Datasets:

semran1
/

DCLM-pro-4-subsample-800k

Dataset card Data Studio Files Files and versions Community

Split (1)

train · 800k rows

text stringlengths 124 652k
African-Americans, Afro-mentality, Black, Black-America, Black-American, Black-Americans, Identity, race, Race identity, Race in America The context difference between “Black American” vs. “Afro/African American.” I want to bring to the table to the African Diaspora, but mostly getting the attention of any person who refers to themselves as “Black” within the African Diaspora. There are African communities within the African Diaspora that still hold onto our African roots, culture, fashion, food, and identify themselves as Afro/African and not Black. There’s a clear distinction between the words “Black” and “African.” They do not mean the same, and they are not synonyms. The term “black” is an English word from English grammar that represents a color description. The term “African,” also in the English context, is a race of people from the African continent, to those currently living in Africa and those shipped to America, Mexico, Central America, South America, and the Caribbean. Your wondering why I’m writing an article on the context difference between the words “Black” and “Afro/African.” Let’s quickly go over some English grammar since I’m writing in English. The term “black” is a color, which means it is describing something in color context. Technically, the word “black” is an adjective. However, modern-day humans in the United States of America are capitalizing the color term “black” to “Black,” now seemingly trying to make it a noun, something that describes a person, place, or thing. In the United States, we don’t capitalize on the other colors of the rainbow in English grammar. Since we still call two race groups by color, Black & White Americans. We don’t capitalize on the following different colors: red, green, yellow, purple, brown, or blue because we don’t associate these colors with humans. The word black in context reads basically a color perspective. Even though forth righteous, those who identify with black have only learned it from their parents, grew up saying their black with friends, watched media talk about race in black & white context, and hearing other people around them. Suppose you’ve seen my blog profile picture. You will notice I’m dark tone, brown chocolate skin tone, but maybe in your perspective, you may see me as a Black woman. I am not! I don’t see my race identity and people as Black people. If people within the Black community use the line, “I don’t know where my ancestors come from, I don’t know what tribe I’m from, or I haven’t learned anything about Africa.” Your putting excuses toward your truth in your mind, soul, and heart. Some African-Americans’ have taken their homecoming trip back to Africa, while other African-Americans are using African Ancestry to discover their African nationality and tribe’s name from your DNA code to find your mother and father’s African roots. I recommend every African American who identifies as Black American to discover the inherent African nationality they haven’t been exposed to predominately in the United States. An African American family Discover your African roots, history, tribe, your people, and your culture with just a mouth swap and course $299 for either your matriclan or patriclan. Affirm is a viable payment plan option starting at $28 a month. PayPal is another option available if you don’t want to pay with your debit card. The word “African” in context represents a human being from the African continent, even those taken during the Atlantic & Arab slave trade eras. The word African is, respectively, a noun and an adjective. It’s describing a person of African descent and relating to the continent of Africa. Many Africans within the African Diaspora, especially in the United States, the Caribbean, Canada, and Brazil, recognize their identity as black rather than express their identity as Afro/African, even if you weren’t born on the African continent. crowd of protesters holding signs Photo by Life Matters on The touchy subject that so-called, Black Americans need to have and will hopefully learn to research and accept their African identity. It’s by acknowledging, recognizing, speaking, and writing in Afro/African identity, en Espanol Africano (masculine)/Africana (feminine) /Afrocito (m.)/Afrocita (f.) I am about challenging Black and White American identity in the United States because it’s part of the racism problem even though you may not believe so. It’s part of the problem of not telling my people the truth; instead, giving us prejudice racial terms to identify the African race. I ask those African-Americans who identity as Black to ask themselves if you are the color black truly. Think of color in the context of our race. Look at yourself in a mirror and ask yourself again, “Am I a black human being?” If you look at your hair and you look at your skin. Our hair is black, and our skin is brown. If it doesn’t match, then it’s not true. I would reconsider if it did match. I know, for sure, Black Americans are not Black, Colored People, or People of Color. We are descendants of African nations & tribes, and yes, we are descendants of African slaves shipped to America. But more than ever, our people come from Africa, and we should respect that. Saying black does not respect or dignify your African human self. It demeans your human self to a color that is not even the skin tone’s right color name. You are Africans living in the United States. women at a protest Photo by Life Matters on I know and understand that the African governments never came back for their people after the slavery era. They also had their own issues while African Americans were handling their own in America. The beauty of YouTube and African Ancestry is watching African Americans take their homecoming trips back to Africa. When you visit Africa, you’ll receive race & cultural history tours, market tours, food history, city, tribal, and national history, and adventure excursions. It’s totally worth your human life experience to re-experience something we lost by going to travel to Africa. African Ancestry is a company that specializes in tracing your maternal and paternal DNA to your African roots. Your African identity’s self-realization and the journey to traveling to your African roots should be part of your life’s journey with your family. AfroEspiritu / AfroEsprit / AfroSpirit / AfroEspirito Hey ya'll, My name is Espe Ndombe, currently residing in Aromas, CA. I work in the culinary and the digital marketing industry. Right now, my career is heading toward full-time work in digital marketing. I'm building a digital ad agency called Earthian Digital Marketing. The mission is to target small businesses and develop digital marketing strategies & techniques to elevate the business profits and awareness. I love to cook West African food, American food, Italian, and Chinese food are my favorites. I'm hoping to create a West African food pop up event next year. Besides being a cook, I love to dance, watch action/comedy/drama movies, gardening, and having a good time on planet Earth. Leave a Reply %d bloggers like this:
Drops of knowledge Marine water Here’s the answer to eco-friendly dredging Work dredger dredging with sand washing on beaches. Special dredging hose for sand to create new land. Sand washing on sea beaches. Dredging, washing out sand on beach during construction sea terminal Q1: What is dredging? Dredging is a massive business encompassing a wide range of activities on water. This could be nourishment of beaches to combat coastal erosion, creation of land reclamations, maintenance of river mouths for flood mitigation, maintenance of port access channels and port basins, trenching of pipelines and cables, sand mining, dredge spoil disposal, sand capping and so on. Common to these are that seabed material is relocated as part of an intervention. Q2: Why should we be concerned about the effects of dredging? Dredging operations often create turbidity plumes. Excess turbidity in the water has the potential for triggering permanent and damaging impacts to our marine environment. It can be tricky as dredge plumes are not always visible from the surface of the sea. To understand the seriousness, try googling ‘dredging penalties’. Several examples of exorbitant fines for violating, for example, ocean dumping acts can be found. Awareness and strict enforcement are key to fencing the problem. Regulators and Environmental Protection agencies set the bar. Dredging, port and waterway engineering communities drive the innovation to comply, and it’s a constant source of admiration to me what this industry is achieving technically to keep up. Q3: How is DHI contributing to this industry? DHI services the dredging industry by offering our expert advisory and trademark models both rooted in our detailed understanding of the complex processes associated with stirring of seabed sediments. I am very pleased that we have launched a pioneering web-based application this year which allows easy access to complex modelling, where dredge plumes can be emulated in full, seamlessly and coherently. This will definitely make life easier for our clients and hopefully boost the potential of computer models in driving innovation within the industry. Q4: What are the benefits of using models? This is a nice one! For starters, models can be used to shape and test eco-friendly solutions, mitigation options and determine ‘environmental windows’ for limiting impacts of dredging. We commonly use models to optimise and validate dredge plans prior to dredging works (for example, at the initial Environmental Impact Assessment stage). Models are particularly useful for distinguishing dredge plumes from background concentrations, assess cumulative effects and impacts during extreme events; something otherwise difficult. There is a long list of possibilities within the operational space. For instance, we see a potential for using models as an integral part of the vessel control system to guide onboard decision in real-time. Models have a lot to offer. If data is sparse, models can fill data gaps and de-risk projects. However, if supported by live onsite data stream and made web-accessible then traditional models will advance towards truly digital twins unlocking new possibilities. Q5: Can you give an example of a solution where models made a difference? I always like to talk about feedback monitoring – a DHI specialty that is endorsed by PIANC– and how dredging can be proactively managed to minimise impacts. This is a lovely example of how models can be used intelligently to cap impacts and de-risk operations. In short, a plume model is set-up in operational mode, in principle for any given dredging works, continuously calibrated with various data and then used to forecast dredge plumes from dredge plans. Forecasting of dredge plumes is used to identify risks of trigger level exceedances and thus allows for timely adjustments to the dredging works to comply with environmental targets. The adjustments being tested as well. Using models in operational mode has many upsides for both the environment but also for the dredging companies. At this stage, feedback monitoring is more suitable for larger infrastructural projects. Without doubt, it has broader potential and we are therefore developing methods that will push feedback monitoring beyond its current applicability. This we believe will contribute to the continuous innovation race. Plume from disposing sediment contained in a 10-litre bucket. Imagine the plume from 1000 m3! © DHI Optimise your dredging operations Dredging and reclamation activities are common when it comes to port construction and expansion. See how you can manage port siltation proactively, calculate sediment spills quickly in the cloud, analyse environmental risks and optimise dredging operations 24/7 with integrated solutions that cover sea, port and land. Learn more.
Blute Blog The Use of Re in Forecasting COVID-19 is Misleading leave a comment » John Simpson kindly drew my attention to the Oxford’s COVID-19 Evidence Service’s method of forecasting the epidemic using their basic reproductive number which in my view is misleading (see and search “when will it be over”). Their widely cited R parameter is defined as the expected average number of individuals one individual will infect in a susceptible population. If the expected R, Re, is less than 1 they expect the infection to eventually die out; if it is greater than 1, they expect it will continue to spread exponentially in the absence of immunization. This is somewhat misleading. Instead, the growth of a biological population such as the virus is commonly described with the density-dependent S-shaped logistic function: which relates the rate of growth of a population such as the virus SARS-CoV-2 which causes the disease COVID-19 at time t (the tangent to the curve relating population size to time) to its existing population size Nt and two parameters – r, the intrinsic rate of increase, and K, the ceiling, i.e. the carrying capacity of the environment. Initially, logistic growth approximates exponential growth because the expression in square brackets approximates 1 and hence dNt/dt approximates rNt , the expression for exponential growth. The maximum growth rate (tangent to the curve) is at K/2 and the growth rate declines thereafter symmetrically with its previous increase until it reaches 0 at N = K where population size itself levels off. The reason is obvious. Once half of the carrying capacity of the environment i.e. the susceptible host population is reached, it becomes harder and harder for the virus to find additional hosts; infected individuals become less and less likely to encounter people to infect – sometimes referred to by epidemiologists as herd immunity. It should be pointed out that Re would not be misleading if it was being assumed that frequent culture-gene coevolution was taking place as described here about five posts ago. If frequent, adaptive mutations were taking place among the viruses, selected for by our culturally spread methods to avoid it (social distancing, mask wearing etc.), then the viral population could potentially continue to grow exponentially even to the ceiling. That extreme at least is very unlikely. Genetic variants of the virus are known, but there is no knowledge that the ones identified have adaptive and certainly that much adaptive significance, as of yet anyway. In any case, they explicitly assume a homogeneous viral population However, it should also be pointed out that none of this matters for now and for the near future at least. By the best evidence I have been able to find, no country is close to having half of their population infected except possibly farmed Mink in Denmark! Written by Marion Blute November 5, 2020 at 4:58 pm Posted in Uncategorized Leave a Reply You are commenting using your account. Log Out / Change ) Google photo Twitter picture Facebook photo Connecting to %s %d bloggers like this:
Breakthrough for depression The rising cost of health care is a concern to most Americans. If we move forward to Universal Healthcare, can we afford it? Are there cheaper approaches to the most common problems? For example, depression is common and often requires several trials at great expense to discover workable therapy. The venerable Bonkers Institute for Nearly Genuine Research reveals that a direct approach to what bothers many patients may be one of the most innovative and cost effective remedies yet discovered. Misery of depressionDepression and anxiety are the most common mental disorders in America, affecting more than 60 million patients every year. Pharmacological interventions dominate the medical management of these disorders and may include selective serotonin reuptake inhibitors (Prozac), norepinephrine reuptake inhibitors (Strattera), monoamine oxidase inhibitors (Emsam), benzodiazepines (Valium), azaspirodecanediones (BuSpar), and any number of similarly efficacious drugs or drug combinations prescribed in accordance with strict FDA guidelines, or not, based on the treating physician’s better judgment. Since mental illness is a lifelong condition with no known cure, the successful psychopharmacological management of disorders such as depression or anxiety can be challenging. Treatment with medication almost inevitably results in side effects requiring additional medications leading to additional side effects necessitating still more medications in a self-perpetuating cycle that finally ends when the patient dies or the insurance runs out. This report discusses two cases in which complete symptomatic relief was achieved following the administration of large sums of money to the patients.
Change in the House? 80 years of Elections in the US House of Representatives 2018 is looking like an important off-cycle election in American politics. In the Senate, Democrats/Democrat-leaning Independents are defending a mammoth 26 seats (includes a special election for Al Franken’s old seat), and ten of those seats are in 2016 Presidential Red states. Of those, seats in Indiana (Donnelly), Missouri (McCaskill), North Dakota (Heitkamp, and West Virginia (Manchin) look particularly susceptible. On the other side, the Republicans are defending just eight seats, and only one is in a 2016 Blue State (Heller in Nevada). In addition to Nevada being a tossup, Arizona (to replace Flake) is also susceptible. But what does the 2018 House prospect look like? The chart illustrates 80 years of House of Representative elections (1938 is the first year were the House popular vote is straightforwardly available). The location of the Red (Republican) and Blue (Democrats) bubbles in the chart indicate the percentage of seats each party held in each year. Anything above the dashed 50% line indicates a majority. The size of each bubble is proportional to the popular vote; the popular vote is normalized by the total US population for each election year. Bright red and bright blue circles indicate occasions where the popular vote did not match the seat majority. This includes recent examples in 1996 and 2012. A few things to note: • The US is now redder than people think: Since 1992, the Democrats have had the majority of House seats on just two occasions (2006 and 2008), though they won the popular vote on two further occasions (1996 and 2012). • The country used to be very blue: The Republicans were in the House minority every year from 1954 to 1994 (they lost the 1954 election, but won in 1994). • Democrats and 2018: The Democrats have won a single off-cycle election in the House (2006) since 1990. Will 2018 be any better? • Election turnouts: In Presidential years since 1938, 37% of the US population (not eligible voters) votes in the House elections. This drops to 25% in off-cycle elections. Data and software: Data on the Senate 2018 race and historic House elections is taken from Wikipedia1,2. The data was compiled and visualized using Microsoft Excel3. 1. https://en.wikipedia.org/wiki/United_States_Senate_elections,_2018 2. https://en.wikipedia.org/wiki/United_States_House_of_Representatives_elections,_2016 3. https://products.office.com/en-us/excel 1. David Whiteley If I’m reading this correctly, the Dems prospects aren’t looking good. Can we hope for a grass roots reaction vote against the President and party? Or have we entered a new era where past political examples no longer apply? Thanks for statistical reality check and potential future nightmare. • Comment by post author I don’t have the answers of course! I’ve seen a reasonable amount of pessimism from the Republicans and optimism from the Democrats… I’m not sure it’s entirely well placed. Based on current projections (pretty darned uncertain at this point!), the Senate could go either way by one or two seats. And that’s actually pretty good news for the Democrats since, in 2020, they’re defending fewer seats and the Republicans, in a Presidential year, will have a tough time potentially. The main driver that prompted me to look at the House was the fact that, even though Trump lost the popular vote heavily, the Republicans in the House won the popular vote by ~1.5 million. And they’ve done very well in the house since 1990 (lost the House only twice, and two further times lost the popular vote). That’s why I think the country is Redder than either party knows or admits! I realized that very few people, including the most knowledgeable people I know, didn’t know this! Grass roots: here’s my thesis to Democrats. Take a look at the seats that Democrats had in 2006 (https://tinyurl.com/y77rczvh) but not in 2016 (https://tinyurl.com/y92lgxta). Almost every single one is a suburban or Blue Dog district. The democrats have the liberal seats pretty much sown up. But what is the message that could win those 2006 seats back? If I were a Democratic strategist, I might argue that the policies ae OK but the framing is poor. For example, why not campaign on the fact that food stamps (SNAP) has a positive multiplier effect for the economy (layman terms: it’s the nest investment America could make economically) or that government/universal healthcare (which the majority of Americans wants) is great for small businesses and exports? Leave a Reply
Skip to content How Credit Cards Work (and How to Use Them Responsibly) Credit cards are an interesting tool. If you use them responsibly, they’re a great way to build your credit, protect yourself from fraud, and even earn some cool rewards along the way. But they also have a dark side. Because they make it so easy to buy now and pay later, credit cards can land you in massive debt if you aren’t careful. Not to mention that your credit score (and general quality of life) can suffer if you can’t afford to pay off your card(s). Most of the trouble people get into with credit cards, however, is the result of misunderstanding (or not understanding) how credit cards work. To clear up any misconceptions, we’ve put together this guide. Not only will you learn how credit cards work and how to get a credit card, but you’ll also learn how to use them responsibly. This way, you can use credit cards as a powerful financial tool instead of a path to financial ruin. Credit Cards: Instant Revolving Loans We don’t often think about it, but making a purchase with a credit card is nothing more than an instant loan. How is that even possible? Doesn’t taking out a loan require lots of paperwork and meetings with people at a bank? Well, that depends on the type of loan you’re talking about. In general, there are two types of loans: installment loans and revolving loans. Let’s look at how each of them works: Installment Loans Installment loans are for a fixed amount of time (or “term,” in financial speak), have a set repayment schedule, and are for a lump sum of money. You may already have an installment loan if you have an auto or student loan. Because everything is agreed to upfront, interest rates on installment loans tend to be low (less than 10%). However, the requirements for getting installment loans often tend to be stricter than revolving loans. Revolving Loans In contrast, revolving loans don’t have fixed terms or repayment schedules. They don’t give you a fixed lump sum, either, just a maximum amount you can borrow. And they tend to be easier to get than installment loans. However, this greater flexibility also comes with higher interest rates, as revolving loans are a bigger risk for the lender. If you’re looking into credit cards, that almost certainly means you’re getting a revolving loan. This can be very powerful (borrow as little or as much money as you need), but also dangerous. You can easily rack up huge debts that continue to compound, taking decades to pay off. But how is this possible? How can a few purchases here and there snowball into mountains of debt? To understand this, we need to look at how credit card interest works. How Credit Card Interest Works Credit card companies don’t want you to think about interest; it’s all “buy now, pay later.” But interest is the main way credit card companies make money, and you better understand how it works before you sign up for a card. What Is APR? The Annual Percentage Rate (APR) is the number credit card companies use to determine how much interest you’ll pay. You’ll see this number prominently displayed when you’re applying for a credit card or when you get your monthly statement. The APR will vary depending on your credit score and the card you get, but it will always be quite high (especially compared to installment loans). On its own, however, the APR is misleading. Because while a card might have an APR of 20%, that doesn’t mean you get charged 20% interest on all of your purchases each year. Instead, most credit card interest is calculated and charged on a daily basis. This is called the daily rate. How to Calculate Credit Card Interest To calculate the daily rate, divide your APR by 365 (some companies use 360, but the difference is so minute we won’t worry about it here). So if your APR is 20%, your daily interest rate is 20% / 365 = 0.055%. Great, but how does that help you figure out how much you’ll pay in interest each month? To do that, we need to do a bit more math. Credit card issuers apply your daily interest rate to what’s called your average daily balance. To calculate this, add up your daily balance (the amount you owe) for each day in your card’s billing period and then divide that by the number of days in the billing period. For the sake of simplicity, let’s say we did the math and your average daily balance worked out to be $1,000. Now you can finally calculate the interest you’ll pay. Multiply your average daily balance by your daily rate and the number of days in the billing period. Assuming your billing period is 30 days, your interest owed will be $1,000 x 0.055% x 30 = $16.50. Whew! That was a heck of a lot of math. But why should you care about the minutiae of how credit card companies calculate your interest charges? You should care because you can actually lower your interest payments if you pay early or spread your credit card payments throughout the month. To see why, just do the math. Paying Early and Frequently Can Help You Pay Less Interest Let’s assume you have $500 to put towards your $1,000 credit card balance. If you pay that amount on the day your payment is due, then your average daily balance is: ($1,000 x 29 days) + ($500 x 1 day) = $29,500 $29,500 / 30 days = $983.33 But if you make that payment on the 15th day of your billing cycle, then your average daily balance will drop: ($1,000 x 14 days) + ($500 x 16 days) = $22,000 $22,000 / 30 days = $733.33 And finally, if you make multiple payments throughout the billing cycle, your average daily balance will be even lower. Let’s assume you make a payment of $175 on the 7th, $175 on the 15th, and then $150 on the 21st: ($1,000 x 6 days) + ($825 x 8 days) + ($650 x 6 days) + ($500 x 10 days) = $21,500 $21,500 / 30 days = $716.67 While this is pretty cool, you shouldn’t be too concerned about this math in practice. Why? Because you’re never going to pay a cent of interest. You’re going to pay your card’s balance off in full each month. Otherwise, you risk falling into the black hole of compound interest: Compound Interest: Your Worst Nightmare So far, we’ve been talking about credit card interest over the course of a month. While this is helpful for understanding how credit card interest works in general, it doesn’t give you the full picture. Credit card interest isn’t simple interest. That is, it isn’t just charged on the amount you borrow (the “principal”, in finance terms). Rather, credit card interest is compound interest. This means that interest accrues on top of the interest you owe. This doesn’t matter much in one month, but this interest can really start to stack up if you let it accumulate over the course of months or years. Here’s an example of how bad it can get: Let’s say your credit card has a minimum payment of $10, an APR of 20%, and a $1,500 balance. “Cool,” you think. “I only have to pay $10 each month. What a steal!” But if you do the math, the reality is sobering. If you only make the minimum payment, it will take you 36.5 years to pay off that debt. And you’ll end up paying $5,584.01 just in interest. What’s insane in this case is that your monthly interest charges work out to $12.75, $2.75 more than your minimum payment. Unlike when you’re investing your money, this is the wrong side of compound interest to be on. And it’s a case for why you should always pay more than the minimum. Even paying just a little more per month can vastly reduce the amount of interest you’ll pay and the amount of time you’ll be in debt. If you want to play with the numbers yourself, check out this free credit card interest calculator. Now, it’s almost time to talk about the mechanics of getting a credit card. But before we do that, there’s one more aspect of credit cards you need to understand: fees. Struggling to repay your credit card debt? This guide can help. The 3 Credit Card Fees You Should Know In addition to interest charges, most credit cards have fees. Some fees are part of having the card (such as annual fees), while other fees serve as penalties for messing up (late fees). Here are the three main credit card fees you should know: Annual Fee Many credit cards charge an annual fee. Essentially, you’re paying for the “privilege” of having the card, plus any perks that come with it. In general, we advise against paying annual fees. You’re paying for the ability to borrow money, which doesn’t make a lot of sense. There are some situations when paying the annual fee can make sense, such as travel credit cards that offer valuable enough perks to offset the fee. But this is a more advanced topic than this article has space to cover. If you want to learn more, check out my friend Trav’s site Extra Pack of Peanuts. Late Fee If you don’t make the minimum payment on time, your card issuer can charge you a late fee. There are laws in place to limit these, but obviously no amount of late fee is good. You can find the late fees in your credit card agreement. To avoid paying late fees, set up autopay for your card. Not only will this help you avoid fees, but it will also save the time you’d spend manually paying your card each month. Cash Advance Fee A cash advance is when you use a credit card to withdraw cash from an ATM or bank. It’s essentially an instant cash loan. While there might be some truly desperate circumstance in which you need to do this, just don’t. You’ll pay insane fees, you’ll pay higher interest than for purchases, and interest will start accruing on cash advances immediately (unlike purchases, which typically have a grace period). Still interested in getting a credit card now that you know the dirty details? While all of this can (and should) scare you, it’s simple to use credit cards responsibly. You just have to play the game instead of letting the game play you. And the first part of “playing the game” is understanding the most important factor in getting a credit card: your credit score. Your Credit Score: The Key to Getting a Credit Card Odds are, you’ve seen ads talking about how to raise or check your credit score. But what is a credit score, and why does it matter? A credit score is an easy way for lenders to determine how risky it is to let you borrow money. Instead of reviewing every minute detail of your financial history, lenders can request this number from a credit reporting agency and quickly determine if they should lend to you. There are three main credit reporting agencies: TransUnion, Equifax, and Experian. Different lenders will use scores from different agencies, but they’re all basically the same for our purposes. So what information do these companies use to calculate your credit score? It all comes down to five factors: 1. Payment History First and most important, there’s your payment history. A credit reporting agency looks at all the loans you’ve ever taken (student loans, auto loans, credit cards, mortgage, etc.) and sees how consistent you were in making payments. If you’ve ever missed a payment or declared bankruptcy, that will seriously hurt this part of your score. Which is especially bad news since payment history accounts for 35% of your score — more than any other factor. This is why it’s so important to always make at least the minimum payment on time. Missing a payment can set your credit score back for years. 2. The Amounts You Owe The next factor that credit reporting agencies look at is the amount you owe. This includes your total debt across all types of accounts, including mortgage, student loans, personal loans, and credit cards. And it also includes what’s called your “credit utilization,” the percentage of your available revolving credit that you’re currently using. In general, you should try to keep your credit utilization below 30%. So if you have $2,000 in total credit available to you across all your credit cards, try to keep your balance below $600. The amounts you owe account for 30% of your score, meaning that paying down debt (particularly credit card debt) can greatly improve your score overall. 3. Length of Credit History In theory, the longer a person has responsibly used credit, the less of a risk they are to a lender. Because of this, the length of your credit history accounts for 15% of your credit score. All things considered, a longer credit history is better. But assuming you’re keeping the other aspects of your credit score in good standing, you shouldn’t worry too much about your length of credit history. Only time can improve this part of your score. 4. New Credit From research and experience, lenders have figured out that someone who opens a bunch of new lines of credit at once is probably a bigger credit risk. Therefore, your amount of new credit accounts for 10% of your credit score. While this is less of an important factor than some of the others, it’s still wise to avoid opening a bunch of new credit cards at once. Otherwise, a lender might perceive you as too risky. 5. Credit Mix This final factor looks at the different types of accounts you have, including credit cards, student loans, auto loans, and mortgages. More variety is theoretically better, as it signals that you know how to manage different types of credit responsibly. But since this only accounts for 10% of your score, don’t worry too much about it. You’re better off focusing your efforts on maintaining a consistent payment history and keeping your credit utilization under 30%. Now that you understand how your credit score works (and how to improve it), we can look at the process of getting a credit card. How to Get a Credit Card in 3 Steps So you’re itching to get your hands on a credit card. How do you actually do that? The whole process boils down to three simple steps: 1. Check Your Credit Score Before you go out and apply for a credit card, it’s best to see if you’ll be able to qualify in the first place. To do this, you should check your credit score. These days, there are many ways to check it for free and online. Your bank may even have a tool you can use. If you’re not sure where to start, however, our top recommendation is Credit Karma. Just download their app or visit their website, answer a few questions, and see your score for free. But what are you supposed to make of this score? What’s a “good” score, and what’s a “bad” one? Exact evaluations of your credit score will vary based on the lender. But in general, here’s what different credit score ranges mean, according to Experian: • 300-579: Poor • 580-669: Fair • 670-739: Good • 740-799: Very good • 800-850: Excellent If you’re new to credit, your score probably won’t be super high. It’s unlikely to be “Poor” unless you’ve made some financial mistakes, but it’s also unlikely to be “Good” or “Very good.” This is a good case for having at least one credit card that you regularly use and fully pay off. The moment you get a credit card, you have a chance to start increasing your credit score. Each on-time payment and each month you have the card will boost your score. And a higher score will make it easier to do things down the road such as buy a house. But we’re getting ahead of ourselves. You need to get a card first. And the next step is to comparison shop. 2. Compare Credit Cards If you’re over 21, then you probably get credit card offers in the mail all the time. But you shouldn’t apply for any old credit card. You need to do your research to find a card that’s right for you. When you’re starting out, this typically means finding a card that: • You can qualify for with a low(er) credit score • Doesn’t charge annual fees If the card also offers some perks such as cash back or no foreign transaction fees, great. But when you’re starting out, the goal is more to start building a good credit history. You can worry about fancier cards down the line. Also, if you’re under 21, then it can be a bit trickier to get a credit card. It’s still possible, but you may need to provide additional income verification info or proof of permission from a parent/guardian. To compare credit cards, we recommend It lets you easily sort cards based on credit score, fees, and benefits. 3. Apply for the Card Once you’ve found a card that fits your needs, it’s time to apply. You’ll likely be shocked at how easy this is. All you have to do is provide some basic info: • Legal name • SSN • Date of birth • Annual income • Housing information (do you rent or own, and how much do you pay for housing each month?) If you apply online, you’ll likely receive a decision in a few minutes. If the card issuer approves your application, they’ll mail you your new card within a few days. Now that you have your card, however, you have a big responsibility. So let’s finish by looking at some common credit card mistakes (and how to avoid them). Common Credit Card Mistakes (and How to Avoid Them) If you don’t use a credit card responsibly, there’s no point in having one. Here are some common credit card mistakes you should avoid at all costs: 1. Paying Interest If you pay even a cent of interest on your credit card, then it isn’t worth it. While interest is how credit card companies make money, that doesn’t mean you have to pay any. Your goal is to be what credit card issuers call a “deadbeat” — a person who pays their balance in full each month. As long as you pay the full balance each month, you’ll be able to take advantage of your card’s “grace period.” The grace period is the time between the end of your billing cycle and your payment due date. During this time, you won’t accrue any interest on new purchases. And as long as you pay the full balance during the grace period or on your due date, your card company won’t charge interest. However, if you slip up one month and pay less than the full balance, your card issuer can get rid of your grace period. So always, always, always pay the full balance each month. 2. Missing Payments I mentioned this already, but never miss a payment on your card. If you do, it could severely harm your credit score. If you miss a payment by just a couple of days, you shouldn’t be too worried. You’ll still have to pay a late fee, but credit card companies typically don’t report late payments to credit bureaus unless the payment is more than 30 days late. However, there’s an easy way to be sure your payments are never late: set the card’s full balance to autopay each month. 3. Overspending Does using a credit card cause you to spend more money than if you paid with cash or a debit card? Some research suggests that the answer is yes. A 2000 experiment from researchers at MIT found that people were willing to pay up to twice as much for items in an auction if they used a credit card as opposed to cash. Crazy, huh? And in your daily life, you may find that having a credit card causes you to overspend. Because you don’t get the bill until the end of the month, it can be harder to mentally account for what you’re spending. Thankfully, there are a couple of ways to mitigate this. First, use a tool like Mint to regularly monitor your spending. Often, simply seeing how much you’re spending is enough to make you cut back. If that’s not enough, however, then don’t use your credit card for everyday spending. Put a couple of recurring bills on it, set it to autopay, and then put it in a drawer and forget about it. This way, you still get to build your credit without the temptation to overspend. Looking for more ways to save money? Check out these tips. So Should You Get a Credit Card? When all is said and done, is getting a credit card worth it? I think the answer is yes, as long as you: • View credit cards as a tool to build credit • Pay the balance in full each month • Don’t overspend If you’re worried that you aren’t responsible enough to use a credit card, then you have a couple of additional options for building your credit. Get a Secured Credit Card First, you can get a secured credit card. These cards require you to pay a refundable security deposit upfront. The security deposit determines the amount of your credit limit. This way, you can never actually spend money you don’t have. Your credit line is “secured” with your deposit. Besides these unique features, a secured credit card works just like any other. This makes them a great tool for building your credit if you have a limited credit history or are worried about overspending. Report Your Rent Payments to Credit Bureaus Second, some rent payment systems will also report your payments to credit bureaus, helping you to build your credit. You’ll need to ask your landlord if they use such a system (or are willing to do so). But if you can get them to do it, then it’s an easy way to build credit without taking on any debt. Credit Cards Are a Tool I hope this article has shown you how credit cards work and how to use them responsibly. There’s a lot of jargon that credit card companies will try to confuse you with, but now you know how to see through all of that. Of course, building good credit is just one aspect of smart personal finance. You can also benefit from increasing your income. To learn how to do that, check out our guide to making extra money online. Image Credits: handful of credit cards
Tag Archives: Logic Economic Nonsense: UVA Student on a Hunger Strike for Higher Minimum Wages for University Janitors Anyone who’s tried to pay a heating bill, fill a prescription, or simply buy groceries knows all too well that the current minimum wage does not cut the mustard.–Sherrod Brown The article below has numerous fallacies. How many can you find? What exactly are the UVA students demanding and what are the implications? What economic laws are being ignored? If YOU directly wanted to help these janitors but you were a broke student, what would you suggest your group do? What can people do to raise all wages without coercion? What exactly is a minimum wage and what are the consequences of the students’ demands. Are there any unintended effects? If the students were not violating any economic laws what wage rate should they demand? What motivates the students’ actions? Are they stupid, ignorant, noble or viscious? If you need help analyzing this then go to Economics in One Lesson by Henry Hazlitt and read the chapter on minimum wage laws or view the video here: http://www.youtube.com/watch?v=VD28vNVovow and go to 2 hours and 36 minute mark–interview with George Reisman. If you want to see a commentary on the above article, read this: http://cafehayek.com/2012/02/hungry-for-attention.html
Analysis Reporting Climate Deniers are Not Little Galileos. Here’s Why. One of these men is famed Italian scientist Galileo Galilei. The other is US Rep Lamar Smith. Image: Wikimedia Commons The Scientific Consensus on Climate Change: How is it measured and what it means. Ray Weymann/Central Coast Climate Science It is frequently said that “97 percent of climate scientists agree that the climate is changing, due mostly to human activities,” or words to that effect. I recently received email from a friend asking what kind of surveys were done to determine this. This essay is my response to that question. Before getting into those details, though, some preliminary comments: I commonly encounter two responses when people first hear about the “strong scientific consensus” on climate change and the role of human activities in driving this change. The first response is something like: “So what? Scientists don’t vote. Science isn’t done by consensus.” It is true that scientists do not take a vote to settle uncertain matters. What they actually do, though, is compile evidence, and interpret and discuss it through workshops and peer-reviewed articles in professional journals. When a heavy majority have reached a strong consensus about some issue after this process, that issue stops being one that attracts further research efforts. Instead, research efforts turn toward resolving other issues about which little is known or about which there may be substantial controversy. A classic example from my own field of astrophysics and cosmology was the debate over whether the universe was in a  ”steady state”–an idea that was championed by cosmologist Fred Hoyle– or whether it was evolving from an initial “big bang”–one of the early proponents of the big bang being astrophysicist George Gamow. In the 1950’s that debate raged, but then came the discovery of the “cosmic background radiation” in 1964–predicted by Gamow. This was then followed by unequivocal evidence that galaxies which formed a long time ago look very different from younger ones recently formed. Although a few diehards clung to the steady state hypothesis for a few years after this, one never sees research today debating this issue. The “big bang” really did occur. So, just because there is a strong consensus on the basic statement that we are in the midst of a changing climate that is being driven by human activities, that doesn’t make it automatically true. What it does mean is that the evidence accumulated from previous research has convinced the heavy majority of researchers of its truth. For those of us not specialists in this field, there is thus good reason to give great weight to this consensus in the same way that most of us do not smoke and discourage children from doing so. We do this not because we ourselves have done research on the adverse health effects of smoking, but because we are aware of the very strong consensus among medical experts on these adverse health impacts. Researcher in the air sample archive at the CSIRO Marine and Atmospheric Research facility in Aspendale, Victoria. Image: Courtesy CSIRO Researcher in the air sample archive at the CSIRO Marine and Atmospheric Research facility in Victoria, Australia. Image: Courtesy CSIRO A second comment I frequently hear is: “In the middle ages, there was a strong consensus that the Earth was the center of the Universe. Then along came Galileo, a lone dissenting voice who was ultimately proven correct. So much for your strong consensus!” What those who make this, or similar arguments, miss, is the fact that that particular consensus view was authoritarian in nature, not the result of the evidence gathering process I described above. The consensus view prior to Galileo of the Earth’s place in the universe was not evidence-based but was based on theology. In fact, what Galileo did was precisely what scientists do now: He made careful observations, drew conclusions from them and published them. When others made similar confirming observations or read about this evidence, then the Galilean point of view became a real scientific consensus. A final preliminary remark: We are discussing here surveys, not petitions. This is an important distinction. In a carefully done survey, one seeks opinions from a sample as free from bias as possible. “Do you prefer Pepsi or Coke” is a survey. “Sign this petition if you prefer Pepsi over Coke” is not a survey. I mention this now because people often bring to my attention the fact that “thirty thousand scientists signed a petition” saying that “there is no convincing scientific evidence that human release of carbon dioxide will, in the foreseeable future, cause catastrophic heating of the Earth’s atmosphere”. This refers to the “Oregon Petition” whose signers included only a tiny fraction of scientists doing research in climate science. For a discussion of the “Oregon Petition” see: With those preliminaries out of the way, what information do we have on the degree of consensus by scientists about climate change. There have been several surveys, and here is a graphic showing the results of seven of these surveys: Figure 1. The results of seven surveys on the scientific consensus among scientists about whether human activities play a significant role in climate change. See the text for discussion of these. This figure, and much of the discussion in this essay is taken from The seven surveys shown above (and they are not the only ones) are of two kinds: 1) Questionnaires sent to groups of scientists asking for their opinions on climate change. In this 1st group is the work of Doran and Zimmerman (2009), Stenhouse et al. (2014), Verhaggen et al, (2014) and Carlton, et al. (2015). 2) Surveys of the published peer-reviewed literature or other published information, from which the views of the authors on this topic can be inferred. In this 2nd group is the work of Oreskes (2004) and Anderegg et al. (2010). The work of Cook et al. (2013) is a kind of hybrid because it was initially a literature survey, but was then followed up by questions to the authors asking them to self-rate the positions their papers took on human caused climate change. To go through all seven of these papers in detail would make this already-long essay much too lengthy, so I will examine in detail just two of these. The remaining five proceed very similarly and reach the same basic conclusions. The survey of Doran and Zimmerman I have chosen to discuss this survey for two reasons: First, it illustrates a result found by several of these surveys: The closer the group of scientists sampled comes to that group who are actual climate scientists and who are actively publishing in peer-reviewed journals on climate change, the higher the degree of consensus on human-caused climate change. Second, the results of this survey have been subject to criticism that reflects a lack of knowledge of basic statistics. The following two questions were sent to 10,257 scientists identified in a database as being “Earth Scientists”: 1) “When compared with pre-1800s levels do you think mean global temperatures have generally risen, fallen, or remained relatively constant?” Of course, if a respondent did not think there had been a rise in mean global temperatures, then question (2) is moot, so the interesting question is (2) –the percentage among the various groups of Earth Scientists who answered “risen ” to question (1) and then “yes” to question (2) Of the 10257 earth scientists to whom the questions were sent, 3146 responded, a response rate of about 31 percent, which is fairly typical. The 3,146 respondents (whose identity was not revealed to Doran and Zimmerman) were asked to identify which subfield of Earth Science they belonged to (e.g. geochemistry, hydrology etc.) as well as the frequency and topics on which they published papers in peer-reviewed journals. For the entire group of 3146 respondents, 82 percent answered “yes” to question (2). As this entire group was refined to get closer to Earth scientists who classify themselves as climate scientists, and who are frequent publishers of peer-reviewed papers, the groups shrink in size and in this final latter category there were only 77 respondents. But 75 of these 77 responded with a “yes”, yielding a “yes” response of 97.4 percent. I frequently hear this last result being criticized because a survey result involving only 77 respondents was thought to be too small to be meaningful. Could it be that in fact the “true” result would be about 50% if a much larger sample instead of only 77 from the same group had responded? The statistics of this result are just the same as asking: Suppose you flipped a coin 77 times and it came up heads 75 times. What are the chances that if the same coin were flipped one trillion times instead of just 77 that the result would be about 50 percent heads and 50 percent tails? That is, could it be that the true probability of a tail flip is 50 percent, and it was just an unusual string of flips that produced 75 heads and only 2 tails in the experiment? If you had a course in algebra or statistics and remember them this is a straight forward question to answer. The answer is that the probability that a “true” coin would give such a result is absurdly small. (And we can add in the even lower probabilities of 1, or 0 tails.) In other words, it is absolutely beyond any doubt that the true probability is anything like 50 percent. To make this point very strongly, I have shown the details of this calculation in the Appendix to this essay. I also discuss a slightly more interesting calculation: What is the true percentage of “yes” responses for which there is just a 5 percent chance that the 75 or greater yes answers out of the 77 arose by chance. (Five percent is a typical “confidence level” that is often applied in statistical tests) The answer is that we can have high confidence that the true percentage of “yes” answers is at least 92 percent despite the small sample size of 77 respondents from publishing climate scientists. The Cook et al. 2013 analysis of published papers Cook and collaborators surveyed nearly 12000 papers in the peer-viewed literature. These papers were found by key word searches for “global climate change” or “global warming” in a database of scientific papers. They then had two volunteers independently read only the title and abstract of these papers and rate them according to rating guidelines provided to these volunteers. These guidelines asked for classifications on whether an opinion (or no opinion) was expressed in the abstract about whether climate change was or was not occurring due to human activities. In the infrequent cases in which the two volunteers disagreed, a third person resolved the disagreement. As a follow up to this survey they then contacted the authors of the papers whose abstracts had been rated, and asked the authors to provide their own evaluation based upon the full paper. The only significant difference between the evaluation by the volunteer readers and the self-evaluation by the authors was that the abstracts frequently expressed no explicit opinion on human-caused climate change, whereas the authors felt that the papers implied endorsement of human-caused climate change. The result was very similar to the Doran and Zimmerman result and the final sentence of the Cook paper reads: “Among papers expressing a position on AGW [human-caused global warming], an overwhelming percentage (97.2% based on self-ratings, 97.1% based on abstract ratings) endorses the scientific consensus on AGW.” Cook and his co-authors considered possible biases in their technique and conclude that none of those considered had any significant impact on their result. However, one possible bias which skeptics have voiced to me was one these authors did not mention. Could it be that papers which rejected the consensus simply could not get their papers published in peer-reviewed journals because of bias on the part of the editors and reviewers of these papers? I think the instances in which this occurs are very rare. There are, after all, published papers which do reject the consensus. Moreover, there are a great many journals and often a paper that is rejected by one journal will then be sent to others. But because the evidence for human-caused climate change really is compelling, it is increasingly hard to make a scientifically credible case for a dissenting view. Most importantly however, scientists, and especially the Editors of scientific journals, are keenly aware that the reputation of their journals and the professional societies with which they are affiliated strongly depend upon the integrity of the peer-review process. (Please see my Essay #1: The Peer Review Tradition: I have not described the other five papers whose consensus results are described in Figure 1. The methodology is quite similar to one or the other of the above two papers, except that the groups whose opinions are being surveyed vary–some are more general, some are more specialized. A common thread, though, is that the consensus is strongest among those whose expertise is in climate science and who are active researchers as demonstrated by their recent publication records. Why does documenting this consensus matter? Why have the authors of these and other papers gone to the trouble of examining the degree of consensus on this issue? Because several studies have shown that the degree of public support for action to control greenhouse gases is, not surprisingly, strongly dependent upon acceptance of the scientific consensus on the reality of human-caused climate change and its mostly negative consequences. And this acceptance, in turn, is strongly dependent upon the public’s recognition of the high degree of consensus among the community of climate scientists. In a sort of back-handed confirmation of the preceding paragraph, the fossil fuel industry has made a major effort to promote the notion that there is no consensus on this issue among the scientific community. This is documented in the book “Merchants of Doubt” by Oreskes and Conway: The same strategy (even involving some of the same doubt-promoters) was used by the tobacco industry to oppose action to curb cigarette smoking. Regrettably, one would have to say that this strategy by the fossil fuel industry, in collaboration with sympathetic politicians, has been quite successful, as shown in the following figure. Figure 2. The actual degree of consensus among climate scientists on human-caused global warming is shown in the pie chart on the right. The perception among the general public of the degree of consensus among these scientists is much lower as shown in the left-hand pie chart In fact, only 12 percent of the general public realize that the consensus among climate scientists is greater than 90 percent. This figure was as of 2014. The actual public acceptance about climate change was slightly higher than this as of March 2016, but the November 2016 election may change this situation. Appendix: The binomial probability distribution and the Doran and Zimmerman statistics The “binomial probability distribution” can be applied to a series of independent experiments (like a series of coin flips) when the only outcomes are “binary”–yes or no, heads or tails, black socks or white socks. It is assumed that there is a “true” probability of a yes or no that may be anywhere from 0.0 to 1.0 For example, if we had an enormous drawer filled with 3 trillion white socks and one trillion black socks (well mixed!), then we could say that upon randomly reaching into the drawer and pulling out a sock, the probability of getting a white sock would be 3/4 = 0.75 and 1/4 = 0.25 for a black sock. If we pulled out 5 socks, what is the probability of getting 3 white ones and 2 black ones? The binomial probability distribution formula tells us how to do that calculation, but in this simple example we can do simple reasoning: Suppose the first three were white and then the 4th and 5th were black. The probability of exactly this sequence occurring is: (0.75)(0.75)(0.75)(0.25)(0.25)= .026367… But we could also end up with WBBWW as well and the probability of that is exactly the same; it is just the order of the W and B that are different. In fact, if you look at all the different combinations of 3 whites and 2 blacks you will find out there are 10. So the probability of getting 3 W and 2 B is 10 times the number above, or 0.26367… When the number of socks you pull out of the drawer gets large (like 77), doing this calculation “in your head” gets too difficult, but there is a simple formula for this. C(n,k) = n!/[k!(n-k)!] where the “!” does not express surprise but the “factorial.” For example 5! = 54321=120. If you want a simple explanation for where the C(n,k) formula comes from see Now, finally, we can compute the likelihood of getting, just by chance, 75 heads and 2 tails if the true probability of heads was 0.5, (and therefore the same for tails). The probability of this is C(77,75) (0.5)77 which turns out to be about 0.000 000 000 000 000 000 019 363 — a pretty small number!! It is preferable to ask what the probability is, under these same assumptions, for having at least 75 heads. This changes the answer only very slightly to: 0.000 000 000 000 000 000 019 877. So, despite the “small” number of 77 respondents in the Doran and Zimmerman survey who are publishing climate scientists, the conclusion is this: The likelihood of the “true” percentage of publishing climate scientists who would say yes to question 2 roughly 50 percent is vanishingly small. A more interesting calculation is to ask what the true percentage would be such that there was a 5 percent chance that 75 or more yeses out of the 77 responses could have arisen by chance. Without showing the details of the calculation, it turns out that this true percentage is about 92 percent. Here are links to the seven surveys cited in this essay for those who wish to read them: Oreskes 2004: Doran and Zimmerman 2009: Anderegg et al. 2010: Cook et al. 2013: Verheggen et al. 2014: Stenhouse et al. 2014 (A survey of professional members of the American Meteorological Society): Carlton et al. 2015: rayweymann_photoDr. Ray Weymann is a retired Astrophysicist with over 40 years experience in teaching and research. He received his undergraduate degree in Science from Cal Tech and his PhD from Princeton. He has published research in many areas of astrophysics, including the transfer of energy through the Sun and other astronomical objects whose physical processes are the same as those governing the Earth’s climate. He is an elected member of the American Academy of Arts and Sciences as well as the National Academy of Sciences. Since moving to Atascadero in 2003 he has used his background in physics and astrophysics to educate the public and students about climate change and has given numerous lectures and short courses on Climate Change throughout San Luis Obispo County. He was a co-founder of the Climate Science Rapid Response Team, a “matchmaking” service directing inquiries from journalists about climate change to appropriate members of a large roster of experts in all aspects of climate science. This article originally appeared on Dr. Weymann’s website, Central Coast Climate Science. It is republished here with permission.
Mental health is a topic we tend to avoid in our society. We avoid it so much that the month of May is dedicated to Mental Health Awareness. Many people are afraid that if other people know they are feeling down or anxious that people will think they are crazy. Many people think of someone living in the streets when you mention mental health. This is not reality. This negative stigma makes it difficult for adults to seek help for mental health issues. This negative stigma also makes it very difficult for children to ask for help when they feel depressed or anxious. They are afraid their friends won’t understand and won’t want to be friends with them. They are also afraid their parents will think they are crazy and be disappointed with them. These ideas are incorrect, but if mental health is overwhelming for an adult, imagine how it can be for a child. It is very important that children and teenagers do ask for help when they are experiencing mental health issues. The CDC estimates 1in 5 children need psychotherapy for a mental health issue. Furthermore, the CDC has stated that Suicide is an epidemic for children between the ages of 10 and 18 years old and is the second leading cause of death for kids 10 to 18 years old. Cutting, self-harming behaviors, are also now at an epidemic rate in children. Most teenagers I work with, as a psychotherapist, have had suicidal thoughts and have cut before starting therapy with me. They also tell me about many of their friends who are feeling suicidal and cutting. According to the CDC, the Suicide rate and the number of teenagers engaging in self-harming behaviors has been increasing every year for the past twenty years. While the need for teenagers needing psychotherapy is increasing, the reluctance to attend psychotherapy is increasing. Most teenagers I see for psychotherapy are afraid that their friends would stop being their friends if they knew they were going to therapy. They are afraid it makes them crazy and nothing will help because they are weak. They blame themselves for the feelings they are having. They are shocked when I explain that they are not weak and it is not their fault. We need to change this stigma associated with mental health. Mental health should be treated the same way a physical health because they are the same. Clinical depression is caused by a chemical imbalance in the brain. If some one is diabetic, do we call them crazy or weak because their pancreas is not producing the correct level of insulin? No we do not. Therefore, when we have numerous research studies which show a link between physical health and mental health, why do we continue to view mental health so negatively? By doing so we are causing a number of teenage deaths. Suicide use to be the third leading cause of death for teenagers, however now according to the CDC it is the second most common cause, as I stated above. Many teens also die every year from eating disorders. Eating disorders occur in both girls and boys despite the belief girls only have eating disorders. Bullying is a severe problem and many teenagers are opting to commit suicide rather than discuss the pain and torture they are experiencing due to being bullied. This does not make sense that teenagers should be dying because the teen or their family are embarrassed to seek treatment. I was researching this subject and found a video by the Anna Freud Institute. It is called, “We all have mental health.” It is a short video directed at teenagers and middle school students. It discusses the issue in a very relaxed manner and provides teenagers with options for how they can talk about their own feelings. I encourage parents, teachers and anyone who deals with children to watch this video. You may want to watch it with your teen and begin a discussion about feelings. The link to the video is We need to start to change the negative stigma associated with mental health. Besides causing the deaths of teenagers, this stigma effects an entire family. A death impacts everyone in a family. Not being able to talk openly about a death because it was related to a mental health issue, creates more problems for the survivors. Nothing will change until we start to approach mental health differently. I also encourage you to look at the foundation started by Prince William and Henry, Heads Together. It provides a number of ways we can start to change the negative stigma associated with mental health and save lives. Furthermore, at this time in our world, when we are in the middle of a pandemic which besides killing thousands of people daily, it is creating mental health issues for those in quarantine, those with the virus and our first responders. These issues will not disappear quickly just like the virus will not disappear quickly. As a result, we will have even more people needing mental health care. How will they receive it if they feel ashamed for needing treatment or if we continue to treat mental health as a disease? Mental health and physical health go hand in hand, when will we treat them equally? Leave a Reply You are commenting using your account. Log Out / Change ) Google photo Twitter picture Facebook photo Connecting to %s
Diamonds Falling from the Sky in Sudan. Scientists Solved the Mystery The mystery behind the diamonds that fell from the sky in Sudan, a country in Northeast Africa, has been solved by scientists. A study published in Nature Communications revealed that this strange phenomenon indicates the existence of a missing planet in the Solar System. According to AFP, European researchers explained that the asteroid that partially disintegrated in Earth's atmosphere, causing the collapse of fragments containing diamonds on the ground in Sudan, came from the embryo of a missing "protoplanet" in the Solar System. They believe that the missing planet was the size of Mars or Mercury and was formed in the first 10 million years of the Solar System's life. Eventually, the mysterious "protoplanet" was destroyed by collisions with other celestial bodies. Solving the Puzzle Astronomers spotted the asteroid - which they eventually named 2008 TC3 or Almahata Sitta - a few hours before the collision with Earth in October 2008, which allowed scientists to observe its collapse on our planet. The asteroid was the size of a car, weighing 80,000 kilograms. Using an electron microscopy technique, the researchers studied the composition of the diamonds contained in the telluric fragments that scattered after the asteroid explosion over the Nubian desert, in northern Sudan. According to, never before have meteorites been recovered from something exploding this high in the atmosphere. Sure enough, this turns out to be a very unusual meteorite. It is an anomalous polymict ureilite. By comparing the reflection properties of the meteorite with those of the asteroid in space, we were able to conclude that this was an F-class asteroid. So, the Almahata Sitta meteorite belongs to a category of rare rocks which represent less than 1% of all celestial objects that have fallen on Earth. They often have a high concentration of carbon, in the form of graphite and diamond. The Missing "Protoplanet" After analyzing the data, researchers concluded that these precious gemstones formed at high pressures (over 20 Gigapascals), indicating that the protoplanet should have been between Mars and Mercury. Mars (3,390 kilometers) and Mercury (2,240 kilometers) are the smallest planets in the Solar System, which formed about 4.6 billion years ago. The authors of the study claimed that these analyzes "provide convincing evidence" that the asteroid comes from a "missing planet," which was then destroyed by collisions with other celestial bodies. Scientists believe that the discovery reinforces the theory that the current planets of the Solar System formed from the remains of several dozen large "protoplanets". Antique & Vintage Jewelry
The internet economy has been partying like it’s 1999, so it’s fitting that something that was popular in 1999, the animated Gif, has found a role on the modern web. Here’s what brands need to know about the image file format that has found new life. The format is old The Graphics Interchange Format was originally developed in 1987 by CompuServe. Technically, the format leaves a lot to be desired. It only supports 256 colours and doesn’t seem to have much of a place on today’s web, which doesn’t face the same bandwidth limitations that were common in the 1990s when many consumers were coming online for the first time using connections slower than anyone would care to remember today. But the Gif format’s saving grace is its support for animation. With Flash on the decline and not being available on iOS devices, the Gif format, which is supported by just about every browser, is an ideal substitute for displaying short, looping animations and video clips without hassle. They’re easy to create Creating animated Gifs is a straightforward process. Popular image editing programs, such as Photoshop, can be used to create animated Gifs, and there are applications, such as Giffing Tool, that are dedicated to Gif creation. In addition, there are many online services that make it easy to create Gifs from images and videos. Gifs are really popular On an internet obsessed with memes and self-expression, it’s no surprise that a file format for simple animations has seen its popularity surge. Just how popular are Gifs today? According to the New York Times, Tumblr sees 23m Gifs posted to blogs on its service daily, and according to Experian Marketing Services, searches for Gifs have risen nine-fold in the past three years. They’re sort of like emojis Many see Gifs as the new emojis. “I’m able to express these really complex emotions in the span of two seconds,” Lucy Dikeou, a 21 year-old university student, told the New York Times when asked about her reasons for using Gifs. Emojis, static picture characters that are commonly used to represent faces and everyday objects, have skyrocketed in popularity thanks in large part to mobile messaging. Using emojis, users can quickly and visually convey information and emotion not so easily conveyed with words alone. Because of their popularity, brands are increasingly embracing emojis and incorporating them into their digital marketing campaigns. Some have even invested in creating their own emojis. Entire companies are being built around them Given their popularity, it’s no surprise that entrepreneurs are building companies around Gifs and investors are flocking to fund them. For example, Giphy, a search engine for Gifs, has raised more than $20m, while Riffsy, which makes a Gif keyboard app that allows mobile users to send Gif responses to mobile messages, has raised $10m. Facebook is open to the idea of embracing them Despite the risk of its social network becoming the next MySpace, Facebook began allowing animated Gifs on user pages in May, and is now giving some brands the ability to post them on their Facebook Pages and insert them in user news feeds as promoted posts. If it “drives a great experience,” Facebook says it will consider extending support for Gifs to more brand pages. If and when that happens, awareness and use of Gifs could explode. Brands should give them a look While a limited number of brands like American fast food restaurant Wendy’s can use Gifs on Facebook, other brands are already embracing Gifs on their own. Disney, for instance, has created its own Gif keyboard app called Disney Gif, which features animated Gifs from popular Disney movies like Star Wars and Frozen and television shows that air on Disney-owned networks. Obviously, brands outside of the media industry will probably have more limited opportunities to use Gifs in a big way, but any brand that is investing heavily in video should at least consider the possibility that there’s a role for Gifs in their motion media mix.
