task
stringlengths 12
101
| input
stringlengths 0
90.2k
| output
stringlengths 1
139k
| options
sequence | pageTitle
stringlengths 0
1.11k
| outputColName
stringlengths 1
3.1k
| url
stringlengths 14
585
| wdcFile
stringlengths 65
76
|
|---|---|---|---|---|---|---|---|
0e5990d8_oom_without_a_roof_____SwagGor__1 | [0] Thigh dagger [2] Raven thigh dagger [1] | Cellar Door | [] | “Clap along if you feel like a room without a roof.” | SwagGor | 1 | https://swaggor.wordpress.com/2014/01/07/clap-along-if-you-feel-like-a-room-without-a-roof/ | 37/1438042988598.68_20150728002308-00336-ip-10-236-191-2_885311517_0.json |
0e5990d8_oom_without_a_roof_____SwagGor__1 | [0] Freckles [2] Dark speckled freckles [1] | Tilly | [] | “Clap along if you feel like a room without a roof.” | SwagGor | 1 | https://swaggor.wordpress.com/2014/01/07/clap-along-if-you-feel-like-a-room-without-a-roof/ | 37/1438042988598.68_20150728002308-00336-ip-10-236-191-2_885311517_0.json |
0e5990d8_oom_without_a_roof_____SwagGor__1 | [0] Eyes [2] Shattered eyes – Olive [1] | Dead Apples | [] | “Clap along if you feel like a room without a roof.” | SwagGor | 1 | https://swaggor.wordpress.com/2014/01/07/clap-along-if-you-feel-like-a-room-without-a-roof/ | 37/1438042988598.68_20150728002308-00336-ip-10-236-191-2_885311517_0.json |
0e5990d8_oom_without_a_roof_____SwagGor__1 | [0] Crossbow [2] Dire crossbow holster R thigh (modded) [1] | Eclipse Designs | [] | “Clap along if you feel like a room without a roof.” | SwagGor | 1 | https://swaggor.wordpress.com/2014/01/07/clap-along-if-you-feel-like-a-room-without-a-roof/ | 37/1438042988598.68_20150728002308-00336-ip-10-236-191-2_885311517_0.json |
0e5990d8_oom_without_a_roof_____SwagGor__1 | [0] Sandals [2] Wayfarer sandals black/gold small [1] | Enfant Terrible | [] | “Clap along if you feel like a room without a roof.” | SwagGor | 1 | https://swaggor.wordpress.com/2014/01/07/clap-along-if-you-feel-like-a-room-without-a-roof/ | 37/1438042988598.68_20150728002308-00336-ip-10-236-191-2_885311517_0.json |
0e5990d8_oom_without_a_roof_____SwagGor__1 | [0] Blush [2] Donatella blush in nude [1] | Fursten | [] | “Clap along if you feel like a room without a roof.” | SwagGor | 1 | https://swaggor.wordpress.com/2014/01/07/clap-along-if-you-feel-like-a-room-without-a-roof/ | 37/1438042988598.68_20150728002308-00336-ip-10-236-191-2_885311517_0.json |
ff7a0e47_eHelper_Class__System_Windows___Description | [Name] BringIntoView [Description] | Attempts to bring the requested UI element into view and raises the FrameworkElement.RequestBringIntoView event on the target in order to report the results. | [] | LogicalTreeHelper Class (System.Windows) | Description | https://msdn.microsoft.com/en-us/library/vstudio/System.Windows.LogicalTreeHelper.aspx | 37/1438042988598.68_20150728002308-00305-ip-10-236-191-2_881438130_0.json |
ff7a0e47_eHelper_Class__System_Windows___Description | [Name] FindLogicalNode [Description] | Attempts to find and return an object that has the specified name. The search starts from the specified object and continues into subnodes of the logical tree. | [] | LogicalTreeHelper Class (System.Windows) | Description | https://msdn.microsoft.com/en-us/library/vstudio/System.Windows.LogicalTreeHelper.aspx | 37/1438042988598.68_20150728002308-00305-ip-10-236-191-2_881438130_0.json |
ff7a0e47_eHelper_Class__System_Windows___Description | [Name] GetChildren(DependencyObject) [Description] | Returns the collection of immediate child objects of the specified object, by processing the logical tree. | [] | LogicalTreeHelper Class (System.Windows) | Description | https://msdn.microsoft.com/en-us/library/vstudio/System.Windows.LogicalTreeHelper.aspx | 37/1438042988598.68_20150728002308-00305-ip-10-236-191-2_881438130_0.json |
ff7a0e47_eHelper_Class__System_Windows___Description | [Name] GetChildren(FrameworkContentElement) [Description] | Returns the collection of immediate child objects of the specified FrameworkContentElement by processing the logical tree. | [] | LogicalTreeHelper Class (System.Windows) | Description | https://msdn.microsoft.com/en-us/library/vstudio/System.Windows.LogicalTreeHelper.aspx | 37/1438042988598.68_20150728002308-00305-ip-10-236-191-2_881438130_0.json |
