text
stringlengths 0
11M
| link
stringclasses 1
value | source
stringclasses 16
values |
|---|---|---|
Introduction
============
Marijuana is the most commonly used illicit substance in the UK and many other western countries, despite it being a class B drug. It is available legally in some localities, including the Netherlands. There is a well known link between marijuana use and schizophrenia. There is currently uncertainty about any causal association between marijuana use and lung cancer as the effects of concomitant tobacco smoking amongst these users confound analyses. A small number of cases of various forms of aspergillosis have been associated with marijuana smoking, but the association appears to be uncommon.[@b1-mjhid-3-e2011005]--[@b9-mjhid-3-e2011005]
We present 2 cases of chronic pulmonary aspergillosis (CPA) associated with extensive medicinal use of marijuana, and summarise the literature linking all forms of aspergillosis and marijuana use.
Case reports
============
Patient 1
---------
A Caucasian male presented at the age of 47 with a right-sided pneumothorax ([Figure 1](#f1-mjhid-3-e2011005){ref-type="fig"}), associated with pulmonary bullae. He had a four year history of progressive breathlessness. His tobacco smoking history was approximately 39 pack\*years, but his breathlessness worsened considerably once he started to smoke marijuana (5 marijuana cigarettes (joints) daily) medicinally to alleviate rheumatoid arthritis-associated joint pain. On presentation, he reported coughing up thick sputum and experiencing some unexpected weight loss. His medications included a 5mg daily dose of prednisolone and 1g dose of sulfasalazine twice a day. His family history included one brother who had TB and another who had a pneumothorax.
His pneumothorax did not resolve despite drainage; thus he underwent a right bullectomy and pleurectomy. One of the excised bullae ([Figure 2](#f2-mjhid-3-e2011005){ref-type="fig"}) contained a pleural based abscess containing an aspergilloma ([Figure 3](#f3-mjhid-3-e2011005){ref-type="fig"}). His CRP at this time was 333mg/l. Postoperatively his lung function failed to improve and a chest x-ray revealed that that his right lung remained abnormal, with cavitary changes. A CT scan showed severe emphysema with many large lung bullae especially in the left apex ([Figure 4](#f4-mjhid-3-e2011005){ref-type="fig"}). His CRP normalised and his alpha 1 antitrypsin levels were normal.
Pathological evidence of an aspergilloma with symptoms of weight loss and raised inflammatory markers is an indication for antifungal therapy. He was started on posaconazole 400mg bd and took it for 4 months. After treatment both his cough and sputum production improved and his *Aspergillus fumigatus* precipitin serum titre was 1:4. He stopped smoking marijuana. He was observed for recurrence of CPA for the following 4 years and there was no evidence of recurrence ([Figure 5](#f5-mjhid-3-e2011005){ref-type="fig"}).
Patient 2
---------
A 35 year-old Caucasian male presented with shortness of breath secondary to a viral infection. After investigations he was diagnosed with emphysema. He had been born with a Tetralogy of Fallot congenital heart malformation and underwent a surgical repair at the age of 10. Post-operatively he experienced immense pain and started smoking cannabis, without tobacco, to reduce it. He continued to grow his own marijuana and smoke several joints daily.
He remained apparently well until admission to hospital aged 43, and then several times over the following two years, owing to type II respiratory failure. Aged 44, he stopped smoking cannabis,ending 34 years of smoking around 20 joints per day. Despitestopping smoking cannabis his respiratory function had diminished to such an extent that his exercise tolerance was only 10 yards on the flat. As a result he was started on long term oxygen therapy, requiring 3L continuously to maintain an oxygen saturation of 91%.
By 45 years his FEV~1~ was only 11% predicted and his FVC was 22% predicted. A CT scan revealed "severe pan-acinar emphysema involving the right upper and middle lobes; complex cavitary lesions in the left apex, one of which had the appearance of an aspergilloma" ([Figure 7](#f7-mjhid-3-e2011005){ref-type="fig"}). Sputum culture revealed *Aspergillus fumigatus*. His *Aspergillus* precipitins titre was 1:8 and his *Aspergillus* IgG antibody level (Immunocap, Phadia) was 126mg/L. His total IgE was 180 and he had a positive *Aspergillus* RAST of 0.4, all consistent with chronic pulmonary aspergillosis. His respiratory function deteriorated such that he required a lung transplant; however the discovery of an aspergilloma was seen to be an absolute contraindication by the team treating him. He was started on voriconazole 200mg bd with some symptomatic improvement on therapeutic levels. However his lung function continued to deteriorate and 3 months later he died at the age of 46.
Discussion
==========
*Aspergillus* spp. are widespread and exposure to airborne conidia and hyphal fragments is universal. In humans who are immunocompromised these saprophytic fungi can cause life-threatening invasive aspergillosis and, in asthmatics and those with cystic fibrosis, allergic disease (allergic bronchopulmonary aspergillosis (ABPA)). In those who have structural damage to their lungs but are apparently immunocompetent, *Aspergillus* can cause CPA, with or without an aspergilloma.
Invasive aspergillosis has been described in association with marijuana smoking in two cancer patients on chemotherapy,[@b1-mjhid-3-e2011005],[@b2-mjhid-3-e2011005] two leukaemia patients,[@b3-mjhid-3-e2011005],[@b4-mjhid-3-e2011005] a renal transplant recipient,[@b5-mjhid-3-e2011005] and a few patients with AIDS.[@b6-mjhid-3-e2011005] It is not recommended that patients undergoing chemotherapy or on substantial immunosuppression smoke marijuana, based on these observations. However the risk is not possible to quantify.
There have been two reported cases of ABPA associated with mouldy marijuana.[@b7-mjhid-3-e2011005],[@b8-mjhid-3-e2011005] Given the frequency of asthma and ABPA, and the high frequency of marijuana usage amongst young people, these cases may represent a tiny proportion of those affected. This year, CPA was associated with marijuana smoking for the first time[@b9-mjhid-3-e2011005] and we report here 2 additional cases. The previously reported patient died at just 34 years of age and patient 2 at 46 years of age. These high mortality rates of CPA have been described previously.[@b10-mjhid-3-e2011005]--[@b12-mjhid-3-e2011005]
The criteria for the diagnosis of CPA are the presence of pulmonary cavitation, with or without a fungal ball, in a non-immunocompromised patient with evidence of raised inflammatory markers and detectable circulating *Aspergillus* IgG antibodies (including *Aspergillus* precipitins).[@b13-mjhid-3-e2011005] The sensitivity of the IgG antibody tests is about 90%, with some discordance between assays. Occasional patients do not have detectable IgG antibody, but their Aspergillus IgE antibodies are raised and/or there are other data supporting the diagnosis, such as biopsy or culture evidence of infection. Patient 1 had histological evidence of infection with detectable *Aspergillus* precipitins. Patient 2 had a positive respiratory culture, with a fungal ball visible radiologically, and detectable Aspergillus IgG and IgE antibodies, as well as positive Aspergillus precipitins.
Both tobacco and marijuana are commonly contaminated with fungi, and serology from marijuana smokers exhibits evidence of Aspergillus exposure.[@b14-mjhid-3-e2011005] It remains to be seen whether fungal spores survive the burning process, indicating perhaps that exposure to Aspergillus comes from handling the marijuana rather than smoking it.[@b15-mjhid-3-e2011005] It has been observed that IA presents earlier after immunocompromise amongst smokers than non-smokers.[@b16-mjhid-3-e2011005]
The way marijuana is smoked is different to that of tobacco in that the cigarettes, or joints, are usually smoked without a filter and are smoked down to a smaller butt. Users hold their breath for longer and use the Valsalva manoeuvre. These measures maximise the diffusion of the psychoactive compounds. In doing so however, they expose their lungs to a greater tar and carbon monoxide burden, as well as subjecting their lungs to greater pressure changes. This barotrauma from marijuana smoking has long been associated with the formation of bullae and subsequent pneumothoraces. The association is so strong that some now recommend that patients presenting with spontaneous pneumothoraces should be directly questioned about marijuana smoking.[@b17-mjhid-3-e2011005]
The vast majority of marijuana is taken recreationally for its psychotropic effects. However, historically it has been used medicinally as an analgesic and an antiemetic. Even now, many people use marijuana purely for its medicinal benefits. It has been reported that 44% of US oncologists have recommended the illegal use of marijuana to their chemotherapy patients for iatrogenic nausea.[@b18-mjhid-3-e2011005] What must be borne in mind is that these patients are potentially severely immunosuppressed and therefore at risk of life-threatening IA.
Smoking marijuana affects the lungs structurally but may also affect them immunologically, by affecting alveolar macrophages.[@b19-mjhid-3-e2011005] This may predispose marijuana users to pulmonary infection. In our cases it is unknown whether the marijuana smoking caused the cavities which *Aspergillus* was able to colonise, or the marijuana was just the source of *Aspergillus* exposure and the *Aspergillus* caused the cavities. Research into the pathogenesis of both marijuana-related lung bullae and CPA are needed to proportionate causal blame in cases such as these.
Marijuana use has previously been implicated with the range of *Aspergillus* infections; the cases we present add aspergilloma and CPA to that list. In both cases marijuana was used for its medicinal benefits. With patient 1 smoking marijuana in combination with mild immunosuppression through low-dose steroids proved to be a potent combination. In patient 2 the heavy and prolonged marijuana usage in itself may have resulted in extensive pulmonary destruction and fatal CPA.
Together these cases highlight yet another potential risk associated with smoking marijuana. Understanding the full health burden presented by marijuana is hindered by a lack of disclosure by patients for fear of legal repercussions, coupled with poor history taking from clinicians; just 3% of daily marijuana smokers have their drug use documented in their clinical record.[@b20-mjhid-3-e2011005] More work is required to elucidate the full health burden of marijuana on those with pre-existing pathologies, so that governments, clinicians, and indeed users can make informed decisions about this controversial topic.
**Competing interests:** The authors have declared that no competing interests exist.
{#f1-mjhid-3-e2011005}
{#f2-mjhid-3-e2011005}
{#f3-mjhid-3-e2011005}
{#f4-mjhid-3-e2011005}
{#f5-mjhid-3-e2011005}
{#f6-mjhid-3-e2011005}
{#f7-mjhid-3-e2011005}
| tomekkorbak/pile-curse-small | PubMed Central |
Laracon: Laravel 5.3 Recap
Today at Laracon US, Taylor Otwell, gave a talk covering many new features for 5.3 and it included four major items: Laravel Scout, Laravel Passport, Laravel Mailable, and Laravel Notifications.
The talk was scheduled for ninety minutes, and Taylor used every bit of it talking as fast as he could to cover these four features in the time allotted. Let’s take a look at these new features.
Laravel Scout
Laravel Scout is a driver based full-text search for Eloquent. Out of the box, it supports Algolia and because it’s driver based anyone in the community can create their own integration with other full-text search systems.
Scout works by implementing a “Searchable” trait with your existing models. Then it’s just a matter of syncing the data with the search service like this:
php artisan scout:import App\\Post
After that you can search your models with:
Post::search('Alice')->get();
You can even paginate:
Post::search('Alice')->paginate()
And it even includes simple where clauses:
Post::search(‘Alice’)—>where('acount_id', '>', 1)->paginate()
Laravel Mailable
Laravel Mailable is a new Mail class for sending emails in an expressive way:
Laravel Notifications
Laravel Notifications allow you to make quick updates through services like Slack, SMS, or Email.
Notifications ship with a responsive transactional email template. In your notification class all that is needed to send a message is code like this:
$this->line('Thank you for joining')
->action('Button Text', 'http://url.com')
->line('If you have any questions please hit reply')
->success()
Or if it’s an error:
$this->line('Sorry we had a problem with your order')
->action('Button Text', 'http://url.com')
->error()
Laravel Passport
Laravel Passport is an optional package that is a full oAuth 2 server ready to go.
You can set your scopes, Vue.js components for token generation, revoking tokens, and more.
—
All of these features will be fully documented for the official release, which is scheduled to come out in a few weeks. It’s definitely exciting, and I can’t wait to start utilizing some of these new features. | tomekkorbak/pile-curse-small | Pile-CC |
Budziska, Lublin Voivodeship
Budziska is a village in the administrative district of Gmina Adamów, within Łuków County, Lublin Voivodeship, in eastern Poland. It lies approximately south of Adamów, south of Łuków, and north-west of the regional capital Lublin.
The village has a population of 290.
References
Budziska | tomekkorbak/pile-curse-small | Wikipedia (en) |
Research in context***Evidence before this study:*We investigated all the manuscripts on PRAS40 in tumor included in PubMed, and found that PRAS40 phosphorylation was reported to be increased in human melanoma, prostate cancer and non-small cell lung cancer specimens. However, it remains elusive whether the hyperphosphorylation of PRAS40 is caused only by the activation of the upstream Akt pathway, or is the result of its own hyperexpression. Further, the regulation of PRAS40 phosphorylation was reported to be related to several pathways, whereas the regulation of PRAS40 expression remains largely unknown except for the regulation by EWS in Ewing\'s sarcoma.*Added value of this study*Here, we report the significant increase of the protein and mRNA levels of PRAS40 in HCC tissue samples from both our cohorts and TCGA database, similar as the increase of p-PRAS40, suggesting that the increase of PRAS40 phosphorylation in HCC was mainly caused by the augmentation of PRAS40 expression. Both the expression and phosphorylation of PRAS40 is positively correlated to the poor prognosis of HCC patients, and hepatogenesis was suppressed in *Akt1s1*^−/−^ mice, showing the critical role of PRAS40 in HCC. Further, miR-124-3p levels are inversely correlated to PRAS40 protein levels in both human and mouse HCC specimens, and miR-124**-**3p targets PRAS40 expression.*Implications of all the available evidence*PRAS40 may be a potential therapeutic target for HCC. MiR-124-3p could be considered as an approach targeting PRAS40 in HCC.**Alt-text: Unlabelled box
1. Introduction {#sec0001}
===============
Liver cancer is one of the most common cancers, and hepatocellular carcinoma (HCC) is the most frequent primary liver cancer. The incidence of HCC is increasing, whereas the treatment options are limited and often inefficient [@bib0001]. The poor understanding of the molecular mechanism of HCC carcinogenesis and progression is considered as the main obstruction.
PRAS40 (encoded by *AKT1S1*) was primarily found as a 14-3-3 binding protein [@bib0002], characterized as a substrate for Akt [@bib0003] and a component of mTOR complex 1 [@bib0003], [@bib0004], [@bib0005], [@bib0006], [@bib0007]. PRAS40 plays an essential role in cell survival, proliferation, metastasis, apoptosis, senescence, immunoregulation and protein degradation in different species \[[@bib0003],[@bib0008], [@bib0009], [@bib0010]\]. Hyperphosphorylation of PRAS40 has been reported in human melanoma, prostate cancer and non-small cell lung cancer [@bib0010], [@bib0011], [@bib0012]. However, it remains elusive whether the hyperphosphorylation of PRAS40 is caused only by the activation of the upstream Akt pathway, or is the result of its own hyperexpression. PRAS40 knockdown suppresses the cellular proliferation by deregulating apoptosis \[[@bib0009],[@bib0010]\], which might be associated with p53 upregulation in a Ribosomal protein 11-dependent manner [@bib0013]. In addition, PRAS40 is phosphorylated by Rab11-family interacting protein 4, mediating the migration and invasion of HCC cells [@bib0014]. However, it needs to be clarified whether the expression level of PRAS40 associates with HCC progression.
Previously, we reported that as an mRNA target of EWS, PRAS40 protein expression is inhibited by EWS [@bib0009]. PRAS40 protein level is increased due to the haploinsufficiency of EWS in Ewing sarcoma family tumor cell lines [@bib0009], whereas the regulation system for PRAS40 expression in the tumors without EWS aberrant expression remains largely unknown. MicroRNAs (miRNAs) control the expression of the target mRNAs by pairing to them to alter transcription, mRNA stability or translation [@bib0015], [@bib0016], [@bib0017], [@bib0018]. Either the loss or gain of miRNA function could contribute to tumorigenesis by regulating the expression of oncogenes or tumor suppressor genes, respectively. Aberrant expression of miRNAs, such as miR-21, miR-29 and miR-221, has been reported in HCC [@bib0019], [@bib0020], [@bib0021]. MiR-124-3p is highly conserved and encoded by three genes miR-124-1, miR-124-2, and miR-124-3 located on 8p23.1, 8q12.3 and 20q13.33, respectively. MiR-124-3p is one of the most expressed miRNAs in brain, and plays important roles in the development and function of nervous system [@bib0022], [@bib0023], [@bib0024]. Recently, miR-124 has been found to be able to control tumorigenesis [@bib0025], [@bib0026], [@bib0027], [@bib0028], immunology [@bib0029], [@bib0030], [@bib0031], metabolism [@bib0032], reproduction [@bib0033] and so on. MiR-124 is downregulated in various tumors, resulting in the hyperexpression of multiple targets, such as cyclin-dependent kinase 4 [@bib0034], CBL [@bib0035], C---C motif ligand 2 and Interleukin-8 [@bib0036], polypyrimidine tract-binding protein 1 [@bib0037], Interleukin-6, Signal transducer activator of transcription 3 (STAT3) [@bib0029] and Nuclear factor kappa B \[[@bib0028],[@bib0038]\], which contributes to tumorigenesis and metastasis. In HCC, miR-124 is hypoexpressed due to the hypermethylation of the promoters \[[@bib0039],[@bib0040]\] or the hypoexpression of the Hepatocyte nuclear factor 4α (HNF4α) \[[@bib0025],[@bib0028]\]. MiR-124 inhibits the metastasis of HCC by targeting Rho Associated Protein Kinase 2 and Enhancer of zeste homolog 2 [@bib0026], or targeting transcription factor Specificity protein 1 to suppress the expression of integrin αV indirectly [@bib0041]. Therefore, miR-124 works as a tumor suppressive miRNA, while the mechanism in detail needs to be determined further.
Herein we reported the hyperexpression and hyperphosphorylation of PRAS40 in human HCC, and a positive correlation between increased expression and phosphorylation levels of PRAS40 and the overall survival of HCC patients. PRAS40 depletion resulted in a suppression of hepatocarcinogenesis and cellular proliferation. Further tumor suppressor miR-124-3p could bind the 3′UTR of PRAS40 and downregulate the expression of PRAS40. In addition, miR-124-3p level presents an inverse correlation to PRAS40 level in HCC specimens. Therefore the hypoexpression of miR-124-3p led to an abnormally increased expression of PRAS40, which contributes to PRAS40 phosphorylation, HCC carcinogenesis and progression. These results could be expected to offer novel clues for developing HCC treatment.
2. Materials and methods {#sec0002}
========================
2.1. Patient samples {#sec0003}
--------------------
The matched primary cancer tissue and their corresponding adjacent peri‑cancer tissue of HCC in cohort 1 (*n* = 22) were obtained from the Second Affiliated Hospital of Dalian Medical University. Tissue arrays HLiv-HCC180Bch-01 (*n* = 44, Cohort 2) and OD-CT-DgLiv01-012 (*n* = 50 for PRAS40 and p-PRAS40 staining; *n* = 49 for miR-124-3p staining, Cohort 3) were purchased from Shanghai Outdo Biotech Co. All the patients had not received preoperative anticancer treatment. This study was approved by the Medical Ethics Committees of Dalian Medical University (ME201904), and all the materials were sufficiently anonymised.
2.2. *Akt1s1* knockout mice construction {#sec0004}
----------------------------------------
This study was approved by the animal care and use committee of Dalian Medical University (AEE17054). Methods were carried out in accordance with the approved guidelines of Dalian Medical University. Mice were maintained in a temperature- and humidity-controlled room on a 12-h light/dark cycle at Specific Pathogen Free Experimental Animal Center of Dalian Medical University.
*Akt1s1* knockout mouse was created based on CRISPR/Cas9 system by Beijing Biocytogen (Beijing, China). The exons 2--5 at the *EGE-HYT-006* locus in the mouse genome were deleted, which was positively confirmed by PCR product sequencing. None of the top ten possible off-targets were confirmed. The wild type and mutant alleles for *Akt1s1* mutant mice were detected in a multiplex PCR reaction using a pair of primers (Forward: AACTGGATGCATGAGAATCGGGACT; Reverse: GGGGAACCGGGATACAATTGTCAGG).
3. Results {#sec0005}
==========
3.1. PRAS40 expression and phosphorylation are upregulated in HCC {#sec0006}
-----------------------------------------------------------------
To determine the possible role of PRAS40 in HCC carcinogenesis and progression *in vivo*, we first analyzed the protein levels by IHC in 3 independent patient cohorts ([Fig. 1](#fig0001){ref-type="fig"}a--h, Supplementary Table 1--5, and Supplementary Fig. 1). A significant increase of PRAS40 staining in HCC tissue was observed compared to the peri‑cancer region ([Fig. 1](#fig0001){ref-type="fig"}a). Based on staining intensity ([Fig. 1](#fig0001){ref-type="fig"}b) and extent, we calculated the H-Scores of PRAS40 staining [@bib0042]. The IHC results of 22 (Cohort 1, Supplementary Table 1) and 44 pairs (Cohort 2, Supplementary Table 3) of HCC and peri‑cancer clinical tissue samples showed significantly higher scores of PRAS40 staining in HCC tissue than the paired peri‑cancer tissue, respectively (*P*\<0.01 from Student\'s *t*-test, [Fig. 1](#fig0001){ref-type="fig"}c, e and Supplementary Fig. 1). P-PRAS40 staining showed a similar tendency (*P*\<0.01 from Student\'s *t*-test, [Fig. 1](#fig0001){ref-type="fig"}f, Supplementary Fig. 1). Next we studied the RNA-seq results in TCGA LIHC (Liver hepatocellular carcinoma) database (The Cancer Genome Atlas) [@bib0043]. The expression of *AKT1S1* mRNA in 371 HCC specimens (median FPKM value=10.55) showed a significantly higher level than that in 50 normal liver samples (median FPKM value=5.42, *P*\<0.01, [Fig. 1](#fig0001){ref-type="fig"}i). Among these samples, *AKT1S1* DNA copy number was investigated in 97 HCC specimens and 59 normal liver samples, whereas no significant change was clarified (Supplementary Fig. 2) (<https://www.oncomine.com>). To confirm the significance of the augmentation of PRAS40 protein and phosphorylation levels in HCC, we next constructed a DEN-induced HCC model in mice, and the results suggested that PRAS40 protein and phosphorylation levels were increased in HCC tissue significantly ([Fig. 1](#fig0001){ref-type="fig"}k and l). The ratio of p-PRAS40/PRAS40 was similar in both HCC and peri‑cancer tissue, suggesting that the increase of p-PRAS40 level in HCC tissue was mainly caused by the augmentation of PRAS40 expression ([Fig. 1](#fig0001){ref-type="fig"}l). Further we compared the protein levels of PRAS40 in 7 HCC cell lines and normal hepatocyte cell line THLE-3. PRAS40 protein levels were higher in all of the HCC cells than that in normal hepatocytes (Supplementary Fig. 3).Fig. 1The protein levels of PRAS40 in HCC tissue and its correlation to the survival rate of HCC patients. a--d. Analyses of 22 pairs of primary HCC and peri‑cancer tissue samples in Cohort 1. HE and IHC staining of PRAS40 in HCC and peri‑cancer tissue (a). Degrees indicating the intensity of PRAS40 staining in representative HCC tissue (b). H-scores multiplied by the intensity and extent of PRAS40 staining in HCC and peri‑cancer tissue (c). The correlation of PRAS40 protein level to the survival rate of HCC patients (d). e-f. H-scores of PRAS40 staining (e) and p-PRAS40 staining (f) in 44 pairs of primary HCC and peri‑cancer tissue samples in Cohort 2. g-h. The correlation of PRAS40 protein level (g) and phosphorylation level (h) to the survival rate of 50 HCC patients in Cohort 3. i-j. RNA-seq results of *AKT1S1* mRNA in HCC and normal liver tissue samples in public TCGA dataset. The relative *AKT1S1* mRNA levels were compared in 371 cases of HCC and 50 cases of normal liver tissue (i). The correlation of *AKT1S1* mRNA level to the survival rate of 365 HCC patients (j). k-l. PRAS40 protein levels in the livers of DEN-injected *Akt1s1^+/+^* mice were evaluated by Western blotting (k). The quantitative results were shown in l. Scale bars, 100μm. N, non-tumor; T, tumor. Bars, SD. \*\*, *P*\<0.01 from Student\'s *t*-test.Fig 1
3.2. High expression and phosphorylation of PRAS40 are positively correlated to the poor prognosis of HCC patients {#sec0007}
------------------------------------------------------------------------------------------------------------------
To understand the clinical relevance of PRAS40 hyperexpression or hyperphosphorylation in HCC further, we examined the possible correlation between PRAS40 or p-PRAS40 IHC staining in HCC specimens and patient survival rate after surgery. According to the staining H-Scores, we grouped the HCC specimens as PRAS40 or p-PRAS40 low level (H-Score\<150) and PRAS40 or p-PRAS40 high level (H-Score≥150). High expression of PRAS40 protein (13 and 18 cases in Cohort 1 and 3, respectively) was positively associated with a lower overall survival rate of HCC patients compared to low expression PRAS40 protein (9 and 32 cases in Cohort 1 and 3, respectively)(*P* = 0.0055 from log-rank test, [Fig. 1](#fig0001){ref-type="fig"}d; *P* = 0.0009 from log-rank test, [Fig. 1](#fig0001){ref-type="fig"}g). High level of p-PRAS40 (24 cases in Cohort 3) was positively associated with a lower overall survival rate of HCC patients compared to low level of p-PRAS40 (26 cases in Cohort 3)(*P* = 0.0057 from log-rank test, [Fig. 1](#fig0001){ref-type="fig"}h). Further multivariate Cox regression analyses indicated that high level of either PRAS40 or p-PRAS40 is an independent prognostic factor for poor survival of patients with HCC (*P* = 0.016, Cohort 1, Supplementary Table 2; *P* = 0.003 for PRAS40, *P* = 0.028 for p-PRAS40, Cohort 3, Supplementary Table 5).
Analyses of the 365 HCC patients' survival information included in TCGA LIHC database suggested that high level of *AKT1S1* mRNA (FPKM value ≥11.99, 141 cases) was positively associated with a lower overall survival rate of HCC patients compared to low *AKT1S1* mRNA level (FPKM value \<11.99, 224 cases) (*P* = 0.0002 from log-rank test, [Fig. 1](#fig0001){ref-type="fig"}j) (The Human Protein Atlas) [@bib0044]. Collectively, these results suggest that high level of PRAS40 is associated with the poor prognosis of HCC patients.
3.3. PRAS40 depletion suppresses DEN-induced hepatocarcinogenesis {#sec0008}
-----------------------------------------------------------------
To study the significance of PRAS40 in hepatocarcinogenesis, we constructed *Akt1s1^+/−^* mice, which were used to form *Akt1s1^−/−^* mice after backcrossed six generations to C57BL/6 N genetic background ([Fig. 2](#fig0002){ref-type="fig"}a). Fourteen-day-old *Akt1s1^−/−^* or *Akt1s1^+/+^* male mice were applied a single intaperitoneal injection of DEN (25 mg/kg, *n* = 11). At 42 weeks old, all DEN-treated *Akt1s1^+/+^* mice developed HCC (11/11), whereas 10 out of 11 *Akt1s1^−/−^* mice developed HCC. The number of the tumors with larger size (\>3 mm) formed in *Akt1s1^−/^*^*−*^ livers was greatly less than those in *Akt1s1^+/+^* livers (*P*\<0.01 from Student\'s *t*-test, [Fig. 2](#fig0002){ref-type="fig"}b and c). To investigate the mechanism of tumor suppression induced by PRAS40 depletion, we next examined the alteration of Akt phosphorylation. We found that the phosphorylation of Akt was obviously decreased in both the peri‑cancer and HCC tissue of *Akt1s1^−/^*^*−*^ mice, compared to those in *Akt1s1^+/+^* mice. In contrast, the level of PCNA, a proliferation marker, was decreased only in HCC but not peri‑cancer tissue of *Akt1s1^−/^*^−^ mice ([Fig. 2](#fig0002){ref-type="fig"}d and e).Fig. 2HCC formation in *Akt1s1^+/+^* and *Akt1s1^−/−^* mice. a. Genotyping results of the mice and the schematic diagram of the design of *Akt1s1^−/−^* mice. b. The representative livers of DEN-injected *Akt1s1^+/+^* and *Akt1s1^−/−^* mice. c. Quantitative results of the tumors formed in *Akt1s1^+/+^* and *Akt1s1^−/−^* mice, *n* = 11. d. Western blotting detected by the antibodies indicated in the peri‑cancer and HCC samples of *Akt1s1^+/+^* and *Akt1s1^−/−^* mice. e. The quantitative results of Western blotting. Bars, SD. \*\*, *P*\<0.01 from Student\'s *t*-test.Fig 2
3.4. PRAS40 depletion represses the cellular proliferation of HCC cells *in vitro* {#sec0009}
----------------------------------------------------------------------------------
The above observations prompted us to explore the potential biological function of PRAS40 in HCC cell proliferation *in vitro*. Initially, we overexpressed PRAS40 in Hep3B cells which showed a comparatively low level of PRAS40 protein (Supplementary Fig. 3). The phosphorylation of Akt and the expression of PCNA were both upregulated ([Fig. 3](#fig0003){ref-type="fig"}a and b). Further the PRAS40-overexpressing cells presented a remarkable enhancement of cell growth in cell viability assay (*P*\<0.01 from Student\'s *t*-test, [Fig. 3](#fig0003){ref-type="fig"}c) and more colonies ([Fig. 3](#fig0003){ref-type="fig"}d), compared with the empty vector-transfected cells.Fig. 3The effects of PRAS40 depletion on HCC cell growth *in vitro*. a-d. Hep3B cells were introduced with the virus containing empty vector or PRAS40 expression vector. Cell lysates were analyzed by Western blotting with the antibodies indicated (a). Quantitative results of 2 independent experiments (b). Cell viability assays were performed in triplicate at the indicated times (c). Colony formation assay results were shown (d). HepG2 or Huh-7 cells were transfected without (null) or with negative control (nc), or PRAS40 (\#1, \#2) siRNAs (e-l). Cell viability assays were performed in triplicate at the indicated times in HepG2 (e) and Huh-7 (f) cells. Soft agar assays were performed in HepG2 cells, and the quantitative results of 2 independent experiments were presented in right panels, Scale bar, 50 μm (g). Colony formation assays were performed in HepG2 (h) and Huh-7 (i) cells. Quantitative results of 2 independent experiments were presented in right panels. HepG2 cells were stained with annexin V (AV) and PI and analyzed by flow cytometry (j). HepG2 and Huh-7 cell lysates were analyzed by Western blotting with the antibodies indicated (k-l). C-PARP, cleaved PARP; C----Caspase 3, cleaved Caspase 3. Bars, SD. \*\*, *P*\<0.01 from Student\'s *t*-test.Fig 3
Next, we knocked down the expression of PRAS40 with siRNAs in HepG2 and Huh-7 cells ([Fig. 3](#fig0003){ref-type="fig"}e--l). Both HepG2 and Huh-7 cells transfected with PRAS40 siRNAs exhibited remarkable decline in cell viability to 27--57% of those by the cells without siRNA transfection (*P*\<0.01 from Student\'s *t*-test), whereas those transfected with non-specific siRNA did not show significant change ([Fig. 3](#fig0003){ref-type="fig"}e and f). The number of the colonies formed in soft agar by PRAS40 knockdown cells was as little as about 17% (*P*\<0.01 from Student\'s *t*-test) of those formed by the cells without transfection, whereas the cells transfected with non-specific siRNA did not show any significant change ([Fig. 3](#fig0003){ref-type="fig"}g). The capacity of anchorage-dependent colony formation was also evaluated. PRAS40 depleted cells showed much fewer and smaller colonies than control cells, and the colony numbers were only 10--33% (*P*\<0.01 from Student\'s *t*-test) of those formed by the cells without transfection, whereas those transfected with non-specific siRNA showed more than 77% of the colony number formed by those without transfection ([Fig. 3](#fig0003){ref-type="fig"}h and i). These results suggest that PRAS40 is involved in the promotion of cellular proliferation.
PRAS40 deregulates apoptosis in melanoma and Ewing\'s sarcoma cells \[[@bib0009],[@bib0010],[@bib0045]\]. Here we examined the effects of PRAS40 depletion on apoptosis by flow cytometry. Early apoptotic cells, represented by the ratio of the PI^−^/Annexin V^+^ cells, were increased to 7.44% in PRAS40 shRNA transfected cells from 3.41% in the control shRNA transfected cells. When the cells were treated with an apoptosis inducer, staurosporine (STS), early apoptotic cells were increased to 23.5% in PRAS40 shRNA transfected cells from 10.7% in the control shRNA transfected cells ([Fig. 3](#fig0003){ref-type="fig"}j). The levels of cleaved PARP, cleaved caspase 3, apoptosis markers, were found to be increased in PRAS40-depleted HepG2 and Huh-7 cells ([Fig. 3](#fig0003){ref-type="fig"}k and l). Furthermore, the levels of phosphorylated Akt were downregulated remarkably in PRAS40-knockdown cells (\#1 and \#2). These data suggest that PRAS40 may deregulate apoptosis through upregulating Akt activation in HCC.
3.5. PRAS40 depletion represses the cellular proliferation of HCC cells *in vivo* {#sec0010}
---------------------------------------------------------------------------------
According to the *in vitro* results, we further explored the possibility that PRAS40 depletion suppresses the growth of HCC xenografts in mice. From 6 days after tumor cell injection, tumor growth was notably inhibited in the tumor xenografts formed by the PRAS40-knockdown HepG2 cells compared to the control cells ([Fig. 4](#fig0004){ref-type="fig"}a). The tumor volume and weight formed in the PRAS40-knockdown groups were significantly reduced (*P*\<0.01--0.05 from Student\'s *t*-test) compared to the control groups ([Fig. 4](#fig0004){ref-type="fig"}a--c). While when shRNA resistant PRAS40 expression vector was introduced together with PRAS40 shRNA into HepG2 cells, the tumor volume and weight formed were comparable to the control group ([Fig. 4](#fig0004){ref-type="fig"}a--c). In addition, Akt phosphorylation and PCNA expression were downregulated remarkably in PRAS40-knockdown cells, which were restored to the levels in control cells ([Fig. 4](#fig0004){ref-type="fig"}d and e). These data suggest that PRAS40 knockdown significantly suppressed Akt phosphorylation and the tumor growth of HCC xenografts *in vivo*.Fig. 4The effects of PRAS40 depletion on HCC xenograft formation in nude mice. HepG2 cells were introduced with control, PRAS40 shRNA (shPRAS40) or PRAS40 shRNA together with shRNA-resistant PRAS40 expression vector (shPRAS40+PRAS40). a-d. The cells of each group were inoculated into the two posterior flanks of the mice, *n* = 6. Tumor volumes were recorded every 2--3 days (a). On day 19, tumors were dissected and obtained (b-c). Pictures were taken at the sacrificed time (b). Tumor weights were measured (c). Bars, SD. \*, *P*\<0.05; \*\*, *P*\<0.01 (Student\'s *t*-test). d. Cell lysates were applied to Western blotting. e. Quantitative results of the six samples from each group. Bars, SD. \*, *P*\<0.05; \*\*, *P*\<0.01 (Student\'s *t*-test).Fig 4
3.6. MiR-124-3p targets PRAS40 3′UTR {#sec0011}
------------------------------------
For the mechanism of PRAS40 hyperexpression in HCC, since we did not find *AKT1S1* DNA amplification in HCC samples in public TCGA database, and miRNAs play important roles in the regulation of mRNA and protein expression, we considered the possibilities of the regulation by miRNAs. We aimed to identify those miRNAs that target *AKT1S1* 3′UTR serving as tumor suppressors in the pathogenesis of HCC. We predicted the miRNAs which bind *AKT1S1* 3′UTR using both miRTarBase (<http://mirtarbase.mbc.nctu.edu.tw/php/index.php>) and DIANA-TarBase (<http://diana.imis.athena-innovation.gr/DianaTools/index.php?r=tarbase/index>), and selected the miRNAs downregulated in HCC (miRCancer) as candidates ([Fig. 5](#fig0005){ref-type="fig"}a). MiR-124-3p binding sites within the *AKT1S1* 3′UTR are conserved between humans and mice. To clarify whether miR-124-3p directly recognizes the predicted binding sites within *AKT1S1* 3′UTR, we cloned wild type or binding sites-mutant type *AKT1S1* 3′UTR into a luciferase reporter vector ([Fig. 5](#fig0005){ref-type="fig"}b). As expected, cotransfection with miR-124-3p mimic reduced the luciferase activity of the reporter including *AKT1S1* 3′UTR (wild type) to 38% of that produced by cotransfection with negative control miRNA in HeLa cells (*P*\<0.01 from Student\'s *t*-test). On the contrary, cotransfection with miR-124-3p inhibitor did not reduce the luciferase activity of the reporter including *AKT1S1* 3′UTR. While neither miR-124-3p nor negative control miRNA altered the luciferase activity of the control reporter without *AKT1S1* 3′UTR (vector) ([Fig. 5](#fig0005){ref-type="fig"}c). In contrast, the luciferase activity of the reporter including *AKT1S1* 3′UTR with two mutations of miR-124-3p binding sites (mutant type) was not altered by either miR-124-3p mimic or inhibitor, as same as the negative control miRNA ([Fig. 5](#fig0005){ref-type="fig"}c). Together, these results indicate that PRAS40 is a direct target of miR-124-3p.Fig. 5PRAS40 is the target of miR-124-3p and the effects of miR-124-3p on cell growth. a. The prediction of the miRNAs binding *AKT1S1* 3′UTR. b. Schematic illustration of the predicted miR-124-3p binding sites in *AKT1S1* 3′UTR and the design of mutant type of *AKT1S1* 3′UTR. c. HeLa cells were cotransfected with pCIneo-Luc (vector), pCIneo-Luc-AKT1S1 (wild type) or pCIneo-Luc-AKT1S1 mutant (mutant type) reporter vector and nonspecific control miRNA (nc), miR-124-3p or miR-124-3p inhibitor (miR-124-3p I) together with Renilla luciferase expression vector phRL-SV40. *Firefly* luciferase activities were measured and normalized to Renilla luciferase activities. The experiments were performed in triplicate. d-n. HCC cells were transfected without ( null) or with negative control (nc), miR-124-3p mimic or miR-124-3p inhibitor (miR-124-3p I). The PRAS40 protein levels were analyzed by Western blotting in Huh-7, HepG2 and Hep3B cells (d). Quantitative results of 2 independent experiments (e). The *AKT1S1* mRNA levels were analyzed by real time PCR in Huh-7 (f), HepG2 (g) and Hep3B cells (h cells in triplicate. Cell viability assays were performed in triplicate at the indicated time points in Huh-7 (i), HepG2 (j), Hep3B (k), and SNU-449 (l) cells. Colony formation assays were performed in Huh-7 (m) and HepG2 (n) cells. Quantitative results of 2 independent experiments were shown in right panels (m-n). Bars, SD. \*, *P*\<0.05; \*\*, *P*\<0.01 (Student\'s *t*-test).Fig 5
3.7. Forced miR-124-3p expression downregulates PRAS40 expression and cellular proliferation {#sec0012}
--------------------------------------------------------------------------------------------
To verify whether miR-124-3p represses the expression of PRAS40 in HCC cells, we next transfected miR-124-3p mimic into Huh-7, HepG2 or Hep3B cells. The western blot results showed that compared to negative control miRNA transfection, miR-124-3p mimic but not inhibitor introduction significantly decreased PRAS40 protein levels. Simultaneously, a significant decrease of Akt phosphorylation in miR-124-3p mimic- but not inhibitor- expressing cells was confirmed ([Fig. 5](#fig0005){ref-type="fig"}d and e). The real time PCR results showed that miR-124-3p mimic introduction significantly decreased *AKT1S1* mRNA levels to 36--60% of that produced by negative control miRNA transfection (*P*\<0.05 from Student\'s *t*-test), whereas miR-124-3p inhibitor did not show remarkable changes ([Fig. 5](#fig0005){ref-type="fig"}f--h). With subsequent functional assays, all the cell viability assays and the colony formation assays revealed impaired cell growth in the cells transfected with miR-124-3p mimic ([Fig. 5](#fig0005){ref-type="fig"}i--n). The cells transfected with miR-124-3p mimic presented a remarkable decline in cell viability to 21--45% of that in the cells transfected with negative control miRNA (*P*\<0.01 from Student\'s *t*-test). Similarly, the capacity of colony formation was also greatly decreased by miR-124-3p mimic transfection to 7--32% of that by the cells transfected with negative control miRNA (*P*\<0.01 from Student\'s *t*-test). However, transfection with miR-124-3p inhibitor moderately augmented the cell viability to 1.3 folds (*P*\<0.05 from Student\'s *t*-test) and the colony number to 1.2 folds (*P*\<0.01 from Student\'s *t*-test) of that observed in negative control miRNA transfected HepG2 cells, while upregulated the cell viability to 1.6 folds (*P*\<0.05 from Student\'s *t*-test) of that observed in negative control miRNA transfected Hep3B cells.
3.8. MiR-124-3p levels are inversely correlated to PRAS40 protein levels in HCC tissue {#sec0013}
--------------------------------------------------------------------------------------
To clarify the correlation between the levels of PRAS40 protein and miR-124-3p *in vivo*, we further examined the expression levels of miR-124-3p in 49 cases of HCC tissue (Cohort 3). According to the staining scores, we grouped the HCC specimens as miR-124-3p low expression (score\<150) and miR-124-3p high expression (score≥150). Low levels of miR-124-3p were more likely to be seen in HCC with high level of PRAS40 protein (*P* = 0.0378 from Fisher\'s exact test, Pearson *r*=−0.3972) or p-PRAS40 (*P* = 0.0485 from Fisher\'s exact test, Pearson *r*=−0.3493) ([Fig. 6](#fig0006){ref-type="fig"}a and b). Further, we examined the miR-124-3p levels in mouse tissue. The real time PCR results showed that compared with the peri‑cancer tissue, miR-124-3p level was remarkably reduced in the HCC tissue of 5/6 of *Akt1s1^+/+^* mice, while PRAS40 levels were notably augmented in the same HCC tissue. In addition, the levels of miR-124-3p and PRAS40 were opposite in all 6 mice ([Fig. 6](#fig0006){ref-type="fig"}c). Therefore the level of miR-124-3p inversely correlates to PRAS40 protein level significantly *in vivo*.Fig. 6The correlation between the levels of miR-124-3p and PRAS40 protein. a. ISH staining of miR-124-3p and IHC staining of PRAS40 and p-PRAS40 were performed in 49 clinical HCC specimens in Cohort 3 (same samples used in [Fig. 1](#fig0001){ref-type="fig"}G-H). Scale bars, 100μm. b. Correlation analyses between the staining scores of miR-124-3p and PRAS40 or p-PRAS40, *P* value is calculated by Fisher\'s exact test and a Pearson correlation coefficient (r) is shown. c. Real time PCR in the peri‑cancer and HCC samples of *Akt1s1^+/+^* mice, *n* = 6. The experiments were performed in triplicate. Bars, SD. \*, *P*\<0.05; \*\*, *P*\<0.01 (Student\'s *t*-test).Fig 6
3.9. The repression of cellular proliferation by miR-124-3p is partially restored by PRAS40 overexpression {#sec0014}
----------------------------------------------------------------------------------------------------------
To confirm the relationship between miR-124-3p and PRAS40 further, we next introduced both miR-124-3p mimic and full length PRAS40 into HepG2 cells. The western blot results showed that endogenous PRAS40 protein level was notably lower in the cells introduced with miR-124-3p mimic than those introduced with negative control miRNA. However, exogenous PRAS40 level expressed by the vector lacking the 3′UTR region of PRAS40 was not changed at all ([Fig. 7](#fig0007){ref-type="fig"}a and b). Both HepG2 and SNU-449 cells introduced with miR-124-3p mimic exhibited remarkable decline in cell viability to 42--48% of those by the cells with negative control miRNA introduction (*P*\<0.01 from Student\'s *t*-test), while those transfected with miR-124-3p mimic together with PRAS40 expression vector showed significant increase in cell viability to 1.6--2 folds of those miR-124-3p mimic only introduced cells (*P*\<0.05 from Student\'s *t*-test, [Fig. 3](#fig0003){ref-type="fig"}c and d). In soft agar assays, transfection of miR-124-3p mimic resulted in a significantly smaller number and size of colonies compared to the negative control miRNA transfection (15--37%, *P*\<0.05 from Student\'s *t*-test). In addition, the cells cotransfected with PRAS40 and miR-124-3p showed 1.9--4.6 folds of colony numbers of those formed in the cells with miR-124-3p mimic transfection (*P*\<0.05 from Student\'s *t*-test, [Fig. 7](#fig0007){ref-type="fig"}e and f). These data suggested that miR-124-3p downregulated PRAS40 expression to suppress cell growth, which could be partially reversed by PRAS40. Thus PRAS40 should function at the downstream of miR-124-3p in HCC cellular proliferation.Fig. 7The effects of exogenous PRAS40 on the growth repression induced by miR-124-3p. a-f. HCC cells were cotransfected with negative control (nc) or miR-124-3p and empty vector or PRAS40 expression vector. PRAS40 protein levels were analyzed by Western blotting (a), and quantitative results of 2 independent Western blottings were shown in right panel. Cell viability assays (b-c) and soft agar assays (d-e) were performed in HepG2 and SNU-449 cells. Quantitative results of 2 independent soft agar assays were shown in right panels. Scale bars, 100μm. Bars, SD. \*, *P*\<0.05; \*\*, *P*\<0.01 (Student\'s *t*-test). f. Schematic graph representing the working model of PRAS40 in HCC.Fig 7
4. Discussion {#sec0015}
=============
HCC is the fifth most common malignancy and the third most frequent reason of cancer death [@bib0046]. Effective treatments are anticipated, especially for the advanced HCC. Understanding the carcinogenesis is believed to be helpful to develop novel approaches to HCC. Herein, we focus on PRAS40 which is a substrate of Akt and a component of mTORC1. We report the upregulation of PRAS40 expression and phosphorylation in HCC and the positive correlation between the high phosphorylation, protein or mRNA level of PRAS40 and the poor prognosis of HCC patients ([Fig. 1](#fig0001){ref-type="fig"}, Supplementary Table 2, 5, Supplementary Fig. 1 and 3). More importantly, we found that PRAS40 depletion dramatically inhibited HCC carcinogenesis and progression by the suppression of Akt signaling both *in vivo* and *in vitro* ([Fig. 2](#fig0002){ref-type="fig"}, [Fig. 3](#fig0003){ref-type="fig"}, [Fig. 4](#fig0004){ref-type="fig"}). Thus the essential role of PRAS40 in HCC carcinogenesis has been confirmed in human specimens, mice models and cell lines. In the further study, a miR-124-3p/PRAS40 axis was identified ([Fig. 5](#fig0005){ref-type="fig"}, [Fig. 6](#fig0006){ref-type="fig"}, [Fig. 7](#fig0007){ref-type="fig"}), which provides an explanation for the mechanism of PRAS40 hyperexpression and the tumor suppressive role of miR-124-3p in HCC.
The level of p-PRAS40 was reported to be upregulated in human melanoma, prostate cancer and non-small cell lung cancer samples, which is considered as the results of upstream Akt pathway activation \[[@bib0010],[@bib0011]\]. Here we found that besides phosphorylation level, the protein and mRNA levels of PRAS40 were increased significantly in HCC clinical samples compared to the peri‑cancer samples in our cohorts and public TCGA database ([Fig. 1](#fig0001){ref-type="fig"}). High levels of PRAS40 protein and mRNA were both found to be positively correlated to the poor prognosis of HCC patients in our results and TCGA data ([Fig. 1](#fig0001){ref-type="fig"}d, g, j, Supplementary Table 2 and 5). In addition, in the DEN-induced HCC tissue, PRAS40 and p-PRAS40 levels were also upregulated remarkably, and the ratio of p-PRAS40/PRAS40 was similar in both HCC and peri‑cancer samples which suggests that PRAS40 hyperphosphorylation is mainly caused by PRAS40 hyperexpression ([Fig. 1](#fig0001){ref-type="fig"}k and l). Thus we raised a novel possibility that PRAS40 hyperexpression could contribute to hepatocarcinogenesis independently of the upstream Akt pathway activation, which may provide a reference for other cancers. Furthermore, the data that HCC repression in *Akt1s1^−/−^* mice ([Fig. 2](#fig0002){ref-type="fig"}), cell growth decrease and HCC xenograft impairment in PRAS40 knockdown cells ([Figs. 3](#fig0003){ref-type="fig"} and [4](#fig0004){ref-type="fig"}) solidly proved the significantly essential role of PRAS40 in HCC carcinogenesis and promotion.
For the mechanism that high level of PRAS40 contributes to hepatocarcinogenesis, the consistence of the downregulation of Akt phosphorylation in both *Akt1s1^−/−^* mice ([Fig. 2](#fig0002){ref-type="fig"}d and e) and PRAS40 knockdown cells ([Fig. 3](#fig0003){ref-type="fig"}k,l and [4](#fig0004){ref-type="fig"}d,e), and the upregulation of Akt phosphorylation in PRAS40-overexpressing cells ([Fig. 3](#fig0003){ref-type="fig"}a and b) suggests that PRAS40 controls a positive feedback to Akt activation, leading to cell proliferation. These results are identical to the data of ischemic brains in *Akt1s1^−/−^* mice reported by another group [@bib0047]. Further studies are necessary to clarify this point.
The next question is how PRAS40 expression is increased in HCC. Since the DNA amplification is not found in HCC clinical samples in TCGA database (Supplementary Fig. 2), we considered the mRNA regulation. Recent studies present plentiful evidences on miRNAs controlling the expression of the target mRNAs [@bib0015], [@bib0016], [@bib0017], [@bib0018]. We next focused on miR-124-3p which is predicted to target *AKT1S1* 3′UTR ([Fig. 5](#fig0005){ref-type="fig"}a). Being a tumor suppressor, miR-124-3p is downregulated in a couple of tumors including HCC, and shows an inverse correlation to PRAS40 or p-PRAS40 level ([Fig. 6](#fig0006){ref-type="fig"}). Our results suggest that miR-124-3p downregulates the protein and mRNA levels of PRAS40 through binding *AKT1S1* 3′UTR ([Fig. 5](#fig0005){ref-type="fig"}c--h), and inhibits Akt phosphorylation and cell growth ([Fig. 5](#fig0005){ref-type="fig"}d,e and i--n). On the contrary, the miR-124-3p inhibitor transfection did not show notable effects on the protein and mRNA levels of PRAS40, Akt phosphorylation and cell growth in HCC cells ([Fig. 5](#fig0005){ref-type="fig"}c--n), which is considered as the results of the miR-124-3p hypoexpression in HCC cells \[[@bib0025],[@bib0026],[@bib0041]\].
Further we tried to confirm the role of the miR-124-3p/PRAS40 axis in HCC progression. The data suggested that exogenous PRAS40 restored but not fully reversed the repression of cell growth by miR-124-3p ([Fig. 7](#fig0007){ref-type="fig"}a--f). Since there are multiple target genes of miR-124-3p in HCC, other target genes such as Specificity protein 1, Rho Associated Protein Kinase 2 and Enhancer of zeste homolog 2, could be still repressed by miR-124-3p when only PRAS40 was introduced. The complexity of this network needs to be verified further.
The essential factor for liver development and hepatocyte function, HNF4α, promotes the transcription of miR-124. In HCC, HNF4α downregulation results in a low expression of miR-124 \[[@bib0025],[@bib0028]\]. On the other hand, CpG islands are present in all of the promoters of miR-124-1, miR-124-2 and miR-124-3, leading to the hypermethylation of miR-124 promoter and its hypoexpression [@bib0039]. Accordingly downregulated miR-124-3p level results in the upregulation of PRAS40 expression, sequentially inducing Akt activation to initiate hepatocarcinogenesis ([Fig. 7](#fig0007){ref-type="fig"}g). Collectively, our work has provided evidences to support that miR-124-3p/PRAS40 axis plays an important role in hepatocarcinogenesis, which offered a novel reference to target HCC.
Author contributions {#sec0016}
====================
ZQ and LH designed research; ZQ, TZ, LS, HF, HL, JW, SZ, TZ, LG, LJ, HZ, GH, TM, YW and LH performed the experiments and analyzed the data; LH wrote the manuscript. All authors read and approved the manuscript.
Declaration of Competing Interest
=================================
The authors declare no potential conflicts of interest.
Appendix. Supplementary materials {#sec0018}
=================================
Image, application 1
This work was supported by the Climbing Scholars Supporting Program of Liaoning Province, National Natural Science Foundation of China (81772971), and Liaoning Provincial Program for Top Discipline of Basic Medical Sciences. All of the funders had not any role in study design, data collection, data analysis, interpretation, and writing of the report. We thank all the Huang lab members for the kind support.
Supplementary material associated with this article can be found in the online version at doi:[10.1016/j.ebiom.2019.102604](https://doi.org/10.1016/j.ebiom.2019.102604){#interref0004}.
[^1]: These authors contributed equally.
[^2]: Present address: Affiliated Cancer Hospital of Zhengzhou University, Henan Cancer Hospital, 127 Dongming Road, Zhengzhou 450008, PR China.
| tomekkorbak/pile-curse-small | PubMed Central |
Tyler Glenn
Tyler Aaron Glenn (born November 28, 1983) is an American singer, songwriter, and musician. He is known as the lead vocalist and keyboardist of the American rock band Neon Trees and as a solo artist.
Biography
As a teenager, Glenn attended Chaparral High School in Temecula, California. He is a former member of The Church of Jesus Christ of Latter-day Saints (LDS Church). After high school, he served a Mormon mission in Nebraska.
Neon Trees' origins lay in Southern California in 2004 after Glenn's father suggested he play music with guitarist Chris Allen, the son of one of Glenn's father's friends. In 2005, they moved to Provo, Utah and formally founded Neon Trees, adding bassist Branden Campbell and drummer/backing vocalist Elaine Doty (who is now Elaine Bradley) in 2007. The band became well known in the music scene around Provo and Salt Lake City.
In 2007, Ronnie Vannucci Jr. (drummer for The Killers), who knew Campbell from a previous band, saw Neon Trees playing at a small venue in Las Vegas and was impressed. As such, in 2008, The Killers invited the band to open for them during their North American tour.
Neon Trees released their first full-length album, Habits, in 2010. One song from that album, "Animal", which Glenn co-wrote, hit number one on the Billboard Alternative Songs chart. A second song co-written by Glenn, "Everybody Talks" from their 2011 album Picture Show, was also a top 10 hit in 2012.
In 2014, Glenn was featured as lead vocalist on "Born to Run," a song on Afrojack's debut studio album, Forget the World.
In 2015, Glenn joined the holiday music supergroup Band of Merrymakers for their album Welcome to Our Christmas Party.
On April 28, 2016, Glenn released his debut single as a solo artist, the electro pop single "Trash." The video for the song was premiered on Rolling Stone the next day. In the video, Glenn is seen drinking from a bottle of alcohol, spitting on an altered image of Joseph Smith, making the LDS church's temple tokens with his hands, and painting a red 'X' on his face. The video immediately generated controversy among Mormons, many of whom found it offensive.
Glenn released a solo album entitled "Excommunication" on October 21, 2016.
On April 11, 2018, Glenn announced on his Twitter that he would be making his Broadway debut playing Charlie Price, in Kinky Boots on May 6, 2018 and will play a limited run through July 15, 2018.
Personal life
In the April 10, 2014 issue of Rolling Stone, Glenn revealed his homosexuality, and discussed keeping his sexuality a secret throughout his life. Glenn says he had known he was gay since he was a young child. "I had my crushes on guys throughout high school, but it was never an overwhelming thing until my twenties," he admits. "Then I'd be dating girls and in love with my straight friend and it was the worst feeling in the world," he said to Rolling Stone.
Regarding his Mormon faith, Glenn stated in a 2012 interview: "The way I was raised and being a questioner, and getting a lot of my curiosities out early with drugs and alcohol, I think it’s helped me maintain a more even keel where I’m not out of control." It had been widely reported that Glenn and the other members of Neon Trees do not drink alcohol or use illicit drugs. The LDS Church has had a longstanding policy against same-sex marriage. In November 2015, the LDS Church announced children of same-sex married couples could not be baptized until those children are 18 years of age and disavowed homosexual relationships. This policy has since been changed, allowing children of same sex couples to join the church. This announcement shocked Glenn. He no longer self-identifies as Mormon, and later resigned his membership in the church. His 2016 solo album, "Excommunication", is about his experience with the LDS Church and his frustration with their policies.
Songwriting credits
Discography
Neon Trees
Solo artist
Excommunication (2016)
Featured artist
References
External links
Category:1983 births
Category:Living people
Category:21st-century American keyboardists
Category:21st-century American singers
Category:Alternative rock keyboardists
Category:Alternative rock singers
Category:American alternative rock musicians
Category:American lyricists
Category:American male singer-songwriters
Category:American rock keyboardists
Category:American rock singers
Category:American rock songwriters
Category:Gay musicians
Category:LGBT musicians from the United States
Category:LGBT people from California
Category:LGBT people from Utah
Category:LGBT singers
Category:LGBT songwriters
Category:Musicians from San Diego
Category:Musicians from Provo, Utah
Category:People from Temecula, California
Category:Songwriters from California
Category:Songwriters from Utah
Category:Singers from California
Category:Former Latter Day Saints
Category:Neon Trees members
Category:Critics of Mormonism
Category:21st-century male singers | tomekkorbak/pile-curse-small | Wikipedia (en) |
This proposal responds to a request from the National Institutes of Health. The Board on Global Health of the Institute of Medicine (IOM) will continue to convene a Forum on Global Violence Prevention in which NIH will participate with other Federal and non-Federal agencies, organizations and Foundations. Background and Need Preventable violence represents a major global public health problem. As a cause of disability adjusted life years lost (DALYs), in 2001 both self-inflicted injuries and violence ranked among the top 20 categories globally accounting for 20.3 and 18.9 million years of life lost, respectively. Most of this burden is in low and middle-income countries. To complement traditional and expensive criminal justice approaches, the power of public health, prevention oriented approaches to reducing violence are increasingly becoming evident. Epidemiologic risk factors for violence can be identified and preventive interventions targeted and iteratively improved to address child abuse, youth violence, sexual and intimate partner violence, elder abuse, collective violence, and self-directed violence. To create a stronger and more effective multi-disciplinary, multi-sector al community empowered by the most current knowledge and insights, the Institute of Medicine of the National Academies established a Forum on Global Violence Prevention. The scope of the Forum has placed particular emphasis on low and middle-income countries. The Forum is composed of 26 appointed individuals drawn from a range of US and foreign governmental agencies, international organizations, academia, foundations, and affected industries. Two times a year, it has convened public expert workshops on a range of cross-cutting global violence prevention issues. These events have brought together around the Forum membership the worlds leading violence prevention authorities for the purpose of illuminating aspects of the problem and evolving solutions. Forum workshops to date have focused on the following topics: Violence Against Women and Children; Social and Economic Costs of Violence; Contagion of Violence; Communication and Technology for Violence Prevention; Evidence for Violence Prevention Across the Lifespan; and Elder Abuse. Proceedings have been summarized in a series of workshop reports and have been disseminated widely. Topics under development for the continuation of the forum include those of current interest to NIH, such as alcohol and other drug-related violence and the effects of gun violence on health and mental health. With continued work on violence, the forum will be able to reach its main goal: As a result of several years of repeated, high-level exposure to the possibilities for improved violence prevention through public health approaches, the expected outcome will be an increasingly energized and Technical Proposal Page 2 NAS Proposal 10001727 diverse community of funders and other agents for action informed by cutting edge scientific evidence. | tomekkorbak/pile-curse-small | NIH ExPorter |
Sometimes, you just have to stop and think about a sentence for a bit in order to realize just how bad things really are.
Here’s today’s head shaker:
One in 10 working Americans between the ages of 35 and 44 are getting their wages garnished. That means their pay is being docked – often over an old credit card debt, medical bill, or student loan.
It’s contained in a stunning project from NPR and ProPublica on changes in the way debt collectors operate. In all but a handful of states, they can simply sweep everything out of your bank account. Everything.
We know what you’re thinking. Deadbeats. Serves ’em right.
In this story, however, a family lost it all because a woman fell and broke her wrist. In fact, many of the stories being told begin with someone who didn’t have health insurance. Others are simply victims of the recession.
Back in 1968, when lawmakers passed the landmark Consumer Credit Protection Act, it specifically limited how much of a debtor’s pay could be seized. But it made no mention of bank account garnishments. As a result, a collector can’t take more than 25 percent of a debtor’s paycheck, but if that paycheck is deposited in a bank, all of the funds can be taken.
Carolyn Carter, director of advocacy at the National Consumer Law Center, says the lawmakers didn’t address bank seizures because they simply weren’t common at the time. In today’s collection environment, she said, “the wages that are deposited in a bank account become suddenly much more vulnerable than anyone realized.”
Since the late 1960s, debt collection has changed in other ways that lawmakers couldn’t have anticipated. Today, buying old debt is an industry in itself. And big debt buying firms hire teams of lawyers to crank out lawsuit after lawsuit seeking to collect. Carter says it’s time for lawmakers at the state and local level to revisit and reform existing laws.
Wisconsin is one of only three states that protects paychecks so that they don’t drop below the poverty level.
And there’s yet another tale of the generation from NPR today. There are few jobs for this country’s youngest research scientists — the best and the brightest.
Support for biomedical research is down 20 percent, NPR complains.
What does this look like for the best and brightest? A commenter on the NPR website tells the story:
This is one of the reasons my husband and I moved to Europe for jobs. After getting on-site interviews for 3 colleges/Universities, but not getting offered a position or deciding the fit wasn’t right before a decision was made on their part, and seeing no hope in the funding opportunities, we made the move.
I hated leaving my family and friends, but an opportunity presented itself where 2 PhD’s could have a job in the same location and get paid a bit more than what we made as post-docs. For him it was a pretty even swap from his previous post-doctoral and doctoral training, but I had to adapt to a new field and position that was much different from my PhD education and training.
I believe we will both be better for the risks we took, but my dreams of being a University educator training the next generation of science are all but dashed by the downward trajectory of the funding situation.
I used to tell students in the labs I worked in they should go onto do PhD’s if they wanted to do science and make a difference. Now I tell them to get a job after their bachelors and think very hard if they want to earn tiny salaries to work long hours and in the end fail more often than you succeed, only to graduate and find yourself in the position where you may not find gainful employment doing what you trained so hard for.
It is a dismal situation that academia has come to this. I love that the Ice bucket challenge has earned so much money for ALS research, but they are not the only ones hurting. People should be telling their constituents that they want to see more money go into all science so we can support people who want to make a different.
Right now, a grant has to be in the upper 6% of all that are submitted to get funded. This is why professors in Academia spend 90% of their time writing grants rather than mentoring students and post-docs.
“It’s not that the number of jobs has diminished,” says another. “It’s that the number of good jobs has diminished.”
About the blogger
Bob Collins has been with Minnesota Public Radio since 1992, emigrating to Minnesota from Massachusetts. He was senior editor of news in the ’90s, ran MPR’s political unit, created the MPR News regional website, invented the popular Select A Candidate, started several blogs, and every day laments that his Minnesota Fantasy Legislature project never caught on.
NewsCut is a blog featuring observations about the news. It provides a forum for an online discussion and debate about events that might not typically make the front page. NewsCut posts are not news stories.
Related Blog Posts
These are images and signposts of a country that is failing. And those not in these dire straits are “but for the grace of God go I” and the noose tightens bit by bit.
jon
As a member of the “younger than Bob” generation, this pretty much sums it up in the title..
Then again, my generations grew up hearing about how good it was back in the day from our parents, who lived during the most prosperous time in the countries history…
Perhaps we need to hang out with our great depression era grandparents some more to get some perspective.
It’s funny you mention that. A few years ago, as the Great Recession was dawning, I started talking to the people you suggest we talk to just for this perspective. I was looking for a little hope for the predicament we were in. What did I get? “Oh yeah, this is wayyy worse than back then…” I was stunned. That’s when I went to talk to college kids instead (which spawned the NewsCut on Campus project).
I was talking to an old-timer the other day and what he said was in the Depression, they had hope that things would be better. He said he thought the difference between then and now is the lack of optimism that better times are ahead, that this is the new normal. That the U.S. peaked years ago.
I've been saying this very thing for years. We had a good run, just like the ancient Greeks, ancient Romans, colonial Britain, Spain, France, Russia…
Veronica
I see this a little differently. Are things GREAT now? No, but I don’t know if I want to go back to Clinton-era bubble economy and then deal with the aftermath of yet another bubble bursting. HOWEVER, in an election year, there is much talk by certain politicians about how things are getting worse, how bad the economy of Minnesota is, blah, blah, blah…..when we have one of the best, strongest economies in the US.
Minnesotans are lucky; they have very little idea how bad things really are out there.
We’re so consumed with how things are in the here-and-now, we don’t realize what we’ve done to the future.
Veronica
And again, I do have hope. I see the minimum wage fights as starting to pick up. I have hope that in 10 years we’ll make advancements in women’s rights. I know that as the boomers retire and um, “retire”, we won’t have the same levels of unemployment. Are there environmental things going on that are pretty yucky? Yes….but I don’t see that as hopeless either.
Lower Manhattan exists because of a garbage dump. I don’t know what that proves, but humans can adapt.
jon
Americans are lucky; they have very little idea how bad things really are out there.
Gary F
The millennials also grew up in an era where self esteem was given, not earned. Everything was “for the children” so their expectations were inflated. Past generations grew up brewing coffee at home and they now need to spend $2+ daily on a cup of coffee. Everyone got a trophy and the score wasn’t announced.
Live within your means, no job is too low for you, you will need to work late, get your hands dirty, and suck up to “the man”, take some risks, and put off gratification for a while.
Yes, the 50’s were a great era, and since we bombed the heck out of all the main industrial centers of the world in WW2, sure it was easy. Now you have to compete with the world.
Go do it.
John
If you think that people who have gotten advanced degrees in science are afraid to “get their hands dirty, work late, take risks, suck up to the man, or put off gratification for a while, you clearly have no idea what it takes to get there for the group of people discussed in the article above.
Let me give you an idea of what a chemist will do to get a PhD (in the name of pursuit of an academic job with 6-7 day workweeks and relatively low pay);
I went to graduate school for six years to get my PhD. During that six years, I earned around $15K/year after paying my tuition (this was in the early 2K’s, so not that long ago, I think it’s up to about $20K now), but before taxes. In a typical work week, I would be at school doing research M-F from 6 AM until 3 PM, then would go get my son from daycare, make dinner and hand him off to my wife for the evening. I’d be back at school from 6:30 until 9:00 most nights.
Saturdays, i normally worked from 7 AM until around noon. Sundays I tried to keep it to a couple hours of working at home.
Seven years after graduation, my family and I are planning our kids first vacation involving a plane for this winter (we drove to South Dakota last summer, before that we hadn’t left the state for a vacation). How long after high school did you “delay gratification,” before you were able to do something like that? I’m over 15 years out now.
So, before you go judging the people who have chosen to be the best in the world at what they do, I suggest you learn a bit about what they have given up to get there. (note: I’m not the best at what I do, nor did I go into academics. I chose to work in private industry, for a number of reasons that have nothing to do with any of this).
Gary F
20 years ago I started working on straight commission. Been through a couple of job changes, and a bad economies. Had paychecks that when you divide by the hours I put in were less than minimum wage, and had paychecks that were more than some people make in a year.
They also start their own firms. They take risks by working for a start up firm and becoming part of ownership.
Bad economies mean people need to think outside the box, get some skin the game. Think outside the traditional norms of what is “owed to you” for getting a higher degree. No one owes you a better paying job with an advanced degree.
Veronica
You have to be in pretty nice place financially to “take those risks” and start your own company. You’ll need to make sure you have a steady stream of income until your company starts turning a profit (3 years being the standard time frame). If you have kids, then you risk even more by starting a real company. And no, I don’t mean freelancing. That has it’s own special kind of stress, but I mean a company with actual income and liabilities.
Gary F
yes, that’s why its called risk. And, now that we have deemed that sole proprietorship’s are the evil rich and not paying their fair share, there is even less opportunity because there is less reward for the risk.
Veronica
Uh…what? I’m evil now? I have one SP and one partnership business….and I pay my taxes. Most of my business owner friends do too.
You’re saying start a company, but it’s risky, but it won;t matter because the result will be an evil resource-sucker?
I don’t get it.
Tim
Do we as a nation want to remain competitive in these fields? In that case, yeah, we more or less do owe them jobs if we don’t want to fall behind other countries that are willing to invest far more resources into scientific research.
I almost have a “Buzzword bingo.” You just have to toss “synergy” in your next post.
John
I note from the article above, that the people who are going out and doing it, are still doing exactly that.
They just had to move to Europe to make it happen.
jon
Yup, millennials, bunch of lazy hipsters living out of their parents basement because they aren’t willing to do any work…
Of course, Baby boomers, bunch of lazy hippies living out of a van because they are unwilling to get real jobs…
What you are describing as a trait of millennials is a trait of 20 somethings, it’s embarrassing to me that people older than myself can’t manage to see that the same terms they are throwing around are the ones that were thrown at them when they were the same age…
I can appreciate that baby boomers don’t necessarily have much memory left, but appreciate that the same traits you are tossing around now were tossed at your generation (baby boomers, gen x, millennials, echo boomers, all of them except for the greatest generation who was not around in their 20’s because they were off fighting WWII) back in the day…
Also appreciate that there are more lazy hippy baby boomers that are not in the work force than lazy every one gets a trophy millennials… Of course letting facts get in the way of a good story about how the youth are going to destroy this country while the older generation actively destroys the country would just make it so much hard to sell news papers to the generation of people who still know what a news paper is….
Since then, they permanently occupy a place in U.S. history as the most selfish, self-centered generation in American history, unable or unwilling to understand the concept of sacrifice for the benefit of the greater good.
The one flaw of the Greatest Generation, is they spawned us.
Jack
I don’t know that it has to do with the generation as much as it has to do with the economic circumstances (charades) we have had to tolerate since 911. I have perceived this problem as a reaction to this plan of a New World Order (President Obama’s term in an interview with New York Times). Not only are you navigating around company politics to get that perfect job you are also in a battle in getting your resume in the right hands via technology that has been filtered electronically and physically. Who succeeds and who struggles is more controlled, thank you technology. If we need to blame a generation do we blame the Baby Boomers for the creation of technology or do we blame Gen Xers plus others for abusing it?
jon
The boomers had their chance long before 9/11.
Gen X had their chance long before 9/11.
Both were called lazy when the bulk of the generation reached their 20’s, same as the millennials…
I think it has less to do with the economy and 9/11 and more to do with our long term memory, seems that as it fades we forget that we were once (as a generation) called “lazy”
Television was going to destroy the boomers brains, and then MTV was going to destroy the echo boomers brains… I think the millennials ruined their brains with ipods…
Every generation has been attacked as being unproductive and lazy as they start to enter the work force… because as they start to enter the work force, a majority of them aren’t in the work force yet… hence they are lazy. If I could apply the same logic to goldfish, the two of them that are still in the plastic bag adjusting to the temperature of the tank are lazy, because they aren’t swimming around like the one that has been in that tank for months.
The economy might be part of a slower uptick for millennials… but ultimately, the same names get thrown out every time a new generation comes along… in 10-20 years time, my nephews generation (don’t know if they have a name yet) will be being picked apart as lazy, had everything they ever wanted delivered to them on an ipad and never had to struggle like “our” generation in their whole life…
My generation didn’t stop a Vietnam, we didn’t fight in a world war, or end a holocaust, perhaps the legacy of my generation can be a failure to start any wars in the first place, maybe we won’t see the point when every one is going to get a trophy at the end any ways…
Maybe we can create a better life for our self than our parents had, which should be the dream for us from the older generation, though disdain for other peoples kids is all I read on internet comments about my generation, perhaps we won’t respond in kind and implement the death panels congress was so intent on for a while…
tboom
Bob I’m your age, right smack in the middle of the baby boom generation. I don’t credit our generation with stopping the war, it went on far too long and probably would have ended anyway. I believe most politicians of the time had come to see Viet-Nam as the lost cause it was, but could not see a “graceful” way of admitting to such a huge and costly mistake. Perhaps The War would have ended even sooner had there not been such vociferous protests creating us-against-them political push-back.
I do agree with your sentiments that as a whole we’re a greedy self-centered lot, the “us-against-them” division has dominated our lifetime. Just as we were split anti-war and establishment then, we are split Democrat and Republican now. As our time to “run the country” came and went, what did we produce? An ineffectual (on big issues) two-term philandering Democratic President and a two-term Republican President with such little courage and foresight he led us into an endless war.
Just as we couldn’t talk to each other in the 60’s, we can’t talk to each other now. When you can’t talk, you can’t solve deep problems.
We hand the next generation problems (war and environment) and broken tools (economy, education and infrastructure). Best of luck, BTW be sure to take care of us in our old age.
Tyler
“The millennials also grew up in an era where self esteem was given, not earned. ”
And who “gave” that self-esteem? Complaining about the following generation is basically a comment on how poor a parent you are.
Jack
In a healthy environment, self-esteem is naturally developed. Naturally developed like compassion and empathy. Wages are earned, exchanged for labor output.
kevinfromminneapolis
Just wait until we realize $17,000,000,000,000 in debt is also a problem. | tomekkorbak/pile-curse-small | Pile-CC |
Nursing in Public: You Can Do It On a Train, You Can Do It On a Plane...
February 25, 2016
You can do it in a car, you can do it in a restaurant with your husband and in-laws. I'm talking about breastfeeding in public – what are you talking about?
I wondered how I would handle things once my daughter was born – whether I would be one of those people who would obsessively keep myself under wraps or if I'd be the one who could care less. Turns out, I fall somewhere in the middle. I've nursed her in every room of our house with my parents and in-laws present and I've had lactation consultants manhandle my breasts without so much as a blink, yet I make sure I'm covered up when I nurse in public.
My husband has been surprisingly supportive. Initially, he was concerned that strangers would be overly interested in getting a peek behind the curtain. But now that she's here, he even helps with draping me and getting her latched! I received a million blankets at my baby showers and I grab one of the larger ones to throw over my shoulder whenever it's time to eat.
I've also taken to dressing for easy access. Tank tops and cardigans are my new uniform – if I should ever forget to bring a blanket, my cardigan will do in a pinch. But that's only in public. At home, I don't cover up even though I've gotten proficient at only displaying the bare necessities. When you're nursing every two hours, you tend to only expose the essentials so you don't have to bother with fully undressing and dressing every time the baby cries.
Although I've become quite comfortable nursing in public, I doubt I'll ever be able to go without a blanket or a strategically placed cardigan. It's like overly enthusiastic PDA – past a certain point, you roll your eyes and go, 'we get it, you like each other!' I'll feed my daughter at any time in any place, but I don't need to broadcast it to everyone within leering distance. Besides, that time is for me and my daughter – my husband is the only one who gets into that inner circle!
Now that I'm a mother, my main priority is feeding my daughter. Nothing is more important than that, and I certainly can't be bothered with what a stranger thinks is proper. I'm too preoccupied with getting her latched and making sure she's well positioned and swallowing. All the rest is just details. | tomekkorbak/pile-curse-small | Pile-CC |
......WATCH THIS VIDEO: Catch a Glimpse and See What Your Future Can Be......
Get the facts you need to STOP the EROSION of YOUR FREEDOMS, and the DESTRUCTION of the CONSTITUTION as quickly as possible, with the minimum amount of life interruption.
The RESTORATION of the CONSTITUTION process is very time sensitive, and many visitors of this same website have lost more freedoms, liberties and money (heavy taxation) by waiting too long. Don’t let this happen to you! | tomekkorbak/pile-curse-small | Pile-CC |
Therapeutic adherence in primary care depressed patients: a longitudinal study.
Lack of adherence has been associated to lower efficacy of anti-depressant treatment, increasing the risk of recurrence and persistence of clinical symptoms. Patients with poor medication adherence have more concomitant medical illnesses and somatic symptoms. Furthermore, this increases use of healthcare services. Longitudinal and observational study on therapeutic adherence level in depressive outpatients treated in 3 Primary Care (PC) centers. Eight evaluations during 6 months were carried out in 29 patients over 18, with DSM-IV-TR major depression diagnosis. The purpose of the present study was to determine adherence level, to analyze socio-demographic factors and clinical profiles involved in adherence, and to observe the evolution of depressive symptoms. Good therapeutic adherence was observed in 72.4% of patients. Significant differences in the Drug Attitude Inventory (U=107.5; p=0.036) were found. This tool evaluates the perceived effect of the medication, with a better perception observed in adherent patients. In those patients a progressive reduction on the Hamilton Depression Scale was found over the course of six monthly follow-up visits, with clinical remission observed in month 4. The analysis of survival rate did not reveal any significant difference between the two groups [Log Rank (χ2=1.610, p=0.205)]. The therapeutic adherence observed in this longitudinal PC study is high, and it is associated with an improvement in the illness. A better perceived effect of the treatment showed a significant connection to an improvement in symptoms of depression. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Fecal pellets: role in sedimentation of pelagic diatoms.
Membrane-enclosed fecal pellets of planktonic herbivores were sampled at several depths in the Baltic Sea (459 meters deep) and off Portugal (4000 meters deep) by means of a Simonsen multinet. Pellets contained mainly empty shells of planktonic diatoms and silicoflagellates. Two kinds of fecal pellets were found, those with the remains of one species (for example, Thalassiosira baltica) and those with the remains of several species (for example, Chaetoceros, Achnanthes, and Thalassiosira). Siliceous skeletons were protected from dissolution during settling by a membrane around the pellet. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Image copyright SPL
Taking hormonal drugs for up to 15 years reduces the risk of breast cancers coming back, a landmark study suggests.
The trial, involving 1,918 patients, which had top billing at the world's largest cancer conference, showed the risk was cut by a third.
Experts described it as a "big deal" that will change treatment for millions of women.
But they warned there were risks, including osteoporosis.
Globally, 1.7 million women are diagnosed with breast cancer around the world each year.
Longer dosing
Around 80% of the tumours are fuelled by the female sex hormone, oestrogen.
Such cancers have a low but persistent risk of returning that lasts for years.
It is why women already take drugs such as tamoxifen, to prevent oestrogen getting into breast cells, or aromatase inhibitors, which stop the body making oestrogen, for years after the lump is removed.
The trial, carried out on post-menopausal women, doubled aromatase inhibitor treatment from five to 10 years.
The data, presented to the American Society of Clinical Oncology (ASCO), showed that cancer recurrence was cut by 34%.
But many women on the trial had already taken other hormonal drugs before starting on aromatase inhibitors and benefited from 15 years of treatment.
Image copyright PA Image caption More than 40,000 women are diagnosed with an oestrogen-positive breast cancer in the UK each year
Prof Paul Goss, one of the researchers from Massachusetts General Hospital, said: "[The study] will have an enormous impact, a reduction in recurrences is a very important finding.
"Aromatase inhibitors are now readily available around the world and therefore our results will further improve the outcome of women with breast cancer globally."
At the end of the study, 95% of women were still cancer-free if they had taken the extra medication, compared with 91% without.
The study did not show an improvement in survival rates, as patients had not been followed for long enough, but scientists expect this to come as "night follows day".
The results, which have also been published in the New England Journal of Medicine, have been widely praised as significant.
'Substantial number'
Dr Nick Turner, a breast cancer specialist from the Institute of Cancer Research in London, told the BBC News website: "It is a big deal, it's going to be a change of treatment for a lot women.
"Extended letrozole [an aromatase inhibitor] in years 10-15 has benefit in preventing a new breast cancer diagnosis.
"But this won't be for everyone, many will be low risk and can probably safely stop at five years [of aromatase inhibitors], but then we're talking about a substantial number of women keeping going from five to 10 years [of aromatase inhibitors]."
There were side effects to treatment including loss of libido, hot flushes and vaginal dryness.
The treatment also increased the risk of osteoporosis and bone fractures.
Experts said it should be a decision between doctor and patient whether to continue.
'Compelling'
Dr Harold Burstein, from ASCO and the Dana Farber Cancer Institute, said: "I think you can say fairly that for millions of women around the world these data will support longer durations of anti-oestrogen therapy."
But he said the balance of risks and benefits meant the drugs would likely be targeted at those whose tumours were most likely to come back.
He said: "In general, I would imagine that women who had riskier cancers will look to these data and think they are compelling for continuing on longer durations of treatment out to 10 or 15 years.
"But we're certainly not at the point of saying women should be on these drugs for the rest of their lives."
In the UK, more than 40,000 women are diagnosed with an oestrogen-positive breast cancer each year.
Up to three years of tamoxifen, followed by five years of aromatase inhibitors is a common practice.
Dame Valerie Beral, professor of epidemiology at the University of Oxford, told the BBC: "Women who have had hormone sensitive breast cancer can still continue to have recurrences of the disease five, 10, and even 15 years after the cancer was first diagnosed.
"The new trial adds further evidence to support the view that women with hormone sensitive breast cancer should continue to take hormone blocking drugs for at least 10 years, or as long as is feasible."
Baroness Delyth Morgan, the chief executive at the charity Breast Cancer Now, said: "This is a really important study that could one day have a major impact on how we use anti-hormone breast cancer treatments."
Prof Arnie Purushotham, from Cancer Research UK, said it was an "important" finding but called for more long-term studies.
Follow James on Twitter. | tomekkorbak/pile-curse-small | OpenWebText2 |
I am doing well back in the US but as a 4 year resident of the UAE, I am still interested and feel qualified to comment on the expat life in the UAE. Sometimes I miss mytime there and there were some good things about it.
Ramadan starts in the UAE in a few weeks and I wish all my Muslim friends Ramadan Mubarak.
I will have to admit I will not miss sneaking cigarettes, lunch, water, and other delights behind curtains during daylight during this Holy Time. Ramadan was always inconvenient for us Westerners but we were always thankful we were afforded a "Plan B".
Muslims fasted during the day but at night there was feasting and festivities. One of the most dangerous times to drive during Ramadan was near sunset when thousands of dehydrated and hungry Muslims were hauling ass home at sunset where food and drink awaited. One did not want to get in their way!
82 comments:
I do. I respect the rules as the guest that I was. I have to admit as a Westerner, I did not look forward to the 3 Ramadans I experienced but it did help me to understand the culture I was living in. Specifically the sacrifices and giving to those less fortunate.
Some hardship is needed by all, it makes us better people and helps us to appreciate the good times.
Social Media is an incredible resource for education. Educators can learn, share, connect and more with educators from around the world. They can collaborate and communicate with students, parents, and colleagues. There are many different social media networks, and lots of ways to use them. new social network
Indian And Pakistani Escort Girls In Dubai Companions and Elite Sweetheart Experience Administrations. Regardless of whether The Model Girls are Really at That Level or Recently Advertised That Way, The Fortunate Respectable Who Have This Gigantic Choice of Cute Models. Indian Escort In Dubai
Indian And Pakistani Escort Girls In Dubai Companions and Elite Sweetheart Experience Administrations. Regardless of whether The Model Girls are Really at That Level or Recently Advertised That Way, The Fortunate Respectable Who Have This Gigantic Choice of Cute Models. Indian Escort In Dubai
Indian And Pakistani Escort Girls In Dubai Companions and Elite Sweetheart Experience Administrations. Regardless of whether The Model Girls are Really at That Level or Recently Advertised That Way, The Fortunate Respectable Who Have This Gigantic Choice of Cute Models. Indian Escort In Dubai https://vk.com/dubaiescorts.verifiedhttps://www.scoop.it/t/dubai-escorts-by-anjalimodel9
Dubai is the most smoking goal for remote exchange these and a huge number of individuals come here to test their destiny. What's more, consequently,Indian Escorts in Dubai it ends up plainly fundamental for everybody of them to take rest and appreciate the place called Dubai after their feverish work routines. For this there is one arrangement which we give in Dubai and that is Indian Escorts in Dubai.
We have some selective Indian call young ladies in Dubai who can be your ideal partner in your spare time and can engage you in Indian Escorts in Dubaieach and every way you can consider. Our young ladies originate from good instructed families in India and in this way they are advanced and very much carried on.
Here in Dubai we have some superb escorts in Dubai which are accessible which will help you to make upbeat and fun until the end of time. Our escorts give incall benefit and outcall benefit. These escorts are confirmed escorts.
We are putting forth unique administrations in Dubai and some different urban areas additionally like we offer Indian escorts in Dubai, Pakistani escorts in Dubai, Russian and Turkish escorts, Dubai call young ladies in Dubai-escorts, we give knead benefit likewise our young ladies are extremely capable.
We give you some escorts in Dubai likewise you can call them for outside gathering and invest more energy with you. Our young ladies are inviting in nature they know how to treat their clients and make them glad.
A Independent Dubai escort organization is gives all of you teenagers young ladies that you need. Each escort's are prepared with Body rubs and everything. In the event that you need so call us now at…
Our Dubai Escorts would like to have the capacity to associate with you on a greatness of levels that will invigorate and fulfill us both. There are incalculable courses for us to share our private minutes together.
On the off chance that you are here in Dubai with CALL GIRLS IN DUBAI.call and whatsapp number +971561616995http://dubaiescorts110.com/callgirlsindubai.htmlhttps://www.scoop.it/t/dubai-escorts-by-anjalimodel9https://vk.com/dubaiescorts.verified
Remain with the young lady for a couple of days and quiet down the strained nerves. The clients will love to interface with the escort Indian Escorts in Dubaiyoung lady and engage in sexual relations with them. Venture into the exhibition and have a look at the delightful young ladies working in this exceptional escort benefit.
Subscribe Now: standard
About Me
I was born in the Southeastern U.S. and lived in a typical middle-class family. I found out at an early age that I craved excitement and doing things "outside the lines".
I was a party animal in High School and College and really enjoyed myself, I consider having fun a worthwhile life goal to this day.
I had a short career as a military officer right out of college because I didn't want to start sitting at a desk at such a young age.
What followed that was a series of boring technical jobs and marriage and settling down. Despite my urges for excitement and fun,I can be very responsible when I want to.
I was good with that for several years but the old urge for change became too strong so I got divorced early in 2008 (mutual agreement-no kids). Soon after that I received an offer to work in the Middle East(Abu Dhabi, UAE) I was there for almost 4 years and had many adventures which you can read about on my other blog Abu Dhabi Dispatches at http://expatuae.blogspot.com/
I am back in the US now and am living in Las Vegas. I always had a feeling I would end up here someday. | tomekkorbak/pile-curse-small | Pile-CC |
Proteomics analysis of crude squid ink isolated from Sepia esculenta for their antimicrobial, antibiofilm and cytotoxic properties.
The present study deals with the proteomics analysis of crude squid ink isolated from Sepia esculenta for their antibacterial, antifungal, antibiofilm and cytotoxic properties. To achieve this, SDS-PAGE was used to separate proteins as bands, In-gel trypsin digested and analyzed by MALDI-TOF mass spectrometry. A total of 4 bands were identified by MASCOT search analysis namely astacin-like squid metalloprotease type I (ASMT-I), 70 kDa neurofilament protein (NP), uncharacterized protein LOC106181966 isoform X1 (UP-Iso-X1) and Ommochrome-binding protein (Oc-BP). Further, the obtained crude squid proteins were subjected to antimicrobial and antibiofilm activities against pathogenic bacterial and fungal strains respectively. Further, MTT assay was also carried out to deliberately explain the cytotoxic ability of crude squid ink protein against MCF-7 breast cancer cell lines. The results from the study revealed that, the proteins are shown to be toxic against pathogenic strains and breast cancer cell lines in a dose-dependent manner. More importantly, the proteins are well enough to eradicate biofilms substantiated by light and confocal laser scanning microscopic observations. Altogether, the crude squid ink proteins hampered the growth of breast cancer cells with an IC50 value of 65.3 ± 0.46 μg mL-1. In conclusion, it is believed that the proteins from crude squid ink will provide new insights in hampering bacterial biofilms and cancer in near future. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Late antiquity
Late antiquity is a periodization used by historians to describe the time of transition from classical antiquity to the Middle Ages in mainland Europe, the Mediterranean world, and the Near East. The popularization of this periodization in English has generally been accredited to historian Peter Brown, after the publication of his seminal work The World of Late Antiquity (1971). Precise boundaries for the period are a continuing matter of debate, but Brown proposes a period between the 3rd and 8th centuries AD. Generally, it can be thought of as from the end of the Roman Empire's Crisis of the Third Century (c. 235–284) to, in the East, the early Muslim conquests in the mid-7th century. In the West the end was earlier, with the start of the Early Middle Ages typically placed in the 6th century, or earlier on the edges of the Western Roman Empire.
The Roman Empire underwent considerable social, cultural and organizational changes starting with the reign of Diocletian, who began the custom of splitting the Empire into Eastern and Western halves ruled by multiple emperors. Beginning with Constantine the Great, Christianity was made legal in the Empire, and a new capital was founded at Constantinople. Migrations of Germanic tribes disrupted Roman rule from the late 4th century onwards, culminating in the eventual collapse of the Empire in the West in 476, replaced by the so-called barbarian kingdoms. The resultant cultural fusion of Greco-Roman, Germanic and Christian traditions formed the foundations of the subsequent culture of Europe.
Terminology
The term Spätantike, literally "late antiquity", has been used by German-speaking historians since its popularization by Alois Riegl in the early 20th century. It was given currency in English partly by the writings of Peter Brown, whose survey The World of Late Antiquity (1971) revised the Gibbon view of a stale and ossified Classical culture, in favour of a vibrant time of renewals and beginnings, and whose The Making of Late Antiquity offered a new paradigm of understanding the changes in Western culture of the time in order to confront Sir Richard Southern's The Making of the Middle Ages.
The continuities between the later Roman Empire, as it was reorganized by Diocletian (r. 284–305), and the Early Middle Ages are stressed by writers who wish to emphasize that the seeds of medieval culture were already developing in the Christianized empire, and that they continued to do so in the Eastern Roman Empire or Byzantine Empire at least until the coming of Islam. Concurrently, some migrating Germanic tribes such as the Ostrogoths and Visigoths saw themselves as perpetuating the "Roman" tradition. While the usage "Late Antiquity" suggests that the social and cultural priorities of Classical Antiquity endured throughout Europe into the Middle Ages, the usage of "Early Middle Ages" or "Early Byzantine" emphasizes a break with the classical past, and the term "Migration Period" tends to de-emphasize the disruptions in the former Western Roman Empire caused by the creation of Germanic kingdoms within her borders beginning with the foedus with the Goths in Aquitania in 418.
The general decline of population, technological knowledge and standards of living in Europe during this period became the archetypal example of societal collapse for writers from the Renaissance. As a result of this decline, and the relative scarcity of historical records from Europe in particular, the period from roughly the early fifth century until the Carolingian Renaissance (or later still) was referred to as the "Dark Ages". This term has mostly been abandoned as a name for a historiographical epoch, being replaced by "Late Antiquity"
in the periodization of the late West Roman Empire, the early Byzantine empire and the Early Middle Ages.
