemistry Department.
Tuesday, March 4, 2008, 1:30 pm
Large Conference Room, Bldg. 490
Hosted by: Jacob Hooker, PhD
A modular synthetic platform has been developed to access targetable delivery vectors for a variety of imaging techniques. Genome-free viral capsids have served as the basic scaffold for these studies, as they provide monodisperse spherical structures that can be tailored to display multiple copies of a desired functional group. The interior surface of each capsid has been modified to house up to 100 gadolinium complexes, yielding MRI contrast enhancement agents with very high relaxivities. Chemical techniques have also been developed for the introduction of F-18 nuclei for PET and cryptophane ligands for the binding of hyperpolarized xenon. Exterior surface modifications have targeted an artificial amino acid that exhibits unique chemical reactivity, allowing the facile attachment of tissue targeting peptides and biocompatible polymers. The cornerstone of these efforts has been the development of reliable synthetic reactions that can modify biomolecules with high site selectivity and yield. This presentation will emphasize the potential of these techniques for the construction of new imaging agents from virtually any protein of interest.
372. Joint HET/RIKEN Lunch Seminar
"New Phenomenological Applications of Lattice Field Theories"
Presented by Taku Izubuchi, Kanazawa University / RBRC
Thursday, February 28, 2008, 12:30 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
373. HET/RIKEN Seminar
"Electroweak corrections to hadronic gauge boson production at large transverse momentum"
Presented by Anna Kulesza, DESY, Germany
Wednesday, February 27, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
374. HET Lunch Seminar
"Maximal Flavor Violation"
Presented by Shaouly Bar-Shalom, Technion -IIT
Friday, February 22, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
375. HET Lunch Seminar
Presented by Hooman Davoudiasl, Brookhaven National Laboratory
Friday, February 15, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
376. Joint HET/RIKEN Lunch Seminar
"Flavor physics from the lattice: a model independent determination of |V_cb|."
Presented by Jack Laiho, Washington University, St. Louis
Thursday, February 14, 2008, 12:30 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
377. Joint HET/RIKEN/YITP Seminar
"Tree Amplitudes in Gauge Theory and Gravity"
Presented by Nima Arkani-Hamed, IAS
Wednesday, February 13, 2008, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
378. HET Lunch Seminar
"The electric dipole moment of the nucleon from simulations at imaginary \theta"
Presented by Yoshifumi Nakamura, DESY
Friday, February 8, 2008, 12 pm
Room 2-95, Bldg. 510
Hosted by: Amarjit Soni
379. Joint HET/RIKEN Lunch Seminar
Presented by Harvey Meyer, MIT
Thursday, February 7, 2008, 12:30 pm
Room 2-160, Bldg. 510
Hosted by: Amarjit Soni
380. Joint HET/RIKEN/YITP Seminar
"QCD on the Light-Front"
Presented by Stanley Brodsky, SLAC
Wednesday, February 6, 2008, 2:30 pm
YITP, SUNY Stony Brook (Room Math 6-125 )
Hosted by: Amarjit Soni
381. Biology Department Seminar
"Guiding Improvements of Photosynthesis Using an Integrated Dynamic Model of Photosynthetic Carbon Metabolism"
Presented by Xinguang Zhu, Department of Plant Biology, School of Integrative Biology, University of Illinois at Urbana-Champaign
Friday, January 25, 2008, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Jorg Schwender
The distribution of nitrogen between enzymes of photosynthetic carbon metabolism might be assumed to have been optimized by natural selection. However, natural selection for survival and fecundity does not necessarily select for maximal photosynthetic productivity. Further atmospheric CO2 concentration, the key substrate, has changed more over the past 100 years than the past 25M years with the likelihood that natural selection has had inadequate time to re-optimize resource partitioning for this change. Could photosynthetic rate be increased by altered partitioning of resource among the enzymes of carbon metabolism? To address this question, we developed a complete dynamic model of photosynthetic carbon metabolism and used an “evolutionary” algorithm to progressively search for multiple alterations in partitioning that increase photosynthetic rate. Our results suggest that manipulation of partitioning could greatly increase carbon gain without any increase in the total protein-nitrogen investment in the apparatus for photosynthetic carbon metabolism.
382. Joint HET/RIKEN Lunch Seminar
"Kaon physics from mixed action lattice QCD"
Presented by Ruth Van de Water, Fermilab
Thursday, January 24, 2008, 12:30 pm
Room 2-160, Bldg. 510
Hosted by: Soni Amarjit
383. Joint HET/RIKEN/YITP Seminar
"Scattering processes in N=4 SYM at strong coupling via AdS/CFT"
Presented by Juan Maldacena, IAS
Wednesday, January 23, 2008, 2 pm
Small Seminar Room, Bldg. 510
384. Joint ATLAS/HET Lunch Seminar
Presented by Hong Ma, BNL
Friday, December 14, 2007, 12 pm
Bldg.510 Rm.2-95
385. Condensed-Matter Physics & Materials Science Seminar
"Antagonistic Orders in Nanoengineered Ferromagnet - Superconductor Heterostructures"
Presented by Ramesh Budhani, Indian Institute of Technology Kanpur, India
Friday, November 30, 2007, 10 am
Bldg. 480 - conference room
Hosted by: Yimei Zhu
The antagonism between superconductivity and ferromagnetism has generated a considerable degree of interest in recent years. Thin film heterostructures of a variety of superconducting (SC) and ferromagnetic (FM) materials permit experimental verification of such diverse phenomena as-phase shift, triplet pairing and enhanced flux pinning by magnetic inhomogeneities. We have been working on FM-SC-FM and SC-FM-SC trilayers of conventional materials such as NbN and CoPt, and the exotic systems comprising of YBa2Cu3O7 (YBCO) and La1-xSrxMnO3 (LSMO) deposited on lattice matched substrates. Transport measurements on LSMO-YBCO-LSMO system show clear oscillations in critical current (Ic) as the thickness of the LSMO layers is scanned from ~ 50 Å to ~ 1100 Å. In the light of existing theories of FM-SC heterostructures, this observation suggests a long range proximity effect in the manganite, modulated by its weak exchange energy (~2 meV). One interesting issue in FM-SC hybrids that defies the notion of antagonistic orders is the magnetic field induced superconductivity (FIS). We have shown that in systems where the FM domains/islands produce spatial inhomogeneities of the SC order parameter, the FIS can derive significant contribution from different mobilities of the magnetic flux identified by two distinct critical states in the inhomogeneous superconductor. Our experiments on nano-engineered bilayers of ferromagnetic CoPt and superconducting NbN where CoPt/NbN islands are separated by a granular NbN, lend support to this alternative explanation of FIS in certain class of FM-SC hybrids. This research has been supported by grants from the Department of Science and Technology (DST) and the Board for Research on Nuclear Sciences (BRNS), Government of India.
386. HET/RIKEN Seminar
Presented by Matthew Schwartz, Johns Hopkins University
Wednesday, November 28, 2007, 2 pm
Small Seminar Room, Bldg. 510
387. HET LUNCH SEMINAR
Presented by Frank Paige, BNL
Friday, November 16, 2007, 12 pm
Bldg.510 Rm. 2-95
388. Joint HET/RIKEN/YITPSeminar
"New ideas for Event Generators"
Presented by Christian Bauer, LBL
Wednesday, November 14, 2007, 2 pm
Small Seminar Room, Bldg. 510
389. National Synchrotron Light Source Lunch Time Seminar
"Fabrication of heterostructured nanoparticles with high magnetic moment in gas phase"
Presented by YunHao Xu, University of Minnesota
Friday, October 5, 2007, 12 pm
Seminar Room, Bldg. 725
390. Biology Department Seminar
"Silent Running: RNA Interference and Heterochromatic Silencing in Plants and Fission Yeast"
Presented by Robert Martienssen, Watson School of Biological Sciences, Cold Spring Harbor Laboratory
Friday, June 8, 2007, 11 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Carl Anderson
Heterochromatin is composed of transposable elements (TE) and related repeats which silence genes located nearby, and play a major role in epigenetic regulation of the genome. Far from being inert, heterochromatin is transcribed and small interfering RNA corresponding to heterochromatic sequences can be detected in plants, animals and fission yeast. We have used tiling microarrays to examine these transcripts and their regulation in plants and fission yeast. In plants, expression of small interfering RNA (siRNA) corresponding to different classes of TE depends on DNA methyltransferase MET1, the SWI/SNF ATPase, DDM1, or both, but not on the histone deacetylase SIL1. All three genes are required for silencing transposons in the absence of RNAi. In fission yeast and in Arabidopsis, centromeric repeats are continually transcribed on one strand, but the transcripts are rapidly turned over by RNA interference, through the combined action of DNA dependent RNA polymerase, Argonaute and RNA dependent RNA polymerase, each of which is associated with heterochromatin. Histone H3 lysine-9 dimethylation (H3K9me2) depends on RNAi, mediated by the Rik1-Clr4 complex. Rik1 has similarity to both DNA and RNA binding proteins, and may play a role in RNA processing. In pombe, spreading of histone methylation into reporter genes that are silenced by position effect variegation (PEV) depends on co-transcription and slicing by Argonaute, leading to a model for PEV.
391. Center for Functional Nanomaterials Seminar
"Theoretical Studies in Heterogeneous Catalysis and Electrocatalysis"
Presented by Ping Liu, Brookhaven National Laboratory
Wednesday, May 16, 2007, 10:30 am
Chemistry Department, Room 300
Hosted by: Mark Hybertsen
Density functional theory has reached a level where it can be used to describe complete catalytic reactions on both surfaces and nanoparticles. This gives a basic insight into these processes, and it allows us to pinpoint the origin of the catalytic activity of the material. The electrocatalytic processes involving in fuel cell and hydrodesulfurization reaction are used to exemplify this approach. It will be shown that by combining density functional calculations with kinetic modeling, we can well predict the catalytic activities of different systems.
392. Joint HET/RIKEN/YITP Seminar
"Violation of Rotational Invariance during Inflation"
Presented by Mark Wise, California Institute of Technology
Wednesday, May 9, 2007, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
393. National Synchrotron Light Source Symposia
"Heteroepitaxy Integration and Interface Engineering: The use of MgO as an Epitaxy Template for Complex Oxide Ferromagnetic and Ferroelectric Integration on 6H-SiC through MBE"
Presented by Katherine S. Ziemer, Northeastern University, Department of Chemical Engineering, Boston, MA
Tuesday, May 1, 2007, 1 pm
Seminar Room, Bldg. 725
Hosted by: Dario Arena
There is a growing interest for the integration of complex magnetic or ferroelectric oxides on wide bandgap semiconductors for robust multifunctional devices. However, difficulties arise at the interface of the complex oxide film and semiconductor substrate due to lattice mismatch, thermal mismatch, and interdiffusion. To address these challenges, it is proposed to use the quasi-hexagonal structure of the alternating layers of magnesium and oxygen in MgO (111) to facilitate, through O-O bonding, the effective integration of more complex oxides with SiC. Epitaxial films of 10 to 300 Å thick MgO (111) were grown under Mg adsorption controlled conditions on 6H-SiC (0001) by molecular beam epitaxy (MBE). Reflection high energy electron diffraction (RHEED) was used real time to monitor the growth rate, crystal structure, and crystallographic orientation. In-situ x-ray photoelectron spectroscopy (XPS) and Auger electron spectroscopy (AES) provided composition and chemical bonding information. Both 38 nm and 20Å MgO films on 6H-SiC tested for thermal stability at 790oC in vacuum (<10-9 Torr) and in air. Films showed no evidence of instability at the interface, as measured by XPS or x-ray diffraction (XRD). However, the RHEED pattern transitioned from a twinned structure to an improved, ordered structure believed to be a result of atom mobility within the MgO lattice. Complex oxides, including barium titanate (BTO) and barium hexaferrite (BaM) were then deposited on the MgO thin films by means of pulsed laser deposition (PLD) and MBE in order to evaluate the potential for crystalline MgO to be used as an epitaxy template. Characterization by both the in-situ techniques and ex-situ atomic force microscopy (AFM), XRD, and general area diffraction (GADDS) of the subsequent complex oxide integration revealed a preferred crystal orientation in the (111) direction. This supports the hypothesis that high-quality, single crystalline MgO (111) deposited on 6H-SiC (0001) has
394. Joint HET/RIKEN/YITP Seminar
"Split or Splat Supersymmetry at the LHC"
Presented by James Wells, University of Michigan
Wednesday, April 11, 2007, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
395. Joint HET/RIKEN/YITP Seminar
"CANCELED"
Presented by Michael Dine, Santa Cruz Institute for Particle Physics (SCIPP)
Wednesday, March 28, 2007, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
396. NSLS-II Seminar
"Thin Films, Heterostructures and Some Applications of High Temperature Superconductors and Other Oxides"
Presented by Kazuhiro Endo, of Kanazawa Institute of Technology (KIT), Japna
Friday, March 2, 2007, 2 pm
NSLS-II Seminar Room, Bldg. 817
Hosted by: John Hill
Top quality thin films for different applications are always of interest. However, it is not easy to grow such films and many criteria have to be fulfilled. The degree of complexity enhances significantly for muticomponent materials such as high-Tc superconductors, giant magnetoresistive materials, heterostructures, other. This translates into a lower growth control level. Solution resides in identification of the specific details as well as of the general principles of growth and their personalized application towards preparation of optimized thin films of top quality. This is our approach and goal. Examples in this regard will be introduced. Applications build on our thin films such as junctions will be also briefly presented.
397. Joint HET/RIKEN/YITP Seminar
"Topological Interactions of Higgs Bosons"
Presented by Richard Hill, Fermilab
Wednesday, February 21, 2007, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
398. Center for Functional Nanomaterials Seminar
"Single-Molecule Confocal Microscopy for Studying Conformational Changes of Light-Harvesting Complex in the Photosynthetic Membrane"
Presented by Duohai Pan, Beckman Institute at UIUC
Tuesday, February 20, 2007, 10 am
Rm. 300, Bldg. 555
Hosted by: Oleg Gang
Single molecule spectroscopy and confocal optical imaging methods have been rapidly become an important new set of tools for probing the individual nanoscale behavior of molecules in complex local environments. In this talk, I will first present the multi-channel confocal fluorescence spectroscopy and imaging technique which was developed recently. This system allows us to study the fluorescence intensity, lifetime, fluorescence resonance energy transfer (FRET) and fluorescence correlation spectroscopy (FCS) at single molecule level. Second, I will present a study of light-harvesting complexes at room temperature with this system. The fluctuating inter-molecule protein energy transfer in bacterial photosynthetic membranes was observed. The results suggest that there are two states (dynamic coupled and non-coupled states) of the light-harvesting protein assemblies in photosynthetic membranes.
399. Joint HET/RIKEN/YITP Seminar
"On the Interplay of B and Higgs Physics in Minimal Supersymmetric Models"
Presented by Carlos Wagner, Argonne National Laboratory
Wednesday, January 31, 2007, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Hooman Davoudiasl
400. Joint HET/RIKEN/YITP Seminar
"The Pentagon Model of TeV Scale Physics"
Presented by Tom Banks, UC, Santa Cruz and Rutgers University
Wednesday, December 6, 2006, 1:30 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
401. Joint HET/RIKEN/YITP Seminar
"Using Effective Field Theory to determine discretization errors in the spectrum of the lattice Dirac operator"
Presented by Steve Sharpe, University of Washington
Wednesday, November 15, 2006, 2 pm
Small Seminar Room, Bldg. 510
Hosted by: Amarjit Soni
402. Center for Functional Nanomaterials Seminar
"Developing Novel Synthetic Biomaterials"
Presented by Sergey Paramonov, Rice University
Monday, July 17, 2006, 10 am
John Dunn Seminar Room, Bldg. 463
Hosted by: Oleg Gang
403. Condensed-Matter Physics & Materials Science Seminar
"Correlated Electron Heterostructures"
Presented by Andrew Millis, Columbia University
Tuesday, January 10, 2006, 10 am
Small seminar room, Bldg. 510
404. Center for Functional Nanomaterials Seminar
"Heterogeneous Catalyst Modeling and Screening from First Principles"
Presented by Jeff Greeley, Technical University of Denmark, Denmark
Wednesday, January 4, 2006, 11 am
Hamilton Seminar Room, Bldg. 555
Hosted by: Jim Davenport
405. Particle Physics Seminar
"Determining the Neutrino Mixing Angle Theta13 with the Daya Bay Nuclear Power Plants"
Presented by Kam-Biu Luk, U.C. - Berkeley
Friday, November 4, 2005, 9:30 am
Small Seminar Room, Bldg. 510
Hosted by: Laurie Littenberg
Besides being a fundamental constant of Nature, the unknown neutrino mixing angle theta_13 will determine whether we can explore CP violation in the lepton sector, which holds the promise of explaining the matter-antimatter asymmetry of the Universe. The Daya Bay nuclear power plants in China have been identified as an excellent site for mounting an experiment for determining sin^2(2theta_13) with a sensitivity to 0.01, using electron antineutrinos from the reactors. The status of the Daya Bay experiment will be presented.
406. Nuclear Physics Seminar
"High Statistics Search for Theta^+ in Photon Production Reactions on Deuterium"
Presented by Tsutomu Mibe, Ohio State University, Japan
Tuesday, September 6, 2005, 11 am
Small Seminar Room, Bldg. 510
Hosted by: Werner Vogelsang
A signature indicating the existence of the S=+1 pentaquark state Theta^+ has been reported in more than ten experiments in a variety of reactions. On the other hand, there are a number of reports of non-observations from high statistics experiments. The main criticism for the existence of the Theta^+ is the low statistical significance. None of the positive results show a high significance with sufficient statistics. A new experiment to search for the Theta^+ in the photon-induced production on a deuteron has been pursued using the CLAS detector and the tagged-photon facility at Jefferson Laboratory. The integrated luminosity of the new data is about 10 times greater than the previously published CLAS data on a deuterium target. In this talk, an experimental overview and preliminary results will be presented.
407. Center for Functional Nanomaterials Seminar
"Experimental Catalysis at the Nanoscale - The Application of Novel Synthetic Strategies for Fundamental Studies of Oxygen Reduction Electrocatalysts"
Wednesday, May 4, 2005, 10 am
Chemistry Bldg., Third Floor Conference Room 300
Hosted by: Bob Hwang
408. Medical Department Seminar
"Imaging d-amphetamine Effects in Healthy Volunteers: Drug Effects on fMRI Brain Responses to a Novel Impulsivity/risk Task (BART) and Emotional Picture Task (IAPS)"
Presented by Tara L. White, Brown University Providence, RI
Thursday, April 21, 2005, 1:30 pm
Large Conference Room, Bldg. 490
Hosted by: Rita Goldstein
Clinical evidence suggests that impulsivity increases after drug consumption in addicted individuals. This increase in impulsive behavior could facilitate the transition to drug abuse through increased drug exposure in vulnerable individuals. To date, however, brain mechanisms involved in the effects of drugs on impulsive behavior have not been well studied in healthy, nonaddicted subjects. Objective: The present fMRI study was designed to determine the brain regions involved in acute drug effects on impulsive behavior and emotion, as measured during a newly developed computerized measure of risk-taking behavior (Balloon Analogue Risk Task, BART) and emotional pictures from the International Affective Picture Set (IAPS). Method: Participants received d-amphetamine (20 mg oral) or placebo 90 minutes prior to fMRI scanning and performance of the BART impulsivity/risk task and IAPS picture set in a double-blind, within-subjects design. Participants were preselected based on personality traits that have been found to modulate the effects of the drug in other samples, as assessed by a standardized personality inventory with an orthogonal factor structure (Multidimensional Personality Questionnaire, Brief Form). Findings: d-amphetamine significantly altered fMRI activation in the limbic thalamus, anterior cingulate, and nucleus accumbens during high reward blocks compared to low reward blocks of the behavioral impulsivity/ risk task. D-amphetamine also decreased amygdala responses to negatively valenced blocks of the IAPS emotional picture task. These data suggest that d-amphetamine selectively shifts brain processing toward high reward, high risk stimuli and away from low reward, low risk alternatives. Individual differences in fMRI responses to amphetamine were also observed, and were found to relate primarily to the stable personality traits of reward sensitivity, harm avoidance, and stress reactivity. Potential findings with regard to SERT and DRD4 polymorphism
409. Center for Functional Nanomaterials Seminar
"Homo-and-Hetero-Nuclear Correlation Solid-State NMR Spectroscopy; Applications to Heterogeneous Catalysts and Nanoscale Materials"
Presented by Marek Pruski, Ames Laboratory
Friday, April 15, 2005, 10 am
Hamilton Seminar Room, Bldg. 555
Hosted by: Bob Hwang
410. Center for Functional Nanomaterials Seminar
"Applications of Imaging Techniques in Heterogeneous Catalysis - From Non-linear Dynamics of Chemical Reactions to Parallel High-Throughput Studies"
Presented by Jochen Lauterbach, University of Delaware
Tuesday, April 5, 2005, 1:30 pm
Hamilton Seminar Room, Bldg. 555
Hosted by: Bob Hwang
411. Particle Physics Seminar
"Measuring the Neutrino Theta_13 with Double Chooz"
Presented by John LoSecco, University of Notre Dame
Thursday, March 24, 2005, 11 am
Small Seminar Room, Bldg. 510
Hosted by: Mary Bishai
A reactor anti-neutrino disappearance experiment with two or more detectors is one of the most efficient ways to extend our reach for the neutrino mixing angle theta_13 without ambiguities from CP violation and matter effects. Double Chooz is a experiment designed to reach a sensitivity of sin^2(2*theta_13) < 0.03 in a three year run, 2008-2011. This would cover roughly 85% of the remaining allowed region. The costs and time to first results can be minimized since this project takes advantage of an exiting infrastructure.
412. Center for Functional Nanomaterials Seminar
"Applications of Imaging Techniques in Heterogeneous Catalysis - From Non-Linear Dynamics of Chemical Reactions to Parallel High-Throughput Studies"
Presented by Jochen Lauterbach, University of Delaware
Monday, February 28, 2005, 11 am
Hamilton Seminar Room, Bldg. 555
Hosted by: Robert Hwang
413. Chemistry Department Seminar
"Density functional studies in heterogeneous catalysis and nanoscience"
Presented by Ping Liu, Chemistry Department, BNL
Wednesday, February 9, 2005, 11 am
Hamilton Seminar Room, Bldg. 555
Hosted by: Jon Hanson
Density functional theory has reached a level where it can be used to describe complete catalytic reactions on both surfaces and nanoparticles. This gives a basic insight into these processes, and it allows us to pinpoint the origin of the catalytic activity of the material. The reactions involving in PEM fuel cell and hydrodesulfurization are used to exemplify the approach. It will be shown that by combining density functional calculations with kinetic modeling we can well predict the catalytic activities of different systems. This provides a strong basis for rational catalyst design.
414. Center for Functional Nanomaterials Seminar
"First-Principles Methods in Heterogeneous Catalysis: From Resolving Mechanistic Puzzles to Identifying Promising Catalysts"
Presented by Manos Mavrikakis, University of Wisconsin
Thursday, December 9, 2004, 11 am
John Dunn Seminar Room, Bldg. 463
415. Medical Department Seminar
"Anesthetic Neurotoxicity"
Presented by Andrew Kofke, Department of Anesthesia, University of Pennsylvania, Philadelphia
Thursday, February 26, 2004, 1:30 pm
Large Conference Room, Bldg. 490
416. Medical Department Seminar
"Synthetic Cytokine Analogs: II. Tissue Engineering"
Presented by Louis Pena, Brookhaven National Laboratory, Medical Department
Thursday, January 29, 2004, 1:30 pm
Large Conference Room, Bldg. 490
417. Medical Department Seminar
"Synthetic Cytokine Analogs: I. Radiation Protection"
Presented by Louis Pena, Brookhaven National Laboratory, Medical Department
Thursday, January 22, 2004, 1:30 pm
John Dunn Seminar Room, Bldg. 463
418. Materials Science Department Seminar
"Size Effects in Nanoscale Ferroelectric Heterostructures"
Presented by Nagarajan Valanoor, Forschungzentrum Juelich, Germany
Tuesday, November 25, 2003, 11 am
Hamilton Seminar Room, Bldg. 555
419. Center for Functional Nanomaterials Seminar
"Universality in Heterogeneous Catalysis"
Presented by J.K. Norskov, Center for Atomic-Scale Materials Physics, Technical University of Denmark
Wednesday, November 5, 2003, 9:30 am
Hamilton Seminar Room, Bldg. 555
420. Medical Department Seminar
"Pathophysiologic Heterogeneity and Cholinergic Mechanisms in Alzheimers Disease"
Presented by Isak Prohovnik,, Department of Psychiatry, Mount Sinai School of Medicine
Thursday, October 23, 2003, 1:30 pm
Large Conference Room, Bldg. 490 | 2019-03-26T17:06:06 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.3902723491191864, "perplexity": 10185.132174380231}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912205597.84/warc/CC-MAIN-20190326160044-20190326182044-00176.warc.gz"} |
https://par.nsf.gov/biblio/10361642-galaxy-velocity-bias-cosmological-simulations-towards-per-cent-level-calibration | Galaxy velocity bias in cosmological simulations: towards per cent-level calibration
ABSTRACT
Galaxy cluster masses, rich with cosmological information, can be estimated from internal dark matter (DM) velocity dispersions, which in turn can be observationally inferred from satellite galaxy velocities. However, galaxies are biased tracers of the DM, and the bias can vary over host halo and galaxy properties as well as time. We precisely calibrate the velocity bias, bv – defined as the ratio of galaxy and DM velocity dispersions – as a function of redshift, host halo mass, and galaxy stellar mass threshold ($M_{\rm \star , sat}$), for massive haloes ($M_{\rm 200c}\gt 10^{13.5} \, {\rm M}_\odot$) from five cosmological simulations: IllustrisTNG, Magneticum, Bahamas + Macsis, The Three Hundred Project, and MultiDark Planck-2. We first compare scaling relations for galaxy and DM velocity dispersion across simulations; the former is estimated using a new ensemble velocity likelihood method that is unbiased for low galaxy counts per halo, while the latter uses a local linear regression. The simulations show consistent trends of bv increasing with M200c and decreasing with redshift and $M_{\rm \star , sat}$. The ensemble-estimated theoretical uncertainty in bv is 2–3 per cent, but becomes percent-level when considering only the three highest resolution simulations. We update the mass–richness normalization for an SDSS more »
Authors:
; ; ; ; ; ; ; ; ; ;
Publication Date:
NSF-PAR ID:
10361642
Journal Name:
Monthly Notices of the Royal Astronomical Society
Volume:
510
Issue:
2
Page Range or eLocation-ID:
p. 2980-2997
ISSN:
0035-8711
Publisher:
Oxford University Press
1. ABSTRACT We quantify the impact of galaxy formation on dark matter halo shapes using cosmological simulations at redshift z = 0. Using magnetohydrodynamic simulations from the IllustrisTNG project, we focus on haloes of mass $10^{10\!-\!14} \, \rm M_{\odot }$ from the 50 Mpc (TNG50) and 100 Mpc (TNG100) boxes and compare them to dark matter-only (DMO) analogues and other simulations, e.g. Numerical Investigation of a Hundred Astrophysical Objects (NIHAO) and Evolution and Assembly of GaLaxies and their Environments (EAGLE). We further quantify the prediction uncertainty by varying the feedback models using smaller 25 ${\rm Mpc}\, h^{-1}$ boxes. We find that (i) galaxy formation results in rounder haloes compared to DMO simulations, in qualitative agreement with past results. Haloes of mass ${\approx }2\times 10^{12} \, \rm M_{\odot }$ are most spherical, with an average minor-to-major axial ratio of $\langle s \rangle$ ≈ 0.75 in the inner halo, an increase of 40 per cent compared to their DMO counterparts. No significant difference is present for low-mass $10^{10} \, \rm M_{\odot }$ haloes; (ii) stronger feedback, e.g. increasing galactic wind speed, reduces the impact of baryons; (iii) the inner halo shape correlates with the stellar mass fraction, explaining the dependence of halo shapes on feedback models; and (iv) the fiducialmore »
2. ABSTRACT The free-streaming length of dark matter depends on fundamental dark matter physics, and determines the abundance and concentration of dark matter haloes on sub-galactic scales. Using the image positions and flux ratios from eight quadruply imaged quasars, we constrain the free-streaming length of dark matter and the amplitude of the subhalo mass function (SHMF). We model both main deflector subhaloes and haloes along the line of sight, and account for warm dark matter free-streaming effects on the mass function and mass–concentration relation. By calibrating the scaling of the SHMF with host halo mass and redshift using a suite of simulated haloes, we infer a global normalization for the SHMF. We account for finite-size background sources, and marginalize over the mass profile of the main deflector. Parametrizing dark matter free-streaming through the half-mode mass mhm, we constrain the thermal relic particle mass mDM corresponding to mhm. At $95 \, {\rm per\, cent}$ CI: mhm < 107.8 M⊙ ($m_{\rm {DM}} \gt 5.2 \ \rm {keV}$). We disfavour $m_{\rm {DM}} = 4.0 \,\rm {keV}$ and $m_{\rm {DM}} = 3.0 \,\rm {keV}$ with likelihood ratios of 7:1 and 30:1, respectively, relative to the peak of the posterior distribution. Assuming cold dark matter, we constrainmore »
3. ABSTRACT Galaxy–galaxy lensing is a powerful probe of the connection between galaxies and their host dark matter haloes, which is important both for galaxy evolution and cosmology. We extend the measurement and modelling of the galaxy–galaxy lensing signal in the recent Dark Energy Survey Year 3 cosmology analysis to the highly non-linear scales (∼100 kpc). This extension enables us to study the galaxy–halo connection via a Halo Occupation Distribution (HOD) framework for the two lens samples used in the cosmology analysis: a luminous red galaxy sample (redmagic) and a magnitude-limited galaxy sample (maglim). We find that redmagic (maglim) galaxies typically live in dark matter haloes of mass log10(Mh/M⊙) ≈ 13.7 which is roughly constant over redshift (13.3−13.5 depending on redshift). We constrain these masses to ${\sim}15{{\ \rm per\ cent}}$, approximately 1.5 times improvement over the previous work. We also constrain the linear galaxy bias more than five times better than what is inferred by the cosmological scales only. We find the satellite fraction for redmagic (maglim) to be ∼0.1−0.2 (0.1−0.3) with no clear trend in redshift. Our constraints on these halo properties are broadly consistent with other available estimates from previous work, large-scale constraints, and simulations. The framework built in this paper willmore »
4. ABSTRACT Cosmological constraints from current and upcoming galaxy cluster surveys are limited by the accuracy of cluster mass calibration. In particular, optically identified galaxy clusters are prone to selection effects that can bias the weak lensing mass calibration. We investigate the selection bias of the stacked cluster lensing signal associated with optically selected clusters, using clusters identified by the redMaPPer algorithm in the Buzzard simulations as a case study. We find that at a given cluster halo mass, the residuals of redMaPPer richness and weak lensing signal are positively correlated. As a result, for a given richness selection, the stacked lensing signal is biased high compared with what we would expect from the underlying halo mass probability distribution. The cluster lensing selection bias can thus lead to overestimated mean cluster mass and biased cosmology results. We show that the lensing selection bias exhibits a strong scale dependence and is approximately 20–60 per cent for ΔΣ at large scales. This selection bias largely originates from spurious member galaxies within ±20–60 $h^{-1}\, \rm Mpc$ along the line of sight, highlighting the importance of quantifying projection effects associated with the broad redshift distribution of member galaxies in photometric cluster surveys. While our results qualitatively agree withmore » | 2023-03-23T08:43:55 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5475785136222839, "perplexity": 2975.7566452670862}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296945030.59/warc/CC-MAIN-20230323065609-20230323095609-00197.warc.gz"} |
https://www.pnnl.gov/explainer-articles?explainer-articles%5B0%5D=research-topic%3A80&explainer-articles%5B1%5D=research-topic%3A89 | 2 results found
Filtered by Geothermal Energy and Computational Mathematics & Statistics
SEPTEMBER 27, 2022
### Renewable Integration
Renewable integration is the process of plugging renewable sources of energy into the electric grid.
SEPTEMBER 30, 2021 | 2022-12-05T08:52:01 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9510011076927185, "perplexity": 5525.215149697601}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711013.11/warc/CC-MAIN-20221205064509-20221205094509-00071.warc.gz"} |
https://www.nist.gov/publications/survey-binary-covering-arrays?pub_id=51256 | A Survey of Binary Covering Arrays
Published: April 07, 2011
Author(s)
James F. Lawrence, Raghu N. Kacker, Yu Lei, David R. Kuhn, Michael Forbes
Abstract
Two-valued covering arrays of strength t are 0--1 matrices having the property that for each t columns and each of the possible 2t sequences of t 0's and 1's, there exists a row having that sequence in that set of t columns. Covering arrays are an important tool in certain applications, for example, in software testing. In these applications, the number of columns of the matrix is dictated by the application, and it is desirable to have a covering array with a small number of rows. Here we survey some of what is known about the existence and production of two-valued covering arrays.
Citation: Electronic Journal of Combinatorics
Volume: 18
Issue: 1
Pub Type: Journals | 2019-02-16T22:32:23 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8114110827445984, "perplexity": 570.8278271426193}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-09/segments/1550247481122.31/warc/CC-MAIN-20190216210606-20190216232412-00015.warc.gz"} |
https://conferences.lbl.gov/event/195/contributions/1050/ | # RIKEN Berkeley Workshop: Quantum Information Science
25-29 January 2019
LBL-Hill
US/Pacific timezone
## Opportunities for Quantum Information Research Using Angle-Resolved Photoemission Spectroscopy
27 Jan 2019, 17:00
25m
Building 66- Auditorium (LBL-Hill)
### Building 66- Auditorium
#### LBL-Hill
Lawrence Berkeley National Lab Berkeley, California
Condensed matter applications
### Speaker
Dr Eli Rotenberg (LBNL)
### Description
Angle-resolved photoemission spectroscopy (ARPES) is a premier tool for determining the charged excited states of quantum materials. It directly measures the single particle spectral function $A(k,\omega)$ that encodes the renormalized lifetime and energy of quasiparticle states as a function of momentum ($k$) and energy ($\omega$). ARPES is complementary to both scanning tunneling microscopy (STM), which does not access the Bloch quantum numbers $k$, and transport measurements which are sensitive to excited states only near $\omega=0$. In addition, ARPES is a highly sensitive probe of the symmetry of itinerant Bloch states. Therefore, ARPES plays a key role in understanding the fundamental properties of emergent ground states in complex materials such as superconductors, 2D, and topological materials, all of which have potential applications in quantum information science. In this talk I will present a review of recent studies of candidate materials for quantum information at the ALS, and in particular I will focus on efforts to enhance spatial resolution, low temperature performance, and *in situ* sample preparation. These abilities will allow ARPES to provide fundamental information for quantum materials not only in pure materials, but also in practical forms such as devices and with tailored surface properties.
