q_id
stringlengths 5
6
| title
stringlengths 3
301
| selftext
stringlengths 0
39.2k
| document
stringclasses 1
value | subreddit
stringclasses 3
values | url
stringlengths 4
132
| answers
dict | title_urls
list | selftext_urls
list | answers_urls
list |
|---|---|---|---|---|---|---|---|---|---|
8e08ee | why is integral of velocity equal to displacement? | So if you graph the velocity as a function and then find the area under the curve, why does that give you the displacement? I get how velocity is the derivative of displacement and doing the opposite which is integrating velocity would obviously get you back to displacement but I just don’t get why that means you have to take the area under the function to get that. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/8e08ee/eli5_why_is_integral_of_velocity_equal_to/ | {
"a_id": [
"dxrdl0p",
"dxrgsgy"
],
"score": [
2,
2
],
"text": [
"An area under a function is the definition of an integral.\n\nOr think of it this way: you have a height of a function on a graph. The slope of the function indicates if the height is getting bigger or smaller. Ex: if your function is a line with positive (upwards) slope that means the height is getting bigger as you move along the line. If downward (negative) the height is shrinking.\n\nSo graphically, that proves the formal definition of a derivative -- the rate at which something changes. Velocity is the rate at which displacement changes. So if you tried to indicate displacement as an area, the function bounding the top of it would be its rate of change, and therefore its velocity. Some examples:\n\nIf velocity = 1 m/s, then every second the displacement is 1 meter. If you only analyzed the displacement for 5 seconds -- from time 0 to time 5, the height of the velocity function would be 1 the whole time. But the width would be 5, and you know that 1 m/s * 5 sec = 5m. Graphically, the area under V from t0 to t5 is 1x5 which also = 5.\n\nIf velocity as a function is equal to 2t, that means that it's 0 at t0, 2 m/s at 1 sec, 4 m/s at 2 sec, etc. So the object is getting faster, which means during each second it moves more than in the previous second. Intuitively the displacement (height) should increase each second. In other words, it would look like a triangle, exactly the shape under the V graph.",
"Just to clarify, you're talking about integrating with respect to *time.*\n\nThe respective differential matters just as much as the nature of *integrand* does.\n\nIf you integrate with respect to *distance* you end up with the total travel time an object takes to get from location A to location B. \n\nThis is useful in a wide range of physics calculations where elapsed time needs to be known. "
]
} | []
| []
| [
[],
[]
]
|
|
ettsci | how exactly is a person's phenotype determined? does every gene in our dna influence our phenotype? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/ettsci/eli5_how_exactly_is_a_persons_phenotype/ | {
"a_id": [
"ffij14n"
],
"score": [
2
],
"text": [
"So to start, there are dominant and recessive genes. You have two sets of every gene (one from each parent), so when one is dominant and the other recessive, the recessive gene isn't contributing anything (in reality this can be a bit more complicated). \n\nThen there's \"non-coding\" DNA, sometimes called \"junk DNA\". There's plenty of ways bits if DNA get into the genome. Viruses, mutations, etc. can all introduce random chunks of DNA with no biological activity. So this will also qualify. It's pretty unclear how much of human DNA is non-coding, but the upper limit of estimates is about 20%. \n\nThere are genes and traits associated with ethnicities, but it is important to be careful when talking about your DNA being a certain percentage Irish or something else. Genetic information codes for certain attributes, and certain regions have higher rates of those attributes. Scotland, for example, had a much much higher percentage of people with red hair than Mongolia. There are also trends in non-coding DNA, where certain random and mutations are more common in certain regions because someone got them and passed them along. This can also happen in functional DNA, as there are multiple ways for DNA to code for the same thing. But again, all of these things are correlations, so having a certain sequence of DNA means your ancestors are more likely to be from a certain region. There's certainly questions about the reliability of these markers. For one, theyre really only reliable if a population lived in an area for a very long time with little intermingling with other populations."
]
} | []
| []
| [
[]
]
|
|
4tso90 | how do laser range finders work? wouldn't the laser bounce away when it hits the target? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4tso90/eli5_how_do_laser_range_finders_work_wouldnt_the/ | {
"a_id": [
"d5jwe7b"
],
"score": [
11
],
"text": [
"if there is a visible dot on the surface, than atleast *some* of that light is being reflected back at you.\n\ndoesnt even need to be visible to you, as the device is going to be far more sensitive."
]
} | []
| []
| [
[]
]
|
|
3ak1u6 | The Anglican Church: Ancient Institution or Created by Henry VIII? | There are those who say that the church in England was founded independently of Rome and has existed since the early middle ages. Others contend that the it only came into existence with the Act of Supremacy. The first theory smacks of revisionism (like the "Trail of Blood") to me. Is there any evidence for a distinct, independent "Church of England" (in terms of doctrine and authority) prior to Henry VIII's reign? | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/3ak1u6/the_anglican_church_ancient_institution_or/ | {
"a_id": [
"csdjhor"
],
"score": [
5
],
"text": [
"Not to any greater a degree than in other regions of Europe. The church in England, in all its guises, has possessed national character, expressed through saints' lives, relics, and architecture. In terms of a church hierarchy the Pope was the official ruler of the English church right up until Henry VIII said he wasn't. That's not to say, however, that there weren't struggles over power and authority between church and state. The murder of Thomas Beckett, for instance (allegedly on the orders or wishes of Henry II) resulted in a struggle between Henry and Pope Alexander III which resulted in Henry II doing public penance -- a humiliating act for a king. Despite the pope's official role as head of the church, there was plenty of contention over who got to wield the real authority throughout the middle ages. This was not unique to England by any means. Henry IV (of the Holy Roman Empire) also interfered in church governance, claiming the right to invest bishops and abbots. His penance was at least as humiliating as Henry II's -- he had to walk barefoot through the snow in a hair shirt. \n\nI'm not sure what scholar you're referring to in your question, but the separate foundation of England in the early middle ages strikes me as revisionist as well. The standard narrative of the christianization of Britain begins with Pope Gregory the Great sending missionaries to evangelize the Anglo-Saxons. Gregory's orders were to not destroy the pagan holy sites but instead to sanctify them. Now we know that there were Christians in Britain before Gregory sent his missionaries. St. Patrick, for instance, was the son and grandson of a deacon and a priest in England around the early 5th century. But Gregory's mission, along with the arrival of Irish missionaries in the 6th century, began the process of converting the kings and leaders. \n\nIf one were to argue that the English church was founded independently, I'm hard-pressed to understand where and when the missionaries would have arrived. Again, not knowing which scholars you're referring to, I'm only guessing, but perhaps they would argue that the process of christianization happened under the Romans? That's true to an extent. Christianity did trickle into Roman Britain through merchants, soldiers, etc. But saying that there were Christians in Britain is very different from saying that a Church was founded, and that may be where the confusion arose.\n\nOne more thing with regard specifically to doctrine: the Pelagian heresy, which emphasizes human free will rather than original sin, started with the British monk Pelagius around the same time as Patrick. Not an auspicious claim to fame. "
]
} | []
| []
| [
[]
]
|
|
4plcsp | Whats stopping us from using H2O electrolysis as energy storage for solar arrays? | I know that one of the bigger costs in solar energy is finding a way to store all the energy you gather during the day for later use, so my question is, why use batteries?
Is it feasible to try and electrolyse water from the electricity created by your solar array, storing the oxygen and hydrogen gas to be used in the future via a voltaic cell setup to produce electricity for a household?
As a bonus, these personal reservoirs could be used as fuel for a fuel cell vehicle theoretically.
What do you think? Would it be feasible? Or is there some huge issue with it that im not aware of? | askscience | https://www.reddit.com/r/askscience/comments/4plcsp/whats_stopping_us_from_using_h2o_electrolysis_as/ | {
"a_id": [
"d4lxrm6",
"d4ly909",
"d4minbg"
],
"score": [
23,
3,
3
],
"text": [
"People have been talking about the \"Hydrogen Economy\" since the 70s, but there are some significant issues that have plagued it, although a lot of smart people are working on the problems.\n\nThe first is how to store the hydrogen. First off, it is extremely flammable (think Hindenburg), and while the gas by weight is very energy dense, it is not very energy dense by *volume*. To make matters worse, because it is so small, it can escape many containers, and even [diffuse into steel or other metals making them brittle.](_URL_0_) This last issue can be avoided by expensive coatings that are already in use for natural gas pipelines.\n\nMost attention has been put into the energy density by volume issue. These include high pressure hydrogen (bad because pressurization is expensive, as well as needing heavy, embrittlement-proof tanks), liquid hydrogen (bad because it is a cryogenic liquid @ ~20 K, again expensive to condense), storage as a metal hydride (reversible, but needs high pressures and temperatures), and probably most promisingly, adsorption on to other materials.\n\nThese adsorption materials are porous in specific manners, which could potentially store molecular hydrogen at high density without extreme conditions. These can be natural rocks such as zeolites, or complex synthetic [metal-organic frameworks](_URL_1_). A lot of current research still requires very low temperature conditions again.\n\nPerhaps the real kicker is the energy efficiency. Electrolysis of water is only about 70% efficient, and a modern fuel cell has an efficiency of only ~40%. Compared to the nearly 90% efficiency that Li-ion batteries have from grid to application, hydrogen doesn't look so great.",
"Efficiency. I'm pretty sure batteries, or even compressed air, would be more efficient than electrolysis. Researchers do seem to come out with improvements to efficiency, but so far I have not heard of any large-scale even-pilot systems to work on a 'grid'. ",
"Why suffer an inefficiency conundrum when Sunlight and water are either inexpensive or free? CO2 and Methane are in the equation. It matters that emission free energy generation and stored short-term fuel from it is free of GHG. Hydrogen is an efficient means to bridge hybrid electric engines. Photovoltaic partial self-consumption from array to generate Hydrogen as a fuel for storage already has proven to work. It's going to be very clear (soon enough) that this is economically feasible. There's also Demand management from Hydrogen which can immediately address peak demand from grid infrastructure. There is behind the meter configuration that blows away Solid Chemistry battery storage (with a coupled solar array, hydrogen generator and a fuel cell) which provides for emergency generator (Islanded) and for disaster relief station's which can be had from this arrangement. Hydrogen is probably more safe a fuel than gasoline or propane or natural gas. The Hindenburg argument is a red herring. Hydrogen open the the atmosphere will travel straight into space (where it yearns to be) at a rate of 40 miles per hour. The Hindenburg's first 4 seconds was all Hydrogen (true) the rest of it, which nobody explains or discusses, was the Magnesium Paint applied to the surface of the Zeppelin... "
]
} | []
| []
| [
[
"https://en.wikipedia.org/wiki/Hydrogen_embrittlement",
"https://en.wikipedia.org/wiki/Metal-organic_framework"
],
[],
[]
]
|
|
6p4576 | how did people who found other people who speak a previously unknown language translate it to the point of perfection? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/6p4576/eli5_how_did_people_who_found_other_people_who/ | {
"a_id": [
"dkmfg1e"
],
"score": [
3
],
"text": [
"The same way children who previously don't know any language learn it to perfection: someone learns the unknown language. As soon as you've got a few people that can translate, the accuracy of it snowballs. "
]
} | []
| []
| [
[]
]
|
||
7te4qe | What happened to General Montgomery after Operation: Market Garden failed? | I know he bet big on Market Garden and it failed to achieve most of its goals. Was he still a high level commander or did he quietly retire? Who took over his position? Patton? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/7te4qe/what_happened_to_general_montgomery_after/ | {
"a_id": [
"dtbzkfg"
],
"score": [
5
],
"text": [
"tl;dr - Almost nothing changed in Montgomery's situation, he continued in command of the 21st Army Group which included most (all?) of the Commonwealth combat divisions, and several US units, until the end of the war.\n\nFor a while since the invasion of Normandy Montgomery had been pressing for Eisenhower to appoint a single commander for the ground troops in NW Europe. Naturally his intent that this commander would be himself. Remember that Montgomery was the ground forces commander for Operation Overlord, having command over Bradley and US 1st Army, until the command structure was changed in July 1944. He also wanted all the allies effort focused on a single push into Germany. Again his intent was he would command this push. Eisenhower resisted these suggestions, not least because the US was already providing the bulk of the armed forces in Europe, but found it difficult to argue against Montgomery's charisma and experience.\n\nFollowing Market Garden, Montgomery continued to argue for a single commander and a single push but the over-worked Eisenhower was now determined to stick to the plan of advancing on multiple fronts. The relationship between the two became further strained and Montgomery wrote an ill-advised letter to Eisenhower which almost cost him his job in October. Eisenhower was forced to give Montgomery a direct order to open him the port of Antwerp to shipping in order to relieve the Allies logistics problems. \n\nWhen the Germans launched their winter offensive (The Battle of the Bulge) on December 16th 1944 they quickly drove a wedge between the US 1st and 9th Armies on the north side of the bulge and the rest of the US 12th Army (see 1 below). Bradley's HQ was south of the Bulge and in order to simplify communications control of those Armies was temporarily transferred to Montgomery. Following the reduction of the pocket control was returned to Bradley, but the US commanders did not appreciate the interference and liked even less Montgomery's implication to the press that he alone had saved the Americans.\n\nHowever, Montgomery's reputation in the UK was such that it was pretty much unaffected by the failure of Market Garden. After the war he commanded the British forces occupying Northern Germany, which became the British Army Of the Rhine (BAOR), was appointed as Chief of the Imperial General Staff and also served as Deputy Supreme Commander of NATO.\n\nSome other points:\n\n1. Montgomery was just one of three ground forces commanders under Eisenhower from August 1944 to the end of the war in Europe. The other two were Bradley, commanding the 12th US Army Group and Gen Jacob Devers, commanding the 6th Army Group^*. Patton commanded the 3rd US Army under Bradley (mostly).\n\n2. Although Market Garden failed to achieve its ultimate goal of seizing the Arnhem bridge, the ground that was taken during the operation was crucial as a jumping off point when the offensive resumed in early 1945.\n\n3. Patton would not have been appointed to command the 21st Army Group which, as noted, was largely composed of Commonwealth troops. Such a move would have been politically impossible.\n\nprinciple source : Rick Atkinson, *The Guns at Last Light*\n\n^* Devers command responsibilities were very complex and fluid and well outside the scope of this question."
]
} | []
| []
| [
[]
]
|
|
am9ewk | Are there any good online sources on the Opium Wars? | It thought I should come here to look for help on this topic. I’m just looking for some online sources on the opium wars. Articles, newspapers, and other websites would help. | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/am9ewk/are_there_any_good_online_sources_on_the_opium/ | {
"a_id": [
"efkxh0l"
],
"score": [
4
],
"text": [
"It is difficult to prove a negative, but from my experience the answer is 'basically no, unless you count output on this subreddit.' While academic consensus on the Opium War has swung decisively in the revisionist direction, most online articles continue to exaggerate the impact of the war and fail to cover the Chinese side in any significant depth. Going back to the paper medium, there are a couple of recent books intended for a wide audience – Julia Lovell's *The Opium War* and Stephen Platt's *Imperial Twilight* especially – which should be relatively accessible and not prohibitively expensive. If, however, you are insistent on the content being free and online, my answers on Opium War topics can be found [here](_URL_0_) and my rebuttal to Extra Credits' Opium War video series [here](_URL_1_)."
]
} | []
| []
| [
[
"https://www.reddit.com/r/AskHistorians/wiki/profiles/enclavedmicrostate#wiki_opium_wars_and_opium_in_china",
"https://www.reddit.com/r/AskHistorians/wiki/profiles/enclavedmicrostate#wiki_saturday_showcases"
]
]
|
|
805q7a | How were the Persians able to field so vast armies? And what are the logistics behind such a monumental effort. | Pardon my English since i'm not a native speaker :)
- And i'm also sorry if this have been asked before.
There are records telling of the Persians in classical times, being able to field armies the size of more than 200 thousand soldiers. How and why was this possible and what logistics problems did they have to overcome to make that task a reality? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/805q7a/how_were_the_persians_able_to_field_so_vast/ | {
"a_id": [
"dutsho2"
],
"score": [
8
],
"text": [
"Hi! You might be interested in [this post](_URL_0_) I wrote recently about the Persian army numbers you find in sources like Herodotos and Xenophon. In short, these numbers are not reliable historic facts, but estimates that were meant to look plausible enough not to undermine Greek authors' credibility. They probably reflect the Greeks' (pretty ill-informed) estimates of the full manpower potential of the Persian empire, not the size of actual field armies. We are fairly certain that the numbers we get (such as Xerxes' army of 2.6 million in 480 BC, or Artaxerxes II's 1.2 million men at Kounaxa in 401 BC) are impossibly large; the logistical challenges would be far too great.\n\nThat said, it's certain that the Persians would have been able to field larger armies than their Greek enemies; modern scholars' estimates for their largest armies tend to range between 60,000 and 150,000. These numbers are entirely plausible given the vast manpower reserves of the Achaemenid Persian empire. This was the largest empire that had ever existed. It covered some of the world's most densely populated areas, such as Egypt, Phoenicia and Mesopotamia. Even if they required each of their satrapies (administrative districts) to supply only a modest number of men, their royal armies would soon reach a vast total. To these levies and locally raised mercenaries the Persians would add their own standing forces: the king's royal bodyguard of 10,000 infantry, and the Persian cavalry raised from estates across the empire.\n\nThe logistical challenges of fielding such forces were immense. Every man and horse needed food and drink; food and equipment needed to be carried either by humans or by pack animals, each of which needed food and drink as well. Armies tended to march with large throngs of merchants, craftsmen, engineers, cooks, guides, servants, entertainers and sex workers in tow. The Persian king travelled with an enormous entourage of courtiers, councillors, concubines and companions. Moving all these people required careful organisation and a tremendous amount of resources. It was practically impossible for an army to carry its own supplies for more than a few days' marching.\n\nHerodotos describes the two ways in which the Persians solved these problems. The first was to \"call ahead\", so to speak, and order the assembly of supply dumps along the route where the army was to march. In friendly territory this was easily done using local food and fodder surplus. It was more than the Greeks themselves ever managed in logistical terms, though, and provoked some admiration in the Greek historian. Greek practice was typically to rely on local markets, and the Spartan king Agesilaos was praised for the simple expedient of having such markets arranged in advance to ensure a supply of food would be available for his men to buy.\n\nThe second solution was simply to requisition supplies from the territories the Persians were moving through. Herodotos reports a Persian practice, also attested elsewhere, to subject these territories to a special tax called the King's Dinner. This meant in theory that a particular city or region would have the honour of setting up a banquet for the king, but in practice that the area's food stores would be used up to feed and entertain the Persian army and allow the king to engage in royal generosity towards his loyal followers. Herodotos tells us that the island of Thasos was made to supply the King's Dinner at a cost of 400 silver talents (about 8,000 years' worth of wages for a skilled worker). Where no supply dumps were set up, then, the Great King simply solved his logistical problems by squeezing his subjects for everything they had."
]
} | []
| []
| [
[
"https://www.reddit.com/r/AskHistorians/comments/7lkmwo/did_ancient_people_knew_their_quoted_numbers_of/drn48gt/"
]
]
|
|
qsbax | Is there a reason that the letters towards the end of the western alphabet (the last five in particular) are less frequently used than the others? | This seems to be an even more prevalent phenomena when looking at the number of words that begin with these letters, for example the number of words beginning with V is a lot fewer than N or B.
edit: Just realised this isn't perhaps the most science-y (for want of a better word) question, but oh well, too late now... | askscience | http://www.reddit.com/r/askscience/comments/qsbax/is_there_a_reason_that_the_letters_towards_the/ | {
"a_id": [
"c401t7a"
],
"score": [
2
],
"text": [
"keep in mind that they are less frequently used *in english*. spanish uses y and z quite a bit. french uses x all the time. italian also uses z a lot. so while they might not be common letters in english, they are common in other languages"
]
} | []
| []
| [
[]
]
|
|
2l9m2s | what are the us voting for today? | I'm from England, I don't understand politics the greatest, not in the UK nor the US. However I understand you elect a new president every 4 years and a president cannot be president for longer than 8 years (2 terms).
What exactly do you vote for in what is being called a 'mid term'? I believe the UK has something similar and I don't understand what is being voted for there either. I know we recently had a big vote. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2l9m2s/eli5_what_are_the_us_voting_for_today/ | {
"a_id": [
"clsoi9k",
"clsosyu",
"clsq2fx"
],
"score": [
7,
2,
2
],
"text": [
"Congress gets voted in more often. The House of Representatives(like your House of Commons) gets completely re-voted every two years, so they're all up for election, and the Senate(vaguely similar to an elected House of Lords) is on staggered 6-year terms, so 1/3 of them are up for election. Also, there's a lot of state and municipal elections and referendums that get bundled into it, including 36 of the 50 state governors. ",
"Congressional races (\"local\" representatives that control the spending of the federal government) occur every two years, to help keep the government accountable to the people and (in certain cases) limit the power of the President and/or the party in the majority. _URL_1_\n\nThis is also an election year for some of the U.S. Senate (there are two senators in every state) who are on a 6 year term. _URL_0_\n\nThere are also some state races for Governor, Auditor, Secretary of State, etc; each state varies as each have their own constitution and laws that determine elections.\n\nThere are also a number of local elections for city councils, mayors, school boards, sheriff's.",
"We have an election every year in November. We don't just elect our president - we also elect many state and local officials. We can also vote on laws and tax levies. \n\nMy ballot today was two pages long. It included the state governor, representatives to the US congress and my state congress, a lot of judges, a school board member, a state treasurer, a county auditor, a revision to my city's charter and tax levies for my city's public schools, hospitals, and the renovation of a historic monument. "
]
} | []
| []
| [
[],
[
"http://en.wikipedia.org/wiki/United_States_Senate",
"http://en.wikipedia.org/wiki/United_States_House_of_Representatives"
],
[]
]
|
|
3jn9fw | expiration dates for painkillers (details inside) | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3jn9fw/eli5_expiration_dates_for_painkillers_details/ | {
"a_id": [
"cuqo1sg",
"cuqr149",
"cuqvjai",
"cur08hw"
],
"score": [
5,
5,
4,
3
],
"text": [
"You are looking at date Filled vs date expired. Not date manufactured vs date expired. These drugs are created in large quantities but that doesnt mean they all get distributed at the same time. So the ones you got in 2013 and the ones you got in 2015 could have all been made in 2013. Drugs do expire. ",
"Also, expiration dates on medications are a date until which they are guaranteed to be 100% as effective as when manufactured. One of the pills, taken a year later, will still be safe but may only be say 90% as potent as when manufactured.",
"Doctors have done studies (most recently by the DHS) to gauge the efficacy of medications past their due dates. Most antibiotics were indistinguishable from new even at 10, 20 or even 40 years past their due date. \n\nThe due date is just so you buy more pills (in most cases). Some notable exceptions include epi pens, insulin. ",
"[This page](_URL_0_), section 5, has a good breakdown on medications that you should NOT use past expiration. Most other medications in pill or tablet form retain good potency for many years."
]
} | []
| []
| [
[],
[],
[],
[
"http://www.emedexpert.com/tips/expired-meds.shtml"
]
]
|
|
u72k2 | To what extent is modern US law derived from Roman law? | I know that US law is derived from English common law which developed as somewhat of an alternative to the Roman-based civil law of continental Europe; what I don't know is the extent to which common law and other US laws can be said to derive from the legal tradition of Roman and Romance civilization. Can anyone elucidate this matter a bit for me? | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/u72k2/to_what_extent_is_modern_us_law_derived_from/ | {
"a_id": [
"c4swmkx",
"c4sxhgn"
],
"score": [
6,
7
],
"text": [
"In *The Common Law* Oliver Wendell Holmes looks at similarities between Roman and common law but I can't remember if he establishes that any common law doctrines were derived from, as oppose to merely resemble, Roman doctrines.",
"Louisiana has a system of civil law, unlike the common law in the rest of the United States. It's codes are derived from French and Spanish law as opposed to English law."
]
} | []
| []
| [
[],
[]
]
|
|
15wbgz | why do we say "on the plane", "on the train", but "in the car"? | Why do we say on in some situations and in in others for the same meaning?
On the sub,
On the blimp,
In the cart.
Edit: On a related note why do you go on vacation but into work? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/15wbgz/eli5_why_do_we_say_on_the_plane_on_the_train_but/ | {
"a_id": [
"c7qdyzt",
"c7qe10e",
"c7qe1ys",
"c7qe8cn",
"c7qedlx",
"c7qelru",
"c7qeqkz",
"c7qetxb",
"c7qeuoa",
"c7qevex",
"c7qewam",
"c7qey5w",
"c7qezr9",
"c7qfskw",
"c7qfziz",
"c7qg9gu",
"c7qjhxm",
"c7qlg2p",
"c7qnvfm",
"c7qo0sb",
"c7qppa2",
"c7qr8vc",
"c7qs0if"
],
"score": [
364,
29,
9,
17,
1000,
31,
11,
3,
2,
50,
23,
170,
3,
3,
2,
4,
5,
2,
2,
2,
4,
2,
2
],
"text": [
"Presumably in this case because a car is ours, so we're *in* our possession.\n\nThe others are open to the public, so we're *on* the service.\n\nAt least, that's how I assumed it works.\n****\nEdit: Giraffebacon has an awesome theory that it doesn't depend on possession, but **control**. If you control something, you're in it. If not, you're on it.\n\nEdit 2: Of course there are exceptions. Bikes / skateboards you are physically \"on\", and can't be \"in\", so the rule doesn't apply.\n\nEdit 3: thedrew is [very clever] (_URL_0_).",
"Not sure if related, but in German, you don't ride on _or_ in any of them (to my knowledge); you ride _with_ them. We're all just weird with our languages. :p\n\nFor example: Ich fahre mit dem Bus. \"I ride _with_ the bus.\"",
"I think it depends on where you're from. People in NYC usually say they're \"waiting on line\" when referring to waiting in line. People where I'm from would say \"waiting in line\". I think the same thing applies to vehicles as I know a person who would say she's \"getting off the car\" when exiting the vehicle. It sounds weird to me because I would say I'm \"getting out of the car\". \n\nTL;DR I think it's just a regional thing.",
"Also, one must board a train, or a plane or a sub. You do not board a car.",
"I thought it was because you can walk around ON a train and plane, but you can't really walk around IN your car. On is for platforms.",
"We ride *in* a car because we ride *in* a carriage, even when that carriage is *on* a train.",
"Related question: Why do we say we're \"driving\" a car, but \"riding\" a bike? Seems like you put much more effort into making the bike move.",
"Do people who own and fly personal planes say they're in' the plane, as opposed to 'on', referring to the personal possession explanation. ",
"The way I have always understood it is in terms of who decides the destination. \n\nA car or Taxi only travels to where we decide for it to go, whereas a train, bus or plane etc have pre-existing destinations that we choose to go on. \n\nFor example, a bus or train will be making that trip regardless of if I am using it or not, where as a car will only travel to a location if I am in it.\n\n\n",
"English is terrible when it comes to consistency of grammar and mechanics rules.",
"As Georgeorgeorge Carlin said: \"'Get on the plane, get on the plane' Fuck you, I'm getting in the plane!\"",
"Linguist teaching English to foreign students here.\n\nCan you be inside it? Yes: you can be \"in\" it (\"I'm in the plane\" is also acceptable, but a little off). No: you can only be \"on\" it (i.e. skateboard).\n\nCan you stand up while inside? Yes: you can be \"on\" it. No: you can only be \"in\" it.",
"My guess is that it relates to the relative size of what you're talking about.\n\nOn the plane. On the train. (They are large.) \nIn the car. In the taxi. (They are small.)",
"Not sure, but it only recently occurred to me why I was raised to say \"get down from the car\" instead of \"get out of the car.\" People have been bugging me about it my whole life. My family is Mexican-American and \"bajar\" means to get out and also to get down in Spanish, so the English translation is \"get down.\" ",
"In sorta relation to this topic. Why do we have a baby but take a shit? Wouldn't we be having a shit?",
"You board a ship.\n\nYou board a train.\n\nYou board a plane.\n\nYou board a bus.\n\nYou are \"on\" them.\n\nYou don't board a car or taxi. You just get in them.",
"Things that you can 'drive': in. \nThings that you can 'ride': on.",
"Because English is the second most ridiculous language on the planet.",
"As a long Islander, I always wondered why you can be \"in New York\" or \"in Brooklyn\" but we are always \" on Long Island.\" Why is that?",
"this is sort of meta, but I thought eli5 was about people asking for simplistic but detailed answers to questions they only know a little about to help them piece together their knowledge... not just generic one-off questions that could be answered with one sentence and would fit better on /r/askreddit or something. I mean, you gotta ask yourself, is this something I want to have explained in laymen's terms, or just a factual answer that I need?",
"I think that a lot of the people responding in this thread are leading you in the wrong direction. I find it unlikely that the preposition which people choose to head these phrases is semantically determined.\n\nMy guess would be that these phrases are forms of [lexical phrases](_URL_1_) or [multi-word expressions](_URL_0_) I think that it's most likely that they are institutionalized phrases which are mentioned at the bottom of the MWE link, which are not as strict as others which would account for why you can rationalize being *on a plane* but also *in a plane*.\n\nI think that it's more sensible to approach items like this descriptively, because I'm not convinced that we actually pick and choose which words we use like this based on any rules.",
"I think it all comes down to whether you need to duck or crouch to board the vehicle, or if you can simply walk on.",
"As a french-canadian, it's so obvious this is just cultural standards, \n\nno real answer can be given, \n\nfor example, \n\nhere **in Quebec we say \"in the city\"** while **in France they say \"on the city\"**, when visiting or living or whatever \"in\" the city (this is a translation, in Quebec we say \"dans la ville\" while in France they say \"sur la ville\")."