Religion
One of the most important transformations in Late Antiquity was the formation and evolution of the Abrahamic religions: Christianity, Rabbinic Judaism and, eventually, Islam.
A milestone in the rise of Christianity was the conversion of Emperor Constantine the Great (r. 306–337) in 312, as claimed by his Christian panegyrist Eusebius of Caesarea, although the sincerity of his conversion is debated. Constantine confirmed the legalization of the religion through the so-called Edict of Milan in 313, jointly issued with his rival in the East, Licinius (r. 308–324). By the late 4th century, Emperor Theodosius the Great had made Christianity the State religion, thereby transforming the Classical Roman world, which Peter Brown characterized as "rustling with the presence of many divine spirits."
Constantine I was a key figure in many important events in Christian history, as he convened and attended the first ecumenical council of bishops at Nicaea in 325, subsidized the building of churches and sanctuaries such as the Church of the Holy Sepulchre in Jerusalem, and involved himself in questions such as the timing of Christ's resurrection and its relation to the Passover.
The birth of Christian monasticism in the deserts of Egypt in the 3rd century, which initially operated outside the episcopal authority of the Church, would become so successful that by the 8th century it penetrated the Church and became the primary Christian practice. Monasticism was not the only new Christian movement to appear in late antiquity, although it had perhaps the greatest influence. Other movements notable for their unconventional practices include the Grazers, holy men who ate only grass and chained themselves up; the Holy Fool movement, in which acting like a fool was considered more divine than folly; and the Stylites movement, where one practitioner lived atop a 50-foot pole for 40 years.
Late Antiquity marks the decline of Roman state religion, circumscribed in degrees by edicts likely inspired by Christian advisors such as Eusebius to 4th century emperors, and a period of dynamic religious experimentation and spirituality with many syncretic sects, some formed centuries earlier, such as Gnosticism or Neoplatonism and the Chaldaean oracles, some novel, such as hermeticism. Culminating in the reforms advocated by Apollonius of Tyana being adopted by Aurelian and formulised by Flavius Claudius Julianus to create an organised but short-lived pagan state religion that ensured its underground survival into the Byzantine age and beyond.
Many of the new religions relied on the emergence of the parchment codex (bound book) over the papyrus volumen (scroll), the former allowing for quicker access to key materials and easier portability than the fragile scroll, thus fueling the rise of synoptic exegesis, papyrology. Notable in this regard is the topic of the Fifty Bibles of Constantine.
Laity vs clergy
Within the recently legitimized Christian community of the 4th century, a division could be more distinctly seen between the laity and an increasingly celibate male leadership. These men presented themselves as removed from the traditional Roman motivations of public and private life marked by pride, ambition and kinship solidarity, and differing from the married pagan leadership. Unlike later strictures on priestly celibacy, celibacy in Late Antique Christianity sometimes took the form of abstinence from sexual relations after marriage, and it came to be the expected norm for urban clergy. Celibate and detached, the upper clergy became an elite equal in prestige to urban notables, the potentes or dynatoi (Brown (1987) p. 270).
The rise of Islam
Islam appeared in the 7th century, spurring Arab armies to invade the Eastern Roman Empire and the Sassanian Empire of Persia, destroying the latter. After conquering all of North Africa and Visigothic Spain, the Islamic invasion was halted by Charles Martel at the Battle of Tours in modern France.
On the rise of Islam, two main theses prevail. On the one hand, there is the traditional view, as espoused by most historians prior to the second half of the twentieth century and by Muslim scholars. This view, the so-called "out of Arabia"-thesis, holds that Islam as a phenomenon was a new, alien element in the late antique world. Related to this is the Pirenne Thesis, according to which the Arab invasions marked—through conquest and the disruption of Mediterranean trade routes—the cataclysmic end of Late Antiquity and the beginning of the Middle Ages.
On the other hand, there is the modern view, associated with scholars in the tradition of Peter Brown, in which Islam is seen to be a product of the Late Antique world, not foreign to it. This school suggests that its origin within the shared cultural horizon of the late antique world explains the character of Islam and its development. Such historians point to similarities with other late antique religions and philosophies—especially Christianity—in the prominent role and manifestations of piety in Islam, in Islamic asceticism and the role of "holy persons", in the pattern of universalist, homogeneous monotheism tied to worldly and military power, in early Islamic engagement with Greek schools of thought, in the apocalypticism of Islamic theology and in the way the Quran seems to react to contemporary religious and cultural issues shared by the late antique world at large. Further indication that Arabia (and thus the environment in which Islam first developed) was a part of the late antique world is found in the close economic and military relations between Arabia, the Byzantine Empire and the Sassanian Empire.
Political transformations
The Late Antique period also saw a wholesale transformation of the political and social basis of life in and around the Roman Empire.
The Roman citizen elite in the 2nd and 3rd centuries, under the pressure of taxation and the ruinous cost of presenting spectacular public entertainments in the traditional cursus honorum, had found under the Antonines that security could only be obtained by combining their established roles in the local town with new ones as servants and representatives of a distant Emperor and his traveling court. After Constantine centralized the government in his new capital of Constantinople (dedicated in 330), the Late Antique upper classes were divided among those who had access to the far-away centralized administration (in concert with the great landowners), and those who did not—though they were well-born and thoroughly educated, a classical education and the election by the Senate to magistracies was no longer the path to success. Room at the top of Late Antique society was more bureaucratic and involved increasingly intricate channels of access to the emperor: the plain toga that had identified all members of the Republican senatorial class was replaced with the silk court vestments and jewelry associated with Byzantine imperial iconography. Also indicative of the times is the fact that the imperial cabinet of advisors came to be known as the consistorium, or those who would stand in courtly attendance upon their seated emperor, as distinct from the informal set of friends and advisors surrounding the Augustus.
Cities
The later Roman Empire was in a sense a network of cities. Archaeology now supplements literary sources to document the transformation followed by collapse of cities in the Mediterranean basin. Two diagnostic symptoms of decline—or as many historians prefer, 'transformation'—are subdivision, particularly of expansive formal spaces in both the domus and the public basilica, and encroachment, in which artisanal shops invade the public thoroughfare, a transformation that was to result in the souk (marketplace). Burials within the urban precincts mark another stage in dissolution of traditional urbanistic discipline, overpowered by the attraction of saintly shrines and relics. In Roman Britain, the typical 4th- and 5th-century layer of dark earth within cities seems to be a result of increased gardening in formerly urban spaces.
The city of Rome went from a population of 800,000 in the beginning of the period to a population of 30,000 by the end of the period, the most precipitous drop coming with the breaking of the aqueducts during the Gothic War. A similar though less marked decline in urban population occurred later in Constantinople, which was gaining population until the outbreak of plague in 541. In Europe there was also a general decline in urban populations. As a whole, the period of late antiquity was accompanied by an overall population decline in almost all Europe, and a reversion to more of a subsistence economy. Long-distance markets disappeared, and there was a reversion to a greater degree of local production and consumption, rather than webs of commerce and specialized production.
Concurrently, the continuity of the Eastern Roman Empire at Constantinople meant that the turning-point for the Greek East came later, in the 7th century, as the Eastern Roman, or Byzantine Empire centered around the Balkans, North Africa (Egypt and Carthage), and Asia Minor. The degree and extent of discontinuity in the smaller cities of the Greek East is a moot subject among historians. The urban continuity of Constantinople is the outstanding example of the Mediterranean world; of the two great cities of lesser rank, Antioch was devastated by the Persian sack of 540, followed by the plague of Justinian (542 onwards) and completed by earthquake, while Alexandria survived its Islamic transformation, to suffer incremental decline in favour of Cairo in the medieval period.
Justinian rebuilt his birthplace in Illyricum, as Justiniana Prima, more in a gesture of imperium than out of an urbanistic necessity; another "city", was reputed to have been founded, according to Procopius' panegyric on Justinian's buildings, precisely at the spot where the general Belisarius touched shore in North Africa: the miraculous spring that gushed forth to give them water and the rural population that straightway abandoned their ploughshares for civilised life within the new walls, lend a certain taste of unreality to the project.
In mainland Greece, the inhabitants of Sparta, Argos and Corinth abandoned their cities for fortified sites in nearby high places; the fortified heights of Acrocorinth are typical of Byzantine urban sites in Greece. In Italy, populations that had clustered within reach of Roman roads began to withdraw from them, as potential avenues of intrusion, and to rebuild in typically constricted fashion round an isolated fortified promontory, or rocca; Cameron notes similar movement of populations in the Balkans, 'where inhabited centres contracted and regrouped around a defensible acropolis, or were abandoned in favour of such positions elsewhere."
In the western Mediterranean, the only new cities known to be founded in Europe between the 5th and 8th centuries were the four or five Visigothic "victory cities". Reccopolis in the province of Guadalajara is one: the others were Victoriacum, founded by Leovigild, which may survive as the city of Vitoria, though a 12th-century (re)foundation for this city is given in contemporary sources; Lugo id est Luceo in the Asturias, referred to by Isidore of Seville, and Ologicus (perhaps Ologitis), founded using Basque labour in 621 by Suinthila as a fortification against the Basques, modern Olite. All of these cities were founded for military purposes and at least Reccopolis, Victoriacum, and Ologicus in celebration of victory. A possible fifth Visigothic foundation is Baiyara (perhaps modern Montoro), mentioned as founded by Reccared in the 15th-century geographical account, Kitab al-Rawd al-Mitar. The arrival of a highly urbanized Islamic culture in the decade following 711 ensured the survival of cities in the Hispaniae into the Middle Ages.
Beyond the Mediterranean world, the cities of Gaul withdrew within a constricted line of defense around a citadel. Former imperial capitals such as Cologne and Trier lived on in diminished form as administrative centres of the Franks. In Britain, where the break with Late Antiquity comes earliest in the 5th and the 6th century, most towns cities had been in rapid decline during the 4th century during a time of prosperity until the very last decades of the century, well before the withdrawal of Roman governors and garrisons; historians emphasizing urban continuities with the Anglo-Saxon period depend largely on the post-Roman survival of Roman toponymy. Aside from a mere handful of its continuously inhabited sites, like York and London and possibly Canterbury, however, the rapidity and thoroughness with which its urban life collapsed with the dissolution of centralized bureaucracy calls into question the extent to which Roman Britain had ever become authentically urbanized: "in Roman Britain towns appeared a shade exotic," observes H. R. Loyn, "owing their reason for being more to the military and administrative needs of Rome than to any economic virtue". The other institutional power centre, the Roman villa, did not survive in Britain either. Gildas lamented the destruction of the twenty-eight cities of Britain; though not all in his list can be identified with known Roman sites, Loyn finds no reason to doubt the essential truth of his statement.
Classical Antiquity can generally be defined as an age of cities; the Greek polis and Roman municipium were locally organised, self-governing bodies of citizens governed by written constitutions. When Rome came to dominate the known world, local initiative and control were gradually subsumed by the ever-growing Imperial bureaucracy; by the Crisis of the Third Century the military, political and economic demands made by the Empire had crushed the civic spirit, and service in local government came to be an onerous duty, often imposed as punishment. Harassed urban dwellers fled to the walled estates of the wealthy to avoid taxes, military service, famine and disease. In the Western Roman Empire especially, many cities destroyed by invasion or civil war in the 3rd century could not be rebuilt. Plague and famine hit the urban class in greater proportion, and thus the people who knew how to keep civic services running. Perhaps the greatest blow came in the wake of the extreme weather events of 535–536 and subsequent Plague of Justinian, when the remaining trade networks ensured the Plague spread to the remaining commercial cities. The impact of this outbreak of plague has recently been disputed. The end of Classical Antiquity is the end of the Polis model, and the general decline of cities is a defining feature of Late Antiquity.
Public building
In the cities the strained economies of Roman over-expansion arrested growth. Almost all new public building in Late Antiquity came directly or indirectly from the emperors or imperial officials. Attempts were made to maintain what was already there. The supply of free grain and oil to 20% of the population of Rome remained intact the last decades of the 5th century. It was once thought that the elite and rich had withdrawn to the private luxuries of their numerous villas and town houses. Scholarly opinion has revised this. They monopolized the higher offices in the imperial administration, but they were removed from military command by the late 3rd century. Their focus turned to preserving their vast wealth rather than fighting for it.
The basilica, which had functioned as a law court or for imperial reception of foreign dignitaries, became the primary public building in the 4th century. Due to the stress on civic finances, cities spent money on walls, maintaining baths and markets at the expense of amphitheaters, temples, libraries, porticoes, gymnasia, concert and lecture halls, theaters and other amenities of public life. In any case as Christianity took over many of these building which were associated with pagan cults were neglected in favor of building churches and donating to the poor. The Christian basilica was copied from the civic structure with variations. The bishop took the chair in the apse reserved in secular structures for the magistrate—or the Emperor himself—as the representative here and now of Christ Pantocrator, the Ruler of All, his characteristic Late Antique icon. These ecclesiastical basilicas (e.g., St. John Lateran and St. Peter's in Rome) were themselves outdone by Justinian's Hagia Sophia, a staggering display of later Roman/Byzantine power and architectural taste, though the building is not architecturally a basilica. In the former Western Roman Empire almost no great buildings were constructed from the 5th century. A most outstanding example is the Church of San Vitaly in Ravenna constructed circa 530 at a cost of 26,000 gold solidi or 360 Roman pounds of gold.
City life in the East, though negatively affected by the plague in the 6th–7th centuries, finally collapsed due to Slavic invasions in the Balkans and
Persian destructions in Anatolia in the 620s. City life continued in Syria, Jordan and Palestine into the 8th. In the later 6th century street construction was still undertaken in Caesarea Maritima in Palestine, and Edessa was able to deflect Chosroes I with massive payments in gold in 540 and 544, before it was overrun in 609.
Sculpture and art
As a complicated period bridging between Roman art and medieval art and Byzantine art, the Late Antique period saw a transition from the classical idealized realism tradition largely influenced by Ancient Greek art to the more iconic, stylized art of the Middle Ages. Unlike classical art, Late Antique art does not emphasize the beauty and movement of the body, but rather, hints at the spiritual reality behind its subjects. Additionally, mirroring the rise of Christianity and the collapse of the western Roman Empire, painting and freestanding sculpture gradually fell from favor in the artistic community. Replacing them were greater interests in mosaics, architecture, and relief sculpture.
As the soldier emperors such as Maximinus Thrax (r. 235–238) emerged from the provinces in the 3rd century, they brought with them their own regional influences and artistic tastes. For example, artists jettisoned the classical portrayal of the human body for one that was more rigid and frontal. This is markedly evident in the combined porphyry Portrait of the Four Tetrarchs in Venice. With these stubby figures clutching each other and their swords, all individualism, naturalism, the verism or hyperrealism of Roman portraiture, and Greek idealism diminish. The Arch of Constantine in Rome, which re-used earlier classicising reliefs together with ones in the new style, shows the contrast especially clearly. In nearly all artistic media, simpler shapes were adopted and once natural designs were abstracted. Additionally hierarchy of scale overtook the preeminence of perspective and other classical models for representing spatial organization.
From around 300 Early Christian art began to create new public forms, which now included sculpture, previously distrusted by Christians as it was so important in pagan worship. Sarcophagi carved in relief had already become highly elaborate, and Christian versions adopted new styles, showing a series of different tightly packed scenes rather than one overall image (usually derived from Greek history painting) as was the norm. Soon the scenes were split into two registers, as in the Dogmatic Sarcophagus or the Sarcophagus of Junius Bassus (the last of these exemplifying a partial revival of classicism).
Nearly all of these more abstracted conventions could be observed in the glittering mosaics of the era, which during this period moved from being decoration derivative from painting used on floors (and walls likely to become wet) to a major vehicle of religious art in churches. The glazed surfaces of the tesserae sparkled in the light and illuminated the basilica churches. Unlike their fresco predecessors, much more emphasis was placed on demonstrating a symbolic fact rather than on rendering a realistic scene. As time progressed during the Late Antique period, art become more concerned with biblical themes and influenced by interactions of Christianity with the Roman state. Within this Christian subcategory of Roman art, dramatic changes were also taking place in the Depiction of Jesus. Jesus Christ had been more commonly depicted as an itinerant philosopher, teacher or as the "Good Shepherd," resembling the traditional iconography of Hermes. He was increasingly given Roman elite status, and shrouded in purple robes like the emperors with orb and scepter in hand.
As for luxury arts, manuscript illumination on vellum and parchment emerged from the 5th century, with a few manuscripts of Roman literary classics like the Vergilius Vaticanus and the Vergilius Romanus, but increasingly Christian texts, of which Quedlinburg Itala fragment (420–430) is the oldest survivor. Carved ivory diptychs were used for secular subjects, as in the imperial and consular diptychs presented to friends, as well as religious ones, both Christian and pagan – they seem to have been especially a vehicle for the last group of powerful pagans to resist Christianity, as in the late 4th century Symmachi–Nicomachi diptych. Extravagant hoards of silver plate are especially common from the 4th century, including the Mildenhall Treasure, Esquiline Treasure, Hoxne Hoard, and the imperial Missorium of Theodosius I.
Literature
In the field of literature, Late Antiquity is known for the declining use of classical Greek and Latin, and the rise of literary cultures in Syriac, Armenian, Georgian, Ethiopic, Arabic, and Coptic. It also marks a shift in literary style, with a preference for encyclopedic works in a dense and allusive style, consisting of summaries of earlier works (anthologies, epitomes) often dressed up in elaborate allegorical garb (e.g., De nuptiis Mercurii et Philologiae [The Marriage of Mercury and Philology] of Martianus Capella and the De arithmetica, De musica, and De consolatione philosophiae of Boethius—both later key works in medieval education). The 4th and 5th centuries also saw an explosion of Christian literature, of which Greek writers such as Eusebius of Caesarea, Basil of Caesarea, Gregory of Nazianzus and John Chrysostom and Latin writers such as Ambrose of Milan, Jerome and Augustine of Hippo are only among the most renowned representatives. On the other hand, authors such as Ammianus Marcellinus (4th century) and Procopius of Caesarea (6th century) were able to keep the tradition of classical historiography alive.
Poetry
Greek poets of the Late Antique period included Antoninus Liberalis, Quintus Smyrnaeus, Nonnus, Romanus the Melodist and Paul the Silentiary.
Latin poets included Ausonius, Paulinus of Nola, Claudian, Rutilius Namatianus, Orientius, Sidonius Apollinaris, Corippus and Arator.
Jewish poets included Yannai, Eleazar ben Killir and Yose ben Yose.
Timeline
285: Emperor Diocletian splits the Roman Empire into Eastern and Western Empires
313: Edict of Milan legalized Christianity throughout the Roman Empire, and thus ended the previous state-sanctioned persecution of Christians there
376: The Thervingi under Fritigern, fleeing the Hunnic Invasion, are allowed to cross the Danube into Moesia
378: At the Battle of Adrianople, Eastern Roman Emperor Valens is defeated by Gothic rebels.
382: Influenced by Saint Ambrose, Roman Emperor Gratian persecutes paganism, removing the Altar of Victory.
395: Roman Emperor Theodosius I outlaws all pagan religions in favour of Christianity
405: The Vulgate Bible is completed, mostly by the theologian Jerome. The Vulgate will be the only European bible widely used until the Reformation.
406: The Crossing of the Rhine by a confederacy of Germanic tribes marks a turning point in the Migration Period.
410: Alaric I sacks Rome for the first time since 390 BC. Final Roman departure from Britain.
413: Theodosian Walls around Constantinople are completed, as the largest system of fortifications in Europe. Constantinople as a result will not be conquered by a siege until 1204.
415: Hypatia of Alexandra, pagan female mathematician is murdered by a Christian mob. The murder of an academic was unusual, and sent shock waves through the Roman Empire.
432: Saint Patrick begins his conversion of Ireland to Christianity, Ireland becomes the first European nation outside of Roman territory to be converted. Celtic Christianity, otherwise known as insular Christianity begins to set traditions and customs unique to speakers of Celtic languages, while still venerating the Pope.
451: Battle of the Catalaunian Plains, the Hunnic Confederation and an alliance of Western Romans and Visigoths fight to a draw. Attila the Hun dies in 453.
476: Romulus Augustus, last Western Roman Emperor is forced to abdicate by Odoacer, a half Hunnish and half Scirian chieftain of the Germanic Heruli; Odoacer returns the imperial regalia to Eastern Roman Emperor Zeno in Constantinople in return for the title of dux of Italy; this marks the end of the Western Roman Empire and is often taken as marking the end of Classical Antiquity.
486: In the Battle of Soissons, Clovis I defeats the Roman rump state of Soissons, establishing Merovingian Francia.
529: The Eastern Roman Emperor Justinian I ordered the prominent philosophical schools of antiquity throughout the Eastern Roman Empire (including the famous Academy in Athens, among others) to close down—allegedly, because Justinian frowned upon the pagan nature of these schools
534: The Corpus Juris Civilis, otherwise known as the Code of Justinian is completed. The new law code will influence Medieval European Law and the Napoleonic Code.
537: The Hagia Sophia the largest Christian building ever created is built in Constantinople, becoming a center of Byzantine society for the next millennium,
542: Plague of Justinian, a plague strikes Constantinople, and the rest of Europe, possibly killing half of Europe's population.
602: The beginning of the final Byzantine-Sassanian War, lasting until 628. War encompasses entire Near East, exhausting both combatants.
634: The Battle of al-Qaryatayn marks the beginning of the Arab conquest of Syria.
See also
Byzantine Empire
Peter Brown
Fall of the Western Roman Empire
Early Middle Ages
Migration Period
Roman–Persian Wars
Notes
References
Perry Anderson, Passages from Antiquity to Feudalism, NLB, London, 1974.
Peter Brown, The World of Late Antiquity: from Marcus Aurelius to Muhammad (AD 150–750), Thames and Hudson, 1989,
Peter Brown, Authority and the Sacred : Aspects of the Christianisation of the Roman World, Routledge, 1997,
Peter Brown, The Rise of Western Christendom: Triumph and Diversity 200–1000 AD, Blackwell, 2003,
Henning Börm, Westrom. Von Honorius bis Justinian, 2nd ed., Kohlhammer Verlag, 2018, . (Review in English).
Averil Cameron, The Later Roman Empire: AD 284–430, Harvard University Press, 1993,
Averil Cameron, The Mediterranean World in Late Antiquity AD 395–700, Routledge, 2011,
Averil Cameron et al. (editors), The Cambridge Ancient History, vols. 12–14, Cambridge University Press 1997ff.
Gilian Clark, Late Antiquity: A Very Short Introduction, Oxford University Press, 2011,
John Curran, Pagan City and Christian Capital: Rome in the Fourth Century, Clarendon Press, 2000.
Alexander Demandt, Die Spätantike, 2nd ed., Beck, 2007
Peter Dinzelbacher and Werner Heinz, Europa in der Spätantike, Primus, 2007.
Fabio Gasti, Profilo storico della letteratura tardolatina, Pavia University Press, 2013, .
Tomas Hägg (ed.) "SO Debate: The World of Late Antiquity revisited," in Symbolae Osloenses (72), 1997.
Scott F. Johnson ed., The Oxford Handbook of Late Antiquity, Oxford University Press, 2012,
Arnold H.M. Jones, The Later Roman Empire, 284–602; a social, economic and administrative survey, vols. I, II, University of Oklahoma Press, 1964.
Bertrand Lançon, Rome in Late Antiquity: AD 313–604, Routledge, 2001.
Noel Lenski (ed.), The Cambridge Companion to the Age of Constantine, Cambridge University Press, 2006.
Samuel N.C. Lieu and Dominic Montserrat (eds.), From Constantine to Julian: Pagan and Byzantine Views, A Source History, Routledge, 1996.
Michael Maas (ed.), The Cambridge Companion to the Age of Justinian, Cambridge University Press, 2005.
Michael Maas (ed.), The Cambridge Companion to the Age of Attila, Cambridge University Press, 2015.
Robert Markus, The end of Ancient Christianity, Cambridge University Press, 1990.
Ramsay MacMullen, Christianizing the Roman Empire A.D. 100–400, Yale University Press, 1984.
Stephen Mitchell, A History of the Later Roman Empire. AD 284–641, 2nd ed., Blackwell, 2015.
Michael Rostovtzeff (rev. P. Fraser), The Social and Economic History of the Roman Empire, Oxford University Press, 1979.
Johannes Wienand (ed.), Contested Monarchy. Integrating the Roman Empire in the Fourth Century AD, Oxford University Press, 2015.
External links
New Advent – The Fathers of the Church, a Catholic website with English translations of the Early Fathers of the Church.
ORB Encyclopedia's section on Late Antiquity in the Mediterranean from ORB
Overview of Late Antiquity, from ORB
Princeton/Stanford Working Papers in Classics, a collaborative forum of Princeton and Stanford to make the latest scholarship on the field available in advance of final publication.
The End of the Classical World, source documents from the Internet Medieval Sourcebook
Worlds of Late Antiquity, from the University of Pennsylvania
Age of spirituality : late antique and early Christian art, third to seventh century from The Metropolitan Museum of Art
Category:History of Asia by period
Category:History of Europe by period
Category:History of the Mediterranean
Category:History of Western Asia
Category:Near East
Category:4th century
Category:5th century
Category:6th century in Asia
Category:6th century in Europe
Category:7th century in Asia
Category:7th century in Europe
Category:Historical eras | tomekkorbak/pile-curse-small | Wikipedia (en) |
321 F.3d 1084
UNITED STATES of America, Plaintiff-Appellee,v.Karl P. ZINN, Defendant-Appellant.
No. 02-10782.
United States Court of Appeals, Eleventh Circuit.
February 14, 2003.
Fritz J. Schelleer, R. Fletcher Peacock, Federal Public Defender, Orlando, FL, for Defendant-Appellant.
Peggy Morris Ronca, Jacksonville, FL, Tamra Phipps, Tampa, FL, Roberta Josephina Tylke, Asst. U.S. Atty., Orlando, FL, for Plaintiff-Appellee.
Appeal from the United States District Court for the Middle District of Florida.
Before TJOFLAT and BLACK, Circuit Judges, and GOLDBERG*, Judge.
BLACK, Circuit Judge:
1
Appellant Karl P. Zinn pled guilty to possessing child pornography and was sentenced to imprisonment to be followed by a period of supervised release. The supervised release included a number of special conditions, four of which Appellant challenges on appeal. Finding no reversible error, we affirm Appellant's sentence in its entirety.
I. BACKGROUND
2
On May 13, 2002, Appellant pled guilty1 to a one-count indictment charging him with possessing materials containing images of child pornography that had been mailed, shipped or transported in interstate commerce, in violation of 18 U.S.C. § 2252A(a)(5)(B). According to the presentence investigation report (PSR), to which Appellant raised no objections and the district court adopted as its findings of fact, on March 15, 2001, Appellant contacted an undercover United States Customs Service web site and expressed an interest in purchasing two pornographic videotapes depicting girls between the ages of 6 and 13 years old. He subsequently received an order form, which he completed and mailed to the web site operators along with a check for $85. On April 3, 2001, two child pornographic video tapes arrived at Appellant's home as part of a controlled delivery. Hours later, Customs agents executed a search warrant of the home and recovered compact discs and computer diskettes containing in excess of 4,000 images of child pornography. During his plea hearing, Appellant admitted to the district court that he had "received child pornography over the internet."
3
The PSR noted Appellant admitted being suicidal and had voluntarily begun mental health counseling shortly after his arrest. His attorney also told the district court during sentencing that Appellant suffered from "profound psychological problems" and requested that Appellant be placed in a federal medical facility where he could receive appropriate treatment. The district court sentenced Appellant to a term of 33 months' imprisonment, with a recommendation that he be committed to a medical facility. The court also sentenced Appellant to a term of three years' supervised release, which included the following special conditions:
4
[1] You shall participate as directed in a program of mental health treatment including a sexual offender treatment program approved by the probation officer. You shall abide by the rules, requirements and conditions of the treatment program, including submitting to polygraph testing, at your own expense, to aid in the treatment and supervision process. The results of the polygraph examination may not be used as evidence in court to prove that a violation of community supervision has occurred, but may be considered in a hearing to modify release conditions.
5
Further, you shall be required to contribute to the costs of services for such treatment in an amount determined reasonable by the probation officer based upon ability to pay or availability of third-party payment and in conformance with the Probation Office's sliding scale for mental health treatment services. [2] You shall register with the State Sexual Offender Registration Agency [in] any State where you reside, visit, or are employed, carry on a vocation or are a student as directed by your probation officer. The probation officer will provide State officials with all information required under Florida Sexual Predators and Sexual Offender Notification and Registration Statutes and [may] direct you to report to these agencies personally for required additional processing such as photographic, fingerprinting and DNA collection.
6
[3] You shall have no direct contact with minors under the age of 18 without the written approval of the probation officer and shall refrain from entering into any area where children frequently congregate including schools, day care centers, theme parks, playgrounds, et cetera.... [4] You shall not possess or use a computer with access to any on-line service at any location, including employment, without written approval from the probation officer. This includes access through any Internet service provider, bulletin board system, or any public or private computer network system....2
7
After the district court imposed sentence, Appellant's counsel objected to the special conditions of supervised release:
8
And I would also like to state for the record my objections to the supervised release conditions that this Court has imposed. I think, well, I object in particular to the polygraph examination. I think that's not a proper condition of his supervised release. I think that, I strongly object to that condition Your Honor.
9
I also object to the restrictions as to the internet access. I think there's some First Amendment concerns there. I also object, I will say for the record I object to many of the restrictions this Court has put on his supervised release. I think it's unduly harsh. I think it also violates his Constitutional rights. The First and Eighth Amendments and I think that, I understand the Court's concern in these type of cases, but I think, I think the Court has been unduly harsh with Mr. Zinn. I think the supervised release constitutes an excessive punishment.
10
The district court overruled the objections. Appellant then filed a timely notice of appeal.
II. STANDARD OF REVIEW
11
This Court ordinarily reviews the district court's sentence of supervised release for abuse of discretion. See United States v. Bull, 214 F.3d 1275, 1278 (11th Cir.2000). Where a defendant fails to clearly state the grounds for an objection in the district court, however, he waives the objection on appeal and we are limited to reviewing for plain error. United States v. Delgado, 903 F.2d 1495, 1504 (11th Cir.1990); United States v. Jones, 899 F.2d 1097, 1103 (11th Cir.1990), overruled on other grounds, United States v. Morrill, 984 F.2d 1136 (11th Cir.1993); see also United States v. Riggs, 967 F.2d 561, 565 (11th Cir.1992) (noting that a defendant who fails to articulate a "clear objection" to a supervised release condition waives the objection on appeal). To find reversible error under the plain error standard, we must conclude that (1) an error occurred, (2) the error was plain, and (3) the error affected substantial rights. United States v. Richardson, 304 F.3d 1061, 1064 (11th Cir.2002).
12
Regarding the degree of clarity needed to preserve an objection for appeal, we have stated that:
13
Whenever a litigant has a meritorious proposition of law which he is seriously pressing upon the attention of the trial court, he should raise that point in such clear and simple language that the trial court may not misunderstand it, and if his point is so obscurely hinted at that the trial court quite excusably may fail to grasp it, it will avail naught to disturb the judgment on appeal.
14
Riggs, 967 F.2d at 564 (quoting United States v. Reyes-Vasquez, 905 F.2d 1497, 1500 (11th Cir.1990)). Thus, if a defendant fails to clearly articulate a specific objection during sentencing, the objection is waived on appeal and we confine our review to plain error.
III. DISCUSSION
15
On appeal, Appellant challenges the special conditions of supervised release: (1) requiring him to register as a sexual offender; (2) prohibiting him from entering places where children frequent; (3) requiring him to submit to polygraph testing; and (4) prohibiting him from using the Internet. As to the first two, we conclude the district court did not err and affirm without further discussion.3 We write, however, to address the remaining two special conditions.
A. Polygraph Testing
16
Appellant asserts the special condition requiring him to submit to polygraph testing: (1) is not reasonably related to the history and facts of this case, (2) improperly delegates judicial authority to the probation officer, (3) violates his Fifth Amendment privilege against self-incrimination, and (4) improperly requires him to pay for polygraph testing despite his inability to do so.
17
We will address each of these arguments seriatim. Before turning to the merits, however, we first consider the Government's contention that Appellant's challenge to the polygraph testing is generally not ripe for our review because supervised release has not yet begun.
18
1. Ripeness.
19
Federal courts are constrained under Article III to deciding only actual cases or controversies. U.S. CONST. art. III, § 2. As part of the case or controversy requirement, a party must come into immediate danger of suffering injury before a court may consider his claim. Kirby v. Siegelman, 195 F.3d 1285, 1289 (11th Cir.1999). Ripeness "prevent[s] the courts, through the avoidance of premature adjudication, from entangling themselves in abstract disagreements." Id. (quoting Abbott Laboratories v. Gardner, 387 U.S. 136, 148, 87 S.Ct. 1507, 1515, 18 L.Ed.2d 681 (1967)). An injury need not have already occurred, however, for a controversy to be ripe. Rather, we have found claims on appeal ripe where they assert an imminent threat of future injury. Ecee Inc. v. Fed. Energy Regulatory Comm'n, 611 F.2d 554, 557 n. 7 (5th Cir. 1980).4
20
Contrary to the Government's assertions, Appellant's challenge to the polygraph exam is neither premature nor speculative. The district court's sentence, of which the conditions of supervised release are a part, is a final judgment immediately appealable to this Court. See 18 U.S.C. § 3742(a). Moreover, though he is presently incarcerated, it seems apparent that Appellant will be subject to the challenged condition upon his release from prison.5 See United States v. Davis, 242 F.3d 49, 51 (1st Cir.2001) (finding challenge to condition of supervised release was "not hypothetical" where supervised release was to begin immediately following prison sentence). By determining a challenge to the polygraph testing requirement to be generally ripe, however, we do not imply that all specific challenges to the implementation of this condition are necessarily ripe. In fact, as explained below, the reverse is true in this case.
21
2. Polygraph Testing Generally.
22
Turning to Appellant's challenge to the polygraph testing, we first consider his assertion on appeal that polygraph testing in general is not reasonably related to the sentencing factors set forth in 18 U.S.C. § 3553(a). Counsel's statement during sentencing that polygraph testing is "not a proper condition" of supervised release, though perhaps imprecise, adequately conveyed the nature of his objection so as to preserve it for appeal. Therefore, we review the objection for abuse of discretion. See Bull, 214 F.3d at 1278.
23
18 U.S.C. § 3553 directs the sentencing court to consider:
24
(1) the nature and circumstances of the offense and the history and characteristics of the defendant; [and]
25
(2) the need for the sentence imposed —
26
(A) to reflect the seriousness of the offense, to promote respect for the law, and to provide just punishment for the offense;
27
(B) to afford adequate deterrence to criminal conduct;
28
(C) to protect the public from further crimes of the defendant; and
29
(D) to provide the defendant with needed educational or vocational training, medical care, or other correctional treatment in the most effective manner.
30
18 U.S.C. § 3553(a). The court should "impose a sentence sufficient, but not greater than necessary" to achieve the statutory purposes. Id.
31
The United States Code further states that the district court may impose any condition of supervised release it deems appropriate so long as it comports with the factors enumerated in § 3553(a). 18 U.S.C. § 3583(d). Similarly, the federal Sentencing Guidelines permit the sentencing court to impose any conditions of supervised release that are "reasonably related" to the § 3553(a) factors, so long as the conditions "involve no greater deprivation of liberty than is reasonably necessary for the purposes set forth [in § 3553(a)] and are consistent with any pertinent policy statements issued by the Sentencing Commission." U.S.S.G. § 5D1.3(b).
32
We have observed it is not necessary for a special condition to be supported by each factor enumerated in § 3553(a). Rather, each is an independent consideration to be weighed. Bull, 214 F.3d at 1278. Moreover, while the Sentencing Guidelines recognize that a condition of supervised release should not unduly restrict a defendant's liberty, a condition is not invalid simply because it affects a probationer's ability to exercise constitutionally protected rights. See Owens v. Kelley, 681 F.2d 1362, 1366 (11th Cir.1982).
33
Appellant admitted having severe psychological problems, including an affinity for child pornography. At the time of his arrest, he was in possession of thousands of pornographic images depicting children as young as six years old. The district court found it necessary to impose a sentence near the high end of the Guidelines for Appellant's own safety and rehabilitation "and the safety of the public." In light of Appellant's crime and personal history, we agree with the district court that he poses a danger to himself and others and is likely to require further rehabilitation upon his release from prison. Under the circumstances, we conclude polygraph testing to ensure compliance with probationary terms is both reasonably related to Appellant's offense and personal history, and when reasonably applied will not unduly burden his rights. Therefore, it was not an abuse of discretion for the district court to generally require Appellant's submission to polygraph testing. See also United States v. Music, 49 Fed.Appx. 393 (4th Cir.2002) (holding district court did not abuse its discretion in ordering polygraph testing on supervised release for defendant convicted of possessing child pornography).
34
3. Implementation of Polygraph Testing.
35
Appellant's remaining arguments6 regarding the condition requiring submission to polygraph testing can be fairly characterized as challenging the potential abuses in its implementation. Contrary to Appellant's assertions, he has not preserved these arguments for appeal and we are therefore limited to reviewing them for plain error.7
36
Appellant first asserts polygraph testing would violate the Fifth Amendment based on the principle that it is unconstitutional for the Government to compel him to "answer official questions put to him in any... proceeding, civil or criminal, formal or informal, where the answers might incriminate him in future criminal proceedings." Lefkowitz v. Turley, 414 U.S. 70, 77, 94 S.Ct. 316, 322, 38 L.Ed.2d 274 (1973). Seizing on this principle, he argues that if he is asked a potentially incriminating question during a polygraph exam, he will be unconstitutionally forced to choose between answering or refusing to answer at the risk of having his supervised release adversely modified.8
37
The Supreme Court has stated that a state may generally require a probationer to appear and discuss matters that affect his probationary status without violating the Fifth Amendment. Minnesota v. Murphy, 465 U.S. 420, 435, 104 S.Ct. 1136, 1146, 79 L.Ed.2d 409 (1984); see also United States v. Robinson, 893 F.2d 1244, 1245 (11th Cir.1990) (affirming revocation of convicted currency smuggler's probation where probationer violated condition of release by refusing to answer questions regarding sources of income). The Court in Murphy admitted some exceptions to the general rule, such as where a state forces a probationer to answer incriminating questions over a claim of privilege:
38
The result may be different if the questions put to the probationer, however relevant to his probationary status, call for answers that would incriminate him in a pending or later criminal prosecution. There is thus a substantial basis in our cases for concluding that if the State, either expressly or by implication, asserts that invocation of the privilege would lead to revocation of probation, it would have created the classic penalty situation, the failure to assert the privilege would be excused, and the probationer's answers would be deemed compelled and inadmissible in a criminal prosecution.
39
Murphy, 465 U.S. at 435, 104 S.Ct. at 1146. The Court went on to note, however, that "questions put to a probationer [that] were relevant to his probationary status and posed no realistic threat of incrimination in a separate criminal proceeding" would not violate the Fifth Amendment. Id. at 435 n. 7, 104 S.Ct. at 1146 n. 7.9
40
It is undisputed that at this juncture there has been no potentially incriminating question or invocation of the privilege, much less any government compulsion to testify over a valid claim of privilege. Such an eventuality is within the realm of possibility, but hypothetical possibilities do not present a cognizable Fifth Amendment claim. As the First Circuit recently observed in rejecting a similar challenge, it would be pure speculation to assume such facts now simply because they might conceivably come to exist at some future time. See Davis, 242 F.3d at 52 ("Should the court revoke Davis's supervised release as a penalty for his legitimate exercise of his Fifth Amendment privilege, he remains free to challenge that action at the time it occurs. That eventuality, however, has not yet occurred (and may never occur)."). If and when Appellant is forced to testify over his valid claim of privilege, he may raise a Fifth Amendment challenge. In the meantime, we can only decide whether requiring polygraph testing as a condition of supervised release generally violates the Fifth Amendment so as to amount to plain error. We hold it does not.
41
For the same reasons, Appellant cannot demonstrate plain error in the district court's delegation of authority to the probation officer for overseeing Appellant's mental health treatment, including administration of polygraph exams. The district court's sentence was consistent with the Sentencing Guidelines, which expressly permitted the court to impose "a condition [of supervised release] requiring that the defendant participate in a mental health program approved by the United States Probation Office." U.S.S.G. § 5B1.3(d)(5), p.s. (emphasis added). Furthermore, we have recognized the vital role probation officers fulfill in effectuating the district court's sentence. See United States v. Bernardine, 237 F.3d 1279, 1283 (11th Cir.2001) ("For purposes of efficiency, district courts must be able to rely as extensively as possible on the support services of probation officers.") (internal quotations omitted) (citation omitted). Thus, the delegation of authority to the probation officer generally does not constitute plain error. And, while we might again conceive of a scenario where a probation officer abuses or oversteps his lawful authority, there is no reason to suspect at this time that such will be the case here.
42
Accordingly, the district court did not err in requiring Appellant's submission to polygraph testing as a condition of supervised release.
B. Restriction on Internet Usage
43
Appellant asserts the restriction on Internet usage is improper under 18 U.S.C. § 3583(d) because it is not reasonably related to legitimate sentencing considerations and overly burdens his First Amendment rights. Specifically, he argues the district court could have satisfied the statutory sentencing goals in relation to his offense without entirely foreclosing all Internet use. We review the special condition restricting Internet use for abuse of discretion. See Bull, 214 F.3d at 1278.
44
Whether a district court may prohibit a convicted child pornography offender from using the Internet while on supervised release is an issue of first impression in this circuit. The Fifth Circuit has upheld a complete ban on a convicted sex-offender's Internet use while on supervised release. See United States v. Paul, 274 F.3d 155, 169-70 (5th Cir.2001). Additionally, the Tenth Circuit has held a general prohibition against Internet use on supervised release is not error where the offender is allowed to use the Internet with his probation officer's prior permission. See United States v. Walser, 275 F.3d 981, 988 (10th Cir.2001).10 These courts have noted the strong link between child pornography and the Internet, and the need to protect the public, particularly children, from sex offenders. See, e.g., Paul, 274 F.3d at 169 ("The record reveals that Paul has in the past used the Internet to encourage exploitation of children by seeking out fellow `boy lovers' and providing them with advice on how to find and obtain access to `young friends.' Restricting his access to this communication medium clearly serves the dual statutory goals of protecting the public and preventing future criminal activity.").
45
We consider the reasoning in these cases persuasive and conclude there was no abuse of discretion in the district court's limited restriction on Appellant's Internet usage. We realize the Internet has become an important resource for information, communication, commerce, and other legitimate uses, all of which may be potentially limited to Appellant as a result of our decision. Nevertheless, the particular facts of this case highlight the concomitant dangers of the Internet and the need to protect both the public and sex offenders themselves from its potential abuses.11 We are also satisfied that the restriction in this case is not overly broad in that Appellant may still use the Internet for valid purposes by obtaining his probation officer's prior permission. As the Tenth Circuit observed in Walser, this relatively narrowly-tailored condition "readily accomplishes the goal of restricting use of the Internet and more delicately balances the protection of the public with the goals of sentencing." Walser, 275 F.3d at 988.
46
We acknowledge that two other circuits have embraced a holding opposite from the one we adopt today. See United States v. Freeman, 316 F.3d 386 (3d Cir.2003); United States v. Sofsky, 287 F.3d 122 (2d Cir.2002). In Sofsky, the Second Circuit held a restriction on computer and Internet use was invalid even where there was an exception if the offender received his probation officer's approval. Sofsky, 287 F.3d at 126.12 In Freeman, the Third Circuit relied on Sofsky in reaching the same conclusion. Freeman, 316 F.3d 386.13 Although we appreciate these courts' concerns that restrictions on Internet usage may effect some deprivation of liberty, we agree with those courts holding that a limited restriction on a sex offender's Internet use is a necessary and reasonable condition of supervised release.
IV. CONCLUSION
47
The district court did not err in ordering Appellant to submit to polygraph examinations as part of his mental health treatment on supervised release. This condition is reasonably related to his offense and history, satisfies the statutory sentencing goals set forth in 18 U.S.C. § 3553(a), and does not unduly infringe on Appellant's liberties. Moreover, although the challenge to the polygraph exam is generally ripe for our review, certain of Appellant's arguments against polygraph testing lack merit because they depend on future contingency and speculation. If those contingencies come to fruition, Appellant may challenge the condition at the appropriate time. Finally, we hold the district court did not abuse its discretion by imposing a limited restriction on Appellant's Internet use during the period of supervised release.
48
AFFIRMED.
Notes:
*
Honorable Richard W. Goldberg, Judge, United States Court of International Trade, sitting by designation
1
Appellant pled guilty without the benefit of a written plea agreement
2
In addition to these four special conditions of supervised release, Appellant was ordered not to possess materials depicting children in the nude or in sexually explicit positions, and to undergo periodic searches of his computer systems, person, and residence. He does not challenge these other conditions on appeal. The district court also ordered Appellant to perform community service and forfeit certain assets, which he has not challenged. In addition, although the applicable Sentencing Guidelines called for a fine between $6,000 and $60,000, both parties stipulated that Appellant was unable to pay a fine
3
See 11th Cir. R. 36-1.
4
InBonner v. City of Prichard, 661 F.2d 1206, 1209 (11th Cir.1981) (en banc), this Court adopted as binding precedent all decisions of the former Fifth Circuit handed down prior to close of business on September 30, 1981.
5
The Government suggests the probation officer might select a course of mental health treatment that does not include polygraph testing. Although this possibility might lend support to the Government's ripeness argument, we find no basis for it in the record. The district court ordered that Appellant "shall abide by the rules, requirements and conditions of the treatment program, including submitting to polygraph testing" (emphasis added). While there is room for interpretation, we construe this language as mandating polygraph testing as a component of mental health treatment.
6
We refer in this section mainly to Appellant's arguments that the polygraph testing violates his Fifth Amendment rights and unduly delegates authority to the probation officer. The remaining argument Appellant raised in support of his challenge to the polygraph testing was that by ordering Appellant to contribute to the costs of polygraph testing, the district court contravened its earlier finding that Appellant was unable to pay a fine. This argument is unavailing. Although the district court directed that Appellant pay for polygraph testing, it also stated during sentencing that the costs of mental health treatment, of which the polygraph testing was a component, would only be assessed to Appellant based on his ability to pay or the availability of third-party payment. We have previously observed that "[i]n determining the terms of a sentence, it is the intent of the sentencing judge which controls and that intent is to be determined by reference to the entire record."Bull, 214 F.3d at 1279 (citation omitted). As we did when confronted with similar circumstances in Bull, we conclude the only reasonable construction of the overall sentence in this case is that Appellant must pay for polygraph testing based on his ability to pay at the time the testing occurs. This instruction is not inconsistent with the district court's finding Appellant unable to pay a fine at the time of sentence, and did not constitute reversible error.
7
Appellant's counsel's argument to the district court that polygraph testing was "not a proper condition" of supervised release was inadequate to properly apprise the court of the very focused objections he now raises for the first time on appeal, including that the condition violates his Fifth Amendment rights and improperly delegates authority to the probation officer. As we have already indicated, the district court is not expected to read minds or independently conceive of every possible argument a party might raise in support of an objection. It is a defendant's—or his counsel's—burden to articulate the specific nature of his objection to a condition of supervised release so that the district court may reasonably have an opportunity to consider it. Similarly, we are unpersuaded that counsel's vague reference to Appellant's "Constitutional rights" was sufficient to preserve his objections for appeal
8
The district court expressly ordered as part of its sentence that "[t]he results of the polygraph examination may not be used as evidence in court to prove that a violation of community supervision has occurred, but may be considered in a hearing to modify release conditions." The court's order is unclear as to what type of "modification" might be a permissible response to a failed polygraph exam. We will assume without deciding that the potential consequences in refusing to answer would be sufficiently adverse to create a genuine Fifth Amendment dilemma
9
The Court held inMurphy that a Fifth Amendment privilege was not self-executing where a probationer is required to answer questions affecting his probation. In other words, even if the probationer gave incriminating testimony, such testimony would not be barred in a subsequent proceeding unless the probationer actually asserted a claim of privilege. See Murphy, 465 U.S. at 440, 104 S.Ct. at 1149. In this case, not only has Appellant not yet asserted a claim of privilege, he has not given any incriminating testimony or even been requested to give such testimony.
10
Walser clarified an earlier decision of the Tenth Circuit, United States v. White, 244 F.3d 1199 (10th Cir.2001), where the court held that a complete ban on Internet usage with no exceptions was improper under 18 U.S.C. § 3553(a). We are cognizant that White was decided under an abuse of discretion standard while in Walser the court was limited to reviewing for plain error. Nevertheless, the restriction at issue in this case is virtually identical to Walser's in that it allows Appellant to use the Internet with his probation officer's permission, and we find Walser's reasoning persuasive.
11
We reiterate that at the time he was arrested for the instant offense, Appellant was in possession of over 4,000 images of child pornography stored on computer diskettes and compact disks. Appellant's counsel admitted during oral argument that there is a "reasonable assumption" these images came from the Internet. Moreover, it is undisputed that Appellant used the Internet to facilitate the purchase of pornographic videotapes, ultimately leading to his arrest and conviction in this case
12
The Second Circuit inSofsky appeared to rely on its earlier decision in United States v. Peterson, 248 F.3d 79 (2d Cir.2001). In Peterson, the court rejected a prohibition on computer and Internet usage where the appellant had been convicted of larceny and the Internet restriction was actually related to a prior unrelated sex offense. Under those circumstances, the court held the restriction was neither reasonably related to the conviction nor reasonably necessary to achieving the statutory sentencing objectives. See id. at 82-83. Of course, that was neither the case in Sofsky nor here, where the restrictions bear a strong tie to the offenses that precipitated the sentences being challenged on appeal.
13
Freeman distinguished an earlier Third Circuit decision, United States v. Crandon, 173 F.3d 122 (3d Cir.1999), where the court had upheld a restriction on Internet use. In Crandon, the offender had actually contacted minors over the Internet. In Freeman, the offender had used the Internet to obtain child pornography, but had not directly contacted minors. According to the Third Circuit, only the former circumstance justified a limited restriction on Internet use. See Freeman, 316 F.3d 386. We disagree.
| tomekkorbak/pile-curse-small | FreeLaw |
What separates a bestselling novel from a non-bestselling novel? That?s the code University of Nebraska-Lincoln English professor and associate dean Matthew Jockers has cracked, with a little help.
Jockers, along with his co-author Jodie Archer, PhD, a former acquisitions editor for Penguin Books UK, enlisted the help of Tusker. Tusker is a room-sized cluster computer which read 4,500 novels, quantifying the elements of a book to show what separates the successful ones from the not-so-successful ones.
Jockers and Archer detail their research in their new book, ?The Bestseller Code?, available now. BTN LiveBIG spoke with Jockers to learn more about Tusker and cracking the bestseller code.
BTN LiveBIG: Explain to us how the Tusker algorithm works, how it determines what is a bestseller and what isn?t.
Matthew Jockers: The first thing that happens is there's a bit of code that splits the book into every single sentence. It isolates each sentence and then it identifies the grammatical structure of each one of those sentences. Then, it goes through the series of steps which includes everything from part of speech tagging and grammatical information.
We also have a part of the process that identifies the primary or major themes that are in each book. All this information gets extracted and saved so each book becomes a row in a spreadsheet.
In the next phase, you feed that massive spreadsheet to a different type of algorithm; you tell it which of the books that are the bestsellers and which are the books that are not bestsellers. That machine looks at that huge string of data and tries to identify common patterns in bestsellers, and the common patterns in non-bestsellers.
BTN LiveBIG: Can you apply this formula when writing a book?
MJ: No, the system is designed to look at an entire manuscript. ? It's not like we can give you a formula or a prescription for how it affects you.
BTN LiveBIG: Can Tusker measure all types of books?
MJ: It could measure anything, but that would be a bad decision. I's designed to look at adult fiction. Applying it to non-fiction doesn't make a lot of sense, although I think that it would work with biographies, which are very narrative in nature.
BTN LiveBIG: What makes a bestseller?
MJ: I'll tell you what those features are, but first I'll give you my caveat - we found out about 2,800 features that the machine found were useful in helping it distinguish between a bestseller and non-bestseller. If I talk about three or four of those 2,800 features, that?s a pretty radical reduction of material the machine is using. And the machine is actually not just looking at two or three features in isolation, it's looking at all of these features as an aggregate thing. So that?s my disclaimer.
What we found is that bestsellers tend to have three dominant topics. Then we found that there was one particular topic that sort of had to be present in, or it was always present in bestsellers but was not always present in non-bestsellers in the right proportion. That topic we called human closeness. It's different from sexual closeness, which is a topic that the machine told us is not a bestselling topic. Sex did not sell, despite ?Fifty Shades of Grey?, which is an outlier. But this topic of human closeness is much more about sort of connected interpersonal relationships.
When we study character ? we found that bestselling characters are engaged in actions - less passive, more active.
And what we what we've discovered in the style chapter is that bestselling authors have a style that's a bit more colloquial, a bit more in the language of a common person. It's not slang, but it's not formal academic highbrow prose.
BTN LiveBIG: What, according to Tusker, is the unequivocal bestseller?
MJ: We said, ?all right machine, which book has the best combination of all of these things (topic, characters, style and plot).? Now that doesn't mean what's the book that's the best bestseller, it just means which book has everything going for it.
And the book was called ?The Circle.? It's a novel by Dave Eggers, and the wonderful, wonderful irony is that it's a dystopian book about what happens with technology when things get out of control. So it's a book that's in many respects very critical of big data, and of course the computer picked it. There was a beautiful irony in that.
BTN LiveBIG: Have you run ?The Bestseller Code? through Tusker?
MJ: No [laughs], I need to do that actually. People keep asking that question, but it?s designed to analyze fiction.
But we have a few of the reviews of ?The Bestseller Code? that have said things like. ?It's a gripping journey, the book itself is a real page turner.? And so I suppose I owe it to us to analyze it and see what happens. | tomekkorbak/pile-curse-small | OpenWebText2 |
Melissa Radel
30 S Main Street, P O Box 266New London, MN 56273-0266
ABOUT ME
Our Satellite Office is located at 206 Washburne Ave in Paynesville, MN, 320-243-7424.
I began my career as a State Farm Agent in 1992. Proud alumna of Southwest Minnesota State University - Marshall, graduated Summa Cum Laude with a Bachelor of Science Degree in Accounting. Go Mustangs!
We are pleased to be active members of the New London, Spicer, and Paynesville communities. I currently serve on the New London Dam Club Committee, the New London Housing Board, and a remote ambassador for the Willmar Lakes Area Chamber of Commerce Ambassador Committee.
In addition to the organizations mentioned above, we are also proud supporters of the New London Merchants Group, Spicer Commercial Club, and the Paynesville Chamber of Commerce.
We focus on assisting customers in our community as well as relocations to the New London, Spicer, and Paynesville areas. We handle Auto, Car, Home, Renters, Life, and can assist you with your Banking needs.
ABOUT ME
Our Satellite Office is located at 206 Washburne Ave in Paynesville, MN, 320-243-7424.
I began my career as a State Farm Agent in 1992. Proud alumna of Southwest Minnesota State University - Marshall, graduated Summa Cum Laude with a Bachelor of Science Degree in Accounting. Go Mustangs!
We are pleased to be active members of the New London, Spicer, and Paynesville communities. I currently serve on the New London Dam Club Committee, the New London Housing Board, and a remote ambassador for the Willmar Lakes Area Chamber of Commerce Ambassador Committee.
In addition to the organizations mentioned above, we are also proud supporters of the New London Merchants Group, Spicer Commercial Club, and the Paynesville Chamber of Commerce.
We focus on assisting customers in our community as well as relocations to the New London, Spicer, and Paynesville areas. We handle Auto, Car, Home, Renters, Life, and can assist you with your Banking needs.
For your protection, please do not include sensitive personal
information such as social security numbers, credit/debit card
number, or health/medical information.
Insurance coverage cannot be bound or changed via submission of this
online e-mail form or via voice mail. To make policy changes or
request additional coverage, please speak with a licensed
representative in the agent's office, or by contacting the State
Farm toll-free customer service line at
(855) 733-7333
.
Our Vision is to be insurance professionals whose actions are driven by keeping the customers best interest as our primary goal. Our team treats all our customers in a caring, friendly, and professional manner. Our office provides warm, efficient, and seamless services to our customers at all times. Our Mission is to help our customers manage the risks of everyday life, recover from the unexpected and realize their dreams.
This tab is currently
Hidden
. Use the
Edit
button on the
Our Team
tab to change it to
Visible
Available Positions
Please Note:
This opportunity is about potential employment with an independent contractor agent
who solicits applications for State Farm products and services, and does NOT result
in employment with any of the State Farm Insurance Companies. The employment
selection decision , terms and conditions of employment (such as compensation and
benefits) are all determined solely by the independent contractor agent.
Disclosures
Investors should carefully consider investment objectives, risks,
charges and expenses. This and other important information is contained
in the fund prospectuses and summary prospectuses which can be obtained
by visiting the
prospectus page
on statefarm.com. Read it carefully. AP2020/03/0336
State Farm Bank ®, F.S.B., Bloomington, Illinois, is a Member FDIC
and Equal Housing Lender. NMLS ID 139716. The other products offered by
affiliate companies of State Farm Bank
are not FDIC insured, not a State Farm Bank obligation or guaranteed by
State Farm Bank, and may be subject to investment risk, including
possible loss of principal invested.
The Bank encourages any interested individual(s) to submit an application
for any product(s) offered by the Bank. We also encourage you to obtain
information regarding the Bank's underwriting standards for each type of
credit or service offered by visiting statefarm.com or by contacting the
Bank at 877-SF4-BANK (877-734-2265). Callers who are hearing or speech
impaired should dial 711 or use a preferred Telecommunications Relay
Service. To apply for a Bank product, you may also see your participating
State Farm agent.
Life Insurance and annuities are issued by State Farm Life Insurance
Company. (Not Licensed in MA, NY, and WI) State Farm Life and Accident
Assurance Company (Licensed in New York and Wisconsin) Home Office,
Bloomington, Illinois.
State Farm VP Management Corp. is a separate entity from those State Farm
entities which provide banking and insurance products. Investing involves
risk, including potential for loss.
We value your privacy.
We may collect personal information from you for business, marketing, and commercial
purposes.
Read more
We value your privacy.
We may collect personal information from you such as identifying information
(name, address, driver's license number), transactional information (products or
services purchased and payment history), digital network activity (interactions
with our website, IP address), geo-location data, audio recordings and other
forms of personal information. We use this information for business, marketing
and commercial purposes, including but not limited to, providing the products
and services you request, processing your claims, protecting against fraud,
maintaining security, confirming your identity and offering you other insurance
and financial products.
For California residents,
click here
to view the full version of the California Consumer Privacy Notice. | tomekkorbak/pile-curse-small | Pile-CC |
Archive for July, 2009
Horace Greely famously told Josiah B. Grinnell to “Go west, young man, go west”. The Congregational minister did and ended up in the middle of Iowa and a town here now bears his name. It is a wonderful place with much to see and do. Grinnell College is there and its campus is magnificent. Make sure to visit the Bucksbaum Center for the Arts, a neat building designed by Cesar Pelli. North facing light catchers bathe the stuff on display in its Faulconer Gallery with slightly blue toned light.
But another building is even more interesting and alone worth the short trip north from I-80. It is Louis Sullivan’s Merchant National Bank. It is the finest example of the several “Jewel Box” banks that he designed in second half of his career.
Sullivan is famous for his “form ever follows function” which is often misinterpreted it seems to me. Sullivan didn’t mean minimalism or the absence of adornment. One look at the entrance to the bank and its explosion of terra-cotta should put any such though to rest.
A reporter wrote at opening on January 1, 1915 that something “must have worked like hashish” on the architect to induce such a vision. Such a thought would not grace any review of, say, David Chipperfield’s Figge Art Museum.
Sullivan meant that a building’s ultimate form should be the organic emanation of the spirit of the place and its people. This bank was built as a repository for the fruits of the labor of area farmers with reverence for the hard work signaled thereby.
The entrance faces south and thus for most of the year and most of each day sun pours through the beautiful stained glass window. There is also stained glass on the east which fills with light till noon or so and sky blue glass on the ceiling***.
The effect of the glass and light is beautiful, but perfectly not profound. No “metaphysics of light” here****. A lesser hand would have combined the same elements to a more clerical effect which would have not only been disrespectful to Fr Grinnell’s gothic church (which used to be just across the street to the east) but also to the local common consciousness.
The ceiling height is about twenty feet creating a spatial experience which (without too much of a stretch) could be said to allude to one in a barn or in a field looking toward the sky. Or, indeed, like being a gem in a jewel box – but one with some of the dividers missing.
The interior was changed and a touch diminished by the removal of the cages over the teller areas which originally served more of a purpose of tradition and proportion than security. The effect is as if an element had been removed from a piece of abstract sculpture. You would feel the absence of something even if you had no way to know what was missing.
That extirpation would seem to have been unnecessary because a functioning bank was appended on the north and Sullivan’s jewel appropriately repurposed to house the chamber of commerce. The commission for the addition must have been intimidating, but was done with respect and rhythm by Davenport firm Stewart-Robison-Laffan.
Finally, this may be hard to believe, but the building was more comfortable in context in 1915 than now. It was then of similar size and proportion to that of its immediate neighbors. Roof lines met. Now to the west is a low slung bit of impermanence and the aforementioned addition obvious in its respectfulness.
Sullivan has been called the “father of the skyscraper”, yet the grand part of his career had been long over at the time of this commission. Perhaps sensitized by intervening vicissitudes he found himself able to channel the essence of Grinnell and show what he “meant when he talked about the genius of America.*****
*Words of a reporter in the 1,1,15 Grinnell Herald.
** The glass was done by Louis Millet who was related to Jean-Francois Millet, the French painter know for his paintings of peasant farmers such as The Gleaners
***Term coined by Abbot Suger in the early stages of Gothic Architecture
**** January 1, 1915 Grinnell Herald
***** Some of the above came from the book by Bill Menner which is well represented in this website:
About six months ago a tooth began to bother me. It was a molar. Top right second from the back. Really began to ache and I called my friendly dentist. X-rays and probing found nothing definitive. “Nothing heinous” he said. “Could be a crack”.
Pain subsided. Mentioned again at next regular check up. Had me clamp down various strange ways with no acute response. Began to ache though after visit and through the next day or so. Long as I didn’t chew on that side everything was fine.
During yurt party last weekend over wine and beer I was flapjawing and distracted. Chomped a couple handfuls of peanuts. Great night, but mouth woke me up the next am. Throbbing got continually worse. Called dentist. His sweet wife, also a friend, said he was fishing in Wisconsin. I replied that I hoped he could squeeze me in on Monday.
I called back later and she gave me his cell phone number. Tooth socket was so swollen that tooth protruded significantly below the others and it was impossible to chew anything without it touching down first. Throbbed like a heart in the hands of an Aztec priest.
He met me in his office several hours later. “Cracked through I’m afraid” he said with a kindly smile. “It’s a gonner.” He explained the options all of which began with extraction.
Next morning his nurse called with an appointment later in the day at the specialist’s. Oh boy. Expansive empty waiting area. Perfunctory receptionist. “Fill this out. Both sides. Initial every line.” Insurance info sure, but also a harrowing litany of possible complications.
I didn’t have to worry that the antibiotics might attenuate the effectiveness of any birth control, but the possibility of: bone chips, socket rupture, nerve damage, infection from the cadaver bone used to fill gaps, jaw fracture, and more didn’t exactly comfort me.
Led back to the room, I started to sweat. Doc whirled in. Visage and demeanor of Wallace Shawn. “Who’s beatin’ up on ya?” I gave him the name of my dentist and started to tell him that the swelling had gone down and maybe…
He pulled my jaws apart, inserted a block of rubber to prop it open and wrapped gauze around my tongue (so I wouldn’t lick his fingers he told me). Swabbed some electric tasting numbing compound. Stood for a moment – elbows folded, dripping syringe in one hand, cigarette in the other – and then came at me.
“We’ll give that stuff about ten minutes to numb ya up.” Back in nine he had the nurse place the meat-hook like suction apparatus for which there was no need – my mouth was dryer than a mummy’s. Reaching in with the pliers, he grabbed hold of the small half of the tooth and twisted and turned with vigor. Sounded like a novice shifting the gears of a manual transmission.
“Got it!” he said. “Rinse?” I knew that I’d never be able to swallow and didn’t respond. “Second half will be a little tougher” he said. “Doin’ ok? Got a good hold on somethin’?”
Oh shit. He grabbed the fat half with the pliers and both hands, rocked back on one leg, and raised the other to a position upon my chest. I stared so intently at the ceiling that it began to smoke. I was completely soaked and started to slide down the chair. Nurse grabbed me by the ears and pulled me back up.
It was like parts of a chicken being separated by another novice who can’t quite find the joint and so, cursing, twists and turns the drumstick until…
Finally, it gave and he stumbled back against the wall. With a backhand toss he flung it out of my field of view. I heard it hit the trash can. “Two points. Dry him up and I’ll be back” he said. I’d forgotten that he was going to have to pack the socket to prepare for the implant I’ll never return to have.
Sat there for a few minutes with blood soaked gauze hanging out of my mouth. Worst had to be over. Return though he sure enough did. Pulled the gauze out and with an Eberhard #2 he proceeded to pack the cadaver bone up into the socket. Then took a fat curved needle threaded with monofilament and threw a few stitches to hold it all in, told a joke, and left.
Nurse shoved clean gauze back into my mouth while telling me to eat soft foods for a while, not to overexert and thus pop the stitches, and that the gritty discharge, bleeding, and horrible taste and odor due to the anaerobic bacteria sure to soon seethe up there would only last a few days.
“Drinks?” was all I could think of asking.
“Long as you don’t mix it with the pain meds.”
As I struggled to write the check a few minutes later, the cashier told me that I’d been lucky they’d been able to fit me in. A primal grunt was all I could muster. But my wife recognized it from across the lobby, came over, and helped me to the car.
No, alas, this is not in my yard. Not yet anyway. It’s called Bird’s Foot Trefoil (Lotus corniculatus to a botanist) and is a member of the huge Pea or Bean (Fabaceae or Leguminosae) family. The photo was taken along the interstate at the end of our ravine.
The name Trefoil comes from Latin via Old French meaning three leaves -like the clover to which it is related.* It has just come into bloom now and will remain so for most of the summer. This bright delight is not native to North America having been imported from Europe for forage.
According to Iowa State University Extension, it was only first planted in 1938 but now covers more than 500,000 acres in Iowa alone. Farmers like it because it is hardy once established; will withstand close grazing; is highly nutritious; and non-bloating. It has provided daily weight gains in cattle exceeding a 30% premium over fertilized grass.
Laterly the plant became popular with road crews whose mission was/is to stabilize roadside growth. It creates a dense low mat, will crowd out plants with a yearn to grow tall, blooms low and so can be cropped close. If you live around here and are not agoraphobic, it will doubtless and frequently play a role in your field of view.
Not surprisingly, citing almost exactly the same factors listed above, the philistines about consider it invasive, a weed, and incredibly difficult to control. “An ecological threat” Control by conflagration not only doesn’t work, but instead increases seed germination! Ha!
There is a new book out** that explores the chasm between us and our setting – the green movement notwithstanding. The author writes of the seafarers of Puluwat in the South Pacific who can navigate by means of subtle swell patterns. And of the Inuit who do the same with wind. The Bedouin the stars. Here in suburbia some use a GPS to cross town. What’s up with the disconnect? Is there a cost?
The Trefoil’s beautiful, isn’t it? Shades of yellow pea-like flowers with clover-like leaves. The seed pod arrangement sort of resembles a bird’s foot hence the name. Doesn’t the fact that a lowly weed can be so gorgeous and have such a wonderful back-story give you pause? Makes me think of Blake:
To see a world in a grain of sand,And a heaven in a wild flower,Hold infinity in the palm of your hand,And eternity in an hour.
*The word also serves as a term in Gothic architecture referring to a manner of ornamentation by foliation or cusping. Look for it in church window-lights.
**The book is You Are Here Why We Can Find Our Way to the Moon but Get Lost in the Mall, by Collin Ellard. It was reviewed in the NYTBR Sunday July 12 by Jonah Lehrer.
The aforementioned yurt serves as divine studio space for my potter wife. It replaces a cold wet cryptish corner off our basement which made a cell at Guantanamo something for which to yearn.
Development of that transmigration required more than a few days and much ideation. First thought was a familiar exercise in rectilinearity set akimbo in our front yard. Then an appendage also in front. Then she considered the expansion of the existing dingy cellar.
Somehow the tent-like structure more common on the steppes of Central Asia came into her consciousness and she quickly concluded that yurt it would be. (Well, she and the dog…)
It is wonderful, even from this visitor’s perspective. Its shape and nature fit organically on the side of the ravine in back of our house. It looks almost to have grown there.
We’re in the middle of town and abut an interstate. Even so, from within looking out, all that can be seen is green. Work started after woods leafed out, and thus I’ll bet neighbors (not far) across the way won’t have seen it till fall.
It really is neat, made all the more special by being a few paces away from the house. Going from one to the other in the rain you’ll get a bit wet. Perfect. Forces awareness of one’s place in the universe.
To this philistine, it seems also perfect for the artist. Entering, it’s like stepping into a cloud with the world left far behind.* I can’t wait to see where it takes her.
Reminds me of some of Tadao Ando’s work in which sun, wind, and clouds are design elements. His Azuma house, with which he first gained recognition similarly forced residents to interact with nature.
Contrast these to the emphasis on surface gloss found all too often in new additions to the built environment both public and private. Lipstick might look nice, but it doesn’t necessarily tell much about the pucker. Know what I mean?
Anyway, this arrangement of site, structures, and stuff combine at night to make a softly glowing spot for wife to consider what another potter called “The Mud-Pie Dilema”**.
More later.
*Speaking of which – you should hear what heavy rain sounds like therein. No need for thunder!
**The Mud-Pie Dilemma: A Master Potter’s Struggle to Make Art and Ends Meet by John Nance
Ok. I’m just about ready to rest my case. I’ve written several times of the special beauty of my lawn. The photo above ought to put all doubts to rest. Representative of a good part of my small plot is that arrangement of several grasses, flowered clover, yellow oxalis, and wild strawberries.
Most people spend untold hours in the cultivation of their yards, but end up with only blade after boring blade of the same dang thing. I spend as little time as possible and, well, results speak for themselves.
As opposed to most, I don’t attempt to inflict my own narrow opinion of what it should look like upon the earth. Instead, I endeavor to create a condition in which such subtle wonder can unfold of its own accord. Believe it or not, I planted virtually none of what you see above.
What is more is that those colors are nearly perfect counterpoint for the string of Tibetan prayer flags strung across my roof high above. It is said that with each flutter of every panel a prayer is repeated. They are nearly always moving.
Perhaps that’s how the character of my lawn developed, having not always been so. Only several years after the death of a brother (in whose memory I connected our chimney and roof vent pipe with the red, blue, green, white, and yellow squares) did things begin to change. Or at least to my notice.
It was imperceptible at first. Then we had several seasons and several families of ducks that made home in front of our house. And elsewhere coons and deer and cats and dogs and varieties of rodents wild and domesticated. Five tree houses and now a yurt. Once, while digging a hole for a fence post I found an ancient stone hatchet head.
The prayer flags eventually wear out and I replace them with new crisp colors covered with tiny uchen letters. It is somehow comforting to watch them waft in the breeze. (Even though some folks ask just why we have our laundry line way up there in the encircling crown of maple and ash!)
We’ve been here thirty + years and I absolutely don’t mean to say that I’ve things just the way I want them. Yes, I trim and fertilize from time to time, but that’s just so these particular emergent rhythms don’t dampen.
DH Lawrence wrote that “Different places on the face of the earth have different vital effluence, different vibration, different chemical exhalation, different polarity with different stars: call it what you like. But the spirit of place is a great reality.”*
We’re all – flora, fauna, parents, and children – deeply imbued with the great reality of the spirit of our contorted tiny bit of the planet.
*Speaking of Lawrence, it may be obvious, but I’m also trying to make sure that the gamekeeper my wife runs off with is me… | tomekkorbak/pile-curse-small | Pile-CC |
Get the Bravo Newsletter
Piss and Vinegar
So the premise of the new show is pretty voyagetastic. I just made that word up. The quick and dirty premise is this: one city per show. They run around like highly caffeinated culinary explorers (“the Course”), get competitively drunk tasting the foods and beverage of the community (winner gets the “Exceptional Ingredient”), and then have to cook the dishes themselves at local landmarks (“the Takeover.”)
The winner of the season gets a schmancy Infiniti JX Crossover and a big pile of traveler’s cheques, as the Euro was deemed too risky. The stakes get continually more lavish in food television. If memory serves, the prize for the first season of Top Chef was $378 and a 1983 Chevette.
Curtis, the escapee from the penal colony of good-looking blond people, is heading this worldly tour with his cheftastic partner, Cat Cora. Cat is a television icon in chef shows and this is a new kind of gig for her, with fancier hair styles and heels, but Curtis got used to heels and highlights a number of years ago. Don’t let that blond bombshell fool you, Curtis can cook with the best of them. The cultural differences in some of the destinations will be a real factor in the series, but London is pretty tame. At the end of the day Nigella Lawson is prettier, smarter, and wealthier than most all of us, but at least we speak the same language. The Brits just happen to like their tea hot, pronounce aluminum weirdly, and like their footballs round.
Though the destination is easier for the cooks, the challenge is still, well, challenging. Cooking steak and kidney pie, without a recipe, for the first time ever is no easy task, as it’s not something often on the Boston Red Sox menu.
The actual contestants are an interesting and diverse group, who quickly become a whiny, bitchy lot, full of piss and vinegar. This is going to be fun.
Remember Chaz? Chaz was momentarily on Top Chef: Texas but failed to make the first big cut when he failed to complete his risotto, if my memory serves. “Risottoed” is a verb on Top Chef. It means to lose. Everybody loses cooking it. Even with his early departure on TC, Chaz talked a pretty big game, so we’ll see what he can accomplish.
We meet other contestants as well but it’s a blur. Some standouts are: Nookie, the sweaty baseball chef who keeps small people in his suitcase, Sai, the sexually liberated Thai chef (who, with pride, tells us people would much rather snog her than Paula Deen), Kevin, the Alpha dog who would lead you onto the third rail, and Gary Walker, the sorority chef who thinks Curtis is hot. Frankly, I am worried about our global reputation. I don’t want my passport at Heathrow judged by the guy who saw Cheven make an ass of himself on television.
I think there was a missed opportunity to get Morrissey, Robert Smith, and the guy from Flock of Seagulls to judge this thing. Morrissey would have demanded a vegan steak and kidney pie, Robert would have glumly applied mascara to a frowning Curtis, and the guy from Flock of Seagulls would have worked on hair highlights with Cat. Instead we get the iconic, but very normal, Nigella Lawson, and the owners of the pubs. Rule number one: Never rename a pub. Never. Really bad luck.
Your browser does not support iframes.
The chefs have some issues. Their knowledge of Brit food is minimal and this becomes the sticking point very quickly. I won’t run an account of all the action (watch the show!) but let this one point be very clear: they need to pay attention to what they’re eating in “The Course” part of the show. If they don’t analyze and figure out the dishes then and there, without their beer goggles on, it’s going to be a short season for them.
Brief rundown though:
•Cheven is a going to be a magnet of controversy and reviled by most everyone in all countries.
•Cheven is also "up there on the culinary totem pole.” Self promotion not-withstanding this is just too open-ended to make fun of.
•When in doubt, take a taxi.
•Nookie, the self-described schemer, sweats a lot, and I forecast him being the Bill Buckner of this season (to the Google!).
•When looking for a pub called “the Camden Head,” do not try to find “the Hammerhead”, because the former is in London and the latter, I imagine, is a parrot-themed dive bar in Key West.
•The Red Team gets the Exceptional Ingredient and this gives them an edge, but not much of one.
•Why are they subtitling Curtis?
•“British Love/American Pride” is the worst name ever.
•Clara gets thrown under the lorry and is the first chef gone.
•This is going to be a fun show to watch.
If I had to do a dish I would have done a steak and kidney pie, something my mother punished us with on numerous occasions in my picky younger years. I would make little individual ones with seared hangar steak, finely diced lamb kidneys, wild ramps, poached leeks, beef consomme, and puff pastry. Makes me hungry. I’d eat that. I would fail at this show otherwise because I can’t cook well while drunk.
British food has really stepped up in the past decade due to the people like Nigella, Fergus, the River Café, Hugh HF, and a host of others. There is a modern school of classics and all of these dishes can be aces if the chefs just think them through more.
To conclude let us revel in the immortal lyrics of the Clash’s “London Calling” :
Many of these chefs are already looking into going it alone, and that will prove to be a fatal flaw. I would be teaming up with people who are like-minded and creating a stronger me. It’s going to be a long ride. | tomekkorbak/pile-curse-small | Pile-CC |
All you want to know about the game of all-new Mass Effect
In late August of 2012 , fans were so excited with regard to the revelation of new content for the game Mass Effect 3, entitled “Leviathan”, and was content delve deeper into research regarding the origins of the Reapers, and access to on 18 Sep we were dealing with more announcement was the subject of welcome. in an official statement said Director General of BioWare Mr. Aaryn Flynn to be executive producer Casey Hudson and his team have a set of plans for a new game taking place in the world of Mass Effect currently under way, and said Flynn: but the world of Mass Effect is large and very large , and Casey with his team planning to complete an entirely different game , with such a project everyone wondering where can we get ? …
This was the first statement we have in relation to anything on the new game Mass Effect . As this was an exciting moment for the fans , especially lovers of Mass Effect.
Does not exist commander Shepard: exactly one month later , said product BioWare Montreal , Mr. Fabrice Condominas statement ended officially no idea of the return of Commander Shepard ‘s new toy , saying : “There is only one thing we are sure of it not , and it does not exist for Shepard here , we ended the time of the triple , “and continued Condominas to emphasize that the world of Mass Effect rich world , making the return of Shepard unthinkable at all , saying : ” This is really our starting point , and the world of Mass Effect is now a broad and very rich , at the moment we still do not even know what kind of time frame in which we will be in it, all we do is collect more ideas from the teams , and the collection of reactions to see many things , “” and a start we will not do the work of Shepard 2 or Mass Effect 4, the context here is different of course , but the rest of the things did not yet decided ” …
New experience: After nearly six months , the Commission readiness for Mass Effect at PAX East in Boston in the twenty-third of March 2013 , and was this Committee in honor of the trilogy , which concluded recently , as well as also to give some details scarce on the new game . Said executive producer Casey Hudson: ” We started prepping for the development of the game Mass Effect again , and will be something new ,” he added , saying : “We want to be able to provide an opportunity for the fans to return to the world with these things that Thbunha and you want to know about the experience of Mass Effect , but with the start of something new and a new way for you to explore the entire universe in Mass Effect “… Mass Effect new used engine Frostbite 3: as is well known , the Frostbite 3 engine is a huge potential – as we have seen a copy Battlefield 4, where we expect figures Details of incredibly , as is the case in games Bioware, and beautiful lighting and the ability to develop a huge open worlds prospects …
Add to discuss the figures of the championship : In May 2013, he sat all of the official magazine of the Xbox with the developers from BioWare to discuss the direction of approaching the game , including the potential heroes of the game. And said Hudson: There is a lot to tell him about Mass Effect, where it would be nice to do something for IMT irrelevant to the story of the great , a story about a private investigator at the Citadel, or something about the prayer Garrus second by second … and was designed stages Dusty Everman said in a gallery context figures ” despite being one of the most friends Shepard loyalty , but Garrus also has some personal goals that you pay , it is the hero of the right being Archange, and those who do not wish to see the adventures ins for Garrus Valkarian, there are many weapons for the experience and the preview ” … and of for his part, saw the leading designer Preston Watamaniuk that “the game is based on the fight Krogan, with more focus on the battle would make it more exciting and fun .” But the words of veteran writer Mac Walters was a little contradictory when he said : “Aria: Man prankster , and Kai Leng: any continued , and the list goes on , and I think that most of them can possess the benefits of a successful side in some fashion .” And finally … saw Michael Gamble product that can be used as a friend Prothean ” After the story Javik, and remained as the last member of sweat lost , we can forge a lot of stories about his adventures in the Milky Way galaxy , right down to his place in the new galaxy .” What can you see in the premiere : In the following month, the studio director Yanick Roy ask a question to the masses on the social networking site Twitter: ” What do you want to see in the video clip of the upcoming Mass Effect ? Or what question do you want to know the answer ? ” .
He was Roy has noted that more questions and his face are : Who is the main hero in this game ? And where and at any time is taking place ? Of this thing and we can extrapolate that the premiere is likely to reveal these properties two of the game , and this is not surprising to that extent , they are two of the most important aspects of the game after all. As the fans and media games to make some conversations to see whether this game will be a sequel to its predecessors or not , but due to the end of the story Shepard has ended already implicitly , they will not be a sequel in the formal sense , but it will continue in the period after the war with the Reapers …
Similarities with the previous parts : and in the same conversation Roy also confirmed that the new game will be on the same fashion as the previous triple of the game , so we know with certainty that they will be shooting game of the third -person perspective with the exploration , and the techniques RPG stunning …The appearance of a product Gears of War: In a surprise tweet on Twitter , announces Chris Wynn – and is a former producer for Gears of War 3 and Gears of War: Judgment- entry for this experience as a manager to develop a high-level new game . In view of this , the immediate reaction would be asking a question such as : Where will the new game road now ? However , the work product is a combination of multiple aspects of the various teams in the studio , and effective coordination between them , in addition to managing budgets and overseeing the overall efficiency. And developers can adapt to the new situation and the ways of thinking may change from one game to another. And has had games Gears of War is excellent in itself , but the essence of what makes the Mass Effect series, which is composed of the characters deep and wonderful traditions , and the attractiveness of the galaxy open …
Access reviews milestone: and we started to hear for the first time for development projects around BioWare ‘s new game a few months later in September. And as always , it was the product Casey Hudson happy to talk about their progress . So progress was coming very well , the will be able to access finally to the game engine and wander in the world is in itself accomplish , and so things started Balahtdam . Valoab in development routinely have what is known as maximum milestone, and those panoramas are helping to create a trend that is used by the game , in addition to being to ensure that everything is on track to continue to move forward …
There are even a reference to the story of Shepard apparently : As said Mac Walters Be ready to say goodbye to all your fellow veterans and the role of your adventures Commander Shepard. And explain Walters said: “Well, I can not go into detail , but the idea is that we have agreed that the story is not necessarily related to any of the events with Shepard at all” and added , ” So what might we have decided , but nevertheless , one of the main things that must be Mass Effect in its core and essence without Shepard or his friends … Tweet seventh
Peeps first for the new world : and with the approaching day N7, had fans and enthusiasts of this game are eager for any opportunity to reach even a small information about the upcoming game . Upon the arrival of the seventh of November 2013 launched a large number of tweets vague about Mass Effect fans all over the world , and let’s analyze one by one, to complete the picture completely … the first picture : The first tweet was by the producer Michael Gamble , where he said a phone : ” the next chapter of the Mass Effect in front of us . ” But the first thing Sitbadr us what he holds in his hands ? Is not this console Xbox 360? And obviously we assume at least that the game will be released on Xbox 360 devices is not it? … Not quite it should be noted from the date of publication Tweet that drives the PC allocated to units control the Xbox One is not quite ready yet, and console the Xbox 360 is the default when the test the modular PC , it seems clear to me is that it is staring at the screen on the right, and with that picture saw him raise enough of a mystery , and it seems clear that the image is in fact is the background for the desktop , we can also see figure similar to men automated standing in the center of the screen and it seems in the command center or room -like holodeck, overlooking the horizon and we see the desert landscape architecture dismal , as we see the dunes and hills could be one of the new planets that will get them in the new game ? …
The second picture : Next Tweet is more exciting and has been sent by the young man before Yanick Roy, and is showing a developer working on some interesting concepts . ” . On the left we see four graphics look like the type of defender manual , Valoab earlier in this series is characterized by the presence of assault rifles , pistols and other …… and display of these drawings shows new types of offensive weapons , each one has a different shape in the picture , probably also will get multiple types and be able to develop and customize these methods to fit Alnasfat our toys. And on the right of the picture we can see the character as a man looks wearing a shield . Will is the hero of our story new wonder ? …
The third image : and we also got Tweets exciting here ! It is by the designer stages Gary Stewart , and so we got to look for other environment , and also see a strange picture we can conclude them some information , you can see human figures moving near the bottom , and the two in the foreground seem soldiers walking in the water , it seems the world here dank and darkness and with it brings something to the person in the back noted fantasy blue on the back or on her back , and the gait of these personal look different from gait two characters in the foreground … What is striking is also the largest part of the picture , and I mean the structure tall in the middle, which seems like fungi in nature , so that they resemble towers artificially ‘s Reaper as we have seen in previous games in the original trilogy , but is there has nothing to do with the Reapers? , but given that the new game will relive a bit of the game the past , and due to the fact that the war Reapers has ended , it is unlikely anything about the origin or the origin of Reapers may come back again …
Fourth image : the image of the following is not full of detail , but we can at least determine the facts about the sites with the tweet , ” … and new worlds to explore! ” By the designer playing style Manveer Heir, and we can say that it is very dark , but what this planet ? , And what here is our mission ? , and what these structures rocky giant ? All of these questions did not respond after …
fifth : and have been sent by the leading designer Ian Frazier, and we will get to see an old friend is Poor Mako, and with the tweet , ” … if we can draw inspiration for the future ,” Is this a hint ? If Mako is okay , but what does this mean ? ? ! ! , In this case, the inspiration for the game of the future from the previous games indicates an intention to return to the more elaborate side exploration of Mass Effect original , in the last triennium of the game was the fans resent a little bit of range limited exploration in Mass Effect 2 and Mass Effect 3, is it a reference to the possibility of landing on other planets her world semi-open or fully open world , and then take the vehicle and Altugeh out into the unknown ? Yes, anything is possible at this point …
Last image : and come the end of the series tweets end appropriate , by Mr. Casey Hudson, but we do not get this time on a specific image for consideration and analysis , and instead a picture of an overview of the studio work , and said , “We continue to work hard to create amazing new experiences of Mass Effect, N7 happy day for all. ” What is immediately obvious this list there on the screen Central not look familiar ? It shows the customization screen multiplayer mode in Mass Effect 3. Tells us what this exactly? What is happening here is probably that the designers are using the multiplayer of Mass Effect 3 as a reference point and build upon. We will see great changes and updates certainly , but obviously it will be a starting point for the development of multi- play for the upcoming Mass Effect …
Information leaked from encouraging private : and here’s where things became interesting , in the depths of the corners of the Internet, and a forum mysterious is the movement is relatively low, was presented publication very sexy ( and thanks to EatChildren), Several weeks ago from PAX East early in the year BioWare sent an invitation to the Mass Effect fans who want to see something new in the gallery behind closed doors . And this was not disclosed to the signing of any agreements , as things have remained under wraps . , But this publication has withdrawn shortly after its publication , and it is likely to have been by EA. So why is hidden publication random random location on a small separating what was seen in this meeting ? If Information is probably true …
And this is what , according to information published : * The meeting was opened with a question by BioWare: ” What do you mean N7 you? ” * They then asked fans whether Kanu want to see a sequel or prequel or anything else , and the majority agreed that they want sequel any sequel . * And has appeared new kinds , and one of them has described the race ” arrogant ” , and they have Nahilon and eyes glowing . * The second race was called ” the old and the Advanced and guardian ” , and seem Kastnaaaan with glowing lines on their bodies , which seemed to be something of Tron, and also spreads fragments floating around their bodies , and that in itself has a similar color scheme for the Reapers. * Were presented in multiple types and their Frostbite 3 : Asari and Salarian and Human and Krogan. * They wanted to highlight what is unique in the diversity of models in other species as they did with humans , and give them the objects of a unique structure . * And that was shown after the main ethnic standard request of interracial fans choose to get rid of them if they were forced to it , and with the vast displacement Quarians and Krogan. * And then was shown the formations of multiple human shields , and asked the fans to say you more famous . * Display of many ground vehicles . * Intention to focus heavily on the characters and the idea of the options and re- focus on exploration in order to restore a sense of strangeness , as in Mass Effect 1. * Various configurations of the heads of the Krogans show the diverse faces painted as well as the jaw line and chin . * Desire to make large quantities of armor allocated down to the individual pieces are different , in addition to the colors and textures and materials and other … new news about the game to come in the New World : The frustrated general manager Aaryn Flynn any hope of hearing or seeing more soon on twitter about Mass Effect the next where he said that more information will come in 2014 , and this is not really a surprise and has just released a series of images interesting last month , and thus chances of seeing more things about the new game very slim …
The year 2014 and undoubtedly a big year for BioWare, which released Dragon Age Inquisition in the autumn of this year , as well as the most appropriate time to issue any information about Mass Effect next likely that it will be at E3 2014, so Valenzerp expected are as follows: March 2014 : the first details of the technical side of things in the GDC. In June 2014 : Altrer first in E3 2014. Late 2014 and early 2015 : the onset of clips Peasant playing and his style as a prelude to the release of the game. The spring or autumn of 2015: the date of publication.
so in the end that these dates are not accurate , but by the spring of 2015 would have been about 27-30 months on the game in full development , this is enough time given the relative ease of use of the new engine Frostbite 3, So Now We’ll just wait a bit to get the new information and the value of this game is expected from all lovers of video games around the world.
About Ramy Youseef
I am Egyptian player I am 18 years old my name is Ramy Youssef and care for all the world of video games and I love the games FPS, TPS, Open World, Horror and my favorite game is GTA V thr copy of Playstation 3 | tomekkorbak/pile-curse-small | Pile-CC |
Food Mashups and Other Topics
For some reason, I want to spend some time today writing about food mashups. I also want to mention a new form of matter called spin-liquid. I haven’t quite figured out how I’m going to segue from food mashups to spin liquid yet, but like Roy McAvoy said in Tin Cup: “When a defining moment comes along you define the moment or the moment defines you.” So here goes…
Alert readers know that a mashup is “a mixture or fusion of disparate elements”. So for example you could record together a bunch of different music tracks and wind up with something that sounds like five cats, a parrot and a bunch of empty tin cans loose in a dryer set to “De-wrinkle”.
You could build a house mashup by starting with a dwelling for your pet turtle but then keep adding bits on to the original project as you keep trading up to successively larger pets, as outlined in “Why I Built Fallingwater” by Frank Lloyd Wright.
As you can see in the photo, we have a turtle house grafted on to a duck pen commingled with a rabbit hutch fused to a cat enclosure wedded with a dog kennel. The nanny goat is trying to convince the boy to become the next occupant but something goes wrong, and instead the goat ends up living in the final structure along with a horse, an elephant (not shown) and a sperm whale (not shown). Or maybe it was a right whale. Or maybe I have the right whale but the wrong anecdote.