ff7a0e47_eHelper_Class__System_Windows___Description | [Name] GetChildren(FrameworkElement) [Description] | Returns the collection of immediate child objects of the specified FrameworkElement by processing the logical tree. | [] | LogicalTreeHelper Class (System.Windows) | Description | https://msdn.microsoft.com/en-us/library/vstudio/System.Windows.LogicalTreeHelper.aspx | 37/1438042988598.68_20150728002308-00305-ip-10-236-191-2_881438130_0.json |
ff7a0e47_eHelper_Class__System_Windows___Description | [Name] GetParent [Description] | Returns the parent object of the specified object by processing the logical tree. | [] | LogicalTreeHelper Class (System.Windows) | Description | https://msdn.microsoft.com/en-us/library/vstudio/System.Windows.LogicalTreeHelper.aspx | 37/1438042988598.68_20150728002308-00305-ip-10-236-191-2_881438130_0.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 6.0 [Year] 2002 [Notes] | Supports creation of disk images on recordable DVD media and external USB drives. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 7.0 [Year] 2003 [Notes] | Includes a wizard-driven interface. Supports disk cloning that directly duplicates the contents of a hard drive to another. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 8.0 [Year] 2004 [Notes] | Supports backing up to a network location and restoring individual files from a disk image. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 9.0 [Year] 2005 [Notes] | The last version to supports Windows 98 and Windows ME. Secure Zone allows backing up to a hidden drive partition. Startup Recovery Manager helps restore during boot time without a separate boot disk. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 10.0 [Year] 2006 [Notes] | Backs up and restores directly from network shares and FTP servers. Can save archives of Microsoft Outlook and Outlook Express as well as Windows Address Book. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 11.0 [Year] 2007 [Notes] | File Shredder helps permanently destroy files. Try&Decide helps set up a sandbox in which untrusted programs can safely run without the risk of permanently changing or damaging the system. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2009 [Year] 2009 [Notes] | One-click Backup backs up a computer using default settings, without asking any question other than backup destination. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2010 [Year] 2010 [Notes] | Supports Virtual Hard Disk (VHD) and Windows 7. Nonstop Backup provides continuous data protection. Online Backup backs up data to an off-site location on the Internet. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2011 [Year] 2010 [Notes] | Supports USB 3.0, integration with Windows 7 and predefined backup schemes. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2012 [Year] 2011 [Notes] | Supports File synchronization, Network-attached storage, Nonstop Backup over network and integrated online backup.[10] | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2013 [Year] 2012 [Notes] | Adds mobile access and Windows 8 support (except UEFI Secure Boot)[11] | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2014 [Year] 2013 [Notes] | Bug fixes, minor changes. UEFI Secure Boot support was added in this version. | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
7dfc1fa1_kipedia__the_free_encyclopedia__Notes | [Version] 2015 [Year] 2014 [Notes] | Radically changed the UI and removed many features including backup file conversion from the .tib format to .vhd and vice versa, user backup file management (deletion of individual backups when destination media is too full to backup), user-driven consolidation of incremental backups, import and export of backup settings, and the ability to sort backups by date.[12] | [] | Acronis True Image - Wikipedia, the free encyclopedia | Notes | https://en.wikipedia.org/wiki/TIB_(file_format) | 37/1438042988598.68_20150728002308-00237-ip-10-236-191-2_861878501_2.