]
} | []
| []
| [
[
"http://www.reddit.com/r/explainlikeimfive/comments/15wbgz/eli5_why_do_we_say_on_the_plane_on_the_train_but/c7qfrze"
],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[
"http://aclweb.org/aclwiki/index.php?title=Multiword_Expressions",
"http://bogglesworldesl.com/askthomas.htm"
],
[],
[]
]
|
|
2iysqh | Light splits in all colors, so is light just a ray of photons with different colors? | For example, the first photon is red, second is blue, third is yellow, fourth is blue, etc...
Or doesnt it work like that? | askscience | http://www.reddit.com/r/askscience/comments/2iysqh/light_splits_in_all_colors_so_is_light_just_a_ray/ | {
"a_id": [
"cl6q371",
"cl6usyw"
],
"score": [
5,
2
],
"text": [
"Yes. You can think of sunlight for example as a very large stream of photons of a variety of colors (wavelengths). For sunlight, the distribution looks like [this](_URL_0_).",
"Yes! \n\nWhen light splits (like when you pass light through a prism) it is because each wavelength of light is going to refract at a different angle. When you see white light all of the wavelengths are being seen by your eye in the same place at the same time. A beam of white light has photons of various different wavelengths all moving in the same direction at the same time. After they pass though a prism you can see all of the different colors because each individual color (wavelength) is refracted at a different angle and they will be in different places when they are perceived by your eye, so now you don't see white, you can see each color on its own.\n\nHere is an analogy:\n\nWhen you mix paints on a pallet, if you have blue and yellow in separate blobs you see blue and yellow. If you mix them you see green, but if you had the ability to look at a small enough scale you could see individual blue and green pigments still but with the naked eye they are mixed. If you had some kind of filter that would separate the blue and yellow pigments then you would see each of them separately again. \n\nA prism is sort of like this filter. It separates the different photons based on their wavelengths and puts them in different places so you can see them without being mixed into white. But that original beam of white light had all of those photons already. You didn't take a single photon and change its wavelength; you just made them all land in different places so now your eyes can see each color. \n\nI hope this helps light is really cool! \n[Here](_URL_1_) is a neat description of how (and why) the different colors separate when you use a prism. \n\nThis doesn't just apply to the visible color either the other (non-visable) wavelengths are also separated when you use a prism. This is actually how [infrared light was discovered by Sir William Hershel](_URL_0_), all he used was a bunch of thermometers, a prism and sunlight!"
]
} | []
| []
| [
[
"http://en.wikipedia.org/wiki/Sunlight#mediaviewer/File:Solar_spectrum_en.svg"
],
[
"http://coolcosmos.ipac.caltech.edu/cosmic_classroom/ir_tutorial/discovery.html",
"http://www.physicsclassroom.com/class/refrn/Lesson-4/Dispersion-of-Light-by-Prisms"
]
]
|
|
740d9n | How did the free peasant republic in Dithmarschen in the 15th and 16th centuries actually function? | As a political body, it was clearly effective enough to organize defence on multiple occasions. How would that have been carried out? How would the lives of Dithmarschers been different from peasants in other Hanseatic places? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/740d9n/how_did_the_free_peasant_republic_in_dithmarschen/ | {
"a_id": [
"dnv1o0i"
],
"score": [
241
],
"text": [
"I've basically covered this on a podcast, so let me start with that.\n\nYour answer is in this episode:\n_URL_0_\n\nThat show was actually about the region south of Dithmarschen. But the cause of their freedom was the same:\n\nIt's swampy and tough economics there. There were NOT actually independent on paper. They were under the Bremen Archbishop, for example. But since that was tough to enforce, and the people so poor that they were all basically egalitarian and helped each other -- no nobility formed. Just like in East Frisia.\n\nAdded to that, it was a buffer state between Denmark and the German empire. So, just weak jurisdiction to begin with. Far away and usually not worth the trouble.\n\nThe Franks (Charlemagne) just gave up on the region after holding it for 20 years.\n\nTechnically there were under Hamburg (church-wise) ..but probably barely even knew that (in the 11the century control was just nominal on paper, really).\n\nWhat you are referring to is the same that happened in other remote, coastal areas. They eventually founded a \"Bauernrepublik\" or Farmers (Peasant's) Republik. Meaning they elected 48 judges to run things.... which... just like in East Frisia, eventually started to come from fewer and fewer families, and the judges dynastic families became the de facto nobility.\n\nThe local \"militia\" were good at fighting in the Watt. They could even just open the dikes and flood the enemy.\n\nDon't underestimate the border factor though.. Even in the 19th century they were still kinda part of the Danish crown, and part of Bismark's Prussia, until wars were fought. But just the fact that they weren't clearly and directly ruled gave them a lot of freedom. Only 1866 was it really, finally, officially part of Germany (Schlesswig Holstein Prussia).\n\nSorry about the lack of sources. I can update this later.\n"
]
} | []
| []
| [
[
"https://www.acast.com/historyofgermany/026-frisianfreedom"
]
]
|
|
960p8g | Catharism was a militant heresy that gained strong support in Southern France in the 13th century before being suppressed in the two decade Albigensian Crusade. Two or three centuries later, Southern France again became a bastion of militant religious heresy with French Huguenots. Any connection? | Catharism seems like it completely dissippeared in the 14th century but I know other medieval Christian heresies like Lollardy survived in England until the 16th century when it merged with the Protestant Reformation, so is it possible that Catharism or some cultural elements or memories of it survived in Southern France for a few centuries from the 1300s until the 1500s and then contributed to Southern France becoming a militant stronghold of Protestantism in the 16th-17th centuries? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/960p8g/catharism_was_a_militant_heresy_that_gained/ | {
"a_id": [
"e3y8q0r"
],
"score": [
5
],
"text": [
"I've asked a few questions about Cathars on this sub, and it seems that a lot of historians question whether the Cathars even existed at all. \nYou might want to look at this answer about Cathars from u/sunagainstgold\n\n_URL_0_\n"
]
} | []
| []
| [
[
"https://www.reddit.com/r/AskHistorians/comments/49rn50/how_did_catharism_start_develop_and_become_so/"
]
]
|
|
5kmkqg | why is the tachometer (rpm counter) so large in a car's dashboard (as large as the speed dial)? how is the information useful to the average driver? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5kmkqg/eli5eli5_why_is_the_tachometer_rpm_counter_so/ | {
"a_id": [
"dbp152l",
"dbp1ins",
"dbp1o03",
"dbp3dic"
],
"score": [
6,
3,
4,
2
],
"text": [
"Great if you drive a manual. Tells you if your revs are too high and you need to shift up, or too low and you need to shift down. No idea why you'd want one on an automatic. ",
"It's mostly useless, even for a standard transmission. If all you drive is a standard, you'll end up shifting based on sound, feel, and perception than by looking at the tach. Normal street legal cars have rev-limiters, so it's difficult to overshoot on accident, even on a down shift.\n\nFor racing, it's a visual queue prior to the shift light to prepare yourself for the shift, lest you miss your shift, over-rev, and blow the engine. Most race cars use light bars and shift lights so you don't have to look directly at the indicator, and don't have a rev-limiter. If you're racing a sports car that doesn't have a light, you'll get in the bad habit of looking at the tach near the top end of the rpm range instead of the road.\n\nIt can convey some diagnostic information depending on the situation and if you know what to look for, but more for standards than automatics.",
"In an automatic I use it to know how much passing power I have while driving on flat roads.\n\nIf I'm midway in my gear (medium RPM) and going the same speed as the car in front of me then I know I can punch it and zoom around. But if I'm high or low in the gear it becomes more doubtful that I have the torque to make a quick pass and I'm better off increasing speed (if I'm low) or letting the gear change (if I'm high) before punching the gas.\n\nIf my car has Overdrive (most do) then it's not so much of an issue.\n\nIn a stick shift you have full control of your torque if you watch where the gears top out. Riding near the top of the RPM's provides you with optimal power; you've got a small amount of excellent torque and the option to slow the vehicle without applying the brake (by just easing off on the gas and letting the engine do the braking.) If you're racing this is critical.\n\nAnybody used to driving in the mountains is as glued to the tach as they are to the speedometer. Application of torque becomes a lot more critical in mountains (especially in snow or mud.)\n\n",
"Even for daily drivers it can be useful info.. if you find your car is most efficient around 3k revs as in power curve ramps up steeply just before there then you know optimum time to shift... over time will get used to a particular car but every car sounds different"
]
} | []
| []
| [
[],
[],
[],
[]
]
|
||
gn2uz | Would you hear an explosion in space from Earth/Endor? | In Return of the Jedi, when the 2nd Death Star is destroyed, everyone on Endor can see AND hear it. Could sound waves actually travel from space to a planet? | askscience | http://www.reddit.com/r/askscience/comments/gn2uz/would_you_hear_an_explosion_in_space_from/ | {
"a_id": [
"c1os7i8",
"c1osnf4"
],
"score": [
2,
3
],
"text": [
"IANA explosion expert. But being historically inclined, I remembered that there have been a few nuclear explosions in the very high atmosphere, and so I went looking for information there. You can find more information than you want [here](_URL_0_) (pdf).\n\nPage 21 says they heard no sounds from the explosion, which was a 1.4 MT weapon, 250 miles above and 19 miles downrange of the listening post.",
"You might hear a sonic boom from very large piece of it entering the atmosphere near your location - but the sound of the blast itself would not be heard as the vacuum of space prevents sound transmission"
]
} | []
| []
| [
[
"http://www.dtic.mil/cgi-bin/GetTRDoc?AD=ADA955411&Location=U2&doc=GetTRDoc.pdf"
],
[]
]
|
|
3gbdc4 | Were there any universally agreed upon "rules of engagement" for hand-to-hand combat in pre-firearm era battles? | My question is basically what you would see when the phalanx broke, or when the initial charge ended. I know some of the bloodiest combat happened after formations broke, but were there rules to how you fought with the enemy, i.e. one-on-one. | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/3gbdc4/were_there_any_universally_agreed_upon_rules_of/ | {
"a_id": [
"ctwpmd0"
],
"score": [
14
],
"text": [
" > I know some of the bloodiest combat happened after formations broke\n\nThe bloodiest combat would happen after the formation of *one side* broke, and almost all of the blood would come from them.\n\n > but were there rules to how you fought with the enemy, i.e. one-on-one.\n\nDon't do it because it's stupid and suicidal?\n\nThe most basic, fundamental rule that governs battles before the gunpowder era (and it's mostly true of later eras too) is that if you have two friends around you and the guy you are facing doesn't, he is going to die and you are going to live. Because of this, almost everything about fighting is about how to ensure that you can maintain the safety of a formation.\n\nHollywood movies often show battles as first having organized lines which then break down into a disorganized general melee. This is completely wrong, and would never happen. The moment your line fails, you don't continue fighting the enemy, you either do everything in your power to rally our friends and form a new line, or you flee the field. Because your enemy is certainly going to try to rebuild his line, and the moment they succeed, they will completely roll over you.\n"
]
} | []
| []
| [
[]
]
|
|
bx3c4t | how does the brain create brand new words? | Is it started in Werneke’s area (or Broca’s area, can’t remember which does what at the moment)? How does the brain decide “oh I need a new word to describe this, here’s something I pulled out of thin air?” Like I called a pain I would get in my stomach as a kid “tummy crustles.” Obviously “crustles” isn’t an English word, so how and why did my brain decide that was the word it was gonna use to describe my pain? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/bx3c4t/eli5_how_does_the_brain_create_brand_new_words/ | {
"a_id": [
"eq2z046"
],
"score": [
2
],
"text": [
"Creativity. You could have merged together \"rustles\" with \"cramp\" or just added a c to the beginning because it was amusing to 8 year old you. Or you just randomly thought of it and it stuck.\n\nFor an example not involving language, imagine a purple creature the size of a chihuahua with a handlebar mustache and monocle. Chances are, you can picture this thing that does not actually exist in real life. Why did I choose these specific features? Because I was actively trying to be random and then when I added the handlebar mustache my brain associated the monocle with it so I added that too."
]
} | []
| []
| [
[]
]
|
|
1ri567 | modern militia purposes? | What do modern militias do? I'm referring to state militias, but not the National Guard. Are they just for natural disaster relief? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ri567/eli5modern_militia_purposes/ | {
"a_id": [
"cdngxh6",
"cdnjnxn",
"cdnktue",
"cdnn128"
],
"score": [
16,
5,
7,
2
],
"text": [
"The are a remnant of an earlier time. The truth is they aren't all that important, but many states feel strongly about maintaining their right to have one (Which is the true point of the 2nd Amendment).\n\nIn theory, in the event of an invasion or the like they would join the fight. The thing is, that is also what the National Guard and the regular military is for.",
"They're also around to overthrow the government should the need arise. The right to revolution is a core principle of the American founding.",
"At least in the U.S., the official state militia is indeed the state's National Guard. Most other militias are associated with smaller townships and are tailored to purposes that serve that specific township (possibly disaster relief, as you mentioned). However, there are established militias that have mission statements that carry more gravitas. For example, it's not unheard of for a town to have a militia whose objective it is to protect the town from unwarranted intrusions (perhaps from the state or, more likely, federal government). ",
"Also the US military \"legally\" is not allowed to conduct operations on American soil. The National Guard is the modern state militia. A state's National Guard answers to the governor of that respective state. Originally the state militia served as a reserve force in event of invasion and also as a counterpoint to the Federal Government's need for a regular military. It ensures (or rather ensured) that should the Feds ever try to overstep their constitutional bounds with force; the states could resist. \n\nTL;DR To back up the military in time of invasion and to balance power between the states and Feds."
]
} | []
| []
| [
[],
[],
[],
[]
]
|
|
5bmvxf | In theory and practice, how did the fascism of Italy and Austria differ from the fascism of Nazi Germany? | My understanding of fascism is very crude. From what I understand, all fascist movements are defined by the enforcement of hierarchy, the valorization of violence, the destruction of democratic governance, and a strong focus on the strength of the nation. However, the fascism present in Mussolini's Italy and, briefly, Dollfus' Italy was apparently quite different.
Racism is apparently not inherent to fascism. I believe that Mussolini rejected Nazi racialism, at least before Italy and Germany became allies. Before this alliance, Italy and Austria seemed to fear or disprove of Nazi fascism. Why was this?
Some right-wingers today will praise Mussolini but claim to loathe Hitler. Were their thoughts and actions really so different? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/5bmvxf/in_theory_and_practice_how_did_the_fascism_of/ | {
"a_id": [
"d9pxz1e",
"d9pzakh",
"d9qfqnn",
"d9qvgvj",
"d9r1g9c"
],
"score": [
46,
22,
2,
3,
2
],
"text": [
"Italian Fascism was a hybrid ideology in practice: it drew elements from socialism (state interventions in economy, an emphasis on welfare policies like public housing schemes, state sanctioned free time activities), liberalism (a tendency to favor industrial and financial interests), totalitarian measures (heavy handed propaganda, total elimination of academic freedom, widespread delation, violent opposition to dissenters) \"old school\" nationalism/traditionalism (militarism, close ties with the Catholic Church, obsequious - if insincere - deference to the monarchy). \n\nThis was just a result of the complex web of political counterweights Mussolini had to move in as a politician. He had many feet in one shoe, having to appease the King, the Pope, the Catholic working masses, the wealthy, the army. \n\nHitler, on the other hand, had a very tense relationship with the religious establishment. He did, however, rule a nation where antisemitism was relatively widespread and historically present - maybe not the raving, all-encompassing hate for Jews he and his cronies adopted, but prevalent enough. \n\nItalians were never that antisemitic, culturally, so Mussolini's platform reflected that.\n\n",
"I wouldn't say that racism wasn't inherent to Fascism. In fact I would assert the opposite. \n\nOne of the main breaking points in the racial theory (if you can call it that) between the Fascist ideology and the Nazi ideology was due to the Nordic centrist view point. Mussolini and the Fascists rejected this idea as it taught that the Mediterranean people were on a lower rung of society from the 'more pure' Nordics. This ideology was actually devisive within Italy itself, as it divided the more 'Nordic' north from the more 'Latin' south. Instead, the Fascists preached a more pan-Italian nationalism: the Italians were better, and more pure as a race, *because they were Italian.* The Italians themselves were placed on a higher rung than other Mediterranean people because they were they 'only ones' that had united themselves behind a national identity (which was conveniently the one preached by the PNF). The Fascists concocted lists detailing the people in lands to be conquered in terms of value. \n\nIt was thus the duty of the Italian people to spread (through the *spazio vitale* program) their culture to the lands which had once been that of the Roman empire. \n\nNow, Mussolini's own views on not just racism but antisemitism varied wildely throughout his life (much like the majority of his opinions). He is on record giving speeches espousing for the need for an increase in the birthrate of 'Aryans and Mediterraneans' in the early 1920s. This would inform one of Fascisms great disasters of the 'Battle of the Births' in which the Fascists attempted to raise the birthrate of the Italian people but ultimately caused it to plummet. He would also espouse beliefs echoing jewish-banking conspiracies throughout much of Fascism's rise to power while keeping a jewish mistress - Margherita Sarfatti - whom has been called the Jewish Mother of Fascism. Sarfatti also played a heavy role in Fascist Party propaganda and was Mussolini's chief biographer in the 1920s. Ultimately, Fascism would remain clear of encoded antisemitism until 1938. \n\nMussolini would also at times decree that there wasn't such a thing as race, and that it was entirely a mental construct. Once again, this was usually used in connection to the belief that the Italians had formed themselves and thus were the strongest out of the Mediterranean people. \n\n**Reading:** Davide Rodogno, *Fascism's European Empire: Italian Occupation during the Second World War*; David Kertzer, *The Pope and Mussolini*; Bosworth, *Mussolini's Italy: Life under the Dictatorship*",
" > However, the fascism present in Mussolini's Italy and, briefly, Dollfus' Italy was apparently quite different. \n\nEngelbert Dollfuß established his dictatorship in 1933 and was assassinated by the Nazis 1934. After that Kurt Schuschnigg took over and lead the regime till 1938 (Anschluß) - so it's more Schuschnigg's Austria than Dollfuß' Austria. (ofc Dollfuß was the one who did the coup in 1933, so I suppose you may call it Dollfuß' Austria, too.)\n\n > Racism is apparently not inherent to fascism. I believe that Mussolini rejected Nazi racialism, at least before Italy and Germany became allies. Before this alliance, Italy and Austria seemed to fear or disprove of Nazi fascism. Why was this?\n\nI can't say much about Italy, but the Austrian Government disproved the Nazis because they were opponents. Until May 1933 the NSDAP was a legal party in Austria - of course they didn't cease to exist when Dollfuß' regime prohibited the party. They killed Dollfuß in 1934 and tried to take over the country, making Dollfuß a martyr who died in a \"war\" against Hitler. It's no big surprise that the regime didn't like the Nazis.\n\nBesides that: Dollfuß' and Schuschnigg's party was the Christlichsoziale Partei ([Christian Social Party](_URL_1_)). \"Christian\" wasn't just a name, they clearly identified themselves as Christian or even Catholic. Like Mussolini they had strong ties with the church (one of their former chancellors even was a Catholic [prelate](_URL_0_)). Hitler otoh didn't like the Catholic church very much. Dollfuß' and Schuschnigg's regime was conservative — they even rehabilitated the Habsburg family, let them return to Austria, returned parts of their confiscated goods and built good connections to Otto Habsburg-Lothringen (the son of the last Austrian emperor and former crown prince).",
"I'll leave Italy to /u/sunshinebag and /u/Klesk_vs_Xaero but start off with something that unites the historically fascist movements in their ideology: As a political movement in the context of its time, Fascism understood itself as the viable alternative to both Democracy and Socialism in solving the political and economic problems of its time, especially the class conflict. Rejecting both liberal democracy and socialism aimed at communist utopia, it saw itself as the \"third way\" to unite the nation and lead its people to greatness, mostly through a policy of uniting the classes in the service of the nation, of violently suppressing political dissent, building or at least attempting to build a mass movement, and an ideological emphasize on practice rather than theory, though this is even more present in Nazism than other forms of Fascism.\n\nAustrofascism was ideologically very much inspired by the Katholiche Soziallehre (Catholic Social Tenet or Social Teaching), meaning that they perceived the way to transcend social class conflict during their rule through the establishment of Catholic inspired Corporate State. This meant that instead of class conflict being waged in the form of unions vs. employers or similar, they sought to organize society along the lines of Stände, i.e. your profession, where all members of one profession no matter on which side they stood in class conflict where organized together in order to transcend class conflict in national and catholic way. Austrofascism has been rightly called a form of clerical fascism in this sense.\n\nNazism on the other hand attempted the same in principle but based on a racial and national rather than religious basis. For the Nazis class conflict was something their imaginary Jewish opponent had introduced and used against the German race and thus only a racially homogeneous German nation could transcend it for the benefit of all Aryans.\n\nAustrofascism saw itself in a more \"restauration\" tradition than the especially the early Nazis who embraced a revolutionary rhetoric. This also becomes apparent in the different practices of Antisemitism. While it is obvious that the Nazis wanted Jews to disappear from German society as a whole through a variety of ways, the Austrofascists did embrace discrimination of Jews but along the lines of them being relegated to their \"place\" in society, meaning that they e.g. enacted quotas that Jews were only supposed to be represented in certain professions in line with their percentage of the total population. The Austrofascists' utopia was a Catholic and restorative nation where everyone knew and only acted accordingly to their \"place\". They imagined their state as the restorer of the \"natural\", i.e. willed by the Catholic God, state of things on earth, which in their interpretation meant that e.g. farmers were more valuable than others, a strong emphasize on \"traditional\" professions and so on and so forth.\n\nWhile this restarautive aspect did ideologically include the restoration of the Habsburg Empire on some level, Austrofascism lacked the sort of expansionist agenda seen by Italian or German fascism. In terms of foreign policy, the main goal of the Austrofascist state was to remain independent of Nazi Germany – a plan that didn't really work as we know now.\n\nSo, in short, in Austria fascism we see a restorative ideology strongly influenced by political catholicism while the Nazis took a very different path ideologically.",
"There are many ways to approach this question. First, though, some distinctions must be made. \n\nItalian Fascism lasted for over twenty years and, during this period – while we can agree that it went solidifying into a more defined character during the 1930s – it changed. The early years Fascism (pre Matteotti murder and Acerbo law) was different from Fascism in the late 1920s and again different from Fascism after the Lateranensi Pacts, which furthermore evolved towards the end of the 1930s with the alliance with Germany.\nThis evolution originated from both internal and external influences.\n\nUnfortunately, as I commented in other circumstances, I find it extremely hard to define Fascism – if not in a very broad sense – without limiting to some subset of its features; which offers very little to a comparison with National socialism, given that the same evolution and complexity – if maybe less marked – exists for the Nazi Regime. I fear therefore that any answer I can attempt will be unsatisfying.\n\n\n & nbsp;\n\n\nYet I have been summoned; and thus I will anyway try to point out some things that may add to the discussion.\n\n\nTo avoid repeating it everywhere: my knowledge of National socialism is essentially based on Kershaw's biography of Hitler. The following will include no doubt some major oversimplifications and – likely – mistakes. But I can't try to make a comparison without speaking of Germany too. If you feel like I am wrong about something, it may very well be so.\n\nI also spoke a bit about Italian foreign policy – this is a brief, brief summary of the parts that are relevant to the question. It does not provide a general overview of foreign policy during Fascism.\n\nAlso, I ignore many points of contact between the two regimes and make passing reference to others. They existed but I try to stay focused on the question. In any case, some of these points of contact are more relevant than the distinctions that end up being made about them, so... \n\n\n & nbsp;\n\n\nFascism lasted for a long period of time without the immediate perspective of a war – and we may argue, up to 1939, with reasonable expectations not to be involved in a major European conflict. This is not true for National Socialism, which increasingly acted within this perspective.\nThis is not to say that Mussolini and the Italian Military did not consider the possibility of a war between European nations; but this was framed in a more conventional foreign policy set up. While on the other hand, it is my understanding that most of the economical and social policies of the National socialists were shaped by the idea of an impending decisive conflict.\n\nThis affected the extent and the rapidity of the transformation of economy – and society to a lesser extent – in a totalitarian sense. A process slower and less definitive in the Italian case.\n\n\n & nbsp;\n\n\nFascism had indeed to develop a regime of forced co-operation with two major powers within Italy: the Church and the King. Throughout the twenty years history of the Fascist Regime, these relations were marked by periods of agreement and periods of conflict, with the major conflict involving the figure of Pope Pius XI. \nOn a purely ideological perspective, these relations tempered some of the most extreme tendencies within Fascism and – at the same time – while confining them on the fringe side of politics, they prevented an abrupt resolution. The internal opposition to Mussolini did not end in bloodbaths but in a slow, gradual, marginalization where the Duce carefully severed his opponent's ties to the actual power, while often leaving him with an aura of prestige among local minorities. While the rise and fall of prominent Nazis also proceeded from the Fuhrer, it was often more dramatic and perhaps less craftily orchestrated.\nOn a practical side: the institutions of the Church and the King's bureaucracy, both administrative and military, were able to survive – to a certain extent and not without a struggle (see for example the events surrounding the *Azione Cattolica*)– as parallel, competing ways of power, whose presence was essential to the possibility of “replacing” Mussolini with Badoglio. The comparative absence of these structures within Germany – where the institutions of the Republic had been quite effectively erased – may have contributed to the difficulties in developing an alternative to Hitler's power.\n\n\n\n & nbsp;\n\n\n\nThe issue of racism... \n\nI need a short premise to this point. It is often complex to define the core elements of a form of government, where effort must be taken to determine whether these elements are injected into the country by the Regime or rather filtered through the country into the Regime. Many of the characters of Fascism – and legitimate ones to be fair, all worth mentioning – are not original to Fascism; they come from a complex, composite tradition which drew back to the period from late XIX century and the immediate post-war: Nationalism, Trade-Unionism, Pan-Culturalism, Expansionism, Neo-aristocracysm, Trencherism, etc. These elements all took their part in defining the unifying myth of the Anti-Liberal opposition: the New State.\n\nIt is not surprising that a Regime heavily shaped by Mussolini, who had very little personal commitment to great ideals as guides but a hefty reliance on them as tools, would have made use of all these myths, weighting more or less on each one during the different phases of its existence.\n\n\nNow, to my understanding, the italian society was in the years building up to Fascism, realistically speaking, racist. We may argue that it was not a malicious racism, advocating violent actions or depicting other races as enemies, but it was the condescending, paternalistic racism that other countries had previously experienced during their history. It was the kind of racism that allowed comic strips depicting the italian colonists civilizing the African people by “impregnating their women” to be perceived as funny and not disturbing. \nIn this context there is no doubt that the italian society was pervaded by a latent racism, as far as our modern understanding goes. This racism filtered through Fascism and became a part of it. \nI would argue though that it was not a core element of it. It was a part of the italian society that con not be taken apart from the regime, to easily tell where one ends and the other one begins.\n\nWhat was on the other hand legitimately different from the National Socialist Regime, was the fact that italian racism had not – with the exception of fringe cultural elements – the character of an irreducible natural struggle. The context of social, national, class struggle was, within Italy, mostly historical and the idea of history as a sequence of unavoidable clashes was not framed in a racial context; which to my understanding marks another difference from the National Socialist case.\n\nFurthermore the racial issue did not extend as much into antisemitism, given the limited number of Jews living in Italy and their deep integration within italian society. There were some antisemitic instances, but even these were mostly framed in a religious context and not a racial one."