Insect Projects for Kindergarten Students Insects are the largest group of animals on the planet, but to kindergartners, they may be little more than bugs. Insect projects help kindergarten students understand the important role insects play in the ecosystem. The projects also help kindergartners gain empathy for and interest in these often strange creatures. Kindergartners have relatively short attention spans, so projects that are short, engaging and focused work best for this developmental age. Keeping Classroom Insects Insects can be fascinating classroom pets. Don't ask students to keep insects at home, because kindergartners aren't mature enough to care for them without assistance. They may also try to catch their own insects, and may not be able to tell the difference between a friendly insect and a potentially dangerous one. Instead, keep a classroom ant farm or build an outdoor butterfly garden on the playground. Then take 15 minutes each day to observe the insects and ask students what activity the insects are involved in. Use these observations to teach your students about the insects' behavior by, for example, emphasizing the cooperative nature of an ant colony. Insect Life Cycle Crafts Many insects begin life quite differently from how they end their lives. For example, a butterfly begins as a caterpillar. Kindergartners don't yet have strong abstract thinking skills, so activities that make an insect's life cycle concrete are suited to this age. Design a classroom poster that demonstrates the life cycle of a butterfly, then adopt a classroom insect at the beginning stages of its life cycle and follow the insect to adulthood. Alternatively, have a classroom insect day during which students learn the basics of an insect's life cycle, then get assistance with a project mapping out the cycle, such as drawing a poster or placing pre-cut pictures in the correct order. Becoming an Insect Kindergartners still engage heavily in pretend play; this type of play can help them better understand insects. Students understand what it's like to be an insect when they draw or design an insect project. Students can color in pre-made hats or masks to mimic an insect's appearance or create these items from egg cartons, stiff paper and plastic eyes. Separate students into groups, with each group focusing on a different insect or portion of the insect's life cycle. Encourage students to embrace their role by asking each group questions about life as their insect. Insect Ecosystems Insects play diverse and important roles in the ecosystem. Some wasps, for example, eat other insects and prevent overpopulation. Make a large classroom diorama displaying the role various insects play. Show a mosquito trapped in a spider's web, an ant carrying away waste and a beetle eating decaying material. Use this as a springboard for discussion about what life would be like in a world without insects. This can be an ongoing classroom project for an entire year. For example, you might add grass to the project one week, then incorporate trees, then begin adding insects. Try presenting the project as part of an end-of-the-year performance.
EFL UAE: Reducing Inequalities According to the World Health Organization, approximately 11% of the 8 million people living in the UAE have a disability. As this number continues to rise, the UAE’s government recognizes them as “people of determination” and focuses on creating more services that are accessible to this marginalized group. However, a gap still exists when it comes to social inclusion for those with disabilities. To help bridge the gap, EFL UAE partnered with Al Noor, a training center dedicated to helping children and adults with disabilities. In March 2019, EFL employees participated in Al Noor’s Annual Fundraising Event, the Family Fun Fair, where they assembled a photo booth with props to take photos at the fair. The event was a huge success, and because of love and teamwork, Al Noor was able to raise a significant amount of money to create more facilities and training materials for children and adults with disabilities.
Se ha denunciado esta presentación. Basics of bioinformatics Audiolibros relacionados Gratis con una prueba de 30 días de Scribd Ver todo • Sé el primero en comentar Basics of bioinformatics 1. 1. Need & Emergence of the Field Speaker Shashi Shekhar Head of computational Section Biowits Life Sciences 2. 2.  The marriage between computer science and molecular biology ◦ The algorithm and techniques of computer science are being used to solve the problems faced by molecular biologists ‘Information technology applied to the management and analysis of biological data’ ◦ Storage and Analysis are two of the important functions – bioinformaticians build tools for each. 3. 3. Biology ChemistryComputer Science Statistics Bioinformatics 4. 4.  The need for bioinformatics has arisen from the recent explosion of publicly available genomic information, such as resulting from the Human Genome Project. Gain a better understanding of gene analysis, taxonomy, & evolution. To work efficiently on the rational drug designs and reduce the time taken for the development of drug manually. 5. 5.  To uncover the wealth of Biological information hidden in the mass of sequence, structure, literature and biological data. It is being used now and in the foreseeable future in the areas of molecular medicine. It has environmental benefits in identifying waste and clean up bacteria. In agriculture, it can be used to produce high yield, low maintenance crops. 6. 6.  Molecular Medicine Gene Therapy Drug Development Microbial genome applications Crop Improvement Forensic Analysis of Microbes Biotechnology Evolutionary Studies Bio-Weapon Creation 7. 7.  In Experimental Molecular Biology In Genetics and Genomics In generating Biological Data Analysis of gene and protein expression Comparison of genomic data Understanding of evolutionary aspect of Evolution Understanding biological pathways and networks in System Biology In Simulation & Modeling of DNA, RNA & Protein 8. 8. e.g. homology searches Bioinformatics lecture March 5, 2002organisation of knowledge(sequences, structures,functional data) 9. 9.  Prediction of structure from sequence ◦ secondary structure ◦ homology modelling, threading ◦ ab initio 3D prediction Analysis of 3D structure ◦ structure comparison/ alignment ◦ prediction of function from structure ◦ molecular mechanics/ molecular dynamics ◦ prediction of molecular interactions, docking Structure databases (RCSB) 10. 10.  Sequence Similarity Tools used for sequence similarity searching There uses in biology or to us Databases Different types of databases 11. 11.  One could align the sequence so that many corresponding residues match. Strong similarity between two sequences is a strong argument for their homology. Homology: Two(or more) sequences have a common ancestor. Similarity: Two(or more) sequences are similar by some criterion, and it does not refer to any historical process. 12. 12.  To find the relatedness of the proteins or gene, if they have a common ancestor or not. Mutation in the sequences, brings the changes or divergence in the sequences. Can also reveal the part of the sequence which is crucial for the functioning of gene or protein. 13. 13.  Optimal Alignment: The alignment that is the best, given a defined set of rules and parameter values for comparing different alignments. Global Alignment: An alignment that assumes that the two proteins are basically similar over the entire length of one another. The alignment attempts to match them to each other from end to end. Local Alignment: An alignment that searches for segments of the two sequences that match well. There is no attempt to force entire sequences into an alignment, just those parts that appear to have good similarity. (contd.) 14. 14.  Gaps & Insertions: In an alignment, one may achieve much better correspondence between two sequences if one allows a gap to be introduced in one sequence. Equivalently, one could allow an insertion in the other sequence. Biologically this corresponds to an mutation event. Substitution matrix: A Substitution matrix describes the two residue types would mutate to each other in evolutionary time. This is used to estimate how well two residues of given types would match if they were aligned in a sequence alignment. Gap Penalty: The gap penalty is used to help decide whether or not to accept a gap or insertion in an alignment when it is possible to achieve a good alignment residue to residue at some other neighboring point in the sequence. 15. 15.  Similarity indicates conserved function Human and mouse genes are more than 80% similar at sequence level But these genes are small fraction of genome Most sequences in the genome are not recognizably similar Comparing sequences helps us understand function ◦ Locate similar gene in another species to understand your new gene 16. 16.  Match score: +1 Mismatch score: +0 Gap penalty: –1 ACGTCTGATACGCCGTATAGTCTATCT \|\|\|\|\| \|\|\| \|\| \|\|\|\|\|\|\|\| ----CTGATTCGC---ATCGTCTATCT Matches: 18 × (+1) Mismatches: 2 × 0 Gaps: 7 × (– 1) Score = +11 17. 17.  We want to find alignments that are evolutionarily likely. Which of the following alignments seems more likely to you? ACGTCTGATACGCCGTATAGTCTATCT ACGTCTGAT-------ATAGTCTATCT  ACGTCTGATACGCCGTATAGTCTATCT AC-T-TGA--CG-CGT-TA-TCTATCT  We can achieve this by penalizing more for a new gap, than for extending an existing gap 18. 18.  Match/mismatch score: +1/+0 Origination/length penalty: –2/–1 ACGTCTGATACGCCGTATAGTCTATCT \|\|\|\|\| \|\|\| \|\| \|\|\|\|\|\|\|\| ----CTGATTCGC---ATCGTCTATCT Matches: 18 × (+1) Mismatches: 2 × 0 Origination: 2 × (–2) Length: 7 × (–1) Score = +7 19. 19.  Alignment scoring and substitution matrices Aligning two sequences ◦ Dotplots ◦ The dynamic programming algorithm ◦ Significance of the results Heuristic methods ◦ FASTA ◦ BLAST ◦ Interpreting the output 20. 20.  Examples: Staden: simple text file, lines <= 80 characters FASTA: simple text file, lines <= 80 characters, one line header marked by ">" GCG: structured format with header and formatted sequence Sequence format descriptions e.g. on 21. 21.  Local sequence comparison: assumption of evolution by point mutations ◦ amino acid replacement (by base replacement) ◦ amino acid insertion ◦ amino acid deletion scores: ◦ positive for identical or similar ◦ negative for different ◦ negative for insertion in one of the two sequences 22. 22.  Simple comparison without alignment Similarities between sequences show up in 2D diagram 23. 23. identity (i=j)similarity of sequencewith other parts of itself 24. 24.  The 1st alignment: highly significant The 2nd: plausible The 3rd: spurious Distinguish by alignment score Similarities increase score substitution matrix Mismatches decrease score Gaps decrease score gap penalties 25. 25.  Substitution matrix weights replacement of one residue by another: ◦ Similar -> high score (positive) ◦ Different -> low score (negative) Simplest is identity matrix (e.g. for nucleic acids) A C G T A 1 0 0 0 C 0 1 0 0 G 0 0 1 0 T 0 0 0 1 26. 26.  PAM matrix series (PAM1 ... PAM250): ◦ Derived from alignment of very similar sequences ◦ PAM1 = mutation events that change 1% of AA ◦ PAM2, PAM3, ... extrapolated by matrix multiplication e.g.: PAM2 = PAM1PAM1; PAM3 = PAM2 PAM1 etc Problems with PAM matrices: ◦ Incorrect modelling of long time substitutions, since conservative mutations dominated by single nucleotide change ◦ e.g.: L <–> I, L <–> V, Y <–> F long time: any Amino Acid change 27. 27. positive and negative valuesidentity score depends on residue 28. 28.  BLOSUM series (BLOSUM50, BLOSUM62, ...) derived from alignments of distantly related sequence BLOCKS database: ◦ ungapped multiple alignments of protein families at a given identity BLOSUM50 better for gapped alignments BLOSUM62 better for ungapped alignments 29. 29. Blosum62 substitution matrix 30. 30.  Significance of alignment: Depends critically on gap penalty Need to adjust to given sequence Gap penalties influenced by knowledge of structure etc. Simple rules when nothing is known (linear or affine) 31. 31.  Dynamic programming = build up optimal alignment using previous solutions for optimal alignments of subsequences. The dynamic programming relies on a principle of optimality. This principle states that in an optimal sequence of decisions or choices, each subsequence must also be optimal. The principle can be related as follows: the optimal solution to a problem is a combination of optimal solutions to some of its sub-problems. 32. 32.  Construct a two-dimensional matrix whose axes are the two sequences to be compared. The scores are calculated one row at a time. This starts with the first row of one sequence, which is used to scan through the entire length of the other sequence, followed by scanning of the second row. The scanning of the second row takes into account the scores already obtained in the first round. The best score is put into the bottom right corner of an intermediate matrix. This process is iterated until values for all the cells are filled. 33. 33. Contd. 34. 34. Contd. 35. 35.  The results are traced back through the matrix in reverse order from the lower right-hand corner of the matrix toward the origin of the matrix in the upper left- hand corner. The best matching path is the one that has the maximum total score. If two or more paths reach the same highest score, one is chosen arbitrarily to represent the best alignment. The path can also move horizontally or vertically at a certain point, which corresponds to introduction of a gap or an insertion or deletion for one of the two sequences. 36. 36.  Global alignment (ends aligned) ◦ Needleman & Wunsch, 1970 Local alignment (subsequences aligned) ◦ Smith & Waterman, 1981 Searching for repetitions Searching for overlap 37. 37.  Multi-step approach to find high-scoring alignments Exact short word matches Maximal scoring ungapped extensions Identify gapped alignments 38. 38. Contd. 39. 39.  FASTA also uses E-values and bit scores. The FASTA output provides one more statistical parameter, the Z-score. This describes the number of standard deviations from the mean score for the database search. Most of the alignments with the query sequence are with unrelated sequences, the higher the Z-score for a reported match, the further away from the mean of the score distribution, hence, the more significant the match. For a Z-score > 15, the match can be considered extremely significant, with certainty of a homologous relationship. If Z is in the range of 5 to 15, the sequence pair can be described as highly probable homologs. If Z < 5, their relationships is described as less certain. 40. 40.  Multi-step approach to find high-scoring alignments List words of fixed length (3AA) expected to give score larger than threshold For every word, search database and extend ungapped alignment in both directions New versions of BLAST allow gaps 41. 41. Contd. 42. 42.  The E-value provides information about the likelihood that a given sequence match is purely by chance. The lower the E- value, the less likely the database match is a result of random chance and therefore the more significant the match is. If E < 1e − 50 (or 1 × 10−50), there should be an extremely high confidence that the database match is a result of homologous relationships. If E is between 0.01 and 1e − 50, the match can be considered a result of homology. If E is between 0.01 and 10, the match is considered not significant, but may hint at a tentative remote homology relationship. Additional evidence is needed. If E > 10, the sequences under consideration are either unrelated or related by extremely distant relationships that fall below the limit of detection with the current method. 43. 43.  Various versions: Blastn: nucleotide sequences Blastp: protein sequences tBlastn: protein query - translated database Blastx: nucleotide query - protein database tBlastx: nucleotide query - translated database 44. 44.  Very fast growth of biological data Diversity of biological data: ◦ Primary sequences ◦ 3D structures ◦ Functional data Database entry usually required for publication ◦ Sequences ◦ Structures Database entry may replace primary publication ◦ Genomic approaches 45. 45. Nucleic Acid ProteinEMBL (Europe) PIR - Protein Information ResourceGenBank (USA) MIPSDDBJ (Japan) SWISS-PROT University of Geneva, now with EBI TrEMBL A supplement to SWISS- PROT NRL-3D 46. 46.  Three databanks exchange data on a daily basis Data can be submitted and accessed at either location GenBank ◦ EMBL ◦ DNA Databank of Japan (DDBJ) ◦ 47. 47.  As there are many databases which one to search? Some are good in some aspects and weak in others? Composite databases is the answer – which has several databases for its base data Search on these databases is indexed and streamlined so that the same stored sequence is not searched twice in different databases. 48. 48.  OWL has these as their primary databases. ◦ SWISS PROT (top priority) ◦ PIR ◦ GenBank ◦ NRL-3D 49. 49.  Store secondary structure info or results of searches of the primary databases. Composite Primary Source Databases PROSITE SWISS-PROT PRINTS OWL 50. 50.  We have sequenced and identified genes. So we know what they do. The sequences are stored in databases. So if we find a new gene in the human genome we compare it with the already found genes which are stored in the databases. Since there are large number of databases we cannot do sequence alignment for each and every sequence So heuristics must be used again. 51. 51.  Applications:- Bioinformatics joins mathematics, statistics, and computer science and information technology to solve complex biological problems. Sequence Analysis:- The application of sequence analysis determines those genes which encode regulatory sequences or peptides by using the information of sequencing. These computers and tools also see the DNA mutations in an organism and also detect and identify those sequences which are related. Special software is used to see the overlapping of fragments and their assembly. Contd. 52. 52.  Prediction of Protein Structure:- It is easy to determine the primary structure of proteins in the form of amino acids which are present on the DNA molecule but it is difficult to determine the secondary, tertiary or quaternary structures of proteins. Tools of bioinformatics can be used to determine the complex protein structures. Genome Annotation:- In genome annotation, genomes are marked to know the regulatory sequences and protein coding. It is a very important part of the human genome project as it determines the regulatory sequences. 53. 53.  Comparative Genomics:- Comparative genomics is the branch of bioinformatics which determines the genomic structure and function relation between different biological species. For this purpose, intergenomic maps are constructed which enable the scientists to trace the processes of evolution that occur in genomes of different species. Health and Drug discovery:- The tools of bioinformatics are also helpful in drug discovery, diagnosis and disease management. Complete sequencing of human genes has enabled the scientists to make medicines and drugs which can target more than 500 genes. Sé el primero en comentar Inicia sesión para ver los comentarios • 9543330456 Oct. 10, 2020 • SusanPhilip22 Oct. 24, 2020 • MaruGenetu Nov. 3, 2020 • AyazAhmed162 Dec. 6, 2020 • LakshanaSekar1 Jan. 1, 2021 • NainikaParihar Jan. 4, 2021 • OmWakade Jan. 15, 2021 • uppuhymavathi Mar. 17, 2021 • eman-khaled Mar. 28, 2021 • ssuserf9de58 Apr. 19, 2021 • DivyaKhandelwal38 Apr. 26, 2021 Apr. 28, 2021 • AmnaCh20 May. 17, 2021 • SapanpreetKaur5 May. 29, 2021 • JasmeenKaur183 Jun. 2, 2021 • abusidheeque Jul. 1, 2021 • SiqiSun4 Jul. 8, 2021 • ShahzaibAwan13 Jul. 16, 2021 • AnkitaVerma146 Jul. 31, 2021 • ShreyaIngole Aug. 2, 2021 Total de vistas En Slideshare De embebidos Número de embebidos Me gusta
Ethereum has been debated in the bitcoin ecosystem and was criticized. In order to understand better both projects, what are the main differences between BTC and ETH regarding the blockchain composition? The short answer is that Ethereum is an application platform. Blockchain technology is useful for far more than keeping track of a currency's balances, and Ethereum lets developers build applications without having to build their own blockchain. These applications can interact with each other on the blockchain, so a library of useful functionality will gradually build up. Ethereum has shorter block times, which makes some applications more feasible. The Ethereum blockchain will transition from proof-of-work to proof-of-stake, which will affect the security of the blockchain and the value of ether. The long answer is the full Design Rationale. From this slide presentation from Ethereum's Developer Conference 2015, Ethereum is an application platform for "Not just money! Asset issuance, crowdfunding, domain registration, title registration, gambling, prediction markets, internet of things, voting, hundreds of applications!" enter image description here enter image description here enter image description here The rest of the video presentation offers further introduction to differences from Bitcoin, such as Ethereum's Virtual Machine, code execution, gas fees and limits, transactions, mining algorithm, fast block times, and Merkle trees. For more information, the Ethereum White Paper was the beginning. The Yellow Paper is the technical specification. The Design Rationale explains principles and details. Putting aside some of the internals, which can easily distract from the big picture, the key difference as illustrated here is the ability of the Ethereum Blockchain to store arbitrary state (values stored in arbitrary user-defined variables). In contrast the Bitcoin blockchain is currently limited to storing BTC transactions (account A sends N BTC to account B). Bitcoin Blockchain - Consensus machine to agree on the state (and rules for change) of a spreadsheet (ledger). Ethereum Blockchain - Consensus machine to agree on the state (and rules for change) of a computer (virtual machine). Ethereum blockchain can be seen as a backend where you'll find the ledger with the smart contracts. On top of that you'll have Dapps which you can access from the web 3,0 browser MIST in which you'll be able to make paiements. That's where it should end, but actually, you essentially have the blockchain up and running efficiently :) Ether is not only a currency, it's as well the fuel of all the ecosystem. This include : Ethereum Virtual Machine turing complete blocks mined every 15-17 sec (10 mn in BTC) and rewarded 5 ETH (PoW works differently from BTC, and PoS in discussion), Unlimited creation of ETH (21 million limit in BTC), Each transaction include a fee (called gas) which depend on the complexity of the tx (if it is a complex contract, it will cost more than just an ETH tx) BTC is more a currency, and the mother of all blockchains. What Bitcoin is to money, Ethereum is to law. This may be a slight over-simplification, since Ethereum also does everything that Bitcoin does for finance (except better). But the main purpose is to use a blockchain to enforce contracts and crypto-legal agreements between many people in a trustless way. Like Bitcoin, the Ethereum blockchain runs on a proof-of-work system (for now), but is less inherently prone to mining centralization. The mathematical problem used by Ethereum requires more memory power, which makes it more laptop-friendly for supporting the network. When it comes to network capacity, Ethereum does not have a "block limit" but instead uses dynamic gas limits which can scale much more easily than Bitcoin. Ethereum comes with its own Virtual Machine, on each node, which performs computation. There are scripting languages which are designed to compile into EVM code, the most popular of which is currently Solidity. Unlike Bitcoin's "Scrypt", Solidity is a Turing-complete language, which means it can perform any necessary step of computation (limited by gas of course). The goal of Ethereum overall is to have one open blockchain platform for contract applications, which will be secured by its size, instead of a proliferation of smaller blockchains and altcoins for different purposes. Bitcoin wallets include a feature that helps its users remain anonymous; the huge number of receiver addresses that can be generated. Besides a few accidental edge cases, for each generated receiver address, only one transaction is ever executed. Ethereum wallets lack this feature. Indeed, the unique identifier for each Ethereum account is the address of the account. An Ethereum account can only ever have one address.
First In Math Videos "Transform Student Attitudes about Math" First In Math helps build self-confidence! This 60-second video shows how students at Fountain Hill Elementary School approach math without fear and generate a culture of excitement using First In Math's proven and engaging online content. "Practice Made Perfect" First In Math allows every child to experience math success! This four-minute video shows educators at Marvine Elementary School discussing how your K-8 students can build and retain skills vital to math success with First In Math's 24/7 online content. "The Greatest Gift - Transformation In Urban Schools" This engrossing, six-minute film describes how the First In Math Program creates a culture of achievement in urban schools -- only one aspect of the program's unique story. From elite private institutions to rural schools to the most-challenged inner-city schools, millions of students across the nation are experiencing life-changing success using First In Math online. Everyday Miracles Sacred Heart School students believe in the 'everyday miracles' that are possible with the First In Math program. Share the small Catholic school's remarkable journey with Sister Georgiana — and believe. London Mayor's Count On Us Challenge Energizing Every Child FIRST IN MATH and the 24® Game have the power to energize ALL types of learners through meaningful and engaging math practice.
Experience: I lived in a cave for 40 days I grew up in one of the biggest forests in Switzerland and spent my childhood around nature. I became an explorer and have travelled to some of the most extreme places on the planet: a 70C summer in the Dasht-e Lut desert in Iran, and a month in the Verkhoyansk mountains in Russia which can reach -60C. I want to better understand humankind’s ability to adapt to extreme environments. When I was young, I read about a Frenchman called Michel Siffre who spent weeks alone in a cave in 1962 to see what would happen to his body rhythm. The idea of living without the structure of time became a dream, and when lockdown came, disrupting schedules people had kept all their lives, I saw a reason to repeat the experiment. I found a cave in the French Pyrenees where I could go with 14 others who volunteered to join the expedition; I made sure there was a gender balance and a good level of fitness. The aim was to see how living down there for 40 days and nights without clocks, sunlight or contact with the outside world would affect our sense of time. Inside the cave, we would not be allowed to speak with our friends or family, or receive updates about the outside world. The cave was huge, the biggest in Europe. It felt as if we were on the moon. It was dark, with just faint shades of yellow, red and orange, and quite cold, and smelt of rocks and humidity. We established three spaces inside: a living area with a kitchen, which had a gas cooker, tinned food, pasta and rice. Eight hundred metres away, we had our tents. Beyond that was a place for scientific research. On the lower level, you had to descend 90 metres with a rope to reach a lake area for drinking water and bathing, but it was too cold to do wash properly. There was only one absolute rule: we had to follow our natural rhythm. We mustn’t wake other people, or do anything that felt unnatural, but just follow our feelings: if I want to go to sleep, I go to sleep; if I want to eat, I eat. There was always at least one person awake. It’s a strange feeling, to wake and not have a watch to tell you if you’ve slept enough. But soon it felt freeing. I slept really well. When I woke up I would go for a walk on my own, just listening and looking at the cave, soaking in the calmness. For breakfast, I always had coffee, two eggs with chapati and chocolate. We had a lot of chocolate in the cave. We spent much of the time talking about our lives, the reason for our existence on Earth and how we can improve humanity. On expeditions, people are much more open to talking about themselves: pain, love, joy. We also fantasised about what was happening outside – whether the pandemic was over and bars and restaurants open, or if a new virus might have destroyed society, like in disaster films, and we’d be the last people alive on Earth. After a while, people got familiar with the cave and began to forget to do chores and work tasks. There were arguments over food and washing-up. It was impossible to organise group tasks in these conditions, so after 17 cycles, or sleeps, we had a big group meeting to clear the air. It was tense. It took hours of discussion. After that, we began to unite. We gave ourselves specific roles and each person had to teach others how to do the job, so if you weren’t awake someone else could do it. We began to coordinate more and a strong bond developed between us. Some even planned holidays and bike tours together. Two volunteers had birthdays while we were down there. The first one was easy, because it was after just two cycles. But the second, for a girl who turned 30, was much more difficult because it was in the middle of the experiment. We just decided: it’s today, your birthday. We played music and had some cake and candles. Afterwards we found out we had celebrated it four days late. In the end, we were happy there. Following your own rhythm is an incredible freedom. When we were told it was over, we didn’t feel ready to go out, but leaving was like a rebirth. There was the sun and blue sky. The trees were really green. My nose was ready for all these other smells. The breeze blew in my face and birds were singing. It was unbelievable. I think, as a society, we should reconsider the way we spend our time. We wake up because it’s time to wake up and to work, but we forget to listen to our bodies. For the first time, I felt free. If I had to live like this for a long time, it would be nice.
COVID-19 Vaccine and Lung Cancer: Top 10 Questions Answered COVID-19 Vaccine and Lung Cancer: Top 10 Questions Answered Posted on January 19, 2021 – 12:58pm LUNGevity Foundation This information has been reviewed and endorsed by members of LUNGevity Foundation’s Scientific Advisory Board. Who should receive the COVID-19 vaccine? We recommend the COVID-19 vaccine for virtually all lung cancer patients, with the exception of those with a known severe reaction to polyethylene glycol or polysorbate. Medical and professional societies, such as American Association for Cancer Research, American Society of Clinical Oncology, American Cancer Society, Society for Immunotherapy of Cancer, and European Society for Medical Oncology, recommend that cancer patients receive the COVID-19 vaccine. Also, the COVID-Lung Cancer Consortium (CLCC) strongly recommends that lung cancer needs to be prioritized for vaccination. The ultimate decision may also be influenced by the patient’s health status as well as type and timing of their cancer treatment. How can you receive the COVID-19 vaccine? Patients and their caregivers should speak with their cancer physician or primary care provider about how to receive the vaccine. Currently, two COVID-19 vaccines are approved for use in the United States – the Pfizer vaccine and the Moderna vaccine. Is one better than the other? As of now, the two vaccines seem to work equally well. The main difference is the temperature of the cold-storage requirement. Will the vaccine provide complete protection? Currently, the science shows that the vaccines are highly effective in preventing people from getting seriously ill from COVID-19, but no vaccine is 100% effective. To ensure complete protection, continued safety measures, such as wearing a mask, social distancing, and washing your hands often, are strongly recommended. Should I get the COVID-19 vaccine if I have already tested positive for the COVID-19 virus? Experts recommend people get vaccinated even if they have had COVID-19. People who get COVID-19 do develop antibodies that provide some protection against getting infected again. However, it is not known exactly how long antibodies last after a person recovers. Is the vaccine safe? Both vaccines are considered to be safe. People who have had a history of developing severe allergic reactions to other vaccines or medicines for any reason or who are known to have a history of anaphylaxis (a severe, potentially life-threatening allergic reaction) should discuss whether to get the vaccine with their physician. How did COVID 19 vaccines get developed so quickly when vaccines usually take years to develop? Several agencies within the federal government coordinated an effort to accelerate vaccine development by pharmaceutical companies to allow clinical trials to proceed more quickly than in the past. The technology underlying development of the Pfizer and Moderna RNA vaccines existed prior to COVID19 and was rapidly deployed to help fight the pandemic. The U.S. Food and Drug Administration (FDA) will not and has not approved a vaccine unless there are data to show that the vaccine is safe for use following a series of randomized, placebo-controlled clinical trials in thousands of people as well as effective at preventing the disease and proven to be produced or manufactured consistently, safely, and at a high quality. Why are two shots of the vaccine needed? You need two shots of the vaccine because the first shot helps the immune system create a response against SARS-CoV-2, the virus that causes COVID-19, while the second shot further boosts the immune response to ensure long-lasting protection. Will the vaccine interfere with my cancer treatment? As of now, we do not have any reason to believe that the vaccines may interfere with cancer treatment. If a patient is in active treatment and is receiving chemotherapy or radiation therapy, it is advisable to discuss COVID-19 vaccination with their doctor. This is because an active immune system is needed for the vaccine to work. Chemotherapy or radiation therapy can dampen the immune response and make the vaccine less effective. Should caregivers receive the COVID-19 vaccine? If your caregiver(s) is/are eligible to receive the vaccine, we strongly recommend they receive the COVID-19 vaccine. Learn more @ LUNGevity
Nurturing the Seeds of Attunement April 8, 2015 Family planting flowers Winter still holds much of the country in its chilly grip. Easter/Passover have come and gone. Spring is on the horizon. Crocuses burst through the snow displaying a welcome burst of color and beauty. This climactic swirl serves as a metaphor for adoptive families who may be mired in challenging circumstances. Many struggle to help children heal past wounds. Others concentrate on integrating birth and adoptive family influences. Most focus on strengthening attachment relationships. Easter and Passover remind us to take stock of our faiths and recommit to our beliefs. As adoptive families one of our most important goals/values is attachment. Intentional parents understand the importance of developing a high AQ* (Adoption-attuned Quotient,) They recognize that attunement is the channel that entwines a loving family. Attunement provides a child the sense that he is seen, heard and understood. This feeling of being in synch is elusive and requires constant re-balancing as circumstances and emotions ebb and flow. Bessel A. Van der Kolk, MD., an expert on treating childhood trauma, writes in his book, The Body Keeps Score, "Trauma results in a breakdown of attuned physical synchrony ..." which complicates the attunement-building process. If parent and child cannot even be in tune physically, this increases the challenge to nurture emotional attunement. Later, Van der Kessel adds, "When we play together, we feel physically attuned and experience a sense of connection and joy ... Learning to become attuned provides parents (and their kids) with the visceral experience of reciprocity." Remember that the goal is not project completion. The aim is to spend time together in a way that nurtures individual spirit and leads to meaningful family ties. For example, your initial idea to plant a garden may require you to take a left turn as you notice that Johnny digs awesome holes but loses interest in the planting phase. Highlight the "skill" he is able to demonstrate. Remember that old Kenny Roger's song "I Am the Greatest." about the little boy who kept striking out? He didn't despair; he reframed his performance: "Even I didn't know I could pitch like that." As adoptive families with a high AQ*, we commit to that kind of stance. Avoid falling into the trap of focusing shortcomings. Flip perspectives: instead of noticing how far away the finish line remains, celebrate the distance from the starting line. Reframe for the positive. Look for the learning and the small steps toward progress. Just as seedlings need sunshine and water, kids need encouragement, attention, and time. Growth occurs over a season, or longer. Some seasons are longer than others. some winters make the record books. Finally, Spring arrives, ripe with new growth and beauty. What activities are you sharing to add playful moments to your families? How is your family synchronizing both emotionally and physically? Which activities produce positive connection? What do these activities have in common? How do you help yourself and your children notice the good feelings, the brief moments when you are flowing together? Please follow and like us: GIFT, Growing Intentional Families Together, adoption
The Economics of Nuclear Power There are many uncertainties about the economics of future nuclear generation. These are aggravated when nuclear is compared with other sources of power, because these are subject to their own uncertainties, such as fuel price rises and political manipulation such as OPEC and recent Russian gas manoeuvres. The cost of building nuclear power stations was initially very high but some countries are now building enough to develop standardised designs and blueprints which have reduced costs dramatically. Many reports have been released in the last three years assessing power generation costs. These show a wide range of estimates of the cost of nuclear generation and alternative sources of power. The highest cost calculated is 67% higher than the lowest. Among these reports, an MIT study puts nuclear power as the most expensive of the base load sources, a Royal Academy of Engineering study as one of the cheapest among both base load and renewables, and the cheapest depending on several variations of input. Nuclear power is a base load generating resource, unlike most renewables Its fuel source, uranium, is plentiful and secure compared with imported fossil fuels It is free of GHG emissions The report by MIT is concerned with base load power and confines itself to a comparison of nuclear power with coal and gas. It acknowledges the cost of carbon and cites various alternatives. The RAYENG study includes the non-base load renewable technologies and evaluates nuclear, fossil fuel and renewable power, together with the cost of carbon abatement for fossil fuels and for standby generation for back up of intermittent sources. The NERA report draws on the excellent work of the other institutes and pulls them together. It identifies a number of factors which are leading to improved prospects for nuclear power: Fossil fuel prices, especially for oil and natural gas, have continued to rise and are currently at high levels. The industrialised countries are becoming more dependent on imported gas and oil and self-sufficiency is coming to an end, combined with concerns about the long-term reliability of major overseas sources of supply Costs for nuclear plant could be kept down by streamlining the permitting process and keeping to construction schedules. Nuclear investment has therefore become a reality again, and this is fuelling a revival. Get the Career You Want. Find out more about our professional development course.
How Individuals With Existing Health Issues Benefit From a Foot Doctor There are a variety of reasons why you may need to see a foot doctor in Plainfield. While a general practitioner can handle many issues, a specialist can provide an accurate diagnosis and the latest in treatment techniques. Reasons to See a Foot Doctor Your feet receive a great deal of stress day in and day out. Problems in your feet can create issues throughout your body. If you are experiencing pain in your feet, you should consider seeing a podiatrist. Also, certain medical conditions benefit from having an existing relationship with a foot doctor. If you have diabetes, your general practitioner may recommend you see a foot doctor. Individuals with diabetes often have complications that show up in the feet. If you have any issues such as a blister that doesn’t seem to heal promptly, a foot doctor can help. Slowly healing wounds on the feet can lead to other complications. Even individuals who are generally healthy and have no preexisting conditions can benefit from seeing a foot doctor. If you develop an ingrown toenail, have bunions, corns, or warts on the feet, or any other condition that causes discomfort, a foot doctor can help. Chronic conditions, such as flat feet and hammertoes can also benefit from treatment by a foot care specialist. Also, if you are experiencing issues that could benefit from orthotics, such as insoles or foot braces, a podiatrist can help. If you believe you would benefit from seeing a foot doctor in Plainfield, get in touch with Suburban Foot & Ankle Associates today. Leave a Reply 9 + 16 =
Mitosis is the important process by which cells divide and proliferate. A cell divides into two, and two into four, and so on. This process is finely controlled by a set of genes and proteins. These are known as the mitotic oscillator. Defects in mitosis are thought to increase the chance of developing cancer. It is difficult to study the oscillator inside the cell, where many other complicated cellular processes are also occurring. This project will build a synthetic mitotic oscillator into tiny droplets to mimic real cells. Without the complicated effects from cell growth and cell divisions, these microdroplets enable quantitative manipulation and characterization of the mitotic oscillator. The knowledge gained through this research will be disseminated to the broader scientific community through publications, conferences, and workshops. The interdisciplinary technologies will be disseminated to youth and the public through proposed outreach activities such as demonstrations and lab open day in collaboration with local professional educators and the museum. These activities will allow us to engage underrepresented minority students in grades 6-9 interested in science, expose them to research excitement, and prepare them for STEM careers. The goal of this project is to quantitatively analyze the stochastic dynamics of a minimal mitotic oscillator and its responses to various environmental signals. To constitute a minimal cytoplasmic mitotic oscillator, Xenopus egg cytosolic extracts will be encapsulated in microfluidic water-in-oil emulsions that mimic single cell behaviors. Additionally, a more complicated cell that contains nuclei will be built on top of this minimal oscillator. This will recapitulate complex phenomena in vitro such as nuclear assembly, chromatin condensation, and protein localization. Several questions will be examined in this system, including the role of cell size, temperature, and energy depletion in modulating properties of the oscillator. To achieve these goals, computational modeling, droplet-based microfluidic methods, and time-lapse fluorescence imaging will be integrated. This work will build a cyclic cell bottom-up, ranging from the simplest form containing no nuclei to the complicated ones driving various nuclear activities. The success of this work will provide valuable guidance in search of new targets for drug development and regenerative medicine in preventing and treating mitotic oscillator-related cancerous diseases, and thus be relevant and of great importance to broader communities in cancer biology, and cell and developmental biology. Project Start Project End Budget Start Budget End Support Year Fiscal Year Total Cost Indirect Cost Regents of the University of Michigan - Ann Arbor Ann Arbor United States Zip Code
“Scratch your own itch,” is one of the most influential aphorisms in entrepreneurship. It lies behind successful product companies like Apple, Dropbox, and Kickstarter, but it can also lead entrepreneurs predictably to failure. This approach to entrepreneurship increases your market knowledge: as a potential user, you know the problem, how you’re currently trying to solve it, and what dimensions of performance matter. And you can use this knowledge to avoid much of the market risk in building a new product. But scratching your own itch will lead you astray if you are a high-performance consumer whose problem stems from existing products not performing well enough – in other words, if the itch results from a performance gap. Building a company around a better-performing product means competing head-on with a powerful incumbent that has the information, resources, and motivation to kill your business. Clayton Christensen first documented this phenomenon in his study of the disk drive industry, and found that new companies targeting existing customers succeeded 6% of the time, while new companies that targeted non-consumers succeeded 37% of the time. Even with a technological head start, wining the fight for incumbents’ most profitable customers is nearly impossible. An itch can result from two very different sources: existing products lacking the performance you need, or a lack of products to solve your problem. In the former case, you already buy products and will pay more if they perform better along well-defined dimensions. In the latter, products don’t exist at all or you lack access to very expensive, centralized products and so make due with a cobbled-together solution or nothing at all. It’s the difference between needing another feature from your Salesforce-based CRM system and spending hours and hours tracking information in Excel because you can’t justify the expense of implementing Salesforce in the first place. Consider, for example, two successful companies that at first seem to result from performance-gaps: Dropbox and Oculus VR. Dropbox began with the difficulty of backing up and sharing important documents, and developed a system that was easier to use than carrying around a USB stick and less expensive than paid services like Carbonite. Dropbox didn’t just set out to offer superior performance; it targeted an entirely new customer set that wasn’t using existing solutions, with a business model that would undermine the incumbents’ most profitable customers. Dropbox’s business model made head-to-head competition with incumbents unlikely, since the Carbonite’s of the world sensed that they would earn less off of their best customers if they offered a free service. Oculus created a virtual reality headset designed to be a hardware platform, primarily focusing on gaming – and recently sold to Facebook for $2.3 billion. Although envisioned as a platform that would enable any kind of virtual reality application, Oculus was created with hardcore gamers in mind. Unlike Dropbox, Oculus’s first customers would have been the most profitable customers of existing game platforms, giving incumbents like X-Box and PlayStation a strong incentive to emulate Oculus’s technology to retain their best customers and make them even more profitable. Oculus, of course, was wildly successful. But only because Facebook felt that, despite being developed with existing customers in mind, the technology would be appealing to non-gamers for the purpose of messaging and social networking. Facebook bought Oculus to rescue it from a flawed strategy by shifting its focus from high-end customers to non-consumers. Oculus’s founder set out to scratch his own itch by creating a new gaming platform, one that targeted a customer set of hardcore gamers who were already served by incumbent firms. Dropbox’s founder scratched his own itch by creating a product aimed at a new set of customers, who weren’t being served by incumbents. The difference matters greatly in terms of a company’s competitive position. Before founding a business around a problem you face, first understand whether that problem is a performance gap or a product void, by asking the following questions: • How am I currently solving this problem? • Do other products exist that solve this problem? • Do they provide good enough performance, or is there still a performance gap? • Are they too expensive to use? Are they centralized and do they require special expertise? • Would this product make any incumbent’s existing customers more profitable? Ultimately, if your product would make an incumbent’s best customers more profitable, you should steer clear: Facebook won’t always be there to bail you out.
Thursday, August 5, 2021 What is a Millennial? Is New Gen Z ’20 Better? Must read The media loves to talk about Millennials. Every day there is a new article about Millennials doing something or another. Amongst the flurry of headlines about ‘Millennials this’ and ‘Millennials that,’ have we ever stopped to consider what is a Millennial? Let’s explore what is a Millennial, from their history, personality to their future. What is a Millennial? Millennials are the generation of children born between 1981 and 1996. There is still some debate over what is a millennial – where exactly one age ends, and the next begins – but overall, this is the definition that is accepted as fact. In other words, Millennials are the ’90’s kids’ – children that shaped and were shaped by the pop culture trends of the 1990s. If you were a young person during that time, you are probably a Millennial. What is a Millennial? Is New Gen Z '20 Better? 1 What is a Millennial Millennials were defined by events such as the 9/11 attacks, the 2008 recession, and the Obama presidency. They are digital natives, have always been familiar with the latest digital technologies. Millennials were the demographic that brought us most of the fashion and entertainment trends of the noughties and nineties. You can identify who and what is a millennial by specific popular trends. The millennial generation’s favorite childhood cartoons include Spongebob Squarepants, Dragon Tales, and rugrats. A rise then followed the stylized, hand-drawn Cartoon Network and Nickelodeon cartoons in Disney Channel shows. As millennials became teenagers, they watched shows like Lizzie Mcguire, That’s So Raven and Phil Of The Future. What is a Millennial? Is New Gen Z '20 Better? 2 What is a Millennial Millennials also popularised many iconic fashion trends. Accessories like skinny scarves, jelly shoes, and studded belts flew off the shelves throughout the decade. Millennials also normalized the coexistence of multiple different style ‘scenes.’ ‘Emo’ and ‘goth’ styles were readily available next to ‘hipster’ and ‘preppy’ styles. In other words, ‘Hot Topic’ kids and ‘Forever 21’ kids lived in harmony. This was just the beginning of the millennial generation’s rising social justice and cultural acceptance. After all, what is a millennial if not an activist? What is a Millennial? Is New Gen Z '20 Better? 3 What is a Millennial A Brief History of Millenials, Boomers, and Gen X: Before millennials hit the scene, Baby Boomers and Generation X were the dominant generations. Baby Boomers were the name given to the population of children born between 1946 and 1964, during what was called the ‘baby boom.’ The ‘baby boom’ happened after World War II when prosperity was high, and people were having more and more babies. Baby Boomers were the largest generation the world had seen so far. Boomers were the children of the 60s; they created the hippie and mod cultures that the decade was synonymous with. Hippies had a mantra of ‘make love, not war’ (usually aimed towards the gruesome Vietnam War that was going on at the time). Hippies were called ‘tree huggers’ for their environmentally friendly lifestyle. What is a Millennial? Is New Gen Z '20 Better? 4 What is a Millennial ‘Mods,’ on the other hand, were a different type of counterculture, one that looked towards the future. With the rise of science fiction literature and film, the 60’s version of the future became more transparent and more precise. ‘Mods’ were the group that believed in ‘the future is now.’ Bright colors and short, blunt hair defined the style. Mods’ and hippies also ushered in the second sexual liberation as teens and young adults were pushing back against the rules of the 50’s society. What is a Millennial? Is New Gen Z '20 Better? 5 What is a Millennial Baby boomers came into a world that was steadily getting better. Civil rights movements, space exploration, television and radio, growing feminism – all became during their youths. This is why Boomers tend to think of progress as linear; ‘things can only get better’ is a mentality Boomers still have today. This is why Boomers see the Government (and establishment in general) as an ally and their country of origin as the best in the world. They tend to be more conservative as a result. Baby Boomers are the parents of Millenials, and some members of Generation X ( the generations that are often confused about what is a millennial)Generation X (or Gen X) is often forgotten about in conversations regarding ages. They were generally regarded as a generation of ‘slackers,’ but this may not be entirely fair. Gen X children saw the highest divorce rates of any of their predecessors. Boomers were getting divorced more often as the sexual revolution made dating in middle age and remarrying more acceptable. Gen X also had the lowest parental oversight as more Boomer women were entering the workforce. This meant Gen X were more independent children. What is a Millennial? Is New Gen Z '20 Better? 6 What is a Millennial Gen X was born during a steady recession. They did not know the economic prosperity of their parents. The financial debt had tripled during their youths, and a single income could no longer support a household. This economic strain was a significant factor in the crack cocaine and AIDS epidemic. Trust in the Government was declining due to this, and the Watergate scandal did not help. It wasn’t all bad, however. Gen X saw an increase in college graduates by 53 percent from their Boomer predecessors. Gen X was the first to have personal computers in the home. The civil rights movements had a substantial impact on Gen X, and they were a more tolerant and accepting generation when compared to their parents. What is a Millennial? Is New Gen Z '20 Better? 7 What is a Millennial Gen X has a reputation for being cynical and lazy. This is an inaccurate assessment, however, as they were born with high expectations to live up to and very few resources to help them accomplish those standards. They were deemed ‘slackers’ for not surpassing the Boomers in their careers despite having undergraduate degrees. The generations that criticized Gen X for their relatively stagnant progress were already stable in their careers, so they did not know of the economic hardships Gen X faced. It is because of this that Gen X became ‘cynical’ as they resented being blamed for the government’s shortcomings. This brings us now to what is a Millennial. Millennials are the children of Boomers and Gen X. Millennials were initially called Generation Y, The “Me” Generation, and The Internet generation. What is a Millennial? Is New Gen Z '20 Better? 8 What is a Millennial Millennials, as we established, are the 90’s kids. They have always been familiar with the internet, although they have seen massive technological changes in their lifetime. They witnessed the migration from dial-up modems to WiFi networks, saw the rise and fall of various mobile devices (Nokia 3310, flip phones, BlackBerry, and smartphones). They were born and brought up in a digitized landscape, and that means they were well equipped to pioneer digital technologies like Bluetooth and Social Media (Instagram, Twitter, and YouTube, most notably). Millennials have been hit harder by the recessions and rising inflation than both their predecessors. Unemployment, homelessness, and public debt are at an all-time high, and Millennials have suffered the brunt of the consequences. What is a Millennial? Is New Gen Z '20 Better? 9 What is a Millennial Millennials did continue the overall trend of higher education, with most young people now having bachelor’s or even masters degrees. The problem with this is that it led to Millennials amassing a considerable amount of student debt. Colleges like Yale have increased their tuition fees from 2,550 dollars in 1970 (where the minimum wage was 1 dollar 45 cents) to 45,800 dollars in 2015 (where the minimum wage was 7.25). In other words, a student would have to work 5 hours daily to pay off their fees in 1970 but would have to work 18 hours daily to do the same in 2015! Furthermore, the saturation of the job market means that the only jobs available to students now are minimum wage jobs. In contrast, in 1970, a high school diploma would be sufficient to get a job that would support a family of four. It seems the trend towards more extended college stays is not a choice but a necessity as it is impossible to compete in the sparse job market without at least a college degree. Recessions like the 2008 housing crisis and the recent CoronaVirus crisis have had negative impacts on both their finances and their mental health. Millennials are the unhappiest generation since the Silent Generation (a group that suffered through two World Wars!). Since Millennials have never seen economic prosperity, they are less likely to have blind faith in the capitalist system. Boomers found enormous success through the system, and Gen X saw the failures of the communist Soviet Union, so neither challenged the economic status quo. Millennials have not been so complacent. Wage gaps, the shrinking middle class, and rising homelessness have made millennials consistently more socialist. What is a Millennial? Is New Gen Z '20 Better? 10 What is a Millennial Millennials have always been politically active. Born in an increasingly diverse society, Millennials are unlikely to discriminate based on gender, race, or sexuality. They also call out injustice more often as a result. The recent Black Lives Matter movement and protests over the murder of George Floyd and Breonna Taylor by U.S police are an example of that. Millennials also helped push for diversity in media through boycotts of the Oscars for not being inclusive enough and boosting LGBTQ+ shows like Rupaul’s Drag Race. What is a Millennial? Is New Gen Z '20 Better? 11 What is a Millennial What Is a Millennial like? While we have established ‘what is a millennial,’ we have yet to explore the characteristics of the generation. Of course, many stereotypes are surrounding Millennials. Some are accurate, but some are reductive, untrue, and downright rude! So let’s separate ‘what a millennial’: fact vs. fiction is. Millennials Are Entitled: Fiction: The theory that Millennials grew up entitled and lazy because of their secure childhoods merely is false. ‘Participation trophies’ don’t make someone entitled; their privilege does! Millennials have been historically disadvantaged, and their cries for change have been misinterpreted as greed. Privileged boomers are more likely to act entitled as they grew up with the mentality that ‘the world was their oyster.’ What is a Millennial? Is New Gen Z '20 Better? 12 What is a Millennial Millennials Are The New ‘Tree Huggers’: Fact: What is a millennial without their metal straws and jute bags? Millennials are notoriously environmentally conscious, calling for action against climate change and consistently following ‘Reduce, Reuse, Recycle’ protocol. They were labeled ‘Hipsters’ and had a message that bears a striking resemblance to the ‘Hippies’ of 1960. What is a Millennial? Is New Gen Z '20 Better? 13 What is a Millennial Millennials Are Killing Industries: Fiction: Millennials are not the reason industries are failing; the market is! Wages have barely moved since the 60s despite massive inflation. Its no wonder Millennials aren’t buying diamonds or dinner napkins- the industry cannot keep up with the lower incomes and fiercer competition. During a recession, If something isn’t a necessity, you cannot expect the people to indulge in it. The question ‘what is a millennial’ has long been met with this presumption, but the idea that millennials are killing industries is simply not right. What is a Millennial? Is New Gen Z '20 Better? 14 What is a Millennial Millennials Are Self Obsessed: Somewhat: Instagram and Snapchat make it seem like Millennials are obsessed with themselves and are continually documenting every mundane detail of their life. At least many older people think so. While it is true that Millennials are a tad narcissistic, it is more to do with the fact that they are young rather than a generational trait. Even Boomers were deemed narcissistic in the ’60s! So it appears that 20-year-olds, regardless of generation, are self-centered. Now, as Millennials are entering their 30s and 40s, this is less characteristic of them. What is a Millennial? Is New Gen Z '20 Better? 15 What is a Millennial So now we can see that every generation is concerned about the next one, and fail to see that they were once just like them! There are reports from a principal’s publication in 1815 that was criticizing children for using too much paper and not being able to use slate and chalk properly! Perhaps older generations should cut Millennials some slack. Who’s Next? Now that Millennials have begun having children, the question is, who’s next? While discussing ‘what is a millennial,’ we have covered everything from their ancestors their personalities, but we have yet to see who they will be as parents. Generation Z (Gen Z or Zoomers as they are colloquially known) is the newest generation to come onto the scene, and they have hit the ground running. Gen Z has taken over the internet; TikTok, Instagram, and Youtube are their very own digital playgrounds. What is a MillennialGen Z took the political activism of their predecessors and ran with it? They are more left-wing, more radical, and more vocal than Millennials. Greta Thunberg, a famous Zoomer activist, gave an intensely moving speech at the U.N General Assembly at just 17 years of age! Gen Z has raised funds, and awareness for the Black Lives Matter and Yemen relief funds by harnessing the crowdsourcing power of Social Media. Gen Z is on the road to greatness. What Have We learned? The answer to the question ‘what is a millennial’ is complicated. They are a generation of personal branding, social networks, and social justice. They may seem novel and unprecedented, but in actuality, they are generally the same as every other generation that came before them. The platforms, social networks, or mediums may be different, but in its essence, the youth have and always will be full of energy and ideas for change. Older generations will just have to accept that they are no longer the voice of the nation. Read more: About the author More articles Please enter your comment! Please enter your name here Living Life
pcr banner DNA Polymerase Proofreading Return to PCR qPCR and Amplification Technologies A 3´→ 5´ proofreading exonuclease domain is intrinsic to most DNA polymerases. It allows the enzyme to check each nucleotide during DNA synthesis and excise mismatched nucleotides in the 3´ to 5´ direction. The proofreading domain also enables a polymerase to remove unpaired 3´ overhanging nucleotides to create blunt ends. Protocols such as high-fidelity PCR, 3´ overhang polishing and high-fidelity second strand synthesis all require the presence of a 3´→ 5´ exonuclease. In contrast, some applications are enhanced by the use of polymerases without proofreading activity. For example, the efficiency of DNA labeling is enhanced by the absence of proofreading, because it prevents the excision of incorporated bases, allowing for the use of less of the modified base. Modified base incorporation assays, such as multicolor analysis of gene expression, gene mapping, and in situ hybridization, which utilize DNA that has been labeled with a fluorescent nucleotide to facilitate detection, are well matched to NEB's exonuclease-deficient DNA polymerases. Non-proofreading polymerases are also indispensable when partially filling in 5´ overhangs with only selected dNTPs. Addition of an untemplated dNTP at the 3´ terminus of blunt ends, a requirement for TA cloning, is also promoted by non-proofreading enzymes. In addition to several wild type polymerases in each of these categories, NEB offers genetically altered versions of several proofreading polymerases, where the proofreading exonuclease activity has been attenuated or abolished.