### Primary author
Dr Eli Rotenberg (LBNL)
### Presentation Materials
There are no materials yet. | 2022-06-28T06:42:21 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.3828212320804596, "perplexity": 3067.3989015581565}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-27/segments/1656103355949.26/warc/CC-MAIN-20220628050721-20220628080721-00306.warc.gz"} |
https://par.nsf.gov/biblio/10360979-pg-rqs-survey-building-radio-spectral-distribution-radio-quiet-quasars-ghz-data | The PG-RQS survey. Building the radio spectral distribution of radio-quiet quasars. I. The 45-GHz data
ABSTRACT
The origin of the radio emission in radio-quiet quasars (RQQs) remains unclear. Radio emission may be produced by a scaled-down version of the relativistic jets observed in radio-loud (RL) AGN, an AGN-driven wind, the accretion disc corona, AGN photon-ionization of ambient gas (free–free emission), or star formation (SF). Here, we report a pilot study, part of a radio survey (‘PG-RQS’) aiming at exploring the spectral distributions of the 71 Palomar–Green (PG) RQQs: high angular resolution observations (∼50 mas) at 45 GHz (7 mm) with the Karl G. Jansky Very Large Array of 15 sources. Sub-mJy radio cores are detected in 13 sources on a typical scale of ∼100 pc, which excludes significant contribution from galaxy-scale SF. For 9 sources the 45-GHz luminosity is above the lower frequency (∼1–10 GHz) spectral extrapolation, indicating the emergence of an additional flatter-spectrum compact component at high frequencies. The X-ray luminosity and black hole (BH) mass, correlate more tightly with the 45-GHz luminosity than the 5-GHz. The 45 GHz-based radio-loudness increases with decreasing Eddington ratio and increasing BH mass MBH. These results suggest that the 45-GHz emission from PG RQQs nuclei originates from the innermost region of the core, probably from the accretion disc corona. Increasing contributions to 45-GHz more »
Authors:
; ; ; ; ; ;
Publication Date:
NSF-PAR ID:
10360979
Journal Name:
Monthly Notices of the Royal Astronomical Society
Volume:
510
Issue:
1
Page Range or eLocation-ID:
p. 1043-1058
ISSN:
0035-8711
Publisher:
Oxford University Press
National Science Foundation
##### More Like this
1. ABSTRACT We examine the 1.4 GHz radio luminosities of galaxies arising from star formation and active galactic nuclei (AGNs) within the state-of-the-art cosmological hydrodynamic simulation Simba. Simba grows black holes via gravitational torque limited accretion from cold gas and Bondi accretion from hot gas, and employs AGN feedback including jets at low Eddington ratios. We define a population of radio loud AGNs (RLAGNs) based on the presence of ongoing jet feedback. Within RLAGN, we define high and low excitation radio galaxies (HERGs and LERGs) based on their dominant mode of black hole accretion: torque limited accretion representing feeding from a cold disc, or Bondi representing advection-dominated accretion from a hot medium. Simba predicts good agreement with the observed radio luminosity function (RLF) and its evolution, overall as well as separately for HERGs and LERGs. Quiescent galaxies with AGN-dominated radio flux dominate the RLF at $\gtrsim 10^{22-23}$ W Hz−1, while star formation dominates at lower radio powers. Overall, RLAGNs have higher black hole accretion rates and lower star formation rates than non-RLAGN at a given stellar mass or velocity dispersion, but have similar black hole masses. Simba predicts an LERG number density of 8.53 Mpc−3, ∼10× higher than for HERGs, broadly as observed. While LERGs dominate amongmore »
2. ABSTRACT
We present new 5 GHz Very Large Array observations of a sample of eight active intermediate-mass black holes with masses 104.9 M⊙ < M < 106.1 M⊙ found in galaxies with stellar masses M* < 3 × 109 M⊙. We detected five of the eight sources at high significance. Of the detections, four were consistent with a point source, and one (SDSS J095418.15+471725.1, with black hole mass M < 105 M⊙) clearly shows extended emission that has a jet morphology. Combining our new radio data with the black hole masses and literature X-ray measurements, we put the sources on the Fundamental Plane of black hole accretion. We find that the extent to which the sources agree with the Fundamental Plane depends on their star-forming/composite/active galactic nucleus (AGN) classification based on optical narrow emission-line ratios. The single star-forming source is inconsistent with the Fundamental Plane. The three composite sources are consistent, and three of the four AGN sources are inconsistent with the Fundamental Plane. We argue that this inconsistency is genuine and not a result of misattributing star formation to black hole activity. Instead, we identify the sources in our sample that have AGN-like optical emission-line ratios as not following the Fundamental Plane and thus cautionmore »
3. ABSTRACT We present a multiwavelength analysis of 28 of the most luminous low-redshift narrow-line, ultra-hard X-ray-selected active galactic nuclei (AGN) drawn from the 70-month Swift/BAT all-sky survey, with bolometric luminosities of $\log (L_{\rm bol} /{\rm erg\, s}^{-1}) \gtrsim 45.25$. The broad goal of our study is to determine whether these objects have any distinctive properties, potentially setting them aside from lower luminosity obscured AGN in the local Universe. Our analysis relies on the first data release of the BAT AGN Spectroscopic Survey (BASS/DR1) and on dedicated observations with the VLT, Palomar, and Keck observatories. We find that the vast majority of our sources agree with commonly used AGN selection criteria which are based on emission line ratios and on mid-infrared colours. Our AGN are pre-dominantly hosted in massive galaxies (9.8 ≲ log (M*/M⊙) ≲ 11.7); based on visual inspection of archival optical images, they appear to be mostly ellipticals. Otherwise, they do not have distinctive properties. Their radio luminosities, determined from publicly available survey data, show a large spread of almost four orders of magnitude – much broader than what is found for lower X-ray luminosity obscured AGN in BASS. Moreover, our sample shows no preferred combination of black hole massesmore »
4. ABSTRACT
We present general relativistic radiation magnetohydrodynamics (GRRMHD) simulations of super-Eddington accretion flows around supermassive black holes (SMBHs), which may apply to tidal disruption events (TDEs). We perform long duration ($t\ge 81,200\, GM/c^3$) simulations that achieve mass accretion rates ≳11 times the Eddington rate and produce thermal synchrotron spectra and images of their jets. Gas flowing beyond the funnel wall expands conically and drives a strong shock at the jet head while variable mass ejection and recollimation, along the jet axis, results in internal shocks and dissipation. Assuming the ion temperature (Ti) and electron temperature (Te) in the plasma are identical, the radio/submillimetre spectra peak at >100 GHz and the luminosity increases with BH spin, exceeding $\sim 10^{41} \, \rm {erg\, s^{-1}}$ in the brightest models. The emission is extremely sensitive to Ti/Te as some models show an order-of-magnitude decrease in the peak frequency and up to four orders-of-magnitude decline in their radio/submillimetre luminosity as Ti/Te approaches 20. Assuming a maximum VLBI baseline distance of 10 Gλ, 230 GHz images of Ti/Te = 1 models shows that the jet head may be bright enough for its motion to be captured with the EHT (ngEHT) at D ≲ 110 (180) Mpc at the 5σ significance level.more »
5. Abstract
We present the analysis of ∼100 pc scale compact radio continuum sources detected in 63 local (ultra)luminous infrared galaxies (U/LIRGs;LIR≥ 1011L), using FWHM ≲ 0.″1–0.″2 resolution 15 and 33 GHz observations with the Karl G. Jansky Very Large Array. We identify a total of 133 compact radio sources with effective radii of 8–170 pc, which are classified into four main categories—“AGN” (active galactic nuclei), “AGN/SBnuc” (AGN-starburst composite nucleus), “SBnuc” (starburst nucleus), and “SF” (star-forming clumps)—based on ancillary data sets and the literature. We find that “AGN” and “AGN/SBnuc” more frequently occur in late-stage mergers and have up to 3 dex higher 33 GHz luminosities and surface densities compared with “SBnuc” and “SF,” which may be attributed to extreme nuclear starburst and/or AGN activity in the former. Star formation rates (SFRs) and surface densities (ΣSFR) are measured for “SF” and “SBnuc” using both the total 33 GHz continuum emission (SFR ∼ 0.14–13Myr−1, ΣSFR∼ 13–1600Myr−1kpc−2) and the thermal free–free emission from Hiiregions (median SFRth∼ 0.4Myr−1,$ΣSFRth∼44M⊙$yr−1kpc−2). These values are 1–2 dex higher than those measured for similar-sized clumps in nearby normal (non-U/LIRGs). The latter also have a much flatter median 15–33 GHz spectral index (∼−0.08) compared withmore » | 2023-03-24T05:28:18 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 1, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6559125781059265, "perplexity": 5251.144115985866}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-14/segments/1679296945248.28/warc/CC-MAIN-20230324051147-20230324081147-00350.warc.gz"} |
https://fuse.education.vic.gov.au/MCC/CurriculumItem?code=VCMNA307 | Skip to Content
Set structures - Maths Curriculum Companion - Department of Education & Training
## Teaching Context
### Victorian Curriculum
Apply set structures to solve real-world problems (VCMNA307)
VCAA Sample Program: A set of sample programs covering the Victorian Curriculum Mathematics.
VCAA Mathematics glossary: A glossary compiled from subject-specific terminology found within the content descriptions of the Victorian Curriculum Mathematics.
##### Achievement standards
Students apply the index laws using integer indices to variables and numbers, express numbers in scientific notation, solve problems involving very small and very large numbers, and check the order of magnitude of calculations. They solve problems involving simple interest.
Students use the distributive law to expand algebraic expressions, including binomial expressions, and simplify a range of algebraic expressions. They find the distance between two points on the Cartesian plane and the gradient and midpoint of a line segment using a range of strategies including the use of digital technology.
Students sketch and draw linear and non-linear relations, solve simple related equations and explain the relationship between the graphical and symbolic forms, with and without the use of digital technology.
## Teaching ideas
### Median age
Tab Content
Working in small groups, students will find the median age of the sample group they are given. Before beginning the task discuss the meaning of ‘median’. i.e. the middle value of a set of data, when the data is placed from smallest to largest. Provide some examples.
Assign each group a different sorting technique. Provide an explanation of their assigned technique, and allow them time to discuss it within their group so that all members understand. When they are ready, provide the data (collection of ages) and instruct them to begin.
Here are the ages of people in a town:
{2, 5, 9, 19, 24, 54, 5, 87, 9, 10, 44, 32, 21, 13, 24, 18, 26, 16, 19, 25, 39, 47, 56, 71, 91, 61, 44, 28} Explain that this is a set of ages which is represented using curly brackets.
Each group will use their technique to sort the data and find the median. Once they have completed this give each group a new set of numbers to sort. They may either use the same technique or they could select a technique.
Explanations of different techniques:
Two sorters:
This sorting technique uses two people (or two groups of people) to sort the data. The first group finds the lowest number and places it at the start. This process is repeated. The second group finds the highest number and places it at the end and then repeats this process. Once in order, they are able to find the median.
Easy quick sort:
First choose an age that you think is close to the middle. Then organise the numbers according to whether each is “higher” or “lower” than that number. Now put the numbers in order. Once in order, they are able to find the median.
Insertion sort:
Select one data item and write it in the middle of a piece of paper. Considering each data value one at a time decide where it belongs in relation to the list established and place it accordingly. Repeat this until all data is sorted. Once in order, they are able to find the median.
Individual:
Give each person in the group the same (or similar) number of items to sort. Each person sorts their data. They then come together to place all the data in order and consequently find the median.
As a class, discuss the pros and cons of each technique.
### Book sorting
Tab Content
Watch the video ‘What’s the fastest way to alphabetiseyour bookshelf?
Ask each student to bring 3 to 4 novels from home, or alternative bring a collection of different books into the class from the school library.
In small groups, ask students to use one of the sorting techniques from the video to arrange the books in alphabetical order. After they have completed one sort, ask them to do the same task using a different technique from the video.
Once students are familiar with one or more different sorting techniques, ask the class to work together to sort other things. For example, sort the class into height order, muesli bars into number of kilojoules, or the names of students in the class into alphabetical order.
As a class discuss which sorting technique worked best for each task.
### Sample proportions
Tab Content
Students will look at sample proportion for a large number of samples of various sizes.
Before you begin this activity review definitions of the following terms:
• Sample – part of a population
• Population – all the items being considered
• Proportion – a number of a particular item in comparison to the whole. For example, I have 100 marbles and 31 of them are red. The proportion of red marbles = 31/100 = 0.31 or 31%.
Gather a large selection (around 100) of a common object (e.g. marbles). Define a success (e.g. red marble) and a failure (e.g. not a red marble).
Ask students to perform many sampling experiments using various sample sizes. For example, students do 10 experiments with a sample size of 5, then 10 experiments with a sample size of 10 and so on. Record the results in a table. See the example below.
Discuss their findings. Which sample size is more accurate? Why? Students will learn that the closer a sample size is to the population size the more closely it represents the population.
Discuss how this activity is connected to real world sampling using examples such as television ratings and political polls. These values are used to represent the population, but only a sample of the population is used. Are they accurate? | 2021-04-16T11:48:05 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 1, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.35267239809036255, "perplexity": 687.0486526694253}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": false}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038056325.1/warc/CC-MAIN-20210416100222-20210416130222-00034.warc.gz"} |
https://www.lessonplanet.com/teachers/subtracting-mixed-numbers-math-5th-6th | # Subtracting Mixed Numbers
According to Sal, there are two ways to subtract mixed numbers. One can turn both mixed numbers into improper fractions, or one can subtract the whole number parts and then the fraction parts. Sal shows the step-by-step process to subtract mixed numbers by subtracting the whole numbers first and then the fraction portions last.
Concepts
Resource Details
5th - 6th
Subjects
Math
2 more...
Resource Types
Videos
1 more...
Instructional Strategy
Flipped Classroom
Usage Permissions
Creative Commons
BY-NC-SA: 3.0 | 2018-10-24T01:37:51 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8249978423118591, "perplexity": 5945.271840747978}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 20, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2018-43/segments/1539583517628.91/warc/CC-MAIN-20181024001232-20181024022732-00318.warc.gz"} |
https://www.zbmath.org/authors/?q=ai%3Ayau.stephen-shing-toung | # zbMATH — the first resource for mathematics
## Yau, Stephen Shing-Toung
Compute Distance To:
Author ID: yau.stephen-shing-toung Published as: Yau, S.; Yau, S. S.-T.; Yau, S. T.; Yau, Stephen; Yau, Stephen S. -T.; Yau, Stephen S. -t.; Yau, Stephen S. T.; Yau, Stephen S.-T.; Yau, Stephen Shing-Toung; Yau, Stephen T. Homepage: http://homepages.math.uic.edu/~yau/publications.html External Links: MGP · Wikidata · ORCID · dblp · GND
Documents Indexed: 252 Publications since 1977, including 9 Books Biographic References: 3 Publications
all top 5
#### Co-Authors
41 single-authored 37 Zuo, Huaiqing 20 Luk, Hingsun 13 Luo, Xue 12 Lin, Ke-Pao 12 Yau, Shing-Tung 9 Du, Rong 9 Xu, Yijing 9 Yu, Yung 7 Chen, Hao 7 Chiou, Wen-Lin 7 Jiang, Tan 7 Zhang, Qinglong 6 Wong, Wing Shing 6 Yin, Changchuan 5 Chen, Jie 5 Hussain, Naveed 5 Shi, Ji 4 Chen, Bingyi 4 Hu, Guoqing 4 Huang, Xiaojun 4 Tan, Sheng-Li 4 Wu, Xi 3 Chang, Der-Chen E. 3 Chen, Xiuqiong 3 Gao, Yun 3 Libgober, Anatoly S. 3 Seeley, Craig 3 Wang, Shaobo 3 Xie, Dan 3 Ye, Fei 3 Yu, Chenglong 3 Zhang, Mingyi 2 Bennett, Bruce M. 2 Benson, Max 2 Calin, Ovidiu L. 2 Chang, Shikuo 2 Cheng, Hon-Wing 2 Chiueh, Woei-Ren 2 Deng, Mo 2 Dong, Ruitao 2 He, Ronglu 2 Ji, Shanyu 2 Jia, Lixing 2 Jiao, Yang 2 Jin, Ning 2 Lawson, Herbert Blaine jun. 2 Lucy He, Rong 2 Mather, John N. 2 Rasoulian, Amid 2 Tam, Luen-Fai 2 Wong, Bun 2 Yeh, Larn-Ying 2 Zhang, Letian 2 Zhao, Linda 2 Zheng, Hui 1 Baillieul, John B. 1 Baouendi, Mohammed Salah 1 Baras, John S. 1 Berhanu, Shiferaw 1 Bielecki, Tomasz R. 1 Bloch, Anthony M. 1 Chen, Hua 1 Chen, Irene A. 1 Chen, Ying 1 Chen, Zhijie J. 1 Cheng, Shiu-Yuen 1 Cheung, Wing-Sum 1 Chiu, Mei Hui 1 Chung Graham, Fan-Rong King 1 Ding, Junfeng 1 Du, Ruxu 1 Duan, Victor 1 Gao, Zhiquan 1 Guo, Lei 1 Hoang, Tung 1 Hounie, Jorge G. 1 Hsu, Chung-Lin 1 Hu, Chuangqiang 1 Huang, Jie 1 Jiao, Xiaopei 1 Kang, Ming-Chang 1 Krishnaprasad, P.s. 1 Kuo, Wei Liang 1 Lai, Yuen-Tai 1 Leung, Chi-wah 1 Leung, Chih-Wah 1 Liang, Andrew 1 Liang, Zhigang 1 Lin, Enbing 1 Lin, Shaopu 1 Liu, Shuai 1 Lu, Qikeng 1 Ma, Guorui 1 Mostow, George Daniel 1 Pei, Shaojun 1 Raghuvanshi, Sarvasva 1 Sampson, Joseph H. 1 Shi, Jianyi 1 Singer, Isadore M. 1 Siu, Yum-Tong ...and 28 more Co-Authors
all top 5
#### Serials
15 Communications in Information and Systems 12 American Journal of Mathematics 12 Journal of Differential Geometry 11 SIAM Journal on Control and Optimization 10 Communications in Analysis and Geometry 9 The Asian Journal of Mathematics 8 IEEE Transactions on Automatic Control 8 Journal of Theoretical Biology 7 International Journal of Control 6 Mathematical Research Letters 6 Science China. Mathematics 5 Journal of Number Theory 5 Pacific Journal of Mathematics 4 Rocky Mountain Journal of Mathematics 4 Journal of the Mathematical Society of Japan 4 Mathematische Nachrichten 4 Mathematische Zeitschrift 4 Transactions of the American Mathematical Society 4 Science in China. Series A 3 Computers & Mathematics with Applications 3 Inventiones Mathematicae 3 Journal of Algebra 3 Journal für die Reine und Angewandte Mathematik 3 Mathematische Annalen 3 Advances in Applied Mathematics 3 Systems & Control Letters 3 Proceedings of the National Academy of Sciences of the United States of America 3 Bulletin of the American Mathematical Society. New Series 3 Pure and Applied Mathematics Quarterly 3 AMS/IP Studies in Advanced Mathematics 2 IEEE Transactions on Information Theory 2 Annali della Scuola Normale Superiore di Pisa. Classe di Scienze. Serie IV 2 Automatica 2 Commentarii Mathematici Helvetici 2 Compositio Mathematica 2 Memoirs of the American Mathematical Society 2 Quarterly of Applied Mathematics 2 Advances in Theoretical and Mathematical Physics 2 Annals of Mathematics. Second Series 2 Journal of the European Mathematical Society (JEMS) 2 Bulletin of the American Mathematical Society 1 Bulletin of the Australian Mathematical Society 1 Arkiv för Matematik 1 Advances in Mathematics 1 Annales Scientifiques de l’École Normale Supérieure. Quatrième Série 1 Applied Mathematics and Computation 1 Applied Mathematics and Optimization 1 Canadian Mathematical Bulletin 1 Duke Mathematical Journal 1 Manuscripta Mathematica 1 Nagoya Mathematical Journal 1 Proceedings of the American Mathematical Society 1 SIAM Journal on Numerical Analysis 1 Mathematical and Computer Modelling 1 MCSS. Mathematics of Control, Signals, and Systems 1 Linear Algebra and its Applications 1 Applicable Algebra in Engineering, Communication and Computing 1 International Journal of Robust and Nonlinear Control 1 Journal of Mathematical Systems, Estimation, and Control 1 Finite Fields and their Applications 1 Methods and Applications of Analysis 1 Contemporary Mathematics 1 Lecture Notes Series, Seoul 1 Surveys in Differential Geometry 1 Nonlinear Analysis. Theory, Methods & Applications
all top 5
#### Fields
124 Several complex variables and analytic spaces (32-XX) 91 Algebraic geometry (14-XX) 50 Systems theory; control (93-XX) 30 Probability theory and stochastic processes (60-XX) 24 Nonassociative rings and algebras (17-XX) 22 Partial differential equations (35-XX) 21 Number theory (11-XX) 17 Convex and discrete geometry (52-XX) 15 Computer science (68-XX) 15 Information and communication theory, circuits (94-XX) 14 Manifolds and cell complexes (57-XX) 13 Biology and other natural sciences (92-XX) 8 Differential geometry (53-XX) 8 Numerical analysis (65-XX) 7 Global analysis, analysis on manifolds (58-XX) 6 General and overarching topics; collections (00-XX) 6 Commutative algebra (13-XX) 4 Combinatorics (05-XX) 4 Dynamical systems and ergodic theory (37-XX) 4 Statistics (62-XX) 3 Quantum theory (81-XX) 2 Group theory and generalizations (20-XX) 2 Measure and integration (28-XX) 2 Special functions (33-XX) 2 Calculus of variations and optimal control; optimization (49-XX) 2 Statistical mechanics, structure of matter (82-XX) 1 History and biography (01-XX) 1 Linear and multilinear algebra; matrix theory (15-XX) 1 Associative rings and algebras (16-XX) 1 Topological groups, Lie groups (22-XX) 1 Ordinary differential equations (34-XX) 1 Harmonic analysis on Euclidean spaces (42-XX) 1 Functional analysis (46-XX) 1 Algebraic topology (55-XX) 1 Mechanics of particles and systems (70-XX)
#### Citations contained in zbMATH
176 Publications have been cited 902 times in 470 Documents Cited by Year
Classification of isolated hypersurface singularities by their moduli algebras. Zbl 0499.32008
Mather, John N.; Yau, Stephen S.-T.
1982
An estimate of the gap of the first two eigenvalues in the Schrödinger operator. Zbl 0603.35070
Singer, I. M.; Wong, Bun; Yau, Shing-Tung; Yau, Stephen S.-T.
1985
Finite dimensional filters with nonlinear drift. I: A class of filters including both Kalman-Bucy filters and Benes filters. Zbl 0811.93059
Yau, Stephen S.-T.
1994
On maximally elliptic singularities. Zbl 0343.32009
Yau, Stephen Shing-Toung
1980
Gorenstein quotient singularities in dimension three. Zbl 0799.14001
Yau, Stephen S.-T.; Yu, Yung
1993
More explicit formulas for the matrix exponential. Zbl 0881.15028
Cheng, Hon-Wing; Yau, Stephen S.-T.
1997
Kohn-Rossi cohomology and its application to the complex Plateau problem. I. Zbl 0464.32012
Yau, Stephen S.-T.
1981
Classification of four-dimensional estimation algebras. Zbl 0958.60040
Yau, Stephen S. T.; Rasoulian, Amid
1999
On a necessary and sufficient condition for finite dimensionality of estimation algebras. Zbl 0694.93103
Tam, Luen-Fai; Wong, Wing Shing; Yau, Stephen S.-T.
1990
Solvability of Lie algebras arising from isolated singularities and nonisolatedness of singularities defined by $$s\ell(2,\mathbb{C})$$ invariant polynomials. Zbl 0747.17012
Yau, Stephen S.-T.
1991
Optimal fast tracking observer bandwidth of the linear extended state observer. Zbl 1115.93018
Yoo, D.; Yau, S. S.-T.; Gao, Z.
2007
Finite-dimensional filters with nonlinear drift. II: Brockett’s problem on classification of finite-dimensional estimation algebras. Zbl 0809.93060
Chiou, Wen-lin; Yau, Stephen S.-T.
1994
Hypersurface weighted dual graphs of normal singularities of surfaces. Zbl 0415.14004
Yau, Stephen Shing-Toung
1979
Diffeomorphic types of the complements of arrangements of hyperplanes. Zbl 0828.57018
Jiang, Tan; Yau, Stephen S.-T.
1994
Durfee conjecture and coordinate free characterization of homogeneous singularities. Zbl 0793.32016
Xu, Yi-Jing; Yau, Stephen S.-T.
1993
A sharp estimate of the number of integral points in a tetrahedron. Zbl 0734.11048
Xu, Yi-Jing; Yau, Stephen S.-T.
1991
Solvable Lie algebras and generalized Cartan matrices arising from isolated singularities. Zbl 0589.17012
Yau, Stephen S.-T.
1986
Hermite spectral method to 1-D forward Kolmogorov equation and its application to nonlinear filtering problems. Zbl 1369.60046
Luo, Xue; Yau, Stephen S.-T.
2013
Finite-dimensional filters with nonlinear drift. IV: Classification of finite-dimensional estimation algebras of maximal rank with state-space dimension 3. Zbl 0847.93062
Chen, Jie; Yau, Stephen S.-T.; Leung, Chih-Wah
1996
Structure and classification theorems of finite-dimensional exact estimation algebras. Zbl 0732.17010
Dong, Rui-Tao; Tam, Luen-Fai; Wong, Wing Shing; Yau, Stephen S.-T.
1991
Rigidity of differentiable structure for new class of line arrangements. Zbl 1115.52010
Wang, Shaobo; Yau, Stephen S.-T.
2005
Variation of complex structures and variation of Lie algebras. Zbl 0666.14002
Seeley, Craig; Yau, Stephen S.-T.
1990
Continuous family of finite-dimensional representations of a solvable Lie algebra arising from singularities. Zbl 0563.17010
Yau, Stephen S.-T.
1983
An example of a real analytic strongly pseudoconvex hypersurface which is not holomorphically equivalent to any algebraic hypersurface. Zbl 1038.32034
Huang, Xiaojun; Ji, Shanyu; Yau, Stephen S. T.
2001
A sharp estimate of the number of integral points in a 4-dimensional tetrahedra. Zbl 0844.11063
Xu, Yi-Jing; Yau, Stephen S.-T.
1996
Topological invariance of intersection lattices of arrangements in $$\mathbb{C}\mathbb{P}^ 2$$. Zbl 0847.52011
Jiang, Tan; Yau, Stephen S.-T.
1993
An upper estimate of integral points in real simplices with an application to singularity theory. Zbl 1185.11062
Yau, Stephen T.; Zhang, Letian
2006
Counting the number of integral points in general $$n$$-dimensional tetrahedra and Bernoulli polynomials. Zbl 1056.11054
Lin, Ke-Pao; Yau, Stephen S.-T.
2003
A sharp upper estimate of the number of integral points in a 5-dimensional tetrahedra. Zbl 0992.11057
Lin, Ke-Pao; Yau, Stephen S.-T.
2002
$$\mathbb Z_8$$-cyclic codes and quadratic residue codes. Zbl 0987.94042
Chiu, Mei Hui; Yau, Stephen S.-T.; Yu, Yung
2000
Intersection lattices and topological structures of complements of arrangements in $$\mathbb{C}\mathbb{P}^2$$. Zbl 0973.32015
Jiang, Tan; Yau, Stephen S.-T.
1998
Micro-local characterization of quasi-homogeneous singularities. Zbl 0927.32022
Xu, Yi-Jing; Yau, Stephen S.-T.
1996
Singularities defined by sl(2,$${\mathbb{C}})$$ invariant polynomials and solvability of Lie algebras arising from isolated singularities. Zbl 0603.32007
Yau, Stephen S.-T.
1986
Criterion for biholomorphic equivalence of isolated hypersurface singularities. Zbl 0477.32005
Mather, John N.; Yau, Stephen S.-T.
1981
Complete real time solution of the general nonlinear filtering problem without memory. Zbl 1369.93640
Luo, Xue; Yau, Stephen S.-T.
2013
On the GLY conjecture of upper estimate of positive integral points in real right-angled simplices. Zbl 1115.11062
Wang, Xuejun; Yau, Stephen
2007
On a CR family of compact strongly pseudoconvex CR manifolds. Zbl 1099.32009
Huang, Xiaojun; Luk, Hing-Sun; Yau, Stephen S. T.
2006
Classification of 3-dimensional isolated rational hypersurface singularities with $$\mathbb{C}^*$$-action. Zbl 1112.14005
Yau, Stephen S.-T.; Yu, Yung
2005
General finite type IFS and $$M$$-matrix. Zbl 1101.28006
Jin, Ning; Yau, Stephen S. T.
2005
Analysis for a sharp polynomial upper estimate of the number of positive integral points in a 4-dimensional tetrahedron. Zbl 1013.11064
Lin, Ke-Pao; Yau, Stephen S.-T.
2002
Finite-dimensional filters with nonlinear drift. VI: Linear structure of $$\Omega$$. Zbl 0876.93090
Chen, Jie; Yau, Stephen S.-T.
1996
Topology types and multiplicites of isolated quasi-homogeneous surface singularities. Zbl 0659.32013
Yau, Stephen S.-T.
1988
Holomorphic symmetries. Zbl 0639.32015
Lawson, H. Blaine jun.; Yau, Stephen S.-T.
1987
Various numerical invariants for isolated singularities. Zbl 0523.14002
Yau, Stephen S.-T.
1982
Gorenstein singularities with geometric genus equal to two. Zbl 0415.14005
Yau, Stephen Shing-Toung
1979
Two theorems on higher dimensional singularities. Zbl 0343.32010
Yau, Stephen Shing-Toung
1977
Derivations of the moduli algebras of weighted homogeneous hypersurface singularities. Zbl 1343.32021
Yau, Stephen S.-T.; Zuo, Huaiqing
2016
Classification of estimation algebras with state dimension 2. Zbl 1116.93052
Wu, Xi; Yau, Stephen S.-T.
2006
Classification of finite-dimensional estimation algebras of maximal rank with arbitrary state – space dimension and Mitter conjecture. Zbl 1121.93068
Yau, S. S.-T.; Hu, G.-Q.
2005
Computation of Fokker-Planck equation. Zbl 1063.60088
Yau, Stephen S.-T.
2004
Approximate nonlinear output regulation based on the universal approximation theorem. Zbl 0957.93030
Wang, Jin; Huang, Jie; Yau, Stephen S. T.
2000
Finite-dimensional filters with nonlinear drift. VIII: Classification of finite-dimensional estimation algebras of maximal rank with state-space dimension 4. Zbl 0910.93080
Chen, Jie; Yau, Stephen S.-T.; Leung, Chi-Wah
1997
Nonexistence of negative weight derivation of moduli algebras of weighted homogeneous singularities. Zbl 0839.32015
Chen, Hao; Xu, Yi-Jing; Yau, Stephen S.-T.
1995
Classification of Jacobian ideals invariant by $$sl(2,\mathbb C)$$ actions. Zbl 0641.17003
Yau, Stephen S.-T.
1988
On strongly elliptic singularities. Zbl 0415.14006
Yau, Stephen Shing-Toung
1979
4d $$\mathcal{N} = 2$$ SCFT and singularity theory. II: Complete intersection. Zbl 1366.81256
Chen, Bingyi; Xie, Dan; Yau, Shing-Tung; Yau, Stephen S.-T.; Zuo, Huaiqing
2017
A sharp upper estimate conjecture for the Yau number of a weighted homogeneous isolated hypersurface singularity. Zbl 1453.32034
Yau, Stephen S.-T.; Zuo, Huai Qing
2016
Coordinate-free characterization of homogeneous polynomials with isolated singularities. Zbl 1246.32030
Chen, Irene; Lin, Ke-Pao; Yau, Stephen; Zuo, Huaiqing
2011
Łojasiewicz inequality for weighted homogeneous polynomial with isolated singularity. Zbl 1222.32051
Tan, Shengli; Yau, Stephen S.-T.; Zuo, Huaiqing
2010
Complete clasification of finite-dimensional estimation algebras of maximal rank. Zbl 1040.93065
Yau, Stephen S.-T.
2003
Topological and differentiable structures of the complement of an arrangement of hyperplanes. Zbl 0795.57012
Jiang, Tan; Yau, Stephen S.-T.
1993
On almost minimally elliptic singularities. Zbl 0365.32006
Yau, Stephen Shing-Toung
1977
A new method to cluster DNA sequences using Fourier power spectrum. Zbl 1342.92138
Hoang, Tung; Yin, Changchuan; Zheng, Hui; Yu, Chenglong; Lucy He, Rong; Yau, Stephen S.-T.
2015
On a number theoretic conjecture on positive integral points in a 5-dimensional tetrahedron and a sharp estimate of the Dickman-de Bruijn function. Zbl 1323.11076
Lin, Ke-Pao; Luo, Xue; Yau, Stephen S.-T.; Zuo, Huaiqing
2014
Real time solution of the nonlinear filtering problem without memory II. Zbl 1172.35411
Yau, Shing-Tung; Yau, Stephen S.-T.
2008
The diffeomorphic types of the complements of arrangements in $$\mathbb{C}\mathbb{P}^3$$. I: Point arrangements. Zbl 1140.14032
Wang, Shaobo; Yau, Stephen S.-T.
2007
Real time solution of nonlinear filtering problem without memory. I. Zbl 0967.93089
Yau, Shing-Tung; Yau, Stephen S.-T.
2000
Finite dimensional filters with non-linear drift IX Construction of finite dimensional estimation algebras of non-maximal rank. Zbl 0901.93065
Rasoulian, Amid; Yau, Stephen S.-T.
1997
Finite-dimensional filters with nonlinear drift. VII: Mitter conjecture and structure of $$\eta$$. Zbl 0908.93065
Chen, Jie; Yau, Stephen S.-T.
1997
Classification of gradient space as $$s\ell{}(2,\mathbb{C}{})$$ module. I. Zbl 0779.32029
Sampson, Joseph; Yau, Stephen S.-T.; Yu, Yung
1992
Equivalences between isolated hypersurface singularities. Zbl 0673.32016
Benson, Max; Yau, Stephen S.-T.
1990
Criteria for right-left equivalence and right equivalence of holomorphic functions with isolated critical points. Zbl 0558.32001
Yau, Stephen S.-T.
1984
Non-existence of negative weight derivations on positively graded Artinian algebras. Zbl 1440.14013
Chen, Hao; Yau, Stephen S.-T.; Zuo, Huaiqing
2019
On the derivation Lie algebras of fewnomial singularities. Zbl 1403.32017
Hussain, Naveed; Yau, Stephen S.-T.; Zuo, Huaiqing
2018
$$4d\; \mathcal{N} = 2$$ SCFT from complete intersection singularity. Zbl 1384.81139
Wang, Yifan; Xie, Dan; Yau, Stephen S.-T.; Yau, Shing-Tung
2017
An improved model for whole genome phylogenetic analysis by Fourier transform. Zbl 1343.92327
Yin, Changchuan; Yau, Stephen S.-T.
2015
On the quenching behavior of the MEMS with fringing field. Zbl 1336.35192
Luo, Xue; Yau, Stephen S.-T.
2015
Complete characterization of isolated homogeneous hypersurface singularities. Zbl 1308.32035
Yau, Stephen; Zuo, Huaiqing
2015
A sharp polynomial estimate of positive integral points in a 4-dimensional tetrahedron and a sharp estimate of the Dickman-de Bruijn function. Zbl 1386.11102
Luo, Xue; Yau, Stephen S.-T.; Zuo, Huaiqing
2015
A measure of DNA sequence similarity by Fourier transform with applications on hierarchical clustering. Zbl 1412.92252
Yin, Changchuan; Chen, Ying; Yau, Stephen S.-T.
2014
Biggest sharp polynomial estimate of integral points in right-angled simplices. Zbl 1284.11129
Yau, Stephen S.-T.; Zhao, Linda; Zuo, Huaiqing
2011
New algorithms in real time solution of the nonlinear filtering problem. Zbl 1162.94317
Yau, Stephen S. T.
2008
The diffeomorphic types of the complements of arrangements in $$\mathbb C\mathbb P^{3}$$. II. Zbl 1192.14042
Wang, Shaobo; Yau, Stephen S.-T.
2008
Structure theorem for five-dimensional estimation algebras. Zbl 1129.93536
Chiou, Wen-Lin; Chiueh, Woei-Ren; Yau, Stephen S.-T.
2006
Classification of affine varieties being cones over nonsingular projective varieties: hypersurface case. Zbl 1072.32022
Lin, Ke-Pao; Yau, Stephen S.-T.
2004
Algebraic determination of isomorphism classes of the moduli algebras of $$\widehat E_6$$ singularities. Zbl 0976.32015
Chen, Hao; Seeley, Craig; Yau, Stephen S.-T.
2000
Counterexample to boundary regularity of a strongly pseudoconvex CR submanifold: An addendum to the paper of Harvey-Lawson. Zbl 0940.32014
Luk, Hing Sun; Yau, Stephen S.-T.
1998
Explicit solution of a Kolmogorov equation. Zbl 0862.35017
Yau, S.-T.; Yau, S. S.-T.
1996
Algebraic classification and obstructions to embedding of strongly pseudoconvex compact 3-dimensional CR manifolds in $$\mathbb{C}^ 3$$. Zbl 0831.32010
Luk, Hing Sun; Yau, Stephen S.-T.; Yu, Yung
1994
Milnor algebras and equivalence relations among holomorphic functions. Zbl 0528.32020
Yau, Stephen S.-T.
1983
$$s^{(n-1)}$$ invariant for isolated $$n$$-dimensional singularities and its application to moduli problem. Zbl 0499.32011
Yau, Stephen S.-T.
1982
Sheaf cohomology on 1-convex manifolds. Zbl 0474.32011
Yau, Stephen S.-T.
1981
Existence of $$L^ 2-$$integrable holomorphic forms and lower estimates of T//$$v^ 1$$. Zbl 0474.14020
Yau, Stephen S.-T.
1981
Normal two-dimensional elliptic singularities. Zbl 0438.14025
Yau, Stephen Shing-Toung
1979
The nonexistence of negative weight derivations on positive dimensional isolated singularities: generalized Wahl conjecture. Zbl 1451.13071
Chen, Bingyi; Chen, Hao; Yau, Stephen S.-T.; Zuo, Huaiqing
2020
On the new $$k$$-th Yau algebras of isolated hypersurface singularities. Zbl 07152510
Hussain, Naveed; Yau, Stephen S.-T.; Zuo, Huaiqing
2020
Finite dimensional estimation algebras with state dimension 3 and rank 2. I: Linear structure of Wong matrix. Zbl 1430.17042
Shi, Ji; Yau, Stephen S.-T.
2017
A sharp estimate of positive integral points in 6-dimensional polyhedra and a sharp estimate of smooth numbers. Zbl 1338.11094
Liang, Andrew; Yau, Stephen; Zuo, Huaiqing
2016
Time-dependent Hermite-Galerkin spectral method and its applications. Zbl 1410.65398
Luo, Xue; Yau, Shing-Tung; Yau, Stephen S.-T.