]
} | []
| []
| [
[],
[],
[
"https://en.wikipedia.org/wiki/Prelate",
"https://en.wikipedia.org/wiki/Christian_Social_Party_(Austria\\)"
],
[],
[]
]
|
|
9i96y7 | why and how do electronic devices draw only as much current from a power source as required in that very moment? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9i96y7/eli5_why_and_how_do_electronic_devices_draw_only/ | {
"a_id": [
"e6htuna",
"e6hvkwr",
"e6hxsgx"
],
"score": [
6,
5,
2
],
"text": [
"Everything draws only as much as it needs.\n\nElectricity flows a little like water, for ELI5. You open the radio a little when you need just a little, or all the way when you want a lot.\n\nYour television, to pick one, draws just a little power while it waits for you to turn it on. Then when it's on, it draws more to turn on the lights, change the sounds and so on.\n\nMore specifically, like water, the ability to take as much as it wants (up to what's available) is always there. When parts of the electronics are used, and they need more, they take more. Different circuits close, allowing there electrons to flow, and more electricity gets used.",
"In some appliances, there is actually a physical rheostat. As you turn the dial, you are physically increasing the contact surface between 2 areas and creating more contact for the electricity to flow through. A familiar use is like the dimmer switch on your wall. (google image search for circular rheostat and you will find good pictures)\n\nThere are also \"digital potentiometers\" which do the same thing but are all electrical. This, for instance, can increase the volume on a tv without a physical control knob.\n\nIn terms of how the TV simply turns on - when the TV get a signal to turn on (either with a physical button or an electronic signal) it electronically \"opens a gate\" to electrical flow. The electrical current would LOVE to rush through your TV, so as soon as that gate is open, the electricity flows through and the TV turns on.\n\nAn electronic device might a combination of on/off gates, and/or variable digital potentiometers as needed.",
"Three important equations: V A R, W A V, and W I^2 R. These three allow you to determine all those power flow numbers if you just know two. In each of these, imagine a circle with the top half to itself, and the bottom half further split in two, so like a T in a circle. The first letter goes up top and the other two in the bottom. Multiply the bottom two to get the top one, or divide the top one by one of the bottom ones to get the other bottom one.\n\nIn this case, we'll be using V A R, because we know the voltage from the power source (let's say it's a toaster at 120V). So why does this toaster pull 5 amps? Because of the other half of that bottom bit, the R, or resistance. Volts divided by resistance equals your amperage, so you hook up a meter and get a reading of 24 ohms. 120 / 24 = 5! Voltage is like the pressure trying to push electricity in, and the resistance U\nIs... Well it's the resistance of the \"pipe\" to having that pushed in, which balances out to how much *actually* goes through. You have a pipe pushing So much water pressure and a valve partially shut holding some of that potential flow back, you'll get less gallons per minute."
]
} | []
| []
| [
[],
[],
[]
]
|
||
vcq00 | Is vaporizing really healthier than smoking? | I've Googled this, but most of the results were specific to weed or part of an e-cigarette forum. I'd like to know if there is actual evidence that supports the common idea that vaporizing is better than smoking.
I ask this because I'm particularly interested in whether electronic cigarettes (which, from what I understand, vaporizes nicotine solutions of varying concentrations...and these solutions vary in quality and safety) are actually healthier than smoking cigarettes. The obvious answer seems to be yes...but why? Is it significantly healthier? | askscience | http://www.reddit.com/r/askscience/comments/vcq00/is_vaporizing_really_healthier_than_smoking/ | {
"a_id": [
"c53ch4t",
"c53efjl"
],
"score": [
2,
4
],
"text": [
"It's healthier since you do not inhale the ash and carcinogens that are present when substances are burned. Smoking involves burning the weed/tobacco, thus chemically carcinogens are formed. Vaporizing relies on heating the substance to a state where certain chemicals are released and ingested via inhalation.",
"\"Less detrimental to health\" is likely to be the best ruling you'll get on this, and Boston University Medical Center's study seems to support this position. Here is the relevant quote from the physorg article regarding the research:\n\n > \"Few, if any, chemicals at levels detected in electronic cigarettes raise serious health concerns,\" the authors said. \"Although the existing research does not warrant a conclusion that electronic cigarettes are safe in absolute terms and further clinical studies are needed to comprehensively assess the safety of electronic cigarettes, a preponderance of the available evidence shows them to be much safer than tobacco cigarettes and comparable in toxicity to conventional nicotine replacement products.\"\n\n > The report reviewed 16 laboratory studies that identified the components in electronic cigarette liquid and vapor. The authors found that carcinogen levels in electronic cigarettes are up to 1,000 times lower than in tobacco cigarettes.\n\n_URL_0_"
]
} | []
| []
| [
[],
[
"http://phys.org/news/2010-12-evidence-e-cigs-safer-cigarettes.html"
]
]
|
|
1xig8h | Light travels so fast that, for all intents and purposes, it's either there or it's not. So what am I seeing when I turn a light off and slowly watch the bulb or housing dim and glow faintly in the dark? | I mean, it's giving off light, right? But how is the incredibly fast light lingering enough for my eye to even see it? | askscience | http://www.reddit.com/r/askscience/comments/1xig8h/light_travels_so_fast_that_for_all_intents_and/ | {
"a_id": [
"cfbq0wk",
"cfbrh81"
],
"score": [
3,
2
],
"text": [
"If this is a lamp you \"burn\"; one with a filament or an arc-lamp. These work by heating an excitable gas inside the bulb, that gas releases light. That gas and filament are pretty hot, and don't cool instantly, just because you've turn the power off. \nI've seen this with CFLs and other Florescent lamps as well, the issue being basically the same principle. \n\nThis can also result from faulty wiring, in that \"off\" on the switch isn't actually breaking the circuit, that's a hazard. ",
"You do not see lingering light in the bulb. You see a bulb that is hot enough to emit new light, until it cools down so much that the emission stops (or rather, it moves into the infrared spectrum where you can no longer see it.)"
]
} | []
| []
| [
[],
[]
]
|
|
199scy | How does Gesture Recognition work? (Computing) | Writing a report on how gesture recognition, which needs to include a technical explanation on gesture recognition, specifically within 2D cameras. I've done research into the including some other reddit [posts in gaming](_URL_1_) AND [tasker](_URL_0_). However, I can not find an explanation of how the computer translates the gesture into algorithms, or how it uses the gesture as information. | askscience | http://www.reddit.com/r/askscience/comments/199scy/how_does_gesture_recognition_work_computing/ | {
"a_id": [
"c8m3xoo"
],
"score": [
3
],
"text": [
"There's a lot of techniques for this, and it's an active research area in man-machine interaction and artificial intelligence. If all you have to do is write an introductory section, look up some survey or review papers on the field. [This](_URL_1_) ([PDF](_URL_2_)) is a good one, as is [this one](_URL_0_) ([PDF](_URL_3_)). Be advised that most algorithms aren't exactly trivial, and involve some knowledge of AI; nonetheless, those papers should be enough to get you started."
]
} | []
| [
"http://www.reddit.com/r/tasker/comments/14dr11/how_to_use_nova_launcher_gestures_to_give_you/",
"http://www.reddit.com/r/compsci/comments/huge9/kinect_artificial_neural_networks_gesture/"
]
| [
[
"http://ieeexplore.ieee.org/xpls/abs_all.jsp?arnumber=4154947",
"http://link.springer.com/chapter/10.1007%2F3-540-46616-9_10?LI=true",
"http://students.sabanciuniv.edu/~kamer/Magitact/References/Other%20Papers/Vision_Gesture_Recog.pdf",
"http://atenea.inf.udec.cl/~rafasepulveda/Gesture%20Recognition:%20A%20survey.pdf"
]
]
|
|
1y0e72 | how significant was finding the rosetta stone? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1y0e72/eli5_how_significant_was_finding_the_rosetta_stone/ | {
"a_id": [
"cfg7x3k",
"cfg7zoz"
],
"score": [
5,
2
],
"text": [
"From an archaeological and histological perspective, massively significant. Before the discovery of the Rosetta Stone we were unable to decipher hieroglyphics from ancient Egypt. The Rosetta Stone had 3 blocks of characters on it, the top was Egyptian Hieroglyphics, the middle was Demotic script and the bottom was Ancient Greek. They all said the same thing.\nBecause we already knew and understood Ancient Greek it allowed us to translate the Hieroglyphics. With this knowledge we were then able to learn what Hieroglyphics meant and unlocked all the texts written in tombs and monuments and all that jazz.\n",
"Extremely: the Rosetta stone's text contains three copies of the same text -- one in a well known language (Greek), a not-quite-so-well-known language (Demotic), and a language they knew very little about (Heiroglyphics).\n\nNow, there had been other examples (couldn't find links right away) of snippets of the same text in heiroglyphics and another known language, but not enough to really figure out heiroglyphics -- mostly names which were pronounced much the same, so they could figure out what some sounds were, but not necessarily what the words meant.\n\nThe Rosetta stone meant, since linguists had a good grasp of Greek, and sorta understood Demotic, they could compare the same sentences in all three and decode not just how to pronounce heiroglyphics, but what the words actually *meant*.\n\nThis was huge in the language community -- but what it also meant for everyone else is that up until we could translate heiroglyphics the only source of Egyptian history was from later writers who were documenting things in a language we understand. Now that the Rosetta stone helped crack the code, it opened up a bunch of history, written in its original language, for historians to add our understanding of one of the biggest and longest-lived societies in history."
]
} | []
| []
| [
[],
[]
]
|
||
1l0sbi | how were cameras allowed inside of concentration camps? | You see all of this footage of people being tortured in concentration camps in school and on the internet. How were these people allowed to record what was going on? I thought most people didn't realize that the holocaust was going on during that time. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1l0sbi/eli5_how_were_cameras_allowed_inside_of/ | {
"a_id": [
"cbulry2",
"cbulwmc",
"cbulx7x",
"cbummu6",
"cbup54l",
"cbur17m",
"cburbek",
"cburrqx",
"cbuta2j"
],
"score": [
58,
23,
26,
2,
16,
4,
8,
2,
7
],
"text": [
"Well the Nazi's documented and kept thourough records of the concentration camps. plus the vast amounts of scientific literature garnered from the medical experiments performed on prisoners has proven very usefull in modern medicine",
"A lot of what went on was being deliberately documented by the Nazis. As far as they were concerned, they were making historical records for future generations. A lot of them actually believed in what they were doing; they bought into the idea of a master race overcoming the weak, the decadent, the defective, and the evil components of humanity. ",
"When the allied forces, most notably [General Eisenhower](_URL_0_), liberated the camps; they brought in journalists to document first hand evidence knowing there would be deniers of the holocaust. ",
"Important to point out that there is no film nor any photos of people being gassed. There are things that seem to indicate it was happening and there is a shit-ton of anecdotal evidence, but that, AFAIK, is it.\n\nEven Schindlers List did not show a gassing taking place, preferring instead to focus on the cruel treatment and callous indifference of certain Nazi's toward Jews.",
"I know that they made recordings about the ghettos of Warzaw etc. where people were held in very small buildings with only very little food. Many starved and were buried in mass graves. The nazis made a lot of such recordings for the Wochenschau, a weekly cinema show. It was basically propaganda material, but many recordings were later seen as too cruel for the audience. These are very interresting/disturbing, as many have the original audio commentary by the nazis. I am german, we saw some of this footage in school. It's far more shocking than a horror movie because you know it is real.\n\nI think some of the pictures are taken by the guards, they had a lot of freedom. Then there's some recordings for \"scientific purposes\" and of course the documentation by the allied forces.",
"The nazis thought they would rule the world. And they thought they were right.",
"The nazis intended to create a museum about the destruction of a race. They brought the cameras an wanted to document all aspects of what they did so that future generations could see how the \"perfect race\" was created. A site for the museum was even pick out and construction began at one point as well.",
"Have you really seen film of people being tortured in the camps in school? That seems very unlikely. Or you have a different definition of \"tortured\" to mine. ",
"Buchenwald had a very good exhibit a few years ago, it was photography from three sides of the war. Prisoners, Nazis, and Allied Liberation.\n\nPrisoners smuggled things like they do now (and like they've done throughout history). Film and cameras were one of many things smuggled by prisoners. Of course, they weren't allowed, so they had to be very secretive about taking photos. Usually when guards weren't around (like on Sundays, which was a \"day off\"). Usually, film got smuggled by prisoners who had special privilege due to their former professions (journalists, artists, and photographers were made to document whatever the Nazis told them to). They also made their own pinhole cameras.\n\nThere is a very bizarre photo of emaciated prisoners sunbathing on a rare Sunday in the spring when they were literally unsupervised for a few hours. They look dead, but they're all in repose. The photographer went outside with his camera under his shirt, lifted it to expose the film, and went back in his bunk and hid it somewhere inside until he could develop it.\n\nThe Nazis documented everything for posterity and instruction. They were either recording the success of a massive experiment or they were documenting how to do it. Many Nazi photographs are staged and were used for propaganda purposes. However, prison officers lived on site with their families. They had beautiful houses and were separated from the prisoners by chain fences. They kept up German family traditions and had scrapbooks. It's also quite eerie to read \"Papi macht eine witzchen\" (Papa makes a little joke) under a photo of a Nazi officer tickling his toddler.\n\nThe Americans documented crimes, perhaps moreso than prisoners because prisoner photos, while exposing some of the atrocities, also had in them a sense of intimacy. There is no intimacy in American photos. It is from a removed perspective that shows: mass graves, starvation, the far ends of human cruelty.\n\nBonus: Buchenwald also had a zoo with fucking black bears (among other animals) for the enjoyment of the officers' families, and many personal photos from the officers were taken in front of the bears. They all look so.fucking.happy. The bear enclosure, I shit you not, is *right next* to the camp's perimeter. You can see the barracks and fence in family photos IIRC. The kennels built for the guard dogs were way nicer than the prisoners' bunks, too.\n"
]
} | []
| []
| [
[],
[],
[
"http://en.wikipedia.org/wiki/Ohrdruf_concentration_camp#Liberation"
],
[],
[],
[],
[],
[],
[]
]
|
|
br0njb | how does the price of the dollar affect the economy of foreign countries? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/br0njb/eli5_how_does_the_price_of_the_dollar_affect_the/ | {
"a_id": [
"eo98isz"
],
"score": [
2
],
"text": [
"If the price of the dollar (exchange rate) is low, it means that countries with a different currency can buy the same US products for less money. Example: company A sells 100 products for 100 USD to a foreign company B. Now the exchange rate falls and 100 products now cost 95 dollars. This might look not great for company A, but now company C would also like the cheaper products. Therefore a lower exchange rate makes US products more compatible with foreign products. US firms will probably have more orders and exports.\nThis is one reason why Germany is fairly interested in keeping the Euro low, since it \"boosts\" exports. (Not the best for the Euro area as a whole, since most countries import a lot)"
]
} | []
| []
| [
[]
]
|
||
4hw4mf | what stops the bones in your foot from ripping through your flesh and skin with all the pressure from walking and running? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4hw4mf/eli5_what_stops_the_bones_in_your_foot_from/ | {
"a_id": [
"d2stikk",
"d2sv5ip"
],
"score": [
7,
3
],
"text": [
"The bones aren't that sharp and your skin isn't that weak. That's really the long and short of it.",
"Where your bones bear on the outside world they have pads - your heel, for example, has quite a thick pad of for want of a better word, gristle.\n\nElsewhere bones generally bear on other bones - your knees for example rely on cartilage between the two parts of the hinge to allow smooth operation, and is wrapped up in a capsule surrounded by ligaments. There's not really anywhere where it could push its way through without first breaking."
]
} | []
| []
| [
[],
[]
]
|
||
2b1grt | on reddit, why are links to youtube, sometimes written as "_url_0_" (dot after u, before b), next to the title | Sometimes it's _URL_0_ | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2b1grt/eli5_on_reddit_why_are_links_to_youtube_sometimes/ | {
"a_id": [
"cj0u216",
"cj0u2e1",
"cj0u4o9",
"cj0ztvo"
],
"score": [
16,
12,
14,
10
],
"text": [
"Because that's what youtube gives you when you click the \"link\" option from the \"share\" box. It's designed to save a few extra letters for stuff like twitter where that matters.",
"_URL_0_\n\nIt's just a way to make your link appear shorter. If you share a video through YouTube's interface, it will link to the shortened URL and not the full one. On most sites it doesn't really matter, but on sites like Twitter that limit the length of posts, shorter links are more useful.",
"For a moment in my life, I genuinely thought these links would get me on a weird website hosted in Belgium.\n\nI was not a smart man.",
"As others have said, it's to have a shorter link for sharing purposes. The reason it works in this case is that it's a [domain hack](_URL_0_). \n\n**.be** is the top-level domain for Belgium, just like *.ca* is for Canada, *.jp* is for Japan, etc. So, in addition to \"normal\" domains like google**.be** and yahoo**.be**, you can be clever and register youtu**.be**.\n\nOther companies have done similar things using domains for other countries, such as instagr**.am** (*.am* is for Armenia) and nyti**.ms** (*.ms* is Montserrat). \n\nReddit does this too. If you look in the sidebar of this page, there's a shortlink for this page: _URL_1_ (*.it* is for Italy)."
]
} | [
"youtu.be"
]
| [
"www.youtube.com"
]
| [
[],
[
"http://en.wikipedia.org/wiki/URL_shortening"
],
[],
[
"http://en.wikipedia.org/wiki/Domain_hack",
"http://redd.it/2b1grt"
]
]
|
|
4kw2is | Did the Persians really have massive casualties at the battle of Thermopylae? | I mean in most movies/comics/whatever you see/read that the persian casualties were massive. but could those few spartans really do "massive" casualties to the persian army? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/4kw2is/did_the_persians_really_have_massive_casualties/ | {
"a_id": [
"d3ip2nd"
],
"score": [
3
],
"text": [
"They suffered heavy casualties *but* that's relative to the losses incurred by a winning side. The thing with ancient and medieval battles is that the majority of losses in a battle were suffered by losers when they routed - the winners could cut them down as they fled. The actual losses on the winners side (losses suffered from the actual hand-to-hand fighting) tended to be low, a fraction of the losers.\n\n\nSo take Herodotus' accounts of Persians being driven on by whips and dying by the score on the end of Greek spears with a massive boulder of salt. There's a lot of Greek tropes present and modern scholars don't believe this is what happened. So the Persians did suffer heavily for a battle that they still won, not Pyrrhic levels but significant. \n\n\nAlso ignore the visuals you usually see of ancient/medieval combat where two sides just smash into each other in a confused melee. We don't know how combat worked but we know it wasn't like that. The current model has the two sides fighting hard for a few minutes then pulling back a safe distance to catch their breath and psych themselves up for the next bout. Rinse and repeat. If the Greeks could rotate their forces (and presumably the Persians with their large army could do the same) they'd keep their forces fresh. Losses in this phase would be low as most would be fighting defensively (e.g. trying not to be hit more than trying to score a hit). Only the most motivated badass/hardcore soldiers would have the nerve to 100% commit to offensive fighting. \n\n\nLastly remember that it was a combined Greek army that fought at Thermopylae and that they rotated contingents so all the Greeks present fought at some time. The final stand was by the Spartans **and** the Thespians. Supposedly the Thebans were also forced to stay behind but surrendered immediately - not sure how accurate that part was, Athens and Thebes did have a rivalry. Furthermore the Helots (Spartan serfs who were traditionally treated atrociously) who accompanied the Spartiates almost certainly died alongside them. "
]
} | []
| []
| [
[]
]
|
|
7323do | physical nature of genes. | A friend of mine asked me about the physical nature of genes but I could not satisfy her. Have the genes any appearance like beads or anything like that? And how is one gene separated from another on a chromosomes locus? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/7323do/eli5_physical_nature_of_genes/ | {
"a_id": [
"dnmzjky",
"dnn1d07"
],
"score": [
2,
4
],
"text": [
"DNA is a string of nucleotides. some of it codes for proteins, some of it controls the expression of genes, some of it is junk. All of it looks the same, it's the same four amino acids in billions of different patterns.\n\nSections that translate into proteins have special bits at each end tat are known as \"stop codons\", this is a code that tells the cellular machinery transcribing the section to top. You still can't see them, since it's just three more amino acids just like all of the DNA before and after it. \n\nThere is no special appearance of a gene, it's just a section in a long, long, long string of AGATAGAGATAGAAAGGTTAAGGG that means something specific. It doesn't have decorations or beads or clumps.\n",
"Genes are separated from each other by non-coding regions on chromosomes. In fact, the majority of the DNA in humans is never expressed as a protein product, and we're not entirely sure what a lot of it is for. \n\nI talked about the structure of DNA in the reply to the above poster,\n adding on to that, every three DNA nucleotides forms a codon - there are special \"Start\" and \"Stop\" codons - the START signal is basically a complex that is designed to attach to the DNA replication machinery in your cells. It will keep reading down the line and producing a mirror image copy of everything it reads until it reaches a \"Stop\" codon."
]
} | []
| []
| [
[],
[]
]
|
|
5qzj1n | Clothing in Archaic, Classical and Hellenistic Greece | Heya :)
I recently made a character for a p & p whose homeland is oriented towards ancient greece, and I'd like to know more about the clothing aspect.
- What clothes were common, for what ocassion (work, travel, etc) and for whom (social class, gender)?
- What were common colours?
- How many (different) clothes did one posses?
- How did that change through (those three) eras?
- I would appreciate any useful references, though ideally they should be in English or German | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/5qzj1n/clothing_in_archaic_classical_and_hellenistic/ | {
"a_id": [
"dd4ilsy"
],
"score": [
3
],
"text": [
"Clothes in ancient Greece are basically just a variety of rectangles. The most basic garment is a chiton and that is essentially piece of cloth folded around the body in a U shape. The opening fell on one side of the body, under the arm. The garment is then pinned on the shoulder and tied at the waist. If you're really fancy, it might be sewn up on the open side or at the shoulders. Sometimes (especially for women), the garment would be wide enough to make sleeves by sewing/pinning at points along the arm. \n\nThe basic cloak is the himation, again just a giant rectangle of cloth (though usually a wool rather than linen) which men usually wore something like a toga, while women would often drape over their heads.\n\nNow to get on to some of these other questions:\nfor labor or sport a man would either wear a shorter chiton or gird the extra material up into his belt, female huntresses (more myth than reality, though likely there were women who had to do physical labor) also dress like this. Hunters might also wear animal pelts tied around their shoulders or at their belts.\n\nSoldiers wear a distinct short cloak pinned on one shoulder called a chlamys (yes, like chlamydia), a traveler might also wear this as well as a wide-brimmed felt hat called a petasos and might carry a walking stick. Tall, knobby walking sticks appear to be a general affectation of aristocratic city boys as well.\n\nA woman, particularly a higher class one, might wear a peplos, which is essentially the same thing as a chiton, just the top is folded over, creating a kind of ruffle that fell to the waist.\n\nClothes were expensive, so the wealthy had more clothes, more layers, thicker cloths, and more ornament. There's a little uncertainty over use of dyes and the ones they had were likely not very strong, but art suggests that the wealthy probably wore clothes with woven patterns on the edges. The poor would own less clothes and less ornate and shorter. Young children were probably only dressed as much as the weather demanded. Slaves also probably owned little or no clothing depending on what their work required.\n\nIf you're looking for some visuals, I would recommend taking a look at some images on ancient pottery (a lot of museums have pictures of their collection online), some of these tend to the less realistic end of the scale (eg, foreigners wearing animals skin and (!) pants, theatrical costumes idealized naked youths), but they can give you a good idea without the interference of modern aesthetics."
]
} | []
| []
| [
[]
]
|
|
axn6g7 | How did amber encapsulations happen? | [deleted] | askscience | https://www.reddit.com/r/askscience/comments/axn6g7/how_did_amber_encapsulations_happen/ | {
"a_id": [
"ehvhb2j",
"ehvwxk1"
],
"score": [
79,
13
],
"text": [
"It probably landed on this poor guy or he fell into it. The weight of the Amber is irrelevant, once it's encapsulated the antenna have plenty of time to spring back before the Amber hardens. Bugs die of oxygen deprevation relatively quickly. Amber is not this pretty in nature, this was almost definitely cut/polished to show this little dude off.",
"There was a cut on a tree that was \"bleeding\" resin. You can spot those e.g. on cherry tries. They are sticky and grow very slowly forming a round droplet that likely won't fall down but will harden still on a tree branch.\n\nThe mantis went on top of such droplet and got stuck, surface tension sucked the mantis slowly for a bit and the continuous flow of resin covered the rest."
]
} | []
| []
| [
[],
[]
]
|
|
9sgnxo | if 52*7 is 364 where do we get our extra day to make a 365 day calendar year? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/9sgnxo/eli5_if_527_is_364_where_do_we_get_our_extra_day/ | {
"a_id": [
"e8oli6j",
"e8oljc9",
"e8olk5e",
"e8olmp4",
"e8om225",
"e8pqwph"
],
"score": [
2,
5,
2,
3,
2,
2
],
"text": [
"52 is just a rough enough guide to how many days there are in a year but if you add the days of each month, you'll get 365.",
"There are 52 FULL weeks in a year, and 365 FULL days. Those extra fractions make the extra day each year and the extra day every four years.",
"The calendar year isn't a whole number of weeks, which is also why a particular date will be one day of the week one year, but another the next year.",
"The year isn't exactly 52 weeks long, it's 52.14 weeks long. This is also why the first of the month moves forward one day of the week each year, and why you'll get an extra paycheck some years if paid weekly or biweekly.\n\n52 weeks is not the definition of a year, it's just a convenient approximation",
"Well there simply isn't 52 weeks in a year, there are 52 weeks and one day or 52.143 weeks. Saying 52 weeks in a year is just a close enough approximation. It's the same when someone says there are 4 weeks in a month even though there isn't exactly 4 weeks. Technically there isn't even 365 days in a year. There is about 365.25 which is why leap years exist to keep everything lined up and even that isn't exactly right. ",
"This isnt exactly a five year old question\n\nI have had to program the leap year algorithm in software control units, before those formulas for the algorithms were commonly found in software libraries. \n\nThe formula goes...\nIf the year is wholly divisible by 4 then it is a leap year,\nUnless it is wholly divisible by 100 then it is not a leap year,\nUnless it is wholly divisible by 400, in which it is a leap year.\n\nThis can be expressed by the formula....\nLeap = year % 400 == 0 and not (year % 100 == 0) and year % 4 == 0,\nWhere % is the modulus operator. \n\nSo this means that 2000 was a leap year, coz 2000. % 400 == 0\nAnd 1900 was not a leap year coz 1900 % 100 != 0\nAnd 2020 will be a leap year coz 2020 % 4.== 0\n\nMakes sense now?\n\nBut even that is not the whole story as that too is an approximation, not to mention that the rotation of the earth and the rotation of the earth around the sun is slowing sown, so future corrections will be needed. "
]
} | []
| []
| [
[],
[],
[],
[],
[],
[]
]
|
||
2wkwh4 | Can something be genetically modified "on the fly" and see results in a (relatively) short period of time or is that something that has to be done before birth? | askscience | http://www.reddit.com/r/askscience/comments/2wkwh4/can_something_be_genetically_modified_on_the_fly/ | {
"a_id": [
"cos3hk3"
],
"score": [
3
],
"text": [
"You can't just re-engineer a somatic cell (non-sex cell) and expect to see changes in the whole body just because of that one change (all of its daughter cells will be different, but only them). You can re-engineer somatic cells with a virus (a.... retrovirus?) which actually changes the DNA of a cell and then moves on to a new cell and keeps going and going.\n\nOtherwise it would be much easier to re-engineer a zygote, that way the changes will affect the whole body. But, there are issues with that as well. Any changes made will be passed on to that person's offspring, regardless if they would want it or not. \n\nA merging of these two techniques would be something like: grabbing the already-determined, somatic cell in an embryo and changin that. Though I'm not too sure of the pros/cons of that."