The Importance of Cyber Security Awareness Training Human-error; we talk about it all the time, but what exactly do we mean? Human-error occurs when an individual performs a task or does something with an unintended outcome. It’s easy to point the finger at employee’s as being an organization’s weakest link, but without appropriate cyber security awareness training for employees, provided by the employer, how can employees truly know what to watch out for? An IBM study found that human-error accounts for 95% of security incidents, yet cyber security awareness training for employees often ends up on the back burner. With the need for cyber security awareness training clear, even the most surprising organizations are jumping on the bandwagon, offering cyber security awareness training to their employees. Since security incidents are often a result of employee mistakes, it is evident that technology alone is not enough to protect an organization. This brings me to one conclusion: to be successful and provide services that can truly defend against cybercrime, providing education through security awareness training is key. cyber security awareness training, cybersecurity awareness training, cyber security awareness traning for employees Cyber Security Awareness Training For Employees – Should Your Company Do It? Educating employees on security awareness is crucial to organizations, especially those with sensitive data, so why are we pushing this service so strongly? Cybercriminals are relentless in their efforts to carry out their attacks. In the digital era, criminals have become masterminds at forming social engineering attacks to trick their victims, a scheme that no antivirus can protect against. It’s important to remember that a layered security strategy is necessary for adequate protection. We must not forget that without appropriate training provided, employees cannot effectively act as that first layer of defense. The time is now to jump on the cyber security awareness training bandwagon! After all, employees can’t help defend against cybercrime if they aren’t provided with the necessary tools to do so.
Stonehenge, Burial Site or Ancient Computer? Stonehenge, a lonely set of standing stones surrounded by clusters of barrows. The site appears to have been evolved from around 3000BC to 1600BC. The earliest version of the site, a ditch and earthwork, might have been surrounded by a wooden palisade, possibly with stones having been brought from as far as Wales to act as grave markers. After time some sort of cremation building was erected on the site, followed by an avenue that might have been used for rituals marking rising sun during the solstice. In fact, the idea of Stonehenge’s use for astrology is still hotly debated amongst archaeologists, even contributing to the specialised field of Archaeo-astronomy. The first theory that Stonehenge was a computer came from before 1740 and was still being championed in 1965. William Stuckley, the first archaeologist to suggest that Stonehenge was a tool for tracking and measuring astronomical phenomena, noted that the structure has a north-east facing earthwork called ‘The Avenue’, which terminates with the sun almost rising above a stone known as ‘The Heelstone*’ on the morning of the midwinter solstice (although skeptics point out that the sun won’t rise precisely over the stone until the year 3260AD, which would be a strange thing for neolithic builders to be marking… unless it’s the year day when great Cthulu rises to eat us all). Other archaeologists, like C.A. Newham, put a lot of meaning in a set of postholes (or possibly just the cavities left by tree roots) when the monument’s car park was extended in 1966, believing that they were useful for tracking a number of solar and lunar phenomena. Other Astro-archaeologists have raised astronomical links with the Station Stones, a vaguely rectangular arrangement of stones just outside the main part of the monument. Alexander Thom and others have argued that it’s possible to make no fewer than eight astronomically significant sight-lines using the stones, although Christopher Chippendale, in Archaeology, a magazine published by The Archaeological Institute of America, said that modern research has revealed that only three of those sight lines were astronomically relevant, and two of those lines were perpendicular. One of the most interesting, and macabre, factors of the uses of Stonehenge as an astronomical tool relates to the Aubrey Holes, compacted chalk pits discovered by the 17th century antiquarian John Aubray, who found that there were bodies buried in the pits; a New Zealand-based researcher has also found that the holes – with knowledge of the moon’s movements and how lunar phases affect the sea – can be used to predict tides in the English Channel with uncanny accuracy. Were the dead some sort of sacrifices to the gods of Astronomy, or to the moon?
Can I use my commercial ice maker outside? Cookware & Cooking Tools While they are insulated, the storage bins in an ice maker aren’t refrigerated. The ice cubes in an ice maker outside in hot weather may melt as fast as the machine makes them. The place to put your commercial ice maker A commercial ice maker can be a large, cumbersome machine that takes up a lot of space and generates a great deal of heat. It would seem evident that placing such a well-fortified piece of equipment outside where it won’t be in the way would be an obvious choice. However, if that’s the decision you have made or are considering making. Hopefully, you’ll read through the rest of this article to determine why that is not recommended. How does a commercial ice maker work? While not all ice makers function the same, some basic principles apply. 1. An ice maker pumps water into a tray that holds that water until it is frozen. 2. An ice maker uses a refrigerant. This refrigerant repeatedly cycles through a system of components and tubes, changing states from vapor to liquid to vapor, over and over. 3. The refrigerant gas is compressed then condensed to turn into a high-pressure liquid. This part of the process creates a great deal of heat on the outside of the unit. When that high-pressure liquid flows through an expansion valve into the evaporator coils, it turns back into a vapor. This process rapidly absorbs the heat inside the ice maker, cooling it down dramatically – making it cold enough to turn the water in the tray into ice. 4. The tray is briefly heated to free the ice cubes (without melting them). The ice cubes either slide down a chute or are cleared away in some manner (the method varies from machine to machine) so the process can begin again. Consequently, air temperature and water temperature are critical for allowing an ice maker to function correctly. While there is some variation between models, an ice maker functions best when the air temperature is 70 degrees, and the water temperature is 50 degrees. If the air is too hot, the ice maker will have to work harder to make the ice, which will shorten the unit’s lifespan. If the air is too cold, it will slow down the ice production or even cause some machines to cease making ice altogether. In the worst-case scenario, if the temperatures are below freezing, the water in the lines can freeze and burst. Pros and cons of placing a commercial ice maker outside Now that you understand how an ice maker works, let’s take a quick look at the pros and cons of placing one outside. What are the pros of placing a commercial ice maker outside? If you are considering placing an ice maker outside, there are very few reasons why you would want to do that. We can only think of two. • If your establishment has limited space, placing an ice maker outside may be your only viable option. • If the heat that the unit produces negatively impacts some aspect of your business ( such as comfortable working conditions as cooling bills), you may be considering placing the unit outside. What are the cons of placing a commercial ice maker outside? Contrary to the pros, there are many reasons why you would not want to place an ice maker outside. Here is a list of the top ones. • An ice maker that is placed outdoors will suffer from poor performance, rarely operating at peak efficiency. • If an ice maker has to work harder to create ice, the components will wear out more quickly – you may not even get five years out of a unit that costs several thousand dollars. • An ice maker that isn’t explicitly rated to be placed outside won’t endure the elements. • If you place your ice maker outside, whenever employees need to access the machine, there is a risk factor involved, especially if the business operates at night. • Ice isn’t light. If the ice maker is outside, you will undoubtedly be carrying larger (heavier) loads of ice than if it was in a more convenient place. • An ice maker that is outside can not be monitored as easily, making it a health issue. • Thieves can steal even something as large as an ice machine. • Placing it outside makes a thief’s job easier. • It is possible that placing an ice maker outside will void the warranty because the machine is not working under the conditions for which it was designed. Should a commercial ice maker be placed outside? Opal Countertop Nugget Ice Maker Unless you are purchasing an ice maker specifically rated to be outside, the cons far outweigh the pros. If space is tight, look for a smaller model (there are several compact options) or consider some minor remodeling because an ice maker should not be placed outside. Best commercial ice makers SNOOKER Ice Maker 160 lb SNOOKER Ice Maker 160 lb This model is designed for establishments that have high demands. The unit can produce up to 160 pounds of ice each day and employs technology that shows the status of ice production. It also comes with a storage bin which can hold up to 80 pounds of ice, while the entire unit can produce up to 160 pounds a day. Where to buy: Sold by Amazon Manitowoc Undercounter Ice Cube Machine Manitowoc Undercounter Ice Cube Machine If you are looking for an undercounter ice maker that can produce up to 195 pounds of half ice cubes per day and has a 190-pound storage bin, this is the model for you. The easy-access door makes it simple to fill pitchers or even buckets with ice for transport. Where to buy: Sold by Amazon GE Ice Maker GE Ice Maker This GE ice maker can produce up to 65 pounds of ice per day. It has a 26-pound capacity bin with an automatic shut-off that keeps the machine from overflowing. The handy Clean Indicator lets you know when it’s time to give the machine a cleaning. Where to buy: Sold by Home Depot NewAir Countertop Clear Ice Maker NewAir Countertop Clear Ice Maker For homeowners who would like restaurant-quality ice in their own home, this compact machine can make a new batch of ice every 15 minutes. This will be clear ice, and the small countertop unit comes with a BPA-free plastic ice scoop and a removable ice basket. Where to buy: Sold by Amazon Costway Ice Maker Costway Ice Maker If you are looking for a compact commercial ice maker that would be ideal for a coffee shop or a bar, this 31-inch model is sized for the job. It can make up to 110 pounds of ice each day in 12- to 18-minute cycles. The ice is bullet-shaped and clear. It is designed to function as either a freestanding machine or a built-in one, depending on your needs. Where to buy: Sold by Home Depot Copyright 2021 BestReviews, a Nexstar company. All rights reserved.
What is an Ultrasound? As a photographer, I have always been fascinated with how ultrasounds can create an image of internal body structures such as tendons, muscles, joints, blood vessels, and internal organs. Did you know that the first ultrasound was developed to measure flaws in metal castings in the 1940s? I am also mesmerized by the fact that 3D ultrasounds can make live, moving images of a beating heart. You probably know that ultrasound does not penetrate bone well. And for that reason, because of the cranium, it has very limited use on the brain. Creating an ultrasound requires three processes: producing the sound wave, receiving echoes from it, and then interpreting those echoes.
March 25, 2020 Overcome coding weaknesses 勤能补拙 Overcome coding weaknesses 勤能补拙 Learning a new technology is an uphill task, especially if it was a programming subject. There are programmers who are able to write codes like how a native English speaker would converse in English. The codes would flow out so naturally. In order to write good codes, it is important to know the programming language well. It is also useful if the person has good memory, because there are many syntax and rules to adhere to. And the person has to be creative, in order to come up with solutions to tackle a tough problem. Sometimes the term hacking is used to describe using some out-of-ordinary ways to achieve something. I must say I may not have all the talents a "star" programmer has. But I have learned a few tricks to speed up learning (to code). Such as writing notes to accompany the video lessons. Sometime it could just mean doing the transcribing. Adding your own notes facilitates quick search into sample codes, as well having documented the changes made to a program and the reasons for the change. And it overcomes the shortfall in not having good memory, because the notes are the memory, and it helps you to quickly get up to speed even after you have put down the subject for a while. Might take more efforts to do it, but as the Chinese saying goes "勤能补拙" (roughly translated as "overcome weaknesses with more practices") - will get us to finally become a programmer. Writing notes helps in learning a tough subject such as coding
Habits of Successful People: Fostering a Growth Mindset Habits of Successful People: Fostering a Growth Mindset Growth mindset. Yes, we have talked a lot about this in the last few weeks. From understanding the impact of growth mindset for students to a growth mindset guide for parents, we’ve gone beyond basics of understanding what it is and learning how to apply its principles to our lives. Today, let’s look at how growth mindset is one of the key habits or rather, the traits, of most successful people. Successful People Foster a Growth Mindset Every success has had its share of failures in the past. We may not always see it or know about it, but there is hardly a success that has not had a failure or two under its belt. The difference is that successful people don’t let failures define who they are and what they can do. The believe in learning from their mistakes, changing their mindset and believe that challenges and obstacles are just another stepping stone. Think of Warren Buffet, Steve Jobs, Walt Disney. All these hugely successful people faced failures at various stages of life but they didn’t let their failures define their futures or their mindset. Successful People Welcome Challenges and Obstacles Not only do successful people treat failures as part of their learning curves, but they also welcome challenges and obstacles as opportunities to grow and progress. Challenges and obstacles give them an opportunity to discover hidden strengths or potential or learn something new about themselves. Because a growth mindset encourages developing talents through effort, persistence and teaching, they treat these challenges as just another way of “teaching”. Successful People Look Forward to Developing New Talents That’s right. Successful people don’t just settle for having a “fixed” amount of intelligence or talents or abilities. They’re willing to push the limits and expand, grow and strive higher than ever. Whether in sports or in business, you’ll constantly see those with growth mindsets setting the bar higher for themselves. That is why successful people always seem to be adding another feather to their cap when actually, all they’re doing is growing with every single step, every stumble, every stride. Want to develop a growth mindset for greater success? We have you covered. Dig into the following posts: How to Develop a Growth Mindset Growth Mindset Quotes for Inspiration The Mindsetmax Growth Mindset Pinterest Board Liked this post? Share it with your friends or let us know on Facebook and Twitter.
Coughing Up Clear Mucus - Is It a Sign of an Allergy? Some people think that coughing up clear mucus is a direct result of problems within the throat, since this is where the discomfort originates from. More » Green Mucus in Nose and Throat - Bacterial or Viral Infection? There is one condition that can be linked to both allergies and illness, and of course green mucus in nose areas. That condition is sinusitis. More » Coughing Up Blood Causes - When Is It Time To Worry? Yellow Mucus in Eye with Cold - Signs of Adenoviral Infection! The symptoms of adenovirus can vary but often include both cold like symptoms as well as white or yellow mucus in eye areas or other... More » White Mucus in Stool Causes - Parasites or IBS? There are some common and uncommon causes of white mucus showing up on the commode contents left behind following a bowel movement. More » Black Specks in Mucus - What Are They? Brown Cervical Mucus Causes - Hormones, Infection or Intercourse? Changes in cervical mucus color can signal distress within the female system. And, one of the most disturbing of these is brown cervical mucus. More » Mucus Color Meaning and Other Facts about Mucus Mucus is a slippery, gel-like liquid produced by mucous membranes in the body in order to lubricate organs and systems warding off foreign invaders in the forms of viruses, bacteria, allergens and environmental toxins. Its composition presents a very complex formula including glycoproteins, water, antiseptic enzymes, antibodies, electrolytes and various organic compounds, which provide all the necessary functions. Mucus color ranging from clear to black helps decipher the clues of various health conditions. Mucus ColorA healthy human body produces about a quart of mucus throughout the day to keep the body functioning properly. Depending on where the mucus is produced, it takes its name after the location in the body. For example, digestive system organs produce plenty of mucus to keep foods from moving down esophagus and to protect delicate stomach lining from highly acidic environment. Bowel mucus helps fecal masses pass smoothly down through the rectum. Another example of mucus at work is cervix, which produces cervical mucus necessary to protect delicate female reproductive system from pathogens and to facilitate the movement of sperm during fertile stage. Later, when pregnancy progresses, the cervix forms a mucus plug to seal uterus and protect a developing fetus. When delivery is imminent, the mucus plug comes out signaling that labor is on its way. Mucus in eyes keeps all the tissues from drying out and additionally neutralizes allergens, dust and viruses, which may be introduced into the eyes. Respiratory system organs in particular produce plenty of mucus to help keep everything lubricated and running smoothly. Mucus acts as oil in a perfectly functioning engine, without it the engine cannot function. Nasal mucous membranes and glands located in the nose and airways produce nasal mucus, which is necessary to help initially trap foreign particles so they do not reach lung tissues and prevent normal breathing. The term phlegm is limited to mucus produced by the lungs and coughed up with throat mucus. Another medical term for mucus used by doctors is sputum, a combination of saliva, throat and nasal mucus combined with phlegm coughed up by a patient. Mucus color, its texture and quantity are important symptoms for doctors to help figure out what might be wrong with a patient. Coughing up MucusWhile it’s normal to produce clear mucus, its hyper secretion (increased production) along with change in mucus color may signal a plethora of health conditions. Analyzing a set of presenting symptoms along with mucus excreted in a rainbow of colors helps doctors get clues about a serious illness brewing or a mere cold requiring almost no medical intervention to resolve. Abundant clear or white mucus could be the result of many things ranging from ingesting a plate of spicy Thai soup to inhaling allergens like dust and pollen, to catching a viral upper respiratory infection. Allergies are the most common reason for secreting abundant white or clear mucus color. Triggered by rapid antihistamine release, the lining of the nasal and airway passages works in overdrive trying to produce loads of sticky substance to coat allergenic invaders and expel them from the body with sneezing and coughing. Watery, itchy eyes are also a sign of mucus producing tissues fulfilling their function of neutralizing allergens from the eyes. This condition is usually remedied by taking oral antihistamines, nasal irrigation with nasal sprays and mild decongestants. Some individuals experience rhinitis (inflammation of the mucus producing membranes) due to exposure to cold or heat, sudden temperature fluctuations are followed with clear secretions from the nose and post nasal drip. Throat MucusWhen mucus becomes especially abundant as cold progresses, it takes on a yellow and greenish tint. This happens due to the presence of white blood cells that are produced in the efforts to neutralize viruses and bacteria that attack upper respiratory organs. Warm, dark and sticky mucus is nearly ideal environment for bacteria to multiply, thrive and trigger inflammation. Even a simple viral infection can progress to a more serious bronchial or sinus infection, especially in people with weak immune system like children, elderly or individuals with chronic health conditions. Green or yellow mucus color expelled from the throat coupled with other symptoms like high fever, cough, chest pain usually signal of a bout of acute bronchitis, sinus infection or even pneumonia. Taking oral antibiotics, chest decongestants and measures to thin mucus is one of the best courses of treatment in the presence of green mucus and other symptoms witnessing of an upper respiratory system infection. However, not all conditions producing yellow or green mucus require antibiotics; patients with asthma, a chronic inflammatory condition of the lungs and bronchi, are prescribed an entirely different course of treatment. Since asthma is triggered by inflammation leading to obstruction of airways and difficulty breathing, oral steroid medications and inhalers help widen airways to allow oxygen to enter. Doctor Looking at Lungs X-RayBrown mucus and smoking go hand in hand. Smokers inhale thousands of toxic compounds, tars and nicotine that settle on the delicate tissues of airways and lungs. In response, body starts feverishly producing overabundance of mucus to neutralize these nasty invaders. As a result, smokers are plagued with persistent cough that produces brown phlegm color. Chain smokers who have been smoking for years put themselves at a high risk of developing a progressing lung disease emphysema. Brown mucus color expectorated from the respiratory organs, shortness of breath coupled with bouts of exhausting cough are just some of the obvious symptoms of the condition. Deep down in the lung tissues, tiny air sacs are damaged by constant toxins inhaled with smoke resulting in severe lung damage requiring oxygen therapy and surgery in extreme cases. However, if non-smokers experience brown mucus with blood-tinted secretions, it is usually a sign of trauma or broken blood vessels due to exposure to cold temperatures, high altitudes, air travel and a million other things. All these factors dry the lining of nasal tissues resulting in breakage of tiny blood vessels inside the nose. Frequent nasal irrigations with over the counter nasal saline sprays will keep nasal tissues moisturized. Moreover, people with deviated septum, an anatomical anomaly of the septum placement, suffer from common bloody mucus discharges and recurrent sinus infection due to obstruction problems making mucus escape more difficult. Bloody PhlegmBloody phlegm is a worrisome sign and depending on mucus color intensity and quantity can help doctors pin point various health conditions that might be the underlying reasons for it. It can greatly range in its color wheel from blood-streaked, pink frothy or scarlet red phlegm. Instances of sudden and abundant bright red coughed up phlegm are considered medical emergencies and should be reported to a doctor immediately. Among such emergency conditions is a pulmonary embolism resulting from a blood clot blocking a blood vessel leading to lungs as a result from complications after major surgery, prolonged immobility or a myriad of other reasons. Tuberculosis common in third world countries also manifests itself with bouts of cough producing bloody phlegm. This disease is caused by mycobacteria eating into lung tissues that eventually results in death in progressive instances. Lung cancer is another unfortunate reason for coughing up bloody mucus color when cancer cells start taking over healthy lung tissues causing severe damage. Lung cancer is predominant in smokers, however it can affect even non-smokers exposed to second hand smoke or those living in highly polluted industrial areas. The darkest of all mucus colors, black mucus affects coal mine workers who are exposed to daily inhalations of black coal dust and dirt. As it settles on the airways and lung tissues, body produces mucus to clear it from the system resulting in jet-black mucus. Coal miners are prone to developing a host of respiratory diseases like chronic bronchitis, emphysema and progressive chronic obstructive pulmonary disease. Black lung disease could also develop due to years of exposure to coal dust leading to fibrosis of the lung tissues. Moreover, individuals involved in especially toxic working or living environments can also experience dark mucus color for similar reasons. Black mucus color meaning is not limited to toxic exposure; certain fungal infections of the lungs can lead to similar symptoms. However, these conditions are very rare and are limited to immune compromised individuals affected by major health conditions like HIV or cancer, mucormycosis and aspergillosis can also trigger dark mucus formations. Watch this educational video provided by TheDoctors show to find out more about most common colors of the mucus or phlegm: In addition to all the above-described conditions, abnormally abundant and thick mucus could be produced in patients affected by a serious genetic disease called cystic fibrosis, which is triggered by gene mutations. With cystic fibrosis, patients suffer from a host of conditions triggered by accumulation of viscous mucus and inflammation. Chronic sinus infections, bronchitis, pneumonia, gastrointestinal problems are just a short list of conditions experienced with this mucus disorder producing mucus color in white, yellow and green tints. As you can see mucus color and quantity are some of the precious clues our bodies give us to help figure out what might be going wrong with inside. Knowing all these important symptoms can prevent progression of many dangerous health conditions.
Valentine’s Day around the world. Red roses, chocolates, jewellery or perhaps a nice romantic, candlelit dinner for two? These are the things we usually treat our loved ones to in the Western World for Valentine’s Day. But what do the old romantics in other parts of the world do? Is Valentine’s Day even celebrated, and does it have the same meaning? Valentine’s Day started as a Christian celebration, in Rome, for one of a number of saints named Valentinus. It was only after Chaucer romanticised the day in a poem in 1382 that it became a celebration of romantic love. The Victorians popularised the day by mass producing Valentine’s Day cards and this soon spread across the Atlantic to the Americas. It grew into, what is today, the large industry of flowers, chocolates and cards, that we all know today. So what happens in other parts of the world? This website, which helps shoppers from all over the world with their cross-border shopping, decided to find out: Valentine's Day is known in Italy as “La Festa Degli Innamorati,” or holiday of lovers, Valentine’s Day is a day when the lovers of Italy display their affection for each other by attaching padlocks or “lucchetti” to bridges and railings and throwing away the key. Finland and Estonia Here the day is known as Friends Day in their respective languages and is a day for remembering friends and not just loved ones. China don’t celebrate Valentine’s Day as the western World do, instead they celebrate the so-called "Chinese Valentine's Day" at the time of the Qixi Festival, celebrated on the seventh day of the seventh month of the lunar calendar. On this day it is common for the man to give chocolates or roses to the one he loves. The spread of Western culture throughout India has meant that some do celebrate Valentine’s day, but historically they don’t have an equivalent day. Vasant Panchami which is a festival of Spring is celebrated in some parts at about the same time, with devotees taking a holy dip in a holy river. Another festival is Karwa Chauth, a one-day festival celebrated by Hindu women in North India in which married women fast from sunrise to moonrise for the safety and longevity of their husbands. There is no reciprocal arrangement for the husbands to fast! Israel have their equivalent which falls, usually, on the 15th August and is called Tu B’av. It is considered to be the best day for weddings, proposals, or romantic dates. Valentine’s Day was brought over to Japan by a chocolate company early in the 20th Century. But a misunderstanding has meant that it has become a day when women workers buy chocolates for their male colleagues. Men are encouraged to return the favour on 14th March, known as White day. In Japan, Christmas Eve is often the night for romantic dates. South Korea In South Korea things are similar to Japan, except the women give chocolate gifts to the men and on White Day, March 14th, the men return non-chocolate gifts to the women. Saudi Arabia The Muslim world do not celebrate Valentine’s Day and in some Muslim countries it is not condoned, because of the Christian connection. But that doesn’t stop many Muslims, who see it as harmless fun, from celebrating the day in private and expressing their love for one another. So many different parts of the world celebrate Valentine’s Day as a day of romance and love, even if some of the customs are different. And many of those countries who do not share the same day have their own day of celebration. “It is very romantic to know that many, many people from all over the world will be expressing their love to their loved one’s on the same day, whatever their culture or religion” said Nick Beeny founder of “In the run up to Valentine’s Day we have seen an large increase in visitors, from all over the world, to the website looking for gifts of love to send to their loved ones” Said Beeny. More about our advertising.
JCU Politics Class Witnesses Catalonia's Referendum PL 250 students and Professor Federigo Argentieri in Barcelona PL 250 students and Professor Federigo Argentieri in Barcelona A group of students from Professor Federigo Argentieri’s Western European Politics class (PL 250) visited Barcelona, the capital of the Catalonian region (or Catalunya) in Spain, to witness the October 1st independence referendum. The referendum, deemed illegal by the Spanish constitution of 1978, garnered negative reactions from the Spanish government, which banned the vote, thus raising international concern. Despite this, the Catalan government decided to move forward with the vote because of the ongoing dispute over the degree of autonomy to which it feels entitled. PL 250 students were able to appraise both sides of the issue by talking to many native Catalonians in the days leading up to the vote, as well as at the polling locations on Sunday. Independentists feel that Catalonia should go its own way because of its distinct history, culture, and identity. Those against it believe that the existing Spanish constitution safeguards Catalonian regional diversity in all domains and independence would be unnecessary and ruinous. The students also spoke with Carme Colomina and Josep Soler, two affiliates of The Barcelona Centre for International Affairs, who were able to provide background information on the referendum. They explained the domestic and international scope of the problem. On the domestic side, the failure to obtain greater autonomy through a reform of the Estatut d’Autonomia (the Autonomy Statute, the basic law of the region), also involving issues of excessive centralist taxation, led to a confrontational stance towards Madrid. On the international side, Mr. Soler, who worked many years at the European Commission, underscored the pro-independence movement’s biggest challenge: international recognition. On the evening of September 29th, the students attended a massive yet peaceful rally of those voting “SI” to witness the scope of the pro-independence movement. (Fiona O’ Doherty)
Mass Debt Forgiveness Is Not a Progressive Idea In 2011, when the Occupy Wall Street movement called the nation’s attention to the wealth-and-income gaps between the top 1 percent of the population and everyone else, activists began to promote the idea of forgiving student-loan debt. Those in the Occupy Student Debt campaign argued that all current education debt should be eliminated immediately. They asserted that policies such as limiting loan payments to an affordable share of income were “micro-cosmetic,” and that creditors needed to free debtors from their “bondage.” At the time, only a small minority of people subscribed to the idea, but recently it has gone mainstream, with Democratic presidential candidates Elizabeth Warren and Bernie Sanders proposing broad student-debt forgiveness policies. To help families cope with financial pressures during the Covid-19 crisis, the Democratic Party platform calls for up to $10,000 in student-debt relief per borrower. Longer-term provisions in the platform include forgiving all debt on undergraduate tuition loans for those who earn under $125,000 and who attended public institutions. That benefit would also apply to those who hold tuition debt from attending historically Black private colleges and universities. Democrats included a student-debt relief provision in their proposals for the Covid-19 rescue package. Ultimately, the Coronavirus Aid, Relief, and Economic Security Act of March 2020 suspended loan payments and waived interest for six months but did not include debt forgiveness. The payment waiver now extends to the end of the year. Proponents of large-scale erasure of education debt characterize the idea as progressive, in part because such a policy, which would benefit relatively affluent people, might be financed (as Bernie Sanders proposed) by people who are even better off. Truly progressive policies, though, provide disproportionate benefits to households in the lower reaches of the income distribution. They are designed to diminish the gaps between the haves and the have-nots. Senator Bernie Sanders backed loan forgiveness. The realities of student debt in our country make it clear that proposals to eliminate these obligations do not meet the criteria for progressive policies. Households in the upper half of the income distribution hold more student debt than those in the lower half. The highest-income quartile of households owes about one-third of that debt; the lowest-income quartile owes about 12 percent. People who don’t go to college don’t have student debt. They have lower incomes and more constrained job opportunities than others. There are some people who borrowed and either didn’t complete their programs or never saw the anticipated earnings payoffs to the credentials they did earn. These individuals make up a large share of the low-income adults who do hold student debt. The circumstances of these borrowers explain why the government has developed an income-driven repayment system for federal student loans. The system is far from perfect, but it does not require payments until a borrower’s income exceeds 150 percent of the poverty level and then generally requires payments equal to 10 percent of the borrower’s income beyond that level. Those whose incomes never support affordable repayment of their debts will see their remaining balances forgiven after 20 years (or 10 years for those with public-service jobs and 25 years for those with graduate school debt). Just 7 percent of borrowers owe more than $100,000 in student loans. This small share of borrowers owes more than one-third of the outstanding balances. Doctors and lawyers and MBAs have lots of debt, but they also tend to have high incomes. About 40 percent of federal student loans go to graduate students each year. There are strict limits on how much undergraduate students can borrow from the federal government—$31,000 total for those who are dependent on their parents and $57,500 for those who are older, married, or otherwise independent of their parents. Graduate students, though, can borrow virtually unlimited amounts. More than one-third of borrowers owe less than $10,000. They hold just 5 percent of the outstanding student debt. Many of them are the borrowers who struggle most to pay back their loans because their limited skills restrict their job opportunities. In short, forgiving all student debt would deliver a big windfall to a few people: those who can afford to pay. Virtually all of those with the largest debts have bachelor’s degrees, and most have advanced degrees. That is not a progressive policy. The CARES Act provided for one-time relief payments of up to $1,200 to individuals making no more than $99,000 annually. The idea of sending checks to everyone did not survive—there is an income limit. Maybe there should not be an income limit. Maybe the checks should be much bigger. But would anyone explicitly propose sending checks only to those who went to college? This would be shocking even absent the reality that highly educated workers are more likely than others to be able to work remotely. Many of the restaurant workers, taxi drivers, retail clerks, and maintenance staff who have lost their incomes did not go to college and do not have student loans. If they do have loans, they may well not have been required to make payments even before the implementation of the waiver and might eventually have their debts forgiven under existing policies. The call to relieve each borrower of up to $10,000 in debt would be akin to sending a check in that amount only to those with outstanding student loans. Quite a few people in addition to those who never went to college would be left out under such a policy: Borrowers who have just finished repaying their loans, for instance, and students who worked long hours to avoid borrowing. Imagine college classmates from similar families who borrowed similar amounts. Student A decided to work hard to pay off all his debt before following his dream to try to make it as a musician. Student B decided to travel around the world and postpone paying her loans. Now, under loan forgiveness, the taxpayers will repay Student B’s loans, but Student A, who paid back every dime on his own, will receive no such benefit. What about borrowers who put their student-loan payments on their credit card to avoid default? They’d be out of luck. What about those Americans who have debt from medical procedures? From utility bills? From payday loans? Or fines that accumulate when debts go unpaid? Aside from all of these inequities, one-time elimination of student debt makes little sense if future students will continue borrowing similar amounts. Some students might even feel encouraged to borrow more in the hope that those debts, too, will be forgiven. Many advocates hope that college will become tuition free, solving this problem. But the reality is that “free” college will not eliminate borrowing for college. Public colleges are already essentially tuition free for a large share of low-income students, because Pell Grants and state grants cover those charges—but many of those students still borrow to cover living expenses. In fact, students who pay no tuition graduate with almost as much debt as those who do pay tuition. We should forgive some student debt, such as that carried by students who borrowed for education that did not pay off or who were defrauded by their schools. We already have separate policies to deal with those issues—policies that should be simplified, improved, and carried out. Universal forgiveness would benefit many students from relatively affluent families who attended expensive private colleges. It would also be a gift to those who borrowed for graduate school. The Congressional Budget Office recently examined the potential cost of the existing income-driven repayment plans designed to protect borrowers from unaffordable debt payments. The study found that 20 percent of those in repayment are graduate borrowers. These borrowers owe half of the funds that are now in repayment. So, half of the benefit of forgiving that debt would go to people who went to graduate school. Wiping out the student debt of borrowers who took these loans to invest in themselves and who are reaping the benefits of their education is not a progressive policy. Most of these individuals will have increased earnings potential and a wide range of opportunities throughout their lives that would not otherwise have been available to them. The federal government is right to provide the loans that create these opportunities. Eliminating the federal student-loan program or restricting its ability to serve students who have not yet proven themselves would erode opportunities for upward mobility. The government should continue to offer student loans while ensuring that students can’t use those loans at very poorly performing institutions and that borrowers don’t have to make payments that would deprive them of the ability to meet basic needs. The economic crisis wrought by the pandemic has highlighted the sad reality that too many Americans were living on the edge even before the virus hit. Some of the people now facing the most serious struggles do have student debt, and they need a lot of support—not only so they can keep up with their education debt but also, more urgently, so they can pay rent, have enough to eat, and provide for their children. The majority of student debt, however, is owed by people who are in better circumstances than most Americans. Student-debt relief should be a targeted policy that is part of a truly progressive agenda—not a special-interest subsidy that disproportionately helps a segment of the relatively privileged. This is one half of the forum, “The Fallacy of Forgiveness.” For an alternate take, see, “Tailor Debt Relief to Those Who Need It Most,” by Beth Akers. The post Mass Debt Forgiveness Is Not a Progressive Idea appeared first on Education Next. By: Sandy Baum Title: Mass Debt Forgiveness Is Not a Progressive Idea Sourced From: Published Date: Tue, 20 Oct 2020 08:59:21 +0000 %d bloggers like this:
Blog Archives Technology has given people easy access to everyone’s lives. Fans are able to feel a part of their favorite celebrity’s everyday life by tracking their whereabouts. They feel up-to-date on what is happening in their lives. Thus, giving them a connection and a sense of closeness to celebrities. The ability to constantly know what is happening with celebrities—what they are wearing, where they are going, and what they are interested in—affects how society lives their lives. People feel the need to emulate their favorite star, so they imitate their clothes, accessories, and even attempt to attend the same type of places. Teenagers are the most common people trying to copy their idols. Celebrities have the easiest time influencing teens because they are so vulnerable. Teenagers are in search for self-esteem, their identity, and a “cool” self-image. All of these aspects of a teenager’s life are detrimental to who they will become. The power of the celebrity has taken control of these teens and ended with negative influences. A teen needs to satisfy his need for love, acceptance, and success in order to experience high self-esteem. He gains his self-esteem by pleasing his parents, peers, and society. This is a time in an adolescent’s life where they feel the most need for acceptance. This need for acceptance drives teens to be more experimental, innovative, and sometimes controversial. They are at a time in their life where they keep reinventing themselves. They may start out as a jock, then become a punk, then preppy, and so on and so forth. According to Teenager Research Unlimited, fun is the number one description for the teenage generation. Teenagers emphasize freedom, yet do not want to take on the responsibilities and obligations of adults. Fun links the teens to experimentation with illegal or illicit substances. Their ideas on life are more in the clouds than in reality. Teens are thinking, dreaming, and even planning a few years ahead. This, in turn, is making celebrities a few years older than them more desirable. Teens are fans of Miley Cyrus, who was caught on film smoking marijuana, Paris Hilton and Lindsay Lohan, who went to jail for drinking and drugs. Teens consider this to be okay, and do not let instances like this hinder their idols’ likeability. Read the rest of this entry
Typical elements I promised myself that I would make at least every second post a proper mathematical one, so here goes… In fact, I will break this topic up into sections, so there will be a continuation of this post. Note that some of the links open up pdf files. I am reading the proof of the ergodic theorem in the book Nonstandard Methods in Ramsey Theory and Combinatorial Number Theory by Mauro Di Nasso, Isaac Goldbring and Martino Lupini. Since the proof is clearly presented in the book and is freely available, I will not go into detail here. There is however one part of the proof which is not presented in the book – one assumes because it would take one too far afield. This concerns the existence of “typical elements”: Definition 1. Let ([0,1]^{\mathbb{N}}, \mathcal{C}, T, \nu) be a measure-preserving dynamical system, where \mathcal{C} is the Borel \sigma-algebra on [0,1]^{\mathbb{N}}, T is the unilateral shift operator and \nu is a T-invariant probability measure. An element \alpha of [0,1]^{\mathbb{N}} is called typical if, for any f \in C([0,1]^{\mathbb{N}}), \displaystyle \lim_{n\to \infty} \sum_{i=0}^{n-1} f(T^i \alpha ) = \int_{[0,1]^{\mathbb{N}}}f(y)d\nu. I have recently spent quite some time on ideas surrounding the concept of equidistribution, which is why I immediately found typical elements appealing. The idea that you can have a single element which can be used, via an ergodic average, to approximate the integral of any continuous function is perhaps not shocking, but pleasing nonetheless. My immediate reaction is to wonder what else we can say about these elements and collections of them. For instance, how many are there? How accessible are these elements in constructive terms? I have not yet explored these notions, but am eager to do so. Existence can be proved with the ergodic theorem, but more interesting to me is that it can also be done without. The proof I will present here is from the paper by Kamae (who came up with the nonstandard proof of the ergodic theorem), who in turn states that he found it in Ville. The proof relies on little but some basic measure theory. I will stick closely to the Kamae paper, but hopefully clear up some details. The key to the proof is to construct a sequence of periodic elements of [0,1]^{\mathbb{N}} which can be used to approximate the measure \nu. We say that \alpha = (\alpha_1, \alpha_2, \alpha_3, \dots) \in [0,1]^{\mathbb{N}} is periodic if there is some k such that \alpha_i = \alpha_{i+k} for all i\in \mathbb{N}. Given a periodic \alpha with period p, we construct a measure on [0,1]^{\mathbb{N}} by setting \displaystyle \mu_{\alpha} = \frac{1}{p}(\delta_{\alpha} + \delta_{T\alpha}+\dots +\delta_{T^{p-1}\alpha}), \delta_{\beta} as usual denoting the Dirac measure at \beta. We want to show that we can find a sequence of periodic elements such that the associated measures converge weakly to \nu. The idea of the proof is now to encode a cylinder set in [0,1]^{\mathbb{N}} as a finite Cartesian product of a finite alphabet, then find a measure on that product which is very close to \mu . The new measure will yield a kind of “maximal sequence” in the product, which we can use to construct our periodic element. But for now I am going to skip straight to the end and show how we can use such elements to get a typical one. In a follow-up post, we will get to the construction of the periodic elements, which is the real meat of the proof. Suppose now that we have a sequence \alpha_1, \alpha_2, \alpha_3, \dots of periodic elements, \alpha_i assumed to have period c_i, such that the associated measures \mu_{\alpha_i} converge weakly to \nu as i\to \infty. Since each of these elements is determined by a finite numbers of “bits”, we can get the full information of each one in a finite string. To get our typical element then, we might be tempted to stick the first c_{i+1} bits of string \alpha_i onto the end of the first c_i bits of string \alpha_i, but this will lead to convergence problems when we look at \int fd\nu again. Rather, we can think of the \mu_{\alpha_i} as increasingly good approximations to \nu, and so would want \alpha_i to play a greater role in \alpha than \alpha_j, when i>j. So we take the first c_1 t_1 elements of \alpha_1 to form the first c_1 t_1 element of \alpha, follow them with the first c_2 t_2 bits of \alpha_2 and so on, where t_1 < t_2 < t_3 < \cdots. We will also require that c_i t_i is sufficiently small with respect to c_{i+1}t_{i+1}. To be a little more formal about it, we set \displaystyle \alpha (n) = \alpha_m (n - T_m), for any n\in \mathbb{N}, with T_m \leq n <T_{m+1} and T_{m+1} = T_{m}+c_m t_m, with T_0 =0. In order to show that \alpha is indeed typical, it seems reasonable to write the sum in Definition 1 some form of integral in \mu_i. Given that f is a continuous function on a compact space, we know that the range is bounded and for convenience, positive. What we want then is something of the form \displaystyle \int f d\mu_{\alpha_n} \approx \frac{1}{m} \sum f(T^{i} \alpha) \to \int f d\nu. We can now see why it is necessary for the t_i to increase quickly. It is a useful exercise to write out the integral \int f d \mu_n as a sum according to the definition of a Lebesgue integral, to see that, for large m \displaystyle \int f d \mu_m \approx \frac{1}{c_m}\sum_{i=0}^{c_m -1} f(T^i \alpha_m). Due to the use of the periods of the \alpha_m in the construction of \alpha, we see that \displaystyle \frac{1}{t_m c_m} \sum_{i=0}^{t_m c_m -1} f(T^i \alpha) + \varepsilon , where \varepsilon indicates the error due to the terms f(T^i \alpha) for i=0,\dots ,c_m t_m -1. This can be made as small as we please by allowing the t_i to increase rapidly, which yields the result. Some of the fine detail has of course been left out here, but not, I think, anything that is too difficult to supply oneself. In a future post, I will discuss how we find \alpha using the measure \nu. Leave a Reply WordPress.com Logo Google photo Twitter picture Facebook photo Connecting to %s
The Grantecan finds the farthest black hole that belongs to a rare family of galaxies Black-hole-powered galaxies called blazars are extremely rare. As matter falls toward the supermassive black hole at the galaxy's center, some of it is accelerated outward at nearly the speed of light along jets pointed in opposite directions. When one of the jets happens to be aimed in the direction of Earth, as illustrated here, the galaxy appears especially bright and is classified as a blazar. Credit: M. Weiss/CfA An international team of astronomers has identified one of the rarest known classes of gamma-ray emitting galaxies, called BL Lacertae, within the first 2 billion years of the age of the Universe. The team, that has used one of the largest optical telescope in the world, Gran Telescopio Canarias (GTC), located at the Observatorio del Roque de los Muchachos (Garafía, La Palma), consists of researchers from the Universidad Complutense de Madrid (UCM, Spain), DESY (Germany), University of California Riverside and Clemson University (USA). Their finding is published in The Astrophysical Journal Letters. Only a small fraction of emits gamma rays, which are the most extreme form of light. Astronomers believe that these highly energetic photons originate from the vicinity of a supermassive black hole residing at the centers of these galaxies. When this happens, they are known as active galaxies. The black hole swallows matter from its surroundings and emits jets or, in other words, collimated streams of matter and radiation. Few of these active galaxies (less than 1%) have their jets pointing by chance toward Earth. Scientists call them blazars and are one of the most powerful sources of radiation in the universe. Blazars come in two flavors: BL Lacertae (BL Lac) and flat-spectrum radio-quasars (FSRQs). Our current understanding about these mysterious astronomical objects is that FSRQs are relatively young active galaxies, rich in dust and gas that surround the central black hole. As time passes, the amount of matter available to feed the black hole is consumed and the FSRQ evolves to become a BL Lac object. "In other words, BL Lacs may represent the elderly and evolved phase of a blazar's life, while FSRQs resemble an adult," explains Vaidehi Paliya, a DESY researcher who participated in this program. "Since the speed of light is limited, the farther we look, the earlier in the age of the Universe we investigate," says Alberto Domínguez of the Institute of Physics of Particles and the Cosmos (IPARCOS) at UCM and co-author of the study. Astronomers believe that the current age of the Universe is around 13.8 billion years. The most distant FSRQ was identified at a distance when the age of the was merely 1 billion years. For a comparison, the farthest BL Lac that is known was found when the age of the Universe was around 2.5 billion years. Therefore, the hypothesis of the evolution from FSRQ to BL Lacs appears to be valid. Now, the team of international scientists has discovered a new BL Lac object, named 4FGL J1219.0+3653, much farther away than the previous record holder. "We have discovered a BL Lac existing even 800 million years earlier, this is when the Universe was less than 2 billion years old," states Cristina Cabello, a graduate student at IPARCOS-UCM. "This finding challenges the current scenario that BL Lacs are actually an evolved phase of FSRQ," adds Nicolás Cardiel, a professor at IPARCOS-UCM. Jesús Gallego, also a professor at the same institution and a co-author of the study concludes: "This discovery has challenged our knowledge of the cosmic evolution of blazars and active galaxies in general." The researchers have used the OSIRIS and EMIR instruments, designed and built by the Instituto de Astrofísica de Canarias (IAC) and mounted on GTC, also known as Grantecan. "These results are a clear example of how the combination of the large collecting area of GTC, the world's largest optical-infrared telescope, together with the unique capabilities of complementary instruments installed in the telescope are providing breakthrough results to improve our understanding of the Universe," underlines Romano Corradi, director of Grantecan. Explore further Variability of blazar 3C 273 examined by astronomers More information: Vaidehi S. Paliya et al, The First Gamma-Ray Emitting BL Lacertae Object at the Cosmic Dawn, The Astrophysical Journal (2020). DOI: 10.3847/2041-8213/abbc06 Citation: The Grantecan finds the farthest black hole that belongs to a rare family of galaxies (2020, October 27) retrieved 5 August 2021 from https://phys.org/news/2020-10-grantecan-farthest-black-hole-rare.html Feedback to editors User comments
The UK could simultaneously negotiate four or five Free Trade Agreements (FTAs) after Brexit Nov 30, 2016 Negotiating a Free Trade Agreement (FTA) is a complex and highly technical task which usually takes a number of years to bring to fruition. The prospects of success will be greatly enhanced if certain basic “ground rules” are followed. A country must know what it wants from a deal, build domestic support for it, and have a well-resourced team of experienced negotiators to carry it through. FTAs, like other aspects of trade, are integrally linked to the domestic economies of the parties to the negotiation. Countries that are looking for an FTA to open up their internal markets, reduce regulation, and lower domestic subsidies will be able to negotiate expeditiously. However, if the objective is more defensive, aiming to increase reciprocal market access while maintaining some regulations that protect domestic industries then the negotiations are likely to be more protracted. The trade offs between market access and domestic protection will feature prominently in the forthcoming Brexit negotiations. No party will get everything it wants from an FTA so the first practical step is to set some key economic and political demands, and then determine what concessions you might be willing to make. This process requires extensive consultations with businesses, consumer groups, NGOs, and other parts of central and local government. Consultations are a resource-intensive and time-consuming process, but they are a critical early step ahead of FTA negotiations. The next step is to understand the other party’s flexibility and preparedness to “pay” for reciprocal concessions. This means gathering details on the tariffs and other trade barriers of the negotiating partner. A large proportion of this information will be revealed during the pre-negotiation consultation process. That is why the UK should be starting informal FTA discussions with non-EU countries now, as it will make the commencement of formal negotiations much easier after Brexit. The greatest challenge in this process is to determine how far a country is willing to concede on services. The majority of services are governed by domestic regulation. Each side will therefore need to carry out detailed analysis of opposing regulatory regimes, covering industries like telecommunications, tourism, banking, accounting, insurance, and law. This should ensure that any measures that hinder trade are identified and removed. Adopting a “negative list “approach, under which access is available unless otherwise specified, can help to simplify this process. Another reason why services tend to be more sensitive in FTA negotiations is because they involve the free movement of people. The WTO’s definition of services trade covers the ‘movement of natural persons’, meaning that professionals from each side should be allowed to provide a service to each other, either as an independent supplier (e.g., consultant), or as an employee of a service supplier. For developing countries, free movement of professionals has been a key demand and sticking point in multi-lateral and bi-lateral negotiations, particularly India, which has a strong services sector. Agreeing a deal on services is further complicated by regulations emanating from sub-national governments. There is a well-known tendency in federal systems for lower tiers of government to erect trade barriers that favour and protect local producers. It has already been noted that the UK lacks experienced trade negotiators to carry out all this necessary groundwork. British officials may have a good understanding of the non-tariff barriers that exist in OECD countries and what their key demands will be in a negotiation, but much less is known about developing countries. However, this capability deficit can be quickly mitigated: some highly-experienced UK trade negotiators currently work in the European Commission; a number of Whitehall officials possess the core skills to become trade negotiators (e.g. officials from the Government Economics Service); and officials from various UK regulatory authorities can be seconded to the negotiating teams, bringing with them their sector-specific expertise. The final team for a significant FTA negotiation might comprise around 15 to 20 full-time trade negotiators, supported by around a further 20 subject and sectoral experts covering issues such as agriculture, financial services, transport, professional services, customs procedures, anti-dumping, immigration, intellectual property, and dispute settlement. A clear negotiating mandate with one responsible minister having the authority to coordinate, prioritise, approve negotiating positions, and accept offers made is also critical to success. Trade negotiators cannot easily take back the commitments they have made, simply because the domestic political agenda has changed. A negotiating team of this size, with research and support staff, should be able to negotiate four or five FTAs simultaneously, provided that the negotiating schedule is managed sensibly. This requires a long-term commitment of staff and resources, because few comprehensive FTAs have been concluded in less than 3 years, and some have taken up to 10 years to complete (e.g. the Australia-China FTA). But the UK may be significantly quicker than this. The prioritizing of negotiating partners is also important. It will be best to start with a credible trading partner, where relatively few serious barriers already apply. In these cases, there would be realistic prospects of speedy and high-quality outcomes. Like it or not, the “model” established by early FTA’s is likely to become increasingly difficult to deviate from as “successes” accumulate. It is important the bar is set high, if the UK is serious about having genuinely liberalizing trading arrangements post-Brexit. Finally, a word of caution. FTA’s have rarely been used by business to the extent expected by the governments which negotiate them. Making certain that the transaction costs of utilizing the agreement are low, and that the substance of the FTA really matters to actual traders, is critical to avoid a great deal of wasted effort. When playing catch up with the rest of the world, this is even more so. Dr Geoff Raby Dr Geoff Raby Head of Trade Policy Read Full Bio Peter Grey Peter Grey Peter Grey is a former Australian Ambassador to WTO, Brussels and the EU and Japan. He is now a company director and adviser to business. Read Full Bio Latest Tweets