2015
On classification of toric surface codes of low dimension. Zbl 1394.14017
Luo, Xue; Yau, Stephen S.-T.; Zhang, Mingyi; Zuo, Huaiqing
2015
The nonexistence of negative weight derivations on positive dimensional isolated singularities: generalized Wahl conjecture. Zbl 1451.13071
Chen, Bingyi; Chen, Hao; Yau, Stephen S.-T.; Zuo, Huaiqing
2020
On the new $$k$$-th Yau algebras of isolated hypersurface singularities. Zbl 07152510
Hussain, Naveed; Yau, Stephen S.-T.; Zuo, Huaiqing
2020
Proper orthogonal decomposition method to nonlinear filtering problems in medium-high dimension. Zbl 07256280
Wang, Zhongjian; Luo, Xue; Yau, Stephen S.-T.; Zhang, Zhiwen
2020
Variation of complex structures and variation of Lie algebras. II: New Lie algebras arising from singularities. Zbl 1454.14007
Chen, Bingyi; Hussain, Naveed; Yau, Stephen S.-T.; Zuo, Huaiqing
2020
Non-existence of negative weight derivations on positively graded Artinian algebras. Zbl 1440.14013
Chen, Hao; Yau, Stephen S.-T.; Zuo, Huaiqing
2019
Real-time solution of time-varying Yau filtering problems via direct method and Gaussian approximation. Zbl 07082394
Chen, Xiuqiong; Shi, Ji; Yau, Stephen S.-T.
2019
On the derivation Lie algebras of fewnomial singularities. Zbl 1403.32017
Hussain, Naveed; Yau, Stephen S.-T.; Zuo, Huaiqing
2018
Suboptimal linear estimation for continuous-discrete bilinear systems. Zbl 1408.93129
Luo, Xue; Chen, Xiuqiong; Yau, Stephen S.-T.
2018
The suboptimal method via probabilists’ Hermite polynomials to solve nonlinear filtering problems. Zbl 1400.93303
Luo, Xue; Yau, Stephen S.-T.
2018
Direct method for Yau filtering system with nonlinear observations. Zbl 1396.93121
Shi, Ji; Yang, Zhiyu; Yau, Stephen S. -t.
2018
A sharp lower bound for the geometric genus and Zariski multiplicity question. Zbl 1408.14010
Yau, Stephen S.-T.; Zuo, Huaiqing
2018
4d $$\mathcal{N} = 2$$ SCFT and singularity theory. II: Complete intersection. Zbl 1366.81256
Chen, Bingyi; Xie, Dan; Yau, Shing-Tung; Yau, Stephen S.-T.; Zuo, Huaiqing
2017
$$4d\; \mathcal{N} = 2$$ SCFT from complete intersection singularity. Zbl 1384.81139
Wang, Yifan; Xie, Dan; Yau, Stephen S.-T.; Yau, Shing-Tung
2017
Finite dimensional estimation algebras with state dimension 3 and rank 2. I: Linear structure of Wong matrix. Zbl 1430.17042
Shi, Ji; Yau, Stephen S.-T.
2017
Derivations of the moduli algebras of weighted homogeneous hypersurface singularities. Zbl 1343.32021
Yau, Stephen S.-T.; Zuo, Huaiqing
2016
A sharp upper estimate conjecture for the Yau number of a weighted homogeneous isolated hypersurface singularity. Zbl 1453.32034
Yau, Stephen S.-T.; Zuo, Huai Qing
2016
A sharp estimate of positive integral points in 6-dimensional polyhedra and a sharp estimate of smooth numbers. Zbl 1338.11094
Liang, Andrew; Yau, Stephen; Zuo, Huaiqing
2016
On the polynomial sharp upper estimate conjecture in 7-dimensional simplex. Zbl 1396.11119
Yau, Stephen S.-T.; Yuan, Beihui; Zuo, Huaiqing
2016
A new method to cluster DNA sequences using Fourier power spectrum. Zbl 1342.92138
Hoang, Tung; Yin, Changchuan; Zheng, Hui; Yu, Chenglong; Lucy He, Rong; Yau, Stephen S.-T.
2015
An improved model for whole genome phylogenetic analysis by Fourier transform. Zbl 1343.92327
Yin, Changchuan; Yau, Stephen S.-T.
2015
On the quenching behavior of the MEMS with fringing field. Zbl 1336.35192
Luo, Xue; Yau, Stephen S.-T.
2015
Complete characterization of isolated homogeneous hypersurface singularities. Zbl 1308.32035
Yau, Stephen; Zuo, Huaiqing
2015
A sharp polynomial estimate of positive integral points in a 4-dimensional tetrahedron and a sharp estimate of the Dickman-de Bruijn function. Zbl 1386.11102
Luo, Xue; Yau, Stephen S.-T.; Zuo, Huaiqing
2015
Time-dependent Hermite-Galerkin spectral method and its applications. Zbl 1410.65398
Luo, Xue; Yau, Shing-Tung; Yau, Stephen S.-T.
2015
On classification of toric surface codes of low dimension. Zbl 1394.14017
Luo, Xue; Yau, Stephen S.-T.; Zhang, Mingyi; Zuo, Huaiqing
2015
A novel suboptimal method for solving polynomial filtering problems. Zbl 1329.93145
Luo, Xue; Jiao, Yang; Chiou, Wen-Lin; Yau, Stephen S.-T.
2015
Plurigenera of compact connected strongly pseudoconvex CR manifolds. Zbl 1317.32069
Lin, KePao; Yau, Stephen; Zuo, HuaiQing
2015
Interplay between CR geometry and algebraic geometry. Zbl 1337.32007
Yau, Stephen; Zuo, Huaiqing
2015
On a number theoretic conjecture on positive integral points in a 5-dimensional tetrahedron and a sharp estimate of the Dickman-de Bruijn function. Zbl 1323.11076
Lin, Ke-Pao; Luo, Xue; Yau, Stephen S.-T.; Zuo, Huaiqing
2014
A measure of DNA sequence similarity by Fourier transform with applications on hierarchical clustering. Zbl 1412.92252
Yin, Changchuan; Chen, Ying; Yau, Stephen S.-T.
2014
Viral genome phylogeny based on Lempel-Ziv complexity and Hausdorff distance. Zbl 1412.92234
Yu, Chenglong; Lucy He, Rong; Yau, Stephen S.-T.
2014
Hermite spectral method to 1-D forward Kolmogorov equation and its application to nonlinear filtering problems. Zbl 1369.60046
Luo, Xue; Yau, Stephen S.-T.
2013
Complete real time solution of the general nonlinear filtering problem without memory. Zbl 1369.93640
Luo, Xue; Yau, Stephen S.-T.
2013
Nonconstant CR morphisms between compact strongly pseudoconvex CR manifolds and étale covering between resolutions of isolated singularities. Zbl 1277.32036
Tu, Yu-Chao; Yau, Stephen S.-T.; Zuo, Huaiqing
2013
Hermite spectral method with hyperbolic cross approximations to high-dimensional parabolic PDEs. Zbl 1286.65133
Luo, Xue; Yau, Stephen S.-T.
2013
Several splitting criteria for vector bundles and reflexive sheaves. Zbl 1284.14025
Yau, Stephen S.-T.; Ye, Fei
2013
Mitter conjecture and structure theorem for six-dimensional estimation algebras. Zbl 1278.93270
Jiao, Yang; Yau, Stephen; Chiou, Wen-Lin
2013
Characterization of isolated complete intersection singularities with $$\mathbb{C}^{\ast}$$-action of dimension $$n \geq 2$$ by means of geometric genus and irregularity. Zbl 1302.32027
Yau, Stephen; Zuo, Huaiqing
2013
Lower estimate of Milnor number and characterization of isolated homogeneous hypersurface singularities. Zbl 1276.32022
Yau, Stephen S.-T.; Zuo, Huaiqing
2012
Kohn-Rossi cohomology and its application to the complex plateau problem. III. Zbl 1254.32051
Du, Rong; Yau, Stephen
2012
Decentralized detection in ad hoc sensor networks with low data rate inter sensor communication. Zbl 1365.94115
Zheng, Lu; Yao, Yingwei; Deng, Mo; Yau, Stephen S. T.
2012
Coordinate-free characterization of homogeneous polynomials with isolated singularities. Zbl 1246.32030
Chen, Irene; Lin, Ke-Pao; Yau, Stephen; Zuo, Huaiqing
2011
Biggest sharp polynomial estimate of integral points in right-angled simplices. Zbl 1284.11129
Yau, Stephen S.-T.; Zhao, Linda; Zuo, Huaiqing
2011
Rigidity of CR morphisms between compact strongly pseudoconvex CR manifolds. Zbl 1202.32035
Yau, Stephen S.-T.
2011
A novel clustering method via nucleotide-based Fourier power spectrum analysis. Zbl 1397.92552
Zhao, Bo; Duan, Victor; Yau, Stephen S.-T.
2011
New invariants for complex manifolds and isolated singularities. Zbl 1243.32018
Du, Rong; Luk, Hing Sun; Yau, Stephen
2011
Łojasiewicz inequality for weighted homogeneous polynomial with isolated singularity. Zbl 1222.32051
Tan, Shengli; Yau, Stephen S.-T.; Zuo, Huaiqing
2010
Nonholonomic systems and sub-Riemannian geometry. Zbl 1216.53036
Calin, Ovidiu; Chang, Der-Chen; Yau, Stephen S. T.
2010
Explicit construction of moduli space of bounded complete Reinhardt domains in $$\mathbb C^n$$. Zbl 1229.32004
Du, Rong; Gao, Yun; Yau, Stephen S. T.
2010
The second pluri-genus of smoothable Gorenstein surface singularities. Zbl 1194.32013
Du, Rong; Yau, Stephen S. T.
2010
Spherical extension property no longer true for domains in algebraic variety with isolated singularity. Zbl 1194.32022
Ji, Shanyu; Yau, Stephen S. T.; Zhan, Cheng
2010
Diffeomorphic types of complements of nice point arrangements in $$\mathbb{C}\mathbb{P}^l$$. Zbl 1197.14015
Yau, Stephen S.-T.; Ye, Fei
2009
Some primitive linear groups of prime degree. Zbl 1211.20040
Kang, Ming-Chang; Zhang, Ji-Ping; Shi, Jian-Yi; Yu, Yung; Yau, Stephen S. T.
2009
Notes on classification of toric surface codes of dimension 5. Zbl 1174.94029
Yau, Stephen S.-T.; Zuo, Huaiqing
2009
Higher order Bergman functions and explicit construction of moduli space for complete Reinhardt domains. Zbl 1181.32003
Du, Rong; Yau, Stephen
2009
On formulas for Dedekind sums and the number of lattice points in tetrahedra. Zbl 1246.11165
Yau, Stephen T.; Zhang, Letian
2009
Real time solution of the nonlinear filtering problem without memory II. Zbl 1172.35411
Yau, Shing-Tung; Yau, Stephen S.-T.
2008
New algorithms in real time solution of the nonlinear filtering problem. Zbl 1162.94317
Yau, Stephen S. T.
2008
The diffeomorphic types of the complements of arrangements in $$\mathbb C\mathbb P^{3}$$. II. Zbl 1192.14042
Wang, Shaobo; Yau, Stephen S.-T.
2008
Mitter conjecture for low dimensional estimation algebras in nonlinear filtering. Zbl 1148.93035
Chiou, Wen-Lin; Chiueh, Woei-Ren; Yau, Stephen S.-T.
2008
Optimal fast tracking observer bandwidth of the linear extended state observer. Zbl 1115.93018
Yoo, D.; Yau, S. S.-T.; Gao, Z.
2007
On the GLY conjecture of upper estimate of positive integral points in real right-angled simplices. Zbl 1115.11062
Wang, Xuejun; Yau, Stephen
2007
The diffeomorphic types of the complements of arrangements in $$\mathbb{C}\mathbb{P}^3$$. I: Point arrangements. Zbl 1140.14032
Wang, Shaobo; Yau, Stephen S.-T.
2007
Efficient association rule mining among both frequent and infrequent items. Zbl 1131.68044
Zhou, Ling; Yau, Stephen
2007
Kohn-Rossi cohomology and its application to the complex Plateau problem. II. Zbl 1123.32020
Luk, Hing Sun; Yau, Stephen S.-T.
2007
An upper estimate of integral points in real simplices with an application to singularity theory. Zbl 1185.11062
Yau, Stephen T.; Zhang, Letian
2006
On a CR family of compact strongly pseudoconvex CR manifolds. Zbl 1099.32009
Huang, Xiaojun; Luk, Hing-Sun; Yau, Stephen S. T.
2006
Classification of estimation algebras with state dimension 2. Zbl 1116.93052
Wu, Xi; Yau, Stephen S.-T.
2006
Structure theorem for five-dimensional estimation algebras. Zbl 1129.93536
Chiou, Wen-Lin; Chiueh, Woei-Ren; Yau, Stephen S.-T.
2006
A remark on lower bound of Milnor number and characterization of homogeneous hypersurface singularities. Zbl 1111.32025
Lin, Ke-Pao; Wu, Xi; Yau, Stephen S. T.; Luk, Hing-Sun
2006
Complete invariant of a family of strongly pseudoconvex domains in $$A_1$$-singularity: Bergman function. Zbl 1111.32023
Luk, Hing Sun; Yau, Stephen S.-T.; Zang, Weitian
2006
Rigidity of differentiable structure for new class of line arrangements. Zbl 1115.52010
Wang, Shaobo; Yau, Stephen S.-T.
2005
Classification of 3-dimensional isolated rational hypersurface singularities with $$\mathbb{C}^*$$-action. Zbl 1112.14005
Yau, Stephen S.-T.; Yu, Yung
2005
General finite type IFS and $$M$$-matrix. Zbl 1101.28006
Jin, Ning; Yau, Stephen S. T.
2005
Classification of finite-dimensional estimation algebras of maximal rank with arbitrary state – space dimension and Mitter conjecture. Zbl 1121.93068
Yau, S. S.-T.; Hu, G.-Q.
2005
Solution of filtering problem with nonlinear observations. Zbl 1130.93421
Yau, Stephen S.-T.; Yau, Shing-Tung
2005
Computation of Fokker-Planck equation. Zbl 1063.60088
Yau, Stephen S.-T.
2004
Classification of affine varieties being cones over nonsingular projective varieties: hypersurface case. Zbl 1072.32022
Lin, Ke-Pao; Yau, Stephen S.-T.
2004
On completeness of reasoning about planar spatial relationships in pictorial retrieval systems. Zbl 1101.68543
Yau, Stephen S.-T.; Zhang, Qing-Long
2004
Wavelet-Galerkin method for the Kolmogorov equation. Zbl 1070.65095
Liang, Zhigang; Yau, Stephen S.-T.
2004
Global invariants for strongly pseudoconvex varieties with isolated singularities: Bergman functions. Zbl 1076.32024
Yau, Stephen S.-T.
2004
Counting the number of integral points in general $$n$$-dimensional tetrahedra and Bernoulli polynomials. Zbl 1056.11054
Lin, Ke-Pao; Yau, Stephen S.-T.
2003
Complete clasification of finite-dimensional estimation algebras of maximal rank. Zbl 1040.93065
Yau, Stephen S.-T.
2003
Explicit solution of DMZ equation in nonlinear filtering via solution of ODEs. Zbl 1364.93818
Yau, Stephen S.-T.; Lai, Yuen-Tai
2003
Some remarks on the local moduli of tangent bundles over complex surfaces. Zbl 1047.32011
Cheung, Wing-Sum; Wong, Bun; Yau, Stephen S.-T.
2003
Punctured local holomorphic de Rham cohomology. Zbl 1034.32018
Huang, Xiaojun; Luk, Hing Sun; Yau, Stephen S.-T.
2003
Holomorphic de Rham cohomology of strongly pseudoconvex CR manifolds with $$S^ 1$$-actions. Zbl 1076.32029
Luk, Hing Sun; Yau, Stephen S.-T.
2003
A sharp upper estimate of the number of integral points in a 5-dimensional tetrahedra. Zbl 0992.11057
Lin, Ke-Pao; Yau, Stephen S.-T.
2002
Analysis for a sharp polynomial upper estimate of the number of positive integral points in a 4-dimensional tetrahedron. Zbl 1013.11064
Lin, Ke-Pao; Yau, Stephen S.-T.
2002
Finite-dimensional filters with nonlinear drift. XII: Linear and constant structure of Wong-matrix. Zbl 1038.93085
Wu, Xi; Yau, Stephen S.-T.; Hu, Guo-Qing
2002
Algebraic classification of rational CR structures on topological 5-sphere with transversal holomorphic $$S^1$$-action in $$\mathbb C^4$$. Zbl 1019.32021
Yau, Stephen S.-T.; Yu, Yung
2002
An example of a real analytic strongly pseudoconvex hypersurface which is not holomorphically equivalent to any algebraic hypersurface. Zbl 1038.32034
Huang, Xiaojun; Ji, Shanyu; Yau, Stephen S. T.
2001
Finite-dimensional filters with nonlinear drift. X: Explicit solution of DMZ equation. Zbl 1056.93636
Yau, Stephen S.-T.; Hu, Guo-Qing
2001
$$\mathbb Z_8$$-cyclic codes and quadratic residue codes. Zbl 0987.94042
Chiu, Mei Hui; Yau, Stephen S.-T.; Yu, Yung
2000
Approximate nonlinear output regulation based on the universal approximation theorem. Zbl 0957.93030
Wang, Jin; Huang, Jie; Yau, Stephen S. T.
2000
Real time solution of nonlinear filtering problem without memory. I. Zbl 0967.93089
Yau, Shing-Tung; Yau, Stephen S.-T.
2000
Algebraic determination of isomorphism classes of the moduli algebras of $$\widehat E_6$$ singularities. Zbl 0976.32015
Chen, Hao; Seeley, Craig; Yau, Stephen S.-T.
2000
Finite-dimensional filters with nonlinear drift. XIII: Classification of finite-dimensional estimation algebras of maximal rank with state space dimension five. Zbl 1169.93415
Hu, Guoqing; Yau, Stephen S. T.; Chiou, Wen-Lin
2000
Classification of four-dimensional estimation algebras. Zbl 0958.60040
Yau, Stephen S. T.; Rasoulian, Amid
1999
Hessian matrix non-decomposition theorem. Zbl 0960.93049
Yau, Stephen S.-T.; Wu, Xi; Wong, Wing-Shing
1999
...and 76 more Documents
all top 5
#### Cited by 594 Authors
68 Yau, Stephen Shing-Toung 18 Zuo, Huaiqing 9 Chen, Hao 9 Isaev, Alexander 9 Luo, Xue 8 Basin, Michael V. 8 Némethi, András 6 Lam, James 6 Ngai, Sze-Man 6 Yu, Yung 5 Calderon-Alvarez, Dario 5 Chiou, Wen-Lin 5 Garber, David 5 Ma, Xi-Nan 5 Shi, Peng 5 Yau, Shing-Tung 4 Bañuelos, Rodrigo 4 Guan, Pengfei 4 Huang, Xiaojun 4 Kulczycki, Tadeusz 4 Li, Songying 4 Lin, Ke-Pao 4 Okuma, Tomohiro 4 Rachidi, Mustapha 4 Sjöstrand, Johannes 4 Teicher, Mina 4 Tomari, Masataka 3 Apostolopoulos, Nicholas 3 Ashbaugh, Mark S. 3 Benguria, Rafael D. 3 Chechkin, A. G. 3 Cheltsov, Ivan Anatol’evich 3 Chen, ChuanQiang 3 Dassios, Ioannis K. 3 Dimca, Alexandru 3 Du, Rong 3 Eliyahu, Meital 3 Friedman, Michael 3 Hussain, Naveed 3 Ji, Shanyu 3 Jiang, Tan 3 Konno, Kazuhiro 3 Kruzhilin, Nikolai Georgievich 3 Li, Xiaoshan 3 Luk, Hingsun 3 Martin, Bernd 3 Ortega, Fernando 3 Pantelous, Athanasios A. 3 Schmude, Johannes 3 Seade, Jose Antonio 3 Shi, Ji 3 Suciu, Alexander I. 3 Wu, Ligang 3 Xu, Yijing 3 Yin, Changchuan 3 Zaitsev, Dmitri 2 Alper, Jarod 2 Andrews, Ben 2 Ashikaga, Tadashi 2 Balaji, Bhashyam 2 Behnke, Kurt 2 Bentaher, R. 2 Bivià-Ausina, Carles 2 Calin, Ovidiu L. 2 Charalambous, Charalambos D. 2 Chen, Bingyi 2 Chen, Xiaoyu 2 Chiueh, Woei-Ren 2 Du, Shihong 2 Elizondo, E. Javier 2 Encinas, Santiago 2 Epstein, Charles Lawrence 2 Faber, Eleonore 2 Fels, Gregor 2 Feng, Jun’e 2 Flicker, Yuval Z. 2 Florchinger, Patrick 2 Gao, Huijun 2 Gao, Yun 2 Gao, Zhiqiang 2 Goyal, Mokshi 2 Guerville-Ballé, Benoît 2 Hauser, Herwig 2 He, Yue 2 Helffer, Bernard 2 Hsiao, Chin-Yu 2 Hu, Bowen 2 Huang, Hsin-Hsiung 2 Huang, Minxin 2 Huang, Yi 2 Jiao, Yang 2 Kalogeropoulos, Grigoris I. 2 Karageorgos, Athanasios D. 2 Kashani-Poor, Amir-Kian 2 Kaup, Wilhelm Gerhard 2 Kaya, Abidin 2 Keller, Bernhard 2 Kerner, Dmitry 2 Kirsch, Werner 2 Klemm, Albrecht ...and 494 more Authors
all top 5
#### Cited in 188 Serials
17 International Journal of Control 17 Mathematische Annalen 15 Mathematische Zeitschrift 15 Transactions of the American Mathematical Society 12 Inventiones Mathematicae 12 Journal of High Energy Physics 11 Advances in Mathematics 11 Journal of Algebra 9 Manuscripta Mathematica 9 Proceedings of the American Mathematical Society 9 International Journal of Mathematics 8 Compositio Mathematica 8 Science in China. Series A 7 Journal of the Franklin Institute 7 Annales de l’Institut Fourier 7 Systems & Control Letters 7 The Journal of Geometric Analysis 6 Communications in Mathematical Physics 6 Journal of Functional Analysis 6 Journal of Pure and Applied Algebra 6 Science China. Mathematics 5 Duke Mathematical Journal 5 Journal of Number Theory 5 Publications of the Research Institute for Mathematical Sciences, Kyoto University 5 Geometry & Topology 5 Journal of Theoretical Biology 4 Journal of Geometry and Physics 4 Advances in Applied Mathematics 4 Bulletin of the American Mathematical Society. New Series 4 Journal of Algebraic Geometry 4 Comptes Rendus. Mathématique. Académie des Sciences, Paris 3 Communications in Algebra 3 Rocky Mountain Journal of Mathematics 3 Automatica 3 Journal of Differential Equations 3 Circuits, Systems, and Signal Processing 3 MCSS. Mathematics of Control, Signals, and Systems 3 Linear Algebra and its Applications 3 Finite Fields and their Applications 3 Discrete and Continuous Dynamical Systems 3 Algebraic & Geometric Topology 3 Asian Journal of Control 2 Bulletin of the Australian Mathematical Society 2 Computers & Mathematics with Applications 2 International Journal of Systems Science 2 Journal of Mathematical Analysis and Applications 2 Moscow University Mathematics Bulletin 2 Annali della Scuola Normale Superiore di Pisa. Classe di Scienze. Serie IV 2 Applied Mathematics and Computation 2 Applied Mathematics and Optimization 2 Geometriae Dedicata 2 Information Sciences 2 Journal of Computational and Applied Mathematics 2 Journal of Differential Geometry 2 Journal of the Mathematical Society of Japan 2 Mathematische Nachrichten 2 Proceedings of the Japan Academy. Series A 2 Semigroup Forum 2 SIAM Journal on Control and Optimization 2 Topology and its Applications 2 Stochastic Analysis and Applications 2 Automation and Remote Control 2 Acta Mathematica Sinica. New Series 2 International Journal of Robust and Nonlinear Control 2 Experimental Mathematics 2 Potential Analysis 2 Calculus of Variations and Partial Differential Equations 2 Mathematical Problems in Engineering 2 Transformation Groups 2 European Journal of Control 2 Doklady Mathematics 2 Acta Mathematica Sinica. English Series 2 Communications in Nonlinear Science and Numerical Simulation 2 Dynamics of Continuous, Discrete & Impulsive Systems. Series A. Mathematical Analysis 2 Central European Journal of Mathematics 2 Statistical Applications in Genetics and Molecular Biology 2 São Paulo Journal of Mathematical Sciences 2 Kyoto Journal of Mathematics 2 Korean Journal of Mathematics 1 Discrete Mathematics 1 Journal d’Analyse Mathématique 1 Journal of Mathematical Biology 1 Journal of Statistical Physics 1 Letters in Mathematical Physics 1 Mathematical Methods in the Applied Sciences 1 Physica A 1 Physics Letters. B 1 Arkiv för Matematik 1 Abhandlungen aus dem Mathematischen Seminar der Universität Hamburg 1 Annali di Matematica Pura ed Applicata. Serie Quarta 1 Annales Scientifiques de l’École Normale Supérieure. Quatrième Série 1 Bulletin of the London Mathematical Society 1 Collectanea Mathematica 1 Czechoslovak Mathematical Journal 1 Functional Analysis and its Applications 1 Glasgow Mathematical Journal 1 Illinois Journal of Mathematics 1 Journal of Applied Probability 1 Journal of Optimization Theory and Applications 1 Kybernetika ...and 88 more Serials
all top 5
#### Cited in 54 Fields
164 Algebraic geometry (14-XX) 158 Several complex variables and analytic spaces (32-XX) 82 Systems theory; control (93-XX) 65 Partial differential equations (35-XX) 35 Probability theory and stochastic processes (60-XX) 26 Convex and discrete geometry (52-XX) 25 Global analysis, analysis on manifolds (58-XX) 24 Commutative algebra (13-XX) 19 Number theory (11-XX) 18 Differential geometry (53-XX) 18 Quantum theory (81-XX) 15 Group theory and generalizations (20-XX) 15 Manifolds and cell complexes (57-XX) 14 Nonassociative rings and algebras (17-XX) 14 Ordinary differential equations (34-XX) 14 Numerical analysis (65-XX) 14 Information and communication theory, circuits (94-XX) 13 Linear and multilinear algebra; matrix theory (15-XX) 13 Associative rings and algebras (16-XX) 12 Relativity and gravitational theory (83-XX) 11 Biology and other natural sciences (92-XX) 9 Calculus of variations and optimal control; optimization (49-XX) 8 Measure and integration (28-XX) 6 Operator theory (47-XX) 6 Statistics (62-XX) 5 Combinatorics (05-XX) 5 Category theory; homological algebra (18-XX) 5 Topological groups, Lie groups (22-XX) 5 Computer science (68-XX) 4 Algebraic topology (55-XX) 4 Mechanics of particles and systems (70-XX) 4 Statistical mechanics, structure of matter (82-XX) 3 History and biography (01-XX) 3 Real functions (26-XX) 3 Special functions (33-XX) 3 Difference and functional equations (39-XX) 3 Functional analysis (46-XX) 3 Fluid mechanics (76-XX) 2 Dynamical systems and ergodic theory (37-XX) 2 Sequences, series, summability (40-XX) 2 Approximations and expansions (41-XX) 2 Harmonic analysis on Euclidean spaces (42-XX) 2 Mechanics of deformable solids (74-XX) 2 Optics, electromagnetic theory (78-XX) 2 Operations research, mathematical programming (90-XX) 1 Potential theory (31-XX) 1 Abstract harmonic analysis (43-XX) 1 Integral transforms, operational calculus (44-XX) 1 Integral equations (45-XX) 1 Geometry (51-XX) 1 General topology (54-XX) 1 Classical thermodynamics, heat transfer (80-XX) 1 Astronomy and astrophysics (85-XX) 1 Game theory, economics, finance, and other social and behavioral sciences (91-XX)
#### Wikidata Timeline
The data are displayed as stored in Wikidata under a Creative Commons CC0 License. Updates and corrections should be made in Wikidata. | 2021-04-11T02:07:03 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5495882630348206, "perplexity": 8336.017540330955}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038060603.10/warc/CC-MAIN-20210411000036-20210411030036-00353.warc.gz"} |
http://dergipark.gov.tr/hujms/issue/39860/471066 | | | | |
## Combinatorial sums and binomial identities associated with the Beta-type polynomials
#### Yılmaz Şimşek [1]
##### 28 221
In this paper, we first provide some functional equations of the generating functions for beta-type polynomials. Using these equations, we derive various identities of the beta-type polynomials and the Bernstein basis functions. We then obtain some novel combinatorial identities involving binomial coefficients and combinatorial sums. We also derive some generalizations of the combinatorics identities which are related to the Gould's identities and sum of binomial coefficients. Next, we present some remarks, comments, and formulas including the combinatorial identities, the Catalan numbers, and the harmonic numbers. Moreover, by applying the classical Young inequality, we derive a combinatorial inequality related to beta polynomials and combinatorial sums. We also give another inequality for the Catalan numbers.
Combinatorial sums, Binomial identities, Generating functions, Functional equations, Beta polynomials, Beta function, Gamma function, Bernstein basis functions, Catalan numbers, Harmonic numbers, Young inequality
• Amdeberhan, T., Angelis, V. D., Lin, M., Moll, V. H. and Sury, B. A pretty binomial identity, Elem. Math. 2012 ;67: 18-25.
• Bajunaid, I, Cohen, J. M., Colonna, F. and Singman. D. Function Series, Catalan Numbers, and RandomWalks on Trees, Math. Association America. 112, 765-785, 2005.
• Bhandari, A. and Vignat, C., A probabilistic interpretation of the Volkenborn integral, arXiv:1201.3701v1.
• Choi, J. and Srivastava, H. M. Certain families of series associated with the Hurwitz-Lerch zeta function, Appl. Math. Comput. 170, 399-409, 2005.
• Chu, W. Summation formulae involving harmonic numbers , Filomat 26, 143-152, 2012.
• Clarrk, D. S. A class of combinatorial identities Discrete Appl. Math. 4, 325-327, 1982.
• Comtet, L. Advanced Combinatorics: The Art of Finite and Infinite Expansions, (Translated from the French by J. M. Nienhuys, Reidel, Dordrecht and Boston, 1974).
• Flajolet, P. and Sedgewick, R. Analytic Combinatorics, (Cambridge University Press, 2009).
• Goldman, R. Identities for the Univariate and Bivariate Bernstein Basis Functions. Graphics Gems V, (edited by Alan Paeth, Academic Press 1995; 149-162).
• Gould, H. W. Combinatorial Identities, (Morgantown Printing and Binding Co., Morgantown, WV, 1972).
• Gould, H. W. Combinatorial Identities, Vol.1-Vol.8, http://www.math.wvu.edu/~gould/
• Graham, R. L., Knuth, D. E. and Patashnik, O. Concrete Mathematics: A Foundation for Computer Science, (Second Edition, Addison-Wesley Publishing Company, Massachusetts, 1989).
• Hilton, P. and Persen, J. Catalan numbers, their generalization, and their uses, Math. Intelligencer, 13 (2), 64-75, 1991.
• Kim, T. A note on Catalan numbers associated with $p$-adic integral on $\mathbb{Z}_p$, https://arxiv.org/pdf/1606.00267v1.pdf
• Kittaneh, F. and Manasrah, Y. Improved Young and Heinz inequalities for matrices, J. Math. Anal. Appl. 361, 262-269, 2010.
• Mansour, T. Combinatorial identities and inverse binomial coefficients, Adv. in Appl. Math. 28, 196-202, 2002.
• Milovanovic, G. V. Extremal problems and inequalities of Markov-Bernstein type for polynomials, In Analytic and Geometric Inequalities and Applications, (Th.M. Rassias, H.M. Srivastava, eds.), Mathematics and Its Applications, 478, 245-264, Kluwer, Dordrecht 1999; MR1785873 (2001i:41013).
• Milovanovic, G. V. and, Rassias, Th. M. Inequalities for polynomial zeros, In survey on classical inequalities, (Th. M. Rassias, ed. Kluwer, Dordrecht, Math. Its Appl. 517, 165- 202, 2000).
• Rainville, E. D. Special functions (The Macmillan Company, New York, 1960).
• Simsek, Y. Functional equations from generating functions: a novel approach to deriving identities for the Bernstein basis functions, Fixed Point Theory Appl. 2003; 80, 2013, doi:10.1186/1687-1812-2013-80.
• Simsek, Y. $q$-Beta polynomials and their applications, Appl. Math. Inf. Sci. 7 (6), 2539-2547, 2013.
• Simsek, Y. A new class of polynomials associated with Bernstein and beta polynomials, Math. Meth. Appl. Sci. 37 (5), 676-685, 2014.
• Simsek, Y. Generating Functions for the Bernstein type polynomials: a new approach to deriving identities and applications for the polynomials, Hacet. J. Math. Stat. 43(1), 1-14, 2014.
• Simsek, Y. Beta-type polynomials and their generating functions, Appl. Math. Comput. 254, 172-182, 2015.
• Simsek, Y. A new combinatorial approach to analysis: Bernstein basis functions, combina- torial identities and Catalan numbers, Math. Meth. Appl. Sci. 38 (14), 3007-3021, 2015.
• Srivastava, H. M. Some generalizations of a combinatorial identities of L. Vietories, Discrete Math. 65, 99-102, 1987.
• Srivastava, H. M. and Choi, J. Series Associated with the Zeta and Related Functions (Kluwer Acedemic Publishers, Dordrecht, Boston and London, 2001).
• Sury, B. Sum of the reciprocals of the binomial coefficients, European J. Combin. 14, 351-353, 1993.
• Trif, T. Combinatorial sums and series involving inverses of binomial coefficients, Fibonacci Quart. 38, 79-84, 2000.
• https://en.wikipedia.org/wiki/Binomial_coefficient#Bounds _and_asymptotic_formulas
Primary Language en Mathematics Mathematics Author: Yılmaz Şimşek (Primary Author)Institution: DEPARTMENT OF MATHEMATICSCountry: Turkey
Bibtex @research article { hujms471066, journal = {Hacettepe Journal of Mathematics and Statistics}, issn = {2651-477X}, eissn = {2651-477X}, address = {Hacettepe University}, year = {2018}, volume = {47}, pages = {1144 - 1155}, doi = {}, title = {Combinatorial sums and binomial identities associated with the Beta-type polynomials}, key = {cite}, author = {Şimşek, Yılmaz} } APA Şimşek, Y . (2018). Combinatorial sums and binomial identities associated with the Beta-type polynomials. Hacettepe Journal of Mathematics and Statistics, 47 (5), 1144-1155. Retrieved from http://dergipark.gov.tr/hujms/issue/39860/471066 MLA Şimşek, Y . "Combinatorial sums and binomial identities associated with the Beta-type polynomials". Hacettepe Journal of Mathematics and Statistics 47 (2018): 1144-1155 Chicago Şimşek, Y . "Combinatorial sums and binomial identities associated with the Beta-type polynomials". Hacettepe Journal of Mathematics and Statistics 47 (2018): 1144-1155 RIS TY - JOUR T1 - Combinatorial sums and binomial identities associated with the Beta-type polynomials AU - Yılmaz Şimşek Y1 - 2018 PY - 2018 N1 - DO - T2 - Hacettepe Journal of Mathematics and Statistics JF - Journal JO - JOR SP - 1144 EP - 1155 VL - 47 IS - 5 SN - 2651-477X-2651-477X M3 - UR - Y2 - 2017 ER - EndNote %0 Hacettepe Journal of Mathematics and Statistics Combinatorial sums and binomial identities associated with the Beta-type polynomials %A Yılmaz Şimşek %T Combinatorial sums and binomial identities associated with the Beta-type polynomials %D 2018 %J Hacettepe Journal of Mathematics and Statistics %P 2651-477X-2651-477X %V 47 %N 5 %R %U ISNAD Şimşek, Yılmaz . "Combinatorial sums and binomial identities associated with the Beta-type polynomials". Hacettepe Journal of Mathematics and Statistics 47 / 5 (October 2018): 1144-1155. | 2019-04-20T16:55:06 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5008965730667114, "perplexity": 6229.576902426226}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-18/segments/1555578529898.48/warc/CC-MAIN-20190420160858-20190420182858-00342.warc.gz"} |
https://www.nist.gov/pml/atomic-reference-data-electronic-structure-calculations/atomic-reference-data-electronic-6-3 | An official website of the United States government
Official websites use .gov
A .gov website belongs to an official government organization in the United States.
Secure .gov websites use HTTPS
A lock ( ) or https:// means you've safely connected to the .gov website. Share sensitive information only on official, secure websites.
# Atomic Reference Data for Electronic Structure Calculations, The Exchange Term
## Share
The exchange term is given by
$$\varepsilon_x(r_s,\zeta) = \varepsilon_x^P (r_s) + [\varepsilon_x^F (r_s) - \varepsilon_x^P(r_s) ] f(\zeta) ~ .$$
(Eq. 1)
The electron gas parameter, rs, the spin polarization, ζ, and the ferromagnetic and paramagnetic exchange energies, $$\varepsilon_x^F (r_s), \varepsilon_x^P(r_s)$$
are defined as
$$r_s=\left({{3}\over{4\pi n}}\right)^{1/3} ~ ,$$
(Eq. 2)
$$\zeta=(n_\uparrow-n_\downarrow)/n ~ ,$$
(Eq. 3)
$$\varepsilon_x^P(r_s)= 2^{-1/3} \varepsilon_x^F(r_s) = -3 \left({{9}\over{32\pi^2}}\right)^{1/3} r_s^{-1} ~ ,$$
(Eq. 4)
and f(ζ) is given by
$$f(\zeta) = {{ (1+\zeta)^{4/3} + (1-\zeta)^{4/3} - 2} \over {2(2^{1/3}-1)}} ~ ;$$
(Eq. 5)
where n is the electron number density (implicitly a function of the spatial coordinates), and $$n_\uparrow$$ and $$n_\downarrow$$ its corresponding spin-up and spin-down components $$(n = n_\uparrow + n_\downarrow).$$
### The correlation term
The correlation term is related to the function,
$$\begin{eqnarray} F(r_s; A, x_0, b, c) & = & A \Big\{ \ln {{x^2}\over{X(x)}} + {{2b}\over{Q}} \tan^{-1} {{Q}\over{2x+b}} \nonumber \\ & & - {{b x_0}\over{X(x_0)}} \Big[ \ln {{(x-x_0)^2}\over{X(x)}} + {{2(b+2x_0)}\over{Q}} \tan^{-1} {{Q}\over{2x+b}} \Big] \Big\}, \nonumber \end{eqnarray}$$
(Eq. 6)
where we have x = rs1/2, X(x) = x2+bx+c, Q = (4c-b2)1/2. The parameters x0, b, and c, given in the table below, are used to create three instances of F, using the table below.