]
} | []
| []
| [
[]
]
|
||
zzd7f | How can I make water boil faster? | Say I pour water in a pot getting ready to make some noodles. It usually takes around/over 10-15 minutes for the water to come to a steady boil. I use a gas stove, not an electric. Is there a way to make the boiling process faster? I've heard that adding salt to the water breaks the bonds of the hydrogen and oxygen, which may help boil the water faster, but I've also heard that adding salt "calms" the boiling down. Any suggestions? | askscience | http://www.reddit.com/r/askscience/comments/zzd7f/how_can_i_make_water_boil_faster/ | {
"a_id": [
"c690y79",
"c6910cy",
"c6911p5",
"c69157t",
"c6919cv",
"c691q63",
"c6920vm",
"c693btb",
"c69eibc"
],
"score": [
6,
12,
13,
9,
4,
4,
2,
2,
2
],
"text": [
"Start with hot water",
"change your elevation",
"If you aren't already doing this, putting a lid on the pot brings water to boil much more quickly. The salt question is addressed [here](_URL_0_), essentially it's equivalent to boiling a smaller quantity of water (so you might as well just make your noodles in a smaller amount of water, skipping the salt.)",
"Adding salt raises the boiling point. The only way to speed it up is to start with hotter water, increase energy in, or reduce energy lost. Anything else people suggest might cause the water to boil faster, but at a lower temperature. For noodles that is fine, but you know how some foods have different directions for cooking at altitude? That's because water will boil at less than 212F due to lower pressure, and things will need more time at the lower temp. to be cooked the same amount. Also, use a lid if you aren't.",
"put a lid on it",
"Buy an electric kettle. ",
"Boil the water in a tea kettle, an electric water heater, or even a pot with the lid on.\n\nDon't salt the water.\n\nYou can start with hotter water, but be aware that it may taste different from cool water, as hot water can dislodge minerals/metals from the plumbing on the way out of the faucet.\n\nSource: practical experience. You can probably test this stuff pretty easily on your own if you have a stopwatch.",
"Start cooking earlier.",
"Some suggestions:\n\n* Start with hot water (Less work needed to heat the water to the boiling point)\n* Use less water (Less water to heat up)\n* Use a lid (To prevent heat from escaping)\n* Use a bigger pot (More surface area to transfer heat to the water)\n* Use an aluminium pot instead of a stainless steel one (aluminium is better heat conductor)\n\nAnd lastly:\n\n* Salt the water.\n\nI found an article regarding the salt effect in boiling. I don't know if this mans scientific reasoning is correct, but you can't argue with empirical results.\n\n_URL_0_\n\n > Here is the data from the experiment:\n\n > 6 cups with no salt took 8 min 24 sec\n\n > 6 cups with no salt took 8 min 9 sec\n\n > 6 cups with no salt took 8 min 19 sec\n\n > 6 cups with 1 Tablespoon salt took 7 min 23 sec\n\n > 6 cups with 1 Tablespoon salt took 7 min 31 sec\n\n > 6 cups with 1 Tablespoon salt took 7 min 27 sec\n"
]
} | []
| []
| [
[],
[],
[
"http://www.swri.org/10light/water.htm"
],
[],
[],
[],
[],
[],
[
"http://voices.yahoo.com/does-salt-water-boil-faster-5411319.html?cat=5"
]
]
|
|
p3ou9 | how to legitimately change your last name? | So I've been contemplating this for awhile and I just need to know what one has to go through to change a last name. I am a freshman in college and wanted to change to my mother's maiden name. Anything can help! | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/p3ou9/eli5_how_to_legitimately_change_your_last_name/ | {
"a_id": [
"c3mano5"
],
"score": [
3
],
"text": [
"I just recently did this! I can't tell you about maybe something weird in your county, but you go to your county of residence. It was super easy. I filled out forms and showed up on the date and time that they have open for name changes. The judge asked why I wanted to change it, I just said I preferred my mother's maiden name, and it was done. It was about $120 I think, and that included three signed and sealed court orders. You'll need those to change your name on your credit cards/bank accounts/drivers license/etc. \n\nThey don't really care that you're doing it or anything, you just swear under oath you're not trying to run from anything (like debts) and you're good. I did it in Snohomish County in WA, if you happen to be from there. :)"
]
} | []
| []
| [
[]
]
|
|
114kfu | Would there ever be a way to dissolve plaque without damaging teeth? | Plaque is a form of crystallization, right? Is it the same compound that teeth are made of? | askscience | http://www.reddit.com/r/askscience/comments/114kfu/would_there_ever_be_a_way_to_dissolve_plaque/ | {
"a_id": [
"c6jbsj4"
],
"score": [
2
],
"text": [
"Not quite, dental plaque is a biofilm formed by bacteria, not a crystal. Certainly not made of enamel. As for alternative methods to remove it, I'm not in the field, so I not sure what's available."
]
} | []
| []
| [
[]
]
|
|
1tzb5w | Did medieval armies have NCO's or something like a centurian to help lead troops into battle? | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/1tzb5w/did_medieval_armies_have_ncos_or_something_like_a/ | {
"a_id": [
"ced9smv",
"cedatds",
"cedazja"
],
"score": [
5,
4,
6
],
"text": [
"For the albeit limited examples of the Holy Orders, the Templars had Sergeants. [Literary Source here](_URL_1_), as did the Hospitallers. [Additional source here, ](_URL_0_) \n\nI do not know about the Teutonic Knights. \n\n",
"Your officers and NCOs would almost certainly be noblemen, the sole exception being if you were fighting in a mercenary company. That said, one of the real problems with medieval warfare is that the leaders and the shock troops come from the same pool of individuals, made up of about 2% of the adult male population. If your trained warrior aristocrats are off making heavy cavalry charges, they're not leading the middle-class infantry.\n\nIn the early middle ages, a king has two ways to assemble an army. One is by mobilizing his household knights, who could number in the hundreds. These would be led by his household officers; the marshal, the constable, etc. These experienced, full-time knights could also be used to form a junior officer corps to oversee the feudal levy, as done in the wars of Edward I.\n\nThe feudal levy is classically perceived as the king planting his standard and the lords of the realm flocking to it to perform their 40-days service (and not an hour more, damn you), but this seems to have rarely worked as intended. Later in medieval England, owing to the demilitarization of society and the gross inefficiency of the levee en masse, a system for contracted military service developed. At the bottom of the pile, you've got the simple esquire with four or five archers, contracting directly with the king. At the top, you've got dukes and earls contracting with scores or hundreds of men under them. \n\nIt's a matter of dispute just what authority these men had once the contracts were signed and they were with the army. At Azincourt, a relatively low-ranking nobleman, a household knight of Henry's, was placed in command of the 5,000-odd archers, while dukes and earls soldiered with the 1,000-odd men-at-arms.",
"Yes. Here is an earlier [post I did specifically on the ranks of the Eastern Roman Empire (c. 1000).](_URL_0_)\n\n > Well obviously there is wide latitude in ranks as there are any number of Armies from that era. I'll use one that I have a book handy for as an example.\n > \n > For the Byzantine/Eastern Roman Empire circa turn of the millenium, the basic unit was the bandon, which is roughly similar to a company in modern military terms.\n > \n > The bandons were commanded by komes (count). With the infantry, the 256 man unit was broken into sixteen platoons of sixteen men each led by a lochaghos and assisted by NCO ranks known as dekarchos, pentarchos, tetrarchos and ourahos. The first three mean \"leader of ten, five and four\" respectively, while the last means \"file closer\".\n > \n > A 300 man cavalry banda was divided into three hekatontarchia, each commanded by a hekatontarchos. The senior hekatontarchos was the illarches, and the second in command to the komes. Later, the hekatontarchia was eliminated and the primary division was into six allaghia commanded by kentarchos (they were still outranked by the hekatontarchos, who oversaw two allaghia each). Allaghia were composed of five dekarchiai of ten men, and the ranks were the same as the infantry there, with dekarchos, pentarchos, tetrarchos and ourahos.\n > \n > Above the bandon level, came the moirai - moirarchai commanding, or dhoungoi - dhoungarii commanding. The number of banda varied, but they seems to have been made up of anywhere from two to five of them. After that was the turmai or merai, commanded by the turmarchai or merarchai respectively, and were made up of three moirai.\n > \n > Now, my book (Byzantine Armies 886-1118 by Ian Heath) doesn't give modern equivalents, but we can make reasonable comparisons (I'm just guessing here roughly based on the number of men they commanded, so don't take this part as certain)\n > \n > Turmarchai/merarchai - Col./Brigadier General\n > \n > Moirarchai/dhoungarii - Lt. Col./Col.\n > \n > Komes - Captain/Major\n > \n > Hekatontarchos -Captain\n > \n > Lochaghos/Allaghia - Lieutenant\n > \n > Dekarchos - Sergeant\n > \n > Pentarchos - Corporal\n > \n > Tetrarchos - Corporal\n > \n > Ourahos - Lance Corporal"
]
} | []
| []
| [
[
"http://books.google.de/books/about/The_Central_Convent_of_Hospitallers_and.html?id=C5FOrh6O_cEC&redir_esc=y",
"http://books.google.de/books/about/The_New_Knighthood.html?id=DhdfTczmwWoC&redir_esc=y"
],
[],
[
"http://www.reddit.com/r/AskHistorians/comments/1sbjda/which_were_the_military_ranks_in_a_medieval_army/cdvxkr7"
]
]
|
||
3qn8vd | why do some radio stations (usually more popular or "mainstream ones) raise the pitch or speed up the songs they play? | I *thought* I have noticed this before a few times but I felt like maybe I was just imagining things. But then I confirmed it that some do. I was covering a song at one point and then it came on the radio. Because I was covering, I was basically studying the song to a "T". So I knew it inside and out. Then I noticed that it was sped up on the more "mainstream" radio stations (i.e. the big stations that play all the Top Hits). But then when the song played on a local "indie" station, it was it's normal pitch.
Has anyone else noticed this? Does anybody know why it happens or why some stations do that? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3qn8vd/eli5_why_do_some_radio_stations_usually_more/ | {
"a_id": [
"cwgo1s0",
"cwgod7o",
"cwgon73",
"cwhb0rz"
],
"score": [
19,
2,
13,
2
],
"text": [
"Just so the song is shorter. Sometimes they will cut sections out of songs too. What comes to mind is when Metallica released death magnetic back in '08.\n\n[The shortest song is 5 minutes, and the next shortest is 6:25](_URL_0_)\n\nI forget which songs they were always playing exactly. \"The day that never comes\" was one of them but there was another also. They would chop whole sections out of that song (it is 8 minutes long....), specifically they would chop out a \"bridge\" which Metallica tends to have in their songs and tends to be repetitive.",
"If you speed it up it raises the pitch slightly in doing that. They can't get the band to just record another version but faster. They do it for time slots usually. They don't want to play seven minute songs because that can be bad for viewers who don't like that one song. Also, if all songs are about three to four minutes then they can fit commercials in nicely without having to worry about a lot of different songs with different durations. It's pretty much just to keep everything organized",
"Radio stations these days are often owned by multi-radio station owning conglomerates. They have a few goals. \n\n1. a consistent song length lets them make sure all of their stations switch to commercials at about the same time (no switching stations to avoid commercials) \n\n2. a large mix of the current play list every hour. So just because you dislike song X, it will be over before you get annoyed enough to switch the station. \n\n3. Fast pitch songs have a faster tempo, seem more up beat and hip. ",
"I am the guy who is messing with your music. I work for A small Radio Station in germany and have worked for other CHR and HotAC stations. Although in my experience mostly the AC stations use this technic.\n\nBefor there were digital workstations you had to use tape. Music on tape is hard to cut. Speeding it up in the otherhand makes the song shorter and also pitches the song up wich makes it sound \"happyer\"\n\nThe main reasons why music is edited in the first place are\n1. you can play more Songs in an houre if they are shorter\n2. editing out instrumental parts that are deemed problematic (best example is the guitar solo in nothing else matters"
]
} | []
| []
| [
[
"https://en.wikipedia.org/wiki/Death_Magnetic#Track_listing"
],
[],
[],
[]
]
|
|
20dxn5 | "for every action there is an equal and opposite reaction". is there anything in the universe where this isn't true? | I'm no scientist but I did read somewhere that that statement is not true for everything, in what cases is it not true? Does anything spontaneously happen without an action causing it? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/20dxn5/eli5_for_every_action_there_is_an_equal_and/ | {
"a_id": [
"cg2as4d"
],
"score": [
3
],
"text": [
"Well, sure. There are all kinds of situations of one thing \"acting\" on another without getting \"acted\" on back, because \"acting\" is not a scientific word. That definition of Newton's Third Law is very vague and actually has no real meaning. A better definition is:\n\n\"For every force there is an equal and opposite force\". I'm sitting on a chair now, and the weight of my butt is pressing against the chair with ~195 lbs of force, because I'm fat and not good at dieting. The chair is also pressing against me with 195 lbs of force, and I know that this is the case because my butt is deformed, and I can feel pressure in the nerves on my skin. \n\nIf we restrict the definition to what it properly should be, then yes, this law is universal and applies to all possible scenarios. "
]
} | []
| []
| [
[]
]
|
|
3gyt91 | Why did the silk road and the other primary east-west trade routes cross through the desert instead of going north through the Eurasian steppes? | I know that the steppes weren't particularly hospitable either but it seems like at least in terms of grazing for caravans' horses and beasts of burden as well as water sources the steppes would be easier to pass through than the mountains and deserts of central Asia and the middle east. | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/3gyt91/why_did_the_silk_road_and_the_other_primary/ | {
"a_id": [
"cu2sx7e"
],
"score": [
15
],
"text": [
"It's important to remember that very few (if any) traders travelled the entire length of the silk road- it was more like a relay of different traders.\n\nThe central Asian deserts were already populated by nomadic people with a long tradition of trade, which facilitated the establishment of the greater trade routes in the way that they were."
]
} | []
| []
| [
[]
]
|
|
12g9ax | What obscure folk tale/s from your area of speciality might have rivalled Grimm's fairytales if they had been helped to spread among Western culture at the right time? | I'd love to discover some of the best stories that are now lost outside of academia. | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/12g9ax/what_obscure_folk_tales_from_your_area_of/ | {
"a_id": [
"c6urwfc",
"c6uvet4"
],
"score": [
2,
2
],
"text": [
"The tales of Hershele of Ostropol are quite entertaining. They're relatively well known amongst some Jews and Ukrainians.",
"I'll refer you to [this story](_URL_0_), which isn't even very well known among Russians, I don't think.\n\nThere's also a hagiography (story of a saint) called *The Tale of Peter and Fevronia*, from eleventh century Russia. I don't have my notes for this one and can't even find my original of it (which was from a version made in the early 18th century, I think), but I'll do my best. I also only have the first half of the story (but it's the part with all the action), so if anyone can and wants to add the rest, they're welcome to.\n\nPrince Paul finds out that his wife is being visited in the night by a serpent disguised as the prince. His wife discovers that the only way to kill the serpent is a magic sword owned by the prince's brother, Prince Peter. They go to Peter and ask him to kill the serpent, and he obliges. However, he gets covered in the serpent's blood after he slays it, and where it touches his skin he breaks out into gross and painful scabby sores. They send for all the doctors in the realm, and not a single one can cure (let alone treat) poor Prince Peter.\n\nSuddenly, word reaches Peter of Fevronia, a young peasant maiden who, they say, will know how to cure him. He leaves Murom to go find her in the countryside, carried by a retinue. When they arrive at her hut, he's carried in, laid on a bed, and his retinue leaves. Fevronia agrees to cure him, on one condition: that he marries her. Peter reluctantly agrees, and Fevronia makes up a salve, applies it to his sores, and they heal instantly. Peter then leaves, and instead of marrying Fevronia, promises to send her plenty of gifts.\n\nIt's not long before Peter's body is again covered in those gross scabby sores, and he returns to Fevronia, and he's pretty mad at her. This time, she makes him swear oaths that he'll marry her if she cures him, and he agrees. She heals him, and they return to Murom together. His brother Paul dies not much later, and they become Prince and Princess of Murom."
]
} | []
| []
| [
[],
[
"http://www.reddit.com/r/AskHistorians/comments/12ci5b/classical_scholars_what_are_your_favorite_obscure/c6u5yp1"
]
]
|
|
2a78y0 | WW2 - U-boats vs the D-Day invasion fleet | Were German submarines put to use in patrolling possible routes to detect/attack the Allied invasion fleet during the run-up to D-Day?
Or would that have been infeasible?
| AskHistorians | http://www.reddit.com/r/AskHistorians/comments/2a78y0/ww2_uboats_vs_the_dday_invasion_fleet/ | {
"a_id": [
"cis80ks",
"cis93mi"
],
"score": [
2,
2
],
"text": [
"It was infeasible because it was suicidal. The invasion convoys were escorted by several dozen destroyers, frigates or other escort ships with Anti Submarine weapons on board. The RAF coastal command flew numerous patrols over the English Chanel, Particularly the western approaches, near Cornwall. \nDoneitz did send four U-Boats to the waters off of Normandy, but all four were sunk, without accomplishing anything, vis-a-vis the dense concentration of merchant ships the Allies had in that area. \nSamuel Elliot Morrison has the complete order of battle for the US Navy, Royal Navy, Canadian Navy and Polish Navy for D-day in his book \"The invasion of France and Germany 1944-1945\" which is part of his fifteen volume set \"History of US Naval Operations in World War II\" ",
"In addition to what /u/davratta said, the U boats were slow and unwieldy, which would lead to less effective patrol areas and lower chance of survival and attack, so [fast attack craft](_URL_2_) were used more as they could cover larger areas and had a better chance of slipping away. For example, a group of nine schnellboot came across a [practice landing](_URL_0_) on the coast of England about a month and a half before the Normandy landing and sank two, killing at least 638 US personnel, with no German losses.\n\nThere was so much Allied air cover that neither Schnellboats (known as E-boats to the allies) or U-boats could venture forth during the day, and German confusion about the invasion (real versus feint) kept the boats away for the first day, but they did deploy and patrol towards the Allied landing the next day. A decent overview is available on the [_URL_3_ site](_URL_1_), which is perhaps a little off topic for your original question, but I suspect of interest if your are looking for German naval opposition to the landings in general. "
]
} | []
| []
| [
[],
[
"http://en.wikipedia.org/wiki/Exercise_Tiger#Battle_of_Lyme_Bay",
"http://s-boot.net/sboats-km-channel44.html",
"http://en.wikipedia.org/wiki/E-boat",
"S-boot.net"
]
]
|
|
2qqx2h | how /r/adviceanimals isn't a default sub even though it has more subscribers than /r/explainlikeimfive? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2qqx2h/eli5_how_radviceanimals_isnt_a_default_sub_even/ | {
"a_id": [
"cn8nilx"
],
"score": [
2
],
"text": [
"It used to be, and redditors got tired of the same misused full-of-shit memes clogging the page. I'm guessing reddit admins did as well."
]
} | []
| []
| [
[]
]
|
||
42lgk0 | how much money is there in the world in total and how's it measured? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/42lgk0/eli5_how_much_money_is_there_in_the_world_in/ | {
"a_id": [
"czb872o"
],
"score": [
2
],
"text": [
"For a while counting is the simplest way to measure money. I say that because eventually it gets tricky.\n\nThere is of course the cash money. Money in our pockets and in the cash drawers of registers. That is the smallest amount. It is counted as it is produced and banks count it as it comes in.\n\nThen there is money on deposit. That also is countable. Once banks count their deposits they are allowed to loan a fraction of this money out. So they like deposits. The money they loaned out was in a sense the money which is deposited. But in another sense it was new money.\n\nSome banks have drawing rights. They are allowed to borrow money on paper, or to be electronically debited. They can loan this money too. This money was created by granting the drawing rights.\n\nNow take the money loaned out as mortgages. They can be bundled and offered for sale. it is future money but can be sold today in a bundle. We just created more money.\n\nIf you are worried those loans will not be paid then the bundle of loans can be discounted. The bundle will be sold for less than their face value because some loans will go into default. \n\nGuarantees can be bought and sold that these bundles will be good. More money is created that way. They are just guarantees. But money will be paid if the defaults exceed the expected amount.\n\nThere is where it gets fuzzy. sometimes these credit default swaps, that is what they are called. are not reported to be counted. The assets of big corporations are used to back the defaults. The regulations are loose. There is not enough accountability and the amount is hard to count. But this kind of money is easily the largest pile of nonexistent money."
]
} | []
| []
| [
[]
]
|
||
1vno20 | why you can get a heart attack if you're shocked or scared. | I'm not sure if it has something to do with blood pressure, but if it is, how is it so quick? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1vno20/eli5_why_you_can_get_a_heart_attack_if_youre/ | {
"a_id": [
"ceu2acf"
],
"score": [
3
],
"text": [
"An increase in heart rate and/or blood pressure can dislodge fatty deposits in the arteries that feed the heart. If they break off they can block the supply of blood to parts of the heart. That's a heart attack. The heart muscle then begins to die. "
]
} | []
| []
| [
[]
]
|
|
2ofydt | Why did French revolutionaries prefer an emperor to a king? | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/2ofydt/why_did_french_revolutionaries_prefer_an_emperor/ | {
"a_id": [
"cmmyl9f"
],
"score": [
6
],
"text": [
"In 1799, the French Directory was a corrupt political machine that used war to divert attention away from problems within France (such as how corrupt they were) and using war to gain funds for both the government and themselves. The coup of 18 Brumaire would drive the corrupt Directory away and place Napoleon with two other consuls as the head of the French government.\n\nThe first thing that was done was clearing away all the rats that plagued the French government and pushing the corruption out and promoting meritocracy within the government. Further, the Napoleonic Code (Civil Code of France) would be unrolled during the first five years before Napoleon would be crowned Emperor. Overall, Napoleon would drive the French government to one of chaos to one of efficiency and quality.\n\nMost importantly, he was popular. In several plebiscites, Napoleon was overwhelmingly elected as Consul for Life and then Emperor (David G. Chandler states in his *Campaigns of Napoleon* that it seems that it was a democratic and fair election process, although the vote for Emperor was tainted with a few hundred odd votes from members of the military clumped together).\n\nI would say that it goes down to the effectiveness of leadership. Louis XVI was a well meaning and kind man that was not a born leader, Napoleon was a man that took charge and had people work toward his will. Further, the people were tired and wanted peace, which Napoleon brought with an effective government, something Louis XVI didn't and couldn't do."
]
} | []
| []
| [
[]
]
|
||
1foogw | What is the most significant historical artifact that has been stolen or appropriated by a state after rediscovery? | For example, either outright stolen and sold in the black market only to disappear into some private collection, or something that may be sitting in a museum; which its country of origin is asking to be returned, while the current host country declines.
Thank you. | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/1foogw/what_is_the_most_significant_historical_artifact/ | {
"a_id": [
"cacar9o"
],
"score": [
2
],
"text": [
"I can't say that this was a re-discovery, but one of the more interesting examples of something like this was when Texas revolutionists attacked and killed General Santa Anna and his army. They stole his wooden leg, and it was held in a museum in what I believe was Illinois. Apparently, Mexico hates him, but the government still wants it back. We just haven't returned it yet. This is very apparent since he died in exile and was buried in a grave in Los Angeles.. But this was after about 150 years or so of having the museum that held the leg decline to give it to Mexico. \n\nReflecting further on this, I believe it may the Illinois State Military Museum, or something to that affect, just don't quote me on it. There is also a second leg that was captured, again from Santa Anna. However, this one is just a peg leg held in what I know for sure is Oglesby Mansion. It is rumored that Lieutenant Abner Doubleday used it as a baseball bat."