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Browser Compatibility [Resolution/ Workaround] Using Internet Explorer 8 with Blackboard will cause problems for students attempting to submit tests or use the file upload feature. To avoid these issues it is suggested to use Mozilla Firefox http://www.mozilla.com/en-US/firefox/ie.html or change to the “compatibility mode” in IE8 (Tools > compatibility mode” in IE8 (Tools > Compatibility View Settings > Check ‘Display all websites in Compatibility View’ > Close. You will need to close IE8 and reopen the browser before the change takes effect.) [Issue] | Issues with Internet Explorer 8 and Blackboard | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Copy and Paste [Resolution/ Workaround] Blackboard offers a Paste from Word Mash Up Tool. Click this link for the video tutorial. [Issue] | Copy and pasting text from Word to a Bb text editor or discussion post causes formatting problems in Blackboard. | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Digital Dropbox [Resolution/ Workaround] Faculty should use assignment manager for file uploads. [Issue] | Removed from version 9 | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] External links – now called URL [Resolution/ Workaround] Please use the Option, “Open in New Window” [Issue] | URL link may not open for students in IE. | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Grade Center [Resolution/ Workaround] Some columns defaulted back to NO CATEGORY. Once the category is changed to assignment, etc., the submitted assignments are accessible. [Issue] | System errors occur when trying to access submitted assignments | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Grade Center [Resolution/ Workaround] Quick Column Information – can access in Internet Explorer but not Firefox. [Issue] | Can’t view column information | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Grade Center [Resolution/ Workaround] Change the ordering of one column temporarily to force a re-organization of Grade Center. Sometimes this will resolve an issue causing a system error. [Issue] | System error occurs when trying to access certain areas of Grade Center | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Homepage [Resolution/ Workaround] Faculty can encourage the use of a blog , if an avatar is added under personal information then a photo is shared in blog. [Issue] | Removed from version 9 | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] Tools – Course Menu [Resolution/ Workaround] The “tools” area was removed after upgrade (was in lower box below course menu in version 8). Faculty can make a Tools menu item for courses prior to SU 2011. All current and future courses will have the tools area as a default option in the snapshot course. [Issue] | Tool not available in course menu | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
4b33eb14___Wilmington_University_Online__Issue | [Area] YouTube Mashup tool [Resolution/ Workaround] Keep the default “thumbnail view” for the YouTube player option. [Issue] | If you choose to pick the Embed Video player option, Firefox will not display video properly | [] | Firefox | Wilmington University Online | Issue | http://blog.wilmu.edu/online/tag/firefox/ | 37/1438042982013.25_20150728002302-00236-ip-10-236-191-2_28907344_0.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] UP-1 [Sequence (5′ → 3′)] | GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTYGA | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] UP-2r [Sequence (5′ → 3′)] | AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRTCNGTCAT | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] UP-1S [Sequence (5′ → 3′)] | GAAGTCATCATGACCGTTCTGCA | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] UP-2Sr [Sequence (5′ → 3′)] | AGCAGGGTACGGATGTGCGAGCC | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] A.s-forward [Sequence (5′ → 3′)] | GGCCATGCAGTGGACCTC | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] A.s-reverse [Sequence (5′ → 3′)] | GCACATCATCACCGGAAAGA | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8cf7ec12_fectious_Disease_journal___CDC__Sequence__5____3__ | [Primer or probe] A.s-probe [Sequence (5′ → 3′)] | TCCGAATCGGTCAATACCTTCGC | [] | Table 1 - Actinobaculum schaalii, a Common Uropathogen in Elderly Patients, Denmark - Volume 16, Number 1—January 2010 - Emerging Infectious Disease journal - CDC | Sequence (5′ → 3′) | http://wwwnc.cdc.gov/eid/article/16/1/09-0761-t1 | 37/1438042982013.25_20150728002302-00284-ip-10-236-191-2_851656832_1.