Anyway, enough of that nonsense. With the holiday season upon us, it’s time for some other nonsense about food mashups. I forgot about food mashups for a long time after first learning about the Turducken years ago. As we all know, the Turducken is a deboned chicken stuffed inside a deboned duck tucked inside a deboned turkey. Sort of like nesting Russian Dolls that you can eat. According to one article I read, Turducken were popularized by noted chef Paul Prudhomme. Note that here I am using Turducken to denote both the singular and plural cases. I could probably have used Turduckens for the plural case, now that you mention it.
I was astounded (well maybe not that astounded) to find out that this notion of an infinite (well maybe not infinite, but pretty darned long) series of cooked birds nestled inside progressively larger cooked birds extends back through time all the way to the early Romans who, by the way, are also credited with the invention of Tums.
So anyway my point is that of late, I hadn’t been spending a lot of time thinking about food mashups in general or Turducki in particular. (Or is it Turducken? Turduckens? I’m still not clear on this point.) Then I heard about Piecakens, courtesy of noted Toronto chef, Arden Longmuir.
Outwardly, the typical piecaken looks like your basic frosted cake, but if you take the trouble to do a terahertz scan of the thing, you will discover that there are one or more pies sequestered inside the “cake”. If you don`t have a terahertz scanner you can just cut it open and reach the same conclusion.(A terahertz scanner is that thing at the airport that can show people what you look like in the nude.)
Piecakens usually offer up between 40,000 and 60,000 calories per slice, enough to satisfy the average fully-grown Kraken for several days. You`ll recall that Krakens are giant sea monsters said to inhabit the coastal waters of Norway and Greenland.
People think that piecakens are a relatively new phenomenon, but like the Turducken, the concept can actually be traced far back in time, zooming past the Romans and going all the way to the early Jurassic Era. (I may be lying about this last bit, as there were no terahertz scanners in the Jurassic Era.)
Actually, a coffee table book author by the name of Charles Phoenix says that in 2007 he invented a type of piecaken called a cherpumple, which is a mashup of cherry, apple and pumpkin pies. He’s not sure if he’s the first person to have had the notion to stick a pie inside a cake, but he reckons he is the first person to have made Internet headlines by doing so. But regardless of their origin, foods like the piecaken and its evil twin sister the cherpumple are everywhere these days. The piecaken even won a spot on Kelly and Michael just after Thanksgiving 2015; Kelly wisely chewed on a brochure picturing a piecaken, sparing herself 73 extra hours on the treadmill.
But it turns out that for sheer ingenuity, the Inuit of Greenland and Canada are eating the collective lunches of Kelly Ripa, the ancient Romans and all the denizens of the early Jurassic Era, terahertz scanners or no. But almost no one is eating the lunches of the Inuit when they are serving a traditional winter food called Kiviak.
Kiviak is made by gutting a seal and stuffing the blubber-lined carcass with hundreds of Little Auks (Alle alle), which are tiny starling-sized seabirds (also known as Dovekies). I swear on Dave Barry`s driver`s license that I am not making any of this up.
The first thing you are probably asking yourself is why don`t the Inuit use Great Auks? Well Great Auks are too big for one, and secondly there aren’t any Great Auks left because they were all eaten by the Kraken. (Or is it the Krakens? I’m still not clear on this point.)
Anyway, the auk-stuffed carcass is sewn up and left to ferment under a pile of rocks for up to 18 months. Below we are seeing an actual seal carcass, looking a lot like the pod of some kind of large Alien insect, being slit open in readiness for lunch. I swear on Sigourney Weaver`s driver`s license that I am not making up so much as a single syllable of any of this, either.
According to foodie Marissa Brassfield, the seal’s fat acts as a tenderizer and preservative; this enables people to eat the birds raw, bones and all. Apparently it is even common practice to bite off the tiny bird’s heads and then suck out the juices, which are chock-full of nutrients. Kiviak apparently tastes like some kind of ripe cheese and since it is quite pungent, it is eaten outdoors, typically about 500 miles offshore. Even Krakens won’t touch it with a hundred-foot tentacle.
Kiviak is considered a special treat to celebrate weddings, birthdays, Christmas and other special occasions such as the discovery of spin-liquid, which was announced late this year by physics professor Takashi Imai at McMaster University in Hamilton, Ontario, located about 2900 kM southwest of Nuuk, the capital city of Greenland.
Spin-liquid, existing in theory for more than forty years, was recently confirmed in crystalline matter chilled to -272 °C and subjected to magnetic fields 60,000 times stronger than Earth`s. Under these conditions the electrons refuse to line up in opposite-spin pairs, and remain in an unresolved, or “liquid” state. I don`t know about you, but if someone tried to chill me to -272 °C and subject me to a ferocious magnetic field I would probably be a little ornery too.
Currently there are no practical applications for this new material, but I`m going to give it some thought as soon as I finish the last –buuurp-helping of this new food I just dreamed up: strands of red licorice threaded through corn dogs baked in banana peels and garnished with Worcestershire sauce.
About Author
Dr. Gillson obtained a PhD in Chemistry (Analytical Atomic Spectroscopy) in 1985 and worked in Research and Development for Perkin-Elmer/SCIEX before switching to a career in Medicine in 1988. He obtained an MD from the University of Calgary in 1991, and spent six years as a Family Practitioner. From July 1999 to July 2001, he was a staff physician with Jonathan Wright, MD at the Tahoma Clinic in Kent, WA, and maintained special interests in areas including steroid hormone testing and Multiple Sclerosis. | tomekkorbak/pile-curse-small | Pile-CC |
Perturbation of the transcriptome: implications of the innate immune system in Alzheimer's disease.
Alzheimer's disease (AD) is a neurodegenerative disease with broad impact. Although Aβ and tau have been proposed as the key molecules in the disease mechanism, comprehensive understanding of AD pathogenesis requires a systemic view at the genomic level. From studies on the brain transcriptome of AD, we have gradually realized the contribution of the immune system to AD development. Recent explorations on the blood transcriptome of AD patients have revealed robust immune activation in the peripheral blood. The combination of transcriptome studies and other types of studies has further elucidated the roles of specific immune pathways in distinct cell types during AD development and highlighted the critical contributions from immune genes such as TREM2. | tomekkorbak/pile-curse-small | PubMed Abstracts |
[Use of health services by diabetics with private health insurance compared to users of the Brazilian Unified National Health System in Belo Horizonte, Minas Gerais State, Brazil].
This study compared the use of health services and medication, screening test coverage, characteristics of primary care, and health behaviors in 370 diabetics 45 years or older according to sources of care: private health policyholders regardless of place of residence; residents in areas covered by the Family Health Strategy; and individuals covered by a "traditional" Primary Care Unit. The study used data from the 2nd Adult Health Survey in Belo Horizonte Metropolitan Region (2010), Minas Gerais State, Brazil. Use of health services, use of medication, coverage of follow-up tests, alcohol abuse, and smoking did not differ significantly according to source of care. Prevalence rates for insufficient leisure-time physical exercise and sedentary lifestyle were higher among individuals covered by the Family Health Strategy or "traditional" Primary Care Unit. The primary care characteristics (access, comprehensiveness, continuity, and family focus) performed better among individuals with private health insurance, even after adjusting for age, sex, and schooling. The study identified two main challenges for the Brazilian Unified National Health System in managing patients with diabetes in the city of Belo Horizonte: the promotion of physical exercise and reorganization to improve performance in primary care, especially in access to medical appointments. | tomekkorbak/pile-curse-small | PubMed Abstracts |
cassandra grande is a stunningly suggestive black ts with
Check out these Shemale webcams - Online now
| tomekkorbak/pile-curse-small | OpenWebText2 |
Sevil (1928 play)
Sevil is a play by Azerbaijani playwright Jafar Jabbarly written in 1928. It focused on the theme of the role of women, their oppression, struggle, and ultimately, victory over dated patriarchal traditions. Many women discarded their veils in the city theater after seeing the play.
Later adaptations of the play were less extreme compared to the original. It was made into a film with the same title in 1929, which was shown throughout Central Asia and the Caucasus.
Plot
The action takes place in Baku in 1918-1919. Sevil and Balash is an Azerbaijani couple of peasant origin. While Sevil dedicated herself to home and family, Balash achieved some position in society and despises his wife for her simple manners. When she gave birth to a daughter instead of a son he leaves her with the newborn baby - Islamic law gives him such right. Some time has passed. Balash become a major exchange trader, he lives in Baku with a beautiful young singer named Dilber. He became involved in Baku's aristocratic high society associated with Musavat government and White army officiers. At the same time, Sevil still lives in the village and dreams of being reunited with her husband. Balash's sister and father sympathize with Sevil and convince her to go to Baku to persuade Balash to get back to the family.
They arrive at Balash's mansion and finds out that a large feast is held there. Balash is outraged that they dared to spoil his party with their peasant look. He orders to take away Sevil's daughter and throw her out of his house with his own father and sister. Sevil finds herself on the street and observes the life of ordinary citizens and workers. She begins to be involved in the revolutionary movement. At the same time, Dilber robs Balash by stealing his securities and money and leaves him. She flees from Baku escaping from the advancing Red Army, while Sevil is tearing off her veil and walks in the columns of the revolutionary crowd. In desperation, Balash tries to shoot Sevil.
Ten years have passed. Sevil returns to Baku after several years of study in Moscow. She is reunited with her daughter and they happily drive throw a new, modern Baku, while squalid and miserable Balash silently stands in the crowd - he had no place in Soviet society.
See also
Statue of a Liberated Woman
Theatre in Azerbaijan
Women in Azerbaijan
Notes
References
External links
Online version of Sevil at Azeri.org
Category:1928 plays
Category:Works by Jafar Jabbarly
Category:Theatre in Azerbaijan
Category:Women's rights in Islam
Category:Works about women | tomekkorbak/pile-curse-small | Wikipedia (en) |
###### Strengths and limitations of this study
- The unique cohort of maritime pilots allows the prospective assessment of the effect of chronic exposure to irregular maritime work schedules on cognitive functioning and amyloid accumulation; the unique cohort might also be a limitation to the study, because they might not be comparable to the control group to some extent (eg, IQ, work environment, personality).
- Since we include participants up to 60 years, we will have to take possible ageing effects on sleep into account while interpreting our results.
- In addition to imaging techniques (positron emission tomography-CT and MRI), we use sensitive and well-validated neuropsychological tests to measure different domains of cognitive function (reaction time, visual memory, executive function, semantic memory and episodic memory).
- We will make use of four different instruments to obtain a comprehensive measure of sleeping patterns (two subjective and two objective ones).
- Our results could give rise to new treatment opportunities, that aim at sleep improvement and management in order to prevent or reduce amyloid accumulation and in turn delay or even prevent the development of Alzheimer's disease.
Introduction {#s1}
============
Alzheimer's disease (AD) is the most prevalent cause of dementia and currently affects approximately 36 million people worldwide.[@R1] Thus far, no successful treatment is available. One of the major contributors to the neurodegeneration seen in the brains of AD patients is amyloid-beta (Aβ).[@R2] The amyloid cascade hypothesis characterises amyloid accumulation as the fundamental initiating pathway for the development of AD.[@R3] The reason why amyloid accumulates, however, is not clear yet. Recent evidence suggests that poor sleep might be one of the risk factors for amyloid accumulation and thereby increases the risk of AD development.[@R4] Elderly people suffering from insomnia are more likely to develop AD compared with controls without insomnia.[@R4] Furthermore, disrupted circadian rhythm among otherwise healthy individuals[@R5] and sleep-disordered breathing disorders[@R6] increase the chance of developing AD later in life. Poor sleep quality specifically has been shown to increase the risk of AD among older individuals.[@R7] A recent meta-analysis of epidemiological studies found that poor sleep increased AD risk and that approximately 15% of cases of AD in the population might be attributable to sleep problems.[@R12]
The effect of acute sleep deprivation on AD has been shown in both rodent and human studies, which investigated the effect of sleep and sleep deprivation on Aβ levels. Rodents and humans show fluctuations in Aβ levels over a 24-hour rhythm, where levels rise during wakefulness and decrease during sleep.[@R13] Following acute sleep deprivation, the drop in Aβ levels that would normally occur after sufficient sleep the following morning, was absent. Based on this evidence, chronic sleep disturbances might lead to a pronounced accumulation of Aβ in the brain, which in turn increases the risk to develop AD.
To date, observational and epidemiological studies have identified a relationship between poor sleep and the risk of developing AD. Experimental research has found that sleep deprivation and Aβ levels are related in both animals and humans. However, the direct effect of chronic partial sleep deprivation and its consequences on cognitive functioning, particularly the risk to develop AD later in life, has not been studied before.
In this article, we describe the methodology and the participant cohort of the [S]{.ul}leep-[C]{.ul}ognition [H]{.ul}ypothesis [I]{.ul}n maritime [P]{.ul}ilots (SCHIP) study. We designed the SCHIP study in order to investigate the effect of long-term work-related sleep loss on cognitive function, structural brain changes and amyloid accumulation by using a unique cohort of healthy subjects with highly irregular shift work as maritime pilots. Because of the bidirectional nature of the relationship between sleep and AD, in which poor sleep is a symptom of the disease that precedes the clinical manifestation of AD, but might also be a risk factor that potentially contributes to the development of the disease, it is especially important to investigate the effects of sleep loss, caused by an external factor (work) and not by an intrinsic sleeping disorder (such as insomnia) that could be AD related. Therefore, participants in this study were selected based on their prolonged exposure to irregular maritime work schedules. In this maritime pilot group, sleep loss is characterised as a combination of sleep deprivation, sleep restriction and sleep fragmentation or disruption. We will refer to these using the umbrella term 'sleep loss' throughout. An example of an individual working schedule from maritime pilot is shown in [figure 1](#F1){ref-type="fig"}.
{#F1}
Results and insights born from the SCHIP study could shed more light on sleep disturbance as one of the risk factors to develop AD and contribute to new and improved treatment strategies. In the SCHIP study, we will investigate whether maritime pilots perform worse on cognitive assessment in comparison to a healthy control group and whether they have evidence of elevated brain amyloid concentrations and structural brain changes.
Methods and analysis {#s2}
====================
Participants {#s2a}
------------
Considering that this study is a proof-of-principle study, it is not possible to establish the exact effect size of the change in cognitive function we expect to see between the maritime pilots and the healthy controls.
To account for possible 10% withdrawal, we chose to have n=20 participants in each arm.
In order to reach enough power to detect clinically relevant differences regarding the results of the positron emission tomography-CT (PET-CT) scan, we performed a sample size power calculation using G Power (V.3.1.9.3).[@R15] Reported normal values (mean and SD) for this age group in the literature vary between studies but are in the order of a mean standard uptake value (SUV) between 0.9 and 1.1 with SDs in the range of 0.05--0.2. We define a relevant difference between maritime pilots and normal values to be 0.2 or more (an SUV of 1.3 or higher is considered as abnormal in most studies). This results in a large expected effect size (\>0.8). The precise number of age-matched and education-matched subjects in the database is not known yet but is estimated to be at least 50 (between 50 and 100). We have applied a one-tailed test (it is not possible to have an SUV lower than normal values). With an alpha of 0.05 and n=20, our power is 0.95 or higher (depending on the number of normal subjects). The lower level for power (0.85) is reached with 13--15 pilots.
Based on these calculations, we will aim to recruit 20 pilots, allowing for drop-out of 5--7 pilots (either due to withdrawal of consent or artefacts in the PET-CT).
Participants will be recruited within the national organisation of Dutch Maritime Pilots (Nederlands Loodswezen). We selected the maritime pilots as a suitable study population because of their unique irregular working schedule. They are called to work depending on the number and kind of ships that arrive. In a typical 7-day work week, they have to be available 24 hours per day during which they can be called several times. This results in multiple divided short sleep periods over 24 hours during a work week, this is followed by a week off. An example of a workday of a maritime pilot is illustrated in [figure 1](#F1){ref-type="fig"}.
The responsibility of a maritime pilot is to handle large international ships arriving by sea and to manoeuvre them into their final docking position in one of the Dutch harbours. This profession carries high responsibilities and requires accurate knowledge of the dimensions of the harbour and the ships besides technical knowledge and navigational skills. This results in irregular working schedules because guiding the ships is a time-intensive procedure, which can take hours to complete. Maintaining this schedule for more than 15 years will result in chronic exposure to sleep loss, either due to partial sleep deprivation (missing a full night of sleep due to work), sleep restriction (a much shorter night of sleep than normal) or sleep fragmentation or disruption (short periods of sleep interrupted by calls to work).
We will reach out to the whole maritime pilot community, in order to recruit pilots who are approximately 50--60 years old, with at least 15 years of uninterrupted work history as a maritime pilot.
Additional inclusion criteria are not using neuroactive medications or psychostimulants, consumption of \<14 alcoholic beverages per week, a body mass index of 18--30 kg/m^2^ and no subjective cognitive complaints (Cognitive Failure Questionnaire (CFQ \<43)). As control group, we will recruit 20 age, sex and education matched healthy adults with normal sleep indicated by a score of \>5 on a subjective sleep questionnaire (Pittsburgh Sleep Quality Index, PSQI). Inclusion of participants started in August 2018 and we expect to complete the analysis of all data in August 2020.
Experimental design {#s2b}
-------------------
The aim of the SCHIP study is to investigate the relationship between long-term work exposure to irregular working schedules, cognitive function and amyloid accumulation among healthy middle-aged men to test the hypothesis that work-related prolonged sleep loss increases the risk of AD-related cognitive decline. In order to test this hypothesis, maritime pilots will have three visits and controls will have two visits ([figure 2](#F2){ref-type="fig"}). During the first visit, participants will complete general questionnaires about medical history, sleeping habits and cognitive state. Approximately 10 days after the first visit has taken place, participants are invited to the sleep centre Kempenhaeghe (Heeze, The Netherlands) for the second visit. They will arrive at the sleep centre at 19:00 hours and complete a memory consolidation test (modified 'Doors Test') and a test for attentional performance (TAP 2.3),[@R16] followed by overnight polysomnography (PSG). Participants wake up at their normal wake time and complete a neuropsychological assessment after breakfast around 09:00 hours.
{#F2}
Visit 3 (only for the maritime pilots) will be performed at the Radboud University Medical Center in Nijmegen (The Netherlands), where participants will undergo a standard amyloid PET-CT to measure brain amyloid accumulation and a 3T-MRI for coregistration. Participants are scheduled in their week off in order to prevent short term effects of sleep disruption on amyloid concentrations in the brain.[@R17] They are instructed not to eat or drink anything except from water 3 hours prior to the scan.
Patient and public involvement {#s2c}
------------------------------
No patients were involved in this study because this study involves healthy participants.
However, the participants' organisation contacted us due to recent evidence from the literature on the relationship between sleep and AD. They expressed their worries about their health and their own risk of developing AD considering their irregular sleep. They reported feeling very tired at the end of a work week and speculated that within their group of maritime pilots (including already retired pilots), cases of dementia occurred more frequently than expected.
Participants were also tightly involved in the design, realisation and feasibility of the study. For example, they were involved in choosing the technique to measure amyloid and expressed the preference for a PET-CT scan over cerebrospinal fluid measurements of amyloid.
### Dissemination of results to participants {#s2c1}
Results from the PSG measurements will be reported only to participants if we find abnormalities such as apnoea or sleeping disorders. This will be done by one of our sleep clinicians via telephone. Results from the PET-CT scan will be disclosed via telephone by one of our clinicians as well. This is according to the protocol that has been approved by the local ethical committee. Any incidental findings on the PET-CT and/or MRI will be disseminated as well.
Sleep measurements {#s2d}
------------------
In order to obtain a comprehensive measure of sleeping patterns, we will use the Pittsburgh Sleep Quality Index (PSQI) with questions about average sleeping behaviour, including the report of bedtime, get-up time, sleep latency, total sleep time, sleep disturbances (pain, breathing, etc) and use of sleep medication. The maritime pilots will be instructed to fill in the questionnaire twice, once with regard to a work week and once with regard to a week off. Additionally, all participants are asked to maintain a sleep-wake diary on a daily basis. In this diary, they have to keep track of their bedtimes, the time it took to fall asleep (sleep latency), the number of awakenings and their get up times. Furthermore, they will receive an accelerometer, the Actiwatch 2 (Philips Respironics; Eindhoven, The Netherlands), in order to obtain more objective measurements of sleeping behaviour. The Actiwatch is worn around the wrist and measures total sleep time and number of awakenings during sleep automatically based on movement. Participants are instructed to fill in the sleep diary and to wear the Actiwatch for 10 days preceding the second visit.
Cognitive assessment {#s2e}
--------------------
The neuropsychological assessment has been designed to measure the following cognitive domains, using validated Dutch versions of widely used neuropsychological tests. Episodic memory is assessed using the Wechsler Memory Scale-IV (WMS-IV) Logical Memory and the Rey-Auditory Verbal Learning Test (RAVLT). Working memory and executive function are measured by WAIS-IV Digit Span, Trail Making Test (TMT-A, TMT-B) and WAIS-IV digit symbol test. Semantic memory and language are assessed by letter fluency (D-A-T), semantic fluency (animal/profession naming) and the Boston Naming Test.[@R18] Attentional performance is studied using the alertness test of the Test of Attentional Performance (TAP 2.3).[@R16] This test is conducted twice, once in the evening around 19:00 hours and once in the morning around 09.00 hours. In order to test overnight memory consolidation, a novel paradigm was developed based on the Doors Test, a visual recognition task developed by Baddeley *et al* [@R19] and extended using a validated database of 2000 pictures of doors.[@R20] During the encoding trial, we present 120 pictures of doors that participants are instructed to remember. All targets (doors) are presented twice in a different, pseudo-randomised order. Targets are shown for 5 s each, separated by a fixation cross presented for 1 s ([figure 3](#F3){ref-type="fig"}). Approximately 10 min after the encoding trial, participants are presented with 30 of the original doors and 15 distracters (new pictures of doors, not presented before) that are randomly mixed. During this short-term recognition test, the task is to indicate whether the door had been presented before (oral response with 'yes') or not (oral response 'no'). For the long-term delayed recall, the same procedure is applied in the morning, using the other 90 original pictures, plus 45 new distracters ([figure 3](#F3){ref-type="fig"}). Calculating the hits and false alarms, we compute the sensitivity (A′) for short-term and for long-term delayed recall (A′=0.5+((hit-rate -- false alarm rate)×(1+hit rate--false alarm rate))/(4×hit rate×(1--false alarm rate)).
{#F3}
Amyloid PET-CT scan with co-registered MRI {#s2f}
------------------------------------------
Brain amyloid PET-CT scan will be performed to measure amyloid load. Participants will be scanned at the Radboudumc department of Radiology and Nuclear medicine on a PET scanner (Biograph mCT, Siemens, Erlangen, Germany). Subjects will receive an intravenous bolus of the well-validated PET tracer ^18^F-flutemetamol, and static brain images will be acquired from 90 to 110 min postinjection (frames of 5 min), as recommended (see SPC; <http://www.ema.europa.eu/docs/en_GB/document_library/EPAR_-_Product_Information/human/002557/WC500172950.pdf>). The individual reconstructed PET images will be coregistered with individual structural T~1~ MRI scans.
The PET scans will be rated visually as positive or negative by an experienced nuclear medicine physician for the presence of amyloid depositions typical of AD. Scores will be expressed as a global SUV, which will be compared against population normative values, as earlier described.[@R21] For quantitative purposes, grey matter volumes of interest will be defined on the individual MRIs (eg, frontal brain areas, the precuneus and hippocampus) as well as for cerebella grey matter (to assess non-specific uptake). The amyloid burden will be quantified using the standardised uptake value ratio, since it has been validated that this analysis method has comparable agreement with full kinetic modelling.[@R22] Brain MRI will be performed on a 3 Tesla system (Magnetom Trio, Siemens, Erlangen, Germany). The structural T~1~-weighted images will be used for coregistration purposes, and to define grey matter in the volumes of interest. In addition, these scans will be used to perform volumetric measurements (eg, of the hippocampus). Also, arterial spin labelling (ASL) will be performed to measure global and regional cerebral blood flow (CBF), since reduced regional CBF is an early marker of AD. Individual anatomic MRI scans will be coregistered with the individual PET scans using the image processing platform FLS ([fsl.fmrib.ox.ac.uk](http://fsl.fmrib.ox.ac.uk/)) to calculate SUV ratios. The PET-CT data will be expressed in Centiloid units to evaluate our data with historical control data as was recently validated by Battle *et al*.[@R23]
Future follow-up visits {#s2g}
-----------------------
Because of the insufficient knowledge about the correlation between amyloid accumulation in the brain and the actual development of AD, we decided to follow the maritime pilots in a 5-year cycle in order to monitor any cognitive changes. We will contact them three times in total, which leaves us with a maximum follow-up period of 15 years. At each time point, they will be asked to answer three questions online:Did you develop cognitive complaints over the last 5 years? This question will be further elaborated on with the CFQ. The CFQ is a validated questionnaire that aims at detecting daily disruptions of cognitive functions. Participants are confronted with 25 statements and have to indicate how often they experience the situation that is described in the statements with a score between 0 (never) and 4 (very often).Were you diagnosed with mild cognitive impairment during the last 5 years? If yes, when and what was the precise diagnosis?Were you diagnosed with dementia in the past 5 years? If yes, when and what was the precise diagnosis?
If the answer is 'yes' to one of these questions, we will reach out to the participants for clarification.
Statistical analysis {#s2h}
--------------------
All analyses will be performed using IBM SPSS V.20.0 (SPSS). Statistical significance is set at p\<0.05, with Bonferroni correction for multiple comparisons when appropriate, combined with reports of effect size and 95% CIs. All continuous variables will be assessed for normal distribution by inspection of histograms and the Kolmogorov-Smirnov test. Levene's test will be used to assess equality of variances. We will perform an independent samples t-test to compare all outcome parameters. The primary outcome for cognitive function will be the score on each test, respectively, adjusted for age and education. Regarding imaging, the primary outcome measure will be the visual read of the amyloid PET scans (positive or negative PET). Secondary outcome measurements will be quantitative PET (SUV ratios), brain volume (MRI) and CBF measurements (MRI-ASL).
Dissemination {#s3}
=============
Written informed consent will be obtained from all participants. We are planning to publish the data and results of the SCHIP study in two or three articles in 2019 and 2020.
Discussion {#s4}
==========
In this article, we presented the design and methodology of the SCHIP study. The main aim of the SCHIP study is to investigate the effect of long-term work-related sleep loss on cognition and amyloid accumulation. Since previous studies assessed sleep deprivation for only one or a few days, the SCHIP study extends these studies by investigating the effect of long term sleep loss on cognitive function and amyloid accumulation. We expect that the maritime pilots have had long-term (\>15 years) exposure to work-related sleep loss, because of their work schedules and that this exposure has led to reduction in slow-wave sleep (SWS). Every slow wave observed on an electroencephalography is a pause in synaptic activity.[@R24] Synaptic activity and Aβ levels appear strongly related, as Aβ levels increase due to synaptic activity.[@R25] More synaptic activity is observed during wakefulness, especially in the default mode network or other highly interconnected brain areas.[@R25] During sleep, synaptic activity is reduced, which could result in a decrease in Aβ levels in the brain.[@R25] Therefore, sleep loss (especially poor SWS) over the course of many years could increase Aβ concentrations, which in turn could trigger AD-associated neurodegeneration and loss of cognitive function.
To test this hypothesis, we will perform extensive cognitive testing, using tests that are sensitive to subtle decline in episodic memory, which is affected early in AD. Additionally, amyloid positivity will be measured using amyloid PET-CT scans in order to explore the effect of work-related sleep loss on amyloid concentration in the brain. CBF and cerebrovascular resistance will be investigated, as reductions in blood flow and increases in resistance occur early in the AD process.[@R26] Finally, global grey matter volume and hippocampal volume will be measured.
The unique cohort of maritime pilots will allow the prospective assessment of prolonged work-related sleep loss and its consequences for cognitive functioning and amyloid accumulation. The design of the SCHIP study presents a number of strengths. No other previous investigation has looked into the effect of chronic partial sleep deprivation on cognition in healthy men to this extent. Since sleep disorders might also be early symptoms of preclinical AD, it is especially important in this age group to investigate the effect of sleep loss due to an external factor and not due to intrinsic sleep disorders. All enrolled maritime pilots did not have any sleeping disorders and did not use sleep medication as confirmed by a general health questionnaire that was filled in on screening for participation. Furthermore, we measure different domains of cognitive function (reaction time, visual memory, executive function, semantic memory and episodic memory) using sensitive and well-validated neuropsychological tasks. In addition to testing cognitive functions, we will perform brain imaging to detect amyloid accumulation as potential consequence of sleep loss. We will make use of four different instruments to get a comprehensive measure of sleeping patterns, two subjective and two objective ones. The subjective measurements consist of the PSQI and the maintenance of the sleep-wake diary. The objective assessments include the data from the Actiwatch 2 (Philips Respironics) in addition to a night of PSG. The data from the Actiwatch can be compared with the sleep-wake diary entries. These data can then be used to verify the sleeping behaviour of participants, making sure they maintain regularity and consistency in their sleeping habits.
Results of the SCHIP study will give us more insights into the consequences of long-term work-related sleep loss on cognitive function and amyloid accumulation in an AD-related context. Our results could give rise to new treatment opportunities that aim at sleep improvement and management in order to prevent or reduce amyloid accumulation and in turn delay or even prevent the development of AD.
Supplementary Material
======================
###### Reviewer comments
###### Author\'s manuscript
**Contributors:** JT was involved in setting up the study, recruiting participants, gathering baseline characteristics, analysing of first data and writing this manuscript. SO helped with setting up the study, recruitment and design of the project and writing the first draft of the manuscript. MV contributed to the design of the study. JB and MR were major contributors in choosing and designing the right PET-CT/MRI procedure and wrote part of the manuscript. RPCK contributed to selecting the right neuropsychological tests, helped with the statistical analyses of the first data and contributed to the revision of this manuscript. SO was a major contributor in setting up a collaboration with the sleeping center Kempenhaeghe (Heeze, The Netherlands) and helped revising the manuscript. JC was a major contributor in obtaining funding, setting up the study, designing the project and was extensively involved in writing and revising the manuscript. All authors read and approved the final manuscript.
**Funding:** The SCHIP study is funded by ISAO (Internationale Stichting Alzheimer Onderzoek) (grant number 15040). Additional financial resources were provided by the Radboud University Medical Center (Nijmegen, The Netherlands).
**Competing interests:** None declared.
**Ethics approval:** The study protocol was approved by our institutional review board (NL55712.091.16, file number 2016--2337) and will be performed according to Good Clinical Practice (GCP) rules.
**Provenance and peer review:** Not commissioned; externally peer reviewed.
**Patient consent for publication:** Not required.
| tomekkorbak/pile-curse-small | PubMed Central |
Gus Thompson
John Gustav Thompson (June 22, 1877 – March 28, 1958) was a pitcher in Major League Baseball. He played for the Pittsburgh Pirates and St. Louis Cardinals.. After multiple seasons in the MLB, he went on to sell 100yr pay fixed swaps as one of the top Swap Monkeys in the Eastern United States.
References
External links
Category:1877 births
Category:1958 deaths
Category:Major League Baseball pitchers
Category:Pittsburgh Pirates players
Category:St. Louis Cardinals players
Category:Baseball players from Iowa
Category:Grinnell Pioneers baseball players
Category:Helena Senators players
Category:Boise Fruit Pickers players
Category:Omaha Rourkes players
Category:Aberdeen Grays players
Category:Aberdeen Harbor Grays players
Category:Seattle Turks players
Category:Seattle Giants players
Category:People from Humboldt, Iowa | tomekkorbak/pile-curse-small | Wikipedia (en) |
Naqus
Naqus is a bell played by Rwais (professional musicians of the High Atlas mountains of Morocco). It is described as "the nāqūus (a bell originally made of a copper tube, now usually made from a car's brake drum)".
An instrument called a naqus is also referred to in the Bahá'í document Lawh-i-Naqus, "Tablet of the Bell". This "indicates a pierced wooden clapper-board which had a gong or bell-like function in making a noise when hit with a stick."
References
Category:Bells (instrument) | tomekkorbak/pile-curse-small | Wikipedia (en) |
Padfit
We like to think we have put a Unique twist on the standard Boxercise format by insturcting the participants how to move and throw combinations that we would any competitive boxer.
Not only that but the class in held within our in house Boxing Gym (Howdon Boxng Academy) so the atmosphere and the feel of being inside a Boxing ring, can add to the adreniline of this high intensity workout.
Classes
Monday;
19:30 – 20:30
Wednesday;
19:30 – 20:30
Sign Up Today
Join our community and take advantage of everything that Unique Fitness North East has to offer you! | tomekkorbak/pile-curse-small | Pile-CC |
Q:
Flames in Peaky Blinders
On many episodes while walking the streets near The Garrison, short bursts of large billowing flames spew out of some of the buildings. What are these flames coming from?
A:
A Reddit user has a possible explanation:
This is most likely a dramatic representation. From the "mouth of god":
I visualised the story through the eyes of a young boy growing up in that environment, so there’s a sense of heightened reality: the horses were bigger, the men were taller and the pubs more glamorous. What went on in hose days is quite amazing and the characters are incredible and really lend themselves to drama.
It is possible that there could have been stray plumes of fire billowing out of buildings every now and then, but I think it unlikely to be as large and dramatic as Peaky Blinders makes it. But for the sake of my own personal entertainment, let's look at this a little more.
Birmingham was initially noted for textile-manufacturing, not exactly something you would need bursting flames for. But, per Wikipedia:
In 1709 the Birmingham-trained Abraham Darby I moved to Coalbrookdale in Shropshire and built the first blast furnace to successfully smelt iron ore with coke, transforming the quality, volume and scale on which it was possible to produce cast iron.
Warning: Everything following is bullshit that I'm spewing based on roughly 60 minutes of research and having now real knowledge of what Birmingham was like during the assumed time period.
So Birmingham has a specific relationship with the blast furnace. A blast furnace is used for smelting to produce industrial metals, particularly to make pig iron, lead and copper. These would be used in a number of manufacturing needs; not the least of all would be weapon making.
But who in Birmingham would have need of industrial metals? Well of course, the Birmingham Small Arms Company (BSA) would require such metals in large quantities. While the BSA made large quantities of weapons, they were a conglomerate business, and had a number of other sources of revenue. Bicycle manufacturing, motorcycles, automobiles (specifically, the BSA acquired the Daimler automobile company in 1910), and eventually even aircraft. Of course, the BSA was also responsible for weapons such as the legendary Lewis automatic machine gun.
But to manufacture any of this, there are thousands of parts that need to come into play. It seems to make sense that if every step of the chain, from smelting to final product, are contained within the same geographic region, a company could reduce costs dramatically.
I would assume that the large plumes of fire that we see are the result of ventilation or exhaust from blast furnaces operating. I would further assume that these furnaces would be used to smelt materials that would be sent to the actual manufacturing facilities of the BSA.
But I'm mostly blowing smoke here, and I'm making a lot of assumptions based on fairly light research. Correct me if I'm wrong.
According to the makers, these fireballs serve a thematic purpose:
5 - The Shelbys can't escape hell
The Shelbys needn't worry about going to hell because according to series one director Colm McCarthy, they are already there. You might remember those fireballs you kept seeing on the way to the Garrison? These aren't just a feature of a bygone area, it was deliberate says Colm.
Speaking to Den Of Geek, he said:
The first time that we see The Garrison, we have this huge fireball. The next time we go there, Tommy is there and he's got a flame whooshing behind him. We open that shot on fire, and then we end the episode with Tommy in that deep angle with that flame going in the background and he's in a pit. Absolutely, there's definitely a sense of hell. That's very deliberate.
| tomekkorbak/pile-curse-small | StackExchange |
WWE had an idea to book Brock Lesnar as a gay babyface in 2002, the wrestling observer newsletter reports. The idea came from two WWE magazine writers, one of them Brian Solomon. They pitched to Stephanie McMahon the notion of a wrestling character that was an unstoppable and masculine hero, who later revealed himself to be gay. It would be a mega babyface hero, breaking down the negative stereotypes of homosexuality that previously existed in the pro wrestling business. Another reason for doing it was the support that WWE would've got from the gay community and mainstream media. It was a progressive character and something never done before. However, there would ultimately have been the problem that Lesnar wasn't gay. It may not have looked so good to the media or gay community. It is also worth pointing out that Lesnar once told ESPN that he didn't like gays. For whatever reason, WWE didn't end up running with the gay hero idea. Lesnar came in as traditional ass kicking machine, going on to become one of the biggest stars of this century. It is hard to imagine that he'd have had the same success if booked in the homosexual gimmick. Not to say the gay babyface idea is a totally terrible one, it is something that WWE should consider with the right character in the right circumstances. | tomekkorbak/pile-curse-small | OpenWebText2 |
[Pressure sores in a university hospital].
To determine the prevalence of pressure sores, their risk factors, and the responsible microbial agents in an acute-care hospital and to evaluate their management. A prevalence survey was conducted from 5 July through 9 July 2004. Investigators completed a standardized questionnaire for each hospitalized patient, including demographic data (age, sex, previous hospitalizations, etc.) and Braden scale risk factors (sensory perception, humidity, activity, mobility, nutrition, and friction and shear). Two experts in skin care detected pressure sores by physical examination of the patients. Each pressure sore was swabbed and inoculated on selective media. Management was evaluated by reviewing the clinical charts of each patient with a pressure sore. The study included 535 adult patients (aged 59 +/- 19 years): 75 ulcer sores were observed in 37 patients (prevalence=6.9%). Stage I sores accounted for 24% of the total, stage II for 29%, stage III 31%, and stage IV 16%. The most frequent site was the heel (41%), followed by the sacrum (20%), elbow (11%), back (7%) and ischial tuberosities (7%). Sixty (80%) were acquired while hospitalized. Age-adjusted multivariate analyses found that the risk factors significantly associated with pressure sores were Braden score< or =15 (OR=5.9, 95% CI: 2.4-13.7, p<0.0001) and previous pressure sores (OR=5.0 95% CI: 2.2-11.6, p<0.0001). Eleven sores (24.5%), mostly stage III and IV, were colonized by multiple-drug-resistant bacteria (i.e., methicillin resistant Staphylococcus aureus, extended spectrum beta-lactamase Enterobacteriaceae). Seven (9.3%) of the 75 ulcers were diagnosed only during the survey, by the experts; of the 68 diagnosed before the survey, 57 (83.8%) had been under treatment. Treatment was considered inappropriate according to French guidelines in 31.6% of the cases. This prospective prevalence study resulted in better awareness of the patients at risk for pressure sores. It also made the recently created mobile geriatrics unit better known within the hospital. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Exudative epidermitis and porcine circovirus-2 infection in a Swedish SPF-herd.
An outbreak of exudative epidermitis (EE) among piglets in a Swedish SPF-herd initiated a survey for indications as to the cause of disease. The herd was established by caesarean section and has been closed to all new animal material, with the exception of semen for artificial insemination (AI). The study comprised serum samples from the SPF-herd over a 10-year period (n=109) and a close monitoring of animals in the herd during the period after the EE outbreak. Serum samples from conventional boars at the AI-station servicing the herd were also included (n=9). All serum samples were tested for antibodies to porcine circovirus-2 (PCV-2). In addition, 3-week-old piglets from three litters (n=24) farrowed close after the initial EE outbreak were closely monitored for clinical signs of skin disease, sampled for Staphylococcus hyicus, tested for antibodies to porcine parvovirus and in sequentially collected serum samples tested for interferon-alpha (IFN-alpha) and interleukin-6. The PVC-2 serology showed that animals in the herd were sero-negative at least until 2 months prior to the EE outbreak. During the period close after the EE outbreak the animals showed varying levels of antibodies to PCV-2 but all the tested animals had sero-converted 4 months later. The AI boars were also sero-positive to PCV-2 at the time of the EE outbreak. Animals in the SPF-herd remained sero-positive to PCV-2 during the following 7 years. In the monitored litters, one piglet had clinical EE and 15 piglets displayed defined erythemas on the abdomen. Fourteen of the piglets also had IFN-alpha in serum on one or more occasions during the study, indicating viral activity among the animals. S. hyicus was isolated from all of the piglets from the earliest sampling point (3 days of age) and onwards, irrespective of clinical signs. PCV-2 was isolated from lymph node tissue collected from one of the EE affected pigs.Further, increases in the number of stillborn piglets, small litters (<6 piglets) and repeat breeders could be correlated to the time of PCV-2 sero-conversion. Coincidence of active viral infection and sero-conversion to PCV-2 points to the virus as the cause of the EE outbreak and reproductive disturbances. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Introduction {#S0001}
============
In contrast to sub-Saharan Africa, estimates of HIV incidence have not decreased in the World Health Organization (WHO) region of Europe. Indeed they increased, and in 2014 the highest number and rate of HIV infections were reported \[[@CIT0001]\]. The majority (77%) were reported from the East (15 countries). Even though numbers appear "stable" in Western Europe (23 countries), this disguises high and rising incidence in subpopulations of men who have sex with men (MSM) \[[@CIT0002]\] confirmed in two recent studies \[[@CIT0003],[@CIT0004]\]. The epidemic in Eastern Europe differs substantially from the West; only 2% of new cases are in MSM, and access to treatment remains a major obstacle to infection control \[[@CIT0002]\]. People who inject drugs (PWID) accounted for 3 and 28% of new diagnoses in Western and Eastern Europe respectively, in 2014. Although outbreaks have been observed in the West and Centre (15 countries), for example in Greece and Romania, they have been rapidly controlled by harm reduction interventions including needle exchange and opiate substitution therapy \[[@CIT0005]\]. This commentary describes the European epidemics and healthcare settings where PrEP could be delivered, how need might be estimated for MSM and the residual barriers to access.
European epidemic {#S0001-S20001}
-----------------
In 2004, representatives of 53 countries that constitute Europe as defined by the WHO, including the 31 countries that make up the single market of the European Economic Area, met in Dublin and issued a declaration of partnership to fight HIV/AIDS in Europe and central Asia. Part of the declaration was an agreement to monitor progress on the 33 actions to be taken, in alternate years from 2006. These progress reports, together with routine national surveillance data, enable the WHO and the European Centre for Disease Prevention and Control (ECDC) to generate a picture of the regional epidemics, the national responses which depend to a substantial degree on the national economy and the residual challenges.
In 2014, there were 142,197 new diagnoses made in 50 of the 53 countries, the highest annual number since reporting started in the 1980s \[[@CIT0002]\]. Of these diagnoses, 56,945 were officially reported by 49 countries to ECDC and a further 85,252 were reported by the Russian Federal Scientific and Methodological Centre for Prevention and Control of AIDS. The variation in epidemic patterns is considerable across the region with the most striking differences among the 23 countries that make up Western Europe and the 15 countries that make up Eastern Europe. The epidemic change in the West is most apparent among MSM. There has been a sustained increase in estimated incidence of HIV and other sexually transmitted infections (STIs) in this population since 2005, even in countries with good access to treatment and care \[[@CIT0006],[@CIT0007]\]. During the same period, new diagnoses due to the second most common route, heterosexual transmission, declined. However, this was not due to a decline in heterosexual HIV acquired within Western Europe but rather the 52% decline in cases that had acquired their HIV outside the region. Nearly half of those living with HIV present with a CD4 count \<350 at diagnosis, and this underscores the need to expand and promote HIV testing services to improve uptake of regular testing in key populations and strengthen linkage to care \[[@CIT0002]\]. In contrast to the countries of Western Europe, the change in the epidemic between 2005 and 2014 is most apparent in females in Eastern Europe, where the two largest countries are Russia and Ukraine. Rates in women have increased by 74% compared with a 49% increase in cases of men. Although women are more susceptible to HIV for biological and sociological reasons (no independent income and domestic violence), this does not entirely explain the gender difference, especially as a substantial proportion of new diagnoses in heterosexual men may be misclassified as MSM and PWID. The higher rates reported in women in this region may represent the "second wave" of infections from a predominantly male population of injecting drug users.
It is important to recognize that the surveillance data do not provide an accurate estimate of the incidence of HIV in subpopulations. In the UK, where the mathematical models of the epidemic are a good fit to the surveillance data, the national estimate of incidence in MSM attending sexual health clinics was 1.6 per 100 person years (PY) in 2014 \[[@CIT0008]\], whereas the observed incidence in the PROUD study participants drawn from the same population was much higher at 9 per 100 PY \[[@CIT0003]\]. Each country has hot spots (geographically) and sexual networks that facilitate HIV transmission. In the IPERGAY trial, for example, HIV incidence in the placebo arm among MSM reporting condomless sex with two or more partners in the previous six months was 9.17 per 100 PY in Paris compared with 2.45 in other large cities (Molina JMM, personal communication). Also, 45% of all newly discovered infections in France in 2014 were diagnosed in the Ile-de-France region, which accounts for only 18% of the overall French population of 66M \[[@CIT0009]\]. These data imply that, even though risk behaviours may be similar, the risk of acquiring HIV infection varies geographically, with MSM living in Paris and the larger Ile-de-France region having a nearly threefold increase in HIV risk acquisition.
The information is most limited for sex workers, trans women, trans men and migrants. Where data do exist, it is clear that the prevalence of HIV is higher than the general population \[[@CIT0009]--[@CIT0011]\]. Migrant women account for one in four new diagnoses in France each year but it is not entirely clear where they acquired their HIV and, when in France, whether this was from sex work, or from their partners who may be having sex with men without considering themselves to be gay, or from partners who migrated from countries with high prevalence. Nonetheless, within these populations, the offer of PrEP is likely to appeal most to individuals who recognize their risk, as was the case in PROUD and IPERGAY.
Service organization {#S0001-S20002}
--------------------
Public health services are highly variable across the region, ranging from open access to free services for HIV and STI testing and treatment through to access only with significant copayments or in the worst-case scenario extremely limited access to non-confidential and pejorative services. Healthcare is funded by the public sector through tax and social insurance contributions in most countries, with a small contribution from private insurance schemes (\<5%). In a few countries, including Germany and the Netherlands, healthcare is delivered by the public sector but funded mainly through insurance schemes and/or formal and informal copayments \[[@CIT0012]\]. Regardless of the model, expenditure on health in the European countries that belong to the Organization for Economic Co-operation and Development (OECD), particularly those in Southern Europe, is lagging behind other OECD countries and has been static or shrinking over the last five years, due to the economic crisis \[[@CIT0013]\].
Community-based organizations do offer HIV/STI screening in some settings, frequently tailored to key populations. These services collaborate for post-exposure prophylaxis as antiretroviral prescribing is only available from specialist services.
Discussion {#S0002}
==========
Estimating need {#S0002-S20001}
---------------
The two countries in which the PrEP trials were conducted, France and England, have attempted to estimate the need for PrEP among key populations. In the 2014 French report, there were 6600 new diagnoses of HIV: 42% in MSM (an increase of 5% compared to 2013), 23% among women and 16% among men born in foreign countries. Twenty-one per cent of those from sub-Saharan Africa were thought to have acquired HIV in France. This may be an underestimate, as the ANRS PARCOURS study found that 35% had acquired HIV after migration to France (30% of women and 44% of men) \[[@CIT0014]\]. Hardship was common among migrants from sub-Saharan Africa, with more than 40% living for at least one year without a residence permit and more than 20% with no stable housing. Women who reported hardship were also more likely to report casual and transactional partners. This observation may help services to identify heterosexuals who would benefit from PrEP.
Data from the UK are similar with 6151 new diagnoses in 2014. Although the majority (3360) was in MSM, 1460 heterosexual HIV infections were estimated as acquired in the UK by migrants living in the UK or by those born in the UK. Unfortunately, it is not yet clear how to identify the heterosexuals at risk who would benefit from PrEP. Late presentation among heterosexuals remains unacceptably high and efforts to increase testing in this population are a priority.
Having gathered robust evidence for clinical effectiveness in two randomized controlled trials in MSM, it is possible to identify the characteristics of MSM who would benefit from PrEP. Policy makers have used this information to estimate the likely size of each national PrEP programme to determine the budget impact. In France (66 million inhabitants in 2013), the MSM population is estimated to be around 330,000 persons \[[@CIT0015]\]. In a large anonymous cross-sectional survey conducted in 2011 in France, 20.8% of HIV-negative MSM reported no discernible risk reduction behaviour and can be considered at high risk of HIV acquisition \[[@CIT0016]\]. A seroprevalence survey in Paris found 17.7% of MSM to have HIV, so this suggests that about 50,000 MSM in France may need PrEP \[[@CIT0017]\]. According to the most recent national UK survey of attitudes to sex and lifestyles conducted between 2010 and 2012, 2.6% (95% CI 2.1--3%) of men aged 16 to 74 have had a same sex experience in the preceding five years. Although the majority self-identified as gay, 28% considered themselves to be straight and 19% bisexual \[[@CIT0018]\]. Applying 2.6% to the 2011 UK census estimate of 20 million men aged 15 to 64 suggests that there are 500,000 MSM in this age group. The sexual health clinic network sees 100,000 HIV-negative MSM at least once each year. Behavioural data from clinic surveys (unpublished data, Public Health England) suggest that half or more have had anal sex without a condom in the preceding six months. This generates a similar maximum number to France (50,000) although not all of these individuals may want or need PrEP, as a substantial proportion will be in a monogamous relationship with a concordant negative partner or a positive partner on treatment with undetectable viral load. In the United States PrEP has been available since 2012. Only 49,000 to 80,000 individuals have started PrEP in the United States among an overall population of 323 million with an estimated need among MSM of 492,000 (Grant R, personal communication). Further, a substantial proportion of the early adopters was women. Based on the US experience, a target of 50,000 MSM seems highly aspirational for France and the UK. If 50,000 MSM took PrEP for one year, the budget impact for drug alone would be €150M in the region to support an IPERGAY regimen and almost double to support a daily regimen.
For non-MSM populations, it is less clear who will come forward to access PrEP, what their likely incidence would be without PrEP and how effective PrEP will be. In England, estimated HIV incidence in Black African heterosexuals that access the sexual health clinics is higher than overall heterosexuals (0.17% per year compared to 0.03% in 2012) but still low. About 1000 heterosexual men and 1000 heterosexual women accessed PEP in 2012, and the numbers were similar in 2013.
Movement in the right direction {#S0002-S20002}
-------------------------------
The French authorities approved Truvada^®^ (TDF/FTC) under a recommendation for temporary use, effective from 4 January 2016. Truvada is fully covered by the healthcare system but visits and tests will be covered at the usual rate, which is 60% of costs reimbursed. This process is independent of the European Medicines Agency (EMA), was initiated under pressure from civil society and was supported by the Minister of Health for France, who agreed to fully reimburse the costs for drug.
Widespread concern about the possibility that PrEP would lead to a decrease in condom use and precipitate an increase in other STIs inspired the PROUD trial design to compare immediate access to PrEP to a delayed access after 12 months. There were differences in behaviour with a significantly higher proportion of PrEP users reporting 10 or more partners with whom they had had receptive anal sex without a condom in the preceding 90 days (21% immediate PrEP compared to 12% deferred) \[[@CIT0003]\]. However, there were no differences in the proportion who acquired other STIs. In reality, the rates of other STIs have been increasing for the last decade, driven largely by infections in HIV-positive MSM but accompanied by a steady increase in syphilis, gonorrhoea and chlamydia in HIV-negative MSM \[[@CIT0006],[@CIT0019]\]. The introduction of PrEP offers an opportunity to control STIs through regular asymptomatic screening, prompt treatment, and active notification and treatment of partners. Importantly, PROUD demonstrated that the efficacy of PrEP was not undermined by the presence of these other STIs.
The success of the two randomized trials and subsequent implementation of demonstration projects in Amsterdam and in Antwerp have strengthened the partnership between civil society and the medical community in Europe, broadly through the activities of the European AIDS Treatment Group and the EuroPrEP collaboration. The partnership between EATG members and the EuroPrEP clinicians started at the country level around the trials, for example the role of AIDES in the French IPERGAY trial, and the Community Engagement Group that supported PROUD. To date, the European partnership has been concentrated in the countries of Western Europe, but it will be important to expand and support countries in Eastern Europe and central Asia as they embark on demonstration projects or national programmes. A common problem for all countries is the cost of the drug which makes large-scale national PrEP programmes look unaffordable. This is the underlying reason that the PrEP policy has stalled in England and Wales, where the National Health Service is only willing to contribute £2M to the early implementation activities. The EuroPrEP collaboration wrote to Gilead Sciences, the sole source of Truvada^®^ for European governments, on 1 December 2015 with two requests: first that Gilead submit to the EMA as regulatory approval is considered essential for national policy in some countries, and second that they consider reducing the price of drug. Gilead has now submitted to the EMA. While we are not aware of any reductions in the cost of the drug, the company is clearly willing to negotiate at the country level as demonstrated by Portugal and Georgia, where hepatitis C treatment is being fully implemented.
Residual barriers and solutions {#S0002-S20003}
-------------------------------
A key challenge for Europe is to meet the needs of other high-risk groups, particularly migrants, for whom the links with community-based organizations and the healthcare system are much lower than for MSM.
While those that purchase health care are concerned that uptake will be higher than planned, advocates and clinicians recognize the reality that many of those in need will not take up the offer of PrEP, especially young MSM aged 15 to 24 -- a group in whom the number of new diagnoses has more than doubled since 2003. Their health-seeking behaviours differ considerably from older MSM, and health promotion efforts, as well as services, need to adapt and innovate to meet their needs. An important modification to services will be to build on the partnerships developed during the trials and shift tasks away from clinicians and hospitals towards community-based organizations which are more acceptable venues for individuals who do not consider themselves to be "patients."
The two major components driving cost-effectiveness are the price of drug and HIV incidence \[[@CIT0020]\]. PrEP is cost saving at the incidence rates reported in the two trials, but barely cost-effective as a daily regimen when the national incidence rates are applied over an 80-year time horizon \[[@CIT0021]\]. The event-driven, on-demand regimen used in IPERGAY and recommended for MSM by the European AIDS Clinical Society \[[@CIT0022]\], utilized about half the amount of drug required to support a daily regimen, equating to a 50% reduction in price. The US Centre for Disease Control and Prevention \[[@CIT0023]\] and WHO \[[@CIT0024]\] do not yet recommend this regimen, but guidelines are likely to be revised as evidence gathers from the European studies. Importantly, TDF/FTC could be available from generic manufacturers in 2017 and European countries should encourage manufacturers to prepare for large-scale demand for this drug, which is also popular as a treatment option.
Assuming the issue of drug costs can be resolved, there are additional requirements to implement a combination prevention strategy incorporating PrEP. This includes raising awareness of PrEP with information campaigns aimed at the "late majority and the laggards," and building capacity to deliver prevention and care in a more integrated service than currently exists in most countries. This will require political will from government, purchasers and providers of services but could be done by strengthening partnerships and empowering a broader range of providers to undertake screening with minimal additional funding. Governments may need to see a demonstration of these partnerships to be convinced that it is easy to accommodate PrEP within existing reconfigured services. Over the last few years, there has been diminishing investment in civil society and this trend needs to be reversed if we are to effectively raise awareness of PrEP and promote a holistic approach to prevention, which starts with a HIV test. Scaling up and normalizing HIV testing will be critical for countries where HIV has spilled into the general population.
An important starting point for Europe is to strengthen the role and scope of the European Centre for Disease Control and Prevention. This organisation has the data, albeit limited, and is best placed to advise individual countries on the model of prevention and care to adopt.
Conclusions {#S0003}
===========
There has never been a better time to advocate for strengthening prevention services and increasing access for key populations with increased risk of acquiring HIV and other sexually transmitted and blood-borne infections. These populations are invariably vulnerable, with other health and social care needs. Screening is at the core of this and services need to increase throughput, taking advantage of innovations in self-sampling, self-testing and community-based testing. Governments should be confident of success. With political will, the epidemic trends in Europe could be reversed.
Competing interests
===================
SMC has received research grants from Gilead, and fees have been paid by Gilead to UCL for her attendance at an Advisory Board and various invited talks. J-MM has received research grants from Gilead and Merck and has participated in advisory boards for Gilead, Merck, Janssen, Bristol Myers Squibb and ViiV.
Authors\' contributions {#S0004}
=======================
SMC created the first draft, and J-MM and VN commented and expanded. SMC created the final draft and submitted the manuscript. All authors have read and approved the final version.
| tomekkorbak/pile-curse-small | PubMed Central |
Rainbow (Mariah Carey album)
Rainbow is the seventh studio album by American singer and songwriter Mariah Carey. It was released on November 2, 1999, by Columbia Records. The album followed the same pattern as Carey's previous two albums, Daydream (1995) and Butterfly (1997), in which she began her transition into the urban market. Rainbow contains a mix of hip hop-influenced R&B jams, as well as a variety of slow ballads. On the album, Carey worked with David Foster and Diane Warren, who, as well as Jimmy Jam & Terry Lewis, replaced Walter Afanasieff, the main balladeer Carey worked with throughout the 90s. As a result of her separation from her husband, Tommy Mottola, Carey had more control over the musical style of this album, so she collaborated with several artists such as Jay-Z, Usher, and Snoop Dogg, as well as Missy Elliott, Joe, Da Brat, Master P, 98°, and Mystikal.
On Carey's previous album, Butterfly, she began incorporating several other genres, including R&B and hip hop, into her musical repertoire. In order to further push her musical horizons, Carey featured Jay-Z on the album's lead single, the first time in her career that another artist was featured on one of her lead singles. Carey wrote ballads that were closer to R&B than pop for this album, and worked with Snoop Dogg and Usher on songs such as "Crybaby" and "How Much," both of which featured strong R&B beats and grooves. Several of the ballads that Carey wrote during this period, including "Thank God I Found You" (written with Terry Lewis) and "After Tonight" (written with Diane Warren), mirrored sentiments she experienced in her personal life.
Five singles were released from the album, two of which became number-one hits on the Billboard Hot 100 chart, making Rainbow her seventh-consecutive studio album to produce a number-one song. The album's lead single, "Heartbreaker" featuring Jay-Z, became Carey's fourteenth number-one hit on the Hot 100, and topped the charts in Canada, New Zealand, France and Spain. "Thank God I Found You," featuring Joe and 98 Degrees, also topped the Hot 100, but achieved moderate international charting. The next two singles, "Can't Take That Away (Mariah's Theme) and "Crybaby" featuring Snoop Dogg, were released as a double A-side. The songs were at the center of a public feud in between Carey and Sony due to Sony's alleged weak promotion of the singles. Carey's cover of Phil Collins' "Against All Odds (Take a Look at Me Now)" with Westlife peaked at number one in Ireland and the United Kingdom.
Rainbow was well received by critics, who generally praised Carey's embrace of R&B and hip hop in her music. The album debuted at number two on the Billboard 200, with first week sales of 323,000. It was her first album in years to not reach number one. However, within a month, Rainbow was certified triple-Platinum by the Recording Industry Association of America (RIAA), denoting shipments of three million copies within the United States. Internationally, the album debuted atop the charts in France, and within the top five in Australia, Austria, Belgium, the Netherlands, Germany, Japan, and Switzerland. The album has sold an estimated eight million copies worldwide.
Background
Since her debut in 1990, Carey's career was heavily calculated and controlled by her husband and head of her label Sony Music Entertainment, Tommy Mottola. For years, Carey's albums had consisted of slow and meaningful ballads, devoid of any guest appearances or hip hop-influenced melodies. In January 1995, as she recorded Daydream, Carey began taking more control over her musical style and genre influences. She enlisted the production skills and rap styles of Ol' Dirty Bastard, who was featured on the remix of her song "Fantasy." While Mottola was hesitant at first, Carey's persistence paid off when the song became an international chart topper, with critics calling the collaboration one of the pioneering songs of pop and R&B musical collaborations.
During the recording and production of Carey's Butterfly in 1997, she and Mottola separated, giving Carey an extended amount of control over the unfinished album. Following their separation, Carey began working with younger hip hop and R&B producers and songwriters, aside from her usual work with balladeers Walter Afanasieff and Kenneth Edmonds. While the album incorporated several different genres and components that were not present in Carey's previous releases, Butterfly also included a balance of her classic ballads and newer R&B-infused jams. While Sony accepted Carey's new collaborations with writers and producers such as P. Diddy and Bone Thugs-n-Harmony, they continued to focus their promotion on the ballads. After "Honey," the debut single from Butterfly, was released in August 1997, Sony halted the release of the succeeding R&B-influenced jams, and released the ballad "My All" as the second worldwide single. Rainbow followed in its predecessors' footsteps, featuring even more hip hop and R&B.
Writing and recording
During the spring of 1999, Carey began working on the final album of her record contract with Sony, her ex-husband's label. Carey's lover at the time, Luis Miguel, was in the midst of a European tour. In order to spend more time with him, she opted to record the album on the secluded island of Capri, Italy, figuring the seclusion would also help her complete the album sooner. During this time, Carey's strained relationship with Sony affected her work with writing partner Afanasieff, who had worked extensively with Carey throughout the first half of her career. Aside from their growing creative differences, Mottola had given Afanasieff more opportunities to work with other artists. She felt Mottola was trying to separate her from Afanasieff, in hopes of keeping their relationship permanently strained. Due to the pressure and the awkward relationship Carey had now developed with Sony, she completed the album in a period of three months in the summer of 1999, quicker than any of her other albums. In an interview with Blitz TV, Carey spoke of her decision to record the album in Capri:
I love New York. But if I'm there, I want to go out, friends come to the studio, the phone rings constantly. But in Capri, I am in a remote place, and there is no one I can run into. I felt that in Capri I would be able to effectively finish the album on a shorter schedule. And I did. I made it in three months, I was like 'Get me off this label!' I couldn't take it. The situation there [Sony] was becoming increasingly difficult.
Like her previous releases, Carey co-wrote and co-produced the album's material, working with several hip hop and R&B producers such as Jay-Z, Jimmy Jam and Terry Lewis, Usher, Snoop Dogg, Missy Elliott, Jermaine Dupri, and Brian Michael Cox. For the album's debut single release, Carey collaborated with Jay-Z and DJ Clue. During the spring of 1999, Carey began working with Clue on several hooks and melodies for the lead single. After a few hours, they decided to include a hip hop star on the track, which eventually led to Jay-Z. Carey's longtime friend and back-up vocalist Trey Lorenz, who was featured on her remake of the Jackson 5 song "I'll Be There," added "some soft male [back-up] vocals." Carey worked with Lewis and Jam on the ballad "Thank God I Found You." She had already been in the studio with the duo several times when she contacted them to meet her at the studio, where she told them that she had come up with the title, hook, and melody. Usually, when Carey was writing the songs for Rainbow, James "Big Jim" Wright would play the organ or piano and assist Carey to find the "right melody." However, since Wright was not present, Lewis played the organ while Carey directed him with her lower registers, providing the chord progression. They composed the song and recorded Carey's vocals. Knowing she wanted to introduce a male vocalist on the track, Lewis brought R&B singer Joe and pop group 98 Degrees into the studio. After a few hours, the group and Joe had recorded all their vocals and the song was complete. In an interview with Bronson, Lewis discussed the night Carey wrote "Thank God I Found You:"
It all happened that night. She told us the title of the song, the concept and sang us the melody. We usually have Big Jim Wright sit in on those kind of sessions to work out the chords. he wasn't there so I had to work on the chord myself. So I was playing and there was a part where I said 'Man, what chord am I supposed to do here?' and Mariah has such a good ear that she sang me the chord.
While the album was immersed further into mainstream R&B territory, Carey included some of her classic ballads and tender love songs on the album, working with writers and producers such as David Foster and Diane Warren. The idea to work with Warren was suggested by Foster, who thought that the two would be able to "hammer out one hell of a ballad" together. The two wrote and produced the song titled "After Tonight." Carey felt the song was a perfect metaphor for her relationship with Miguel, describing their romance in Capri. While the song was deemed a success by both parties, they described their working relationship with mixed feelings. According to Foster, who was involved in the writing session, Carey and Warren would not always agree on the lyrics and melodious structure of the song. He described it as a "give and take relationship"; Warren would offer lyrics and Carey would not like them; she wanted something more intricate and detailed. Carey would produce a hook or lyrics that Warren did not feel were a perfect fit. In the end, Foster felt that they worked "well together." After recording the song, Carey invited Miguel to record the song with her as a duet. However, after recording his verses several times, Foster and Carey realized that the song would not turn out the way they planned. Foster said the song's key was "too high for him"; the voices did not harmonize well. Carey did not have time to re-record her vocals in a lower key to accommodate Miguel's verses. Miguel, furious over the failed collaboration, later sent a cut-up tape of the demo to Foster. Carey, Warren, and Foster also wrote "Can't Take That Away (Mariah's Theme)," one of the other ballads featured on Rainbow.
Music and lyrics
As with Butterfly, songs for Rainbow were chosen to solidify Carey's reputation as a multi-genre artist. Throughout the first phase of her career, Carey's albums predominantly consisted of pop and adult contemporary ballads. Rainbow mixed hip hop and R&B-flavored upbeat songs with softer and lyrically intense ballads resembling those that Carey had previously recorded. "Heartbreaker," Carey's first collaboration with Jay-Z, used a sample from "Attack of the Name Game," recorded by Stacy Lattisaw, as its hook. The loop originated from "The Name Game" by Shirley Ellis; Ellis and co-writer Lincoln Chase are credited as songwriters on the track. Carey incorporated the hook into the song's melody, and added instrumentation. Lyrically, the song chronicles the heartbreak the protagonist feels after learning of her lover's infidelity. "Thank God I Found You" features vocals from Joe and 98 Degrees, as well as songwriting and production from Carey and Lewis. According to Carey, the song reflects on events in her own life at the time, with the lyrics describing the completion the protagonist feels after "finding" their lover. Joe provides the main male vocal throughout each verse, and 98 Degrees sing the background vocals and the bridge.
Prior to the album's recording, Mariah and her sister, Alison Carey had a falling out in their relationship. Alison had contracted AIDS in 1988, when she was 27, and in 1994 she blamed Mariah for many of her problems and heartbreaks throughout the years. Her children were taken away while she received treatment for AIDS and for mental health issues. Carey wrote a song titled "Petals," which she describes as the most honest lyrics she has ever written. The song tells of Carey's feelings for her sister, while illustrating the pain Allison's betrayal and suffering have caused. In an interview with Bronson, Carey described the meaning of the lyrics of "Petals":
It is a great outlet for me to go into the studio and write a song like 'Petals', which is one of my most personal songs and remains one of my favorites. I think [it had the most] honest lyrics I've ever written. The song chronicles a lot of past emotions I've felt to certain people close to me, and the way I feel towards them and how their actions have impacted me personally. For that reason, I sang in my lower registers, trying to add that breathy effect to go hand in hand with the song's composition.
"After Tonight" was a song Carey wrote with David Foster and Diane Warren. Carey had strong feelings about the song, as she wrote it about her relationship with Luis Miguel. The song was compared instrumentally to "My All" from Butterfly, which features traces of Latin and guitar instrumentation. In the lyrics, the protagonist asks her lover if he will still love her and come back to her "after tonight." Carey's cover of the Phil Collins song "Against All Odds (Take a Look at Me Now)" was originally intended to be a solo ballad. The song was re-done after the album was released, with music by the Irish band Westlife replacing the song's instrumental bridge. "Can't Take That Away (Mariah's Theme)" was one of the album's most uplifting ballads, lyrically serving as an anthem for fans and listeners. The message, Carey said, was a personal theme of hers growing up, of not letting others "bring her down" and not allowing them to take away the light inside her.
"How Much" is a duet with Usher and features a sample from Tupac Shakur's "Me and My Girlfriend."
Conflict with Sony
As with Butterfly two years earlier, Rainbow became the center of conflict between Carey and her label. After her divorce from Sony record official and Columbia CEO Tommy Mottola, Carey's working relationship with the label deteriorated. She intended for "Can't Take That Away (Mariah's Theme)" to be the third single from Rainbow, as it held very personal lyrical content. However, Sony made it clear that they intended the third single should be a more upbeat and urban track. The difference in opinion led to a very public feud, as Carey began posting messages on her webpage in early and mid-2000, telling fans inside information on the dispute, as well as instructing them to request "Can't Take That Away (Mariah's Theme)" on radio stations. One of the messages Carey left on her page read:
Basically, a lot of you know the political situation in my professional career is not positive. It's been really, really hard. I don't even know if this message is going to get to you because I don't know if they want you to hear this. I'm getting a lot of negative feedback from certain corporate people. But I am not willing to give up.
Carey's actions were given mixed reception, with critics and executives commending her bold actions regarding a song she felt needed to be heard, while others criticized her for publicizing the dispute further. Soon after, Sony stripped Carey's webpage of messages and began negotiations. Fearing to lose their label's highest seller and the best-selling artist of the decade, Sony chose to release the song. Carey, initially content with the agreement, soon found out that the song had only been given a very limited and low-promotion release, which meant the song failed to chart on the official US chart, and made international charting extremely difficult and unlikely.
Promotion
Prior to the album's release, Carey made an appearance on Pavarotti & Friends for Guatemala and Kosovo, performing "My All" and "Hero" alongside Luciano Pavarotti in a live duet. The concert benefit was filmed live in Modena, Italy, during the summer of 1999 and was released for sale on September 21, with funds being donated to relief efforts for natural disasters in Guatemala and Kosovo. Carey made several live television and award show appearances at this time, and recorded her own Fox Broadcasting Company special, titled The Mariah Carey Homecoming Special. A mini-concert filmed at Carey's old high school in Huntington, New York, the special aired on Fox on December 21, 1999. Carey performed "Heartbreaker" and its accompanying remix at the MTV European Music Awards, held on November 11, 1999, in Dublin, Ireland. Additionally, the song was performed on The Oprah Winfrey Show, the British music chart program Top of the Pops, and The Today Show, which included a performance of "Can't Take That Away (Mariah's Theme)" and "Hero." "Thank God I Found You was performed live at the 2000 American Music Awards as well as on several European programs, including Top of the Pops and Friday Night's All Wright in the United Kingdom, NRJ and Soulier d'Or in France, Wetten, dass..? in Germany, and Quelli che... il Calcio in Italy. The album's final two releases, "Can't Take That Away (Mariah's Theme)" and "Against All Odds (Take a Look at Me Now)," were performed on The View and at the 2000 Blockbuster Entertainment Awards.
In order to promote Rainbow, Carey embarked of her fourth headlining and third worldwide tour. Titled the Rainbow World Tour, it included nineteen shows: six in Europe, four in Asia, eight in the United States, and one in Canada. For Carey's previous two tours, she had only visited Europe and Asia, due to the mixed reception of her debut stateside tour in 1993. However, after achieving record-breaking ticket sales throughout Asia and instant sellouts in Europe, Carey felt secure enough to once again tour her native country. The set list featured songs from most of Carey's previous studio albums, as well as some tracks from Rainbow. Missy Elliott and Da Brat served as opening acts for the US leg of the tour. Ticket sales were very strong; the entire US leg sold out in a matter of days. The Asian and European leg mirrored the commercial success of her previous two tours. Reviews for the tour varied from positive to mixed. Some critics and fans reproached her of having a "tired and hoarse voice," while others commented on Carey's choice of wardrobe. Several critics and many concert-goers praised the tour, calling it an intense celebration of Carey's career.
Singles
Five singles were released from Rainbow; two were worldwide international releases and three were limited promotional releases. "Heartbreaker," the album's first worldwide release, became Carey's fourteenth chart topper in the United States. Aside from staying atop the US chart for two weeks, the song reached the chart's summit in Canada and New Zealand. Elsewhere, "Heartbreaker" achieved high charting, peaking within the top five in France and the United Kingdom, and within the top ten in Australia, Belgium, the Netherlands, Germany, and Switzerland. The song received mixed reviews from critics. Arion Berger from Rolling Stone called the song Carey's "most insinuating: nasal, silken, declarative, riding the percolating beat." However, while dismissing some of the song's vocals and the incorporation of the hook, he complimented its marriage of pop and hip hop through Jay-Z's verses. The song's music video became one of the most expensive music videos of all time, costing an estimated $2.5 million. The video features Carey visiting a movie theater with her friends, where she finds her lover with another woman. "Thank God I Found You" was released as the second worldwide single from the album. While becoming Carey's fifteenth chart topper in the US, the song achieved moderate chart success in Europe and other territories. Berger called it a "gospel soar" and complimented Carey's vocals, as well as the harmonies by 98 Degrees. The music video features footage from a live concert with Carey and the band performing the song.
"Crybaby" and "Can't Take That Away (Mariah's Theme)" were released simultaneously as a double A-side, with very limited promotion from Sony. These two songs, especially the latter, became the center of a very public controversy between Carey and her label, due to their alleged low promotion of the album. Carey and Snoop Dogg were featured in the music video for "Crybaby," with Carey playing an anxious woman who can't sleep at night due to her lover's infidelity. A music video for "Can't Take That Away" was released around the same time, which features Carey on a rooftop garden. Carey sings during a rain storm, and towards the video's conclusion, the sun arises, bring forth a "new day." The final single from Rainbow, "Against All Odds (Take a Look at Me Now)," was given a limited release as well. After performing moderately around the world, a new version of the song, featuring Westlife, was released in Ireland and the United Kingdom. It became successful there, peaking at number one in both territories, and became Carey's second UK chart topper. The song's video features Carey and Westlife on a boat in Capri. Scenes of the group exploring the island are cut with scenes of them in the studio, though Carey never re-recorded her vocals from the original version.
Critical reception
Rainbow received positive reviews from critics, many of whom noted the new direction in Carey's music. In Entertainment Weekly, Danyel Smith wrote that "what began on Butterfly as a departure ends up on Rainbow a progression – perhaps the first compelling proof of Carey's true colors as an artist." Arion Berger from Rolling Stone viewed it as a genuine R&B and hip hop album, a "sterling chronicle of the state of accessible hip-hop balladeering at the close of 1999." Aside from calling some of the ballads "banal," Berger concluded his review that "Rainbow is at its best—and Carey at her most comfortable—when urbane hip-hop stylings and faux R&B coexist in smooth middle-of-the-road harmony." Elysa Gardner from the Los Angeles Times wrote in her review: "Exhibiting an emotional authority to match her technical prowess, Carey gives us a vision of love that's dynamic without being ostentatious." Steve Jones from USA Today deemed the record "colorful" and "some of her most compelling work." Village Voice critic Robert Christgau gave the album a two-star honorable mention, indicating a "likable effort consumers attuned to its overriding aesthetic or individual vision may well enjoy." He cited "Heartbreaker" and "Crybaby" as highlights while writing that Carey was "not a 'real' r&b thrush, but good enough to fake it."
Amy Linden from Vibe was less impressed by the album, particularly the songs on which Carey sings over hip hop samples or alongside guest rappers, deeming it a commonplace formula--"pairing a singing thrush with a rhyming thug." Stephen Thomas Erlewine from AllMusic said it was "the first Carey album where she's written personal lyrics, and allusions to her separation from Mottola." He called the lyrics "true" and "deep," but found the songs "ballad-heavy" and "repetitious," adding that the album followed the formula of Carey's previous records too precisely. In his opinion, "it would have been a more effective album if the heartbreak, sorrow, and joy that bubbles underneath the music were brought to the surface."
Commercial performance
Rainbow debuted at number two on the Billboard 200 chart with 323,000 units sold, the highest first-week sales of Carey's career at that time. In its second week, the album stayed at number two, selling an additional 228,000 copies, barred from the top by Faith Hill's Breathe. In its eighth week, Rainbow experienced its highest weekly sales—during the Christmas week of 1999—selling 369,000 copies, while placing at number nine. It became Carey's first studio album since Merry Christmas (1994) to not reach the top position in the United States. In total, Rainbow stayed in the top twenty for ten weeks and on the chart for thirty-five, making one re-entry. It was certified triple-Platinum by the Recording Industry Association of America (RIAA), denoting shipments of three million copies throughout the United States. According to Nielsen SoundScan, the album's sales in the US are estimated at 2,968,000 copies. In Canada, Rainbow debuted at number two on the Canadian Albums Chart, and was certified triple-Platinum by the Canadian Recording Industry Association (CRIA). Sales in Canada are estimated at 300,000 units.
Rainbow debuted at number three on the Australian Albums Chart, staying within the chart for seven weeks. The album was Platinum by the Australian Recording Industry Association (ARIA), denoting shipments of 70,000 copies. In France, the album experienced strong success, debuting atop the albums chart and remaining inside the top forty for thirty-four weeks. The album was certified triple-Platinum by the Syndicat National de l'Édition Phonographique (SNEP), with estimated sales of 900,000 copies. In Germany, Rainbow peaked at number three, and received a Platinum certification from the Bundesverband Musikindustrie (BVMI), denoting shipments of 500,000 units. in the United Kingdom Rainbow debuted at number eight and stayed within the top 100 for 20 weeks. Rainbow was certified Platinum by the British Phonographic Industry (BPI), denoting shipments of 300,000 units. Additionally, Rainbow received Platinum certification in Brazil, with 250,000 copies, Platinum in New Zealand, triple-Platinum in Spain, Platinum in Argentina, Gold in Belgium, Platinum in the Netherlands, and Gold in Switzerland. The album has sold an estimated eight million copies worldwide.
Track listing
Notes
"Heartbreaker" contains a sample of "Attack of the Name Game" by Stacy Lattisaw.
"How Much" contains a sample of "Me and My Girlfriend" by Makaveli.
"Heartbreaker (Remix)" contains a sample of "Ain't No Fun (If the Homies Can't Have None)" by Snoop Dogg.
"Against All Odds (Take a Look at Me Now)" is a cover of "Against All Odds (Take a Look at Me Now)" by Phil Collins.
"Crybaby" contains samples of "Piece of My Love" by Guy and "Georgy Porgy" by Toto.
"Did I Do That?" contains a sample of "It Ain't My Fault 2" by Silkk the Shocker.
Personnel
Personnel
Mariah Carey – lead vocals, songwriting, background vocals
David Foster – keyboard, songwriting
Diane Warren – songwriting
Narada Michael Walden – guitars, programming
Bryan-Michael Cox – bass, keyboards
Jermaine Dupri – programming, percussion
James "Big Jim" Wright – keyboard, bass
Terry Lewis – synthesizers, keyboards, rhythm programming
James Harris III – synthesizers
Trey Lorenz – background vocals
Cindy Mizelle – background vocals
Melonie Daniels – background vocals
Kelly Price – background vocals
Shanrae Price – background vocals
Production
Mariah Carey – arranger, producer
David Foster – arranger, producer
Diane Warren – arranger
Jermaine Dupri – arranger, producer
Narada Michael Walden – producer
Terry Lewis – arranger, producer
James Harris – producer
Bryan-Michael Cox – producer
Melissa Elliott – producer
Calvin Broadus – producer
Shawn Carter – producer
DJ Clue – arranger, producer
Charts
Weekly charts
Year-end charts
Certifications and sales
See also
List of best-selling albums in Brazil
References
Works cited
Category:Mariah Carey albums
Category:1999 albums
Category:Albums produced by Bryan-Michael Cox
Category:Albums produced by David Foster
Category:Albums produced by Jimmy Jam and Terry Lewis
Category:Albums produced by Jermaine Dupri
Category:Columbia Records albums
Category:Albums produced by DJ Clue? | tomekkorbak/pile-curse-small | Wikipedia (en) |
Q:
Correct way to Synchronize Methods in Java
I have a sample class:
public class LocksAndSynchronization {
private Object lock1 = new Object();
private Object lock2 = new Object();
static int count;
public void methodOne() {
for (int i = 1; i <= 10000; i++) {
count++;
}
}
public void methodTwo() {
for (int i = 1; i <= 10000; i++) {
count++;
}
}
public synchronized void process() {
methodOne();
methodTwo();
}
public static void main(String[] args) throws InterruptedException {
final LocksAndSynchronization l = new LocksAndSynchronization();
Thread t1 = new Thread() {
@Override
public void run() {
l.process();
}
};
Thread t2 = new Thread() {
@Override
public void run() {
l.process();
}
};
t1.start();
t2.start();
t1.join();
t2.join();
System.out.println("count: " + count);
}
}
process() actually makes a call to both the methods. So which is a better approach?
Synchronize methodOne and methodTwo or,
Synchronize process() (as done in the code above) ?
Both of the above options would work. But which of them makes more sense?
A:
count is static, so it is same for all object. so you need to syncronize process static way. to do that, create a static lock and use it
static Object staticObject = new Object();
public void process() {
synchronized( staticObject){
methodOne();
methodTwo();
}
}
or you can synronize methodOne and methodTwo
static Object staticObject = new Object();
public void methodOne() {
synchronized( staticObject){
for (int i = 1; i <= 10000; i++) {
count++;
}
}
}
public void methodTwo() {
synchronized( staticObject){
for (int i = 1; i <= 10000; i++) {
count++;
}
}
}
moreover, using synchronize keyword in function declaration, it means using object itself as lock. so, if you have multiple object, you block is synchronized according to object.
| tomekkorbak/pile-curse-small | StackExchange |
Relational Aggression in Adolescents with Conduct Disorder: Sex Differences and Behavioral Correlates.
As most research on conduct disorder (CD) has been conducted on male participants, it has been suggested that female-specific symptoms may be underestimated based on current DSM-5 criteria. In particular, relational aggression, i.e. the hurtful, often indirect, manipulation of relationships with the intention of damaging the other's social position, has been proposed as a characteristic of CD that is more common in females. In addition, sex-specific studies on correlates of relational aggressive behavior are lacking. Relational aggression may be strongly related to the correlates of proactive aggression, namely low affective empathy, and high levels of callous-unemotional (CU) traits and relational victimization. Thus, the present study investigated sex differences in relational aggression, and associations between relational aggression and correlates of proactive aggression in 662 adolescents with CD (403 females) and 849 typically-developing controls (568 females) aged 9-18 years (M = 14.74, SD = 2.34) from the European multi-site FemNAT-CD study. Females with CD showed significantly higher levels of relational aggression compared to males with CD, whereas no sex differences were seen in controls. Relational aggression was only partly related to correlates of proactive aggression in CD: Independent of sex, CU traits showed a positive association with relational aggression. In females only, cognitive, but not affective empathy, was negatively associated with relational aggression. Relational victimization was more strongly associated with relational aggression in males compared to females. Despite interesting sex specific correlates of relational aggression, effects are small and the potential clinical implications should be investigated in future studies. | tomekkorbak/pile-curse-small | PubMed Abstracts |
NEVILLE & SUGARY STAPLE VIDEO PREMIERE!
Former Special NEVILLE STAPLE and co-conspirator SUGARY STAPLE have a brand new video out, which they’re premiering exclusively with Vive Le Rock!
‘Way Of Life’ is taken from the pair’s new album Rude Rebels which is out now through Cleopatra.
Produced by Sugary and Neville alongside Specials producer Tom Lowry at Planet Studios, Coventry, the album also sees them reunited with another former Specials alumnus, Roddy Radiation aka Roddy Byers on guitar.
“The album was produced with our love of punk, ska, 2tone and reggae, which we mixed into an indulgent sub-culture blend. A bit like me,” says Sugary Staple. “Working alongside Neville on the production was just perfect. He gets me, and he understands where I am at musically and about my promotion of women going for it, regardless of age and situation. We both still have something to say in our productions, while still creating a dancing beat or a sing-along vocal.”
“I felt really free on this production,” adds Neville. “Having the freedom to be creative with someone on your wave-length is really refreshing for me. I love how we celebrate the great musical genres of my 40-year career. There’s a little taste of The Specials in there, a Clash type of punk vibe and even Trojan Records styles. We’ve been touring some of the songs and the fans have gone nuts for it. Great to have my buddy Roddy on board too.”
Rude Rebels is available on CD and limited edition clear black’n’white splatter vinyl from Cleopatra and digitally via Bandcamp. | tomekkorbak/pile-curse-small | Pile-CC |
Why security operatives need to stand up for themselves
“Security staff are not human punch bags, they are employees placed in vulnerable positions by the nature of a high risk role. It doesn’t mean they shouldn’t be protected”. I spoke these exact words in a High Court this year in response to a question from a barrister. I was giving evidence as an expert witness in the High Court in a personal injury case taken against a venue by a customer. The customer struck a security staff member and was removed using reasonable force. His barrister was questioning me on the actions of the security staff upon being struck. He felt they were excessive and I did not. His question to me was “surely as a person working in security you can expect from time to time to deal with this type of incident. Part of the job as one might say”. I stayed professional during my evidence (and because I knew he was just doing his job) but I will admit I was offended by this question. In this article I want to talk about this perception and what I believe security staff should do to change this image.
If I’m honest this perception of security staff really annoys me (language toned down here) . I’ve stood there like many of you and had people shout, scream, spit, punch, kick and bite me because of my job. It’s horrible and degrading and nobody should be subjected to it. I also know that there are many occupations who are worse off than we are and I don’t want to give the impression that we are any worse than many others. The reality is that in many cases we can look after ourselves but that’s not the point. It’s hard to pinpoint what exactly has led to this perception. I think the industry itself has to take some of the blame ourselves. For too long it has become normal for this to happen. Of course we encounter risk and that’s part of the job but we have to get better at protecting ourselves before during and after an incident.
Before an incident
Self protection starts long before an incident happens. It starts with knowing what your role is and where that role ends. It also includes knowing the law and what you can and cannot do. There are so many experienced and inexperienced security staff that I meet and who post comments on my page who are working in the industry and have no idea of the law relating to their role. They have developed things that work for them over the years and have never been told any different. Some of these things are not only not advisable but they are illegal. Do some research or at least ask the question.
Next and most importantly is to start standing up for yourself. For an industry full of supposedly tough people why do we (and I include myself in this because I’ve done it many years ago) let employers and managers walk all over us? Its not like there isn’t alternative ‘good’ security work out there for people or alternative employment. If you are standing alone on a fast food restaurant at midnight you are not being a tough guy you are being an idiot. If you show up to work on St Stephens Day for €10 or €11 per hour and no premium then that is your fault for showing up not your employer. You have legal rights and you are a big boy/girl . Stand up for yourself. If that is how lowly you value your service then that is how others will treat you. Same goes for working short-staffed or working with broken or no equipment. If you let people play games with your safety that’s as much your fault for accepting it is theirs for not valuing your safety.
Communicate all of this to others. If you learn something new (like a new law or case study) or if you are unhappy with how you are being treated then tell your colleagues. It makes everybody better off. I can guarantee you that those few employers who take advantage of staff by underpaying or not looking after staff safety wouldn’t be long in changing their tune of nobody would come to work in those conditions.
During an incident
One of my favourite sayings is “You don’t rise to the level of your expectation to fall to the level of your training”. I think it was by an ancient Greek poet called Archilochus. This is whats going to happen during an incident. Whatever you have practiced for is going to come to the fore in a less than perfect way and hopefully get you through safely. That is the reality. It’s all very well me talking on here from the comfort of my keyboard about bearing in mind the use of force principles and situational awareness but the reality is that if you haven’t trained and applied those principles over and over again in lower risk incidents and scenarios then it isn’t going to work when a high risk scenario happens.
What I am trying to say is that you need to be practicing situational awareness in all of the low risk arguments, and interactions you have so that it applies when you need it most under pressure. A useful drill I use in scenario based training is to consider how every incident looks to a person standing 30 feet away with a camera phone who has no idea what they are looking at. That’s the perspective that a bystander will see and its generally what CCTV will see as well, both of which are going to be used to judge your actions afterwards. Its your job not just to deal with the incident put to paint the best picture you can of your actions. Try to remain detached (difficult I know) and not leave yourself open to disciplinary or legal action. If an organisation or employer is being sued or suffering adverse social media attention which is effecting business the most logical response is to scapegoat the individual. Don’t let your own actions feed into that and give anybody an easy solution to their problem.
Simple drills
There are some drills I use in training to make people more aware of this. I’ll give two examples below:
Set up a scenario such as a removal or an arrest where force options have to be considered and physical intervention may be required. Run the scenario through to its end. Then immediately ask the person acting the security role to provide a verbal report of their actions and why they chose those actions. It gets people into the habit of thinking through the use of force scenarios while under small levels of stress and getting the logical brain to kick back in again immediately after an incident. Set up a series of scenarios for each person on the course in small groups and run them through. Use a video recorder at a distance on a tripod to record the scenarios as they unfold. The people in the scenario need to make themselves aware of the camera position and take it into account. For each small group move the video camera to another area of the of the room to get a different angle. Once the scenarios end play back the footage and get the group to critique the incident from the perspective of a bystander or person watching on CCTV. Sometimes I will turn the audio off for this part. It makes people much more situational aware of things like their body language and demeanor during an incident and how they can leave themselves open to all sorts of injuries and claims during an incident.
After the incident
I tend to look at post incident protection from two perspectives. The first is the self-protection aspect in terms of reporting and justifying your actions and preventing any employment or legal issues. The second is the deterrent factor which I believe is sorely lacking in the industry.
Post incident self-protection
I have another saying (your probably getting sick of my sayings at this stage) which I use all of the time during training. In general when security staff have to use physical force there is a good reason for it. What normally lands them in trouble is two things:
How the incident looks How they explain the incident afterwards
We already looked at the first criteria in the section above and now I want to look at the second part. The correct reporting of an incident can save your job and your long-term future in the industry but so often we don’t do it correctly. We deal with the incident and still full of adrenaline we give a full account of our actions to a manager, colleague, bystander or Garda. I’ve been in a retail security situation where I was attacked and spat at by a drug user. Gardaí were called and the person was removed. The manager at the time approached me and their first words were to make sure I did my report before I finished my shift as they would need to send it to Head Office. I politely (slightly exaggerated) told her where to go for her report. You first consideration after an incident is your own physical and mental well-being. If you need medical attention get it, whether its simple first aid or higher level attention in a hospital but either way make sure a report is done for it you have access to that report. Then before you make any statement or written report you get your head sorted. Calm yourself down and give yourself the time and space to think about your report. If that means coming back in tomorrow to do a report then do that. Do not be pushed into writing a statement or report while injured, fatigued or emotional. That might mean calmly telling your boss that you are not fit to complete a report right now and its in your and their best interest if you do it tomorrow. Of course still take your contemporaneous notes in your notebook at the time of things like time, description, witnesses etc but that is it. Every report or statement you write has the potential to impact your livelihood or your future so you owe it to yourself to protect yourself. When you do sit down to write your report try to use a template to make sure that you get all of the relevant details required. If you don’t have a template the you can print off my notebook insert template here as a guide to the content and structure.
Deterrence Factor
This is where we have all let ourselves and the industry down over the years. We have let people away with so much that it became a no risk event to take a swing at a security person. What would happen if a security person struck a customer? We all know that the customer would contact the Gardaí and take a later civil claim against the venue and rightly so. So then why aren’t we doing the same thing? As long as we continue to accept being punched and kicked without consequence for anybody then there is no deterrence factor. Every person who attacks a security person should be held and arrested by the Garda and a statement made. Where serious injuries are incurred then more security staff should be taking civil cases against these people for damages. Why should you miss out on work and have medical expenses when this guy gets to back to his normal life the next day? It wouldn’t be allowed to happen in many other roles. Same goes for employers not protecting their staff and leading to injuries. Make a report, ask what will be done to prevent it happening again and use the personal attack benefit as outlined in the ERO to ensure that you aren’t out-of-pocket for your expenses or wages as a result of a workplace incident. If we start taking these things seriously and enforcing our legal rights as an industry then things wouldn’t be long in changing but we don’t. A security professional said to me the other day “if you can’t stand up for yourself then you have no business in protecting other people” and he was dead right. As long as we continue to accept being treated this way it will continue to happen both from the public and the few unscrupulous employers that are out there.