]
} | []
| []
| [
[]
]
|
|
1gte4l | What makes gecko feet walk on whatever surface? | I watched a documentary about geckos which pretty much said that their feet are so unique that they interfere with the surface on a molecular level. Can I get a more specific answer on how exactly do they interfere? | askscience | http://www.reddit.com/r/askscience/comments/1gte4l/what_makes_gecko_feet_walk_on_whatever_surface/ | {
"a_id": [
"canmu5i",
"cannfs5"
],
"score": [
4,
12
],
"text": [
"The idea is that Van der Waals force comes into effect as the \"hairs\" on the bottom of gecko's feet are so small.\n\n\nWiki has a good explanation of what this force is:\n > \"The van der Waals force is the sum of the attractive or repulsive forces between molecules (or between parts of the same molecule) other than those due to covalent bonds, the hydrogen bonds, or the electrostatic interaction of ions with one another or with neutral molecules or charged molecules.\"\n\n_URL_0_",
"To answer, we first need to consider the gecko's feet on a larger scale. On the bottom of each foot is thousands of small hairs. At the tip of these hairs are thousands more microextensions. These hairs are the key to the foot's adhesive properties. On the molecular level, the hair interact via van der waals forces with the surface. Van der waal forces are a type of transient force that creates a temporary dipole (more in a bit). \n\nA polar molecule is simply a molecule with an uneven electron distribution, aka an uneven charge. Some molecules are polar, like water, which has a partial positive charge on the hydrogens and a partial negative charge on the oxygen, since more negatively charged electrons are clustered around the oxygen molecule. Other molecules are nonpolar, and have an even distribution of electrons. Methane (CH4) is a nonpolar molecule. The electrons are distributed evenly between Carbon and the four hydrogens. \n\nThere's a common phrase in chemistry that \"like dissolves like,\" which means polar molecules like to mix with other polar molecules and nonpolar molecules like to mix with other nonpolar molecules. Water and ethanol, both polar, mix because of this. Water (polar) and oil (nonpolar) separate and do not mix because of their different polarity properties. \n\nIt's easier to visualize how two polar molecules can mix. Each has a charge (or a partial charge) and opposite charges on the molecules can attract and interact. In the case of how two nonpolar molecules interact, the visualization is a bit more complicated.\n\n Although nonpolar molecules have an overall even electron distribution, there are transient periods in which the molecule does have a slight partial charge. That is to say, the electron distribution is not static. There are random times when one side of the molecule will have a more electrons (and thus be more negatively charged) than another side of the molecule. It has spontaneously become a dipole. Now if we split our imaginary nonpolar molecule in half we can imagine a side that is briefly negatively charged (side A) and a side that is briefly positively charged (side B). Because opposites attract, the molecules that are next to our spontaneous dipole become affected. So a neighboring molecule that is next to negatively charged side A will rearrange it's electrons so it becomes slightly positively charged on the side closest to A. This action has now made a second molecule a temporary dipole. Likewise, molecules closest to positively charged side B will rearrange their electrons so that they are more negatively charged closest to B. Again, we have another dipole! *These are van der waal forces* and are one of the ways nonpolar molecules can interact.\n\nA gecko's feet hair utilizes this mechanism on a molecular level. It's why a gecko can climb equally well up a polar or a nonpolar surface. The number of hairs on the foot, as well as the number of microscopic tendrils coming off of the tips of these hairs, greatly increases the foot's surface area and the number of molecules that will be able to interact with a surface. \n\nSo in brief, the hairs create increased surface area which allows temporary electrostatic interactions to form between the foot and the surface enabling the gecko to crawl up it with grace!\n\nsource: _URL_0_, _URL_1_"
]
} | []
| []
| [
[
"https://en.wikipedia.org/wiki/Van_der_Waals_force#Use_by_geckos"
],
[
"http://news.sciencemag.org/sciencenow/2002/08/27-02.html",
"http://www.pnas.org/content/99/19/12252.full.pdf+html"
]
]
|
|
dxmbcq | 5: why is it so hard to replace plastics with another material with similar properties? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/dxmbcq/elif5_why_is_it_so_hard_to_replace_plastics_with/ | {
"a_id": [
"f7soiee",
"f7sonp6",
"f7tpnwm",
"f7tw9dj"
],
"score": [
138,
3,
12,
6
],
"text": [
"Cost: plastic is extremely cheap to produce (also to recycle), currently nothing as cheap exists so companies will keep using what makes them the most money. \n\nProperties: there actually aren't many materials with similar properties: \n- recycled/compostable plastics aren't as maleable and mess up the recycling of normal plastics. \n- paper, well just see the outrage of paper straws \n- metal costs too much and is heavy \n- the cutting edge \"plastic killers\" don't currently work on large scale due to lack of technology/knowledge in how to scale (eg. Nanostructures)\n\nIn actuality plastics are probably the most important, useful and revolutionary material technology in history. It would also be the most environmentally friendly material if we would be able to close the loop and recycle most of it. Problems only arise when it ends up in nature, which I personally believe to just be due to severe incompetence on parts of government, companies and to some extent people.\n\nAFAIK \"fact\" to take forward: Producing paper straws rather than plastic ones is often a net loss in terms of GHG emissions, habitat loss and chemical intensity. \n\nUse this to always think about the whole life-cycle of products and on the many different ways the environment can be hurt.",
"There are two parts to this question: first plastics are largely defined by their properties and composition. If something had all the same propertied then it likely is another plastic.\n\nSecondly for different individual properties (malleable, non biodegradable, non reactive to most things, etc.) there are plenty of alternatives.\n\nNone are as cheap.\n\nThere are also minor issues like paper products breakdown faster, metal things are heavier, etc. that add up to issues over time but the big simple one is that plastic is very very cheap. Its a considerable investment in both short and long term to switch to something else (certainly one worth making but people don’t like to spend money).",
"Plastics are incredible. There isn't one single material capable of having the wide range of material properties plastics can have. They can be cheap, durable, lend themselves well to manufacturing methods such as blow moulding, rotation moulding, injection moulding etc. In the case of thermoplastic elastomers they can be reused (in some capacity anyway). There are food grade plastics, plastics capable of withstanding pretty impressive temperatures (the inner side of many cooking pans are coated with a thin layer of PTFE, better known as Teflon, for non-sticking purposes). They have favourable mechanical properties in that some can act as living hinges in many products (think the lid of a tictac box), meaning no bearings and with that no additional manufacturing processes are required. Sure there are materials with similar properties to _some_ plastic types but you'll be hard pressed to find one which can mimic most let alone all plastic types.",
"\"Plastics\" is not a single thing, it is a group of things defined by properties. Specifically the ability to be easily molded into various shapes while being durable.\n\nIf you find something that has the properties of plastic, it's plastic. \n\nFwiw, we already do have plastics that will biodegrade. Made from corn. Not economically practical and cannot replace everything we use plastic for."
]
} | []
| []
| [
[],
[],
[],
[]
]
|
||
2rgt4a | why farmers give their cows nose rings | I've seen a few pics of cows (male cows, I think) with the nose ring. Is there a purpose there? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2rgt4a/eli5_why_farmers_give_their_cows_nose_rings/ | {
"a_id": [
"cnfq5ez"
],
"score": [
7
],
"text": [
"It's to attach a leash to. It's very painful for a cow to pull against a lead when it's attached by the nose, so this allows humans to walk them around. If it were around their neck, there's no wah you'd get them to move unless they wanted to."
]
} | []
| []
| [
[]
]
|
|
4ajrel | how does mental illness start? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ajrel/eli5_how_does_mental_illness_start/ | {
"a_id": [
"d10x8e1",
"d10xq2o"
],
"score": [
6,
2
],
"text": [
"It's a large category, including different illnesses with several different causes. These can include:\n\n- Chemical imbalances\n- Traumatic experiences\n- Inadequate care during the first 3 years of life\n- Brain injury\n- Genetic abnormalities\n- Long-term stress",
"For some illnesses and in some patients, we can say for sure (but it's not always the same cause even for the same illness in different patients, or for different illnesses in one patient!). Some mental illnesses often seem to be something to do with how the chemicals in your brain are made, which in turn is often related to your genetics: but this doesn't tell the whole story, because even if both of your parents have a particular mental illness it doesn't have to mean that you'll get it... and even if neither of them do it doesn't mean that you won't! But we've done lots of studies that have shown that many mental illnesses seem to run in families, and some of those have clear things that you can test for that are different about people who have them.\n\nThere are other big things, though, that affect whether or not you'll be affected by mental illness. Some mental illnesses can be caused during your development in the womb (it's one of the many reasons that pregnant women are generally advised not to drink alcohol!). Some kinds of mental illness can be caused by injury - for example, a blow to the head. There are even some bacteria and viruses that seem to be able to cause long-term mental illness in some people: and some kinds of drugs seem to be associated with some kinds of mental illness, too!\n\nAside from these \"physical\" ways that mental illness can be caused, there are also lots of psychological ways... although they're even harder to understand and pin-down, and we're only just beginning to make sense of them. Abuse and trauma can lead to mood disorders, anxiety, paranoid, and post-traumatic stress disorder (PTSD), for example. Difficult circumstances in your life, especially when you're a child, seem to be especially effective at triggering depression and might be linked to bipolar disorder.\n\nWe're a long way from understanding exactly what causes mental illness, and it clearly varies from case to case."
]
} | []
| []
| [
[],
[]
]
|
||
9l0yl8 | Why doesn't the water from the river mix with the water from the sea? | [_URL_0_](_URL_1_) | askscience | https://www.reddit.com/r/askscience/comments/9l0yl8/why_doesnt_the_water_from_the_river_mix_with_the/ | {
"a_id": [
"e7506z6"
],
"score": [
3
],
"text": [
"It is mixing. Just slowly and in places you can't see. The different densities, salinities and turbidities are very large so it will always take a long time to mix. Furthermore both bodies of water are being replenished so the mixing is counterbalanced. It is likely you are seeing the top of a less dense plume here overlying the dense ocean water with a large surface within the water column where mixing takes place. Because fresh water is less dense it stays on top. The waves and turbulence do mix the water but not fast enough to dissipate the plume."
]
} | []
| [
"https://www.reddit.com/r/BeAmazed/comments/9l0s1q/where\\_yellow\\_river\\_meets\\_the\\_sea/",
"https://www.reddit.com/r/BeAmazed/comments/9l0s1q/where_yellow_river_meets_the_sea/"
]
| [
[]
]
|
|
fdhmsz | I don't understand how a serf and a slave in Medieval Europe were different? Was serfdom just slavery with extra steps? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/fdhmsz/i_dont_understand_how_a_serf_and_a_slave_in/ | {
"a_id": [
"fjik17g"
],
"score": [
11
],
"text": [
"Serfs were a bit similar to slaves, but a slight bit more well off. While slaves were considered the property of their owners, serfs were not. And while they did not live the luxurious lifestyles of those they served, they still had their place, and had their limited rights (even if these rights may or may not have been actually enforced). Serfs were essentially attached to land, with feudal contracts. The owner of the land could not sell the serf to another and force him to go somewhere else, and if their lord sold the land they lived on to another, the serfs most often followed. \n\nSerfdom was more of a contract. Serfs lived and worked the land that the Lords owned, and in return had the Lord’s protection and a place to live/work. Now a serf could not leave the land without his Lord’s permission, and could not sell the land, they still had a bit of freedom, and a day or two per week when they could work for themselves to raise money. \n\nThis most often began when one accumulated a very large amount of debt. He would then go to a lord, and get into a feudal contract of serfdom. This meant that the Lord would protect the man and slowly pay off his debt, in return for the man living on the land and working the fields for said lord. Then the man’s children became serfs to work off the debt, so on and so forth. \n\nSo unlike slaves, serfs had rights, and actually got something back from their work, even getting paid. \n\nThis actually became an issue for the Lords during the Black Plague, because most serfs died off, allowing the remaining serfs to demand more payment for their work, allowing the serfs more free time to hone crafts skills and move away from their lords, and into the cities for better paying jobs, but that is a whole another story. \n\nTldr: slaves were property and treated as such. Serfs were citizens in contract with their lords, receiving paychecks and actual compensation for their work, as well as having rights, but they were still attached to the land, and leaving serfdom was extremely difficult."
]
} | []
| []
| [
[]
]
|
||
4ti7z2 | why does it mess up my counting when someone starts saying random numbers | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ti7z2/eli5_why_does_it_mess_up_my_counting_when_someone/ | {
"a_id": [
"d5hlks9"
],
"score": [
3
],
"text": [
"It's not just counting which is effected by other people talking. A similar experience can be had when someone else talks to you about a similar topic at the same time as you try to speak (it's often used as a demonstration of what it's like to live auditory hallucinations). Sadly I can't find a video demonstrating the effect but I can speak first hand of it's effectiveness. \n\nI understand this works on similar vine as demonstrated in the following video regarding speech jamming and how the brain takes all it's inputs sound, touch etc and that stronger signals can overpower weaker ones. \n\n_URL_1_\nThis seems to be an international link to the segment in question\n\n_URL_0_\nThis is an alternative source for the same episode with the relevant time stamp for anyone that the first link doesn't work on."
]
} | []
| []
| [
[
"https://youtu.be/GaWhr7-X7sU?t=8m45s",
"https://www.youtube.com/watch?v=wnt8qWZAflI"
]
]
|
||
6k90nb | How did the Romans communicate their laws to newly conquered, non-Latin speaking territories? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/6k90nb/how_did_the_romans_communicate_their_laws_to/ | {
"a_id": [
"djkpcts"
],
"score": [
3
],
"text": [
"I'm going to speak in broad and general terms here, since you've asked a question that concerns a wide area both geographically, as well as temporally and in terms of existing, previous legal practices (conquered Greek or Hellenistic cities, f.e. would have their own extensive bodies of law, while Germans wouldn't, while in other conquered territories local administration was built up *ex nihilo*, f.e. in Germany on the right bank of the Rhine). Roman law is also not a monolithic body, so this is only a general overview.\n\nOften, newly conquered territories weren't directly subject to Roman laws. That was, broadly speaking, the situation of most land that was conquered by Rome in Italy and during republican times until the 1st century B.C. Those lands that didn't directly become Roman territory (*ager romanus*) or were settled by Roman colonies (*colonia civium Romanorum*) were under their own autonomous laws. The allied cities (*civitates foederatae*, *liberae* or *stipendiariae*) were autonomous in internal affairs, while Rome was in control of external matters. \n\nFor the most part, this is also true of the Roman conquest of territories in imperial times, say Gaul, Germany, Britain, the Balkans and Danube region. Roman rule initially was rather indirect, focussed on controlling and integrating the leadership and aristocracy of local groups, generally organized along the lines of *gentes* (peoples) or *civitates*, citizenships or groups centered around ethnic lines. So in newly conquered Roman territories, Roman law wasn't too relevant for most people, since the local *civitates*, client kingdoms, tribes or cities would govern their internal affairs largely after their own fashion. Gradually, they would be more integrated into the Roman polity, or new *civitates* or *coloniae* might be founded. Colonies would have Roman citizenship and generally have municipal laws modelled after the example of Rome, but generally cities retained a degree of local legal autonomy.\n\nIn addition, one thing to understand about Roman law is that it was not so much codified as it was a cumulative body of jurisdiction. There were the famous twelve tables in the beginning in the early republic, but those covered only narrow areas of law and were not applicable to many of the legal questions that would arise later in Rome's history. The most important sources for Roman law - besides the twelve table law and recognized customs - were edicts and judgements arising out of legal practice, as well as statutes or special laws formulated by the public assemblies, the senate or the emperor to deal with very specific circumstances. One of the most important sources for this was the *praetor*, a high ranking office whose responsibility was judging cases between citizens. In the beginning of his annual term of office, the *praetor* would publish an edict in which he stated which types of cases, or actions (*actiones*) he would grant for judication, which remedies he would offer to settle legal disputes, and which not. \n\n*De jure*, he didn't create new law (that wasn't in his powers), but in effect he made what the Romans called *ius honorarium*, by choosing which legal remedies he would grant (or was persuaded to create for unforeseen circumstances), he created a body of legal instruments that could be used and referred to in the future. In the conquered provinces, this role was taken over by the governour similarly to how the *praetores* spoke law at Rome, by their edicts. For the provinces, these edicts by the governour were one important source of law. \n\nA second important source of law for the provinces was the emperor himself, who might either set law by decree, decide to hear cases brought to him by provincials himself or settle legal disputed brought to him by provincials (often the governour himself, of which many examples survive in the letters between Pliny in his function as provincial gouvernor and the emperor Trajan) either by provocation or by letter (*epistula*), to which the emperor gave answer (which was calles subscription, since he wrote his answer below the letter, and later rescript). Appeal to the governour or emperor was one often used example to settle disputes in the provinces.\n\nSo, how were such things made public? Thankfully, we have quite a few examples of these. Usually, they would be inscribed into large bronze tables (many of these legal acts contained a clause that they were to be *in aere incisa*, inscribed into bronze), and hung up in a public place. This is the case for many municipal laws that survive, especially from Spain, for example the municipal law of the *colonia Iulia Genetiva*, modern Urso. [This is one of the tables containing chapter 61-69](_URL_1_), and you can check a translation of the surviving fragmente [here](_URL_0_). Others are known f.e. from Irni, the *lex Irnitana* also being interesting in this context. The lex Irnitana contained a clause that specified up to which amounts in dispute the local magistrates were responsible for judication, and when the case should be brought before the provincial gouvernor, and also (in chapter 85), that the local magistrates were require to put up, in legible writing and in a public place, those edicts of the provincial governour according to which they would judge local cases.\n\nMany of these municipal laws show close parallels to Roman civil law, in the modelling, duties, responsibilites of the magistrates and the political organization itself. Edicts by the senate pertaining to Roman subjects were also published in the same way, the most famous example probably being the *senatus consultum de Bacchanalibus*, which outlawed practice of the Bacchanalian cult throughout Italy (and thus also in allied towns!) and consequently was hewn into bronze tables put up all over Italy, of which one example survives from Tiriolo. \n\nA famous case of imperial judication is well known from several examples found in the Greek provinces. It seems that the provincial governour, the proconsul, had tried to force a Roman senator living in Asia to take a travelling Roman into his home against his will. Against this, the governour petitioned the emperor, and received a harsh reply: \"Sacred letters (from the chancellery of the Emperor, sc. imperial ruling). You seem to us to be ignorant of the *senatus consultum*. For if you had conferred with (your) experts, you would know that a roman senator is not required to take in a guest against his will.\" This decision seems to have been (unsurprisingly) popular with local senators, and so it was put up in inscription in several places such as Antiochia Pisidia, Ephesos and Paros [f.e. CIL III 14203, 8), and surviving examples have been found in urban contexts, so probably close to senatorial estates who thus communicated to possible uninvited guests that they were not really required to house them. They were also put up in latin as well as in Greek, to prevent people from putting the language barrier forward as an excuse.\n\nTo bring this to a conclusion, the Romans were usually quite anxious about having those laws according to which public life was ordered publicly displayed for anyone to see (to read, well, that is an interesting question if you consider that probably only a fifth of people could read, and less comprehend the legalese). Newly conquered people were usually left to govern their own affairs under the patronage of Rome, and cities could be granted their own legal autonomy that would continue throughout imperial times. Relevant laws and legal decisions would be inscribed, either on bronze or sometimes less durable materials like whitewashed wood (which of course do not survive), for anyone to read who was interested and literate. In cases were local law didn't apply, Roman law could be brought in to settle disputes. But since Roman law was a cumulative body of legal decisions, the possibility remained in most cases to petition the local governour or the emperor to pass judgement, and this was done often, and the results (if advantageous), proudly displayed. \n\nSources and further reading:\n\n* D. Johnston, Roman Law in Context (Cambridge 2004)\n\n* D. Knibbe - R. Merkelbach, Allerhöchste Schelte (Zwei Exemplare der Sacrae Litterae aus Ephesos), Zeitschrift für Papyrologie und Epigraphik 31, 1978, 229-232.\n\n* E. Metzger, Agree to Disagree: Local Jurisdiction in the *lex Irnitana*, in: A. Burrows, D. Johnston, R. Zimmermann, eds., Judge and Jurist: Essays in Memory of Lord Rodger of Earlsferry (Oxford 2013) 207–225.\n\n* K. Tuori, The Emperor of Law. The Emergence of Roman Imperial Adjudication (Oxford 2016)\n\n\n\n\n\n"
]
} | []
| []
| [
[
"http://avalon.law.yale.edu/ancient/charter_of_urso.asp",
"https://upload.wikimedia.org/wikipedia/commons/thumb/4/49/Lex_Ursonensis_-_tabla_1_%28M.A.N._16736%29_01.jpg/1280px-Lex_Ursonensis_-_tabla_1_%28M.A.N._16736%29_01.jpg"
]
]
|
||
2xwfo9 | What were the most sought after professions in the Ancient and Classic era? | Also some not so sought after professions would be interesting too.
I know in Ancient Egypt that Scribes were seen as elite and skilled but I would like to know some other jobs that would have been up there in the food chain. | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/2xwfo9/what_were_the_most_sought_after_professions_in/ | {
"a_id": [
"cp4ccb3"
],
"score": [
7
],
"text": [
"Could you please specify more exactly what you're interested in? Antiquity encompasses a period of several thousand years, with myriad peoples and cultures interacting with each other for every moment of that time. Depending on time and place there are vastly different cultural and social attitudes and approaches towards various means of accumulating wealth and various trades. For example, while the mercantile classes appear to have been fairly powerful and prestigious at Carthage, you won't find the same respect for merchants in Rome even as late as the Principate. \n\nIn addition to when and where it might be worth it for you to clarify what you mean by a profession and what you mean by \"sought-after.\" The first is mainly for the purposes of semantic (and rather pedantic, sorry) clarity--members of the senatorial class were not ideally supposed to have a profession, as in a trade, and made their money off of land-trading and rents mostly, which we might consider a profession but not an occupation. The latter is essential to your question, however--do you mean professions that are the most respected or those that are sought after because they provide the greatest opportunity for wealth? Those are not necessarily the same thing--to use my Roman example again, while merchants often could amass large fortunes the occupation was dominated in the Principate by non-*nobiles* and freedmen"
]
} | []
| []
| [
[]
]
|
|
153rk4 | is there an actual quote from bible that condems homosexuality? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/153rk4/is_there_an_actual_quote_from_bible_that_condems/ | {
"a_id": [
"c7j0fw4",
"c7j135d",
"c7j7kb1",
"c7kcnm9"
],
"score": [
4,
4,
2,
2
],
"text": [
"It depends on what you believe 1 Corinthians 6:9 says\n\nThe Apostle Paul warns people against being \"arsenokoitai\" in the original Greek language text. Arsenokoitai were male shrine prostitutes that claimed to sell religious ritual sexual experiences.\n\nSome people believe the sin of the arsenokoitai was homosexuality, and that Paul is warning people not to be homosexual. Other people believe the sin of the arsenokoitai was being profane in selling their bodies at the temple, and that Paul is warning people away from that kind of degradation of a holy place in general.",
"this verse along with the other verse mentioned by cecikierk, is from Leviticus, which is from before Jesus' time, known as the Old Testament. this is from chapter 20, verse 13.\n > 13 “‘If a man has sexual relations with a man as one does with a woman, both of them have done what is detestable. They are to be put to death; their blood will be on their own heads.\nLeviticus is a book from the old testament, which is still relevant, but it was before Jesus' time (I'm not sure how much you know so I'll try and make it as understandable as possible).\n\nthis verse is from after Jesus' time, or the New Testament (see explanation below)\n**1 Corinthians 6:9-10**\n > 9 Or do you not know that wrongdoers will not inherit the kingdom of God? Do not be deceived: Neither the sexually immoral nor idolaters nor adulterers nor men who have sex with men[a] 10 nor thieves nor the greedy nor drunkards nor slanderers nor swindlers will inherit the kingdom of God.\n\nJesus came down to earth many years (im not 100% sure, i believe it was at least 1500 years) after Leviticus was written, he lived for around 30 years and then was crucified (killed on a cross) - 3 days later, he rose from the dead. (his birth was used for a basis of the date system, so year 0 was around about when he was born) After these events is when Christianity was formed. A large amount of these first Christians were Jews (Israel). They had many rules and regulations for how one was supposed to live - but they were focusing on following rules and doing good works to get into heaven, rather than redemption from God - and while Jesus was alive, He 'called them out' on it, said that they were 'doing it wrong' and they needed to change. Before - and after - Jesus explained to his followers (the disciples) that the only way to get to heaven is through grace - in laymans terms, not by doing anything, but God accepting you, despite you not deserving being saved (see verse below)\n > For it is by grace you have been saved, through faith--and this not from yourselves, it is the gift of God - Ephesians 2:8\n\nso i've deviated here, and my explanation is average, but if you do want to know more, you're welcome to ask me (or i can find someone more knowledgeable and better at explaining)\n\n**TL:DR** there are multiple places in the bible that condemn homosexuality (see the two above as well as Leviticus 18:22). \nAs for Christian's views of homosexuality, there are a few:\n\n~Some say it is ok.\n\n~some are unsure but will accept homosexuals.\n\n~some are unsure but will not accept homosexuals.\n\n~some are opposed, but will not ignore/harass homosexuals.\n\n~and some (the most conservative) are opposed, and are very critical of gay people.\n\nand with all the publicity they have been getting lately, i would say that Westboro is a cult more than a baptist church (just throwing it out there)\n\n\n",
"The interesting part is, as far as I know, there is absolutely no reference in the bible, even once, about women having relations/relationships with other women. It only targets males. Even more reason its stupid and should have no bearing on today's society.",
"Another quote I haven't seen mentioned is from the book of Romans (which is a letter written by a guy named Paul to the Christians living in Rome). This was after Jesus.\n\nNear the beginning of the letter, he states that since the creation of the world, God's existence, power, and nature have been evident in his creation. But people chose to ignore the evidence and ignore God. In light of that, he goes on to say:\n\nSo God abandoned them to do whatever shameful things their hearts desired. As a result, they did vile and degrading things with each other’s bodies. They traded the truth about God for a lie. So they worshiped and served the things God created instead of the Creator himself, who is worthy of eternal praise! Amen. That is why God abandoned them to their shameful desires. **Even the women turned against the natural way to have sex and instead indulged in sex with each other. And the men, instead of having normal sexual relations with women, burned with lust for each other. Men did shameful things with other men, and as a result of this sin, they suffered within themselves the penalty they deserved.**\n\nSince they thought it foolish to acknowledge God, he abandoned them to their foolish thinking and let them do things that should never be done. Their lives became full of every kind of wickedness, sin, greed, hate, envy, murder, quarreling, deception, malicious behavior, and gossip. They are backstabbers, haters of God, insolent, proud, and boastful. They invent new ways of sinning, and they disobey their parents. They refuse to understand, break their promises, are heartless, and have no mercy. They know God’s justice requires that those who do these things deserve to die, yet they do them anyway. Worse yet, they encourage others to do them, too.\n\n**You may think you can condemn such people, but you are just as bad, and you have no excuse! When you say they are wicked and should be punished, you are condemning yourself, for you who judge others do these very same things.** And we know that God, in his justice, will punish anyone who does such things. Since you judge others for doing these things, why do you think you can avoid God’s judgment when you do the same things? Don’t you see how wonderfully kind, tolerant, and patient God is with you? Does this mean nothing to you? Can’t you see that his kindness is intended to turn you from your sin?\n\n---\n\ntl;dr, The Bible does say homosexuality is a sin. But in the same breath, it also says hate, gossip, and pride are wrong, and it specifically instructs Christians not to condemn other people for their sin."
]
} | []
| []
| [
[],
[],
[],
[]
]
|
||
afzqqn | how do you get four first degree murder charges from one death? | Sad story if the allegations are true, but the charges confuse me.
_URL_0_
TLDR: A 19 year old man allegedly killed his gf’s 4 year old daughter for spilling juice on his Xbox. He has been charged with four counts of first degree murder. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/afzqqn/eli5_how_do_you_get_four_first_degree_murder/ | {
"a_id": [
"ee3uref"
],
"score": [
2
],
"text": [
"This is a case of 'throwing everything at the wall and seeing what sticks'.\n\nOr to put this another way - if you really piss the government or wrong person off they can really fuck up your life.\n\nNormally if you punch your girlfriend that's one count of domestic violence. But if the prosecutor really hates you that can be 5-10 different charges. Just to list a few - threatening (when you make that loud sound as you prepare to hit), first degree assault (when the fist connects), causing bodily injury (the bruise), failure to stop and render medical aid (not calling the ambulance for your girlfriend), endangerment of a child (if there's a kid asleep anywhere in the house), failure to report a crime against a child (for not calling the cops on yourself after you endangered a sleeping child 3 rooms away). I'm sure an actual prosecutor could think up a few dozen more. Some of these are dependant on state.\n\nIn IL you can be charged for murder for any felony that results in a death - so one murder for the murder, one murder for beating her, one murder for having a gun in the house, one murder for the drugs. She could probably have found a dozen more felonies to charge him with murder for if she really wanted to.\n\nNormally acts committed at the same time the sentences are served at the same time - but if the judge doesn't like you he may order them sequentially served with any or no justification.\n\nMurder means, literally, whatever the government says it means. In AZ it can mean \"walked into the wrong house with my friend and the homeowner shot him to death while I laid facedown on the ground with my hands on my head\".\n\nYou're making the mistake of assuming words mean what they normally mean. To the government they can mean literally anything they decide. That's how sexual assault can be a wholesome, enjoyable experience for all involved."
]
} | []
| [
"https://www.ctvnews.ca/mobile/world/man-accused-in-death-of-girl-4-who-spilled-juice-on-xbox-1.4251640"
]
| [
[]
]
|
|
a6w7zv | why do foreign names get spelled and pronounced differently in english? | I️ always see English translations of Chinese words or names and they utilize letters that can in no way phonetically produce the sound of the word. A close example would be “Zhou.” So what’s the purpose of spelling a word that does not translate correctly letter for letter but also does not phonetically have the correct meaning? Why not spell Xiang as Chiang?