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] incompetent [1] intolerant [2] inflexible [4] cowardly [3] | timid | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] violent [1] aloof [2] glum [4] simple [3] | stupid | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] insecure [1] irresponsible [2] vulgar [4] withdrawn [3] | lethargic | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] hostile [1] selfish [2] unhappy [4] cynical [3] | unhelpful | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] needy [1] unimaginative [2] inane [4] cruel [3] | brash | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] ignorant [1] irrational [2] distant [4] boastful [3] | childish | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] blasé [1] imperceptive [2] chaotic [4] weak [3] | impatient | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] embarrassed [1] loud [2] vacuous [4] unethical [3] | panicky | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] insensitive [1] self-satisfied [2] passive [4] rash [3] | smug | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] dispassionate [1] overdramatic [2] dull [4] callous [3] | predictable | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
8e591410_Window___Describe_JocktheMotie__3 | [0] inattentive [1] unreliable [2] cold [4] humourless [3] | foolish | [] | The Nohari Window - Describe JocktheMotie | 3 | http://kevan.org/nohari?name=jockthemotie | 37/1438042982013.25_20150728002302-00244-ip-10-236-191-2_132001791_0.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] EmptyTag [Quick Fix Proposals] | remove this tag | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] MissingEndTag [Quick Fix Proposals] | convert to self-ending tag insert end tag remove this tag | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] AttrsInEndTag [Quick Fix Proposals] | remove all attributes in end tag | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] MissingAttrValue [Quick Fix Proposals] | insert default attribute value from content model remove this attribute | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] NoAttrValue [Quick Fix Proposals] | insert default attribute value from content model remove this attribute | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] SpacesBeforeTagName [Quick Fix Proposals] | remove spaces before tag name | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] SpacesBeforePI [Quick Fix Proposals] | remove spaces before processing instruction | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] NamespaceInPI [Quick Fix Proposals] | remove namespace in processing instruction | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] UnknownElement [Quick Fix Proposals] | remove this element local rename | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] UnknownAttr [Quick Fix Proposals] | remove this attribute local rename | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] InvalidAttrValue [Quick Fix Proposals] | replace with default attribute value from content model remove this attribute value | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] MissingRequiredAttr [Quick Fix Proposals] | insert required attribute and default value from content model | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
ae875b22_ource_Editing_Evaluation_Guide__Quick_Fix_Proposals | [Validation Error or Warning] AttrValueNotQuoted [Quick Fix Proposals] | quote attribute value | [] | Structured Source Editing Evaluation Guide | Quick Fix Proposals | http://www.eclipse.org/webtools/initial-contribution/IBM/evalGuides/SSEEval.html?p=1 | 37/1438042982013.25_20150728002302-00278-ip-10-236-191-2_415573954_3.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] all [Directory] n/a [Provides] | All resources listed in this table | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] autostart [Directory] share/autostart [Provides] | Apps to start on login | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] data [Directory] share/apps [Provides] | Application data | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] data_ [Directory] share/apps [Provides] | Application data for the application named | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] html [Directory] share/doc/HTML [Provides] | HTML files | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] icon [Directory] share/icon [Provides] | Icons | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] config [Directory] share/config [Provides] | Application configurations | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] pixmap [Directory] share/pixmaps [Provides] | Images | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] xdgdata-apps [Directory] share/applications [Provides] | Application .desktop files | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] sound [Directory] share/sounds [Provides] | Sound files | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] locale [Directory] share/locale [Provides] | Localization data | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] services [Directory] share/services [Provides] | Protocols, plugins, kparts, control panels, etc. registry | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] servicetypes [Directory] share/servicetypes [Provides] | Plugin definitions, referenced in services registry entries | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] mime [Directory] share/mimelnk [Provides] | Mimetype definitions | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] wallpaper [Directory] share/wallpapers [Provides] | Desktop wallpaper images | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] templates [Directory] share/templates [Provides] | Document templates | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] exe [Directory] bin [Provides] | Executable files | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
c54c63e1_ion_Kiosk_Keys____KDE_TechBase__Provides | [Key] lib [Directory] lib [Provides] | Libraries | [] | Difference between revisions of "KDE System Administration/Kiosk/Keys" - KDE TechBase | Provides | https://techbase.kde.org/index.php?title=KDE_System_Administration/Kiosk/Keys&diff=75735&oldid=13687 | 37/1438042988598.68_20150728002308-00169-ip-10-236-191-2_891253545_7.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] During this period of time, potentially fatal complications (hypotension, shock) may develop. [Nursing Interventions] | Monitor vital signs closely, especially during initiation of therapy. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Although patient may find expectoration offensive and attempt to limit or avoid it, it is essential that sputum be disposed of in a safe manner. Changes in characteristics of sputum reflect resolution of pneumonia or development of secondary infection. [Nursing Interventions] | Instruct patient concerning the disposition of secretions: raising and expectorating versus swallowing; and reporting changes in color, amount, odor of secretions. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Effective means of reducing spread or acquisition of infection. [Nursing Interventions] | Demonstrate and encourage good handwashing technique. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Promotes expectoration, clearing of infection. [Nursing Interventions] | Change position frequently and provide good pulmonary toilet. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Reduces likelihood of exposure to other infectious pathogens. [Nursing Interventions] | Limit visitors as indicated. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Dependent on type of infection, response to antibiotics, patient’s general health, and development of complications, isolation techniques may be desired to prevent spread from other infectious processes. [Nursing Interventions] | Institute isolation precautions as individually appropriate. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Facilitates healing process and enhances natural resistance. [Nursing Interventions] | Encourage adequate rest balanced with moderate activity. Promote adequate nutritional intake. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Signs of improvement in condition should occur within 24–48 hr. Note any changes. [Nursing Interventions] | Monitor effectiveness of antimicrobial therapy. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Delayed recovery or increase in severity of symptoms suggests resistance to antibiotics or secondary infection. [Nursing Interventions] | Investigate sudden change in condition, such as increasing chest pain, extra heart sounds, altered sensorium, recurring fever, changes in sputum characteristics. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
caf8c43b_ursing_Care_Plans___Nurseslabs__Nursing_Interventions | [Rationale] Fiberoptic bronchoscopy (FOB) may be done in patients who do not respond rapidly (within 1–3 days) to antimicrobial therapy to clarify diagnosis and therapy needs. [Nursing Interventions] | Prepare and assist with diagnostic studies as indicated. | [] | 8 Pneumonia Nursing Care Plans - Nurseslabs | Nursing Interventions | http://nurseslabs.com/8-pneumonia-nursing-care-plans/ | 37/1438042982013.25_20150728002302-00178-ip-10-236-191-2_182288783_6.json |