A x0 b c Paramagnetic εcP 0.031 090 7 -0.104 98 3.727 44 12.935 2 Ferromagnetic εcF 0.015 545 35 -0.325 00 7.060 42 18.057 8 Spin Stiffness αc -1/(6π2) -0.004 758 40 1.131 07 13.004 5
The correlation energy is given by
$$\varepsilon_c (r_s,\zeta) = \varepsilon_c^P (r_s) + \Delta \varepsilon_c (r_s,\zeta) ~ .$$
(Eq. 7)
The paramagnetic correlation energy is given by εcP(rs) = F(rs; A, x0, b, c) with the four parameters taken from the "Paramagnetic" line in the table. (Similar definitions hold for εcF and αc.) The polarization contribution is given by
$$\Delta \varepsilon_c (r_s,\zeta) = \alpha_c(r_s) [ f(\zeta)/f^{\prime\prime}(0)][1+\beta(r_s)\zeta^4] ~ ,$$
(Eq. 8)
with the function f as defined above, and where we have
$$\beta(r_s) = {{f''(0) \Delta \varepsilon_c(r_s,1)}\over{\alpha_c(r_s)}} -1\quad,$$
(Eq. 9)
and
$$\Delta \varepsilon_c(r_s,1) = \varepsilon_c(r_s,1) - \varepsilon_c(r_s,0) = \varepsilon_c^F(r_s) - \varepsilon_c^P(r_s)$$
(Eq. 10)
is the difference of the ferromagnetic and paramagnetic correlation energies.
The exchange-correlation potential is given by
$$V_{xc}(n) = {{{\rm d} [ n (\varepsilon_x + \varepsilon_c)]}\over{{\rm d} n}} ~ .$$
(Eq. 11)
We use this form in all of the codes in this study. To avoid undetected code bugs, the associated subroutine was recoded independently for one of the codes, although the other three codes shared a common subroutine. This subroutine will be provided upon request to [email protected].
Created October 15, 2015, Updated November 4, 2019 | 2020-11-01T02:08:08 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5987886190414429, "perplexity": 4760.9381995478}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107922746.99/warc/CC-MAIN-20201101001251-20201101031251-00623.warc.gz"} |
https://nla.gov.au/nla.obj-1108185496/view?sectionId=nla.obj-1641943472 | ## Financial assistance granted to each state in respect of ..., Schools Assistance (Learning together - Achievement through Choice and Opportunity) Act 2004 / Department of Education, Science and Training
Call Number
Nq 328.94 AUS
Created/Published
Canberra : Australian Govt. Pub. Service, c2006-
Issue
2008, PP no. 28 of 2010
Images
254
View Catalogue
## Contents
Report on financial assistance granted to each State in respect of 2008 1 FINANCIAL ASSISTANCE GRANTED TO EACH STATE IN RESPECT OF 2008 Schools Assistance (Learning Together - Achievement Through Choice and Opportunity) Act 2004 3 , 4 , 5 INTRODUCTION 7 FORMS OF FINANCIAL ASSISTANCE GENERAL RECURRENT GRANTS PROGRAM 8 , 9 , 10 , 11 , 12 CAPITAL GRANTS PROGRAM 13 INVESTING IN OUR SCHOOLS PROGRAM 14 TARGETED PROGRAMS 15 , 16 , 17 , 18 , 19 , 21 , 22 , 23 , 24 , 25 , 26 , 27 , 28 , 29 , 30 , 31 , 32 , 33 , 34 , 35 , 36 , 37 , 38 , 39 , 40 , 41 , 42 , 43 , 44 , 45 , 46 , 47 , 48 , 49 , 50 , 51 , 52 , 53 , 54 , 55 , 56 , 57 , 58 , 59 , 60 , 61 , 62 , 63 , 64 , 65 , 66 , 67 , 68 , 69 , 70 , 71 , 72 , 73 , 74 , 75 , 76 , 77 , 78 , 79 , 80 , 81 , 82 , 83 , 84 , 85 , 86 , 87 , 88 , 89 , 90 , 91 , 92 SUMMARY OF CAPITAL GRANTS AND PROJECT DESCRIPTIONS FOR GOVERNMENT AND NON GOVERNMENT SCHOOLS 93 , 94 , 95 , 96 , 97 , 98 , 99 , 100 , 101 , 102 , 103 , 104 , 105 , 106 , 107 , 108 , 109 , 110 , 111 , 112 , 113 , 114 , 115 , 116 , 117 , 118 , 119 , 120 , 121 , 122 , 123 , 124 , 125 , 126 , 127 , 128 , 129 , 130 , 131 , 132 , 133 , 134 , 135 , 136 , 137 SUMMARY OF INVESTING IN OUR SCHOOLS GRANTS FOR GOVERNMENT SCHOOLS 138 , 139 , 140 , 141 , 142 , 143 , 144 , 145 , 146 , 147 , 148 , 149 , 150 , 151 , 152 , 153 , 154 , 155 , 156 , 157 , 158 , 159 , 160 , 161 , 162 , 163 , 164 , 165 , 166 , 167 , 168 , 169 , 170 , 171 , 172 , 173 , 174 , 175 , 176 , 177 , 178 , 179 , 180 , 181 , 182 , 183 , 184 , 185 , 186 , 187 , 188 , 189 , 190 , 191 , 192 , 193 , 194 , 195 , 196 , 197 , 198 , 199 , 200 , 201 , 202 , 203 , 204 , 205 , 206 , 207 , 208 , 209 , 210 , 211 , 212 , 213 , 214 , 215 , 216 , 217 , 218 , 219 , 220 , 221 , 222 , 223 , 224 , 225 , 226 , 227 , 228 , 229 , 230 , 231 , 232 , 233 , 234 , 235 , 236 , 237 , 238 , 239 , 240 , 241 , 242 , 243 , 244 , 245 , 246 , 247 , 248 , 249 , 250 , 251 , 252 , 254
## Cite
Citation options:
Work identifier
http://nla.gov.au/nla.obj-1108185496
APA citation
Australia. Department of Education, Science and Training & Australia. (2006). Financial assistance granted to each state in respect of ..., Schools Assistance (Learning together - Achievement through Choice and Opportunity) Act 2004 Retrieved May 27, 2022, from http://nla.gov.au/nla.obj-1108185496
MLA citation
Australia. Department of Education, Science and Training and Australia. Financial assistance granted to each state in respect of ..., Schools Assistance (Learning together - Achievement through Choice and Opportunity) Act 2004 Canberra: Australian Govt. Pub. Service, 2006. Web. 27 May 2022 <http://nla.gov.au/nla.obj-1108185496>
Harvard/Australian citation
Australia. Department of Education, Science and Training & Australia. 2006, Financial assistance granted to each state in respect of ..., Schools Assistance (Learning together - Achievement through Choice and Opportunity) Act 2004 Australian Govt. Pub. Service, Canberra viewed 27 May 2022 http://nla.gov.au/nla.obj-1108185496
Wikipedia citation
{{Citation
| author1=Australia. Department of Education, Science and Training.
| author2=Australia.
| title=Financial assistance granted to each state in respect of ..., Schools Assistance (Learning together - Achievement through Choice and Opportunity) Act 2004
| year=2006
| section=v. ; 25 cm.
| issn=2203-6849
| series=Parliamentary paper (Australia. Parliament)
| issue=2008, PP no. 28 of 2010
| location=Canberra
| publisher=Australian Govt. Pub. Service
| url=http://nla.gov.au/nla.obj-1108185496
| id=nla.obj-1108185496
| access-date=27 May 2022
| via=Trove
}}
Citations are automatically generated and may require some modification to conform to exact standards.
Available formats
##### TIF high resolution
Include
Or select a range of images:
## Order
You can order a copy of this work from Copies Direct.
Copies Direct supplies reproductions of collection material for a fee. This service is offered by the National Library of Australia
Include
Or select a range of images:
## What can I do with this?
Copyright varies by issue and article | 2022-05-27T02:55:17 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9162490367889404, "perplexity": 133.8005132917873}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-21/segments/1652662631064.64/warc/CC-MAIN-20220527015812-20220527045812-00558.warc.gz"} |
https://arcaea.fandom.com/wiki/Potential | ## FANDOM
288 Pages
Potential is a mechanic added in version 1.1.0. It acts as a representative value of the player's best and recent performances. It generally does not affect gameplay, with the following few exceptions:
Playing songs while online will affect this value, displayed on the icon of your partner at the top of the screen.
## Ranks
There are eight different icons for your Potential rating: seven representing distinct potential ranges, and one for those who have "Show Potential" disabled under Settings.
As potential is strongly dependent on which songs are owned and inflates upon the release of new song packs, descriptions become obsolete over time and are hence not provided.
Icon From To 0.00 3.50 7.00 10.00 11.00 12.00 12.50 -- 3.49 6.99 9.99 10.99 11.99 12.49 ∞ --
## Mechanics
Early research credit goes to choka_noah and is posted here with their permission.
There are three relevant quantities to the Potential, each explained in its own section.
### Chart Constant
The chart constant is an internal value assigned to a chart, which is a more precise representation of its difficulty than its difficulty level. It is currently unknown how these values are determined or calculated.
Chart constants for various songs, as well as the methods used to obtain these values, are detailed in Songs by Chart Constant.
Additionally, they also determine how much Steps are gained when completing songs in World Mode.
### Score Modifier
The score modifier is a value computed from your score in a round. It can be positive or negative, depending on whether your score is above or below 9,500,000.
Below is a table showing the formula for calculating the score modifier for various score ranges.
Score Score Modifier
≥ 10,000,000 $2.0$
9,800,000 ~ 9,999,999 $1.0 + \dfrac{\text{Score} - 9,800,000}{200,000}$
≤ 9,800,000 $\dfrac{\text{Score} - 9,500,000}{300,000}$
Below are score modifiers for some notable scores:
EX+ 10,000,000 2.0
9,900,000 1.5
EX 9,800,000 1.0
AA 9,500,000 0.0
A 9,200,000 -1.0
B 8,900,000 -2.0
C 8,600,000 -3.0
### Play Rating
The play rating, previously called chart potential, is an intermediate value used to calculate your potential. In each round, it is calculated by adding the chart constant and the score modifier, then rectified to zero if the result is negative:
$\text{Play Rating}=\max\left\{\text{Chart Constant}+\text{Score Modifier},0\right\}$
For example, Sayonara Hatsukoi [FTR] has a chart constant of 7.0, so if you obtain a Pure Memory, the corresponding score modifier is 2.0. This results in a play rating of 9.0 which gets saved in your recent/best entries.
### Calculation
At the end of each round, your play rating is recorded under your Recent Entries (with a few exceptions later mentioned). If high enough, it might also be recorded under your Best Entries.
Best Entries
A list of 30 unique charts with the highest play ratings ever obtained. Charts can only appear once.
Recent Entries
A list of 10 plays with the highest play rating, out of the 30 most recent plays. Charts can appear more than once.
Since 3.0.0, the 10 plays with highest play rating have to be unique. This means that there must be at least 10 unique charts under these entries.
The formula for potential is as follows:
$\text{Potential}=\dfrac{S_R+S_B}{40}$
• $S_R$ is the sum of all Play Ratings in Recent Entries.
• $S_B$ is the sum of all Play Ratings in Best Entries.
This formula applies even when not all entries are filled. Potential is displayed up to two decimal points, with any more being truncated.
There are 2 special cases wherein Potential cannot decrease:
Plays falling under any of these situations are only added to your recent/best entries if they cause an increase in Potential.
## Maximum Potential
Main article: Misc Trivia § Maximum Potential
## Gallery
Community content is available under CC-BY-SA unless otherwise noted. | 2020-07-10T08:59:15 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.32231664657592773, "perplexity": 2188.1516385421796}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-29/segments/1593655906934.51/warc/CC-MAIN-20200710082212-20200710112212-00001.warc.gz"} |
http://pdglive.lbl.gov/Particle.action;jsessionid=10FE6934A153A92DE38EFD1F86898DDD?node=S029&init=0 | GAUGE AND HIGGS BOSONS INSPIRE search
# Axions (${{\mathit A}^{0}}$) and Other Very Light Bosons, Searches for
Review: Axions and other Similar Particles (rev.)
${{\mathit A}^{0}}$ (Axion) MASS LIMITS from Astrophysics and Cosmology
${{\mathit A}^{0}}$ (Axion) and Other Light Boson (${{\mathit X}^{0}}$) Searches in Hadron Decays
${{\mathit A}^{0}}$ (Axion) Searches in Quarkonium Decays
${{\mathit A}^{0}}$ (Axion) Searches in Positronium Decays
${{\mathit A}^{0}}$ (Axion) Search in Photoproduction
${{\mathit A}^{0}}$ (Axion) Production in Hadron Collisions
${{\mathit A}^{0}}$ (Axion) Searches in Reactor Experiments
${{\mathit A}^{0}}$ (Axion) and Other Light Boson (${{\mathit X}^{0}}$) Searches in Nuclear Transitions
${{\mathit A}^{0}}$ (Axion) Limits from Its Electron Coupling
Search for ${{\mathit A}^{0}}$ (Axion) Resonance in Bhabha Scattering
Search for ${{\mathit A}^{0}}$ (Axion) Resonance in ${{\mathit e}^{+}}$ ${{\mathit e}^{-}}$ $\rightarrow$ ${{\mathit \gamma}}{{\mathit \gamma}}$
Search for ${{\mathit X}^{0}}$ (Light Boson) Resonance in ${{\mathit e}^{+}}$ ${{\mathit e}^{-}}$ $\rightarrow$ ${{\mathit \gamma}}{{\mathit \gamma}}{{\mathit \gamma}}$
Light Boson (${{\mathit X}^{0}}$) Search in Nonresonant ${{\mathit e}^{+}}{{\mathit e}^{-}}$ Annihilation at Rest
Searches for Goldstone Bosons (${{\mathit X}^{0}}$)
Majoron Searches in Neutrinoless Double $\beta$ Decay $>7200 \times 10^{21}$ yr
Invisible ${{\mathit A}^{0}}$ (Axion) MASS LIMITS from Astrophysics and Cosmology
Search for Relic Invisible Axions
Invisible ${{\mathit A}^{0}}$ (Axion) Limits from Photon Coupling
Limit on Invisible ${{\mathit A}^{0}}$ (Axion) Electron Coupling
Invisible ${{\mathit A}^{0}}$ (Axion) Limits from Nucleon Coupling
Axion Limits from $\mathit T$-violating Medium-Range Forces
Hidden Photons: Kinetic Mixing Parameter Limits | 2017-09-24T17:39:44 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9131677150726318, "perplexity": 12104.986480049356}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-39/segments/1505818690112.3/warc/CC-MAIN-20170924171658-20170924191658-00534.warc.gz"} |
https://www.usgs.gov/media/files/boron-2020-tables-only-release | # Boron in 2020, tables-only release
Boron in 2020, tables-only release
## Detailed Description
Advance data tables (XLSX format) for the boron chapter of the Minerals Yearbook 2020. A version with an embedded text document and also a PDF of text and tables will follow. | 2021-12-03T03:17:36 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9453837871551514, "perplexity": 9731.494123799115}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-49/segments/1637964362589.37/warc/CC-MAIN-20211203030522-20211203060522-00007.warc.gz"} |
https://zbmath.org/authors/?q=R%2A+Curtain | zbMATH — the first resource for mathematics
Curtain, Ruth Frances
Compute Distance To:
Author ID: curtain.ruth-f Published as: Curtain, R. F.; Curtain, Ruth; Curtain, Ruth F. Homepage: http://www.math.rug.nl/curtain/ External Links: MGP · Wikidata · ResearchGate · dblp
Documents Indexed: 160 Publications since 1970, including 8 Books Reviewing Activity: 2 Reviews Biographic References: 2 Publications
all top 5
Co-Authors
65 single-authored 15 Zwart, Hans J. 8 Pritchard, Anthony J. 7 Sasane, Amol J. 7 Weiss, George 6 Bontsema, Jan 6 Glover, Keith J. 6 Opmeer, Mark R. 5 Logemann, Hartmut 5 Oostveen, Job C. 4 Iftime, Orest V. 4 Kotelenez, Peter M. 4 Weiss, Martin G. 4 Zhou, Yishao 3 Ichikawa, Akira 3 Partington, Jonathan R. 3 van Keulen, Bert A. M. 2 Falb, Peter L. 2 Hinrichsen, Diederich 2 Ito, Kazufumi 2 Rodman, Leiba X. 2 Salamon, Dietmar Arno 2 Staffans, Olof Johan 1 Arnold, Ludwig 1 Bensoussan, Alain 1 Costveen, Job C. 1 Demetriou, Michael A. 1 Green, Michael M. 1 Jacob, Birgit 1 Kaashoek, Marinus Adriaan 1 Kubrusly, Carlos S. 1 Kuiper, C. R. 1 Lions, Jacques-Louis 1 Mikkola, Kalle M. 1 Morris, Kirsten A. 1 Osinga, Hinke Maria 1 Peters, Marc A. 1 Ran, André C. M. 1 Rodríguez, Alejandro F. 1 Schumacher, Johannes M. 1 Stoorvogel, Antonie Arij 1 Townley, Stuart B.
all top 5
Serials
23 Systems & Control Letters 17 SIAM Journal on Control and Optimization 11 Automatica 10 IEEE Transactions on Automatic Control 9 International Journal of Control 7 Integral Equations and Operator Theory 6 Journal of Mathematical Analysis and Applications 4 Stochastics 4 MCSS. Mathematics of Control, Signals, and Systems 2 IMA Journal of Mathematical Control and Information 2 Linear Algebra and its Applications 2 International Journal of Robust and Nonlinear Control 2 Journal of Mathematical Systems, Estimation, and Control 2 International Journal of Applied Mathematics and Computer Science 2 SIAM Journal on Control 2 Lecture Notes in Control and Information Sciences 2 Texts in Applied Mathematics 1 Journal of the Franklin Institute 1 IEEE Transactions on Circuits and Systems 1 Journal of Differential Equations 1 Journal of Optimization Theory and Applications 1 Mathematical Systems Theory 1 Proceedings of the London Mathematical Society. Third Series 1 SIAM Journal on Matrix Analysis and Applications 1 Journal de Mathématiques Pures et Appliquées. Neuvième Série 1 SIAM Review 1 Matemática Aplicada e Computacional 1 Nieuw Archief voor Wiskunde. Vierde Serie 1 Indagationes Mathematicae. New Series 1 European Series in Applied and Industrial Mathematics (ESAIM): Control, Optimization and Calculus of Variations 1 ZAMM. Zeitschrift für Angewandte Mathematik und Mechanik 1 Proceedings of the Royal Society of London. Series A. Mathematical, Physical and Engineering Sciences 1 Lecture Notes in Mathematics 1 Mathematics in Science and Engineering 1 NATO ASI Series. Series F. Computer and Systems Sciences 1 Mathematical Control and Related Fields 1 IEEE Control Systems
all top 5
Fields
150 Systems theory; control (93-XX) 48 Operator theory (47-XX) 22 Probability theory and stochastic processes (60-XX) 20 Calculus of variations and optimal control; optimization (49-XX) 15 Ordinary differential equations (34-XX) 12 Partial differential equations (35-XX) 12 Functional analysis (46-XX) 7 Approximations and expansions (41-XX) 6 Mechanics of deformable solids (74-XX) 5 General and overarching topics; collections (00-XX) 3 Linear and multilinear algebra; matrix theory (15-XX) 3 Statistics (62-XX) 2 History and biography (01-XX) 1 Measure and integration (28-XX) 1 Functions of a complex variable (30-XX) 1 Dynamical systems and ergodic theory (37-XX) 1 Difference and functional equations (39-XX) 1 Integral equations (45-XX) 1 Numerical analysis (65-XX)
Citations contained in zbMATH
136 Publications have been cited 2,327 times in 1,471 Documents Cited by Year
An introduction to infinite-dimensional linear systems theory. Zbl 0839.93001
Curtain, Ruth F.; Zwart, Hans
1995
Infinite dimensional linear systems theory. Zbl 0389.93001
Curtain, Ruth F.; Pritchard, Anthony J.
1978
Spectral realizations for delay systems. Zbl 0646.93014
Curtain, R. F.; Zwart, H. J.
1987
Functional analysis in modern applied mathematics. Zbl 0448.46002
Curtain, Ruth F.; Pritchard, A. J.
1977
Realisation and approximation of linear infinite-dimensional systems with error bounds. Zbl 0654.93011
Glover, Keith; Curtain, Ruth F.; Partington, Jonathan R.
1988
The infinite-dimensional Riccati equation for systems defined by evolution operators. Zbl 0352.49003
Curtain, Ruth; Pritchard, A. J.
1976
A semigroup approach to infinite dimensional system theory. Zbl 0426.93001
Curtain, Ruth F.; Pritchard, A. J.
1978
Stochastic differential equations in Hilbert space. Zbl 0225.60028
Curtain, Ruth F.; Falb, Peter L.
1971
Transfer functions of distributed parameter systems: a tutorial. Zbl 1162.93300
Curtain, Ruth; Morris, Kirsten
2009
Dynamic stabilization of regular linear systems. Zbl 0876.93074
Weiss, George; Curtain, Ruth F.
1997
Finite dimensional compensators for parabolic distributed systems with unbounded control and observation. Zbl 0542.93056
Curtain, Ruth F.
1984
Invariance concepts in infinite dimensions. Zbl 0602.93037
Curtain, Ruth F.
1986
Finite-dimensional compensator design for parabolic distributed systems with point sensors and boundary input. Zbl 0477.93039
Curtain, Ruth F.
1982
Well posedness of triples of operators (in the sense of linear systems theory). Zbl 0686.93049
Curtain, Ruth F.; Weiss, George
1989
Ito’s lemma in infinite dimensions. Zbl 0233.60051
Curtain, Ruth F.; Falb, Peter L.
1970
The Salamon-Weiss class of well-posed infinite-dimensional linear systems: A survey. Zbl 0880.93021
Curtain, Ruth F.
1997
Equivalence of input-output stability and exponential stability for infinite-dimensional systems. Zbl 0657.93050
Curtain, Ruth F.
1988
Robust stabilization of infinite dimensional systems by finite dimensional controllers. Zbl 0601.93044
Curtain, Ruth F.; Glover, Keith
1986
Finite dimensional compensators for infinite dimensional systems with unbounded input operators. Zbl 0598.93033
Curtain, R. F.; Salamon, D.
1986
Exponential stabilization of well-posed systems by colocated feedback. Zbl 1139.93026
Curtain, Ruth F.; Weiss, George
2006
Well-posedness, stabilizability, and admissibility for Pritchard-Salamon systems. Zbl 0815.93046
Curtain, Ruth F.; Logemann, Hartmut; Townley, Stuart; Zwart, Hans
1994
System theoretic properties of a class of spatially invariant systems. Zbl 1184.93094
Curtain, Ruth; Iftime, Orest V.; Zwart, Hans
2009
A survey of infinite-dimensional filtering. Zbl 0308.60022
Curtain, Ruth
1975
Spectral systems. Zbl 0541.93041
Curtain, Ruth F.
1984
Robust stabilizability of normalized coprime factors: The infinite- dimensional case. Zbl 0703.93050
Curtain, Ruth F.
1990
Stability of stochastic partial differential equation. Zbl 0452.60072
Curtain, Ruth F.
1981
Stochastic evolution equations with general white noise disturbance. Zbl 0367.60067
Curtain, Ruth F.
1977
Coprime factorization for regular linear systems. Zbl 0870.93025
Curtain, Ruth; Weiss, George; Weiss, Martin
1996
Comparison theorems for infinite-dimensional Riccati equations. Zbl 0716.93021
Curtain, Ruth F.; Rodman, Leiba
1990
Infinite-dimensional filtering. Zbl 0296.93036
Curtain, Ruth F.
1975
Linear operator inequalities for strongly stable weakly regular linear systems. Zbl 1114.93029
Curtain, Ruth F.
2001
Controller design for distributed systems based on Hankel-norm approximations. Zbl 0591.93033
Curtain, R. F.; Glover, K.
1986
Estimation theory for abstract evolution equations excited by general white noise processes. Zbl 0344.93064
Curtain, Ruth F.
1976
Compactness and nuclearity of the Hankel operator and internal stability of infinite-dimensional state linear systems. Zbl 1011.93024
Curtain, R. F.; Sasane, A. J.
2001
Robust control of flexible structures: A case study. Zbl 0643.93056
Bontsema, J.; Curtain, R. F.; Schumacher, J. M.
1988
Riccati equations for strongly stabilizable bounded linear systems. Zbl 0979.93092
Oostveen, Job C.; Curtain, Ruth F.
1998
$$L_{\infty}$$ approximation and nuclearity of delay systems. Zbl 0641.93018
Partington, J. R.; Glover, K.; Zwart, H. J.; Curtain, Ruth F.
1988
Balanced realisations for infinite dimensional systems. Zbl 0619.93016
Curtain, Ruth F.; Glover, Keith
1986
Explicit formulas for Hankel norm approximations of infinite-dimensional systems. Zbl 0681.47008
Curtain, Ruth F.; Ran, A. C. M.
1989
Partial fraction expansions for delay systems. Zbl 0654.93034
Zwart, H. J.; Curtain, R. F.; Partington, J. R.; Glover, K.
1988
Stability results of Popov-type for infinite-dimensional systems with applications to integral control. Zbl 1032.93061
Curtain, R. F.; Logemann, H.; Staffans, O.
2003
Linear-quadratic control problem with fixed endpoints in infinite dimensions. Zbl 0527.93037
Curtain, R. F.
1984
An abstract theory for unbounded control action for distributed parameter systems. Zbl 0359.93021
Curtain, Ruth F.; Pritchard, A. J.
1977
The separation principle for stochastic evolution equations. Zbl 0359.60076
Curtain, Ruth F.; Ichikawa, Akira
1977
Regular linear systems and their reciprocals: applications to Riccati equations. Zbl 1157.93345
Curtain, Ruth F.
2003
Robustly stabilizing controllers for dissipative infinite-dimensional systems with collocated actuators and sensors. Zbl 0979.93101
Oostveen, Job C.; Curtain, Ruth F.
2000
The Nehari problem for the Pritchard-Salamon class of infinite- dimensional linear systems: A direct approach. Zbl 0807.47011
Curtain, Ruth; Zwart, Hans
1994
Disturbance decoupling by measurement feedback with stability for infinite-dimensional systems. Zbl 0591.93032
Curtain, Ruth F.
1986
(C,A,B)-pairs in infinite dimensions. Zbl 0553.93037
Curtain, Ruth F.
1984
Compensators for infinite dimensional linear systems. Zbl 0518.93045
Curtain, Ruth F.
1983
Estimation and stochastic control for linear infinite-dimensional systems. Zbl 0444.60046
Curtain, Ruth F.
1978
The infinite-dimensional Riccati equation. Zbl 0279.93048
Curtain, Ruth F.; Pritchard, A. J.
1974
A comparison between LQR control for a long string of SISO systems and LQR control of the infinite spatially invariant version. Zbl 1204.49035
Curtain, Ruth; Iftime, Orest; Zwart, Hans
2010
Exponential stabilization of a Rayleigh beam using collocated control. Zbl 1367.74029
Weiss, George; Curtain, Ruth F.
2008
Necessary and sufficient conditions for strong stability of distributed parameter systems. Zbl 0917.93059
Curtain, Ruth F.; Oostveen, Job C.
1999
Representations of infinite-dimensional systems. Zbl 0684.93045
Curtain, R. F.
1989
Perturbation properties of a class of infinite-dimensional systems with unbounded control and observation. Zbl 0666.93067
Bontsema, Jan; Curtain, Ruth F.
1988
Local behaviour of Hilbert space valued stochastic integrals and the continuity of mild solutions of stochastic evolution equations. Zbl 0486.60058
Kotelenez, Peter; Curtain, Ruth F.
1982
Stabilization of collocated systems by nonlinear boundary control. Zbl 1347.93216
Curtain, Ruth; Zwart, Hans
2016
On Riccati equations in Banach algebras. Zbl 1223.46050
Curtain, Ruth; Sasane, Amol
2011
Normalized doubly coprime factorizations for infinite-dimensional linear systems. Zbl 1105.93052
Curtain, Ruth F.; Opmeer, Mark R.
2006
Absolute-stability results in infinite dimensions. Zbl 1074.93031
Curtain, R. F.; Logemann, H.; Staffans, O.
2004
Optimal Hankel norm approximation for the Pritchard-Salamon class of infinite-dimensional systems. Zbl 0990.93021
Sasane, Amol J.; Curtain, Ruth F.
2001
Old and new perspectives on the positive-real lemma in systems and control theory. Zbl 0961.93045
Curtain, R. F.
1999
The Nehari problem for nonexponentially stable systems. Zbl 0910.93024
Curtain, Ruth F.; Costveen, Job C.
1998
A weighted mixed-sensitivity $$H_ \infty$$-control design for irrational transfer matrices. Zbl 0865.93021
Curtain, Ruth F.; Zhou, Yishao
1996
Robust stabilization of infinite-dimensional systems with respect to coprime factor perturbations. Zbl 0792.93097
Curtain, Ruth F.; Pritchard, A. J.
1994
A note on spillover and robustness for flexible systems. Zbl 0644.93043
Bontsema, J.; Curtain, Ruth F.
1988
Pole assignment for distributed systems by finite-dimensional control. Zbl 0558.93035
Curtain, Ruth F.
1985
Finite dimensional compensators for some hyperbolic systems with boundary control. Zbl 0527.93048
Curtain, R. F.
1983
A representation of all solutions of the control algebraic Riccati equation for infinite-dimensional systems. Zbl 1115.93041
Iftime, O. V.; Zwart, H. J.; Curtain, R. F.
2005
New Riccati equations for well-posed linear systems. Zbl 1157.49316
Opmeer, Mark R.; Curtain, Ruth F.
2004
Riccati equations for stable well-posed linear systems: The generic case. Zbl 1048.49022
Curtain, Ruth F.
2003
Sub-optimal Hankel norm approximation for the analytic class of infinite-dimensional systems. Zbl 1007.93040
Sasane, Amol J.; Curtain, Ruth F.
2002
Inertia theorems for operator Lyapunov inequalities. Zbl 0974.93026
Sasane, A. J.; Curtain, R. F.
2001
Absolute stability results for well-posed infinite-dimensional systems with applications to low-gain integral control. Zbl 0964.93048
Logemann, Hartmut; Curtain, Ruth F.
2000
The Kalman-Yakubovich-Popov Lemma for Pritchard-Salamon systems. Zbl 0877.93065
Curtain, R. F.
1996
The Nehari problem for infinite-dimensional linear systems of parabolic type. Zbl 0858.47017
Curtain, Ruth F.; Ichikawa, Akira
1996
Riccati equations for second order spatially invariant partial differential systems. Zbl 1244.49061
Curtain, Ruth F.
2012
Robustly stabilizing controllers with respect to left-coprime factor perturbations for infinite-dimensional linear systems. Zbl 1129.93522
Curtain, Ruth F.
2006
The suboptimal Nehari problem for well-posed linear systems. Zbl 1094.47057
Curtain, Ruth F.; Opmeer, Mark R.
2005
Linear quadratic Gaussian balancing for discrete-time infinite-dimensional linear systems. Zbl 1090.47508
Opmeer, Mark R.; Curtain, Ruth F.
2004
Stabilization of irrational transfer functions by controllers with internal loop. Zbl 1175.93186
Curtain, Ruth F.; Weiss, George; Weiss, Martin
2001
Analytic system problems and $$J$$-lossless coprime factorization for infinite-dimensional linear systems. Zbl 0876.93028
Curtain, Ruth; Green, Michael
1997
The strict bounded real lemma in infinite dimensions. Zbl 0782.93043
Curtain, Ruth F.
1993
$$H_{\infty}$$-control with state-feedback: The infinite-dimensional case. Zbl 0770.93031
van Keulen, Bert; Peters, Marc; Curtain, Ruth
1993
Robust control with respect to coprime factors of infinite-dimensional positive real systems. Zbl 0760.93061
Curtain, Ruth F.; Van Keulen, Bert
1992
On stabilizability of linear spectral systems via state boundary feedback. Zbl 0557.93050
Curtain, Ruth F.
1985
Markov processes generated by linear stochastic evolution equations. Zbl 0461.60078
Curtain, Ruth F.
1981
A semigroup approach to the LQG problem for infinite-dimensional systems. Zbl 0402.93045
Curtain, Ruth F.
1978
Identification of noisy distributed parameter systems using stochastic approximation. Zbl 0351.93030
Kubrusly, C. S.; Curtain, R. F.
1977
The infinite-dimensional Riccati equation with applications to affine hereditary differential systems. Zbl 0316.93054
Curtain, Ruth F.
1975
Stability of stochastic dynamical systems. Proceedings of the international symposium. Organized by ”The Control Theory Centre”, University of Warwick, July 10-14, 1972. Sponsored by the ”International Union of Theoretical and Applied Mechanics”. Zbl 0238.00016
Curtain, Ruth F. (ed.)
1972
Riccati equations on noncommutative Banach algebras. Zbl 1262.46035
Curtain, Ruth
2011
Comments on “On optimal control of spatially distributed systems”. Zbl 1367.93277
Curtain, Ruth
2009
A robust LQG-controller design for DPS. Zbl 1122.93325
Curtain, R. F.
2006
Hankel norm approximation for well-posed linear systems. Zbl 1157.93419
Curtain, Ruth F.; Sasane, Amol J.
2003
Adaptive compresators for perturbed positive real infinite-dimensional systems. Zbl 1051.93051
Curtain, Ruth F.; Demetriou, Michael A.; Ito, Kazufumi
2003
An approximation theory for strongly stabilizing solutions to the operator LQ Riccati equation. Zbl 0970.49025
Oostveen, J. C.; Curtain, R. F.; Ito, K.
2000
Stabilility of semilinear evolution equations in Hilbert space. Zbl 0544.93056
Curtain, Ruth F.
1984
Introduction to infinite-dimensional systems theory. A state-space approach. Zbl 07188322
Curtain, Ruth; Zwart, Hans
2020
Strong stabilization of (almost) impedance passive systems by static output feedback. Zbl 1441.93219
Curtain, Ruth F.; Weiss, George
2019
A Kleinman-Newton construction of the maximal solution of the infinite-dimensional control Riccati equation. Zbl 1375.93063
Curtain, Ruth F.; Zwart, Hans; Iftime, Orest V.
2017
Stabilization of collocated systems by nonlinear boundary control. Zbl 1347.93216
Curtain, Ruth; Zwart, Hans
2016
Stabilizability and controllability of spatially invariant PDE systems. Zbl 1360.93177
Curtain, Ruth F.
2015
Riccati equations for second order spatially invariant partial differential systems. Zbl 1244.49061
Curtain, Ruth F.
2012
On Riccati equations in Banach algebras. Zbl 1223.46050
Curtain, Ruth; Sasane, Amol
2011
Riccati equations on noncommutative Banach algebras. Zbl 1262.46035
Curtain, Ruth
2011
Comments on “Distributed control of spatially invariant systems”. Zbl 1368.93267
Curtain, Ruth
2011
Coprime factorization and robust stabilization for discrete-time infinite-dimensional systems. Zbl 1248.93148
Curtain, Ruth F.; Opmeer, Mark R.
2011
A comparison between LQR control for a long string of SISO systems and LQR control of the infinite spatially invariant version. Zbl 1204.49035
Curtain, Ruth; Iftime, Orest; Zwart, Hans
2010
Analytic solutions of matrix Riccati equations with analytic coefficients. Zbl 1273.47020
Curtain, Ruth; Rodman, Leiba
2010
Transfer functions of distributed parameter systems: a tutorial. Zbl 1162.93300
Curtain, Ruth; Morris, Kirsten
2009
System theoretic properties of a class of spatially invariant systems. Zbl 1184.93094
Curtain, Ruth; Iftime, Orest V.; Zwart, Hans
2009
Comments on “On optimal control of spatially distributed systems”. Zbl 1367.93277
Curtain, Ruth
2009
Spectral properties of pseudo-resolvents under structured perturbations. Zbl 1248.93051
Curtain, Ruth F.; Jacob, Birgit
2009
State space formulas for a solution of the suboptimal Nehari problem on the unit disc. Zbl 1189.47080
Curtain, Ruth F.; Opmeer, Mark R.
2009
Exponential stabilization of a Rayleigh beam using collocated control. Zbl 1367.74029
Weiss, George; Curtain, Ruth F.