This occurs in other language translations to English to it’s just prominent in Chinese. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/a6w7zv/eli5_why_do_foreign_names_get_spelled_and/ | {
"a_id": [
"ebyhukf",
"ebylyyu",
"ebysmvz",
"ebyta2k"
],
"score": [
8,
4,
2,
2
],
"text": [
"Because they have different origin languages. English is Germanic in origin, converts semi-ok to Romanic languages but not really. Nordic languages have different letter sets, and the Chinese has different inflections on syllables, makes its tough",
" > I️ always see English translations of Chinese words or names and they utilize letters that can in no way phonetically produce the sound of the word.\n\nThose aren't translations, but *transliterations*. It really only shows up most significantly in Chinese.\n\nThe short version is that there are a lot of sounds in Chinese that just don't have analogues in English or with the Latin alphabet. Worse, Chinese doesn't have a phonetic alphabet. We've gone through successive styles for representing Chinese in Latin characters. The current version (Hanyu Pinyin) is just the latest, and was developed by the Chinese government, and adopted in the US as part of Nixon's push to open up China to the rest of the world.\n\nFor example, if you were referring to that most infamous of Warlords (and of the Kingdom of Wei) from the Three Kingdoms period of Chinese history, if you were using the old Wade-Giles system you'd spell it as Ts'ao Ts'ao, which is relatively close to the actual pronunciation. Under the current system, it's Cao Cao.",
" > Why not spell Xiang as Chiang?\n\nBecause \"x\" and \"ch\" are used to represent two different Chinese sounds, neither of which appears in English (just as the English \"ch\" sound doesn't appear in Chinese). \"Xiang\" and \"Chiang\" would be pronounced completely differently. The sound represented by \"ch\" is closer to an English \"ch\" than anything else in Mandarin Chinese, so it gets represented as \"ch\". Similarly, Mandarin doesn't have the English \"sh\" sound, so the closest thing they have gets represented as \"sh\". The sound represented by \"x\" does also sound kind of like an English \"sh\", but that's already taken by a different sound so they had to pick something else. \"x\" in particular was chosen because the sound is similar to a Portuguese \"x\" sound.",
" > I️ always see English translations of Chinese words or names and they utilize letters that can in no way phonetically produce the sound of the word\n\nActually, they very much do. *To native-speakers of European languages.*\n\nThe English-language is a composite of a group of languages, specifically the *Indo-European languages*- the core of which is Latin, French and North Germanic.\n\nEuropean-language speakers use the Pinyin system instead of Chinese characters to indicate phonetic sounds of Chinese words.\n\nPinyin is the standard system invented by Zhou Youguang to *romanize* the Chinese characters into phonetic sounds *with the tonal marks* (as you would see in Polish or French) so that they are comprehensible to Indo-European languages, not just for native-English speakers, but for all European languages.\n\nChinese is a *tonal* language with four diacritic-tones *(zhōu; zhòu; zhǒu; zhóu)- the infliction-sound of a Chinese word that goes up and down in four different tones.\n\nBecause other cultures outside the Sino-Tibetian group *(Chinese, Burmese, etc)* do not use a logogram-writing system, it is very difficult for European-speakers to interpret phonetic sounds from Chinese characters *(aka Hanzi)*. \n\nSpelling \"Xiang\" as *Chiang* would not be correct within the Pinyin system. \"Xi\" *(sh-urh)* has a completely different meaning to \"Chi\" *(ch-ee)* when spoken.\n\n'Chiang' in pinyin means it should sound like *\"gee-yang\"*. \n\nIt's a completely different sound to Xiāng *(\"shee-yang\")* In fact, the *\"gee-yang\"* sound should be written in Pinyin as *Jiang.*\n\nIn learning Chinese, it is always useful to visualise both the Chinese character along with the Pinyin-tone word. This is what makes learning Chinese so very difficult and laborious.\n\n\n"
]
} | []
| []
| [
[],
[],
[],
[]
]
|
|
3bvb0b | What is the actual rarity of male calico cats? | askscience | http://www.reddit.com/r/askscience/comments/3bvb0b/what_is_the_actual_rarity_of_male_calico_cats/ | {
"a_id": [
"cspv1u3"
],
"score": [
5
],
"text": [
"It's a surprisingly complicated question as there's more than one way to get a calico/tortie male cat, including mutant coat patterns that look like calico but aren't produced by the same genes that produce a calico pattern in females. As such, there's no simple answer for \"how rare\".\n\nMore in-depth information can be found here: \n_URL_0_"
]
} | []
| []
| [
[
"http://messybeast.com/mosaicism.htm"
]
]
|
||
2e9yc3 | why does starting task manager when my computer is frozen seem to unfreeze it? | I've been remedying my frozen computer this way for as long as I can remember, and with many different computers. Does it have something to do with the priority the computer places on starting up the task manager?
Thanks! | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2e9yc3/eli5_why_does_starting_task_manager_when_my/ | {
"a_id": [
"cjxfpkd",
"cjxgc72",
"cjxii0x",
"cjxlnl0"
],
"score": [
14,
3,
6,
4
],
"text": [
"Task manager has top priority, so if any other program is hogging up the computer in an endless cycle you can force it to shut down.",
"Well, I can't say the same for my computer...\n_URL_0_",
"Context: Task Manager is a program like any other program and as such is subject to the same resource limitations as any other program. However, because of the nature of the program (I.E. reading other processes and being able to send a terminate signal to said processes) Task Manager runs in what's called an \"elevated user space.\" An elevated user space is a special way of running a program (it much like running a program as administrator, but it is different in a few ways) that allows special privileges. \n\nExplanation: there are two things that go into Task Manager being able to run when the computer appears \"frozen.\" One: different user spaces have different process priority queues in the NT architecture. Task Manager is most likely one of the few programs in its queue, so it gets more processing time in its individual queue than the program that's one of many programs in the normal user space. Two: applications that aren't part of the system invoke parts of the kernel via an API layer, but Task Manager is part of the system. What this means is that Task Manager has direct access to system resources that eliminates the need for extra processing time and delays from making these API calls.\n\nAddendum: running Task Manager will not \"unfreeze\" a computer. It only seems to because it is allotted more processing time (see above.) If a computer is truly locked up Task Manager will **not** start (ctrl+alt+del will probably not do anything either.) ",
"I like to think that my computer knows shit is about to go down, so it stops playing games with me and gets back to work"
]
} | []
| []
| [
[],
[
"http://i.imgur.com/kBd2Pya.png"
],
[],
[]
]
|
|
5n6daw | what's the deal with yellowstone? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5n6daw/eli5whats_the_deal_with_yellowstone/ | {
"a_id": [
"dc8zcan",
"dc8zxno",
"dc905op"
],
"score": [
2,
2,
5
],
"text": [
"Yellowstone National Park sits over what is known as the Yellowstone Caldera. This is the mouth of what's called a supervolcano. There are many predictions online on what would happen if the supervolcano erupted. [Here is one](_URL_0_).\n\nThe worst part, other than the immediate effects is such an eruption would severely hurt growing seasons for most of the farmland in the U.S.",
"Yellowstone is a supervolcano. If it erupted it would cover most of North America in ash, something that is very lethal as volcanic ash is shards of glass. Anything it touches including water and food is contaminated and breathing it in deadly. It would also put enough ash into the air to put the world into a volcanic winter, potentially even starting a new Ice Age if the eruption is big enough. ",
"Yellowstone sits over a massive hotspot and is a supervolcano.\n\nWhile it would be very bad if it erupted, the danger is rather hilariously overblown by Hollywood. Granted, Wyoming and parts of Idaho and Montana would be gone, and the states immediately east and southeast of Wyoming (so, Colorado, the Dakotas, Nebraska, Iowa, Minnesota, and Kansas) would have a lot of ashfall and a slight but still significant global temperature shift for a few years (honestly, less than 5 years), that would be it. Anything West of the Rockies, or East of the Appalachians, would be basically unscathed other than a very light dusting of ash.\n\nIt would be less of a \"everyone on Earth is going to die\" and more of a \"North America is going to kind of suck for the next decade\" kind of thing."
]
} | []
| []
| [
[
"https://io9.gizmodo.com/what-will-really-happen-when-yellowstone-volcano-has-a-508274690"
],
[],
[]
]
|
|
1ua3k7 | why do people get diarrhea when they are dehydrated? | Why do you get diarrhea when you are dehydrated instead of constipation? Doesn't it lead to further dehydration? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ua3k7/eli5_why_do_people_get_diarrhea_when_they_are/ | {
"a_id": [
"cefz5qv",
"ceg0ctp"
],
"score": [
2,
3
],
"text": [
"It does, and it's responsible for quite a lot of deaths annually in less developed areas.\n\nThe mechanics of diarrhea are not your body having too much liquid, but rather the balance of things dissolved on one side of your colon versus the other being off. This can happen even when you're dehydrated - in fact, if you're losing lots of electrolytes but bringing in some water, it may even get worse.",
"For the most part it's the other way around. People get dehydrated because they have diarrhea due to sickness, etc. When you have diarrhea you aren't absorbing the water from your digestive tract, which causes the dehydration."
]
} | []
| []
| [
[],
[]
]
|
|
m5cum | What is the best scientific paper you have read? | I have to teach a course on scientific literature next spring, and I'm looking for exemplary scientific papers. I'm not primarily interested in papers that are important because of their content, but ones that are well written, concise, cleverly conceived, or for whatever reason a pleasure to read (which is a unfortunately a rare quality, as far as I can tell).
If you can think of such a paper, please provide a link/reference and - if possible - a reason for why that paper is great.
(I'll be teaching biology undergrads, but to make this more interesting, submissions from all fields are welcome.)
Thanks, scientists of reddit!
**Edit:** Thanks (again) to everyone who contributed or is still contributing! This is turning into a treasure trove. I may end up reading recommended papers in my free time, instead of keeping tabs on /r/all. (Oh no, what have I become?!)
| askscience | http://www.reddit.com/r/askscience/comments/m5cum/what_is_the_best_scientific_paper_you_have_read/ | {
"a_id": [
"c2y85t6",
"c2y85xx",
"c2y87cf",
"c2y87ga",
"c2y8ahr",
"c2y8b26",
"c2y8dlh",
"c2y8f77",
"c2y8ihs",
"c2y8ldi",
"c2y8onp",
"c2y8r5j",
"c2y8t7q",
"c2y8vms",
"c2y8wbt",
"c2y8zdt",
"c2y8zwb",
"c2y92kw",
"c2y9304",
"c2y935a",
"c2y95xc",
"c2y97l8",
"c2y97yt",
"c2y98l2",
"c2y98yi",
"c2y9a4h",
"c2y9d9h",
"c2y9due",
"c2y9f47",
"c2y9fxf",
"c2y9jg6",
"c2y9lea",
"c2y9o8l",
"c2y9q4j",
"c2y9s3x",
"c2y9t7l",
"c2y9vlo",
"c2y9vmj",
"c2y9wpx",
"c2y9y00",
"c2y9ypj",
"c2y9zkw",
"c2ya37y",
"c2ya51g",
"c2ya7d3",
"c2ya8vg",
"c2yaapv",
"c2yadcr",
"c2yads9",
"c2yag6e",
"c2yagiw",
"c2yahn5",
"c2yaiyu",
"c2yaka7",
"c2yanwp",
"c2yaojw",
"c2yapjj",
"c2yapl8",
"c2yatiu",
"c2yavas",
"c2yavmx",
"c2yaybj",
"c2yb05w",
"c2yb65a",
"c2ybepl",
"c2ybfns",
"c2ybh9j",
"c2ybivh",
"c2ybjg3",
"c2ybn5d",
"c2ybq1g",
"c2ybsd9",
"c2yc233",
"c2yc6t5",
"c2ycv18",
"c2ycxjp",
"c2yd1ch",
"c2yd8uk",
"c2ydwwr",
"c2ye3da",
"c2ye5zs",
"c2ye682",
"c2ye8i4",
"c2yeejz",
"c2yeeok",
"c2yehzv",
"c2yenqq",
"c2yeoc1",
"c2yepub",
"c2yexzk",
"c2yeyc5",
"c2yeyfb",
"c2yeyh3",
"c2yf364",
"c2yf3ae",
"c2yfghg",
"c2yfpsm",
"c2ygp9t",
"c2yh1q0",
"c2yh8m7",
"c2yhagr",
"c2ypuc8",
"c3i4xgg",
"c2y85t6",
"c2y85xx",
"c2y87cf",
"c2y87ga",
"c2y8ahr",
"c2y8b26",
"c2y8dlh",
"c2y8f77",
"c2y8ihs",
"c2y8ldi",
"c2y8onp",
"c2y8r5j",
"c2y8t7q",
"c2y8vms",
"c2y8wbt",
"c2y8zdt",
"c2y8zwb",
"c2y92kw",
"c2y9304",
"c2y935a",
"c2y95xc",
"c2y97l8",
"c2y97yt",
"c2y98l2",
"c2y98yi",
"c2y9a4h",
"c2y9d9h",
"c2y9due",
"c2y9f47",
"c2y9fxf",
"c2y9jg6",
"c2y9lea",
"c2y9o8l",
"c2y9q4j",
"c2y9s3x",
"c2y9t7l",
"c2y9vlo",
"c2y9vmj",
"c2y9wpx",
"c2y9y00",
"c2y9ypj",
"c2y9zkw",
"c2ya37y",
"c2ya51g",
"c2ya7d3",
"c2ya8vg",
"c2yaapv",
"c2yadcr",
"c2yads9",
"c2yag6e",
"c2yagiw",
"c2yahn5",
"c2yaiyu",
"c2yaka7",
"c2yanwp",
"c2yaojw",
"c2yapjj",
"c2yapl8",
"c2yatiu",
"c2yavas",
"c2yavmx",
"c2yaybj",
"c2yb05w",
"c2yb65a",
"c2ybepl",
"c2ybfns",
"c2ybh9j",
"c2ybivh",
"c2ybjg3",
"c2ybn5d",
"c2ybq1g",
"c2ybsd9",
"c2yc233",
"c2yc6t5",
"c2ycv18",
"c2ycxjp",
"c2yd1ch",
"c2yd8uk",
"c2ydwwr",
"c2ye3da",
"c2ye5zs",
"c2ye682",
"c2ye8i4",
"c2yeejz",
"c2yeeok",
"c2yehzv",
"c2yenqq",
"c2yeoc1",
"c2yepub",
"c2yexzk",
"c2yeyc5",
"c2yeyfb",
"c2yeyh3",
"c2yf364",
"c2yf3ae",
"c2yfghg",
"c2yfpsm",
"c2ygp9t",
"c2yh1q0",
"c2yh8m7",
"c2yhagr",
"c2ypuc8"
],
"score": [
173,
88,
140,
3,
34,
13,
153,
25,
25,
4,
49,
97,
3,
15,
32,
10,
50,
7,
2,
2,
4,
14,
6,
527,
3,
5,
9,
74,
111,
3,
16,
86,
11,
12,
2,
3,
4,
2,
22,
5,
2,
3,
2,
11,
2,
3,
2,
5,
4,
2,
3,
2,
3,
2,
2,
2,
3,
5,
3,
3,
2,
2,
2,
2,
5,
2,
2,
2,
2,
4,
2,
2,
2,
6,
2,
2,
2,
3,
2,
2,
2,
2,
2,
2,
2,
2,
2,
2,
3,
2,
3,
2,
2,
2,
12,
2,
3,
2,
2,
2,
2,
6,
2,
173,
88,
140,
3,
34,
13,
153,
25,
25,
4,
49,
97,
3,
15,
32,
10,
50,
7,
2,
2,
4,
14,
6,
527,
3,
5,
9,
74,
111,
3,
16,
86,
11,
12,
2,
3,
4,
2,
22,
5,
2,
3,
2,
11,
2,
3,
2,
5,
4,
2,
3,
2,
3,
2,
2,
2,
3,
5,
3,
3,
2,
2,
2,
2,
5,
2,
2,
2,
2,
4,
2,
2,
2,
6,
2,
2,
2,
3,
2,
2,
2,
2,
2,
2,
2,
2,
2,
2,
3,
2,
3,
2,
2,
2,
12,
2,
3,
2,
2,
2,
2,
6
],
"text": [
"Francis Crick - Molecular Structure of Nucleic acids(DNA)\n_URL_0_\nGreat paper, and very short!",
"I would have to go with [The Hallmarks of Cancer](_URL_0_). (pdf [here](_URL_1_)).\n\nIf you have ever wanted to know how cancer works, this is the paper for you. The authors go step by step through 6 molecular characteristics that almost all cancers share, including what they are, how they arise, and what they do/how they lead to cancer.",
"[Why Most Published Research Findings Are False](_URL_0_) by John P. A. Ioannidis.\nInformative *and* open-source.\n",
"As a starting point, my favorite papers to read are physiology papers from the early 1900s. More specifically, papers regarding muscle physiology.\n\nThese papers are great for a few reasons:\n\n1) The underlying concepts are easy to explain\n\n2) The concepts are easy to visualize\n\n3) They are historically valuable. The concepts introduced in many of the popular papers are the same concepts your undergrad students will learn once they start taking physiology or general biology courses.\n\n4) Some of the experiments were quite simple and crazy sounding, but they worked. It's a good way to illustrate how far science has come.\n",
"I'm utterly biased but short, to the point and revolutionary: [Woese's 1977 paper outlining the discovery of the archaea](_URL_1_) (not formally classified as a separate domain of life until [this paper](_URL_0_)) \n\nApart from that I also love whole exchange around the development of understanding into vesicle trafficking and in particular Jim Rothman's papers (brilliant experiments, great results, somewhat incorrect conclusions) but probably requires to get into field a bit too much to be of use for this exercise. \n\nI also love almost anything by [Sean Nee](_URL_5_) because he does good science, reports it concisely and clearly and is entirely irreverent (for an amusing, single page, incredibly accessible essay by him (not a paper) check out [the Great Chain of Being](_URL_6_).\n\nFinally, for a wonderful example of scientific squabbling and missing each other's points there is [Trewavas' Green Plants as Intelligent Organisms](_URL_4_), to which there was [this 33 prominent author backlash](_URL_2_) followed by Trewavas' [reply](_URL_3_).\n\n",
"The best example of conciseness that comes to my mind is [Detection of Antiferromagnetism by Neutron Diffraction](_URL_0_), by C.G. Shull and J.S. Smart (Physical Review, 1949).\n\n1 measurement, 2 pages, 1 Nobel prize (physics, 1994).",
"[Einstein's 1905 paper describing special relativity](_URL_0_) is a remarkably easy read; efficient and graceful.",
"* [The Dieter's Paradox](_URL_0_) — because people estimate that more food means less calories. Fascinating!\n\n* Not a paper, but really insightful into a particular set of researchers: [Talking Nets: An Oral History of Neural Networks](_URL_4_).\n\n* [\"How reliable are the results from functional magnetic resonance imaging?\"](_URL_1_) - but I prefer [this version much more!](_URL_3_). — it shows how *not* to do things in fMRI - with fish!\n\n* And [Haxby's](_URL_2_) classic 2001 paper — one of the *coolest* papers to show that there are specific parts of the brain that respond in specific ways to specific types of stimuli.",
"Kahneman & Tversky's prospect theory is great. Here is an easy to read (hard to accept) [review paper](_URL_0_). They won the nobel prize in economics. ",
"Maybe \"old\" (2009) news now, but I found George Church's [MAGE paper](_URL_0_) a fascinating read when it came out.",
"[Computing Machinery and Intelligence](_URL_0_) by Alan Turing. An easy and enjoyable read even for laymen.",
"[Hodgkin and Huxley's classic 1952 papers describing the action potential.](_URL_0_)\n\nTo think that, completely ignorant of the membrane proteins involved, they were able to develop a quantitative model that *accurately corresponds to ion channel subunits discovered decades later* is just fucking beautiful.",
"[The Best of Nature](_URL_0_) is a great place to look. Surely journal article standards have changed, but there's something missing in contemporary articles.",
"I always like [George Miller's *The Magical Number Seven (Plus or Minus Two)*.](_URL_0_)",
"More is Different - By Nobel prize winner Phil Anderson.\n\nMany advisors make their prospective students read this paper before they are willing to take them on as RA's. I still read this paper about once a year. It helps me stay inspired as a scientist. \n\n_URL_0_",
"Personally I really like [Strong Inference by Platt from 1964](_URL_0_). (PDF download warning) It not only concisely and effectively outlines the reasons why we bother with the scientific method as opposed to observational research but also basically issued a massive 'fuck you' to every field outside of molecular biology and physics. It has some really great lines in it and it's criticisms are easy to follow and still relevant to all fields of science today.",
"This is my favorite study: [Effects of remote, retroactive intercessory prayer on outcomes in patients with bloodstream infection: randomised controlled trial.](_URL_0_)\n\nThe most brilliant piece of understated satire I've ever read in a scientific journal.",
"Robert Sapolsky's \"Social Status in Health in Humans and Other Animals\" - concise, clear, AND interesting\n\n_URL_0_",
"Political Science, but [Bowling Alone](_URL_0_) is masterful and would spark a great discussion about, eg, whether the internet helps or hinders social capital formation. If you want to do that with a bio class.",
"The market for lemons by akerloff. It makes economics really interesting and had vast implications for the field.",
"Not the best I've ever read, but I had it in my hand and it's interesting and it's short.\n\n[Loftus (2004) *Memories of Things Unseen*](_URL_0_)\n",
"[Platt, \"Strong Inference,\"](_URL_0_). It's about doing science. If you're ever going to go into research, it's a really good one to read.\n\nI linked to an html version, but a pdf is readily available.\n\nAlso, [Why Snakes Have Forked Tongues](_URL_1_) just because it's something we've all wondered, and it was a good paper.",
"Gould and Lewontin's [Spandrel Paper](_URL_0_) is generally considered to be one of the more important ones, whether or not you agree with it. It was presented to me as something I should be able to say I had read, by a professor who had taken to calling the authors \"The Harvard Commies\".",
"A message from the moderators:\n\nPlease do not post a top-level reply to this thread unless you are contributing a paper from the peer-reviewed literature. If possible, please link to a PDF of the article that can be downloaded by everyone, not just those with journal subscriptions.\n\nAlso, arXiv is not a peer reviewed source.",
"One of my favorites: \n\n[Inhibition of Cell Division in Escherichia Coli by Electrolysis Products from a Platinum Electrode](_URL_0_).\n\nThis is especially awesome since they started out with an incorrect hypothesis and still found an effect. Through careful controls they determined the true nature of the novel and serendipitous discovery which became one of the first effective cancer treatments. Its concise and well written as well.\n\nAnother more sobering choice might be:\n\nWinstein, S. Bycycloheptadiene Dibromides. Journal of the American Chemical Society 83, 1516-1517 (1961).\n\nWhat makes this article interesting is the warning at the end, a reminder that lab safety should be paramount even when working with presumably benign substances.\n\n > There is no a priori reason to believe that these \nparticular compounds are more dangerous to man \nthan several related substances widely used as \nindustrial chemicals; however, of the three labora- \ntory workers who have used the dibromides and \nbromohydrin, two later developed similar \npulmonary disorders which contributed to their \nsubsequent deaths. The third has exhibited \nminor skin sensitivity reactions. \n > Although we are aware of no prior toxicological \nhistory of these compounds, one cannot ignore \nthe possibility of an insidious long-term effect \nunknown to medicine. Until further information \nis obtained from toxicological testing, we recom- \nmend that the compounds be handled only with \nextreme caution, and that all persons concerned \nwith their use be informed of their possible danger- \nous propensities. \n\n > We would appreciate any toxicological informa- \ntion on the above-mentioned or related compounds. \n\n",
"[Fire and Mello RNAi paper](_URL_0_) Not only is the paper a pleasure to read its importance can't be understated. They were awarded the Nobel Prize 8 years later and this paper has been cited approximately 2x per day since publication. ",
"My favorite is the one describing the famous Miller experiment:\n^ Miller, Stanley L. (May 1953). \"Production of Amino Acids Under Possible Primitive Earth Conditions\" (PDF). Science 117 (3046): 528. doi:10.1126/science.117.3046.528. PMID 13056598.\n\nWhy? This was a deceptively simple experiment, using simple concepts and reagents and very basic (primitive?) analysis techniques (thin layer chromatography) which produced a groundbreaking result: key insights into how life began. ",
"[The tragedy of the commons](_URL_0_)\n\nIt's an interesting paper whose importance grows by the second.",
"I remember reading a chemistry journal in iambic pentameter... I have to go find it.\n\nEDIT: Found it! _URL_0_ Bunnett, J. Kearley Jr, F. \"Comparative mobility of halogens in reactions of dihalobenzenes with potassium amide in ammonia\" J. Org. Chem. **1971.** *36.* pp.184-6 This is awesome, particularly footnote 2.",
"This may be too obvious, but I've always enjoyed [The Spandrels of San Marco and the Panglossian Paradigm: A Critique of the Adaptationist Programme](_URL_0_) by Stephen J. Gould and Richard C. Lewontin. Made me think a lot about how we can view evolution.\n",
"Kurt Adelberger (astronomer) is the best writer of scientific papers I've come across. Ha manages to put popular-science-style exciting prose into professional research papers. An example here:\n\n_URL_0_\n\nThe first paragraph:\n\n > As the photons from the microwave background stream towards earth they are gradually joined by other photons, first by those produced in the occasional recombinations of the intergalactic medium, later by those cast off from cooling H2 molecules, later still, after hundreds of millions of years, by increasing numbers from quasars and galaxies, by bremsstrahlung from the hot gas in galaxy groups and clusters, and finally, shortly before impact, by photons emitted by the Milky Way’s own gas and stars and dust. All reach the earth together. They provide a record of the history of the universe throughout its evolution, but it is a confused record. Two photons that simultaneously pierce the same pixel of a detector may have been emitted billions of years apart by regions of the universe that were in vastly different stages of evolution. One of the challenges in observational cosmology is to separate the layers of history that we on earth receive superposed.\n\n",
"Claude Shannon's [A Mathematical Theory of Communication](_URL_0_)",
"BMJ ran this fabulous little work of satire a few years ago: _URL_0_.\n\nIt's a literature review of the efficacy of parachutes and ends with a recommendation for randomized control trials or something fantastically short-sighted. The paper is structurally and methodologically solid. And it's a great warning against losing perspective while slavishly devoting oneself to format.",
"It's not quite a paper (though it has been cited 1000 times) as much as the edited transcript of a technical talk, but Purcell's [Life at Low Reynolds Number](_URL_0_) has spectactular breadth and clarity of content. It is mandatory reading if you're interested in physics at the biological scale. It was a tremendous pleasure to read and read again.",
"\"A Mathematical Theory of Communication,\" Claude Shannon.",
"If you're looking for a more modern paper, [Takahashi and Yamanaka paper](_URL_0_) on iPS cells is a good one, especially if you want to teach methods/concepts used in current research. This is a paper that played a pivotal role in the stem cell field. Classic papers are good; methods and concepts are important to understand, can be demonstrated and largely accepted. The Yamanaka paper is a classic paper of a currently, still evolving, and (somewhat politically) controversial field. The series of studies presented in the paper are really tour-de-force experiments. ",
"Hopefully, this doesn't get buried but, [RNAi in C. elegans, work which Fire and Mello recieved a Nobel for in 2006](_URL_0_) \n\nWhile not the best it is still pretty well written. I think it would be a beneficial exercise to have the class, read and critique the content, writing style ect. Of course, you get discussion going and the more critical the class is, the more of a shock you get when you reveal that they won a Nobel for the work. \n\nThis is how this paper was presented to me in a class. It really did a lot in the way of teaching us that papers in high tier journals are not perfect, and moreover that Nobel prize winning work is not perfect. You also get the opportunity to speculate on the implications of their work at that period in time which is fun! \n\nMaybe this outside the realm of your class but maybe not?",
"Roald Hoffman, How Chemistry And Physics Meet In The Solid State. He emphasizes the intuitive nature of chemistry and explains solid state physics through qualitative arguments ... Really nice.",
"[How to Write a Scientific Paper](_URL_0_) by Whitesides. It's a paper on how to write a paper. It's awesome.",
"[Nothing in Biology Makes Sense Except in the Light of Evolution](_URL_0_) seems perfect for your class.",
"[The price of beer and Salary of priests](_URL_0_). Seriously, its a nice talk about statistics",
"I really like Rodney Brooks' 1999 paper [Intelligence Without Representation](_URL_0_), one of the few papers I remember from when I was studying artificial intelligence. The paper argues against a dominant trend in AI at the time and for a radically different approach. His central rhetorical device --- comparing artificial intelligence to the study of artificial flight --- is an idea that has stuck with me ever since I read it.",
"I found [this paper](_URL_0_) to be really interesting because it lays down mathematics to situations with which we have an intuitive understanding of. It discusses swarm theory mathematically, particularly how a few knowledgeable individuals in the swarm can direct the entire swarm. The exact example is in terms of a school of fish in which a few fish know where food is.",
"Mendel's paper on inheritance. Foundation for modern genetics.\n\n_URL_0_",