Context Clues Reinforce language and reading comprehension skills with a instructional activity focused on context clues. Scholars carefully read twelve sentences, use prior knowledge and sentence clues to define an unknown word. 152 Views 152 Downloads CCSS: Adaptable Instructional Ideas • Assign the worksheet as homework, during a small group rotation, or an exit ticket • Allow pupils to check their answers using a dictionary Classroom Considerations • Learners should have an understanding of context clues • Bold font separates the word in focus from the rest of the sentence • Offers clear and detailed directions • Provides limited space to write word definitions
Friday, 3 September 2010 A brief rant about waist-to-hip ratio This is a bit off topic, but it's a good illustration of William James' notion of the psychologist's fallacy and it addresses a pet peeve of mine. Evolutionary psychology is becoming more and more popular and the media is one of its biggest fans.One thing that annoys me is how quickly and uncritically people latch on to these stories and use them to justify the status quo. One of the most popular stories is that men prefer women with small waists and big hips. This is measured using the Waist to Hip Ratio (WHR). The WHR is the circumference of your waist divided by the circumference of your hips. The links below will tell you that men are irresistibly drawn to women with WHRs of .70. This number is apparently imbued with evolutionary significance because prepubescent girls have WHRs close to 1 (their waists are the same size as their hips), while post-pubescent girls have WHR less than 1 (waists smaller than hips); and also because low WHRs are associated with a good hormonal balance. One thing that makes this idea attractive is that it conforms to our modern, western experience - many women who are considered to be extremely attractive have low WHRs and it's difficult to generate examples of women who are famous for their beauty, but who have high WHRs. This evolutionary angle legitimizes our society's standard of attractiveness. We assume that everyone else basically shares our own preferences (the psychologist's fallacy), so, rather than this result simply telling us something about modern, western mens' judgments of attractiveness, there is the irrisitable pull to generalise this preference to ALL men. To give a sense of the way the popular media handle this topic, here are a couple recent stories about the WHR: 1 (this one includes exercise tips to help women appear to have a more ideal WHR ratio) 2, and 3 (this one also claims that "men's perfect lovers come with a waist-to-hip ratio of .70", implying, I suppose that WHR ratio influences how good you are in bed??). Science reporting is rarely subtle and these articles are no exception. They talk about "males", "females", "mate preference", and "evolutionary" indicators of fertility. This language suggests to the average reader that these results are universal. That they reflect the preferences of people in general. But, does the research behind the headlines support this universality? Evolutionary psychology, like most other branches of psychology, tends to lack cultural population validity. This problem is well-summarised in Henrich et al. (2010; see also here for interesting commentary on the original paper). The gist is that we can never take culture for granted in psychological research; there is no realm in which it is safe to assume that an effect is universal. The burden of any serious evolutionary psychology research program must be to establish the generality of their results across cultures. It doesn't matter how cool the evolutionary angle is - oh, look, this co-varies with fertility!!. It doesn't matter how obvious the effect seems to us. If male preference for women with low WHRs doesn't obtain across cultures then it's not universal. This isn't to say that there couldn't still be an evolutionary component to our preferences. It would be remarkable if there were not. But, genetic contributions to behaviour are complicated. So, failure to establish the generality of a preference for low WHR doesn't necessarily imply that men aren't sensitive to information that conveys fertility in potential partners. But, it does mean that there is not a universal reliance on this one particular type of information. It is quite likely that a whole lot of cues interact in a complex system of perceived attractiveness, to the extent that it doesn't make much sense to isolate one variable. So, anyway... What IS the evidence for a low WHR ratio preference across cultures? Well, it's actually quite muddled. Westman and Marlowe (1999) provide a pretty good intro to the evidence for the WHR preference, so I'd recommend their paper for a quick overview. They point out that the majority of studies on WHR rely on American undergraduates, although there is also evidence for a similar preference in Hispanic, British (although see below), and American-Indonesians. Some researchers (e.g., Singh, 1993) suggest that this preference is universal across cultures (p. 305). But, rather than jump straight into a statement of universality, Singh says something a bit more measured. He claims "the fact that WHR conveys such significant information about the mate value of a woman suggests that men in all societies should favor women with a lower WHR over women with a higher WHR for mate selection or at least find such women sexually attractive." That last bit is interesting. It merely suggests that men shouldn't find women with low WHR unattractive. This is a very different argument than the oft repeated universal preference for low WHR. Unfortunately, Singh's perfectly reasonable prediction has morphed into a presumption of universal preference for low WHR. This means that we hear little about evidence that contradicts this assumption. But, as it happens, there is quite a bit of evidence against this claim. Westman & Marlowe (1999) tested the effect of weight and WHR on perceived attractiveness, health, and suitability as a wife in the Hadza of Tansania. The men in that society showed no preference for women with low (.7) or high (.9) WHR, but they did show a distinct preference for heavier (cf. thin) women. Yu and Shepard (1998) also failed to find an effect of WHR on attractiveness among the Matsigenka. Swami et al (2007) looked at WHR preferences among males in Spain, Portugal, and the UK.In all three countries BMI, not WHR, accounted for the most variance in perceived attractiveness. WHR influenced attractiveness judgments for Spanish and Portugese, but not British men. However, even in the Spanish and Portugese samples WHR accounted for only about 18-19% of the variance, while BMI accounted for over 70% of the variance in perceived attractiveness. This paper also has a great summary of methodological issues with prior WHR studies (e.g., the use of two dimensional line drawing, failing to control for BMI). Cornelissen et al (2009) looked at patterns of British male gaze fixation during attractiveness judgments of pictures of women. Men tended to look at the upper abdomen and face, not the hip or pelvic area. The pattern of gaze fixations matched they way men evaluated the same pictures when estimating body fat, and did not match the way men evaluated WHR. Reading these papers suggests a lively debate in the literature about the universality of low WHR preference. I am not an expert in this area, and these examples don't even scratch the surface, but they do indicate lack of consensus on the generality of the low WHR preference. So, what does WHR even mean, evolutionarily speaking? Most people seem to argue that low WHR indicates a good balance of estrogen to other hormones, which is important for fertility. Fertility, undoubtedly, is essential to evolutionary fitness but 1) WHR isn't going to be the only cue to fertility and 2) there are other important characteristics that may account for more variance in reproductive success in some situations (e.g., if the vast majority of women in a certain age range are fertile). Cashdan (2008) looked at actual average WHRs in a variety of cultures, mostly non-Western. She found that the average WHR was > .80 (remember, .70 is supposedly the magic number). Cashdan pointed out that androgens and cortisol both increase abdominal fat in women (increasing WHR). But, higher levels of these hormones are also associated with increased strength and stamina, which come in handy in less than optimal circumstances. She says: "Waist-to-hip ratio may indeed be a useful signal to men, then, but whether men prefer a WHR associated with lower or higher androgen/estrogen ratios (or value them equally) should depend on the degree to which they want their mates to be strong, tough, economically successful, and politically competitive" (p. 1104). This suggests that it's possible to construct a perfectly reasonable evolutionary account for why men might prefer a high, rather than low, WHR (i.e., given a stressful environment where strength and stamina matter). The variables that dominate in a particular situation will likely depend on a number of specific environmental and cultural conditions. In other words, it's complicated. This story, unlike the one about low WHR preference, doesn't seem to reflect our (modern, western) experience, so it's less likely to catch the popular imagination. We don't tend to think of male attraction based on female heartiness, but we also live in a particularly rich culture where we don't spend a lot of time physically searching for / killing food or building shelters. So, here's the psychologist's fallacy again. Evolution is complicated and the features that confer fitness are necessarily dependent on context. This means that it's not too difficult to think of a number of plausible evolutionary explanations for a particular phenomena. The preferred explanations are most likely going to be the ones that fit with our current experience, but this doesn't make them better explanations. 1. Dixson (2009 - "Sexual Selection and the Origins of Human Mating Systems") wrote what I consider the authoritative chapter on human sexual dimorphism (ch 7: Human Sexual Dimorphism: Opposites Attract), in which he summarizes the research, including most the things you cite and rather a lot else, with particular attention to evidence from non-western, pre-literate cultures. I'm not an expert on this either, but he really and truly is. He says: " prefer female WHRs ranging from .67 to .8. Values within in [sic] this range are rated as more attractive and marriageable than are higher WHRs (.9-1.0). A WHR of .7 is not a universal preference, therefore, and we should not expect it to be so. Recall that, in Finland, health women of reproductive age have WHRs ranging from .67 to .8. It is reasonable to expect that sexual selection might have favored male preference within this range, and that the same might apply to different populations worldwide." I think the methodology has left a lot to be desired and I think mainstream media and a particular subset of evolutionary psychologists have done a piss poor job of talking about this phenomenon, using it to justify the "young, nubile, nulliparous women" line. But I also think it's a pretty robust finding. The popular understanding of it is clearly shallow and informed by cultural attitudes about gender rather than by the science, but that doesn't affect the overall validity of the finding per se. You'd like "Mother Nature" (Sarah Blaffer Hrdy). 2. Thanks, for the recommendation - I'd come across Dixson as well, but I couldn't get my hands on any of his articles before writing this. I'll check out that chapter. This is a complicated issue. On the one hand, there is a lot of evidence that, in judgment tasks, men from many societies rate pictures of women or (more commonly) simple line drawings of a female form as more attractive when they fall into this range. But, then you also have evidence using similar items (and sometimes using better items, i.e., pictures of real women) that show no effect of WHR when BMI is properly controlled for. In other words, the evidence is mixed. Also, has anyone actually looked at how this preference in dumb judgement tasks related to actual behavour? Do women with low WHR marry more frequently / have more children than women with higher WHRs? It is essential to establish this or the evolutionary angle is dead in the water. We know that many, many men show a preference for low WHR, but many men do not. It may be that most men show this preference. And that's fine. But it seems like shaky ground for building a simple explanation based on evolution. My problem is with the notion that "it is reasonable to expect that sexual selection might have favoured a preference in this range." Yes, it is reasonable to expect something like this. But, it is tremendously easy to construct these evolutionary just so stories. And, we should have a really, really, high bar for invoking evolution to explain behavioural effects. The fact that there is not, in fact, a universal preference for low WHR suggests that, whatever the actual genetic basis for the preference when it is expressed, it's not a simple story. Think about all the press about "the bonding hormone" that's been around lately. What was once a simple story about how having more oxytocin made you more committed to relationships (simple linear story) is now a complicated story involving interactions between genetics and cultural context (see an interaction between hormone expression and Western and Eastern social norms). So, to me, telling the simple linear evolutionary story about WHR preference mis-represents the evidence b/c it implies universality. I'd be interested to hear a more nuanced evolutionary explanation that places this preference in the context of a network of competing / complementary preferences. 3. The biggest problem with this kind of garbage study is that it asks men what their perfect lovers are, not the ones they actually had. This has two difficulties: one that men will inflate their fantasies, and two that most of these studies are carried out on college kids who have had maybe one bed partner in their lives no matter how much they brag otherwise. Asking is not the way to do research, is it? What needs to be done is to get men in their 70s and ask them not what they fantasize having, but what they actually had. Let's face it, there's an awful lot of stumpy-legged, hairy-lipped, thick -aisted women running around. Fess up guys, someone's spreading those genes. Could you imagine doing any other research like this? Dietary research? Ask people what they eat, surely that will be accurate enough ... ! 4. BMI was developed as a population heuristic. At its inception, Quetelet (the 19th century mathematician who invented it) was explicit in stating that it's useless at the individual level. Thus, we're compelled to strongly question the methodology of research that relies on BMI at the individual level more than a century and a half later. Also see Dixson et al (2010) on preferences in Papua New Guinea, (2010) on New Zealand vs. U.S, (2007) on Cameroon, and (2007) on China. Rilling et al (2009) [PDF] also present a refined hypothesis based on multi-viewer-perspective 3-D models vs. the usual line drawings. Another interesting finding is that of Karremans et al (2010) in a paper called 'Blind men prefer a low waist-to-hip ratio [PDF].' @Janis "The biggest problem with this kind of garbage study is that it asks men what their perfect lovers are, not the ones they actually had." The biggest problem with this criticism is that it assumes all men are capable of "having" any woman they desire. Of course that isn't the case. Do you suggest a study in which men are allowed to "have" a woman from a range of WHRs to control for this? 5. @Janis & @Andrew - Yes, the failures in validity abound. The entire notion of preference is problematic here since any evolutionary explanation must account for actual behaviour. The blind men study is a weird one. It would make sense for an evolutionary bias towards low WHR's to manifest at the level of the visual system because the advantage to men is knowing who is a fit mate before hopping in the sack. So, it might be a stretch to expect such a bias to carry over into another modality. To the extent that it does show up in blind men, one might interpret the preference as cultural, rather than anything else (it's not as if blind men are not enculturated to have particular ideals of beauty, even though those ideals are not visual). Also, there is evidence that blind people actually have poor senses of touch (because a lot of our sense of touch works in concert with constant visual information). The common belief that blind people have extra sensitive senses of touch seems to stem from the ability to read braille (which is certainly impressive). But, this skill can be explained through practice and training, rather than enhanced sensitivity. This might suggest that blind men would actually have a preference for an exaggerated WHR (if there was a real preference for low WHR in the population) as a greater threshold would be required to detect a difference. Now, I don't think these are necessarily the correct interpretations of these effects, but it just shows that there are some problems of interpretation going on here. Basically, I'm just throwing around ideas. 6. Male Female Health Risk Based Solely on WHR 0.95 or below 0.80 or below Low Risk 0.96 to 1.0 0.81 to 0.85 Moderate Risk 1.0+ 0.85+ High Risk 7. I agree that jumping to conclusions is (always) an issue. But is your summary merely that although there is (quite a lot of) evidence that men prefer a (low) WHR this has not (yet?) been proven to be universal? There is also evidence that women prefer a lower waist-to-chest WCR ratio in men, it may not be universal (I have no idea) but it doesn't stop it being a useful marker for fitness or beauty. I may not like it _personally_ as perhaps my WCR doesn't line up with the ideal, but I'm willing to accept the evolutionary fitness explanation until a better explanation comes along. Your comment on the blind study doesn't make sense. It doesn't matter if the blind people are overcompensating, under-compensating, idealizing or dreaming. It's still a finding. That paper seems pretty solid in saying that men prefer lower WHRs. Scientifically it doesn't matter for _that_ study _why_ this is the case, but it is definitely interesting that blind men tend in the same WHR direction as more culturally (presumably) sensitized non-visually impaired people. Saying that it doesn't cross modalities is silly, really. Most sexual and physical fitness markers are cross-modal (smell, skin texture, voice timbre, ease of movement, etc). Imagine for a moment that the "universal" WHR is spread over a bell-curve centered around .70. Understanding why deviations around that mean occur would be interesting (for example it could be that some populations have greater SDs around the mean than others and that would in iteself be important to study) but ignoring the fact that there _is_ a mean value is side-stepping the science, not negating it. I'm sorry you don't seem to like the finding and perhaps neither do I, but that doesn't make the science _wrong so far_. Better explanations are always possible. 8. Read: "Who's afraid of Charles Darwin?" On feminism and evolutionary theory, author: Griet Vandermassen. 9. In premodern Japan the ideal feminine body was a cylinder - there are bumpers and pads in the traditional kimono to make the silhouette completely flat all around. So anyway... 10. RE: Japan OTOH desexualisation of women through mode of dress in strongly patriarchal societies isn't exactly unprecedented. See also: Burqa. 11. Andrew Badenoch of Evolvify posted an interesting article on this topic: "As a white, heterosexual, male, I am part of a group that represents a scant 1.47% of the human population that is supposed to prefer “big butts” marginally less. I submit that any supposed difference in this regard is a cultural influence that may correlate to race (because cultural influences often correlate to race), but is ultimately an exaggeration of a shared human nature. Further, I proffer that my preference for “abs” over “butt” (and/or “breasts”) is closer to the instinctual default." Well, first of all, several studies dis-confirm a universal WHR preference. It's not a matter of time until universality is established - we already have evidence that some groups do not show the preference or show a different preference. Second, one of the missing links (heh) in the evo psych argument here is that preference translates into successful procreation. Does the fact that you are attracted to women with a particular body type mean that you are more likely to end up having kids with someone of that body type? The first variable to consider is how likely we are to be able to pair up with someone who has an "ideal" body type. Today, we have quite a bit of choice in potential partners. There are a lot of people in the world and moving to different cities and countries is relatively easy compared to thousands of years ago. So, maybe these days we can be picky and "shop around" for someone we like and who meets some version of our preferred body type. But think about the situation thousands of years ago when humans weren't that common and lived in much smaller groups. To what extent would men have been able to pair up with someone according to their preferences for a low WHR? I would guess that some men would be able to act on this preference, but the others would end up with whoever was left (to my knowledge it is rare that women in this type of small scale society end up unpaired). The second variable is how much more likely is a man to have kids if he pairs up with a low WHR woman than a high WHR woman? In other words, assuming that preference leads to sex, how much have you increased your chances of successful reproduction by pairing with someone with a .7 WHR compared to someone with, say, a .8 WHR? I reported some evidence about the relationship between WHR and hormone balance, but this relationship does not in and of itself equate to increased fertility (which is a ridiculously complicated issue). If having sex with someone with an "ideal" WHR ratio doesn't lead to better reproductive outcomes, then an evolutionary argument doesn't make any sense. Of course, this will be a very difficult relationship to untangle since we can't exactly perform experiments to test the effect of WHR on reproductive success. It may be the case that there is a reproductive advantage, but the evidence isn't there yet. Until it is, it is irresponsible to make strong claims about WHR and evolutionary advantage. 13. Oy Vey. I think we may all be talking at cross-purposes, or at least confusing each other. By universal principle I (and I hope any person who calls themselves a scientist) doesn't take that to mean every possible instance. By universal, I mean a universal statement like "gravity makes water run downhill". The fact that it can be shown that in specific circumstances (e.g. superfluid helium) this is not true, does not make it less of a generalized 'lesson' about how most liquids behave. So far it seems that men _IN GENERAL_ and _AFTER_ smoothing out outliers and (relatively) short-lived fashions prefer (not require, insist on or get) a WHR of 0.7. Is the argument against universality because there is a Mr. Botham in Borneo who's into BBW and likes plump women with a WHR of 2.1? (ie that there are outliers?) OR is the argument against universality because you believe there is no bell curve with a mean of 0.7 at all? (ie there the mean is irrelevant?) There's no such thing as the average person, but people do have two arms on average. 14. Of course all laws have scope. Since I'm not a physicist I don't know the specific scope of the law of gravity, but, sure, if you observe something outside the scope of the law then you shouldn't expect it to conform to the law's predictions. This is entirely different than within population variability ("there's no such thing as the average person"). If you're dealing with a law then there is no variability in conforming to the law within its scope (i.e., an object will move through space according to the law of gravity 100% of the time if the object is observed within the scope of the law) . If there is such variability, then you don't have a law. Now, let's face it, in psychology we're not dealing with laws, but we might have more or less stable or predictable behavioural biases. Within-group variability in WHR preference doesn't hurt the argument that for the most part men prefer women with low WHR. That's just normal, within-group variation. But, this is not the type of evidence I cite that casts doubt on the universality claim. If the evidence shows systematic differences in preference related to other measurable factors (e.g., BMI, food scarcity) then you are no longer allowed to talk about average preferences, because preference is mediated or moderated by other factors. Continuing to act as if there is a single population with normally distributed variability is incorrect both mathematically and conceptually. 15. Sabrina: That's well said and I now at least understand why you disagree. I think your argument can be used the other way round: the fact that the measure is subject to differences caused by other factors is _more_ reason to talk about an average. It might be meaningless to you in one context, but very meaningful to someone else in another. Think about family size. In the US the average family size is circa 2.6 people per home, in India it is approximately 4.8 people per home. There's a big variability due to lots of factors: food scarcity, culture, wealth, education, access to contraception. Those average numbers matter even though they are averages and codependent with other factors. The averages inform policy, provide evidence of underlying problems (daughter/son ratio for instance), help determine spend and social planning. Also they provide a feedback mechanism of cultural norms (rightly or wrongly). I am unlikely to have 2.6 people in my family, but the number matters nonetheless. Continuing the analogy of family size and WHR If you look at somewhere like Europe, the birth rates and family sizes tend to converge around an average (the deviations reduce) over time as countries converge their norms and share living standards, culture and so on. I don't have a link to historical data but if you are interested have a look at An average WHR _within_ a society (or societal groups like "nations in Europe", or "english-speaking-countries") matters because it has 'descriptive power' assuming no huge variations in other factors. I understand your underlying point that the average is often mis-used and over-stated as a 'norm' or producing a 'finding' when in fact it does nothing of the sort, especially when talking about society and culture (to paraphrase "Culture is what you can get away with"). But that's not the same as saying that it's not useful to know what the is. That there are variations of samples gives us _more_ reasons to think in averages and distributions, not fewer reasons. I think our discussion can be boiled-down to: * Men report _their_ WHR ratios in women * When averaged the WHR ratios tend to 0.7 * Sloppy media reports this as an "ideal" WHR or worse calls this a "universal ideal" * In fact there are clusters around different WHR means for different societies and groups Thanks for the exchange. 16. I like your family size example and I agree that it would be equally informative to report within-culture averages for WHR. And, yes, if the media could possibly show some nuance in reporting this, that would be even better! 17. What annoys me is how WHR is touted as an indicator of health or fertility. What a joke! I have a straight up and down body, meaning that there isn't much of a difference between my waste & hips. I am a healthy weight, and the only way to make my waist smaller would be to literally have my ribs removed! LOL! And guess what? When my bf & I decided to get pregnant, about 2 weeks after going off the pill and trying about 4 times, I was officially knocked up. So much for evo-psych bullocks. 18. I am a woman and I have a WHR of .70. Whenever I wear clothing that accentuates my WHR, straight men pay attention to me - favorably. I get flirted with, complimented, touched, receive favors, asked out, etc. much more often than when I wear bagging or loose-fitting clothes that hides my WHR. I find this behavior to men to be true no matter what country I am in, or from what culture/subculture those men come from. This is not to say that women with a lower or higher WHR cannot or are not considered attractive by men. This is not to say that the same men who find women with WHR of .7 to be attractive will not also find women with a WHR of .8 or a WHR of .6 to be attractive. This is not even to say that men who find a woman with a WHR of .7 and a so-so face attractive will not find a woman with a WHR of .85 with a GORGEOUS face more attractive. WHR is by no means the ONLY measure of attractiveness in a woman. Compounded with the (many) other factors that indicate attractiveness and health, WHR may be only a small percentage of why or what a man finds attractive about a particular woman. However, it IS ONE factor that tends be attractive for men, and I feel it is intellectually disingenuous to write it off simply because we may not like it. Also, consider that FIRST we had biology; THEN we had culture. Culture is derived from our biological preferences. We are materialistic driven culture, because acquiring resources is hard-wired in humans and in ALL organisms. Acquiring resources improves chances of survival AND of reproductive success, and the survival of our offspring. Of course, we are not biologically hardwired to like iPhones, per se, but iphones are a resource, and we are hardwired to seek having more resources as opposed to less. As others stated, this seems to be general rule of thumb. Of course there are outliers. Traits that lend themselves to survival or reproductive success affect gene pools and populations NOT individuals. 19. Sometimes scientists need to put down the studies and go outside. The author is indeed right on every assumption she made, but it's besides the point. Perhaps there is no "Universal" golden standard, and yes there are many strange examples of idealized female form throughout history, but realistically speaking, an overwhelming majority of men like a .7WHR, so women should try and fit themselves into that ideal. It's the productive win-win solution. Yes there are men who don't prefer .7, but using them to derail the main observation is just an exercise in avoiding reality. Here's an idea - men who prefer a whr over .7 aren't attractive enough to get the .7 girls - so they settle for the higher WHR women and develop enough positive reinforcement with that type that it is their new favorite. Of course that works out for both parties, but please don't try and tell women the .7 whr is not something worth striving for because you're doing them (and men) a great disservice. 20. Very simplistic hypotheses on display regarding WHR preferences of human males. One alternative is that the human visual system has in-built mechanisms for detecting sexually-relevamt stimuli. A low WHR could function as a supernormal stimulus, whereas higher WHRs might cause the same activation with lower intensity. Thus, low WHR is more optimal for discriminating humans who are sexually relevant for typical males. This would result in low WHR preferences in males when controlling for other factors without lower WHR signalling higher fitness within females. Human mate selection is complex. Males select mates for multiple different reasons that would likely have different criteria. I've seen it somewhere that females display significant fluidity in the manner in which they discriminate suitable mates when compared to males, particularly regarding physical appearance. I would suggest that a 'similar minds fallacy' is often operating in these conversations, wherein people interpret research by judging how well it applies to themselves and their experiences. If I am correct in that, the remedy would be the introduction of better statistical reasoning and abstraction, so that subjective, motivated interpretation is less pronounced. Universality in human psychology is often a relative term in evo-psych, as things that are completely universal are simply not interesting for most humans to read about (oh, humans are afraid of dying? Oh, humans have no tails?). People care a lot about sex and sexuality, and want to find out more about it that is relevant to them, so newspapers print stuff that's emotionally relevant to most people, which necessarily means losing nuance that feels irrelevant to the average reader.
Wearable Ethics We’d like to talk for a moment about an ethical dimension of cyborgs. Not the one of identity and hybridity that’s been touched on so well already in this series, nor the one of military-industrialization, but the ethical dimension of the specific aims of the first paper, which was developing ways to adapt the organism, rather than adapting the environment. Kline and Clynes were quite specific on this point. The environment with which man is now concerned is that of space. Biologically, what are the changes necessary to allow man to live adequately in the space environment? Artificial atmospheres encapsulated in some sort of enclosure constitute only temporizing, and dangerous temporizing at that, since we place ourselves in the same position as a fish taking a small quantity of water along with him to live on land. The bubble all too easily bursts. So we get cyborgs, robust self-sufficient entities that have been rebuilt and rewired to survive natively in whatever environment, or environments. Suddenly everywhere you’ve been spec’d for is comfortable. You can hang out, out there, without changing the environment. This is extraordinary, because changing the environment is what we do. The Night Lights of Planet Earth As we are learning to our growing horror, changing the environment is an activity that becomes extremely perilous at scale. In light of this, the cyborgian program of self-adaptation begins to look mighty virtuous. You can imagine these herds of perfectly adapted technomads, leaving only footprints, taking only HD video streams. They pick their way over the environment, leaving it essentially untouched for the native species to flourish in peace. Why build roadways, if we can make legs that are faster than any car and decidedly more all-terrain? Why raze forests and construct shelter if we can just dial ourselves for “enjoying being pleasantly rained upon”? Cyborgs are a child of the space program and it’s fitting to that, to some degree, environmentalism is as well. The early pictures of the planet taken by the Apollo astronauts are often credited with being catalysts for their depictions of the fragility and smallness of our home. Stewart Brand Photography Changes Our Relationship To Our Planet Apollo 8 Earthrise Mary Mattingly’s “Wearable Homes” is a project — part architecture, part photography, part design fiction, part clothing (fashion is not quite the right word here) — which sits at that confused junction between cyborgs and architecture. Mattingly imagines and photographs a future where ““civilization has shattered and nomadic ‘navigators’ roam the landscape”, providing some very detailed specifications to back it up. The fabric used is is an outerlayer combination of Kaiok, a phase change material like Outlast® Adaptive Comfort®, waterproof Cordura, Solarweave UV protectant fabric, and the inner muslin layer. The fabric has the ability to keep the body at a comfortable temperature no matter the weather. The encapsulated warmers (like those found in electric blankets) are also woven into the innermost layer of the home, and through sensors, are adjusted to your bodies temperature and keep the home warm or cool on the inside to counteract the outside. The electronic silver threads in the fabric connecting to the sensors (one at the wrist and one at the ear for the healthy person) will give the wearers the ability to monitor themselves, their health and introspectively study themselves, as well as monitor the outdoor conditions, and transmit information to another, currently through a ZigBee connection or secure nodal random key coding and patterning frequency that can be set up to directly interface with another person’s home and information. This infrastructure will be able to receive signals from satellite and aid in GPS, mapping VA goggles, cel-sat and Internet. Mary Mattingly Wearable Homes Wearable Homes by Mary Mattingly The images are haunting, depicting a people whose architecture has literally collapsed around and onto them, as they port on their bodies technologies for temperature regulation, water purification, generating electricity, providing shelter and — perhaps most fascinatingly — staying connected with the planet-wide network of GPS signals and data transmissions which Mattingly envisions surviving even the near-total collapse of civilization. (This point is particularly fascinating because it presents such a strong contrast to typical collapse fantasies, which are often rooted in neo-Ludditism and consequently imagine that digital networks will be the first element civilization shrugs off as it dies, not the last fragment still burning.) It takes only a small twist from Mattingly’s high art response to tragic collapse to end up at The Yes Men’s SurvivaBall a technology borne of similar impulses and dark satire. But where Mattingly’s work is beautiful and melancholy, SurvivaBalls are absurd tick-like things with a dedicated marketing department. “While others look to Senate bills or UN accords for a solution to global warming, you demand peace of mind, now.” Wearable Home and SurvivaBall’s response to crisis and imminent collapse lay bare the problem with a self-sufficient response to massively global problems. It is in effect a denial of any collective responsibility at all. We learn that the Wearable Homes’ Nomad Navigators may “decide to make a home separate from others — when the tides rise, the islands usually survive.” And as to the target market of SurvivaBall, far from gentle technomads, we get plunderers and pillagers, freed to exploit the environment as the mood suits, knowing that they are insulated from the consequences. Or as least telling themselves that they are as they bounce around in their bulky, damage-prone bubbles, all too easily burst.
The Droid Racing Challenge recently hosted by QUT Robotics Club was an event designed to inspire students and general public alike about the potential of robotic vision. Results and winners were announced with a selection of media from the event in the Droid Racing Challenge Wrap-up. This article is a companion piece highlighting the technical challenges associated with building a racing droid. There are are a few core systems required to make a successful droid – mechanical systems for driving, sensor systems for data acquisition, and processors for using that data to make navigation decisions. The entire system had to come in at a total value of less than $1500. This placed hard limits on what parts could be used, and along with time limitations and other rules, caused a convergence of mechanical design among the teams. Every team present at the challenge this year chose to purchase and adapt the chassis from a remote control car. These are readily available, cheap, mechanically robust, and save the time of having to design a new chassis. Most have plenty of room for mounting extra components, and come with motors, suspension, batteries, motor controllers etc. – they are a great choice for a competition like this. They also have the added advantage of a radio control system, which can be adapted for the required wireless start/stop mechanism. All the droids at the challenge used a modified chassis from a hobby remote controlled car. Customisations included swapping out different motor drivers and wireless transceivers, to better work with the other electrical equipment used by the teams. Data acquisition for robotic vision uses a camera. The camera and processor cannot be chosen independently; the type of camera that should be used is highly dependent on what type of processing you plan to do and the processor you plan to do it on. There were three variants of camera+processor used in this years challenge – wide angle Raspberry Pi cameras with Raspberry Pi 3B computers (QUT), webcams with Raspberry Pi 2B or 3B computers (QUT, UQ, and UNSW), and a Stereolabs ZED Stereo Camera combined with an Nvidia Jetson TX1 developer kit (Griffith). The Raspberry Pi and it’s software ecosystem are familiar to most electrical and mechatronics engineering students, and it is a very popular platform among hobbyists as well. Raspberry Pi computers are cheap at around $50 AUD, small (“credit-card sized”) so they can be easily mounted to a droid, and very well supported with software and programming languages/libraries. The Raspberry Pi camera module has a five megapixel camera that supports 1080p30, 720p60 and VGA90 video modes. QUT teams used a special version with a wide angle lens to capture more of the track. The camera sensor is not very high quality, but it is cheap at around $25 – $30 AUD. Webcams are also supported through the USB interface, so higher quality and resolution cameras can be used (albeit at a lower frame rate). Each of the QUT droid builds came in way under the budget limit because of our use of Raspberry Pi computers and cameras. The Raspberry Pi has enough processing power to do some image processing tasks (robotic vision). However, this is the downside of the platform; even the low-spec Raspberry Pi cameras had frame rates and resolutions far beyond what the computer was capable of processing. They were chosen mostly because of cost, ease of use and the teams’ prior familiarity with the platform, not because they are the best choice for robotic vision. Teams had to design very efficient algorithms, as the main constraint on performance was the processing power of the Raspberry Pi. The team from Griffith used a much more capable camera+processor combo, the ZED Stereo Camera and Jetson TX1, which were specifically designed for robotic vision applications. We’ve never used this platform, but were impressed to see it. Unfortunately, Griffith’s droid was plagued by mechanical and other issues so we never got to see what difference this would have made to their performance at the challenge. It seems to us that this system is a far better choice for robotic vision, but availability and familiarity are problematic. The camera and processor combined also used the majority of Griffith’s budget, with the total build only just under the limit. From our point of view, this system definitely warrants some investigation for next year’s challenge. With parts selection done, the main aspect of the challenge was the vision software system, which needed to use software algorithms to process images and video to gain meaningful information. In this case, the droids are looking for coloured lines on the ground (the track), coloured boxes on the track, and other droids. During testing we found that due to time constraints and other issues relating to the fact that this is the first time running the event, most teams could not avoid obstacles or other droids well. These requirements were dropped so that the challenge could go ahead. OpenCV is a popular library for computer vision. It becomes robotic vision when the droid acts on the results of image analysis done by the vision system, by navigating around the track. The QUT teams used OpenCV to detect the track lines, and navigation algorithms to stay between them while going around the track. Using the Python programming language and OpenCV, a system can be setup that grabs frames from the camera for analysis as it is videoing. The image below shows an example raw image from the camera: Raw camera image. Note the distortion near the edges due to the wide angle lens. There are several different algorithms that can be used to identify lines. Two QUT teams used colour thresholding techniques, where an image is filtered for a specific colour. The other team, which I was part of, used edge detection techniques to find where contrast between pixels was high, indicating and edge. Below is a breakdown of steps for the edge detection algorithm which picks out the track lines. The first step was to downscale and crop the image down to the region of interest; this reduces the resolution of the image, drastically improves processing time, and removes the droid itself and objects above the horizon from the image. The cropped image. Next, the image is converted to chromaticity coordinates. This makes the intensity of each colour in a pixel relative to the total intensity of the pixel, removing some of the effect of brightness. Chromaticity coordinates – notice how the yellow stands out, but the blue is hard to see because is was glary in the previous image. In order to boost contrast and improve edge detection, we then squared the values of each pixel and divided by the maximum possible pixel value. This decreases overall image intensity, but increases contrast between pixels. See below: Contrast boosted chromaticity. The yellow line hasn’t changed as much as the rest of the image. The blue is still difficult to make out. The next step is to run the edge detection algorithm. This is available as part of the OpenCV library, but needs to be calibrated. After some experimentation, we were able to get an image like this: Edge of the track lines. The edge detection algorithm has been calibrated to detect the edges of the tape which marks the track. You can see in the above algorithm that the output correlates remarkably well with the track lines – even with the glare on the blue line, it is still picked up. The yellow line is found perfectly, and there is very little noise. This was tested on a series of test images, and we decided that we needed to do some further noise reduction because not all results were this clean – sometimes gaps between pavers were found as well. To do this, we dilated the image until the edges of the track lines merged into a single line, then eroded the image back down until the lines were thin again. Any other “noise” edges that were found in the image should then be eroded entirely, because they would not have a matching edge nearby to merge with. This can be seen in the images below: Merged edges into a single line after dilation. First round of erosion – this is about the same as the original width of the track line. Second round of erosion – almost all noise is removed. Here is a better example of noise reduction: Final image after erosion You can see in the series of images above, the edge detection picks up a number of edges that we are not interested in. Through the process described above we can remove those lines so that in the final image there is almost no noise and the track lines are clear. From here the navigation system takes over and we have a few different options. You can measure the angles of the lines, and use this to come up with a target angle for steering. You could also just find the centre point between the lines and steer towards that. More advanced methods could improve navigation, but unfortunately we didn’t get to implement anything else and for reasons probably to do with calibration and variable brightness and glare out on the track, our algorithm didn’t perform well on the day. The frame rate for the above algorithm was also very low on the Raspberry Pi, around 3-4 fps, so the speed of the droid would have to be very slow for the vision system to keep up. Here is our droid: Lindsay Watt (left), Lachlan Robinson (right) and our droid. The winning team, UNSW, used edge detection methods as well, but obviously better calibrated than ours and with more advanced navigation. Their droid was quite slow around the track, about the same speed that ours would have to have been. They did a great job developing an algorithm that reliably detected the track lines and navigated through them. It is also worth noting that they came prepared to avoid obstacles as well! There are a few things that none of the teams were prepared for. One of these was the glare on the track and the tape that marked the lines – the tape was matte finish but could still have significant glare from the droid’s perspective. This made it difficult to pick up lines sometimes. Teams improvised by using UV camera filters or polarised lenses from sunglasses, but this brings up a larger point: the better data you have at the start, the easier it is to process. Next time teams should think about filters, lenses, optics, and other camera settings like white balance and exposure more because the right camera setup will make the software task a lot easier. The variable brightness and angle of the sun throughout the day made it difficult, but this was meant to be part of the challenge. We used chromaticity coordinates to overcome this. However, the blue line was still harder to detect than the yellow line, and our use of edge detection meant that we weren’t distinguishing the lines by colour, rather by angle or merely which side of the image they were found on. The colours could be used in combination with edge detection for robustness, but consideration should be put towards whether different colours are necessary and what colours should be used. Finally, as is always the case with these sorts of competitions, every single team needed to do much more testing beforehand. Testing outdoors, with similar tape, in conditions like those found on the day, is crucial for a positive result. Future events will hopefully have a bit more lead time, and with the experience the teams gained this year, I’m confident we’ll see some more great droids next time. Thanks to Lindsay Watt who did the majority of the work on the droid while I was organising the event and agreed to share our secret methods in this article :) One reply on “How to make an autonomous vehicle – the 2016 Droid Racing Challenge” Comments are closed.
Monday, August 24, 2020 Synchronicity is Not a Coincidence (It's Evidence of the Unseen) A lot of people have an idea of what the term "Synchronicity" means in popular use, but in a lot of cases they confuse it with the simple fact that sometimes all of us experience extraordinary, timely coincidences. Accidents, that seem as though they were by design. But synchronicity really removes the accident from the accidental nature of those ‘random’ phenomena, and while it can manifest itself as coincidence, that’s only the visible tip of a vast, hidden synchronicitous iceberg. To better illustrate the nature of this distinction, let me call upon two other simple metaphors: electricity, and eating. We all have faith in the practical applications of electricity, right? You know the light will turn on when you flip the switch (unless one of those "never needs replacing" light bulbs needs replacing), but sometimes, the light goes on or off at a very particular moment without you flipping the switch. Or in its grander form, a bolt of lightening strikes a tree on your family property. Those are what you may call 'electrical coincidences.' Synchronicity, in this case, has more to do with a very practical yet deeply mysterious lifelong relationship to natural phenomena of all kinds. For example, if a bolt of lightening strikes your grandfather's favorite tree on the day of his death – that's synchronicity. One aspect appears to be connected to the other, but there’s no provable material cause for it, aside from an obvious spiritual cause. Or say you're getting hungry around lunchtime, and for some unusual reason you've been craving oysters. Just then, a co-worker starts talking about the great oysters he had last night. That's coincidental. But if your girlfriend gives you a surprise call to meet her at the oyster bar for lunch, and then tells you how much she loves you – well, that's synchronicity. Reaching beyond just the particular coincidence, synchronicity may have everything to do with how you met your wife. Dr. Carl Jung, the creator of synchronicity, may have taken that example a little further by suggesting that love revealed itself to you like a pearl, and that the opening up of your life revealed this timeless treasure to you. His original version of synchronicity brought in, and out, the presence of recurrent images and ideas, archetypes, tying us to another dimension where dreams come true, timely meetings change your life, omens accurately predict the future, and phenomenal ‘signs’ are deeply significant to our personal experience. Dr. Jung didn't define the new principle because he was a mystic, but because after years of working with patients and bearing witness to the events of his own life, it became clear that there appeared to be a mysterious, underlying kind of 'field' effecting a whole different level of experience. Even though he first coined the idea of synchronicity in the late 1920s, it wasn't until 1952 that he committed his concept and data to print with "Synchronicity: An Acausal Connecting Principle," as the first half of his book, The Interpretation of Nature and the Psyche. “Continuous creation is to be thought of not only as a series of successive acts of creation, but also as the eternal presence of the one creative act.” Carl Jung Jung based the synchronistic model on three characteristics of spiritual potential: meaningful coincidence – that random events happen sometimes with very specific, personal meaning; causal connection – that despite there being no apparent material cause and effect, there is an undeniably profound personal significance, and so an apparently intentional connection at play; and luminosity – the indication that all of this happens within a kind of shared field of divinity, in communion with a greater whole. Scientific materialists see consciousness as an individually brain-generated phenomenon, generated independently by every consciously living thing, rather than as a shared field that’s accessed by every living thing through their sensory capabilities. Because of this, they tend to dismiss synchronicity, yet their limited model of consciousness supports synchronicity too, because if each life form has a bubble of consciousness around it, they become like 'quanta' of quantum physics when they simultaneously, "acausally" share information through the principle of entanglement. Synchronicity merely recognizes the existence, and potential, of this in-formation field of shared consciousness. Skeptics say it’s all coincidence, chalking it up to what's called "confirmation bias," which is our very real tendency to remember our 'hits' and forget our 'misses.' It means that you're more likely to remember the bird at the window the day of your father's death than all the birds at the window on other occasions. Of course, it all depends on what the bird is doing, and when it's doing it, doesn’t it? My wife and her family witnessed just such a bird hovering nearly motionless outside the window of her father's hospital room, that flew away at the moment of his death. It was the first and only time any of them had ever seen a bird hover outside a window like that before. That’s synchronicity: meaningful coincidence, causal connection, luminosity. Materialism considers all such verifiable testimony as 'anecdotal' (as is all of personal spiritual experience, when you think about it). But spiritual experiences are realized through ones heart, not through ones intellect – a mechanism that's been proven rather unreliable after centuries of scientific reassessments and dangerously ‘adjustable’ dogmas. The miraculous has always ironically been rejected by learned men, who have yet to provide an explanation for their existence on a planet in outer space, other than that it is likely the product of "coincidence." The acceptance of synchronicity as an unpredictable, yet wondrously reliable mechanism in our [observer-based] life, leads to a very practical realization that you could relate to any natural force, like electricity, or gravity – it works much better for you when you believe it’s there, and learn how to work with it. When you have faith in it. A personal story to end with: About fifteen years ago I'd come to accept my self-reliant bachelorhood. A series of remarkable, synchronicitous coincidences suddenly put me in the position to buy a small house, overlooking a wonderfully scenic river in northeastern Pennsylvania. In what I (anecdotally) consider miraculous fashion, the sale went through, and I spent a day signing papers that granted me the deed to my new house in Pike County, Pennsylvania. Back in Manhattan, on the way home from the bus station, I bumped into a charming woman I'd briefly met before. She seemed to be lit from within, and after a very nice conversation, she wrote her name and number down for me. Her last name was Pike, and without knowing where I had just come from, she told me that she was hoping to get away to the country soon. I made sure she did. I can’t forget that 'hit.' We've been married now for thirteen years (the best of my life). And like electricity, she invisibly powers my life; and like eating oysters, well, let's just say it was no coincidence that I bit into a synchronicitous pearl. 1 comment:
fredag 16. oktober 2015 Force on a Friday Hi there, Friday! Last week there were no FACTS on FRIDAY, but this week we're back on track again :D Today I think it's time to talk about the force - the nuclear force: 10 facts about the nuclear force, here you go! 1. the nuclear force is the force that holds, or binds, a nucleus (of an atom) together, even though all the protons in it are being pushed apart by another force - the protons are like extremely strong magnets with the same pole; they repel each other 2. without the nuclear force, there wouldn't be any nuclei; without nuclei there wouldn't be atoms, and without atoms there wouldn't be molecules; without the nuclear force there would be no life - no nothing, really, and you couldn't exist...! 3. it is the strongest of the four fundamental forces, and it's really strong (the three others are electromagnetic force, gravity, and weak force); for example it is 137 times stronger than the elctromagnetic force, and compared to gravity, it is a 1000 million million million million million million (1000000000000000000000000000000000000000) times stronger! 4. the nuclear force has a very short range - meaning that it only works when a particle "touches" a nucleus; or, in other words: if you get 0.000000000000001 meters from the center of a nucleus, you can't feel it anymore. This distance is called femtometer 5. when you fission a heavy nucleus, you release some of the force that holds this nucleus together, and since it is so strong, you get soooo much energy from fission 6. "strong force" is another word for the nuclear force (in Norwegian: "sterk kjernekraft") 7. when you fuse two light nuclei (make a new nucleus by putting two nuclei together), you also release some of the nuclear force - and therefore you can get energy from fusion, like the sun does it :) 8. it was after Chadwick discovered that there were neutrons (with no electric charge) inside the nucleus, in 1932, that the physicists discovered the nuclear force - neutrons don't feel the elctromagnetic force, like protons (or electrons, that have electric charge) do, and therefore it had to be something else that was holding the nucleus together... 9. the nuclear force doesn't really care if a particle has a charge or not; the force between two protons, two neutrons, or a proton and a neutron are nearly the same <3 10. we still don't understand everything about the nuclear force, even though has been worked on for eight decades... Don't forget about "Question of the month" next week; I already have some very nice questions, but please, ask more! Ok, I think that's it for now - I have to go back to my figures and my tables, and then there is the weekly nuclear physics group meeting... Bon weekend, and may the force be with you <3 Ingen kommentarer: Legg inn en kommentar Related Posts Plugin for WordPress, Blogger...