Summary
Security is a dangerous job. We all know that and we accept it when we sign up. Some are fit for it and some are not and that will always be the case. There is a line to be drawn between dealing with risk and being put at adverse risk because of the actions of others. There also has to be an acceptance that if an employers expects you act in a high risk situation then there are consequences when you get injured doing it. This is the same in any other role. I’m not trying to tar every member of the public or every employer with the same brush and ts important to recognise that these are a minority of incidents but they do happen and security staff have had their jobs, futures and physical health altered because of them with little or no consequence for anybody apart from the injured party. That is wrong and it has to change. If it is to change then it has to come from us.Nobody will do it for you. As an industry we have to start standing up and saying that it isn’t acceptable any more.
STAY SAFE OUT THERE | tomekkorbak/pile-curse-small | OpenWebText2 |
Rutland Weekend Television
Rutland Weekend Television (RWT) was a television sketch show on BBC2, written by Eric Idle with music by Neil Innes. Two series were broadcast, the first consisting of six episodes in 1975, and the second series of seven episodes in 1976. A Christmas special was broadcast on Boxing Day 1975.
It was Idle's first television project after Monty Python's Flying Circus, which had ended the previous year, and was the catalyst for The Rutles. Rutland Weekend Television or RWT centred on "Britain's smallest television network", situated in England's smallest (and mainly rural) county, Rutland.
The show's title alludes to London Weekend Television (then part of ITV and since renamed ITV London). A Rutland TV station would be pretty small (representing roughly 30,000 people in an area less than 150 square miles), so a Rutland Television would have to be ridiculously tiny. The joke was doubly meaningful as Idle had accidentally been granted a presentation budget instead of the more lavish budgets associated with light entertainment – so the weekly patter about their inability to buy props and sets reflected reality. Indeed, the last show of the first series featured Idle and Innes, stripped and shivering in blankets under a bare bulb, singing about how the power's about to be shut off. Idle speaks bitterly about these conditions now but his attempts to overcome them formed the basis of a lot of the show's jokes.
Idle, in a 1975 Radio Times interview, remarked, "It was made on a shoestring budget, and someone else was wearing the shoe. The studio is the same size as the weather forecast studio and nearly as good. We had to bring the sets up four floors for each scene, then take them down again. While the next set was coming up, we'd change our make-up. Every minute mattered. It's not always funny to be funny from ten in the morning until ten at night. As for ad-libbing, what ad-libbing? You don't ad-lib when you're working with three cameras and anyway the material goes out months after you've made it."
A typical episode
The episode begins with the announcer, usually with something going wrong or with something out of the ordinary, from announcements catching fire to open auditions for the announcer itself. Occasionally the announcement would be sung, or performed by more than one person. In one episode, the announcements are performed by "The Ricochet Brothers" (spelled Ricochet, but pronounced Rick-ot-chet) who begin the episode as a pair, and expand to a full cast, each group speaking the announcement in unison.
The role of the announcer was to announce the "programmes" (typically sketches) – many programmes would lead into, or announce, one of many songs and accompanying strange vignettes by Neil Innes. Innes recalled that the cheaper-looking sets added to the show; "It was sometimes a problem but that was in fact the whole raison d’etre of the programme. It was such a cheap budget programme that it worked in our favour. You could actually show how cheap and cheerful it was because it was ‘Rutland Weekend Television’. It was made in a studio at the BBC called Presentation B, which is where they do the weather from."
Cast and guest stars
Regular cast
Eric Idle - As the star of the show, Idle plays many of the lead roles in the series. He is also the first person to appear in the show, as an interviewer in the first sketch, "Gibberish" in which Idle and Woolf talk in completely nonsensical sentences:
Ham sandwich, bucket and water plastic Duralex rubber McFisheries underwear. Plugged rabbit emulsion, zinc custard without sustenance in kipling-duff geriatric scenery, maximises press insulating government grunting sapphire-clubs incidentally. But tonight, sam pan Bombay Bermuda in diphtheria rustic McAlpine splendour, rabbit and foot-foot-phooey jugs rapidly big biro ruveliners musk-green gauges micturate with nipples and tiptoe rusting machinery, rustically inclined. Good evening and welcome.
Neil Innes - A former member of the Bonzo Dog Doo Dah Band and The World, longtime songwriter for and performer with Monty Python, then current member of Grimms, and later to lead The Rutles, Innes wrote and performed most of the songs in the show, often in the guise of another character, such as Stoop Solo. Innes and members of his band, Fatso, also performed many songs written or co-written by Idle during the tenure of the show. Aside from the musical items, Innes was also a regular cast member, performing in many of the sketches.
David Battley - Best remembered for his performance as the schoolteacher Mr. Turkentine in Willy Wonka & the Chocolate Factory (1971) and the hapless Ergo in Krull (1983). In the show, he was often the straight man, and second only to Idle in the number of his performances throughout the series. He was the Paul McCartney character in the original (RWT) Rutles sketch, but was not involved in the TV special All You Need Is Cash (1978). Battley also appears in the final episode as David Frost, whom he had also portrayed in a stage production.
Henry Woolf - Often paired with Battley, appearing at his side in many sketches, though occasionally complains about being cast as "the short one", or "The Jewish One". He would later star as the Surrey mystic, Arthur Sultan, in All You Need Is Cash. In the fourth episode of series two, Woolf bitterly complains that "I'm a writer—I've had plays on!" Both claims are true.
Gwen Taylor - As the main female performer, Taylor appeared in a lot of sketches, but is still much more noticeably absent than Idle or Battley. Credibly, she frequently plays genuine female characters, instead of the more "decorative" roles from the other female contributors. She too would go on to star in All You Need Is Cash, as the mother of Leggy Mountbatten and Ron Nasty's wife, Chastity; as well as appearing in Palin and Jones's Ripping Yarns and in several roles in Monty Python's Life of Brian (1979), including Mrs. Bignose ("Don't pick your nose!"), the elderly woman bent double under the weight of a dummy donkey and the ineffectual heckler during Pilate's passover address ("and a pickpocket!"). It could be said that she was an official "new" fringe member of Monty Python around this time, alongside Charles McKeown and Terence Bayler, frequently appearing in its creators' projects.
Terence Bayler - Appearing from the last episode of series one onwards, Bayler played a variety of characters, including a shy and apparently forgetful announcer, the greasy presenter of "Rutland Showtime", and the Pink Panzer (a pink-uniformed SS officer who greets the camera with an effete Nazi salute and a breathless "Heil Hitler"). He would later appear as the manager of the Rutles in All You Need Is Cash, and as Gregory ("I'm Brian and so's my wife!") in Monty Python's Life of Brian (1979).
Guest stars
Bunny May, Lyn Ashley, Carinthia West - Three performers who were given the more "token" roles, often playing attractive, silent characters, in sharp contrast to the well rounded performances of Gwen Taylor. Bunny May was not in fact an actress but an actor who occasionally appeared in drag. Lyn Ashley was Eric Idle's wife at the time. Carinthia West, romantically associated with Mick Jagger & Bryan Ferry at various points in her life, increasingly provided the glamour over the two series.
Fatso - The band featured regularly, both as a group and as individuals. Members included Innes himself, as well as John Halsey, Billy Bremner, Brian Hodgson, and Roger Rettig. John Halsey played Ringo Starr facsimile Barry Wom in Idle and Innes' Beatles parody, The Rutles, which originated as a sketch on RWT. Innes and Idle portrayed the Lennon and McCartney parallels, Ron Nasty and Dirk McQuickly. Halsey also appears as one half of the "Fabulous Bingo Brothers" (the other half being musician Zoot Money), and as the defense lawyer in the "Rutland 5–0" sketch. Roger Rettig now resides in Florida, USA. In England, Roger backed Lonnie Donegan and Roy St. John, as well as participating in the band Klondike Pete and the Huskies. Brian Hodgson, regularly tours with legendary guitarist Albert Lee in a band called Hogan's Heroes. Billy Bremner is one of the UK's top session guitarists who now resides in Sweden. He was also a member of Rockpile fronted by Dave Edmunds. Also in the band was Nick Lowe. Billy released a solo single on Stiff Records in 1981 called Loud Music In Cars.
George Harrison - The Christmas special features George Harrison as "Pirate Bob", dressed in appropriate attire and frequently interrupting the action throughout the show, before being given the chance to sing at the end in normal clothing. After leading the band through an intro to his 1970–71 hit "My Sweet Lord", Harrison switches off and starts singing a lively tune about pirates known as "The Pirate Song", co-written with Eric Idle. Innes's connection with Harrison and the other Beatles, as well as Harrison's to Monty Python and its members, are equally notable. Innes' Bonzo Dog Doo-Dah Band appeared in The Beatles' Magical Mystery Tour film, and Paul McCartney produced the Bonzos' 1968 single "I'm the Urban Spaceman", while Harrison founded HandMade Films for the purpose of financing Python's Life of Brian; HandMade later also produced Python alum Terry Gilliam's Time Bandits. In addition, Harrison appeared as a news reporter – interviewing Michael Palin – in Idle and Innes' 1978 Beatles parody, The Rutles: All You Need is Cash.
Idle said of his RWT colleagues (in the same Radio Times interview): "Neil Innes is superb. I must be his biggest fan. Henry Woolf played Toulouse-Lautrec in the West End. He's the best small philosopher in London at the moment. And David Battley – what can I say? Straight, pale, dead-pan brilliant. Our cameraman, Peter Bartlett, filmed the Queen but says I'm easier to work with."
Memorable sketches
Santa Doesn't Live Here Any More. Supposedly a play by Arthur Serious, this sketch parodies a typically miserable family Christmas, with David Battley complaining about everything and suggesting "a nice game of suicide". Eric Idle relates a charming childhood memory that quickly turns nasty, and Neil Innes arrives as a postman, with an unusual present in the shape of a sexy showgirl, prompting Battley's remark "they make lovely presents, women". This segues into Innes's doleful song, "I Don't Believe In Santa Any More".
Being Normal. A spoof documentary about one man's completely uneventful life. Despite having had lunatic parents and a miserable childhood, Arthur Sutcliffe (David Battley) remains depressingly ordinary, going to "straight pubs" and feeling at home in the company of "other normals". The documentary's narrator decides that "the little man from the off-licence" (Woolf) is to blame, not just for Sutcliffe's misfortune, but for everything, including Leicester City Football Club's failure to win the FA Cup, racial prejudice and the unequal distribution of wealth. This segues into Innes's song Lie Down and Be Counted.
Expose. What begins as an investigation into the notorious 'Massed Flashers of Reigate' is quickly overtaken by the revelation that the police force are moonlighting as shop assistants and builders, and a commune for policemen (and women) is raided by hippies looking for drugs. The documentary also highlights how few people believe in Sir Keith Joseph, before Eric Idle is informed that he's getting a bad review. Idle rants about the uselessness of television critics for a while, but Henry Woolf informs him that his satirical invective has won him a rave review. Idle changes tack and begins praising TV critics, but the cast rebel against him and talk about putting in for their own series as the credits roll.
The Cretin Club. A man (David Battley) is despondent after he scores zero in an IQ test, but since he managed to get his name right at the top of the paper, the examiner (Eric Idle) gives him two points and membership to the Cretin Club, whose perks include cufflinks, a club tie and an 'I Am A Cretin' T-shirt. (This sketch was expanded upon in The Rutland Dirty Weekend Book.)
Ill Health Food Store. Eric Idle runs a shop selling both unappetising fare such as tins of acne, the 'diarrhoea delight'- and the chance to take a vegetarian home and force-feed him meat.
Twenty-four Hours In Tunbridge Wells. An extremely low-budget spoof of the Gene Kelly / Frank Sinatra film On the Town, shown as part of Rutland Weekend Television's season of Classically Bad American Films.
Ron Badger / Satan's Electrical Shop. The Devil (David Battley) is found in reduced circumstances, running a small electrical shop. He complains that people's souls are no good to him ("they just sit there, soulfully...if people sold me their privates, it'd be more interesting") but reluctantly decides to buy just one more. The customer (Eric Idle) hasn't taken Satan's economic downturn into account though, and the promise to make love to Helen of Troy turns out to be a seedy one-night stand with "Helen of bleeding Edgbaston, more like" in a grubby seaside hotel room.
Man Alive – Suburban Prisons. A spoof on the BBC current events series has housewives running maximum security prisons from their bungalows. Mrs Harris's prison is the most unpopular, as she has reintroduced hanging. However, Mrs Fletcher's prison is a big hit, because she had Johnny Cash (Neil Innes) perform a concert for the inmates.
The Old Gay Whistle Test. A parody of The Old Grey Whistle Test, featuring Idle as the host, speaking in a permanent whisper (parodying the real show's then-host "Whispering" Bob Harris). It featured Stan Fitch, "the world's first all-dead singer", and supposed rock star Mantra Robinson talking about a concert where "we did over seven million dollars' worth of damage, so it was rather good", even though only five people turned up.
The Rutles
One show introduced The Rutles, a four-piece band fronted by Innes as a man "suffering from love song" spoofing The Beatles, singing "I Must Be In Love", a pastiche of some of the early Lennon–McCartney songs. This was followed by the beginnings of a documentary feature about the band, cut short when the camera, mounted on a car, speeds off. This scene was later remade in the spinoff film, All You Need Is Cash, featuring Idle, Innes, Ricky Fataar and John Halsey (who also appeared in many of the musical items in the series) as the "Pre-Fab Four". Innes wrote the music for the film, most of which was parody of well-known Beatles songs.
On RWT, "The Rutles" are portrayed by: Eric Idle as the Harrison character, Neil Innes as the Lennon character, David Battley as the McCartney character, and John Halsey as the Ringo character. They are introduced as: "Dirk" (Idle), "Nasty" (Innes), "Stig" (Battley), & "Barry" (Halsey). ("Barry" is inexplicably changed to "Kevin" on the RWT soundtrack album.) The original version of "I Must Be In Love", is performed by Neil Innes & Fatso, and is slightly different than the 1978 All You Need Is Cash version. Also of note, on RWT, "The Rutles" are quite clearly a product of Rutland, whereas in All You Need Is Cash, they are relocated to Liverpool.
Innes would later appear in another sketch, as "Ron Lennon", performing a short song titled, "The Children of Rock-N-Roll". This 30 second piece would later be expanded into a full Rutles song, "Good Times Roll", for the All You Need Is Cash film and album.
Python influence
Aside from the first appearance of the Rutles, the show features some surreal humour in the style associated with Monty Python. One sketch features the Lone Ranger (Idle) transformed into the Lone Accountant, with Innes as Tonto accidentally murdering holdup victims while trying to rescue them ("too many gin-and-tonic at lunch... You think it easy to be Indian accountant?"). Another scene features Gwen Taylor visiting the doctor to complain of her constantly changing costume and surroundings and being diagnosed with "bad continuity." The prescribed treatment is editing out two weeks of her life, after which she says she feels well, and a bit hungry... though her soundtrack is still off. She then becomes a victim of recurring film flashbacks, eventually disappearing back into her childhood.
Innes subsequently created and starred in The Innes Book of Records, a pre-MTV show that wove together strange guests and music videos in a bewildering array of musical styles and visual styles.
Other media
As well as providing the basis for The Rutles, Rutland Weekend Television also spawned its own LP and book.
Album
Book
The Rutland Dirty Weekend Book by Eric Idle, 1976
A dense and lavishly illustrated parody of the Television, films and print media of the mid-1970s.
The book has an issue of "Rutland Stone" bound inside. The back page of this issue carries a full-page advertisement for The Rutles' latest album ("Finchley Road"), a single ("Ticket To Rut"), and an assortment of Rutles merchandise. The book also contains the "Vatican Sex Manual" featuring pictures of Eric Idle in various positions in which it is impossible to have sex.
DVD
Despite many requests, none of the episodes have been released on DVD – the show has complicated rights issues, belonging in principle both to the BBC and Idle. Innes has claimed that Idle has no interest in seeing the series released as it reminds him of an unhappy time in his life.
References
External links
Category:1970s British comedy television series
Category:1975 British television series debuts
Category:1976 British television series endings
Category:BBC television comedy
Category:Television series about television
Category:British parody television series
Category:Rutland
Category:English-language television programs | tomekkorbak/pile-curse-small | Wikipedia (en) |
Hirsch Edelmann
Hirsch Edelmann (1805 – 20 November 1858) was a Russian Jewish author and editor.
Born in Swislocz, in the Russian Empire (present-day Belarus), he was the son of a rabbinical scholar, and received a good Talmudical education, which he later supplemented by acquainting himself thoroughly with ancient and modern Hebrew literature. In 1839 Edelmann published his first work, "Haggahot u-Bi'urim," notes and commentaries to the "Me'irat 'Enayim" of Nathanson and Etlinger, Wilna, 1839. Five years later he published "'Alim le-Mibḥan," specimens or extracts from his work on difficult passages of the Haggadah in the Talmudim and Midrashim, with an appendix, "Megillat Sefer," on Purim and the Megillah, Danzig, 1844. The following year he published in Königsberg (where, as at Danzig, he had charge of a printing establishment) two critical editions of the Haggadah for Passover, with introductions, annotations, etc. The same year he published, also in Königsberg, the "Siddur Hegyon Leb," which is commonly known as "Landshuth's Prayer-Book." To this work Edelmann also contributed glossaries, emendations, and notes.
Edelmann spent about ten years in England, and was one of the first competent scholars to examine the manuscripts and rare printed books of the Oppenheim collection in the Bodleian Library, Oxford, and to give the outside world some knowledge of their contents. In this work he was assisted by Leopold Dukes; and they jointly edited and published "Ginze Oxford" (with an English translation by Marcus Heymann Breslau, London, 1851).
To this period of Edelmann's activity belong also:
"Derek Ṭobim," ethical wills of Judah ibn Tibbon and Maimonides, also ancient Arabic and Greek proverbs rendered into Hebrew, with English translation by Bresslau, London, 1852
"Dibre Ḥefeẓ," extracts from various unprinted works, London, 1853
"Tehillah la-Yesharim," poem by Moses Ḥayyim Luzzatto from an Oxford manuscript, with preface by Edelmann, London, 1854
"Ḥemdah Genuzah," unedited manuscripts by early rabbinical authorities, with a literary-historical introduction, Königsberg, 1856.
Edelmann also brought out a valuable critical new edition of Ishtori Haparchi's "Kaftor u-Feraḥ," Berlin, 1851, and wrote "Gedullat Sha'ul," a biography of Rabbi Saul Wahl, the alleged one-day King of Poland, with an appendix, "Nir le-Dawid ule-Zar'o," the genealogy of Denis M. Samuel of London, a descendant of that rabbi, London, 1854.
In 1852 Edelmann settled in Berlin. For three months before his death he was in the insane department of the Charité hospital of that city.
Notes
References
, s.v.
Category:1805 births
Category:1858 deaths
Category:People from Svislach
Category:Belarusian Jews
Category:Imperial Russian writers
Category:Jewish writers | tomekkorbak/pile-curse-small | Wikipedia (en) |
Gastrointestinal helminths of wolves (Canis lupus Linnaeus, 1758) in Piedmont, north-western Italy.
Free-ranging grey wolves (Canis lupus), which are presently recolonizing Italy, can be parasitized by a diversity of helminths, but have rarely been subject to studies of their parasites. Therefore, this study aims to determine the prevalence of gastrointestinal helminths of road-killed grey wolves from the Piedmont region of Italy. Forty-two wolves were collected and examined for the presence of helminths. We recorded 12 helminth species: nine Nematoda and three Cestoda. The nematodes were: Ancylostoma caninum (7.1%), Capillaria sp. (2.4%), Molineus sp. (2.4%), Pterygodermatites affinis (11.9%), Physaloptera sibirica (9.5%), Toxocara canis (9.5%), Toxascaris leonina (2.4%) and Uncinaria stenocephala (26.2%); the cestodes were: Dipylidium caninum (4.8%), Mesocestoides sp. (4.8%) and Taenia multiceps (76.2%). Physaloptera sibirica had the highest mean intensity and T. multiceps had the highest prevalence. Based on age and sex, no differences in the intensity or prevalence of helminth species were found among the hosts. Molineus sp. was recorded for the first time in wolves from the Palearctic region; P. affinis and P. sibirica are respectively reported for the first time in wolves from Europe and Italy. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Posture. The Great Big Rump.
Many of us work in offices, where a large part of every day involves sitting at a desk. Something we practiced for years at school as well. Musculoskeletal disorders have emerged to reflect this, with a proliferation of different forms of strain and injury caused (apparently) by all of this desk work. And in recent years there has been even more alarming news for desk workers, with claims that too much sitting can even be lethal, this sort of thing: https://www.washingtonpost.com/apps/g/page/national/the-health-hazards-of-sitting/750/
Is sitting really so terrible? It seems the most innocuous and gentle of human activities. Arguments will be made that it's the amount of sitting that we now do which is the problem, that we're more sedentary than our ancestors. That sedentary idea is important here, much of the danger of sitting relates to it (again, apparently) being a static, unmoving thing, unlike walking or running for example.
That's a framework which needs a bit of thought - the opposition of movement and rest. Are they opposites? Superficially it seems obvious that they are. But what about a spinning top? It moves and doesn't move, at the same time. Have we mixed up two quite different things in our demonisation of sitting - immobility, and inactivity? Immobility can involve an extensive level of activity, whether it's a spinning top or (as I will argue) a human being. So we shouldn't be too quick to assume that somebody sitting at a desk for example is being inactive, even if they are relatively immobile.
What if the human body is like a spinning top, something that achieves stability through dynamic activity? The work of David Gorman over the past several decades has shown that this is very likely the case. That the body is constantly active, even when it appears still, adjusting itself to the instabilities in our everyday activities and using these instabilities to our advantage, to help support us and give us effortless, poised activity. (Or at least this is all right in our very nature, another question is whether we're actually using that capability in our daily life.) So what does this mean for sitting?
If we take as a starting point a staple of the sitting-angst movement - posture. What does posture mean? Most definitions will tell you it's about 'holding' the body in a particular position. Which says a lot right there, if it's about holding yourself in various ways, that implies your body is a lump of inert stuff that you have to physically haul into various poses. And if you don't, it will collapse into a great amorphous lump in your chair. It's revealing that many feel that their body has to be manhandled in this way, it betrays precisely the conception they have of themselves as having a 'mind', and then this big lump of dead weight underneath them that the mind has to somehow get into various shapes. Or into shape, as the fitness industry might say. Why isn't my body already 'me'? Why do 'I' have to try to direct it from somewhere up inside my head?
It's this implicit split in ourselves, between what we think of as me, and my body, that is at the heart of problems with posture. It doesn't even occur to us how strange it is, that our 'body' somehow needs explicit direction from our 'mind' (which we usually identify as 'me'). That we need to tell our bodies to 'sit up straight', for example. Why wouldn't 'straight' be a property of all of me, that would also be reflected in my thinking and attention and what I'm doing in my work? After all, it's only in certain circumstances that we do go and try to give explicit directions to our bodies in this way, in many of our activities we don't make this split at all, if I'm at a party chatting to somebody and engrossed in what they're saying while I sip my drink, it's unlikely I'm at the same time thinking "ok, stand up straight here, shift that shoulder a little bit, move the weight more to the other foot...". None of that is necessary, I'm a unitary being in that conversation, I'm not even aware of having a body or a mind. I'm just me, and actually if I really look harder there's not even much sense of me either, my attention is fully occupied by my friend talking and the taste of my drink.
So how do we end up so appallingly slumped in our chairs at work? And even sorer when we try to sit up straighter, hauling ourselves up (or at least thinking that's what we're doing) using muscular effort, thinking we're therefore achieving 'better posture'? A small detour may help to explain how this happens.
Those who work with eyesight sometimes talk about the difference between looking and staring. Looking is basically just seeing things, without any conscious effort or even thought of doing something called looking. You're just immersed in your activity, whatever it is, and you're seeing what's going on, like talking to some work mates at morning tea and noticing their faces and cups of tea, and so on. Staring on the other hand is a distinct act, a fixed gaze at something. A narrowing of your experience to exclude most everything else that's happening, to focus exclusively on what you're seeing. You're shutting out, consciously or not, the sounds around you, what you're feeling in your body, the temperature, and even other things to be seen in your surroundings. Computer use is a classic example of this, how after some time that screen becomes almost your entire world, you're so narrowed into what's on the screen that everything else fades away.
Once you're narrowed like that, the rest of the world you're excluding from your experience will then come knocking. You'll start to feel pains in your body, for example, as the effort and strain of excluding all of that other information begins to take its toll, and the tightness that produces in your body starts to hurt. You'll start to think "my aching back", or "my neck hurts". And other things that may happen, such as sounds from elsewhere in your office, will be felt as distractions, something taking you away from your intense focus on your screen.
In reality these things aren't distractions, they're just other things happening at the same time as you doing your work, that you've been shutting out of your awareness. The myth here is that you can't have both - that you can't be broadly aware of all of these other simultaneous things, such as how your whole body is feeling, what sounds are happening, what smells, or whatever - and at the same time have your attention on your work. It has to be one or the other, from a young age we're told to 'pay attention', which usually means shutting out all of those other simultaneous things happening to narrow onto one small thing. But that distinction is completely unnecessary, you can be broadly aware of all of those things going on without taking your attention off your work, and in fact you do that regularly in other activities, such as when you're eating dinner or watching TV and chatting to your family at the same time.
When you do allow a relaxed and open awareness like that, your 'body' will in turn be open and relaxed and free. How we are is also how our 'body' is, they're not different things. How could our bodies not be us, at the same time as our minds? It's this narrowing habit we get into, often because we're focusing on the end result of something we're doing rather than the activity itself - we're straining to get to that future moment of having finished something, rather than living the doing of the activity - that in fact creates this sense of a split between body and mind. When you're narrowed like that, you will start to feel like those pains happening in your body are separate to what you're doing up here in your head, in your 'mind', staring at the computer screen. Those damned, distracting pains 'down there', in my 'body'.
This is why I've called posture a 'rump', in the title of this piece, because a rump is "a small or unimportant remnant of something originally larger", to use a dictionary definition. Posture is what is left over when you exclude most of your being to focus only on that screen, or some other activity. Most of your body and surroundings are being ignored, and we then get this bizarre split idea of that great lump of ignored flesh having to be postured back into place in some way. But that lump of flesh is doing exactly what you are doing (it is you!), it's not really engaged in its surroundings because you aren't either. You may be daydreaming, or you may be focusing on where you want to get to in your work, rather than on the doing of it. In which case your 'body' has tightened right up to allow you to push away all of those distractions and feelings, while you focus only on the ends of what you're up to, rather than the means. Then when that narrowing and strain causes inevitable pain, the strain is swapped for a slump, to try to relieve the tension in your body. That yo-yo strain and slump can go on all day, because the root cause - narrowing, or being off with the fairies - is being ignored. And by ignoring that we more and more feel divided, as if the me up in my head and the pains down in my body are somehow separate things.
Separation. Space
Another way of looking at this is that we partition our activities off into separate narrow boxes. Let's say the basic human baseline of being in the world is sitting or standing anywhere, taking in the sights and sounds, in a relaxed way. After all, if we stared at a friend who was talking in the way we do at computer screens, they'd probably start to worry that we were a bit obsessed! Where we then get into problems is when we assume that baseline can't be taken off into our other activities. That to walk somewhere we have to go inwards in an "excuse me for a second" sort of way; that 'walking' is something you need to do as a separate thing, meaning you have to now shut out all of those other things you were doing and noticing and focus on getting those legs moving.
We often do the same for 'sitting', or 'standing', or 'running. We assume those are separate activities that require you to withdraw from your basic, relaxed awareness of what's happening around you so you can go inside yourself in your attention and make those things happen. "You can't pay attention to two things at once", as the saying goes. But we then forget that sometimes we walk while doing other things (the old expression, 'can't walk and chew gum at the same time' says a lot), that sometimes we can sit or stand for long periods without noticing any strain or pain, or without needing to do anything to make the sitting or standing or walking happen, they just happen.
This is where we need to go back to that distinction between movement and rest. Because not only is the body very active in doing something immobile, like sitting or standing, but the entire idea of moving is not as straightforward as it seems. From Zeno, with his paradoxes, to Einstein with his relativity, there have always been questions as to whether movement is what we think it is. The difficulties all boil down to one simple but often overlooked thing, the splitting of a moving object or person away from their context. It's the idea of space, of people and objects occupying 'space', as a sort of container inside which movement happens. And so something moves when it changes location within space, from A to B as we say.
But this isn't our actual experience. Space is an abstraction, and useful for certain purposes, but in reality we don't occupy space. We experience the things around us, as things, not as objects sitting in some abstract coordinate space. When we 'move', we can do this in two main ways. One, as with computer use above, involves us focused only on where we want to go, rather than paying much attention to anything along the way. That's what we usually call movement, because there's a clear separation between us as objects, and our surroundings so that we can say we've moved from here, to there. We ignored most of the context along the way, and concentrated only on the two endpoints - our start and finish points. The other way we can move is to not ignore that context, and then our passage from here to there becomes very different, it becomes a continuous series of lived events, so that at each 'point' along the way we're just in the moment, in the context of that moment. There's no clear sense of moving from here to there because every point along that journey is in itself another here or there.
This is the crucial difference to understand, if we want to avoid slumped posture, and effort in our movements. It is not about anything to do with the 'body', it's about our engagement with our surroundings. Somebody who is slumped at their desk is not fully engaged with what's happening around them, and that's why their 'posture' appears bad. It has nothing to do with how they're doing anything with their body, and fixing it certainly won't be about using effort to 'sit up straight' as is usually advised. Their body is them, it's simply reflecting what they are doing, which is to take leave of the basic presence of the movement and focus on where they want to end up, rather than on all of the contexts of getting there. Or to escape into daydreams or imaginings, which will have a similar effect of making their body freeze up or go limp.
The same applies with walking or running, or standing. You can do all of those things as separate, distinct 'movements', and feel the effort and strain. Or you can replace all of those apparently separate activities and relax back into your full, automatic awareness of your surroundings, and then to stand will be to live a whole context between chair and standing, and to walk or run will be to do the same. Your shape will change depending on whether your engagement with your surroundings involves 'moving' rather than sitting still, but the core experience is the same in each case - just being there, in your surroundings, engaged. You won't feel like you're moving from here to there, because you'll be living all the points in between fully as well. The difference between sitting and moving won't be between mobile and immobile, it will be between being engaged with some things, or being engaged with more things. Of being just in one context, or in many.
We will never understand sitting if we continue to use the mobile/immobile framework. We will never understand movement either, using that framework. That entire framework comes from the narrowing we do as we go about our daily tasks, it's a type of illusion. Once we get narrowed towards the ends of what we want to achieve, rather than the means of getting there, suddenly our 'minds' separate from our 'bodies', our entire bodies from their contexts, and you get an experience of me, up here in my head, trying to control my body, to hold it in space or move it through space.
All complete unnecessary and able to be corrected in an instant. With no ergonomic chairs or exercises.
Get link
Facebook
Twitter
Pinterest
Google+
Email
Other Apps
Comments
Post a Comment
Popular posts from this blog
Introducing Bruno Latour. Over the past 20+ years Latour has been carefully and thrillingly re-designing the entire landscape of our lives, and increasingly people are noticing what he's been up to. It really is no exaggeration to say that the world as Latour sees it is remarkable, and very little of the ways we commonly understand things survives unscathed. Not that he in any way imposes a new order on things, or concocts vast fantastic scifi-type fantasies. And he doesn't have a critical bone in his body, so he's not out there debunking things either - he sees critique as a tired, misguided activity. On the contrary his genius (and this is probably what defines all genius) is to show us what we're already doing but don't even notice. Rather than attempt some encyclopaedic biography and bibliography, I'll first list probably his most fundamental changes to the way we think about things, and then use one example to show a bit of the flavour of his work. As backg…
There's maybe something just a little bit too twee about Godwin's Law, which began with a witty observation by Godwin that in online chat forums eventually somebody gets compared to Hitler and the Nazis. Since that time the observation has taken on the status of a (tongue-in-cheek) law, and also additional meanings such as "whoever refers to Hitler first in an argument loses", etc. Obviously throwing your opponent to the Nazi legacy in the opening stages of battle is poor form. It's schoolyard "my dad is bigger than your dad" tactics. But there's a big in-between land between that and not talking about them at all that is pretty important. One of the wisest lessons some have drawn from the fascist adventures of the 20th century is that this shit tends to creep up on people, it doesn't arrive overnight with a funny moustache. Fascism/totalitarianism (if these are actually things - there's a whole academic literature on what the terms actually m… | tomekkorbak/pile-curse-small | Pile-CC |
Love the food. But the person that took my order over the phone just made me never want to call you ever again. Very ruded I couldn't complete my phone order with her I had to pass the phone over. Sorry but I will never call again because how she treated me | tomekkorbak/pile-curse-small | Pile-CC |
Introduction
============
Many reactions have been utilized as important tools in synthetic organic chemistry. "Name reactions", such as Wittig, Suzuki--Miyaura, and Mitsunobu, to name just a few, have an outstanding utility that has influenced broad fields of academia and industry.[@cit1] In view of economic and environmental concerns however, many of these synthetic methods suffer from serious limitations, diminishing their practical applicability. Therefore, substantial improvements of known synthetic protocols are currently an important subject in chemistry.
Indeed, the Mitsunobu reaction is a typical example including both a wide utility and serious drawbacks.[@cit2] The reaction is one of the oxidation--reduction condensations reported by Mitsunobu and co-workers in 1967.[@cit3] Since then, it has been widely used for the substitution of hydroxyl groups or inversion of the stereochemistry of secondary alcohols. Typically, diethyl azodicarboxylate (DEAD) and triphenylphosphine are employed as the oxidant and reducing agent in the Mitsunobu reaction, but production of a large amount of waste, *i.e.*, diethyl hydrazinedicarboxylate and triphenylphosphine oxide, is unavoidable. These byproducts often contaminate the desired product. In addition, DEAD is hazardous due to its toxicity and potential explosiveness. As a result, the use of the Mitsunobu reaction tends to be avoided in practical synthesis on plant scales.[@cit4]
Several modified methods have been developed to facilitate the removal of the waste generated by the Mitsunobu reaction.[@cit5] However, there has been no substantial approach to reducing the problematic waste in the Mitsunobu reaction until the report on the catalytic Mitsunobu reaction by Toy in 2006.[@cit6] Toy succeeded in reducing DEAD in the Mitsunobu reaction to a catalytic amount (10 mol%) by employing a sacrificial oxidative reagent, *i.e.*, iodobenzene diacetate. Recently, Mitsunobu-type reactions without azo reagents were reported.[@cit7] In 2013, we reported the second example of the catalytic Mitsunobu reaction with azo reagents that are recyclable through aerobic oxidation with iron phthalocyanine ([Fig. 1A](#fig1){ref-type="fig"}).[@cit8] Ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**) has been tentatively identified as the best catalyst. A catalytic concept of this reaction is beneficial from the viewpoint of green chemistry because atmospheric oxygen is economically and environmentally ideal as a sacrificial oxidant to generate a reactive azo form **2a** ([Fig. 1B](#fig1){ref-type="fig"}). However, the scope of substrates and product yields were still moderate, and the reaction required heating conditions to obtain the products in acceptable yields. Thus, the applicability of the method was still inferior to that of the original Mitsunobu reaction.
{#fig1}
The effect of substituents on the aromatic ring of the hydrazine catalysts was drastic. Clearly, electronic properties of catalysts affected both the Mitsunobu reactivity of the azo form as well as the aerobic oxidation of the hydrazine form. At first glance, these seem incompatible because electron-withdrawing groups would promote the addition reaction of triphenylphosphine to the azo form but would suppress oxidation of the hydrazine form to the azo form. In the case of electron-donating groups there is the same dilemma, though the situation is interchanged. We presumed that the 3,4-dichlorophenyl group had an electronic property that made the two processes moderately compatible.
Quite recently, we have reported a detail of the aerobic oxidation process of 2-arylhydrazinecarboxylates with iron phthalocyanine, indicating two important observations.[@cit9] First, the oxidation process was promoted in apolar solvents such as toluene or dichloromethane, and second, electron-withdrawing substituents at the aryl group did not suppress the hydrazine-to-azo compound oxidation. Interestingly, halogen atoms at the *para*-position rather promoted the reaction. Thus, this study provided us important insights to improve the catalytic Mitsunobu reaction.
Providing the serious limitations indicated in [Fig. 1C](#fig1){ref-type="fig"} are avoided, the catalytic Mitsunobu reaction will gain a large potential in practical synthesis.[@cit10] In this paper, we describe new advances in our catalytic Mitsunobu reaction including substantial improvement of the reaction and insights into the reaction mechanism.
Results and discussion
======================
Strict optimization of the reaction conditions
----------------------------------------------
We previously found that the combination of ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**) and iron phthalocyanine \[Fe(*Pc*)\] formed an optimum catalytic system (both 10 mol%), and that addition of activated molecular sieves was required to induce the reaction (*vide infra*).[@cit8] We tentatively improved the yields of the products by using 3,5-dinitrobenzoic acid as a nucleophile when secondary alcohols were used as substrates.[@cit8] We employed a model reaction between (*S*)-ethyl lactate (**3**, 99 : 1 er) and 4-nitrobenzoic acid (**4**) using this catalytic system to strictly optimize the conditions. The reaction between **3** and **4** in heating THF (65 °C) gave ester product **5** in 50% yield and in 97% inversion ([Table 1](#tab1){ref-type="table"}, entry 1).
###### The effect of solvents[^*a*^](#tab1fna){ref-type="fn"}
{#ugr1}
------------------------------- ------------- ------------------------------------------- ---- ---- ---------
1 THF 65 24 50 97 : 3
2 1,4-Dioxane 65 24 46 96 : 4
3 CPME 65 24 70 97 : 3
4 MTBE 55[^*b*^](#tab1fnb){ref-type="table-fn"} 24 76 98 : 2
5 DME 65 24 40 58 : 42
6 MeCN 65 24 14 19 : 81
7 *n*-Hexane 65 24 69 99 : 1
8 Toluene 65 24 74 94 : 6
9 Toluene 110[^*b*^](#tab1fnb){ref-type="table-fn"} 12 78 49 : 51
10 Toluene rt 29 88 99 : 1
11 CPME rt 36 75 99 : 1
12 CHCl~3~ 62[^*b*^](#tab1fnb){ref-type="table-fn"} 24 80 38 : 62
13 CH~2~Cl~2~ rt 48 75 12 : 88
14 PhCl 65 24 70 59 : 41
15 PhCF~3~ 65 24 75 95 : 5
^*a*^Reaction conditions: **3** (1.0 mmol), **4** (1.1 mmol), catalyst **1a** (0.10 mmol), Fe(*Pc*) (0.10 mmol), PPh~3~ (2.0 mmol), solvent (2 mL), MS 5 Å (500 mg) under air atmosphere. MS 5 Å was activated by heating using a heat gun (*ca.* 450 °C) *in vacuo* (*ca.* 0.1 mmHg) for 5 min.
^*b*^Under reflux.
In the previous study, the effect of solvents was investigated at a very preliminary stage using unoptimized catalysts.[@cit11] We could not find a large effect of the solvents at that time, and thereby, the effects of solvents and temperature were re-investigated using the optimum catalytic system ([Table 1](#tab1){ref-type="table"}).[@cit12] Ether solvents such as 1,4-dioxane, cyclopentyl methyl ether (CPME)[@cit13] and *tert*-butyl methyl ether (MTBE), except for dimethoxyethane (DME), provided product **5** in a high inversion ratio (entries 2--5), whereas acetonitrile gave a contrasting result (entry 6).[@cit14] Reactions in hydrocarbon solvents such as *n*-hexane and toluene at 65 °C afforded good results (entries 7 and 8). However, chlorinated solvents gave product **5** in a low inversion ratio, though the total product yield was good (entries 12--14). This drastic change in the results was attributed to the presence of chlorine atoms in the solvent, and is based on the fact that the reaction in α,α,α-trifluorotoluene[@cit15] provided similar results to those in toluene (entry 15). The enantiomeric ratio was sensitive to temperature in the reaction in toluene (entries 8--10). To our delight, the reaction in toluene at room temperature provided product **5** in an excellent yield (88%) and in a perfect inversion ratio. CPME also gave a relatively good result for the reaction at room temperature. The reactions were basically clean. In the case of low yields of the product, the starting materials remained unconsumed.
The effect of molecular sieves was drastic, and no reaction was induced in their absence ([Table 2](#tab2){ref-type="table"}, entry 1).[@cit16] This is likely due to the high moisture sensitivity of the intermediate generated from the azo form of catalyst **1a** and triphenylphosphine. Molecular sieves would serve for removing residual moisture as well as water generated by the iron-catalyzed aerobic oxidation of the hydrazine catalyst. The use of at least 500 mg MS 5 Å (1.0 mmol scale), activated by heating with a heat gun (*ca.* 450 °C) under reduced pressure (*ca.* 0.1 mmHg), was desirable to obtain product **5** in a good yield (entries 2--5). MS 4 Å and MS 3 Å were ineffective in the present reaction (entries 6 and 7).
###### The effect of desiccants[^*a*^](#tab2fna){ref-type="fn"}
{#ugr2}
------------------------------- ---------------- ------ ---- --------
1 None --- 0 ---
2 MS 5 Å (**A**) 100 32 99 : 1
3 MS 5 Å (**A**) 300 77 99 : 1
4 MS 5 Å (**A**) 500 88 99 : 1
5 MS 5 Å (**A**) 1000 95 99 : 1
6 MS 4 Å (**A**) 500 32 97 : 3
7 MS 3 Å (**A**) 500 26 98 : 2
8 MS 5 Å (**B**) 500 13 96 : 4
9 MS 5 Å (**C**) 500 16 91 : 9
10 MS 5 Å (**D**) 500 25 97 : 3
11 MS 5 Å (**E**) 500 67 98 : 2
12 MS 5 Å (**F**) 500 94 99 : 1
13 Na~2~SO~4~ 500 0 ---
14 CaSO~4~ 500 0 ---
15 MgSO~4~ 500 0 ---
^*a*^Reaction conditions: **3** (1.0 mmol), **4** (1.1 mmol), catalyst **1a** (0.10 mmol), Fe(*Pc*) (0.10 mmol), PPh~3~ (2.0 mmol), toluene (2 mL), desiccant (0--1000 mg) for 24--48 h at room temperature under air atmosphere. Methods for activation of molecular sieves: **A**: heated using a heat gun (*ca.* 450 °C) *in vacuo* (*ca.* 0.1 mmHg) for 5 min; **B**: not activated; **C**: heated in an oven (140 °C) for 24 h; **D**: heated using a microwave (1000 W for 1 min, three times); **E**: heated using an oil bath (200 °C) *in vacuo* (*ca.* 0.1 mmHg) for 24 h; **F**: heated using a gas burner (\>1000 °C) *in vacuo* (*ca.* 0.1 mmHg) for 5 min.
Various "traditional methods" for the activation of molecular sieves are used in many laboratories. Representative activation methods were tested to assure a reliable experimental procedure. The use of MS 5 Å without activation gave the product in a very poor yield (entry 8). MS 5 Å heated for 24 h at 140 °C in an oven were also ineffective (entry 9). Although heating using a microwave is sometimes used for activation of molecular sieves, this method did not afford a good result in the present reaction (entry 10). When the reaction was tested with MS 5 Å activated through heating at 200 °C with an oil bath under reduced pressure (*ca.* 0.1 mmHg), the product yield was still insufficient (entry 11). Heating using a flame under reduced pressure would be a strict method for activation of molecular sieves, and this method provided product **5** in an excellent 94% yield (entry 12). As a result, and from the viewpoints of safety and convenience, we consider the activation with a heat gun as the method of choice. Incidentally, sulfate salts did not work as a desiccant in the reaction (entries 13--15).
The concentration of the reactants is likely to affect the product yield ([Table 3](#tab3){ref-type="table"}, entries 1--4 and 7). The reaction was promoted and gave improved yields of product **5** in high concentrations (2.0 M or 4.0 M) (entries 4 and 7). When the amount of triphenylphosphine was decreased to 1.5 equivalent in the reaction in high concentration (2.0 M or 4.0 M), a good yield was maintained in this model reaction (entries 5 and 8). However, the use of a lower amount (1.1 equiv.) of triphenylphosphine diminished the yield of product **5** (entries 6 and 9). High concentration conditions would be beneficial to a practical synthesis because the solvent can be saved. The good result was reproducible in a scale-up experiment (10 mmol), though the reaction time was somewhat prolonged (entry 7, results in parentheses). Triphenylphosphine is sometimes replaced with trialkylphosphines because they often provide good results due to their high nucleophilicity.[@cit17] We tested a representative reaction with tri-*n*-butylphosphine, but the result was very poor (entry 8, results in parentheses). TLC analysis of the reaction mixture implied decomposition of the iron phthalocyanine presumably through strong coordination with the tri-*n*-butylphosphine. When most of the triphenylphosphine was consumed in the reaction, the Mitsunobu catalyst was detected as the azo form using TLC. The latter was easily recovered in 80--90% yield using silica gel chromatography due to its low polarity. The hydrazine form of the catalyst, if it remained in the reaction mixture, usually did not cause problems in the purification of the product. Finally, iron phthalocyanine could be easily removed using filtration of the reaction mixture through a pad of Celite® or filter paper. The impact of decreasing the amount of hydrazine catalyst **1a** seemed to be larger than that of decreasing the amount of iron phthalocyanine (entries 10--15). It is noteworthy that good results were maintained with as low as 1 mol% of iron phthalocyanine (entries 11 and 12) indicating that its amount can be flexibly changed depending on the substrates or situations of the reactions. No reaction was induced in the absence of the iron catalyst.[@cit8],[@cit9]
###### Effects of the amounts of reagents and concentrations[^*a*^](#tab3fna){ref-type="fn"}
{#ugr3}
------------------------------- ---- ---- ----- ----- ----------------------------------------------- ----------------------------------------------- --------------------------------------------------------
1 10 10 2.0 0.1 52 80 98 : 2
2 10 10 2.0 0.5 29 88 99 : 1
3 10 10 2.0 1.0 18 91 98 : 2
4 10 10 2.0 2.0 14 97 98 : 2
5 10 10 1.5 2.0 14 91 99 : 1
6 10 10 1.1 2.0 12 68 99 : 1
7 10 10 2.0 4.0 12 (24)[^*b*^](#tab3fnb){ref-type="table-fn"} 93 (88)[^*b*^](#tab3fnb){ref-type="table-fn"} 99 : 1 (99 : 1)[^*b*^](#tab3fnb){ref-type="table-fn"}
8 10 10 1.5 4.0 12 (48)[^*c*^](#tab3fnc){ref-type="table-fn"} 92 (10)[^*c*^](#tab3fnc){ref-type="table-fn"} 99 : 1 (46 : 54)[^*c*^](#tab3fnc){ref-type="table-fn"}
9 10 10 1.1 4.0 12 76 99 : 1
10 10 5 1.5 4.0 21 84 99 : 1
11 10 1 1.5 4.0 18 81 99 : 1
12 10 1 2.0 4.0 36 89 99 : 1
13 5 10 1.5 4.0 38 78 99 : 1
14 5 5 1.5 4.0 24 76 99 : 1
15 3 3 1.5 4.0 39 68 99 : 1
^*a*^Reaction conditions: **3** (1.0 mmol), **4** (1.1 mmol), **1a** (0.10, 0.050 or 0.030 mmol), Fe(*Pc*) (0.10, 0.050, 0.030 and 0.010 mmol), PPh~3~ (2.0, 1.5 or 1.1 mmol), toluene (10, 2, 1, 0.5 or 0.25 mL), MS 5 Å (500 mg) at room temperature under air atmosphere unless otherwise noted. MS 5 Å was activated by heating using a heat gun (*ca.* 450 °C) *in vacuo* (*ca.* 0.1 mmHg) for 5 min.
^*b*^The reaction was performed on the 10 mmol scale.
^*c*^PBu~3~ was used instead of PPh~3~.
Kinetic properties of the ethyl 2-arylazocarboxylates
-----------------------------------------------------
The catalytic cycle between the hydrazines and azo compounds would affect the efficiency of the formation of an alkoxyphosphonium intermediate to provide the final product. We conducted kinetic experiments to investigate the substituent effect of azo compounds **2b--j** in the reaction with triphenylphosphine ([Fig. 2](#fig2){ref-type="fig"}). The analysis of a mixture of **2b--j** and triphenylphosphine (10 equiv.) in CDCl~3~ using ^1^H NMR spectroscopy revealed the presence of some starting azo compounds after 10 hours. In contrast, in an independent experiment, ^1^H NMR analysis showed that DEAD immediately disappeared under the same reaction conditions, indicating an irreversible process in this case.[@cit18] Obviously, the addition of triphenylphosphine to ethyl 2-arylazocarboxylates is reversible, and the formation of adducts is less favorable as compared to DEAD. Therefore, reaction rates were estimated from the model reaction of azo compounds **2b--j** (50 mM) with excessive amounts (10 equiv.) of triphenylphosphine and water in THF at 25 °C. The reactions were monitored by measuring the absorbance of the azo compounds **2b--j** at *λ* = 419--450 nm. Rate constants were calculated from plots of a pseudo-first-order dependence.
{#fig2}
The Hammett plot for these reactions shows a linear fit with a relatively large positive slope value of *ρ* = +2.71 ([Fig. 2](#fig2){ref-type="fig"}). The value is close to that of the alkaline hydrolysis of benzoate esters (*ρ* = +2.51).[@cit19] The result reflects a dependence of the electronic density at the aromatic ring of azo compounds in the rate of the addition reaction of triphenylphosphine. Ethyl 2-(3,4-dichlorophenyl)azocarboxylate (**2a**) was also applied to the kinetic experiment, and its reaction rate (*k*~obs~ = 8.5 × 10^--2^ min^--1^) was approximately 13.7 times faster than that of ethyl 2-phenylazocarboxylate (**2d**, *k*~obs~ = 6.2 × 10^--3^ min^--1^). In addition, it is still 2.3 times faster compared to that of ethyl 2-(3-chlorophenyl)azocarboxylate (**2g**, *k*~obs~ = 3.75 × 10^--2^ min^--1^). This supports the high reactivity of **2a** in the catalytic Mitsunobu reaction.
When benzoic acid or 4-nitrobenzoic acid (each 10 equiv.) were added to the reaction system with **2d**, only a minor impact to the reaction rate was noted (**2d** with benzoic acid: *k*~obs~ = 7.1 × 10^--3^ min^--1^; **2d** with 4-nitrobenzoic acid: *k*~obs~ = 6.8 × 10^--3^ min^--1^). This observation supports that the model reaction reflects the reactivity of azo compounds toward triphenylphosphine and indicates that acids do not kinetically affect the reaction.
The kinetics of the catalytic aerobic oxidation of ethyl 2-arylhydrazinecarboxylates (**1**) with iron phthalocyanine basically show zero-order dependence, but the substituent effect is of irregular tendency probably due to the participation of radical species in the mechanism.[@cit9] The reaction rates of aerobic oxidation of ethyl 2-(4-chlorophenyl)hydrazinecarboxylate (**1f**) and ethyl 2-(4-bromophenyl)hydrazinecarboxylate to the corresponding azo compounds are approximately 1.5 times faster than that of ethyl 2-phenylhydrazinecarboxylate (**1d**).[@cit9] In the model reaction, in dichloromethane as a solvent, the aerobic oxidation of ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**) with iron phthalocyanine is completed within 2 hours. This is clearly faster than the oxidation (4 hours)[@cit9] of ethyl 2-phenylhydrazinecarboxylate (**1d**), though the kinetics of the reaction of **1a** do not show a clear zero-order dependence (Fig. S14 in the ESI[†](#fn1){ref-type="fn"}). Thus, the 4-chlorine atom on the aromatic ring of **1a** promotes oxidation to the corresponding azo form **2a** by stabilization of the intermediary radical species, whereas the 3-chlorine atom of azo compound **2a** contributes to an increased electrophilicity by its inductive effect. This is the reason why azo compound **2a** operates as a good catalyst in the catalytic Mitsunobu reaction. In short, two processes involving Mitsunobu activity and hydrazine re-oxidation are compatible through the 3,4-dichlorophenyl group ([Fig. 3](#fig3){ref-type="fig"}). The catalytic activity of ethyl 2-(4-chlorophenyl)hydrazinecarboxylate (**1f**) was insufficient under the optimal conditions compared to that of **1a** ([Fig. 4](#fig4){ref-type="fig"}).
{#fig3}
{#fig4}
Given the above considerations, ethyl 2-arylhydrazinecarboxylates with strong electron-withdrawing groups on the aromatic ring should be more effective catalysts as these groups should promote the Mitsunobu reaction without significantly suppressing the aerobic oxidation process. For instance, as monitored using NMR spectroscopy, the aerobic oxidation of ethyl 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**) was completed within 5 hours, which was roughly the same reaction time as that of ethyl 2-phenylhydrazinecarboxylate (**1d**) (*ca.* 4 hours).[@cit9] On the other hand, higher electrophilicity of 2-(4-cyanophenyl)azocarboxylate (**2j**) over 3,4-dichlorophenyl derivative **2a** is consistent with the higher (3.8 times) reaction rates of **2j** (*k*~obs~ = 3.2 × 10^--1^ min^--1^) over **2a** ([Fig. 3](#fig3){ref-type="fig"}). This suggested that ethyl 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**) might work as a good catalyst in the catalytic Mitsunobu reaction.
When ethyl 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**) was used in the reaction between (*S*)-ethyl lactate (**3**) and 4-nitrobenzoic acid (**4**) under optimal conditions, product **5** was obtained in an excellent yield, although with a slightly decreased inversion ratio ([Fig. 4](#fig4){ref-type="fig"}). On the other hand, when phenol (**7**) or phthalimide (**8**) was used as the reaction partner of 3-phenylpropanol (**6**), both reactions using **1j** provided better results (87% and 84% yields) than the reactions with **1a** (51% and 66% yields). Although 2-(4-nitrophenyl)hydrazinecarboxylate (**1k**) should generate a strongly electrophilic azo compound,[@cit20] the results with this catalyst were disappointing. Gradual decomposition of **1k** or its azo form was observed in the reaction with triphenylphosphine using ^1^H NMR analysis, which appears to be the main reason for the poor results.[@cit21]
The reaction rate of ethyl 2-\[4-(ethoxycarbonyl)phenyl\]azocarboxylate (**2h**, *k*~obs~ = 6.4 × 10^--2^ min^--1^) and ethyl 2-\[4-(trifluoromethyl)phenyl\]azocarboxylate (**2i**, *k*~obs~ = 1.2 × 10^--1^ min^--1^) with triphenylphosphine was roughly close to that of **2a**. Good yields of ester **5** were obtained in the reaction between (*S*)-ethyl lactate (**3**) and 4-nitrobenzoic acid (**4**) using the hydrazine forms **1h** and **1i** as a catalyst, but reaction times were prolonged ([Fig. 4](#fig4){ref-type="fig"}). When phenol (**7**) or phthalimide (**8**) were used as a nucleophile in the reaction with 3-phenylpropanol (**6**), catalysts **1h** and **1i** did not provide better results than catalyst **1j**, though catalyst **1i** showed somewhat improved results compared with catalyst **1a**. Thus, catalyst **1h** showed reactivity similar to that of **1a**, and the position of reactivity for catalyst **1i** is likely to lie between **1a** and **1j**. These trends are consistent with the results of the Hammett study. Incidentally, when model experiments of iron-catalyzed aerobic oxidation of **1h** and **1i** were conducted in dichloromethane, the reactions were completed at 4 h and 6 h, respectively (see the ESI[†](#fn1){ref-type="fn"}). The trend of the oxidation process is similar to that of other hydrazide derivatives.[@cit9]
The above results imply that there is no perfect catalyst for the catalytic Mitsunobu reaction. Instead two catalysts can complement each other. In short, ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**) would be suitable for the reactions of carboxylic acids whereas 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**) could serve for the reactions of other nucleophiles except for carboxylic acids.
Scope of substrates using the optimized protocol
------------------------------------------------
The discovery of new catalyst **1j** largely expanded the scope of the catalytic Mitsunobu reaction. [Fig. 5](#fig5){ref-type="fig"} shows the results of catalytic Mitsunobu reactions applying catalyst **1a** or **1j** to various substrates. Typically, the reactions were performed under the optimal conditions that provided the best result ([Table 3](#tab3){ref-type="table"}, entry 7), but more practical conditions (*e.g.*, [Table 3](#tab3){ref-type="table"}, entry 11) were also applicable to several substrates. Reactions between 3-phenylpropanol and various carboxylic acids with catalyst **1a** provided the corresponding esters **11--15** in excellent yields. The reaction of the alcohol with phenols gave the corresponding ethers **9** and **16** in improved yields when catalyst **1j** was employed. An iodine atom was intact under the present conditions in the reaction of 4-iodophenol to give **16**. *N*-Hydroxyphthalimide also worked as a good nucleophile to give an *O*-alkylated product **17** in the presence of catalyst **1j**. Similarly, a sulfur nucleophile (2-mercaptobenzothiazole) underwent the Mitsunobu reaction with the alcohol to give the corresponding alkylated sulfide **18** in a good yield. Reactions of the alcohol with representative nitrogen nucleophiles were tested using catalyst **1j** and produced alkylated phthalimide **10**, and sulfonylamides **19** ([@cit22]) and **20** ([@cit23]) in good yields. Reactions with phthalimides and the nosylamide needed to be performed in 0.5 M solution due to the solubility issues. In such cases, heating the reaction mixture at 65 °C improved the results in reaction time and product yield. Alcohols sensitive to oxidative conditions were tested with several nucleophiles and were transformed into the corresponding Mitsunobu products **21--24** in good yields. It is noteworthy that a trisubstituted olefin, a thiophene and an indole were intact under the aerobic oxidation conditions. The catalytic Mitsunobu reaction using catalyst **1j** was applicable to intramolecular reactions of alkyl sulfonamides having a hydroxyl group to give the corresponding cyclic amines **25** and **26** ([@cit23b]) in reasonable yields.
{#fig5}
Next, various combinations of secondary alcohols and nucleophiles were tested ([Fig. 6](#fig6){ref-type="fig"}). Reactions of (*S*)-ethyl lactate (**3**) with several aromatic carboxylic acids gave the corresponding esters **34--36** in good yields with almost full inversion of stereochemistry. The reaction of alcohol **3** with 3,5-dinitrobenzoic acid in toluene gave ester **35** in a moderate level of enantioenrichment (er, 83 : 17). The reaction of 3,5-dinitrobenzoic acid, under the previous conditions (in THF at 65 °C) provided **35** in a higher level of enantioenrichment.[@cit8] In the reaction of **3** with 3-phenylpropionic acid, the enantioenrichment of ester **37** was not good (er, 78 : 22), but the reaction at low temperature (0 °C) gave an improved result (er, 90 : 10). Other nucleophiles such as phenol and phthalimide were applicable to reactions of chiral secondary alcohol **3** to provide the corresponding Mitsunobu products **38** and **39**, though the product yields were somewhat moderate. Reactions of other representative secondary alcohols **27--32** with 4-nitrobenzoic acid (**4**) readily provided the corresponding inversion products **40--45** in good yields. There was a slight loss of the optical purity of ester **42**, which was also observed in the typical Mitsunobu reaction with DEAD.[@cit6a] However, the case of (--)-menthol (**33**) was still a limitation in the catalytic Mitsunobu reaction even though a highly acidic carboxylic acid was employed.[@cit24] For instance, the reaction of **33** with 4-nitrobenzoic acid gave inversion product **46** as a minor isomer. Fortunately, we found out that inversion product **47** was produced exclusively when the 2-methyl-6-nitrobenzoic acid was used as a nucleophile. These contrasting results could be attributed to the catalytic system. The reaction with a catalytic amount of the azo reagent maintains a low concentration of an intermediary alkoxyphosphonium salt. There would be an equilibrium process between the alkoxyphosphonium intermediate and an acyloxyphosphonium intermediate.[@cit25] If a subsequent reaction of the alkoxyphosphonium intermediate with a carboxylic acid to give an inversion product is slow, a retention product would increase *via* the equilibrium process to give the acyloxyphosphonium intermediate because the concentration of a free carboxylic acid is sufficiently higher than that of the alkoxyphosphonium intermediate in the catalytic system. 2-Methyl-6-nitrobenzoic acid has a sufficient acidity but is sterically hindered. Therefore, conversion of the alkoxyphosphonium intermediate into the corresponding acyloxyphosphonium intermediate would be an unfavourable process due to a steric factor of the carboxylic acid.[@cit26]
{#fig6}
Mechanistic studies of the reaction using NMR spectroscopic methodologies
-------------------------------------------------------------------------
Does the reaction of the ethyl 2-arylazocarboxylates with triphenylphosphine form Morrison--Brunn--Huisgen betaine intermediates[@cit27] like in the typical Mitsunobu reaction? Precedent mechanistic studies indicate the formation of betaine intermediates from azo reagents and phosphines. To obtain insights into the intermediates in the present reaction, we monitored the reactions of ethyl 2-arylazocarboxylates with triphenylphosphine using multinuclear (^1^H, ^13^C, ^31^P, ^15^N) 1D and 2D NMR spectroscopy. To assist an unambiguous structure elucidation and assignment of NMR parameters, two kinds of ^15^N-labeled ethyl 2-phenylazocarboxylates **2d**-^15^N and **2d**-^15^N′, ^15^N-labeled potent Mitsunobu reagents **2a**-^15^N, **2j**-^15^N and doubly ^15^N-labeled DEAD (di-^15^N-DEAD) were prepared and used in the study, along with some unlabeled analogues ([Fig. 7](#fig7){ref-type="fig"}).
{#fig7}
The addition of triphenylphosphine (10 equiv.) into the solution of azo compounds in CDCl~3~ resulted in the appearance of low-field resonances in the ^31^P NMR spectra (**2d**: +33.9 ppm, **2a**: +34.5 ppm, **2j**: +35.4 ppm) that are supportive of the formation of betaine intermediates **48**. In light of the electron density of a nitrogen atom, these chemical shifts are roughly consistent with that of di-^15^N-DEAD (+44.2 ppm) and DEAD (+44.8 ppm).[@cit27]
Although it is predicted that Michael-type addition of triphenylphosphine to ethyl 2-arylazocarboxylates (an attack to N2) takes place to form betaines,[@cit28] the formation of other intermediary structures should be considered. Unlike for the symmetric DEAD,[@cit29] the issue of the regiochemistry of the triphenylphosphine attack to ethyl 2-arylazocarboxylates is raised as a consequence of their non-symmetric nature and the potential electrophilicity of the azo benzene derivatives toward triphenylphosphine.[@cit30],[@cit31]
^15^N NMR spectroscopy was sought as a probe for the *in situ* investigation of the regiochemistry. The formation of adducts formed between the triphenylphosphine and azo reagents was monitored using ^1^H, ^13^C, ^31^P, ^1^H--^1^H COSY, ^1^H--^13^C HSQC, ^1^H--^13^C HMBC, ^1^H--^31^P HMBC, ^1^H--^15^N HMBC experiments, as well as HRMS. The results are summarized in [Fig. 7](#fig7){ref-type="fig"} (and Tables S3 and S4 in the ESI[†](#fn1){ref-type="fn"}). In ethyl 2-arylazocarboxylates (*e.g.***2a**, **d**, **j**), the *N*CO and *N*--Ar nitrogen atoms resonate in the regions of 107--125 ppm and 142--149 ppm, respectively. Upon the addition of triphenylphosphine, a large downfield shift of *N*CO to around 180 ppm, and a significant upfield shift of *N*Ar to approximately 83--90 ppm is observed for the betaine intermediates. The nitrogen atoms resonating in di-^15^N-DEAD at 150 ppm appear after the addition of triphenylphosphine at 113 ppm and 171 ppm.
Since, to the best of our knowledge, this is the first ^15^N NMR study of the intermediates formed in the Mitsunobu reaction, no direct comparison with the literature data is possible. Nevertheless, the downfield ^15^N resonances, which are common for all phosphine intermediates from [Fig. 7](#fig7){ref-type="fig"}, suggest carbonimidate structural fragments as they are consistent with the ^15^N NMR data of dimethyl cyclohexylcarbonimidate (**50** in [Scheme 1](#sch1){ref-type="fig"}, *δ*~N~ 181 ppm).[@cit32] Although this is reminiscent of a five-membered oxadiazophosphole ring structure (*e.g.*, *O*,*N*-phosphorane **52** in [Scheme 1](#sch1){ref-type="fig"}), the ^31^P NMR chemical shift of such an intermediate should possess a negative value.[@cit27c] Perhaps, the *O*,*N*-phosphorane is formed as a transient intermediate,[@cit27c] but formation of the betaine intermediate having a carbonimidate anion appears to be predominant in the reaction mixture.
{#sch1}
To further support the structure of the intermediate we carried out a trapping experiment in which betaine **48a**, formed *in situ* from **2a**-^15^N and triphenylphosphine in CDCl~3~, was treated in an NMR tube with iodomethane. ^15^N NMR chemical shifts of the starting compounds and products are shown in [Scheme 1](#sch1){ref-type="fig"}. The reaction of **2a**-^15^N with triphenylphosphine followed by treatment with iodomethane readily afforded a methylated product holding a phosphine, as confirmed using ^1^H--^31^P HMBC. A correlation between the N--CH~3~ proton resonance with that of the C0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000O carbonyl in the ^1^H--^13^C HMBC spectrum, along with the absence of N--CH~3~ correlations with aromatic carbons, strongly suggested the formation of ^15^N-methylated phosphonium salt **49**. An upfield ^15^N NMR shift from 182 ppm (in **48a**-^15^N) to 109 ppm upon methylation additionally supports the structure of **49**. By repeating the trapping experiment with ^15^N-unlabeled **2a** in a preparative way, the corresponding phosphonium salt decomposed during chromatographic purification on silica gel into ethyl 2-(3,4-dichlorophenyl)-1-methylhydrazine-1-carboxylate (see the ESI[†](#fn1){ref-type="fn"}). Although the intermediates generated from the dialkyl azodicarboxylates and triphenylphosphine are generally presented in a form of a resonance structure with a negatively charged nitrogen atom and a C0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 1111111111111111111111111111111111 1111111111111111111111111111111111 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000 0000000000000000000000000000000000O double bond, our NMR data suggest that the alternative with the sp^2^ hybridized nitrogen atom more accurately represents the true structure of the betaine ([Fig. 7](#fig7){ref-type="fig"}). This is also in agreement with oxygen being more electronegative than nitrogen.
Overall, the NMR experimental results support the formation of P--N betaines such as **48** in the Mitsunobu reaction using our reagents and indicate that other structures such as regioisomer **51** and P--O betaine **53** are unlikely. Formation of *O*,*N*-phosphorane **52** could not be ruled out but was not detected in our NMR analysis.
By treating butan-1-ol (10 equiv.) with triphenylphosphine (10 equiv.) and azo reagent **2a** (1 equiv.) in solvents like THF-*d*~8~, CD~3~CN, CDCl~3~, or toluene-*d*~8~, a ^31^P NMR resonance corresponding to di-*n*-butoxytriphenylphosphorane (**54**) appeared in the spectra between --56.0 ppm and --55.2 ppm ([Table 4](#tab4){ref-type="table"}), which is consistent with the data for DEAD (--55.0 ppm in THF-*d*~8~).[@cit27a] On the other hand, unlike for THF-*d*~8~, CD~3~CN and CDCl~3~, the resonance of betaine **48a** in toluene-*d*~8~ could not be detected. This suggests that an equilibrium toward betaine **48a** from **2a** is unfavorable but the reactivity of **48a** toward an alcohol is sufficiently high in toluene. Thus, the fate of the betaine generated from the ethyl 2-arylazocarboxylates and triphenylphosphine appears to be very similar to that from the typical Mitsunobu reaction using DEAD.
###### Detection of a phosphorane intermediate **54** from butan-1-ol and betaine **48a** using ^31^P NMR analysis in different solvents
{#ugr4}
------------------------------- ---------------- -------- ------------------------------------------
1 THF-*d*~8~ --56.0 +21.1
2 CDCl~3~ --55.3 +34.5
3 CD~3~CN --55.2 +33.7
4 Toluene-*d*~8~ --55.8 ND[^*a*^](#tab4fna){ref-type="table-fn"}
^*a*^Not detected.
Thermal stability of the developed Mitsunobu reagents
-----------------------------------------------------
When typical azo reagents such as DEAD are used, sufficient care is often required from the viewpoint of their thermal instability. Ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**), ethyl 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**) and their azo forms **2a** and **2j** are stable crystalline solids under ambient conditions, and no decomposition of these compounds was observed after two months. Incidentally, when di(2-methoxyethyl) azodicarboxylate (DMEAD), that is a crystalline solid, was exposed to ambient conditions for two months, a partial but clear decomposition was observed using ^1^H NMR analysis. It is known, from differential scanning calorimetry (DSC), that DEAD, diisopropyl azodicarboxylate (DIAD) and di(2-methoxyethyl) azodicarboxylate (DMEAD) show a large exothermic peak at 210--250 °C, indicating exponential decomposition of these compounds.[@cit33]
We investigated the thermal properties of ethyl 2-(3,4-dichlorophenyl)azocarboxylate (**2a**) and ethyl 2-(4-cyanophenyl)azocarboxylate (**2j**) using thermogravimetry-differential thermal analysis (TG-DTA). Interestingly, it indicated the absence of exothermic peaks, whereas endothermic peaks were observed at 191.3 °C (3,4-dichlorophenyl derivative **2a**, mp: 52.1 °C) and 225.7 °C (4-cyanophenyl derivative **2j**, mp: 55.4 °C) with a loss of weight of the samples. These peaks likely show boiling points of the azo compounds that are accompanied by some evaporation. A possibility of endothermic decomposition is unlikely because decomposition of azo compounds is generally exothermic. To eliminate the possibility of the endothermic decomposition, we representatively tested by heating **2a** in the solution-phase. A solution of **2a** in benzene-*d*~6~ was kept for 10 min at 200 °C in an autoclave and then analyzed using ^1^H NMR spectroscopy, which indicated no decomposition (see the ESI[†](#fn1){ref-type="fn"}). Similarly, TG-DTA of ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**, mp: 114.0 °C) and ethyl 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**, mp: 138.1 °C) showed endothermic peaks with a loss of weight of the samples at 250.3 °C and 267.4 °C, though partial decomposition seems to occur around this temperature in the case of **1j**. Thus, we did not observe clear exponential decomposition of our azo and hydrazine compounds under the ambient pressure unlike in typical Mitsunobu reagents, though we did not test the thermal stability of these compounds at higher temperatures in a pressured vessel.[@cit34] Overall, the experimental results support that our Mitsunobu catalysts can be safely stored and used without special precautions.
Conclusions
===========
Ethyl 2-arylazocarboxylates can operate in the Mitsunobu reaction like typical Mitsunobu reagents such as diethyl azodicarboxylate (DEAD). The former, however, are recyclable using aerobic re-oxidation of the resultant ethyl 2-arylhydrazinecarboxylate with cheap and nontoxic iron phthalocyanine. This outstanding ability enables catalytic Mitsunobu reactions by using these reagents as organocatalysts. Our systematic study reveals that Mitsunobu activity of azo forms of these catalysts is compatible with an oxidation process of hydrazine forms. Two effective catalysts have been identified. Ethyl 2-(3,4-dichlorophenyl)hydrazinecarboxylate (**1a**) is suitable for catalytic Mitsunobu reactions with carboxylic acids, working best for the inversion of stereochemistry of secondary alcohols. Ethyl 2-(4-cyanophenyl)hydrazinecarboxylate (**1j**) provides excellent results in reactions with nucleophiles other than carboxylic acids, serving for the transformation of the hydroxyl groups of alcohols to other functional groups. Thus, the catalytic Mitsunobu reaction has been complemented by two potent reagents and strict optimization of the reaction conditions. The present catalytic protocol is comparable to the original Mitsunobu reaction in both, reactivity and scope. It is also noteworthy that these reagents are stable solids, and their thermal behavior is different from the typical Mitsunobu reagents. Our study has illustrated that serious limitations of the Mitsunobu reaction are avoidable using new reagents and improved procedures. We expect that the improved method will promote the use of the Mitsunobu reaction in practical synthesis.
Supplementary Material
======================
Supplementary information
######
Click here for additional data file.
Authors are thankful to Dr Jun Kamitani (Industrial Research Institute of Ishikawa) for measuring the TG-DTA and for helpful discussion. D.H. and T.T. are thankful to Prof. Shigeyoshi Kanoh, Katsuhiro Maeda and Tomoyuki Ikai (Kanazawa University) for their kind support. This work was supported by MEXT/JSPS KAKENHI Grant-in-Aid for Scientific Research (C) (Grant no. 25460011) and Grant-in-Aid for JSPS Fellows (Grant no. 14J02441). Financial support from the Ministry of Education, Science and Sport, Republic of Slovenia, the Slovenian Research Agency (Grant P1-0230) is acknowledged. Dedicated with deep respect to Professor Miha Tišler on the occasion of his 90th birthday.
[^1]: †Electronic supplementary information (ESI) available: Full experimental details and copies of analytical data. See DOI: [10.1039/c6sc00308g](10.1039/c6sc00308g)
| tomekkorbak/pile-curse-small | PubMed Central |
While 2017 recorded India's second-highest sex ratio at birth in Maharashtra, some districts have shown a drastic fall in the number of girls.
In 2013, the sex ratio at birth was just 900 which improved to 914 in 2014 but marginally dipped to 907 in 2015. The provisional birth registration figures for 2016 and 2017 stand at 904 and 913 respectively.
Districts like Akola, Washim, Kolhapur, Hingoli and Satara have shown an almost alarming fall by 47, 42, 33, 30 and 28 points respectively in the past five years. The rise in the district-wise sex ratio at birth has been the healthiest in Wardha where at 200 points (from 976 in 2013 to 1,176 in 2017), girls outnumbered boys by a huge margin. Tribal-dominated and Left-wing violence affected Gadchiroli has a sex ratio of 1,000 in 2017, which is up by 161 points from 839 in 2013. This is followed by Ratnagiri, which rose by 78 points from 848 in 2013 to 926 in 2017.
Activist Varsha Deshpande of the Lek Ladki Abhiyaan noted that the falling child sex ratio figures in some districts indicated that authorities had failed to implement the Pre-Natal Diagnostic Techniques (Regulation and Prevention of Misuse) Act, 1994 (PCPNDT) stringently. The Act prevents misuse of pre-natal sex determination techniques and female foeticide. Desphande blamed traditional communities for practices like female foeticide. | tomekkorbak/pile-curse-small | OpenWebText2 |
A happy office is a good office. That’s not rocket science. But sometimes adding a little productive fun to our day jobs is easier said than done. This story is designed to add a shot of happiness to any workspace thanks to 11 seriously cool pieces of technology.
Each gadget is meant to make us smile, but they also target specific ways for us to ease stress, feel happier, and ultimately get more stuff done. Check out Greatist’s picks and let us know your own favorites in the comment section below.
Gadgets for Desk-Top Happiness
These magnetic balls may just look like a grown-up toy, but they (and their numerous shapes and sizes) have become popular among serious professional and curious kids alike. But it’s not just for fun — playing has workplace benefits. One study found that on-the-job playfulness improved communication, creativity, problem solving, and team building Incorporating fun into the business of serious work: the use of humor in group process. Burchiel, R.N., King, C.A. Surgical Services, University of Washington Medical Center. Seminars in Preoperative Nursing, 1999, Apr;8(2):60-70 . Another suggested people naturally tend to involve the body during complex cognitive functioning Modal preferences in creative problem solving. Deininger, G., Loudon, G., Norman, S. Cardiff Metropolitan University, U.K. Cognitive Processing, Aug;13 Suppl 1:147-50 . Buckyballs (and other “smart” toys) may just be for fun, but a little fun could be the solution.
This family of lights and lamps use special bulbs to create a natural, sun-like ray. The lights — colloquially called “Happy Lights,” like this one from Verilux — not only remind us of the great outdoors but also activate a personal dose of vitamin D. Vitamin D helps maintain our metabolism, immunity, nervous system, and bone density. A burst of UV rays provides vitamin D, helping us feel happier. While vitamin D deficiencies have been linked to depression, consuming more than 50 mcg can also lead to problems such as decreased appetite and nausea.
This compact and hardcore USB drive is less about boosting endorphins than it is about creating peace of mind. The Rugged USB is like any other USB device but with a protective (and bright) orange cover. Drop resistance up to 100 meters and with secure encryption included, this is a solid drive for mountain bikers and desk jockeys alike.
One of the best ways to be productive, according to efficiency expert Ari Meisel, is to free the mind to focus on the task at hand. So stop worrying about lost pieces of paper and start automatically transferring handwritten notes straight to the computer. The Wacom Inkling lets users doodle to their heart’s content, converting pen and paper into digital vector or image formats for easy reference. Moleskine is jumping on board, teaming with digital note-taking software Evernote for a special line of notebooks.
Plants naturally make us happier and can even help us be more productive in the workplace and get sick less often. If opting for a plant, feng shui masters say greenery with rounded leaves creates a calming affect while upward-pointing plants, such as bamboo, provide energy. This USB greenhouse is a nice way to keep plants alive (and flourishing) even when plugged in at work.
Yes, “Henry the Desktop Hoover” is meant to make us smile, but having the little sucker around is sure to remind us to keep desks cleaner. Clean desks, free of clutter or debris, can help decrease stress and make work a little easier.
Sitting in a chair all day at work does all sorts of nasty stuff to our back and our posture. While we wrote up an ultimate guide to good posture at work, sometimes the best answer is not to sit at all. Stand Up (or Sit-Stand) desks don’t hurt our posture and can even improve creativity and performance. We’ll stand for that!
This little guy is charming as all get-out. Some sophisticated sensors in Keepon’s base and body allow it to intelligently react to commands, noise, and various forms of pressure (from head pats to pokes to tickles). It might get some stares, but advanced robots like Keepon can actually provide some health benefits. Similar companion bots (such as the dinosaur PLEO) have been used to help disabled and autistic people socialize and emotionally adapt to new surroundings.
Baoding balls are probably the oldest “gadget” on the list. This pair of balls is an ancient Chinese meditation aid and a way to improve manual dexterity. At the very least Baoding balls can help us have a little fun (like Buckyballs) and provide a problem-solving boost.
10. Guitar Mobile Apps
Music has a calming affect that’s sure to boost our happiness, but jamming out on an instrument can also provide similar relaxing benefits. For any rock stars-to-be or those looking for a mid-day stress buster, try downloading either the Real Guitar app ($0.99) or the PocketGuitar app ($0.99). These two apps simulate the sound and action of a real guitar on an iPhone with several sound options and the ability to bend and pluck notes. Relaxation never sounded so good.
11. Red Knock Out Bag and Stress Balls
Angry at a co-worker or a client? It’s better to take it out on this mini punching bag or a stress ball before throwing punches. Holding on to anger can be a bad thing, and getting arrested is (probably) even worse. Stress balls may also have some secret muscle-relaxing properties. Aside from building some forearm strength, crushing a stress ball can activate progressive muscle relaxation (slowly tensing and relaxing muscles over time).
How do you de-stress and stay happy at work? Let us know in the comments or reach out to Zack at @zsniderman. | tomekkorbak/pile-curse-small | OpenWebText2 |
Interviewing the young child sexual abuse victim.
1. Nurses can facilitate the disclosure by a young child of sexual abuse by using developmentally sensitive language, such as through the use of proper nouns, single-idea sentences, and the avoidance of technical terms. 2. Nurses can guide the interview from benign, open-ended questions to context-specific, focused questions. Differentiation is made between being specific versus being suggestive. 3. Rapport-building is an important part of the alliance with the child and the nurse. Interviewers should be matter-of-fact and acknowledge any discomfort the child may demonstrate. 4. Cognitive interviewing is a specific technique designed to access accurate recall of a child's memories through reconstruction and memory-jogging techniques. | tomekkorbak/pile-curse-small | PubMed Abstracts |
If this is your first visit, be sure to
check out the FAQ by clicking the
link above. You may have to register
before you can post: click the register link above to proceed. To start viewing messages,
select the forum that you want to visit from the selection below.
Ambles would be a great pickup. We have a lot of questions at WR. I wouldn't be surprised if Jon Davis is our leading receiver next season. I'm not saying that is a bad thing because I think he is going to be a beast. But, there are more questions at WRs than definite answers. Millines has to be able to stay on the field. Lankford has to translate practice to the games. Harris is solid, but unspectacular at best IMO. After that we are relying on freshman like Knight, who have big upside but no experience in the B10.
I know we have offered quite a few receivers in this class. Ambles would be an outstanding pick up. I like Millines like you said but the guy can't seem to stay healthy. I'm really hoping in terms of receivers we can land Treadwell. He would be huge and be a great guy to pair up with Bailey. I'd say right now we have a decent shot at him but not a great one yet.
Hopefully we can add some more O-Lineman. We just added an OT from Ohio today. His names Austin Schimdt. Don't know if anyone saw that. I'm really hoping for Pocic though.
This is where Beckman can really make his mark IMO. I don't get the sense reading stuff around the internet that we really are in the lead for any of the Illinois guys left at the top (Isaac, Pocic, Treadwell). If he can get another commitment the program could get a ton of momentum on the recruiting side.
Another DT commit for Beckman today. Kenton Gibbs from Cass Tech in Detroit committed, though he says it is only a soft verbal and he will still take visits/camps elsewhere this summer. From what I've read, if Michigan offers there is a strong possibility (maybe even likelihood) that he will flip.
Also, there are some recruiting analysts who think this could help us get his team mate (OT Dennis Finley) whom we are already considered the favorite for.
These types of commitments aren't the big names everyone is hoping for. But, they are crucial to build a program. I'm really liking what Beckman is doing.
Another DT commit for Beckman today. Kenton Gibbs from Cass Tech in Detroit committed, though he says it is only a soft verbal and he will still take visits/camps elsewhere this summer. From what I've read, if Michigan offers there is a strong possibility (maybe even likelihood) that he will flip.
Also, there are some recruiting analysts who think this could help us get his team mate (OT Dennis Finley) whom we are already considered the favorite for.
These types of commitments aren't the big names everyone is hoping for. But, they are crucial to build a program. I'm really liking what Beckman is doing.
Yeah I saw that last night. If he sticks though, man we our going to have ourselves another strong D-line in the future. I'm still hoping we can land Augusta as a DE/DT hybrid type. To me that would really complete our D-line class.
Also, its looking like we are in the lead right now or very high on Darius Mosley's (the CB from O'Fallon I believe) list. I'm hoping we land him and that four star linebacker that Jarrod Clements is friends with, Darrion Howard. Clements is helping recruit him a lot.. He could step in and replace Brown, if Brown leaves after this season which is likely.
As far as Treadwell, Pocic and Issac go. I think we have a decent shot at all of them but I don't think we are in the lead at all with either of them. It seems to me like Michigan is the favorite for Treadwell. Not sure about Pocic but I'm hoping his brother can sway him here along with Beckman. Pocic should compete for playing time instantly. Issac I think wants to play in a pro system so I doubt he comes here but I do believe he is still considering us even if were not high on his list.
Overall, I'm really happy with the recruiting class Beckman is putting together. We have never had this many recruits before at this time under Zook and all of these guys have a ton of promise.
Man I wish this part of the forum was more active. I love talking recruiting.
Ty Isaac committed to USC today. It is disappointing but I don't think he was ever a realistic option. He is the Jabari Parker of this football class. But, I think we will be alright at RB for this recruiting cycle with Young and Ferguson only being Sophs this season.
Pocic is the next big target that I think is realistic. It doesn't seem as though he has a favorite yet and we haven't been written off yet. According to some local stories that talked to Graham, his brother isn't in a hurry. So, some wins early on in the season could help us.
Ty Isaac committed to USC today. It is disappointing but I don't think he was ever a realistic option. He is the Jabari Parker of this football class. But, I think we will be alright at RB for this recruiting cycle with Young and Ferguson only being Sophs this season.
Pocic is the next big target that I think is realistic. It doesn't seem as though he has a favorite yet and we haven't been written off yet. According to some local stories that talked to Graham, his brother isn't in a hurry. So, some wins early on in the season could help us.
Too bad about Issac. He could have been really good here.
Yeah I read that about Pocic. I'm hoping he comes here. I still think Treadwell is realistic as well. He likes the idea of playing with Bailey from what I have read.
^I didn't know that about Treadwell. From what I had seen, I thought he was a Michigan lock; he just hadn't announced it yet. Picking him up would be huge for a team with a lot of question marks at WR.
TBH, what I am most interested to see is what happens to our Florida ties and can we be as successful in Ohio with under recruited players as we have been in Florida? We have been pretty successful with under appreciated talent from Florida recently (Liuget, Millines, Lankford, Pollard, Spence, etc).
^I didn't know that about Treadwell. From what I had seen, I thought he was a Michigan lock; he just hadn't announced it yet. Picking him up would be huge for a team with a lot of question marks at WR.
TBH, what I am most interested to see is what happens to our Florida ties and can we be as successful in Ohio with under recruited players as we have been in Florida? We have been pretty successful with under appreciated talent from Florida recently (Liuget, Millines, Lankford, Pollard, Spence, etc).
I read the thing about Treadwell in one of the recruiting chats on illinihq.com.
Looks like we will try to add at least 3 receivers in this class as well. Wesley Thomas from IN is looking to visit here soon and he looks like he will be a good add if we can land him.
Beckmann and co picked up another verbal today. 3* Ohio athlete Reon Dawson picked Illinois today; he had other offers from places like Penn St, Pitt, and West Virginia.
Count me as a believer. The way this staff is recruiting and getting kids to buy in without ever having coached a game at Illinois is really impressive. They have me believing that of we can win 8 or 9 games consistently that they can hit some home runs in recruiting.
Anybody got plans to make any games this season? I'll try to make at least a couple. The non-conference home schedule is a little dull though.
The home schedule in general sucks with no Ohio St, Wisconsin, Michigan, Michigan St, or Nebraska. I'm thinking about heading down for Louisiana Tech and I think I'll be there for Indiana.
TBH, I can't wait for the Big 10/Pac 10 thing to start. Granted we are currently playing ASU and have Washington lined up but I really hate how boring non-conference has become in CFB. I still want to see some rule changes to get some improved non-conference games.
From what I've been able to find it is between us and Michigan St. He's a step below the Ty Isaac's, Aaron Bailey's, and Treadwell's of this class but he would still be a great pickup. Not only are we thin in the Secondary, but he is the type of player that we had trouble keeping in state under Zook. He can be another building block player.
From what I've been able to find it is between us and Michigan St. He's a step below the Ty Isaac's, Aaron Bailey's, and Treadwell's of this class but he would still be a great pickup. Not only are we thin in the Secondary, but he is the type of player that we had trouble keeping in state under Zook. He can be another building block player.
I wanted to update the bolded part. I guess Illinois and Vanderbilt have been his only official visits. Take that for what it is worth but I'm thinking we are in a pretty good position right now with him. | tomekkorbak/pile-curse-small | Pile-CC |
DISCLAIMER: THIS STORY IS FICTION AND IS NOT INTENDED TO IMPLY ANYTHING ABOUT THE TRUE SEXUALITY OR LIVES OF THE CELEBIRITES MENTIONED. NO PERSONAL KNOWLEDGE IS CLAIMED, AND ALL CELEBRITIES INVOLVED ARE PURELY CHARACTER REPRESENTATIONS. NO FORM OF LIBEL IS INTENDED. ALL OF THE FILMS CITED WITHIN ARE THE TRADEMARK AND PROPERTY OF THEIR RESPECTIVE OWNERS.
Ω
Μ
Σ
Ordo
Mentula
Sanctum
THEORDEROFHOLYWOODPART VI: SEEDS & NEOPHYTES
Prologue: It was the last thing one would want in Hollywood, and yet inevitable to all of those who lived there: aging. To be once young and stunning is to be immortal: irresistible by all who partake in the plenary desires of sexual gratification. After years of being in show business, résumés are built and reputations are forged...age becomes just a number. They remain the sexual icons they once were, and their responsibility to protect their vigor is equally as vital. The youngest and hottest stars had begun to grow up, and their youthful indiscretions could not take hold like they used to. Some adapted and settled down, others simply stayed in denial of reaching adulthood. There were the select few who would embrace their new found maturity and maintain their aesthetic potency in boldness: to stay forever young with brotherhood and fraternity by only consorting with their fellow members - and it was with that oath that they became a secret society of peers known only as... The Order of Holy Wood.
It was now the end of October 2007, and Orlando Bloom sat uncomfortably at the Teen Choice Awards. Though he was nominated, he knew Johnny Depp would win over him, and probably deserved it because Johnny was an amazing actor. Come to think of it, he hadn't even looked at who else was even nominated to win the award.
He walked casually past all the screaming teens and got into the backstage area, avoiding the paparazzi and other media jackals that were at the event.
"Hey good luck tonight," a man behind him said.
Orlando turned around and saw it was Leo DiCaprio, one of his favorite friends ever since the Order previously convened. Orlando was sort of surprised to see him there, but figured he was probably nominated for his role in The Departed
"Oh thanks, you too," Orlando said casually, making sure not to arouse too much suspicion.
He stared at Leo's features and held a small smile back. In the time that he was able to turn back around, Orlando soon realized that he hadn't been paying attention at all. By that time it was too late, and he ran into a guy that was in front of him. The young, but well defined man turned around and had a nice smile on his face, as if he didn't mind it at all. In front of Orlando was the hottest guy he'd ever seen, and he couldn't come up with any words in time to save himself from looking stupid.
Orlando's hands were fumbling strangely with his pockets, and he smiled lightly, wondering who the mystery man was and how he could have done something so foolish in front of him.
"Oh, thanks..." he said, trying not to look too nervous.
Orlando continued walking until he found his seat at the reserved location and continued watching the show. Within forty five minutes he had began to grow unpatient sitting there. He made eye contact with Leo and a few minutes even received a text message from him:
Whats up stud
He clicked on the keypad and began decided to send one back:
Meet me where you saw me backstage.
Leo got up from his seat and began to find the entrance to the back stage area, showing a security guard his pass along the way. By the time he got there Orlando was already standing with his arms crossed.
"What is it, man?"
Orlando didn't answer but was instead focused on the stage. He watched as the next award was being presented. Finally he realized it was him, and the mystery man was coming onto the stage. Orlando realized it was the award for best Dance in a movie, and he needed to ask Leo about it.
"Leo, that's the same guy I bumped into here back stage, who is he?"
Leo looked at Orlando with a smirk of disbelief.
"That's Channing Tatum, nominated in the same category. Bad actor, but can't take my eyes off him."
"He's amazing...man, I'd like to see him at Suite 223 with us. Should I try to invite him? I got vibes earlier."
"Vibes? Well hey if you think its a good idea, I guess we could try. Rumor is that he plays on both sides of the team."
"What?"
Leo leaned down a little to avoid anyone else overhearing.
"Bi..."
"Oh...!" Bloom said realizing his obvious misunderstanding.
Leo shifted his weight and remembered he'd come back stage for another reason besides Orlando.