"Doll, R. and A.B. Hill. 1950. [Smoking and Carcinoma of the Lung](_URL_0_). British Medical Journal 30:739–748. \n\nThis was perhaps the first major use of the case-control method in epidemiology, a methodological approach which allowed the investigation of many long-term public health threats. It also linked smoking and lung cancer, which saved certainly thousands if not millions of lives. It is also relatively simple to read.",
"Seymour Benzer's \"Fine structure of a genetic region in bacteriophage\" is da shiznit and a classic. \n\n_URL_0_\n\n",
"Have you looked at the papers on [Faculty of 1000](_URL_0_)? I have found a lot of great papers on that website. ",
"The solution to one of the most famous mathematics problems of all time:\n\n_URL_0_\n\nFermat's Last Theorem.",
"Tversky and Kahneman's [Judgment Under Uncertainty: Heuristics and Biases](_URL_0_).\n\nThe work is all about the way people make decisions in life based on an incomplete understanding of probability. Totally changed my life when I read it the first time.",
"My favorite scientific poster:\n[Neural correlates of interspecies perspective taking in the post-mortem Atlantic Salmon](_URL_0_)",
"Hands down: [Who says you cannot get published?](_URL_0_) References papers like: \"Will humans swim faster or slower in syrup?\" \"How chewing gum flavor affects measures of global complexity of multichannel EEG.\" And my personal favorite, \"An analysis of the forces required to drag sheep over various surfaces.\"",
"\"Energy Gap in Superconductors Measured by Electron Tunneling\", by Ivar Giaever [Phys. Rev. Lett. 5, 147–148 (1960)](_URL_0_)\n\nA straightforward experiment showing a phenomenal result: the existence of an energy gap in superconductors",
"[Recursive Functions of Symbolic Expressions and Their Computation by Machine](_URL_1_) by John McCarthy, and Paul Graham's [article](_URL_0_) about it, made me understand computer programming as a formally definable endeavor and not just a hack",
"The best three papers we learned about in school were the Framingham studies, the study finding estrogen replacement therapy increases risk for breast cancer, and the study linking folate to the prevention of neural tube defects. The first is one where an entire town has participated in the study generation by generation for decades, and has given really useful data that has shaped how America sees \"health\". The second one is remarkable because unforeseen side effects became so prominent so quickly during the study that they had to cancel it early because continuing it would increase risk of morbidity/mortality unacceptable in the researchers' behalf. The third used and absolutely INGENIOUS method of retrospectively questioning mothers about PNV use and confounding for their guilt in losing their babies.\nThese papers are all great examples of what practice-shaping clinical research is all about. ",
"[E. M. Purcell - Life at Low Reynolds Numbers](_URL_2_) ([Dropbox Public Link](_URL_0_))\nEverything you need to know about Biophysics, even if you don't study biology or physics.\n\n[V. F. Weisskopf - Search for Simplicity](_URL_1_) ([Dropbox Public Link](_URL_1_))\nThe best kind of physics.\n\nBoth of these were suggested by a colleague of mine and have been immensely enjoyable and illuminating. The American Journal of Physics is a great place for these kind of articles.",
"I use this paper with my students to get them over the scientific paper intimidation factor: [Detection of Large Woody Debris Accumulations in Old-Growth Forests](_URL_0_)",
"[The first case of homosexual necrophilia in the\nmallard Anas platyrhynchos](_URL_0_) (pdf warning) is concise and quite the interesting topic.",
"[The importance of stupidity in scientific research](_URL_0_). Pretty self explanatory and a nice handout for a Biology class. ",
"[Arms races between and within species by Dawkins & Krebs](_URL_2_)\n\nThey write in a very clear and eloquent style which makes difficult to grasp concepts easy to understand. Its a greatly influential paper--it has been cited nearly 1000 times in biology and life science journals. One of the best biology papers I have had the pleasure to read.\n\nAlso, a few good books, available free online:\n\n[The selfish gene by Richard Dawkins](_URL_1_)\n\n & \n\n[River out of eden by Richard Dawkins](_URL_0_)",
"[Linus Pauling - The Nature of the Chemical Bond](_URL_0_)\n\nI'm pretty sure it's the most cited paper in all of chemistry, and for good reason. It's a pretty easy read, and the concepts contained within are still very much relevant.",
"On computable numbers (Theory of Computation) - Alan Turing.\n\nBrilliant.\n\n",
"From Anthropology:\n[Deep Play: Notes on the Balinese Cockfight](_URL_0_)\nMakes me chortle every time I read it.\n",
"My favorite is [Feline High-rise Syndrome: 119 cases](_URL_0_). I found it a really neat read with pretty cool statistics about cats and apartment buildings.",
"[Simon's The Architecture of Complexity](_URL_0_)",
"Edmund Gettier: \"Is Justified True Belief Knowledge?\" in Analysis, v. 23. Available at _URL_0_\n3 pages of earth shattering profoundness. Just when philosophers thought they were on the verge of actually solving a problem, along comes Gettier and nips that nonsense in the bud!",
"[Binford's 1962 'Archaeology as Anthropology'](_URL_0_) is one of the landmark articles for archaeology as a discipline. I can name a bunch of other ones that are much more relevant to my specific research interests (Neutron Activation Analysis and Inka Administration in Coastal Peru) but this is the best archaeology article I can give you in terms of being broadly accessible and relavant.",
"It's not exactly a paper, but it is a fairly quick read. *The Structure of Scientific Revolution* by Thomas Kuhn is indispensable, IMHO.",
"[Evidence](_URL_0_) of van der Waals forces in gecko setae.\n\nRarely do you see evidence presented so simply. Hopes for setae dry-adhesive products in the future have sky-rocketed since this paper.",
"[Deterministic Nonperiodic Flow](_URL_0_) by Ed Lorenz, the founder of Chaos theory. A \"deep, prescient, and surprisingly readable paper.\"",
"[The Market For Lemons](_URL_0_), by George Akerlof. Decades of people taking shots at the neoclassical economy building unsuccesfully, and this guy comes along with the simplest example and tears it down easily. He got a Nobel for it, too.\n\n",
"[Mathematical Modelling of an Outbreak of Zombie Infection](_URL_0_). Interesting read on the outbreak and spread of zombification.",
"Not sure if somebody else posted this...and also this is by no means the best scientific paper I've ever read but nevertheless it is very interesting and IIRC Feynman called it the best paper he has ever read.\n[N.D.Mermin's experiment to make quantum behavior obvious to 'anybody'](_URL_0_)\n",
"_URL_0_\n\nThe Unsuccessful Self Treatment of Writer's Block always gets a laugh, and can provide a nice break for your students.",
"This is one of the more jocular articles I've read:\n\n[Effects of Sexual Activity on Beard Growth in Man](_URL_0_)",
"[Geminoid: Teleoperated Android of an Existing Person ](_URL_0_) - For everyone who likes some robotics. ",
"Ronald Coase's \"The Problem of Social Cost\" is widely considered one of the most important social science papers ever written. It deals with the economics topic of \"externalities.\" It has been massively cited in the social science literature and does not require advanced mathematical, legal or economics knowledge to understand (Coase was a lawyer turned economist). \n\nInterestingly, readers of \"The Problem of Social Cost\" seem to reach quite different conclusions about what what the paper means, with widely differing papers citing it in support of their conclusions.\n\nCoase is considered to have earned his Nobel with this paper and his other classic \"The Nature of the Firm\" (about transactions costs). The papers are available on JSTOR and there are pdf copies around on the web (whose legal availability I cannot speak to).",
"Grave Shortcomings, Gargett et al 1989. Great article on the reinterpretation of supposed Neandertal ritual behavior, notably burials. Hence the cool title. In addition to being an interesting and accessible topic, it is a fantastic illustration of things that influence all scientific literature and the value of critical thinking and balancing different hypotheses in general. In this case, some previous conclusions (that neandertals had various examples of ritualistic behavior including burying their dead) were influenced by the social and political environment in which they were written, among other things. Gargett takes another look and some of the most famous examples, and alternately applies various hard sciences and occam's razor to dispute some of the original findings. There are plenty of peer responses, as this was in Current Anthropology. Anyway, I haven't read it for 10+ years, and I don't even recall agreeing with all of it, but it should be helpful to discuss ALL sorts of topics related to scientific literature. Especially for that audience.",
"This may be a good time to mention that the British Royal Society has released their historical archive to the public. It includes:\n\n[Theory about Light and Colours](_URL_0_content/6/69-80/3075.full.pdf+html?sid=0d477dd8-8dec-4ac3-8187-b6df96d4d670) - Isaac Newton\n\n[Philosophical Transactions of the Royal Society](_URL_0_) - First ever peer reviewed journal (1665)\n\n[Electric Kite Experiment](_URL_0_content/47/565.full.pdf+html?sid=491066f9-1f77-4232-a45c-3e859a60867e) - Benjamin Franklin\n\n[Search the archive](_URL_0_).",
"[Right here.](_URL_0_) I used to work as \"Mr. Concrete\" for a Q and A website, and this was one of the most useful articles I ever used in my research. Who knew concrete was so fascinating?",
"To me, nothing compares with the Einstein, Podolsky and Rosen paper on the nature of physical reality and quantum mechanics. It's beautiful for the simplicity of its argument, and it is basically the spawning point for all subsequent work in quantum foundations. It can be found here:\n\n_URL_0_\n\nStaying with Einstein, his book on special relativity is extremely intuitive and understandable to anyone, and is definitely worth a read.",
"\"Consequences of Erudite Vernacular Utilized Irrespective of Necessity: Problems with Using Long Words Needlessly\"\n\n_URL_0_",
"[Primer](_URL_0_) from the book, but I found 'Structures of Scientific Revolutions' by Kuhn to be impressive and insightful for me as I went through college.",
"This may be the best Reddit topic on r/AskScience I've seen in a while! I have [Kaila, Ville. \"Natural Selection for least action\"](_URL_0_) where natural selection is described using physics terms, the law of least action and the 2nd law of thermodynamics. ",
"My favorite is a short article from Nature in 1985 by Harold Kroto that more or less won a Nobel Prize for him, and pissed off a slew of Exxon researchers who realized that they had observed these \"C60\" structures but just didn't know what they had a year before the article was published.... Gene Dresselhous has a great video about it. This was the first mention of the now ubiquitous Buckyball.\n\n_URL_0_",
"[Matrix elasticity can dictate stem cell lineage](_URL_0_)\n\nI find this paper fascinating - mechanotransduction as a field seems to be growing exponentially and showing this profound an effect is really cool. \n\n",
"Here's a good list, with more being added each week:\n_URL_0_\n",
"I used to work in programming language design and the following paper on planning for growth -- for unexpected uses in the wild -- is a delightful and brilliant read:\n\n[Steele, G. R. Jr. (1999). Growing a language. Higher-order and symbolic computation, 12, 221-236.](_URL_0_)\n\nThe paper works really well as a [talk](_URL_1_) because of its unique and surprising rhetorical structure.",
"There are very few biology papers in this thread, and the ones that have the most upvotes are very poor representatives of the scientific method. Observational studies on the structure of DNA had a huge impact, but they barely qualify as science. The other articles on the elucidation of action potentials and the hallmarks of cancer both strike closer to the mark, but they are reviews, and do not provide experimental details. I would think that would be the most important part if I were teaching a biology class (rather than a history of science class).\n\nEdit: Just so I'm not throwing stones, I think Mendel's paper on inheiritance is the best example I can think of. [A nod to umdiddly for posting the link first.](_URL_0_)",
"I really like the following:\n\n[Tonegawa's paper on DNA recombination in immunology](_URL_1_) (Sorry I don't have the PDF available)\n\nBarbara McClintock's paper on transposons (McClintock, B., 1950. The origin and behavior of mutable loci in maize. Proc. Nat. Acad. Sci. 36: 344-355.) This paper is socially interesting as much as scientifically. The amount of evidence she felt she needed to have in order to publish a paper (presumably because she was a woman) is astounding. \n\nThe last suggestion is about [Educational Research: The Hardest Science of All?](_URL_0_) which allows you to discuss the differences in science in different fields. In education we can't control all the factors so we have to approach some things differently. Doesn't mean we're less scientific, we just have to make adjustments to our expectations and results.",
"The Expensive-Tissue Hypothesis by Leslie Aiello. The actual article [here](_URL_1_) needs JSTOR access, but she published a very similar paper in the Brazilian Journal of Genetics [here](_URL_0_).\n\nAmazing read. Best article I've ever read on human evolution.",
"Here's one of my favorite's: [\"How long is the coast of Britain?\"](_URL_0_) by Benoit Mandelbrot. An incredibly clear (and incredibly early) discussion of the importance of fractals published years before fractal was a word!",
"[On the follow of rewarding A while hoping for B](_URL_0_)\n\nA great read on the importance of understanding how rewards work. ",
"Smashing the stack for fun and profit\n_URL_0_\n",
"Hey, friends, I just made a folder of these files for my own purposes, so I t thought I might share it. Here are all of the PDFs and replies for comments above 10 upvotes (at the time of posting). Hope that's okay, mods. \n\n_URL_0_",
"Hey, friends, I just made a folder of these files for my own purposes, so I t thought I might share it. Here are all of the PDFs and replies for comments above 10 upvotes (at the time of posting). Hope that's okay, mods. \n\n_URL_0_",
"What has really helped my scientific writing alot is editing articles in Wikipedia. Perhaps an assignment for your students could be to edit or write (or atleast verify) an article on the site?",
"Not sure, but the worst ones I've read are definitely the ones I've written & #3232;\\_ & #3232;\n",
"Meselson and Stahl's paper on semi-conservative nature of DNA replication. Historically and scientifically this is recognized as the apex of molecular biology research elegance in the 50s.\n_URL_0_\nRequired reading for any molecular biologist.",
"Some German punk wrote [\"On the electrodynamics of moving bodies\"](_URL_0_), but that was a long time ago.\n\nGreat piece though, I think he's on to something.",
"I personally like \"Growth of Graphene from Food, Insects, and Waste\", or how I would have titled it: \"Making the next buzzword in semiconductors out of cookies, cockroach legs, and dog shit.\" < _URL_0_;.\n\nHere's a sample:\n\"Here we demonstrate that much less expensive carbon sources, such as food, insects, and waste, can be used without purification to grow high-quality monolayer graphene directly on the backside of Cu foils under the H2/Ar flow. For food, a Girl Scout cookie and chocolate were investigated. For waste with low or negative monetary value, we used bulk polystyrene plastic, a common solid waste, blades of grass, and dog feces.\"",
"[Parachute use to prevent death and major trauma related\nto gravitational challenge: systematic review of\nrandomised controlled trials](_URL_0_).\n\nI have never read anything quite as ground-breaking in my life. Though more RCT:s are needed.",
"I've put a lot of effort into finding good modern science writing for insiders. Until this thread, my best single source of leads has been the Oxford Book of Modern Science Writing, edited by Dawkins. But its mostly popular writing by insiders. I can't say that I've read a post-1980 scientific paper that has made me think \"This is well-written.\" Something happened after the 50s. \n\n\n\nFrom cognitive science, \n\n* I second George Miller's magic number 7+-2 and Herbert Simon's Architecture of Complexity. \nAdding:\n* Tolman (1948) \"Cognitive Maps in Rats and Men\" _URL_0_\n* Shepard, R., & Metzler, J. (1971). Mental rotation of three-dimensional objects. Science, 171(3972), 701. _URL_1_ \n\n\n\nI also keep a collection of horrible sentences. \n\n* This is from the abstract of a paper on sentence comprehension: \"\"Arguments are made for autonomy of the lexical access process of a model of semantic context effects is offered.\"\" \nSwinney, D. (1979). Lexical access during sentence comprehension: (Re)consideration of context effects. Journal of verbal learning and verbal behavior, 18(6), 645–659.\n* Here is another recent entry into the collection: \n_URL_2_\n* And here is the worst I've seen:\n\"\"A further - quite different - but potentially equally and in the long run probably even more important but also more debated stream of research is the recent combination of neuroscience with experimental and behavioral economics.\"\"\nRiedl, A. (2009). Behavioral and Experimental Economics Can Inform Public Policy: Some Thoughts. CESIFO Working Papers, 1–37.\n\n",
"CTMU - Cognitive Theoretical Model of the Universe. Available online for free, by Robert Langon",
"Francis Crick - Molecular Structure of Nucleic acids(DNA)\n_URL_0_\nGreat paper, and very short!",
"I would have to go with [The Hallmarks of Cancer](_URL_0_). (pdf [here](_URL_1_)).\n\nIf you have ever wanted to know how cancer works, this is the paper for you. The authors go step by step through 6 molecular characteristics that almost all cancers share, including what they are, how they arise, and what they do/how they lead to cancer.",
"[Why Most Published Research Findings Are False](_URL_0_) by John P. A. Ioannidis.\nInformative *and* open-source.\n",
"As a starting point, my favorite papers to read are physiology papers from the early 1900s. More specifically, papers regarding muscle physiology.\n\nThese papers are great for a few reasons:\n\n1) The underlying concepts are easy to explain\n\n2) The concepts are easy to visualize\n\n3) They are historically valuable. The concepts introduced in many of the popular papers are the same concepts your undergrad students will learn once they start taking physiology or general biology courses.\n\n4) Some of the experiments were quite simple and crazy sounding, but they worked. It's a good way to illustrate how far science has come.\n",
"I'm utterly biased but short, to the point and revolutionary: [Woese's 1977 paper outlining the discovery of the archaea](_URL_1_) (not formally classified as a separate domain of life until [this paper](_URL_0_)) \n\nApart from that I also love whole exchange around the development of understanding into vesicle trafficking and in particular Jim Rothman's papers (brilliant experiments, great results, somewhat incorrect conclusions) but probably requires to get into field a bit too much to be of use for this exercise. \n\nI also love almost anything by [Sean Nee](_URL_5_) because he does good science, reports it concisely and clearly and is entirely irreverent (for an amusing, single page, incredibly accessible essay by him (not a paper) check out [the Great Chain of Being](_URL_6_).\n\nFinally, for a wonderful example of scientific squabbling and missing each other's points there is [Trewavas' Green Plants as Intelligent Organisms](_URL_4_), to which there was [this 33 prominent author backlash](_URL_2_) followed by Trewavas' [reply](_URL_3_).\n\n",
"The best example of conciseness that comes to my mind is [Detection of Antiferromagnetism by Neutron Diffraction](_URL_0_), by C.G. Shull and J.S. Smart (Physical Review, 1949).\n\n1 measurement, 2 pages, 1 Nobel prize (physics, 1994).",
"[Einstein's 1905 paper describing special relativity](_URL_0_) is a remarkably easy read; efficient and graceful.",
"* [The Dieter's Paradox](_URL_0_) — because people estimate that more food means less calories. Fascinating!\n\n* Not a paper, but really insightful into a particular set of researchers: [Talking Nets: An Oral History of Neural Networks](_URL_4_).\n\n* [\"How reliable are the results from functional magnetic resonance imaging?\"](_URL_1_) - but I prefer [this version much more!](_URL_3_). — it shows how *not* to do things in fMRI - with fish!\n\n* And [Haxby's](_URL_2_) classic 2001 paper — one of the *coolest* papers to show that there are specific parts of the brain that respond in specific ways to specific types of stimuli.",
"Kahneman & Tversky's prospect theory is great. Here is an easy to read (hard to accept) [review paper](_URL_0_). They won the nobel prize in economics. ",
"Maybe \"old\" (2009) news now, but I found George Church's [MAGE paper](_URL_0_) a fascinating read when it came out.",
"[Computing Machinery and Intelligence](_URL_0_) by Alan Turing. An easy and enjoyable read even for laymen.",
"[Hodgkin and Huxley's classic 1952 papers describing the action potential.](_URL_0_)\n\nTo think that, completely ignorant of the membrane proteins involved, they were able to develop a quantitative model that *accurately corresponds to ion channel subunits discovered decades later* is just fucking beautiful.",
"[The Best of Nature](_URL_0_) is a great place to look. Surely journal article standards have changed, but there's something missing in contemporary articles.",
"I always like [George Miller's *The Magical Number Seven (Plus or Minus Two)*.](_URL_0_)",
"More is Different - By Nobel prize winner Phil Anderson.\n\nMany advisors make their prospective students read this paper before they are willing to take them on as RA's. I still read this paper about once a year. It helps me stay inspired as a scientist. \n\n_URL_0_",
"Personally I really like [Strong Inference by Platt from 1964](_URL_0_). (PDF download warning) It not only concisely and effectively outlines the reasons why we bother with the scientific method as opposed to observational research but also basically issued a massive 'fuck you' to every field outside of molecular biology and physics. It has some really great lines in it and it's criticisms are easy to follow and still relevant to all fields of science today.",
"This is my favorite study: [Effects of remote, retroactive intercessory prayer on outcomes in patients with bloodstream infection: randomised controlled trial.](_URL_0_)\n\nThe most brilliant piece of understated satire I've ever read in a scientific journal.",
"Robert Sapolsky's \"Social Status in Health in Humans and Other Animals\" - concise, clear, AND interesting\n\n_URL_0_",
"Political Science, but [Bowling Alone](_URL_0_) is masterful and would spark a great discussion about, eg, whether the internet helps or hinders social capital formation. If you want to do that with a bio class.",
"The market for lemons by akerloff. It makes economics really interesting and had vast implications for the field.",
"Not the best I've ever read, but I had it in my hand and it's interesting and it's short.\n\n[Loftus (2004) *Memories of Things Unseen*](_URL_0_)\n",
"[Platt, \"Strong Inference,\"](_URL_0_). It's about doing science. If you're ever going to go into research, it's a really good one to read.\n\nI linked to an html version, but a pdf is readily available.\n\nAlso, [Why Snakes Have Forked Tongues](_URL_1_) just because it's something we've all wondered, and it was a good paper.",
"Gould and Lewontin's [Spandrel Paper](_URL_0_) is generally considered to be one of the more important ones, whether or not you agree with it. It was presented to me as something I should be able to say I had read, by a professor who had taken to calling the authors \"The Harvard Commies\".",
"A message from the moderators:\n\nPlease do not post a top-level reply to this thread unless you are contributing a paper from the peer-reviewed literature. If possible, please link to a PDF of the article that can be downloaded by everyone, not just those with journal subscriptions.\n\nAlso, arXiv is not a peer reviewed source.",
"One of my favorites: \n\n[Inhibition of Cell Division in Escherichia Coli by Electrolysis Products from a Platinum Electrode](_URL_0_).\n\nThis is especially awesome since they started out with an incorrect hypothesis and still found an effect. Through careful controls they determined the true nature of the novel and serendipitous discovery which became one of the first effective cancer treatments. Its concise and well written as well.\n\nAnother more sobering choice might be:\n\nWinstein, S. Bycycloheptadiene Dibromides. Journal of the American Chemical Society 83, 1516-1517 (1961).\n\nWhat makes this article interesting is the warning at the end, a reminder that lab safety should be paramount even when working with presumably benign substances.\n\n > There is no a priori reason to believe that these \nparticular compounds are more dangerous to man \nthan several related substances widely used as \nindustrial chemicals; however, of the three labora- \ntory workers who have used the dibromides and \nbromohydrin, two later developed similar \npulmonary disorders which contributed to their \nsubsequent deaths. The third has exhibited \nminor skin sensitivity reactions. \n > Although we are aware of no prior toxicological \nhistory of these compounds, one cannot ignore \nthe possibility of an insidious long-term effect \nunknown to medicine. Until further information \nis obtained from toxicological testing, we recom- \nmend that the compounds be handled only with \nextreme caution, and that all persons concerned \nwith their use be informed of their possible danger- \nous propensities. \n\n > We would appreciate any toxicological informa- \ntion on the above-mentioned or related compounds. \n\n",
"[Fire and Mello RNAi paper](_URL_0_) Not only is the paper a pleasure to read its importance can't be understated. They were awarded the Nobel Prize 8 years later and this paper has been cited approximately 2x per day since publication. ",
"My favorite is the one describing the famous Miller experiment:\n^ Miller, Stanley L. (May 1953). \"Production of Amino Acids Under Possible Primitive Earth Conditions\" (PDF). Science 117 (3046): 528. doi:10.1126/science.117.3046.528. PMID 13056598.\n\nWhy? This was a deceptively simple experiment, using simple concepts and reagents and very basic (primitive?) analysis techniques (thin layer chromatography) which produced a groundbreaking result: key insights into how life began. ",
"[The tragedy of the commons](_URL_0_)\n\nIt's an interesting paper whose importance grows by the second.",
"I remember reading a chemistry journal in iambic pentameter... I have to go find it.\n\nEDIT: Found it! _URL_0_ Bunnett, J. Kearley Jr, F. \"Comparative mobility of halogens in reactions of dihalobenzenes with potassium amide in ammonia\" J. Org. Chem. **1971.** *36.* pp.184-6 This is awesome, particularly footnote 2.",
"This may be too obvious, but I've always enjoyed [The Spandrels of San Marco and the Panglossian Paradigm: A Critique of the Adaptationist Programme](_URL_0_) by Stephen J. Gould and Richard C. Lewontin. Made me think a lot about how we can view evolution.\n",
"Kurt Adelberger (astronomer) is the best writer of scientific papers I've come across. Ha manages to put popular-science-style exciting prose into professional research papers. An example here:\n\n_URL_0_\n\nThe first paragraph:\n\n > As the photons from the microwave background stream towards earth they are gradually joined by other photons, first by those produced in the occasional recombinations of the intergalactic medium, later by those cast off from cooling H2 molecules, later still, after hundreds of millions of years, by increasing numbers from quasars and galaxies, by bremsstrahlung from the hot gas in galaxy groups and clusters, and finally, shortly before impact, by photons emitted by the Milky Way’s own gas and stars and dust. All reach the earth together. They provide a record of the history of the universe throughout its evolution, but it is a confused record. Two photons that simultaneously pierce the same pixel of a detector may have been emitted billions of years apart by regions of the universe that were in vastly different stages of evolution. One of the challenges in observational cosmology is to separate the layers of history that we on earth receive superposed.\n\n",