2008
The Hilbert-Schmidt property of feedback operators. Zbl 1154.93332
Curtain, Ruth; Mikkola, Kalle; Sasane, Amol
2007
Exponential stabilization of well-posed systems by colocated feedback. Zbl 1139.93026
Curtain, Ruth F.; Weiss, George
2006
Normalized doubly coprime factorizations for infinite-dimensional linear systems. Zbl 1105.93052
Curtain, Ruth F.; Opmeer, Mark R.
2006
Robustly stabilizing controllers with respect to left-coprime factor perturbations for infinite-dimensional linear systems. Zbl 1129.93522
Curtain, Ruth F.
2006
A robust LQG-controller design for DPS. Zbl 1122.93325
Curtain, R. F.
2006
Robustly stabilizing controllers with internal loop. Zbl 1118.93047
Curtain, Ruth F.
2006
A representation of all solutions of the control algebraic Riccati equation for infinite-dimensional systems. Zbl 1115.93041
Iftime, O. V.; Zwart, H. J.; Curtain, R. F.
2005
The suboptimal Nehari problem for well-posed linear systems. Zbl 1094.47057
Curtain, Ruth F.; Opmeer, Mark R.
2005
Absolute-stability results in infinite dimensions. Zbl 1074.93031
Curtain, R. F.; Logemann, H.; Staffans, O.
2004
New Riccati equations for well-posed linear systems. Zbl 1157.49316
Opmeer, Mark R.; Curtain, Ruth F.
2004
Linear quadratic Gaussian balancing for discrete-time infinite-dimensional linear systems. Zbl 1090.47508
Opmeer, Mark R.; Curtain, Ruth F.
2004
Stability results of Popov-type for infinite-dimensional systems with applications to integral control. Zbl 1032.93061
Curtain, R. F.; Logemann, H.; Staffans, O.
2003
Regular linear systems and their reciprocals: applications to Riccati equations. Zbl 1157.93345
Curtain, Ruth F.
2003
Riccati equations for stable well-posed linear systems: The generic case. Zbl 1048.49022
Curtain, Ruth F.
2003
Hankel norm approximation for well-posed linear systems. Zbl 1157.93419
Curtain, Ruth F.; Sasane, Amol J.
2003
Adaptive compresators for perturbed positive real infinite-dimensional systems. Zbl 1051.93051
Curtain, Ruth F.; Demetriou, Michael A.; Ito, Kazufumi
2003
Sub-optimal Hankel norm approximation for the analytic class of infinite-dimensional systems. Zbl 1007.93040
Sasane, Amol J.; Curtain, Ruth F.
2002
Linear operator inequalities for strongly stable weakly regular linear systems. Zbl 1114.93029
Curtain, Ruth F.
2001
Compactness and nuclearity of the Hankel operator and internal stability of infinite-dimensional state linear systems. Zbl 1011.93024
Curtain, R. F.; Sasane, A. J.
2001
Optimal Hankel norm approximation for the Pritchard-Salamon class of infinite-dimensional systems. Zbl 0990.93021
Sasane, Amol J.; Curtain, Ruth F.
2001
Inertia theorems for operator Lyapunov inequalities. Zbl 0974.93026
Sasane, A. J.; Curtain, R. F.
2001
Stabilization of irrational transfer functions by controllers with internal loop. Zbl 1175.93186
Curtain, Ruth F.; Weiss, George; Weiss, Martin
2001
The Popov criterion for strongly stable distributed parameter systems. Zbl 1014.93034
Curtain, Ruth F.; Oostveen, Job C.
2001
Robustly stabilizing controllers for dissipative infinite-dimensional systems with collocated actuators and sensors. Zbl 0979.93101
Oostveen, Job C.; Curtain, Ruth F.
2000
Absolute stability results for well-posed infinite-dimensional systems with applications to low-gain integral control. Zbl 0964.93048
Logemann, Hartmut; Curtain, Ruth F.
2000
An approximation theory for strongly stabilizing solutions to the operator LQ Riccati equation. Zbl 0970.49025
Oostveen, J. C.; Curtain, R. F.; Ito, K.
2000
Necessary and sufficient conditions for strong stability of distributed parameter systems. Zbl 0917.93059
Curtain, Ruth F.; Oostveen, Job C.
1999
Old and new perspectives on the positive-real lemma in systems and control theory. Zbl 0961.93045
Curtain, R. F.
1999
Riccati equations for strongly stabilizable bounded linear systems. Zbl 0979.93092
Oostveen, Job C.; Curtain, Ruth F.
1998
The Nehari problem for nonexponentially stable systems. Zbl 0910.93024
Curtain, Ruth F.; Costveen, Job C.
1998
Dynamic stabilization of regular linear systems. Zbl 0876.93074
Weiss, George; Curtain, Ruth F.
1997
The Salamon-Weiss class of well-posed infinite-dimensional linear systems: A survey. Zbl 0880.93021
Curtain, Ruth F.
1997
Analytic system problems and $$J$$-lossless coprime factorization for infinite-dimensional linear systems. Zbl 0876.93028
Curtain, Ruth; Green, Michael
1997
Coprime factorization for regular linear systems. Zbl 0870.93025
Curtain, Ruth; Weiss, George; Weiss, Martin
1996
A weighted mixed-sensitivity $$H_ \infty$$-control design for irrational transfer matrices. Zbl 0865.93021
Curtain, Ruth F.; Zhou, Yishao
1996
The Kalman-Yakubovich-Popov Lemma for Pritchard-Salamon systems. Zbl 0877.93065
Curtain, R. F.
1996
The Nehari problem for infinite-dimensional linear systems of parabolic type. Zbl 0858.47017
Curtain, Ruth F.; Ichikawa, Akira
1996
Riccati equations and normalized coprime factorizations for strongly stabilizable infinite-dimensional systems. Zbl 0875.93201
Curtain, Ruth F.; Zwart, Hans
1996
Approximate solutions to a weighted mixed-sensitivity $$H^ \infty$$-control design for irrational transfer matrices. Zbl 0863.93023
Curtain, R. F.; Weiss, M.; Zhou, Y.
1996
Closed formulae for a parametric-mixed-sensitivity problem for Pritchard-Salamon systems. Zbl 0866.93028
Curtain, R. F.; Weiss, M.; Zhou, Y.
1996
Corrections to “The Kalman-Yakubovich-Popov lemma for Pritchard-Salamon systems”. Zbl 0883.93032
Curtain, R. F.
1996
An introduction to infinite-dimensional linear systems theory. Zbl 0839.93001
Curtain, Ruth F.; Zwart, Hans
1995
A weighted mixed-sensitivity $$H_ \infty$$-control design for irrational transfer matrices. Zbl 0852.93033
Curtain, Ruth F.; Zhou, Yishao
1995
Well-posedness, stabilizability, and admissibility for Pritchard-Salamon systems. Zbl 0815.93046
Curtain, Ruth F.; Logemann, Hartmut; Townley, Stuart; Zwart, Hans
1994
The Nehari problem for the Pritchard-Salamon class of infinite- dimensional linear systems: A direct approach. Zbl 0807.47011
Curtain, Ruth; Zwart, Hans
1994
Robust stabilization of infinite-dimensional systems with respect to coprime factor perturbations. Zbl 0792.93097
Curtain, Ruth F.; Pritchard, A. J.
1994
The Nehari problem for the Pritchard-Salamon class of infinite-dimensional linear systems: A direct approach. Zbl 0925.93322
Zwart, Hans; Curtain, Ruth
1994
Necessary and sufficient conditions for J-spectral factorizations with a J-Lossless property for infinite-dimensional systems in continuous and discrete time. Zbl 0802.93049
Curtain, Ruth F.; Rodríguez, Alejandro
1994
The strict bounded real lemma in infinite dimensions. Zbl 0782.93043
Curtain, Ruth F.
1993
$$H_{\infty}$$-control with state-feedback: The infinite-dimensional case. Zbl 0770.93031
van Keulen, Bert; Peters, Marc; Curtain, Ruth
1993
Analysis and optimization of systems: state and frequency domain approaches for infinite-dimensional systems. Proceedings of the 10th international conference, Sophia-Antipolis, France, June 9-12, 1992. Zbl 0771.00025
Curtain, R. F. (ed.); Bensoussan, A. (ed.); Lions, J. L. (ed.)
1993
Robust control with respect to coprime factors of infinite-dimensional positive real systems. Zbl 0760.93061
Curtain, Ruth F.; Van Keulen, Bert
1992
Robust stabilizability of normalized coprime factors: The infinite- dimensional case. Zbl 0703.93050
Curtain, Ruth F.
1990
Comparison theorems for infinite-dimensional Riccati equations. Zbl 0716.93021
Curtain, Ruth F.; Rodman, Leiba
1990
Well posedness of triples of operators (in the sense of linear systems theory). Zbl 0686.93049
Curtain, Ruth F.; Weiss, George
1989
Explicit formulas for Hankel norm approximations of infinite-dimensional systems. Zbl 0681.47008
Curtain, Ruth F.; Ran, A. C. M.
1989
Representations of infinite-dimensional systems. Zbl 0684.93045
Curtain, R. F.
1989
Robustness of distributed parameter systems. Zbl 0698.93061
Curtain, Ruth F.
1989
Equivalence of input-output stability and exponential stability. Zbl 0673.93041
Curtain, Ruth F.
1989
Realisation and approximation of linear infinite-dimensional systems with error bounds. Zbl 0654.93011
Glover, Keith; Curtain, Ruth F.; Partington, Jonathan R.
1988
Equivalence of input-output stability and exponential stability for infinite-dimensional systems. Zbl 0657.93050
Curtain, Ruth F.
1988
Robust control of flexible structures: A case study. Zbl 0643.93056
Bontsema, J.; Curtain, R. F.; Schumacher, J. M.
1988
$$L_{\infty}$$ approximation and nuclearity of delay systems. Zbl 0641.93018
Partington, J. R.; Glover, K.; Zwart, H. J.; Curtain, Ruth F.
1988
Partial fraction expansions for delay systems. Zbl 0654.93034
Zwart, H. J.; Curtain, R. F.; Partington, J. R.; Glover, K.
1988
Perturbation properties of a class of infinite-dimensional systems with unbounded control and observation. Zbl 0666.93067
Bontsema, Jan; Curtain, Ruth F.
1988
A note on spillover and robustness for flexible systems. Zbl 0644.93043
Bontsema, J.; Curtain, Ruth F.
1988
$$L_{\infty}$$-approximations of complex functions and robust controllers for large flexible structures. Zbl 0672.93039
Curtain, Ruth F.
1988
Spectral realizations for delay systems. Zbl 0646.93014
Curtain, R. F.; Zwart, H. J.
1987
Stochastic models for uncertain flexible systems. Zbl 0631.93069
Curtain, Ruth F.; Kotelenez, Peter
1987
Modelling, robustness and sensitivity reduction in control systems. (Proceedings of the NATO Advanced Research Workshop on Modelling, Robustness and Sensitivity Reduction in Control Systems held in Groningen, The Netherlands, December 1-5, 1986). Zbl 0624.00022
Curtain, Ruth F. (ed.)
1987
Stochastic bilinear spectral systems. Zbl 0615.60055
Curtain, Ruth F.; Kotelenez, Peter
1987
Invariance concepts in infinite dimensions. Zbl 0602.93037
Curtain, Ruth F.
1986
Robust stabilization of infinite dimensional systems by finite dimensional controllers. Zbl 0601.93044
Curtain, Ruth F.; Glover, Keith
1986
Finite dimensional compensators for infinite dimensional systems with unbounded input operators. Zbl 0598.93033
Curtain, R. F.; Salamon, D.
1986
Controller design for distributed systems based on Hankel-norm approximations. Zbl 0591.93033
Curtain, R. F.; Glover, K.
1986
Balanced realisations for infinite dimensional systems. Zbl 0619.93016
Curtain, Ruth F.; Glover, Keith
1986
Disturbance decoupling by measurement feedback with stability for infinite-dimensional systems. Zbl 0591.93032
Curtain, Ruth F.
1986
Pole assignment for distributed systems by finite-dimensional control. Zbl 0558.93035
Curtain, Ruth F.
1985
On stabilizability of linear spectral systems via state boundary feedback. Zbl 0557.93050
Curtain, Ruth F.
1985
Disturbance decoupling for distributed systems by boundary control. Zbl 0584.93037
Curtain, Ruth F.
1985
Decoupling in infinite dimensions. Zbl 0565.93038
Curtain, Ruth F.
1985
Finite dimensional compensators for parabolic distributed systems with unbounded control and observation. Zbl 0542.93056
Curtain, Ruth F.
1984
...and 36 more Documents
all top 5
Cited by 1,609 Authors
65 Curtain, Ruth Frances 38 Zwart, Hans J. 32 Guo, Bao-Zhu 25 Partington, Jonathan R. 20 Leiva, Hugo 18 Logemann, Hartmut 17 Sukavanam, Nagarajan 17 Weiss, George 16 Morris, Kirsten A. 16 Sasane, Amol J. 15 Henríquez, Hernán R. 15 Winkin, Joseph J. 14 Dubljevic, Stevan S. 14 Kobayashi, Toshihiro 14 Sano, Hideki 14 Wu, Huaining 13 Iftime, Orest V. 12 Jacob, Birgit 12 Wang, Junmin 11 Balas, Mark J. 11 Fridman, Emilia 11 Fu, Xianlong 11 Paunonen, Lassi 11 Wang, Junwei 10 Balachandran, Krishnan 10 Boutoulout, Ali 10 Nambu, Takao 10 Opmeer, Mark R. 10 Xu, Gen-Qi 9 Aksikas, Ilyasse 9 Callier, Frank M. 9 Kunisch, Karl 9 Mahmudov, Nazim Idrisoglu 9 Özbay, Hitay 9 Pritchard, Anthony J. 8 Bonnet, Catherine 8 Breiten, Tobias 8 Demetriou, Michael A. 8 El-Sayed, Ahmed Mohamed Ahmed 8 Kotelenez, Peter M. 8 Krstić, Miroslav 8 Pandey, Dwijendra Narain 8 Pohjolainen, Seppo A. 8 Rebarber, Richard 8 Shukla, Anurag 8 Staffans, Olof Johan 8 Tucsnak, Marius 7 Da Prato, Giuseppe 7 Deutscher, Joachim 7 El Jai, Abdelhaq 7 Glover, Keith J. 7 Guiver, Chris 7 Ibiejugba, Matthew A. 7 Ichikawa, Akira 7 Lam, James 7 Lasiecka, Irena 7 Michiels, Wim 7 Otsuka, Naohisa 7 Pandolfi, Luciano 7 Prieur, Christophe 7 Rabah, Rabah 7 Singler, John R. 7 Zerrik, El Hassan 7 Zhou, Hua-Cheng 6 Caraballo Garrido, Tomás 6 Chen, Jianhua 6 Goreac, Dan 6 Grabowski, Piotr 6 Makila, Pertti M. 6 Meurer, Thomas 6 Ouzahra, Mohamed 6 Rosen, I. Gary 6 Sklyar, Grigory Mikhailovitch 6 Townley, Stuart B. 6 Xu, Xiaodong 6 Yang, Kunyi 5 Ahmed, Nasir Uddin 5 Arora, Urvashi 5 Bagchi, Arunabha 5 Bashirov, Agamirza E. 5 Chentouf, Boumediène 5 Cuevas, Claudio 5 Dochain, Denis 5 Dragan, Vasile 5 Gao, Hang 5 Guo, Faming 5 Hadd, Said 5 Immonen, Eero 5 Inaba, Hiroshi 5 Le Gorrec, Yann 5 Matignon, Denis 5 Mironchenko, Andrii 5 Mokkedem, Fatima Zahra 5 Pfeiffer, Laurent 5 Ran, André C. M. 5 Ryan, Eugene P. 5 Shao, Zhichao 5 Unny, T. E. 5 Xu, Cheng-Zhong 4 Achhab, Mohammed Elarbi ...and 1,509 more Authors
all top 5
Cited in 233 Serials
171 Systems & Control Letters 167 Automatica 94 Journal of Mathematical Analysis and Applications 78 International Journal of Control 46 MCSS. Mathematics of Control, Signals, and Systems 35 European Series in Applied and Industrial Mathematics (ESAIM): Control, Optimization and Calculus of Variations 33 Journal of the Franklin Institute 33 SIAM Journal on Control and Optimization 28 Journal of Differential Equations 27 International Journal of Systems Science 26 European Journal of Control 25 Journal of Optimization Theory and Applications 24 Integral Equations and Operator Theory 23 Applied Mathematics and Computation 22 Linear Algebra and its Applications 19 Stochastic Analysis and Applications 17 Applied Mathematics and Optimization 15 International Journal of Robust and Nonlinear Control 15 Abstract and Applied Analysis 14 Stochastics 14 Journal of Dynamical and Control Systems 14 Mathematical Control and Related Fields 13 Numerical Functional Analysis and Optimization 13 International Journal of Applied Mathematics and Computer Science 10 Journal of Functional Analysis 10 Journal of Systems Science and Complexity 9 Journal of Fluid Mechanics 8 Computers & Mathematics with Applications 8 Nonlinear Analysis. Theory, Methods & Applications. Series A: Theory and Methods 8 Applied Mathematics Letters 8 Mathematical and Computer Modelling 8 Evolution Equations and Control Theory 8 Nonlinear Analysis. Theory, Methods & Applications 7 Mathematical Methods in the Applied Sciences 7 Journal of Evolution Equations 7 Journal of Control Theory and Applications 7 Asian Journal of Control 6 Applicable Analysis 6 Kybernetika 6 Circuits, Systems, and Signal Processing 6 Mathematical Problems in Engineering 6 Nonlinear Dynamics 6 Discrete and Continuous Dynamical Systems. Series B 5 Computer Methods in Applied Mechanics and Engineering 5 Mathematics and Computers in Simulation 5 Statistics & Probability Letters 5 Applied Numerical Mathematics 5 Stochastic Hydrology and Hydraulics 5 Applied Mathematical Modelling 5 Automation and Remote Control 5 International Journal of Computer Mathematics 5 Discrete and Continuous Dynamical Systems 5 Advances in Difference Equations 5 Complex Analysis and Operator Theory 4 Journal of Computational and Applied Mathematics 4 Mathematische Nachrichten 4 Mathematical Systems Theory 4 Numerische Mathematik 4 Quarterly of Applied Mathematics 4 Rendiconti del Seminario Matematico della Università di Padova 4 Optimal Control Applications & Methods 4 Acta Applicandae Mathematicae 4 Journal of Mathematical Sciences (New York) 4 Positivity 3 Chaos, Solitons and Fractals 3 Information Sciences 3 Mathematische Annalen 3 Proceedings of the American Mathematical Society 3 Rendiconti del Circolo Matemàtico di Palermo. Serie II 3 Zeitschrift für Analysis und ihre Anwendungen 3 SIAM Journal on Matrix Analysis and Applications 3 Japan Journal of Industrial and Applied Mathematics 3 Stochastic Processes and their Applications 3 Cybernetics and Systems Analysis 3 Journal of Vibration and Control 3 Fractional Calculus & Applied Analysis 3 Comptes Rendus. Mathématique. Académie des Sciences, Paris 3 Stochastics and Dynamics 3 African Diaspora Journal of Mathematics 2 Bulletin of the Australian Mathematical Society 2 Journal of Mathematical Physics 2 Mathematical Biosciences 2 Reports on Mathematical Physics 2 Rocky Mountain Journal of Mathematics 2 ZAMP. Zeitschrift für angewandte Mathematik und Physik 2 Annali di Matematica Pura ed Applicata. Serie Quarta 2 Fuzzy Sets and Systems 2 Journal of Soviet Mathematics 2 Kodai Mathematical Journal 2 Proceedings of the Japan Academy. Series A 2 Results in Mathematics 2 Semigroup Forum 2 Transactions of the American Mathematical Society 2 Applied Mathematics and Mechanics. (English Edition) 2 Annales de l’Institut Henri Poincaré. Analyse Non Linéaire 2 Acta Mathematicae Applicatae Sinica. English Series 2 Probability Theory and Related Fields 2 Multidimensional Systems and Signal Processing 2 Dynamics and Control 2 Annales de l’Institut Henri Poincaré. Nouvelle Série. Section B. Calcul des Probabilités et Statistique ...and 133 more Serials
all top 5
Cited in 44 Fields
1,137 Systems theory; control (93-XX) 304 Partial differential equations (35-XX) 288 Operator theory (47-XX) 201 Ordinary differential equations (34-XX) 175 Calculus of variations and optimal control; optimization (49-XX) 149 Probability theory and stochastic processes (60-XX) 67 Numerical analysis (65-XX) 62 Mechanics of deformable solids (74-XX) 47 Functional analysis (46-XX) 38 Fluid mechanics (76-XX) 31 Biology and other natural sciences (92-XX) 30 Dynamical systems and ergodic theory (37-XX) 27 Integral equations (45-XX) 24 Linear and multilinear algebra; matrix theory (15-XX) 23 Operations research, mathematical programming (90-XX) 22 Mechanics of particles and systems (70-XX) 18 Approximations and expansions (41-XX) 15 Real functions (26-XX) 13 Functions of a complex variable (30-XX) 12 Computer science (68-XX) 11 Statistics (62-XX) 8 Harmonic analysis on Euclidean spaces (42-XX) 8 Classical thermodynamics, heat transfer (80-XX) 8 Information and communication theory, circuits (94-XX) 7 Difference and functional equations (39-XX) 6 Integral transforms, operational calculus (44-XX) 6 Game theory, economics, finance, and other social and behavioral sciences (91-XX) 3 History and biography (01-XX) 3 Mathematical logic and foundations (03-XX) 3 Abstract harmonic analysis (43-XX) 3 Global analysis, analysis on manifolds (58-XX) 3 Optics, electromagnetic theory (78-XX) 3 Quantum theory (81-XX) 3 Statistical mechanics, structure of matter (82-XX) 3 Geophysics (86-XX) 2 General and overarching topics; collections (00-XX) 2 Number theory (11-XX) 2 Measure and integration (28-XX) 1 Combinatorics (05-XX) 1 Associative rings and algebras (16-XX) 1 $$K$$-theory (19-XX) 1 Several complex variables and analytic spaces (32-XX) 1 Convex and discrete geometry (52-XX) 1 Astronomy and astrophysics (85-XX)
Wikidata Timeline
The data are displayed as stored in Wikidata under a Creative Commons CC0 License. Updates and corrections should be made in Wikidata. | 2021-04-11T16:36:56 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6492696404457092, "perplexity": 8873.020762061215}, "config": {"markdown_headings": false, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038064520.8/warc/CC-MAIN-20210411144457-20210411174457-00148.warc.gz"} |
http://www.nist.gov/publication-portal.cfm?researchField=422&sortBy=date&page=7 | # Publications Portal
You searched on:
Topic Area: Modeling
Sorted by: date
Displaying records 61 to 70 of 143 records.
Resort by: Date / Title
61. Towards a Metric for Communication Network Vulnerability to Attacks: A Game Theoretic Approach
Topic: Modeling
Published: 2/13/2012
Authors: Assane Gueye, Vladimir V Marbukh
Abstract: In this paper, we propose a quantification of the vulnerability of a communication network when links are subject to failures due to the actions of a strategic adversary. We model the adversarial nature of the problem as a 2-player game between a net ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=910926
62. First Variation of the General Curvature-dependent Surface Energy
Topic: Modeling
Published: 1/1/2012
Authors: Gunay Dogan, Ricardo H. Nochetto
Abstract: We consider general weighted surface energies, where the energies have the form of weighted integrals over a closed surface and the weight depends on the normal and the mean curvature of the surface. Energies of this form have applications in many ar ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=901101
63. Predicted Energy Resolution of a Running-Sum Algorithm for Microcalorimeters
Topic: Modeling
Published: 12/1/2011
Authors: Bradley K Alpert, William Bertrand Doriese, Joseph Westbrook Fowler, Joel Nathan Ullom
Abstract: The energy resolution of a high-pulse-rate filtering algorithm recently introduced by Hui Tan et al., based on running sums of TES microcalorimeter output streams, is predicted from average pulse shape and noise autocovariance. We compare with empiri ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=909156
64. Comparing VM-Placement Algorithms for On-Demand Clouds
Topic: Modeling
Published: 11/29/2011
Authors: Kevin L Mills, James J Filliben, Christopher E Dabrowski
Abstract: Much recent research has been devoted to investigating algorithms for allocating virtual machines (VMs) to physical machines (PMs) in infrastructure clouds. Many such algorithms address distinct problems, such as initial placement, consolidation, or ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=909220
65. Fundamental Solution of Laplace's Equation in Hyperspherical Geometry
Topic: Modeling
Published: 11/29/2011
Author: Howard S Cohl
Abstract: Due to the isotropy of $d$-dimensional hyperspherical space, one expects there to exist a spherically symmetric fundamental solution for its corresponding Laplace-Beltrami operator. The $R$-radius hypersphere ${\mathbf S}_R^d$ with $R>0$, represents ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=909273
66. VM Leakage and Orphan Control in Open-Source Clouds
Topic: Modeling
Published: 11/29/2011
Authors: Christopher E Dabrowski, Kevin L Mills
Abstract: Computer systems often exhibit degraded performance due to resource leakage caused by erroneous programming or malicious attacks, and computers can even crash in extreme cases of resource exhaustion. The advent of cloud computing provides increased o ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=909325
67. In Search of Enhanced Electrolyte Materials: A Case Study of Doubly Doped Ceria
Topic: Modeling
Published: 10/28/2011
Authors: Pratik Dholabhai, James B. Adams, Peter A. Crozier, Renu Sharma
Abstract: Various compositions of gadolinium-praseodymium doubly doped ceria (GPDC) have been studied to appreciate the effect of two co-dopants in enhancing the ionic conductivity. A Kinetic Lattice Monte Carlo (KLMC) model of vacancy diffusion in GPDC has be ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=909021
68. Mathematical Model Formulation and Validation of Water and Cryoprotective Agent Transport in Whole Hamster Pancreatic Islets
Topic: Modeling
Published: 10/11/2011
Authors: James D. Benson, Charles T Benson, John K Critser
Abstract: A mathematical and conceptual model of water and solute transport for whole hamster pancreatic islets has been developed and experimentally validated incorporating fundamental biophysical data from previous studies on individual hamster islet cells ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=906347
69. COMPARISON OF TWO DIMENSION-REDUCTION METHODS FOR NETWORK SIMULATION MODELS
Series: Journal of Research (NIST JRES)
Report Number: 116-5
Topic: Modeling
Published: 10/5/2011
Authors: Kevin L Mills, James J Filliben
Abstract: Experimenters characterize the behavior of simulation models for data communications networks by measuring multiple responses under selected parameter combinations. The resulting multivariate data may include redundant responses reflecting aspects of ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=906588
70. A Mathematical Model of Joint Congestion Control and Routing in Multisource Networks
Topic: Modeling
Published: 9/28/2011
Authors: Fern Y Hunt, Vladimir V Marbukh, Yi Wang
Abstract: In this paper we study a model of joint congestion control and routing in a ring of network sources with a single destination at the center. A utility maximization problem subject to routing constraints is posed and equations for its solution are pre ...
http://www.nist.gov/manuscript-publication-search.cfm?pub_id=907904
## Search NIST-wide:
(Search abstract and keywords)
Last Name:
First Name:
Special Publications:
Looking for a NIST Special Publication (NIST SP Series)? Place the series number and dash in the report number field (Example: 800-) and begin your search.
• SP 250-XX: Calibration Services
• SP 260-XX: Standard Reference Materials
• SP 300-XX: Precision Measurement and Calibration
• SP 400-XX: Semiconductor Measurement Technology
• SP 480-XX: Law Enforcement Technology
• SP 500-XX: Computer Systems Technology
• SP 700-XX: Industrial Measurement Series
• SP 800-XX: Computer Security Series
• SP 823-XX: Integrated Services Digital Network Series | 2014-12-20T00:57:18 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.5583019256591797, "perplexity": 11188.22808451548}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2014-52/segments/1418802769305.158/warc/CC-MAIN-20141217075249-00100-ip-10-231-17-201.ec2.internal.warc.gz"} |
https://lammps.sandia.gov/doc/fix_neb.html | # fix neb command
## Syntax
fix ID group-ID neb Kspring keyword value
• ID, group-ID are documented in fix command
• neb = style name of this fix command
• Kspring = spring constant for parallel nudging force (force/distance units or force units, see parallel keyword)
• zero or more keyword/value pairs may be appended
• keyword = parallel or perp or end
parallel value = neigh or ideal
neigh = parallel nudging force based on distance to neighbor replicas (Kspring = force/distance units)
ideal = parallel nudging force based on interpolated ideal position (Kspring = force units)
perp value = Kspring2
Kspring2 = spring constant for perpendicular nudging force (force/distance units)
end values = estyle Kspring3
estyle = first or last or last/efirst or last/efirst/middle
first = apply force to first replica
last = apply force to last replica
last/efirst = apply force to last replica and set its target energy to that of first replica
last/efirst/middle = same as last/efirst plus prevent middle replicas having lower energy than first replica
Kspring3 = spring constant for target energy term (1/distance units)
## Examples
fix 1 active neb 10.0
fix 2 all neb 1.0 perp 1.0 end last
fix 2 all neb 1.0 perp 1.0 end first 1.0 end last 1.0
fix 1 all neb 1.0 parallel ideal end last/efirst 1
## Description
Add nudging forces to atoms in the group for a multi-replica simulation run via the neb command to perform a nudged elastic band (NEB) calculation for finding the transition state. Hi-level explanations of NEB are given with the neb command and on the Howto replica doc page. The fix neb command must be used with the “neb” command and defines how inter-replica nudging forces are computed. A NEB calculation is divided in two stages. In the first stage n replicas are relaxed toward a MEP until convergence. In the second stage, the climbing image scheme (see (Henkelman2)) is enabled, so that the replica having the highest energy relaxes toward the saddle point (i.e. the point of highest energy along the MEP), and a second relaxation is performed.
A key purpose of the nudging forces is to keep the replicas equally spaced. During the NEB calculation, the 3N-length vector of interatomic force Fi = -Grad(V) for each replica I is altered. For all intermediate replicas (i.e. for 1 < I < N, except the climbing replica) the force vector becomes:
Fi = -Grad(V) + (Grad(V) dot T') T' + Fnudge_parallel + Fnudge_perp
T’ is the unit “tangent” vector for replica I and is a function of Ri, Ri-1, Ri+1, and the potential energy of the 3 replicas; it points roughly in the direction of (Ri+i - Ri-1); see the (Henkelman1) paper for details. Ri are the atomic coordinates of replica I; Ri-1 and Ri+1 are the coordinates of its neighbor replicas. The term (Grad(V) dot T’) is used to remove the component of the gradient parallel to the path which would tend to distribute the replica unevenly along the path. Fnudge_parallel is an artificial nudging force which is applied only in the tangent direction and which maintains the equal spacing between replicas (see below for more information). Fnudge_perp is an optional artificial spring which is applied in a direction perpendicular to the tangent direction and which prevent the paths from forming acute kinks (see below for more information).
In the second stage of the NEB calculation, the interatomic force Fi for the climbing replica (the replica of highest energy after the first stage) is changed to:
Fi = -Grad(V) + 2 (Grad(V) dot T') T'
and the relaxation procedure is continued to a new converged MEP.
The keyword parallel specifies how the parallel nudging force is computed. With a value of neigh, the parallel nudging force is computed as in (Henkelman1) by connecting each intermediate replica with the previous and the next image:
Fnudge_parallel = Kspring * (|Ri+1 - Ri| - |Ri - Ri-1|)
Note that in this case the specified Kspring is in force/distance units.
With a value of ideal, the spring force is computed as suggested in ref(WeinanE) <WeinanE>
Fnudge_parallel = -Kspring * (RD-RDideal) / (2 * meanDist)
where RD is the “reaction coordinate” see neb section, and RDideal is the ideal RD for which all the images are equally spaced. I.e. RDideal = (I-1)*meanDist when the climbing replica is off, where I is the replica number). The meanDist is the average distance between replicas. Note that in this case the specified Kspring is in force units.
Note that the ideal form of nudging can often be more effective at keeping the replicas equally spaced.
The keyword perp specifies if and how a perpendicular nudging force is computed. It adds a spring force perpendicular to the path in order to prevent the path from becoming too strongly kinked. It can significantly improve the convergence of the NEB calculation when the resolution is poor. I.e. when few replicas are used; see (Maras) for details.
The perpendicular spring force is given by
Fnudge_perp = Kspring2 * F(Ri-1,Ri,Ri+1) (Ri+1 + Ri-1 - 2 Ri)
where Kspring2 is the specified value. F(Ri-1 Ri R+1) is a smooth scalar function of the angle Ri-1 Ri Ri+1. It is equal to 0.0 when the path is straight and is equal to 1 when the angle Ri-1 Ri Ri+1 is acute. F(Ri-1 Ri R+1) is defined in (Jonsson).
If Kspring2 is set to 0.0 (the default) then no perpendicular spring force is added.
By default, no additional forces act on the first and last replicas during the NEB relaxation, so these replicas simply relax toward their respective local minima. By using the key word end, additional forces can be applied to the first and/or last replicas, to enable them to relax toward a MEP while constraining their energy E to the target energy ETarget.
If ETarget>E, the interatomic force Fi for the specified replica becomes:
Fi = -Grad(V) + (Grad(V) dot T' + (E-ETarget)*Kspring3) T', when Grad(V) dot T' < 0
Fi = -Grad(V) + (Grad(V) dot T' + (ETarget- E)*Kspring3) T', when Grad(V) dot T' > 0
The “spring” constant on the difference in energies is the specified Kspring3 value.
When estyle is specified as first, the force is applied to the first replica. When estyle is specified as last, the force is applied to the last replica. Note that the end keyword can be used twice to add forces to both the first and last replicas.
For both these estyle settings, the target energy ETarget is set to the initial energy of the replica (at the start of the NEB calculation).
If the estyle is specified as last/efirst or last/efirst/middle, force is applied to the last replica, but the target energy ETarget is continuously set to the energy of the first replica, as it evolves during the NEB relaxation.
The difference between these two estyle options is as follows. When estyle is specified as last/efirst, no change is made to the inter-replica force applied to the intermediate replicas (neither first or last). If the initial path is too far from the MEP, an intermediate replica may relax “faster” and reach a lower energy than the last replica. In this case the intermediate replica will be relaxing toward its own local minima. This behavior can be prevented by specifying estyle as last/efirst/middle which will alter the inter-replica force applied to intermediate replicas by removing the contribution of the gradient to the inter-replica force. This will only be done if a particular intermediate replica has a lower energy than the first replica. This should effectively prevent the intermediate replicas from over-relaxing.
After converging a NEB calculation using an estyle of last/efirst/middle, you should check that all intermediate replicas have a larger energy than the first replica. If this is not the case, the path is probably not a MEP.
Finally, note that the last replica may never reach the target energy if it is stuck in a local minima which has a larger energy than the target energy.
Restart, fix_modify, output, run start/stop, minimize info:
No information about this fix is written to binary restart files. None of the fix_modify options are relevant to this fix. No global or per-atom quantities are stored by this fix for access by various output commands. No parameter of this fix can be used with the start/stop keywords of the run command.
The forces due to this fix are imposed during an energy minimization, as invoked by the minimize command via the neb command.
## Restrictions
This command can only be used if LAMMPS was built with the REPLICA package. See the Build package doc page for more info.
## Default
The option defaults are parallel = neigh, perp = 0.0, ends is not specified (no inter-replica force on the end replicas).
(Henkelman1) Henkelman and Jonsson, J Chem Phys, 113, 9978-9985 (2000).
(Henkelman2) Henkelman, Uberuaga, Jonsson, J Chem Phys, 113, 9901-9904 (2000).
(WeinanE) E, Ren, Vanden-Eijnden, Phys Rev B, 66, 052301 (2002).
(Jonsson) Jonsson, Mills and Jacobsen, in Classical and Quantum Dynamics in Condensed Phase Simulations, edited by Berne, Ciccotti, and Coker World Scientific, Singapore, 1998, p 385.