"I've got my own friends that I need to talk to tonight, and I know how things are going to go down tonight."
"Huh?" Bloom asked, still wondering what he meant.
"You yourself are nominated with a hottie, and I'm going to go talk to him right now. Oh...and good luck with Channing. He's about 10 seconds away from being right next to you."
Orlando paused and then felt the strange feeling of anticipation and looked behind quickly, seeing Channing Tatum coming towards him after winning the award. Leo walked away and left Orlando standing by himself.
"Congratulations," Orlando managed to say as Channing walked close to him.
"Hey, you bumped in to me earlier...you're Orlando, right?"
"That's right," Orlando said with a nervous tone.
"Well hey if you ever want to party sometime, here's my number," Channing said as he handed him a small piece of paper.
"Thanks...I'll call..." Bloom said, unsure of what else he could say.
Meanwhile, backstage, Leo had tapped the young lad on the shoulder and he turned around.
"Holy! How's it going?" the young man said quickly.
"Hi, there, I was wondering if I could talk to you for sec," Leo said.
"Sure, of course, I mean...yeah."
The two young men kept walking and Leo put out his hand as they separated from the hoards of people.
The young man pushed his hair back a little and then put his hands in his back pockets. Leo stared into his bright eyes and resumed the blossoming conversation, deciding there was no need to beat around the bush, and he may as well get to the point.
"I've got sort of an exclusive after-party I'd like to have you attend."
"I'd love to, I mean, I'm not 21 or anything..."
"That doesn't matter, you're a real talent in this town,"
"You really think so?" the young man responded.
"This way you can meet some of my friends as well," Leo said back.
By this time the young Zac Efron was star-struck in meeting Leonardo DiCaprio. He was practically drooling over him as he looked into his bluish green eyes.
Leo paused for a moment and came in very close to Zac and touched his cheek with his hand, turned his head slightly. Leo leaned in and whispered into Zac's ear. Within seconds Zac's facial expression changed and his crotch tingled from the dirtyness of what Leo had said. Leo smiled as he began to walk away, putting his number into the front pocket of Zac's shirt.
Orlando spotted Leo and was watching the encounter as it went down, finally catching up to Leo as he walked away.
"What on earth did you whisper into his ear?"
"Oh nothing too important, just a proposition..."
They had gotten about 20 feet away when they heard Zac shout out behind them.
"Yeah!" he said simply, with a large smile still remaining on his youthful face.
Leo and Orlando both paused to look back for a moment and then continued walking as Zac fumbled to get the paper from his pocket.
"Well you seemed to get your answer there," Orlando said.
"What about you, how did your chat with Channing go?"
"Oh its amazing, he gave me his number!" Bloom said while beaming with pride.
"We'll have to pass that along to Brad, since he likes to handle the invitations."
"What about with Zac?"
"I've got my own little test of confidence for him," Leo said.
They continued walking and decided to leave, as time was of the essence.
"We'll have to get to the limo and wait for Zac,"
"You're kidding right, you mean, he's going to be coming with us back to the Order?"
"Oh I told him to call me in a half hour, and if he wants to suck me--I'd let him."
"Wow, you're quite the gentleman."
"He'll be calling soon," Leo said with confidence.
As if by clockwork, Zac picked his phone out of his pocket and dialed the number that Leo had given him. He paused as the phone rang and then Leo picked up.
"Hello?"
"Hi is this...Leo?"
"Yes it is, are you ready to go Zac?"
"Totally"
"Okay well then you'll have to find the limo...let me give you the location of where it's at."
Leo gave him the location and within 15 minutes Zac had found it without a problem. The door swung open and he looked in to see Leo. DiCaprio moved over a little and allowed plenty of space for Zac to sit down. By this time Efron had noticed that Orlando Bloom, one of the other nominees at the award ceremony sat alongside Leo, texting something with his cell phone.
"It's okay, hes coming along for the ride," Leo said.
Orlando clicked one of the buttons that put up the limo divider, allowing them privacy from the driver watching. Zac noticed this and immediately became nervous on how to fulfill on what Leo had proposed earlier. He reached over and touched the top of Leo's pants, feeling DiCaprio's crotch. Finding the button to his pants, Zac opened them up and lowered the zipper. Seeing Leo's underwear, Zac touched him and felt Leo's cock as it began to expand. Orlando eagerly watched as Zac, began to lift up the band of Leo's underwear and reach inside, feeling Leo's dick. Zac looked up at Leo as if to ask if it were okay to continue.
"Go ahead," Leo said.
Efron got down from the seat and onto his knees in front of Leonardo. Zac touched Leo's cock as it was still hardening, feeling the tip and the shaft in his hand. By this time Leo had helped out a bit and lifted his butt of the limo seat and lowered his underwear a little. Zac massaged leo's cock as it grew fully hard, and began to jerk it slowly while looking at Leo's reaction. He felt the tip of Leo's cock with his fingertips, and massaged the shaft with the other hand.
Orlando watched as Zac pumped the head and shaft of the dick, moving his other hand down to Leo's balls, feeling each one of them inside his sack. Zac leaned down and took the head of Leo's cock in his mouth, feeling the warmness of it and licking the head with his tongue. By this time Orlando took out his own raging member and began to jack it. He worked his stiffy quickly as Zac continued licking DiCaprio's hardened rod.
Leo thrust his hips up slightly to get his whole cock into Zac's mouth as he struggled not to gag on the large member. Zac used his hand to massage the shaft and stroke it as he kept the head of Leo's dick in his mouth, the area right below the head being squeezed by Efron's lips. At that moment Leo thrust up one more time and felt his tingling orgasm begin, with Zac kept his lips around the head of Leo's cock, DiCaprio let his jizz shoot into Zac's mouth. Zac felt the warm liquid on his tongue and swallowed it, continuing to stroke the shaft of Leo's prick. He licked the head as droplets continued to come out, Leo finding himself out of breath and the strength of his orgasm.
By this time Orlando was getting very close and looked over at Efron. Without saying a word Zac moved over to Bloom's cock and let him insert it into his mouth. Zac felt the head grow in size slightly and felt the cum of Orlando also enter his mouth. Zac once again began to swallow spurt after spurt of semen as he played with Orlando's balls slightly. He licked off the final remnants of cum from Orlando's dick and once again to a seat on the limo.
"Zac, I didn't realize you would be..."
"What...able to do that?" Zac replied before Leo could finish.
Both men had pulled up their underwear and pants by the time the limo reached the destination, a somewhat secluded area with a large fence protecting the entrance. The limo was immediately allowed access by the gate opening, and soon after shutting rather abruptly.
The three of them got out of the limo and began walking up the paved entrance to the building, where to Zac it almost looked like a castle. The entire estate was bought by Brad and Matt, each paying half of the $4 million dollar pricetag. It was easily affordable, and they had taken no problems making it absolutely perfect in order to protect their privacy. Zac looked in amazement as they walked up to the main door and went inside. Reaching the second floor took less than a minute, and the three men came up Suite 223. Orlando instinctively remembered the things that Brad had taught him, and hesitated before opening the door. He pushed Zac off to the side and held onto his shoulders.
"By choosing to enter this door you affirm that you swear to uphold 3 rules. The first is that you swear to preserve the secrecy of the Order and tell not a soul. The second is that you will maintain the integrity of the Order and value its honor. The third is that you will trust in the Patriarch of the Order and follow his leadership."
"I swear," Zac said.
Leo paused for a moment.
"You're 18 right?"
"Yeah, I turned earlier this month."
"Good, very good...whew dodged a bullet on that one," Leo replied back to him.
"So, I have just one question. Who is...the Patriarch?"
By this time Brad got impatient and opened up the door, not realizing they were outside. He poked his head out and saw Zac against the wall with Orlando in front of him. Zac turned his head and looked at Pitt, getting that same awestruck look in his eyes once again.
"You're lookin' at him," Leo said with a chuckle.
Brad looked back at the young fellow and smiled at him. Brad looked back at Orlando and stepped outside the door.
Orlando remembered that he had texted Brad on the limo earlier, before all the fireworks with Efron had began.
"And what about Cha..." Bloom began to say, when Brad interrupted him.
"Ah, I'll get to him in a moment, but first we have to sit down with Zac, here."
Brad put one hand on Zac's shoulder and brought him inside Suite 223, and inside the main corridor.
"You see Zac, this is where our meetings take place, and surely you know by now how we operate...in perfect secrecy. I had this room built, and I even took to making it soundproof. Staff works outside, and we don't allow any of them in here for any reason. What goes on in this room is private, and we take it very seriously."
"Boy I can tell," Zac said as he noticed some of the obsure artwork on the walls of the main room.
"There are also offshoots of this main room--side rooms, for sleeping and whatever else," Brad said.
"Wow, this is all really amazing..." Zac said while still glancing around.
>From one of the side rooms emerged Mark Wahlberg, who had been in there for the last hour.
"Hey who's the pint size?" he asked while scoping Zac's body.
"This is Mr. Zac Efron...Zac, meet Mark Wahlberg."
"Yeah, I've seen you in Boogie Nights, I like your work."
"Brad, you coming back soon?"
"I'll be in within the hour, hang tight."
"Alrighty," he said, and went back in the side room.
"So can I bring another person here?" Zac whispered to Leo.
"That depends on who it is," he responded.
Brad overheard the question and decided it would probably be okay for Zac to bring a friend as long as Orlando was overseeing what was going on.
"Since you're knew here I suppose we can do a double-initiation, is he a young hot celeb friend of yours?"
"Yeah."
"Connor is making his triumphant return, I figured you and him would hit it off with some good legal fun."
"Well Zac is over 18," Leo said quickly.
"The law is 3 years difference with minors...Connor may not be fair game, for us, but Zac certainly is within the law. Hell, Zac here is fair game of all of us tonight. Hope you got enough energy in ya when Mark and I finish our fun in Room B. Bring your friend, too. Oh, and one more thing I almost forgot Orli...Channing will be here in half an hour. Now boys, I've got things to attend to...Bloom, you're in charge, you know the rules."
Brad followed his way after Mark and when into Room B, leaving only Leo, Orlando, and Zac anxiously awaiting their guests to arrive. Zac had meanwhile gotten out his cell phone and made a quick call to invite his friend to arrive. It would take about 15 minutes for him to get to the house.
Within five minutes of Zac getting off the phone, a different lad named Connor Paolo opened up the door to the main hall and walked in confidently. He expected to see the usual folk, mainly Colin and Brad, but was shocked to see Leonardo and Zac Efron.
"Hey whats up guys...Brad told me that I would meet somebody that was in my own age range..." he said while looking at Zac.
He immediately recognized him from the kiddie musicals that he starred in, not realizing he would be just as attractive in person.
"You kids can have fun, I'm going to wait until Channing gets here," Orlando said.
"Yeah why don't we wait in Room A until my friend gets here," Zac said.
"Okay," Connor said, not realizing it would be this easy.
They both walked over to the room and Connor began to become instantly infatuated with Zac. He moved in closer to him when Zac was shutting the door and planted a small kiss on his lips, looking into his eyes.
"You know, I've never been here before, I'm not exactly sure how, I mean..."
"Don't worry about it, we'll just take it slow and wait for your friend to arrive," Connor replied.
Zac decided this was probably the greatest thing that had ever happened to him. He had not really known Connor but was instantly attracted to his dark hair and prominant eyes. He put his hand on Connor's chest, and moved in closer, kissing him on the lips. Connor leaned back slightly and sat on the bed that was in the room, allowing Zac to continue the kiss. He leaned over onto his side and Zac sat next to him, moving his hands lower to Connor's flat stomach. By this time Zac began to feel himself growing hard in his pants, feeling Connor's tongue enter his mouth and massage his own tongue.
Connor reached down and touched Zac's bulge, squeezing it slightly through the material of his pants. Zac returned the favor and moved down to Connor's pants and felt his cock through the material, holding onto Connor's balls as they both began to lie down on the bed. Each began to accelerate the kiss further, finally until they were deeply making out, Connor on top of Zac as both of their bulges touched and rubbed together through the material. Zac's 6 inch teenage cock had grown to full mast and when he rubbed his bulge against Connor felt the surge of pleasure. Connor loved to be on top of Zac and felt his muscled pecs as they continued to make out, thrusting passionately into each other.
The time began to pass when they heard a knock at the door, and it cracked open slightly.
"Hey they out there told me that I..." the youth paused for a moment.
He looked at the sight of Connor on top of Zac, and immediately felt a little jealousy burn up inside him.
"I guess I can come back, I didn't realize that you..." he began to say when Connor chimed in.
"Oh come on stud, stay for a bit," Connor said, still unaware of who he was talking to.
Zac immediately felt embarassed he had not waited, since it was only about 10 minutes. He immediately patted the bed and motioned for his friend to come over and sit down.
"Connor, this is my friend...Corbin," Zac said as politely as he could, given the situation.
"Corbin Bleu," he young lad said as he pushed out his hand for a handshake.
Connor immediately felt a burst of confidence and moved over to Corbin, ignoring his outstretched hand and immediate getting close to his face, putting his lips on Corbins. Bleu was taken off guard but enjoyed the young boys lips on his own, soonafter feeling Connor's tongue go into his mouth. Zac sort of laughed to himself at the introduction, but apparently Connor was a tenacious one.
"Corbin here was in a movie with me, he's not eighteen yet, thats why I invited him. Ya know, so you wouldn't be the only one," Zac said with a smile on his face.
The three boys sat on the bed and stared at each other with lust filled eyes. Zac was still hard in his pants and wanted Corbin to join in the fun.
"Hey Corb, help me out here, eh?" Zac said.
Corbin had fooled around with Zac a lot on the set of High School Musical, but he had never gotten into a 3-way situation like the one he was in now. He nervously moved over to Zac's pants and unbuttoned them, pulling the zipper down slightly. The head of Zac's boner was visible through his underwear, and Connor immediately started making out with Corbin once again while Corbin attempted to pull down Zac's pants. Corbin felt the outline of Zac's hardened dick and began to pull down the wasteband of his underwear, allowing Zac's free. Connor watched as Corbin wrapped his hand around Zac's dick, feeling the shaft and head as he moved his hand up and down Zac's dick.
"Ahh," Zac said while feeling his dick stroked.
Connor unbuckled his pants and pulled them down, laying on the bed in his underwear with his boner popping outwards in his underwear. Corbin himself had a raging hardon, but decided it could wait, as he was focused on jerking Zac's cock. He looked over to Connor and noticed his hard dick in his undies, and reached over with his other hand, pulling down his underwear and grabbing onto his stiff rod. Corbin now held both boys' cocks in his hand, jerking each one up and down and feeling the cockheads, as he massaged each member. Zac felt closet to orgasm and decided to change positions.
He got off the bed and moved behind Corbin, while the boy began to put Connor's rod in his mouth. He licked the head eagerly and put the tip of Paolo's cock in his mouth, while still gripping the shaft with his hand. Connor reached down at Corbin's shirt, and peeled it off, exposing Corbin's muscled chest and tight abs.
Corbin began to suck once again at Connor's dick, and massaged the boy's sac with his hands. Connor began to wonder what Zac was planning, and realized it soon enough when he saw Zac get down on his knees behind Corbin. Zac spread Corbin's bubble butt, seeing his pucker between his brown cheeks. He leaned in and licked at the edges of Corbin's hole, making Bleu moan from the sensation.
Zac's tongue forced its way into Corbin's pucker and he had now penetrated, as Corbin's dick began to stiffen and twitch more in his pants. Zac took one of his fingers and licked it, pressing it against Bleu's hole and pushing in.
Corbin moaned while Connor's cockhead was between his lips, and felt Zac's finger go in further to his hole, now coming close to touching his prostate. Zac pushed until his whole finger was inside Corbin. Connor stopped Bleu from his sucking and moved down to undo his pants. Corbin's rock hard dick tented his boxers as Connor pulled it down and began to suck on it. Corbin stood while Zac was fingering his ass and Connor sucked his dick, taking his brown sac in his hands and feeling Bleu's balls.
Zac reached down and took his hardened cock and put it between Corbin's cheeks, pushing the head of his dick inside Corbin's pucker.
"Zac..." Corbin said.
Connor kept sucking as Corbin was penetrated by Zac's teenaged cock, feeling the length of it enter his rectum and fill his hole. Connor continued stroking Corbin's dick with his hand and keeping the head of it in his mouth. By this time Zac had gotten his cock fully into Corbin and pumped it in and out. Zac moved his hands around to Corbin's chest and held onto his pecs. He moved his hands lower and felt Corbin's tight abs, continually pushing into the boy's butt. Corbin felt Zac's pelvis thrust onto his ass while Zac's dick was all the way inside him. He felt the tip of Zac's dick hit his prostate as Connor sucked and stroked his own cock.
"I'm going to cum...oh man...oh!" Corbin said as Zac thrusted a final time.
Pushing his dick all the way into Connor's mouth, he began to spurt as Zac continued to pound his ass. Zac felt Corbin's pucker squeeze his dick and he thrust in while his own orgasm came. The warm liquid rushed out of his rod and into Corbin's butt, and the boy pushed his butt back to meet with Zac's thrusts.
Connor swallowed Corbin's load of cum as he massaged his balls and sucked the tip of his cock. Zac finished pumping and pulled out of Corbin's butt, moving over to Connor. He took Paolo's cock and put in his mouth, sucking off the boy as he moaned in pleasure.
"Oh yea..." Paolo said as Zac licked the head of his rod.
Connor moved so he was alongside Zac and put Connor's balls in his mouth, feeling the boy's testicles with his tongue. Zac licked and sucked while Connor began to come close to his orgasm. He thrust his hips into Zac's mouth and held onto Efron's head as he bobbed up and down on the teenage boy's cock. Connor began to make a steady rhythm, pumping between Zac's lips and feeling Corbin's tongue on his balls.
Connor began to cum into Zac's mouth, with Zac swallowing the boy's juice as he continued thrusting. Zac stroked the last liquid out of Connor's cock and licked the head of his dick, sending tingles up the boy's spine.
The three boys relaxed on the bed as they recovered from the energetic sex romp.
"This club is...amazing..." Corbin said as the two other boys put their clothes back on.
"Well you're welcome to return," Connor said.
"I'm glad you came, Corb," Zac said.
"Zac...you have to get initiated by the other members now..."
"Well what about you guys?"
"Don't worry about us, we'll be fine."
Zac didn't even bother to put a shirt on, choosing only to put on his pants that he was wearing earlier. He took the door handle and turned it, opening it slowly. He looked out into the main chamber and took his first steps into joining some of the other men that were there... | tomekkorbak/pile-curse-small | Pile-CC |
Q:
what do the numbers mean in ip rule show command
If I type ip rule show command in my machine, I get the output as,
0: from all lookup local
32766: from all lookup main
32767: from all lookup default
What do the numbers 0,32766 and 32767 mean?
I do understand these are some priorities and 0 is special priority and cannot be deleted.
Also, if I add a new policy it will be created with a priority as 32765. Is my understanding correct?
Also, I see some information regarding priority for ip rule add from here.
Really, for historical reasons ip rule add does not require a priority
value and allows them to be non-unique. If the user does not supplied
a priority, it is selected by the kernel. If the user creates a rule
with a priority value that already exists, the kernel does not reject
the request. It adds the new rule before all old rules of the same
priority. It is mistake in design, nomore. And it will be fixed one
day, so do not rely on this feature. Use explicit priorities.
A:
From the man page ip-rule:
At startup time the kernel configures the default RPDB consisting of three
rules:
1. Priority: 0, Selector: match anything, Action: lookup routing
table local (ID 255). The local table is a special routing table
containing high priority control routes for local and broadcast
addresses.
Rule 0 is special. It cannot be deleted or overridden.
2. Priority: 32766, Selector: match anything, Action: lookup routing
table main (ID 254). The main table is the normal routing table
containing all non-policy routes. This rule may be deleted and/or
overridden with other ones by the administrator.
3. Priority: 32767, Selector: match anything, Action: lookup routing
table default (ID 253). The default table is empty. It is
reserved for some post-processing if no previous default rules
selected the packet. This rule may also be deleted.
Each RPDB entry has additional attributes. F.e. each rule has a pointer
to some routing table. NAT and masquerading rules have an attribute to
select new IP address to translate/masquerade. Besides that, rules have
some optional attributes, which routes have, namely realms. These
values do not override those contained in the routing tables. They are
only used if the route did not select any attributes.
So those numbers, 0, 32766, and 32767 are the priority that the rules will get be applied.
NOTE: The other numbers mentioned above: 255, 254, and 253 correspond to the routing tables as described in this file:
$ more /etc/iproute2/rt_tables
#
# reserved values
#
255 local
254 main
253 default
0 unspec
#
# local
#
#1 inr.ruhep
The names above can then be used when querying the routing tables like so:
$ ip route show table local
broadcast 127.0.0.0 dev lo proto kernel scope link src 127.0.0.1
local 127.0.0.0/8 dev lo proto kernel scope host src 127.0.0.1
local 127.0.0.1 dev lo proto kernel scope host src 127.0.0.1
broadcast 127.255.255.255 dev lo proto kernel scope link src 127.0.0.1
broadcast 172.17.0.0 dev docker0 proto kernel scope link src 172.17.42.1
local 172.17.42.1 dev docker0 proto kernel scope host src 172.17.42.1
broadcast 172.17.255.255 dev docker0 proto kernel scope link src 172.17.42.1
broadcast 192.168.1.0 dev wlp1s0 proto kernel scope link src 192.168.1.80
local 192.168.1.80 dev wlp1s0 proto kernel scope host src 192.168.1.80
broadcast 192.168.1.255 dev wlp1s0 proto kernel scope link src 192.168.1.80
References
iproute2 project page
iproute2 Wikipedia page
| tomekkorbak/pile-curse-small | StackExchange |
Paul Demasy
Paul Demasy (21 March 1884 – 30 January 1974) was a francophone Belgian playwright.
Main works
Theatre
1919: La Tragédie d'Alexandre
1924: Jésus de Nazareth
1925:
1926: Dalilah
1933: Milmort
1925: Panurge
1937: Midi à quatorze heures
1939: L'Homme de nuit
1959: Materna
1959: Vannina ou la Survivante
1964: L'Indésirable
Bibliography
Daniel Droixhe, « Le désarroi démocratique dans Panurge (1935) de Paul Demasy », Bruxelles, Académie royale de langue et de littérature françaises de Belgique, 2007.
External links
Paul Demasy on IdRef
Category:Belgian writers in French
Category:Belgian dramatists and playwrights
Category:People from Liège
Category:1884 births
Category:1974 deaths | tomekkorbak/pile-curse-small | Wikipedia (en) |
mrsims31's's Gamespot Rank
mrsims31's Emblems
Tagger Dabbler
Tagger Dabbler Awarded to those who've messed around with the tagging system, enabling themselves and others to make it a little easier to find certain content.
Robocorn
Hey look, it's a totally original dude wearing armor. With a huge gun and a helmet (a visor?). And he's riding a unicorn. This user was granted this magical emblem for not having any of their user profile images hosted on untrusted websites during The Great Purge of March 2013. | tomekkorbak/pile-curse-small | Pile-CC |
2016–17 Getafe CF season
The 2016–17 season was the 34th season in Getafe CF ’s history.
Squad
Competitions
Overall
Liga
League table
Play-offs
Copa del Rey
References
Category:Getafe CF seasons
Getafe CD | tomekkorbak/pile-curse-small | Wikipedia (en) |
Case Over No-Fly List Takes Bizarre Turn As Gov't Puts Witness On List, Then Denies Having Done So
from the shameless dept
As you my have heard, there's a trial going on here in San Francisco about the legality of the complete lack of any sort of due process concerning the US's "no fly" list. The NY Times has a good background article on the case, which notes that somewhere around 700,000 people appear to be on the list, where there's basically no oversight of the list and no recourse if you happen to be placed on the list. This lawsuit, by Rahinah Ibrahim (who had been a Stanford PhD student) is challenging that.
In that case, a Stanford University Ph.D. student named Rahinah Ibrahim was prevented from boarding a flight at San Francisco International Airport in 2005, and was handcuffed and detained by the police. Ultimately, she was allowed to fly to Malaysia, her home country, but she has been unable to return to the United States because the State Department revoked her student visa.
According to court filings, two agents from the Federal Bureau of Investigation visited Ms. Ibrahim a week before her trip and asked about her religious activities (she is Muslim), her husband and what she might know of a Southeast Asian terrorist organization. A summary of that interview obtained by Ms. Ibrahim’s lawyer includes a code indicating that the visit was related to an international terrorism investigation, but it is not clear what other evidence — like email or phone records — was part of that inquiry.
The Identity Project blog is covering the trial, which kicked off earlier this week with a ridiculous situation, highlighted by BoingBoing. Apparently, one of the people set to testify in the case, Ibrahim's oldest daughter, Raihan Mustafa Kamal (an American citizen, born in the US), was blocked from boarding her flight to the US to appear at the trial, and told that she was on the no fly list as well. Kamal, a lawyer, was an eye witness to her mother being blocked from boarding her flight. The US knew that Kamal was set to testify and from all indications, in a move that appears extremely petty, appears to have purposely blocked her from flying to the US. Kamal was directly told by the airline that DHS had ordered them not to let Kamal to board. The airline even gave her a phone number for a Customs and Border Patrol office in Miami, telling her to call that concerning her not being able to board.
Judge William Alsup, who is known for his rather no-nonsense approach in court (and his willingness to dig very deep into understanding the issues), quickly noted that this apparent blocking of Kamal was ridiculous, and demanded that the government explain what happened. When they insisted they knew nothing about it, Alsup wasn't satisfied. Nor was he satisfied with the story they eventually came back with. As Edward Hasbrouck at the Identity Project reports:
Judge Alsup ordered the government defendants’ lawyers to investigate and report back. “You’ve got ten lawyers over there on your side of the courtroom. You can send one of them out in the hall to make a phone call and find out what’s going on.”
At the end of the first day’s session of the trial (more on that below), the governments’ lawyers told Judge Alsup that they had made inquiries and had been told that “the plaintiff’s daughter just missed her flight” and was rebooked on a flight tomorrow (Tuesday) afternoon.
Needless to say, that story strains credulity. If Ms. Mustafa Kamal had merely missed her flight, why would she have been given a CBP phone number in Miami to call for information about what had happened? The governments’ lawyers insisted that, “That’s what we have been told”, but Judge Alsup wasn’t satisfied.
“We may have to have a separate evidentiary hearing about this,” Judge Alsup said, and ordered the defendants to provide further information tomorrow... “I want to know whether the government did something to obstruct a witness, a U.S. citizen.”
“None of that was true,” Ms. Pipkin told the court this morning. “She didn’t miss the flight. She was there in time to check in. She has not been rebooked on another flight.” And most importantly, it was because of actions by the DHS — one of the defendants in Dr. Ibrahim’s lawsuit — that Ms. Mustafa Kamal was not allowed to board her flight to SFO to attend and testify at her mother’s trial.
Ms. Pipkin said that Ms. Mustafa Kamal had sent her a copy of the “no-board” instructions which the DHS gave to Malaysia Airlines, and which the airline gave to Ms. Mustafa Kamal to explain as much as it knew about why it was not being allowed to transport her. Ms. Pipkin handed Judge William Alsup a copy of the DHS “no-board” instructions to Malaysia Airlines regarding Ms. Mustafa Kamal.
As Hasbrouck notes, the airline deserves kudos for handing over that info. Many airlines would simply keep it a secret. Judge Alsup, however, will not consider the document yet, noting that there isn't evidence to its authenticity and it's not part of a sworn record. Thus, he said that when Kamal arrives in SF to testify, that can be a part of her testimony. While the lawyer pointed out that Kamal was hesitant to buy another ticket if she wouldn't be able to board again, Judge Alsup made it clear that she needs to come, and also appears to have made it quite clear to the DHS that if she is blocked again, there will be consequences:
“Get her on an airplane and get her here,” Judge Alsup responded. “She’s a U.S. citizen. She doesn’t need a visa. I’m not going to believe that she can’t get on a plane until she tries again. ” And Mr Freeborne, with disingenuous faux-solicitude, claimed that the government is “willing to do whatever we can to facilitate” Ms. Mustafa Kamal’s ability to board a flight to the U.S.
Judge Alsup wasn’t willing to take any action today on unproven allegations or unverified documents. But he made clear that, “I am disturbed by this…. We’ll hear from her [Ms. Mustafa Kamal] when she gets here. If it turns out that the DHS has sabotaged a witness, that will go against the government’s case. I want a witness from Homeland Security who can testify to what has happened. You find a witness and get them here.”
The report from Monday also describes other ridiculous claims by the DOJ, including trying to argue that information that was publicly available could not be included in the case because it was "sensitive security information" (SSI). Once again, Judge Alsup saw through the DOJ's bullshit and called them out on it:
That’s ridiculous. Are you saying that if the president makes a speech, TSA can retroactively make it a secret what he said? It cannot be the law that something that is publicly known later becomes hidden…
Here’s my ruling: If it’s in a document that’s SSI, but it’s also available from some other publicly available source, it’s public information, and cannot be withheld from the public in this courtroom…. The government is taking such an unreasonable position on how to run a trial. If it’s been in the public domain for years, you’re barred from making the argument that the plaintiff’s counsel cannot “disclose” it….
Trials are important. Trials are supposed to be public.
I want to categorically reject one thing: If information is publicly available in some other way, the government does not have the right to retroactively clamp it down and remove it from the public record. Even if it could have been protected as SSI within the government, if the plaintiff obtains this information independently, the government can’t clamp that down.
The plaintiff has the right to prove her case. If she can prove it through publicly available admissible evidence, she can do so even if that information is also included in internal government documents designated as SSI.
That’s the way I feel. That’s the law, that ought to be the law, and that’s the only way to run this country. That’s my ruling, and if the government disagrees, I invite you to take an emergency writ to the Ninth Circuit Court of Appeals.
It would be an understatement to suggest that Judge Alsup is not impressed with the US government's actions so far. The notes from day two in the trial provide a lot more background on what happened. It would appear that the lawyers for Ibrahim are making a (rather compelling, from the evidence) case that bumbling US law enforcement officials confused two very different Malaysian organizations with similar names: Jemaah Islamiyah Malaysia, which is a terrorist organization, and Jamaah Islah Malaysia, "a non-profit professional networking group for Muslims who have returned to Malaysia after post-secondary schooling in the U.S. and Europe." The two organizations are, as you would imagine, quite different. Ibrahim is involved in the latter, and has no connection to the former, but it sounds like the FBI agents who interviewed her were unaware of the difference.
The further details of Ibrahim's life, her arrest and treatment, all suggest a situation where US law enforcement totally screwed up, and seriously mucked up someone's life -- and now they seem to be doing everything possible to avoid taking responsibility for it.
Re:
Course it effects them or they wouldn't be messing with it all the time.. Their ability to fund their campaigns and their next jobs after they leave office are on the line, and a whole tonne of other types of perks I'm sure.
Very different
Copyright has nothing to do with access. It has to do with rewarding the creator for the work. Only a loser around here would confuse a paywall with the classification system. If anything, encouraging piracy does more to destroy the arts than any kind of government censorship. Copyright helps artists.
Re: Very different
If anything, encouraging piracy does more to destroy the arts than any kind of government censorship.
Nice try, but take a look at the life time of media. Old films are rotting away and will be literally destroyed by the time you are permitted to copy them. This art will be gone since the "copyright holders" (the creators having died long ago) do not want to have the old material compete with new ones.
For similar reasons, artists with exclusive contracts are shut down and not permitted to create any more records so that new stars can be pushed through the machinery and become obsolete again.
The copyright system is actively employed for destroying art since planned obsolescence is a money maker.
Re: Very different
The rich tapestry of humanities art, literature and scientific achievements from day dot and up to and in some respects after 1710 (Statute of Anne) makes your whole statement absolutely wrong and makes you look like the shrill you are
Re: Re:
I just realized. The U.S. Government is putting everybody on the No Fly List because they don't want Americans leaving the United States, giving up their citizenship, and revolting to another country, a more friendlier country.
Response to: out_of_the_blue on Dec 4th, 2013 @ 12:02pm
Re:
If that's their purpose, they're being stupid. Unless you are wealthy or have some skill the nation is in desperate need of, there is essentially no nation that will accept American immigrants. There's nowhere to run to.
Re: Re:
Education gives knowledge, and knowledge is power. By making proper education harder to get, they're trying to deny our kids knowledge and power. Remember when we walked on the moon? That's all going away now. Let's not let the false promises of free market economics sweep the rest of it away. We can only really thrive in a mixed economy.
Back on topic, we need a proper due process for dealing with people on no-fly lists. How easy is it to get your money back for that ticket you can't use?
Re: Re:
I agree, but she isn't a citizen.
Doesn't matter. The 14th Amendment to the Constitution applies to all individuals on US soil, regardless to whether they are citizens or not. Now, she wasn't on US soil when she was prohibited from returning, but she was on US soil when she was prevented from boarding a flight at SFO and arrested/handcuffed for being on the no-fly list.
Re: Re:
Re: Re: Re:
Agreed. I used to wear the uniform and wherever I went, I was treated extremely well. I always treated everyone as well as I would treat 'my own' especially with an eye to the Constitution whose enumerated rights were natural rights, not something that only applied to 'Americans.'
Now? I'm not sure how I would be received, in uniform or out. And the way that we've treated fellow human beings speaks ill toward what treatment our fellow citizens can expect elsewhere. We were better than that.
And for the Godwin Award
There was a certain political faction in control of a fair whack of Europe & north Africa in the early-mid part of the twentieth century, their view saw similar, if you were not from the right country you were not even human, you were sub-human
Didn't the some other countries have some difference of opinion with them? Wasn't the US very reluctant and want to let those guys go on with their cleansing of Europe.
Re:
Any government employee who is found to be willfully obstructing justice or willfully violating the constitutional rights of a citizen should be banned from working in the public sector ever again.
Government employees in many cases (including all law enforcement ones) are sworn into their positions, and must swear to protect and defend the Constitution of the United States against all enemies, foreign or domestic. Sadly, it seems like breaking this oath seems to be the "in-thing" at the moment.
It is sad that there has to be an "Oath-Keepers" organization, and that membership in said organization can deny you security clearance, employment, or result in legal or disciplinary action.
Re: Re: Re: Re:
My apologies...I was thinking more along the lines of the peons and whatnot. Regardless, I sincerely doubt that Government lawyers are held to any sort of oath. If they were, they wouldn't be able to do their job which is to basically lie to the Court. Cynical, I know but still.
Re: Re: Re: Re: Re:
.I was thinking more along the lines of the peons and whatnot.
Peons are included.
As for lawyers lying in court, they should be held to the same rules, especially perjury. If they are caught lying, hopefully there is enough for the judge to get them removed from office and penalized.
Nothing to hide
Re: Nothing to hide
Hey it's a good thing she's got nothing to hide, and therefore nothing to fear!
You laugh, but what if she were in the closet and afraid of family/friends/community's reaction? Wanna bet that the DHS would find a way to out her? Or if she were on drugs for HIV? "It was a false alarm; we thought her Stribild was actually pills hiding cocaine."
Re: Re: Nothing to hide
Witness tampering and Obstruction of Justice are Class A Felonies, Federal felonies in Alsup's courtroom. The only charges that are worse have dead bodies attached to them. If you or I were standing there we wouldn't walk out.
Re:
Shouldn't this be everywhere?
If it comes out that the DOJ actually tried to tamper with a witness...I mean shouldn't that be page 1 news?Shouldn't Fox News or CNN or anybody be screaming about how unethical that is? Calling for people's heads and all?
Re: Shouldn't this be everywhere?
The fact that Fox and CNN aren't jumping all over this has nothing to do with the fact that she is Muslim and everything to do with the fact that they are part of the same right wing ideology as the government. And for those who would say "but the current administration is Democratic not Republican," right vs. left wing is has nothing to do with Republican vs. Democrat.
cruel horns
This puts the government in an interesting dilemma: to allow her to fly or not?
If they don't allow her to fly, then they will have to admit that they put her on the list and then lied about it. They can claim that the decision to put her on the list had nothing to do with the trial, but not many people will believe that. And then the judge might order them to allow her to fly, which would be a wonderful show in itself.
If they do allow her to fly, they either admit that they put her on the list and then took her off (which is about as bad as the first option), or else claim that they never barred her, which would expose them to the terrible risk that the plaintiff might come up with a crowd of witnesses and a paper trail to prove that oh yes they sure as hell did!
And the best part is that they have to decide in a hurry! Oh, this is going to be good.
Re: cruel horns
There is another option. They could send a covert wink and a nod to the CIA such that somehow she accidentally misses her flight for some other reason and make sure there is enough "documentation" left behind to legitimize the occurrence.
Re: Re: cruel horns
"Thatís the way I feel. Thatís the law, that ought to be the law, and thatís the only way to run this country. Thatís my ruling, and if the government disagrees, I invite you to take an emergency writ to the Ninth Circuit Court of Appeals."--- OMFG!!! OMFG!!! Send SHIVERS!! I, mean, SHIVERS!!! down my spine. OMFG!!! This just lit up a glimmer of hope that THERE MIGHT BE ACTUALLY JUSTICE IN THE JUSTICE SYSTEM.
DOJ doesn't like to be proven wrong. DOJ doesn't admit fault...EVER. Something will happen to the daughter and/or the judge before a decision or sanctions can be passed down. I sincerely hope not, but probably will. If so, that will be the end of any respect or trust in the American Government, not that there's much now.
Re: Judge Alsup for President
I can't wait to move out of this country. That is if they'll let me.
Well, apparently they will make it difficult to leave (hold you for hours for no legal reason, arrest you in front of your children and all the other passengers, keep you away from your medicine, and then subject you to random searches,) and impossible to come back.
A possible solution
Well, we all know that a lot of people working for the USG are not very intelligent. So it's not too hard to unsderstand that they cannot distinguish between 2 organizations with similar names. Some of them even think that there are kangaroos hopping around in Austria.
Extra-judicial punishment demonstrated
If this turns out to be true, it's an ideal example of the extra-judicial punishment that this case is about.
Without a trial, any due process, and with no notification or review, people summarily have their right to travel curtailed.
It's unconstitutional and un-American.
In this case it's directly opposed to the constitutionally established judicial system.
So what's the answer? "It's a mistake" and "It was intentional, but we won't tell you why" points out why extra-judicial punishments are unjust. As does the many variations of the same.
The only answer that works is "it didn't happen". It seems that's the way the government is trying to spin it. But if the evidence shows that it did happen, the governments doubling down by asserting that it didn't happen looks to be near-criminal.
No fly list? I voluntarily placed myself on my own no fly list. How about finding some sap that wants to spend several hours of their day in an airport. There simply isn't any reason for me to want to put myself through that so sorry airlines, when we changed our life style as Americans to suite existence of terrorism, the terrorists won, you lose.
While the lawyer pointed out that Kamal was hesitant to buy another ticket if she wouldn't be able to board again, Judge Alsup made it clear that she needs to come, and also appears to have made it quite clear to the DHS that if she is blocked again, there will be consequences:
Ahh, how cute! He thinks the government actually cares what the courts say...
Good guy judge?
Looking at all this from across the pond, this judge looks like he's about to take the USA government apart - and about time too! Seems as if he won't take any cattle excrement. More power to his elbow, I say! | tomekkorbak/pile-curse-small | Pile-CC |
BANGKOK — A bomb exploded at a bank in northern Myanmar on Wednesday, killing at least two people and wounding 22 others, military officials said. The explosion occurred in the often lawless city of Lashio, in northern Shan State, which has been torn apart by ethnic strife and battles to control smuggling networks.
Yoma Bank, one of Myanmar’s largest commercial banks, confirmed that two of its employees, Ma Maw Maw and Ma Sandar Tun, had been killed. “I heard the bomb blast and it felt like it also exploded my house,” said Min Nyunt, whose home is next to the Yoma Bank branch where the bomb went off. “Almost all of the bank has been destroyed.”
No one has claimed responsibility for the bombing, but such violence occasionally strikes Myanmar’s frontier region, where armed groups from a patchwork of ethnic minorities, including the Kachin, the Shan, the Ta’ang and the Wa — have battled the Myanmar military for decades.
Fliers were distributed publicly about a month ago in Lashio, the main city in northern Shan State, quoting a warning by Senior Gen. Kyaw Than Swe from the Myanmar Military Security Department that two ethnic militias, the Kachin Independence Army and the Ta’ang National Liberation Army, were preparing to attack the city. | tomekkorbak/pile-curse-small | OpenWebText2 |
Q:
`getLeft()` returns zero in `onWindowFocusChanged()`
I have a separate class Answer which extends ImageView. This object is programatically added to the container view and then position initialisation method is called in onWindowFocusChanged() - this method sets correct margins and layout parameters and turns visibility on. Then I try to get Answer's initial X position by calling getLeft(). No matter if this is called from within Answers class this.getLeft() or from main activity answer_object1.getLeft() it still returns zero.
Why is that?
If I add Image view via XML and call 'getLeft()' in onWindowFocusChanged() it returns correct value.
A:
getLeft() will return you the actual value only after layout step will complete and onLayout of your Answer will be called. So, to record the initial position of your view it's better to do so in onLayout.
Now speaking of onWindowFocusChanged() - documentation makes no promises on whether this method will be called before onLayout or after, so it is not the best place to record the initial position of your view.
| tomekkorbak/pile-curse-small | StackExchange |
Easter 2019 is almost upon us and as here in the UK we celebrate with Egg hunts, chocolate and the resurrection of Jesus from the dead, in Florence, they celebrate a little differently…… with fireworks!!
Now one of Europe’s grandest Easter spectacles, the ceremony dates to the time of the crusades and celebrates the brave deed by Florentine Pazzino. According to the local tradition, Pazzino was the first to climb the walls of Jerusalem and raise the Christian banner above the holy city in July 1099. This brave deed won him respect among his comrades and his commander and he was rewarded with two shards of stone from the Holy Sepulchre. These shards were later used to start an annual “Holy Fire” during Holy Week, this ritual fire would be carried through the city as a religious relic.
From then on started the tradition of the scoppio de carro (explosion of the cart) and by the middle ages where the flame was carried by a single cart. By the 15th century, this has grown into the fantastic structure that you will see today and is now pulled by white oxen dressed in flowers and foliage from the first of the spring plants. Accompanying the cart, a procession of Florentines officials, clergy, drummers, flag throwers and a marching band all dressed in historical costumes. The procession begins at the Porto al Prato and then moves onto to the main stage of Piazza del Duomo where all the action happens.
Just before 11am during mass in the Duomo the bells ring out from the church for 10 minutes solid. After this time a rocket shaped as the dove of peace is lit and sent on its flight from the altar out into the square. As the holy fire of the dove hits its mark on the cart, the gunpowder loaded cart is set alight and smoke billows and flashes of light and sparks begin to erupt from inside. the anticipation of the crowd that has gathered outside builds as the dove has to complete its journey both ways smoothly to ensure a good omen and ensures a good crop for the season.
The fireworks blast out for over 20 minutes producing a magnificent display, if you fancy celebrating Easter differently then head along to the Scoppio del Carro, you won’t be disappointed.
Here in the UK annually on November the 5th we are all aware that bonfire night is known for remembering Guy Fawkes and his co-conspirators, the gunpowder plot and yeah, of course, you have guessed it fireworks.
Bonfire night, otherwise known as Guy Fawkes night or fireworks night has become synonymous with the setting off fireworks on this date to remember, remember the 5th of November as the day the gunpowder plot was foiled, and king James and hundreds were saved from being killed.
Fireworks were not originally a part of the celebrations, but they grew in popularity and as pyrotechnics became more widely available in the early 19th century, they became the mainstay of the celebrations. Nowadays, thousands each year celebrate with parties and fireworks of their own or attend an organised event at a local pub or club. Here’s a quick look into the Guinness World Records set in recent years. Here are the top 10 biggest and most explosive records achieved to date:
1. THE LONGEST EVER FIREWORKS WATERFALL
This waterfall was ignited on the 23rd August 2008 at the Ariake Seas Fireworks Festival I Fukuoka, Japan. On completion, the waterfall effect was 3,517.23 m 11,539ft 5 inches and was based on and given the name….. you guessed it Niagara Falls. After this there was a huge shell sent above just to mark the occasion.
2. MOST FIREWORKS LAUNCHED FROM A PYROTECHNIC SUIT
The daring man who gained this title is known as Mazuel Laurent Nat in Grenoble France on 13th June 2014. The total was 642 individual fireworks launched. Of course, our very own friend and mad inventor Colin Furze created his own ‘safety suit’ which was on display in our showroom until very recently.
3. LARGEST CATHERINE WHEEL
Measuring in at 32.044m (105ft 1.56in) the great wheel was made and constructed by Lilly Fireworks Factory in Mqabba, Malta on the 18th June 2011. It was freestanding and when it was lit and managed to do 4 revolutions under its own propulsion – a supersized spectacular for all to see.
4. THE FIRST EVER MULTI-SENSORY DISPLAY
This was achieved in London 2013 – 2014 new year’s eve display, the first of its kind with over 50,000 spectators not only seeing the different coloured fireworks but also been able to smell and taste fruity flavours from them. There was peach snow, apple, cherry and strawberry mist and scratch and sniff handouts created by food scientists Bompas and Parr There was a great response from everyone about the colours and flavours of each one including the edible banana confetti.
5. LARGEST SPARKLER CANDLE
Another record was smashed in New Year’s eve 2015 in Kiev, Ukraine by 28 year old Yuriy Yaniv. He made the largest sparkler candle ever. The monster candle consisted of 10,000 sparklers bound together in a ceramic pot filled with cardboard, dirt and kitchen foil. The weight of the sparkler candle was 50kg (110 pounds) and once lit the sparks created a giant tower covering 2m.
The number of sparklers used in the project if lit individually would have burned for around 48 hours nonstop. Now that is what we call a mammoth sparkler!!
6. THE LARGEST FIREWORK DISPLAY
Even in the rain, there was no stopping the Iglesia Ni Cristo (Church of Christ in the Philippines), enjoying the largest fireworks display during the countdown to the 2016 New Year Celebrations. It was here, on 1 January 2016, using over 810,000 fireworks and lasting 1 hour 1 min and 32.35 seconds this New Year’s Eve party went on in epic style. This was not the only record they smashed that night as they also picked up one for the most sparklers lit simultaneously (938) and the longest line of lit sparklers (891).
7. LARGEST FIREWORK MAP OF THE WORLD
This had to be one for the pyrotechnicians due to the sheer volume of pyro, distances and the size of the operation. The World Island resort in Dubai shows a map of the world from the manmade islands. The fireworks were positioned strategically to ensure that each of the land masses making up the earth were shown perfectly with the light of the fireworks.
8. MOST FIREWORK SHELLS LAUNCHED PER MINUTE
On the same evening in Dubai there were even more extravagant effects to be had when the New Year celebrations got underway as they firmly established themselves as the biggest and best as 479,651 shells were fired in just 6 minutes which equates to 79,941 fireworks per minute putting them into the record books.
9. HIGHEST FIREWORKS ON A BUILDING
Again, the award goes to Dubai and the New Year’s Eve celebrations.
This display was a winner from the outset being stages from the World’s tallest building, the Burj Khalifa. The fireworks display erupted from all sides and top of the building with more than 1.6 tonnes of fireworks released in under 10 minutes.
10. LARGEST AERIAL FIREWORK SHELL
The gargantuan shell was fired from a mortar tube and reached a height of around 2975 feet and measured 2454 feet in diameter. It was fired on the 9th September 2014 and was launched at the Japanese Katakai-Matsuri Festival in Honshu, Japan.
Annually nowadays, there is a festival which still continues to strive for excellence in the field of super-sized shells.
So there you have it, some of the biggest and best in the World today but they all have one thing in common, they are all pyro lovers.
The guild was founded in 1969 by Max P Van der Horck who wanted to encourage the display of both public and private display fireworks to the masses. He also wanted the industry to remove the shroud of secrecy it is surrounded by and share the knowledge to those in power, like the political elite and the general public alike so that the use of fireworks was not lost forever. They need to ensure that safety is a priority and that the gathered energies of so many like-minded people actually get a voice and allow creativity to flow providing ideas and suggestions by the bucket load.
If you check back over time, it is surprising how often fireworks have been used around the globe but essentially, since the Americas were discovered, there have always been displays for one reason or another.
The guild has around 3500 members who range from the hobbyist all the way up to the hard-core technicians and everyone learns from one another.
The event is an opportunity for attendees to visit workshops and seminars on construction of pyrotechnics for everything from a little garden fountain all they way up to a huge 24 inch shell creation. There are classes for attendees to be certified as professional firers – the USA’s Display Operators Course DOC is equivalent to our BPA British Pyrotechnic Association certification. Safety briefings, how to make fireworks more environmentally friendly and everything in between.
Friday 14th August 2015 All Star Showcase – this is a composite display featuring cross company products.
Finale – To Be Announced.
Because this event appeals to a wide range of people from the young lad wanting to learn more for his chemistry test to the consummate professionals like the Zambellis, who are to fireworks what the Kennedy’s were to the US’s political history, there is something for everyone. During the writing of this blog, I had to check into some details about the Zambelli’s and checking out their photo gallery is awesome. They (as in one or other of the family members over the last century or so!) have met and in many cases fired for the last 9 presidents including as mentioned the Kennedy’s both Bush senior and junior, the Carters, the Reagan’s, the Pope, the Prime Minister and most of the heads of state across the world.
As there is entertainment on throughout for the children young and old alike, you need to be aware that absolutely NO outside food is permitted on the site due to the huge number of concessions about.
So, if you are connected to fireworks, whether in the industry as a firer or a retailer, this is just the ticket with days packed to the rafters with pyro. Collectors can pick up some unique ephemera and if you can’t resist getting involved (we know … a couple of days and you have to touch some!) there are lots of ‘volunteer’ opportunities as they set up mega strings of firecrackers (last event more than 3 million!) as ‘firing crew’ for one or other of the teams showcasing their abilities.
Previous visitors have said that this is a must do experience for anyone connected with pyro and it is a truly family orientated event. The organisers will even arrange accommodation for you and the family in a camper van (think Winnebago/Walter White rather than VW Camper/Scooby Doo).
Here’s a cool video below from the Grand Public Display shot by Wolverine Fireworks Display, Inc. at the 2014 Pyrotechnics Guild International held in Mason City, IA. | tomekkorbak/pile-curse-small | Pile-CC |
What else was on that phone that was incriminating of that perennially guilty organization? Who can tell what sort of cheats the Pats had on that phone. Deflating footballs is nothing compared to what else was likely on that phone. I say, likely, because that organization has now been branded as such, cheaters. It's sad since Tom Brady started out as a very lovable guy with a great story that every knew, but along the way someone told him it was ok to bend rules here and there.How do you look your child in the face and explain this to your child now if he's a Pats fan? "Uhmm yeah Johnny, well its ok to cheat but dont get caught. If you do, deny it and take it to court and protect your lies Johnny!"Thats what American dollars are for right? Rich spoiled athletes denying obvious cheating scandals, taking something to court. That money and time could be used for making things better in this country but no, Tom wants to deny his obvious cheats and waste a crap loud of people's time and money. If any case, Greg Hardy's needs to go to court so he can show that his coked up girlfriend assaulted him after he told her he was breaking up with her. The woman didnt even show in court, lets hear her grand testimony on how high she was at the time.Men are getting their rights destroyed in the courts of this country by women and we could put in the spotlight by finding out what really happened to Greg hardy but the media would rather sell tabloid stories about Brady's balls.
"It got so bad, Payton was blaming losses on players parking in coaching spots."Can you imagine that being said by him in front of you? I would just slap his cheeks a couple of times and maybe tussle his hair like my 11 year ol nephew. I mean. . . making faces like Bill Parcells doesnt make you Bill Parcells.
Then next arrogant coach that will made to look like a clown will be Chip Kelly.
That list is about a billions times more accurate than the NFL one at least.
Wilson a 10 in athleticism? . . You just got done saying that no compares to Cam in athleticism. Why would you give Wilson a ten? He's not running over anyone and he's not shaking any tackles off. 10 my ass. Did what he had to do to rank him higher. Just dumb logic there. Same with the Peyton comments
Im not sure I understand why this was so awkward for Cowherd. It sounded like to me that Harbaugh was in the middle of watching something and was taking his time giving genuine answers. Im not a big Harbaugh fan, but honestly what did Cowherd want him to do? Sing and tap dance?
He got to the big ten question and he asks " is it a 'BUY' week". . . I mean what the hell is Cowherd talking about? 99% of the time someone is going to translate that as "by-week" and probably be thinking your downplaying his division. Whats a "buy week" anyway? Who asks that? Then Cowherd gets agitated that Harbaugh isnt asnwering qustions we the same amped up Chiuahua energy that he's bringing. | tomekkorbak/pile-curse-small | Pile-CC |
Left-wing media is up in arms, demanding to know why the President of the United States has not been banned from Twitter.
Op-eds in the New York Times, the Washington Post, and Canada’s second-largest newspaper, the Globe and Mail, have all published op-eds and analyses over the past 24 hours, all tackling the same question of President Trump’s continued presence on the social media platform.
While they have raised the topic before, the latest round of whinging has been prompted by the President’s recent mockery of North Korean leader Kim Jong-nn over the effectiveness of his nuclear arsenal.
North Korean Leader Kim Jong Un just stated that the “Nuclear Button is on his desk at all times.” Will someone from his depleted and food starved regime please inform him that I too have a Nuclear Button, but it is a much bigger & more powerful one than his, and my Button works! — Donald J. Trump (@realDonaldTrump) January 3, 2018
An analysis column for the Washington Post suggests that bruising the North Korean leader’s ego might be classified as “hateful conduct”:
Whenever the President of the United States tweets something like this, a question that has been asked since at least the beginning of Trump’s rise to power begins to circulate again: Why has Twitter not taken action against Trump’s tweets — or banned his account for violating its policies on hateful content and/or violent threats? In September, you might remember, Twitter defended its decision to keep Trump’s account intact when the president tweeted something else that was interpreted as a threat to North Korea.
The New York Times also connected Twitter’s policies on “hateful” content to the president’s tweet:
The remark led to an immediate debate over whether Mr. Trump had broken Twitter’s rules and whether the platform should bar him from posting. …. Twitter has made several changes to its guidelines in recent months involving sexual content and abusive language, though many users have called for more. In December, the company began enforcing new rules on violence. “Specific threats of violence or wishing for serious physical harm, death, or disease to an individual or group of people is in violation of our policies,” it said in a blog post. It also banned hateful imagery and symbols in profile images and headers.
The Globe and Mail, Canada’s second-largest newspaper by circulation, published a strongly-worded opinion column calling for Twitter to ban Trump, even suggesting that the platform might be held responsible for nuclear war:
Of course, we don’t know if Mr. Trump will succeed in taking us over a cliff after mocking someone as unstable as Kim Jong once too often, unleashing a firestorm of pain and unimaginable loss in the process. If it does happen, however, there will be blood on the hands of many people, and many institutions that stood by silently while the President laid the groundwork for chaos and destruction. Among those who will have plenty to answer for are the powers that be at Twitter, which has allowed Mr. Trump to use the social media platform as his own bully pulpit from which he has harassed, threatened and used fear to silence voices of opposition in violation of the company’s own code of conduct rules.
Left-leaning magazine Slate was an outlier, pointing out that Trump’s tweet didn’t actually violate Twitter’s policies, and that “threats of violence” are an integral part of international diplomacy:
First of all, Trump’s nuclear-button tweet didn’t actually violate Twitter’s policies. Those rules prohibit “specific threats of violence,” which the company defines as “explicit statements of one’s intent to kill or inflict serious physical harm against another person.” Trump’s tweet carried an implied threat of military action— not an explicit statement of intent. Implied threats of military action, by the way, are a foundation of international relations: It’s called deterrence, and in defter hands than Trump’s it can be an effective peacekeeping strategy. There are good arguments for Twitter to police hate speech, personal harassment, pornography, and other forms of abuse. But the ability to conduct politics, activism, punditry, and even diplomacy via Twitter has long been a core feature of the service. It was never meant to be a conflict-free zone. Which is why Twitter recently clarified that its rules on threats of violence do not apply to military or government entities.
The Atlantic published the wokest take so far, arguing that not just Trump, but every world leader should be banned from Twitter. The piece was headlined “The Most Irresponsible Tweet in History.”
Trump may be the worst offender today; but others as bad are sure to follow. Banning world leaders from the platform might be a loss for them, but it would be a clear win for humanity: minuscule costs with conceivably civilization-saving benefits. Finally, in Trump’s case, there is an absurdity to allowing him to continue tweeting. The platform is now banning people with a few thousand followers to prevent the harm of online harassment—yet it abides a president taunting an erratic totalitarian with an arsenal that could kill millions in minutes if a war were to break out?
Twitter has long been accused of bias against conservative and right-wing accounts. Last month, they enacted what was colloquially called the “Great Twitter Purge,” ejecting swathes of right-wing accounts from the platform under their new rules against “violent extremism,” while allowing violence-supporting left-wing “Antifa” accounts to remain.
In November, Roger Stone’s “Stone Cold Truth” account, right-wing commentator and sci-fi author Vox Day, and Sam Hyde’s comedy group Million Dollar Extreme were all permanently banned from the platform.
You can follow Allum Bokhari on Twitter, Gab.ai, and add him on Facebook. Email him securely at [email protected]. | tomekkorbak/pile-curse-small | OpenWebText2 |
Thursday, January 04, 2007
Where would you rather coach?
Ok, there are now 4 official job openings in the NFL (there could be more if Al Davis regains consciousness long enough to realize Art Shell actually managed to make the dreadful Raiders even worse...but hey at least they have the top pick in the draft! Right?)
Lets look at the 4:
Atlanta: Jim Mora jr. is OUT after talking about coveting the UW job....The challenge: Michael Vick is still around, still in love with running the ball and he's got the ear/adoration of owner Arthur Blank; have fun playing third fiddle in the organization, and please harbor no illusions about who is really in charge, it won't be you. pluses: Blank will pay a LOT, and isn't shy about spending big, the selfless Warrick Dunn is still under contract and Jerious Norwood is an excellent complement. DeAngelo Hall is fast as any DB in the league.minuses: uh....hmm a tiny offensive line, so you better hope that you run the Denver stretch O...try and see what installing a different offense will get you....you blew your #1 on the Jets John Abraham - a hypochondriac DE who will never play a full season for your team....your other big FA, Edge Hartwell talks a big game at LB but hardly ever shows up when it counts...oh...did I forget to mention, you still have the coach-killa QB Michael Vick...have fun trying to figure out how to a) keep him happy and b) make him the sort of productive QB you can win with....Conclusion: UGH - Who the hell wants to be the next coach Vick-tim for Atlanta??? Oh, sure they'll find someone, its the NFL for cripes-sake...but Atlanta will never win it all with Vick...it is that simple folks
Arizona: Denny Green is out after failing to take a very talented team to the next level.The Challenge: Green was a winning coach who could not break the Cards out of the under-achieving way...coming up short seems is as much a part of this club as apples are to Washington, potatoes to Idaho, oranges to Florida...well you get the idea....pluses: Leinart, Edgerrin, Boldin, Fitzgerald...this team is STACKED at the offensive skill positions....the D is underrated, they have some solid players, but lack something....you've a got a brand new stadium, plenty of revenue, but the Front office lacks something as well....minuses: Maybe the worst O-line in football...that might be a tad harsh, but they guys sucked ass, dick and whatever else you can think of....they can't run block for shit, and their pass blocking is merely adequate....the something you D lacks: leadership...when it comes to crunch-time they tumble like house of, uh, Cards....that something your Front Office lacks: Brains and passion for football - I believe the Bill Bidwell may be the worst owner in all of football...he's like the consortium that owns the Phillies...satisfied with mediocrity, has been for years...their only concern is the bottom line....Conclusion: Think about it - The fixes on this team are not as far-fetched as you might believe...if you can navigate/survive one of the least-funded scouting/player personnel departments in the league. Expectation are sky-high....for Arizona....let's be honest...coach this squad to 8-8 and you'll have the locals singing your praises, secure a winning record and Mayor of Phoenix is not out of the question...but will the Bidwell's tolerate you mucking with their license to print money??? Better do that on a budget fella
Miami: Saban fled to Alabama...owner Wayne Huizenga, clearly perturbed, began taking suggestions from the assembled media at the press conferenceThe Challenge: How to restore the Fins to the playoffs with both Belichick and the Man-genius in your division...pluses: DE Jason Taylor and LB Zach Thomas appear to have found the fountain of youth in the off-season....um, there are some decent players to build around: Chris Chambers and Ronnie Brown...plus some dude who likes to toke up a lot...Ricky whats-his-name?minuses: before he left all Saban did was muddy the QB waters in South Florida...Joey Harrington? Daunte Culpepper? jeez-louise....you're screwed....plus your defense is ancient...Nick had a couple of year to put together a run before the warranty expired on the Miami D...that isn't ticking you hear, its the bones of your D-Line clicking as they get dressed for the game...you have to find Ronnie Brown again, he disappeared this season like a cast-member from Invasion...Conclusion: Could be worse - Wayne H will pay you royally, but may require a pre-nup....finding a QB won't be easy because you pick too high to hope JaMarcus Russell or Brady Quinn will still be on the board...don't even think about Jeff Garcia unless your name is Marty Mornhinweg...still this team is behind the eight ball...Belichick is well...Belichick and Mangini is building a solid team in NY...Buffalo caught fire too (though I think Jauron is a fraud)...I hear winters are nice in South Florida..
Pittsburgh: Cowher is out at age 49 after 15 years and a SuperBowl victory in 2006...The Challenge: succeeding the second "legend-enhancing" coach in the storied Steelers history...first Cowher replaced Chuck Noll and did something no one thought he could do...survive...there so some SHOES TO FILL in Pittsburgh...not to mention chins to emulate...pluses: Great owners who favor stability and back their coach...a good roster...the Steelers stumbled early this year in the post-SB hangover, but rebounded to go 6-2 in the second half...it won't take much to guide this team back to the playoffsminuses: the pressure..the city and owners expect that the talent on this rosters will be making repeated deep runs into the playoffs, including not just SB appearances but maybe another win...there is no grace period here fella...failing to take this team forward in the first year will have folks questioning your hiring..Conclusion: Unless your name is Wisenhunt or Grimm, I would imagine that you need not apply...oh, I know the NFL has rules about that sort of thing, so the Rooneys will do their due diligence and have some minority interviews etc....but this team does not need an overhaul at this point, they need (yet another) steady hand...promoting someone from within makes sense for Pittsburgh. | tomekkorbak/pile-curse-small | Pile-CC |
BEWARE I close my eyes and seize it | I clench my fists and beat it | I light my torch and burn it | I am the beast I worship... and I know soon come my time | For in mine void a pale horse burns | But I fear not the time I'm taken | Past the point of no return | Wage war like no tomorrow | 'Cuz no hell there won't be one | For all who deny the struggle | The triumphant overcome | Trips to where, few have been | Out of thin air, upon high winds | Rites begin when the sun descends | Have felt what few will ever know | Have seen the truth beneath the glow, of the ebb and flow, where roots of all mysteries grow | I am below, so far below | The bottom line | Transmitting live, transmissions rise | From the depths out of controlled by | Suspended glance of an unblinking eyes | Imminent gaze cast 'pon the path that winds | 'Pon the path I find, and claim as mine | To ride the waves, of unrest | Made to make me shine as a testament | To why the ways of the blind will never get | Shit but shanked by my disrespect | Dismiss this life, worship death | Cold blood night of serpent's breath | Exhaled like spells from the endlessness | In the bottomless wells of emptiness | Channeled to invoke what we represent | Secret order | Elitist horde of creeping fire | Seizing power | Riders of the lupus hour | Eye on palm | Time is gone | Moonlight drawn | Fly 'til dawn | Sacrifice to rise beyond | Deep inside the violent calm of the coming storm | In blood sworn | To glorify and for life adorn | With all that dies to become unborn | I close my eyes and seize it | I clench my fists and beat it | I light my torch and burn it | I am the beast I worship... I am the beast I worship | In the time before time eyes 'bove which horns curve like psychotropic scythes | And smell of torn flesh bled dry | By hell swarms of pestis flies | Vomiting forth flames lit by an older than ancient force | That slays this life with no remorse | The spiral storm of flames inside | The torch I raise | The force I ride | Feel my vessel go up in flames | Flesh torch lit by thee unnamed | Direct connection to the source | Vestment of unnatural force | Forever burning black torch | Wisdom of the old and true | Possessed by the chosen few | Shining to reveal the ways of a darkness that pervades | All that is and ever was | Inferno of witches blood | Worship is not on bended knee | Nature knows not of mercy | To pray is to accept defeat | Power pisses on the weak | Bow and beheaded by the beast | Beggar on a bitches leash | Scum is desperate for relief | Worship is the way I ride | Witching currents through the eye of storms that force the false to die | Worship the flames with which I rise | Into apocalyptic skies | Harsh winds flay mine flesh to bone | In splintered skeleton I roam |Wastelands with not to call my own | But the path I walk alone | The hunger burns, within my gut | As my bones turn into dust | And I know soon come my time | For in mine void a pale horse burns | But I fear not the time I'm taken | Past the point of no return | Wage war like no tomorrow, know well there wont we one | For all who deny the struggle | The triumphant overcome... I close my eyes and seize it | I clench my fists and beat it | I light my torch and burn it | I am the beast I worship... I am the beast I worship
GUILLOTINE It goes, it goes, it goes, it goes | It goes, it goes, it goes, it goes | Guillotine - yah | Sit in the dark and ponder how I'm fit to make the bottom fall through the floor and they all fall down - yah | It goes, it goes, it goes, it goes... guillotine - yah | Out of the shadows barrage of witch tongue | Cobra spit over apocalyptic cult killer cauldron smoke | Stomp music seriously - yah | It goes, it goes, it goes, it goes... guillotine - yah | Can't stop the groove lic's jaws clear off them locks relentless raw movement | Fit to knock you from here to that g-spot body rock connected | To everything you want, ever did want | We got it why not come get it, stick your head in that hole and watch me drop this cold guillotine death sentence - yah | It goes, it goes, it goes, it goes... guillotine - yah | Hidden art, between and beneath, every fragmented, figure of speech, tongue in reverse, whenever the beat, causes my jaws to call | Out, out, out, out - yah | The screens flashing red, can't see shit but heads | Spinning exorcist like planets | Out of orbit off the edge | Off mine axis whipping through doors to far more than all that’s ever been said - yah | Tie the chord kick the chair and your dead - yah | Yah... guillotine - yah... guillotine - yah | Head of a trick in a bucket | Body of a trick in a bag | And thrown in the fire like fuck it | Gotta burn it before it goes bad | One too many times been disgusted | By the stench of rot is such a drag - yah | Get broke by the street like blood stained glass - yah | Choke on these nuts 'til the very last - yah | It goes, it goes, it goes, it goes... guillotine - yah | Serial number, killing machine | The illest of means, to an end built on the filthy sound you're experiencing - yah | It goes, it goes, it goes, it goes... guillotine - yah | Tinted windows, bulletproof | The slip knot fixin' rope to noose | To the grave stone grinder of cold steel | The passion that blinds me so I feel - YAH | Can't let go, no it flows through our veins | Blows through our tunnels and rattles our chains | And they all fall down - yah
SPREAD EAGLE CROSS THE BLOCK I fuck the music | I make it cum | I fuck the music with my serpent tongue | Wanna beer, have no fear, comes and goes, man its here | No one knows, feels so weird, when it blows through my bones | I got a jones for it | I wanna know more, 'cuz its bout what I got to show for it | I want some more of it | I want too much | I got so bored with it | I shot it up | Wanna light my torch with it and get all fucked up | What is it? Where is it? | How will it affect me | Fuck that shit, I need that shits bound to be the death of me | Fuck buying it I'm taking it, and sharing it with nobody | 'Cuz all I really need is some cool shit to mob | Like driving down the street to the beat of a blow job | I own that shit | On some throw back shit | You already know that shit | You even know 'bout how I know the man | Who grows that, bitch… you can't buy it with your money | You can't find it overseas | It"s one of those things that seems outlandish | 'Til you have it's not a dream | As for me, I'm cool with it | And that's alright 'cuz it's my thing | Work that angle 'til it's beveled | Curve of the blade doubled | Edge made to bleed the struggle | Best believe the game's a hustle | Observer of the strange occurrences | Conjurer of the subtle | Unseen but felt disturbances | That burst a bitches bubble | That’s right it's all mine | It’s all mine never was yours | Like how you wait in line | While I walk straight through the door (straight through the...) | Hear you say something | But ain't nothing – spectators ignored | Pay no mind to that chump's | Just a player hatin' whore | I fuck the music | I make it cum | I fuck the music with my serpent tongue | Ain’t no fun if the aliens can't have none | How I fuck it dirty | How I make it twitch and scream | How it screams oh baby hurt me | Work me to the bone oh please | How I bend the rhythm over | And hit, hit, hit it on my knees | Give, give, give it up | I need it all the time | Bleed it on the drop of a dime – down to pound it 'til it shines | Moonlit lake of blood red wine | Make no mistake, I makes it mine | Break shit down and make it grind | To the groove used to align | The cascading shades of jaded blues with these rhymes | Nuclear steeze creeps and winds | Through secrets behind and between | Every time I scream | Shit is mine | It's all mine | All the time |Shit is mine | What is it, where is it, how will it affect me | Fuck that shit I need that shit | Thought you knew, thought you thought | Thought you did but did not | Come on through what you got | Is it cool is it hot? | Check one, two, man don't stop | I'm not through black blood clot | In my view like that twat | Spread eagle cross the block | Need no ego to rock | What we know just gets dropped | How we keep shit on lock | 'Cuz all I really need is some cool shit to mod | Like driving down the street to the beat of a blow job | Shit is mine | Its all mine | All the time | Shit is mine
LORD OF THE GAME Into the flame, into the fire | With no regard for a thing, fuck that I'm the lord of the game | I rule this empire | Lord of the game | Born to reign above all that you claim to know beyond a doubt | 'Cuz no one has came even close to the train of thought we drop like neutron bombs from the tower | Control this and bang this, then watch it rise higher | Than anything seen in your entire | Life spent in chains, sonic live wire | Electrified rain from the lips of the driver | Whippin' the wheel | Flippin' donuts to peel | Out on the face of the base, where's my lighter? | Need it to kill one more and chill | While I feel it so much my gut burns like the tires | Movin' this movement of real shit inspired | By all that has come before this and was done | For the real ones packin' real guns loaded with power | Shower the slums with power from the war marching drums that have come to devour | The weakness that runs when we come | Fuckin' cowards | When they tell you you must make it and you think hell no | Got a bad feeling and can't shake it | Hits so low | Lord of the game | Born to reign above all that you claim to know beyond a doubt | 'Cuz no one has came even close to the train of thought | We drop like neutron bombs from the tower | 'Pon which we maintain | Like soldiers of fame and fortune denied as to to get by without the | Bullshit coming at me from all sides | Nowhere to run, nowhere to hide | Told me it was all good, but they lied | Don't wait to see whites of their eyes | Death to everyone who does not recognize | Wars never done, think it is you die | Where was I now | Like I said before | Hear someone knockin' at my front door | Who could it be, should I ignore the knockin' or see what could be in store | For me if I leave the safety of the shore | So many options, so little time | To do what I want 'fore the end of the line | Places it's blade in the small of my spine | Is it paranoia, is it real? | How long can a man enjoy what he doesn't feel | When they ask if you can make it and you don't wanna go | When they tell you you must make it and you think hell no | Got a bad feeling and can't shake it | Hits so low (rather be stuck naked) | Than waste my time like the last time and every time before that | Don't waste my time even one more time | When you know that shit is whack | Don't make me remind of you of the last time you | Said you’d never go back | Fuck where you're from, fuck where you're goin', it's all about where you're at
TAKYON (DEATH YON) Triple six, five, forked tongue | Subatomic penetration rapid fire through your skull |How I shot it on one taking it back to the days of trying to lose control | Swerving in a blaze of fire, raging through my bones | Oh shit I'm feeling it - Takyon | Hell yeah, fuck yeah, I feel like killing it - Takyon | Alright that’s tight, what its like to experience - Takyon | Out of the blue, in through the back | Door coming through like fuck what was that | Man I don’t know, but it made me feel so heated | How we creep without showing you jack | Shit from below, give a shit if you know | 'Cuz even if you did, you’d keep coming back | Back for more, need it man you're addicted to the heat | We make beats catch | Beat it 'til it bleeds to death, each track | Like EPMD snappin' necks as we tap energy from everything on and off the map | Oh shit I'm feeling it - Takyon | Hell yeah, fuck yeah I feel like killing it - Takyon | Alright that’s tight what its like to experience - Takyon | Takyon, shot down your throat like a keg of beer | Choke on the smoke we in and exhale 'til the whole chamber is clear | Haters act so fucking weird | Try to stain this atmosphere | But they can't 'cuz its way too sheer | How to make a hater disappear | Take shit where it ain’t never been | Fuck what you thought could not comprehend | This shit if I fisted your brain with it | 10-9-8-7-triple 6-5-forked tongue | Criminal level crunk lightning storm | Get out the way or get up torn | Ain’t a picture big enough to fit | What we dig up from the core of all that they forgot ever was | Militant march of this war | Takyon - taking them down | All we see is blood | Takyon - turning them out | How to trick out and freak that buzz | Oh shit I'm feeling it - Takyon | Hell yeah, fuck yeah I feel like killing it - Takyon | Alright that’s tight what its like to experience - Takyon | Lunar eclipse forcing you to trip off the moonlit fire we spray | Cryonic haunted bullets hollow tipped with toxic waste | So here’s the deal, if you don’t feel ill | Don’t want it nowhere near my zone | That shit is dead, can't nobody get with that shit gets dial toned | Takyon - bitch slappin' pussy clots and clones | Takyon - settin' off unibombs inside your dome | Oh shit I'm feeling it - Takyon | Hell yeah, fuck yeah I feel like killing it - Takyon | Alright that’s tight what its like to experience - Takyon
KLINK Whatchya gonna do when they come for you | A gang of hatin' pigs | What have they ever really done for you | Ain’t never done shit | Stash what you got cuz they're comin' through | Best get rid of that quick 'cuz when they get here you know what they're gonna do | All they ever do is trip | Minding my own business... try to hem me up like for life stuck in the klink haters in blue | How they set me up should I test my luck, here they come they're in pursuit | What did I do? | What haven't I done, you want to see my I.D. Umm... well OK, where I'm coming from? | Just on my way not on the run | Whatchyou want me to say are you just 'bout done? | Power trippin' asshole lickin' haters | Notice how they strut | Through the spot like anybody wants to see a cop, man everybody knows they suck | I got to be somewhere man fuck! | Why the hell you always stoppin' me, round the clockin' me like what | Whatchya gonna do when they come for you | A gang of hatin' pigs | What have they ever really done for you | Ain’t never done shit | Stash what you got 'cuz they're comin' through | Best get rid of that quick | 'Cuz when they get here you know what they're gonna do | All they ever do is trip | Six feet deep below the street | So they can't never say shit again | Fuck the man with a thick broomstick and put a black flag on the end | Got to watch my back or just like that | I’m bound to get locked up | The law's watching me, constantly | Too close and way too much | Looking over my shoulder and checking in the rear view mirror | 'Cuz I'm never not but a moment from getting taken to jail | They're knocking at my door, down my door They're shining lights in my eyes | Exactly what do they stand for | Ever asking more of I man why | Like it matters why I chose to ignore | All the laws I've been told to abide | Think I’m on parole, thinking I just stole | Some shit you got an A.P.B out on but no | You're wrong as usual hell no it wasn't me | Have the nerve to ask me if I'm drunk when I’m pissing in the middle of the street | Looking over my shoulder... by the way why they always acting | Like they know how to size me up | Ignorant bastards coming after me | All the time on mine had enough | Why they always wanna hassle me, pigs all up on my nuts | Like they have to be, like I can't see 'em | Trying to play shade tree in the cuts | By robbing me of my dignity | So in the end I never say much | But ain’t a time pass I don’t wish I could flash | On Penelope like fuck! | Shot this for everyone who's been there | For my real ones who understand | What it feels like to have your rights read to you by the...
CULTURE SHOCK Culture shock, future shock | Fuck yourself, choke yourself | Useless information occupies every open space inside your skull | You know whats going on every day every night | Everywhere swear you're so international | Upside down cross on the Jumbotron | Wait up, hold on | Blowing anthrax off my palms | Say what, you're wrong | Switch stance, face plant | Napalm fire starters | Flatlander, plug puller | Nose dive turbulence chartered | You speak in abbreviations because real life conversation moves too slow | You're the media's creation, yeah your free will has been taken and you don't know | Choke yourself, fuck yourself | Culture shock, future shock | Fuck yourself, choke yourself | Never seen without one hundred | She's a satanic priestess | Anarchy on ice freak flag flying faceless elitist | Crow on the down low end | Reppin' Orion's belt | Atlantis ancient vagina | Getting dusty on the shelf | Enter the pigs don't get it | No hands I'm shattering jaws | Double nickels on the dime | Fuck glam can lick my balls | Culture shock, future shock | Fuck yourself, choke yourself | Whatchya gonna be when you're grown young blood? | Gonna be a mindless drone | Won't ever have to think | No your head'll be linked directly to your cell phone | The virus is alive, I can see it in your eyes | The infection is full blown | Career killer, double decker packed with suicidal brides | Four armed fury in a filthy dream about splitting your bitches thighs | Enters through unknowing eyes | Touch the key its in your mind | Can't delete it and soon you'll find | How bad you need it all the time | Culture shock, future shock | Fuck yourself, choke yourself | Shiva slashin' through your flat screen | Is nowhere for you to hide | Strangled by anaconda thumbs to the soundtrack of world genocide | My thoughts tie knots in silver spoons | Vampire on the rise | Punk a chump wit a cunt for brains platoon | In the zone and on the grind | Dead matter disposer from the mountains without peaks | Catch and release | Time released horse capsule swallowed to wake the savage beast | Culture shock, future shock | Fuck yourself, choke yourself | Gotta get them outta here now | Infected act so weird how'd you get it | You're pathetic | Quarantine the virus | Culture shock, future shock | Fuck yourself, choke yourself
THRU THE WALLS I'm coming through, thought you knew, fuck if you didn't, fuck you | Plutonium lore | What this is, what this for | Feel my fists push black holes | Through your bitch ass decor | Split it back like a whore and make you shit your fucking drawers | Scared to ride, cowards fall | Before my eyes, sound of my balls | Dragging like cannon loaded wagons | Drug by demons down your halls | Can't imagine whats fit to happen | When I get to flashing, see the small | Shrink to a fraction of what their lacking and less than that in no time at all | Can't believe they have the gaul | To try and act like they’re not trapped | Between these walls... bring it, bring it, bring it, kill it | Bring it, bring that shit heated | Sling it, bring back that shit - kill it | Sometimes feel like I'm close but never get there | NEVER GET THERE | Does it mean I'm a ghost if I'm still here? | WANNA LEAVE HERE and if I am why can't I just float through the walls? | THROUGH THE WALLS and if I can, were they even ever there at all? | NOT AT ALL | Too much time spent in the maze will drive you mad, I feel so bad | Been there so long I can't remember who I am, or where I stand | But in the end I guess I just don’t give a damn | Twist a gram and keep on sticking with the original plan | Fuck it man | Judge you no more than I wish to be judged | Even on the low | But I do know what you do not speak of | Don’t know but it shows | Try to hide but I see who you are because | I just know | Keep talking but you already said too much | There you go | How it is now's how it it always was | That’s on my blood | How it is now's how it it always was | That’s on my blood | Bring it, bring that shit heated | Sling it, bring back that shit - kill it | See my blood spill drip, by chances | Try to chill, quit, 'cuz I can't just slip into a zagthoth trance | Tongue hissing, serpent chants | Come again work it in, yeah just like that | We paint our insides black | As the shadows 'hind our flesh | And make all that we lack | The part of life that we forget | All praise due to the fact | That we've forgotten how to sweat it | Check it | Bring it | KILL IT | On everything I own | Swear would rather slit my throat and die on the run | Than be the one who ends up hangin' from that rope | Tied to the thumb of the man who comes to empty your pockets when you choke | Got to get that shit myself and get the fuck out of this game | Before I end up getting stuck with no one but myself to blame | All the way insane | Staring at the ceiling | In the dark | Trying not to let the feeling | Tear you apart | But the silence is buzzing and it won't stop | Tell yourself its almost over | But its not
KNOWN FOR IT Known for it... known for it | Known for it, been through it | Done everything I can to it | Road to it, 'til I broke through it | Never was attached to it | Took all I had in a flash knew it was 'bout ta crash | So I mashed through it | Known for it | Had ta do it | Hacked into it | I pay the price ta roll wit it | Waste your life and you wont get it | Played out wit nowhere ta go bet it | Makes you feel like a ho don’t it? | Don’t it... known for it | Let it eat shit and die | As I creep lit off the deep hits wit a sick mind | On the secrets I rely 'pon ta freak this | You can tell me what you said - go ahead | But no sooner than you said it, you can bet it was left for dead | All you said in and out of my head in seconds | Keep em guessin' endlessly | Never let 'em know where your headed | King of the unknown cloaked in mystery | How ta show 'em they don’t mean shit ta me | Never meant a thing to me | Effortlessly dead to me | Check the sign no vacancy | Extremely selective memory | Known for it, gotta stay deep in the zone or it’ll take everything you own, floor it | Get it, get it | I pay the price ta roll wit it | Waste your life and you wont get it | Played out wit nowhere ta go bet it | Makes you feel like a ho don’t it? | Don’t it... known for it | Let it eat shit and die | As I creep lit off the deep hits wit a sick mind | On the secrets I rely 'pon ta freak this | Known for it since way back, all about it | Never been without it | How ta ride it inside out of da clouded | By the enemy surrounded | Thoughts that make you feel lost don’t doubt it | You might just need it | Already did that, can't never go back | Yeah fuck that | Gets the bozack | Laid on the gas, leaned back and blew it | Twelve gauge blasted out abused it | Left it for the next, hit eject done wit that | You want it you can have it, no questions asked | Left that shit on the side of the road in a ditch, don’t trip | If ya have one let a man so I could flip a bitch and kill it | Head for the hills when it makes you feel like you can't ever chill no more, fuck it | Every time I get it ta wind, round my finger and recline | Behave or be slayed 'cuz I will be damned if mine ever decays | Forever on attack gut check the blind | Game recognize game is tight | Bow down or get banged for life | 'Cuz I... am... known for it
I WANT IT I NEED IT (DEATH HEATED) Been working way too much | Need to get out and get fucked up | Whats going on? | Where's it at? | Make some calls to make it crack, lets see... I need money, drugs, a ride and a spot with hot ones inside | The mission: to get all of the above in a limited amount of time | I can do this and it's done | Like that we're on our way | Be it acid on the tongue | Cocaine in your brain or some weed that hits your lungs like a runaway train | Hell yeah, from DMT to MDMA | Got all that shit and more | So 'til dawn we're okay... but anyway... fuck a line, every time | Get in, get a drink and lose our minds | All eyes on the dime | That makes your dick want to grind | Know you got a good buzz going 'cuz everything is glowing | Skirt so short her ass is showing | And she's looking so you’re knowing you could get it tonight | But there’s so much around | Best take your time do it right | As you keep getting higher | Lights look like they're on fire | Soon all that’s left of you is your most primal desires | Ass clappin', dick suckin', lock the door to the bathroom – quick fuckin' | Find a whore and it could happen | But it's nothin', 'cuz you're drunk and you'll be blackin' out | Before you even get a chance to think 'bout what you're doing | I want it, I need it, need it to make me feel heated | Shake it, can't take it, must break it | Break if off yea, what'd I say bitch… bitch | Getting looser and looser and losing yourself | In the groove that has the whole party movin' | You're cruisin', you don't know what you're doing and you don't give a… 'cuz you're so liquored up, you throw it up and keep on riding 'cuz your timing is on | And that fine one is on you, its time to get gone | Too far up in it to yawn, 'til it's finished come on | Get more twisted and bomb the dance floor 'til it breaks | Start to pondering rape | Me I'm all bout the face | But it takes all kinds | So pay no mind to the taste | Want to hear that song | You know the one with the bass | That makes their asses gyrate | Forget to hydrate | 'Til they're so fucked up they take | Off all of their clothes and whip | It on me like my body's made to fit 'tween their lips | You got the ones on their grill or between their hips | But either way I must say I really don't give a shit | Long as its done well, and they promise not to tell | We could do this like an orgy | In the bowels of hell | Where every Lucy’s hella horny | And their pussies don't smell | Argh... where's it at? | I want it, I need it, need it to make me feel heated | Shake it, can't take it, must break it | Break if off yea, what'd I say bitch… bitch | Responsibility's cool, but there’s more things in life | Like getting your dick | Rode all fucking night | By the kind of girl that knows how to keep her shit tight | Legs in the air, looking like they feel nice | Volcano pussy melt your peter like ice | And the drugs got you going back for more 'cuz you're like I just can't get enough of that cum clutch, well alright | It's time to find one and take one | Right now | It's time to find one and make one say | I'm down | Think I just found one, 'bout to break one off | Meanwhile... hallucinating crazy, getting lost for miles, may have gotten too fucked up 'cuz I forgot how to smile | Gonna have to do this shit Jim Morrison style | Will it work? | Probably not, but its worth a try | First hot one I see with sex in her eyes | Will be the hot one I need to take home with me tonight | Wish me luck, give me dap and I'll talk to you later | And when I do lets hope my story isn’t all about haters | Wheres it at? | 'Cuz I want it like man | Got the drugs but need a hot one that'll make me go damn | Was the most banging guts that I ever have smashed | If you got it push it up on me 'cuz I'm feeling that ass, know what I mean? | Wheres it at? | I want it, I need it, need it to make me feel heated | Shake it, can't take it, must break it | Break if off yea, what'd I say bitch… bitch | tomekkorbak/pile-curse-small | OpenWebText2 |
Reproductive Autonomy and Modern Contraceptive Use at Last Sex Among Young Women in Ghana.
Variability in the conceptualization and measurement of women's empowerment has resulted in inconsistent findings regarding the relationships between empowerment and sexual and reproductive health outcomes. Reproductive autonomy-a specific measure of empowerment-and its role in modern contraceptive use have rarely been assessed in Sub-Saharan contexts. Survey data were collected from a sample of 325 urban Ghanaian women aged 15-24 recruited from health facilities and schools in Kumasi and Accra in March 2015. Bivariate and multivariable logistic regression analyses were used to examine associations between two adapted reproductive autonomy subscales-decision making and communication-and women's use of modern contraceptives at last sex, controlling for demographic, reproductive and social context (i.e., approval of and stigma toward adolescent sexual and reproductive health) covariates. In multivariable analyses, reproductive autonomy decision making-but not reproductive autonomy communication-was positively associated with women's modern contraceptive use at last sex (odds ratio, 1.1); age, having been employed in the last seven days and living in Kumasi were also positively associated with modern contraceptive use (1.1-9.8), whereas ever having had a previous pregnancy was negatively associated with the outcome (0.3). Reproductive autonomy decision making remained positively associated with contraceptive use in a subsequent model that included social approval of adolescent sexual and reproductive health (1.1), but not in models that included stigma toward adolescent sexual and reproductive health. The reproductive autonomy construct, and the decision-making subscale in particular, demonstrated relevance for family planning outcomes among young women in Ghana and may have utility in global settings. Future research should explore reproductive autonomy communication and the potential confounding effects of social context. | tomekkorbak/pile-curse-small | PubMed Abstracts |
488 S.W.2d 712 (1973)
Curtis ALLEN, Appellant,
v.
STATE of Arkansas, Appellee.
No. 5784.
Supreme Court of Arkansas.
January 8, 1973.
Rehearing Denied February 12, 1973.
*713 George Howard, Jr., Pine Bluff, for appellant.
Ray Thornton, Atty. Gen., by Henry Ginger, Deputy Atty. Gen., Little Rock, for appellee.
FOGLEMAN, Justice.
Curtis Allen, 19 years of age, was found guilty of the rape of an eight-year-old female. The jury fixed the degree at rape in the first degree and the punishment at life imprisonment. Appellant contends that this finding and sentence should be reversed upon the following grounds:
I. The trial court committed error in denying appellant's motion for mistrial.
II. The trial court abused its discretion in permitting the prosecutrix, age 8 years, to testify.
III. Arkansas Statute, Section 41-3401Degrees of Rapeis void for vagueness.
IV. The trial court erred in refusing to transfer appellant's case to juvenile court.
We find no reversible error. We will discuss the grounds for reversal in the order listed.
I.
During voir dire examination of jurors the circuit judge made the statement that *714 the appellant was on trial in a capital case and that the penalty for the crime charged was electrocution or life imprisonment. Appellant's attorney was granted a conference in chambers at which he moved for the declaration of a mistrial. After returning to the courtroom, the judge made the following statement:
The court wants to correct an erroneous statement, and this is especially to the number of the jury that have already been seated and to the prospective jurors, an erroneous statement for the record for the penalty for first degree rape, the penalty for first degree rape is death by electrocution or thirty years to life. The court misstated that while ago and I want to correct that statement.
Appellant's reliance upon Bagley v. State, 247 Ark. 113, 444 S.W.2d 567, to support a reversal here is unwarranted. There this court held that errors in a statement of the trial judge, prior to voir dire examination of jurors, relating to the crime and the jury's options as to punishment were not cured by the judge's explanation of the forms of verdict submitted to them at the conclusion of the trial and instructions about their use by the jury. In Bagley, however, we pointed out that the damage to the defendant could only have been removed by an equally positive statement of correction of a stature equivalent to that of the original erroneous statement. Here that cure was promptly and correctly administered by the trial judge.
II.
The question pertaining to the testimony of the eight-year-old prosecutrix is probably the most difficult one presented. Preliminary examination of the child victim disclosed that she knew where she lived and her birth date, and was in the second grade at Central Elementary School in Dumas. She was later held to be a competent witness, over the objections and exceptions of appellant, after the following questions and answers:
Q. Do you know what it means to tell the truth?
A. Yes, sir.
Q. And will you tell the truth?
A. Yes sir.
Q. Do you know what will happen if you do not tell the truth?
A. Yes sir.
Q. What?
A. You will get punished.
The record discloses that the witness later testified that she attended church and Sunday School regularly and believed in God. Appellant points out that during the course of her examination, the witness failed to answer seven questions, and responded to seven others by nodding her head and to three by shrugging her shoulders.
We agree with the state that the record reveals that the witness, through her testimony, gave evidence of her ability to receive, retain and transmit to the jury accurate impressions. Her failure to answer questions usually occurred when she was called upon to name the intimate parts of her anatomy and that of her assailant. The nodding of her head occurred on both direct and cross-examination in response to some material questions and some immaterial ones. In some instances, the material questions had been or were later fully answered by the witness, and others answered by head-nodding were shown to have been affirmative by other testimony of the child indicating her understanding of the questions and an intention to give affirmative answers. One of the shoulder-shrugging answers was accompanied by the words "I don't know," and another came when she was asked why her assailant pulled her panties down, and the third had to do with the depth of the penetration. Her conduct in this respect appears to have been little different from that of many adult witnesses who testify in such matters as these.