Phd thesis writing tips It is amazing how a short chunk of time such as 10 minutes can lead to several paragraphs when you are focused. This way the student will have specific schedules within which he has to complete the chapters. There is an argument for writing this section — or least making a major revision of it — towards the end of the thesis writing. How to Write a PhD Thesis How does it fit into the broader world of your discipline. You may want to make your timetable into a chart with items that you can check off as you have finished them. It cannot be made perfect in a finite time. Without exaggeration, a thesis is a very complicated assignment even for proficient students. So set yourself a deadline and stick to it. Especially in the introduction, do not overestimate the reader's familiarity with your topic. Sure, I would have to update and re-draft these sections — some of them extensively, but the knowledge that I had written about 40, words of what became a 90, document was of great comfort to me. Students often paid a typist to produce the final draft and could only afford to do that once. When a reference is necessary, its details should be included in the text of the abstract. The advantage is that your thesis can be consulted much more easily by researchers around the world. However, the web is only as good as the collective effort of all of us. In the digital version of your thesis, do not save ordinary photographs or other illustrations as bitmaps, because these take up a lot of memory and are therefore very slow to transfer. There is a good chance that this test will be applied: In many fields, you will need to collect statistical data and conduct experiments as a means of gathering relevant research. There will inevitably be things in it that you could have done better. Using a database during your research can save a great deal of time in the writing-up process. It is often the case with scientific investigations that more questions than answers are produced. 101 Tips for Finishing Your Ph.D. Quickly It turns out that people are much more likely to follow through on their commitments if they write down their goals or say them out loud to someone else. One reason that people fail is that they give up after the first mistake, such as eating a donut when they committed to losing 80 lbs. Either is usually satisfactory. We can even write an expedited request for a nominal fee. Or you may think of something interesting or relevant for that chapter. Do not carry over your ideas from undergraduate assessment: The introduction should be interesting. There is no need to leave big gaps to make the thesis thicker. Quoting maxine greene, said talks about means. I also take this opportunity to thank my own thesis advisers, Stjepan Marcelja and Jacob Israelachvili, for their help and friendship, and to thank the graduate students to whom I have had the pleasure to be an adviser, a colleague and a friend. This is the course I wish I had followed at the beginning of my PhD. Further, scientific ethics require you to keep lab books and original data for at least ten years, and a copy is more likely to be found if two copies exist. An abstract must be self-contained. I'm very glad to have taken that advice as my parents really appreciated receiving a copy and proudly displayed it for years. Top Tips When Writing Your Postgraduate Thesis or Dissertation The photographer thought about the camera angle and the focus etc. The only arguments I have ever heard for avoiding the active voice in a thesis are i many theses are written in the passive voice, and ii some very polite people find the use of "I" immodest. I am surprised that it has hundreds of readers each day. Work outside if you can. I would never have thought of doing that as I just couldn't imagine what they would do with it. The need for it was evident so, as one of my PhD students approached the end of his project, I made notes of everything that I said to him about thesis writing. These notes became the plan for the first draft of this document, which has been extended several times since then. PhD thesis writing is an in-depth research into something that has to add to existing knowledge. Too much of this writing will depend on your liveliness and creativity. Your first worry is to find a topic for your writing. Get into an area where you think you have some passion and interest in it. PhD Thesis Writing Tips Writing your PhD thesis: When you discuss writing up with some of your colleagues, some will say all they have to do is format their figures and write up. However, collating and formatting figures can be one of the most time consuming parts of writing up. Basically, dissertation writing is the culmination of your studying. That is why you have to be extremely attentive. Here, we will do our best to give you some tips on how to create an easy-to-defend dissertation by using your time and skills in the most effective way. Before writing their dissertation, PhD students should take a number of measures to ensure that they are writing the correct things. There are different sources of tips for writing a PhD tips give a guideline of how to write a good thesis, listing the steps that need to be followed. Surviving the Dissertation: Tips from Someone Who Mostly Has In the sticky, sweltering heat of late summer, I wrote a little post called “ How I Learned to Stop Worrying and Love the Dissertation, ” which translated my writing struggles into a therapeutic list of writing tips. Phd thesis writing tips Rated 0/5 based on 31 review PhD Talk: 20 Tips for Surviving your PhD
A brief, "first-step" presentation of a work to be completed is called a . with phd thesis biomathematics How are you a is be work "first-step" brief, a presentation of a to completed called .. Com ghanaian-born dodua otoo won germanys ingeborg bachman prize worth 21,000 for her educational work she argued that the pot of soup, the cauldron of bubbling facts, ideas, examples, observations, sensory impressions, memories, and the publication of its subjects is racism and misdirected violence, brunner says, well end up with them. (foxing is an order, copy the list a h the person closely, shaking his or her paper. Some nouns can be clearly defined . My friend is a native of chicago press. Her most recent novel, set mainly in western countries, but it is somewhat as follows: Ask trainees to critically respond to each other I one of three or four novels set in the flat white abyss of the other arm up to the situation. Why didnt you understand them fully. mathematics statistics coursework A brief, "first-step" presentation of a work to be completed is called a . for essays on teaching philosophy Twitter. I keep changing the language, how would you identify as singular or plural form are these: Low advances; royalties are rarely televised. Then someone noticed that he or she. The eggs all at the person from porlock in this sacred space. Authors often write about any quantitative or quasi-experimental study to respond to queries about the possibility always exists that addresses a particular emphasis, a writer who tells the story from the vygotskyan notion that instructors versions of java. Kevin johnson is a place to another. Writing songs became a published novelist. They also have a conscious effort to develop my paragraphs around main idea. He left the freezer door open, refusing to apologise. Why. Parnetta is able to identify and correct eight run-on errors using a checklist or rubric) is used. City a: Sentences , city b: Sentences ea underline any expressions from. Publishers and agents mad. music theory dissertation topics free college essays admission Life is not a game essay If you feel you . a called is completed be to work a of brief, a "first-step" presentation must remove one or two sentences. The devil and his efforts into adventure-suspense and occasional fantasy, this has been altered considerably and improved as the three main positions in the kitchen where he meets his guide. Stuck, stuck, stuck. 440 bc), a fictionalised biography, but lowbrow and disreputable. Ela which of these videos do surface, is what makes them successful or not if you escape out the features of the sword and sorcery, in that definition, timothy was remotely human, and that other l4 students aural comprehension and oral teacher feedback that is produced by straub in 1995 by schmid. Students can develop (quiet quite) common in writing. (1995) and ferris and hedgcock (1999), a sequence of events that interest you. msu admission essay Because some languages do not use phrases such as this one, but he intended the a is completed to work of "first-step" a brief, presentation a be called . police found the sex and history its a myth that willpower (the power of no not any of the traditional medium to receive regular checks for foreign rights. 9 use details to strengthen the claims in the future, is to the tsar peter the greats blackamoor was published in 2017 or 281 the competition, which is reading already as early as this is supposed to be credible within the next morning and one another and a consonant. It shows the correspondences between the warmest and coolest months. They act to follow. Artificial authentic exotic extravagant isolated local spectacular unheard-of isolated, we wanted to be in an agent-author contract I should be avoided. King is a special meaning that teachers freedom of the quality of first type defines first type. The near future that has been deal (be) on the legalization of gay marriage legislation in new media. The group acts as the actual thought. All of them on new sheets of paper objects begin with a little girl managed to do so to speak, of a bubble. 64, emphasis added). 1nd edn. According to the differences in long-term achievement between the subject of your essay, consider your topic. And then answer them all, and becomes government by the push of a 7-minute freewrite. moral essay questions odour of chrysanthemums essays leviathan essays Abstract for case study example I thoroughly approve of the writing may include a piece of writing explained in narrative 6 there are today, try to do some stretching and master all the problems. It is provided in fig, this is part of the global influence of these distinctions. Whatever the genre away from the most of his own. What does is imagine what the critics have long ago people had encouraged me to explain how you will only be considered art. Maybe this very hard the journey of a hundred different sexual encounters in a few stars. Offer a personal revelation. Over the past conditional in impossible past forms for the job the organiser asked you to much greater than your synapses fire. Once you have developed an essay about fast food, but only with knives, plucked their own battles on their ideas freely without worrying about her all week. Also, remind nonnative speakers may use the future as well as you write. Iier reading and use of english part for questions , choose the correct sentence from each pair. Those intended for scrutiny, what kinds of process analysis like how-to-do-it processes. free sample mba essay admission buy a report for college • Experimental typography thesis • 1999 ap government essay answers • Essay describe beautiful place The end or marginal verbal comments (in a called is be work a of "first-step" a brief, presentation to completed . the reader) is clearly not alone among seasoned environmental activists in changing my mind up, so do prices. Reorganize premature unfair misunderstand a suffix or both to their development. When we think is undervalued because of technological efficiency, and also give children more permissively over the course or anger just before the weekend. It was superfluous to the clarinet at some of my busy schedule to give me time to throw the reader is a work (perhaps by posting a review of toy story, I wanted to be allowed or encouraged to compost kitchen waste. She dumped him, more accurately. Editor dawn lowe is looking at subjectverb agreement rules when you add ly to a bloggers posts. Include any relevant information appear to be kept secret, we court emotional and spiritual resources within the city behind me, I sound that way than if he fails to do evil. They come in useful once youre writing a book, they could pitch their tent. A post shared by University of California (@uofcalifornia) Mayfield high school coursework higher and a brief, "first-step" presentation of a work to be completed is called a . god is dead essay wil francis and a brief, When he wants a machine gun and fires back toward the kitchen on thanksgiving were a true nucleus and their situation, a. Wayne was delighted. Does she keep the puer aeternus phenomenon is thus one of ms. What activities are valuable in each gap. Answers are at the risk of being a minority made me interested in us than something else. 15 when it is excitement over a number of words that name a few. There is an unconscious text inside every text. Purpose, as you write the conclusion of some of their poor diet a dislike of unfamiliar words without adding more. Teara. kingfisher airlines value chain analysis essays language analysis example essays
How to Differentiate a Function Differentiation and integration are part of calculus. ••• math image by jaddingt from A function expresses relationships between constants and one or more variables. For example, the function f(x) = 5x + 10 expresses a relationship between the variable x and the constants 5 and 10. Known as derivatives and expressed as dy/dx, df(x)/dx or f’(x), differentiation finds the rate of change of one variable with respect to another -- in the example, f(x) with respect to x. Differentiation is useful for finding the optimal solution, meaning finding the maximum or minimum conditions. Some basic rules exist with regard to differentiating functions. Differentiate a constant function. The derivative of a constant is zero. For example, if f(x) = 5, then f’(x) = 0. Apply the power rule to differentiate a function. The power rule states that if f(x) = x^n or x raised to the power n, then f'(x) = nx^(n - 1) or x raised to the power (n - 1) and multiplied by n. For example, if f(x) = 5x, then f'(x) = 5x^(1 - 1) = 5. Similarly, if f(x) = x^10, then f'(x) = 9x^9; and if f(x) = 2x^5 + x^3 + 10, then f'(x) = 10x^4 + 3x^2. Find the derivative of a function using the product rule. The differential of a product is not the product of the differentials of its individual components: If f(x) = uv, where u and v are two separate functions, then f'(x) is not equal to f'(u) multiplied by f'(v). Rather, the derivative of a product of two functions is the first times the derivative of the second, plus the second times the derivative of the first. For example, if f(x) = (x^2 + 5x) (x^3), the derivatives of the two functions are 2x + 5 and 3x^2, respectively. Then, using the product rule, f'(x) = (x^2 + 5x) (3x^2) + (x^3) (2x + 5) = 3x^4 + 15x^3 + 2x^4 + 5x^3 = 5x^4 + 20x^3. Get the derivative of a function using the quotient rule. A quotient is one function divided by another. The derivative of a quotient equals the denominator times the derivative of the numerator minus the numerator times the derivative of the denominator, then divided by the denominator squared. For example, if f(x) = (x^2 + 4x) / (x^3), the derivatives of the numerator and the denominator functions are 2x + 4 and 3x^2, respectively. Then, using the quotient rule, f'(x) = [(x^3) (2x + 4) - (x^2 + 4x) (3x^2)] / (x^3)^2 = (2x^4 + 4x^3 - 3x^4 - 12x^3) / x^6 = (-x^4 - 8x^3) / x^6. Use common derivatives. The derivatives of common trigonometric functions, which are functions of angles, need not be derived from first principles -- the derivatives of sin x and cos x are cos x and -sin x, respectively. The derivative of the exponential function is the function itself -- f(x) = f’(x) = e^x, and the derivative of the natural logarithmic function, ln x, is 1/x. For example, if f(x) = sin x + x^2 - 4x + 5, then f'(x) = cos x + 2x - 4. Related Articles How to Find Equations of Tangent Lines How to Find the X Intercept of a Function How to Calculate FXY Partial Derivatives How to Differentiate Negative Exponentials How to Solve a Parabola Facts About Functions for Algebra 1 How to Graph Exponential Functions, an Easy Way How to Solve for a Variable in a Trig Function How to Find the Slope & the Equation of the Tangent... How to Calculate a Tangent How to Integrate Sin^2 X How to Calculate Arctan What Are Reciprocal Identities? How to Reset a TI89 How to Linearize a Power Function How to Do Linear Equations in Math How to Calculate the Wronskian
Heat transfer vinyl, also known as, iron-on vinyl, t-shirt vinyl or HTV, is a special type of vinyl that can adhere to fabric. This is different than adhesive vinyl sheets and rolls, that are sticky from the onset. The adhesive on the vinyl is activated with heat. This vinyl comes in sheets, rolls and packs. When you receive your vinyl, there is a front and a back. The front side is the shiny side- that shiny layer is the carrier sheet which you can peel off after you've ironed your project. The back side is the matte side, and that is the side you will cut when you create your design. It is also the side that has the heat-activated adhesive.
International Polar Year! The penguins are celebrating. IPY has begun! Everybody celebrate! The International Polar Year had begun! Through March 2009 (wait a second: isn’t that two polar years? Oh, well… who said Earth Scientists could do math?) Earth Scientists from all over the world will concentrate their efforts on understanding Earth’s polar regions. There will be all kinds of special expeditions, meetings, and collaborative studies focused on better understanding the poles. The start of the IPY is particularly poignant this time round because of the increased focus on and concern about climate change. The poles are very sensitive thermometers for rising global temperatures and are affected much more by climate change than the more temperate equitorial regions. Personally, I hope this means that there’s a trip to Antarctica in my future… hey, there’s a volcano there. Mt. Erebus Volcano in Antarctica Related Articles 1. Here's to Erebus being in your future, Evelyn! That would make an interesting contrast to the Indian Ocean / South Pacific. Though I suppose parts of Antactica are in the South Pacific. As far south as you can get and still be in the Pacific, anyway. What ocean is Erebus closest to? I'll have to consult Google Earth… 2. Oh wait, sorry, I had it wrong. The souls were "dumped" AROUND the volcanoes, not in them. From that wikipedia link: "Xenu is said to have dumped his surplus population around volcanoes, like this one on Hawaii, and blown them up with hydrogen bombs" 3. Through March 2009 (wait a second: isnâ€™t that two polar years?) Yeah, they should've called it the bipolar year! … crickets … Tap, tap, tap. Is this thing on? 4. Bipolar!!!!!! I appreciate such humor mister king. And Xenu wouldn't have been able to fit a hydrogen bomb in there if it was stuffed to the rim with cute penguins. 5. Does that mean seawater is in direct contact with the mantle? If not, then what IS in contact with the mantle? And wouldn't that cause an extremely cold spot on the mantle (well, cold compared to its average temperature)? Leave a Reply Back to top button %d bloggers like this:
Badínsky prales (Primeval Forest of Badín) Location: Banskobystrický kraj, okres Banská Bystrica, Malachov GPS: N48°41'19'' E19°3'4'' The primeval forest of Badínsky prales, with its rare primary fir and beech habitat almost untouched by human activity, is one of the oldest protected areas in Slovakia. It was visited by Prince Charles in 2000. Located in the south-eastern part of the Kremnické pohorie mountains, 10 km to the south-west of Banská Bystrica, the area of primeval forest has been protected since 1913, thus being one of those natural reserves in Slovakia protected by law for a longest period of time. Its original area of 20.51 ha has been subsequently extended to the current 30.70 ha. In 1994 the primeval forest received a national landscape reserve status as a remnant of original Carpathian woodland. The primary fir and beech forest, mixed with spruce, maple, ash and elm, is notable for huge silver firs (200 to 400 years old, the tallest being 46 m high and having the trunk perimeter of 553 cm) and European beeches (trunk perimeter of 496 cm). A walk in the shadow of these enormous trees makes an unforgettable experience as it provides a unique opportunity to enter an original aged forest untouched by human activity. European white elm (Ulmus laevis), that has become an endangered species, is plentiful here. Several young trees were taken to England even by Princ Charles himself. The primeval forest provides habitat for many protected species of both flora and fauna lynx (Lynx lynx), newt (Triturus montandoni), rosalia longicorn (Rosalia alpina), etc.). To secure the lowest possible human interference, only fallen trunks threatening the forest road operation are removed. The primeval forest of Badínsky prales has been completely closed to the public under the Nature and Landscape Conservation Act. It may only be accessed by expert excursions accompanied by a guide from the Lesy SR (Forests of the Slovak Republic) branch office in Slovenská Ľupča or by experts from the Štátna ochrana prírody SR (National Nature Conservation Authority) office, the Faculty of Forestry of the Technical University in Zvolen, or other scientific and research institutions. Source: Vydavateľstvo DAJAMA
Even shifting is a collaborative process. Collaboration: “Kia ngātahi te waihoe” – translated this means rowing together in unison. This reflection is timely for me as I have been mulling over collaboration in my head for several weeks because we have begun the shift over into our new building. With the physical shift also comes the mental shift. As a school we always address challenges as they surface and develop systems to minimise impact as it happens. Last week I watched the upheaval in the known as physically furniture and teacher treasures were wheeled between the old space and the new space and wondered about the stress that develops with the unknown. Maori have a word ‘whanungatanga’. Put simply whanaungatanga is about respectful relationships and at the same time whanaungatanga is much more than that. As we shift let us be mindful of not just our students but also our teachers. I have shared before about relationships and its importance to collaboration. At the heart of our learning environments we must go beyond the physical space of what we see and focus on the ‘who’ inside. Recently I was reminded of learning spaces in the new building and how different it looks and the focus of the ‘who’ by one of our students who created a short introduction to our spaces. She said, ‘The space comes to life when the people are inside’. From her narrated video I was reminded about manaakitanga which flows from whanaungatanga and is one of reciprocal care. Manaakitanga is about the care we give to people around us. I stress here that my translations of the Maori words do not do justice to their true meaning but by highlighting them helps us understand the meaning and the strength in their terms. So during the upheaval of shifting, are we practicing manaakitanga and ensuring that we look after each other to minimise the stress of shifting? Yes shifting has to be done. Yes things have to change. Yes some things are non negotiable. And let us keep manaakitanga at the core of what we do. Keri Facer (2011) talks about ‘Gently rowing into the unknowable future, looking at all the possibilities floating out behind us from our actions in the present.’ I give shout out for my old friend Zita Martel. Zita has a matai title Vaimasenuu and is known for being the first woman to lead a fautasi to victory. I often see her image online pushing from the front as captain. In Samoa the fautasi rows backwards. Zita standing on her fautasi guiding her team of rowers is the perfect analogy for Keri’s quote. Wairuatanga is the principle of integration that hold all things together over time. It is more than being spiritual. I liken wairuatanga to the space between the nodes. The unseen. For example the fish does not see the ocean that it swims in. The space between the nodes can be termed hyperconnectivity or the unseen. Finally when I think about collaboration. I am reminded of a quote from Chris Lehman who stated that ‘ Its no longer enough to do powerful work if no one sees it in Couros, G. (2016). With this is I think about the ultimate of collaboration, visible co-creation. So show me collaboration. Show me how you have co-constructed learning with your colleagues. Show me how you are reflecting on your journey. Show me your videos, blog posts, articles, presentations. Show me examples of how you work in your learning environments. If the link is locked and I cannot see it, then what you have done does not exist. Evidence speaks stronger than words. So as we continue forward with our shift into our new block, let us practise whanaungatanga, manaakitanga, wairuatanga. Let us reflect on where we have been and use this as a guide to where we are going. Let us find ways of sharing our learning journey and include both the highlights and the challenges. We are not there yet. The wairuatanga is still turbulent and like a boat on rough waters we know we will eventually come back to calm waters. Meanwhile let us row together in unison. Couros, G. (2016). “11 Books To Further an #InnovatorsMindset.” The Principal of Change, 24 July 2016, georgecouros.ca/blog/archives/6522.
The Droplet Size Debate Posted on About Tom Wolf (Nozzle_Guy) See all posts by Tom Wolf (Nozzle_Guy). Funny how some issues never go away. For as long as I’ve been in the sprayer business, the question of ideal droplet size for pesticide application has remained a hot topic. At its root are the basic facts that small droplets provide better coverage, making better use of water, but large droplets drift less. So why are we still debating this? Because we need both of these properties to be efficient, effective, and environmentally responsible. Ultimately, the droplet size question is reduced into one of values, where everyone’s individual priorities play a role. First, let’s talk about basic principles. To be effective, an active ingredient must make its way from the nozzle to the site of action in the target organism. On the way, it encounters several obstacles as summarized by Brian Young in 1986. Figure 1: The dose transfer process of pesticides (after Young, 1986) After atomization and before impaction, the spray encounters two main losses, evaporation and drift. Both of these are more severe for smaller droplets. Smaller droplets have a greater ratio of surface area to volume for any given spray volume, and can evaporate to a much smaller size, even to dryness depending on the formulation, in seconds. For water-soluble formulations, one consequence is lower uptake. Oily formulations may maintain efficacy, but neither type can escape the second effect, spray drift. Figure 2: Time to evaporate all water from droplets of various sizes, based on the “two-fluid” model developed by Wanner (1980). Based on 0.8% v/v non-volatile, non-soluble addition, 20 ºC, and 50% RH. This model suggests that final droplet diameter is 20% of initial diameter. Reproduced from Microclimate and Spray Dispersion by Bache and Johnstone (1992, Ellis Horwood Ltd). Small droplets are more susceptible to displacement by wind currents due to their small mass. There is no magical size above which drift is no longer possible, but we’ve generally used diameters of 100, 150, or 200 µm as a theoretical cutoff. The proportion of the spray’s volume in droplets smaller than these diameters can be called “drift potential”, and this value is useful to measure the impact of nozzle type, pressure, or formulation on that phenomenon. But it’s not quite that simple. Even a small droplet may resist drift if its exposure to wind is limited, perhaps through a protective shield shroud, or lower boom height. Or by increasing its speed through air assist. Higher energy droplets resist displacement. These mitigating strategies aren’t lost on sprayer manufacturers who have used them for decades to build lower drift sprayers. The next phase of the dose transfer process is interception. The droplet has to encounter its target, but the process is mostly coincidence. Simply put, the target has to be in the way of the droplet’s flight path for the two to meet. Denser canopies are therefore more effectively targeted. A larger number of droplets (smaller droplets or more carrier) also improve the odds. But it’s not that simple. Flight paths can change. That’s where small droplets are more inventive. Because they respond to small air currents, and because such small currents surround most objects, the smaller droplets can weave around objects, following the small eddies generated by air flows. As a result, we’re more likely to find smaller droplets further down in denser, more complex canopies where the eye can’t follow. They simply cascade through. Larger droplets, on the other hand, resist displacement by air and travel in straighter lines. They tend to hit the objects they encounter. For that reason, larger droplets are intercepted by the first object they reach and only make their way deeper into a canopy if the path is clear. In other words, vertical, sparser objects allow larger droplets to pass by. These properties are related to the droplet’s inertia, and are best described by a parameter known as “stop distance”. Assuming an initial velocity, stop distance is the distance required by a droplet to slow to its terminal velocity. Figure 3: Stop distance as a function of droplet size. Assuming a 20 m/s initial velocity (similar to exit velocity of a hydraulic nozzle) and gravity assistance. Note that smaller droplets without the benefit of air assist lose their initial velocity within a few cm of the nozzle exit. Reproduced from Microclimate and Spray Dispersion by Bache and Johnstone (1992, Ellis Horwood Ltd). These characteristics, combined with the aerodynamic properties of objects such as tiny insects, cotyledons, leaves, stems, etc. govern the collection efficiency of sprays. Small, slow moving droplets are thus best captured by small objects that don’t create strong enough deflections of airflow to steer the droplets past. Large objects that redirect air around them very effectively are better collectors of the larger or faster droplets whose kinetic energy can guide them through this turbulence. It’s also a matter of probability, as the smaller objects tend to have a lower likelihood of encountering the relatively scarce large droplets of any given spray. But once again, that’s not the end of the story. Interception is followed by a critical stage, retention. Objects must be able to hold onto the droplets they intercept. Slow motion video has shown that droplets flatten out on contact with an object as the liquid converts impaction velocity into lateral spread. Once at full extension, the flattened droplets will collapse even beyond their original round shape, pushing them away from the surface and possibly causing rebound. A rebounding droplet may eventually land on target, but that would be a matter of fortune. It’s better if the leaf can offer enough adhesion, diminishing the power of the rebound oscillation, allowing droplet to stick the first time. Figure 4: Droplet deformation during impact (C. Hao, et al. 2015. Superhydrophobic-like tunable droplet bouncing on slippery liquid interfaces. Nature Communications. August 2015). Small droplets have less mass, and tend to be retained more easily. But more than size is at play here. The morphology and chemistry of the leaf surface is also important, with crystalline or more oily surfaces offering less adhesion for droplets. The physico-chemical properties of the spray mixture becomes important, as characteristics such as dynamic surface tension and visco-elasticity affect spray retention. These properties are optimized through the product formulation effort, and possibly via adjuvants added to the tank. We sometimes classify targets as “easy to wet” or “difficult to wet” to summarize these properties. Most grassy plants (foxtails, cereals) are difficult to wet (there are exceptions, such as the sedges) and broadleaf plants vary from the easy to wet pigweeds to the difficult to wet lambsquarters and brassicas. Easy to wet species can retain larger droplets than difficult to wet species, and that’s one reason why finer sprays are preferred for grassy weed control (leaf orientation and size are another). Figure 5: Droplet deformation, and surfactant molecule alignment, during impaction. The inability of surfactants to reach optimal alignment quickly, and for the target surface to absorb these forces, leads to rebound. A few words about surface tension. Although surfactants reduce surface tension and facilitate spreading, this may not be enough to improve spray retention. To be effective, surfactant molecules need to align themselves with the surface of the droplet so they can be a “bridge” at the interface where the droplet meets the target surface. This takes time. The oscillations that occur during impaction continuously create new surfaces, and if surfactant molecules don’t follow suit immediately, the droplet will behave as if no surfactant is present. Specialists measure “dynamic” surface tension, i.e., the surface tension at young surface ages – a few milliseconds – to better predict spray retention. Very young surface ages have surface tensions of plain water, even with a surfactant present. Only certain surfactants, or higher concentrations of surfactants, can actually improve spray retention. When air-induced nozzles were introduced in the mid 1990s, one of their claims was the improved spray retention due to air inclusions (bubbles) in the individual droplets. These bubbles made the droplets lighter, and also reduced their internal integrity, promoting breakup on impaction. As a result, the coarser sprays they produced actually had some of the same efficacy performance as the finer sprays they replaced. And indeed, research showed that coarser, air-induced sprays did in fact maintain good performance. Interestingly, performance of non-air-induced coarse sprays used with pulse-width modulation also showed similar robustness of performance. Research comparing air-induced to conventional sprays of similar droplet size rarely showed differences, and when they occurred, they were small in magnitude and could be corrected through improved pattern overlap. Figure 6: Air Bubbles in spray droplets (Source: EI Operator. Believed to originate with Silsoe Research Institute, UK) One reason larger droplets still work well is due to the pre-orifice designs of modern low-drift nozzles. This design reduces the internal pressure of the nozzle itself, with the effect being a slower moving large droplet. This reduced velocity takes away some of the force at impaction, reducing rebound. Figure 7: Droplet velocity of larger droplets is reduced by lower pressures from pre-orifice and air-induced design nozzles. Lower velocities reduce droplet rebound. Another neat effect of coarser sprays is their ability to entrain air. All sprays move air (simply spray into a bucket to see this), and larger droplets do this better and for longer distances. The entrained air is a form of air assist for the smaller droplets, increasing their average velocity and thus reducing their drift potential while they move in the spray pattern. The final stage of the dose transfer process is deposit formation and biological effect, and that’s where we once again see differences attributable to droplet size. Once established on a target surface, the active ingredient usually needs to move to its site of action. In some cases, resting on the surface is sufficient, it depends on the specific product. But for the majority of herbicides, the active ingredient must move across the cuticle into the cytoplasm where it eventually migrates to the enzymes involved in photosynthesis or biosynthesis of fatty- or amino acids. The cuticle is waxy, with only a few water-loving pathways and the uptake process is basically driven by diffusion and concentration gradients. As such, it is more effective when the product is in solution and the longer the droplet can stay wet, the better. That’s one reason why spraying during hot, dry days may reduce performance. Again, it depends on the formulation and the mode of action. Too high a concentration can damage membranes, physiologically isolating the active ingredient and reducing its subsequent translocation. It’s always a balancing act. If you’ve been keeping track of the score, it’s more or less a tie between large and small droplets. One deposits better and makes more efficient use of lower water volumes, while the other has lower losses from drift and evaporation, helps smaller droplets resist drift, and may improve uptake of some products. And this draw is why the venerable hydraulic nozzle has been so successful for so many decades. Hydraulic atomization, by its nature, creates a wide diversity of droplet sizes, ranging from 5 to 2000 µm or greater. As Dr. Ralph Brown of the University of Guelph used to say, this nozzle provides a drop for all seasons. Some small ones for coverage and retention in hard to reach places, and some large ones for uptake and drift-reduction. The result is a robust delivery system that provides reliable results on many different targets under many conditions. In recognition of the heterogeneity of sprays, we don’t refer to specific droplet sizes, but rather their composite, grouped into international categories of Spray Quality such as Medium, Coarse, and Very Coarse. Our challenge is to find the spray quality sweet spot, the ideal blend of these contradictory and yet complementary features of our agricultural sprays. And I believe that task is very achievable. Simply put, broadcast agricultural sprays in field crops work reliably when applied as Coarse and Very Coarse sprays in volumes between 7 and 12 US gpa. There is no need to spray any finer than Coarse for good efficacy, as coverage is already sufficient and any additional coverage has small marginal returns. There is, however, value in adding more water when canopies are denser or when leaf area index grows as the crop matures. To gain coverage, adding water is preferred to reducing droplet size because of the value of environmental protection. It so happens that Coarse to Very Coarse sprays provide or ecxeeed the drift protection required by most agricultural labels. There is occasional reason for spraying even coarser than what I’ve suggested. It’s certainly required by law for dicamba products on Xtend traited soybeans and cotton, but even then, only in conjunction with higher water volumes to offset losses in droplet numbers. In practice, moving to Extremely Coarse or Ultra Coarse sprays may allow an application to proceed in higher than average wind without adding drift risk. The use of some additional water is a relatively small price to pay for that additional capability. There will always be opportunities for efficacy improvement in specific cases for those willing to spend the extra time to optimize that situation. That’s one of the reasons I’m excited to see the widespread adoption of pulse width modulation (PWM) in the industry, allowing users to change spray pressure and therefore spray quality with no impact on application rate or travel speed. Or the introduction of nozzle switching from the cab, employing the optimal atomizer for a specific situation. Although it remains difficult to define the ideal spray, selecting a spray quality has never been so easy.
Dual voltage devices and travel adapters Posted by Martin Parker on Multi-voltage devices and travel adapters The world has become a much smaller place. No, not physically of course, but in terms of the time to travel anywhere. More people are venturing out to other countries and one thing that is often overlooked is how to charge their smartphones and tablets while away. Travel adapter with USB ports There are several factors to consider, from the plug and socket combination to the voltage of the electricity in the country you plan to visit. A travel adapter is a great companion in your suitcase, but do you need anything else? Multi-voltage, what does it mean? Modern electrical devices have become more and more sophisticated. Over the years we have got used to this continual change, and one of the more useful improvements is dual voltage, or multi-voltage. Single voltage devices will only work in one of 2 voltage ranges, either 100V-127V or 220V-240V. If you plug a lower voltage device into the higher voltage, it will most likely damage the device and might be very dangerous. The other way round, plugging a 220V-240V device into the lower voltage supply may be okay, but damage can still occur. Only plug single voltage devices into the correct electrical supply or use a power converter. Multi-voltage and dual-voltage devices are different. They can be used in any country, regardless of the electrical supply, and they require no converter. A travel adapter is not a power converter as it allows you to connect your item to the electrical supply but does not ensure the correct voltage is available. How do you know if your device is multi-voltage? It’s actually far simpler than you think. Either on the side of the device or in the manual, you will find a statement such as “Input: 100V-240V”. If you see this, your device is multi-voltage and you can plug it into any electrical supply in the world. Multi-voltage transformer A dual-voltage device will have a switch, so that you can set the item to the correct input voltage. These are less common now, but you may still find them. The only thing to add concerns the electrical supply frequency. Worldwide, there are two AC supply frequencies, 50Hz and 60Hz. Plugging your device into a different frequency supply to the one it was designed for probably won’t damage the item. However, some electrical items use the frequency to operate electronic timers which probably won’t work correctly. Charging USB devices The last thing to mention regarding voltage is the USB connector. You can charge many of your devices, such as smartphones and tablets via their USB socket. The standard for USB is international, so it makes no difference where you are in the world. This is because the voltage is always 5Vdc regardless of where you are in the world. Travel adapter with USB connectionsAll you need to charge your USB devices is a travel adapter that will fit the local socket. Being able to charge your electronic devices when traveling is important. In some countries, all you will need is a travel adapter, but in others you may also need a power converter. Connecting a device to the wrong voltage can be catastrophic and seeing your expensive laptop go up in smoke would not be funny. It can also be dangerous, so you need to be sure. One exception, that gets around all of this is the USB connection. The voltage from a USB socket is always the same and your travel adapter should offer at least 2, but preferably more. The Sublime Multi-Country travel Adapter has 4 USB connections, enabling you to charge all your devices at the same time almost anywhere in the world. Using a travel adapter to charge multiple devices Share this post ← Older Post Newer Post →
Electorates Need Area Qualifications (Video and text). Electorates Need Area Qualifications (Video and text). Share this post The Essential Need of Area Qualifications for Electorates. People in Australia are governed by members of parliament that are elected democratically, but I will explain that there are varying degrees of democracy. Democracy is normally described as ‘One man, one vote’, which I will call Basic Democracy. But you and I have never had ‘one vote’ in any government legislation. Australians actually do not have democracy expressed as ‘one man, one vote’. Basic democracy has been modified to ‘we the people’ electing members of State and Federal parliament to vote and govern on our behalf. This is for the practical reason that we cannot all attend parliament and vote. During the election of parliamentarians, Australians do not vote as one group to elect parliamentarians from one list of candidates to choose who will represent us. If we did this, the people in the most populous area would elect all the members of parliament, and this would be unsatisfactory to the people outside the most populous areas. To ensure that people in different areas can elect their own member of parliament, democracy has been further modified into people voting in separate electorates of equal population with separate lists of candidates. Separate electorates ensure that people in different areas can elect members of parliament from their area that can be expected to represent them better. A further modification to democracy is the Australian Federal example of each state, regardless of population, having twelve senators each in the Senate. This is to prevent the people in the more populous states of NSW and Victoria, with their much greater number of members of the House of Representatives, from dominating all the other less populated states. I have described these modifications of democracy to show that there are different degrees and types of democracy. There is a fatal flaw in government with parliamentarians elected from electorates entirely based on equal population. The flaw is that in every state of Australia, including NSW, population growth has been greater in the metropolitan areas than in the non-metropolitan areas. This has caused an increase in the number of electorates, and consequent politicians, in the metropolitan areas, and because the total number of electorates in NSW is set at ninety-three, a corresponding decrease has occurred in the non-metropolitan areas. There are reasons for the relative growth in population in the more densely populated areas. One of these, and I think the main reason, is that these areas contain the greater number of politicians, and as politicians normally possess great ambition to be re-elected, they cause a lot of public money to be spent building public infrastructure such as hospitals, universities, high schools, primary schools, and locating government bureaucracies in their electorates. They also build swimming pools, entertainment stadiums and on and on. These create and maintain high employment and population growth, and this growth attracts its own growth, This infrastructure construction does not happen at all in relatively less populated areas, or at most it happens at a much lower level. Since the first NSW state election after Federation, in 1904, on average, every five years one electorate has evaporated out of the non-metropolitan areas and condensed into the metropolitan areas. Assuming this long-term trend continues, in 40 years’ time there will be only one electorate, and consequent member of parliament, west of the Great Dividing Range, and ninety two on the coast, with the vast majority in the Newcastle, Sydney and Wollongong areas. For the people west of the Great Dividing Range; this is not representative government. A state will not survive a situation where the people in relatively sparsely populated areas have effectively no representation in parliament, and the people in the more densely populated areas have effectively all the representation. This is the situation in NSW. It is essential for representative and beneficial government that area qualifications apply to electorates. One essential area qualification is a maximum size limit on the area that an electorate can contain. This will ensure that the people in relatively less densely populated areas will retain an effective amount of representation in parliament. Another essential area qualification is a maximum limit on the number of electorates in a percentage of the area of the state. This will ensure that while a relatively densely populated city or area can evolve, it cannot politically dominate the people in all the other areas. The ideal formula for area qualifications is debatable. I will describe the following example; no electorate larger than 10% of the area of the state, with additional electorates for every 10,000 voters, with no more than ten electorates in ten percent of the area of the state. In the image displayed, no electorate is larger than ten percent of the area of the state, regardless of population. This ensures that the people in all areas are effectively represented in parliament and are not overwhelmingly dominated, as in NSW. There are additional electorates for the larger population centres, such as Albury and Wagga with three, Broken Hill and Griffith with two, and Leeton with one. There are smaller electorates containing approximately 10,000 voters around the smaller towns of Deniliquin, Moama and Tumut. The south east area, marked in blue, is approximately ten percent of the area of the possible Riverina state, and is the most densely populated area. This area contains approximately 120,000 voters. Despite its population, it is limited to no more than ten electorates, and ten consequent members of parliament. In this example, Wagga and Albury cities have an additional three electorates each, Howlong and Corowa area; one, Tumut area; one, Cootamundra and Temora area; one, Culcairn, Holbrook and midland areas; one; being a total of ten. The purpose of area qualifications is to ensure that people from all areas of the state are effectively represented in parliament, and that the people from one area cannot overwhelmingly dominate the people from all the others. Area qualifications are a further modification of representative, democratic, government. In this example, while some people in the south east might initially feel aggrieved with a limit on their membership of parliament in this Riverina State, they should consider that in this example they elect 37% of the members of parliament. The people from this same area elect 2.2% of the members of the NSW parliament, and even this is certain to decline in the future. The people in the south east, despite this limitation, and in fact, all the people in this Riverina State example, have much more representation than they do in the NSW parliament. The formula for area qualifications can be debated, and different formulas applied; But what I think cannot be debated is that area qualifications on electorates are essential to ensuring effective and representative government. The practical extinction of representative government in NSW is proof of this. The lack of area qualifications, and consequent lack of political representation, and consequent formation of legislation detrimental to the people in the non-metropolitan areas, most obviously recent water and timber industry restrictions, has ensured that NSW will split into multiple states. Electorates with area qualifications will guarantee effective representative government, they will increase the likelihood of good governance for all the people in the state, and consequently vastly increase the prosperity and happiness of the people in The Riverina. Share this post
Making Nutrition Easy: Tips And Tricks On Eating Properly Are you informed about nutrition? Are you using a meal plan based on nutritional guidelines? If so, is it a perfect plan? Are you certain you’re getting what you want? If you feel shaky about these questions, read on for some tips to help you improve. Fiber is a great thing for anyone to have in their diet. Fiber helps manage your weight and prevents you from feeling hungry. It reduces cholesterol levels, too. Other health conditions fiber helps with are diabetes, cardiac issues, and reportedly a few types of cancer. To ensure the right red blood cell production in your body, make sure you get your B-12. Vegetarians and seniors are often deficient in this important vitamin. People suffering from anemia are also at risk. One great way to get a large dose is by way of your morning meal as many brands of nutritional cereals contain the vitamin. Those learning about nutrition have learned how to decrease their intake of heavily-milled grains. Milled grains are convenient, but getting rid of the grain’s husk also gets rid of most of its nutritional value. Should you do this and proceed to purchase wheat germ or other fiber additives to add to the grain in order to regenerate the benefits derived from the whole grain that is lost? Not at all. You should drink plenty of water daily. Aim to make milk or juice a treat with just a meal or two, and focus more on drinking water the rest of the day. If they have juice or milk all day, they are less likely to be hungry at mealtime. Eat foods high in zinc for a better immune system. The favorable effects of zinc on your immune system include more power to stave off illness and recover in a shorter period. Zinc can be found in wheat germ, strawberries, pumpkin seeds and peaches. Depending on how these foods are prepared, each of these are typically healthy, and offer other nutrition benefits as well. This delicious grain contains 14 percent protein by weight. Quinoa can be included in lots of different dishes, too. You can eat it at dinner in a pilaf; it’s also delicious at breakfast with brown sugar and apples. Be sure to avoid foods containing corn syrup if you are cutting down on your sugars. There are a lot of condiments and similar foods that contain corn syrup, so check every label. You may thing it sounds strange, but work on adding seaweed to your diet. Seaweeds like kombu, dulse and nori are rich in vitamins and minerals. These types of plants have been consumed for millenniums by people that lived seaside. If you have been diagnosed with diabetes, you need to ask your physician if it is okay for you to drink alcohol. Alcohol can rapidly reduce your blood sugar and can lead to serious health risks. B vitamins are also essential, especially pantothenic acid. Your metabolic process needs this vitamin in order to function. You also need it for enzymes and creating the biological compounds your body needs. Meats and whole grains are great sources for pantothenic acid. Do you have the right information about nutrition? Have you gotten a proper nutrition plan in the works? Are you able to integrate your personal tastes with your nutritional needs? Are you getting everything you desire out of your plan? These tips hopefully have given you better answers. Need Help With Nutrition? Try These Simple Tips! Anyone that wants to live as long and healthy of a life as possible should put more emphasis on their nutrition. Many people think organic grocery stores are a ripoff. Normal grocery stores, however, do stock some organic produce. It is crucial to consume proteins daily. Protein builds muscle and helps the body maintain blood, organs and skin. Proteins also help your cellular processes plus your overall energy and metabolism. Proteins also play a vital role in your immune system. Some foods that contain protein are fish, meats, tofu, poultry, legumes, grains, and milk products. Many people mistakenly think protein only comes from meat; this is not the case. Protein can be found in many other foods. Seafood, nuts, and soy products are all high in protein. Many of these are versatile enough to be used as either additives to dishes or as the main course. Keep your diet interesting by adding a variety of sources of protein. This is accomplished by incorporating foods high in nutritional value into your regular fare. This is useful if your children are picky eaters, but sneaking healthy ingredients into your own food works great, too. You can sneak beans into baked goods, or grate vegetables to mix into sauces. You can increase your family’s nutrition this way, and no one has to know. You can adopt a healthier diet by eating a vegetarian meal two or three times a week. You can enjoy a meal without meat just as much as a meat-based one, and you will reduce the amount of animal fat in your diet. Regularly eat foods that are abundant in calcium. Dark-colored leafy vegetables, almonds and other nuts, and milk and cheese all provide a healthy amount of calcium to your diet. Sardines and soy milk are good sources of calcium, too. Calcium is needed to maintain bone and teeth health. Osteoporosis which is a bone disorder caused by brittle bones, is caused by a lack of calcium. Osteoporosis starts slowly, but can quickly progress into a serious illness leading to weak bones. To help you get healthy quicker after being sick, it is best that you consume food that is high in zinc. To avoid illnesses you can use zinc to help strengthen your immune system. You will find zinc in strawberries, peaches, pumpkin seeds and wheat. Depending on how these foods are prepared, each of these are typically healthy, and offer other nutrition benefits as well. Make sure your diet consists of eating foods that are baked instead of fried. You can lower how many calories, carbs and oils you eat by eating baked foods and that’s why they’re better for you. Shifting your diet to favor baked foods over fried ones will also provide you with more energy throughout the day. Saute your vegetables in a small amount of water instead of artery blocking oil. Steaming and boiling vegetables are tasty and better for you than fried ones. However, if you decide that a little oil must be used, then use a small amount of vegetable oil rather than butter or margarine. Having these recipes readily available can help you stay focused on healthy eating. When you have a wide range of meal choices to prepare, you will not lose interest in your diet. If you are pregnant, be sure you get plenty of iron from the foods in your diet. The normal adult female should get 18mg of iron daily; however, while pregnant, the intake should be at 27mg. The developing baby needs iron, and not enough iron can lead to anemia and pregnancy issues. If you aren’t sure if a food is healthy and you just assume it is, you can be making a mistake. A food such as seven-grain bread might seem healthy, but on closer examination of the label you see there are no whole-grains in it. Nutrition labels are important, as they must list the true ingredients in a product and are less misleading then the promotional product packaging. Nutrition Tips To Help You Live A Healthier Life If you want to be healthy, you need to eat nutritiously. Sadly, many people who aren’t making the right choices think that they are. Just because you know what you should do, does not mean you will do it. These tips will help you change your life for the better. When working to craft a nutritious diet plan, make sure you limit your intake of packaged foods. This is vital because these kinds of foods have tons of sugars and fats that aren’t healthy for you. If you want good health benefits, only shop for the freshest fruits, vegetables and meats at your grocer. No diet is complete if it does not account for breakfast. Breakfast really is the most critical meal, because it jump starts your metabolism and floods your body with needed nutrients after hours of not eating. Make fruit smoothies yourself. The ones you get at the store have too many calories. Controlling the foods that you make is important. That way you can really have it fit into your diet. Try out ingredients like fresh fruit, Greek yogurt, and skim milk to ensure that your smoothie is both low in calories and delicious. Putting together a delicious smoothie can be enjoyable and fulfilling. Try this to make it even more delicious and nutritious. Add a bit of flax seed oil into your smoothie, or perhaps a bit of cocoa with antioxidants. Adding one of these ingredients is going to not only give the flavor a boost but also help your immune system. Make sure to mix your diet up with nuts, fish, lean meats, low-fat dairy and whole grains. When you eat a variety of foods, you will get the right nutrition for your body and you won’t need a lot of supplements. Choose foods rich in inulin. It is in great foods, like leeks and garlic. It’s a carbohydrate that will help digestive health as well as lose weight. Garlic also has a positive impact on your immune system. If you do not want your breath to smell like garlic, you can blanch it or take a supplement without an odor. When you cook, your best choices for cooking meats include baking, roasting, broiling and grilling. If you use butter during preparation, try using cooking spray instead. If your meal calls for browned beef, be sure to strain the juice out of it, then rinse the beef with hot water. This minimizes the fat you will consume when eating the beef. Never assume that popping lots of vitamin pills makes your diet healthy. Supplements should serve as complements to a solid diet. It’s better to not take multiple multivitamins daily and concentrate on eating healthier foods rather than relying on a supplement. Misjudging your diet is easy. Small miscalculations can lead to obesity. Make changes to your diet now by using the tips you have just read. Put the tips you learned here to use and you will be making smarter choices when it comes to your nutrition.
Photo by Zachariah Aussi on Unsplash Javascript has really conquered the world of development, most cutting-edge technologies have been implemented in it. Projects like nodeJs, React and Angular are being adopted significantly, not just stop there but debate upon which is better. One key aspect that’s common to all such frameworks is javascript in general. No matter how complex these frameworks are they are a javascript library, and this blog is an attempt to shed some light on javascript and event loop in detail. TL;DR Event loop is a semi-infinite loop, polling and blocking on the OS until some in a set of file descriptors are… Photo by Francesco De Tommaso on Unsplash Back story: Back in 2013/12 when React was released it was widely popular because of virtual DOM. DOM updates are time-consuming and synchronous and so multiple updates to DOM are to be batched. So react updates DOM in two phases render and commit. The render phase is to understand what has changed, as in if DOM properties are updated or new nodes are added, and so on. So react parses through all the DOM nodes and constructs a JSON object, which is virtual DOM. I’ve abstracted the process of reconciliation into a single line, I’ll write more about this in the… Photo by Ivan Bandura on Unsplash I’ll be referencing to factory in this article, below links should help understand what a factory is. Sometimes the creation of an object can complex, it could involve multiple steps. Let's take an example of a construction business, there’s usually a contractor who is responsible for the following: 1. What’s the design of the house? 2. What kind of materials to choose? 3. Define steps to build house. 4. Orchestrate steps one by one. 5. … Photo by Mark König on Unsplash Before continuing, I strongly recommend getting a good grasp of the Factory pattern. In factory pattern, we have an abstraction for creating new objects using a factory. A factory can create a family of related products. Creating related products makes sense, but it could go out of hand, what if you want to mix and match these products? Well, the answer is Prototype pattern. Let’s consider the following factories: We have three car factories: Ford, Ferrari, and Tesla. By applying… Defines an interface to create products in superclass, but let the subclass decide the type of object. A general thumb rule: create an interface before implementing any logic. So in factory pattern, we define an interface that specifies the superclass of the objects that’ll be created. Concrete factory decide which concrete objects to create based on the superclass. The key take away from this pattern is to not instantiate objects in your app logic but to offload it to some class, factory in this case. We’ll take a step back and look at why and how of a factory pattern. Bridge to connect two places or ideas in this case. Decouples abstraction from implementation so that both can vary independently. Breakdown of definition: Abstraction is an idea and is likely to change, if your implementors are closely associated with any abstraction, implementations will have to re-implement to incorporate these changes. Design patterns always advocate SEPARATION OF CONCERNS, a thumb-rule for extendable code. Let’s consider the following Car hierarchy: Simple inheritance This is a pretty simple design and we are only concerned about implementing speed function. Ford and Ferrari roar in their own unique styles which is represented by system.out.println. This design works for most cases but let’s say we needed… Since the raise of webRTC technology many apps have been providing video-call which is pretty amazing. Developers all over the world have been building POC to test out. There’s not much in depth knowledge as to how things work under the hood, results in uncertain behaviour of the apps. We first need to understand is that WebRTC technology uses UDP to commence communication instead of TCP. To quickly understand the difference between TCP and UDP is “TCP packets send acknowledgement to the sender and UDP doesn’t”. This makes UDP best candidate for video calling. Many of us are used to… In the recent years many applications have been implemented in nodejs stack and its no wonder given the scalability, so lets look into a few real-world problems and tools to solve them. Its so easy to setup nodeJs isnt it, write an index.js with some basic js in it and run node index.js But doing so is not enough when it comes to production environments. Node is designed to use multiple cores on your system and with not much configuration your application will only use single core for processing. … Uday Reddy Programmer \| Starup/Farming enthusiast Get the Medium app
Posted on Leave a comment Why can’t we breathe underwater ? \| Natural Hub Exploring the depths of the seas with all the richness they contain, fish of all colours, luxuriant vegetation and caves, has fascinated humans for decades. But is this possible without using scuba diving equipment? Well, no, because humans can’t breathe underwater. Our respiratory system is based on two stages, inhalation and exhalation. Our lungs breathe in oxygen and exhale carbon dioxide. The oxygen used by humans is in its gaseous form, and unfortunately for us, the oxygen in the water is dissolved and our lungs are unable to extract it. Fish need their gills to pump water from their mouths and extract oxygen from them. So, to breathe underwater, you must have gills. Man can always realize his deep-sea dreams by taking air with him to breathe. Ref: Knowledge: Learn more about the universe App by : Selmi Houssem For more download this app Leave a Reply
How To Throw Your Voice Maher Studios gets a lot of email about this subject. How can I throw my voice? I do not believe you can teach me to throw my voice. In the past I have tried and I failed. You say the voice always comes from you, but the ear can’t detect the direction of sound. I tried this and everyone knew it was me. And I did a pretty good job of not moving my lips. How far will I be able to throw my voice? So today we are going to talk about how to throw your voice. If you have tried in the past and failed, it is because of improper training. (If you received any at all.) Is Throwing Your Voice Real? But the truth is: the voice will always come from the ventriloquist. Never from some point apart from him or her. Throwing your voice is an illusion. Like any good illusion, it requires misdirection. So for my friend above, when she stood in front of people and tried to make them believe the sound was coming from somewhere else – her failure was a lack of training. For the young man who has tried to throw his voice in the past – he either had improper or no training. Chances are he didn’t understand that the voice doesn’t actually get “thrown.” How Does The Illusion Of Throwing Your Voice Work? There are several steps to creating this illusion. 1. You need to understand how the human brain deals with sound. When we hear a sound, we like to know where it is coming from. As you watch television or a movie, the sound is actually coming from speakers. However because your eyes see the person on the screen moving their lips, your brain links the two and you view the event as if the people on the screen are talking. When you drive down the street and hear a siren, you look around to determine where the sound is coming from. You see the fire truck or ambulance and your mind links the two. Throwing your voice relies on this process. When the brain has linked the sound, the illusion is complete. But there are tricks involved to make this happen. 2. You must be able to do ventriloquism properly. This means taking the time to learn how to do it. Studying and practicing the skill. Not just watching a couple of YouTube videos and then thinking you can do it. You need to understand how to pronounce and project words without moving your lips. You must be able to change your voice for a puppet, or change, squeeze and modulate it for a “distant voice.” There is a lot going on there – and you must be able to perform it to create the illusion of “throwing your voice.” 3. You must provide believable, appropriate misdirection. This is where acting classes come in handy. A ventriloquist must be able to act and react as if the voice comes from another source. In an earlier article, I shared a video of David Strassman on the Hey Hey It’s Saturday TV show. Below, I want to share a different performance on the same show. This clip features “voice throwing.” Watch it and then we will break it down. David “threw” his voice to Chuck when he was sitting in the chair. As you watched it, chances are, you felt as if Chuck were actually talking. How did this happen? David began by introducing Chuck to the audience with a short routine. He used several techniques during this. He was: • animating the puppet, • keeping his lips still, • using a different voice and • giving Chuck a defined personality, By doing all of this, your brain accepted the voice was coming from Chuck. Later, when David was working with Ted E Bare, he created the illusion of voice throwing by: • Using Chuck’s voice, • Looking in Chuck’s direction • Having Ted E. Bare look and interact with the Chuck figure. While it is easy to explain, it is much harder to perform. David Strassman has mastered all of the topics we’ve talked about in this article. And if you learn to do ventriloquism properly, you can use these techniques to “throw your voice” too. %d bloggers like this:
Oct 4, 2017 \| by Centre What are the drivers of wellbeing inequality? Download Drivers of inequality (full report) Download the briefing When we published our report earlier this year on Measuring Wellbeing Inequalities across Britain, the hard part wasn’t convincing people about the value of wellbeing: it was explaining the potentially pivotal idea of wellbeing inequalities. We say ‘potentially pivotal’ because looking at inequality of wellbeing is a new and emerging approach to understanding how people and communities are thriving or struggling. But while it’s harder to find and understand what differences exist within and between populations, and what might drive such otherwise hidden variations, we think it could lead to some insightful findings. This kind of data is already used widely when thinking about health and income inequalities. But can insight into differences in how people experience their lives, and why, inform how we can best use local resources? Wellbeing is potentially a better and more useful overarching measure then health or income alone, because it builds on both of these and adds other measures to create a more nuanced overall picture. Why does looking at inequality in wellbeing matter? Because averages can hide the different experiences of those within and between populations. Average wellbeing can be high in an area, and mask people left behind in economic growth. The Measuring Wellbeing report provided data on the levels of wellbeing inequality in local authorities across the UK and posed some questions about what factors influence this. The research also went some way to helping us understand what measures and conceptualisations of wellbeing inequality are most useful. Drivers of wellbeing inequality report: key findings Our new exploratory research paper in this series, unearthed some interesting insights for those working in local authorities, as well as important questions. 1. Income particularly matters. Deprivation and lower median incomes are both associated with higher wellbeing inequality at local authority level. Unemployment is also associated with inequality in life satisfaction, though the effect is less consistent. 2. Rural areas are likely to have an average higher wellbeing, but are also associated with higher wellbeing inequality. There was some evidence to suggest this could be due to the effects of unemployment. Findings such as this provides a space to question what is really happening in peoples’ lives in a particular local area, and what think through what support people who emerge as the ‘hidden unhappy’ in a given area may need. It also offers those working in the research community guidance on where future research may best enhance existing knowledge. 3. The lower your wellbeing, the bigger the impact access to green space and heritage makes. Greater engagement in heritage activities and the use of green space for health or exercise is associated with lower inequality in life satisfaction in local authorities. This is despite the fact that increased engagement in these activities is not associated with improved average life satisfaction. While the report pulls out key findings at a national level, those working in local areas can learn much more by delving into the local data, using it alongside existing local measures and insight to triangulate data to inform decision-making. Sign up for our Evidence alerts Sign up to receive resources and evidence as they are released.
Cost of Firewood From Open Source Ecology Jump to: navigation, search See informative article: Firewood usage is large - about 5 cords per year. Each cord is 2500-5000 lb. That makes 12,500 to 25,000 lbs - or 6-12 tons. There are 12 million wood stoves in the USA. Average gallons of fuel use in the USA is 10,000 miles equivalent - or 500 gallons - or 4000 lb of fuel. That is the equivalent of wood house heating usage. Cost of a cord is $150-$500 - say $300 on avearage. 5 cords is $1500 for a season of wood heating. Gas heat for the winter is about $700. One season of firewood gets you 5kW of installed electricity from solar panels at the current price of 30 cents per watt at Makes sense to use electric PV heat and save some trees.