(Maras) Maras, Trushin, Stukowski, Ala-Nissila, Jonsson, Comp Phys Comm, 205, 13-21 (2016). | 2019-05-20T02:37:21 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.598276674747467, "perplexity": 3810.962864831595}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-22/segments/1558232255536.6/warc/CC-MAIN-20190520021654-20190520043654-00300.warc.gz"} |
https://zbmath.org/authors/?s=0&q=Kublanovskaya%2C+Vera | ## Kublanovskaya, Vera Nikolaevna
Compute Distance To:
Author ID: kublanovskaya.v-n Published as: Kublanovskaya, V. N.; Kublanoskaya, V. N.; Kublanovskaya, Vera more...less External Links: MacTutor · Wikidata · Math-Net.Ru · GND
Documents Indexed: 170 Publications since 1959, including 1 Book 30 Contributions as Editor · 1 Further Contribution Biographic References: 4 Publications Co-Authors: 24 Co-Authors with 84 Joint Publications 506 Co-Co-Authors
all top 5
### Co-Authors
116 single-authored 23 Khazanov, V. B. 17 Kolotilina, Lily Yu. 11 Simonova, V. N. 9 Kon’kova, T. Ya. 7 Smirnova, T. N. 5 Il’in, Valeriĭ Pavlovich 4 Faddeeva, Vera Nikolaevna 4 Savinova, L. T. 3 Bashmakov, M. I. 3 Borevich, Zenon Ivanovich 3 Faddeev, Dmitriĭ Konstantinovich 3 Skopin, A. I. 3 Yakovlev, Anatoliĭ Vladimirovich 2 Aleksandrov, Pavel Sergeevich 2 Savinov, Georgiĭ Vladimirovich 2 Sobolev, Sergeĭ L’vovich 2 Vashchenko, T. V. 1 Aleksandrov, Aleksandr Danilovich 1 Apokorinaya, V. S. 1 Bely, Vladimer 1 Bersenëv, S. M. 1 Deinezhenko, A. L. 1 Fadeeva, V. N. 1 Finogenov, S. A. 1 Ivana, V. V. 1 Kuznetsov, Yurii Alekseevich 1 Lebedev, Vladimir Sergeevich 1 Lebedev, Vyacheslav Ivanovich 1 Macokin, A. 1 Marchuk, Guriĭ Ivanovich 1 Marozov, V. A. 1 Matsokin, A. M. 1 Mikhailov, V. B. 1 Mikhajlov, Veselin B. 1 Nikulin, Mikhail Stepanovich 1 Sablin, N. I. 1 Shajdurov, V. V. 1 Vulicevic, B. D. 1 Vulicevic, V. D.
all top 5
### Serials
49 Journal of Mathematical Sciences (New York) 24 Journal of Soviet Mathematics 23 Zapiski Nauchnykh Seminarov POMI 23 Zapiski Nauchnykh Seminarov Leningradskogo Otdeleniya Matematicheskogo Instituta Imeni V. A. Steklova 15 U.S.S.R. Computational Mathematics and Mathematical Physics 7 Zhurnal Vychislitel’noĭ Matematiki i Matematicheskoĭ Fiziki 6 Soviet Journal of Numerical Analysis and Mathematical Modelling 5 Trudy Matematicheskogo Instituta Imeni V. A. Steklova 4 Computational Mathematics and Mathematical Physics 3 Vychislitel’nye Protsessy i Sistemy 2 Uspekhi Matematicheskikh Nauk [N. S.] 2 Soviet Mathematics. Doklady 2 Algebra i Analiz 2 Leningrad Mathematical Journal 2 Proceedings of the Steklov Institute of Mathematics 2 Translations. Series 2. American Mathematical Society 1 Acta Universitatis Carolinae. Mathematica et Physica 1 Russian Mathematical Surveys 1 Numerische Mathematik 1 SIAM Journal on Numerical Analysis 1 Russian Journal of Numerical Analysis and Mathematical Modelling
all top 5
### Fields
171 Numerical analysis (65-XX) 89 Linear and multilinear algebra; matrix theory (15-XX) 31 General and overarching topics; collections (00-XX) 9 Field theory and polynomials (12-XX) 7 History and biography (01-XX) 3 Functions of a complex variable (30-XX) 3 Partial differential equations (35-XX) 3 Systems theory; control (93-XX) 2 Computer science (68-XX) 1 Commutative algebra (13-XX) 1 Real functions (26-XX) 1 Ordinary differential equations (34-XX)
### Citations contained in zbMATH Open
87 Publications have been cited 350 times in 159 Documents Cited by Year
Solution of linear algebraic systems with rectangular matrices. Zbl 0208.40001
1968
On an approach to the solution of the generalized latent value problem for $$\lambda$$-matrices. Zbl 0225.65048
Kublanovskaya, V. N.
1970
On some algorithms for the solution of the complete eigenvalue problem. Zbl 0128.11702
Kublanovskaya, V. N.
1961
AB-algorithm and its modifications for the spectral problems of linear pencils of matrices. Zbl 0542.65020
Kublanovskaya, V. N.
1984
Methods and algorithms of solving spectral problems for polynomial and rational matrices. Zbl 0928.65064
Kublanovskaya, V. N.
1997
Modification of the $$\Delta W$$-$$q$$ factorization method for multiparameter polynomial matrices and their properties. Zbl 1073.15508
Kublanovskaya, V. N.; Khazanov, V. B.
2004
Spectral problems for matrix pencils. Methods and algorithms. II. Zbl 0825.65031
Khazanov, V. B.; Kublanovskaya, V. N.
1988
On an application of Newton’s method to the determination of eigenvalues of $$\lambda$$-matrices. Zbl 0242.65042
Kublanovskaya, V. N.
1969
On a method of solving the complete eigenvalue problem for a degenerate matrix. Zbl 0171.36003
Kublanovskaya, V. N.
1968
The AB-algorithm and its properties. Zbl 0509.65017
Kublanovskaya, V. N.
1980
On the spectral problem for polynomial pencils of matrices. II. Zbl 0521.65026
Kublanovskaya, V. N.
1981
To solving problems of algebra for two-parameter matrices. I. Zbl 1177.65057
Kublanovskaya, V. N.
2009
Spectral problems for matrix pencils. Methods and algorithms. I. Zbl 0825.65030
Khazanov, V. B.; Kublanovskaya, V. N.
1988
On some factorizations of two-parameter polynomial matrices. Zbl 0867.15009
Kublanovskaya, V. N.
1994
Construction of the fundamental row of solutions for a pencil of matrices. Zbl 0552.65036
Kublanovskaya, V. N.; Vashchenko, T. V.
1984
Solving eigenvalue problems for two-parameter polynomial matrices. Methods and algorithms. I. Zbl 0818.65027
Kublanovskaya, V. N.
1994
Deflation in spectral problems for matrix pencils. Zbl 0825.65033
Kublanovskaya, V. N.; Khazanov, V. B.
1987
Relative factorization of polynomials of several variables. Zbl 0911.65041
Kublanovskaya, V. N.; Khazanov, V. B.
1996
Spectral problems for pencils of polynomial matrices. Methods and algorithms. V. Zbl 0796.65051
Kublanovskaya, V. N.; Khazanov, V. B.
1992
On irreducible factorizations of rational matrices and their applications. Zbl 0867.15010
Kublanovskaya, V. N.; Khazanov, V. B.
1994
Operations with scalar polynomials and their computer realization. Zbl 0867.65005
Kublanovskaya, V. N.; Simonova, V. N.
1994
Analysis of singular matrix pencils. Zbl 0515.65031
Kublanovskaya, V. N.
1983
Spectral problems for rational matrices. Methods and algorithms. IV. Zbl 0819.65048
Belyi, V. A.; Kublanovskaya, V. N.
1991
On some modifications of the AB algorithm. Zbl 0467.65017
Kublanovskaya, V. N.; Simonova, V. N.
1981
To solving problems of algebra for two-parameter matrices. IV. Zbl 1288.65075
Kublanovskaya, V. N.
2010
An approach to solving multiparameter algebraic problems. Zbl 0899.65022
Kublanovskaya, V. N.
1995
An algorithm for computation of the spectral structure of a singular linear pencil of matrices. Zbl 0625.65029
Kublanovskaya, V. N.
1987
Inversion of polynomial and rational matrices. Zbl 0844.65032
Kon’kova, T. Ya.; Kublanovskaya, V. N.
1992
Construction of the canonical basis for matrices and pencils of matrices. Zbl 0454.65030
Kublanovskaya, V. N.
1979
A method for the construction of the fundamental sequence of polynomial solutions and Jordan chains for a singular linear pencil of matrices. Zbl 0522.15004
Kublanovskaya, V. N.
1983
Newtonsches Verfahren zur Bestimmung der Eigenwerte und Eigenvektoren einer Matrix. Zbl 0259.65043
Kublanovskaya, V. N.
1972
Spectral problems for matrix pencils. Methods and algorithms. III. Zbl 0825.65032
Belyj, V. A.; Khazanov, V. B.; Kublanovskaya, V. N.
1989
Exhausting in spectral problems for matrix pencils. Zbl 0637.15007
Kublanovskaya, V. N.; Khazanov, V. B.
1987
Spectral problems for pencils of polynomial matrices. Methods and algorithms. V. Zbl 0844.65025
Kublanovskaya, V. N.; Khazanov, V. B.
1992
The method of least squares for matrices depending on a parameter. Zbl 0867.65015
Kublanovskaya, V. N.
1994
An approach to solving nonlinear algebraic systems. Zbl 0816.65030
Kublanovskaya, V. N.; Simonova, V. N.
1990
To solving problems of algebra for two-parameter matrices. VII. Zbl 1291.65125
Kublanovskaya, V. N.; Khazanov, V. B.
2011
To solving multiparameter problems of algebra. I: Methods for computing complete polynomials and their applications. Zbl 1071.65053
Kublanovskaya, V. N.
2002
On the solution of inverse eigenvalue problems for parametric matrices. Zbl 1221.15017
Kublanovskaya, V. N.; Khazanov, V. B.
2006
On the connection of a spectral problem for linear pencils of matrices with some problems of algebra. Zbl 0434.65028
Kublanovskaya, V. N.
1978
On an approach to solve systems of nonlinear algebraic equations. II. Zbl 0799.65052
Kublanovskaya, V. N.; Simonova, V. N.
1992
On the solution of the addition eigenvalue problem for the matrix. Zbl 0348.65034
Kublanovskaya, V. N.
1974
Zum Problem der Eigenwerte einer nichtregulären $$\lambda$$-Matrix. Zbl 0365.65022
Kublanovskaya, V. N.; Mikhajlov, V. B.; Khazanov, V. B.
1976
Zur Lösung des nichtlinearen Spektralproblems für eine Matrix. Zbl 0366.65019
Kon’kova, T. Ya.; Kublanovskaya, V. N.; Savinova, L. T.
1976
On solving problems with sparse matrices. Zbl 0375.65015
Kublanovskaya, V. N.; Savinov, G. V.; Smirnova, T. N.
1977
Normalized scheme of the square-root method and its application to the solving of certain problems of algebra. Zbl 0375.65020
Kublanovskaya, V. N.
1977
An approach to solving nonlinear algebraic systems. II. Zbl 0844.65046
Kublanovskaya, V. N.; Simonova, V. N.
1992
Analysis of singular pencils of matrices. Zbl 0429.65030
Kublanovskaya, V. N.
1977
Evaluation of a generalized inverse matrix and projector. Zbl 0171.35904
Kublanovskaya, V. N.
1968
The problem of eigenvalues for a regular linear pencil of matrices close to singular ones. Zbl 0459.65017
Kublanovskaya, V. N.
1979
Sur les systèmes linéaires algébriques de matrices rectangulaires et malconditionnées. Zbl 0208.39905
1968
Die Anwendung der analytischen Fortsetzung durch Substitution der Variablen in der numerischen Analysis. Zbl 0085.33601
Kublanovskaya, V. N.
1959
To solving problems of algebra for two-parameter matrices. III. Zbl 1177.65059
Kublanovskaya, V. N.; Khazanov, V. B.
2009
To solving problems of algebra for two-parameter matrices. VIII. Zbl 1291.65123
Kublanovskaya, V. N.
2011
To solving problems of algebra for two-parameter matrices. VI. Zbl 1288.65077
Kublanovskaya, V. N.; Khazanov, V. B.
2010
Solution of the Cauchy problem. Methods and algorithms. Zbl 1017.34003
Kublanovskaya, V. N.
1998
Irreducible factorizations of rational $$q$$-parameter matrices. Zbl 0959.15012
Kublanovskaya, V. N.; Khazanov, V. B.
1998
Solution of systems of nonlinear algebraic equations in three variables. Methods and algorithms. III. Zbl 0899.65030
Kublanovskaya, V. N.
1995
To solving spectral problems for $$q$$-parameter polynomial matrices. III. Zbl 1362.65045
Kublanovskaya, V. N.
2013
On a spectral problem for polynomial pencils of matrices. Zbl 0434.65019
Kublanovskaya, V. N.
1978
On a method for estimating unremovable error. Zbl 1161.65326
Kublanovskaya, V. N.
1996
A spectral problem for polynomial pencils of matrices. Zbl 0559.65022
Kublanovskaya, V. N.
1985
On some factorizations of matrix and scalar polynomials. Zbl 0721.15016
Kublanovskaya, V. N.
1990
A general approach to reducing a regular linear pencil to a pencil of quasitriangular form. Zbl 0581.65025
Kublanovskaya, V. N.
1984
Application of the normalized decomposition for the partial solution of a matrix eigenvalue problem. Zbl 0335.65014
Kublanovskaya, V. N.
1975
Eigenvalue problem for an irregular $$\lambda$$-matrix. Zbl 0428.65020
Kublanovskaya, V. N.; Mikhailov, V. B.; Khazanov, V. B.
1980
Solving the eigenvalue problem for sparse matrices. Zbl 0428.65021
Kublanovskaya, V. N.; Smirnova, T. N.; Khazanov, V. B.
1980
On a method for the triangular factorization of an inverse matrix. Zbl 0184.37601
Kublanovskaya, V. N.
1966
Solution of the eigenvalue problem for a regular pencil $$\lambda A_0-A_1$$ with singular matrices. Zbl 0429.65031
Kublanovskaya, V. N.; Kon’kova, T. Ya.
1977
On the solution of matrix eigenvalue problems. Zbl 0429.65032
Kublanovskaya, V. N.; Savinova, L. T.
1977
Solution of spectral problems for matrix pencils. Zbl 0645.65021
Kublanovskaya, V. N.
1988
An algorithm for calculating the eigenvalues of positive-definite matrices. Zbl 0176.13602
Kublanovskaya, V. N.
1965
On a certain approach to the solution of spectral problems for pencils of matrices. Zbl 0519.65021
Kublanovskaya, V. N.
1980
Certain modifications of the AB-algorithm. Zbl 0527.65029
Kublanovskaya, V. N.; Simonova, V. N.
1984
On a new algorithm for the solution of the generalized eigenvalue problem. Zbl 0538.65016
Kublanovskaya, V. N.; Simonova, V. N.
1983
An iteration process for obtaining small eigenvalues of a matrix and the corresponding eigenvectors. Zbl 0213.16401
Kublanovskaya, V. N.
1968
Application of orthogonal transformations to the numerical realization of linear algebraic perturbation problems. Zbl 0222.65042
Kublanovskaya, V. N.
1970
On one approach to the solution of the inverse eigenvalue problem. Zbl 0254.65028
Kublanovskaya, V. N.
1970
Application of a normalized process to the solution of linear algebraic systems. Zbl 0282.65028
Kublanovskaya, V. N.
1973
Application of a normalized process to the solution of the inverse eigenvalue problem of a matrix. Zbl 0284.65031
Kublanovskaya, V. N.
1971
On the inverse eigenvalue problem of a matrix. Zbl 0284.65032
Kublanovskaya, V. N.; Khazanov, V. B.
1971
On the solution of multiparameter problems of algebra. IV: The $$AB$$ algorithm and its applications. Zbl 1073.65529
Kublanovskaya, V. N.
2004
To solving multiparameter problems of algebra. II: The method of partial relative factorization and its applications. Zbl 1080.65530
Kublanovskaya, V. N.
2003
Lösung des Eigenwertproblems für eine beliebige Matrix. Zbl 0131.14205
Kublanovskaya, V. N.
1962
Computational methods for the solution of a generalized eigenvalue problem. Zbl 0149.36804
Kublanovskaya, V. N.; Faddeeva, V. N.
1964
Construction of a canonic basis for matrices and pencils of matrices. Zbl 0486.65026
Kublanovskaya, V. N.
1982
Solution of spectral problems for polynomial matrix pencils. Zbl 0681.65022
1988
To solving spectral problems for $$q$$-parameter polynomial matrices. III. Zbl 1362.65045
Kublanovskaya, V. N.
2013
To solving problems of algebra for two-parameter matrices. VII. Zbl 1291.65125
Kublanovskaya, V. N.; Khazanov, V. B.
2011
To solving problems of algebra for two-parameter matrices. VIII. Zbl 1291.65123
Kublanovskaya, V. N.
2011
To solving problems of algebra for two-parameter matrices. IV. Zbl 1288.65075
Kublanovskaya, V. N.
2010
To solving problems of algebra for two-parameter matrices. VI. Zbl 1288.65077
Kublanovskaya, V. N.; Khazanov, V. B.
2010
To solving problems of algebra for two-parameter matrices. I. Zbl 1177.65057
Kublanovskaya, V. N.
2009
To solving problems of algebra for two-parameter matrices. III. Zbl 1177.65059
Kublanovskaya, V. N.; Khazanov, V. B.
2009
On the solution of inverse eigenvalue problems for parametric matrices. Zbl 1221.15017
Kublanovskaya, V. N.; Khazanov, V. B.
2006
Modification of the $$\Delta W$$-$$q$$ factorization method for multiparameter polynomial matrices and their properties. Zbl 1073.15508
Kublanovskaya, V. N.; Khazanov, V. B.
2004
On the solution of multiparameter problems of algebra. IV: The $$AB$$ algorithm and its applications. Zbl 1073.65529
Kublanovskaya, V. N.
2004
To solving multiparameter problems of algebra. II: The method of partial relative factorization and its applications. Zbl 1080.65530
Kublanovskaya, V. N.
2003
To solving multiparameter problems of algebra. I: Methods for computing complete polynomials and their applications. Zbl 1071.65053
Kublanovskaya, V. N.
2002
Solution of the Cauchy problem. Methods and algorithms. Zbl 1017.34003
Kublanovskaya, V. N.
1998
Irreducible factorizations of rational $$q$$-parameter matrices. Zbl 0959.15012
Kublanovskaya, V. N.; Khazanov, V. B.
1998
Methods and algorithms of solving spectral problems for polynomial and rational matrices. Zbl 0928.65064
Kublanovskaya, V. N.
1997
Relative factorization of polynomials of several variables. Zbl 0911.65041
Kublanovskaya, V. N.; Khazanov, V. B.
1996
On a method for estimating unremovable error. Zbl 1161.65326
Kublanovskaya, V. N.
1996
An approach to solving multiparameter algebraic problems. Zbl 0899.65022
Kublanovskaya, V. N.
1995
Solution of systems of nonlinear algebraic equations in three variables. Methods and algorithms. III. Zbl 0899.65030
Kublanovskaya, V. N.
1995
On some factorizations of two-parameter polynomial matrices. Zbl 0867.15009
Kublanovskaya, V. N.
1994
Solving eigenvalue problems for two-parameter polynomial matrices. Methods and algorithms. I. Zbl 0818.65027
Kublanovskaya, V. N.
1994
On irreducible factorizations of rational matrices and their applications. Zbl 0867.15010
Kublanovskaya, V. N.; Khazanov, V. B.
1994
Operations with scalar polynomials and their computer realization. Zbl 0867.65005
Kublanovskaya, V. N.; Simonova, V. N.
1994
The method of least squares for matrices depending on a parameter. Zbl 0867.65015
Kublanovskaya, V. N.
1994
Spectral problems for pencils of polynomial matrices. Methods and algorithms. V. Zbl 0796.65051
Kublanovskaya, V. N.; Khazanov, V. B.
1992
Inversion of polynomial and rational matrices. Zbl 0844.65032
Kon’kova, T. Ya.; Kublanovskaya, V. N.
1992
Spectral problems for pencils of polynomial matrices. Methods and algorithms. V. Zbl 0844.65025
Kublanovskaya, V. N.; Khazanov, V. B.
1992
On an approach to solve systems of nonlinear algebraic equations. II. Zbl 0799.65052
Kublanovskaya, V. N.; Simonova, V. N.
1992
An approach to solving nonlinear algebraic systems. II. Zbl 0844.65046
Kublanovskaya, V. N.; Simonova, V. N.
1992
Spectral problems for rational matrices. Methods and algorithms. IV. Zbl 0819.65048
Belyi, V. A.; Kublanovskaya, V. N.
1991
An approach to solving nonlinear algebraic systems. Zbl 0816.65030
Kublanovskaya, V. N.; Simonova, V. N.
1990
On some factorizations of matrix and scalar polynomials. Zbl 0721.15016
Kublanovskaya, V. N.
1990
Spectral problems for matrix pencils. Methods and algorithms. III. Zbl 0825.65032
Belyj, V. A.; Khazanov, V. B.; Kublanovskaya, V. N.
1989
Spectral problems for matrix pencils. Methods and algorithms. II. Zbl 0825.65031
Khazanov, V. B.; Kublanovskaya, V. N.
1988
Spectral problems for matrix pencils. Methods and algorithms. I. Zbl 0825.65030
Khazanov, V. B.; Kublanovskaya, V. N.
1988
Solution of spectral problems for matrix pencils. Zbl 0645.65021
Kublanovskaya, V. N.
1988
Solution of spectral problems for polynomial matrix pencils. Zbl 0681.65022
1988
Deflation in spectral problems for matrix pencils. Zbl 0825.65033
Kublanovskaya, V. N.; Khazanov, V. B.
1987
An algorithm for computation of the spectral structure of a singular linear pencil of matrices. Zbl 0625.65029
Kublanovskaya, V. N.
1987
Exhausting in spectral problems for matrix pencils. Zbl 0637.15007
Kublanovskaya, V. N.; Khazanov, V. B.
1987
A spectral problem for polynomial pencils of matrices. Zbl 0559.65022
Kublanovskaya, V. N.
1985
AB-algorithm and its modifications for the spectral problems of linear pencils of matrices. Zbl 0542.65020
Kublanovskaya, V. N.
1984
Construction of the fundamental row of solutions for a pencil of matrices. Zbl 0552.65036
Kublanovskaya, V. N.; Vashchenko, T. V.
1984
A general approach to reducing a regular linear pencil to a pencil of quasitriangular form. Zbl 0581.65025
Kublanovskaya, V. N.
1984
Certain modifications of the AB-algorithm. Zbl 0527.65029
Kublanovskaya, V. N.; Simonova, V. N.
1984
Analysis of singular matrix pencils. Zbl 0515.65031
Kublanovskaya, V. N.
1983
A method for the construction of the fundamental sequence of polynomial solutions and Jordan chains for a singular linear pencil of matrices. Zbl 0522.15004
Kublanovskaya, V. N.
1983
On a new algorithm for the solution of the generalized eigenvalue problem. Zbl 0538.65016
Kublanovskaya, V. N.; Simonova, V. N.
1983
Construction of a canonic basis for matrices and pencils of matrices. Zbl 0486.65026
Kublanovskaya, V. N.
1982
On the spectral problem for polynomial pencils of matrices. II. Zbl 0521.65026
Kublanovskaya, V. N.
1981
On some modifications of the AB algorithm. Zbl 0467.65017
Kublanovskaya, V. N.; Simonova, V. N.
1981
The AB-algorithm and its properties. Zbl 0509.65017
Kublanovskaya, V. N.
1980
Eigenvalue problem for an irregular $$\lambda$$-matrix. Zbl 0428.65020
Kublanovskaya, V. N.; Mikhailov, V. B.; Khazanov, V. B.
1980
Solving the eigenvalue problem for sparse matrices. Zbl 0428.65021
Kublanovskaya, V. N.; Smirnova, T. N.; Khazanov, V. B.
1980
On a certain approach to the solution of spectral problems for pencils of matrices. Zbl 0519.65021
Kublanovskaya, V. N.
1980
Construction of the canonical basis for matrices and pencils of matrices. Zbl 0454.65030
Kublanovskaya, V. N.
1979
The problem of eigenvalues for a regular linear pencil of matrices close to singular ones. Zbl 0459.65017
Kublanovskaya, V. N.
1979
On the connection of a spectral problem for linear pencils of matrices with some problems of algebra. Zbl 0434.65028
Kublanovskaya, V. N.
1978
On a spectral problem for polynomial pencils of matrices. Zbl 0434.65019
Kublanovskaya, V. N.
1978
On solving problems with sparse matrices. Zbl 0375.65015
Kublanovskaya, V. N.; Savinov, G. V.; Smirnova, T. N.
1977
Normalized scheme of the square-root method and its application to the solving of certain problems of algebra. Zbl 0375.65020
Kublanovskaya, V. N.
1977
Analysis of singular pencils of matrices. Zbl 0429.65030
Kublanovskaya, V. N.
1977
Solution of the eigenvalue problem for a regular pencil $$\lambda A_0-A_1$$ with singular matrices. Zbl 0429.65031
Kublanovskaya, V. N.; Kon’kova, T. Ya.
1977
On the solution of matrix eigenvalue problems. Zbl 0429.65032
Kublanovskaya, V. N.; Savinova, L. T.
1977
Zum Problem der Eigenwerte einer nichtregulären $$\lambda$$-Matrix. Zbl 0365.65022
Kublanovskaya, V. N.; Mikhajlov, V. B.; Khazanov, V. B.
1976
Zur Lösung des nichtlinearen Spektralproblems für eine Matrix. Zbl 0366.65019
Kon’kova, T. Ya.; Kublanovskaya, V. N.; Savinova, L. T.
1976
Application of the normalized decomposition for the partial solution of a matrix eigenvalue problem. Zbl 0335.65014
Kublanovskaya, V. N.
1975
On the solution of the addition eigenvalue problem for the matrix. Zbl 0348.65034
Kublanovskaya, V. N.
1974
Application of a normalized process to the solution of linear algebraic systems. Zbl 0282.65028
Kublanovskaya, V. N.
1973
Newtonsches Verfahren zur Bestimmung der Eigenwerte und Eigenvektoren einer Matrix. Zbl 0259.65043
Kublanovskaya, V. N.
1972
Application of a normalized process to the solution of the inverse eigenvalue problem of a matrix. Zbl 0284.65031
Kublanovskaya, V. N.
1971
On the inverse eigenvalue problem of a matrix. Zbl 0284.65032
Kublanovskaya, V. N.; Khazanov, V. B.
1971
On an approach to the solution of the generalized latent value problem for $$\lambda$$-matrices. Zbl 0225.65048
Kublanovskaya, V. N.
1970
Application of orthogonal transformations to the numerical realization of linear algebraic perturbation problems. Zbl 0222.65042
Kublanovskaya, V. N.
1970
On one approach to the solution of the inverse eigenvalue problem. Zbl 0254.65028
Kublanovskaya, V. N.
1970
On an application of Newton’s method to the determination of eigenvalues of $$\lambda$$-matrices. Zbl 0242.65042
Kublanovskaya, V. N.
1969
Solution of linear algebraic systems with rectangular matrices. Zbl 0208.40001
1968
On a method of solving the complete eigenvalue problem for a degenerate matrix. Zbl 0171.36003
Kublanovskaya, V. N.
1968
Evaluation of a generalized inverse matrix and projector. Zbl 0171.35904
Kublanovskaya, V. N.
1968
Sur les systèmes linéaires algébriques de matrices rectangulaires et malconditionnées. Zbl 0208.39905
1968
An iteration process for obtaining small eigenvalues of a matrix and the corresponding eigenvectors. Zbl 0213.16401
Kublanovskaya, V. N.
1968
On a method for the triangular factorization of an inverse matrix. Zbl 0184.37601
Kublanovskaya, V. N.
1966
An algorithm for calculating the eigenvalues of positive-definite matrices. Zbl 0176.13602
Kublanovskaya, V. N.
1965
Computational methods for the solution of a generalized eigenvalue problem. Zbl 0149.36804
Kublanovskaya, V. N.; Faddeeva, V. N.
1964
Lösung des Eigenwertproblems für eine beliebige Matrix. Zbl 0131.14205
Kublanovskaya, V. N.
1962
On some algorithms for the solution of the complete eigenvalue problem. Zbl 0128.11702
Kublanovskaya, V. N.
1961
Die Anwendung der analytischen Fortsetzung durch Substitution der Variablen in der numerischen Analysis. Zbl 0085.33601
Kublanovskaya, V. N.
1959
all top 5
### Cited by 162 Authors
39 Kublanovskaya, Vera Nikolaevna 9 Khazanov, V. B. 6 Benner, Peter 6 Kon’kova, T. Ya. 5 Faßbender, Heike 5 Lin, Wen-Wei 4 Chen, Xiaoping 4 Noferini, Vanni 4 Savinova, L. T. 4 Van Dooren, Paul M. 3 Barlow, Jesse L. 3 Byers, Ralph 3 Erbay, Hasan 3 Jarlebring, Elias 3 Mehrmann, Volker 3 Tisseur, Françoise 3 Voss, Heinrich 3 Watkins, David S. 3 Wilkinson, James Hardy 2 Borisevich, V. D. 2 Dai, Hua 2 Dopico, Froilán M. 2 Drmač, Zlatko 2 Golub, Gene Howard 2 Guo, Jong-Shenq 2 Honda, Syuta 2 Lin, Wenwei 2 Malyshev, Alexander N. 2 Martin, Robert Samuel 2 Miyata, Takafumi 2 Naito, Ryohei 2 Pan, Xiaoming 2 Potemkin, V. G. 2 Simonova, V. N. 2 Smirnova, T. N. 2 Tanabe, Kunio 2 Tyrtyshnikov, Evgeniĭ Evgen’evich 2 Wang, Chern-Shuh 2 Wood, Houston G. III 2 Zhang, Zhenyue 1 Abdelmalek, Nabih N. 1 Abdolmaleki, Mohammad 1 Adhikari, Bibhas 1 Ahues, Mario Paul 1 Aldeen, Mohammad 1 Andrew, Alan L. 1 Attoh, Kwami 1 Ba, Thang Luu 1 Babich, Ivan Yur’evich 1 Bai, Zhaojun 1 Beckermann, Bernhard 1 Beelen, Theo G. J. 1 Bini, Dario Andrea 1 Bosner, Nela 1 Bowdler, H. J. 1 Busé, Laurent 1 Casado, Silvia 1 Chan, Eunice Y. S. 1 Chu, K. E. 1 Corless, Robert Malcolm 1 Dehghani Darmian, Mahdi 1 Demidenko, Gennadiĭ Vladimirovich 1 Demmel, James Weldon 1 Dzeng, D. C. 1 Edelman, Alan Stuart 1 Faddeev, Dmitriĭ Konstantinovich 1 Faddeeva, Vera Nikolaevna 1 Ferng, William R. 1 Gaidomak, Svetlana Valer’evna 1 Garashchuk, I. N. 1 Garrett, C. Kristopher 1 Garvey, Seamus D. 1 Gill, Philip E. 1 Gong, Fanghui 1 Gugercin, Serkan 1 Güttel, Stefan 1 Guz, Alexander Nikolaevich 1 Han, Xiaoying 1 Hanson, Richard J. 1 Hashemi, Amir 1 He, Chunyang 1 Hunek, Wojciech Przemysław 1 Huseyin, Koncay 1 Ikramov, Saidkhakim Dododshanovich 1 Kågström, Bo 1 Kalogeropoulos, Grigoris I. 1 Karcanias, Nicos 1 Kawamura, Haruka 1 King-wah Chu, Eric 1 Konstantinov, Mikhail Mikhajlov 1 Kudrinskij, B. Yu. 1 Kunkel, Peter 1 Kuznetsov, Andreĭ Nikolavich 1 Labahn, George 1 Lampe, Jörg 1 Lancaster, Peter 1 Latawiec, Krzysztof J. 1 Lawson, Charles L. 1 Li, Rencang 1 Li, Tiexiang ...and 62 more Authors
all top 5
### Cited in 48 Serials
31 Linear Algebra and its Applications 30 Journal of Mathematical Sciences (New York) 25 Journal of Soviet Mathematics 6 Numerische Mathematik 5 Journal of Computational and Applied Mathematics 4 Mathematics of Computation 4 Applied Mathematics and Computation 3 Computing 3 SIAM Journal on Matrix Analysis and Applications 3 International Journal of Applied Mathematics and Computer Science 2 Computers & Mathematics with Applications 2 Linear and Multilinear Algebra 2 Applied Numerical Mathematics 2 Japan Journal of Industrial and Applied Mathematics 2 Computational Mathematics and Mathematical Physics 2 Computational Statistics and Data Analysis 2 SIAM Journal on Scientific Computing 1 Computer Methods in Applied Mechanics and Engineering 1 International Journal of Systems Science 1 Journal of Computational Physics 1 Journal of Engineering Mathematics 1 Journal of Fluid Mechanics 1 Journal of the Franklin Institute 1 Bulletin of Mathematical Biology 1 Soviet Applied Mechanics 1 ACM Transactions on Mathematical Software 1 Annals of the Institute of Statistical Mathematics 1 Automatica 1 BIT 1 Czechoslovak Mathematical Journal 1 Journal of Optimization Theory and Applications 1 Siberian Mathematical Journal 1 Cybernetics 1 Mitteilungen der Gesellschaft für Angewandte Mathematik und Mechanik 1 Computer Aided Geometric Design 1 Journal of Symbolic Computation 1 Applied Mathematics Letters 1 Mathematical and Computer Modelling 1 Applications of Mathematics 1 Applied and Computational Harmonic Analysis 1 Numerical Linear Algebra with Applications 1 Computational and Applied Mathematics 1 ETNA. Electronic Transactions on Numerical Analysis 1 ELA. The Electronic Journal of Linear Algebra 1 Acta Numerica 1 Journal of Physics A: Mathematical and Theoretical 1 Vestnik Samarskogo Gosudarstvennogo Tekhnicheskogo Universiteta. Seriya Fiziko-Matematicheskie Nauki 1 Iranian Journal of Mathematical Sciences and Informatics
all top 5
### Cited in 27 Fields
132 Numerical analysis (65-XX) 74 Linear and multilinear algebra; matrix theory (15-XX) 9 Systems theory; control (93-XX) 5 Partial differential equations (35-XX) 5 Computer science (68-XX) 4 Ordinary differential equations (34-XX) 4 Operations research, mathematical programming (90-XX) 3 Commutative algebra (13-XX) 3 Operator theory (47-XX) 3 Mechanics of deformable solids (74-XX) 2 General and overarching topics; collections (00-XX) 2 History and biography (01-XX) 2 Combinatorics (05-XX) 2 Number theory (11-XX) 1 Order, lattices, ordered algebraic structures (06-XX) 1 General algebraic systems (08-XX) 1 Field theory and polynomials (12-XX) 1 Algebraic geometry (14-XX) 1 Dynamical systems and ergodic theory (37-XX) 1 Sequences, series, summability (40-XX) 1 Statistics (62-XX) 1 Fluid mechanics (76-XX) 1 Optics, electromagnetic theory (78-XX) 1 Quantum theory (81-XX) 1 Statistical mechanics, structure of matter (82-XX) 1 Game theory, economics, finance, and other social and behavioral sciences (91-XX) 1 Biology and other natural sciences (92-XX)
### Wikidata Timeline
The data are displayed as stored in Wikidata under a Creative Commons CC0 License. Updates and corrections should be made in Wikidata. | 2023-02-06T12:41:47 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 1, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6768587231636047, "perplexity": 13251.614147799031}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764500339.37/warc/CC-MAIN-20230206113934-20230206143934-00529.warc.gz"} |
https://www.detailedpedia.com/wiki-Fielding_percentage | # Fielding percentage
In baseball statistics, fielding percentage, also known as fielding average, is a measure that reflects the percentage of times a defensive player properly handles a batted or thrown ball. It is calculated by the sum of putouts and assists, divided by the number of total chances (putouts + assists + errors).
While a high fielding percentage is regarded as a sign of defensive skill, it is also possible for a player of lesser defensive skill to have a high fielding percentage, as it does not reflect or take into account a player's defensive range; a player who cannot get to a ball surrenders a hit instead of having an opportunity to make an out or an error. Conversely, a highly skilled fielder might have a comparatively low fielding percentage by virtue of reaching, and potentially missing, a greater number of balls.
In order to qualify for the league lead in fielding percentage, an infielder or outfielder must appear at the specific position in at least two-thirds of his team's games (games in the outfield are not separated by position). A catcher must appear in at least half his team's games. A pitcher must pitch at least one inning for each of his team's scheduled games (however, a pitcher with fewer innings may qualify if they have more total chances and a higher average). In order to qualify for major league career records for fielding average, a player must appear in 1,000 games at the position; pitchers must have at least 1,500 innings.
The MLB record for team fielding percentage is currently held by the 2013 Baltimore Orioles, with a .99104 fielding percentage.
## Footnotes
1. ^ Rule 10.21(d). "Official Rules". Major League Baseball (MLB.com). Retrieved 2010-06-02.
2. ^ Center, Bill (March 31, 2010). "In defense of the Padres". The San Diego Union-Tribune. Archived from the original on April 3, 2010.
3. ^ Fitzpatrick, Frank (September 30, 2011). "Phillies can rely on their defense ... or maybe not". The Philadelphia Inquirer. Retrieved October 6, 2011. But there's a lot more to defense, obviously, than just not making errors. You have to get to the ball to not make an error in the first place.
4. ^ Rule 10.22(c)(2). "Official Rules". Major League Baseball (MLB.com). Retrieved 2010-06-02.
5. ^ Rule 10.22(c)(1). "Official Rules". Major League Baseball (MLB.com). Retrieved 2010-06-02.
6. ^ Rule 10.22(c)(3). "Official Rules". Major League Baseball (MLB.com). Retrieved 2010-06-02.
This page was last updated at 2022-05-27 22:30 UTC. . View original page.
All our content comes from Wikipedia and under the Creative Commons Attribution-ShareAlike License.