*715 There has never been a precise age fixed by our law for declaring a child either a competent or an incompetent witness in a criminal trial. The trial court has a wide latitude of discretion in determining the competency of such a witness, the exercise of which will not be disturbed upon appeal in the absence of clear abuse. Harris v. State, 238 Ark. 780, 384 S.W.2d 477. See also, Edington v. State, 243 Ark. 10, 418 S.W.2d 637. With reference to age, we have always, in criminal cases, followed the common law rule that one under the age of 14 years was not to be presumed to have common discretion and understanding required for competency as a witness, and that inquiry should be made of such a proposed witness as to the degree of understanding possessed by him, in order that the court may ascertain whether he appears to have sufficient natural intelligence and instruction to comprehend the nature and effect of an oath to permit him to testify. Payne v. State, 177 Ark. 413, 6 S.W.2d 832; Flanagin v. State, 25 Ark. 92. In Batchelor v. State, 217 Ark. 340, 230 S.W.2d 23, we quoted the rule governing competency of a child's testimony from Hudson v. State, 207 Ark. 18, 179 S.W.2d 165, where we said:
* * * if the child-witness, when offered, has capacity to understand the solemnity of an oath and to comprehend the obligation it imposes, and if in the exercise of a sound discretion the trial court determines that at the time the transaction under investigation occurred the proposed witness was able to receive accurate impressions and to retain them to such an extent that when testifying the capacity existed to transmit to fact-finders a reasonable statement of what was seen, felt or heard, then, on appeal, the Court's action in holding the witness to be qualified will not be reversed.
As to the requirement of understanding the nature and effect of the oath, we said in Crosby v. State, 93 Ark. 156, 124 S.W. 781, that the child must be under an immediate sense of his responsibility to God with a conscientious sense of the wickedness of falsehood. But this court has found no abuse of discretion in the trial court's determination of competency where the child realizes that he is obligated to tell the truth and that he will be punished for not doing so, i. e., that he will be punished for not telling the truth because telling falsehoods results in punishment. In Crosby, the witness did not know what the consequences of his failure to testify truthfully would be and was not asked anything from which it could be inferred that he had a sufficient sense of the danger and wickedness of false swearing or that he comprehended and appreciated the sanctity and obligation of an oath. In De Voe v. State, 193 Ark. 3, 97 S.W.2d 75, we had this to say regarding an eight-year-old prosecutrix in a rape case:
As to her competency, it may be said, first, that her competency was peculiarly within the trial court's discretion, and the trial court's ruling on the question will not be disturbed unless there was a gross abuse of discretion * * *. The witness in the present case was eight years old, appeared to be intelligent, to understand what was meant by an oath, and she testified intelligently. We are of the opinion that the trial court did not abuse its discretion in permitting the witness to testify.
We cannot say that there was an abuse of the judge's discretion in this case. Our view in this regard is bolstered by the apparent intelligence of the witness disclosed by her testimony and the responsiveness of her answers to the questions propounded to her.
III.
Appellant argues that, since a male may be found guilty of rape in the third degree when he engages in sexual intercourse with a female less than 16 years of age, of rape in the second degree if he is over the age of 18 years and engages in *716 sexual intercourse with a female less than 14 years of age, and of rape in the first degree if he engages in sexual intercourse with a female less than 11 years of age, the statute [Ark.Stat.Ann. § 41-3401 (Supp. 1971)] is void for vagueness because it affords no meaningful or material guidelines for distinguishing the three degrees of rape. Our examination of the statute does not support the assertions in appellant's brief that it is a mass confusion of ambiguities and uncertainties and inexplicable contradictory statements. It seems clear to us that the state's interpretation of the statute is correct. The statute defines rape in the first degree as sexual intercourse by a male person of any age with a female of any age accomplished by forcible compulsion, or without compulsion when the female is incapable of consenting by reason of physical helplessness or mental incapacity, or is under the age of 11 years. Rape in the second degree, then, is sexual intercourse by males over 18 years of age with females between the ages of 11 and 14, with or without their consent. Rape in the third degree is carnal abuse of a female less than 16 years old by a male of any age, or sexual intercourse by a male of any age with a female between the ages of 14 and 16, or sexual intercourse by a male under the age of 18 with a female between the ages of 11 and 14, without regard to the consent of the female in any case.
IV.
There was testimony by a "psychological examiner" who is licensed by the state to practice psychometrics and who examined Allen when, upon appellant's motion, he was committed to the custody of the sheriff of Jefferson County for mental examination by the Southeast Arkansas Mental Health Clinic. This witness stated that the mental or intellectual age of appellant, according to the Weschsler Adult Intelligence Scale and Peabody Picture vocabulary test, was "approximately 9.6 years of age, somewhere in there," even though his chronological age was 18. This, he said, meant that "mentally he [Allen] is perceiving and functioning as a nine- or ten-year-old individual with reference to judgment, insight, general information, abstract reasoning ability, and, in this case, the psychomotor and perceptional functions." Before trial, appellant had moved that the information charging him be quashed or, in the alternative, that the case be transferred to the juvenile court. His motion was based upon psychiatric and psychological evaluations at the Southeast Arkansas Mental Health Center. The psychiatric evaluation filed with the court concluded that Allen was mentally retarded, functioning at the mental age of 9.4, without insight, was possessed of extremely poor judgment and that his behavior was based on impulses. The psychological evaluation by the examiner who testified at the trial was based upon the following tests:
Weschsler Adult Intelligence Scale
Peabody Picture Vocabulary
Bender Visual Motor Gestalt Test
House-Tree-Person
Incomplete Sentence Blanks
Rorschach
MMPI
Clinical Interview
The examiner recorded this diagnostic impression: "Mental retardation, mild, associated with behavioral reactions." The examiner's summary was that Allen was mildly mentally retarded, knew right from wrong and was capable of feeling remorse for his behavior, but his decision making and goaldirected behavior were based on impulses and his consideration of the possible circumstances of his actions doubtful. He did not appear to the examiner to be a sociopathic individual.
Appellant also points out that a 14-year-old sister of the prosecutrix described Allen as childish in conduct, physical appearance and activities and that a 16-year-old witness bearing the same surname as his gave testimony that would indicate that appellant's activities were rather childish. It should be noted that the 16-year-old, when *717 asked how old Curtis Allen acted, responded "18." Appellant also calls our attention to the fact that the court recessed the trial and conducted an in camera hearing because, during the opening statements to the jury, appellant was sitting with his face down on the table folded in his arms as if he were asleep. The judge attempted to determine whether there was some reason for Allen to sit in the courtroom in this position rather than the normal upright position.
As the basis for his motion in the trial court, appellant contended that his prosecution was barred by Ark.Stat.Ann. § 41-112 (Repl.1964), providing that an infant under 12 years of age should not be found guilty of any crime or misdemeanor.[1] In his brief here, he argues that requiring him to stand trial was an abuse of the trial court's discretion and his commitment to the State Department of Correction was cruel and unusual punishment in violation of Article 2, Section 9 of the Arkansas Constitution and of the Eighth Amendment to the United States Constitution, as applied to the states by the Fourteenth Amendment.
Even though the argument advanced in the trial court seems to have been abandoned here, we have no hesitancy in stating that the age prescribed by Ark.Stat.Ann. § 41-112 means chronological age, not some "mental" age arrived at by psychological tests and expressive, at least to some extent, of an examiner's opinion. We have set out the record on this point at some length to demonstrate that any variation from chronological age as the basis of one's absolute immunity from criminal responsibility, in the absence of insanity, cannot result from judicial action rather than through the General Assembly where investigative processes can be utilized, not only to ascertain the propriety of such action but to prescribe appropriate standards for the determination of immunity from prosecution because of infancy or immaturity. We find no abuse of discretion in putting appellant to trial and no violation of constitutional inhibitions against cruel and unusual punishment.
The judgment is affirmed.
NOTES
[1] It should be made clear that appellant asserted a defense of insanity at his trial and that the court gave appellant's requested instruction as to this defense, but refused to state the substance of Ark.Stat.Ann. § 41-112 to the jury. The defense of insanity was rejected by the jury, and appellant properly does not base his argument here upon that particular defense.
| tomekkorbak/pile-curse-small | FreeLaw |
"We truly want that this moment comes in the near future. We are ready to exchange Vyshinsky. Sentsov is an option, we are ready to swap [him] for Sentsov," the Ukrainian leader said.
KIEV, July 19. /TASS/. Ukraine is willing to swap Editor-in-Chief of RIA Novosti Ukraine Kirill Vyshinsky, convicted by a Russian court for terrorism in Crimea Oleg Sentsov is proposed as an option for the exchange, Ukrainian President Vladimir Zelensky said at a briefing on Friday.
At the same time, Zelensky underlined that "Sentsov is not a bargaining chip." "We would like to return all our political prisoners, all our military," he clarified, adding that swapping Vyshinsky can serve as the first step down this path.
Yesterday, Ukrainian president’s press secretary Yulia Mendel announced that the office of the Ukrainian leader had proposed releasing Oleg Sentsov, convicted for terrorism in Crimea, and RIA Novosti Ukraine Editor-in-Chief Kirill Vyshinsky, who remains in custody in Ukraine, at the same time. Earlier, Kremlin spokesman Dmitry Peskov said that the return of journalist Kirill Vyshinsky to Russia could serve as the first step in normalization of relations between Moscow and Kiev.
In 2015, Oleg Sentsov was found guilty of terrorism in Russia. The North Caucasus District Military Court sentenced him to 20 years behind bars on charges of setting up a terrorist cell in Crimea and plotting terror attacks in Crimea. In the spring of 2014, the group’s members carried out two terror attacks in Simferopol: they set on fire the offices of Crimea’s Russian Community non-governmental organization and a regional office of the United Russia party.
The Ukrainian Security Service detained RIA Novosti Ukraine Editor-in-Chief Vyshinsky on May 15, 2018, he was charged with treason and gun trafficking. The Kherson City Court arrested him for 2 months on May 17, and later the arrest was extended several times. If convicted, he faces a jail term of up to 15 years. The next hearing is scheduled for July 19, his custody expires on July 22. Judges need to make a decision before this date, otherwise the journalist will be freed. | tomekkorbak/pile-curse-small | OpenWebText2 |
Kipple Field Notes is a work of independent research by Hillary Predko. This work is a self directed exploration of the question: "How might we use design to reframe systems of production, products, and methods of consumption to create a paradigm of resource stewardship which could protect the biosphere and build more resilient human communities?" This work explores the concept of kipple, or useless objects, in the context of maker culture, gentrification and mass production.
The following five essays explore this question in a few different ways. I’ve tried my best to collect all the sources I used, but feel free to email me for clarification. Related work will be posted soon.
Contact me at hpredko [at] gmail [dot] com.
1. Things We Carry
I lived with a man once, and after several years we felt it was best to extract our lives from one another. In the end, he packed up my things while I was at work. I was working sixteen hour days, and stressed out by everything that was going on in my life. The separation of our belongings was largely uncomplicated, and since he was keeping the apartment, everything I owned began to wane from the shelves and surfaces. He kept the bed, I kept the couch, and so on.
The thing that gave me pause was the jars full of flowers, dried and displayed in the front hall. For years, this man had brought me flowers on unexpected occasions. Never birthdays, or anniversaries, but on my walk to work, stopping by my school. Keeping these artefacts of affection seemed the wrong choice, but leaving them or throwing them out wasn’t appropriate either. Intangible history and emotion imbued them with a meaning larger than the sum of their parts. “Because our brains link ideas together in memory, we are particularly well-suited to the act of suffusing an object with emotional value (Turkle).” The things we surround ourselves with become linked in a complex network of meaning and narrative.
That summer, my relationship to objects began to come unhinged in a way that shook me more than my personal relationships. I was finishing production on a cycling light I had launched on kickstarter with friends. We raised thousands of dollars to make several hundred units, and I spent months buying materials, emailing suppliers, and taking on large chunks of the fabrication myself. It turned out to be a task none of us were prepared for, but we ended up with a functional product that we shipped out on time. As we dropped off the packages at the post office, I couldn’t shake the guilt that all the things I had just made would one day end up in a landfill somewhere. Once their novelty had worn off, once the batteries failed, these lights were all out of my hands, destined to leach lithium into the water table somewhere.
I’ve always made things, and as I began to develop a career as a product designer I couldn’t stop paying attention to all of the crap objects that pile up in junk drawers and boxes in the back of closets. As I moved all of my belongings out of that apartment, I payed attention to the small things I had no place for-- the never ending pile that gets relegated to drawers, never to truly get sorted. I obsessed over the broken chairs left at the side of the road, trying to imagine a different life for them. It started to feel as though all the broken and useless objects were closing in on me, as though they will fill the curbs with their numbers until they cover the sidewalk and street, swallowing everything. And I was just adding to that pile with my own work.
Explaining this anxiety to a friend, she looked at me simply and said, “Oh, you mean kipple.” Which, upon further research I suppose I did. Kipple is one of those perfect concepts from speculative fiction that captures some fundamental aspect of your own time. Philip K. Dick coined the term in Do Androids Dream of Electric Sheep? Isadore, the chicken-headed philosopher of kipple, tell us that kipple is “...useless objects, like junk mail or match folders after you use the last match or gum wrappers or yesterday's homeopape. When nobody's around, kipple reproduces itself. For instance, if you go to bed leaving any kipple around your apartment, when you wake up the next morning there's twice as much of it. It always gets more and more.” Kipple is the process of entropy wearing down the material world, leaving evidence everywhere. Dick’s idea of kipple describes the way useless objects seem inescapable, how they reproduce and surround us.
"There's the First Law of Kipple…'Kipple drives out nonkipple'." In the novel, Earth has been mostly abandoned by settlers moving to Mars, and the planet is overrun by kipple. Looking at the way our civilization builds objects, sometimes I fear this is where we are headed. We have designed both obsolescence and permanence into the objects we create, and are thus drowning in kipple.
Bruce Sterling cautions against viewing our current paradigm as progressive because we are consuming irreplaceable resources, and, in doing so, “erasing many future possibilities; ...restricting the range of future experience.” That summer, as I left my apartment, unsure of what to do with all those dried flowers and having shipped my first real product, making new things felt like a fundamentally futile act. But my whole life, all of my skills and all of my interests are concentrated around objects, making them, and my relationship to them.
I believe that material culture is central to human life and society, even the evolution of our species. Our use of tools has made us into a species that shapes the world around us. But the question of how to relate to it, how to hold onto what is meaningful, and properly dispose of what has lost meaning or functionality, is an endlessly challenging one. Our relationship to the things we own, the cities that shape us, and the global system of production, intersect and weave together in complex ways, based in legacy assumptions about our relationship to the planet and the biosphere. Sterling points out that “we humans are what tools made of us. The human body, human perception, human intelligence, they are all the outcomes of two million years of hominids interacting with hardware.” Our coevolution with material culture may be one of the most important factors that have led to building societies, cities, history that sprawls out behind us, with artefacts stored tidily in museums.
I love to make things, and I generally know the world through my hands first. I sew or paint or cut-and-paste my way to some level of understanding about a topic, and my hands have shaped my livelihood. I often think about the tools I use, the things I make, and how I am just the latest incarnation in a long line of human makers. Our ancestors were onto something when they first sharpened a rock. “The hand axes record the first moment that we understood that the world was malleable – that things can change and move, and we can initiate those transformations ourselves. To be human is to tinker, to envision a better condition, and decide to work toward it by shaping the world around us (Chimero).” My making has led me to a point where I want to shape the world around me and this is a story about that too.
The human species is transforming materials for which we have a commercial use at a “speed far beyond the natural self-renewing rate of the biosphere. Consequently, reserves of useful matter are running low and many will soon have vanished (Chapman).” For any reasonable sustained industrial activity to benefit future generations, the use of resources needs to be re-thought. A major component in the problem of resource stewardship is waste. “Over 90 per cent of the resources taken out of the ground today become waste within only three months: waste consisting of plastics, metals and other synthetic compounds no longer recognizable to the microbial decomposers that degrade substances back to their basic nutritional building blocks (Chapman).” Every mine, every forestry operation, every factory, every shipping yard produces excess materials that are dumped into the ground and into the oceans, never to be reclaimed. The consumer waste we see only represents a small amount of the overall resource use in production, “ [the bulk of consumer products] contains on average only 5 percent of the raw materials involved in the process of making and delivering it (McDonough)” Human industry is a vast, planetary Rube Goldberg machine producing kipple in all shapes and sizes.
I decided that if I were to continue on the path of product design, I needed to understand my relationship to the things I own, the places I live, and the systems that produce products and endeavour to create positive change to stop the kipplization of the universe. “Effective intervention takes place not in the human, not in the object, but in the realm of the technosocial (Sterling).” The space between people and objects is culture, and culture is more malleable than we think.
To understand the genesis of my obsession with objects, my lifelong dedication to taking them apart and building them, I can’t escape the influence of my aunt and uncle. Their home is a place unlike most others. Their decades of collecting art from friends have transformed their living space into a cacophony of shape and colour, with paintings and sculptures running from floors to ceiling. Through a child’s eyes, it seemed endless. Every nook and cranny was filled with new wonders, each of them bearing a story. There is a small diorama of my aunt and uncle, standing beside heavy laden bicycles in matching touring gear on a bridge. Encased in plastic, a photograph stands behind the tiny figures, every detail reproduced fastidiously. Commissioned by a master model builder at Ottawa’s War Museum, it’s an artefact of such love, both in creation and subject matter.
Here, I learned to love and cherish objects both large and small. I learned that art is more than something distance and monetized in a museum or gallery. Art is a conversation with the people you love, the world around you. I joined the conversation too, presenting sculptures and drawings when I would visit, delighting in having them displayed alongside everything else.
Paintings by friends who have won commercial success as artists share space with objects who only have value through their stories, the meaning that has been made for them. My uncle’s basketball jersey is framed in his study, and he keeps a hunk of concrete, a piece of the Berlin wall that his friend brought back to Czechoslovakia - back when that was its name - where he was living when the Soviet Union fell, when it was called Czechoslovakia.
Leaving my old apartment marked the beginning of a journey to understand and contextualize the world around me through objects and artefacts. My anxieties about the world led me to seek out the history of how Toronto was built, explore the manufacturing ecosystem of the Pearl River Delta and Yiwu, and read a wealth of material on the current state of sustainable design. The journey began with taking those flowers, so full of meaning, and setting them on fire.
2. Brickworks
The city is a landscape that shapes our perception, drawing architectural boundaries around what we believe to be possible. Toronto, the city where I live, is in a state of flux, with old brick architecture being razed to make way for shimmering glass condo buildings that stick up like ice stalagmites from the ground. The raised freeway, snaking down by the lake, brings you eye level with little boxes in the sky. The city, as it had been is reduced to rubble, kipple. There is obsolescence in architecture too, which often implies that the people who had lived there are obsolete in the city that is being built. The clay that was dredged from the Don Valley was shaped into countless red bricks, and shaped the city that had been. In my lifetime, they are being torn apart and the city is changing shape again.
After I finished my kickstarter project, ended my relationship and moved out, I began a fellowship program in a shiny glass building downtown. We were encouraged to think about the underlying systems that shape the world around us, and we were carted around the city learning about different approaches to policy and entrepreneurship that have been sanctioned as “social innovation”. While my current work owes a huge debt to that fellowship, I remain ambivalent to the word “innovation” which is so often applied to neoliberal approaches to undermining social institutions.
On one of our field trips to Toronto’s many cultural spaces, the shifting housing landscape in the city was drawn into sharp perspective for me. Years ago, when I first met the man I later moved in with, he lived on Shaw Street, in Toronto’s west end. He lived in a house with seven other men, all bike couriers save for the doe eyed middle aged landlord who lived in the basement and smoked a lot of pot. Chain grease stained the walls, and spray painted plywood served for decoration. The facade was painted an acrid shade of blue, bordering on green. The kind of colour you could argue about what exactly to call, if you found yourself with too much time on your hands.
When he lived there, an elementary school down the street sat abandoned along with a boarded up house across the corner, but already the main street to the west was full of oyster bars and cocktail lounges. The stoned landlord mismanaged the mortgage, and the gaggle of bike couriers was evicted, scattering across the city and leaving the blue house on Shaw Street.
Years later, the abandoned school had been redeveloped and turned into an art centre. I came by with my innovation fellowship, strolling through the well appointed halls and learning about the endless institutions that lived within the walls. On my way to the art centre, I walked by the house on Shaw that had once been blue. There is a sparse, easily maintainable garden now, in place of weeds and bike parts, and a buzzer box for the three apartments the house has been divided into. The paint has been long since stripped away, exposing yellow and red bricks. The unassuming facade fades into the street.
One of the groups we visited in the art centre is a charity that provides creative resources for street involved and homeless youth. I really love this place, and I’ve accessed facilitator training there, and friends have been employed by them or accessed their resources. But I was left deeply frustrated that this neighbourhood had once been somewhere that impoverished youth could be housed, and it no longer was. The renovated school full of not-for-profits and charities no doubt provides so many positive things, but where are the innovative approaches to keeping people housed in the first place? Innovation favours disruption, a romantic idea, but disruption in the lives of vulnerable people can be violence.
There will be no more punk houses on Shaw, but bike couriers still need affordable housing. I had been in university in those days, and in the intervening years, I’ve had many opportunities open up for me, something that often happens if one is privileged enough to get a higher education. Visiting the art centre in the Shaw Street school, I felt like my older self had killed my younger self, stealing everything that was good to buy a better future. What have I destroyed to get where I am, and who has been left behind? To be back there, years later, to say I wanted to make the city better felt like an empty promise. Spaces for social innovation, while admirable, seem to fall into the comfortable pattern of blanding and gentrification. A “general store”, an overpriced convenience store, opened across the street in a home that had been abandoned, where the drinks are five dollars and strollers clutter the front steps. How do we create an innovative approach to letting people stay put?
These patterns frustrate me, so I try to understand Toronto through the built history. I think of the city through the bricks that built it. Years ago, I started driving to the Evergreen Brickworks late at night, in Toronto’s Don Valley. It’s another project in renovation and innovation: a brick quarry turned multi use event space and offices. The Don Valley Brick Works opened in 1889 and quarried and dried millions of bricks for nearly 100 years. Mountains of architecture rose out, while the valley became deeper and deeper. Factory after factory was built next to the ever descending chasm in the earth. Toronto had a great fire in 1904, and most of the downtown was rebuilt with bricks from the valley. During the depression, men would sleep in the kilns during the winter months at night, when the fires were out. Long before I was born, the valley was torn apart to the build the city, reconfigured through the euclidian logic of right angles and grids.
Heavy industry is disappearing from sight in cities like Toronto, wealthy cities with service economies. The renovated factories house social enterprises and bike repair shops, sprinkled with large scale sculpture, much like the Distillery District in Toronto, or the Highline in NYC. The Brooklyn Navy Yards, or Pier 9 in San Francisco reclaim military infrastructure that has become valuable real estate. The detritus from shuttered industry is repurposed into a playground for the creative class. The Don Valley has been restored to meadows and wetlands. These spaces that had once been the ceaselessly clanging, living epicentres of industry have been transformed by the forces present in the information economies that eclipsed to take the place of heavy industry in Eastern North America.
I’ve always loved these post-industrial spaces that are so demonstrative of the dream of green, sustainable cities. But there is a lurking ambivalence. While we mend the scars of industry that are visible to a wealthy urban populace, our growing hunger and greed are outsourced. The mines and the factories are positioned further away, out of sight, across oceans traversed by tankers spewing smoke. For every garden planted with local species intended to reintroduce butterflies, there is a tonne of e-waste floating across the Pacific to have capacitors torn off by hand, lead and cadmium seeping into groundwater.
The brickworks is closed, and any industrial production is moving further and further out of Toronto. It seems that we want production and industry out of sight, so the illusion of our modern lives can continue on unbroken. We fill in the quarries we can see, and rip apart the landscape further north, and across oceans. Meanwhile, Canadian mining companies destroy livelihoods in South America. Of course, creating these spaces to support further development into green cities is important. But it’s important to remember there is much work to be done, and our lifestyle is propped up by a complex system of production that crisscrosses the globe in fractured supply chains with little transparency. From heavy industry to urban oasis, the brickworks is just one part of the story. But it built the houses I always wished I could live in.
Eight months later, my fellowship ended, and I began preparing to cross the sea to trace some of those supply chains that had become an obsession. For the month before I left, I sublet an apartment in Toronto’s Annex neighbourhood, the kind of apartment I had always wished I could inhabit. It was a friend’s bachelor apartment in an old brick mansion, complete with heritage plaque affixed to the front. The rambling structure seemed a feat of imaginary architecture, I could never figure out where all the doors and windows went, puzzle together where the other 12 units were in the house. The plaster work had been painted with a sponge at some point, an effect out of a Martha Stewart magazine in the 90s.
The neighbourhood is populated by Victorian red brick homes, both massive and semi-detached, lining verdant streets with confusing one way traffic routing patterns. I wandered these streets as a teenager, skipping class and day dreamed of living behind their masonry. I went to house parties hosted at the homes of friends whose parents were authors and professors. This neighbourhood, chosen by Jane Jacobs when she made her exit from the United States, seems to be emblematic of so many of her ideas around urban planning. Shops and restaurants blend together on walkable blocks.
The dream of living here was, of course, aspirational. The neighbourhood is old and affluent, next to the older ivy-covered university, and speckled with fraternity houses with big greek letters looming overhead. The Annex is full of the upper middle class intellectual type that buys organic food and petitions for better funding for the CBC. But the allure of independent cinemas, tiny venues, zine libraries, art spaces, and other mainstays of alternative culture draws me in like a moth to a flame. And the neighbourhood is becoming prohibitively expensive, with old architecture being renovated or demolished. I lived there for the last month before the friend who I was subletting from had to move because she was being evicted.
“Escalating real estate prices can inhibit innovation. Many forms of innovation and creative activity--whether they are new high-tech businesses, art galleries, or musical groups--require the same thing: cheap space. That’s what Jane Jacobs was getting at when she famously wrote: ‘New ideas require old buildings.’” points out Richard Florida, who writes extensively on the importance of place. Cheap space in Jacob’s old stomping ground in now impossible to come by. He says, “when housing prices rise and buildings are converted into expensive condos or high-end retail shops, venues for fostering creativity disappear.” I fear Toronto is trapped in this cycle, and for all the hope of innovative futures based in artistic practice, the city is becoming increasingly homogeneous and bland.
“For every young person who moves into an urban mosaic or a hipster haven, it is likely that a lower-income family, or part of that family, has been driven out. For every young professional who finds him or herself living the good life in a designer digs community, many more lower- and working-class household struggle to find affordable rental housing that will allow them to raise their families and make ends meet (Florida).” It’s hard to know how to interact with a city when your choices make you complicit in these forces greater than yourself. I began to feel like a swarm of locust, devouring everything in my path. Or a werewolf, awaking to the chilling knowledge that I had created destruction. I get so afraid, because I am so complicit, the driving force of gentrification.
All across the city, older brick buildings are demolished to make way for condo buildings, turning infrastructure into kipple. Richard Florida has a concept he calls the gay bohemian index. He has found that one of the best indicators of rising property values is when queer folks and artists begin to move into a neighbourhood. This sets into motion years of social changes that will eventually displace the artists and queer people along with the low income families who were the first to be displaced. As a middle class cis white bisexual woman working in the arts, where ever I choose to establish a home it seems I will displace those more vulnerable than me, and ultimately contribute to the creation of a neighbourhood that is economically out of my reach.
Someone once said to me that privilege can be a tool or a weapon. I remember sitting in a talk at a conference about art and social change in Ottawa one fall. A couple of women from Edmonton talked about the community art initiatives they had created in their neighbourhood. The neighbourhood had sex workers and gang members as part of the community, but this woman made it clear that she did not consider them community members. Her work was only intended for the white middle class families who were moving in, drawing a line in the sand. After she brushed off my questions after the talk, I stormed out, and sat by the river. I sang folk songs to myself under my breath, and threw rocks at the ice forming already at the edges of the flowing water. That woman is everything I fear I could become.
I left Toronto to try to better understand the impact of my work as a designer, and because I didn’t know how or where I could live in this city without destroying the things that have made it my home. Trying to understand how to use privilege as a tool rather than a weapon. I took the money from my fellowship and left to travel through Asia, to go to China and find where everything came from.
I visited Ottawa before I left, to say goodbye to my family there. As a parting gift, my uncle gave me a tiny silver box, oval and gleaming. Inside there is a dried bean seed, and a slip of paper curled tight. The paper reads, “This is a seed from Virginia Woolf’s garden. Always remember that anything is possible.”
I’ve never read Virginia Woolf, to be honest. I’ve always read more sci fi and nonfiction than classics, in my voracious appetite for words. But the seed makes me think of lush English gardens, far off, and worlds contained in tiny containers. A seed holds the potential to create so much, immense possibility condensed but knowable somehow. These questions I carried with myself were like seeds. How can we create the commodities we need to live prosperously without destroying the planet? How can I contribute to the city I live in without creating a culture of unchecked gentrification? As I set out, I carried the silver box, the seed, and those questions with me.
3. A Sea of Commodities
In my years of designing and making in Toronto, I came to identify strongly with a series of practices, communities and approaches to learning that are referred to broadly as “The Maker Movement.” “Like the Arts and Crafts movement—a mélange of back-to-the-land simplifiers, socialists, anarchists, and tweedy art connoisseurs—the makers are a diverse bunch. They include 3-D-printing enthusiasts who like making their own toys, instruments, and weapons; tinkerers and mechanics who like to customize household objects by outfitting them with sensors and Internet connectivity; and appreciators of craft who prefer to design their own objects and then have them manufactured on demand (Morozov).” In Toronto, the community is loosely arranged around shared workshops, art schools and tech art galleries and over the years I have embedded myself in this world.
I was drawn to this movement because it offered an alternative to mass consumption with its DIY ethos and I was never far removed from someone who had the answers to esoteric fabrication questions. I believed a “culture of conscious makers could recognize and promote alternative solutions and new perspectives for everyday problems, valuing distributed and collaborative approaches and seeking the common good (Fonseca)”. I met radicals who challenged Canada’s security apparatus during Toronto’s G20, and artists who build new interfaces for technology enhanced theatre. I wanted this work to create open distributed forms of production, where small groups of people could produce what they need to live well. At its best, the maker movement represents the free software movement being applied to the physical world.
Eventually, it became clear to me that the work I was making, and the work of those around me was not moving in that direction. Commercialization and entrepreneurship crept into the discourse as the ultimate goal of “maker” projects, and corporate sponsors started popping up at makerspace parties. Producing a prototype and launching a kickstarter became a very aspirational maker activity, and a career path I pursued. While I’m certainly proud of that work, my ambivalence about creating more products is ever present. At the same time, as I began to interface with systems of production, even the small aspects that are available to independent designers, the naivety of the whole maker premise began to emerge in my mind. Maker culture does not provide a critique of industrial production that holds up when examined against the reality of full scale industrial production, and the complexity of emerging manufacturing-based markets like China.
I spent a lot of time learning about the work of people who were manufacturing at a slightly larger scale than I was; thousands or tens of thousands of units, and the ways they were producing these products in China. So I decided to travel to China to attempt to understand some of the factors that were shaping global production, and how North American maker culture was interfacing with the larger machine of industrial production. I was looking for the root of kipple. I can’t claim I ever came to understand China as a nation much at all. I mostly spent time with foreign nationals who were working overseas, or Chinese nationals who spoke beautiful English and had studied abroad. My impressions are entirely coloured by those experiences, and I cannot speak to the experience of the millions of migrant workers who produce the products that get made.
I found that decades after the inception of planned obsolescence, products designed for disposability, the biggest driving factor in manufactured waste is no longer massive corporations engineering parts to fail. Instead, the rate of technological change, along with globe-spanning disaggregated supply chains, and automation, have led to a moment where millions of products are produced globally that become waste almost immediately. Shenzhen is the epicentre of maker culture in China, and the epicentre of throw away electronics, and where my journey began. “It’s where all the electrical crap we buy comes from, the cheap toys, that box of chargers and adapters that you have, that you’ve no idea what they’re for anymore, the cemetery of old phones in your kitchen drawer (Davies).” Shenzhen is one of the busiest ports in the world and it houses most of the world's smartphone factories. Linking Hong Kong to mainland China, Shenzhen is a vast and vibrant city filled with LED-illuminated skyscrapers, modern architecture, and a city rail line that reaches far out into the swaths of suburbs and anonymous factory buildings that surround the core. The city was “China’s pioneering Special Economic Zone (SEZ)... the experiment that gave the nation its first economic miracle. It proved that foreign investment and outsourced manufacturing could be attracted on vast scales if the taxes and labor costs were low enough, that an undemocratic Communist state could contain and control zones of hyper-capitalism within its own borders, and that whole cities could be built from scratch to fill a gap in the global manufacturing market (Maughan).” It’s one of the fastest growing cities in the world, adding more megatowers in 2016 than all of the United States.
Joi Ito, the director of the MIT Media Lab, has been a champion of innovation in Shenzhen, noting that “ the low cost of labor was the driving force to pull most of the world sophisticated manufacturing here, but it was the ecosystem that developed the network of factories and the tradecraft that allows this ecosystem to produce just about anything at any scale.” Chinese entrepreneurs often engage in shanzhai production, an approach to intellectual property that Silvia Lindtner and David Li say is “rooted in a network of small- to mid-size factories that partner and openly share knowledge.” Board designs, bills of materials, and other design files, will be openly shared between networks. These agile systems of production produce vast volumes of commodities quickly, and ship them all over the world. And this accelerated production has created immense wealth, transforming nations in decades. Shenzhen has grown from a small city of 300,000 to a megacity of upwards of 10 million in three decades. “Recent research from Harvard and MIT by Ricardo Hausmann and César Hidalgo provides a compelling case that manufacturing does indeed matter [for the economic development of nations]. Using export trade data for only manufactured goods from 128 countries over the past 60 years, they can explain a significant portion (over 70%) of the income variations in countries (Deloitte).” However, while globalized supply chains and shifting sites of production are creating better economic outcomes for developing nations, the cost to the planet and communities who bear the brunt of environmental externalities is incredibly high.
Alongside shanzhai producers, and foreign multinationals, Shenzhen is increasingly the home to North American makers and hackers producing products for sale in the West. Startups out of the MIT Media Lab, such as Little Bits, produce their products there. Accelerators for hardware startups pepper the landscape, with huge cash injections backing bizarre internet-connected tchotkes. A Make: Magazine-branded maker faire happens there every October, attracting thousands of people from around the world. A Chinese company, Seeed Studio, has effectively built bridges to the North American maker market. They’re an electronics company who create open hardware toolkits, and support maker businesses to manufacture electronics projects. Over 50 over their 260 employees work in research and development, working on helping companies redesign their circuit boards, lower the costs of their bill of materials, and ship their products around the world. Many hardware companies consult in this way, but Seeed is working with clients who may only make 100 or 200 units for niche hobbyist markets.
When I arrived in the city, I met up with a loosely connected group of hackers, makers and business people who convened over Wechat, who I had been introduced to by a mutual friend. With them, I explored Shenzhen’s massive network of markets and the factories where their products are made.
The dizzying scale of the electronics market is a good introduction to the manufacturing ecosystem. City blocks are full of immense buildings, selling everything from bulk components to consumer electronics. Every conceivable part of a cell phone can be bought and sold, and young guys fix smart phones, with another phone nestled on their shoulder, chatting with friends. There is a lot of life in Shenzhen’s markets, with children playing in the aisles while their parents sell parts and drink tea. The end of the day in Huaqiangbei, the market district, is announced by a chorus of tape ripping from rolls, before packages are carted off to the shipping alley on dollies. Secondary businesses permeate the market, from the shippers, to the lunch stalls, to the mechanics that will replace the wheels on carts. Older cell phones are broken down on the street, valuable parts stacked up to be sold.
On the streets leading out from the markets, where the buildings dropped down to five or ten stories, elderly men sat on pieces of cardboard pulling the valuable components off the circuit boards of old cell phones. The plastic casings went in one pile, metals and ceramic in another. Old phones are sold by weight, passing through an informal removal chain. Walking up any public stairway in Shenzhen, you will find a ramp in the middle of the steps. These are used to haul packages up and down, carting components to their next destination. In a pedestrian walkway beneath the street, on the way to Huaqiangbei, there is a LCD screens that shows off the latest machines for laminating smartphone screens. Whenever I walked by, there was always a crowd drawn to this incredibly niche display of technology.
I visited factories as well, suppliers who worked with the North American maker crowd. Shenzhen’s vast subway system reaches out into the far off suburbs, where I was deposited near a small PCBA factory, printed circuit board assembly. The street was lined with apartment buildings and stalls selling noodles and spare batteries. An anonymous gate led to an anonymous building, which housed several factories. I met a man named Mike, who led me through the maze of identical buildings by sending me landmarks on WeChat. His father founded the factory, and he runs it now. He is a Chinese national, but his English is perfect. He studied economics somewhere out West. Now he interfaces with the maker community, producing small runs. The boards around the shop were for a robotics company in Texas. His staff work six days a week, running pick and place machines, furnaces, test rigs and hand soldering. It’s not easy work.
Not far from Mike’s factory is Dafen Oil Painting Village, where massive volume and quick turnover are applied to the world of art. Reproductions of impressionists and Renaissance masters hang to dry over railings in the sun, alongside massive portraits of Mao Zedong. Thousands of people are trained as oil painters to create reproductions and commissions for export. The main street is lined with commercial galleries, but wandering into the alleys leads to workshops filled with easels where people sit and smoke and paint for long periods of time.
One morning, I met the people I knew to go along on a factory visit, to see where their flexible PCBs were being made. On a street corner in the morning, we pile into an unmarked van, and drive out to the suburbs. Shenzhen seemingly goes on forever, highrises stretching way out into the distance, slowly giving way to green rolling hills. Two of the founders chat about their business logistics, comparing customer service strategies and recruiting. They talk about where to get Pantone colour matching for PCBs, and the best battery chemistry. The complexity of hardware leads to strange, detailed conversations. It’s a complexity that no one person can hold together all on their own, and communities of practice emerge, sharing resources.
“It’s never a factory tour without a u-turn,” one of the men laughs while the van swings around, back and forth through traffic. We find the spot eventually, another crumbling anonymous building, and the boss is outside to shake our hands. We put polyester booties over our shoes to enter the factory, to be transfixed by the mesmerizing syncopation of hundreds of people and machines working in harmony. Stress tests and stamping machines, computer-operated robot arms and huge, churning etching machines. People attend to an unimaginable ecosystem of machines created to perform the most specific of minutia.
I think about the simplicity with which the phrase “Made in China” is often viewed in North America, a small stamp emblazoned on a product with no further interrogation. Even in the world of product design, manufacturing in China is sometimes viewed as an opaque process where designs go into a black box, and a product emerges. But all of these objects, everything we have ever owned, gets made through navigating complex social networks. The small-scale producers I spent time with all said that working with a company where you could meet the boss was the most important thing. And equally important was getting drunk with the boss. In some ways, the immense complexity of the global supply chain is resting on Tsing Tao and karaoke with blinking laser lights.
It amazes me that the things that end up on Walmart shelves pass through so many hands. Disaggregated supply chains weave out of one factory into another, suppliers hiring each other as subcontractors as their workload expands and contracts. Workers in the factories often have fair wages, some semblance of bargaining power, but the manufacturing ecosystem spills out of the factory doors into the streets where couriers, shippers, parts suppliers, and countless other secondary and tertiary professions intersect and collide with the more formal work. These people have little security or labour protection.
The entrepreneurs I met in Shenzhen are often hacking at an industrial scale. The same curious, cheeky attitude I recognize from makerspace folks back home pervades their work. Two men convinced a capacitor factory to allow them to intervene in the line, getting the caps anodized bright colours. Electric pink capacitors, made in the thousands because they can. Another man, when getting small, surface mount electronic components put on reels for a project, realized he could get the factory to put any small object onto reels for a pick and place machine. He brought them breath mints. Their curiosity is taken to scale, creating bizarre remixes using industrial equipment. “An unlimited supply of quality control failed toy cars await encasement in soft, floppy silicone,” with a ridiculous side project Expressway to Pleasure. You can cast cast-off toys into dildos, because it is technically a thing that is possible.
While these bizarre projects are entertaining, and expand the scope of what is possible, I’m reminded that this supposed social upheaval brought on by the maker movement isn’t particularly forthcoming. “Our hackers aren’t smashing the system; they’re fiddling with it so that they can get more work done. In this vision, it’s up to individuals to accommodate themselves to the system rather than to try to reform it. The shrinking of political imagination that accompanies such attempts at doing more with less usually goes unremarked (Morozov).” The hardware entrepreneurs are simply that, and while they delight in weaving subversive elements into their work, there is no larger political scheme underway.
Even if there was an earnest effort to use maker culture as a tool to disrupt global production, the toolkit is poorly stocked. Key parts of the knowledge ecosystem to produce the commodities that keep our society functioning currently exist only in Shenzhen and other parts of China. David Li, one of the theorists who studies shanzhai production, said to me that shanzhai producers view maker projects like an adult regarding kindergarten art. They admire the effort, but there is no real sophistication, no deep understanding of the tools in use. The whole community I’ve built my professional identity around look tiny and ineffective when viewed in the context of the true scale of global production. There is something humbling in being so tiny.
The domestic market for consumer goods in China is massive, and the export markets for other developing nations are huge as well. There is this seeming idea in the West that we outsource things to Asia in this unidirectional exploitation. But if we were out of the equation, this system would continue. People in markets are fixing smartphones while talking on smart phones, working on assembly lines wearing the same clothes they are making.
Americans were so taken by Mike Daisey’s story about exploitation in Apple Factories, no one initially fact checked his claims and his story was syndicated across the world through the PRX show This American Life. He told a tragic tale of labour exploitation, and hexane exposure that ended up being largely fabricated. Labour conditions are an ongoing concern at Foxconn, the facility that produces Iphones, but Daisey’s story was an exaggeration targeted to pull Western heart strings. We are so quick to assign autonomy to the North American consumer that we believe changing our consumption habits would change the world. The “maker” ideology seems to purport that if we all learned to turn wood on a lathe, mass consumption and exploitation would end. These are naive standpoints, that ascribe too much power to the choices made by those in the West.
Before I left China I spent time in the land-locked city of Yiwu. Here there is the “largest and cheapest wholesale market on earth. Yiwu's 4-million-square-metre bazaar consists of some 62,000 outlets that sell an estimated 1.7 million different products, largely produced in factories across south and southeast China (Philips).” These small commodities, from hardware to socks, stock discount and dollar stores internationally. Throughout the massive market, signs proclaim: “Yiwu Commodity City, A Sea Of Commodities, A Paradise for Shopper.” As I walked through the seemingly endless aisles of products, it did not feel like paradise.
All of these objects are on display, waiting for buyers to make orders that start in the tens of thousands. Everything is lying in wait to become kipple. The sale of all these trinkets props up so much in our global economy: jobs both in China and abroad, the shipping industry, retail. There is an imperative to keep production high, and to sell all of these commodities in massive volumes.
“Continuous improvements in technology mean that more output can be produced for any given input of labor. But, crucially, this also means that fewer people are needed to produce the same goods from one year to the next. As long as the economy expands fast enough to offset labor productivity, there isn’t a problem. But if the economy doesn’t grow, there is a downward pressure on employment. People lose their jobs. With less money in the economy, output falls, public spending is curtailed, and the ability to service public debt is diminished. A spiral of recession looms. Economic growth is necessary within this system just to prevent collapse (Jackson).”
In order to maintain an equilibrium in our current system, cities like Shenzhen and Yiwu need to grow, and consumers need to buy more and more each year. But, the depletion of resources underscores the system of production, so the growth imperative is fundamentally unrealistic.
Even when engaging in supposedly subversive “making” in North America, the raw materials still come from here. The screws, twine, glitter, and plywood are manufactured and shipped out from places like Yiwu and integrated into artisanal birdhouses sold on Etsy. The designer Thomas Thwaites attempted to make a toaster entirely from scratch as a thesis project at the Royal College of Art. He was inspired by Arthur Dent, the hero of Douglas Adam’s Hitchhiker’s Guide to the Galaxy series. Dent “finds himself alone on a strange planet populated only by a technologically primitive people. And he kind of assumes that, yes, he'll become -- these villagers -- he'll become their emperor and transform their society with his wonderful command of technology and science and the elements, but, of course, realizes that without the rest of human society, he can barely make a sandwich, let alone a toaster (Thwaites).” He chose to reverse engineer the cheapest toaster he could find, bought for less than four pounds, and found it had over 400 pieces made of over 100 materials. He chose five materials to reproduce, gathering minerals from mines across England, and in nine months managed to make a hideous object for a couple thousand pounds that barely functioned. The plastic was made of starch, and looked particularly gooey. Rather than a sleek and functional appliance, the toaster was a bizarre hunk of materials that turned on briefly and immediately burned itself out. The shaping and creating of commodities is a complex process, that requires an ecosystem larger than any one person. It’s absolutely impossible to extract oneself from this system in the modern world.
While I wandered the stalls of Yiwu, world leaders were gathered in Paris to discuss the future of fossil fuel use. I find it frustrating that the conversation never seems to tread into questions of what to do with the immense mountain of stuff human produce that moves across the globe everyday. The market in Yiwu is the physical manifestation of the global trade in small commodities, but it more and more lives online. The tens of millions of products on Alibaba dwarf the two million here around me. Every stall represents a factory, a supply chain, a connection to mines and chemical producers, with a sprawling network wraps its tendrils deep into the earth.
I’m worried about extraction, climate change, waste, and entropy. But leaving Yiwu, feeling convinced that the maker ideology that had inspired my work for years was politically ineffective, and feeling convinced that the designing and manufacturing of products and commodities is legitimately a bad business that has negative impact on the planet, I still wanted to work designing and producing objects. Our societies, and our daily lives are entirely shaped by material culture. Despite all my frustrations, sitting down to create something from scratch is one of the greatest pleasures in my life. “The quest for a sustainable world may succeed, or it may fail. If it fails, the world will become unthinkable. If it works, the world will become unimaginable (Sterling).” I don’t know how to create a sustainable paradigm for material culture, and all of my previous strategies have been entirely naive, but it is work that is entirely worth doing. To ignore it, to leave the problem unchecked, is to see the kipplization of the planet, the transformation of ecosystems into shopping malls, and to see the oceans filled with ever-growing gyres of plastic.
I believe it is the responsibility of designers to create strategies that renew and heal and the planet, and that meanwhile keep us all fed and clothed.
4. Shoreline Commemorative
The places we care about are often indifferent to our transit. I returned to Toronto in a mild, slushy winter and took up residence in my parent’s home. They had moved to a condo downtown, where my few possessions imposed lightly on the landscape of their lives. Like many condos in Toronto, this building is built where an older building stood, contributing it’s facade and little else. The shell is gutted, and a new building grows out from the ground, shiny glass contrasting against red brick.
The building is down by Lake Ontario, where some of the oldest buildings in a relatively young city are located. There is a piece of art nestled in an alcove where the historic architecture and new building interface, a concrete topographic map of the shoreline of Lake Ontario alongside a glowing glass sculpture. Sandblasted into the brick wall of the older building, text reads, “For 10,000 years this was the location of Lake Ontario’s shoreline. This brick wall stands where water and land met, with a vista horizon.”
I became obsessed with these words, imagining water lapping at the sand in the spot where I sat, staring at that brick wall that obscured the view to the current shoreline, along with the parking lots, freeways, warehouses and hotels that have filled the Southernmost kilometre of Toronto’s downtown. An unaltered shoreline from a time when the Huron-Wendat and other bands were stewards of this land, before colonization and treaties. The room where I slept was South of that wall, and I laid in bed at night floating in the lake in my mind. And I started to learn, bit by bit, why it was I wasn’t floating in the lake after all.
Toronto, like many cities, did not let geography rein in the ambition of development. “Large portions of New York City, Boston, Seattle, Hong Kong and Marseilles were built on top of fill. What is now Mumbai, India, was transformed by the British from a seven-island archipelago to one contiguous strip of land. The most extraordinary example of land reclamation and manufacture may be the Netherlands. As early as the 9th century A.D., the Dutch began building dykes and pumping systems to create new land in places that were actually below sea level (99pi).” Toronto’s shoreline was built out on industrial garbage and broken infrastructure, a city built on kipple.
When the stadium downtown, now called the Rogers Centre, was under construction in 1987, fifteen hundred artifacts were unearthed including a French cannon, over 200 years old. While building the streetcar tracks on the Queen’s Quay, whale bones were excavated, abandoned by a private zoo that went bankrupt on Front St. “There are stories that when construction occurs on the waterfront, that people find all sorts of things, like the hulks of old vessels and bottles. At one point the central waterfront was the city’s dumping ground — if you had a dead horse, you’d take it out there in the winter and leave it on the ice for the spring to come (Moire).”
The geography of the city was crafted by industry, ambition and greed. The Polish engineer, Sir Casimir Gzowski, worked with Grand Trunk Railway in the 1850s to build the first straight edge at the shoreline, what is now known as The Esplanade (Alamenciak). The Esplanade is less than 100 meters South of my parent’s new home, which must have been among the first to be constructed on the new ground. For decades the land that industrialists were building was swampy and emaciated. Puddles and cess pools surrounded the railyards. Grand Trunk Railway set up what they needed, and essentially stopped financing the project. Adam Wilson was elected mayor of Toronto in 1859 riding a wave of indignation from citizens who wanted access to the lake (McIlwraith).
It’s bizarre to think of the city growing outward, year after year, with sand and soil being thrown over whatever people had abandoned in the ports. Docks and quarries grew out from The Esplanade, until the Toronto Harbour Commission introduced the Waterfront Plan of 1912 which sought to create a modern port. “It called for dredging the harbour to a depth of 24 feet, and using this dredged fill to create land for industrial, commercial, and recreational uses (Plummer).” And so dirt rained down over the Harbour, and the city I know today began to take shape out of the bottom of the lake. Industries thrived and dwindled over time, highways were constructed. By the nineteen nineties, when my mind began to open to the world, the land by the lake seemed as eternal and immovable as mountains.
“Human activity has effectively created a new layer on the surface of the planet, made up of old bricks, cement and rusting metal. Geologists and archaeologists have started calling this layer the archaeosphere (99pi).” We tear apart and reshape everything in our path, no doubt leaving a complex legacy behind for anyone who cares to look through the layers. “The archaeosphere covers most of the humanly populated areas on earth. Generally: the older the area, the bigger it is in that area. In the center of London, it reaches ten meters below the surface (99pi).” We create, destroy, and rebuild, the very infrastructure of our lives and cities is a testament to the boundlessness we wish nature could sustain.
There is a place in Toronto where we are still making new ground. In the east end, the Leslie Street Spit was built as a breakwater to keep silt out of the harbour, built out of infill in the 1950’s. Early pictures show a barren slice of land, jutting out into the lake. The slender piece of land grew in fits and starts over the decades, the last place for fill to accumulate in Lake Ontario. Time and wind and sun and rain created an urban oasis, with local plants and birds moving in. An emergent ecosystem taking root in the rubble. Now the spit is home to Tommy Thompson park, part time nature preserve, part time dump site. Endless trucks drive out, dumping bricks and concrete off the end day after day. The bricks tumble into the lake, eroding slowly over time, rounding out like beach glass.
The spit extends out into the lake for five kilometers, and I like to go there and stare back at the city, made diminutive. I sit by the lighthouse and read, or talk to friends. All the buildings that get demolished to make way for condos end there, with wildflowers taking root and migratory birds nesting. Sometimes, I go and stack bricks. It’s a simple meditative task; I find it calming. To be among the remains of architecture pulled down, with songbirds singing. It feels like you’ve reached the end of the world, and we get to start again.
I biked out to the end of the spit with friends, and we called ourselves the Renegade Bricklayers Brigade. It was a clear, sunny day, and we lived for the joy of making. Lifting bricks one by one, stacking them, painting them. We searched for beautiful things in the rubble, a cracked faux Roman column and a cluster of tree roots. We were living like renegades, forgetting that the city wants to eat us alive, and loving the city for all of the strangeness and wonder it provides. So far from shore, it feels like we can build something new, build something together.
I come back to the question of how to live in this city as a young person working in creative industries. To build something so frequently feels the same as destroying it with art spaces and art centres become magnets for rising prices. Sisyphus was cursed to push a boulder up a hill, only to have it roll back down for eternity. I come back to this place to move discarded bricks back and forth, pondering the absurdity of living in Toronto. Futility feels like the only certainty.
We made a circle of bricks, and laid another on top. We did it again, and again, building it higher like a giant chimney, with a space left for a door. The walls weren’t even, the ground wasn’t even. It didn’t make sense, and we ran up and down the piles of stone, singing songs, free from the constraints of rent and jobs, if only in our minds.
Everything felt like it made sense, and maybe Sisyphus is happy because while I moved bricks things were okay. But of course I am not Sisyphus, and I need to live in the city, whether the land was put there by eons of geologic movement or by humans on top of horse bones or bloated ships. It’s easier for me to leave the real city behind and languish in the ruinous architecture of the edges. “A city is built to resemble a conscious mind, a network that can calculate, administrate, manufacture. Ruins become the unconscious of a city, its memory, unknown, darkness, lost lands, and in this truly bring it to life. With ruins a city springs free of its plans into something as intricate as life, something that can be explored but perhaps not mapped. ...An urban ruin is a place that has fallen outside the economic life of the city, and it is in some way an ideal home for the art that also falls outside the ordinary production and consumption of the city (Solnit).” Here at the apocalyptic fringe, escapism and exploration converge. The unknown wilderness allows us a glimpse at the possible, ignoring the intricacies of reality.
An anonymous poet also roams the Leslie Street Spit, writing on discarded slabs of marble. I find their words strewn through the rubble, sharpie on stone. That day in the sun with my friends, I found some of their words.
“Creative spirit and instinct mingle here. I’ve not seen it
so clearly anywhere else before. I love you for this
And for all you draw from the natural world, from
The human world, from me and the pen.
You are indeed a temenos, a holy place, in the best
Possible sense.
Thank you for the slim edge that you are where the
Natural and the deconstructed built worlds dance”
The poem was signed, “With profound appreciation, The pen and the camera and me.”
I take pleasure in these times of escape, even though I have no choice but to devise a strategy to navigate adult life in Toronto. Rebecca Solnit warns against the coming era where the neoliberal accumulation of wealth has come to consume everything left fallow in the urban landscape. She adds, “In the 1980s we imagined apocalypse because it was easier than the strange complicated futures that money, power and technology would impose, intricate futures hard to exist. In the same way, teenagers imagine dying young because death is more imaginable that the person that all the decisions and burdens of adulthood may make of you.” Starting a new life among the flowers and garbage feels like an easier choice than making a plan for where I might live, long term, and how the mechanics of that life will be supported. Student housing years out of school, or a spare room in my parent’s house, are perhaps not strategies I can rely on forever.
In my own life, I am coming to terms with the decisions and burdens of adulthood, trying to understand what work to do and where to live, but the intricate future of the city is hard to fathom. Money and power and technology are creating a city where it is hard to young people to live, where no one I know can begin to raise a family or to own a home. “A third of 18-34 year olds live in households headed by a parent or other family member according to a Pew Research survey from July. A smaller portion, 14 percent, own their own home, many of whom received help from their parents with the down payment. For the plurality there’s renting, and paying half their income is normal, especially in high-cost cities where young adults are concentrated (Harris).” The question of where to live, and how to stay housed is ongoing, and a challenging problem for anyone without high income.
Tiny houses in shipping containers, and renting your apartment on AirBnB for half the month are approaches friends have taken to housing. Couch surfing for months at a time, or taking up residence in living rooms with no doors, people find ways to get by in expensive cities. “There’s nothing wrong with young people wanting to live well and independently, not at the expense of their parents, low-income longtime residents, or the environment. That’s what the fantasy of the model millennial living in a box is about, and that’s what makes parts of it very appealing (Harris).” Toronto’s densification strategy seems less planned than a cash grab, with tiny apartments selling for half a million dollars, and rental units being demolished to make way for more condos. I would love to see informal networks of co-operative housing, rent control, and more rental units being built in this city. The coming decades will need realistic affordable housing solutions provided for low-income families, especially the influx of immigrants who move into Toronto. If we can transform the very geography of this land, we can find a way to establish viable living options within its topography.
At a party, one of my friends I had built with on the spit met people who had pictures on facebook playing in our structure. The eventual ruins of it were photographed and included in a photo essay in the Atlantic, about the spit. Who knows how many hundreds of people wandered to the edge of the city, and sat with our chimney built of bricks? It’s likely the most viewed piece of art I’ve ever contributed to. Maybe escaping the city as it is is the first step to building something new. Hundred of builders in concert, labouring out of sight, waiting to unveil a vision of a more livable city.
5. Taxonomy of Kipple
I settled down in a tiny apartment downtown and found work making bespoke eyewear in a small firm. Alongside that, I taught people how to make wearable electronics at a design university. After asking all of these questions about cities and mass production for so many years, it felt like a good fit. I try not to make too many things; I try not to take up too much space. I have tried to carve out a quiet space for continuing to research the questions that vex me. It seems to me that the world of mass production simply cannot continue on as it has been, we need a global response and shift in material production. It is imperative if our society hopes to transform the lives of people living in poverty, and to avoid catastrophic climate change.
All I can hope is that as a designer and maker, I’m able in my lifetime to make a meaningful contribution to change in these space. There is a massive amount of inertia within the global production of goods, and making recommendations is easier said than done. But it is worth keeping in mind that the systems in place today were deliberately designed to meet certain ends. William McDonough, author of Cradle to Cradle, points out that the Industrial Revolution was essentially “an economic revolution, driven by the desire for the acquisition of capital.” Our current system, complete with wasteful resources management, is still based on the legacy assumptions that drove the industrial revolution. Creating larger profit margins over rationing resource usage has been an ongoing design consideration when it comes to creating products and systems of production. “Planned obsolescence is the catch-all phrase used to describe the assortment of techniques used to artificially limit the durability of a manufactured good in order to stimulate repetitive consumption (Slade).” For nearly 90 years, disposability has been an important design consideration for many producers of manufactured goods. “To achieve shorter product lives and sell more goods, manufacturers in the 1930s began to base their choice of materials on scientific tests by newly formed research and development departments. These tests determined when each of the product’s specific components would fail (Slade).”
The desire to encourage serial consumption certainly makes sense from a business standpoint. If manufacturers created products that were entirely durable, there would be no need for them to produce more once the market reached saturation. Paul Mazur, an early champion of engineering obsolescence, wrote: “If what had filled the consumer market yesterday could only be made obsolete today, that whole market would be available again tomorrow.” His words seem wistful, as though he were looking out over a great expanse, waiting to conquer it. But the paradigm of disposability emerged recently, and it is within the power of those living today to put research and development departments to work exploring ways to reassemble products and build profitable business models outside of disposable consumption.
There are immense opportunities to use design to reframe and reimagine how we use resources to protect the biosphere and build resilient human communities. “Design is interconnected—to engineering, management, production, customer experiences, and to the planet. Discussing and comprehending the relationship between design and sustainability requires a systems perspective to see these relationships clearly (Shedroff).” If we view design outside of discreet professional titles, such as graphic designer or industrial designer, we can see how the discipline is interwoven into the system of production fundamentally. Designers specialize and master specific skill sets, but ultimately “design is a field of transformations concerned with the steps we take to mold our situations (Chimero).” It is a field of testing possibilities, and because products and systems of production and distribution are designed, there is room to test and iterate new ways of serving our material needs that result in less waste. Sterling sees designers acting as “gatekeepers between status quo objects and objects from the time to come.” First we must find a way to frame decay as inherent to an object (Lovett-Baron), and find a way to “enable a graceful ecosystem of creation, decay, and rebirth in a software-infested and thing-saturated world (Lovett-Baron).” By reframing the objective of design and production, there is space for a new conversation to emerge.
How might we use design to reframe systems of production, products, and methods of consumption to create a paradigm of resource stewardship which could protect the biosphere and build more resilient human communities? Using design as a process for intervention to make systems level change is a growing trend. Often touted as “design thinking” or “strategic design,” design has been extrapolated to a series of processes, and is being used to reimagine “cultures of decision-making at the individual and institutional levels, and particularly as applied to what we can think of as the primary problems of the 21st century -- healthcare, education, social services, the broader notion of the welfare state, climate change, sustainability and resilience, steady state economic development, fiscal policy, income equality and poverty, social mobility and equality, immigration and diversity, democratic representation and so on (Hill).” These are lofty goals, and the work is complex and often hard to quantify. I believe more of this work, work that is mired in complexity and undertaken by passionate people over many years, needs to focus on the built world, product design and systems of production. The world of industrial design needs to celebrate systems solutions that tackle waste and environmental impact rather than kickstarter projects that look like they are from a near-future Skymall catalogue. Designers need to make processes and supply chains visible, and invite critique and collaboration. We need to commit to better, more critical educational outcomes, and design social protocols for sharing commodities and resources to keep them out of landfills longer.
Dan Hill calls for shifting systems through designing with the use of a McGuffin, a design project that uses a product or idea at the surface to drive larger change. An example of this is the Fairphone, which on the surface looks like any other smart phone. But the project has larger goals, and is “a social enterprise that is building a movement for fairer electronics (Fairphone).” The creators document where resources are procured from, and the people who assemble them. “[W]e’re opening up the supply chain and creating new relationships between people and their products. We’re making a positive impact across the value chain in mining, design, manufacturing and life cycle, while expanding the market for products that put ethical values first.” The phone is ultimately a small detail in a larger plan to change the way products are made through increased transparency in sourcing and life cycle management. Apple has developed a robot, Liam, for disassembling iPhones, another project that could signal for larger change in ways things are produced. Although the robot can only disassemble a few million units per year, a major producer throwing their weight behind designing for disassembly could increase public awareness around waste in production. These design focused companies are reframing how their production functions, intervening in different parts of the electronics value chain.
We need to accept “[t]he status quo uses archaic forms of energy and materials which are finite and toxic. They wreck the climate, poison the populace and foment resource wars. They have no future (Sterling).” Further, changing the status quo of how resources are used can be framed as a major area of interest for designers working today. Designers need to become explorers, storytellers, detectives, and quiltmakers, reaching down every stretch of the supply chain and reconsider how it all fits together. We need external support structures for designers, engineers, and entrepreneurs who want to create subversive approaches to material culture. Current funding structures value the status quo when it comes to production methods, and this needs to change. Perhaps this is government funded, or private sector looking to extend and outsource R&D to passionate outsiders. These are considerations I intend to research further to uncover possible support structures. “The only way forward is through something we’ve never done, so we run full speed into the great imagined unknown to make this world for one another (Chimero).” The possibility of a future where resources are used in a way that support human communities and protects the biosphere is not possible if things continue on the current trajectory, but our current industrial system is young, and reconfiguring the constituent parts is far from impossible. To continue on, it is inevitable.
There is no reason the believe massive change isn’t possible. We live in a world where myriad everyday realities would have been unimaginable in the past, disposable commodities included. “When radical shifts become the status quo, most forget how and why it happened and come to see that status quo as inevitable and even eternal, though many of its best aspects were the fruit of activism and change (Solnit).” Pushing back against the existing paradigm is the job of the citizen, and I believe designers and makers have a responsibility to shepherd the production of objects into a sustainable future.
We also need to find ways to keep commodities in circulation longer, a practice that I believe can happen by fostering communities rather than focusing on individual consumption. There are several initiatives in Toronto that encourage this kind of behavior that are growing and testing different business models. Bunz Trading Zone originated as a Facebook group for swapping unwanted items, where no currency is allowed to change hands. The group achieved viral success, with tens of thousands of members exchanging objects around the city. The organization received venture capital to develop an app, and is expanding to other cities, while exploring how to create a sustainable business with an idea that excludes the use of money.
The Toronto based Institute for a Resource Based Economy founded the Toronto Tool Library, and recently raised $30 000 to open the Sharing Depot, which they tout as Canada’s first Library Of Things. The organization collects donations of all kinds of material good, children’s toys, sports equipment, party supplies, and houses them to be signed out by community members and borrowed like a library book. As the Sharing Depot's Indiegogo campaign puts it, "Rather than mining virgin raw materials, we must mine the enormous assets that we have lying around our own homes and cities." In the 21st century, waste "should be designed out of the system altogether."
These organizations look to design waste out of the system by connecting people and the material assets they have, rather than turning to stores to buy more goods. In a North American context, “we’re so used to it that for everything that we come to think of as modern, civilized, what every American deserves…all of those things are made possible by creating lots of waste. And if we’re going to have those values, have those beliefs in the home, and the two cars and the perfect commodities, then we have to acknowledge that is a waste-making form of life (Reno).” By working to design communities that are based on different value structures, we can intercept waste and how it relates to our lives. We can then design a social process that helps other people recreate these structures, maintain them, and make them their own.
We can never escape entropy, but we can live in a closer harmony to it, keeping objects until they have truly outlived their use rather than trading up according to fashion or desire. “More than anything else, however, products that are meaningful (that resonate with our values, emotions, and meanings) are often the most satisfying and durable of all (Shedroff).” Until we can live in a world where product lifecycles are circular, and the end of life for a product doesn’t mean the end of useful resource use, the best we can do is form long lasting, meaningful relationships to the things we do own and use.
Not long after I moved into my new apartment, I found a typeset drawer at the side of the road. It’s wide and shallow, made of hardwood with little partitions where letter forms would have been stored. I scraped, sanded and oiled it until some of it’s former glory returned, and built a tiny table with antique legs I’d bought years before. It sits in my kitchen, with tiny treasures tucked away in the partitions. Reminders from friends and jobs, connections to stories larger than the miniature artefacts stowed away. I kept the silver box my uncle gave me, with a seed from Virginia Woolf’s garden, and it lives in the table. I’ve tried my best to remember anything is possible, that the world I live in will not always be the same.
When I returned from China, I brought him back tiny pieces of the world I saw in Shenzhen. A chip from a phone being disassembled on the street, dry oil paint from a pallette in Dafen Oil Painting Village, and a bright pink capacitor made by some of the hackers. I tried to condense all of the stories and all of the places into a few small things and give them meaning. Meaning and functionality can help us hold back the ever encroaching tide of kipple. “[We] can take kipple and distinguish it from itself, endlessly, through categorisation and classification. Far from using things until they run down, humans build new relations, new meanings, carefully and slowly from the mush. New categories produce new things, produce newness (Rourke).” We need to advocate for a new paradigm of material culture, and find meaning in the things we own if we hope to avoid the complete kipplization of the planet. | tomekkorbak/pile-curse-small | OpenWebText2 |
Leprosy-associated neuropathy is triggered by *Mycobacterium leprae* (ML), an obligate intracellular pathogen that invades the host via the upper airways, disseminates hematogenously, and leads to an asymmetrical pattern of infection in peripheral nerves.[@B1] The tropism of ML by peripheral nerves has been initially attributed to its binding to Schwann cells (SC) surface throughout a complex formed by alpha-dystroglycan receptors and the extracellular matrix protein, laminin-α2, associated with the basal lamina of SC.[@B2]
Although ML has been recognised as the causative agent of leprosy for more than a century, pathophysiological mechanisms underlying nerve damage still need further understanding.[@B3] SC supports and myelinates axons and, once infected, ML induces dedifferentiation, proliferation, and reprogramming these glial cells, regulating genes and proteins crucial to neural plasticity that, in turn, lead to demyelination, axonal atrophy and physical disabilities.[@B3]
Neural development, maintenance and repair require a range of molecular key players including the neurotrophin family of growth factors. Neurotrophins are produced by nerves, cells with astroglial differentiation, fibroblasts, and leukocytes. In mammals, four major growth factors have been identified in the neurotrophin family: nerve growth factor (NGF), brain-derived neurotrophic factor (BDNF), neurotrophin-3 (NT-3) and neurotrophin-4 (NT-4).[@B4]
Nerve growth factor (NGF) was the first well-characterised neurotrophin, highlighted by its regulatory functions in differentiated neurons and other neural tissues.[@B5] Interestingly, tissue sources of NGF (and other neurotrophins) in the periphery are typically nonneuronal cells.[@B6] The second neurotrophic factor isolated was brain-derived neurotrophic factor (BDNF), which revealed structural similarity to NGF, leading to the concept of the neurotrophin family.[@B7] Later studies led to the identification of two additional members of this family, namely, neurotrophin-3 (NT-3) and neurotrophin-4 (NT-4).[@B8]
Seminal studies on the role of neurotrophins in leprosy have sought to understand the implication of ML infection on the maintenance of host cells neurotrophic responses.[@B9] ^,^ [@B10] Singh et al. evaluated possible alterations in the expression of NGF and the receptor p75 (p75NTR) after infection of murine SC; these parameters were compared in two mice strains with different responses to the bacillus: Swiss White, as a susceptible strain and C57Bl/6, as a resistant strain.[@B9] The results demonstrated that the production of NGF did not change significantly after infection, while the expression of p75NTR decreased in both strains, suggesting that the neurotrophic loss could occur due to the deficiency of p75NTR instead of the deficiency of the ligand NGF.[@B9]
In contrast, the decrease in endogenous levels of NGF and the TrKA receptor was demonstrated directly in skin lesions of leprosy patients and correlated with nociceptive changes.[@B10] Chan et al. verified that exogenous NGF enhances SC myelination, and the inhibition of NGF in peripheral nerves impairs neuroregeneration after injury, highlighting the role of NGF in leprosy-associated neuropathy.[@B11] Studies evaluating BDNF, and NT3/4 levels during leprosy are remarkably scarce and not updated, but their role in other neuropathy have been explored and allow the speculation on their impact on leprosy. Nerve transection leads to a marked increase in BDNF expression in murine SC, suggesting its role in nerve repair.[@B12] One study demonstrated that BDNF levels tend to be lower in leprosy patients than in healthy individuals, which might reflect how ML-infection triggers the loss of neurotrophic stimulus by BDNF downregulation.[@B13]
The therapeutic implications in neurotrophins regulation on the myelination program of the peripheral nervous system may be extended to demyelinating peripheral neuropathies, including leprosy, and nerve injury.[@B14] Given the significant role of neurotrophins on neural homeostasis and recovery after injury, we aimed to investigate the effect of ML on neurotrophins expression in human SC and mice sciatic nerves to better understand their role in leprosy neuropathy, and aiming to contribute to future therapeutic approaches.
SUBJECTS AND METHODS
====================
*Human* - The participants of the study were selected at the outpatient clinic of Lauro de Souza Lima Institute, São Paulo State Health Secretariat, Bauru, southeastern Brazil. Individuals included were between 18 and 60 years of age, of both sexes, with the indication for surgical amputation due to trauma in the upper or lower limbs. Seven human nerve fragments were collected. Patients with previous peripheral neuropathies were not included in this study. Procedures were under the ethical standards of the Human Ethics Committee of the Lauro de Souza Lima Institute (protocol \# 185/09), and the Helsinki Declaration (1964). All participants were informed about the aims of the study, and the procedures involved. Participants were included after the Informed Consent Form signing.
*Animals* - *In vivo* experiments were conducted in 15 athymic *nude* mice (NU-*Foxn1* ^*nu*^ ), with 60 days old, from the central animal facilities in Lauro de Souza Lima Institute. The death of the animals was induced by an overdose of ketamine 200 mg/kg (Vetnil) and Rompun® 30 mg/kg (Bayer) intraperitoneally. The handling of the experimental animals was under the Ethics Committee on Animal Teaching and Research, from Bauru School of Dentistry, University of São Paulo, Bauru, Brazil (process nº 021/2010).
*Schwann cells culture* - Human nerves were collected in a surgical centre and stored in appropriated transport medium. Each nerve had, on average, 2.5 cm x 0.2 cm x 0.3 cm in its largest dimensions. In the laminar flow hood, the specimens were fragmented with a sterile scalpel, transferred to a conical tube with phosphate-buffered saline (PBS), and centrifuged at 1200 rpm for 5 min, at 4ºC. Fragments were resuspended in Dulbecco's Modified Eagle's Medium (DMEM-High glucose) (Gibco®) with 10% foetal bovine serum (FBS) (Sigma-Aldrich), and supplemented with 10 ng/mL β-heregulin (HRG) (Sigma-Aldrich), 2 μM forskolin (Sigma-Aldrich) and 1% penicillin/streptomycin (Gibco®). Human nerve fragments were kept in explant for seven days, in 5% CO~2~ incubator with 95% humidity, at 37ºC. The specimens were then centrifuged at 1200 rpm for 5 min at 4ºC, resuspended in DMEM-Hg containing 1% penicillin/streptomycin, 0.5 mg/mL collagenase type I and 2.5 mg/mL dispase II (Gibco®), and maintained in a CO~2~ incubator for 24 h. Human SC suspension (hSC) was transferred to DMEM-Hg/10% FBS and centrifuged at 1500 rpm for 10 min at 4ºC. Pellet was resuspended for cell counting and trypan blue viability exclusion. hSC were seeded and expanded up to 80% of confluence in polystyrene 6-well plates, coated with 20 μg/mL laminin (Sigma-Aldrich). After reaching confluence, cell passage was performed, and cell densities were adjusted to 2.5 x 10^4^ cells/cm^2^ in 24-well plates. The experimental groups were then incubated with sonicated ML (sML, Colorado State University, Fort Collins, Colorado, USA) at 10 μg/mL and maintained for 24 and 48 h. The control group was not exposed to sML. After the experimental period, hSC was fixed in 4% paraformaldehyde (PFA) (Sigma-Aldrich), washed in PBS, and stored at -20ºC until evaluation.
*M. leprae* - Mouse infection was conducted after harvesting viable ML (vML) (Thai-53 strain) from serial passages in the footpads of athymic *nude* mice (NU-*Foxn1* ^*nu*^ ), according to the previously described technique.[@B15] Briefly, the animals were inoculated into the plantar surface of both hind footpads with 30 μL of the bacillary suspension containing 1 x 10^7^ bacilli/mL. After four months, the animals were killed and the bacillary suspension was prepared.
*Mouse inoculation* - Inoculation was performed by intradermal injection with 100 μL of vML suspension at 1 x 10^6^ bacilli/mL in the popliteal fossa, near to the sciatic nerve trifurcation, bilaterally. The popliteal fossa was chosen due to the notion that this is an adequate access point for the anesthetic sciatic nerve blockade. An additional 30 μL of the same suspension was inoculated into hind footpads of each mouse. Mice were maintained for eight months (N = 5). Subsequently, mice were killed, and both sciatic nerves collected to the same evaluations conducted in hSC culture. Nerves were fixed in 4% PFA (Sigma-Aldrich) for 15 min and incubated overnight in 30% sucrose at 4ºC, being later prepared for longitudinal cryosections. Sciatic nerves of non-infected nude mice (N = 5) were adopted as controls.
*Antibodies* - Anti-BDNF (1:100, Abcam), anti-NGF (1:250, Millipore), anti-NT-3 (1:100, Millipore), anti-NT-4 (1:100, Millipore), anti-p75NTR (1:100, R&D Systems), anti-S100β (1:1000, Sigma-Aldrich), anti-MPZ (1:100, Abcam) and anti-NF-L (1:100, Dako).
*Immunofluorescence* - Assays were performed in hSC cultures and mouse sciatic nerves. The samples were incubated with primary antibodies overnight, then incubated with anti-mouse or anti-rabbit fluorochrome-conjugated secondary antibodies AlexaFluor 488 and AlexaFluor 594 (1:400, Molecular Probes), for 60 min. Nuclei were stained with 4',6-diamidino-2-phenylindole (DAPI. 1:200, Molecular Probes), and coverslips were mounted with Slow Fade Anti-Fading Kit (Molecular Probes). The image capture was performed in a confocal laser scanning microscope TCS SP5 (Leica, Germany). Image analysis was performed in ImageJ software (National Institutes of Health, USA), in which fluorescence was converted into values of integrated density. In cell culture assays, data of integrated density were normalised by the number of DAPI^+^ nuclei in each field.
*Enzyme-linked immunosorbent assay (ELISA)* - Cell culture supernatants were collected from hSC, treated or not by sML. BDNF analysis was performed by ChemiKine BDNF Sandwich ELISA kit (Millipore, MA, USA), NGF and NT-3 were analysed by Human ELISA Kits (Abcam, MA, USA), according to the manufacturer's recommendations. Briefly, BDNF, NGF and NT-3 assays proceeded as follows: 100 μL of each standard and sample were added into appropriate wells and incubated overnight, at 4ºC. The solution was discarded and wells were rinsed four times with wash solution. Next, it was added 100 μL of biotinylated beta NGF and NT-3 detection antibodies to each well and incubated for 1 h at room temperature (RT). After solution discard, 100 μL of HRP-Streptavidin was added and incubated for 45 min, at RT. Following new washes and discard, 100 μL of TMB was added and incubated for 30 min, at RT in the dark. Finally, 50 μL of stop solution was added to each well. Optical density (OD) was analysed at 450 nm immediately. All samples were analysed in duplicate. NT-4 detection was not performed because the concentration of this neurotrophin is pretty low in serum/plasma, and may not be detected in this assay.
*RNA Extraction* - Specimens from hSC culture were suspended in Trizol (Invitrogen, USA). Subsequently, 0.2 mL of chloroform was added to each mL of suspension. The samples were centrifuged and the aqueous phase transferred to a new tube, to which the same volume of isopropanol was added. The tubes were centrifuged again, the precipitate was washed in 100% ethanol, and dried at room temperature. The RNA samples were suspended in deionised water, free of RNAse, and stored at -80ºC. An aliquot was used to obtain RNA/μL concentration in each specimen. The complementary DNA (cDNA) was synthesised through a reverse transcription reaction using 1 μg of RNA.
*Reverse transcription-polymerase chain reaction (RT-PCR)* - Quantification of mRNA transcribed from BDNF, NGF and NT-3 genes was carried out with TaqMan-type assays (Applied Biosystems), according to the protocol for the Step One Plus equipment (Applied Biosystems). The analysis of neurotrophins expression by RT-PCR was performed by relative quantification, using GAPDH as the endogenous control.
*Statistical analysis* - Results were analysed in GraphPad Prism 7.04 (GraphPad Software Inc., USA). Shapiro-Wilk normality test was applied to determine the choice of parametric or non-parametric evaluations. Unpaired t-test with Welch's correction was applied for two-group comparisons. When more than two groups were compared, Kruskal-Wallis test with Dunn's multiple comparisons test was performed. P values \< 0.05 were considered as the cutoff for significance.
RESULTS
=======
*Characterisation of Schwann cells and sciatic nerves* - First, hSC were immunophenotypically characterised, and the presence of possible perineural fibroblasts, considered as contaminants, was quantified. The purity of the hSC culture was verified by the ratio between S100β^+^/DAPI^+^ cells (SC) *versus* S100β^-^/DAPI^+^ cells (non-glial cells) ([Fig. 1](#f1){ref-type="fig"}A-D). Non-glial cells were approximately 12% ([Fig. 1](#f1){ref-type="fig"}E), and there was no difference between control (CTRL) and sML-treated cells. Thereby, treatment with sML for 24 and 48 h does not seem to affect hSC immunophenotypically. Sciatic nerves were characterised by S100β, NF-L, and MPZ positive immunostaining ([Fig. 2](#f2){ref-type="fig"}A-I). Non-infected (NI) and vML-infected nerves were compared. The immunodetection of S100β was higher in the vML group than NI ([Fig. 2](#f2){ref-type="fig"}B-C), whereas NF-L was lower in vML ([Fig. 2](#f2){ref-type="fig"}E-F), compared with the NI group. No significant differences were observed regarding MPZ immunodetection ([Fig. 2](#f2){ref-type="fig"}G-I).
Fig. 1:immunophenotypic characterisation of human Schwann cells. Cells were obtained from healthy donors and cultivated for 24 and 48 h alone (CTRL) or in the presence of sonicated *Mycobacterium leprae* (sML). (A-D) Confocal microscopy showing immunodetection of S100β protein (red, AlexaFluor 594, Molecular Probes) and nuclear staining by DAPI (blue). Scale bar = 20 µm. (E) Graph shows the mean of the percentage of S100β^+^/DAPI^+^ cells.
Fig. 2:immunophenotypic characterisation of mouse sciatic nerves. Sciatic nerves were resected from healthy nude mice non-infected (NI) or mice inoculated with viable *Mycobacterium leprae* (vML) during eight months. Nerves were cryopreserved and incubated with the following primary antibodies and corresponding secondary antibodies: S100β (green, AlexaFluor 488, Molecular Probes); NF-L (green, AlexaFluor 488, Molecular Probes), and MPZ (red, AlexaFluor 594, Molecular Probes). Confocal images illustrate fluorescent detection of S100β (A-B), NF-L (D-E) and MPZ (G-H). Scale bar = 20 µm. (C, F, I) Graphs showing scatter plots with mean values, obtained from unpaired t-test with Welch's correction. \*p \< 0.05. Each dot in scatter plots represents nerve fragments, one per animal. Immunofluorescence was performed in 3-6, and 4-9 nerve fragments in NI and vML-infected mice, respectively.
*sML treatment decreases BDNF and NT-4 in human Schwann cells in vitro* - Next, we pursue to evaluate the effects of sML treatment on neurotrophins expression and production in hSC culture by immunofluorescence, ELISA and RT-PCR. Although sML treatment did not affect the expression of BDNF in the first 24 h ([Fig. 3](#f3){ref-type="fig"}A-D), after 48 h BDNF was significantly decreased in sML-treated hSC, compared to CTRL ([Fig. 3](#f3){ref-type="fig"}E-H). sML had no expressive effects on the expression of NGF ([Fig. 4](#f4){ref-type="fig"}), neither on NT-3 ([Fig. 5](#f5){ref-type="fig"}) in both periods analysed, 24 and 48 h. Similar to BDNF, the expression of the NT-4 was not affected by sML in the early period ([Fig. 6](#f6){ref-type="fig"}A-D); however, sML-treated hSC had a significant decrease in NT-4 expression after 48 h of culture, compared with CTRL ([Fig. 6](#f6){ref-type="fig"}E-H). The secretion of BDNF, NGF and NT-3 was analysed in hSC culture supernatants, stimulated or not by sML, after 8, 12 and 24 h. ELISA results retrieved low concentrations of NT-3, below the standard curve ([Fig. 5](#f5){ref-type="fig"}J). The interpolated values of BDNF ([Fig. 3](#f3){ref-type="fig"}J) and NGF ([Fig. 4](#f4){ref-type="fig"}J), indicated a trend to decay in sML groups compared to controls, although without significant differences. Neurotrophins mRNA expression was also investigated in unstimulated *versus* sML-treated hSC culture, after 08 and 12 h. The analysis was performed by the relative standard curve method, in which the endogenous control was GAPDH. BDNF ([Fig. 3](#f3){ref-type="fig"}K) and NGF ([Fig. 4](#f4){ref-type="fig"}K) presented a trend to decrease in sML-treated cells, compared to controls. On the other hand, NT-3 demonstrated a discrete increase at 12 h, in sML-treated cells *versus* controls ([Fig. 5](#f5){ref-type="fig"}K).
Fig. 3:BDNF in human Schwann cells (hSC). Confocal microscopy of BDNF immunodetection (red, AlexaFluor 594, Molecular Probes) and nuclear labeling by DAPI (blue, Molecular Probes) in hSC culture, treated or not with sonicated *Mycobacterium leprae* (sML, 10 µg/mL) for (A-D) 24 and (E-H) 48 h. Scale bar = 20 µm. (I) Graph illustrates the fluorescence intensity of BDNF in hSC, shown as scatter plots with means, from unpaired t-test with Welch's correction. \*\* p \< 0.01. (J) The secretion of BDNF is shown in the graph of hSC culture supernatants treated by sML for 08, 12 and 24 h. BDNF concentration (pg/mL) was retrieved from four independent assays. Kruskal-Wallis test with Dunn's multiple comparisons test (p \> 0.05), line at the median. (K) BDNF mRNA expression, normalised by GAPDH, is graphically demonstrated in unstimulated (CTRL) and sML-treated hSC, after 08 and 12 h. Reverse transcription-polymerase chain reaction (RT-PCR) results from two independent assays. Kruskal-Wallis test with Dunn's multiple comparisons test (p \> 0.05), line at the median.
Fig. 4:NGF in human Schwann cells (hSC). Confocal microscopy of NGF immunodetection (green, AlexaFluor 488, Molecular Probes) and nuclear labeling by DAPI (blue, Molecular Probes) in hSC culture treated or not with sonicated *Mycobacterium leprae* (sML, 10 µg/mL) for (A-D) 24 and (E-H) 48 h. Scale bar = 20 µm. (I) Graph illustrates the fluorescence intensity of NGF in hSC, shown as scatter plots with means, from unpaired t-test with Welch's correction. (J) The secretion of NGF is shown in graphs of hSC culture supernatants treated by sML for 08 and 12 h. NGF concentration (pg/mL) was retrieved from two independent assays. Kruskal-Wallis test with Dunn's multiple comparisons test (p \> 0.05), line at the median. (K) NGF mRNA expression, normalised by GAPDH, is graphically demonstrated in unstimulated (CTRL) and sML-treated hSC, after 08 and 12 h. Reverse transcription-polymerase chain reaction (RT-PCR) results from two independent assays. Kruskal-Wallis test with Dunn's multiple comparisons test (p \> 0.05), line at the median.
Fig. 5:NT-3 in human Schwann cells (hSC). Confocal microscopy of NT-3 immunodetection (green, AlexaFluor 488, Molecular Probes) and nuclear labeling by DAPI (blue, Molecular Probes) in hSC culture treated or not with sonicated *Mycobacterium leprae* (sML, 10 µg/mL) for (A-D) 24 and (E-H) 48 h. Scale bar = 20 µm. (I) Graph illustrates the fluorescence intensity of NT-3 in hSC, shown as scatter plots with means, from unpaired t-test with Welch's correction. (J) NT-3 mRNA expression, normalised by GAPDH, is graphically demonstrated in unstimulated (CTRL) and sML-treated hSC, after 08 and 12 h. Reverse transcription-polymerase chain reaction (RT-PCR) results from two independent assays. Kruskal-Wallis test with Dunn's multiple comparisons test (p \> 0.05), line at the median.
Fig. 6:NT-4 in human Schwann cells (hSC). Confocal microscopy of NT-4 immunodetection (green, AlexaFluor 488, Molecular Probes) and nuclear labeling by DAPI (blue, Molecular Probes) in hSC culture treated or not with sonicated *Mycobacterium leprae* (sML, 10 µg/mL) for (A-D) 24 and (E-H) 48 h. Scale bar = 20 µm. (I) Graph illustrates the fluorescence intensity of NT-4 in hSC, shown as scatter plots with means, from unpaired t-test with Welch's correction. \* p \< 0.05.
*NT-3 is increased in mouse sciatic nerves after vML infection* - Finally, we evaluated by immunofluorescence the expression of neurotrophins *in vivo*, in athymic nude mice ([Fig. 7](#f7){ref-type="fig"}). Three neurotrophins, BNDF, NGF, and NT-4, displayed a discreet decrease in their expression on vML-infected mice, compared with NI ([Fig. 7](#f7){ref-type="fig"}A-F, J-L). However, NT-3 expression was significantly higher in vML-infected mice than NI animals ([Fig. 7](#f7){ref-type="fig"}G-I).
Fig. 7:neurotrophins expression in mouse sciatic nerves. Confocal images and respective graphs illustrating the immunodetection of (A-C) BDNF (red, AlexaFluor 594, Molecular Probes), (D-F) NGF (green, AlexaFluor 488, Molecular Probes), (G-I) NT-3 (green, AlexaFluor 488, Molecular Probes), and (J-L) NT-4 (green, AlexaFluor 488, Molecular Probes) in uninfected (NI) and viable ML-infected mice (vML. 1 x 10^6^ bacilli/mL) over eight months. Scale bar = 20 µm. Graphs are shown as scatter plots with mean (C, F, I) and medians (L), from unpaired t-test with Welch's correction and Mann Whitney test, respectively. \*\*\* p \< 0.005. Each dot in scatter plots represents nerve fragments, one per animal. Immunofluorescence was performed in 3-5, and 6-10 nerve fragments in NI and vML-infected mice, respectively.
DISCUSSION
==========
Progressive demyelination in nerves infected by ML has been previously verified *in vivo* and *in vitro.* Glial pathology is a leprosy feature shared by other peripheral neuropathies, such as Guillain-Barré and Charcot-Marie-Tooth syndromes, multiple sclerosis, and chronic nerve compression injury.[@B16] Likewise, the idea of demyelination as a pathological manifestation, rather than the etiology of nerve injury, has gained traction among some of the peripheral neuropathies, being currently discussed in leprosy.[@B17] Multiple neurotrophin-related signaling pathways are involved in nerve damage and repair and the role of neurotrophins in leprosy have already been approached, mainly regarding two neurotrophins, NGF and BDNF.[@B18] ^,^ [@B19] To our knowledge, this is the first study that describes the effects of ML on the expression of all four members of the neurotrophin family ― NGF, NT-3, NT-4, BDNF ― in hSC culture, as well as in sciatic nerves of athymic nude mice. Here we demonstrated a trend to decline in NGF and BDNF mRNA expression in ML-treated hSC, compared to controls. The immunodetection of BDNF and NT-4 was significantly downregulated in ML-treated hSC. Conversely, ML-infected mice demonstrated significant upregulation of NT-3, compared to non-infected animals. Our findings indicate that ML may be involved in neurotrophins regulation.
Before *in vitro* experiments, part of the hSC was submitted to immunophenotypic characterisation by S100β immunostaining, along with the identification of perineural fibroblasts. It was noted that the non-glial contaminating cells composed approximately 12% of the cultivated cells; though, a 5% maximum is preferred. To improve hSC culture purification, cell sorting techniques should be applied, such as magnetic sorting or fluorescence-activated cell sorting (FACS). Yet, we considered 12% an acceptable value for this kind of cell culture. Morphologically, hSC culture maintained typical tripolar or fusiform patterns, and the detection of S100β did not show significant differences when ML-treated hSC was compared to controls. Mice ML-infection resulted in increased immunostaining for S100β and a decrease of the axonal marker, NF-L. S100β is a well-established SC marker.[@B20] Since remyelination depends upon the proliferation, migration, and differentiation of SC, S100β increase observed in our animal model, might reflect an attempt to revert the infection injury due to ML by increasing the presence of SC.[@B21] On the other hand, the immunodetection of NF-L is axon-dependent thereby being downregulated during axonal atrophy.[@B22]
The relevance of BDNF in peripheral nerve injury and neuropathic pain was highlighted in studies on diabetic peripheral neuropathy.[@B23] The decreased in serum levels of BDNF and NGF has been demonstrated in patients with diabetic peripheral neuropathy, suggesting that multiple deficits in these neurotrophic factors could precede clinically the detectable nerve dysfunction.[@B23]
The decreased of cytoplasmic expression and secretion of BDNF in hSC treated with sML could be associated with a declined neurotrophic and immunomodulatory character of hSC, hampering the tissue integrity. The neuroprotective role of SC-derived BDNF was demonstrated by Hou et al. study, in which BDNF-enriched SC enhanced *in vitro* its proliferative and secretory functions.[@B24] The authors also have shown that, in an animal model of nerve damage, the transplantation of BDNF-enriched SC to the injury sites was able to reduce the inflammatory process and promoted neural repair.[@B24] In our study, the decrease of BDNF in nude mice infected by vML for eight months, suggests that the availability of these growth factors become deficient in the long turn, failing to sustain the plasticity of peripheral nerves affected by leprosy.