3cbec8f2_se_Notes___Amazon_Web_Services__Issue | [Description] The response element, RelatedItemsCount returns the number of related items found. However, the number of related items returned can be less, because not all of the related items found are necessarily available for purchase. [Impact] Do not use RealtedItemsCount to iteratively return results programmatically. [Issue] | RelatedItemsCount is greater than the number of related items returned. | [] | Release: Product Advertising API on 2009-11-02 : Release Notes : Amazon Web Services | Issue | http://aws.amazon.com/releasenotes/Product-Advertising-API/3062 | 37/1438042991019.80_20150728002311-00135-ip-10-236-191-2_19126955_2.json |
3cbec8f2_se_Notes___Amazon_Web_Services__Issue | [Description] In an ItemSearch request that uses a KindleStore search index, the BrowsenodeId parameter has no effect. [Impact] Avoid using the BrowsenodeId parameter in ItemSearch requests when using the KindleStore search index. [Issue] | When using the KindleStore search index, the BrowsenodeId parameter has no effect. | [] | Release: Product Advertising API on 2009-11-02 : Release Notes : Amazon Web Services | Issue | http://aws.amazon.com/releasenotes/Product-Advertising-API/3062 | 37/1438042991019.80_20150728002311-00135-ip-10-236-191-2_19126955_2.json |
3cbec8f2_se_Notes___Amazon_Web_Services__Issue | [Description] Typically, you use quotation marks around one or more words to get exact results. When you use quotation marks around an author's name in an ItemSearch request, Product Advertising API does not always return all of the results for the specified author. [Impact] Do not use quotes around an Author's name when the search index is Books. [Issue] | Author parameter for Books index is not working as expected when you use quotes. | [] | Release: Product Advertising API on 2009-11-02 : Release Notes : Amazon Web Services | Issue | http://aws.amazon.com/releasenotes/Product-Advertising-API/3062 | 37/1438042991019.80_20150728002311-00135-ip-10-236-191-2_19126955_2.json |
3cbec8f2_se_Notes___Amazon_Web_Services__Issue | [Description] Items sorted by release-date should be returned in chronological order. This is not the case when the search index is VideoGames. [Impact] If you need to return video games chronologically according to release-date, you will need to post-process the response elements. Otherwise, your items video games will not be sorted correctly. [Issue] | In the JP locale, the Sort parameter value, release-date, does not work correctly when the search index is VideoGames. | [] | Release: Product Advertising API on 2009-11-02 : Release Notes : Amazon Web Services | Issue | http://aws.amazon.com/releasenotes/Product-Advertising-API/3062 | 37/1438042991019.80_20150728002311-00135-ip-10-236-191-2_19126955_2.json |
3cbec8f2_se_Notes___Amazon_Web_Services__Issue | [Description] Previously, Product Advertising API returned all of the actors and directors associated with each DVD, video or piece of music returned. Now, Product Advertising API returns up to the first five actors and the first five directors. [Impact] Fewer directors and actors are returned. [Issue] | Product Advertising API now returns up to the first five actors and the first five directors associated with a DVD, video, or piece of music. | [] | Release: Product Advertising API on 2009-11-02 : Release Notes : Amazon Web Services | Issue | http://aws.amazon.com/releasenotes/Product-Advertising-API/3062 | 37/1438042991019.80_20150728002311-00135-ip-10-236-191-2_19126955_2.json |
3cbec8f2_se_Notes___Amazon_Web_Services__Issue | [Description] ISBN numbers have increased to 13 digits. The existing EAN field can hold 13 digits. ItemSearch requests using the EAN field this way, however, return inaccurate results. [Impact] JP locale ItemSearch requests cannot use the EAN field for the ISBN number. The work-around is to use the "ISBN" for the IdType parameter in an ItemLookup request. In this case, the ItemId is the ISBN number of a book. The ISBN value works only with the Book search index. [Issue] | The EAN field does not support ISBN-13 in the JP locale. | [] | Release: Product Advertising API on 2009-11-02 : Release Notes : Amazon Web Services | Issue | http://aws.amazon.com/releasenotes/Product-Advertising-API/3062 | 37/1438042991019.80_20150728002311-00135-ip-10-236-191-2_19126955_2.json |
Subsets and Splits
No saved queries yet
Save your SQL queries to embed, download, and access them later. Queries will appear here once saved.