Contact
Top | 2022-09-30T10:14:42 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 1, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.4453069567680359, "perplexity": 4933.638200310901}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-40/segments/1664030335448.34/warc/CC-MAIN-20220930082656-20220930112656-00256.warc.gz"} |
https://pdglive.lbl.gov/DataBlock.action?node=M300J19 | # $\mathbf {{{\boldsymbol f}_{{3}}{(2300)}}}$ $\boldsymbol I\boldsymbol G(\boldsymbol J{}^{PC}) = 0{}^{+}(3{}^{++})$ INSPIRE search
MASS ${\mathrm {(MeV)}}$ WIDTH ${\mathrm {(MeV)}}$ DOCUMENT ID TECN
$2334 \pm25$ 200 +-20 1
2004 A
RVUE
1 Partial wave analysis of the data on ${{\mathit p}}$ ${{\overline{\mathit p}}}$ $\rightarrow$ ${{\overline{\mathit \Lambda}}}{{\mathit \Lambda}}$ from BARNES 2000 .
References:
BUGG 2004A
EPJ C36 161 Partial Wave Analysis of ${{\overline{\mathit p}}}$ ${{\mathit p}}$ $\rightarrow$ ${{\overline{\mathit \Lambda}}}{{\mathit \Lambda}}$ | 2021-04-17T17:54:39 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.519142746925354, "perplexity": 4955.103676439452}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2021-17/segments/1618038461619.53/warc/CC-MAIN-20210417162353-20210417192353-00503.warc.gz"} |
http://dlmf.nist.gov/19.25 | # §19.25 Relations to Other Functions
## §19.25(i) Legendre’s Integrals as Symmetric Integrals
Let ${k^{\prime}}^{2}=1-k^{2}$ and $c={\mathop{\csc\/}\nolimits^{2}}\phi$. Then
19.25.1 $\displaystyle\mathop{K\/}\nolimits\!\left(k\right)$ $\displaystyle=\mathop{R_{F}\/}\nolimits\!\left(0,{k^{\prime}}^{2},1\right),$ $\displaystyle\mathop{E\/}\nolimits\!\left(k\right)$ $\displaystyle=2\!\mathop{R_{G}\/}\nolimits\!\left(0,{k^{\prime}}^{2},1\right),$ $\displaystyle\mathop{E\/}\nolimits\!\left(k\right)$ $\displaystyle=\tfrac{1}{3}{k^{\prime}}^{2}\left(\mathop{R_{D}\/}\nolimits\!% \left(0,{k^{\prime}}^{2},1\right)+\mathop{R_{D}\/}\nolimits\!\left(0,1,{k^{% \prime}}^{2}\right)\right),$ $\displaystyle\mathop{K\/}\nolimits\!\left(k\right)-\mathop{E\/}\nolimits\!% \left(k\right)$ $\displaystyle=k^{2}\mathop{D\/}\nolimits\!\left(k\right)=\tfrac{1}{3}k^{2}% \mathop{R_{D}\/}\nolimits\!\left(0,{k^{\prime}}^{2},1\right),$ $\displaystyle\mathop{E\/}\nolimits\!\left(k\right)-{k^{\prime}}^{2}\mathop{K\/% }\nolimits\!\left(k\right)$ $\displaystyle=\tfrac{1}{3}k^{2}{k^{\prime}}^{2}\mathop{R_{D}\/}\nolimits\!% \left(0,1,{k^{\prime}}^{2}\right).$
19.25.2 $\mathop{\Pi\/}\nolimits\!\left(\alpha^{2},k\right)-\mathop{K\/}\nolimits\!% \left(k\right)=\tfrac{1}{3}\alpha^{2}\mathop{R_{J}\/}\nolimits\!\left(0,{k^{% \prime}}^{2},1,1-\alpha^{2}\right).$
19.25.3 $\mathop{\Pi\/}\nolimits\!\left(\alpha^{2},k\right)=\tfrac{1}{2}\pi\mathop{R_{-% \frac{1}{2}}\/}\nolimits\!\left(\tfrac{1}{2},-\tfrac{1}{2},1;{k^{\prime}}^{2},% 1,1-\alpha^{2}\right),$
with Cauchy principal value
19.25.4 $\mathop{\Pi\/}\nolimits\!\left(\alpha^{2},k\right)=-\tfrac{1}{3}(k^{2}/\alpha^% {2})\mathop{R_{J}\/}\nolimits\!\left(0,1-k^{2},1,1-(k^{2}/\alpha^{2})\right),$ $-\infty.
19.25.5 $\displaystyle\mathop{F\/}\nolimits\!\left(\phi,k\right)$ $\displaystyle=\mathop{R_{F}\/}\nolimits\!\left(c-1,c-k^{2},c\right),$ 19.25.6 $\displaystyle\frac{\partial\mathop{F\/}\nolimits\!\left(\phi,k\right)}{% \partial k}$ $\displaystyle=\tfrac{1}{3}k\mathop{R_{D}\/}\nolimits\!\left(c-1,c,c-k^{2}% \right).$
19.25.7 $\mathop{E\/}\nolimits\!\left(\phi,k\right)=2\!\mathop{R_{G}\/}\nolimits\!\left% (c-1,c-k^{2},c\right)-(c-1)\mathop{R_{F}\/}\nolimits\!\left(c-1,c-k^{2},c% \right)-\sqrt{(c-1)(c-k^{2})/c},$
19.25.8 $\mathop{E\/}\nolimits\!\left(\phi,k\right)=\mathop{R_{-\frac{1}{2}}\/}% \nolimits\!\left(\tfrac{1}{2},-\tfrac{1}{2},\tfrac{3}{2};c-1,c-k^{2},c\right),$
19.25.9 $\mathop{E\/}\nolimits\!\left(\phi,k\right)=\mathop{R_{F}\/}\nolimits\!\left(c-% 1,c-k^{2},c\right)-\tfrac{1}{3}k^{2}\mathop{R_{D}\/}\nolimits\!\left(c-1,c-k^{% 2},c\right),$
19.25.10 $\mathop{E\/}\nolimits\!\left(\phi,k\right)={k^{\prime}}^{2}\mathop{R_{F}\/}% \nolimits\!\left(c-1,c-k^{2},c\right)+\tfrac{1}{3}k^{2}{k^{\prime}}^{2}\mathop% {R_{D}\/}\nolimits\!\left(c-1,c,c-k^{2}\right)+k^{2}\sqrt{(c-1)/(c(c-k^{2}))},$ $c>k^{2}$,
19.25.11 $\mathop{E\/}\nolimits\!\left(\phi,k\right)=-\tfrac{1}{3}{k^{\prime}}^{2}% \mathop{R_{D}\/}\nolimits\!\left(c-k^{2},c,c-1\right)+\sqrt{(c-k^{2})/(c(c-1))},$ $\phi\neq\tfrac{1}{2}\pi$.
Equations (19.25.9)–(19.25.11) correspond to three (nonzero) choices for the last variable of $\mathop{R_{D}\/}\nolimits$; see (19.21.7). All terms on the right-hand sides are nonnegative when $k^{2}\leq 0$, $0\leq k^{2}\leq 1$, or $1\leq k^{2}\leq c$, respectively.
19.25.12 $\frac{\partial\mathop{E\/}\nolimits\!\left(\phi,k\right)}{\partial k}=-\tfrac{% 1}{3}k\mathop{R_{D}\/}\nolimits\!\left(c-1,c-k^{2},c\right).$
19.25.13 $\mathop{D\/}\nolimits\!\left(\phi,k\right)=\tfrac{1}{3}\mathop{R_{D}\/}% \nolimits\!\left(c-1,c-k^{2},c\right).$
19.25.14 $\mathop{\Pi\/}\nolimits\!\left(\phi,\alpha^{2},k\right)-\mathop{F\/}\nolimits% \!\left(\phi,k\right)=\tfrac{1}{3}\alpha^{2}\mathop{R_{J}\/}\nolimits\!\left(c% -1,c-k^{2},c,c-\alpha^{2}\right),$
19.25.15 $\mathop{\Pi\/}\nolimits\!\left(\phi,\alpha^{2},k\right)=\mathop{R_{-\frac{1}{2% }}\/}\nolimits\!\left(\tfrac{1}{2},\tfrac{1}{2},-\tfrac{1}{2},1;c-1,c-k^{2},c,% c-\alpha^{2}\right).$
If $\alpha^{2}>c$, then the Cauchy principal value is
19.25.16 $\mathop{\Pi\/}\nolimits\!\left(\phi,\alpha^{2},k\right)=-\tfrac{1}{3}\omega^{2% }\mathop{R_{J}\/}\nolimits\!\left(c-1,c-k^{2},c,c-\omega^{2}\right)+\sqrt{% \frac{(c-1)(c-k^{2})}{(\alpha^{2}-1)(1-\omega^{2})}}\*\mathop{R_{C}\/}% \nolimits\!\left(c(\alpha^{2}-1)(1-\omega^{2}),(\alpha^{2}-c)(c-\omega^{2})% \right),$ $\omega^{2}=k^{2}/\alpha^{2}$.
The transformations in §19.7(ii) result from the symmetry and homogeneity of functions on the right-hand sides of (19.25.5), (19.25.7), and (19.25.14). For example, if we write (19.25.5) as
19.25.17 $\mathop{F\/}\nolimits\!\left(\phi,k\right)=\mathop{R_{F}\/}\nolimits\!\left(x,% y,z\right),$
with
19.25.18 $(x,y,z)=(c-1,c-k^{2},c),$ Symbols: $k$: real or complex modulus Permalink: http://dlmf.nist.gov/19.25.E18 Encodings: TeX, pMML, png See also: Annotations for 19.25(i)
then the five nontrivial permutations of $x,y,z$ that leave $\mathop{R_{F}\/}\nolimits$ invariant change $k^{2}$ ($=(z-y)/(z-x)$) into $1/k^{2}$, ${k^{\prime}}^{2}$, $1/{k^{\prime}}^{2}$, $-k^{2}/{k^{\prime}}^{2}$, $-{k^{\prime}}^{2}/k^{2}$, and $\mathop{\sin\/}\nolimits\phi$ ($=\sqrt{(z-x)/z}$) into $k\mathop{\sin\/}\nolimits\phi$, $-i\mathop{\tan\/}\nolimits\phi$, $-ik^{\prime}\mathop{\tan\/}\nolimits\phi$, $(k^{\prime}\mathop{\sin\/}\nolimits\phi)/\sqrt{1-k^{2}{\mathop{\sin\/}% \nolimits^{2}}\phi}$, $-ik\mathop{\sin\/}\nolimits\phi/\sqrt{1-k^{2}{\mathop{\sin\/}\nolimits^{2}}\phi}$. Thus the five permutations induce five transformations of Legendre’s integrals (and also of the Jacobian elliptic functions).
The three changes of parameter of $\mathop{\Pi\/}\nolimits\!\left(\phi,\alpha^{2},k\right)$ in §19.7(iii) are unified in (19.21.12) by way of (19.25.14).
## §19.25(ii) Bulirsch’s Integrals as Symmetric Integrals
Let $r=1/x^{2}$. Then
19.25.19 $\displaystyle\mathop{\mathrm{cel}\/}\nolimits\!\left(k_{c},p,a,b\right)$ $\displaystyle=a\mathop{R_{F}\/}\nolimits\!\left(0,k_{c}^{2},1\right)+\tfrac{1}% {3}{(b-pa)}\mathop{R_{J}\/}\nolimits\!\left(0,k_{c}^{2},1,p\right),$ 19.25.20 $\displaystyle\mathop{\mathrm{el1}\/}\nolimits\!\left(x,k_{c}\right)$ $\displaystyle=\mathop{R_{F}\/}\nolimits\!\left(r,r+k_{c}^{2},r+1\right),$ 19.25.21 $\displaystyle\mathop{\mathrm{el2}\/}\nolimits\!\left(x,k_{c},a,b\right)$ $\displaystyle=a\mathop{\mathrm{el1}\/}\nolimits\!\left(x,k_{c}\right)+\tfrac{1% }{3}{(b-a)}\mathop{R_{D}\/}\nolimits\!\left(r,r+k_{c}^{2},r+1\right),$ 19.25.22 $\displaystyle\mathop{\mathrm{el3}\/}\nolimits\!\left(x,k_{c},p\right)$ $\displaystyle=\mathop{\mathrm{el1}\/}\nolimits\!\left(x,k_{c}\right)+\tfrac{1}% {3}{(1-p)}\mathop{R_{J}\/}\nolimits\!\left(r,r+k_{c}^{2},r+1,r+p\right).$
## §19.25(iii) Symmetric Integrals as Legendre’s Integrals
Assume $0\leq x\leq y\leq z$, $x, and $p>0$. Let
19.25.23 $\displaystyle\phi$ $\displaystyle=\mathop{\mathrm{arccos}\/}\nolimits\sqrt{\ifrac{x}{z}}=\mathop{% \mathrm{arcsin}\/}\nolimits\sqrt{\ifrac{(z-x)}{z}},$ $\displaystyle k$ $\displaystyle=\sqrt{\frac{z-y}{z-x}},$ $\displaystyle\alpha^{2}$ $\displaystyle=\frac{z-p}{z-x},$
with $\alpha\neq 0$. Then
19.25.24 $(z-x)^{1/2}\mathop{R_{F}\/}\nolimits\!\left(x,y,z\right)=\mathop{F\/}\nolimits% \!\left(\phi,k\right),$
19.25.25 $(z-x)^{3/2}\mathop{R_{D}\/}\nolimits\!\left(x,y,z\right)=(3/k^{2})(\mathop{F\/% }\nolimits\!\left(\phi,k\right)-\mathop{E\/}\nolimits\!\left(\phi,k\right)),$
19.25.26 $(z-x)^{3/2}\mathop{R_{J}\/}\nolimits\!\left(x,y,z,p\right)=(3/\alpha^{2}){(% \mathop{\Pi\/}\nolimits\!\left(\phi,\alpha^{2},k\right)-\mathop{F\/}\nolimits% \!\left(\phi,k\right))},$
19.25.27 $2(z-x)^{-1/2}\mathop{R_{G}\/}\nolimits\!\left(x,y,z\right)=\mathop{E\/}% \nolimits\!\left(\phi,k\right)+(\mathop{\cot\/}\nolimits\phi)^{2}\mathop{F\/}% \nolimits\!\left(\phi,k\right)+(\mathop{\cot\/}\nolimits\phi)\sqrt{1-k^{2}{% \mathop{\sin\/}\nolimits^{2}}\phi}.$
## §19.25(iv) Theta Functions
For relations of symmetric integrals to theta functions, see §20.9(i).
## §19.25(v) Jacobian Elliptic Functions
For the notation see §§22.2, 22.15, and 22.16(i).
With $0\leq k^{2}\leq 1$ and $\mathrm{p,q,r}$ any permutation of the letters $\mathrm{c,d,n}$, define
19.25.28 $\Delta(\mathrm{p,q})={\mathop{\mathrm{p\!s}\/}\nolimits^{2}}\left(u,k\right)-{% \mathop{\mathrm{q\!s}\/}\nolimits^{2}}\left(u,k\right)=-\Delta(\mathrm{q,p}),$ Defines: $\Delta(\mathrm{p,q})$: function (locally) Symbols: $\mathop{\mathrm{p\!q}\/}\nolimits\left(\NVar{z},\NVar{k}\right)$: generic Jacobian elliptic function and $k$: real or complex modulus Permalink: http://dlmf.nist.gov/19.25.E28 Encodings: TeX, pMML, png See also: Annotations for 19.25(v)
which implies
19.25.29 $\displaystyle\Delta(\mathrm{n,d})$ $\displaystyle=k^{2},$ $\displaystyle\Delta(\mathrm{d,c})$ $\displaystyle={k^{\prime}}^{2},$ $\displaystyle\Delta(\mathrm{n,c})$ $\displaystyle=1.$ Symbols: $k$: real or complex modulus, $k^{\prime}$: complementary modulus and $\Delta(\mathrm{p,q})$: function Referenced by: §19.25(v) Permalink: http://dlmf.nist.gov/19.25.E29 Encodings: TeX, TeX, TeX, pMML, pMML, pMML, png, png, png See also: Annotations for 19.25(v)
If ${\mathop{\mathrm{cs}\/}\nolimits^{2}}\left(u,k\right)\geq 0$, then
19.25.30 $\mathop{\mathrm{am}\/}\nolimits\left(u,k\right)=\mathop{R_{C}\/}\nolimits\!% \left({\mathop{\mathrm{cs}\/}\nolimits^{2}}\left(u,k\right),{\mathop{\mathrm{% ns}\/}\nolimits^{2}}\left(u,k\right)\right),$
19.25.31 $u=\mathop{R_{F}\/}\nolimits\!\left({\mathop{\mathrm{p\!s}\/}\nolimits^{2}}% \left(u,k\right),{\mathop{\mathrm{q\!s}\/}\nolimits^{2}}\left(u,k\right),{% \mathop{\mathrm{r\!s}\/}\nolimits^{2}}\left(u,k\right)\right);$
compare (19.25.35) and (20.9.3).
19.25.32 $\mathop{\mathrm{arcp\!s}\/}\nolimits\left(x,k\right)=\mathop{R_{F}\/}\nolimits% \!\left(x^{2},x^{2}+\Delta(\mathrm{q,p}),x^{2}+\Delta(\mathrm{r,p})\right),$ Symbols: $\mathop{R_{F}\/}\nolimits\!\left(\NVar{x},\NVar{y},\NVar{z}\right)$: symmetric elliptic integral of first kind, $k$: real or complex modulus and $\Delta(\mathrm{p,q})$: function Referenced by: §19.25(v) Permalink: http://dlmf.nist.gov/19.25.E32 Encodings: TeX, pMML, png See also: Annotations for 19.25(v)
19.25.33 $\mathop{\mathrm{arcs\!p}\/}\nolimits\left(x,k\right)=x\mathop{R_{F}\/}% \nolimits\!\left(1,1+\Delta(\mathrm{q,p})x^{2},1+\Delta(\mathrm{r,p})x^{2}% \right),$ Symbols: $\mathop{R_{F}\/}\nolimits\!\left(\NVar{x},\NVar{y},\NVar{z}\right)$: symmetric elliptic integral of first kind, $k$: real or complex modulus and $\Delta(\mathrm{p,q})$: function Referenced by: §19.25(v) Permalink: http://dlmf.nist.gov/19.25.E33 Encodings: TeX, pMML, png See also: Annotations for 19.25(v)
19.25.34 $\mathop{\mathrm{arcp\!q}\/}\nolimits\left(x,k\right)=\sqrt{w}\mathop{R_{F}\/}% \nolimits\!\left(x^{2},1,1+\Delta(\mathrm{r,q})w\right),$ $w=\ifrac{(1-x^{2})}{\Delta(\mathrm{q,p})}$, Symbols: $\mathop{R_{F}\/}\nolimits\!\left(\NVar{x},\NVar{y},\NVar{z}\right)$: symmetric elliptic integral of first kind, $k$: real or complex modulus and $\Delta(\mathrm{p,q})$: function Referenced by: §19.25(v) Permalink: http://dlmf.nist.gov/19.25.E34 Encodings: TeX, pMML, png See also: Annotations for 19.25(v)
where we assume $0\leq x^{2}\leq 1$ if $x=\mathop{\mathrm{sn}\/}\nolimits$, $\mathop{\mathrm{cn}\/}\nolimits$, or $\mathop{\mathrm{cd}\/}\nolimits$; $x^{2}\geq 1$ if $x=\mathop{\mathrm{ns}\/}\nolimits$, $\mathop{\mathrm{nc}\/}\nolimits$, or $\mathop{\mathrm{dc}\/}\nolimits$; $x$ real if $x=\mathop{\mathrm{cs}\/}\nolimits$ or $\mathop{\mathrm{sc}\/}\nolimits$; $k^{\prime}\leq x\leq 1$ if $x=\mathop{\mathrm{dn}\/}\nolimits$; $1\leq x\leq 1/k^{\prime}$ if $x=\mathop{\mathrm{nd}\/}\nolimits$; $x^{2}\geq{k^{\prime}}^{2}$ if $x=\mathop{\mathrm{ds}\/}\nolimits$; $0\leq x^{2}\leq 1/{k^{\prime}}^{2}$ if $x=\mathop{\mathrm{sd}\/}\nolimits$.
For the use of $R$-functions with $\Delta(\mathrm{p,q})$ in unifying other properties of Jacobian elliptic functions, see Carlson (2004, 2006a, 2006b, 2008).
Inversions of 12 elliptic integrals of the first kind, producing the 12 Jacobian elliptic functions, are combined and simplified by using the properties of $\mathop{R_{F}\/}\nolimits\!\left(x,y,z\right)$. See (19.29.19), Carlson (2005), and (22.15.11), and compare with Abramowitz and Stegun (1964, Eqs. (17.4.41)–(17.4.52)). For analogous integrals of the second kind, which are not invertible in terms of single-valued functions, see (19.29.20) and (19.29.21) and compare with Gradshteyn and Ryzhik (2000, §3.153,1–10 and §3.156,1–9).
## §19.25(vi) Weierstrass Elliptic Functions
For the notation see §23.2.
19.25.35 $z=\mathop{R_{F}\/}\nolimits\!\left(\mathop{\wp\/}\nolimits\!\left(z\right)-e_{% 1},\mathop{\wp\/}\nolimits\!\left(z\right)-e_{2},\mathop{\wp\/}\nolimits\!% \left(z\right)-e_{3}\right),$
provided that
19.25.36 $\mathop{\wp\/}\nolimits\!\left(z\right)-e_{j}\in\mathbb{C}\setminus(-\infty,0],$ $j=1,2,3$,
and the left-hand side does not vanish for more than one value of $j$. Also,
19.25.37 $\mathop{\zeta\/}\nolimits\!\left(z\right)+z\mathop{\wp\/}\nolimits\!\left(z% \right)=2\!\mathop{R_{G}\/}\nolimits\!\left(\mathop{\wp\/}\nolimits\!\left(z% \right)-e_{1},\mathop{\wp\/}\nolimits\!\left(z\right)-e_{2},\mathop{\wp\/}% \nolimits\!\left(z\right)-e_{3}\right).$
In (19.25.38) and (19.25.39) $j,k,\ell$ is any permutation of the numbers $1,2,3$.
19.25.38 $\omega_{j}=\mathop{R_{F}\/}\nolimits\!\left(0,e_{j}-e_{k},e_{j}-e_{\ell}\right),$ Symbols: $\mathop{R_{F}\/}\nolimits\!\left(\NVar{x},\NVar{y},\NVar{z}\right)$: symmetric elliptic integral of first kind, $\mathrm{e}$: base of exponential function and $k$: real or complex modulus Referenced by: §19.25(vi), §19.25(vi) Permalink: http://dlmf.nist.gov/19.25.E38 Encodings: TeX, pMML, png See also: Annotations for 19.25(vi)
19.25.39 $\eta_{j}+\omega_{j}e_{j}=2\!\mathop{R_{G}\/}\nolimits\!\left(0,e_{j}-e_{k},e_{% j}-e_{\ell}\right).$ Symbols: $\mathop{R_{G}\/}\nolimits\!\left(\NVar{x},\NVar{y},\NVar{z}\right)$: symmetric elliptic integral of second kind, $\mathrm{e}$: base of exponential function and $k$: real or complex modulus Referenced by: §19.25(vi), §19.25(vi) Permalink: http://dlmf.nist.gov/19.25.E39 Encodings: TeX, pMML, png See also: Annotations for 19.25(vi)
Lastly,
19.25.40 $z=\mathop{\sigma\/}\nolimits\!\left(z\right)\mathop{R_{F}\/}\nolimits\!\left(% \sigma_{1}^{2}(z),\sigma_{2}^{2}(z),\sigma_{3}^{2}(z)\right),$
where
19.25.41 $\sigma_{j}(z)=\mathop{\exp\/}\nolimits\!\left(-\eta_{j}z\right)\mathop{\sigma% \/}\nolimits\!\left(z+\omega_{j}\right)/\mathop{\sigma\/}\nolimits\!\left(% \omega_{j}\right),$ $j=1,2,3$. Defines: $\sigma_{j}(z)$: function (locally) Symbols: $\mathop{\sigma\/}\nolimits\!\left(\NVar{z}\right)$ (= $\mathop{\sigma\/}\nolimits\!\left(z|\mathbb{L}\right)$ = $\mathop{\sigma\/}\nolimits\!\left(z;g_{2},g_{3}\right)$): Weierstrass sigma function and $\mathop{\exp\/}\nolimits\NVar{z}$: exponential function Permalink: http://dlmf.nist.gov/19.25.E41 Encodings: TeX, pMML, png See also: Annotations for 19.25(vi)
## §19.25(vii) Hypergeometric Function
19.25.42 $\mathop{{{}_{2}F_{1}}\/}\nolimits\!\left(a,b;c;z\right)=\mathop{R_{-a}\/}% \nolimits\!\left(b,c-b;1-z,1\right),$
19.25.43 $\mathop{R_{-a}\/}\nolimits\!\left(b_{1},b_{2};z_{1},z_{2}\right)=z_{2}^{-a}% \mathop{{{}_{2}F_{1}}\/}\nolimits\!\left(a,b_{1};b_{1}+b_{2};1-(z_{1}/z_{2})% \right).$
For these results and extensions to the Appell function $\mathop{{F_{1}}\/}\nolimits$16.13) and Lauricella’s function $\mathop{F_{D}\/}\nolimits$ see Carlson (1963). ($\mathop{{F_{1}}\/}\nolimits$ and $\mathop{F_{D}\/}\nolimits$ are equivalent to the $R$-function of 3 and $n$ variables, respectively, but lack full symmetry.) | 2017-02-20T04:25:09 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 369, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.9282392263412476, "perplexity": 8776.099778139862}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-09/segments/1487501170404.1/warc/CC-MAIN-20170219104610-00610-ip-10-171-10-108.ec2.internal.warc.gz"} |
https://pdglive.lbl.gov/Particle.action?init=0&node=S042&home=MXXX045 | BOTTOM MESONS($\mathit B$ = $\pm1$) ${{\mathit B}^{+}}$ = ${\mathit {\mathit u}}$ ${\mathit {\overline{\mathit b}}}$, ${{\mathit B}^{0}}$ = ${\mathit {\mathit d}}$ ${\mathit {\overline{\mathit b}}}$, ${{\overline{\mathit B}}^{0}}$ = ${\mathit {\overline{\mathit d}}}$ ${\mathit {\mathit b}}$, ${{\mathit B}^{-}}$ = ${\mathit {\overline{\mathit u}}}$ ${\mathit {\mathit b}}$, similarly for ${{\mathit B}^{*}}$ 's
#### ${{\mathit B}^{0}}$
$I(J^P)$ = $1/2(0^{-})$
Quantum numbers not measured. Values shown are quark-model predictions. See also the ${{\mathit B}^{\pm}}$ /${{\mathit B}^{0}}$ ADMIXTURE and ${{\mathit B}^{\pm}}$ /${{\mathit B}^{0}}$ /${{\mathit B}_{{s}}^{0}}$ /${{\mathit b}}$ -baryon ADMIXTURE sections. See the Note Production and Decay of ${{\mathit b}}$ -flavored Hadrons'' at the beginning of the ${{\mathit B}^{\pm}}$ Particle Listings and the Note on ${{\mathit B}^{0}}-{{\overline{\mathit B}}^{0}}$ Mixing'' near the end of the ${{\mathit B}^{0}}$ Particle Listings.
See related reviews: Polarization in ${{\mathit B}}$ Decays ${{\mathit B}^{0}}$ $-$ ${{\overline{\mathit B}}^{0}}$ Mixing
${{\mathit B}^{0}}$ MASS $5279.66 \pm0.12$ MeV
${\mathit m}_{{{\mathit B}^{0}}}–{\mathit m}_{{{\mathit B}^{+}}}$ $0.32 \pm0.05$ MeV
${{\mathit B}^{0}}$ MEAN LIFE $(1519 \pm4) \times 10^{-15}$ s
${\mathit \tau}_{{{\mathit B}^{0}}}/{\mathit \tau}_{{{\overline{\mathit B}}^{0}}}$ $1.000 \pm0.012$
$\Delta \Gamma _{{{\mathit B}_{{d}}^{0}} }$ $/$ $\Gamma _{{{\mathit B}_{{d}}^{0}} }$ $0.001 \pm0.010$
${{\overline{\mathit B}}^{0}}$ modes are charge conjugates of the modes below. Reactions indicate the weak decay vertex and do not include mixing. Modes which do not identify the charge state of the ${{\mathit B}}$ are listed in the ${{\mathit B}^{\pm}}$ /${{\mathit B}^{0}}$ ADMIXTURE section.
The branching fractions listed below assume 50$\%$ ${{\mathit B}^{0}}{{\overline{\mathit B}}^{0}}$ and 50$\%$ ${{\mathit B}^{+}}{{\mathit B}^{-}}$ production at the ${{\mathit \Upsilon}{(4S)}}$ . We have attempted to bring older measurements up to date by rescaling their assumed ${{\mathit \Upsilon}{(4S)}}$ production ratio to 50:50 and their assumed ${{\mathit D}}$ , ${{\mathit D}_{{s}}}$ , ${{\mathit D}^{*}}$ , and ${{\mathit \psi}}$ branching ratios to current values whenever this would affect our averages and best limits significantly.
Indentation is used to indicate a subchannel of a previous reaction. All resonant subchannels have been corrected for resonance branching fractions to the final state so the sum of the subchannel branching fractions can exceed that of the final state.
For inclusive branching fractions, $\mathit e.g.,$ ${{\mathit B}}$ $\rightarrow$ ${{\mathit D}^{\pm}}{{\mathit X}}$ , the values usually are multiplicities, not branching fractions. They can be greater than one.
$\Gamma_{1}$ ${{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}{{\mathit X}}$ [1] $(10.33\pm{0.28})\%$
$\Gamma_{2}$ ${{\mathit e}^{+}}{{\mathit \nu}_{{e}}}{{\mathit X}_{{c}}}$ $(10.1\pm{0.4})\%$
$\Gamma_{3}$ ${{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}{{\mathit X}_{{u}}}$ $(1.51\pm{0.19})\times 10^{-3}$
$\Gamma_{4}$ ${{\mathit D}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}{{\mathit X}}$ $(9.3\pm{0.8})\%$
$\Gamma_{5}$ ${{\mathit D}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ [1] $(2.24\pm{0.09})\%$ 2309
$\Gamma_{6}$ ${{\mathit D}^{-}}{{\mathit \tau}^{+}}{{\mathit \nu}_{{\tau}}}$ $(1.05\pm{0.23})\%$ 1909
$\Gamma_{7}$ ${{\mathit D}^{*}{(2010)}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ [1] $(4.97\pm{0.12})\%$ 2257
$\Gamma_{8}$ ${{\mathit D}^{*}{(2010)}^{-}}{{\mathit \tau}^{+}}{{\mathit \nu}_{{\tau}}}$ $(1.58\pm{0.09})\%$ S=1.1 1838
$\Gamma_{9}$ ${{\overline{\mathit D}}^{0}}{{\mathit \pi}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ $(4.1\pm{0.5})\times 10^{-3}$ 2308
$\Gamma_{10}$ ${{\mathit D}_{{0}}^{*}{(2300)}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ , ${{\mathit D}_{{0}}^{*-}}$ $\rightarrow$ ${{\overline{\mathit D}}^{0}}{{\mathit \pi}^{-}}$ $(3.0\pm{1.2})\times 10^{-3}$ S=1.8
$\Gamma_{11}$ ${{\mathit D}_{{2}}^{*}{(2460)}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ , ${{\mathit D}_{{2}}^{*-}}$ $\rightarrow$ ${{\overline{\mathit D}}^{0}}{{\mathit \pi}^{-}}$ $(1.21\pm{0.33})\times 10^{-3}$ S=1.8 2065
$\Gamma_{12}$ ${{\overline{\mathit D}}^{(*)}}$ n ${{\mathit \pi}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ (n ${}\geq{}$ 1) $(2.3\pm{0.5})\%$
$\Gamma_{13}$ ${{\overline{\mathit D}}^{*0}}{{\mathit \pi}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ $(5.8\pm{0.8})\times 10^{-3}$ S=1.4 2256
$\Gamma_{14}$ ${{\mathit D}_{{1}}{(2420)}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ , ${{\mathit D}_{{1}}^{-}}$ $\rightarrow$ ${{\overline{\mathit D}}^{*0}}{{\mathit \pi}^{-}}$ $(2.80\pm{0.28})\times 10^{-3}$
$\Gamma_{15}$ ${{\mathit D}_{{1}}^{\,'}{(2430)}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ , ${{\mathit D}_{{1}}^{'-}}$ $\rightarrow$ ${{\overline{\mathit D}}^{*0}}{{\mathit \pi}^{-}}$ $(3.1\pm{0.9})\times 10^{-3}$
$\Gamma_{16}$ ${{\mathit D}_{{2}}^{*}{(2460)}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ , ${{\mathit D}_{{2}}^{*-}}$ $\rightarrow$ ${{\overline{\mathit D}}^{*0}}{{\mathit \pi}^{-}}$ $(6.8\pm{1.2})\times 10^{-4}$ 2065
$\Gamma_{17}$ ${{\mathit D}^{-}}{{\mathit \pi}^{+}}{{\mathit \pi}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ $(1.3\pm{0.5})\times 10^{-3}$ 2299
$\Gamma_{18}$ ${{\mathit D}^{*-}}{{\mathit \pi}^{+}}{{\mathit \pi}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ $(1.4\pm{0.5})\times 10^{-3}$ 2247
$\Gamma_{19}$ ${{\mathit \rho}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ [1] $(2.94\pm{0.21})\times 10^{-4}$ 2583
$\Gamma_{20}$ ${{\mathit \pi}^{-}}{{\mathit \ell}^{+}}{{\mathit \nu}_{{{{\mathit \ell}}}}}$ [1] $(1.50\pm{0.06})\times 10^{-4}$ 2638
$\Gamma_{21}$ ${{\mathit \pi}^{-}}{{\mathit \mu}^{+}}{{\mathit \nu}_{{\mu}}}$ 2637
$\Gamma_{22}$ ${{\mathit \pi}^{-}}{{\mathit \tau}^{+}}{{\mathit \nu}_{{\tau}}}$ $<2.5\times 10^{-4}$ CL=90% 2339
FOOTNOTES | 2022-12-09T11:42:38 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8749951124191284, "perplexity": 731.2209738809399}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-49/segments/1669446711396.19/warc/CC-MAIN-20221209112528-20221209142528-00722.warc.gz"} |
http://dlmf.nist.gov/19.17 | # §19.17 Graphics
See Figures 19.17.119.17.8 for symmetric elliptic integrals with real arguments.
Because the $R$-function is homogeneous, there is no loss of generality in giving one variable the value $1$ or $-1$ (as in Figure 19.3.2). For $\mathop{R_{F}\/}\nolimits$, $\mathop{R_{G}\/}\nolimits$, and $\mathop{R_{J}\/}\nolimits$, which are symmetric in $x,y,z$, we may further assume that $z$ is the largest of $x,y,z$ if the variables are real, then choose $z=1$, and consider only $0\leq x\leq 1$ and $0\leq y\leq 1$. The cases $x=0$ or $y=0$ correspond to the complete integrals. The case $y=1$ corresponds to elementary functions.
To view $\mathop{R_{F}\/}\nolimits\!\left(0,y,1\right)$ and $2\!\mathop{R_{G}\/}\nolimits\!\left(0,y,1\right)$ for complex $y$, put $y=1-k^{2}$, use (19.25.1), and see Figures 19.3.719.3.12.
To view $\mathop{R_{F}\/}\nolimits\!\left(0,y,1\right)$ and $2\!\mathop{R_{G}\/}\nolimits\!\left(0,y,1\right)$ for complex $y$, put $y=1-k^{2}$, use (19.25.1), and see Figures 19.3.719.3.12. | 2016-05-03T23:58:45 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 100, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8890485763549805, "perplexity": 287.72776131033396}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2016-18/segments/1461860121985.80/warc/CC-MAIN-20160428161521-00047-ip-10-239-7-51.ec2.internal.warc.gz"} |
https://www.nist.gov/publications/practical-cryptanalysis-k-ary-c | # Practical Cryptanalysis of k-ary C*
Published: July 18, 2019
### Author(s)
Daniel C. Smith-Tone
### Abstract
Recently, an article by Felke appeared in Cryptography and Communications discussing the security of biquadratic $C^*$ and a further generalization, k-ary $C^*$. The article derives lower bounds for the complexity of an algebraic attack, directly inverting the public key, under an assumption that the first-fall degree is a good approximation of the solving degree, an assumption that the paper notes requires greater justification and clarification.'' In this work, we provide a practical attack breaking all k-ary $C^*$ schemes. The attack is based on differential techniques and requires nothing but the ability to evaluate the public key and solve linear systems. In particular, the attack breaks the parameters provided in CryptoChallenge 11 by constructing and solving linear systems of moderate size in a few minutes.
Citation: Cryptology ePrint Archive
Volume: 2019
Pub Type: Websites | 2019-10-16T03:50:36 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 1, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.6288198232650757, "perplexity": 1217.847741962642}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-43/segments/1570986661296.12/warc/CC-MAIN-20191016014439-20191016041939-00149.warc.gz"} |
http://www.itl.nist.gov/div898/handbook/pmc/section2/pmc222.htm | 6. Process or Product Monitoring and Control
6.2. Test Product for Acceptability: Lot Acceptance Sampling
6.2.2. How do you Choose a Single Sampling Plan?
## Choosing a Sampling Plan with a given OC Curve
OC curves We start by looking at a typical OC curve. The OC curve for a (52, 3) sampling plan is shown below.
It is instructive to show how the points on this curve are obtained, once we have a sampling plan $$(n,c)$$ - later we will demonstrate how a sampling plan $$(n,c)$$ is obtained.