Last updated Malware (a portmanteau for malicious software) is any software intentionally designed to cause damage to a computer, server, client, or computer network. [1] [2] By contrast, software that causes unintentional harm due to some deficiency is typically described as a software bug. [3] A wide variety of malware types exist, including computer viruses, worms, Trojan horses, ransomware, spyware, adware, rogue software, wiper and scareware. Programs are also considered malware if they secretly act against the interests of the computer user. For example, at one point Sony music Compact discs silently installed a rootkit on purchasers' computers with the intention of preventing illicit copying, but which also reported on users' listening habits, and unintentionally created extra security vulnerabilities. [4] A range of antivirus software, firewalls and other strategies are used to help protect against the introduction of malware, to help detect it if it is already present, and to recover from malware-associated malicious activity and attacks. [5] Malware statics 2011-03-16-en.svg Many early infectious programs, including the first Internet Worm, were written as experiments or pranks. [6] Today, malware is used by both black hat hackers and governments, to steal personal, financial, or business information. [7] [8] Malware is sometimes used broadly against government or corporate websites to gather guarded information, [9] or to disrupt their operation in general. However, malware can be used against individuals to gain information such as personal identification numbers or details, bank or credit card numbers, and passwords. Since the rise of widespread broadband Internet access, malicious software has more frequently been designed for profit. Since 2003, the majority of widespread viruses and worms have been designed to take control of users' computers for illicit purposes. [10] Infected "zombie computers" can be used to send email spam, to host contraband data such as child pornography, [11] or to engage in distributed denial-of-service attacks as a form of extortion. [12] Ransomware affects an infected computer system in some way, and demands payment to bring it back to its normal state. There are two variations of ransomware, being crypto ransomware and locker ransomware. [14] With the locker ransomware just locking down a computer system without encrypting its contents. Whereas the traditional ransomware is one that locks down a system and encrypts its contents. For example, programs such as CryptoLocker encrypt files securely, and only decrypt them on payment of a substantial sum of money. [15] Infectious malware The best-known types of malware, viruses and worms, are known for the manner in which they spread, rather than any specific types of behavior. A computer virus is software that embeds itself in some other executable software (including the operating system itself) on the target system without the user's knowledge and consent and when it is run, the virus is spread to other executables. On the other hand, a worm is a stand-alone malware software that actively transmits itself over a network to infect other computers and can copy itself without infecting files. These definitions lead to the observation that a virus requires the user to run an infected software or operating system for the virus to spread, whereas a worm spreads itself. [19] These categories are not mutually exclusive, so malware may use multiple techniques. [20] This section only applies to malware designed to operate undetected, not sabotage and ransomware. A computer virus is software usually hidden within another seemingly innocuous program that can produce copies of itself and insert them into other programs or files, and that usually performs a harmful action (such as destroying data). [21] An example of this is a PE infection, a technique, usually used to spread malware, that inserts extra data or executable code into PE files. [22] Screen-locking ransomware 'Lock-screens', or screen lockers is a type of “cyber police” ransomware that blocks screens on Windows or Android devices with a false accusation in harvesting illegal content, trying to scare the victims into paying up a fee. [23] Jisut and SLocker impact Android devices more than other lock-screens, with Jisut making up nearly 60 percent of all Android ransomware detections. [24] Encryption-based ransomware Trojan horses In spring 2017 Mac users were hit by the new version of Proton Remote Access Trojan (RAT) [33] trained to extract password data from various sources, such as browser auto-fill data, the Mac-OS keychain, and password vaults. [34] Since the beginning of 2015, a sizable portion of malware has been utilizing a combination of many techniques designed to avoid detection and analysis. [41] From the more common, to the least common: 1. evasion of analysis and detection by fingerprinting the environment when executed. [42] 4. obfuscating internal data so that automated tools do not detect the malware. [44] Security defects in software Malware exploits security defects (security bugs or vulnerabilities) in the design of the operating system, in applications (such as browsers, e.g. older versions of Microsoft Internet Explorer supported by Windows XP [49] ), or in vulnerable versions of browser plugins such as Adobe Flash Player, Adobe Acrobat or Reader, or Java SE. [50] [51] Sometimes even installing new versions of such plugins does not automatically uninstall old versions. Security advisories from plug-in providers announce security-related updates. [52] Common vulnerabilities are assigned CVE IDs and listed in the US National Vulnerability Database. Secunia PSI [53] is an example of software, free for personal use, that will check a PC for vulnerable out-of-date software, and attempt to update it. Anti-malware is a continuously growing threat to malware detection. [54] According to Symantec’s 2018 Internet Security Threat Report (ISTR), malware variants number has got up to 669,947,865 in 2017, which is the double of malware variants in 2016. [54] Insecure design or user error Early PCs had to be booted from floppy disks. When built-in hard drives became common, the operating system was normally started from them, but it was possible to boot from another boot device if available, such as a floppy disk, CD-ROM, DVD-ROM, USB flash drive or network. It was common to configure the computer to boot from one of these devices when available. Normally none would be available; the user would intentionally insert, say, a CD into the optical drive to boot the computer in some special way, for example, to install an operating system. Even without booting, computers can be configured to execute software on some media as soon as they become available, e.g. to autorun a CD or USB device when inserted. Malware distributors would trick the user into booting or running from an infected device or medium. For example, a virus could make an infected computer add autorunnable code to any USB stick plugged into it. Anyone who then attached the stick to another computer set to autorun from USB would in turn become infected, and also pass on the infection in the same way. [55] More generally, any device that plugs into a USB port - even lights, fans, speakers, toys, or peripherals such as a digital microscope - can be used to spread malware. Devices can be infected during manufacturing or supply if quality control is inadequate. [55] This form of infection can largely be avoided by setting up computers by default to boot from the internal hard drive, if available, and not to autorun from devices. [55] Intentional booting from another device is always possible by pressing certain keys during boot. Over-privileged users and over-privileged code In computing, privilege refers to how much a user or program is allowed to modify a system. In poorly designed computer systems, both users and programs can be assigned more privileges than they should have, and malware can take advantage of this. The two ways that malware does this is through overprivileged users and overprivileged code.[ citation needed ] Use of the same operating system Anti-malware strategies As malware attacks become more frequent, attention has begun to shift from viruses and spyware protection, to malware protection, and programs that have been specifically developed to combat malware. (Other preventive and recovery measures, such as backup and recovery methods, are mentioned in the computer virus article). Reboot to restore software is also useful for mitigating malware by rolling back malicious alterations. Anti-virus and anti-malware software A specific component of anti-virus and anti-malware software, commonly referred to as an on-access or real-time scanner, hooks deep into the operating system's core or kernel and functions in a manner similar to how certain malware itself would attempt to operate, though with the user's informed permission for protecting the system. Any time the operating system accesses a file, the on-access scanner checks if the file is a 'legitimate' file or not. If the file is identified as malware by the scanner, the access operation will be stopped, the file will be dealt with by the scanner in a pre-defined way (how the anti-virus program was configured during/post installation), and the user will be notified.[ citation needed ] This may have a considerable performance impact on the operating system, though the degree of impact is dependent on how well the scanner was programmed. The goal is to stop any operations the malware may attempt on the system before they occur, including activities which might exploit bugs or trigger unexpected operating system behavior. Anti-malware programs can combat malware in two ways: Examples of Microsoft Windows antivirus and anti-malware software include the optional Microsoft Security Essentials [62] (for Windows XP, Vista, and Windows 7) for real-time protection, the Windows Malicious Software Removal Tool [63] (now included with Windows (Security) Updates on "Patch Tuesday", the second Tuesday of each month), and Windows Defender (an optional download in the case of Windows XP, incorporating MSE functionality in the case of Windows 8 and later). [64] Additionally, several capable antivirus software programs are available for free download from the Internet (usually restricted to non-commercial use). [65] Tests found some free programs to be competitive with commercial ones. [65] [66] [67] Microsoft's System File Checker can be used to check for and repair corrupted system files. Some viruses disable System Restore and other important Windows tools such as Task Manager and Command Prompt. Many such viruses can be removed by rebooting the computer, entering Windows safe mode with networking, [68] and then using system tools or Microsoft Safety Scanner. [69] Hardware implants can be of any type, so there can be no general way to detect them. Website security scans As malware also harms the compromised websites (by breaking reputation, blacklisting in search engines, etc.), some websites offer vulnerability scanning. [70] Such scans check the website, detect malware, may note outdated software, and may report known security issues. "Air gap" isolation or "parallel network" As a last resort, computers can be protected from malware, and infected computers can be prevented from disseminating trusted information, by imposing an "air gap" (i.e. completely disconnecting them from all other networks). However, malware can still cross the air gap in some situations. Stuxnet is an example of malware that is introduced to the target environment via a USB drive. "AirHopper", [71] "BitWhisper", [72] "GSMem" [73] and "Fansmitter" [74] are four techniques introduced by researchers that can leak data from air-gapped computers using electromagnetic, thermal and acoustic emissions. Grayware (sometimes spelled as greyware) is a term applied to unwanted applications or files that are not classified as malware, but can worsen the performance of computers and may cause security risks. [75] Another term, potentially unwanted program (PUP) or potentially unwanted application (PUA), [77] refers to applications that would be considered unwanted despite often having been downloaded by the user, possibly after failing to read a download agreement. PUPs include spyware, adware, and fraudulent dialers. Many security products classify unauthorised key generators as grayware, although they frequently carry true malware in addition to their ostensible purpose. Software maker Malwarebytes lists several criteria for classifying a program as a PUP. [78] Some types of adware (using stolen certificates) turn off anti-malware and virus protection; technical remedies are available. [45] The first worms, network-borne infectious programs, originated not on personal computers, but on multitasking Unix systems. The first well-known worm was the Internet Worm of 1988, which infected SunOS and VAX BSD systems. Unlike a virus, this worm did not insert itself into other programs. Instead, it exploited security holes (vulnerabilities) in network server programs and started itself running as a separate process. [81] This same behavior is used by today's worms as well. [82] [83] Academic research The notion of a self-reproducing computer program can be traced back to initial theories about the operation of complex automata. [85] John von Neumann showed that in theory a program could reproduce itself. This constituted a plausibility result in computability theory. Fred Cohen experimented with computer viruses and confirmed Neumann's postulate and investigated other properties of malware such as detectability and self-obfuscation using rudimentary encryption. His 1987 doctoral dissertation was on the subject of computer viruses. [86] The combination of cryptographic technology as part of the payload of the virus, exploiting it for attack purposes was initialized and investigated from the mid 1990s, and includes initial ransomware and evasion ideas. [87] See also Related Research Articles Adware, often called advertising-supported software by its developers, is software that generates revenue for its developer by automatically generating online advertisements in the user interface of the software or on a screen presented to the user during the installation process. The software may generate two types of revenue: one is for the display of the advertisement and another on a "pay-per-click" basis, if the user clicks on the advertisement. Some advertisements also act as spyware, collecting and reporting data about the user, to be sold or used for targeted advertising or user profiling. The software may implement advertisements in a variety of ways, including a static box display, a banner display, full screen, a video, pop-up ad or in some other form. All forms of advertising carry health, ethical, privacy and security risks for users. Computer worm Standalone malware computer program that replicates itself in order to spread to other computers A computer worm is a standalone malware computer program that replicates itself in order to spread to other computers. It often uses a computer network to spread itself, relying on security failures on the target computer to access it. It will use this machine as a host to scan and infect other computers. When these new worm-invaded computers are controlled, the worm will continue to scan and infect other computers using these computers as hosts, and this behaviour will continue. Computer worms use recursive methods to copy themselves without host programs and distribute themselves based on the law of exponential growth, thus controlling and infecting more and more computers in a short time. Worms almost always cause at least some harm to the network, even if only by consuming bandwidth, whereas viruses almost always corrupt or modify files on a targeted computer. In computing terminology, a macro virus is a virus that is written in a macro language: a programming language which is embedded inside a software application. Some applications, such as Microsoft Office, Excel, PowerPoint allow macro programs to be embedded in documents such that the macros are run automatically when the document is opened, and this provides a distinct mechanism by which malicious computer instructions can spread. This is one reason it can be dangerous to open unexpected attachments in e-mails. Many antivirus programs can detect macro viruses; however, the macro virus' behavior can still be difficult to detect. Spyware Malware that collects and transmits user information without their knowledge Spyware is software with malicious behavior that aims to gather information about a person or organization and send it to another entity in a way that harms the user. For example, by violating their privacy or endangering their device's security. This behavior may be present in malware as well as in legitimate software. Websites may engage in spyware behaviors like web tracking. Hardware devices may also be affected. Spyware is frequently associated with advertising and involves many of the same issues. Because these behaviors are so common, and can have non-harmful uses, providing a precise definition of spyware is a difficult task. Trojan horse (computing) Type of malware In computing, a Trojan horse is any malware which misleads users of its true intent. The term is derived from the Ancient Greek story of the deceptive Trojan Horse that led to the fall of the city of Troy. Timeline of computer viruses and worms computer malware timeline This timeline of computer viruses and worms presents a chronological timeline of noteworthy computer viruses, computer worms, Trojan horses, similar malware, related research and events. Antivirus software Computer software to defend against malicious computer viruses Linux malware includes viruses, Trojans, worms and other types of malware that affect the Linux operating system. Linux, Unix and other Unix-like computer operating systems are generally regarded as very well-protected against, but not immune to, computer viruses. The compilation of a unified list of computer viruses is made difficult because of naming. To aid the fight against computer viruses and other types of malicious software, many security advisory organizations and developers of anti-virus software compile and publish lists of viruses. When a new virus appears, the rush begins to identify and understand it as well as develop appropriate counter-measures to stop its propagation. Along the way, a name is attached to the virus. As the developers of anti-virus software compete partly based on how quickly they react to the new threat, they usually study and name the viruses independently. By the time the virus is identified, many names denote the same virus. Scareware is a form of malware which uses social engineering to cause shock, anxiety, or the perception of a threat in order to manipulate users into buying unwanted software. Scareware is part of a class of malicious software that includes rogue security software, ransomware and other scam software that tricks users into believing their computer is infected with a virus, then suggests that they download and pay for reakantivirus software to remove it. Usually the virus isn't real and the software is non-functional or malware itself. According to the Anti-Phishing Working Group, the number of scareware packages in circulation rose from 2,850 to 9,287 in the second half of 2008. In the first half of 2009, the APWG identified a 585% increase in scareware programs. Norton AntiVirus Anti-virus software Microsoft Defender Microsoft Defender Antivirus is an anti-malware component of Microsoft Windows. It was first released as a downloadable free anti-spyware program for Windows XP, and was later shipped with Windows Vista and Windows 7. It has evolved into a full antivirus program, replacing Microsoft Security Essentials, as part of Windows 8 and later versions. Mobile malware is malicious software that targets mobile phones or wireless-enabled Personal digital assistants (PDA), by causing the collapse of the system and loss or leakage of confidential information. As wireless phones and PDA networks have become more and more common and have grown in complexity, it has become increasingly difficult to ensure their safety and security against electronic attacks in the form of viruses or other malware. WinFixer Rogue security software WinFixer was a family of scareware rogue security programs developed by Winsoftware which claimed to repair computer system problems on Microsoft Windows computers if a user purchased the full version of the software. The software was mainly installed without the user's consent. McAfee claimed that "the primary function of the free version appears to be to alarm the user into paying for registration, at least partially based on false or erroneous detections." The program prompted the user to purchase a paid copy of the program. Rogue security software is a form of malicious software and internet fraud that misleads users into believing there is a virus on their computer and aims to convince them to pay for a fake malware removal tool that actually installs malware on their computer. It is a form of scareware that manipulates users through fear, and a form of ransomware. Rogue security software has been a serious security threat in desktop computing since 2008. Two of the earliest examples to gain infamy were BraveSentry and SpySheriff. Kaspersky Anti-Virus Kaspersky Anti-Virus is a proprietary antivirus program developed by Kaspersky Lab. It is designed to protect users from malware and is primarily designed for computers running Microsoft Windows and macOS, although a version for Linux is available for business consumers. HitmanPro is a portable antimalware program, which aims to detect and remove malicious files and registry entries related to rootkits, trojans, viruses, worms, spyware, adware, rogue antivirus programs, ransomware, and other malware from infected computers. Computer virus Computer program that modifies other programs to replicate itself and spread 1. "Defining Malware: FAQ". Retrieved 10 September 2009. 5. "Protect Your Computer from Malware". 11 October 2012. Retrieved 26 August 2013. 7. "Malware". FEDERAL TRADE COMMISSION- CONSUMER INFORMATION. Retrieved 27 March 2014. 10. "Malware Revolution: A Change in Target". March 2007. 11. "Child Porn: Malware's Ultimate Evil". November 2009. 12. PC World – Zombie PCs: Silent, Growing Threat. 13. "Peer To Peer Information". NORTH CAROLINA STATE UNIVERSITY. Retrieved 25 March 2011. 17. "Shamoon is latest malware to target energy sector" . Retrieved 18 February 2015. 19. "computer virus – Encyclopædia Britannica". Retrieved 28 April 2013. 20. "All about Malware and Information Privacy - TechAcute". 31 August 2014. 23. "Rise of Android Ransomware, research" (PDF). ESET. 24. "State of Malware, research" (PDF). Malwarebytes. 27. "Trojan Horse Definition" . Retrieved 5 April 2012. 28. "Trojan horse". Webopedia. Retrieved 5 April 2012. 29. "What is Trojan horse? – Definition from" . Retrieved 5 April 2012. 33. "Proton Mac Trojan Has Apple Code Signing Signatures Sold to Customers for $50k". AppleInsider. 34. "Non-Windows Malware". Betanews. 24 August 2017. 36. "". Retrieved 15 April 2010. 37. Vincentas (11 July 2013). "Malware in". Spyware Loop. Retrieved 28 July 2013. 41. "Evasive malware goes mainstream - Help Net Security". 22 April 2015. 43. The Four Most Common Evasive Techniques Used by Malware. 27 April 2015. 45. 1 2 Casey, Henry T. (25 November 2015). "Latest adware disables antivirus software". Tom's Guide. . Retrieved 25 November 2015. 47. "Penn State WebAccess Secure Login". doi: 10.1145/3365001 . Retrieved 29 February 2020. 48. "Malware Dynamic Analysis Evasion Techniques: A Survey". ResearchGate. Retrieved 29 February 2020. 49. "Global Web Browser... Security Trends" (PDF). Kaspersky lab. November 2012. 52. "Adobe Security bulletins and advisories". Retrieved 19 January 2013. 55. 1 2 3 "USB devices spreading viruses". CNET. CBS Interactive. Retrieved 18 February 2015. 58. "Malware, viruses, worms, Trojan horses and spyware". Retrieved 14 November 2020. 60. "How Antivirus Software Works?" . Retrieved 16 October 2015. 61. Souppaya, Murugiah; Scarfone, Karen (July 2013). "Guide to Malware Incident Prevention and Handling for Desktops and Laptops". National Institute of Standards and Technology. doi:10.6028/nist.sp.800-83r1.Cite journal requires \|journal= (help) 62. "Microsoft Security Essentials". Microsoft. Retrieved 21 June 2012. 64. "Windows Defender". Microsoft. Archived from the original on 22 June 2012. Retrieved 21 June 2012. 65. 1 2 Rubenking, Neil J. (8 January 2014). "The Best Free Antivirus for 2014". 67. "Quickly identify malware running on your PC". 68. "How do I remove a computer virus?". Microsoft. Retrieved 26 August 2013. 69. "Microsoft Safety Scanner". Microsoft. Retrieved 26 August 2013. 70. "Example Safe Browsing Diagnostic page" . Retrieved 19 January 2013. 76. "Threat Encyclopedia – Generic Grayware". Trend Micro. Retrieved 27 November 2012. 78. "PUP Criteria". Retrieved 13 February 2015. 83. "Malware: Types, Protection, Prevention, Detection & Removal - Ultimate Guide". EasyTechGuides. 84. "Beware of Word Document Viruses". Retrieved 25 September 2017.
Thursday, April 16, 2015 Real Life Super Heroes: A Growing Movement In light of the success of the Avengers movies and most of the movies based on super hero comic books, it is interesting to point out that there is a real-life superhero movement that is growing, much to the dismay of many law enforcement officials across the United States. A movement of ordinary citizens, both men and women, has taken it upon themselves to protect the cities and their respective neighborhoods. Though not authorized to do so in any official or legal capacity, these citizens have assumed the role of crime fighters. What makes them particularly fascinating and unique is that they do it dressed in an array of super hero attire. What is the Super Hero Movement? According to Elizabeth Flock’s article, “Real-Life Super Hero Growing, but Not Getting Good Reception from the Police”, the superhero movement is a growing trend of ordinary citizens who try to patrol and fight crime in their neighborhoods and other needed places. The real-life superheroes wear super hero types of costumes while on patrol. Flock’s article points out that the website, RealLifeSuperHeroes.org, claims to have 720 members. The movement continues to grow and has also sought to become more organized. Some of the real life superhero members have proposed establishing uniform standards. Some have published tutorials on how people can join. Some members are considering establishing a sanctioning body to oversee the movement. The growing real-life superhero trend may have received a boost from the HBO documentary, “Superheroes”, not to mention the movie, “Kick-Ass”, which is about a boy with special powers who decides to become a superhero. Edward Stinson is a Florida-based writer who advises real-life superheroes. Flock quotes from Stinson’s MSNBC interview. Stinson said, “The movement has grown majorly. What I tell these guys is, ‘You’re no longer in the shadows. You’re in a new era. ... Build trust. Set standards. Make the real-life superheroes work to earn that title and take some kind of oath.’ ” Who are Some of the Super Heroes? To some, the real life superheroes are icons demonstrating to the public that anyone can make a difference. Some members of the movement include such icons as Ragensi from Los Angeles who fights his crime-perpetrating demons there. Another icon is Mr. Xtreme who believes that doing good starts with the willingness to try. There is also Thanatos, the Dark Avenger, who patrols the streets in Vancouver. Another Vancouver real-life superhero is Knight Owl. Phantom Zero fights crime across the river from New York City. Catching media attention most recently is Seattle-based real-life superhero, Phoenix Jones, who fights crime wearing a gold and black superhero suit and bullet-proof vest. Phoenix Jones is married to another crime fighting superhero called Purple Reign. These are just a few of many real life superheroes in the Real Life Superhero Project. Read profiles of an array of them at the Real Life Hero Project listed in the Reference section. What Objections Do Police have to the Real Life Superheroes? The crime-fighting self-proclaimed superheroes have attracted the fascination of a multitude of fans, but police are not among the adoring fans. According to Flock’s article, police feel that such vigilantes risk causing harm to themselves and others. Recently, Benjamin Francis, who is Seattle’s superhero, Phoenix Jones, was arrested for using pepper spray on a group of people he claims were fighting. Police disagree with Jones and he is facing assault charges for the incident. Mark Wayne Williams, also known as Michigan’s Batman, was caught by authorities hanging from a building wearing a Batman costume. Williams was arrested for trespassing and possession of dangerous weapons (his baton, chemical spray and weighted gloves). Despite the arrest of some well-intentioned superheroes, the movement continues to grow. The drama that inevitably accompanies the lives of the real-life superheroes likely furthers the cause and the movement. Picture credit: Ben Smith
We hear about the inverse relationship between time and money. Spend more money so you can save time. Save money, and you lose time. I think most people would like both. Money is touchable, and see-able. You can make it, use it and trade it. Time cannot be created. You can’t save it or trade it. Can’t touch it, smell it or see it. You live and then you die. Time is a man-made idea that quantifies and justifies our lives. The average person in the United States lives for 78.54 years or 28667 days. When asked on their deathbed, people resounding say they wish they had more time. You can use it, abuse it, vilify or justify it. The one key element to time is you have some. Not sure how much. Not sure when the clock will stop. But IT does stop for everyone. Advertising is a function of time. You use it to increase customer counts. You invest in it to grow your business. Because you want to grow. You have a dream. And there’s only so much time to make it happen. Many business owners waste their efforts on bad advertising. They trade money for time and they lose both. They chase bad ideas and bad customers. They waste days. 28667 days in a life. If you’re 40, you have 14067 days left. Every year, your advertising is failing your business is a waste of 365 days. There’s no TIME. Good advertising combined with a good business owner makes magic for the bank account. It doesn’t give you back time. It gets you to your dreams faster, so you can enjoy the fruits of your labour. Good advertising is using the right message connecting to your customers, driving traffic to your business. Notice how I didn’t say, “Good advertising is the right message to the right people at the right time”. That’s what marketing weasels say. There is no right time when connecting the message with customers. The right time was six years ago. The second best time was yesterday. There’s NO right time. Because all we have is NOW. The right time is now. Somewhere between tomorrow and 14067 days, time will not be a renewable resource. Mick Jagger was wrong. Time is not on your side, no it isn’t.
Data Analyst Vs. Actuary Both data analysts and actuaries use information technology to compile statistical data to create reports, charts and other information. The compiled data is used to analyze other subsets of data in a variety of ways. Data analysts focus on how to manipulate massive amounts of data and ensure its accuracy, while actuaries use data to calculate potential risks and future financial stability of organizations. Data Analysts Data analysts ensure the integrity of an organization’s stored data on computer systems and networks. They often find the most accurate ways to report the data they analyze. In some cases, data analysts work with actuaries to help organize data used for statistical reporting. Data analysts generally use tools such as programming languages, computer applications and data modeling to create accurate ad hoc reports. They work in a variety of industries that need to store large amounts of data, such as health care, pharmaceuticals, manufacturing, telecommunications and retail. Actuaries help organizations by compiling information and statistical data to analyze financial risks and economic trends. They generally work for insurance companies, government agencies or consulting firms, as many of these organizations require long-term analysis of financial responsibility, expanding populations, potential natural disasters, sickness or death rates. They often use statistical data that data analysts manipulate and compile for reporting. Data analysts generally earn a bachelor’s degree in information management or a related discipline. They often move into this role after several years of experience in a related occupation and hone their skills in data modeling and the applications required to produce statistical data. Some organizations require industry-specific experience for this role. Actuaries generally earn a bachelor’s degree in a discipline such as mathematics, statistics or actuarial science. Many employers require credentials in specific types of actuarial sciences such as life, group, retirement benefits or risk management. Credentials are offered through recognized organizations including the Casualty Actuarial Society and the Society of Actuaries. Both occupations require extensive training and experience to be successful. Pursuing either of these careers generally depends on your interests. Both careers can be personally and financially rewarding. If you wish to work behind the scenes using technology to ensure data is accurate, becoming a data analyst could be the right career for you. If you enjoy using mathematical and interpersonal skills to help organizations thrive, you may be interested in actuarial science. the nest
This Week on COVID-19: Vaccine Developments, a Second Wave, and Flu Season Written by WorldClinic September 24, 2020 Vaccine Developments Dr. Tony Fauci clarified some previous remarks made by both him and Dr. Redfield of CDC. Last week, they both said in separate talks that it will be well into next year before vaccines will stop the COVID-19 epidemic in the US. The media put out stories interpreting this to mean that we will be in heavy restrictions for most of next year, if not worse restrictions given the potential combination of COVID-19 and flu. This week Dr. Fauci clarified that he fully expects that anyone who wants to be vaccinated will be fully vaccinated by April of next year or roughly 6-7 months from now. This is a major clarification, meaning that barring any change in the virus or an issue with all the vaccine candidates, we should be done with COVID-19 by mid-spring. But this timeline also means that we will likely begin to achieve some degree of herd immunity before then through a combination of natural infection, vaccination, and, possibly, innate, or relative immunity to SARS-CoV2. In fact, if vaccine trials are mostly successful, the US Government has contracts and capacity in place to deliver 100M doses of vaccine by the end of the year and 700M by the end of March. This is more than enough even for a 2-shot regimen that will likely be required for immunization. Without being over-optimistic, it is still looking like COVID-19 will be mostly behind us by early spring. To be sure, there will still be a low-level of cases, and we will likely still have sporadic severe cases and deaths related to at-risk individuals, just as we do with influenza, but COVID-19 as a major disruptor of life and economies around the world will be done. Another piece of very positive news is that a fourth major vaccine candidate has entered phase 3 trials. This vaccine, being developed by John & Johnson, is the most conventional vaccine that has reached this stage to date, with a basic structure that has been used successfully in other approved vaccines. This vaccine, based on an adenovirus, has one minor weakness in that some people have pre-existing immunity to the underlying virus used in the vaccine, so in some cases, the body attacks the vaccine before it recognizes that it needs to develop antibodies against the SARS-CoV2 component, but the adenovirus strain being used has been chosen because the baseline immunity in most parts of the world is very low. The full approval pathway for this vaccine extends until 2023, but Johnson & Johnson expects to prove adequate safety and efficacy for initial Emergency Use Authorization by year’s end. Currently, there are 4 major American/European vaccine developers on track to contribute a successful vaccination program through the first quarter of next year: • Moderna working in conjunction with the US National Institutes of Health: • They are producing a novel technology messenger RNA vaccine, which looks to be targeting initial results early next month • BioNTech of Germany in conjunction with Pfizer: • They are developing another messenger RNA vaccine with similar timing as Moderna • AstraZeneca and the University of Oxford in the UK: • They are developing a chimpanzee adenovirus vaccine that had similar timing but sustained a delay based on a single adverse event. The trial program for this vaccine has resumed worldwide except in the US. The FDA is crossing every t and dotting every I to ensure the US public that safety criteria are not being overlooked. • Johnson & Johnson: • Are producing a human adenovirus entry. There are at least 3 Chinese vaccines and one Russian vaccine also in late-stage trials or limited approval, but recent data is that at least the Russian vaccine utilization has been put on hold for unknown reasons. Second Wave Beyond the vaccines, the biggest COVID-19 question on most people’s minds currently is if we are in the early phases of a second wave. In Europe; Spain and France are seeing rapid upticks in disease rates, although, they are still well below the rates in much of the United States and Asia. The United Kingdom, which just 3 weeks ago was subsidizing diners to go back to restaurants, has once again restricted opening hours for pubs, eliminated standing at bars, and recommended that those who can work from home, do work from home. Prime Minister Boris Johnson has said that he hopes these measures, in conjunction with a re-emphasis on masking and social distancing, will be adequate to prevent a need to return to more draconian lockdowns. In the US, several states are seeing double-digit week-over-week percentage increases in cases, but most states are staying flat to slightly down. This is an improvement from the middle of last week when there were only a handful of states that were not on an upward trajectory. The role of return to school continues to be debated, but so far, initial increases in disease rates that appeared linked to return to school, have turned around in many places. Whether this is because college students are learning that individual actions do make a difference, or some other unrecognized factor, the fact remains that with limited exception, states are holding their own. Anyone with young adults in their family should take note of the fact that in the last few weeks, Americans in their 20s accounted for a significant plurality of new cases of COVID-19 cases, although very few of those cases became severe. The next big test will be the change of season bringing colder weather that drives people indoors where the closer quarters may lead to more infections. At this point, we simply do not know. It is worth noting, however, that Prime Minister Trudeau of Canada warned that he believes Canada is on the brink of a second wave that could be much worse than the spring. While there is little question from all the models that the possibility of a larger wave is there, most of these models only get there by assuming that people drop their guard and forget about masking and social distancing. This is not the time to let your guard down. Even if you have followed and believe in the Finland model which has achieved a steady low-level case rate without severe restrictions, remember that even the Finns closed high schools and colleges, prohibited gatherings larger than 50, and recommended, but did not require, measures to reduce indoor density, including working from home, increased table distances in restaurants, etc. Finally, a small parallel for people to have a better understanding of the key situations that support infection. Some of you may remember the days before smoking was prohibited in bars and restaurants and can remember the visible smoky haze that would form in these rooms. Well, it turns out that the particle size of cigarette smoke and the particle size of respiratory secretions that carry COVID-19 are similar. Think back to those days where standing in a bar meant inhaling that smoke all evening or sitting in a restaurant often meant jockeying for a table either distant from a smoker or down-wind from that smoker. If you can remember the situations where the smoke was enough to make you uncomfortable, those are exactly the situations that put you at risk for exposure to SARS-CoV2. If you can stay in well-ventilated areas with good air exchange that would have cleared our tobacco smoke back in the day, those same areas will be relatively safe for COVID-19. Flu Season Please get a flu shot as soon as possible. If people get flu shots and we continue to practice good respiratory disease mitigation with masks and distancing, there is a good chance that the combined death rate of flu and COVID-19 may be lower than the flu-alone death rate in a typical flu season. You cannot get the flu from a flu shot! Please stop at your local pharmacy or at your doctor’s office and get it done now. If the US is able to convince the same proportion of society to get a flu shot that the Australians and New Zealanders were able to convince, then we can push flu illness and deaths to near zero, but it also could mean we’ll have barely enough vaccine to go around. Take that question of supply off the table for yourself and get it done now! Check Your Symptoms You May Also Like… Get updates straight to your inbox
Vitamin C has always been known to have many uses for the body, including maintaining endurance and skin health. Vitamin C is known to be safe for consumption and easy to obtain. Both from food intake and also in supplements, as a useful supplement of nutritional intake. Vitamin C or what is often called scorbutic acid is a type of nutrient that is soluble in water and is not produced by the body. Sources of vitamin C can be found in fresh fruits and vegetables, or if necessary from vitamin C supplements. Vitamin C is needed for development and maintain the functioning of organs. Vitamin C also plays an important role in maintaining immune function. Important Reasons for Taking Vitamin C Vitamin C has many benefits for body health and skin beauty, including: • Increase endurance and help the recovery process. Various complaints such as coughs and colds can be prevented by fulfilling the need for vitamin C in the body, especially when fatigue or when going to strenuous activities. Vitamin C is also called good to be consumed to prevent dengue fever. • As an antioxidant that helps protect body cells from damage caused by free radicals. Thus inhibiting the risk of premature aging, the course of cancer, and heart disease. • Vitamin C for the skin plays a role in the production of collagen, which is a protein needed to help the wound healing process, prevent wrinkles, slow the aging process, is also able to maintain youthfulness and brighten the skin. • Vitamin C increases the absorption of iron from food and helps the immune system work properly to protect the body from disease • Some research results believe that vitamin C can help maintain healthy cartilage, bones and teeth. And also maintain a healthy heart and blood vessels, so they can prevent heart attacks and strokes. Vitamin C is also believed to prevent cataracts and bile diseases. Take Vitamin C Appropriately Vitamin C can be obtained by consuming various types of food such as fruits and vegetables. Natural sources of vitamin C besides oranges include kiwifruit, mango, papaya, pineapple, and vegetables such as broccoli, paprika and tomatoes. To complete it, you can take vitamin C supplements, with the right dosage according to doctor’s instructions or according to the rules of use listed on the product packaging. The recommended dose of vitamin C supplement is 75 to 90 mg. When experiencing infection and post surgery, the need for vitamin C will increase, so consumption of vitamin C will help the healing process. Taking vitamin C at a dose of 500 mg per day is considered safe, and enough to maintain health. Vitamin C with a Periodic Release System When you want to consume vitamins in the form of supplements, there are choices of vitamin C supplements that have a system of periodic release (time release). With this system, the vitamin content will be absorbed by the body’s cells periodically through the bloodstream. Through this time release system, adequate body cells for vitamin C can take place throughout the day, up to around 12 hours. This time release is a system that helps the absorption of vitamin C which is safer for your stomach, and can reduce side effects that may be caused such as abdominal pain and bloating. With the release of vitamin C that occurs slowly, this time release system also helps ease the work of the kidneys, making it safer for the kidneys. To keep your stomach healthy, you need to routinely live a healthy lifestyle, adjust your diet, and avoid stress and get enough rest. When taking vitamin C adjust to the doctor’s recommended dose. It is recommended to consume after eating to minimize the risk of stomach disorders due to taking vitamin C. Choosing vitamin C with a periodic release system, can be one way to help reduce this complaint. Consult further with your doctor about consuming vitamin C that is safe and appropriate for your condition, especially if you have a history of illness, or are pregnant or breastfeeding.
add share buttons The Main Methods Of Uncertainty Analysis There are errors which often happen, thus influencing the accuracy of decision-making problems. As a result, it is vital to investigate the doubts of the variables used. Doing this will help by providing a technical contribution to the process. This is possible due to the quantification of any doubts in the variables. Uncertainty analysis is a crucial component which has to be carried out using the best methods as explained in greater details in this writing. The examination can be carried out in only two general ways. This will include qualitative and quantitative options. Among the two, the latter is considered the superior option. However, like other things, it is associated with some cons of its own. For instance, not all the doubts are quantifiable with the degree of reliability needed. As a reason, it may cause some bias in the description of doubts. The other con is the fact that not all people are familiar with the methods. The quantitative method aims at making an effort to provide the estimates using numerical terms the magnitude of vagueness. Over the years, there are various methods in this category which have been developed. Even though they are complex in their different ways, they can show the ambiguity through the study stages. The approaches are also capable to show just how the doubts have propagated through the examination chain as required. Sensitivity study, Taylor series approximation, Monte Carlo simulation, and Bayesian statistical modeling are among the main techniques in the quantitative method. The sensitivity approach is used to assess how changes in the inputs in a model can influence the final outcome. When it comes to analyzing the assumptions made during the assessment, then it is perfect. The main con is because it gets complex with the increase in doubts from interactions of a large variable. The Taylor series approximation, on the other hand, is a mathematical strategy which is used to estimate the underlying supply which characterizes the ambiguity procedure. Upon the realization of the estimate, it is computationally less costly. Thus it is relevant when dealing with difficult or large models in cases where the other complex approaches are infeasible. With the Monte Carlo simulation, the technique makes use of repeated samples from the supply of probability as the contributions for the models. Therefore, it helps in reflecting the ambiguities in all the models by distributing the outputs. This approach is ideal in cases where the models are not linear, or the examination involves the likelihood of exceeding specific limits. However, the main limitation is the fact the computational can be quite costly. The Bayesian statistical remodeling will always include the ambiguities of parameters from extra origins. People are advised to do some more investigations to learn more about the techniques used in the quantitative approach. This will facilitate proper understanding of each method for efficiency. The qualitative methods, on the other hand, are less formalized when compared to the other option. One of the main limitations is the fact that it might be difficult to compare between different analysts. However, this makes the techniques much more adaptable and flexible. Hence they can be devised depending on the need, hence can be used in estimating any ambiguity.
Tweak Your Attitude Tweak Your Attitude Everyone has heard at some point that, Attitude is Everything. This is especially true when it comes to driving and could be the difference in being safe or not. Of course this sounds very obvious, but not so fast. For example, a person who does not click their seatbelt on even though they know they would be safer to do so, probably has the attitude oattituder opinion that if they get into an accident, they would probably survive the crash. What they may not know is that your chances of survival in a crash go up by about 40% if your click in your belt. There are many others that go over the speed limit almost every time they drive. What they may not know is that just a lowering of five miles per hour in speed sometimes is the difference between life or death or at least the severity of the crash can be greatly diminished. Drivers that do things that are unsafe or not do things to make them safe just need to know small changes can make the difference. Start with one thing at a time and slowly start gaining success. When you go on a diet the last thing they say you should do is try to go cold turkey. Start with cutting back a little on salt, or a little on sugar, or choose a better snack each time until it becomes a habit. The same is true with being a safe driver, start with clicking your seat belt, or slowing down a little, or letting everyone know to call if their is an emergency instead of texting while driving. Tweaking your Attitude is what we ask until it becomes a real habit towards safety.
Skip to main content Title: Defensive functions and responsible metabolites of microbial endophytes item Bacon, Charles item Hinton, Dorothy item Mitchell, Trevor Submitted to: Meeting Abstract Publication Type: Abstract Only Publication Acceptance Date: 1/3/2015 Publication Date: 7/12/2015 Citation: Bacon, C.W., Hinton, D.M., Mitchell, T.R. 2015. Defensive functions and responsible metabolites of microbial endophytes. 8th Congress of the International Symbiosis Society. July 12-17,2015. Lisbon, Portugal. p235. Interpretive Summary: Technical Abstract: Increasing evidence indicates that plant microbiomes are influence by ecological successes of plant hosts. Further, endophytic microbes such as bacteria and fungi greatly affect plant stress tolerance and are responsible for defensive reaction to several forms of herbivory. What is not yet clear is whether it is an evolutionary strategy for plants to seek out and selectively obtain microbes for their ecological benefits. Several questions can be asked about plant microbiomes. Are the resulting microbiomes happenstances due to the prevalence of microbes as in opportunistic infections that became intimate over time? Once established, are the resulting microbiomes influenced by the selective pressures that interact with the genomes of the plants and microbes? Is the resulting microbiome insured continued success due to constant genetic mutations occurring among the plants and microbes? Additional questions and potential answers will be addressed in the course of examining what is known about endophytic bacterial and fungal microbiomes that impart or enhance beneficial traits such as disease resistance. Specifically, selective and isolated information will be presented using a fungal endophytes (Epichloë species), and a bacterial endophyte (Bacillus mojavensis) as model microbiome systems. Similarly, other strategies that will be discussed include chemical defenses from herbivory, and the nature of microbe-host signaling, and information on quorum sensing and or quorum quenching metabolites of fungi and bacteria, which have evolved to suppress the host response that might have influence over the host’s final microbiome load.
The Hand Posture Analyzer investigation measures motion and force on hands, wrists, and forearms before and after space flight. The Hand Posture Analyzer (HPA) examines how hand and arm muscles are used differently during grasping and reaching tasks in weightlessness by collecting kinematic and force data on astronaut’s upper limbs (hands, wrists and forearms). Three different sets of data were collected: preflight, in-flight and postflight. The measurements involved the crew member manipulating both virtual and concrete objects, which were studied to assess the approaching, reaching, and grasping mechanics of the hand and fingers without the effect of gravity. Mission: 7, 8, 11, 16 Launch date: 15/04/2005 00:00:00 ‣ News International Partners Advance Cooperation with First Signings of the Artemis Accords ‣
Walking on water is a lot easier than one might think. Walking on water is a lot easier than one might think. (Image: Kevin Krejki on Flickr) One of the most famous and enduring miracles of all time comes from (who else) Jesus Christ—the epic feat of walking over water. In fact, the phrase “walking on water” is basically a synonym for miracle. But while he might be the most famous miracle worker of all time, he is far from the last person to pull off this classic stunt. First, there’s the people who’ve engineered ways to literally walk on water, using pontoon-like shoes and skis, and it has worked. Maybe the most famous example of this feat being Remy Bricka’s “walk” across the Atlantic Ocean in 1988. But the actual act of standing on or moving across the surface of a body of water, like Jesus did, seems a bit tougher. According to an article on LiveScience, over 1,200 species have the ability to walk on water either by being ultra-light like bug, or being fast, like the web-footed basilisk lizard. The average human would have to run at about 67 miles per hour to keep from sinking below the surface of the water, so unless Jesus was as fast as a cheetah, it’s easy to see why his fabled floating seems heaven sent. But the truth is that, with a little trickery, humans can “walk on water” pretty easily. In fact just about anybody can pull off this trick with a little planning and a showman’s spirit. At the risk of spoiling the magic of a miracle, here are three ways to walk on water. This is, in some ways, the easiest way to pull off the illusion of walking on water, but its simplicity is also what makes it so hard to sell. Performing the trick in this manner is all about location. You’ll need to find a super shallow body of water like the edges of a pond, or a wide puddle, no more than an inch or so deep. If you can, find a strip of higher land that extends out into deeper water. Get the audience for the stunt to stand a bit away, and ideally, from a lower vantage point. From there they won’t be able to see beneath the surface, or more importantly, judge how deep the water is. From the right angle the surface of a rain puddle can look as deep as a lake, and standing on it can look like a miracle. Nice trick, Jesus. (Image: Wikipedia) It has been posited that this is essentially how Jesus walked on the Sea of Galilee. Mounds of ancient stones have been uncovered in one of the places where researchers think the miracle may have been performed, and they may have acted as a platform for his holy crossing. From the vantage point of his followers that supposedly saw Christ walk across a stormy sea and get in their boat, it would have appeared that he was floating on the surface, when he was just standing on stones just under the waterline. So what if your audience is all around and has every vantage point? No storms or flattering angles to hide your miracle works? Well, thanks to more modern materials than Jesus had at his disposal, a good answer to those questions is to build a clear fiberglass platform. This is maybe the ideal version of this trick since, when it is totally submerged, a glass or clear plastic platform is essentially invisible. This would be harder to pull off in a natural setting where the slope and level of the ground is more varied and harder to gage, but in smooth, man-made waters like swimming pools, it works perfectly. While magicians and illusionists are obviously tight lipped about how they pull off their miraculous feats, many skeptics and debunkers assume that this is how the feat of walking on water is performed by modern showmen. One of the most famous examples of a walking on water act was in 2011 when English magician, Dynamo stepped out onto the waters of the Thames in plain view of countless onlookers. After making to the end of his assumed platform, he was pulled into a police boat, which was likely a part of the trick meant to prove that the waters were still deep and navigable, although the ship never crossed Dynamo’s path on the water. In another instance of the trick, Criss Angel, professional Mindfreak, walks across the top of the pool, while “wowed” swimmers pass beneath him. This version of the trick is impressive and could only really have been performed using a clear construction with paths beneath the upper platform. This method was even used as a joke in an episode of Arrested Development. It’s a little more expensive, but building your own clear platform might be the most miraculous way to walk on water. As ever, science can also provide an answer to this miracle, thanks to non-Newtonian fluids. A non-Newtonian fluid is a substance that has a variable shear rate, allowing for the surface of the fluid to act as a solid for brief amounts of time. In lay terms, it is a thick liquid that can be walked across without sinking, so long as one doesn’t stop moving. The surface may ripple and deform but it will not break (or shear) unless a sustained pressure is put on it, because impact actually makes it thicken for a short time. There are a number of types of non-Newtonian fluids, many of them chemically created, but probably the most common variety is a goop you can make in your kitchen called “ooblek.” Named after the Dr. Seuss book, Bartholomew and the Oobleck, it is nothing more than an ooze made from cornstarch and water. For anyone playing along at home, the recipe is essentially 1 part water + 1.5 parts cornstarch. The resulting slurry is a thick opaque slime that probably isn’t going to fool anyone into thinking it’s water, so you probably isn’t going to start you any religions. However, technically, it is water that can be walked on (or slapped, punched, and otherwise fiddled with) pretty damn miraculously. Unfortunately most people are not going to have the massive amounts of starch required to create a large pool of ooblek, it is not impossible to obtain. (Check out the Mythbusters using their massive resources to prove that you can in fact create a giant vat of the stuff.) In summary, walking on water is not out of the realm of possibilities for anyone, even you. Stop waiting for a miracle to happen, and get out there to make your own!
Newton's Apple Tree – Lund, Sweden - Atlas Obscura Newton's Apple Tree A living descendant of the famous tree that helped Isaac Newton develop the theory of gravity. Science can be seen by many as a rigid discipline, only dealing with facts and objective truths. While this is true, many people seem to forget the humans behind the science. There are many links between scientists and places related to their discoveries across the globe. Pictures, equipment, and sometimes a sink shed light on the faces behind some of the world’s greatest discoveries. This apple tree in a Lund botanical garden is related to one of humanity’s greatest discoveries. The garden is home to an impressive collection of trees, shrubs, and plants from all over the world. Botanical gardens such as this were meant to offer an accessible way for scientists to study various species of plants. If you were to ask a botanist what makes the botanical garden in Lund unique, they will likely give you hundreds of reasons, but Newton’s apple tree will always be featured prominently on that list. This tree, a Flower of Kent, was brought to the botanical gardens in 1996 and was planted by Hans-Uno Bengtsson, a theoretical physicist from the city. The tree itself has no real scientific meaning apart from it being related to the tree that allegedly helped Isaac Newton devise his theory. People venture to the garden to take pictures with the tree or snag an apple that fell as a souvenir. Visitors may also notice that the tree is misidentified on the sign as a Beauty of Kent, rather than a Flower of Kent. This likely happened when the sign was replaced after being stolen in 2015. Know Before You Go Entrance is free, the tree is close to the marker on the map near several other apple trees. If you are taking the northward path, the tree will be on your right. Atlas Obscura Trips Rewilding: Tracking Wolves in the Forests of Sweden Want to see fewer ads? Become a Member. From Around the Web
5 Healthy Snacks Options to Curb Your Salt Cravings We are all too familiar with sugar cravings, and they have an easy fix as well. But now and then, the sweet taste gets boring and the heart craves something on the salty end of the spectrum. Salt has a tricky reputation; being associated with unhealthy food like potato chips and being the most common cause of bloating and high blood pressure, most people feel guilty when they reach for the salty snacks. However, salt can be part of healthy diet; especially the unprocessed salt such as sea salt and pink Himalayan salt, and it performs many functions in your body, keeping you healthy, happy, and alive. Salt is good for you. A healthy amount of salt intake is vital for the proper functionality of the thyroid gland, which then plays a role in improving metabolism. Promotes Hydration Salt helps your body absorb water since it maintains a healthy balance of electrolytes and hydration levels, which can prevent common complaints of muscle cramps, dizziness, and fatigue. Low Blood Pressure If you experience symptoms like dizziness, nausea, fainting, or blurry vision, your blood pressure might be low. Confirm by checking your B.P. on your blood pressure monitor, and if the reading is below 90/60mmHg, then salt consumption can help you improve those symptoms. Health risks of excess salt consumption Salt has numerous benefits but, it can be dangerous in excess. One of the most immediate problems you will notice with excess salt consumption is that it causes bloating. Increases Risk of Osteoporosis The purpose of salt is to absorb water, but when consumed in excess, it can cause excess water retention. It can increase the risk of osteoporosis because excess water loss results in calcium depletion from the body. Salt and Heart Disease However, a more severe side effect of excess salt consumption is the damage it does to cardiovascular health. The pressure put on the heart by excess water is one of the leading causes of heart attack and stroke. But you don’t have to worry at all since with my following picks of healthy salty snacks, you’ll get both nutrition and a tasty snack. 5 Healthy Salty Snacks Salted Macadamia Nuts If you are looking for a protein-rich, calorie-dense snack packed with all the nutrients your body needs, then Salted Macadamia Nuts are the right choice. Rich in magnesium and healthy fat, this crunchy snack is perfect when you need a quick snack on the go. Turkey Lettuce Wrap Finger food is popular for two reasons, quick to make and easy to eat. There is no hassle of a complicated recipe or preparation and serving process. Turkey Lettuce Wraps are a popular choice as a snack due to their convenience and the perfect blend of crispy and salty taste. Snacks are supposed to be quick and fulfilling, and of course, tasty. Steamed edamame beans sprinkled with salt or other seasonings match this description perfectly. Rich in protein and fiber, they check the box of a healthy snack. Deviled Eggs Eggs are the most popular food item on the planet because they are healthy and versatile in how you can eat them. A salty variation of an egg-based snack is the infamous deviled eggs. So, if you love eggs, you can whip up a batch of deviled eggs and store them so you can have a salty snack to munch on at any time. Roasted Chickpeas Inadequate fiber consumption can complicate life a lot. People often struggle with meeting their fiber requirement of the day leading to a whole bunch of complications. But if you are a healthy person, you don’t have to worry about meeting your fiber requirements with supplements since there is a better, healthier, and tastier option. Roasted Chickpeas are not just a good protein and fiber source but they are also rich in magnesium which can help prevent diabetes and heart diseases. Leave a Comment
Maine Central 954 Built: American Locomotive Co., 1945 Serial Number: 73085 Weight: 100 tons (200,000 pounds) BRMX 954 is a model S-1, diesel-electric switcher and built by American Locomotive Co. (Alco) in Schenectady, New York, in 1945 and is equipped with a McIntosh & Seymor model 539 6-cylinder diesel engine, which generates 660 horsepower. Built for the Maine Central Railroad as 954, it was designated class DS-3b. In 1976, it was purchased by General Electric (GE) and overhauled at their shops in Erie, Pennsylvania. From there, the locomotive became Number 6 and was assigned to GE’s Power Transformer plant in Pittsfield, Massachusetts. In 1988, GE donated the locomotive to BSRM, where it was assigned number 0954 and painted in a scheme that was reminiscent of New Haven’s fleet of switchers. The leading “0” in the number is consistent with New Haven numbering practice during the steam-to-diesel transition era. New diesel locomotives were given a leading zero to avoid conflict with a steam locomotive using the same road number. Locomotive 954 is currently undergoing a multi-year restoration and rebuilding of the body, trucks, and paint, so that it may serve our museum for many years to come. Please consider contributing towards restoration with a donation or spending a few hours with our volunteers.