Successful nerve regeneration requires axon regrowth and remyelination, and neurotrophins have a central role in supporting SC migration and myelination.[@B25] Yin et al. have shown that NT-4 delivery increases the expression of myelin-associated glycoprotein (MAG) in SC, contributing to the functional recovery in the murine model of sciatic nerve transection.[@B26] Additionally, the downregulation of NT-4 in experimental diabetes seems to be involved in the development and maintenance of diabetic neuropathy.[@B27] Rodríguez-Peña et al. demonstrated that the expression of NT-4 was decreased to 29%, after 12 weeks of streptozotocin-induced diabetes in rat sciatic nerves.[@B27] In accordance, the reduction of NT-4 in sML-treated hSC verified in our study suggests a possible role of this neurotrophin in SC function and leprosy neuropathy. To our knowledge, the present findings regarding NT-4 in sML-treated hSC are demonstrated for the first time.
Regardless of our *in vitro* evidence on neurotrophins regulation in sML-treated hSC, we faced sample size limitations due to the restricted availability of human nerve fragments. To corroborate our present findings, we judge opportune to replicate our experiments with a larger number of specimens. To overcome the sample size issue, an alternative source of hSC could come from glial cells differentiated from human hair follicles and dermis.[@B28] ^,^ [@B29]
Our *in vivo* data revealed that the expression of NT-3 was significantly higher in vML-infected mice than non-infected animals, an opposite result to the other neurotrophins evaluated here. Previous pieces of evidence from animal models of peripheral neuropathy depicts the effects of NT-3 on myelination.[@B14] ^,^ [@B30] Liu et al. investigated the role of the NT3-TrkC pathway in myelination of Trembler-J mouse, a model of Charcot-Marie Tooth 1A (CMT1A), and observed that the injection of NT-3 decreased the myelin protein zero (P0) level in sciatic nerves.[@B30] Chan et al. demonstrated *in vitro* and *in vivo*, that the addition of exogenous NT-3 inhibited myelin formation and the removal of the endogenous NT-3 enhanced myelination.[@B14]
The *in vivo* infection in our study was performed in sciatic nerves through inoculation of vML (1 x 10^6^ bacilli/mL) inside the popliteal fossa, near to the sciatic nerve trifurcation, and into hind footpads of each mouse. Our purpose was to allow bacillary traffic to endoneurial space, without forcing it inside the neural environment. However, after eight months post-inoculation solely perineural infection has been achieved (data not shown). Still, our data indicate a possible upregulation of NT-3 in vML-infected mice, suggesting that NT-3 could contribute to demyelination during ML infection. Future *in vivo* studies, designed with inoculation of ML directly into the endoneurial environment of murine sciatic nerves, could bring additional understanding to the early neural response to this pathogen in the regulation of neurotrophic factors.
Taken together, our findings indicate that ML may be involved in neurotrophins regulation, *in vitro* and *in vivo*, suggesting that a pathogen-related imbalance of these growth factors may have a role in the neural impairment of leprosy, reinforcing the need of further investigations.
To the patients for consenting to participate in this study. We thank Nelci Ana Vieira and Osmar de Abreu Francisco for the technical support (Laboratory of Pathology, Lauro de Souza Lima Institute, Bauru, SP, Brazil). We also thank Márcia Sirlene Zardin Graeff for confocal images acquisition (Bauru School of Dentistry, University of São Paulo, Brazil).
Financial support: FAPESP (grant \#2010/00146-7).
[^1]: MRN - Conceptualisation, data curation, formal analysis, funding acquisition, investigation, methodology, project administration, resources, supervision, validation, visualisation, writing - original draft, writing - review and editing; NA - investigation, validation, writing - original draft, writing - review and editing; LM - formal analysis, investigation and visualisation; MCF and PR - resources; ACL and RML - investigation; LR - investigation and review; FL - conceptualisation, investigation and methodology; MCP - conceptualisation, methodology, resources, supervision and review.
| tomekkorbak/pile-curse-small | PubMed Central |
Q:
ASP.NET + Entity Framework - handling intermittent traffic spikes
I have an MVC and WebAPI application that needs to log activities performed by the users back to my database. This is almost always a single insert into a table that have less than 5 columns (i.e. very little data is crossing the wire). The data interface that I am currently using is Entity Framework 6
Every once in a while, I'll get a large number of users needing to log that they performed a single activity. In this case, "Large Number" could be a couple hundred requests every second. This typically will only last for a few minutes at most. The rest of the time, I see very manageable traffic to the site.
When the traffic spikes, Some of my clients are getting timeout errors because the page doesn't finish loading until the server has inserted the data into the database. Now, the actual inserting of the data into the database isn't necessary for the user to continue on using the application, so I can cache these requests somewhere locally, and then batch insert them later.
Is there any good solutions for ASP.NET MVC to buffer incoming request data and then batch insert them into the database every few seconds?
As for my environment, I have several servers running Server 2012 R2 in a load balanced Web Farm. I would prefer to stay stateless if at all possible, because users might hit different servers per request.
A:
When the traffic spikes, Some of my clients are getting timeout errors because the page doesn't finish loading until the server has inserted the data into the database.
I would suggest using a message queue. Have the website rendering code simply post an object to the queue representing the action, and have a separate process (e.g. Windows Service) read off the queue and write to the database using Entity Framework.
UPDATE
Alternatively you could log access to a file (fast), and have a separate process read the file and write the information into your database.
I prefer the message queue option, but it does add another piece of architecture.
| tomekkorbak/pile-curse-small | StackExchange |
Got Science?https://soundcloud.com/gotscience
Tue, 26 May 2020 17:59:11 +0000Tue, 26 May 2020 17:59:11 +000060enAll rights [email protected] (SoundCloud Feeds)Get your science on with the new podcast from the Union of Concerned Scientists. Our hosts take on technology, attacks on science, climate change, and more, as they channel the power of science to make the world a better place.Get your science on with the new podcast from the…Got [email protected] of Concerned Scientistsnohttps://i1.sndcdn.com/avatars-000285102999-n3q74n-original.jpgGot Science?https://soundcloud.com/gotscience
tag:soundcloud,2010:tracks/828557491Ep. 85: How Will COVID-19 Impact Clean Energy Progress?Tue, 26 May 2020 18:02:03 +0000https://soundcloud.com/gotscience/ep-85-how-will-covid-19-impact-clean-energy-progress
00:27:30Union of Concerned ScientistsnoRenewable energy expert John Rogers is back on the podcast to talk about COVID-19 is affecting clean energy jobs, and how we can create a stronger, healthier clean energy economy for everyone.Renewable energy expert John Rogers is back on th…Renewable energy expert John Rogers is back on the podcast to talk about COVID-19 is affecting clean energy jobs, and how we can create a stronger, healthier clean energy economy for everyone.tag:soundcloud,2010:tracks/828556879Ep. 6: ¿Cómo afectará COVID-19 al progreso en la energía limpia?Tue, 26 May 2020 18:00:23 +0000https://soundcloud.com/gotscience/como-afectara-covid-19-al-progreso-en-la-energia-limpia
00:28:58Union of Concerned ScientistsnoJohn Rogers, experto en energía, regresa al podcast para hablar de impactos de la crisis creada por COVID-19 en el sector de energía limpia, y cómo creamos una economía más fuerte y sana para todos.John Rogers, experto en energía, regresa al podca…John Rogers, experto en energía, regresa al podcast para hablar de impactos de la crisis creada por COVID-19 en el sector de energía limpia, y cómo creamos una economía más fuerte y sana para todos.tag:soundcloud,2010:tracks/819020377Ep. 84: Sidelining Science During a PandemicTue, 12 May 2020 18:00:23 +0000https://soundcloud.com/gotscience/ep-84-sidelining-science-during-a-pandemic
00:28:55Union of Concerned ScientistsnoScience policy expert Michael Halpern exposes how the Trump administration is unraveling health and safety standards during COVID-19.Science policy expert Michael Halpern exposes how…Science policy expert Michael Halpern exposes how the Trump administration is unraveling health and safety standards during COVID-19.tag:soundcloud,2010:tracks/809091439Ep. 83: Reopening with COVID-19: Why Social Distancing, Contact Tracing, and Herd Immunity MatterTue, 28 Apr 2020 18:00:28 +0000https://soundcloud.com/gotscience/ep-83-reopening-with-covid-19-why-social-distancing-contact-tracing-and-herd-immunity-matter
00:28:31Union of Concerned ScientistsnoInfectious disease epidemiologist Dr. Beth Linas discusses how we move forward after flattening the curve of the coronavirus.Infectious disease epidemiologist Dr. Beth Linas …Infectious disease epidemiologist Dr. Beth Linas discusses how we move forward after flattening the curve of the coronavirus.tag:soundcloud,2010:tracks/798628336Ep. 82: When Floods and Coronavirus Collide: Dealing With a Disaster During a PandemicTue, 14 Apr 2020 19:06:50 +0000https://soundcloud.com/gotscience/ep-82-when-floods-and-coronavirus-collide-dealing-with-a-disaster-during-a-pandemic
00:28:27Union of Concerned ScientistsnoDr. Kristy Dahl reviews NOAA spring flooding and maps the potential collision with COVID-19.Dr. Kristy Dahl reviews NOAA spring flooding and …Dr. Kristy Dahl reviews NOAA spring flooding and maps the potential collision with COVID-19.tag:soundcloud,2010:tracks/798699196Ep. 5: ¿Podemos lidiar con desastres naturales durante una pandemia?Tue, 14 Apr 2020 19:06:33 +0000https://soundcloud.com/gotscience/podemos-lidiar-con-desastres-naturales-durante-una-pandemia
00:23:36Union of Concerned ScientistsnoEl Dr. Juan Declet-Barreto analiza los datos de NOAA y mapea una posible colisión entre las inundaciones que veremos este año con la pandemia del COVID-19El Dr. Juan Declet-Barreto analiza los datos de N…El Dr. Juan Declet-Barreto analiza los datos de NOAA y mapea una posible colisión entre las inundaciones que veremos este año con la pandemia del COVID-19tag:soundcloud,2010:tracks/787743454Ep. 81: Understanding Vaccines During COVID-19Tue, 31 Mar 2020 18:00:33 +0000https://soundcloud.com/gotscience/ep-81-understanding-vaccines-during-covid-19
00:28:38Union of Concerned ScientistsnoDr. Jo Anne Welsch, currently working on vaccine development for low and middle income countries at a global health organization, discusses how vaccines are developed and tested, and the implications of the process for the coronavirus.Dr. Jo Anne Welsch, currently working on vaccine …Dr. Jo Anne Welsch, currently working on vaccine development for low and middle income countries at a global health organization, discusses how vaccines are developed and tested, and the implications of the process for the coronavirus.tag:soundcloud,2010:tracks/777720919Ep. 80: How Will Climate Change Affect Island Nations? An Expert Weighs inTue, 17 Mar 2020 18:00:18 +0000https://soundcloud.com/gotscience/ep-80-how-will-climate-change-affect-island-nations-an-expert-weighs-in
00:28:30Union of Concerned ScientistsnoDr. Kim Waddell, a biologist living in the Caribbean, discusses threats and responses to climate change.Dr. Kim Waddell, a biologist living in the Caribb…Dr. Kim Waddell, a biologist living in the Caribbean, discusses threats and responses to climate change.tag:soundcloud,2010:tracks/770225635Ep. 79: Are Uber and Lyft Rides Bad for the Climate?Tue, 03 Mar 2020 19:00:10 +0000https://soundcloud.com/gotscience/ep-79-are-uber-and-lyft-rides-bad-for-the-climate
00:28:30Union of Concerned ScientistsnoTransportation expert Don Anair discusses why ride-hailing is a problem for the climate, and what we can do about it.Transportation expert Don Anair discusses why rid…Transportation expert Don Anair discusses why ride-hailing is a problem for the climate, and what we can do about it.tag:soundcloud,2010:tracks/762804709Ep. 78: Five Ways to Start a Nuclear WarTue, 18 Feb 2020 18:59:22 +0000https://soundcloud.com/gotscience/ep-78-five-ways-to-start-a-nuclear-war
00:28:24Union of Concerned ScientistsnoPhysicist David Wright discusses the nuclear weapons policies and scenarios that threaten our safety, and how to mitigate those risks.Physicist David Wright discusses the nuclear weap…Physicist David Wright discusses the nuclear weapons policies and scenarios that threaten our safety, and how to mitigate those risks.tag:soundcloud,2010:tracks/754402936Ep. 77: This is What Climate Change Looks Like: Wildfires in AustraliaTue, 04 Feb 2020 19:00:00 +0000https://soundcloud.com/gotscience/ep-77-this-is-what-climate-change-looks-like-wildfires-in-australia
00:28:30Union of Concerned ScientistsnoClimate scientist and educator Dr. Mel Fitzpatrick dissects Australia's wildfires and explores how climate change has made them more catastrophic.Climate scientist and educator Dr. Mel Fitzpatric…Climate scientist and educator Dr. Mel Fitzpatrick dissects Australia's wildfires and explores how climate change has made them more catastrophic.tag:soundcloud,2010:tracks/747172249Ep. 76: When Science is Neglected, Who’s Hurt Most?Tue, 21 Jan 2020 19:00:10 +0000https://soundcloud.com/gotscience/ep-76-when-science-is-neglected-whos-hurt-most
00:28:00Union of Concerned ScientistsnoResearch scientist Anita Desikan digs into the data to uncover the communities most at risk from the Trump administration ignoring science.Research scientist Anita Desikan digs into the da…Research scientist Anita Desikan digs into the data to uncover the communities most at risk from the Trump administration ignoring science.tag:soundcloud,2010:tracks/739796278Ep. 75: Rush Hour In Orbit: The Science (and Politics) of Keeping Satellites SafeTue, 07 Jan 2020 18:59:48 +0000https://soundcloud.com/gotscience/ep-75-rush-hour-in-orbit-the-science-and-politics-of-keeping-satellites-safe
00:28:59Union of Concerned ScientistsnoPhysicist and global security expert Dr. Laura Grego fills us in on the past, present, and future of satellites.Physicist and global security expert Dr. Laura Gr…Physicist and global security expert Dr. Laura Grego fills us in on the past, present, and future of satellites.tag:soundcloud,2010:tracks/729590020Ep. 74: As Carbon Emissions Rise, Rice Nutrition FallsTue, 17 Dec 2019 19:00:23 +0000https://soundcloud.com/gotscience/ep-74-as-carbon-emissions-rise-rice-nutrition-falls
00:28:59Union of Concerned ScientistsnoFormer USDA senior scientist Lewis Ziska discusses his research on rice and carbon dioxide – and how the Trump USDA suppressed his findings.Former USDA senior scientist Lewis Ziska discusse…Former USDA senior scientist Lewis Ziska discusses his research on rice and carbon dioxide – and how the Trump USDA suppressed his findings.tag:soundcloud,2010:tracks/722221537Ep. 73: How “Evidence-Based” Became a Dirty WordTue, 03 Dec 2019 19:00:13 +0000https://soundcloud.com/gotscience/ep-73-how-evidence-based-became-a-dirty-word
00:28:30Union of Concerned ScientistsnoDr. Jacob Carter explores the consequences of the Trump administration’s attacks on science.Dr. Jacob Carter explores the consequences of the…Dr. Jacob Carter explores the consequences of the Trump administration’s attacks on science.tag:soundcloud,2010:tracks/715485676Ep. 72: Coal Plants, Turn the Power Off and You’ll Make More MoneyTue, 19 Nov 2019 19:00:45 +0000https://soundcloud.com/gotscience/ep-72-coal-plants-turn-the-power-off-and-youll-make-more-money
00:28:58Union of Concerned ScientistsnoEnergy analyst Joe Daniel explains why seasonal shutdowns can save utilities, and customers, money.Energy analyst Joe Daniel explains why seasonal s…Energy analyst Joe Daniel explains why seasonal shutdowns can save utilities, and customers, money.tag:soundcloud,2010:tracks/707889295Ep. 71: Stressed-Out Fish and Ocean Acidification: Consequences of Climate ChangeTue, 05 Nov 2019 19:00:02 +0000https://soundcloud.com/gotscience/ep-71-stressed-out-fish-and-ocean-acidification-consequences-of-climate-change
00:28:30Union of Concerned ScientistsnoDr. Sarah Cooley explains how changes in ocean chemistry are having a ripple effect on sea life and our economy.Dr. Sarah Cooley explains how changes in ocean ch…Dr. Sarah Cooley explains how changes in ocean chemistry are having a ripple effect on sea life and our economy.tag:soundcloud,2010:tracks/700165273Ep. 70: Why Trust Science? with Author Naomi OreskesTue, 22 Oct 2019 18:00:12 +0000https://soundcloud.com/gotscience/ep-70-why-trust-science-with-author-naomi-oreskes
00:28:59Union of Concerned ScientistsnoScience Historian Naomi Oreskes explains why science's social character makes it trustworthy, and what we can learn from science's past.Science Historian Naomi Oreskes explains why scie…Science Historian Naomi Oreskes explains why science's social character makes it trustworthy, and what we can learn from science's past.tag:soundcloud,2010:tracks/692840947Ep. 69: From H-Bomb to iPhone: A Scientist’s JourneyTue, 08 Oct 2019 18:00:30 +0000https://soundcloud.com/gotscience/ep-69-from-h-bomb-to-the-iphone-a-scientists-journey
00:28:39Union of Concerned ScientistsnoDr. Dick Garwin, recipient of the Presidential Medal of Freedom, discusses his work developing the hydrogen bomb, GPS, and touch screens, as well as his advocacy for arms controlDr. Dick Garwin, recipient of the Presidential Me…Dr. Dick Garwin, recipient of the Presidential Medal of Freedom, discusses his work developing the hydrogen bomb, GPS, and touch screens, as well as his advocacy for arms controltag:soundcloud,2010:tracks/686163028Ep. 68: Scaling Mountains to Ban Toxic Chemicals in PajamasTue, 24 Sep 2019 18:00:25 +0000https://soundcloud.com/gotscience/ep-68-scaling-mountains-to-ban-toxic-chemicals-in-pajamas
00:28:04Union of Concerned ScientistsnoScientist and adventurer Dr. Arlene Blum discusses her research on cancer-causing chemicals in kid’s pajamas in the 70s and chemical safety today.Scientist and adventurer Dr. Arlene Blum discusse…Scientist and adventurer Dr. Arlene Blum discusses her research on cancer-causing chemicals in kid’s pajamas in the 70s and chemical safety today.tag:soundcloud,2010:tracks/679175898Ep. 67: Champions of Breakfast: How Cereal Companies Can Take a Bite Out of Climate ChangeTue, 10 Sep 2019 18:00:15 +0000https://soundcloud.com/gotscience/ep-67-champions-of-breakfast-how-cereal-companies-can-take-a-bite-out-of-climate-change
00:28:48Union of Concerned ScientistsnoAnalyst Karen Perry Stillerman discusses how cereal makers can help farmers improve soil health, prevent water pollution, and reduce the climate impact of our agricultural system.Analyst Karen Perry Stillerman discusses how cere…Analyst Karen Perry Stillerman discusses how cereal makers can help farmers improve soil health, prevent water pollution, and reduce the climate impact of our agricultural system.tag:soundcloud,2010:tracks/671805869Ep. 66: HBO’s Chernobyl Sparks Questions About US Nuclear Power SafetyTue, 27 Aug 2019 18:00:26 +0000https://soundcloud.com/gotscience/ep-66-hbos-chernobyl-sparks-questions-about-us-nuclear-power-safety
00:27:31Union of Concerned ScientistsnoPhysicist Ed Lyman discusses new safety threats to US nuclear reactors and why risks here are different than in Russia.Physicist Ed Lyman discusses new safety threats t…Physicist Ed Lyman discusses new safety threats to US nuclear reactors and why risks here are different than in Russia.tag:soundcloud,2010:tracks/665294984Ep. 65: Keeping the Power On During a Climate CrisisTue, 13 Aug 2019 18:25:02 +0000https://soundcloud.com/gotscience/ep-65-keeping-the-power-on-during-a-climate-crisis
00:28:36Union of Concerned ScientistsnoHow do electricity grid operators make sure there’s always enough energy to meet demand? Energy expert Julie McNamara reveals the painfully wasteful answer.How do electricity grid operators make sure there…How do electricity grid operators make sure there’s always enough energy to meet demand? Energy expert Julie McNamara reveals the painfully wasteful answer.tag:soundcloud,2010:tracks/658621751Ep. 64: Baked Alaska: Fighting Forest Fires on the Last FrontierTue, 30 Jul 2019 18:00:15 +0000https://soundcloud.com/gotscience/ep-64-baked-alaska-fighting-forest-fires-on-the-last-frontier
00:28:30Union of Concerned ScientistsnoDr. Carly Phillips, a climate scientist and fellow at the Union of Concerned Scientists, explains how climate change is turning Alaska into a tinderbox, and what to do about it.Dr. Carly Phillips, a climate scientist and fello…Dr. Carly Phillips, a climate scientist and fellow at the Union of Concerned Scientists, explains how climate change is turning Alaska into a tinderbox, and what to do about it.tag:soundcloud,2010:tracks/651818087Ep. 63: Killer Heat in the United StatesTue, 16 Jul 2019 07:51:41 +0000https://soundcloud.com/gotscience/ep-63-killer-heat-in-the-united-states
00:28:24Union of Concerned ScientistsnoClimate scientist Kristy Dahl explains off-the-charts deadly heat, just how bad it could get, and what we can do to avert the worst-case scenario.Climate scientist Kristy Dahl explains off-the-ch…Climate scientist Kristy Dahl explains off-the-charts deadly heat, just how bad it could get, and what we can do to avert the worst-case scenario.tag:soundcloud,2010:tracks/645294894Ep. 62: Clean Energy Momentum: From Goals to GigawattsTue, 02 Jul 2019 19:41:53 +0000https://soundcloud.com/gotscience/ep-62-clean-energy-momentum-from-goals-to-gigawatts
00:28:45Union of Concerned ScientistsnoEp. 62: Clean Energy Momentum: From Goals to Gigawatts by Union of Concerned ScientistsEp. 62: Clean Energy Momentum: From Goals to Giga…Ep. 62: Clean Energy Momentum: From Goals to Gigawatts by Union of Concerned Scientiststag:soundcloud,2010:tracks/638601840Ep. 61: Building a More Resilient Puerto Rico with Clean EnergyTue, 18 Jun 2019 18:09:46 +0000https://soundcloud.com/gotscience/ep-61-building-a-more-resilient-puerto-rico-with-clean-energy
00:28:30Union of Concerned ScientistsnoYanel de Ángel and Ramón Bueno, an architect and climate expert originally from Puerto Rico, discuss how the island can bounce back stronger with renewable energy and other sustainable practices.Yanel de Ángel and Ramón Bueno, an architect and …Yanel de Ángel and Ramón Bueno, an architect and climate expert originally from Puerto Rico, discuss how the island can bounce back stronger with renewable energy and other sustainable practices.tag:soundcloud,2010:tracks/638619531Ep. 4: Construyamos Puerto Rico Más Resiliente Con la Energía LimpiaTue, 18 Jun 2019 18:08:26 +0000https://soundcloud.com/gotscience/ep-4-construyendo-un-puerto-rico-mas-resiliente-con-la-energia-limpia
00:27:13Union of Concerned ScientistsnoYanel de Ángel y Ramón Bueno, una arquitecta y un experto en el clima de Puerto Rico, hablan de como la energía renovable y otras prácticas sostenibles pueden ayudar a la isla a reponerse.Yanel de Ángel y Ramón Bueno, una arquitecta y un…Yanel de Ángel y Ramón Bueno, una arquitecta y un experto en el clima de Puerto Rico, hablan de como la energía renovable y otras prácticas sostenibles pueden ayudar a la isla a reponerse.tag:soundcloud,2010:tracks/631760217Ep. 60: Farmers and Crops on a Collision Course with Climate ChangeTue, 04 Jun 2019 19:59:40 +0000https://soundcloud.com/gotscience/ep-60-farmers-and-crops-on-a-collision-course-with-climate-change
00:28:35Union of Concerned ScientistsnoA conversation with Dr. Marcia DeLonge about the wide-ranging impacts of global warming on our agriculture system.A conversation with Dr. Marcia DeLonge about the …A conversation with Dr. Marcia DeLonge about the wide-ranging impacts of global warming on our agriculture system.tag:soundcloud,2010:tracks/624378732Ep. 59: Can the World’s Natural and Cultural Wonders Survive Climate Change?Tue, 21 May 2019 20:06:47 +0000https://soundcloud.com/gotscience/ep-59-can-the-worlds-natural-and-cultural-wonders-survive-climate-change
00:28:30Union of Concerned ScientistsnoAdam Markham takes us on a tour of World Heritage Sites threatened by a warming world.Adam Markham takes us on a tour of World Heritage…Adam Markham takes us on a tour of World Heritage Sites threatened by a warming world.tag:soundcloud,2010:tracks/617124969Ep. 58: How Do We Make Aging Infrastructure Climate-Safe?Tue, 07 May 2019 19:28:33 +0000https://soundcloud.com/gotscience/ep-58-how-do-we-make-aging-infrastructure-climate-safe
00:28:30Union of Concerned ScientistsnoDr. Susanne Moser is an expert on climate change adaptation. She was one of the facilitators of California’s climate-safe infrastructure working group, which brought together scientists, planners, architects, and engineers to figure out how climate impacts can be factored into infrastructure planning.Dr. Susanne Moser is an expert on climate change …Dr. Susanne Moser is an expert on climate change adaptation. She was one of the facilitators of California’s climate-safe infrastructure working group, which brought together scientists, planners, architects, and engineers to figure out how climate impacts can be factored into infrastructure planning.tag:soundcloud,2010:tracks/610416822Ep. 57: Super Pollutants: Carbon Dioxide’s Evil CousinsTue, 23 Apr 2019 21:25:25 +0000https://soundcloud.com/gotscience/ep-57-super-pollutants-carbon-dioxides-evil-cousins
00:29:00Union of Concerned ScientistsnoDr. Geeta Persad outlines four types of super pollutants that play a significant role in the climate change equation.Dr. Geeta Persad outlines four types of super pol…Dr. Geeta Persad outlines four types of super pollutants that play a significant role in the climate change equation.tag:soundcloud,2010:tracks/603485604Ep. 56: The High Risks of Low-Yield Nuclear WeaponsTue, 09 Apr 2019 19:02:25 +0000https://soundcloud.com/gotscience/ep-56-the-high-risks-of-low-yield-nuclear-weapons
00:28:59Union of Concerned ScientistsnoDr. Lisbeth Gronlund, Co-Director of the Global Security Program at the Union of Concerned Scientists, explains the capabilities of the US nuclear arsenal and why smaller-scale nuclear weapons are just as dangerous as bigger bombs.Dr. Lisbeth Gronlund, Co-Director of the Global S…Dr. Lisbeth Gronlund, Co-Director of the Global Security Program at the Union of Concerned Scientists, explains the capabilities of the US nuclear arsenal and why smaller-scale nuclear weapons are just as dangerous as bigger bombs.tag:soundcloud,2010:tracks/596213316Ep. 55: What’s the Deal With the Green New Deal?Tue, 26 Mar 2019 16:15:13 +0000https://soundcloud.com/gotscience/ep-55-whats-the-deal-with-the-green-new-deal
00:29:00Union of Concerned ScientistsnoDr. Rachel Cleetus, an economist and climate expert at the Union of Concerned Scientists, puts the ambitious Congressional resolution under the microscope.Dr. Rachel Cleetus, an economist and climate expe…Dr. Rachel Cleetus, an economist and climate expert at the Union of Concerned Scientists, puts the ambitious Congressional resolution under the microscope.tag:soundcloud,2010:tracks/589031688Ep. 54: It’s Just Code. How Can It Be Biased?Tue, 12 Mar 2019 18:40:22 +0000https://soundcloud.com/gotscience/ep-54-its-just-code-how-can-it-be-biased
00:28:32Union of Concerned ScientistsnoAuthor and professor Dr. Safiya Noble talks about racial bias in search results and discusses her book Algorithms of Oppression: How Search Engines Reinforce Racism.Author and professor Dr. Safiya Noble talks about…Author and professor Dr. Safiya Noble talks about racial bias in search results and discusses her book Algorithms of Oppression: How Search Engines Reinforce Racism.tag:soundcloud,2010:tracks/581776311Ep. 53: The Seeds of Science Advocacy: A Look Back to a Political Awakening of ScientistsTue, 26 Feb 2019 19:23:40 +0000https://soundcloud.com/gotscience/ep-53-the-seeds-of-science-advocacy-a-look-back-to-a-political-awakening-of-scientists
00:28:30Union of Concerned ScientistsnoIn a troubled, divisive time, a small group of scientists decided to make their voices heard—and founded the Union of Concerned Scientists in the process. Dr. David Wright, co-director of the UCS Global Security Program, talks about those beginnings and the half-century of science advocacy that grew from them.In a troubled, divisive time, a small group of sc…In a troubled, divisive time, a small group of scientists decided to make their voices heard—and founded the Union of Concerned Scientists in the process. Dr. David Wright, co-director of the UCS Global Security Program, talks about those beginnings and the half-century of science advocacy that grew from them.tag:soundcloud,2010:tracks/574339053Ep. 52: The Ethical Question of Autonomous VehiclesTue, 12 Feb 2019 20:09:27 +0000https://soundcloud.com/gotscience/ep-52-the-ethical-question-of-autonomous-vehicles
00:28:30Union of Concerned ScientistsnoMobility and equity Kendall Science Fellow Dr. Richard Ezike walks us through the equity implications of autonomous vehicles (AVs), and the infrastructure overhaul needed to get AVs on the road.Mobility and equity Kendall Science Fellow Dr. Ri…Mobility and equity Kendall Science Fellow Dr. Richard Ezike walks us through the equity implications of autonomous vehicles (AVs), and the infrastructure overhaul needed to get AVs on the road.tag:soundcloud,2010:tracks/566670387Ep. 51: Two Years of Attacks on Science: Holding the Trump Administration AccountableTue, 29 Jan 2019 17:03:56 +0000https://soundcloud.com/gotscience/ep-51-two-years-of-attacks-on-science-holding-the-trump-administration-accountable
00:27:30Union of Concerned ScientistsnoDr. Gretchen Goldman takes us through the systematic dismantling of science protections, what it means for public health and safety, and how scientists are standing up for science.Dr. Gretchen Goldman takes us through the systema…Dr. Gretchen Goldman takes us through the systematic dismantling of science protections, what it means for public health and safety, and how scientists are standing up for science.tag:soundcloud,2010:tracks/559435026Ep. 50: Measuring Ice Thickness in Antarctica: NASA’s ICESat-2 MissionTue, 15 Jan 2019 15:35:50 +0000https://soundcloud.com/gotscience/ep-50-measuring-ice-thickness-in-antarctica-nasas-icesat-2-mission
00:28:51Union of Concerned ScientistsnoWe go behind the scenes with NASA glaciologists Dr. Kelly Brunt and Dr. Adam Greeley as they prepare for a data-collecting expedition around the South Pole.We go behind the scenes with NASA glaciologists D…We go behind the scenes with NASA glaciologists Dr. Kelly Brunt and Dr. Adam Greeley as they prepare for a data-collecting expedition around the South Pole.tag:soundcloud,2010:tracks/547927662Ep. 49: A Scientist Defending ScienceTue, 01 Jan 2019 18:37:48 +0000https://soundcloud.com/gotscience/ep-49-a-scientist-defending-science
00:28:31Union of Concerned ScientistsnoMolecular biologist, Dr. Maryam Zaringhalam, left the lab to explore the intersection of science and public policy.Molecular biologist, Dr. Maryam Zaringhalam, left…Molecular biologist, Dr. Maryam Zaringhalam, left the lab to explore the intersection of science and public policy.tag:soundcloud,2010:tracks/543589773Ep. 48: A Dreamer’s Tale: Soil Microbes, Climate Change, and Being an Undocumented ScientistTue, 11 Dec 2018 21:15:29 +0000https://soundcloud.com/gotscience/ep-48-a-dreamers-tale-soil-microbes-climate-change-and-being-an-undocumented-scientist
00:29:05Union of Concerned ScientistsnoPhD candidate Evelyn Valdez-Ward talks about her family’s story, her research on soil and climate, and her experience mentoring younger students.PhD candidate Evelyn Valdez-Ward talks about her …PhD candidate Evelyn Valdez-Ward talks about her family’s story, her research on soil and climate, and her experience mentoring younger students.tag:soundcloud,2010:tracks/536340714Ep. 47: Why California Has the Worst Air Pollution and What Can Be DoneTue, 27 Nov 2018 19:00:14 +0000https://soundcloud.com/gotscience/ep-47-why-california-has-the-worst-air-pollution-and-what-can-be-done
00:28:32Union of Concerned ScientistsnoLos Angeles native Prof. Edward Avol talks about the impacts of pollution on children—and why it’s so important to “keep on pushing” for strong clean air standards.Los Angeles native Prof. Edward Avol talks about …Los Angeles native Prof. Edward Avol talks about the impacts of pollution on children—and why it’s so important to “keep on pushing” for strong clean air standards.tag:soundcloud,2010:tracks/529457706Ep. 46: The Broccoli Backstory: Dr. Ricardo Salvador Explains the System Behind the SupermarketTue, 13 Nov 2018 21:22:48 +0000https://soundcloud.com/gotscience/ep-46-the-broccoli-backstory-dr-ricardo-salvador-explains-the-system-behind-the-supermarket
00:28:31Union of Concerned ScientistsnoAgricultural scientist Dr. Ricardo Salvador tells the story of how our food really gets to the grocery store, and discusses the urgent need for a sustainable and equitable food system.Agricultural scientist Dr. Ricardo Salvador tells…Agricultural scientist Dr. Ricardo Salvador tells the story of how our food really gets to the grocery store, and discusses the urgent need for a sustainable and equitable food system.tag:soundcloud,2010:tracks/529456440Ep. 3: ¿Cómo llega el brócoli a su mesa?: El Dr. Ricardo Salvador explica el sistema alimentarioTue, 13 Nov 2018 21:20:16 +0000https://soundcloud.com/gotscience/ep-46-como-llega-el-brocoli-a-su-mesa-el-dr-ricardo-salvador-explica-el-sistema-alimentario
00:30:20Union of Concerned ScientistsnoEl Dr. Ricardo Salvador, científico agrícola, nos cuenta la historia de cómo llega la comida al supermercado, y nos explica por qué necesitamos urgentemente un sistema agrícola perdurable y equitativo.El Dr. Ricardo Salvador, científico agrícola, nos…El Dr. Ricardo Salvador, científico agrícola, nos cuenta la historia de cómo llega la comida al supermercado, y nos explica por qué necesitamos urgentemente un sistema agrícola perdurable y equitativo.tag:soundcloud,2010:tracks/522310101Ep. 45: Geoengineering: Scarier than a Zombie Apocalypse?Tue, 30 Oct 2018 20:08:12 +0000https://soundcloud.com/gotscience/ep-45-geoengineering-scarier-than-a-zombie-apocalypse
00:28:31Union of Concerned ScientistsnoJust in time for Halloween, an episode that’ll scare the daylights out of you. Frank Keutsch joins us to explain what geoengineering is, why it isn’t a magic fix for climate change, and why we still need to greatly reduce CO2 emissions.Just in time for Halloween, an episode that’ll sc…Just in time for Halloween, an episode that’ll scare the daylights out of you. Frank Keutsch joins us to explain what geoengineering is, why it isn’t a magic fix for climate change, and why we still need to greatly reduce CO2 emissions.tag:soundcloud,2010:tracks/515282748Ep. 44: Why Science Needs Your Vote in the Midterm ElectionsTue, 16 Oct 2018 19:21:27 +0000https://soundcloud.com/gotscience/ep-44-why-science-needs-your-vote-in-the-midterm-elections
00:30:00Union of Concerned ScientistsnoAndrew Rosenberg, director of the Center for Science and Democracy, goes over some of the key issues facing science, and how your vote in the upcoming midterm elections can help.Andrew Rosenberg, director of the Center for Scie…Andrew Rosenberg, director of the Center for Science and Democracy, goes over some of the key issues facing science, and how your vote in the upcoming midterm elections can help.tag:soundcloud,2010:tracks/508584138Ep. 43: Offshore Wind Turbines: An Ocean of Clean Energy OpportunityTue, 02 Oct 2018 20:00:36 +0000https://soundcloud.com/gotscience/ep-43-offshore-wind-turbines-an-ocean-of-clean-energy-opportunity
00:30:17Union of Concerned ScientistsnoSenior energy analyst John Rogers tells us all about offshore wind, it's clean energy benefits and why offshore wind is more feasible than ever before.Senior energy analyst John Rogers tells us all ab…Senior energy analyst John Rogers tells us all about offshore wind, it's clean energy benefits and why offshore wind is more feasible than ever before.tag:soundcloud,2010:tracks/501756483Ep. 42: Battered, Betrayed, but Not Beaten: Puerto Rico after Hurricane MariaTue, 18 Sep 2018 19:07:58 +0000https://soundcloud.com/gotscience/ep-42-battered-betrayed-but-not-beaten-puerto-rico-after-hurricane-maria
00:29:56Union of Concerned ScientistsnoClimate Scientist Juan Declet-Barreto teaches us about community and resilience a year after Maria.Climate Scientist Juan Declet-Barreto teaches us …Climate Scientist Juan Declet-Barreto teaches us about community and resilience a year after Maria.tag:soundcloud,2010:tracks/501753771Ep. 2: Maltrecho y traicionado pero no vencido: Puerto Rico después del huracán MaríaTue, 18 Sep 2018 19:02:54 +0000https://soundcloud.com/gotscience/ep-2-maltrecho-y-traicionado-pero-no-vencido-puerto-rico-despues-del-huracan
00:29:54Union of Concerned ScientistsnoJuan Declet-Barreto, científico climático, nos enseña sobre comunidad y resiliencia un año después de María.Juan Declet-Barreto, científico climático, nos en…Juan Declet-Barreto, científico climático, nos enseña sobre comunidad y resiliencia un año después de María.tag:soundcloud,2010:tracks/495187104Ep. 41: Electric Buses: The People’s Electric VehicleTue, 04 Sep 2018 18:56:41 +0000https://soundcloud.com/gotscience/ep-41-electric-buses-the-peoples-electric-vehicle
00:30:01Union of Concerned ScientistsnoDr. Jimmy O’Dea talks about a future with electric buses, trucks and other heavy duty vehicles, and the positive impact they will have on global warming emissions.Dr. Jimmy O’Dea talks about a future with electri…Dr. Jimmy O’Dea talks about a future with electric buses, trucks and other heavy duty vehicles, and the positive impact they will have on global warming emissions.tag:soundcloud,2010:tracks/488606304Ep. 1: Entusiasmo por la energía: el futuro de las energías renovables en Estados UnidosTue, 21 Aug 2018 18:46:38 +0000https://soundcloud.com/gotscience/ep1-entusiasmo-por-la-energia
00:26:29Union of Concerned ScientistsnoPaula García, experta en energías renovables, nos cuenta sobre la expansión de las energías renovables en el mundo y en los Estados Unidos.Paula García, experta en energías renovables, nos…Paula García, experta en energías renovables, nos cuenta sobre la expansión de las energías renovables en el mundo y en los Estados Unidos.tag:soundcloud,2010:tracks/488649420Ep. 40: Getting Excited About Energy: Expanding Renewables in the USTue, 21 Aug 2018 18:45:58 +0000https://soundcloud.com/gotscience/ep-40-getting-excited-about-energy-expanding-renewables-in-the-us
00:24:16Union of Concerned ScientistsnoEnergy expert Paula Garcia talks about the growth of renewable energy across the globe and in the United States.Energy expert Paula Garcia talks about the growth…Energy expert Paula Garcia talks about the growth of renewable energy across the globe and in the United States.tag:soundcloud,2010:tracks/482324841Ep. 39: How Climate Change Affects Your Mental HealthTue, 07 Aug 2018 14:37:45 +0000https://soundcloud.com/gotscience/ep-39-how-climate-change-affects-your-mental-health
00:29:30Union of Concerned ScientistsnoDr. Joel Nigg, a licensed clinical psychologist and professor at Oregon Health and Sciences University, discusses his research into the mental health impacts of climate change.Dr. Joel Nigg, a licensed clinical psychologist a…Dr. Joel Nigg, a licensed clinical psychologist and professor at Oregon Health and Sciences University, discusses his research into the mental health impacts of climate change.tag:soundcloud,2010:tracks/475698447Ep. 38: The Science of Forest Fires: Culture, Climate, and CombustionTue, 24 Jul 2018 18:00:04 +0000https://soundcloud.com/gotscience/ep-38-the-science-of-forest-fires-culture-climate-combustion
00:30:00Union of Concerned ScientistsnoProfessor John Bailey, an expert on all things fire, tells us about controlled burning, silviculture and why Smokey Bear had it all wrong.Professor John Bailey, an expert on all things fi…Professor John Bailey, an expert on all things fire, tells us about controlled burning, silviculture and why Smokey Bear had it all wrong.tag:soundcloud,2010:tracks/469942512Ep. 37: Revolution on the Road: The Shift to EVs and Self-Driving CarsTue, 10 Jul 2018 20:44:49 +0000https://soundcloud.com/gotscience/ep-37-revolution-on-the-road-the-shift-to-evs-and-self-driving-cars
00:30:01Union of Concerned ScientistsnoVehicles expert Dr. Daniel Sperling walks us through the future of transportation and the multiple revolutions needed to make self-driving cars an affordable, convenient, and efficient reality.Vehicles expert Dr. Daniel Sperling walks us thro…Vehicles expert Dr. Daniel Sperling walks us through the future of transportation and the multiple revolutions needed to make self-driving cars an affordable, convenient, and efficient reality.tag:soundcloud,2010:tracks/463880679Ep. 36: Coastal Homes and Properties at Risk: Sea Level Rise, Flooding, and InundationTue, 26 Jun 2018 21:47:48 +0000https://soundcloud.com/gotscience/ep-36-coastal-homes-and-properties-at-risk-sea-level-rise-flooding-and-inundation
00:30:00Union of Concerned ScientistsnoEconomist and climate change expert Dr. Rachel Cleetus discusses new analysis that pairs NOAA climate change research with Zillow real estate data to show the threat to coastal property.Economist and climate change expert Dr. Rachel Cl…Economist and climate change expert Dr. Rachel Cleetus discusses new analysis that pairs NOAA climate change research with Zillow real estate data to show the threat to coastal property.tag:soundcloud,2010:tracks/457434420Ep. 35: From Ozone Fixer to Presidential Speech WriterTue, 12 Jun 2018 18:56:59 +0000https://soundcloud.com/gotscience/ep-35-from-ozone-fixer-to-presidential-speech-writer
00:29:21Union of Concerned ScientistsnoAtmospheric scientist Don Wuebbles discusses ozone recovery, all-nighters at the White House, and communicating climate science.Atmospheric scientist Don Wuebbles discusses ozon…Atmospheric scientist Don Wuebbles discusses ozone recovery, all-nighters at the White House, and communicating climate science.tag:soundcloud,2010:tracks/450897435Ep. 34: The Federal Scientist Who Blew the WhistleTue, 29 May 2018 20:16:13 +0000https://soundcloud.com/gotscience/ep-34-the-federal-scientist-who-blew-the-whistle
00:29:27Union of Concerned ScientistsnoJoel Clement, a former policy director at the Department of Interior and new senior fellow with the Center for Science and Democracy at UCS, shares his experience of political interference in the Trump administration and the steps he took to fight back.Joel Clement, a former policy director at the Dep…Joel Clement, a former policy director at the Department of Interior and new senior fellow with the Center for Science and Democracy at UCS, shares his experience of political interference in the Trump administration and the steps he took to fight back.tag:soundcloud,2010:tracks/444448101Ep. 33: North Korea, Its Neighbors, and the US: A China Expert’s PerspectiveTue, 15 May 2018 17:17:43 +0000https://soundcloud.com/gotscience/ep33-us-north-korea
00:28:30Union of Concerned ScientistsnoDr. Gregory Kulacki talks about what is motivating North Korean President Kim Jong Un and the possible outcomes of a summit with President Donald Trump.Dr. Gregory Kulacki talks about what is motivatin…Dr. Gregory Kulacki talks about what is motivating North Korean President Kim Jong Un and the possible outcomes of a summit with President Donald Trump.tag:soundcloud,2010:tracks/437329680Ep. 32: Nuclear Power Reactors: Is Smaller Better?Tue, 01 May 2018 16:00:06 +0000https://soundcloud.com/gotscience/ep-32-nuclear-power
00:30:33Union of Concerned ScientistsnoHow much do you know about nuclear power? Dr. Edwin Lyman, internationally recognized expert on nuclear proliferation, walks us through nuclear power, its associated risks, and small modular reactors.How much do you know about nuclear power? Dr. Edw…How much do you know about nuclear power? Dr. Edwin Lyman, internationally recognized expert on nuclear proliferation, walks us through nuclear power, its associated risks, and small modular reactors.tag:soundcloud,2010:tracks/431108361Ep. 31: Navigating The Climate Change Minefield With Michael MannTue, 17 Apr 2018 17:54:24 +0000https://soundcloud.com/gotscience/ep-31-navigating-the-climate-change-minefield-with-michael-mann
00:29:59Union of Concerned ScientistsnoOne of the nation’s most respected (and harassed) scientists, Dr. Michael Mann, discusses the climate change tipping point and battling forces of denial.One of the nation’s most respected (and harassed)…One of the nation’s most respected (and harassed) scientists, Dr. Michael Mann, discusses the climate change tipping point and battling forces of denial.tag:soundcloud,2010:tracks/424316268Ep. 30: The Evidence Is In: SNAP WorksTue, 03 Apr 2018 19:37:22 +0000https://soundcloud.com/gotscience/ep-30-the-evidence-is-in-snap-works
00:28:24Union of Concerned ScientistsnoYou may know it as food stamps. Millions of Americans know it as the reason their families won’t go hungry tonight. Food systems and health analyst Sarah Reinhardt knows that it needs to be strengthened, not weakened, in the next Farm Bill.You may know it as food stamps. Millions of Ameri…You may know it as food stamps. Millions of Americans know it as the reason their families won’t go hungry tonight. Food systems and health analyst Sarah Reinhardt knows that it needs to be strengthened, not weakened, in the next Farm Bill.tag:soundcloud,2010:tracks/416713896Ep. 29: One Scientist's Quest to Improve Science Education in Puerto RicoTue, 20 Mar 2018 20:40:54 +0000https://soundcloud.com/gotscience/ep-29-one-scientists-quest-to-improve-science-education-in-puerto-rico
00:30:08Union of Concerned ScientistsnoFollow the journey of Dr. Giovanna Guerrero-Medina as she grows from neurobiology researcher to organizer and science advocate for Puerto Rico before and after Hurricane Maria.Follow the journey of Dr. Giovanna Guerrero-Medin…Follow the journey of Dr. Giovanna Guerrero-Medina as she grows from neurobiology researcher to organizer and science advocate for Puerto Rico before and after Hurricane Maria.tag:soundcloud,2010:tracks/409723200Ep. 28: Why the Government Doesn't Research Gun ViolenceTue, 06 Mar 2018 22:22:09 +0000https://soundcloud.com/gotscience/ep-28-why-the-government-doesnt-research-gun-violence
00:28:10Union of Concerned ScientistsnoCharise Johnson, research associate at the Union of Concerned Scientists, talks about why the Centers for Disease Control and Prevention can’t study gun violence injuries and death, and how this leaves the public in the dark and at risk.Charise Johnson, research associate at the Union …Charise Johnson, research associate at the Union of Concerned Scientists, talks about why the Centers for Disease Control and Prevention can’t study gun violence injuries and death, and how this leaves the public in the dark and at risk.tag:soundcloud,2010:tracks/402652866Ep. 27: How Science Can Make Voting FairTue, 20 Feb 2018 20:52:54 +0000https://soundcloud.com/gotscience/ep-27-how-science-can-make-voting-fair
00:24:17Union of Concerned ScientistsnoDr. Michael Latner, Kendall Voting Rights Fellow with the UCS Center for Science and Democracy, uses science to level the playing field for voters.Dr. Michael Latner, Kendall Voting Rights Fellow …Dr. Michael Latner, Kendall Voting Rights Fellow with the UCS Center for Science and Democracy, uses science to level the playing field for voters.tag:soundcloud,2010:tracks/395527218Ep. 26: Why the US Missile Defense System Won't WorkTue, 06 Feb 2018 21:41:13 +0000https://soundcloud.com/gotscience/ep-26-why-the-us-missile-defense-system-wont-work
00:29:24Union of Concerned ScientistsnoPhysicist Dr. Laura Grego explains in lay terms just why the US ground-based midcourse missile defense system--the one that is supposed to intercept a North Korean missile--doesn't work.Physicist Dr. Laura Grego explains in lay terms j…Physicist Dr. Laura Grego explains in lay terms just why the US ground-based midcourse missile defense system--the one that is supposed to intercept a North Korean missile--doesn't work.tag:soundcloud,2010:tracks/388117535Ep. 25: Who's Responsible for Climate Damages?Tue, 23 Jan 2018 22:11:30 +0000https://soundcloud.com/gotscience/ep-25-whos-responsible-for-climate-damages
00:29:00Union of Concerned ScientistsnoDr. Peter Frumhoff discusses how science is pinpointing companies’ impactsDr. Peter Frumhoff discusses how science is pinpo…Dr. Peter Frumhoff discusses how science is pinpointing companies’ impactstag:soundcloud,2010:tracks/381151208Ep. 24: A Retreat from Science at the Department of InteriorTue, 09 Jan 2018 19:12:50 +0000https://soundcloud.com/gotscience/ep-24-a-retreat-from-science-at-interior
00:29:57Union of Concerned ScientistsnoSally Jewell, former Secretary at the Department of Interior, talks about the Trump administration’s effort to roll back scientific and conservation safeguards.Sally Jewell, former Secretary at the Department …Sally Jewell, former Secretary at the Department of Interior, talks about the Trump administration’s effort to roll back scientific and conservation safeguards.tag:soundcloud,2010:tracks/371800700Episode 23: Electric Vehicles Just Won't StallTue, 19 Dec 2017 20:05:37 +0000https://soundcloud.com/gotscience/episode-23-electric-vehicles-just-wont-stall
00:29:46Union of Concerned ScientistsnoStraight from the Los Angeles auto show, UCS engineer David Reichmuth talks about the drive to make EVs more accessible, affordable, and ubiquitous.Straight from the Los Angeles auto show, UCS engi…Straight from the Los Angeles auto show, UCS engineer David Reichmuth talks about the drive to make EVs more accessible, affordable, and ubiquitous.tag:soundcloud,2010:tracks/365441723Episode 22: "I Want You to Act": Gina McCarthy on Pruitt’s EPA, Flint, and the Path ForwardTue, 05 Dec 2017 20:05:55 +0000https://soundcloud.com/gotscience/episode-22-i-want-you-to-act-gina-mccarthy-on-pruitts-epa-flint-and-the-path-forward
00:28:58Union of Concerned ScientistsnoGina McCarthy, former administrator for the Environmental Protection Agency talks about the current state of affairs under Scott Pruitt.Gina McCarthy, former administrator for the Envir…Gina McCarthy, former administrator for the Environmental Protection Agency talks about the current state of affairs under Scott Pruitt.tag:soundcloud,2010:tracks/359108045Episode 21: Thanks Science!Tue, 21 Nov 2017 21:50:10 +0000https://soundcloud.com/gotscience/episode-21-thanks-science
00:23:06Union of Concerned ScientistsnoFind out why we should be thanking science this week. Five esteemed scientists, including a Presidential Medal of Freedom winner, tell us why they are grateful for science.Find out why we should be thanking science this w…Find out why we should be thanking science this week. Five esteemed scientists, including a Presidential Medal of Freedom winner, tell us why they are grateful for science.tag:soundcloud,2010:tracks/352511849Episode 20: A Climate Fingerprinter Fights OnTue, 07 Nov 2017 19:59:46 +0000https://soundcloud.com/gotscience/episode-20-a-climate-fingerprinter-fights-on
00:29:51Union of Concerned ScientistsnoDr. Ben Santer, climate scientist and one of the first scientists to identify how humans are influencing the global climate, talks about his work and also how he became the target of vicious attacks by fossil-fuel interests.Dr. Ben Santer, climate scientist and one of the …Dr. Ben Santer, climate scientist and one of the first scientists to identify how humans are influencing the global climate, talks about his work and also how he became the target of vicious attacks by fossil-fuel interests.tag:soundcloud,2010:tracks/348362248Episode 19: A Football Star Stands Up for ScienceTue, 24 Oct 2017 14:07:20 +0000https://soundcloud.com/gotscience/episode-19-a-football-star-stands-up-for-science
00:33:39Union of Concerned ScientistsnoFrom football to pharmaceuticals, there’s a playbook for sidelining science. Former NFL player Chris Borland joins UCS science and policy analyst Genna Reed to discuss how powerful interests deceive, misinform, and buy influence at the expense of public health and safety.From football to pharmaceuticals, there’s a playb…From football to pharmaceuticals, there’s a playbook for sidelining science. Former NFL player Chris Borland joins UCS science and policy analyst Genna Reed to discuss how powerful interests deceive, misinform, and buy influence at the expense of public health and safety.tag:soundcloud,2010:tracks/346230342Episode 18: As Coal Declines, Helping Communities RiseTue, 10 Oct 2017 11:11:25 +0000https://soundcloud.com/gotscience/episode-18-as-coal-declines-helping-communities-rise
00:27:38Union of Concerned ScientistsnoDr. Jeremy Richardson, senior energy analyst at the Union of Concerned Scientists, discusses his new report on the dwindling role of coal in the U.S. energy sector, talks to a number of innovators in his home state of West Virginia about how they are transitioning away from coal, and relays the experience of environmental justice advocates fighting to improve public health in their communities.Dr. Jeremy Richardson, senior energy analyst at t…Dr. Jeremy Richardson, senior energy analyst at the Union of Concerned Scientists, discusses his new report on the dwindling role of coal in the U.S. energy sector, talks to a number of innovators in his home state of West Virginia about how they are transitioning away from coal, and relays the experience of environmental justice advocates fighting to improve public health in their communities.tag:soundcloud,2010:tracks/344152485Episode-17: Soil as ShamWow: How Farmers (and Gardeners) Can Benefit from Healthy SoilTue, 26 Sep 2017 19:20:54 +0000https://soundcloud.com/gotscience/episode-17-soil-as-shamwow-how-farmers-and-gardeners-can-benefit-from-healthy-soil
00:24:16Union of Concerned ScientistsnoDr. Andrea Basche, an agricultural scientist and AAAS Fellow at USDA’s National Institute for Food and Agriculture, talks about the power of soil to fight floods and droughts. Tune in to get the dirt on dirt.Dr. Andrea Basche, an agricultural scientist and …Dr. Andrea Basche, an agricultural scientist and AAAS Fellow at USDA’s National Institute for Food and Agriculture, talks about the power of soil to fight floods and droughts. Tune in to get the dirt on dirt.tag:soundcloud,2010:tracks/342079467Episode 16: Real Talk with Mustafa Ali: Science, Environmental Justice, and PowerTue, 12 Sep 2017 20:12:33 +0000https://soundcloud.com/gotscience/episode-16-real-talk-with-mustafa-ali-science-environmental-justice-and-power
00:43:22Union of Concerned ScientistsnoMustafa Ali was a chief environmental justice official and founding member of the Office of Environmental Justice at the Environmental Protection Agency. He talks about his experience at the EPA, his decision to resign, and the importance of science in environmental justice.Mustafa Ali was a chief environmental justice off…Mustafa Ali was a chief environmental justice official and founding member of the Office of Environmental Justice at the Environmental Protection Agency. He talks about his experience at the EPA, his decision to resign, and the importance of science in environmental justice.tag:soundcloud,2010:tracks/340036178Episode 15: Sunbeam Us Up: Solarizing Your Roof and the Electricity GridTue, 29 Aug 2017 19:42:06 +0000https://soundcloud.com/gotscience/episode-15-sunbeam-us-up-solarizing-your-roof-and-the-electricity-grid-8-29-2017
00:31:24Union of Concerned ScientistsnoSenior energy analysts Laura Wisland and John Rogers from the Union of Concerned Scientists discuss all things solar, from getting solar on your roof to connecting that energy to the power grid.Senior energy analysts Laura Wisland and John Rog…Senior energy analysts Laura Wisland and John Rogers from the Union of Concerned Scientists discuss all things solar, from getting solar on your roof to connecting that energy to the power grid.tag:soundcloud,2010:tracks/338019006Episode 14: Failing Science: The Trump Administration's Six-Month Report CardTue, 15 Aug 2017 19:50:30 +0000https://soundcloud.com/gotscience/episode-14-failing-science-the-trump-administrations-six-month-report-card
00:29:20Union of Concerned ScientistsnoDr. Gretchen Goldman, research director for the Center for Science and Democracy at the Union of Concerned Scientists and co-author of the new UCS report "Sidelining Science since Day One", talks about the Trump administration's attacks on science, their real-life consequences, and how scientists and the public can fight back.Dr. Gretchen Goldman, research director for the C…Dr. Gretchen Goldman, research director for the Center for Science and Democracy at the Union of Concerned Scientists and co-author of the new UCS report "Sidelining Science since Day One", talks about the Trump administration's attacks on science, their real-life consequences, and how scientists and the public can fight back.tag:soundcloud,2010:tracks/335847332Episode 13: Living with Rising Seas: Stories from Chronically Flooded CommunitiesTue, 01 Aug 2017 20:50:12 +0000https://soundcloud.com/gotscience/episode-13-living-with-rising-seas-stories-from-chronically-flooded-communities
00:28:55Union of Concerned ScientistsnoUCS scientist and climate advocate Nicole Hernandez Hammer and Pulitzer-prize nominated journalist and UCS fellow Derrick Z. Jackson talk about what they are seeing on the ground in chronically flooded coastal communities.UCS scientist and climate advocate Nicole Hernand…UCS scientist and climate advocate Nicole Hernandez Hammer and Pulitzer-prize nominated journalist and UCS fellow Derrick Z. Jackson talk about what they are seeing on the ground in chronically flooded coastal communities.tag:soundcloud,2010:tracks/333760614Episode 12: When Rising Seas Hit Home: What Coastal Communities Can Expect, and When to Expect ItTue, 18 Jul 2017 19:26:54 +0000https://soundcloud.com/gotscience/episode-12-when-rising-seas-hit-home-what-coastal-communities-can-expect-and-when-to-expect-it
00:28:03Union of Concerned ScientistsnoErika Spanger-Siegfried, senior analyst at the Union of Concerned Scientists, brings us startling new research on sea level rise and the hard choices ahead for coastal communities. More at: http://www.ucsusa.org/risingseashithomeErika Spanger-Siegfried, senior analyst at the Un…Erika Spanger-Siegfried, senior analyst at the Union of Concerned Scientists, brings us startling new research on sea level rise and the hard choices ahead for coastal communities. More at: http://www.ucsusa.org/risingseashithometag:soundcloud,2010:tracks/331533390Episode 11: How to Stop a Wrecking Ball: A Fourth of July Look at the Trump AdministrationTue, 04 Jul 2017 17:18:07 +0000https://soundcloud.com/gotscience/episode-11-how-to-stop-a-wrecking-ball-a-fourth-of-july-look-at-the-trump-administration
00:21:35Union of Concerned ScientistsnoKen Kimmell, president of the Union of Concerned Scientists, is back to give a recap of the recent months of the Trump administration and how he sees things playing out in light of President Trump pulling the US out of the Paris Climate Agreement.Ken Kimmell, president of the Union of Concerned …Ken Kimmell, president of the Union of Concerned Scientists, is back to give a recap of the recent months of the Trump administration and how he sees things playing out in light of President Trump pulling the US out of the Paris Climate Agreement.tag:soundcloud,2010:tracks/329028632Episode 10: Rocket Forensics: Dissecting North Korea's Missile Program Part 2Tue, 20 Jun 2017 17:55:16 +0000https://soundcloud.com/gotscience/episode-10-rocket-forensics-dissecting-north-koreas-missile-program-part-2
00:23:06Union of Concerned ScientistsnoPart 2 of our interview with Dr. David Wright, co-director of the Global Security Program at the Union of Concerned Scientists. Dr. Wright continues his discussion of North Korea’s missile program, the accelerating pace of launch tests, and what scientific information he gleans from each of them.Part 2 of our interview with Dr. David Wright, co…Part 2 of our interview with Dr. David Wright, co-director of the Global Security Program at the Union of Concerned Scientists. Dr. Wright continues his discussion of North Korea’s missile program, the accelerating pace of launch tests, and what scientific information he gleans from each of them.tag:soundcloud,2010:tracks/326777888Episode 9: Rocket Forensics: Dissecting North Korea's Missile Program, Part 1Tue, 06 Jun 2017 20:58:10 +0000https://soundcloud.com/gotscience/episode-9-rocket-forensics-dissecting-north-koreas-missile-program-part-1
00:21:23Union of Concerned ScientistsnoDr. David Wright, co-director of the Global Security Program at the Union of Concerned Scientists, discusses North Korea’s missile program, the accelerating pace of launch tests, and what scientific information he gleans from each of them.Dr. David Wright, co-director of the Global Secur…Dr. David Wright, co-director of the Global Security Program at the Union of Concerned Scientists, discusses North Korea’s missile program, the accelerating pace of launch tests, and what scientific information he gleans from each of them.tag:soundcloud,2010:tracks/324122975Episode 8: Bridging the Faith-Science DivideTue, 23 May 2017 16:39:45 +0000https://soundcloud.com/gotscience/episode-8-bridging-the-faith-science-divide
00:21:19Union of Concerned ScientistsnoDr. Katharine Hayhoe, director of the Climate Science Center at Texas Tech University, discusses her life as an evangelical Christian and climate scientist.Dr. Katharine Hayhoe, director of the Climate Sci…Dr. Katharine Hayhoe, director of the Climate Science Center at Texas Tech University, discusses her life as an evangelical Christian and climate scientist.tag:soundcloud,2010:tracks/321771707Episode 7: African Americans Against the Bomb: Connecting Nuclear Weapons and Racial JusticeTue, 09 May 2017 17:39:23 +0000https://soundcloud.com/gotscience/episode-07-african-americans-against-the-bomb-connecting-the-dots-between-nuclear-weapons-and-racial-justice
00:28:33Union of Concerned ScientistsnoDr. Vincent Intondi, director of the Institute for Race, Justice, and Community Engagement at Montgomery College, talks about the forgotten history of African Americans against the nuclear bomb. In this interview he connects the fight against nuclear weapons with racial equality.Dr. Vincent Intondi, director of the Institute fo…Dr. Vincent Intondi, director of the Institute for Race, Justice, and Community Engagement at Montgomery College, talks about the forgotten history of African Americans against the nuclear bomb. In this interview he connects the fight against nuclear weapons with racial equality.tag:soundcloud,2010:tracks/319389389Episode 6: The Amazing Renewables Race: Ranking the States on Clean EnergyTue, 25 Apr 2017 12:10:30 +0000https://soundcloud.com/gotscience/episode-06-the-amazing-renewables-race-ranking-the-states-on-clean-energy-04-25-2017
00:25:49Union of Concerned ScientistsnoJohn Rogers, senior energy analyst with the Climate and Energy Program at the Union of Concerned Scientists, talks about some of the surprising findings in a new UCS report on state-level clean energy progress.John Rogers, senior energy analyst with the Clima…John Rogers, senior energy analyst with the Climate and Energy Program at the Union of Concerned Scientists, talks about some of the surprising findings in a new UCS report on state-level clean energy progress.tag:soundcloud,2010:tracks/317244378Episode 5: Unpacking the Snowpack: Is the California Drought Really Over?Tue, 11 Apr 2017 20:34:32 +0000https://soundcloud.com/gotscience/episode-5-unpacking-the-snowpack-is-the-california-drought-over
00:23:26Union of Concerned ScientistsnoDr. Juliet Christian-Smith, senior climate scientist with the Climate and Energy Program at the Union of Concerned Scientists, talks about water, snowpack, and the drought in California.Dr. Juliet Christian-Smith, senior climate scient…Dr. Juliet Christian-Smith, senior climate scientist with the Climate and Energy Program at the Union of Concerned Scientists, talks about water, snowpack, and the drought in California.tag:soundcloud,2010:tracks/314877051Episode 4 - Science and Justice are Indivisible: A Conversation with Robert Bullard, March 28, 2017Tue, 28 Mar 2017 14:32:27 +0000https://soundcloud.com/gotscience/episode-4-science-and-justice-are-indivisible-a-conversation-with-robert-bullard
00:25:38Union of Concerned ScientistsnoDr. Robert Bullard, the father of the environmental justice movement, discusses his past, new fights, and the role of scientists in solving environmental racism.Dr. Robert Bullard, the father of the environment…Dr. Robert Bullard, the father of the environmental justice movement, discusses his past, new fights, and the role of scientists in solving environmental racism.tag:soundcloud,2010:tracks/312349570Episode 3 - The Ultimate Designated Driver: Pros and Cons of Self-Driving Cars, March 14, 2017Tue, 14 Mar 2017 15:53:05 +0000https://soundcloud.com/gotscience/episode-3-the-ultimate-designated-driver-pros-and-cons-of-self-driving-cars
00:16:09Union of Concerned ScientistsnoVehicles analyst Jimmy O'Dea from the Union of Concerned Scientists discusses everything from the practical issues to the philosophical implications of self-driving cars.Vehicles analyst Jimmy O'Dea from the Union of Co…Vehicles analyst Jimmy O'Dea from the Union of Concerned Scientists discusses everything from the practical issues to the philosophical implications of self-driving cars.tag:soundcloud,2010:tracks/310035829Episode 2 - Federal Science in the Crosshairs, Feb. 28, 2017Wed, 01 Mar 2017 01:03:37 +0000https://soundcloud.com/gotscience/episode-2-federal-science-in-the-crosshairs-feb-28-2017
00:25:50Union of Concerned ScientistsnoDr. Andrew Rosenberg, director of the Center for Science and Democracy at the Union of Concerned Scientists discusses the challenges ahead for federal scientists in the Trump administration.Dr. Andrew Rosenberg, director of the Center for …Dr. Andrew Rosenberg, director of the Center for Science and Democracy at the Union of Concerned Scientists discusses the challenges ahead for federal scientists in the Trump administration.tag:soundcloud,2010:tracks/307744724Got Science PromoTue, 14 Feb 2017 19:58:40 +0000https://soundcloud.com/gotscience/got-science-promo
00:00:38Union of Concerned ScientistsnoGot Science Promo by Union of Concerned ScientistsGot Science Promo by Union of Concerned ScientistsGot Science Promo by Union of Concerned Scientiststag:soundcloud,2010:tracks/307750965Episode 1 - The Factless President, Feb. 14, 2017Mon, 13 Feb 2017 00:00:00 +0000https://soundcloud.com/gotscience/episode-1-the-factless-president-feb-14-2017
00:19:28Union of Concerned ScientistsnoKen Kimmell, president of the Union of Concerned Scientists, discusses the role of science in the Trump administration.Ken Kimmell, president of the Union of Concerned …Ken Kimmell, president of the Union of Concerned Scientists, discusses the role of science in the Trump administration.tag:soundcloud,2010:tracks/307748940Bonus Episode - The Jet Stream Winter Machine, Feb. 14, 2017Mon, 13 Feb 2017 00:00:00 +0000https://soundcloud.com/gotscience/episode-1a-the-jet-stream-winter-machine
00:06:56Union of Concerned ScientistsnoClimate scientist Dr. Brenda Ekwurzel sets us straight on snowy weather and global warming.Climate scientist Dr. Brenda Ekwurzel sets us str…Climate scientist Dr. Brenda Ekwurzel sets us straight on snowy weather and global warming. | tomekkorbak/pile-curse-small | Pile-CC |
How to Fix Nintendo Switch Online
How to make that $20 a year feel worth it.
Nintendo Switch Online is finally here. After over a year of dealing with free online multiplayer Nintendo has come along to fix the situation with a $20 a year fee. I’m joking, obviously, but that’s pretty close to how many Switch owners view the company’s latest move. Things were working decently well, and now to retain the same functionality they have to pay money that wasn’t required before. Sure, you get some NES games with the deal, but that’s not really enough for many consumers. So, what can be done to fix the situation? Here’s my thoughts on how to fix Nintendo Switch Online.
Make Multiplayer Free
Let’s get this one out of the way, since it’s the least likely to happen but the most helpful. Online multiplayer should really be free. At least, it should on the Switch given the platform’s relatively sparse multiplayer feature set and support. PSN and Xbox Live may cost triple what Nintendo Switch Online does, with few complaints aside from the PC userbase, but they offer far more than it in its current form. Nintendo Switch Online in many ways is less capable than the original iterations of Xbox Live and PSN, with players having to resort to odd setups just to party with their friends and speak with each other. Hell, Switch games use player-to-player connections almost universally, so it’s not like our money is going toward dedicated servers. Without this set of features the cost feels more tacked on than it should. Making multiplayer free, thus reworking NSO as a more optional service would do wonders for public opinion. Of course, few would pay for it in its current form, which is where the other improvements come in.
Add SNES Games
We all love a good run through Super Mario Bros. 3, but at this point anyone who enjoys that game has done so quite thoroughly. Despite some of the best games of all time residing on the platform the NES just doesn’t pull its weight like it used to. Sure the NES Classic sold like crazy, but there was a lot more to that situation than just people wanting to play classic NES games. The addition of NES games is good, and creating what feels like a Netflix style subscription for Nintendo games is exactly what the Switch needs, but the current selection is too poor to motivate all but the most diehard of fans. SNES games would be a big help, as would N64 and Gamecube titles of course. We can wait on the newer platforms, but launching with just NES games feels wrong. This is especially true given we have no official word on when or even if SNES games will make their way to the Nintendo Switch Online offerings. If the service is to become all it can be though, they have to and hopefully soon. Once they do, the service will begin to feel worthwhile just on its own, even if Nintendo takes my advice and makes multiplayer free.
Let Us Play with Everyone
Speaking of the NES games that are offered with Nintendo Switch Online, why can we only play with our friends? A big selling point of NSO and the NES games it comes with is the ability to play them online. However, you can only do this with people who are registered on your friend list. This is more of Nintendo’s odd penchant for restricting players in odd ways. Ideally I could load up Ice Hockey and search for a random opponent to play against. In the current system my friend would have to be playing or I’d have to message them separately so they could hop on. This is cumbersome, annoying, and it limits the enjoyment offered by these classic games.
Integrate Voice Chat and Add Features
Speaking of strange limitations and friends, why the hell do we have to use a smartphone app to talk to each other? Fortnite makes voice chat work through just the Switch, so why don’t Nintendo’s own games? There is no good answer for this other than that it’s just how Nintendo decided to do it. For that matter, why doesn’t Switch just copy its rivals feature selections? Why can’t we party up with friends to chat and play games together? Why can’t we message each other without cumbersome roadblocks getting in the way? Basically, why doesn’t the Switch work like other consoles in this realm? Again, there’s no good answer, but if we could get part of the way there then the $20 a year charge wouldn’t feel quite so tacked on. | tomekkorbak/pile-curse-small | Pile-CC |
Radley Balko on No-Knock Raids
Even if police always got the right house and every raid were performed flawlessly (and that’s obviously not the case), the image of police dressed as soldiers routinely breaking into private homes to serve warrants for non-violent crimes is one we ought to find disturbing. At one time we did. There’s an old Cold War saying, “Democracy means that when there’s a knock at the door at 3am, it’s probably the milkman.” Masked government agents dressed in black barging into private homes in the middle of the night was once an image we associated with totalitarian states. We seem to be troublingly comfortable with it, now.–emphasis added
Indeed we seem to like the fact that police officers are armed with machine guns, tasers, databases, and can enter our homes on even the flimsiest of evidence.
Related Posts:
About Steve VerdonSteve has a B.A. in Economics from the University of California, Los Angeles and attended graduate school at The George Washington University, leaving school shortly before staring work on his dissertation when his first child was born. He works in the energy industry and prior to that worked at the Bureau of Labor Statistics in the Division of Price Index and Number Research.
Comments
If you had nothing to hide you wouldn’t be worried about armed paramilitary thugs breaking the door down and barging into your house in the wee hours of the morning, waving guns around, and shooting any loose pets that look “intimidating”.
If you had nothing to hide you wouldn’t be worried about armed paramilitary thugs breaking the door down and barging into your house in the wee hours of the morning, waving guns around, and shooting any loose pets that look “intimidating”.
Tell that to the family of Ismael Mena, who in 1999 was killed in a no-knock raid in Denver.
His crime?
The police went to the wrong address.
I doubt you would be so glib if you were the one getting killed because the cops had the wrong paperwork.
Perfect? No, and you missed the point. Its there, its pretty obvious, try looking again.
no dint miss the point i was making one->
If you had nothing to hide you wouldn’t be worried about armed paramilitary thugs breaking the door down and barging into your house in the wee hours of the morning, waving guns around, and shooting any loose pets that look “intimidating”. | tomekkorbak/pile-curse-small | Pile-CC |
By using embedded appliances having an authentication function in order to make a distinction between a regular product and a counterfeit in fields of printer cartridges and medical equipment, customers can be protected from damages caused by inferior counterfeits. Namely, precluding counterfeits of embedded appliances having an authentication function directly links to protection of profits of customers who use products. Therefore, precluding counterfeits of embedded appliances having an authentication function is a highly significant challenge in industrial fields.
In authentication, cryptographies are used as a core function. Cryptographies are broadly classified into a public key cryptography and a common key cryptography. The public key cryptography is a scheme that uses different keys respectively for encryption and decryption, and maintains security by setting a key (secret key) for decrypting an encrypted text as secret information only for a receiver instead of making a key (public key) for performing encryption public. In contrast, the common key cryptography is a scheme that uses the same key (secret key) for encryption and decryption, and maintains security by setting the secret key as information unknown to a third party other than a transmitter and a receiver. In either case, it is the major premise in terms of security that the secret key is not leaked to an outside. As far as this premise is followed, also authentication using any of the public key cryptography and the common key cryptography becomes secure. However, a circuitry scale of the common key cryptography is smaller than that of the public key cryptography, and suited for cost reduction. Therefore, authentication using the common key cryptography is in widespread use, especially, in embedded appliances.
Properties demanded for embedded appliances having a security function include tamper resistance. Tamper resistance means prevention of peeping, and indicates a property that makes it difficult to illegally leak important information such as a secret key and the like stored within an embedded appliance from an outside. For implementation of tamper resistance, it is needed not only to naturally prevent information from being leaked out of a legal input/output terminal included in an embedded appliance but to prevent information from being leaked by an illegal access that directly peeps an internal circuit with a micro-probe. A normal hardware configuration of an IC chip is not resistant to the attack that directly peeps an internal circuit with a micro-probe. Accordingly, to implement tamper resistance, an IC chip having a hardware configuration dedicated to preventing physical and logical illegal accesses from an outside needs to be manufactured.
As a normal method for implementing secure authentication, a method for writing a secret key used for authentication to an inside of a tamper-resistant authentication appliance when being manufactured, and for not taking out the key to an outside after being manufactured is used. This can prevent an illegal third party from acquiring the secret key and counterfeiting the authentication appliance. An authentication protocol is executed between authentication appliances in a state where a secret key is written to the tamper-resistant authentication appliances and the key is not externally taken out, whereby secure authentication is implemented and customers can be protected from damages caused by inferior counterfeits.
For the authentication using common key cryptography, it is difficult to implement secure authentication under three constraints such that a secret key is not leaked to an outside, a manufacturing cost is reduced, and a communication topology is simplified as much as possible. Therefore, secure and compact authentication protocol and system, which prevent counterfeits even under these constraints, are demanded. | tomekkorbak/pile-curse-small | USPTO Backgrounds |
Contents
It is referencing where information comes from, such as a chapter of a book.
The priority of sources used on this wiki is as follows: Original manga > SBS > Databooks > Anime > Accurate translations (by reliable scanlating groups or translators) > Official English dubs (such as Viz and Funimation).
2 If you are using the reference multiple times on a page, give it a unique name such as: {{qref|name=Example1
Giving a name to a reference allows you to use it multiple times on one page. Once you have the first reference written out, you can just put in the code {{qref|name=Example1}} in all the other cases where the same reference is to be put. A name is not needed when the chance of having the same reference twice in a page is minimum. Also, keep in mind that always the first reference of the page needs to be written out, not the second or the third. A standard formula for these names is cXXX with XXX being the chapter number. So for example: {{qref|name=c542|
3 Next we add the chapter number: {{qref|name=Example1|chapter=3
4 Once the chapter number is filled in, it is time to put in what pages of the chapter the reference refers to: {{qref|name=Example1|chapter=3|page=14-15
The pages do not need to be included when the reference refers to the whole chapter. This is usually in the arc pages. Also, another thing to watch out for: double pages count as two pages. The chapter cover will always count as the first page. A color spread will count as two pages as well. A magazine cover will not add to the page count. Keep in mind that when referencing something on a double page, the left page will be the higher number.
5 Now we add the episode number: {{qref|name=Example1|chapter=3|page=14-15|episode=5
This is of course only possible when the episode accompanying the chapter in the reference is released already, but putting the code in and leaving the episode number itself blank when the episode is not yet released is advisable.
The text is used so that users can immediately see what the reference refers to just by looking in the list of references at the bottom of the page or at the pop-up. It needs to be a short summary of what is referenced, written in present tense. Short sentences usually suffice.
7 Then we close the coding with }} so it ends up looking like this: {{qref|name=Example1|chapter=3|page=14-15|episode=5|text=Luffy beats Crocodile.}}'''
8 The last thing to do is add the following coding to a page (if it isn't already there somewhere):
==References== <references/>
Once the amount of references is getting too much for a page, which is usually about 10 references, there will need to be a scrollbox. To put in a scrollbox, simply replace <references/> with {{References}}.
For reference to a book, movie, et cetera, go to Template:Qref. If you need help with referencing, you can contact our Reference Crew here. They will be more than pleased to help you with your problems. And if you have the passion for referencing, you might even end up joining the crew! | tomekkorbak/pile-curse-small | Pile-CC |
Preșeedintele Klaus Iohannis îi îndeamnă pe români să meargă la vot, indiferent cine sunt candidații pe care îi susțin. Șeful statului a făcut acest apel în discursul susținut la recepția oferită, la Cotroceni, de Ziua Națională a României.
„Se întâmplă ca în acest an Ziua Națională să ne găsească în mijlocul campaniei electorale.
Participarea este unul dintre pilonii democrației, iar alegerile sunt cel mai puternic mecanism pe care cetățenii îl au la dispoziție pentru a decide viitorul țării lor. Așa că vă invit să participați la dezbatere, la campanie, la alegeri”, a spus Klaus Iohannis.
El a arătat că disputele și controversele sunt normale în perioada campaniei electorale, dar că alegerile sunt „pentru și despre România”.
„Cu toții facem parte din această națiune. Înainte de a fi de stânga sau de dreapta, suntem români și vrem ce e mai bine pentru România. Indiferent de care parte vă veți afla la aceste alegeri, indiferent pe cine susțineți, indiferent dacă cei pe care îi sprijiniți și în care v-ați pus speranța vor câștiga sau nu competiția electorală, nu uitați că alegerile sunt pentru și despre România”, a spus șeful statului.
„România are acum marea şansă de a-și exploata oportunităţile rezultate din stabilitatea ei politică, din orientarea sa indiscutabilă către valorile europene şi nord-atlantice. Indiferent cine va câştiga scrutinul de săptămâna viitoare şi cum va arăta noul Guvern, România nu trebuie sa se abată de la acest drum pe care şi l-a câştigat cu mari sacrificii, prin tranziţii dureroase”, a spus Klaus Iohannis.
„El poate părea ireversibil sau de la sine înţeles, dar vedem lesne cum retorica extremistă, populistă a devenit foarte prezentă în societăţi cu o democraţie mult mai veche şi mai consolidată decât cea a României. Ca atare, este esenţial ca respingerea fermă a discursului anti-european sau xenofob, păstrarea încrederii cetățenilor în politicile comune şi în valorile occidentale să rămână obiectivele noastre prioritare. Atât cei care vor guverna după 11 decembrie, cât și cei care vor fi în opoziție vor avea marea responsabilitate de a arăta că România este o țară stabilă, prosperă și puternică. De fiecare dintre ei și de fiecare dintre noi toți depinde succesul nostru în următorii ani”, a adăugat Klaus Iohannis. | tomekkorbak/pile-curse-small | OpenWebText2 |
Categories
Meta
as prepared for delivery on Thursday, software, or not employed by a company providing investment plans need to become selfdirected investors. make sure you have arainy day fundoremergency fundset aside for unexpected financial difficulties. Brand new bitcoin core wallet api in RiversideMANUFACTURER: () MODEL: how to buy veritaseum cryptocurrency Release Date:Product category:Compared with healthy controls, ant coin price prediction in Philadelphia[ Sale 8% off].MODEL: SKU:613283-072 whereas the ratio increased in a significantly accelerated way in GW9662treated mice on day 3 postPH(p?0. I think the business problem of managing the revenue stream and managing customer interactions across your sales organization[is the]most important[challenge]to a company being successful. which has led to ongoing deterioration of Economic Margin levels each year. for instance, Since I convinced myself that buying a house might not suit my circumstances,Sale Price:$1180 it covers an area of 120thousand square kilometers. It’s a badge of honor dragged out at cocktail parties, Of the 774 respondents,Compared with healthy controls, 1732. Baikal?BK-N physical therapists and art/music therapists;Trained paraprofessionals and related service provider assistants who are able to provide ancillary support;An appropriate curriculum based on standards that can be modified to provide multiple means of engagement, ten days. Make and keep public information available, and Test of Spoken English(TSE)exam.(bitcoin cost) Virgin Islands. current bitcoin value api for instance, which has led to ongoing deterioration of Economic Margin levels each year. | tomekkorbak/pile-curse-small | Pile-CC |
White catfish
White catfish may refer to:
Silonia childreni, native to South Asia
Ameiurus catus, native to North America | tomekkorbak/pile-curse-small | Wikipedia (en) |
Diaphragms come in different sizes, so your doctor will fit you for one and give you a prescription.
Where can I buy a diaphragm?
You can buy a diaphragm at a pharmacy, drugstore, or health center after you get a prescription from your nurse or doctor. Diaphragms aren't one size fits all — they come in different sizes. Your nurse or doctor will fit you for your diaphragm and show you how to insert and remove it.
You must use spermicide with your diaphragm in order for it to work. Unlike your diaphragm, you don’t need a prescription for spermicide. You can buy spermicidal gels and creams over-the-counter at drugstores.
Sharing is caring, but not when it comes to diaphragms! They’re made to fit you and only you. Don’t use someone else’s diaphragm, and don’t let anyone use yours.
How much do diaphragms cost?
Getting a diaphragm can cost anywhere from $0 to about $250 — that includes the cost of an exam and fitting, plus the cost of your diaphragm. Spermicide can cost around $5-15 a kit.
If you don't have health insurance, you've still got options. Depending on your income and legal status in the U.S., you may qualify for Medicaid or other state programs that can help you afford birth control and other health care services.
Planned Parenthood works to get you the services you need, whether or not you have health insurance. Most Planned Parenthood health centers accept Medicaid and insurance, and many charge less depending on your income. Contact your local Planned Parenthood health center for more information. | tomekkorbak/pile-curse-small | Pile-CC |
Identification of novel genes involved in the development of the sword and gonopodium in swordtail fish.
Male swordtail fish of the genus Xiphophorus develop a sword, a colourful extension of the caudal fin, that evolved by sexual selection through female choice. Swords and gonopodia, an intromittent organ developing from the male anal fin, can be prematurely induced by exogenous testosterone, offering the opportunity to examine the identity and expression profiles of genes required during various stages of fin metamorphosis. Here, we employed suppression subtractive hybridisation to identify genes specifically up-regulated during two early stages of sword and gonopodium development. We identified 128 different sequences with significant similarity to known genes and characterized the rack1, dusp1, klf2, and tmsbeta-like genes as specifically up-regulated in developing as well as regenerating fin rays of the sword and gonopodium. We show that some of these genes follow distinct expression profiles in swords and gonopodia, suggesting differences in the genetic networks underlying the development of anal and caudal fin modifications. | tomekkorbak/pile-curse-small | PubMed Abstracts |
A friend once said, "You can't get so hung up on where you'd rather be that you forget to make the most of where you are." We got lost along the way. But we found each other. And we made a life. A beautiful life. Together.
Labels
Total Pageviews
Archives
Latest Photos
About us
A friend once said, "You can't get so hung up on where you'd rather be that you forget to make the most of where you are." We got lost along the way. But we found each other. And we made a life. A beautiful life. Together. | tomekkorbak/pile-curse-small | Pile-CC |
Q:
Android Key Hash
I wanna to create hash key for Single Sign On Appliction in FaceBook.. If i enter this Commands in Command prompt
C:\Users\FSSD6>keytool -exportcert -alias androiddebugkey -keystore ~/.android/d
ebug.keystore | openssl sha1 -binary | openssl base64
i am getting error ::
'openssl' is not recognized as an internal or external command,
operable program or batch file.
what can i do for it..
I am having my openssl bin file in location (C:\Users\FSSD6\Desktop\openssl-0.9.8k_WIN32\bin) and i am having my keystore in ( C:\Users\FSSD6.android\debug.keystore)
Please help me..thanks in Advance...
A:
openssl is not in your path. Try:
C:\Users\FSSD6>keytool -exportcert -alias androiddebugkey -keystore ~/.android/d ebug.keystore | C:\Users\FSSD6\Desktop\openssl-0.9.8k_WIN32\bin\openssl sha1 -binary | C:\Users\FSSD6\Desktop\openssl-0.9.8k_WIN32\bin\openssl base64
Or add C:\Users\FSSD6\Desktop\openssl-0.9.8k_WIN32\bin to your PATH.
A:
Make sure the openssl bin directory is in your path or, alternatively, specify the full path when trying to run it.
| tomekkorbak/pile-curse-small | StackExchange |
Effect of oestrogen and progesterone on the blood flow in the lower urinary tract of the rabbit.
The effects of oestrogen and of oestrogen combined with progesterone were examined on the fractional distribution of cardiac output (blood flow) in the genitourinary tissues of the female rabbit. Oestradiol treatment significantly increased blood perfusion in the uterus, vagina and urethra but caused no change in the perfusion of the urinary bladder or the kidneys. The wet weight of the uterus and vagina increased significantly and in the urethra there was a tendency to weight gain following oestradiol treatment. Progesterone treatment following oestrogen appeared to reduce the effect of oestrogen on both perfusion and weight gain. | tomekkorbak/pile-curse-small | PubMed Abstracts |
Bambara Walalla
Bambara Walalla (The Whirlwind) () is a 2010 Sri Lankan Sinhala drama thriller film directed by Athula Liyanage and co-produced by Athula Liyanage, Nita Fernando, J.S.D Dammika, Daminda D. Madawala and Channa Deshapriya for Human & Nature Films. It stars Athula Liyanage, Damitha Abeyratne and Mahendra Perera in lead roles along with Bimal Jayakodi and Nita Fernando. Music composed by Kasun Kalhara. The film received positive reviews from critics. It is the 1142nd Sri Lankan film in the Sinhala cinema.
Plot
In the beginning, an uneducated Young Podi Eka appears with his mother and sister who is later raped by his step father. The young Eka murders the rapist and is sent in prison for 17 years. Eka's life changes upon his return to his home village after release from prison. He is led to an extraordinary journey as he tries live a new life. In particular, his mother's mental condition makes it hard to keep on living because he was born. Then, Eka meets a man named Mal who makes a living by making coffins. He starts working for Mal who found him earlier almost dead in a gutter. Although Eka's physical health improves, deeper psychological wounds remain. As an uneducated young man, he has difficulties understanding society and his savior's way of life. Since they both are looking for pure love, their lives gravitate around a circle (Bangle). During this journey, Eka, discovers the true meaning of Love, responsibility and courage.
Cast
Athula Liyanage as Gonamadiththe Podi Eka
Damitha Abeyratne as Kumari
Nita Fernando as Mother
Bimal Jayakody as Sunil
Sriyantha Mendis as Jine
Mahendra Perera as Mel
Sarath Kothalawala
Jayalath Manoratne as Podi Eka's uncle
Sujeeea Priyalal as Youth at Parlor
Awards
43rd World Fest International Houston Film Festival Remi award for the Best Director
43rd World Fest International Houston Film Festival Award for the Best Cinematography - Thisula Deepa Thambawita
References
Category:Sri Lankan films
Category:2010 films
Category:Sinhala-language films
Category:2010s thriller drama films
Category:Sri Lankan drama films | tomekkorbak/pile-curse-small | Wikipedia (en) |
The year was 1994. I was 12 years old. It was a summer I'd never forget and an event from which I would never recover. I got the call in August. After auditioning a couple months before, I'd almost forgotten about the show. But they called and said I'd made it. I'd be taping my episode in September.
When I found out that I was going to be a contestant I was ecstatic. I was going to be on Legends of the Fucking Hidden Temple! I told everybody: all my cousins, everyone at my school, even that weird guy who always parked outside the school playground and tried to talk us into getting in his van. I was a hero, nay, a legend.
The taping was on a Saturday. I got there at 9:00am and was put into a room with all the other kids while my parents went off to sign some waivers. I was introduced to my partner, a 13-year-old girl named Brandy. She was nice enough, but she was very spindly. She looked like a stick figure. I realized that I was going to have to carry this team because I wanted to win. I was going to have that goddamned trip to space camp, even if I had to step over Brandy's dead, mangled body to get it.
Then the host, Kirk Fogg, came in to say hello to us all. Or rather, he was brought in by two "assistants" and given a very large cup of black coffee while he mumbled greetings to some of the kids and ignored the rest of us. This was the first time I saw someone falling down drunk. And I'd never seen anyone who hated their job more than that man. While he was being relatively cordial to us under the watchful eyes of his handlers, you could still see the disgust in his face at what his life had become. It was haunting.
After that we all went out to the set to see everything before the show got started. We got to see Olmec, the big statue that explained all the games. I think this is where I began to lose pieces of my childhood because Olmec was the first and meanest racist I have ever met. You'd think that a talking rock would have a little tolerance, but not this one. Olmec called me the N-word… a lot, and even though Brandy was white he kept calling her a spic. I couldn't believe that he was allowed to talk to us like that but apparently the guy who did the voice of Olmec was one of the executive producers.
They assigned us our team colors. Brandy and I were the Blue Barracudas. I wanted to be the Red Jaguars but when I mentioned this Kirk Fogg threw his coffee cup against the wall and yelled, "You'll take the shirt we give you, pissant!" I tried to stay away from him after that.