We assume that the lot size $$N$$ is very large, as compared to the sample size $$n$$, so that removing the sample doesn't significantly change the remainder of the lot, no matter how many defects are in the sample. Then the distribution of the number of defectives, $$d$$, in a random sample of $$n$$ items is approximately binomial with parameters $$n$$ and $$p$$, where $$p$$ is the fraction of defectives per lot.
The probability of observing exactly $$d$$ defectives is given by
The binomial distribution $$P(d) = f(d) = \frac{n!}{d!(n-d)!} p^d (1-p)^{n-d} \, .$$
The probability of acceptance is the probability that $$d$$, the number of defectives, is less than or equal to $$c$$, the acceptance number. This means that $$P_a = P(d \le c) = \sum_{d=0}^c \frac{n!}{d!(n-d)!} p^d (1-p)^{n-d} \, .$$ Using this formula with $$n = 52$$, $$c=3$$, and $$p = 0.01, \, 0.02, \, \ldots, \, 0.12$$ we find $$\begin{eqnarray} P_a & \,\,\,\,\, & P_d \\ 0.998 & \,\,\,\,\, & 0.01 \\ 0.980 & \,\,\,\,\, & 0.02 \\ 0.930 & \,\,\,\,\, & 0.03 \\ 0.845 & \,\,\,\,\, & 0.04 \\ 0.739 & \,\,\,\,\, & 0.05 \\ 0.620 & \,\,\,\,\, & 0.06 \\ 0.502 & \,\,\,\,\, & 0.07 \\ 0.394 & \,\,\,\,\, & 0.08 \\ 0.300 & \,\,\,\,\, & 0.09 \\ 0.223 & \,\,\,\,\, & 0.10 \\ 0.162 & \,\,\,\,\, & 0.11 \\ 0.115 & \,\,\,\,\, & 0.12 \, . \end{eqnarray}$$
Equations for calculating a sampling plan with a given OC curve Solving for $$(n,c)$$
In order to design a sampling plan with a specified OC curve one needs two designated points. Let us design a sampling plan such that the probability of acceptance is $$1-\alpha$$ for lots with fraction defective $$p_1$$ and the probability of acceptance is $$\beta$$ for lots with fraction defective $$p_2$$. Typical choices for these points are: $$p_1$$ is the AQL, $$p_2$$ is the LTPD and $$\alpha$$, $$\beta$$ are the Producers Risk (Type I error) and Consumers Risk (Type II error), respectively.
If we are willing to assume that binomial sampling is valid, then the sample size, $$n$$, and the acceptance number, $$c$$, are the solution to $$\begin{eqnarray} 1-\alpha & = & \sum_{d=0}^c \frac{n!}{d!(n-d)!} p_1^d (1-p_1)^{n-d} \\ \beta & = & \sum_{d=0}^c \frac{n!}{d!(n-d)!} p_2^d (1-p_2)^{n-d} \, . \end{eqnarray}$$ These two simultaneous equations are nonlinear so there is no simple, direct solution. There are however a number of iterative techniques available that give approximate solutions so that composition of a computer program poses few problems.
Calculating $$AOQ$$ Average Outgoing Quality ($$AOQ$$)
We can also calculate the $$AOQ$$ for a $$(n,c)$$ sampling plan, provided rejected lots are 100 % inspected and defectives are replaced with good parts.
Assume all lots come in with exactly $$p_0$$ proportion of defectives. After screening a rejected lot, the final fraction defectives will be zero for that lot. However, accepted lots have fraction defective $$p_0$$. Therefore, the outgoing lots from the inspection stations are a mixture of lots with fractions defective $$p_0$$ and 0. Assuming the lot size is $$N$$, we have $$AOQ = \frac{p_a p(N-n)}{N} \, .$$
For example, let $$N=10,000$$, $$n = 52$$, $$c=3$$ and $$p$$, the quality of incoming lots, = 0.03. Now at $$p=0.03$$, we glean from the OC curve table that $$p_a=0.930$$ and $$AOQ = \frac{0.930(0.03)(10,000-52)}{10,000} = 0.00278\, .$$ Setting $$p = 0.01, \, 0.02, \, \ldots, \, 0.12$$, we can generate the following table. $$\begin{eqnarray} AOQ & \,\,\,\,\, & P_d \\ 0.0010 & \,\,\,\,\, & 0.01 \\ 0.0196 & \,\,\,\,\, & 0.02 \\ 0.0278 & \,\,\,\,\, & 0.03 \\ 0.0338 & \,\,\,\,\, & 0.04 \\ 0.0369 & \,\,\,\,\, & 0.05 \\ 0.0372 & \,\,\,\,\, & 0.06 \\ 0.0351 & \,\,\,\,\, & 0.07 \\ 0.0315 & \,\,\,\,\, & 0.08 \\ 0.0270 & \,\,\,\,\, & 0.09 \\ 0.0223 & \,\,\,\,\, & 0.10 \\ 0.0178 & \,\,\,\,\, & 0.11 \\ 0.0138 & \,\,\,\,\, & 0.12 \end{eqnarray}$$
A plot of the $$AOQ$$ versus $$p$$ is given below.
From examining this curve we observe that when the incoming quality is very good (very small fraction of defectives coming in) then the outgoing quality is also very good (very small fraction of defectives going out) When the incoming lot quality is very bad, most of the lots are rejected and then inspected. The "duds" are eliminated or replaced by good ones, so that the quality of the outgoing lots, the $$AOQ$$, becomes very good. In between these extremes, the $$AOQ$$ rises, reaches a maximum, and then drops.
The maximum ordinate on the $$AOQ$$ curve represents the worst possible quality that results from the rectifying inspection program. It is called the average outgoing quality limit, ($$AOQL$$).
From the table we see that the $$AOQL = 0.0372$$ at $$p = 0.06$$ for the above example.
One final remark: if $$N \gg n$$, then $$AOQ \approx p_a p$$.
Calculating the Average Total Inspection
The Average Total Inspection ($$ATI$$)
What is the total amount of inspection when rejected lots are screened?
If all lots contain zero defectives, no lot will be rejected.
If all items are defective, all lots will be inspected, and the amount to be inspected is $$N$$.
Finally, if the lot quality is $$0 < p < 1$$, the average amount of inspection per lot will vary between the sample size $$n$$, and the lot size $$N$$.
Let the quality of the lot be $$p$$ and the probability of lot acceptance be $$p_a$$, then the $$ATI$$ per lot is $$ATI = n + (1-p_a)(N-n) \, .$$ For example, let $$N = 10,000$$, $$n=52$$, $$c=3$$, and $$p=0.03$$. We know from the OC table that $$p_a = 0.930$$. Then $$ATI = 52 + (1-0.930)(10,000-52) = 753 \, .$$
Setting $$p = 0.01, \, 0.02, \, \ldots, \, 0.14$$ generates the following table. $$\begin{eqnarray} ATI & \,\,\,\,\, & P_d \\ 70 & \,\,\,\,\, & 0.01 \\ 253 & \,\,\,\,\, & 0.02 \\ 753 & \,\,\,\,\, & 0.03 \\ 1584 & \,\,\,\,\, & 0.04 \\ 2655 & \,\,\,\,\, & 0.05 \\ 3836 & \,\,\,\,\, & 0.06 \\ 5007 & \,\,\,\,\, & 0.07 \\ 6083 & \,\,\,\,\, & 0.08 \\ 7012 & \,\,\,\,\, & 0.09 \\ 7779 & \,\,\,\,\, & 0.10 \\ 8388 & \,\,\,\,\, & 0.11 \\ 8854 & \,\,\,\,\, & 0.12 \\ 9201 & \,\,\,\,\, & 0.13 \\ 9453 & \,\,\,\,\, & 0.14 \end{eqnarray}$$
A plot of $$ATI$$ versus $$p$$, the Incoming Lot Quality (ILQ) is given below. | 2017-10-17T14:52:15 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 2, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.7686445116996765, "perplexity": 631.076619785649}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2017-43/segments/1508187822116.0/warc/CC-MAIN-20171017144041-20171017164041-00768.warc.gz"} |
http://dlmf.nist.gov/33.22 | # §33.22 Particle Scattering and Atomic and Molecular Spectra
## §33.22(i) Schrödinger Equation
With denoting here the elementary charge, the Coulomb potential between two point particles with charges and masses separated by a distance is , where are atomic numbers, is the electric constant, is the fine structure constant, and is the reduced Planck’s constant. The reduced mass is , and at energy of relative motion with relative orbital angular momentum , the Schrödinger equation for the radial wave function is given by
With the substitutions
33.22.2
(33.22.1) becomes
## §33.22(ii) Definitions of Variables
### ¶ Scaling
The -scaled variables and of §33.2 are given by
At positive energies , , and:
Attractive potentials: , . , . , .
Positive-energy functions correspond to processes such as Rutherford scattering and Coulomb excitation of nuclei (Alder et al. (1956)), and atomic photo-ionization and electron-ion collisions (Bethe and Salpeter (1977)).
At negative energies and both and are purely imaginary. The negative-energy functions are widely used in the description of atomic and molecular spectra; see Bethe and Salpeter (1977), Seaton (1983), and Aymar et al. (1996). In these applications, the -scaled variables and are more convenient.
### ¶ Scaling
The -scaled variables and of §33.14 are given by
For and , the electron mass, the scaling factors in (33.22.5) reduce to the Bohr radius, , and to a multiple of the Rydberg constant,
.
Attractive potentials: , . , . , .
### ¶ Scaling
The -scaled variables and of §13.2 are given by
33.22.6
Attractive potentials: , . , . , .
Customary variables are in atomic physics and in atomic and nuclear physics. Both variable sets may be used for attractive and repulsive potentials: the set cannot be used for a zero potential because this would imply for all , and the set cannot be used for zero energy because this would imply always.
## §33.22(iii) Conversions Between Variables
33.22.10
from .
33.22.12
from .
Resolution of the ambiguous signs in (33.22.11), (33.22.12) depends on the sign of in (33.22.3). See also §§33.14(ii), 33.14(iii), 33.22(i), and 33.22(ii).
## §33.22(iv) Klein–Gordon and Dirac Equations
The relativistic motion of spinless particles in a Coulomb field, as encountered in pionic atoms and pion-nucleon scattering (Backenstoss (1970)) is described by a Klein–Gordon equation equivalent to (33.2.1); see Barnett (1981a). The motion of a relativistic electron in a Coulomb field, which arises in the theory of the electronic structure of heavy elements (Johnson (2007)), is described by a Dirac equation. The solutions to this equation are closely related to the Coulomb functions; see Greiner et al. (1985).
## §33.22(v) Asymptotic Solutions
The Coulomb solutions of the Schrödinger and Klein–Gordon equations are almost always used in the external region, outside the range of any non-Coulomb forces or couplings.
For scattering problems, the interior solution is then matched to a linear combination of a pair of Coulomb functions, and , or and , to determine the scattering -matrix and also the correct normalization of the interior wave solutions; see Bloch et al. (1951).
For bound-state problems only the exponentially decaying solution is required, usually taken to be the Whittaker function . The functions defined by (33.14.14) are the hydrogenic bound states in attractive Coulomb potentials; their polynomial components are often called associated Laguerre functions; see Christy and Duck (1961) and Bethe and Salpeter (1977).
## §33.22(vi) Solutions Inside the Turning Point
The penetrability of repulsive Coulomb potential barriers is normally expressed in terms of the quantity (Mott and Massey (1956, pp. 63–65)). The WKBJ approximations of §33.23(vii) may also be used to estimate the penetrability.
## §33.22(vii) Complex Variables and Parameters
The Coulomb functions given in this chapter are most commonly evaluated for real values of , , , and nonnegative integer values of , but they may be continued analytically to complex arguments and order as indicated in §33.13.
Examples of applications to noninteger and/or complex variables are as follows.
• Scattering at complex energies. See for example McDonald and Nuttall (1969).
• Searches for resonances as poles of the -matrix in the complex half-plane . See for example Csótó and Hale (1997).
• Regge poles at complex values of . See for example Takemasa et al. (1979).
• Eigenstates using complex-rotated coordinates , so that resonances have square-integrable eigenfunctions. See for example Halley et al. (1993).
• Solution of relativistic Coulomb equations. See for example Cooper et al. (1979) and Barnett (1981b).
• Gravitational radiation. See for example Berti and Cardoso (2006).
For further examples see Humblet (1984). | 2013-06-19T02:59:29 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8879294991493225, "perplexity": 1782.3461732602568}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2013-20/segments/1368707440258/warc/CC-MAIN-20130516123040-00003-ip-10-60-113-184.ec2.internal.warc.gz"} |
https://pdglive.lbl.gov/DataBlock.action?node=S017MPL&home=BXXX005 | # ${{\boldsymbol n}}$ MAGNETIC POLARIZABILITY ${{\boldsymbol \beta}_{{n}}}$ INSPIRE search
VALUE ($10^{-4}$ fm${}^{3}$) DOCUMENT ID TECN COMMENT
$\bf{ 3.7 \pm1.2}$ OUR AVERAGE
$3.65$ $\pm1.25$ $\pm0.8$
2014
CNTR ${{\mathit \gamma}}$ ${{\mathit d}}$ $\rightarrow$ ${{\mathit \gamma}}{{\mathit d}}$
$2.7$ $\pm1.8$ ${}^{+1.3}_{-1.6}$ 1
2003
CNTR ${{\mathit \gamma}}$ ${{\mathit d}}$ $\rightarrow$ ${{\mathit \gamma}}{{\mathit p}}{{\mathit n}}$
$6.5$ $\pm2.4$ $\pm3.0$ 2
2003
CNTR ${{\mathit \gamma}}$ ${{\mathit d}}$ $\rightarrow$ ${{\mathit \gamma}}{{\mathit d}}$
• • • We do not use the following data for averages, fits, limits, etc. • • •
$1.6$ 3
2000
CNTR ${{\mathit \gamma}}$ ${{\mathit d}}$ $\rightarrow$ ${{\mathit \gamma}}{{\mathit n}}{{\mathit p}}$
1 KOSSERT 2003 gets $\alpha _{{{\mathit n}}}−\beta _{{{\mathit n}}}$ =($9.8$ $\pm3.6$ ${}^{+2.1}_{-1.1}\pm2.2){\times }10^{-4}~$fm${}^{3}$, and uses $\alpha _{{{\mathit n}}}+\beta _{{{\mathit n}}}$ = ($15.2$ $\pm0.5$) $\times 10^{-4}~$fm${}^{3}$ from LEVCHUK 2000 . Thus the errors on $\alpha _{{{\mathit n}}}$ and $\beta _{{{\mathit n}}}$ are anti-correlated.
2 LUNDIN 2003 measures $\alpha _{\mathit N}−\beta _{\mathit N}$ = ($6.4$ $\pm2.4$) $\times 10^{-4}$ fm${}^{3}$ and uses accurate values for $\alpha _{{{\mathit p}}}$ and $\alpha _{{{\mathit p}}}$ and a precise sum-rule result for $\alpha _{{{\mathit n}}}+\beta _{{{\mathit n}}}$. The second error is a model uncertainty, and errors on $\alpha _{{{\mathit n}}}$ and $\beta _{{{\mathit n}}}$ are anticorrelated.
3 KOLB 2000 obtains this value with an upper limit of $7.6 \times 10^{-4}~$fm${}^{3}$ but no lower limit from this experiment alone. Combined with results of ROSE 1990 , the 1-$\sigma$ range is ($1.2 - 7.6){\times }10^{-4}~$fm${}^{3}$.
References:
MYERS 2014
PRL 113 262506 Measurement of Compton Scattering from the Deuteron and an Improved Extraction of the Neutron Electromagnetic Polarizabilities
KOSSERT 2003
EPJ A16 259 Quasifree Compton Scattering and the Polarizabilities of the Neutron
LUNDIN 2003
PRL 90 192501 Compton Scattering from the Deuteron and Neutron Polarizabilities
KOLB 2000
PRL 85 1388 Quasifree Compton Scattering from the Deuteron and Nucleon Polarizabilities | 2020-10-25T11:06:01 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 1, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8289374709129333, "perplexity": 3896.348860937466}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2020-45/segments/1603107888931.67/warc/CC-MAIN-20201025100059-20201025130059-00598.warc.gz"} |
http://gea.esac.esa.int/archive/documentation/GDR2/ | # Gaia Data Release 2 Documentation release 1.1
European Space Agency (ESA)
and
Gaia Data Processing and Analysis Consortium (DPAC)
9 July 2018
###### Executive summary
The second Gaia data release, Gaia DR2, encompasses astrometry, photometry, radial velocities, astrophysical parameters (stellar effective temperature, extinction, reddening, radius, and luminosity), and variability information plus astrometry and photometry for a sample of pre-selected bodies in the solar system. The basic number statistics of the contents of Gaia DR2 are as follows:
Data product or source type Number of sources Total (excluding Solar system) $1\,692\,919\,135$ Five-parameter astrometry (position, parallax, proper motion) $1\,331\,909\,727$ Two-parameter astrometry (position only) $361\,009\,408$ ICRF3 prototype sources (link to radio reference frame) $2\,820$ Gaia-CRF2 extra-galactic sources (optical reference frame) $556\,869$ $G$-band (330–1050 nm) $1\,692\,919\,135$ $G_{\mathrm{BP}}$-band (330–680 nm) $1\,381\,964\,755$ $G_{\mathrm{RP}}$-band (630–1050 nm) $1\,383\,551\,713$ Median radial velocity over 22 months $7\,224\,631$ Classified as variable $550\,737$ Variable type estimated $363\,969$ Detailed characterisation of light curve $390\,529$ Effective temperature $T_{\mathrm{eff}}$ $161\,497\,595$ Extinction $A_{G}$ $87\,733\,672$ Colour excess $E(G_{\mathrm{BP}}-G_{\mathrm{RP}})$ $87\,733\,672$ Radius $76\,956\,778$ Luminosity $76\,956\,778$ Solar system object epoch astrometry and photonetry $14\,099$
The basic quality statistics of the contents of Gaia DR2 are as follows (where the astrometric uncertainties as well as the Gaia-CRF2 alignment and rotation limits refer to epoch J2015.5 TCB):
Data product or source type Typical uncertainty Five-parameter astrometry (position & parallax) $0.02$–$0.04$ mas at $G<15$ $0.1$ mas at $G=17$ $0.7$ mas at $G=20$ $2$ mas at $G=21$ Five-parameter astrometry (proper motion) $0.07$ mas yr${}^{-1}$ at $G<15$ $0.2$ mas yr${}^{-1}$ at $G=17$ $1.2$ mas yr${}^{-1}$ at $G=20$ $3$ mas yr${}^{-1}$ at $G=21$ Two-parameter astrometry (position only) $1$–$4$ mas Systematic astrometric errors (sky averaged) $<0.1$ mas Gaia-CRF2 alignment with ICRF $0.02$ mas at $G=19$ Gaia-CRF2 rotation with respect to ICRF $<0.02$ mas yr${}^{-1}$ at $G=19$ Gaia-CRF2 alignment with ICRF $0.3$ mas at $G<12$ Gaia-CRF2 rotation with respect to ICRF $<0.15$ mas yr${}^{-1}$ at $G<12$ Mean $G$-band photometry $0.3$ mmag at $G<13$ $2$ mmag at $G=17$ $10$ mmag at $G=20$ Mean $G_{\mathrm{BP}}$- and $G_{\mathrm{RP}}$-band photometry $2$ mmag at $G<13$ $10$ mmag at $G=17$ $200$ mmag at $G=20$ Median radial velocity over 22 months $0.3$ km s${}^{-1}$ at $G_{\rm RVS}<8$ $0.6$ km s${}^{-1}$ at $G_{\rm RVS}=10$ $1.8$ km s${}^{-1}$ at $G_{\rm RVS}=11.75$ Systematic radial velocity errors $<0.1$ km s${}^{-1}$ at $G_{\rm RVS}<9$ $0.5$ km s${}^{-1}$ at $G_{\rm RVS}=11.75$ Effective temperature $T_{\mathrm{eff}}$ 324 K Extinction $A_{G}$ 0.46 mag Colour excess $E(G_{\mathrm{BP}}-G_{\mathrm{RP}})$ 0.23 mag Radius 10% Luminosity 15% Solar system object epoch astrometry 1 mas (in scan direction)
The above uncertainties on the photometry refer to the mean magnitudes listed in the main Gaia DR2 catalogue. The Gaia DR2 parallaxes show evidence for a global zeropoint, in the sense Gaia $-$ ’true’, of about $-0.03$ mas, which has not been ’corrected’ in the data (for details, see Lindegren et al. 2018; Arenou et al. 2018).
The data collected during the first 22 months of the nominal, five-year mission have been processed by the Gaia Data Processing and Analysis Consortium (DPAC), resulting into this second data release. A summary of the release properties is provided in Gaia Collaboration et al. (2018b). The overall scientific validation of the data is described in Arenou et al. (2018). Background information on the mission and the spacecraft can be found in Gaia Collaboration et al. (2016), with a more detailed presentation of the Radial Velocity Spectrometer (RVS) in Cropper et al. (2018). In addition, Gaia DR2 is accompanied by various, dedicated papers that describe the processing and validation of the various data products: Lindegren et al. (2018) for the Gaia DR2 astrometry, Riello et al. (2018) and Evans et al. (2018) for the Gaia DR2 photometry, Sartoretti et al. (2018), Soubiran et al. (2018), and Katz et al. (2018) for the Gaia DR2 spectroscopy (radial velocities), Holl et al. (2018) for the Gaia DR2 variability, Andrae et al. (2018) for the Gaia DR2 astrophysical parameters, Gaia Collaboration et al. (2018f) for the Solar-system objects, and Mignard et al. (2018) for the celestial reference frame. Four more papers present a glimpse of the scientific richness of the data in the areas of the Hertzsprung-Russell diagram (Gaia Collaboration et al. 2018a), the mapping of the kinematics and large-scale structure of the Milky Way (Gaia Collaboration et al. 2018e), parallaxes and proper motions of Milky Way satellite galaxies (Gaia Collaboration et al. 2018d), and variable stars in the colour-magnitude diagram (Gaia Collaboration et al. 2018c). In addition to the set of references mentioned above, this documentation provides a detailed, complete overview of the processing and validation of the Gaia DR2 data.
Gaia data, from both Gaia DR1 and Gaia DR2, can be retrieved from the Gaia archive, which is accessible from https://archives.esac.esa.int/gaia. The archive also provides various tutorials on data access and data queries plus an integrated data model (i.e., description of the various fields in the data tables). In addition, Luri et al. (2018) provide concrete advice on how to deal with Gaia astrometry, with recommendations on how best to estimate distances from parallaxes. The Gaia archive features an enhanced visualisation service, described in Moitinho et al. (2018), which can be used for quick initial explorations of the entire Gaia DR2 data set. Pre-computed cross matches between Gaia DR2 and a selected set of large surveys is provided, with details described in Marrese et al. (2018).
Gaia DR2 represents a major advance with respect to Gaia DR1 in terms of survey completeness, precision and accuracy, and the richness of the published data. Nevertheless, Gaia DR2 is still an early release based on a limited amount of input data, simplifications in the data processing, and imperfect calibrations. Many limitations hence exist (as described in Gaia Collaboration et al. 2018b) and we summarise here the most important ones that the user of Gaia DR2 should be aware of:
• The validation of Gaia DR2 was done in various stages and led to the decision to filter out parts of the available data processing results before publication. The applied filters are summarised in Gaia Collaboration et al. (2018b) and the details can be found in the data processing papers listed above, and in this documentation (Sections 4.4.3, 6.2.1, and 9.2.3, and Chapter 10).
• The survey represented by Gaia DR2 is essentially complete between $G=12$ and $G=17$ mag. At the bright end, the completeness has improved compared to Gaia DR1. At $G<7$ mag, however, there are still many sources missing from the catalogue, primarily due to the difficulties of treating saturated CCD images. Fainter than $G=17$ mag, the completeness is affected by a combination of data processing limitations in crowded fields and the filtering applied before publication. Filtering based on the number of observations of a given source will lead to imprints of the scanning law in the celestial distribution of sources which is noticeable at $G>17$ mag. The various subsets of Gaia DR2, such as the radial velocity or variability surveys, are all incomplete to varying degrees with respect to the overall catalogue. More details on the survey completeness can be found in Gaia Collaboration et al. (2018b), Arenou et al. (2018), the papers listed above, and in Chapter 10. No attempt was made at deriving a selection function for Gaia DR2.
• During the data processing for this release, including the astrometric and radial velocity processing, all sources were treated as single stars. This means that, for binary and multiple stellar systems, the astrometry and median radial velocity will be less accurate. Sources that are not single stars are not marked as such in the catalogue. The auxiliary information in Gaia DR2 does allow the identification of, for example, extragalactic sources but this should be done with care and only after verification on known samples.
• The systematic errors in the parallaxes are estimated to be below the $0.1$ mas level (Lindegren et al. 2018) but the following systematics remain. There is an overall parallax zeropoint which, from an examination of QSO parallaxes, is estimated to be around $-0.03$ mas (in the sense of the Gaia DR2 parallaxes being too small). The estimated parallax zeropoint depends on the sample of sources examined (Arenou et al. 2018) and the value above should not be used to ’correct’ the catalogue parallax values. In addition to a global zeropoint, there are also regional systematic errors as well as source-to-source correlations in the errors (which also affect the other astrometric parameters). The astrometric uncertainties are known to be underestimated and the bright star ($G\lesssim 13$ mag) astrometry is still limited by calibration uncertainties. More information is provided in Lindegren et al. (2018), Arenou et al. (2018), and Chapter 10.
• Systematic errors also exist in the photometry (Evans et al. 2018) and in the radial velocities (Katz et al. 2018), where we note in particular a positive bias, with respect to other radial velocity surveys, which increases with source magnitude up to around $500$ m s${}^{-1}$ at $G_{\rm RVS}$$\sim 12$ mag (see Section 6.5.2). The astrophysical parameter estimates in Gaia DR2 suffer from systematics related to the strong assumptions necessary to derive effective temperature and extinction from the Gaia broad band photometry and parallaxes only as well as limitations in the model grids that were used to train the machine learning algorithms employed in the data processing (Andrae et al. 2018).
• The photometric colour information in Gaia DR2 suffers from systematics at the faint ($G>19$ mag) end of the survey, in crowded regions, and in the vicinity of bright stars. In these cases, the removal of the astronomical and stray light background contributions from the integrated fluxes in the BP and RP prism photometers was inaccurate, leading to overestimates of the fluxes in $G_{\rm BP}$ and $G_{\rm RP}$. The result is that source colours for faint stars, in crowded regions, and in the surroundings of bright stars are unreliable. One should treat colour-magnitude diagrams constructed for these cases with care. The Gaia DR2 catalogue provides a field, phot_bp_rp_excess_factor, which can be used to judge the extent to which the photometry of a given source is compromised. More detailed information and guidance on cleaning samples from unreliable photometry is provided in Evans et al. (2018), Arenou et al. (2018), Gaia Collaboration et al. (2018a), and Section 5.5.2 and Chapter 10 of this documentation.
• Radial velocities are only reported for stars for which the template spectrum used in the cross-correlation method has an effective temperature in the range $3550$$6900$ K. Radial velocities with absolute values above $550$ km s${}^{-1}$ should be treated with care. See Katz et al. (2018) and Section 6.5.2 for more details.
• The astrophysical parameters $T_{\rm eff}$, $A_{\rm G}$, $E(G_{\rm BP}-G_{\rm RP})$, radius, and luminosity should be used with care. It is strongly recommended to follow the guidelines for using these data provided in Andrae et al. (2018).
• For closely aligned sources (separated by $0.2$$0.3$ arcsec), which are only occasionally resolved in the Gaia observations, confusion in the observation-to-source matching can lead to spurious parallax values which are either very large or have a negative value very far away from zero in terms of the formal parallax uncertainty quoted in the catalogue. These sources tend to be faint and located in crowded regions and are also associated with unreliable (large) proper motions (Gaia Collaboration et al. 2018b). Guidance on how to clean samples from spurious parallax values is provided in Lindegren et al. (2018).
• Gaia DR2 and Gaia DR1 should be treated as two completely independent catalogues. This is explained in detail in Gaia Collaboration et al. (2018b). In particular the photometric systems of the two catalogues are different (see also Evans et al. 2018) and the source list has changed substantially in the sense that many sources (some 80–90% at $G<16$ mag) have changed source identifier between Gaia DR1 and Gaia DR2. This means that one cannot look up sources from Gaia DR1 in Gaia DR2 on the basis of the source identifier. A table to identify the same physical source in the two data releases is provided in the Gaia DR2 archive. For samples of sources one should not use a previously calculated cross-match with Gaia DR1 but calculate a new cross-match with Gaia DR2. For several large surveys, pre-computed cross-matches are already provided in the Gaia DR2 archive (see Marrese et al. 2018, and Section 14.5).
Summary of miscellaneous links: | 2019-03-24T15:33:59 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 218, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.7469915747642517, "perplexity": 1882.407784466564}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.3, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2019-13/segments/1552912203462.50/warc/CC-MAIN-20190324145706-20190324171706-00531.warc.gz"} |
https://www.usgs.gov/media/images/cannel-coal-0 | # Cannel Coal
2013 (approx.)
### Detailed Description
Cannel coal is a type of bituminous coal that is also sometimes referred to as a type of oil shale. It's name likely came from the word "candle." Cannel coal was once used as a source for kerosene. Read more about our coal research here: https://www.usgs.gov/centers/cersc/science/us-coal-resources-and-reserves-assessment
Public Domain.
Public Domain | 2023-02-02T09:46:24 | {"extraction_info": {"found_math": false, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 0, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.8001773357391357, "perplexity": 7031.913778225618}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 5, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2023-06/segments/1674764499967.46/warc/CC-MAIN-20230202070522-20230202100522-00324.warc.gz"} |
https://wlresources.dpi.wi.gov/authoring/358-how-do-i-measure-that/3/view | # How Do I Measure That?
Title: How Do I Measure That?
Author: Stacy Roe
Overview / Description: Students will learn common standard and metric measurement tools to measure distance, weight, and volume. Then they will complete a series of hands-on labs where they apply the use of measurement skills.
Subject(s): STEM (Science, Engineering, Math, and Technology)
Special Education
Learning goals/objectives:
After completing this activity, students should be able to:
• Choose and use the appropriate tool to properly measure
• Convert between standard and metric units
• Use a “step” sheet to convert between units in the metric system
Type of Activity:
• Individual
• Small Group
• Whole Class
Teaching Strategies:
• Discussion
• Partner work
• Use of non-standard tools
• Use of manipulatives
Content Standards:
HS-ETS1-2
Design a solution to a complex real-world problem by breaking it down into smaller, more manageable problems that can be solved through engineering.
Length of Time: Designed for 10 block schedule periods.
Materials:
• Rolling rules-standard and metric
• Poster board
• Markers
• Standard and metric rulers
• Small White Boards
• 8 ½ x 11 paper
• Copy
• Cardstock
• Construction
Directions (Step-by-Step):
Day 1: Pre-test on measurement to gauge the students prior knowledge of standard and metric measurements. The results of this assessment will be used to determine how many days we spend on each type (inches, feet, meter, centimeter, etc) of measurement.
After the pretest use non-standard measurement tools such as paperclips, hands, shoes, etc. to measure common objects in the classroom. Record the measurement data on a table. This data will be used later in the unit when the students convert their alternative measurement to standard and metric measurements.
Introduce paper airplane design challenge at the end of class. Open Resource lesson Paper Airplanes Away!
Day 2: Each student will be given a giant inch model (scale ¼ inch=4 inches) and as a group we will label the segments between 0 and 1 inch down to the ⅛ of an inch.
When individual rulers are compete, students will measure straws cut to different lengths and record their answers on a the straw length data sheet.
Have students start to research paper airplane designs with remaining time. Students will be constructing a plane using one of three types of paper and conducting trials to see what type of paper and design flies best in a later lesson.
Students should also work on converting their non-standard measurements into standard measurements by measuring the actual length of the object they used and dividing or using repeated subtraction to find how many inches the object they measured is.
Day 3: Using parts of Unit 1; lesson 1 developed by Engage NY from Unit Conversions and Problem Solving with Metric Measurement. Start in the classroom with a five-minute discussion about the length of a centimeter, meter, and kilometer. Have the students each select an object they feel represents each of these measurements. Form a circle and use a talking piece to share out what different students feel represent a centimeter, meter, and kilometer. Write their conjectures on a piece of paper/board. After everyone has shared show them a centimeter is about the size of a staple or pinky fingernail, a meter is the width of a door frame, and a kilometer is two laps around a track, and a kilometer is about the distance to the Rec Center from Menominee Indian High School. Take the students outside and walk a kilometer (or two laps around the track) so they can feel the distance.
Day 4:
Start class repeating the straw lab this time using the centimeter side of the ruler to measure the straws. They will put their measurements on this record sheet
Introduce metric conversion and the metric step chart. Students will be converting their straw measurements into millimeters and decimeters and recording it on this data table.
After students complete their straw lab they should work on making prototypes of their airplanes for testing.
Day 5:
Open class with Meter and Centimeter Number Bonds which is taken from Unit 1. After that is complete the class is going to be divided into groups; group A is going to work on the problem set from Unit 1 which are conversions within metric measurements and group B is going to go into the hall and complete test fights with their airplanes. The groups will switch multiple times during the class period as students make changes to their planes.
Students will be asked to journal what they learned from making test fights and what changes they made and/or plan to make the next day in preparation for the competition. Journal entries will be graded on content, grammar, and structure not on length.
Day 6:
This will be a work day to make changes to overall airplane design and complete test fights. Students will also be working with English units of measure by completing a packet converting inches to feet, yards, and miles. Addition and subtraction of units will be incorporated into the packet learning. Resource to generate packet pages.
Day 7:
Competition day! To keep the conditions as equal as possible the airplanes should be flown inside the school gym. Each student will get three attempts to throw their plane and average will be recorded. As each plane is thrown the time the plane is in the air (time from when it leaves the students hand until it lands) should be recorded as well as the distance traveled. To help keep non-throwing students busy give multiple students the jobs of measuring distance and timing. This will teach them accountability and demonstrate the importance of accuracy. It doesn’t hurt to have a teacher time as well.
Competition recording data table
Day 8:
As a group we will discuss what it means to find an average or mean. Then students will find their individual averages for distance traveled and hang time. The individual information will be shared to fill in a class data table. After the class information is compiled the class average will be calculated. Next we will discuss the terms median, mode, and range. Students will work individually or in pairs to find each of those using our paper airplane data.
Individually students will work on finding how far their plane traveled converting the inches we measured in the gym to feet, yards, miles, kilometers, etc. Walk around and help students work on the conversion table using the metric step chart they should have from an earlier lesson.
Day 9:
Review mean, median, mode, and range by having students make posters illustrating each term.
Introduce the formula for finding rate: rate = distance/time or r = d/t; each student should find their airplane average flight rate. Pass out a sheet with some fictional distances and hang times on it. Practice finding the rate together.
Students will rotate to different stations and complete tasks such as measuring objects with a teachers; measuring using nonstandard units and converting to inches; finding their rate of flight; and filling in the missing names of lines on a blank inch ruler.
The very end of class will be an award ceremony for most creative plane design, longest hang time, longest flight distance, and most time spent on design/revision.
Day 10:
Extra day build in to warp up any work that is not finished. Watch video of airplane contest and if time allows experiment with balsa wood planes, rubber band powered planes and any other toy planes available.
Wrap-Up:
Talking circle to discuss learning using questing that requires more than yes/no answers.
Assessment (Formative / Summative):
Performance assessment: the students will measure actual objects in front of a teacher, label the lines on a standard inch ruler to the ⅛ of an inch and complete skill sheets to demonstrate knowledge of unit conversion. Throughout the unit students have been assessed as they complete various tasks. They will also be assessed during the station rotation; therefore, there will not be a formal test.
Extension Activity:
The amount of work will be reduced for struggling learners and those that are meeting the learning target will complete the whole assignment. The level of adult support will be modified to meet the needs of individual learners. | 2022-08-08T22:30:56 | {"extraction_info": {"found_math": true, "script_math_tex": 0, "script_math_asciimath": 0, "math_annotations": 0, "math_alttext": 0, "mathml": 0, "mathjax_tag": 0, "mathjax_inline_tex": 0, "mathjax_display_tex": 0, "mathjax_asciimath": 0, "img_math": 0, "codecogs_latex": 0, "wp_latex": 0, "mimetex.cgi": 0, "/images/math/codecogs": 0, "mathtex.cgi": 0, "katex": 0, "math-container": 0, "wp-katex-eq": 0, "align": 1, "equation": 0, "x-ck12": 0, "texerror": 0, "math_score": 0.31903350353240967, "perplexity": 3110.5989794264788}, "config": {"markdown_headings": true, "markdown_code": true, "boilerplate_config": {"ratio_threshold": 0.18, "absolute_threshold": 10, "end_threshold": 15, "enable": true}, "remove_buttons": true, "remove_image_figures": true, "remove_link_clusters": true, "table_config": {"min_rows": 2, "min_cols": 3, "format": "plain"}, "remove_chinese": true, "remove_edit_buttons": true, "extract_latex": true}, "warc_path": "s3://commoncrawl/crawl-data/CC-MAIN-2022-33/segments/1659882570879.1/warc/CC-MAIN-20220808213349-20220809003349-00318.warc.gz"} |
Subsets and Splits