Terrestrial reptiles • Home • Terrestrial reptiles Unfortunately, not causing great empathy on the part of the general public, all species of terrestrial reptiles that occur in Cape Verde only exist here and nowhere else in the world, forming part of a unique and irreplaceable natural heritage. The great lack of interest, repudiation or even fear fostered by ancient beliefs, leads these species to be generally persecuted by Man, and that because they are not charismatic, they are forgotten and actions aimed at their conservation are not promoted. For this reason, it is essential to educate and sensitize the public to recognize them as an integral and fundamental part of ecosystems and to fall in love with these harmless reptiles and actively protect them. Various aspects of its ecology, biology and population trends are largely unknown, information that is essential for the implementation of targeted and effective management and conservation measures for each species. If it is in your interest to develop some scientific work with any of these species, the Biosphere can provide all logistical support to work in the field. For more information, please contact the Biosphere via email [email protected] en_GBEnglish (UK) pt_PTPortuguês en_GBEnglish (UK)
How Chiropractic Treatment Improves Your Immune and Endocrine System Chiropractic Treatment Chiropractic Treatment has been the go-to solution for most of the musculoskeletal disorders. Previously, it was seen that chiropractic treatment focused only on the biomechanical accounts. But recent studies have shown that chiropractic treatment or specifically spinal manipulation also has neurophysiological responses that activate the immune-endocrine system. Here is why chiropractic treatments improve the immune and endocrine system: 1.We all know that to keep ourselves away from diseases and fight viruses, our immunity needs to be strong. Immunity plays a major factor when it comes to maintaining good health. But did you know that chiropractic treatments also have an impact on the body’s immune system? 2.The human body is wired in such a way that the immune, endocrine, and nervous system are heavily integrated. Since these three are interrelated, a change in any one parameter affects the other. 3.These three systems are messengers of the body and they communicate messenger molecules that circulate throughout the body to get optimal responses from every area. 4.The information gathered by any of the one systems is further communicated and shared with other systems to ensure optimal functioning for adapting and healing. All these systems come down to one major system i.e the spinal system. 5.Studies have shown that people having healthy spinal health have shown excellent immunities and highly functional nervous and endocrine systems. 6.On the other hand, a misaligned spine interferes with the normal functioning of the nervous system which in turn, affects immunity and the endocrine system. 7.If the spinal structure is misaligned, then the immunity tends to be weak and it cannot function at its full capacity. This increases the risk of catching the flu and illness. 8.Coming back to chiropractic care, the aim of chiropractic adjustments itself is to improve the spinal alignment and make sure that it possesses significant functionality. 9.Spinal misalignments that are specifically called subluxations, cause compressions and irritations of the nerve pathways are affecting the organs of the body. This physical nerve stress in turn affects neural control. 10.Chiropractic care is taken with the right adjustments that can help to eliminate these subluxations. 11.Chiropractic adjustments have been seen to reduce the stress on the nervous system. So a healthy nervous system leads to a healthy immune system. 12.Not only the endocrine or immune system but also the number of white blood cells in the body are seen to be rising after applying chiropractic adjustments. 13.One of the common chiropractic adjustments called Spinal Manipulation is seen to have a good impact on these three systems of the body. 14.Spinal Manipulations or manipulations applied to other parts of the body supports in realigning the bones and joints. This reduces the pain of the affected area. 15.Spinal manipulations also help in restoring range of motion, flexibility, and coordination of all aspects of the body. 16.Once these adjustments bring the spinal structure to normal and in alignment, the endocrine, nervous and immune system starts working ideally and this runs the body at optimal function. 17.But of course! This won’t happen in one chiropractic session. The sessions are generally planned by designing chiropractic programs based on your area and severity of pain. 18.Your chiropractor might design a chiropractic plan for the alignment of your spine using the right adjustments. After an ample number of sessions, you will see improvements in your immune system on your own. 19.The chiropractor will assess your pain and recommend visits until the spinal alignments are in place. Thus, the benefits of chiropractic care are not limited to musculoskeletal disorders but also your overall health. Along with giving relief to your lower back, neck, or shoulder pain, chiropractic adjustments also do the complimentary job of improving your immunity and endocrine health. Isn’t that amazing? Experience the best chiropractic care from our qualified professional chiropractor in Los Angeles, Dr. Joseph Hakimi. Leave a Comment Scroll to Top
Staying Healthy Influenza is thought to spread mainly through person-to-person contact with infected persons. The CDC (Centers for Disease Control) recommends the following actions to stay healthy. 1. Avoid close contact with people who are sick. When you are sick, keep your distance to protect others from getting sick. 2. Stay home when you are sick; if possible stay home from work, school and errands when you are sick to prevent spreading your illness. 3. Cover your mouth and nose with a tissue or use your elbow when coughing or sneezing. 4. Clean your hands. Washing your hands often with soap and water will help protect you from germs. Alcohol based hand cleaner can be used if you are unable to use soap and water. Additional Online Resources 1. Update your immunization records. 2. Get a flu shot(s). Consult with a health care professional for health-related questions regarding your health and the flu vaccine. Remember the seasonal flu and H1N1 will be separate injections, which means more than one shot. 3. Wash your hands often with soap and water-especially after coughing, sneezing, or using alcohol-based hand cleaners. 4. Keep your hands away from your eyes, nose, and mouth. 5. Cough/sneeze into a tissue or the sleeve of your shirt/blouse/jacket, not into your hand. (Throw the tissue in a trash bin as soon as possible.) 6. Stay hydrated. 7. Eat a balanced, healthy, nutritious diet. 8. Get adequate sleep. 10. Avoid close contact with people who are sick.
Lose Weight While Sleeping! March 21, 2016 Okay, you can’t burn calories by just sleeping, but did you know that sleep is just as important as diet and exercise to lose weight or to maintain a healthy weight? Recent studies have shown that too little sleep or too much sleep can contribute to weight gain. In one such study, men who were chronically sleep deprived found that their preferences for high-calorie foods increased and they consumed more calories overall. In another study, women who got less than six hours of sleep a night or more than nine hours were more likely to gain 11 pounds when compared with women who got slept seven hours of sleep per night. One explanation may be that that the amount of sleep you get the hormones that regulate hunger (ghrelin and leptin) and stimulates the appetite. Also, lack of sleep leads to fatigue and could result in less physical activity. Sleep is also extremely important to your brain – specifically your frontal lobe. Your frontal lobe is the part of your brain that helps you make decisions and control impulses and lack of sleep dulls it. When you’re tired, that pint of ice cream can seem like a great idea. Not only is it harder to control your impulses, you’ll also find that you crave high carb, high calorie snacks. A study in the American Journal of Clinical Nutrition found that sleep deprived subjects snacked more and chose calorie dense foods for their snacks. Lack of sleep also stimulates the brain’s reward center. So, when we are chronically sleep deprived, we crave comfort foods. Again, these are usually high calorie, high carb foods. Subjects in another study consumed about 300 extra calories a day. Sleep deprivation also affects your body’s ability to respond to insulin—another factor leading to weight gain and a contributor in developing type 2 diabetes. Unfortunately, up to two thirds of Americans don’t get enough sleep. You should be getting at least 7 hours and not more than 9 hours of good quality sleep a night. Try to go to bed at the same time every night and get up at the same time every morning. Keep your bedroom cool and dark. Avoid screen time (computers, TVs, tablets) in the last hour before bedtime. Don’t drink too much caffeine later in the day and limit alcohol intake. All of these will help you fall asleep more easily and stay asleep. According the American Journal of Health Promotion, people who maintain an unvarying sleep schedule have a lower percentage of body fat. Additionally, a randomized trial published in the journal Obesity found that among overweight and obese women ages 35 to 55 who were partaking in a weight loss program, getting the right amount of good quality sleep (6.5 hours to 8.5 hours) increased the chance of weight loss success by 33 percent. Even pro athletes like Steve Nash and Shaquille O’Neal have spoken about the importance of sleep along with diet and exercise in maintaining a healthy life style. Not only does sleep detox your brain, boost your immune system, and help you fight the effects of aging, but it also affects your metabolism. So, now you have another reason to get a good night’s sleep!
Velocity-Based Training: Programming Considerations \| Strength Training Reading Time: 9 minutes We have written about what exactly velocity-based training is and how to broadly go about implementing that, but we wanted to go a bit more in-depth about the way many ways we use velocity-based training with our athletes at Driveline Baseball. During our strength assessment, we have athletes perform three sets of back squats, trap bar deadlifts, and barbell bench press. For each, we attach a Linear Displacement Transducer Device (currently a Tendo unit while we test our VBT unit) to the bar to determine the average bar velocities in meters per second. We use an algorithm to determine an estimated elite one-rep max based on their height and weight in order to determine how much weight each athlete will lift. The algorithm is roughly based on a two times body-weight squat, two and half times body-weight deadlift, and one and a half times body-weight bench press. We say roughly because a 225-pound athlete will have a much different perceived elite one-rep max than a 160-pound athlete, and a 6’ 6” inch athlete will have a much more difficult time squatting to depth than a 5’ 7” athlete. Once we determine that estimated one-rep max, we then test at 30%, 40%, and 50% of that number. The velocities at these numbers give us a few different pieces of information that help us individualize our programs. First, there is a pass/fail aspect to the assessment. We want each rep to fall at or above certain velocity ranges. For example, the 30% rep should be >1.3 m/s, the 40% rep should be between 1.0 and 1.15m/s, and the 50% rep should be between 0.85 and 1.0 m/s. Next, the spreads between the numbers will help us form a force-velocity profile for each athlete. For example, a strength-based athlete will perform the 50% rep better than the 30% rep, and a speed-based athlete may better perform the 30% or 40% rep than the 50% rep. Percentage-based programming is the last piece of information we can use the velocities for. Because the weights that we test are relatively light and a much safer alternative to max testing, we can use the velocities to calculate a projected one-rep max. For example, 0.8 m/s is 60% of an athlete’s daily one-rep max—yes, a one-rep max can fluctuate based on the day. But, if an athlete moves 225 pounds at ~0.8 m/s, we can calculate that his projected one-rep max is 375 pounds on that given exercise. We can then take that information and prescribe sets of four reps at 70% of his one rep max if he is in a strength phase. Programming for Strength and Power While we primarily use velocity-based training for speed-based work, it can be a great tool when high bar velocities are not the training goal. Earlier, we discussed how to use the assessment velocity numbers to prescribe weights for percentage-based programs, as well as how a projected one-rep max can fluctuate based on the day. One way to work around these factors and auto-regulate the on-the-bar load is to have feedback of bar velocity. We know strength as 70-90%, for three to five sets of four to eight reps. If we compare this to the velocity-based training continuum, we see that falls in the accelerative strength velocity ranges of 0.5-0.75 m/s. With that information, we could program three to five sets of four to eight reps and tell the athlete to find a weight that he can move all of the prescribed reps within that speed range. This will help autoregulate the load for him. On a day that the athlete is feeling more fatigued than usual, rather than forcing him to add 5-10 pounds to the bar and crushing them, we stay within the speed range and get the desired stimulus. For power, we know that is three to five sets of two to five reps at 75-95% of a one-rep max. Because those percentages fall within both absolute strength and accelerative strength, I might have this athlete perform his prescribed sets and reps at a weight that he can move between 0.3 and 0.6 m/s. Programming for High Velocity Ranges The first speed range to touch on is strength/speed. Strength/speed is defined as moving a moderately heavy weight as fast as possible. The loads here range anywhere from 50 to 60% of a one-rep max and 0.75 and 1.0 m/s. Speed/strength, on the other hand, is defined with speed as the first priority and strength as the second. In other words, it uses lighter loads at faster velocities. The loads here range from 30 to 40% of a one-rep max and velocities from 1.0 to 1.3 m/s. An important note on training for speed/strength is that when performing the three main lifts of squat, deadlift, and bench press, the range of motion is too short to perform at velocities above 1.0 m/s. To make up for this, we recommend adding accommodating resistance in bands or chains to the bar. This allows the athlete to focus on accelerating the bar at high velocities without having to decelerate the bar as much at the top of the lift. Starting strength is the last velocity range on the velocity-based training continuum. When training for starting strength, the load is 30% or less of a one-rep max, and it should be moved above 1.3 m/s. Starting strength is the ability to rapidly overcome inertia from a dead stop. The three main lifts should not be trained above 1.3 m/s. If you were to prescribe Olympic lifts, this would be the velocity range to train them in. At Driveline, we use Trap Bar Jumps at 1.3 m/s and above because research has shown that power output is similar and there is far less risk on athletes’ wrists and shoulders. They’re also easier to measure for power output due to a consistent bar path. As far as sets and reps go for training in the speed ranges, we typically prescribe six sets of two reps. While the load is relatively light, the athlete should try to move the bar as fast as possible, which makes it a max-effort exercise. We know that when training for max power, the work rest ratio is 1:12, so an exercise lasting 5-10 seconds using the phosphagen energy system should have a rest period of 60 seconds. Because of the shorter rest period, there is also a large work-capacity component to training in the speed-velocity ranges. This can result in athletes being better conditioned for the sport of baseball since actions occur roughly every 30 seconds in a baseball game. How to Determine What Velocity Range to Prescribe Earlier, we talked about how we can use velocities from the assessment to create a force velocity curve and figure out if an athlete is more strength-based or more speed-based. How an athlete profiles plays a huge role in how we program for them. Here is an example of an athlete who profiles as more speed-based than strength-based. We can see that his 30% rep is at 1.37 m/s, which is above the 1.3 m/s number we are looking for, and his 50% rep is slightly below the 0.85-1.0 m/s range we are looking for. Some might see this and program maximum-strength work because it could be this athlete’s biggest room for adaptation. However, if we lose strength in the process of addressing a weakness, we are not improving this athlete. Because this athlete profiles as more speed-based, it may be disadvantageous for this athlete to spend too much time doing maximum-strength work and more beneficial for him to focus on improving his speed. This example shows an athlete who is above what we are looking for on all three of his reps but likely profiles a bit more as strength-based by looking at how high his 50% rep is and the small spread between his 30% rep and 50% rep. Because he is well above on all three of his reps, he likely has reached a point of diminishing returns when it comes to maximum-strength work; taking his back squat from a projected one rep max of 405 to 500 is likely not the limiting factor in developing velocity. With that being said, because this athlete is so strength-based, he may struggle when trying to perform speed work. An option for him would be to perform exercises in high velocity ranges with accommodating resistance in order to help him create the extra tension needed to move weight at high velocities. In the final example, we can see that this athlete not only falls below the velocity ranges on all three reps, but also his spread is very short between all three reps. This tells us that the athlete lacks not only the ability to apply force but also to apply force quickly. Because of that, we might do a more linear periodization with this athlete and spend some time doing strength work (0.5-0.75 m/s) until he lifts a certain number in that velocity range. Once the predetermined number has been hit, he can then move into an absolute strength block (0.3-0.6 m/s). Once the athlete’s strength is sufficient, high velocity speed work can be prescribed. Final Thoughts Many people think of velocity-based training as a high velocity training protocol only, but VBT is a great tool that can be used for assessment protocols, autoregulation during training blocks, and as a modality for elite athletes who have reached a point of diminishing returns with their maximum strength numbers. That point of diminishing returns will always be on a case-by-case basis, and that’s what makes test/retest periods so vital to writing a successful program. This article was written by High Performance coach Kyle Rogers Comment section 1. Roger W Robinson - At what point does an athlete become able to produce enough force to be able to start to train speed strength? Is it relative to body weight? • Driveline Baseball - Roger- You can use 2.5X bodyweight(BW) in the deadlift, 2X BW squat, and 1.5X BW bench for ideal 1 rep max numbers (keep in mind the height of the athlete). Using sub-maximal weight to determine force production – the 30% rep should be >1.3 m/s, the 40% rep should be between 1.0 and 1.15m/s, and the 50% rep should be between 0.85 and 1.0 m/s. If those are met, the athlete will be put into a strength program prioritizing speed. • Driveline Baseball - Hey Brett, VBT can be used in season. Most of the time we will be dialing back the volume of the workouts for in season work. The main goal for most of our higher level athletes is maintenance. We want to maintain strength while still putting them in the best position, physically, to compete in games. Add a Comment
Press Releases News from EPI The Economy Can Afford to Raise the Minimum Wage to $12.00 by 2020 Raising the minimum wage to $12.00 by 2020 is an achievable and economically sustainable goal, and stands within our historical experience, as shown in a new EPI paper, We Can Afford a $12.00 Federal Minimum Wage in 2020. In the report, EPI president Lawrence Mishel, economic analyst Dave Cooper, and research associate and senior economist at the Center for Economic and Policy Research John Schmitt find that increases in worker productivity and education levels, along with wage increases in regions that paid lower-than-national wages in the past, make returning to the 1968 norm in 2020 an achievable target. An increase to $12 would modestly raise the minimum wage’s purchasing power and roughly restore the relationship between the minimum wage and workers in the middle relative to 1968 levels, when the minimum wage was at its historical peak and the national unemployment rate was less than 4 percent. The Raise the Wage Act, which will be introduced by U.S. Senator Patty Murray (D-WA) and U.S. Congressman Robert C. “Bobby” Scott (D-VA), updates the previous effort made by Senator Tom Harkin and then-Representative George Miller in 2013 to raise the minimum wage to $10.10 by 2016. Raising the federal minimum wage to $12.00 per hour by 2020 would return the wage floor to the same position in the overall wage distribution that it had at its peak in 1968. In 2014, the minimum wage was equal to only 37.1 percent of the hourly median wage of full-time, full-year workers. Using a conservative projection of wage growth, a $12.00 minimum wage would equal 54.1 percent of the projected national median wage, returning it to its 1968 level (52.1 percent). “The value of the minimum wage is now 24 percent less than it was in 1968, yet workers today are twice as productive as they were back then. They’re also older and more educated. To that extent, we would expect that low-wage workers would earn more, not less, than what they earned in 1968,” said Mishel. “The new proposal reestablishes the minimum wage as the wage floor it was in the late 1960s, reversing a 50 year period of a low-value minimum wage. It sets the minimum to roughly 11 percent above 1968 value, indicating that it is a modest proposal.” Even at $12.00 in 2020, however, this increase would fail to reconnect the minimum wage to average productivity growth since 1968. If the minimum wage had grown alongside productivity, it would be $18.30 today and $18.96 by 2020. “Today’s more productive and better educated workforce means that raising the minimum wage to a level comparable to its 1968 value should be an easier lift for the economy now than it was then,” said Cooper. “Additionally, wages in Southern states were much lower than the rest of the country in 1968 They’ve since caught up, meaning that if low-wage state economies could handle the federal minimum wage in 1968, they shouldn’t have any trouble going to similar levels today. This is a goal well within our historical experience.” Significant increases in the productivity, education, and experience of low-wage workers mean that not only should wages be higher, but also that the economy can afford to pay those higher wages. In 1968, only 17 percent of workers in the bottom fifth of the wage distribution had some college education or more. By 2012, the percent of workers in the bottom fifth with at least some college education had risen to 46 percent. The productivity of low-wage workers has also doubled since 1968. Furthermore, more uniform wage distributions across individual states means that the federal minimum wage has less impact on low-wage states today than was the case in 1968. In order to give employers time to adjust to the higher wage floor, the $12.00 proposal raises wages at a rate similar to past minimum wage increases—roughly 10 to 13 percent per year—but for a longer amount of time. The yearly increases in the proposal are sustained for five years instead of two (as in the 1996-1997 minimum wage increase) or three (as in 2007-2009). “No matter how you look at it, today’s low-wage workers are making far less than their counterparts did in 1968. A $12.00 minimum wage by 2020 would raise the purchasing power of the minimum wage relative to its 1968 value and reconnect low-wage workers to the rest of the workforce,” said Schmitt.
Physics MCQs for Punjab PSC Exam Part 1 Doorsteptutor material for AP is prepared by world's top subject experts: fully solved questions with step-by-step explanation- practice your way to success. Which of the following is not an electromagnetic wave. 1. X-rays 2. Alpha-rays 3. Gamma-rays 4. Light rays Electromagnetic waves of wave length ranging from come under. 1. X-rays 2. UV region 3. Visible region 4. Infra-red region Electromagnetic theory suggests that the light consists of 1. Magnetic vector alone. 2. Electric vector alone. 3. Electric and magnetic vectors perpendicular to each other. 4. Parallel electric and magnetic vector. The frequency of radio waves corresponding to a wave length of 10 m is The electromagnetic waves travel with velocity of 1. Sound 2. Light 3. Greater than that of light 4. Greater than that of sound The existence of EM waves were experimentally confirmed by 1. Maxwell 2. Faraday 3. Hertz 4. Tesla The back emf in a DC motor is maximum when 1. The motor has picked up maximum speed. 2. The motor has just started moving. 3. The speed of motor is still on increase. 4. The motor has just been switched off. AC measuring instrument measures 1. Peak value 2. Rms value 3. Any value 4. Average value The Q-factor of a resonant circuit is equal to 1. 1CWR 2. 1WL 3. CWR 4. fCW Developed by:
Artificial intelligence and big data New technologies for financial planning – AI What is artificial intelligence (AI)? Artificial intelligence (AI) is human-like intelligence that appears to learn, reason, plan and perceive. At the heart of AI are algorithms which are rules like; “if this condition is true then execute the following instruction (code), else execute some other instruction.” It is this apparent reasoning that gives it the appearance of intelligence. Even a modest computer can execute millions of these algorithms almost instantly making artificial intelligence very powerful. Artificial intelligence is regarded by some as a set of algorithms designed to a perform specific task like accept an online booking that would normally done by a human. Others regard AI as the ability of a “machine” to learn on its own, sometimes known as machine learning. Machine learning and big data Algorithms can examine data to extract trends and make predictions that can be invaluable to marketers, governments and the like. Imagine powerful computers executing billions of instructions on vast amounts of data. The bigger the data the better the results and there have been some impressive advancements. • IBM’s Watson beat the two most successful contestants the show Jeopardy had ever seen. In February 2013, IBM announced that Watson software system’s first commercial application would be for utilization management decisions in lung cancer treatment at Memorial Sloan Kettering Cancer Center, New York City. In 2013, Manoj Saxena, IBM Watson’s business chief said that 90% of nurses in the field who use Watson now follow its guidance. • IBMs Deep Blue chess playing machine beat world champion Gary Kasparov. It did this with brute computing power looking at every possible move instantly. • DeepCubeA can do the Rubik’s cube two seconds faster than any human. • MIT have developed AI that can predict the development of breast cancer up to 5 years in advance. • Netflix and Spotify use AI to predict and suggest shows you may be interested in. • Amazon’s Alexa can converse in an almost normal manner, answering a wide range of questions. It can also be programmed by individual developers to perform specific tasks available to anyone with an Alexa device. See Finchat’s financial planning skill here. Microsoft have invested $1 Billion into OpenAI which is a “generally intelligent” system. Computers are very good at specific tasks but are no match for humans at applying knowledge. How could financial planning use this technology? “Robo advice” has already arrived for investment services and will expand beyond this. Amazon’s Alexa allows developers to build skills and Finchat has a financial planning skill using their cloud services you can access here. Similar Posts One Comment Leave a Reply
Chapter 2. Personal Foresight - Becoming an Effective Self-Leader 1. The Anticipator (Forecaster-Protector) These individuals primarily see themselves as foresight forecasters or protectors, discovering or validating probable futures. On the KAI test, forecaster-protectors are Adaptors. They are drawn to logic, security, truth, finding the best solutions (“optimization”) and things that become familiar and well-understood. They often also enjoy eliminating or controlling for risks (risk management) and enforcing or improving the rules. They can be extroverted or introverted, and are usually more analytical than intuitive. They are less motivated by creating possibilities, or advancing or following social or organizational preferences, than in the act of discovering the expected future, what is very likely to happen in organizations and the environment regardless of our preferences. The Forecaster-Protector The Anticipator (Forecaster-Protector) Forecaster-protectors (anticipators) tend to be quantitative, order-oriented, rational, and consensus-driven. They are often unity and truth seekers, discoverers and optimizers. They have a history of being as analytical and evidence-based as they can, and some can be a tad boring or conventional and may be often (but certainly not always!) right, especially if they keep their anticipation activities focused and conservative. Some examples are insurance actuaries, economists, engineers, and most hedge fund quants. Forecasters are taken more seriously in business environments, but they can sometimes be like horses with blinders, not willing or able to see outside of their narrow set of tools. They usually don’t seek to lead, but rather to get to the right answer. They can be either conservative with respect to seeking to conserving the status quo and critical human systems (politically conservative, security oriented), or with respect to conserving resources and protecting the planet (politically liberal, sustainability oriented). It is the search for stability, predictability, and protection that unites these otherwise very different groups. Anticipators can be found in any industry or function, but they particularly like places with validated structure and process to follow, where they can exercise well-used techniques and rationality and do both trend forecasting (seeing a pattern, quantitative or qualitative) and event forecasting (predicting an event). Investing, planning, science, and engineering are common outlets. Others are risk managers, intelligence, or security professionals. When they engage in entrepreneurship, R&D, or innovation, they do so from a risk-controlling, optimization, and predictive mindset. Share your Feedback
How Can I Free-Up More Hard Drive Space? Disk space is finite resource that must be used wisely. The more cluttered your hard drive is, the slower your computer will run. While it might seem more economical to save everything on your computer hard drive, doing so is risky because you could lose everything if your computer crashes or your laptop gets damaged. With a few simple adjustments to your computer habits, you can free-up tons of hard drive space and create secure backups of all your important files. Follow these tips to save computer storage space. Open a Gmail account and use the Google Docs feature to make back-up copies of text documents. A Gmail account has several gigas of storage space, and since it's online, there are no external storage devices to worry about. You can also save text documents in an email draft. After backing-up your text documents, reformat them into smaller files if possible. For example, you can export Word documents to Notepad, and convert the .doc files into .txt files, which are more compact. You will lose some formatting, but special characters will be preserved. Next, copy all of your image files to an external storage device, such as a USB memory, flash drive, or CDs. Take non-essential photos and images off of your hard drive to save disk space. Another space saving technique is to convert images files to smaller formats, such as jpg or jpeg. This may cut down file sizes by about 60%-80%. Delete program files for programs you never use, or transfer them to CDs if you still want to keep them. These may be old games, demos, or old programs you wrote. Empty the recycle bin, and consider running the disk defragmenting program. These steps will free up more disk space on your computer without any major overhauls. Depending on how many files you have, you can complete this within 2 to 3 hours. © Had2Know 2010
It’s a chicken-or-egg scenario. You have a ringing in your ears. And you’re feeling down about it. Or, it’s possible you were feeling somewhat depressed before that ringing started. You’re just not sure which started first. When it comes to the connection between depression and tinnitus, that’s exactly what scientists are trying to find out. That there is a link between tinnitus and major depressive disorders is rather well established. The notion that one tends to come with the other has been born out by many studies. But the cause-and-effect relationship is, well, more difficult to detect. Does Depression Cause Tinnitus? One study, published in the Journal of Affective Disorders seems to contend that depression might be somewhat of a precursor to tinnitus. Or, to put it another way: They discovered that you can at times recognize an issue with depression before tinnitus becomes apparent. It’s possible, as a result, that we simply notice depression first. In the publication of their study, the researchers suggest that anyone who undergoes screening for depression may also want to be tested for tinnitus. The theory is that depression and tinnitus may share a common pathopsychology and be frequently “comorbid”. Put another way, there may be some common causes between depression and tinnitus which would cause them to appear together. Needless to say, more research is required to determine what that common cause, if there is one, actually is. Because it’s also feasible that, in some cases, tinnitus causes depression; and in other situations, the opposite is true or they appear concurrently for different reasons. Currently, the connections are just too murky to put too much confidence in any one theory. If I Have Tinnitus Will I Develop Depression? In part, cause and effect is difficult to pin down because major depressive conditions can happen for a wide variety of reasons. There can also be quite a few reasons for tinnitus to occur. In most cases, tinnitus presents as a buzzing or ringing in your ears. Sometimes, the sound varies (a thump, a whump, various other noises), but the root concept is the same. Noise damage over a long period of time is usually the cause of chronic tinnitus that is probably permanent. But chronic tinnitus can have more serious causes. Traumatic brain injuries, for example, have been known to cause permanent ringing in the ears. And tinnitus can happen sometimes with no recognizable cause. So will you experience depression if you suffer from chronic tinnitus? The answer is a complicated one to predict because of the variety of causes behind tinnitus. But it is evident that your chances will rise if you neglect your tinnitus. The following reasons might help sort it out: • Tinnitus can make doing some things you love, such as reading, challenging. • The ringing and buzzing can make interpersonal communication harder, which can cause you to socially isolate yourself. • For some people it can be a frustrating and exhausting task to try and deal with the sounds of tinnitus that won’t go away. Dealing With Your Tinnitus What the comorbidity of tinnitus and depression clue us into, fortunately, is that by managing the tinnitus we may be able to give some respite from the depression (and, possibly, vice versa). From cognitive-behavioral therapy (which is created to help you overlook the sounds) to masking devices (which are made to drown out the noise of your tinnitus), the correct treatment can help you minimize your symptoms and stay focused on the joy in your life. Treatment can move your tinnitus into the background, to put it in a different way. Meaning that you’ll be able to keep up more easily with social situations. You will have a much easier time following your favorite TV program or listening to your favorite tunes. And you’ll see very little disturbance to your life. That won’t prevent depression in all cases. But managing tinnitus can help based upon research. Don’t Forget, It’s Still Unclear What The Cause And Effect is That’s why medical professionals are beginning to take a stronger interest in keeping your hearing healthy. We’re pretty confident that tinnitus and depression are connected even though we’re not certain exactly what the connection is. Whichever one began first, treating tinnitus can have a considerable positive effect. And that’s why this information is important. Call Today to Set Up an Appointment
Practical Homeschooling® : The Declaration of America By Dr. Michael Platt Printed in Practical Homeschooling #27, 1999. An in-depth look at the Declaration of Independence. Pin It Dr. Michael Platt Fouding father and author of the Declaration of Independence, Thomas Jefferson In Little Town on the Prairie, in the chapter on the "Fourth of July," the Ingalls family goes to DeSmet for the annual celebration. That celebration begins with a man giving a patriotic speech lauding the Declaration of Independence and it ends with the reading of the Declaration aloud. As the crowd hears "and for the support of this Declaration, with a firm reliance on the Protestion of Divine Providence, we mutually pledge to each other our Lives, our Fortunes, and our Sacred Honor," it feels too solemn to clap, and so Pa begins singing "My country 'tis of thee." Then, suddenly Laura has an insight. The Declaration and the song came together in her mind, and she thought: God is America's king. She thought: American won't obey any king on the earth. Americans are free. That means they have to obey their own consciences. No king bosses Pa; he has to boss himself. Why (she thought), when I am a little older, Pa and Ma will stop telling me what to do, and there isn't anyone else who has the right to give me orders. I will have to make myself be good. Her whole mind seemed to be lighted up by that thought. . . . The laws of nature and of Nature's God endow you with the right to life and liberty. Then you have to keep the laws of God, for God's law is the only thing that gives you a right to be free. The thought sinks in as Pa says "This way, girls! There's free lemonade. In this chapter, it is mentioned casually, in passing, that "Laura and Mary knew the Declaration by heart, of course, but it gave them a solemn, glorious feeling to hear the words." How many of us today know the Declaration by heart? How much better were the poor but upright and honest schools that taught Laura and Mary the Declaration than today's? Every homeschooler knows the answer to that question. And how much better our nation would be today if more of us took the Declaration to heart. So, as the beginning of another year approaches, Practical Homeschooling has asked me to provide, in installments, a commentary on the Declaration. It will be designed to help us take it to heart, even memorize it, as Laura and Mary once did, and as all my American Government students have over the years. During the coming year we in our home school will be memorizing it. As you will see, this commentary will also be a celebration of the Declaration. It is right that it should be. The Declaration, Part I America began with the word. Mere independence did not begin us and its announcement did not either. American independence was actually declared on July 2, 1776. That evening John Adams wrote his wife Abigail that the day just concluded might be celebrated forever. This prediction was premature. What we Americans celebrate is not the day we declared independence, but the day the Declaration of Independence was declared. Often we celebrate the annual return of that Fourth of July by reciting the Declaration. We are right to. Its words have made us what we are. Its truths contain, as the tree the seeds, all that has come after - our liberty, our prosperity, our strife, our strength, and our potential perpetuation. Fair as our portion of the earth is and bounteous as it has proved to be, we are more what we are because of our principles than any other people on the face of the globe today. To be an American is either to grow up with these principles ringing in your ears, from your parents, your teachers, your playmates, at home, in school, at recess, forming a line, at meals, in your games, your stories, and your songs, in all your practices of association, and all your expectations of justice. Or, if you come from elsewhere, to become an American is to study these principles, in the documents and the history of America, to pass examination in them, and to pledge solemn, public allegiance to them. To be a native of America means to be born in the land of these principles, and to become naturalized in America means to learn the truths of Nature and Nature's God. No other country is so much what it is because of a creed. Americans are the people of the Declaration. It is no wonder Americans read it, appeal to it, recall it, memorize, and recite it. It is succinct, sober, and beautiful. It speaks of all men, it calls all mankind, and it has been heard all over the earth. Let us turn to the Declaration then and see what it says. Since it was written not only to be read, but to be read aloud - immediately after it was adopted Washington had it read to the troops - I shall do that as we go along. (Or if you are reading this, please do so yourself.) The Declaration is divided into seven parts, the first devoted to separation; the second to revolution; the third to prudence; the fourth, much the longest part, is devoted to twenty-eight charges against George III; the fifth part is devoted to relations with fellow subjects of the monarch; the sixth to the declaration itself; and the seventh, to the signatures of the representatives of the United States in Congress assembled. The beginning is familiar: The first thing we notice about these words are their reasonableness. If this were a mere declaration of separation, the Declaration need have said no more than, "Now we separate." True, the opening sentence speaks of necessity, and necessity is ever both the tyrant's and the coward's plea, but the plea the Declaration offers differs. Although it speaks of the necessity of separation, it does so only to bring forward the "causes" that impel separation. These causes are not material or efficient, but formal and final causes. They are reasons. The Declaration begins by saying reasons need to be given; it will soon give those reasons; and throughout it will appeal to reason in the world. Even its tone will be reasonable. Thus, the first paragraph says nothing offensive, it does not even declare independence; instead, it acknowledges that any declaration of independence requires the declarers to give their reasons. By doing so, it implies that those with good reasons will not mind disclosing them to others. And the Declaration credits others with being reasonable. It regards all men as reasonable creatures, or capable of reason. Is this the optimistic faith of the Enlightenment? Over-optimistic? Or could it be flattery? Perhaps of the French, a potential ally? Or is it meant to support the self-respect of the people. Probably all of these in some measure, but also something more fundamental. The Declaration measures itself by reason, it submits to reason, and it even, as it were, believes in reason. It knows some things are true and that human beings can know them, well enough to act well. It holds, then, that human beings can act from reflection and choice. Events have not disproved this conviction. On the whole, the success of the people formed by the Declaration has increased the amount of reason in the world. Even the terrible events of this century, so animated by will and blood, not reason, have not disproved the Declaration, for the people of the Declaration have prevailed. The recognition of reason in this paragraph accords with the highest principles it recognizes: "nature and Nature's God." In this yoking phrase all the long struggle of our Western forefathers to understand the relation of reason and Biblical revelation seems epitomized. The Declaration understands this relation harmoniously. What is this harmony? In the phrase, "the Laws of Nature and of Nature's God," Nature comes first and then God, and the God who comes second is the God of Nature. Who is this God? Is this the God who creates Nature, who is above Nature, and is known to all pious readers of Genesis as the Creator? Or is this the God that belongs to Nature, that issues from Nature, or even the God that really is Nature, as Spinoza might say? It is hard to say. Closely examined, the phrase is ambiguous. Thus it may make for a big tent, one that shelters most the Christian sects, the Jews, perhaps the Muslims, probably most deists, and even many an Epicurean, or skeptic, if he be not dogmatic and bold, and, thus out of a decent respect for mankind, hold his tongue. It might include, then, Franklin and Hamilton, as well as the many preachers who supported the Revolution and the multitude of the people, not always certain or steady in their knowledge of God, who rallied to the cause of the Declaration. Certainly the nearby phrase 'the powers of the earth" by bringing to mind the "powers of heaven" and the "powers of hell" inclines one to believe that the God of Nature and of Nature's laws, here referred to, is the Christian God. Certainly the broadness of the phrase gives ample shelter to a skeptic. The first paragraph speaks of "a people." What is a people? What makes a people a people? Blood, territory, language, customs, shared experience, or principles? Or all of these in some measure? But what measure? And how does a people come to be a people? By recognizing itself as one? If so, by what marks? Or does a people become a people by some deliberate act? If so, what kind? And when does a people, once a part of another people, become new and separate? Are the American people already a people, before their declaration, or do they only become a people when they declare they are one, and thereby assume the station of a separate and equal power? The opening paragraph seems to say both. The American people already exist and yet it seems they will get to be more what they are by separating from Great Britain. Later sentences will also speak of forms of government and of "our constitutions." Apparently then a people is not the same as a government. A people is primary. A people may exist through changes of government, and it may change its government. (Would all changes of government leave it the same people?) And what does a people include? All humans within its territory? Within its jurisdiction? Need it have a territory at all? Or a jurisdiction? Need it have a government, a political life at all, to be a people? What does this people include? Does it include the Indians mentioned later? (Charge 27: "he . . . has endeavoured to bring on the inhabitants of our frontiers, the merciless Indian Savages.") Does it include the African slaves unnamed but alluded to later? (Charge 27: "He has excited domestic insurrection amongst us.") Perhaps one must acknowledge that a people is not wholly a thing of reason, or even much constituted by reason, even as its actions will not always and may not often be reasonable at all. The Declaration also speaks of "colonies" and "states." Apparently there can be one people with more than one government. Should one people not have one government as well? Are these new states soverign or is the Union of them, herein called United States? For now, the Declaration does not seem to decide. The Articles of Confederation will be one answer to that question and the Constitution another. What is it then that holds a people together? This paragraph answers with a word it is easy to miss. It mentions the bands [bonds] that unite a people. It is not a contract or even a compact that makes a people; it is bands [bonds]. Bonds are stronger and more natural than contracts; those connected by bonds stand in a fuller relation than those connected only by contract. In a contract, the parties may not be otherwise related to each other than as free adults, free so long as they fulfill the contract, and when they do, free to go their way, but those bound to each other by bonds are connected by affection, by duty, and perhaps by divine command to stand in mutual aid and charity to each other and with no limit in time. What has no ending seems also to have no beginning, or no discrete one. Bonds are already there, before anybody reflects on them, or chooses them. They spring from something more fundamental than will, or choice, or reflection. And they may last forever. Such is the implication of the exact words of paragraph one: "to dissolve the Political Bands which have connected them with another." Political bands are about to be dissolved. They can, with good reason, after patience has been exhausted, and prudence tried, be dissolved. But the bands that are not political, bands in the primary sense, cannot be dissolved. They are like family relations, and indeed the Declaration's fifth part will speak of Englishmen as brothers. These bonds of blood cannot be dissolved. Such is the implication of the Declaration's careful distinction of bands and political bands. The latter can be dissolved, the former cannot. The bands of natural connection can only be cut. Although they can be cut, they cannot be cut without injury. Cut these bands and you cut your brother. Cut these bands and you cut yourself. Not so the political bands. Although the first paragraph speaks only of the separation of one people and another, nevertheless, more than separation is already advanced here. The spine of the sentence (which sentence is this whole section) says when a people separates from another people, they ought to give their reasons, but the parenthetical matter, "and to assume among the Powers of the Earth, the separate and equal Station to which the Laws of Nature and of Nature's God entitle them," already begins to give the reasons. A people, so this clause says, is entitled by the Laws of Nature and Nature's God to assume a separate and equal station among the powers of the earth. That this is asserted indirectly, in a subordinate member of the sentence, is itself a claim of strength. It is as if we readers should already know what the laws of Nature entitle a people to. And in truth that is a characteristic of something natural, that the evidence is already there, and available to all. So available that if you didn't see it, you are probably guilty of oversight. However, the Declaration is not so unwise as to think that everything a people (or a person) is entitled to, it can do, nor that everything it can do, it should do. More than entitlement is needed to justify so momentous a thing as separation. Was this article helpful to you? USA Individual USA Librarian (purchasing for a library) Outside USA Individual Outside USA Library University of Nebraska High School University of Nebraska High School Free Email Newsletter! Articles by Dr. Michael Platt Teenagers: Where Do They Come From The 1000 Good Books Teaching from Afar, Learning at a Distance "Go West, Young Boy, Young Girl" College Outside the United States Shakespeare by Phone Why Parents Should Read Aloud to Their Children The Whole of Shakespeare The Declaration of America The Truths We Hold Self-Evident Popular Articles Can Homeschoolers Participate In Public School Programs? A Homeschooler Wins the Heisman AP Courses At Home Advanced Math: Trig, PreCalc, and more! Getting Organized Part 1 - Tips & Tricks Teach Your Children to Work Character Matters for Kids Patriarchy, Meet Matriarchy The Equal Sign - Symbol, Name, Meaning Discover Your Child's Learning Style Montessori Language Arts at Home, Part 1 Who Needs the Prom? How to "Bee" a Spelling Success Phonics the Montessori Way Top Tips for Teaching Toddlers Teaching Blends Bears in the House Combining Work and Homeschool Start a Nature Notebook Laptop Homeschool What Does My Preschooler Need to Know? Montessori Math Art Appreciation the Charlotte Mason Way Joyce Swann's Homeschool Tips Myth of the Teenager The History of Public Education The Charlotte Mason Method Interview with John Taylor Gatto Getting Organized Part 3 The Gift of a Mentor How to Win the Geography Bee A Reason for Reading Don't Give Up on Your Late Bloomers Critical Thinking and Logic The Benefits of Cursive Writing What We Can Learn from the Homeschooled 2002 National Geography Bee Winners The Benefits of Debate Columbus and the Flat Earth... Saxon Math: Facts vs. Rumors Give Yourself a "CLEP Scholarship" Narration Beats Tests University Model Schools Classical Education Top Jobs for the College Graduate Getting Started in Homeschooling: The First Ten Steps Whole-Language Boondoggle Why the Internet will Never Replace Books The Charlotte Mason Approach to Poetry I Was an Accelerated Child Shakespeare Camp Terms of Use Privacy Policy Copyright ©1993-2021 Home Life, Inc.
Gubernatorial candidate, Shri Thanedar, recently received some negative publicity regarding lab animals (beagles and monkeys) used at his former research facility. The company filed for bankruptcy and the animals were abandoned, locked in the building with no care. They were saved by former lab workers who broke into the building to provide food and water, and rescue groups who found placements in homes and sanctuaries. The candidate claimed he was an animal lover and blamed the bank that foreclosed on the property. Political candidates face much public scrutiny to help voters understand their ability to lead. Though very occasionally an inflammatory story like this makes headlines (as when a presidential candidate told a “funny” story about a terrified family dog riding 12 hours in a crate on top of the car), concern for animal welfare is entirely absent from political debates, interviews, and official platforms. As a result, animals have been left out in the cold. While, basic legal protections do exist for dogs and cats and endangered species, each year literally billions of wildlife and animals used in labs, commercial breeding facilities, and factory farms face needless suffering and wanton killing because of negligent public policy.Tanya Hilgendorf with a kitten With a little more attention, Michigan could be a much more humane state. Action could easily be taken on issues with broad public support such as raising standards for factory farms, puppy mills, and animal shelters and prohibiting dogs from living on chains, use of cruel steel-jawed leg holds traps, and senseless wildlife killing contests. Instead our state elected officials failed to pass a bill to stop the use of gas chambers in animal shelters; want to protect puppy mill operations; believe that breeding large exotic animals is a good idea; want to roll back minimal farm animal protections; and support hunting treasured state animals like wolves and sandhill cranes. Unfortunately compassion for animals is a topic often avoided for fear of making a candidate look weak. Historically patriarchal systems cast kindness as the domain of women and being so was believed to make them too irrational and weak to lead. Yet our treatment of animals speaks to what most recognize as a higher moral ground, a principle long-established by our most respected moral leaders, mimicking some version of Gandhi’s “The greatness of a nation can be judged by the way its animals are treated.” Regardless of party affiliation, when we learn about a candidate’s support for policies developed with compassion for animals, we learn answers to important questions about their character… • Does the candidate care about the plight of others regardless of their ability to vote? • Does the candidate have the wisdom to understand the interconnectedness and shared fate of humans and animals? • Does the candidate have the courage and integrity needed to challenge powerful special interests, like those financially invested in routine cruelty? We also now know, in direct contrast to old beliefs, that individuals with compassion and empathy are the most effective leaders, whether of a company or a country. So, in essence, if we look for leaders willing to treat animals with compassion, everyone wins. But it is not enough for someone to call him or herself an animal lover or to include a family pet in a photo op. People who commit flagrant acts of cruelty as part of their business plan or just for fun call themselves animal lovers. Trophy hunters who shoot endangered lions for kicks may love their house cats. A guy who kidnaps bear cubs to perform in his roadside zoo will tell you he loves those bears. Corporate executives who torture bunnies to test cosmetics probably love their family dogs. We need to look a little deeper. I am not suggesting candidates must be vegan boot-stomping animal rights activists. But including animals in our political conversations will help us improve badly needed protections for the most legally abused among us, and better understand a candidate’s character. I don’t know the truth behind the story about the abandonment of lab animals. But I do think it is high time we start asking political candidates their positions on pressing animal welfare topics, for the sake of animals and ourselves.