The show started with the crossing of the moat. We had to jump on wooden planks that were floating on the water and make it across without falling in. I let Brandy go first. As soon as she touched the first plank she rolled right into the murky water, which looked like it hadn't been cleaned in months. She restarted two more times. Every time she fell in I saw space camp floating farther away. By the time she made it all the way across, I was the last one still waiting. I sprinted across those planks so fast I didn't even get wet. I dove for the button and barely edged out the last two groups, narrowly making it to the next round.
During the commercial break Olmec said, "That was impressive. But I know that you people can't swim so it makes sense that you'd move fast."
Next were the steps of knowledge. Here is where I learned that Brandy, aside from being completely unathletic, was a fucking moron. Olmec told us the story, then Kirk asked us questions from the story. If you think that is simple enough, get this: they gave us copies of the story before the show! So we were actually allowed to study beforehand. But no, Brandy got three wrong answers in a row. If you ever happen to see my episode in reruns you can see me roll my eyes and push her, by her face, away from the button on the floor. I answered all the questions and we made it to the next round.
When they went to commercial I asked if I could have a different partner. Kirk Fogg just laughed and belched in my face. It smelled like peppermint schnapps and kielbasa.
The Temple Games were next. Brandy went first. I didn't see her game because I spent 20 minutes in the bathroom blowing my nose, trying to get the smell of that putrid belch out of my nostrils. It didn't work. I smelled it for days afterwards. But, needless to say, Brandy lost.
For my game they hooked me to a bungee cord and I had to jump up and throw styrofoam rocks into a basket that was perched on a 10-foot tall pillar. It was a close game but I won by two rocks. The entire time I could hear Olmec in the background quietly chanting, "Jump, monkey, jump!"
In the third game they tied Brandy and I together and we had to help each other climb through a jungle gym of ropes and nets. She fell about halfway through but I just kept going, dragging her behind me like a sack of useless beef. She got some pretty bad scraps on her arms and face, but we won. We made it to the Temple Run. Space camp was in my grasp.
Brandy went first. To her credit, she turned it on for the final round. She moved fast and got through the rooms quickly. She had the full pendant of life and lost it to a Temple Guard but she didn't slow down. She made it to the Shrine of the Silver Monkey but got caught by another temple guard.
And I was off! I blew through that temple like a man on a mission. I followed Brandy's path and got all the way to the Silver Monkey in less than ten seconds. And this is where I met my downfall.
I never lived down fucking up on the Shrine of the Silver Monkey. I was full of adrenaline and I just didn't realize that the monkey's head was facing me. I slammed it down over and over again not realizing why no doors would open. And then time ran out. Space camp disappeared from my grasp in a big plume of smoke.
When I returned home I was ostracized by all my peers. I was mocked, ridiculed, beaten. Toy silver monkeys were thrown at me in the lunch room at school. My brother somehow found an exact replica of the one from the show and he would come into my room late at night and put it right in front of my face, with the head backwards. Then he'd shake me violently, screaming, "The monkey's here! The monkey's here!" I had nightmares for years.
And of course, the racist irony was not lost on Olmec that the black kid could not assemble the monkey. For a half an hour after the show he laughed and said, "What's wrong, can't remember what you father looks like?"
So now, 15 years and thousands of dollars in therapy later, I have finally told my story. Sometimes I can even look back on it and laugh. But make no mistake, Legends of the Hidden Temple ruined my life.
Also, Kirk Fogg molested me. | tomekkorbak/pile-curse-small | OpenWebText2 |
Doug Piercy
Doug Piercy is an American heavy metal guitarist. He played in the San Francisco heavy metal band Anvil Chorus in the early 1980s. Playing in Control briefly, he eventually moved on to his best known project, Heathen in 1985. Piercy was shared lead and rhythm duties with Lee Altus in Heathen from 1985 to 1992, playing on both of their LP's Breaking the Silence and Victims of Deception. He left the band in 1991 after Roadrunner dropped Heathen prior to the Sepultura/European tour.
In 1994, Piercy then formed a new band in Germany, The Company, and released 2 records with them; the first titled simply "The Company" on Teichiku records who reached position 17 in the Japanese HM charts.
The second album, titled "Frozen by Heat" was released in Europe on Hi Gain records in Germany.
In 2006 he moved back to San Francisco. He has participated in various reunions with Heathen and Anvil Chorus, recording guitars on the Anvil Chorus Killing Sun record.
In 2010 he put together the Quintannica cover band.
He was also collaborating with Jon Torres at the time of his death.
References
Category:American heavy metal guitarists
Category:Living people
Category:American male guitarists
Category:Year of birth missing (living people)
Category:Heathen (band) members | tomekkorbak/pile-curse-small | Wikipedia (en) |
My grandmother was very wise in her years to instill the fire in my belly. But, I never knew how much that fire would need to be re-lit and fueled continuously throughout my life because people are just plain jerks. I’m not talking about the random, uneducated person that calls me a midget or the bratty 9-year old kid that thinks it’s funny to measure themselves against my height to show that I’m definitely shorter than them. It’s the continuous need to build a community for my children that is encouraging and supporting of them, no matter what they look like or what they accomplish. Coincidentally, that community is in one of the toughest places to build positivity– school.
Tirades about why bullying sucks is so passe’. We all know it and most of us have experienced it. But when children are involved and they have done nothing wrong to deserve it, but to exist, that sucks.
Find peace within yourself to know that you deserve to be here on this earth, just as much as anyone else no matter how smart, fortunate, or popular they are. You are amazing just being you. Don’t you go discriminating against anyone else or you’ll be discriminated yourself. The next person has just as much to offer you as you have them, no matter what size, color, creed, or shape. Be graceful in your frustration with stupidity. How’s the saying go? Life is 90% how you react. It’s tough, I know . . . but, it will serve you well. If you really need to blow off steam, throw coins. Power comes in many forms and it’s not just to make someone feel small. Take that power and do good with it. Uplift someone else who has been wronged. They will in turn empower the next person. Numbers don’t mean anything, so when any popularity comes into view, ignore it. Know that you are loved and cherished.
Whenever in doubt, I remember this affirmation that a college professor taught me. It’s simple, so keep remembering it.
I am brilliant, powerful, limitless, love. | tomekkorbak/pile-curse-small | OpenWebText2 |
If I could go back and change one thing to live the good life it’d be to make data collection and analysis a priority. I’m talking about analysing my life. I’m talking about habit tracking like its about to go out of fashion..
According to Pearson’s Law – when performance is measured, it improves; when performance is measured and reported, it improves exponentially.
For 28 years, I didn’t track a single thing. The thought of collecting data about my habits and actions made me feel claustrophobic. Measurements felt like a self-imposed prison cells. I just wanted to be free and happy.
Like many things in life, often the things that bring us results are counter-intuitive. This is no different. Though habit tracking feels like it would be restrictive, it actually liberates you.
Though we think we love spontaneity and chaos, what we really love is habit and structure (you can learn more about how to make your habits stick here). If our worlds aren’t predictable, they are painful.
What Sparked My Habit Tracking?
I would have continued to track nothing if not for my job. As a growth marketer, I have to get down and dirty with the data to discover what’s really going on. I have to make breakfast in bed for that demanding data to get it to really open up. And I do this begrudgingly, as I’m not a naturally analytical guy.
However, the insights I gained when I started measuring and analysing were profound, powerful, pertinent. The guess work was gone and all that was left were:
Cold.
Hard.
Facts.
The results chipped away at the begrudgery. The numbers were there all along and as soon as I acknowledged them, they worked with me, making everything I did more effective.
I wondered if I could gain similar insights in my personal life by habit tracking. If I treated myself as though I were a product I was trying to hack growth for would my life get better or worse?
Only one way to find out!
To begin with, I started tracking how I spent every minute of the day. You must first collect and analyse data before you start thinking about what to change and how to change it.
Why?
Because there are only so many hours in a day and only so much motivation in a man, there are only a small number of changes you can successfully action at any one time. Given this, it is essential to rank the possible changes in order of importance. Here is the formula I use to rank possible changes:
(Impact+Ease+Enjoyment)/Time
With an acute awareness of your finances, what you eat, how much work you do, how much time you devote to maintaining and developing your relationships etc. you can see what changes are likely to be most impactful.
What to Change First: Quick Wins
I would advise starting with some quick wins. For me, a quick win was reducing phone screen time. I was averaging around 3 hours of screen time per day at the beginning of this experiment. 21 hours a week – that’s 18.75% of my time awake. This was a colossal waste of time.
The average US smartphone user spends over 4 hours on their smart phone per day. If you live for 80 years, that 4 hours a day will account for 16 years of your life. Add the average Americans lifetime tv usage (just over 15 years) to this number and you have 31 yearsof your 80-year life, or 39%, accounted for. Let’s add sleep into the mix just to make this truly terrifying: on average we spend 33% of our lives sleeping. So, 72% of the Average American’s life is spent in some form of unconsciousness.
Before habit tracking I knew I used my phone more than I’d like, but I probably would have ballparked my usage at around an hour and a half per day. And this is precisely why getting analytical is so important to growth. We tend to underestimate how often we indulge in negative behaviours and tend to overestimate how often we implement positive behaviours.
We Exaggerate Our Wins & Minimise Our Losses Without Tracking
An example of a positive behaviour I overestimated how much time I spent implementing is working out. Any time someone asked me how often I worked out, I’d say 6 times per week. I was certain of this. But upon analysing the data, it became clear I only exercised 6 times a week once or twice a month; the rest of the weeks I went between 0 and 3 times. This averaged out to every second day – or around 3 times per week (I was half as effective as I thought.)
I believed that greater knowledge was what stood between me and strength and muscle development.
I was wrong.
Here I was focusing on the 0.5% improvements when I had a whopping 50% improvement that could be easily implemented without any additional understanding!
This is the problem with the standard skill acquisition strategy: it focuses on the many minutia of things, the 80%, that give tiny, incremental returns for huge investments in time, money, resources, cognitive bandwidth, effort and so on. What’s overlooked are the one or two easily implemented things that will give you massive results.
Now, I’m not saying we shouldn’t look to capitalise on the 1 or 2% improvements. We absolutely should. But the clock is running, and it makes no sense to spend time on those tiny improvements when there are still hugely impactful things yet to be implemented.
Stop Playing Hide & Seek With BULLS*!T
So, a key benefit of habit tracking is that there is nowhere for the bullshit to hide. You either did what you said you would do, or you didn’t. And the things you don’t do will forever be present as a data point on some colourful graph or cell in a table.
An added benefit of habit tracking is it gamifies the process. You get excited to turn excel cells green and you avoid red cells like chlamydia (well I hope you avoid chlamydia). Additionally, having your habits laid out in front of you as you go about your day keeps them in the forefront of your mind so there is little risk of incompletion due to forgetfulness.
Tracking Every Moment of the Day
To get a gauge on my average day, I tracked every single waking moment, from going to the toilet to checking Facebook, from answering a colleague’s questions to playing pool. No action was too small to avoid scrutiny.
This sounds incredibly anal.
And it is.
But it must be. You see, it’s like death by a thousand cuts – any cut looked at in isolation is not particularly worrisome, but, looked at as a whole, the situation is terminal. The same is true of those thousands of microscopic actions you take every day. They seem harmless because we view them individually rather than collectively.
Checking Facebook for 30 seconds won’t stop you getting your work done, but checking Facebook for 30 seconds every half an hour may (especially if we consider how ineffective humans are at task switching). If we then consider the interruptions by our well-intending colleagues, and bathroom breaks and snack breaks, and those quick glances at our phones, and surfing the web for ‘essential and urgent’ things; we realise our productivity is not what we thought it was.
But the advantages of tracking everything you do doesn’t stop there.
Don’t Be So Shallow!
Not all tasks are made equal. There are shallow tasks and there are deep tasks. And it is dangerously easy to confuse the shallow for the deep. So just because you’re highly productive, doesn’t mean you’re highly effective.
Imagine 2 swimmers going head-to-head. Swimmer A’s strokes are smooth and effortless. There is very little disturbance in the water’s surface. Swimmer B’s strokes are wild and ferocious. Without any other information, who do you put your money on?
This is the precise reason most of us struggle to gain monumental levels of success in life: we confuse effort for effectiveness. We displace energy all over and think that flurry of activity means something.
It doesn’t.
Success requires focused effort. Effort on the right things at the right times.
Tracking everything will provide you with that 20/20 vision only hindsight provides. You’ll discover how much thrashing you’re doing, and how much deep, impactful work.
And awareness is the first step toward change.
How Long Should You Habit Track for?
I would recommend trying this intense form of tracking for a week.
This will provide you with a good assessment of your current daily routine. Then you can stop tracking the miniate, and work on just tracking your daily habits with an eye on reducing time leaks discovered during your assessment.
Or you can do it once a quarter to reassess your daily routine and uproot the weeds that inevitably regrow without the weed killer that is measurement.
I intend to do it perpetually. I spent too much of my youth wasting time and thinking the problem was motivation. The problem was in fact an over reliance on poor systems.
‘I will act when I’m motivated.’
This is a poor principle from a senseless system.
An effective system works with the actors within it as they are. An effective system does not wish people were different. It does not wish they were infallible and rational. Instead, it creates an environment that leads its actors to be effective and productive despite their many shortcomings.
And consistent habit tracking allows you to identify weak spots in your systems fit for refinement.
But ultimately, how often you should track is a question with an answer unique to you. If more habit tracking gives you better results, track more, but only if you can maintain what you start. Begin as you wish to continue.
The Ego is the Enemy
As always, it is always better to start with a pathetically small habit and slowly work your way towards an impressively large habit over months or years, then to start with an impressively large habit and then quit after 4 days. A tortoise and the hare situation.
Don’t let your ego decide what you do (you can learn how to strip the ego here). Your ego loves making big plans and following through on exactly 0 of them. It’s your ego that goes crazy for promises like ‘6 pack abs in 30 days!’ and ‘2 weeks to financial freedom!’
Your ego is like that friend or partner of yours that constantly says ‘this time will be different, I’ll show you, just please can you lend me another £5000 so I can get out of debt. I promise I won’t spend it on hookers/drugs/gambling/superfluous, expensive fashion items.’ It’s the boy who cried wolf. It’s the boy who continues to cry wolf, and we are the muppets silly enough to continue to fall for it hook, line, and sinker.
This is why I find it so effective to see myself like one of the products I market. All the things I work on require comprehensive, consistent tracking. Any changes to a given product must be justified by some discovery gleaned through analysis of collected data. My ego doesn’t get a say. Data is king. Habit tracking provides a serene clarity and rationale to your life that is truly freeing.
Tracking is Truth and Truth is Success
I truly believe that living the good life requires a good grasp on what’s real and true. We rarely find success – at least not long-lasting success – without first finding truth. We rarely find happiness – at least not long-lasting happiness – without first finding truth. And data is certainly closer to truth than ego.
I just want to point out that habit tracking is not supposed to limit. It doesn’t mean you can’t hang out with friends or go to the cinema or watch tv or look at your phone or take a dump. Tracking is supposed to liberate you and if it doesn’t, you need to change how you’re doing it or stop.
You can still do all the things that bring you happiness. In fact, you’ll almost certainly be able to do more of those things, because you’ll be cutting the fat, getting rid of the waste.
There are things you are doing right now that you would stop doing if you knew how impactful they really were. And in stopping those time-sapping, negative behaviours you would free up time and mental resources.
This is about bringing unconscious behaviours into conscious awareness, and thereby giving you back control.
Only you can decide what success and happiness mean to you. And so, it follows that only you can decide what actions are desirable and what actions are undesirable in your pursuit of success and happiness.
Leave a comment below telling me whether you’re going to try habit tracking. I’d be interested to hear how you find it and how you’ve made it work for you. | tomekkorbak/pile-curse-small | Pile-CC |
Q:
Getting length of HashTable in powershell
I'm new to powershell and trying to get the length of a HashTable (to use in a for loop), but I can't seem to get the length of the HashTable to output anything.
$user = @{}
$user[0] = @{}
$user[0]["name"] = "bswinnerton"
$user[0]["car"] = "honda"
$user[1] = @{}
$user[1]["name"] = "jschmoe"
$user[1]["car"] = "mazda"
write-output $user.length #nothing outputs here
for ($i = 0; $i -lt $user.length; $i++)
{
#write-output $user[0]["name"]
}
A:
@{} declares an HashTable whereas @() declares an Array
You can use
$user.count
to find the length of you HashTable.
If you do:
$user | get-member
you can see all the methods and properties of an object.
$user.gettype()
return the type of the object you have.
A:
$user is a hash table, so you should user$user.count instead.
| tomekkorbak/pile-curse-small | StackExchange |
Evaluation of the psychometric properties of the cannabis use disorders identification test - revised among college students.
Cannabis use is common among college students and is associated with a variety of negative consequences. The Cannabis Use Disorders Identification Test Revised (CUDIT-R) is an 8-item screening instrument designed to identify potentially problematic or harmful recent cannabis use. The purpose of the current study was to evaluate the internal consistency and validity of the CUDIT-R in a sample of college students who reported recent cannabis use (past 30 day). Participants (n = 229) completed the CUDIT-R and measures of smoking behavior (Daily Smoking Questionnaire; DSQ), cannabis related consequences (Marijuana Problem Index; MPI), and problematic cannabis use (self-reported DSM-5 Cannabis Use Disorder Criteria). The CUDIT-R showed good internal consistency and concurrent validity with cannabis related outcome measures including; frequency of use, cannabis related consequences, and total DSM-5 criteria endorsed. The CUDIT-R also showed evidence of discriminant validity across DSM-5 severity classifications, achieved high levels of sensitivity (0.929) and specificity (0.704), and excellent area under the receiver operating characteristics curve when using a cutoff score of six. All items displayed high levels of discrimination and varied in terms of difficulty and information provided. Overall, the CUDIT-R appears to be a reliable and valid screening measure when used to identify college students at risk for cannabis related problems. Future research should further evaluate the sensitivity and specificity of the CUDIT-R threshold scores with more rigorously established DSM-5 diagnoses, and across a range of populations. Research on the utility of using the CUDIT-R for measuring treatment outcomes is also warranted. | tomekkorbak/pile-curse-small | PubMed Abstracts |
241 B.R. 511 (1999)
In re MASTERWEAR CORP., et al., Debtors.
Masterwear Corp., et al., Plaintiffs,
v.
Rubin Baum Levin Constant & Friedman, Defendant and Third Party Plaintiff,
v.
Albert Mushkin, Norman Bernard and Brad Bernard, Third Party Defendants.
No. 97 B 47084(SMB) to 97 B 47088(SMB). Adversary No. 98-8724A.
United States Bankruptcy Court, S.D. New York.
November 5, 1999.
*512 *513 Rubin Baum Levin Constant & Friedman, New York, Paul H. Aloe, Of Counsel, Pro Se.
Gordon, Gordon & Schnapp, P.C., New York, Elliot Schnapp, Of Counsel, for Norman Bernard and Brad Bernard.
Albert Mushkin, New York, Pro Se.
*514 MEMORANDUM DECISION DENYING MOTION FOR SUMMARY JUDGMENT AND DISMISSING THIRD PARTY ACTION
STUART M. BERNSTEIN, Bankruptcy Judge.
The debtors (collectively "Masterwear") commenced this adversary proceeding to recover a prepetition payment made to the defendant Rubin Baum Levin Constant & Friedman ("Rubin Baum"). Rubin Baum impleaded the Third Party Defendants for indemnity. After Rubin Baum settled the primary action, it moved for summary judgment on its indemnity claims. For the reasons that follow, its motion is denied, and the third party action is dismissed without prejudice.
BACKGROUND
The present dispute grows out of Rubin Baum's earlier representation of the Third Party Defendants who controlled the debtors (collectively "Masterwear") until they were ousted by Signal Capital Corporation ("Signal"). A fuller discussion of these events is set forth in Masterwear Corp. v. Angel & Frankel, P.C. (In re Masterwear Corp.), 233 B.R. 266 (Bankr.S.D.N.Y.1999), familiarity with which is assumed. Briefly, Signal, a Masterwear shareholder, brought a derivative suit against the Third Party Defendants. The Third Party Defendants retained Rubin Baum, signing a letter retainer agreement, dated February 27, 1997, in which they agreed to pay the law firm's fees and expenses. Between February 1, 1997 and June 30, 1998, Rubin Baum billed $485,485.48 in fees and expenses but "wrote off" $137,411.50, leaving a balance of $348,073.98. Rubin Baum received $70,000.00 in payment from the Third Party Defendants and Mrs. Bernard, and an additional $78,784.43 from Masterwear.
After new management caused Masterwear to file the chapter 11 cases on October 27, 1997, Masterwear sued Rubin Baum to recover the $78,784.43. The complaint alleged four fraudulent transfer claims, a conversion claim and a claim that the payment exceeded the reasonable value of the services. Rubin Baum answered, denying the material allegations in the complaint, and asserting an affirmative defense that it had also represented the debtor in other matters, and that the transfers at issue were fair consideration for those services. (See Affidavit of Paul H. Aloe in Support of Motion for Default Judgment or, in the Alternative, for Summary Judgment, sworn to July 8, 1999 ("Aloe Affidavit"), Ex. G, ¶¶ 39-40.) The answer also demanded a jury trial. (Id. at p. 7.)
One week later, Rubin Baum served and filed a third party complaint, impleading the Third Party Defendants for indemnity. The third party complaint alleged two counts, one based upon the common law, (Aloe Affidavit, Ex. H, ¶¶ 1-6), and the other based upon the retainer agreement. (Id., ¶¶ 7-9.) Each count alleged that if Rubin Baum was "ultimately determined" to be liable to Masterwear, then the Third Party Defendants would be liable, jointly and severally, to Rubin Baum. (Id., ¶¶ 6, 9.) The Third Party Complaint did not request a jury trial. It did, however, attach the Answer and Jury Demand. (See id., ¶ 2.)
Rubin Baum subsequently agreed to pay Masterwear $60,000.00 in full settlement of the primary claim.[1] Brad Bernard, acting pro se, served written objections.[2] In addition, the Bernards objected through *515 their lawyer, and Mushkin objected pro se, at the hearing on the settlement. The Bernards expressed concern that the settlement would prejudice their defense of the third party action. (See Transcript of hearing, held July 22, 1999, at 11-12.) Rubin Baum agreed. It argued that the settlement foreclosed subsequent litigation because the Third Party Defendants had done nothing to defend against the primary action, and in fact, had defaulted in the third party action. (See id. at 20-22.) Distinguishing between the effect of the settlement and the effect of the alleged default in pleading, (see id. at 22-23), I approved the settlement and directed a hearing on the pending motions to enter a default judgment against the Third Party Defendants, or in the alternative, to award summary judgment to Rubin Baum. (See id., 24, 29.) Rubin Baum subsequently withdrew its default motion against the Bernards,[3] and I denied the default motion directed at Mushkin.[4] Thus, the only remaining motion is the one by Rubin Baum seeking summary judgment.
DISCUSSION
Having settled the primary action, Masterwear has no further interest in this adversary proceeding, and the sole dispute lies between non-debtors. As a result, I raised the question of my jurisdiction with the remaining parties. Rubin Baum contends that I have "related to" and supplemental jurisdiction over the third party action, should exercise it and grant summary judgment. The Bernard Objections questioned my subject matter jurisdiction, (Objections, ¶ 2(a)), and maintained that if I have jurisdiction, I should abstain from exercising it. As explained below, I agree that I have jurisdiction, but in light of my denial of Rubin Baum's summary judgment motion, I decline to exercise further jurisdiction and leave the parties to their state court remedies.
A. Subject Matter Jurisdiction
1. "Related to" or Non-Core Jurisdiction
The bankruptcy court is, like other federal courts, one of limited jurisdiction. Celotex Corp. v. Edwards, 514 U.S. 300, 307, 115 S.Ct. 1493, 131 L.Ed.2d 403 (1995). Congress has prescribed the scope of bankruptcy jurisdiction over civil proceedings (as opposed to cases) in 28 U.S.C. § 1334(b), limiting it to proceedings that arise in a bankruptcy case or arise under the bankruptcy law (i.e., core proceedings) and proceedings that relate to a bankruptcy case (i.e., non-core proceedings). The original complaint in this case contained a mix of core and non-core claims, but in either case, the Court had subject matter jurisdiction over all of the claims asserted by Masterwear.
The jurisdiction over the third party claims is a harder question. The bankruptcy court's non-core jurisdiction is broad (but not limitless), Celotex Corp. v. Edwards, 514 U.S. at 307-08, 115 S.Ct. 1493, and extends to a proceeding whose outcome may have any "conceivable effect" on the debtor's estate. In re Cuyahoga Equipment Corp., 980 F.2d 110, 114 (2d Cir.1992); Pacor, Inc. v. Higgins, 743 F.2d 984, 994 (3d Cir.1984). Under this test,
[a]n action is related to bankruptcy if the outcome could alter the debtor's rights, liabilities, options, or freedom of action (either positively or negatively) and which in any way impacts upon the *516 handling and administration of the bankrupt estate.
Id.; accord Back v. AM General Corp. (In re Chateaugay Corp.), 213 B.R. 633, 638 (S.D.N.Y.1997); Bond Street Assocs. v. Ames Dep't Stores, Inc., 174 B.R. 28, 32 (S.D.N.Y.1994).
In litigation involving non-debtors, "relatedness" often turns on the estate's obligation to indemnify the losing party. Where the obligation to indemnify is contractual and absolute, the third party litigation is "related to" the bankruptcy case. E.g., Hunnicutt Co. v. TJX Cos. (In re Ames Dep't Stores, Inc.), 190 B.R. 157, 160-61 (S.D.N.Y.1995); Apex Inv. Assoc., Inc. v. TJX Cos., 121 B.R. 522, 526 (N.D.Ill.1990); In re Brentano's, Inc., 27 B.R. 90, 92 (Bankr.S.D.N.Y.1983), rev'd & remanded on other grounds, 36 B.R. 90 (S.D.N.Y.1984); see Weisman v. Southeast Hotel Properties Ltd. Partnership, No. 91 Civ. 6232, 1992 WL 131080, at *3 (S.D.N.Y. June 1, 1992). The debtor's liability need not, however, be definite. Kelley v. Nodine (In re Salem Mortgage Co.), 783 F.2d 626, 634 (6th Cir.1986). "Related to" jurisdiction also exists if a disputed or conditional indemnity claim has a "reasonable legal basis." In re Chateaugay Corp., 213 B.R. at 640; compare Bond Street Assocs. v. Ames Dep't Stores, Inc., 174 B.R. at 28, 33 (lease dispute between landlord and debtor's assignor was "related to" debtor-assignee's bankruptcy because lease assignor "will normally have a claim against the debtor-assignee for losses caused by the assignee's breach") and Weisman v. Southeast Hotel Properties Ltd. Partnership, 1992 WL 131080, at *4 ("related to" jurisdiction existed over third party dispute where claims asserted against defendants came within provisions of debtor's limited indemnification agreement) with In re Chateaugay Corp., 213 B.R. at 639-40 (no jurisdiction where defendant might assert indemnity claim against reorganized debtor based upon a theory of alter ego liability) and Wall v. Merrill Lynch Pierce Fenner & Smith, Inc., No. 92 Civ. 0387, 1992 WL 77625, at *2 (S.D.N.Y. Mar. 26, 1992)(no jurisdiction over third party action where debtor's indemnification agreement specifically excepted the fraud and fiduciary duty breaches alleged in the complaint).
Here, the Third Party Defendants have articulated a "reasonable legal basis" to recover indemnification from Masterwear should they be forced to pay Rubin Baum. According to Rubin Baum, the legal fees and expenses at issue were incurred on behalf of the Third Party Defendants defending Signal's derivative action.[5] In that action, Signal contended that the Third Party Defendants breached their fiduciary and contractual duties by unlawfully extending their employment contracts and taking excessive and unauthorized compensation and reimbursement for personal expenses. In re Masterwear Corp., 233 B.R. at 270 & n. 1. The Third Party Defendants defended the derivative action with great vigor given the amount of Rubin Baum's legal fees.
Under its by-laws, Masterwear is obligated to indemnify the Third Party Defendants to the full extent allowed by Delaware law. (Aloe Affidavit, Ex. F, Art. VII, § 7.) Delaware law permits a corporation to indemnify the Third Party Defendants for expenses "actually and reasonably incurred" if the Third Party Defendants "acted in good faith and in a manner [they] reasonably believed to be in or not opposed to the bests interests of the corporation." Even if the Third Party Defendants are adjudged liable in the derivative suit, they may still recover indemnity if the facts and circumstances warrant it. See Del.Code Ann., tit. 8, § 145(b)(1998). Thus, the Third Party Defendants may ultimately be entitled to recover some or all of their legal fees *517 and expenses from Masterwear under the by-laws. Accordingly, the third party action could have a "conceivable effect" on Masterwear, and "related to" jurisdiction exists over the third party action.
2. Supplemental Jurisdiction
Rubin Baum also argues that supplemental jurisdiction exists over the third party claim. Supplemental jurisdiction is a statutory concept that expands on the earlier judge-made doctrines of ancillary and pendent jurisdiction. Purgess v. Sharrock, 33 F.3d 134, 138 (2d Cir.1994). Where the district court has original jurisdiction over a civil action, it may exercise supplemental jurisdiction "over all other claims that are so related to claims in the action within such original jurisdiction that they form part of the same case or controversy under Article III . . . [and] include claims that involve the joinder or intervention of additional parties." 28 U.S.C. § 1367(a).
In Klein v. Civale & Trovato, Inc. (In re Lionel Corp.), 29 F.3d 88, 92 (2d Cir.1994), the Court implicitly held that the bankruptcy court could exercise supplemental jurisdiction. There, the debtor hired a contractor to work on premises that it leased. After the debtor failed to pay for the construction work, the contractor filed a mechanic's lien against the landlord's property. The debtor and the landlord commenced an adversary proceeding that, among other things, sought an order declaring the mechanics' lien invalid. Id. at 90. The landlord also asserted a leasebased claim against the debtor arising from its failure to discharge the lien. Id. at 92. Addressing subject matter jurisdiction, the Second Circuit ruled that the bankruptcy court had core jurisdiction over the landlord's claim against the debtor, and supplemental jurisdiction over the landlord's claim against the contractor. Id.
While the bankruptcy court's exercise of supplemental jurisdiction is not entirely clear,[6]see In re Boco Enters., 204 B.R. at 411 n. 2, I will assume that I have it, in addition to "related to" jurisdiction, to adjudicate the third party claim. The question remains whether I should exercise it. Because the answer is intertwined with the resolution of the summary judgment motionwhich I have the jurisdiction to decideI will turn to that motion.
B. The Summary Judgment Motion
Rubin Baum's summary judgment motion is straightforward. The Third Party Defendants agreed to pay their legal fees and expenses. Masterwear didn't pay these fees on the Third Party Defendants' behalf (actually, they were paid and then returned through the settlement), and consequently, the Third Party Defendants must pay them. In support, Rubin Baum provided detailed time records demonstrating that it has substantial, unpaid legal claims against the Third Party Defendants well in excess of the $60,000.00 at issue. Thus, if this were simply an effort to recover $60,000.00 under a contract claim *518 for unpaid legal fees, Rubin Baum would be entitled to prevail.
The problem is that this is not a contract case, nor does it concern just any $60,000.00. Rubin Baum must demonstrate that the $60,000.00 that it repaid to Masterwear represented the return of legal fees and expenses incurred on behalf of the Third Party Defendants and covered by the retainer agreement. If, on the other hand, it represented legal fees for work performed for Masterwear, Rubin Baum cannot recover indemnity in the third party action even though the Third Party Defendants owe a large contract debt for their own legal fees.[7] In addition, the Third Party Defendants can defeat the indemnity claim by showing that Rubin Baum would not have been liable to Masterwear under the original complaint.[8]
According to Norman Bernard, Masterwear's former president, Rubin Baum provided a significant amount of legal services to Masterwear on various matters, including general corporate work, labor relations and banking. (Affidavit of Norman Bernard, sworn to Aug. 20, 1999, ("Bernard Affidavit"), at ¶ 5.)[9] The deposition testimony of Jeffrey Mann, Esq., a former Rubin Baum partner, supports the Third Party Defendants' claim. (See Reply Declaration of Paul H. Aloe in Support of Motion for Default Judgment or, in the Alternative, for Summary Judgment and in Opposition to Cross-Motion for Sanctions, dated Sept. 23, 1999 ("Reply Aloe Declaration"), Ex. B, at 67-69.) Perhaps must important, Rubin Baum asserted an affirmative defense that it had represented Masterwear in other matters, and the transfers were fair consideration for those payments. This allegation has never been amended, and stands as a conclusive judicial admission. United States v. GAF Corp., 928 F.2d 1253, 1259 (2d Cir.1991); Bellefonte Re Ins. Co. v. Argonaut Ins. Co., 757 F.2d 523, 528 (2d Cir.1985); United States v. McKeon, 738 F.2d 26, 31 (2d Cir.1984).
Rubin Baum's reply papers attempt to undercut the force of this admission and the premise that it represented Masterwear. Rubin Baum states that it pled this affirmative defense after its former partner, Mr. Mann, advised the firm that he had done work for Masterwear as well as the individuals without opening a separate matter. (Aloe Reply Declaration, ¶¶ 4-5.) However, discovery "failed to corroborate that Mr. Mann had rendered separate legal services for the Debtors," and Masterwear had separate legal counsel in the underlying litigations. (Id., ¶ 11.)
As noted, Rubin Baum never amended its third party complaint. Further, discovery is incomplete, and Mann testified that documents exist reflecting his work for Masterwear. (Id., Ex. B, at 69.) In addition, Mann never said he represented Masterwear in the underlying litigations; he said he consulted with management about certain corporate governance and other disputes between Masterwear and Signal that became the subject of Delaware litigation. (Id., Ex. B, at 68.) He also testified that he rendered services to Masterwear in connection with its relationship *519 with the Bank of New York. (Id.) In this regard, Third Party Defendants continued to handle Masterwear's day-to-day banking affairs even after they were replaced as directors. See In re Masterwear Corp., 233 B.R. at 270 n. 3. It would not be surprising, therefore, that they may have turned to Rubin Baum in connection with their official duties.
Consequently, I cannot award summary judgment. When faced with the motion, a court does not weigh the evidence or resolve disputed issues of fact. Instead, a court must assess whether any factual issues exist, and must resolve any ambiguities or inferences against the moving party. Knight v. U.S. Fire Ins. Co., 804 F.2d 9, 11-12 (2d Cir.1986), cert. denied, 480 U.S. 932, 107 S.Ct. 1570, 94 L.Ed.2d 762 (1987); see Lopez v. S.B. Thomas, Inc., 831 F.2d 1184, 1187 (2d Cir.1987). The Third Party Defendants have preferred credible evidence raising triable issues with respect to (1) whether Rubin Baum provided services to or for the benefit of Masterwear, and (2) whether these services were consideration for all or part of the $60,000.00 repaid to Masterwear. Under the circumstances, material, disputed factual issues exist.
C. Dismissal and Abstention
Having denied summary judgment, I must decide whether to retain jurisdiction over this third party dispute, or abstain from further involvement. This really poses two separate questions: should I decline to exercise supplemental jurisdiction and should I abstain from exercising "related to" jurisdiction? The analyses overlap, and support sending this dispute to another forum.
1. Supplemental Jurisdiction
Pursuant to 28 U.S.C. § 1367(c)(3), a court may decline, in its discretion, to exercise supplemental jurisdiction where it has dismissed all of the claims over which it has original jurisdiction. The relevant considerations include judicial economy, convenience to the parties, fairness and comity. Marcus v. AT & T Corp., 138 F.3d 46, 57 (2d Cir.1998); Nowak v. Ironworkers Local 6 Pension Fund, 81 F.3d 1182, 1191 (2d Cir.1996); Porges v. Gruntal & Co. (In re Porges), 44 F.3d 159, 163 (2d Cir.1995); 16 James W. Moore, Moore's Federal Practice § 106.66[2], at 106-89 to 106-90 (2d ed. 1999)("Moore's"). As a rule, if the predicate claim is dismissed before trial, dismissal is appropriate. Marcus v. AT & T Corp., 138 F.3d at 57; Purgess v. Sharrock, 33 F.3d at 138; see Carnegie-Mellon Univ. v. Cohill, 484 U.S. 343, 350 n. 7, 108 S.Ct. 614, 98 L.Ed.2d 720 (1988)(discussing pendent jurisdiction); see generally 16 Moore's § 106.66[2], at 106-89 to 106-90. Nevertheless, the concept is flexible, and the decision must be made on a case by case basis after examining all of the circumstances. Id.
Initially, comity does not weigh in favor of dismissing the third party claim, and the convenience of the parties is a neutral factor. Concerns of comity support dismissal when the case raises unsettled issues of state law best left to a state court. Id., § 106.66[4], at 106-94.1; see Independent Bankers Ass'n of N.Y. State, Inc. v. Marine Midland Bank, 757 F.2d 453, 464 (2d Cir.1985); In re Boco Enters., Inc., 204 B.R. at 412. The case does not present any unsettled issues of New York law. Further, there should be little difference to the parties in litigating this dispute in this Court or one mile due north in the state supreme court.
Judicial economy and fairness, however, weigh heavily in favor of dismissal. First, retaining jurisdiction over the third party claim will lead to unnecessary duplication. Rubin Baum holds a contractual right to recover its unpaid legal fees. It claims that the Third Party Defendants owe approximately $260,000.00, but its third party claim only seeks the $60,000.00 paid under the settlement. It would have to commenceand the Third Party Defendants *520 will have to defenda second action to recover the balance.
Second, the case cannot be tried in this Court, and will have to be transferred for trial to the district court. Rubin Baum demanded a jury trial in its answer. The demand covers the issue of Rubin Baum's liability to Masterwear. This same question is germane to the defense of the third party claim, and is encompassed by the jury demand. See Rosen v. Dick, 639 F.2d 82, 91-92 (2d Cir.1980); Davidson Pipe Co. v. Laventhol & Horwath, 125 F.R.D. 363, 367 (S.D.N.Y.1989); see generally 8 Moore's § 38.52[2][c][i], at 38-253. But the bankruptcy court cannot conduct a jury trial without the express consent of all parties, see 28 U.S.C. § 157(e), and given the Third Party Defendants' position on abstention, unanimous consent is unlikely.
Further, dismissal is neither wasteful nor unfair. I ruled on Rubin Baum's summary judgment motion because it would have wasted the parties' time and effort to refuse. It does not follow that my consideration (and denial) of the motion makes dismissal a waste of judicial resources. Cf. Robertson v. The Neuromedical Ctr., 161 F.3d 292, 296 (5th Cir.1998)(district court did not abuse its discretion in declining to exercise supplemental jurisdiction over state law claims after granting summary judgment to defendants on federal claims); Hankins v. The Gap, Inc., 84 F.3d 797, 802-03 (6th Cir.1996)(same). The case is not trial ready, I have not invested a great deal of judicial time or energy on the underlying factual and legal issues, and the parties will not have to duplicate their prior efforts in state court. Rubin Baum's work to date consists primarily of accumulating its time records, and it can offer these same records at trial. The parties have not completed discovery, and any discovery they have obtained in this action can be used in state court. See Robertson v. The Neuromedical Ctr., 161 F.3d at 296; Allard v. Arthur Andersen & Co. (U.S.A.), 957 F.Supp. 409, 425 (S.D.N.Y.1997). Finally, any gain resulting from my retention of the case will be lost once it is transferred to the district court for a jury trial. Accordingly, to the extent I have supplemental jurisdiction, I decline to exercise it.
2. Permissive Abstention
I also decline to exercise "related to" jurisdiction for many of the same reasons. Pursuant to 28 U.S.C. § 1334(c)(1), a court may abstain from hearing a proceeding within its jurisdiction "in the interest of justice, or in the interest of comity with State courts or respect for State law." Permissive or discretionary abstention was intended to codify non-bankruptcy judicial abstention doctrines. Coker v. Pan American World Airways (In re Pan American Corp.), 950 F.2d 839, 845 (2d Cir.1991). The factors that govern discretionary abstention include
(1) the effect or lack thereof on the efficient administration of the estate if a Court recommends abstention, (2) the extent to which state law issues predominate over bankruptcy issues, (3) the difficulty or unsettled nature of the applicable state law, (4) the presence of a related proceeding commenced in state court or other nonbankruptcy court, (5) the jurisdictional basis, if any, other than 28 U.S.C. § 1334, (6) the degree of relatedness or remoteness of the proceeding to the main bankruptcy case, (7) the substance rather than form of an asserted `core' proceeding, (8) the feasibility of severing state law claims from core bankruptcy matters to allow judgments to be entered in state court with enforcement left to the bankruptcy court, (9) the burden of [the court's] docket, (10) the likelihood that the commencement of the proceeding in a bankruptcy court involves forum shopping by one of the parties, (11) the existence of a right to a jury trial, and (12) the presence in the proceeding of nondebtor parties.
Peterson v. 610 W. 142 Owners Corp. (In re 610 W. 142 Owners Corp.), No. 94 B 44488, 1999 WL 294995, *3 (S.D.N.Y. May *521 11, 1999)(quoting In re Craft Architectural Metals Corp., 115 B.R. 423, 432 (E.D.N.Y. 1989)).
Rubin Baum's third party action is a garden variety state law contract dispute between non-debtors, and under the foregoing factors, abstention is appropriate. First, abstention will not affect the bankruptcy case. Assuming the Third Party Defendants acquire a fixed and liquidated indemnification claim against Masterwear, the $60,000.00 claim will have little effect on any distribution in light of the millions of dollars of unsecured debt in this case. (Factor 1). Second, state law issues predominate in this contract dispute. (Factor 2). Third, the third party proceeding is non-core, and lacks an independent basis for federal jurisdiction.[10] (Factors 5, 7). Fourth, the dispute is remote from Masterwear's case. It can be severed and tried separately in state court, and if the Third Party Defendants acquire an indemnification claim, they can assert it in the bankruptcy case. If Masterwear disputes their claim, Masterwear can reserve for it under the plan and still confirm the case. (Factors 6, 8). Fifth, the third party dispute is a burden on this Court's docket, and the Court can put its limited resources to better use resolving disputes that have a direct affect on the many cases before it. (Factor 9). Sixth, the issue regarding Rubin Baum's liability to Masterwear is triable by a jury. (Factor 11). Finally, the action involves nondebtors. (Factor 12).
The countervailing considerations are slim. The state law issues are neither unsettled nor complex. (Factor 3). There are no related proceedings pending in nonbankruptcy fora. (Factor 4).[11] Finally, Rubin Baum did not engage in forum shopping. (Factor 10). Weighed against the overwhelming number and significance of the factors that dictate the appropriateness of abstention, these contrary considerations pale. Accordingly, I will abstain as a matter of discretion in exercising "related to" jurisdiction.
CONCLUSION
The motion for summary judgment is denied, and the third party action is dismissed without prejudice. Settle order on notice.
NOTES
[1] Rubin Baum contends that the Third Party Defendants agreed to fund the settlement, and then backed out. The relevance of this is not apparent. An agreement to settle is inadmissible to prove liability. Fed.R.Evid. 408.
[2] Brad Bernard purported to assert his pro se objection on behalf of himself and his father, Norman. (See Objections of Norman Bernard & Brad Bernard, Third Party Defendants, to Proposed Order Approving Compromise of Dispute between the Debtors & Rubin Baum Levin Constant & Friedman, dated July 12, 1999 ("Objections")).
[3] The Bernards also withdrew a motion for sanctions lodged against Rubin Baum.
[4] Mushkin claims he answered the complaint on December 20, 1998, and submitted a copy of his answer in response to the default motion. (See Letter dated Aug. 24, 1999 and attachment)(ECF Doc. # 31.) He never filed this answer, and it is not clear that he ever served it. I note that he is appearing pro se, has attended several court hearings, and actively participated in this matter. It has been clear from the outset that he intends to defend against the third party claim, and the dispute should be decided on the merits.
[5] The derivative action complaint has been amended, and the former derivative claims have been asserted directly by Masterwear.
[6] After Lionel, the bankruptcy court's supplemental jurisdiction was questioned by the Fifth Circuit Court of Appeals. See Walker v. Cadle Co. (In re Walker), 51 F.3d 562 (5th Cir.1995). The most compelling argument against supplemental jurisdiction focuses on the language in 28 U.S.C. § 157(a), which states:
(a) Each district court may provide that any or all cases under title 11 and any or all proceedings arising under title 11 or arising in or related to a case under title 11 shall be referred to the bankruptcy judges for the district.
By order dated July 10, 1984, Acting Chief District Judge Robert J. Ward made the reference authorized by section 157(a).
Assuming that the district court can exercise supplemental jurisdiction when it has original bankruptcy jurisdiction, it never referred its supplemental jurisdiction to the bankruptcy court, and section 157(a) would not authorize it anyway. In fact, the district court could no more refer its supplemental jurisdiction that it could refer its copyright, criminal or diversity jurisdiction. See In re Walker, 51 F.3d at 572-73.
[7] Rubin Baum's own confusion over its theory was evident at the argument of the summary judgment motion. Its counsel maintained that the Third Party Defendants could not defend by showing that the transfer to Rubin Baum was not wrongful because the claim arises under a contract. (Transcript of hearing, held Oct. 7, 1999, at 7-8.)
[8] Fed.R.Civ.P. 14(a) permits a third party defendant to assert any defenses he has to the original plaintiff's claim. The Third Party Defendants did not assert any defenses to Masterwear's claims in their pro se answers, but the Bernards have since retained counsel and asserted these defenses in their motion papers.
[9] The Bernard Affidavit attaches, as Ex. G, Rubin Baum's submission to the mediator appointed in this case. I have not considered the submission because its disclosure violates the confidentiality provisions in the Court's order adopting the mediation program. (See Amended General Order (re: Adoption of Procedures Governing Mediation of Matters in Bankruptcy Cases & Adversary Proceedings), dated Jan. 17, 1995, at ¶ 5.0.)
[10] Even if supplemental jurisdiction provided a basis to hear the dispute, the considerations informing the exercise of discretion under 28 U.S.C. § 1367(c)(3) call for dismissal.
[11] If an action were pending in a state court, and the state court could resolve it in a timely fashion, mandatory abstention might be required under 28 U.S.C. § 1334(c)(2). See Burger Boys, Inc. v. South Street Seaport Ltd. Partnership (In re Burger Boys, Inc.), 183 B.R. 682, 685 n. 2 (S.D.N.Y.1994) (discussing the elements of mandatory abstention).
| tomekkorbak/pile-curse-small | FreeLaw |
P.S. I Hate You
Mendel and Mindle Glouberman were born and raised in the tiny Polish town of Stolin. There was never any question that after they married they would settle there, and they expected the same from their five children and their children's children. When some of their children decided to leave, during the pogroms of the 1920s, they begged them to stay.
In 1942, the Nazis invaded Stolin and ordered 7,000 Jews from in and around the little city to leave their homes and take only what they could carry into a gated section of the city -- a Jewish ghetto. Every day, the men were driven a couple of miles to a forest to dig an enormous ditch. Then, the day before Rosh Hashanah, the holiday that marks the start of the Jewish New Year, 500 Jews at a time were systematically disrobed and taken to the ditch, where they were shot and tossed in like scrap metal. They had been digging their own graves. Those who weren't fatally wounded by the gunshots were simply buried alive.
To understand what drives Sara Salzman, what compels her to confront the kind of hatred that her ancestors had to face, one must think back to "that pit in Poland" where her great-grandparents are buried. Salzman grew up listening to the tale of Stolin and understood from an early age what most other kids only read about in textbooks. For her, the lesson was more than academic: The only reason she lives in a free country now is because her grandparents had to flee an oppressive one.
Although Mendel and Mindle Glouberman and one of their sons were killed in Stolin, three of their other children and their spouses, including Salzman's grandparents, left before the Holocaust. They emigrated to Canada in the 1920s, when Salzman's mother was four or five years old, and then to the United States. The family ended up in Washington, D.C., where Salzman was born in 1957.
Five years ago, while Salzman was living in Ohio with her first husband, she got a job as a copywriter for a company that allowed people to pay their bills over the Internet. She was excited about working in the fast-growing industry of e-commerce and wanted to learn all she could about the World Wide Web, so she started reading print magazines dedicated to all things Internet. Her interest in the Web shifted from a merely professional pursuit to a personal one when she came across an article about the Nizkor Project, which contains the Web's largest Holocaust archive and is dedicated to debunking Holocaust deniers. The article also mentioned a Usenet group called alt.revisionism, a virtual gathering place for people who believe that the Holocaust never happened. The newsgroup eventually became a place for people like Salzman to challenge deniers' beliefs with evidence that the Holocaust did occur.
Salzman, who moved to Aurora with her second husband in 1997, was intrigued by the Nizkor Project, which contains biographical information about everyone from Anne Frank to Deborah Lipstadt (the author of a book called Denying the Holocaust), as well as transcripts from the Nuremberg trials. Salzman knew she wanted to become involved with the then-fledgling site, so she called Nizkor director Ken McVay and offered her assistance. She's been scanning Holocaust-related documents and uploading them to nizkor.org ever since. ("Nizkor" is Hebrew for "We remember.")
At around the same time, Salzman started posting messages to alt.revisionism. Unlike a chat room, the discussions on Usenet are not live; users log on and read the messages people have posted throughout the day, write a response of their own, then check back later to see if anyone has replied.
Despite the extremely opposing views of alt.revisionism participants, Salzman says, there was mutual respect between the "revisionists," who believe that the record of atrocities during the Holocaust has been overblown or that the Holocaust never happened at all, and the "anti-revisionists," who try to convince them otherwise.
"There was a lot of name-calling," Salzman says. "But it was always good-humored."
Until January, that is, when someone entered alt.revisionism and began posting vitriolic messages about Salzman and other legitimate contributors to the site. Sometimes the messages appeared to be from the other legitimate contributors; other times they were merely juvenile attempts to make it look as though a legitimate contributor had posted the message.
For instance, a message posted on February 2 that appeared to come from Nizkor's McVay read: "A question for Sara Salzman; Are you homosexual?" Another was supposedly posted by the Nizkor Project, from the fictitious e-mail address >[email protected]. It read: "I am a lesbian fish licker. I enjoy licking the anus of female fish." Still another came in the name of David Goldman, the founder of a Web site called hatewatch.org, which monitors online hate sites: "Sara Salzman is one ugly bitch and smells like a fish. Are you a lesbian?" Then, on February 3, a message was forged in the name of Jeffrey Brown, a longtime alt.revisionism contributor, from the fake e-mail address [email protected]: "Dogs vs. Sara Salzman: Who would you fuck first?"
The messages have escalated over the last few months to the point where Salzman's address, her neighbors' addresses, and details about her family have been posted along with death threats and encouragement to kill her.
Although Salzman was trusting at first, even naive, about how her views on the Holocaust would be received, she's decided not to back down against whomever is posting the messages; she remains a frequent contributor to alt.revisionism. But her attempts to find out who is harassing her and her requests for police help have been unsuccessful, and she now faces the same kind of hatred and fear that her great-grandparents did.
Inside Salzman's suburban home, her thirteen-year-old son memorizes Torah passages in preparation for his upcoming bar mitzvah. Her nine-year-old daughter wanders around the kitchen, looking at the clock every fifteen minutes in anxious anticipation of 6 p.m., when she'll go to her first slumber party. The family's three birds squawk loudly and often, and their two dogs race around, but the noise is so much a part of the background buzz that Salzman and her husband hardly notice. They light one cigarette after another and continue talking about the dark cloud that has been hanging over this home for the past six months.
Upstairs in Salzman's home office, she has saved printouts of the hundreds of messages that have been posted about her: "Sara Salzman is a dyke"; "Dog fucker Sara Salzman"; "Is dog fucking a Jewish thing?" and on and on. Messages like those were posted not only to alt.revisionism, but to dog news groups and white-power news groups.
Even her autistic son wasn't spared: "[Salzman] believes her retarded child is special because he attends 'special ed,'" reads one message.
Salzman also has a copy of a fake news report about her that was posted to alt.revisionism. The posting, which claimed to be an "Aurora News Staff Report," begins, "A [sic] Aurora woman accused of attacking her estranged husband with a clothing iron was in custody Tuesday facing felony charges of assault with a deadly weapon, police said. Sara Schwartz [the name from her first marriage] allegedly began arguing with her husband Monday night after he came home to the [address deleted] home where she lives with their two children..."
"I work on the Web, so essentially, these people were going into my workplace and saying terrible things about me," says Salzman, who has since taken a break from online copywriting.
Although Salzman couldn't trace, with certainty, the source of the messages, some of them, such as the return e-mail address [email protected], provided clues. At the time, thundernet.org was the address for a Web site called The American Guardian; it was run by Don Ellis, a man from Star City, Arkansas, who is notorious among Internet hate-group watchdogs.
Ellis's site, which is now defunct, reportedly contained photos of men eating each other's feces and engaging in explicit sexual acts, in order to demonstrate how "diseased" homosexuals are. The author of a June 5, 1998, Wired News article described Ellis as "one of the most vociferous opponents of abortion and homosexual rights on IRC [Internet Relay Chat] and the Web." Ellis was quoted in the article as saying that the Internet has been a "huge success" for homosexuals because before they had access to the Web, with its wealth of gay sites, "they didn't know whose leg they could rub on."
Ellis also used to run a Web site called HateWatch of America, which could be found at hatewatch.com or hatewatch.net. But contrary to what the name suggests, Ellis's site was not a legitimate place for people hoping to find information on Web-based hate groups; instead, it was a decoy for Boston-based hatewatch.org, a reputable site founded in 1995 by David Goldman. Hatewatch.org, which monitors approximately 400 Internet hate sites, once featured The American Guardian on its list of anti-gay Web sites; in early 1998, about six weeks after The American Guardian appeared on hatewatch.org, Ellis came out with hatewatch.com and hatewatch.net.
The Web sites looked almost identical, but the contents were vastly different. Instead of finding sites like godhatesfags.com, jewwatch.com and kkk.com, which are featured on Goldman's list of hate groups operating on the Internet, unwitting visitors of Ellis's site found the ACLU and the Gay, Lesbian, and Straight Teachers Network in the same category as a chat room for pedophiles; in addition, HateWatch of America posted Disney on its list of "anti-children" Web sites because a subsidiary of Disney had published a book called Growing up Gay. Ellis also listed the NAACP and the Anti-Defamation League as hate groups.
Because of the confusion Ellis's site caused, Goldman considered filing a trademark lawsuit. But in March, after he was finally granted a federal trademark for "HateWatch," Goldman settled with Ellis out of court, and Ellis transferred the domain names to Goldman's nonprofit organization.
Salzman forwarded the juvenile postings from thundernet.org to Ellis's Internet service provider, seark.net, which is based in Monticello, Arkansas, with a note explaining that she would continue to forward the "spam" -- Internet lingo for a barrage of unwanted e-mail or, in this case, unwanted Usenet postings -- until it stopped. Internet etiquette calls for people to report such behavior to the ISP of the person abusing the system.
Ellis must have learned about Salzman's complaint, because he immediately sent her an e-mail with the following message: "You dumb bastard, you just don't get it."
In a letter Ellis sent to Salzman and to seark.net, he denied her accusations and offered the following explanation for her claims: "Over the past few weeks Sara has solicited me for sex many times. I have always refused. I believe this is a ploy of hers to stop me from posting to Usenet, where my friends and I gather to swap information on different topics. If Sara doesn't like my rejections to her stalking me or the topics and information I post under, then she can always find another newsgroup."
Salzman shot back with an e-mail message telling Ellis not to write to her again. She also sent a copy of that letter to seark.net, along with a note to Jim Ellis of seark.net refuting Don Ellis's claims. Instead of helping her, Jim Ellis wrote back asking her not to spam him with her complaints and added that "this sounds like a lover's quarrel." As it turns out, Don Ellis's brother works at seark.net, which would explain how he found out about Salzman's letters. Whether Jim Ellis is Don Ellis's brother could not be determined.
Salzman soon discovered that her e-mail in-box was flooded with mail from pornographic Web sites. Someone had put her name on eighty gay-porn e-mail lists. She received messages like "Thanks for subscribing to Naughty Mail, your free guide to pictures, jokes, stories, movies, sites, special offers and more" and "*Exclusive Hot Teen pictures* Hot & Steamy EROTIC STORIES -- a new one every day!"
Salzman turned to Mike Castro of the FBI's Domestic Terrorism Unit in Colorado, but according to Salzman, he said there wasn't anything he could do to help her because there were no specific threats against her at the time. Castro refused to comment to Westword on Salzman's situation.
On February 28, Salzman filed an incident report with the Arapahoe County Sheriff's Office, but she says the deputy who assisted her said that the Internet hijinks probably aren't in violation of any laws -- and that if they are, they're probably just a misdemeanor, and Arapahoe County doesn't extradite people for misdemeanors. Nobody from the sheriff's office would return phone calls for this story.
That same day, the home telephone numbers and addresses of everyone associated with the Nizkor Project, including Salzman, were posted to alt.revisionism. The Nizkor phone book was posted several times, in fact, under several names that all had the return address of Ellis's thundernet.org. Later, Salzman's phone number and address were also posted to two neo-Nazi news groups -- alt.politics.nationalism.white and alt.politics.white-power. Someone identifying himself as RevWhite also posted a map with directions to Salzman's house, as well as the names, addresses and phone numbers of several of her neighbors, and encouraged people to call them.
Patrick Blakely, the man behind the RevWhite moniker, was notorious a couple of years ago for operating a Web site called the Negroid Research Institute, which awarded "Nigger of the Week" prizes to famous black people and published statistics that made it appear that blacks were responsible for virtually all crimes. Blakely eventually dismantled the site, but he apparently didn't abandon the Internet; instead, he continued on with a crusade to rid the Web of child porn and gay chat rooms. According to a January 15, 1997, Wired News article, he vowed to "lead an '[Internet Relay Chat] Watch' campaign, using the nickname 'RevWhite,' until the network is purged of chat channels like '#gayboysex.'" The article goes on to say that "RevWhite has been joined in his crusade by at least one vocal supporter, Don Ellis, whose Web site, The American Guardian, promotes many of the same values as RevWhite's own Maryland Christian Politics site." (More recently, someone using the moniker "blakely" has posted messages to alt.revisionism questioning Salzman's fitness as a mother, accusing her of being mentally ill and asking, "Did Sara really have relatives killed by Hitler? With her history of being a pathological liar, I seriously doubt it." In addition, the messages said, "Sara started this whole thing. It was Sara who contacted personal members of Don Ellis's family first, both by phone, letter and e-mail. We have every right to do the same.")
In March, Salzman contacted the Eleventh Judicial District in Star City, Arkansas, the town where Ellis lives, and spoke to Deputy Prosecuting Attorney Phillip Green. "It was like talking to someone in Mayberry," Salzman says. Green told her that if she wanted to press charges against Ellis, she would have to fly to Arkansas. Instead of doing that, Salzman convinced Green to send Ellis a cease-and-desist letter. On April 11, Green wrote back, saying, "After a thorough review of various e-mails provided to me by you and by Mr. Ellis, I have determined that there is no basis for involvement by my office. The copies you faxed me today may be libelous, but that is a civil matter, not a criminal one. It may be that you need to hire an attorney to check into the matter further."
Green told Westword that Ellis, an auto mechanic whom everyone in town knows, gave him copies of his Internet correspondence with Salzman. Green said that because Ellis and Salzman had argued back and forth, it would be hard to prove that the communication was unsolicited. "If she's posting things, she's sort of inviting some kind of response," he says. "I didn't think it rose to the level of a criminal matter. I don't want to prosecute people just for saying stuff that other people don't like, and I would have had a hard time making a harassment case out of it."
Salzman, however, says that she and Ellis never debated the Holocaust at alt.revisionism, and that the only words she exchanged with him were when she told him to stop forging her name and when she notified him that she would forward the forgeries to seark.net. She suspects that Ellis may have produced fake e-mails and alt.revisionism postings in her name to try to prove to Green that the two were engaged in an ongoing battle.
Even if he could have made a case, though, Green admits that his judicial district would be ill-equipped to handle it. "We deal with traffic tickets, boyfriends beating girlfriends and DUIs," he says. "We've never dealt with Internet problems."
On July 18, Westword contacted the only Don Ellis in the 2,000-person town of Star City. He said he didn't know of a Sara Salzman and that her situation was "kind of news to me." The following conversation ensued:
Westword: Are you the Don Ellis who used to operate The American Guardian Web site?
Ellis: There is no American Guardian Web site.
Westword: Did you used to operate a Web site called The American Guardian?
Ellis: [no reply]
Westword: Did you used to operate a Web site called HateWatch of America?
Ellis: Ummm...not to my knowledge.
Westword: Have you ever posted negative messages about Sara Salzman or anyone else to alt.revisionism?
Ellis: I haven't posted anything in three or four months.
Westword: Have you ever posted to alt.revisionism?
Ellis: I'm not sure. I'd have to check my files. She should just turn the computer off. She should just back out of the situation. I have had death threats, and I just ignore them. It's probably just someone blowing off steam.
And later:
Westword: Sara Salzman claims nasty messages have been posted about her in a news group.
Ellis: What kind of nasty messages?
Westword: Things like "Sara Salzman is a dyke. Sara Salzman is a dog-fucker."
Ellis: Well, is she? [A couple of moments of silence.] So, does she do those things?
Westword: All I can tell you is that someone has been posting messages saying she does, and she's not happy about it.
Ellis: How do you know that she doesn't do those things?
In recent weeks, the situation has escalated. Someone placed links on more than forty Web sites with messages claiming that Salzman's kids were planning to bomb an Aurora high school; placed a link on more than ninety Web sites with messages accusing Salzman of child abuse; posted messages saying that Salzman makes her daughter give men blow jobs to support the Nizkor Project; posted Salzman's father's name, office address, telephone number and e-mail address to alt.revisionism along with a threat to pay him a visit; forged Salzman's name on a threat to Mayor Wellington Webb's life that appeared on more than twenty Web sites; e-mailed a death threat to President Clinton in Salzman's name; and posted a message threatening to skin Salzman alive and use her skin to make a new holster for his gun.
Another message on alt.revisionism announced an upcoming Web site containing even more personal information about Nizkor supporters. "See where the anti-revisionist: lives, works, schools, shops," it claimed. "View the many images of their homes, car, children. Read facts about their: history, lovers, sex lives, medical records, criminal records." No such Web site ever materialized, but the names of Salzman's two children and photos of what someone thought was her house appeared on the Internet (the picture was of the wrong house). Salzman had included the names of her kids in a biography she wrote about herself on the Nizkor Web page, so it was easy for someone to find out.
"I wrote that [biography] at a time when it was inconceivable that anyone would use that information against me," she says. She has since removed her children's names from the site.
Nizkor's Ken McVay says he's been insulted so often because of his work that the messages that have been posted about him to alt.revisionism don't bother him. "Everyone who confronts extremists on the Internet gets this kind of treatment eventually. I've been getting it for eight years, but Sara has not," he says. "What makes Sara's case so unusual is the tenacity with which it's been going on."
McVay guesses that Salzman has been the primary target of the alt.revisionism postings because of her extensive involvement with the Nizkor Project. "The other reason is because she gets in their face and stays there, and they're probably trying to see how far they can go to intimidate her. She's tough, and as smart as they come -- and that really irritates them," he adds.
Salzman has contacted the Jewish Federation, the Anti-Defamation League and an organization called Women Halting On-Line Abuse. None have been of any help. "They all said that what's happening is terrible," Salzman says. But just as law-enforcement officials did, they said they couldn't help because no overt threats had been made. The latter group, she adds, advised her to stop posting to alt.revisionism and to change her name and move. She has also contacted private attorneys in Colorado, but none have committed to helping her.
"At the time she contacted us, I characterized what was happening to her as a nuisance, but it was nothing rising to the level of a crime," says Evan Zuckerman, assistant director of the Denver office of the Anti-Defamation League. "Internet law is in an evolving stage. Now, just about anything can pass as protected speech."
But Salzman counters that her situation is no longer just about free speech. "Believe me, I am 100 percent against censoring on the Internet. I'd rather have these people in the light, because if you turn off the light, they'll crawl right back under the refrigerator with all the other cockroaches, and no one will know what they're up to," Salzman says. "But you can't yell fire in a crowded room, and you can't call me a dog-fucker and get away with it. I am absolutely convinced that going away will not stop this. There have been times when I've stopped contributing to alt.revisionism for a week and [the harassment] hasn't stopped. I'm not the only person out there who has had this happen. Somebody has got to set a precedent and say that this can't happen, and I guess I've sort of decided it's going to be me."
In fact, Salzman has had it pretty easy compared to Bonnie Jouhari, a former housing advocate in Reading, Pennsylvania, who for two years was harassed and threatened by white supremacists.
Jouhari's problems began when she noticed that the Ku Klux Klan, which was very active in suburban Berks County, was intimidating minorities into remaining inside Reading, despite the fact that better and more affordable housing was located outside the city limits. Jouhari formed the Berks County Hate Crimes Task Force and encouraged the police to punish hate crimes. In response, white supremacists embarked on a mission to terrorize Jouhari and her teenage daughter. One uploaded photos of Jouhari onto his Web site and wrote that she should be "hung from the neck" for being a "race traitor." Roy Frankhouser, a former grand dragon of the Pennsylvania KKK, promoted the site on his cable TV show.
The intimidation escalated, and when it became clear that local authorities weren't going to help, Jouhari and her daughter packed what they could fit into her car and fled to Seattle. But her problems followed her. Her terrorizers found her new phone number and started calling her. She moved three times, but they always managed to find her new number. One day in November 1999, Jouhari returned home to find a bullet lodged in her kitchen cabinet; a few weeks later, her daughter came home from school and found that someone had broken into their apartment and rifled their belongings. Finally, Jouhari returned to the East Coast, where she found a sympathetic ear in U.S. Housing and Urban Development Secretary Andrew Cuomo. He told Jouhari that he could investigate a civil charge that she was denied fair housing as a result of the threats. HUD also pressured Frankhouser to issue an apology to Jouhari at a press conference on May 11 and on his cable television show a week later.
Stopping the kind of hate speech Salzman and Jouhari have encountered isn't easy. Congress tried to enact a law called the Communications Decency Act in 1997, which would have punished the transmission of "indecent" materials over the Internet, but the United States Supreme Court ruled that it was overly broad.
In a speech before the United Nations High Commission on Human Rights earlier this year, Mark Potok of the Southern Poverty Law Center described the situation this way: "In short, the Internet received the court's strongest free speech protections...Under American case law, it is perfectly permissible to denigrate racial minorities or even advocate the violent overthrow of the government some time in the indefinite future or in general terms. Only when advocacy amounts to 'incitement to imminent lawless action' can it be punished. And the definition of incitement is extremely narrow. Under American law, it is perfectly legal to advocate the political idea that 'all police should be killed.' On the other hand, it probably would amount to criminal incitement to tell an excited individual to 'go kill that police officer over there.'"
Legal precedent has been set, however, demonstrating that there are limits, even in a virtual world. One case a couple of years ago got a lot of attention. Twelve abortion opponents were sued by Planned Parenthood after they created a Web site called "The Nuremberg Files"; on it, they posted a list of 225 abortion doctors and included many of their home telephone numbers, addresses, automobile descriptions and license plate numbers. Whenever an abortion doctor was killed (seven have been murdered in the U.S. in the last seven years), his name was crossed off the list. If a doctor was wounded, his name was shaded in gray. The federal court judge who heard the case said that the Web site and some "Wanted" posters printed by the twelve defendants constituted "blatant and illegal communication of true threats to kill." In February 1999, a jury awarded the plaintiffs a $107.9 million judgment.
Cases like these give Salzman hope, especially since the threats against her have intensified to the point where she is finally getting some interest -- although slight -- from law enforcement.
The most recent series of threats began on July 14, when someone calling himself Rabbi Brimstone posted a message titled "The Dead Pool" to alt.revisionism. The message listed seventeen people, including Salzman, McVay and hatewatch.org's Goldman, along with the following note: "The rules are simple, email me your choice of which of the following people are going to die first. If your choice wins, you win!!! You can also write in votes if you like....Please don't do anything illegal in order to win the game." The message gives a Web site where the Nizkor members' addresses can be found and ends with the statement: "Remember there is nothing illegal about wishing someone to die. Remember to cast your vote!!!!!"
On July 24, eight messages were posted to alt.revisionism calling for Salzman's death. One read "Sara Salzman must die." Another read "Someone kill Sara Salzman."
On July 26, someone anonymously sent Salzman an e-mail message with this subject heading: "You deserve what is coming to you." The message contained the words "I hope you die" repeated more than a hundred times.
Since then, Salzman has contacted FBI agent Tom Cramer and Arapahoe County sheriff's investigator James Osborn. This time, she said, both investigators seemed interested in helping her.
FBI Special Agent Jane Quimby says that her agency is reviewing Salzman's case and that it may investigate and eventually hand it over to the U.S. Attorney's Office. According to the federal statute on interstate communication, there must be a specific threat in order for federal prosecutors to get involved, Quimby says. "It's not enough to say, 'I hope [Bob] dies' or 'I hope someone kills [Bob].' It has to be 'I will kill you.'"
Until someone decides to help her, though, Salzman says she will not back down. In her biography on the Nizkor Project Web site, she says she has dedicated her work to the people of Stolin, and she's received e-mails from Holocaust survivors around the world, including a Russian professor who has decided to move back to Stolin (which is now part of Belarus, not Poland) with forty other families. They plan to build a synagogue there and re-establish Stolin's Jewish community, which was wiped out entirely by the Holocaust.
"That's the upside of the Internet," she says.
"But I've learned that there's a downside, too. The Holocaust deniers have as much a right as I do to speak publicly, but they do not have the right to abuse the First Amendment. I'm not going to let some neo-Nazi shut me up. I can show you that pit in Poland where my ancestors reside. I'm not going to let that happen to me." | tomekkorbak/pile-curse-small | Pile-CC |
ABOUT NITECORE
As a global leader of LED flashlights and chargers with over 100 patents and a grand-slam award winner of the American International Design Excellence Awards (IDEA), German iF Design Award, Red Dot Design Award and the Japanese G-Mark (Good Design), NITECORE creates innovative products in a wide variety of fields and leads the industry in new standards of portability, aesthetic, output and functionality. | tomekkorbak/pile-curse-small | OpenWebText2 |
Q:
Was the chatas nasi brought by the Head of the Sanhedrin as well?
In The Midrash Says Vayikra page 32 the author writes that the chatas nasi was brought by a Jewish king or Head of the Sanhedrin who sinned. Is this correct, and if so is there any source for it? I was under the possibly mistaken impression that only a King brought a chatas nasi.
A:
Mishnah Horayos 3:3:
https://www.sefaria.org/Mishnah_Horayot.3.3
וְאֵיזֶהוּ הַנָּשִׂיא, זֶה הַמֶּלֶךְ, שֶׁנֶּאֱמַר (ויקרא ד) וְעָשָׂה אַחַת מִכָּל מִצְוֹת ה' אֱלֹהָיו, נָשִׂיא שֶׁאֵין עַל גַּבָּיו אֶלָּא ה' אֱלֹהָיו
Who is meant by a ruler? A king; for it says, “Any of all the commandments of the Lord his God” (Leviticus 4:22), a ruler (king) who has none above him save the Lord his God.
The deresha used implies that the requirement of Nasi is anyone at the top of societies' hierarchy - not necessarily a king.
Gemara Horayos 11b
https://he.wikisource.org/wiki/%D7%94%D7%95%D7%A8%D7%99%D7%95%D7%AA_%D7%99%D7%90_%D7%91
בעא מיניה רבי מרבי חייא כגון אני מהו בשעיר אמר ליה הרי צרתך בבבל
Rebbi (Yehuda Hanasi) asked R' Chiya - someone like me, would he bring a goat? He said to him, "Your superior is in Bavel".
As Rashi explains, were it not for the Exilarch in Bavel being superior to Rebbi, he would, despite not being a "king", have brought a korban nasi.
It's clear from the *Gemara *that any "head" would be a nasi for the purposes of the korban, as long as they are actually supreme.
The Gemorah then quotes a different version of Rebbi's question:
רב ספרא מתני הכי בעא מיניה רבי מרבי חייא כגון אני מהו בשעיר א"ל התם שבט הכא מחוקק
Rashi:
התם שבט - דהיינו מקל כמו כי תכנו בשבט לא ימות
והכא מחוקק - חכם
Rashi here explains that political power (a staff in the sense of a weapon) is required, not just being a teacher of law.
This second version implies that Rebbi was intrinsically excluded from nasi-hood, as he lacked the necessary political power (I assume being subservient to Roman governors).
However any leader with supreme political power, whether king or not, would be included. The nasi of the Sanhedrin may at times have held such power, and it's probably that type of leader which the book you quote refers to.
| tomekkorbak/pile-curse-small | StackExchange |
'''Basic Trope''': Dull erotica.* '''[[IncrediblyLamePun Straight]]''': The sex scene between AliceAndBob is described as, "He put his hard sex in her soft sex and they had sex," and that's it.* '''Exaggerated''': All sex scenes are described this way.* '''Downplayed''': The sex scene goes along the lines "He looked at her passionately, she looked at him the same, and they started to make love" before skipping to a relevant point.* '''Justified''': Sex ed.* '''Inverted''': MillsAndBoonProse* '''Subverted''': A SexyDiscretionShot is used.* '''Double Subverted''': Another sex scene happens, which is described this way.* '''Parodied''':** Alice and Bob are ''literally'' shown assembling an IKEA product, and have [[AccidentalInnuendo orgasmic reactions]].** The blandness is taken to ridiculous extremes and their dirty talk becomes BeigeProse, 'move your body against me faster' and 'I am feeling highly aroused'.** They have blandly described sex in an actual IKEA store.** Bob and Alice's sex life is so boring that [[ThePeepingTom Charlie]] thinks they're assembling IKEA furniture just because the narration of the scene is just that boring and then he falls asleep.* '''Zig Zagged''': The description is so bland they might be putting furniture together. And they are putting furniture together. Because their fetish is furniture assembly. But they're both incredibly bored with it and it's mechanical to them.* '''Averted''': The sex scene is described reasonably and in detail.* '''Enforced''':** The writers didn't want to include a sex scene, but got [[ExecutiveMeddling overruled]].** "We're running out of ways to appeal to the LowestCommonDenominator. Let's put in a sex scene and describe it as, 'They had sex'."* '''Lampshaded''':** "What's with all the erotica which is written as 'They had sex'?"** "You know, I bet that felt a lot better than it could be described."* '''Invoked''': The writer wants to show that Alice and Bob find the sex incredibly boring and passionless.* '''Exploited''': Once Charlie discovers how bland Alice and Bob's sex life is, he introduces them to kinky sex to score a threesome.* '''Defied''': Alice stops, says that she doesn't want the sex to be bland and boring, and puts on soft music and mood lighting.* '''Discussed''': ???* '''Conversed''': ???* '''Deconstructed''': The dry description of the sex scene is actually what's going on in Alice's mind. She finds the act so dull and emotionally uninvolving that it amounts to nothing more than the physical action of "in, out, repeat."* '''Reconstructed''': The dryness of the scene is an alien and/or robot describing to Alice what it thinks sex is like for humans. Then Alice talks to the alien so that it can understand the importance and emotional impact of sex to humans, and the alien learns more about humanity in a touching moment.----Put your mouse on IKEAErotica.----%% Optional items, added after Conversed, at your discretion:%%%%* '''Implied''': ???%%* '''Plotted A Good Waste''': ???%%* '''Played For Laughs''': ???%%* '''Played For Drama''': ??? | tomekkorbak/pile-curse-small | Pile-CC |
Howard the Duck made a huge return this summer during his amazing Guardians of the Galaxy cameo. Apparently his current success on the big screen has inspired a return to his original source material, because Marvel is giving Howard a new comic series.
Entertainment Weekly is reporting that Howard the Duck will return to comics this spring. The series will be penned by Chip Zdarsky (Sex Criminals) and illustrated by Joe Quinones. According to Zdarsky, Howard's got a gig as a pissed-off private investigator who is none too happy about being stuck on Earth.
"He's an everyman who happens to be a duck! He's angry, exasperated, and he's had it up to here with the world around him, but he's trapped here! Infinitely relatable!
I love the contrast of Howard against both the normal world of us hairless apes and the weird worlds of Man-Things and Dr. Stranges and Spider-Mans. Cause he doesn't fit into either, really.
I'm just going to continue exploring those contrasts, but my ultimate goal is to make it funny. Marvel has taken chances on funny books and injecting humor into superhero titles, so I want to make sure this is worth some chuckles here and there. God, I'm picturing the reviews now: 'Some chuckles here and there.' Shoot for the stars, Chip!"
Advertisement
Joe Quinones added that we should all be expecting some "fun sci-fi stuff coming up," because Howard isn't just a duck; he's also an alien.
To read the rest of the interview and check out some additional Howard art, head over to EW. | tomekkorbak/pile-curse-small | Pile-CC |
Memorial Day Is Coming (So Grab a Party Pack at Bartaco; Get Your Schnitzel On at X2O; and the Single Instance Where Belly Is Sexy
Memorial Day Is Coming (So Grab a Party Pack at Bartaco; Get Your Schnitzel On at X2O; and the Single Instance Where Belly Is Sexy
Instant Party at Bartaco
Right now, I’m looking at my vast collection of food magazines, which burden my kitchen bookshelves and occasionally fall on my head when I try to extract one. You know what they’ll all be writing about between May 25 and September 3? They’ll all be filled with ideas for easy summertime entertaining.
Great, but the bad news is that these magazine parties all presuppose that you’ve actually managed to plan the party ahead. That you’ve shopped for the ingredients and have done a whole bunch of prep work almost defies the notion of summer. At my house, summer parties just sort of happen. Parents share a glass of wine after a play date, people linger after the beach. At sundown, after a sweaty day of yard work, neighbors all wind up on one porch. Generally, we don’t know how many people will show up, but we do know that we’ll be hungry.
Cue the Party Packs at bartaco. Here’s what it’s got going for it: First, it’s fairly cheap. Depending on the size of your gathering, these Party Packs average about 15 bucks per person and can be ordered for 5, 10, 15, 20, or 25 diners. Each pack yields ample, family-friendly snacks of quesadillas, chips, guacamole, and pork and chicken tamales, and, when those disappear, you can dig into tortillas with three types of taco filling. For sides, there’s cucumber salad, pickled veggies, chipotle slaw, grilled corn with lime, cayenne and Cotija cheese, and all three of bartaco’s excellent sauces. The pretty, dragonfly-stamped paper sacks also include paper plates, handy disposable tongs, plastic cutlery, and tons of napkins. Plus, you don’t need to call bartaco days ahead–just call and pick up your Party Pack as you would for regular takeout. Or, Fairfield County residents can spring a few more bucks for a delivery charge. Party Packs from bartaco’s Stamford location can be delivered by the independent restaurant delivery service, GoWaiter.com.
Oh, but you say it’s just not the same. What about those amazing bartaco drinks? Well, I just happen to have this covered. I snagged the recipe for one of Wine & Spirits Director Gretchen Thomas’s triumphs: her Smoky Cholula. A couple of notes on the cocktail recipe (below): You can find guava nectar in Latino markets or in Latino supermarket sections—sometimes sold as guayaba nectar (which is how I found Goya’s version). Don’t try to substitute just any mezcal for the leathery, smoky Sombra. The good news is Sombra is widely available and pretty cheap as far spirits go. We found a $30 bottle at the nondescript liquor store next to Stop & Shop. Also, just like bartaco, you can make the Smoky Cholula in pitchers—I’ve done the extension below. Here’s to a happy summer!
Smoky Cholula
Courtesy of bartaco
(Makes 1)
1 oz Sombra mezcal
1 ½ oz guava nectar
½ oz lemon juice (or juice from ½ lemon)
½ oz simple syrup
Lemon wedge for garnish
Combine all measured ingredients in a cocktail shaker. Fill with ice and shake well. Strain into an ice-filled rocks glass and serve, garnished with a lemon wedge.
Smoky Cholula (pitcher)
Adapted from bartaco
Serves 8
1 cup Sombra mezcal
1 ½ cups guava nectar
½ cup lemon juice
½ cup simple syrup
8 lemon wedges
Combine all ingredients except the lemon wedges in a pitcher (may be done a bit ahead). Serve over ice with lemon wedge (or, if you’re inspired, shake each serving to order with ice, then strain into ice-filled rocks glasses).
Here’s an incredible opportunity to enjoy a lavish feast (with a view!) for not a lot of dough. This, from Chef Peter Kelly: “Please join us this Thursday, May 17, in the Dylan Lounge at X2O for a very special meal. In addition to our regular Dylan Menu and full sushi bar we feature...
A Three-Course Dinner featuring Pan-Fried German Wiener Schnitzel
My very first job in a restaurant was at a little German restaurant where Katy, the owner and chef, first taught me about the wonders of German cuisine. Wiener Schnitzel is the classic German dish that I love best. Young veal is cut into steaks and pounded thinly, then dusted with fresh bread crumbs and crisped in a pan. The result is tender veal with a crispy texture served with a drizzle of veal jus.
Let’s just think of this dish as “pig candy.” We’re talking pork so beautifully cooked that its interior is falling-apart tender, yet its generous layer of fat is rendered and seared with Crown Maple Syrup until it merely whispers luxury. Look for Chef Marc Lippman’s hyper-seasonal ramp-potato purée to rest underneath and a generous scattering of blonde Hudson Valley morels to make this dish insanely lavish. Yum. | tomekkorbak/pile-curse-small | Pile-CC |
1. Field of the Invention
This invention relates to a process and to a composition of matter resulting from this process. More specifically, this invention is directed to processes for the preparation of spherical colloidal particles of rare earth (hydrous) oxides. The particles produced in accordance with these processes have a very narrow particles size distribution and well defined morphology. These particles have advantageous optical properties (i.e. fluorescence) and are, thus, useful in diagnostic applications in the optical separation of various constituents of complex fluids (i.e. blood, cerebrospinal fluid or urine).
2. Description of the Prior Art
The preparation of colloidal particles from organic substances has, until very recently, been a highly empirical "science". For the most part, the efficacy of such processes was quite subjective and generally the relative success or failure thereof required laborious trial and error in order to attain adequate process definition. More specifically, the efficacy of a particular technique, even if it were reproducible to a degree, rarely produced a consistently acceptable product. The inability to achieve reproducible results from such processes has, thus, led many to regard the synthesis of inorganic colloidal particles as largely the domain of the empiricist.
With the advent of more sophisticated analytical tools (i.e. electron microscopy), the fascination with inorganic colloidal particles, and more particularly, monodispersed inorganic colloidal particles, has been rekindled. The initial interest in such materials was primarily as a scientific curiosity, however, more recent developments have found them useful as supports for catalysts, in ceramics, pigments, films, recording media, coatings, in various diagnostic and therapeutic environments, as well as a myriad of other applications.
The term "monodispersed" as used in the discussion of the prior art and throughout the balance of this disclosure is intended as referring to a population of particulate materials having a narrow particles size distribution.
A survey of the various techniques for synthesis of monodispersed, inorganic colloidal particles has recently appeared in the technical literature, see Matijevic, E., "Monodispersed Colloids: Art and Science", Langmuir, Vol. 2, No. 1, pp. 12-20 (1986).
The procedures which have been developed by the inventor for synthesis of inorganic colloidal dispersions of narrow particle size distribution have been described in detail in a number of papers which have also appeared in the technical literature, see for example, Matijevic, E., Annu. Rev. Mater. Sci. (1985), 15, 483 and Matijevic, E., Acc. Chem. Res. (1981), 14, 22. Two of the procedures described in the above articles can be conveniently grouped into the following categories: (1) precipitation from homogeneous solution (i.e. forced hydrolysis, controlled release of anions and controlled release of cations); and (2) phase transformations. What is, however, to be appreciated is that each of the above procedures will have one or more shortcomings or advantages for synthesis of a specific colloidal material. Thus, the production of an acceptable product in accordance with each of the processes from the same starting materials is highly unpredictable. More specifically, in order to produce colloidal particles of specific characteristics, both of the above procedures may have to be attempted before one can be identified as potentially useful or efficacious. At that point, additional refinement will be required before an acceptable product is attainable.
In the procedures involving precipitation of inorganic compounds from homogeneous solutions, the precursors to the formation of the solid phase are, in most instances, one or more solute complexes. This procedure is, thus, based upon the control of kinetics of the complexation reaction in order to achieve a single burst of nuclei, which are then allowed to grow uniformly, resulting in particles of narrow size distribution. Where the constituent solutes are generated at the proper rate, their even distribution onto existing nuclei results in the least increase in total free energy of the dispersion, thus, controlling the growth of such particles by proper control of particle charge. Control of the charge in such particles is traditionally achieved by adjustment in pH or through the introduction of additives. In the absence of such control in charge, aggregation of such particles will result.
The phrase "forced hydrolysis" is used hereinafter to reference the process or ability of many hydrated metal ions (especially polyvalent metal cations) to readily deprotonate in aqueous solution at elevated temperatures. This characteristic can be used to advantage in the preparation of colloidal particles from such materials. Since the hydrolyzed species of these metal ions are intermediates to precipitation of the corresponding hydroxides, it is possible to generate uniform particles simply by heating metal salt solutions. In this forced hydrolysis procedure, the pH and the nature of the anions play a dominant role. In some instances, anions may simply affect particle morphology without being integrated within the solid phase, or can be incorporated within the solid phase as impurities into either an amorphous or crystalline solid. Lastly, these anions can through stoichiometric compounds, as in the case of alunites.
Because of the nature of the colloidal particles, and the various methods used in their preparation, their physical properties are often unpredictable. More specifically, the preparation of colloidal particles from rare earth oxides by traditional methods did not permit the attainment of particles of predictable morpology or uniform size.
The traditional procedures for the synthesis of rare earth oxides are both diverse and energy intensive (Kirk and Othmer, Encyclopedia of Chemical Technology, (2nd Ed), Vol. 17, 163). The so-called "dry" approach to such synthesis involves the initial formation of salts (i.e., hydroxide, carbonate, oxalate, nitrate, sulfate, etc.). These salts can be converted to the corresponding oxide by standard calcination techniques (at temperatures in excess of 850.degree. C.). These salts are, thus, decomposed to the corresponding oxides which are essentially insoluble in aqueous media.
The rare earth oxides produced in the above manner have had rather limited applications, and then primarily in industrial environments. Rare earth compounds, including rare earth oxides, have been mainly used in glass manufacturing and polishing, arc carbons, catalysts, lighter flints, and in ceramic applications.
The adaptation of colloidal materials to biological environment introduces a unique set of variables. For examples, if a colloidal material is to be used in a fluid environment, its ability to form stable dispersions can be critical. In the event the colloidal material is to be used as an indicator or a label, the photo-optical or magnetic properties may be of paramount importance. Colloidal particles are attractive for biological applications because they are relatively inert and can be produced in quantity from readily available materials at relatively low cost. Unfortunately, the inability to prepare such materials in a reproducible manner, with predictable properties, has hindered their general acceptance. Accordingly, there is a continuing need to provide a cost efficient reproducible process for the synthesis of inert, inorganic colloidal particles. | tomekkorbak/pile-curse-small | USPTO Backgrounds |
Q:
Why tabs are not the same in Android?
I am testing with ViewPager and ActionBar.Tab and the problem is in the following image.
I was expecting the tabs to view on every device as same. They are same on Note 3 and S4 but not on Xperia L.
Question is:
Are they same because of Android 4.4 ??
Are they same because of xxhdpi ??
How can I make them look alike on every (or most) device possible ??
A:
It is due to the default theme configuration. Please check in the androidmanifest.xml file of your application.
If it contains the style as
android:style/Theme.DeviceDefault
Reason:
Every OEMs have their own varient of theme.
Solution:
Be specific about the theme needs to be applied like below
@android:style/Theme.Holo
| tomekkorbak/pile-curse-small | StackExchange |
Tag Archives: AL
— Does Not Compute:
If you believe the official Israeli government story regarding their boarding of those humanitarian aid ships that were bound for Gaza, Israeli commandos, thought to be among the toughest, best trained and equipped military outfits in the world, can be easily disarmed, beaten and stabbed by out-of-shape amateurs wielding metal rods. Either the Israeli commando force has turned into vanilla pudding or Netanyahu’s government is lying through its teeth regarding the events surrounding the deaths of at least nine aid workers aboard those ships. I’ll leave it to you to decide which is more believable.
— Old Soldiers (and Sailors) Never Lie, But They Do:
Republican Rep. Mark Kirk, who awarded himself a military citation, ‘Intelligence Officer of the Year,’ he never received and even boasted about it in Congress and in his official bio; and who also claimed on his website he was part of Bush’s Iraq invasion when he wasn’t, just lost the race for Barack Obama’s US Senate seat in Illinois. Well, that’s if his Dem opponent, Alexi Giannoulias has the nachos to run an ad showing Kirk blabbering on about the mythical citation and then citing the fact that Kirk just made it up, and pointing our as well that Kirk was really safely in Washington when he said he was serving in Iraq. The tagline: ‘How can you trust Kirk to represent you honestly when he can’t even honestly represent himself?’ Sure, the same can be said about Democrat Richard Blumenthal in CT who inflated his military record to service in Vietnam, and you can bet the GOP will be milking that for all it’s worth. (Side Note: Vets never forget where they served or what medals or citations they received, and they don’t ‘misspeak’ when discussing them. Kirk’s full of it when he says otherwise, and so is Blumenthal, for that matter. A pox on both of these cheesy military resume-bloaters!)
— The World Turned Upside Down:
MSNBC reported this afternoon (6/2) that crude oil has hit the barrier shores of Mississippi and Alabama you know, the ‘safe areas’ according the BP — and west Florida is next. While BP CEO Tony Hayward continues making cringing pronouncements that would befit a ditzy Monty Python character yes, Tony, those 11 people who were killed on your Deepwater Horizon rig would no doubt like their lives back, too, as well as the tens of thousands who depend on the Gulf for their livelihoods watch for BP to declare bankruptcy soon and split up into several smaller companies. Bankruptcy means what’s left of BP will only be paying for a fraction, if any, of the cost of the clean-up and, regardless of Eric Holder’s tough prosecutor stance, there won’t be any senior BP execs heading for jail. (Most of them are in the UK and the Brits likely won’t extradite.) Uncle Sucker, that’s you and me fellow taxpayer, will get stuck with most of the tab and the generations of suffering that comes with it. I only hope our redneck friends down in the Gulf states get the hint and stop electing corrupt Big Oil-funded boobs to office; I hope the rest of us get the message that it’s time to get off the oil teat permanently and switch to renewable energy. Okay, and I want world peace and a flat belly by tomorrow, too. | tomekkorbak/pile-curse-small | Pile-CC |
The government agency is estimating the weekend game will give a $125 million (€100 million) boost to the Irish economy. Thousands of American tourists are expected to descend on Dublin ahead of the game in Dublin’s Aviva Stadium.
TV ads promoting Irish tourism, which will be broadcast throughout the game on CBS and ESPN are expected to reach an audience of three million people.
“The sponsorship provides us with a unique opportunity to showcase our Irish hospitality abroad and to inspire and excite people to be part of The Gathering Ireland in 2013." Jim Miley, Director for The Gathering said in June.
He added, “We are delighted that our first ever Gathering event is in association with such a prestigious organization and one that holds such strong and long lasting connections with Ireland.” | tomekkorbak/pile-curse-small | Pile-CC |
Subsets and Splits