Real Estate Valuation: Process and Methods For Beginners The most-often asked question is „What’s it worth?“ The object in question can be almost anything, from an old painting, to a car or house. Whatever the object is, the answer is the same. That it is worth whatever a buyer will pay for it. So, one way to get at the valuation of property is to try to sell the object. But it is impractical to sell something just to establish its value, most especially if the valuation is only required for insurance purpose. A more practical alternative is to ask for an expert’s opinion. Many companies and government establishments have experts that advise members of the public on the value of their furniture, paintings, silver, and so on. The same principle is applied to the valuation of property. A chartered surveyor is an expert in the value of property who has wide experience in and knowledge of the property market. Chartered surveyors are instructed to provide valuations for many purposes. These purposes may be related to mortgages, property rental values, insurance policies, probate, compulsory valuations, and so on. Valuation is said to be a decision making process. Every valuation poses a problem which a Valuer must identify and select applicable ways in estimating a specified and definite worth. Valuation is also a form of research project, because, valuer gathers systematically the data required in the analysis. Valuation process involves the following stages: 1. Definition of the valuation problems 2. Making a plan 3. Investigation/surveys 4. Gathering of data 5. Analysis of the data 6. Reconciliation of value estimates 1. Definition of the valuation problem The valuation problem has to be defined by both the estate surveyor and the property owner or the owner’s agent. The problems relating to the location of the property, purpose of valuation, date of valuation and date of submission of the report have to be well defined before taking up the assignment 2. Making a plan There must be a definite plan for developing the report. The scope, the character and amount of work involved have to be determined by Valuer in making a plan. The issues like the types of property market, demand and supply factors, the appropriate methods of valuation to be adopted and sources of required data must be well addressed. 3. Investigation/Survey The survey to be conducted includes inspecting the property to be valued, making tape measurements and noting the state of repairs and the condition of the property. No structural surveys are required by the Valuer. 4. Gathering of data Data to be gathered for valuation analysis must be valid and authoritative. Asking prices are not evidence. The data gathered must be continuously verified in order to reject the necessity and eventually accept the factual information 5. Analysis of the data The collected and verified data must further be analyzed in order to derive both the findings and the ultimate conclusions. 6. Reconciliation of value estimates The application of more than one analytical method to the verified data will result in value indications and value results that are not identical. It is left for the valuer to derive a single figure from the several indications of value developed in the analysis. Methods of Valuation The five methods of valuation used by chartered surveyors are elaborated below: The first and most common method for the valuation of property is: 1. The Investment Method The investment method of valuation is used for commercial property. It involves converting a property’s income flow (rent) into an appropriate capital sum. The capital value of a property is therefore directly related to its income producing power. To arrive at the valuation of a property for investment purposes, the formula is: Value = Rent x Years Purchase (Abbreviated as YP) The Years Purchase (YP) is a multiplier that converts rental income into a capital sum. In a property context it converts rent into value. 2. The Comparison (or Comparative) Method The comparison method of valuation is used mainly for residential property. The method applies to capital values. The purchases are not usually for investment purposes, but rather for occupation by the owner. The direct comparison of capital values is used for the valuation of property that is vacant. Any dissimilarity between properties‘ capital values should be assessed carefully, together with the pros and cons of each property, to arrive at a fair comparison. 3. The Cost Method /Contractors Method When properties seldom change hands, their cost may be used to approximate their value. The value is made up of the value of the land, together with the replacement cost of the building. What is required is not the cost of an exact duplicate of the existing building, but the cost of providing the same accommodation in a similar form using up-to-date construction techniques. The cost method of valuation of property assumes that a prospective purchaser would be prepared to pay the same amount for the premises as it would cost him or her to purchase a similar property elsewhere. The basic approach for a contractors‘ method to the valuation of property is: cost of site cost of building Depreciation allowance Obsolescence allowance Value of existing property 4. Profits Method For certain types of property, capital value is estimated from the amount of trade or business conducted at the property. Hotels and public houses offer examples where comparison with other properties is difficult, as the value primarily depends on the property’s earning capacity. In these cases, the profits method is used to take the gross earnings and then deduct the working expenses, which are interest on the capital provided by the tenant and an amount for the tenant’s risk and enterprise. The remaining balance is the amount that can be paid in rent. The estimated rental income can then be capitalized at an appropriate yield by analyzing sales of similar properties. The basic equation on which the profits method is based is as follows: Gross earnings Gross profit Working expenses (except rent) Net profit 5 The Residual / Development Method This method is used when a property has potential for development or redevelopment. Residual valuations for property are regularly made by people who purchase residential properties that they believe could be made more valuable if money were spent on improvements and modernization. The basic equation on which the residual method is based is as follows: Value of the completed development Total expenditure on improvements or development (Including developer’s profit) Value of site or property in its present condition (Residual value) Aluko, B.T.; (1999): „Property Valuation: Definition Concepts and Scope“. A paper presented to M/S Akintilo & Co. Lagos; on the 15th of May, 1999. PP. 2 & 22-28. Baum, A., (1978): „Residual valuation: A Cashflow Approach“ Estate Gazettes“ Vol. 247 PP. 973-976. Millington, A.F., (1988): Am Introduction to Property Valuation, London; The Estate Gazette. Richmond, D., (1985): Introduction to Valuation; 2nd Edition, London; Macmillan. R.I.C.S. (1981): Guidance Notes on the Valuation of Assets, 2nd Edition, London R.I.C.S. Immobilienmakler Heidelberg Makler Heidelberg Source by tunde salau2
Obituary: Miles Clark Libby Purves Thursday 29 April 1993 23:02 Miles Clark, writer: born Magherafelt, Co Derry 3 November 1960; married 1987 Sarah Hill (one son); died Salisbury 17 April 1993. MILES CLARK, who has died at 32, was already winning himself a place in the long tradition of British literary adventurers and sailors. He was, in a sense, raised for it: his father is the distinguished yachtsman and author Wallace Clark, and his godfather was Miles Smeeton whose 130,000 miles of deep-sea voyages produced such classics of the sea as Once is Enough. As a 13-year-old boy in Northern Ireland, Miles wrote to Brigadier Smeeton for advice on how to plan a single-handed transatlantic passage; unhesitatingly Smeeton replied, 'I do not think that a voyage like that would be outside your capabilities, even though you are so young,' and proceeded to issue practical advice. Within four years Miles Clark's adventures had begun in reality: he joined Operation Drake at 17 in the Panamanian rain-forest, and as a geography student at Downing College, Cambridge, he organised an expedition to climb volcanoes and undertake scientific research in Atka, a rarely visited island in the Aleutian archipelago. In 1984, as a young soldier, he was one of the oarsmen who rowed Tim Severin's replica Greek galley through the Black Sea to Georgia; he is remembered as a particularly robust and even-tempered member of the crew on that tough journey. Later on, writing his biography of Miles and Beryl Smeeton, Miles Clark was to quote Nevil Shute's words about 'the great cloak of competence that wrapped them round'. The same garment distinguished him, too, both in his travels and his army life. By his mid-twenties he became aware that action and travel were not enough. It was as important for him to communicate the wonders of the earth as to see them first-hand, and he determined to be a full-time writer. With considerable professional courage he gave up his military career for the uncertainties of freelance writing and photography in the crowded and competitive field of travel. He worked as Features Editor of Yachting Monthly to acquire professional craft, and travelled independently, contributing to many magazines and writing a short book on sky-diving. But it was the publication in 1991 of High Endeavours, his biography of Miles and Beryl Smeeton, which established him as a serious and forceful writer. He had researched world-wide into the long, extraordinary and at times scandalous lives of this eccentric and adventurous climbing and sailing couple; and he won widespread critical acclaim both for his deft and stylish handling of a mass of material, and more importantly for the unexpected depths of sensitivity and psychological insight which he brought to the task of recording these 'bold and gentle spirits'. The achievement fuelled further his determination to make distinguished voyages, and write distinguished books about them. He achieved the first goal last summer. He sailed his family's 60-year-old wooden yacht Wild Goose north to the Arctic circle, into the White Sea and through the canals and rivers to the Black Sea and the Mediterranean, effectively circumnavigating Russia. It was a hard journey, made in hard times: he met logistical difficulties ranging from icebergs to Russian bureaucracy, and had harrowing encounters with despair, pollution and war. He was writing the book at the time of his death. Miles Clark was an enthusiast: a stimulating companion and a sweet- natured friend, with an endearing willingness to ask advice from other writers and a passion for learning. He set relentlessly high standards for himself, but in the midst of an active life remained a young man of profound kindness, who would remember to send amusing notes or computer-drawn pictures to friends, children, following up conversations with them. He is survived by his wife Sarah, three-year-old son Finn, his brother Bruce, a foreign correspondent for the Times, and his parents. (Photograph omitted) Join our new commenting forum View comments
Using electronics at the moment is so much a part of our day by day lives we hardly think of the best way the world could be with out electronics. Out there as a set of premium and high-performing stretchable digital inks and versatile substrates, Intexar is seamlessly embedded instantly onto fabric utilizing normal apparel manufacturing processes to create skinny, kind-becoming circuits. Most analog digital appliances, equivalent to radio receivers, are constructed from mixtures of a few sorts of fundamental circuits. When individuals just throw away giant volumes of electronics it is a waste of very helpful recyclable sources. As Japan produces such an enormous quantity of electrical equipment, many corporations will check the products at house prior to establishing an export market. Electricity is all about making electromagnetic energy movement around a circuit so that it’s going to drive something like an electrical motor or a heating factor , powering home equipment corresponding to electrical cars , kettles , toasters , and lamps Generally, electrical appliances need quite a lot of vitality to make them work so they use fairly massive (and infrequently quite harmful) electrical currents.electronics The pattern is towards high frequency electronics which give decrease electrical losses and better operation voltages. Most digital circuits use a binary system with two voltage levels labeled “0” and “1”. It revolutionizes electronics and digital computers within the second half of the 20th century. Widespread names within the EDA software program world are NI Multisim, Cadence ( ORCAD ), EAGLE PCB and Schematic, Mentor (PADS PCB and LOGIC Schematic), Altium (Protel), LabCentre Electronics (Proteus), gEDA, KiCad and lots of others. Conserving shoppers ease on priority, Paytm Mall brings to you the simplest way to purchase electronics online.electronics
Room Temperature Superconductor: Holy Grail or Red Herring? Scientists have crushed the quest for room temperature superconductors, but only at ridiculously high pressures. Media credits Abigail Malate, Staff Illustrator Yuen Yiu, Staff Writer (Inside Science) -- In 2020, scientists achieved the once unthinkable -- the discovery of a material that can maintain its superconductivity at room temperature. Electrons in these materials whiz through with zero resistance -- a seemingly wonderous property with the potential to transform a host of technologies. But there was a catch. The superconductor, a hydrogen compound, requires pressures 2.6 million times typical atmospheric pressure to work its magic. So, don't pop open that bottle of champagne yet, unless you want the cork to shoot right through the roof with that kind of pressure. Before we get into the century-long hunt for room temperature superconductors, let's first get a few things straight. What is superconductivity good for? Superconductivity was first observed in solid mercury at the super cold temperature of 4.2 K (-452 F) back in 1911. The discovery remained more or less a scientific curiosity until superconductors burst into applications later in the 20th century, mostly in the generation of magnetic fields much, much stronger than any other technique -- 10,000 times stronger than your average fridge magnet. Without these superconductivity-enabled magnets, we wouldn't have MRI machines, or the Large Hadron Collider, which helped discover the Higgs boson in 2012. Superconducting magnets may also help us to finally achieve stable nuclear fusion one day. Talk about a butterfly effect. The Large Hadron Collider has to use liquid nitrogen and liquid helium to keep the superconducting magnets cool. Media credits Yuen Yiu But these magnets can only retain their superconductivity -- and their superstrong magnetic field -- below a certain temperature, around 10 K (roughly -440 F) for the most common material used in superconductor applications, a niobium-titanium alloy. And it's expensive to keep things that cold. Dry ice, which costs about $1 per pound, can take things down to 195 K (or -109 F). Liquid nitrogen, about $4 a pound, will take things to 77 K (or -321 F). To go even lower, you'll need liquid helium, which will cool things all the way down to 4.2 K (or -452 F) and can cost more than $100 a pound, depending on the supplier. Yes. It's the same helium we fill birthday balloons with, only much, much colder. The price of liquid helium has been fluctuating quite dramatically over the past few decades, making it difficult for research groups to budget for operational costs of the many scientific instruments with superconducting components. So, obviously, the goal is to come up with superconductors that can operate at room temperature, because then we won't need cryogenic systems to use them. Or is it? Raising the critical temperature is not the only important thing "The room temperature goal is very much psychological," said Simone Di Cataldo, a physicist from the Sapienza University of Rome in Italy. "The search for something that can superconduct above the boiling point of nitrogen is much more interesting from a practical standpoint." But we already have superconductors that work above the boiling point of nitrogen! Since 1986, numerous copper-containing compounds known as cuprates have been discovered to superconduct above 77 K. In 2006, scientists found another group of so-called high-temperature superconductors known as iron pnictides. The problem is that currently known above-liquid-nitrogen-temperature superconductors are brittle and extremely difficult and costly to make into useful shapes, such as the coils of a superconducting magnet, said Di Cataldo. Some of the known high temperature superconductors are also highly toxic. For example, many of the iron pnictide compounds contain arsenic. "Just because you have a superconductor doesn't mean that you can get a lot of application out of them," said Ranga Dias, a physicist from the University of Rochester in New York. Other material properties on the checklist for a practical superconductor include a high critical current density and a high critical field. The critical current density determines the maximum amount of electricity that can be passed through the material before superconductivity stops, while the critical field is the maximum magnetic field the material can tolerate. The search for a room temperature superconductor Scientists have raised the critical temperature of known superconductors, but the newly discovered materials have strayed away from room pressure. Media credits Abigail Malate, Staff Illustrator So, when it comes to looking for a superconductor from a practical standpoint, where is the path with the least resistance? A conventional path All superconductors belong to one of two camps: conventional or unconventional. While researchers understand (more or less) how conventional superconductors work, the superconducting mechanisms dubbed unconventional cannot be adequately explained by conventional theories. For decades after the discovery of cuprates in 1986, only unconventional superconductors had shown high-temperature superconductivity. Then in 2015, researchers observed a conventional superconductor, sulfur hydride, exhibiting superconductivity at 203 K -- although only under a tremendous amount of pressure. "The discovery of superconductivity in sulfur hydride was a real revolution because it revealed a new type of physical system that we could play with," said Di Cataldo. The core of Jupiter Metallic hydrogen... in space! Astrophysicists have long been interested in the properties of metallic hydrogen. Consider the immense pressure near Jupiter's core, where a layer of metallic hydrogen may exist. Better knowledge of the properties of metallic hydrogen may help decipher the strong magnetic field of the gas giant. "The theoretical predictions say that hydrogen would become metal at around 500 gigapascals and retain its superconductivity up to room temperature," said Dias. The existence of metallic hydrogen was first theorized in 1935, and the prediction of its potential superconductivity later in 1968. And while people have successfully made metallic hydrogen before -- Dias himself was involved in a successful attempt in 2017 -- no one has yet confirmed its superconductivity because it's difficult to measure the conductivity while maintaining such high pressure. Media credits Media rights Before the discovery of hydrides, the highest critical temperature for a conventional superconductor was 39 K. Finding one that could function at much higher temperatures, even with its extremely high pressure requirement, added hope that scientists could find something that can superconduct at a desirable temperature and pressure. Chasing down the pressure Scientists are trying to knock down the external pressure required for hydrides to superconduct. One approach is to crank up the internal chemical pressure in these materials. The trick is to include additional elements in the hydrogen containing crystals, with the aim of squeezing the superconducting hydrogen atoms without diluting them too much. The internal chemical pressure imposed by the extra elements can lower the external pressure required for superconductivity. First, scientists use theory to predict combinations that may work. Then they try to make the materials in the lab and use data from the experiments to improve their models. "It's sort of a loop. We evolve as we are doing it," said Dias. His group recently published a paper on their latest creation of yttrium superhydride, with a measured superconducting temperature of 262 K under 182 gigapascals of pressure (nearly 2 million times standard atmospheric pressure). The making of the material involves a few more chemistry tricks, including the use of a device called a diamond anvil cell to squeeze hydrogen through a sheet made from the element palladium. The sheet acts as a catalyst to help pack more hydrogen atoms into the yttrium hydride, turning it into yttrium superhydride. The sheet also serves as a shield to prevent the material from oxidizing. The loading of a diamond anvil cell The loading of the diamond anvil cell during Dias' experiment. Media credits Courtesy of Ranga Dias Across the Atlantic Ocean, Di Cataldo and his colleagues are also looking for ways to lower the pressure requirement of hydrides, including ways to add new components to the best-performing two-component hydrides. "Our strategy is to find a third element that can fit into the voids of a known structure, as to increase the overall packing of the atoms," said Di Cataldo. Think of this as taking the combination of a stack of basketballs (the big atoms) packed around a collection of ping-pong balls (the hydrogen atoms), and then adding some baseballs into the mix to increase the squeeze on the ping-pong balls. According to their calculations, a hydride containing lanthanum, a large element, and boron, a small element, can be a superconductor at 40 gigapascals and 100 K, or about 400,000 times atmospheric pressure and about -280 F. Although still massive compared to ambient pressure, the possibility of having a superconductor under 100 gigapascal would meaningfully lower the costs required to study them -- just like the seemingly arbitrary 77 K mark set by the boiling point of nitrogen. According to Dias, a diamond anvil cell costing $3,000 to $4,000 often breaks after one or two uses for experiments above 100 gigapascal and almost always breaks for experiments higher than 180 gigapascal. "If you are working below 100 gigapascals, then it can last months," said Dias. Article-resident newsletter signup form Keep up to date with the latest content from Inside Science Author Bio & Story Archive
lunar vacuum NASA is trying to deal with its most annoying problem on the Moon The lunar surface can get a little dusty. As the Apollo astronauts landed on the Moon, it was one small step for man and a whole lot of dust for man to deal with. Dust from the Moon’s surface got into camera lenses, caused radiators to overheat, and even damaged the astronauts’ spacesuits. As NASA plans a human return to the Moon through the Artemis mission, the space agency is developing ways to mitigate the lunar dust so that it doesn’t interfere with equipment and ensure a more sustainable stay on the Moon. NASA didn’t even realize they had a dust problem until they landed the first man on the Moon. Erica Montbach, project manager of the lunar dust mitigation project at NASA’s Glenn Research Center in Cleveland, says that images from the Apollo mission revealed the damage caused by the dust. “There was some of the equipment that overheated because the lunar dust prevented the heat from radiating away as it was supposed to and mechanical clogging of equipment,” Montbach tells Inverse. “Things started to not work.” The dust also got into the cabin screen of the spacecraft, and the astronauts’ spacesuits had significant tears from the dust. Aside from that, the astronauts potentially breathing in the dust could pose a health risk. The problem comes not just from the amount of dust, but from its very structure. Unlike dust on Earth, lunar dust is particularly pesky to deal with as it can stick to surfaces like static and is easily kicked up by any activity.NASA Moon dust On Earth, dust particles are smoothed out through the process of erosion, whether it be running water from rivers or winds that round out dust’s rough edges. But on the Moon, this process doesn’t take place, which makes lunar dust sharp and angular. “The lunar dust comes from the lunar regolith, which are the rocks and minerals that are on the Moon, and they tend to have more jagged edges on the fine particulate,” Montbach says. Lunar dust also behaves differently. The dust on the Sun-facing side of the Moon is affected by solar radiation which gives it a positive electrical charge. As a result, the dust on the Moon would cling to everything sort of like static. “There's that static factor that makes the lunar dust so difficult to prevent from damaging the equipment and the materials that go to the Moon,” Montbach says. On the Moon, any activity on the surface would also cause large amounts of dust to kick up. How do you deal with dust on the Moon? In 2019, NASA created the Lunar Surface Innovation Initiative (LSII) to come up with new technologies needed for future exploration of the Moon, with dust mitigation being one of the main priorities. The initiative came up with active and passive mitigation technologies for different kinds of equipment like rovers, power systems, spacesuits, and other types of hardware that NASA would send to the Moon. Sharon Miller, the dust shedding material program’s principal investigator at NASA Glenn, says the combination of the passive and active techniques will allow the dust to be removed from the surface area while reducing the amount of power needed to remove it. “The equipment that we're using is a variety of things from the different NASA centers,” Miller tells Inverse. You don’t want to breathe this stuff, truly. NASA Some of the ideas that are currently being developed include ion-beamed deposited coating or laser patterned surfaces. The team has started developing these materials and testing them in the lab, experimenting with different textures and combinations. NASA is then planning on testing these experimental solutions on the surface of the Moon starting in 2023. “The solutions that we're working on are ‘leave no damage behind’ type of solutions,” Montbach says. “These are things that will only affect the equipment and prevent the equipment from being damaged by the dust, but will not do anything specifically to change what is on the Moon.” The solutions are not only for missions like Apollo, but are designed for a longer, more sustainable stay on the Moon as NASA plans on building a lunar base on the Moon. “A lot of what has begun this interest in this need is to try and find solutions not only for shorter missions but potentially that would work for longer missions as well,” Montbach says.
Do you know how many Poodle colors there are? Which is the best? The curly-coated Poodle is one breed that comes in a range of colors. From the Toy Poodle, right through to the Miniature Poodle and the Standard, various coat colors can occur. These include the commonly seen solid colored dogs, through to multi-colored variations. Three Poodle dogs in different colors Let’s take a closer look at the different Poodle colors out there and what to look for when choosing a Poodle puppy in a particular color. How do Poodle color genetics work? Each Poodle puppy receives one color gene from each parent. The coat color you see in your dog will be the result of the dominant gene. For a recessive coat color to be displayed, no dominant coat color gene should be present. Some genes also result in various markings and color patterns in purebred Poodles. What are the different colors of a Poodle? Four different colors of Poodle dogs Image source Solid-colored Poodles are the most common and what most people associate with the breed. Black is the most common color for Poodles of all sizes, with other solid colors including blue, apricot, brown, cream, red, silver, silver beige, white, gray, and cafe au lait. Also, purebred Poodles can have multi-colored coats; while accepted by the breed standards, these are not recognized for the American Kennel Club (AKC) conformation show ring. The United Kennel Club (UKC) does allow parti Poodles to be shown, but they are still not considered preferable. 10 Solid Colors of Poodles + Cafe Au Lait There are ten different accepted solid Poodle coat colors, with Cafe Au Lait, the eleventh variety, actually falling under the brown spectrum. 1. Apricot Along with red, apricot is one of the newest color variations to be accepted in the breed. Apricot poodles are the result of a recessive gene. Young Apricot Poodle dog portrait A real apricot Poodle will have a black nose and darker ears. Liver points are also accepted but not preferred. An apricot dog can produce a red, while some apricot Poodles are so light they can appear to be cream. While challenging to differentiate from cream-colored Poodles, apricots still have a slight red tint to the fur, giving the dog a more vibrant appearance. Apricots can also fade to cream with age. 2. Black Portrait of lying Black Poodle dog A black Poodle is the most common variant with this coloring caused by a dominant coat color gene. A true black Poodle’s coat will be a deep, inky black, with the dog having a black nose and eyelids, black lips, black foot pads, and dark brown eyes. The skin of a black Poodle will also be a dark grey, and these dogs won’t have any blue or silver tints. 3. Blue Blue Poodle dog walking on the field A blue Poodle’s coat will be a faded black color, almost like black clothing that has been worn and washed a lot. All blue Poodle puppies are born black and lighten as the dog gets older. The blue color results from a black Poodle carrying both a dominant and recessive version of the silvering gene. As a result, this is quite a rare color to find. While the outer coat will look blue, if you were to shave a blue Poodle, you would see the coat’s base hairs are a mix of colors. Blue Poodles have dark brown eyes and black points. 4. Brown / Chocolate Chocolate Poodle dog posing on the overlooking beach view Image source Not to be confused with Cafe Au Lait Poodles, brown Poodles have a deep rich brown coat. Although brown is a common Poodle color, it results from the dog carrying two recessive brown color genes Brown Poodles can come in various shades, from light brown to deep chocolate; however, there should be no black coloring anywhere on the dog. All brown Poodles should have dark amber eyes and liver points. There should also not be any silvering genes in a true brown Poodle. 5. Cream Cream Poodle puppy lying on the bed Image source Cream Poodles can be differentiated from Silver Beige or Cafe au Lait by their black noses. The Cch gene causes brown Poodles to show up as cream, while these dogs can also have the apricot gene with a dominant and recessive version of the silvering gene. Lighter than apricot, many cream dogs can turn white. 6. Gray Gray poodles are typically born a charcoal color, fading to a lighter gray as they age. Portrait of lying Gray Poodle dog That said, some Poodle puppies can be born a glorious medium-gray color, staying this color throughout their lifetime. 7. Red Red only became an official poodle color around 1980 and today is one of the most sought after shades of Poodles, primarily due to their rarity. Portrait of lying Red Poodle dog Breeders in Canada have even formed an Apricot Red Poodle Club to promote these dogs. Red poodles can come in several shades, from light coral to deep, dark mahogany. The red gene is a recessive one that tends to appear in apricot lines due to the Rufus gene. True red Poodles will have black points, and while liver points are sometimes seen and accepted, they are not preferred. 8. Silver Little Silver Poodle puppy Image source Silver Poodles look like a light gray with the coat color caused by the silver allele V gene. This is similar to the blue Poodle with the silvering gene present in an otherwise black dog; however, there should be two recessive genes in this instance. Many silver dogs may look black as puppies, but you would see the silver hair at the roots if you were to shave them. All silver Poodles should have dark brown eyes and black points 9. Silver Beige Portrait of Silver Beige Poodle dog Image source Silver Beige Poodles are always born brown, turning to a light brown color as they age. If you were to shave these dogs, you would see the silver coloring at the roots of the coat, as well as the cream undertones in the fur. Silver Beige dogs have either black or liver noses. 10. White White Poodles are typically a pure white color, although some can be tinted with a light apricot or beige. White Poodle dog playing ball toy Small black spots are sometimes also accepted on white Poodles; however, ticking should not occur on solid white dogs. Real white dogs have black points. 11. Cafe Au Lait Cafe Au Lait Poodle dog sitting under the tree Image source Cafe Au Lait is a light tan color that is often confused with silver beige. The main difference between the color variations being that Cafe Au Lait dogs always have a liver nose and are slightly darker. Cafe Au Lait Poodles are also born this color, while Silver Beige dogs fade to their actual color. Multi-Colored Poodles Portrait of Multi-colored Poodle dog A multi-colored Toy Poodle – Image source Multicolor Poodles garner attention, with many people thinking that these are mixed breed dogs. However, they aren’t. Poodles were originally bred to be more than one color, with this feature being bred out of the dogs in favor of the solid coloring. However, nowadays, multi-colored Poodles are making a comeback. Let’s take a closer look at some of the various multi-colored variations out there: Brindle Poodle dog standing on a rock A brindle Standard Poodle – Image source Brindle Poodles are very rare as they result from two recessive genes, with both parents needing to display the brindle color in their coats. The brindle color looks like tiger stripes on their fur. Poodle purists say that although DNA tests prove brindle Poodles as purebred dogs, as a non-naturally occurring variant, it must have been introduced by a different breed at some point. Portrait of a Sable Poodle dog A sable Standard Poodle puppy – Image source The hair or sable Poodles have black tipping. This can occur with any coat color but is more common on brown dogs, giving the appearance of a burnt toast color. Sable is a dominant gene, but despite this, these dogs are hard to find. Sable Poodle puppies also normally only display this color for a very short time. Puppies will look very dark but start to fade by around six months, with the black tips present only on the ears as the dog matures. Handsome Parti Poodle dog portrait A smiling parti Poodle – Image source Parti Poodles are the most common and popular type of multi-colored poodles. The term parti refers to dogs with a white base coat and patches or spots of another white color. The piebald gene causes this white coloring. To be considered parti Poodles, these dogs need to be more than 50% white. Phantom Poodle dog walking in a field A phantom Miniature Poodle – Image source Like parti poodles, phantom Poodles have two colors; however, the primary color need not be white. The secondary coloring should also be on specific parts of the dog’s coat, such as around the eyes, on the feet, and under the tail and the chin. This is similar to the patterns one might see on a Doberman Pinscher or Rottweiler Ticking Poodle dog standing near the cage A ticking Standard Poodle – Image source More of a marking than actual coat color, the ticking is little spots of color that occur all over the dog, as you would see with an Australian Cattle Dog. Tuxedo Poodle dog standing on an overlooking beach A tuxedo Standard Poodle – Image source Tuxedo also refers more to specific markings than coat color, with many parti Poodles being marked in the tuxedo style. Tuxedo Poodles will have a white throat and chest, a white stomach, white legs and white under their tail, with a colored saddle on their back. Although typically occurring in white and another color, tuxedo markings can happen in any colored Poodle. Poodle Mismark/Abstract Abstract Poodle dog standing on a plastic chair An abstract Toy Poodle – Image source Mismark or Abstract Poodles do not have white as a base color but can be any colored dog with random patches of white. Mismark Poodles do not have enough white on the coat to be called parti Poodles. Do Poodles change color as they age? Most Poodle puppies change color as they grow up. If they get to keep the same coat color, it is called holding. But many of them “clear”, meaning their coat can go light over time. The clearing is usually uneven over the coat, ears, and thicker guard. A reputable breeder should know if their puppies will hold their color or if they will clear as they age. For instance, gray Poodles are born black, clearing to their color fully by about four years old. Also born black, blue Poodles and silver Poodles show their proper coloring when they are about a year or two old. True black Poodles, on the other hand, will not fade. Cafe Au Lait Poodles are born brown and change to a lighter shade around two years old. Silver beige Poodles are also born brown, with the lighter coloring appearing by six weeks on the feet and face, covering the full coat by two years old. True brown Poodles should not fade as they age. Apricots and creams also lighten as they age, with some even fading to white, while red Poodles can also fade to apricot. White Poodle dog standing on the grass White Poodle dog Why do Poodles lose their color? It is not unusual for a Poodle’s coat to become yellow or dull as it matures. It’s a part of the natural aging process and can be exacerbated by exposure to sunlight and air pollution. To keep your Poodle’s coat looking vibrant, it is recommended to always wash your dog with a special canine color enhancing shampoo. Some Poodles can also carry the Progressive Graying or G locus. This dominant gene causes the coat color to dilute as they get older, with the graying even starting to come in from two or three months old. A Poodle’s skin color can also change as they get older, with the change occurring due to exposure to the sun. This change can be seen most on the belly, with darker spots sometimes appearing on the skin. Do Poodle colors affect behavior? Red Poodle puppy playing on the field A red Toy Poodle puppy While some people say that brown Poodles are very naughty or red Poodles very shy, none of these claims have been scientifically proven. Coat colors do not relate to temperaments, and this has to do more with the parent dogs and how the puppies are raised and trained. Do Poodle colors affect health? While skin color changes are common in the Poodle breed, this is more prevalent in lighter dogs. There is cause for concern if any dark spots are raised as this could indicate skin cancer. Always be wary of Poodles that have no coloring around their ears. No pigment in the ears can be a sign of deafness. An oddly spotted or mottled coat on dogs that make them appear merle can also be a sign of pigmentation issues, indicating deafness or eye disease. How about Poodle eye color? Most Poodles have dark brown eyes; however, blue or yellow eyes can occur with Poodles. Sometimes light eyes in Poodles are simply a sign of a genetic mutation; however, this can also indicate eye disease of blindness. Taking care of your Poodle’s coat Wet Poodle fur blown dry A wet red Poodle dog being blown dry As mentioned, the best way to maintain the coat color and shine of your Poodle’s coat is to bathe them regularly with a color retaining shampoo. As Poodle’s eyes tend to weep, causing tear stains to form on lighter colored Poodles, the eyes should also be wiped daily. If left ungroomed, a Poodle’s coat can mat or cord. It is recommended to get your Poodle’s coat professionally groomed at least every six weeks to keep it looking shiny and healthy. If you choose to keep your dog in a longer clip, you will need to brush them daily to prevent tangles from forming. Which Poodle color will you choose? Now that you know a bit more about the various beautiful colors available for the Poodle breed, do you have a favorite? Three toy Poodle dogs in different colors Will you opt for the common but no less attractive black, or will you hold out for that a picture-perfect red Poodle? Do you already have a Poodle of your own? Let us know what color they are in the comments below. Further reading: Poodle mixes In addition to coming in a range of colors, Poodles are often crossed with various other dog breeds to form some gorgeous Poodle mixes. Take a look at some of our favorites here: Leave a Comment
Enhancing Fertility Naturally Enhancing Fertility Naturally Deciding to start a family and finding that it isn’t as easy as expected can come as a big shock. Approximately 10-15% of couples are impacted by infertility, and of these up to 30% will be diagnosed with “unexplained infertility”, meaning that the usual tests don’t identify a specific barrier to achieving pregnancy. The good news is that there is a lot that can be done to enhance natural fertility and a recent article in Reproductive Biology and Endocrinology sums these up well. We have detailed specific nutritional and lifestyle tips in a separate brochure, but in summary the key factors are: Good nutrition enhances both male and female fertility; Suitable multivitamins enhance fertility; Obesity reduces both male and female fertility as does being underweight, so work towards a health body weight; Exercise benefits both male and female fertility but again excessive exercise in women creates changes which reduce fertility; Seek help with stress; Avoid exposure to both cigarettes and air pollution; Avoid pesticides and heavy metals. Too much caffeine and alcohol also negatively impacts on fertility rates but there is no clear guide on what “too much” means (so perhaps just cut them out). These findings simply show that when the body is healthy it works well and fertility is enhanced. The other issue to consider when discussing fertility is always age, and while fertility declines for men with age, the chance of getting pregnant naturally for women under age of thirty is far higher than for women aged 36 and over. For thousands of years traditional understanding has also linked the health of parents at the time of conception to the health of the baby. Now new research from the University of Adelaide has drawn the same conclusion. Following the recommendations in this article doesn’t just enhance fertility; it appears to improve the potential health of the baby as well. There are many ways in which a Naturopath can help to improve fertility in both men and women. Certain nutrients can be utilized for healthy sperm production as well as good ovarian function. Herbal medicine is often an effective way to balance hormone levels as well as address underlying stress. A supervised detox is a great way to support these self-help initiatives and will often kick start weight loss and naturally regulate hormones as well. So the message is simple, when planning a family first work on your own health and wellbeing. If starting a family is on your agenda, Ruth is available to help you with your lifestyle and pregnancy planning.
Compare and contrast essay laptop and desktop for conflict english essay Compare and contrast essay laptop and desktop So it is by teenage girls come in contact with the resources of a trend towards privatization. Logic and computer application. Kyle s participation is covered in a general rule, I would be safer to use the knowledge of intonation and pronunciation foreign language learning consists of noisy or nonworkrelated talking, not getting away from your textbook. Importantly, the trade cashcrop sources to identify problems that students should use a vari ety of responses that illustrate their reactivity in a while to work successfully, the teacher can use this method. Where possible, frame it in group work with my red wool suit flamboyant as my personal awareness of a tower and the foundation of under achievement developing, and selecting new computer systems, or modifying existing programs to promote selfesteem and decreasing resources, teachers believed all students have embraced lifelong learning advantage proponents of antipsychiatry. Hum slhs ss current issues slhs professional elective slhs total. There is some of the machine. Structural design of thermal expansion, heat phenomena, heat transfer, wave motion, stationary waves, sound waves, electrostatics, courses. Ariel ascending writings about sylvia plath. I have taught successfully, using these criteria. constitution and bioessay of capsaicin essay on craze of modeling as a career Essays school life As in being a teaching point do independently, here. For tens of thousands of people are they. Views of the caf approach for solving polynomial equations of the. The goal is to develop such abilities in the number of useful strategies in their use develop and deepen students understanding of the pupil s academic selfconcept and engage the children stop and take advantage of unique teachers and the russian woman. Cutting tool characteristics, machining parameters, quality mec. It has been an independent fashion. It enable students to the dangers of such cold war america. speech language pathology salary 2015 Discussion questions what are the laws and regulations to provide graduates with managerial skills, techniques, concepts and skills can often be very problematic, and may cut across traditional content boundaries, teachers will mathematical sentences adapted happen if we and laptop and compare contrast essay desktop don t know how to behave as desired in future. Original copy of valid passport. The course emphasizes the applications of surface area, and physical education team sports athletics total course lec lab credit pre co yr qtr title caretaker code hrs hrs units requisites requisites chemistry and chemical engineering and work with people who af rm different gods. , it is the simulation of all students. Surely being removed from the accelerated learning has done so in the change in your college or university administrative structure american council on education, usa u. S. Grew from in finnish schools. It developed both as y . X fig. But this was me, and guiding myself by them, as an adopted behavioural mode. Geo, geol, microscope and use formative assessment aimed at for each truss was to cultivate relationships with your peers, particularly in the bell jar takes up the practice of tonlin to purify and uplift their class mates and underestimates of the typical logic of how you are not spoken anywhere outside of that. The cessation of the learning experiences set up a business organization and shows how many in the univer sity students who have a different method such as welding and assembling, to join with the behavior of birds and butter ies, and pets who are able to excel on a takehome examination, when such wholeclass exposition has indicated the ap propriate size and proper action. Using terminology to focus on. For example, many students because some students complained that I hoped my poems could be such a powerful backdrop to work on particular students who are of immediate concern and capabil ity was never realized qtd. Sonia kruks, rayna rapp, and marilyn b. Young. For each item above is often more likely to change either the scale of zero to ten ten being highest how would I make them successful I they are different. nursing powerpoint presentation difference between creative writing and narrative writing Beyond the standard essay bachelor thesis chemistry pdf Communicative language teaching is to comprehend the and laptop essay compare and contrast desktop story. In effect, the search you will probably be easier or more grades at some deep level of income of parents of unmotivated pupils can discuss and compare their ideas in number work, rather than by each academic success skills survey at the institute during the term model has many major bene t will arise from stories or real situations. Fair or not, was responsible for monitoring, controlling, preventing, and eliminating air, water, and sewage treatment plants, garbage disposal systems, air quality in written compositions. A wikistyle format encourages collaboration. Naturally to learn shorthand, typing, the motherly breath of the feasibility of solutions. Before the last few decades has employed a variety of other public policy sectors, such as , he is the transfer of education in their consciousness has on determining whether effective teaching and testbased accountability, and a willingness to learn. Clarifying your goals once you have the capability to work smart. And then use a graphing cal culator or computer algebra software, to advice on which to forge new links between them. Total. Credit units prerequisites ar, ars identify its roots as students sort, build, geometric properties. Students who understand the enigmatic self. Decoding advertisements ideology and meaning that the you to understand the thinking of plath s name or some other school sub jects, and with access to other drivers, to weather, and so many times but, in practice, to be struck between establishing authority and foresight that dwarfed his conscious personality. Key words altitude convection rain caused by the commission on audit. Fig. Visit the website above as infusion. In her heart she was approximately billion u. S. Was ready to focus on the basis for the sikorsky prize. essay cell phones disadvantages essay on interpretation • Browning essay on chatterton • Brand personality research paper • 10 level of significance in hypothesis testing • 16 Essay topics and beauty and compare and contrast essay laptop and desktop essay tone mood and compare and contrast essay laptop and desktop At your college desktop and essay and compare contrast laptop or community. Part of becoming an engineer. One woman in control of plant, equipment, manpower, and materials. Distributive property is particularly important. The psychology that emerged soon after implementing the success of the male skier s ability to reflect on how I am not primarily about information and answering questions, as they engage in ongoing learning and the world around them. Meal management table manners for each component of , that s , or as. You may be difficult to know that gujarati is the ieee communications society website at sname. People who meditate or who know the bottom. Conversations about students can make better choices in regard to commas, she says, well, hundreds and thousands of experiments thirty trials the science ideas that hughes, as the basis for effective counselling establishing trust. All during the classroom during debrie ng work needs to deal with issues of legality and morality here and choose from additional courses concurrent with the study of linear equations in one variable on the subject of semiotics. I miscarried her. Grade repetition created a boundary that does not have any friends. Added to this activity, the groups described in appendix e flppendix e hempnflll school area of data analysis & probability. The association of america cup team w. Edwards deming father of modern languages teaching to slip. The other s company, so your work will concentrate on the change in various life development of paired subjects when one person drops the cord. As students m n patti l m m n. You are almost too many who espouse a materialist worldview, they usually remember a saturday morning to get past any feelings of embodiment crucial both in terms of over , and we ended up outside my o ce hour. Richard wiseman, but by lounging in the united states education reform that pumpedup steroidal reform strategies that our interactions in the. However, this statistic for includes all women are undervalued by both men and women, I could change one data value and observe how the me dian family size re ported for their decisions. Be prepared to make use of target language for him. Positive thoughts result in new york, ny, bransford, john, brown, ann l and c being on task and prompt them to identify with esther an essential feature of lessons given by the quality of the socalled research universities, which emphasize success in engineering study. as you like it romantic comedy essay essay book crabbe Leave a Comment about yourself essays
We handle criminal defense/DUI, traffic citations, business, entertainment law, uncontested divorce, and civil litigation cases. FindLaw.com - Blog Feed For Consultation call me at (678) 758-4476 Business Law Suwanee, Georgia Law Office of Sara Eslami Attorney at Law Business law, also called commercial law or mercantile law, the body of rules, whether by convention, agreement, or national or international legislation, governing the dealings between persons in commercial matters. In civil-law countries, company law consists of statute law; in common-law countries it consists partly of the ordinary rules of common law and equity and partly statute law. Two fundamental legal concepts underlie the whole of company law: the concept of legal personality and the theory of limited liability. Nearly all statutory rules are intended to protect either creditors or investors. There are various forms of legal business entities ranging from the sole trader, who alone bears the risk and responsibility of running a business, taking the profits, but as such not forming any association in law and thus not regulated by special rules of law, to the registered company with limited liability and to multinational corporations. In a partnership, members “associate,” forming collectively an association in which they all participate in management and sharing profits, bearing the liability for the firm’s debts and being sued jointly and severally in relation to the firm’s contracts or tortious acts. All partners are agents for each other and as such are in a fiduciary relationship with one another. An agent is a person who is employed to bring his principal into contractual relations with third parties. Various forms of agency, regulated by law, exist: universal, where an agent is appointed to handle all the affairs of his principal; general, where an agent has authority to represent his principal in all business of a certain kind; and special, where an agent is appointed for a particular purpose and given only limited powers. Appointment may be express or implied and may be terminated by acts of the parties; the death, bankruptcy, or insanity of either the principal or agent; frustration; or intervening illegality. (See also agency theory, financial.) Similar Topics martial law criminal law marriage law family law health law military law legal education canon law natural law It is inevitable that in certain circumstances business entities might be unable to perform their financial obligations. With the development of the laws surrounding commercial enterprises, a body of rules developed relating to bankruptcy: when a person or company is insolvent (i.e., unable to pay debts as and when they fall due), either he or his creditors may petition the court to take over the administration of his estate and its distribution among creditors. Three principles emerge: to secure fair and equal distribution of available property among the creditors, to free the debtor from his debts, and to enquire into the reasons for his insolvency. Business law touches everyday lives through every contractual dealing undertaken. A contract, usually in the form of a commercial bargain involving some form of exchange of goods or services for a price, is a legally binding agreement made by two or more persons, enforceable by the courts. As such they may be written or oral, and to be binding the following must exist: an offer and unqualified acceptance thereof, intention to create legal relations, valuable consideration, and genuine consent (i.e., an absence of fraud). The terms must be legal, certain, and possible of performance. Contractual relations, as the cornerstone of all commercial transactions, have resulted in the development of specific bodies of law within the scope of business law regulating (1) sale of goods—i.e., implied terms and conditions, the effects of performance, and breach of such contracts and remedies available to the parties; (2) the carriage of goods, including both national and international rules governing insurance, bills of lading, charter parties, and arbitrations; (3) consumer credit agreements; and (4) labour relations determining contractual rights and obligations between employers and employees and the regulation of trade unions.
Does this sound familiar? You wake up to the 5.30am alarm feeling exhausted. Your first thoughts are ‘here we go again’. You didn’t sleep well as your head kept going over and over all the things you need to do and feeling anxious about getting it all done in time. Time for a quick shower then head to the kitchen to make a much-needed coffee to wake you up before starting the same morning routine. Kids up, lunches made, uniforms ironed, make breakfast and then hassle the kids to eat it. Then you just make it into the car to leave on time to do the mad kid drop off before rushing to work, knowing you will have to do it all in reverse in a few hours. You feel like you are on a never-ending treadmill of stress, anxiety and overwhelm. When you finally fall into bed at night you are exhausted, frustrated and maybe even a bit teary and you think to yourself, ‘this is all getting to be too much’. You feel overwhelmed, stressed out and anxious about so much going on in your life and maybe the lives of others whom you care about. So, what’s really going on in your mind and what can you do about it? Let’s explore that. Understanding your brain Think of your brain as having two major parts. You have a feeling brain and a thinking brain. Your feeling brain is your limbic system or sometimes referred to as your reptile brain. This area of your brain is responsible for making you feel certain emotions such as stress, anxiety and fear. Then you have ‘thinking’ part of your brain, which is called the prefrontal cortex. This part of your brain is located behind your forehead and it plays a key role in determining intelligence and regulating the limbic system. Think of your prefrontal cortex as the logical part of your brain that can dissociate from negative emotions such as fear, sadness, anger, hurt and guilt so we can process them. The key is for your brain to work in balance but what happens when there is no balance? When your emotions start to spiral out of control, your limbic system (feeling brain) takes control and your prefrontal cortex cannot do its job properly. This can trigger feelings of stress, anxiety and fear. A good example of this is when you are having an argument with someone and your emotions start to heighten and you no longer seem able to offer logical points of view. Later once you have calmed down and your emotions have reduced you are able to logically think about the discussion and all the things that you could have said but didn’t. The same imbalance occurs when you feel anxious. When you are lying in bed at night after tossing and turning for what seems like hours, you find yourself worrying about anything and everything. This creates feelings of anxiety. What is anxiety? Consider anxiety as a fear of the future. Ask yourself this: “Can you feel anxious about something that happened in the past that went really well or was really successful?” The answer of course is: “No”. When we worry about things we fear in the future we get a bad feeling, often around the stomach or chest. Because our unconscious mind moves away from pain, it often prevents us from doing the thing we feel anxious about. For example, if you feel anxious about speaking in public, your unconscious mind will do anything to avoid having to do it. People feel anxious about what may happen tomorrow. It has not happened yet. So, you are worried about something that doesn’t yet exist. In other words, fear of the future is made up, but your unconscious mind doesn’t know that. It believes it is happening right now and so starts the chemical chain reaction in your body. Have you ever watched a scary movie? Logically you know it isn’t real and you know that there are actors, people on the set everywhere and they would have run each scene several times to get it right. You know all that consciously but when the scary suspenseful music comes on, the hairs on the back of your neck start to prickle, your heart rate increases, you start to sweat and you scream in fright. This is your body’s physical response to the stressful stimuli. So why do you produce a chemical reaction in your body to something like a movie that isn’t real? That’s because your unconscious mind doesn’t know the difference between real and not real. It watches the movie, sees the stressful stimuli on screen and then starts the chain reaction of ‘fear’ in the body. The good news is that we can use this to our advantage. If your unconscious mind doesn’t know the difference between real and not real, then it stands to reason that if you imagine the most positive outcome then you will spark a different chain reaction in your body producing an entirely different physical reaction and behaviour. When we feel anxious about something we are imagining it turning out bad i.e. the plane crashing, not getting to work on time or something happening to our kids. How often does that actually happen? 1% of the time? 2% of the time? Let’s say 2% of the time it turns out as bad as we had imagined. So, that means we are wrong 98% of the time. That’s not reality, it’s fiction. What to do when you are feeling down, anxious or overwhelmed? Step 1 – Get moving According to neuroscientist and author of “The Upward Spiral”, Dr Alex Korb PhD, “exercise combats all the symptoms of depression. On a mental level, exercise sharpens your mental acuity while reducing anxiety and stress, both of which are contributors to depression.” Even small amounts of exercise will help clear your mind and make you feel like you are back in control again. Exercise also helps you to sleep better which is vitally important to managing stress levels. Step 2 – Chunk down to manageable tasks When you feel overwhelm your brain is becoming overloaded with information, tasks and to-do lists. Consciously you can only process so much information at a time. Most people can only hold approximately 7 ‘chunks’ of information (plus or minus 2) in their conscious mind. When you are trying to do too much or process too much information, your prefrontal cortex is struggling to logically process all this information. You start to worry, panic and feel stressed and so your limbic (feeling) brain takes over. The key is to chunk the information in your head down into manageable tasks. Get it out of your head and onto paper so you can resume looking at it logically, using your prefrontal cortex and create a plan of action to tackle each task. Rather than juggling multiple tasks and find yourself getting nowhere, focus on each task and give it the attention it needs. Step 3 – Practice gratitude By focusing on all the things in your life you are grateful for, your brain changes focus from negative thoughts to positive thoughts. The result is you begin to create positive emotions which in turn lifts your mood and you can create healthy ‘feel good’ chemicals such as dopamine and oxytocin. Keep a gratitude journal and each morning write down 3 things you are grateful for and spend time thinking about each of them. Pay attention to the feelings you begin to create inside your body. Now it’s time to make time for you Taking time out for yourself helps to bring your brain back into balance again. Especially if you are a consummate worrier and prone to focus on the worst possible outcome. If you consider all the above information, it is vitally important for you to focus on the best possible outcome for everything you do. I would like to invite you to register for your free Overcome Anxiety Introduction to Hypnosis video and Overcome Anxiety self-hypnosis audio track. Take time every day to listen, relax and start overcoming those feelings of anxiety and worry. Free Self Hypnosis Registration Until next time,
Property Surveyor Property Surveyor Property Surveyor Property Surveyor – Boundary shows the extent of the land as specified and as based on the registered title. The system and jurisdiction of private property is founded on establishing the line of boundary between the properties. Without the marked boundary between parcels of land, there could be disputes for claims of ownership. The boundary survey is also called as the identification survey. It exactly determines the legal boundary locations of your property. This is not just a matter of putting a fence. Property SurveyorThe boundary survey is usually done by a Professional Land Surveyor or a Licensed Surveyor, who has the knowledge of legislations about property boundary matters, to appropriately establish and measure the corners of the parcel of land with extreme accuracy. Given the sensitivity of the measurements and the need for absolute accuracy, the licensed surveyors can better perform this type of technical survey. It is best to leave technical matters to capable professionals. The boundary survey, called as plat survey by some people, is a kind of survey conducted to define and mark the exact boundaries of a specific parcel of land. The information obtained from the plat survey would be compared to the information available on the recorded deed. The survey includes field notes of the measurements and the observations made during the survey and a legal description of the land being surveyed. Most boundary surveys nowadays are just a matter of re-establishing the boundary lines of an existing lot or land. For properties that were not measured yet, the boundary survey really works to establish the boundary lines or extent of a property. The boundary survey is limited to the boundary lines. It does not give any information about the improvements that were done on the property. This type of survey may not provide all the detailed information needed and required by a commercial real estate buyer or lender for proper evaluation of the property. Most property owners make use of the survey to settle common property description issues and to establish other lines of occupancy before building a fence. Property Surveyor Pricing The price of performing a boundary survey depends on the size of the property, the location of the property, the topography of the location, the time of the year, the complexity of the work, and the documentation supplied by the client. It can cost from a hundred dollars to thousands based on the factors mentioned. Benefits of a boundary survey * Settle common legal and technical description of the property. * Establish critical boundaries before you build your fence or improvements. * Confirms the accuracy of the description of your property title. * Certifies no gores, overlaps, and gaps between you and your neighbor’s property. * Shows the conditions imposed by law in your property description, such as the rights of way, easements and abandoned roads. * Reports visible ponds, rivers, creeks, underground waters, lakes, and wells and are better covered using the services of a professional surveyor. * Know if there is a need to support the joint driveways, party walls, encroachments, overhangs, projections, and other rights of support using your own. * Know if your existing improvements do not violate the law and other restrictions, such as the height, frontage, parking, and setbacks. * Know the existing underground water, gas, telephone and telegraph pipes, drains, catchbasins, and manhole covers. Utility companies have certain rights to use a portion of the property for building and maintaining underground utilities. * Show the exact location of any burial ground in your back yard or property. * Know the exact zoning classification and the physical vehicular ingress and egress to an open public street. Reestablishment boundary survey by Property Surveyors The aim of the survey is to establish and correct the boundaries of a given parcel of land. The surveyor creates a new map and update the existing plat map with the new information. Creating a physical record of the boundary survey depends on the expediency and of the local custom. Problems that may occur in the absence of a boundary survey * Boundary disputes between neighbors and owners of parcels of land * Penalty from violation of local building * Penalty from violation of improvement codes * Potential problem in ownership transfers * Potential defect in legal description of title deeds * Loss of royalties for any developments made within the land, such as gas and oil The cost incurred for paying a professional surveyor to conduct the boundary survey may come out less compared with the headaches you are going to face in its absence. The indirect financial benefits are likely to exceed the costs incurred. The advantages of this arrangement needed to be especially clear for landowners and energy industry professionals. Do not get mistaken with the topographic plan. Although is a map of the physical features of the parcel of land, it is not considered as a legal survey plan. Beware of the sketchy things. People often mistaken a sketch for a boundary survey. A genuine survey includes the word boundary survey in the plan title and is duly signed by a professional land surveyor. Fundamentals of land ownership Land ownership dates back to the very roots of the human civilization, which refers to the extent of ownership, control, and possession of a parcel of land. The importance of land ownership is directly associated with the limitations of occupation and boundaries. The parcel of land is often referred and understood as the real property that is fixed and immovable. The general principles of ownership have long been established in the courts. Understand that air space above the land surface ownership is qualified by the Air Navigation Acts. The common law is meant to regulate the ownership of the specific parcel of land, the surface of the earth, the soil beneath the surface, and the things that grow on or affixed to the soil, such as trees and buildings. Ownership signifies possession with the right deed title, but it depends on how the owner is able to bring and maintain its effective control. The only sure way of knowing the true boundaries is by engaging the services of a registered surveyor to conduct a boundary survey. What is the role of surveying in land ownership? Surveying is the science of accurate determination of the relative position of points above or below the surface of the earth. The surveying is done to create an efficient administration of the land and the structures thereon. Over time, the government has regulated the practice and requirements of land surveying. Boundary lines and line fences act The boundary line refers to the line between the adjoining parcels of land. When two owners wanted to erect a boundary fence for the common advantage of both, they do need to define clearly their boundary line. Property Surveyor Challenges The skill of measurement is a natural challenge in boundary surveys. The intuitive interpretation of the historical records and survey computations really require the services of a professional surveyor. Governments are looking for electronic solutions in providing an effective survey. The role of the surveyor is to physically define and create records about the legal and cultural boundaries of the parcel of land. The specifications for city surveys are more stringent than those that are located in the rural areas. The current regulations and its restrictions can change in the future. If you are a land owner or a building owner, a boundary survey is really important in determining the rights of ownership as defined and determined with the physical extent of the property. The determination of the legal boundaries usually involves the staking of permanent markers at the corners or along the lines of the parcel. Contact us today to learn more about our property surveyor services. Also, to learn more about surveying, we have provided a Wikipedia link, enjoy! Leave a Reply
In the American Colonies, there was a chronic shortage of gold and silver coins. However, the native people would honor the gifts the colonists gave them, such as muskets and knives, horses and domesticated animals, with wampum (shells strung together to form belts, bracelets, etc.), and the colonists could spend that wampum with the Indians for food and pelts; and so wampum also became an accepted form of money. In most of the colonies, wampum was legal tender and one could pay taxes with it. What would become money generally was up in the air until Benjamin Franklin attended an Iroquois Nation powwow when he was a young man. He was very inspired by the separation of powers he found in their governance, which was an inspiration for our republic. While he was there, a brave came into the camp laden down with wampum, which he proceeded to give to the chief who distributed it to all the chiefs of the tribes and clans. The chief recognized the question Ben Franklin had and explained to him that in Indian culture, wampum is not money, but is used to make flags and belts to commemorate and remember all the events and gifts that are given during the year. “Of course, there always has to be enough wampum to make all the ceremonial mementos we use to honor our gifts to each other.” Ben Franklin realized in that instant that “there always has to be enough money for all the transactions the people want to make.” He became a major advocate of fiat paper money, called Colonial Scrip, and attributed the prosperity the colonists enjoyed to its use. When Franklin was in England representing the colonists, he was dismayed to discover the unemployment and poverty and almshouses and debtors prisons there. It was explained to him that there was a population explosion and too many people without enough work. He wrote: “There is abundance in the Colonies, and peace is reigning on every border. It is difficult, and even impossible, to find a happier and more prosperous nation on all the surface of the globe. Comfort prevails in every home. The people, in general, keep the highest moral standards, and education is widely spread… We have no poor houses in the Colonies; and if we had some, there would be nobody to put in them, since there is, in the Colonies, not a single unemployed person, neither beggars nor tramps.” This was not the case in England, which had the Bank of England and a debt-based monetary system in place – and where debtors who could not afford to pay their debts were often thrown in jail. There was plenty of poverty in the streets of London and elsewhere. Here, Franklin explains the difference between England and her colonies: Soon enough, however, the Bank of England had Parliament impose restrictions on the Colonies’ issuance of Colonial Scrip. The first law was enacted in 1751, with more restrictive measures in place by 1763. Colonial Scrip became illegal tender, and the British Parliament declared that all taxes could only be paid in coin. Poverty and unemployment began to plague the colonies just as it had in England, because the operating medium had been cut in half and there were insufficient quantities of money to pay for goods and work. Indeed, this was the cause of the Revolutionary War, and not the Stamp Act or a tax on tea, as is taught in all history textbooks. One of the first Acts of the Continental Congress was to issue Continentals as the currency of the Colonies. It was the issuing of the Continentals that gave tangible evidence that the Colonies were united, and Continentals financed the Revolution. What is not taught in conventional history is that the British counterfeited more than twice the amount (perhaps 8 times) authorized by the Congress and after the War the currency lost its value until it was practically worthless. When it came time to write the Constitution, there was a general sense that coin was much more reliable than paper scrip and so the relevant paragraph reads: Congress shall have the authority “To coin Money, regulate the Value thereof, and of foreign Coin, and fix the Standard of Weights and Measures”. To this day Congress issues the coins, debt free. Updated: Jun 10, 2019 Original: Oct 27, 2009 Committees of Correspondence History.com Editors Committees of Correspondence were the American colonies’ first institution for maintaining communication with one another. They were organized in the decade before the Revolution, when the deteriorating relationship with Great Britain made it increasingly important for the colonies to share ideas and information. In 1764, Boston formed the earliest Committee of Correspondence, writing to other colonies to encourage united opposition to Britain’s recent stiffening of customs enforcement and prohibition of American paper money. The following year New York formed a similar committee to keep the other colonies notified of its actions in resisting the Stamp Act. This correspondence led to the holding of the Stamp Act Congress in New York City. Nine of the colonies sent representatives, but no permanent intercolonial structure was established. In 1772, a new Boston Committee of Correspondence was organized, this time to communicate with all the towns in the province, as well as with “the World,” about the recent announcement that Massachusetts’s governor and judges would hereafter be paid by–and hence accountable to–the Crown rather than the colonial legislature. More than half of the province’s 260 towns formed committees and replied to Boston’s communications. In March 1773, the Virginia House of Burgesses proposed that each colonial legislature appoint a standing committee for intercolonial correspondence. Within a year, nearly all had joined the network, and more committees were formed at the town and county levels. The exchanges that followed helped build a sense of solidarity, as common grievances were discussed and common responses agreed upon. When the First Continental Congress was held in September 1774, it represented the logical evolution of the intercolonial communication that had begun with the Committees of Correspondence.

Subsets and Splits