"Claude Shannon's [A Mathematical Theory of Communication](_URL_0_)",
"BMJ ran this fabulous little work of satire a few years ago: _URL_0_.\n\nIt's a literature review of the efficacy of parachutes and ends with a recommendation for randomized control trials or something fantastically short-sighted. The paper is structurally and methodologically solid. And it's a great warning against losing perspective while slavishly devoting oneself to format.",
"It's not quite a paper (though it has been cited 1000 times) as much as the edited transcript of a technical talk, but Purcell's [Life at Low Reynolds Number](_URL_0_) has spectactular breadth and clarity of content. It is mandatory reading if you're interested in physics at the biological scale. It was a tremendous pleasure to read and read again.",
"\"A Mathematical Theory of Communication,\" Claude Shannon.",
"If you're looking for a more modern paper, [Takahashi and Yamanaka paper](_URL_0_) on iPS cells is a good one, especially if you want to teach methods/concepts used in current research. This is a paper that played a pivotal role in the stem cell field. Classic papers are good; methods and concepts are important to understand, can be demonstrated and largely accepted. The Yamanaka paper is a classic paper of a currently, still evolving, and (somewhat politically) controversial field. The series of studies presented in the paper are really tour-de-force experiments. ",
"Hopefully, this doesn't get buried but, [RNAi in C. elegans, work which Fire and Mello recieved a Nobel for in 2006](_URL_0_) \n\nWhile not the best it is still pretty well written. I think it would be a beneficial exercise to have the class, read and critique the content, writing style ect. Of course, you get discussion going and the more critical the class is, the more of a shock you get when you reveal that they won a Nobel for the work. \n\nThis is how this paper was presented to me in a class. It really did a lot in the way of teaching us that papers in high tier journals are not perfect, and moreover that Nobel prize winning work is not perfect. You also get the opportunity to speculate on the implications of their work at that period in time which is fun! \n\nMaybe this outside the realm of your class but maybe not?",
"Roald Hoffman, How Chemistry And Physics Meet In The Solid State. He emphasizes the intuitive nature of chemistry and explains solid state physics through qualitative arguments ... Really nice.",
"[How to Write a Scientific Paper](_URL_0_) by Whitesides. It's a paper on how to write a paper. It's awesome.",
"[Nothing in Biology Makes Sense Except in the Light of Evolution](_URL_0_) seems perfect for your class.",
"[The price of beer and Salary of priests](_URL_0_). Seriously, its a nice talk about statistics",
"I really like Rodney Brooks' 1999 paper [Intelligence Without Representation](_URL_0_), one of the few papers I remember from when I was studying artificial intelligence. The paper argues against a dominant trend in AI at the time and for a radically different approach. His central rhetorical device --- comparing artificial intelligence to the study of artificial flight --- is an idea that has stuck with me ever since I read it.",
"I found [this paper](_URL_0_) to be really interesting because it lays down mathematics to situations with which we have an intuitive understanding of. It discusses swarm theory mathematically, particularly how a few knowledgeable individuals in the swarm can direct the entire swarm. The exact example is in terms of a school of fish in which a few fish know where food is.",
"Mendel's paper on inheritance. Foundation for modern genetics.\n\n_URL_0_",
"Doll, R. and A.B. Hill. 1950. [Smoking and Carcinoma of the Lung](_URL_0_). British Medical Journal 30:739–748. \n\nThis was perhaps the first major use of the case-control method in epidemiology, a methodological approach which allowed the investigation of many long-term public health threats. It also linked smoking and lung cancer, which saved certainly thousands if not millions of lives. It is also relatively simple to read.",
"Seymour Benzer's \"Fine structure of a genetic region in bacteriophage\" is da shiznit and a classic. \n\n_URL_0_\n\n",
"Have you looked at the papers on [Faculty of 1000](_URL_0_)? I have found a lot of great papers on that website. ",
"The solution to one of the most famous mathematics problems of all time:\n\n_URL_0_\n\nFermat's Last Theorem.",
"Tversky and Kahneman's [Judgment Under Uncertainty: Heuristics and Biases](_URL_0_).\n\nThe work is all about the way people make decisions in life based on an incomplete understanding of probability. Totally changed my life when I read it the first time.",
"My favorite scientific poster:\n[Neural correlates of interspecies perspective taking in the post-mortem Atlantic Salmon](_URL_0_)",
"Hands down: [Who says you cannot get published?](_URL_0_) References papers like: \"Will humans swim faster or slower in syrup?\" \"How chewing gum flavor affects measures of global complexity of multichannel EEG.\" And my personal favorite, \"An analysis of the forces required to drag sheep over various surfaces.\"",
"\"Energy Gap in Superconductors Measured by Electron Tunneling\", by Ivar Giaever [Phys. Rev. Lett. 5, 147–148 (1960)](_URL_0_)\n\nA straightforward experiment showing a phenomenal result: the existence of an energy gap in superconductors",
"[Recursive Functions of Symbolic Expressions and Their Computation by Machine](_URL_1_) by John McCarthy, and Paul Graham's [article](_URL_0_) about it, made me understand computer programming as a formally definable endeavor and not just a hack",
"The best three papers we learned about in school were the Framingham studies, the study finding estrogen replacement therapy increases risk for breast cancer, and the study linking folate to the prevention of neural tube defects. The first is one where an entire town has participated in the study generation by generation for decades, and has given really useful data that has shaped how America sees \"health\". The second one is remarkable because unforeseen side effects became so prominent so quickly during the study that they had to cancel it early because continuing it would increase risk of morbidity/mortality unacceptable in the researchers' behalf. The third used and absolutely INGENIOUS method of retrospectively questioning mothers about PNV use and confounding for their guilt in losing their babies.\nThese papers are all great examples of what practice-shaping clinical research is all about. ",
"[E. M. Purcell - Life at Low Reynolds Numbers](_URL_2_) ([Dropbox Public Link](_URL_0_))\nEverything you need to know about Biophysics, even if you don't study biology or physics.\n\n[V. F. Weisskopf - Search for Simplicity](_URL_1_) ([Dropbox Public Link](_URL_1_))\nThe best kind of physics.\n\nBoth of these were suggested by a colleague of mine and have been immensely enjoyable and illuminating. The American Journal of Physics is a great place for these kind of articles.",
"I use this paper with my students to get them over the scientific paper intimidation factor: [Detection of Large Woody Debris Accumulations in Old-Growth Forests](_URL_0_)",
"[The first case of homosexual necrophilia in the\nmallard Anas platyrhynchos](_URL_0_) (pdf warning) is concise and quite the interesting topic.",
"[The importance of stupidity in scientific research](_URL_0_). Pretty self explanatory and a nice handout for a Biology class. ",
"[Arms races between and within species by Dawkins & Krebs](_URL_2_)\n\nThey write in a very clear and eloquent style which makes difficult to grasp concepts easy to understand. Its a greatly influential paper--it has been cited nearly 1000 times in biology and life science journals. One of the best biology papers I have had the pleasure to read.\n\nAlso, a few good books, available free online:\n\n[The selfish gene by Richard Dawkins](_URL_1_)\n\n & \n\n[River out of eden by Richard Dawkins](_URL_0_)",
"[Linus Pauling - The Nature of the Chemical Bond](_URL_0_)\n\nI'm pretty sure it's the most cited paper in all of chemistry, and for good reason. It's a pretty easy read, and the concepts contained within are still very much relevant.",
"On computable numbers (Theory of Computation) - Alan Turing.\n\nBrilliant.\n\n",
"From Anthropology:\n[Deep Play: Notes on the Balinese Cockfight](_URL_0_)\nMakes me chortle every time I read it.\n",
"My favorite is [Feline High-rise Syndrome: 119 cases](_URL_0_). I found it a really neat read with pretty cool statistics about cats and apartment buildings.",
"[Simon's The Architecture of Complexity](_URL_0_)",
"Edmund Gettier: \"Is Justified True Belief Knowledge?\" in Analysis, v. 23. Available at _URL_0_\n3 pages of earth shattering profoundness. Just when philosophers thought they were on the verge of actually solving a problem, along comes Gettier and nips that nonsense in the bud!",
"[Binford's 1962 'Archaeology as Anthropology'](_URL_0_) is one of the landmark articles for archaeology as a discipline. I can name a bunch of other ones that are much more relevant to my specific research interests (Neutron Activation Analysis and Inka Administration in Coastal Peru) but this is the best archaeology article I can give you in terms of being broadly accessible and relavant.",
"It's not exactly a paper, but it is a fairly quick read. *The Structure of Scientific Revolution* by Thomas Kuhn is indispensable, IMHO.",
"[Evidence](_URL_0_) of van der Waals forces in gecko setae.\n\nRarely do you see evidence presented so simply. Hopes for setae dry-adhesive products in the future have sky-rocketed since this paper.",
"[Deterministic Nonperiodic Flow](_URL_0_) by Ed Lorenz, the founder of Chaos theory. A \"deep, prescient, and surprisingly readable paper.\"",
"[The Market For Lemons](_URL_0_), by George Akerlof. Decades of people taking shots at the neoclassical economy building unsuccesfully, and this guy comes along with the simplest example and tears it down easily. He got a Nobel for it, too.\n\n",
"[Mathematical Modelling of an Outbreak of Zombie Infection](_URL_0_). Interesting read on the outbreak and spread of zombification.",
"Not sure if somebody else posted this...and also this is by no means the best scientific paper I've ever read but nevertheless it is very interesting and IIRC Feynman called it the best paper he has ever read.\n[N.D.Mermin's experiment to make quantum behavior obvious to 'anybody'](_URL_0_)\n",
"_URL_0_\n\nThe Unsuccessful Self Treatment of Writer's Block always gets a laugh, and can provide a nice break for your students.",
"This is one of the more jocular articles I've read:\n\n[Effects of Sexual Activity on Beard Growth in Man](_URL_0_)",
"[Geminoid: Teleoperated Android of an Existing Person ](_URL_0_) - For everyone who likes some robotics. ",
"Ronald Coase's \"The Problem of Social Cost\" is widely considered one of the most important social science papers ever written. It deals with the economics topic of \"externalities.\" It has been massively cited in the social science literature and does not require advanced mathematical, legal or economics knowledge to understand (Coase was a lawyer turned economist). \n\nInterestingly, readers of \"The Problem of Social Cost\" seem to reach quite different conclusions about what what the paper means, with widely differing papers citing it in support of their conclusions.\n\nCoase is considered to have earned his Nobel with this paper and his other classic \"The Nature of the Firm\" (about transactions costs). The papers are available on JSTOR and there are pdf copies around on the web (whose legal availability I cannot speak to).",
"Grave Shortcomings, Gargett et al 1989. Great article on the reinterpretation of supposed Neandertal ritual behavior, notably burials. Hence the cool title. In addition to being an interesting and accessible topic, it is a fantastic illustration of things that influence all scientific literature and the value of critical thinking and balancing different hypotheses in general. In this case, some previous conclusions (that neandertals had various examples of ritualistic behavior including burying their dead) were influenced by the social and political environment in which they were written, among other things. Gargett takes another look and some of the most famous examples, and alternately applies various hard sciences and occam's razor to dispute some of the original findings. There are plenty of peer responses, as this was in Current Anthropology. Anyway, I haven't read it for 10+ years, and I don't even recall agreeing with all of it, but it should be helpful to discuss ALL sorts of topics related to scientific literature. Especially for that audience.",
"This may be a good time to mention that the British Royal Society has released their historical archive to the public. It includes:\n\n[Theory about Light and Colours](_URL_0_content/6/69-80/3075.full.pdf+html?sid=0d477dd8-8dec-4ac3-8187-b6df96d4d670) - Isaac Newton\n\n[Philosophical Transactions of the Royal Society](_URL_0_) - First ever peer reviewed journal (1665)\n\n[Electric Kite Experiment](_URL_0_content/47/565.full.pdf+html?sid=491066f9-1f77-4232-a45c-3e859a60867e) - Benjamin Franklin\n\n[Search the archive](_URL_0_).",
"[Right here.](_URL_0_) I used to work as \"Mr. Concrete\" for a Q and A website, and this was one of the most useful articles I ever used in my research. Who knew concrete was so fascinating?",
"To me, nothing compares with the Einstein, Podolsky and Rosen paper on the nature of physical reality and quantum mechanics. It's beautiful for the simplicity of its argument, and it is basically the spawning point for all subsequent work in quantum foundations. It can be found here:\n\n_URL_0_\n\nStaying with Einstein, his book on special relativity is extremely intuitive and understandable to anyone, and is definitely worth a read.",
"\"Consequences of Erudite Vernacular Utilized Irrespective of Necessity: Problems with Using Long Words Needlessly\"\n\n_URL_0_",
"[Primer](_URL_0_) from the book, but I found 'Structures of Scientific Revolutions' by Kuhn to be impressive and insightful for me as I went through college.",
"This may be the best Reddit topic on r/AskScience I've seen in a while! I have [Kaila, Ville. \"Natural Selection for least action\"](_URL_0_) where natural selection is described using physics terms, the law of least action and the 2nd law of thermodynamics. ",
"My favorite is a short article from Nature in 1985 by Harold Kroto that more or less won a Nobel Prize for him, and pissed off a slew of Exxon researchers who realized that they had observed these \"C60\" structures but just didn't know what they had a year before the article was published.... Gene Dresselhous has a great video about it. This was the first mention of the now ubiquitous Buckyball.\n\n_URL_0_",
"[Matrix elasticity can dictate stem cell lineage](_URL_0_)\n\nI find this paper fascinating - mechanotransduction as a field seems to be growing exponentially and showing this profound an effect is really cool. \n\n",
"Here's a good list, with more being added each week:\n_URL_0_\n",
"I used to work in programming language design and the following paper on planning for growth -- for unexpected uses in the wild -- is a delightful and brilliant read:\n\n[Steele, G. R. Jr. (1999). Growing a language. Higher-order and symbolic computation, 12, 221-236.](_URL_0_)\n\nThe paper works really well as a [talk](_URL_1_) because of its unique and surprising rhetorical structure.",
"There are very few biology papers in this thread, and the ones that have the most upvotes are very poor representatives of the scientific method. Observational studies on the structure of DNA had a huge impact, but they barely qualify as science. The other articles on the elucidation of action potentials and the hallmarks of cancer both strike closer to the mark, but they are reviews, and do not provide experimental details. I would think that would be the most important part if I were teaching a biology class (rather than a history of science class).\n\nEdit: Just so I'm not throwing stones, I think Mendel's paper on inheiritance is the best example I can think of. [A nod to umdiddly for posting the link first.](_URL_0_)",
"I really like the following:\n\n[Tonegawa's paper on DNA recombination in immunology](_URL_1_) (Sorry I don't have the PDF available)\n\nBarbara McClintock's paper on transposons (McClintock, B., 1950. The origin and behavior of mutable loci in maize. Proc. Nat. Acad. Sci. 36: 344-355.) This paper is socially interesting as much as scientifically. The amount of evidence she felt she needed to have in order to publish a paper (presumably because she was a woman) is astounding. \n\nThe last suggestion is about [Educational Research: The Hardest Science of All?](_URL_0_) which allows you to discuss the differences in science in different fields. In education we can't control all the factors so we have to approach some things differently. Doesn't mean we're less scientific, we just have to make adjustments to our expectations and results.",
"The Expensive-Tissue Hypothesis by Leslie Aiello. The actual article [here](_URL_1_) needs JSTOR access, but she published a very similar paper in the Brazilian Journal of Genetics [here](_URL_0_).\n\nAmazing read. Best article I've ever read on human evolution.",
"Here's one of my favorite's: [\"How long is the coast of Britain?\"](_URL_0_) by Benoit Mandelbrot. An incredibly clear (and incredibly early) discussion of the importance of fractals published years before fractal was a word!",
"[On the follow of rewarding A while hoping for B](_URL_0_)\n\nA great read on the importance of understanding how rewards work. ",
"Smashing the stack for fun and profit\n_URL_0_\n",
"Hey, friends, I just made a folder of these files for my own purposes, so I t thought I might share it. Here are all of the PDFs and replies for comments above 10 upvotes (at the time of posting). Hope that's okay, mods. \n\n_URL_0_",
"Hey, friends, I just made a folder of these files for my own purposes, so I t thought I might share it. Here are all of the PDFs and replies for comments above 10 upvotes (at the time of posting). Hope that's okay, mods. \n\n_URL_0_",
"What has really helped my scientific writing alot is editing articles in Wikipedia. Perhaps an assignment for your students could be to edit or write (or atleast verify) an article on the site?",
"Not sure, but the worst ones I've read are definitely the ones I've written & #3232;\\_ & #3232;\n",
"Meselson and Stahl's paper on semi-conservative nature of DNA replication. Historically and scientifically this is recognized as the apex of molecular biology research elegance in the 50s.\n_URL_0_\nRequired reading for any molecular biologist.",
"Some German punk wrote [\"On the electrodynamics of moving bodies\"](_URL_0_), but that was a long time ago.\n\nGreat piece though, I think he's on to something.",
"I personally like \"Growth of Graphene from Food, Insects, and Waste\", or how I would have titled it: \"Making the next buzzword in semiconductors out of cookies, cockroach legs, and dog shit.\" < _URL_0_;.\n\nHere's a sample:\n\"Here we demonstrate that much less expensive carbon sources, such as food, insects, and waste, can be used without purification to grow high-quality monolayer graphene directly on the backside of Cu foils under the H2/Ar flow. For food, a Girl Scout cookie and chocolate were investigated. For waste with low or negative monetary value, we used bulk polystyrene plastic, a common solid waste, blades of grass, and dog feces.\"",
"[Parachute use to prevent death and major trauma related\nto gravitational challenge: systematic review of\nrandomised controlled trials](_URL_0_).\n\nI have never read anything quite as ground-breaking in my life. Though more RCT:s are needed.",
"I've put a lot of effort into finding good modern science writing for insiders. Until this thread, my best single source of leads has been the Oxford Book of Modern Science Writing, edited by Dawkins. But its mostly popular writing by insiders. I can't say that I've read a post-1980 scientific paper that has made me think \"This is well-written.\" Something happened after the 50s. \n\n\n\nFrom cognitive science, \n\n* I second George Miller's magic number 7+-2 and Herbert Simon's Architecture of Complexity. \nAdding:\n* Tolman (1948) \"Cognitive Maps in Rats and Men\" _URL_0_\n* Shepard, R., & Metzler, J. (1971). Mental rotation of three-dimensional objects. Science, 171(3972), 701. _URL_1_ \n\n\n\nI also keep a collection of horrible sentences. \n\n* This is from the abstract of a paper on sentence comprehension: \"\"Arguments are made for autonomy of the lexical access process of a model of semantic context effects is offered.\"\" \nSwinney, D. (1979). Lexical access during sentence comprehension: (Re)consideration of context effects. Journal of verbal learning and verbal behavior, 18(6), 645–659.\n* Here is another recent entry into the collection: \n_URL_2_\n* And here is the worst I've seen:\n\"\"A further - quite different - but potentially equally and in the long run probably even more important but also more debated stream of research is the recent combination of neuroscience with experimental and behavioral economics.\"\"\nRiedl, A. (2009). Behavioral and Experimental Economics Can Inform Public Policy: Some Thoughts. CESIFO Working Papers, 1–37.\n\n"
]
} | []
| []
| [
[
"http://www.nature.com/nature/dna50/watsoncrick.pdf"
],
[
"http://en.wikipedia.org/wiki/The_Hallmarks_of_Cancer",
"http://www.weizmann.ac.il/home/fedomany/Bioinfo05/lecture6_Hanahan.pdf"
],
[
"http://www.plosmedicine.org/article/info:doi/10.1371/journal.pmed.0020124"
],
[],
[
"http://www.pnas.org/content/87/12/4576.full.pdf+html",
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC432104/?tool=pmcentrez",
"http://blumwald.ucdavis.edu/publications/Alpi%202007.pdf",
"http://www.linv.org/images/about_pdf/Trends%202007%20Trewavas.pdf",
"http://www.mediafire.com/?8d4p7dygrum1oaf",
"http://homepages.ed.ac.uk/snee/publications.htm",
"http://homepages.ed.ac.uk/snee/chain.pdf"
],
[
"http://prola.aps.org/abstract/PR/v76/i8/p1256_2"
],
[
"http://www.fourmilab.ch/etexts/einstein/specrel/www/"
],
[
"http://www.myscp.org/pdf/short%20articles/JCPS_10-00088_180.pdf",
"http://dx.doi.org/10.1111/j.1749-6632.2010.05446.x",
"http://www.sciencemag.org/cgi/content/abstract/293/5539/2425",
"http://prefrontal.org/files/posters/Bennett-Salmon-2009.pdf",
"http://www.amazon.com/Talking-Nets-History-Neural-Networks/dp/0262011670"
],
[
"http://webs.wofford.edu/pechwj/Choices,%20Values,%20and%20Frames.pdf"
],
[
"http://www.nature.com/nature/journal/v460/n7257/full/nature08187.html"
],
[
"http://cogprints.org/499/1/turing.html"
],
[
"http://www.sfn.org/skins/main/pdf/HistoryofNeuroscience/hodgkin5.pdf"
],
[
"http://www.nature.com/nature/history/century.html"
],
[
"http://cogprints.org/730/1/miller.html"
],
[
"http://robotics.cs.tamu.edu/dshell/cs689/papers/anderson72more_is_different.pdf"
],
[
"http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.152.2513&rep=rep1&type=pdf"
],
[
"http://www.ncbi.nlm.nih.gov/pubmed/11751349"
],
[
"http://www.jstor.org/pss/25064859"
],
[
"http://xroads.virginia.edu/~HYPER/DETOC/assoc/bowling.html"
],
[],
[
"http://cdp.sagepub.com/content/13/4/145.short"
],
[
"http://scholar.googleusercontent.com/scholar?q=cache:3f8TlWK12EIJ:scholar.google.com/+platt,+strong+inference&hl=en&as_sdt=0,33",
"http://www.csus.edu/indiv/b/baxterj/bio160/readings/Schwenk%201994.pdf"
],
[
"http://www.aaas.org/spp/dser/03_Areas/evolution/perspectives/Gould_Lewontin_1979.shtml"
],
[],
[
"http://www.nature.com/nature/journal/v205/n4972/abs/205698a0.html"
],
[
"http://www.nature.com/nature/journal/v391/n6669/full/391806a0.html"
],
[],
[
"http://www.sciencemag.org/content/162/3859/1243"
],
[
"http://pubs.acs.org/doi/abs/10.1021/jo00800a036"
],
[
"http://condor.wesleyan.edu/courses/2004s/ees227/01/spandrels.html"
],
[
"http://arxiv.org/abs/astro-ph/0401445"
],
[
"http://cm.bell-labs.com/cm/ms/what/shannonday/shannon1948.pdf"
],
[
"http://www.bmj.com/content/327/7429/1459.abstract"
],
[
"http://www.damtp.cam.ac.uk/user/gold/pdfs/purcell.pdf"
],
[],
[
"http://www.ncbi.nlm.nih.gov/pubmed/16904174"
],
[
"http://www.nature.com/nature/journal/v391/n6669/pdf/391806a0.pdf"
],
[],
[
"http://yjsy.nenu.edu.cn/downloads/jiao%27an/Writing%20a%20Paper.pdf"
],
[
"http://en.wikipedia.org/wiki/Nothing_in_Biology_Makes_Sense_Except_in_the_Light_of_Evolution"
],
[
"http://www.ncbi.nlm.nih.gov/pubmed/6334504"
],
[
"http://people.csail.mit.edu/brooks/papers/representation.pdf"
],
[
"http://www.princeton.edu/~icouzin/Couzinetal2005.pdf"
],
[
"http://www.esp.org/foundations/genetics/classical/gm-65-a.pdf"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2038856/"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC528093/"
],
[
"http://f1000.com/"
],
[
"http://math.stanford.edu/~lekheng/flt/wiles.pdf"
],
[
"http://www.math.mcgill.ca/vetta/CS764.dir/judgement.pdf"
],
[
"http://prefrontal.org/files/posters/Bennett-Salmon-2009.jpg"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2492027/"
],
[
"http://prl.aps.org/abstract/PRL/v5/i4/p147_1"
],
[
"http://lib.store.yahoo.net/lib/paulgraham/jmc.ps",
"http://www.cs.nccu.edu.tw/~chenk/Courses/PL/Papers/Mccarthy-Lisp60.pdf"
],
[],
[
"http://dl.dropbox.com/u/1117606/Purcell_life_at_low_reynolds_number.pdf",
"http://dl.dropbox.com/u/1117606/weisskopf-simplicity.pdf",
"http://jila.colorado.edu/perkinsgroup/Purcell_life_at_low_reynolds_number.pdf"
],
[
"http://scq.ubc.ca/papers/TimberPaper.pdf"
],
[
"http://www.nmr.nl/nmr/binary/retrieveFile?instanceid=16&itemid=2574"
],
[
"http://jcs.biologists.org/content/121/11/1771.full.pdf"
],
[
"http://www.macroevolution.narod.ru/river/river.html",
"http://www.macroevolution.narod.ru/gene/gene30.htm",
"http://www.google.ca/url?sa=t&rct=j&q=arms%20races%20between%20and%20within%20species%20filetype%3Apdf&source=web&cd=1&ved=0CB8QFjAA&url=http%3A%2F%2Fwww.oeb.harvard.edu%2Ffaculty%2Fpringle%2Fjc%2FDawkins%2520and%2520Krebs1979.pdf&ei=mfe5TqHMF4Ts2QW28Ji6Bw&usg=AFQjCNEHHyHoQr1oevG3B1CVhGv5T8Tg6A&cad=rja"
],
[
"http://osulibrary.oregonstate.edu/specialcollections/coll/pauling/bond/papers/1931p.3.html"
],
[],
[
"http://www.google.com/url?sa=t&rct=j&q=notes%2Bbalinese%2Bcockfight&source=web&cd=1&ved=0CB0QFjAA&url=http%3A%2F%2Frfrost.people.si.umich.edu%2Fcourses%2FMatCult%2Fcontent%2FGeertz.pdf&ei=Nvy5ToD2IcTDgQe1kNHlCA&usg=AFQjCNGcJOllPpmzN9m-ARwPM1Msna7jew"
],
[
"http://www.scribd.com/doc/35730924/Feline-high-rise-syndrome-119-cases-1998%E2%80%932001"
],
[
"http://www.informatics.sussex.ac.uk/courses/ModDis/Internal/SimonAoC.pdf"
],
[
"http://www.ditext.com/gettier/gettier.html"
],
[
"http://www.scribd.com/doc/30525496/Binford-1962-Archaeology-as-Anthropology"
],
[],
[
"http://www.pnas.org/content/99/19/12252.full.pdf+html"
],
[
"http://tnt.phys.uniroma1.it/twiki/pub/TNTgroup/AngeloVulpiani/lorenz.pdf"
],
[
"http://books.google.com/books?hl=en&lr=&id=hkaigWlUSsoC&oi=fnd&pg=PA201&dq=The+market+for+lemons&ots=7VwqleIJ7Q&sig=4K7gJlMue3po82ZLdCaGgLEuJy8#v=onepage&q=The%20market%20for%20lemons&f=false"
],
[
"http://mysite.science.uottawa.ca/rsmith43/Zombies.pdf"
],
[
"http://hep.ucsb.edu/courses/ph125_02/mermin.pdf"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1311997/pdf/jaba00061-0143a.pdf"
],
[
"http://www.nature.com/nature/journal/v226/n5248/abs/226869a0.html"
],
[
"http://www.intechopen.com/articles/show/title/geminoid__teleoperated_android_of_an_existing_person"
],
[],
[],
[
"http://rstl.royalsocietypublishing.org/",
"http://rstl.royalsocietypublishing.org/content/47/565.full.pdf+html?sid=491066f9-1f77-4232-a45c-3e859a60867e",
"http://rstl.royalsocietypublishing.org/content/6/69-80/3075.full.pdf+html?sid=0d477dd8-8dec-4ac3-8187-b6df96d4d670"
],
[
"http://wings.buffalo.edu/academic/department/eng/mae/cmrl/Interface%20between%20steel%20rebar%20and%20concrete,%20studied%20by%20electromechanical%20pull-out%20testing.pdf"
],
[
"http://www.staff.science.uu.nl/~stief101/epr_latex.pdf"
],
[
"http://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&ved=0CCAQFjAA&url=http%3A%2F%2Fpersonal.stevens.edu%2F~ysakamot%2F730%2Fpaper%2Fsimple%2520writing.pdf&ei=-I66ToXINOe62wWukb2fBw&usg=AFQjCNEO1mrPKwyEFwxuei-25QArSHR5Yw"
],
[
"http://mitpress.mit.edu/books/chapters/0262610620chap1.pdf"
],
[
"http://rspa.royalsocietypublishing.org/content/464/2099/3055.full"
],
[
"http://www.nature.com/physics/looking-back/kroto/kroto.pdf"
],
[
"http://www.sciencedirect.com/science?_ob=MiamiImageURL&_cid=272196&_user=655046&_pii=S0092867406009615&_check=y&_coverDate=2006-08-25&view=c&_gw=y&wchp=dGLbVlS-zSkzS&md5=378a9d3770e4afcb3787320cb0eace50/1-s2.0-S0092867406009615-main.pdf"
],
[
"http://greatexperimentsblog.blogspot.com/"
],
[
"http://cs.au.dk/~hosc/local/HOSC-12-3-pp221-236.pdf",
"http://video.google.com/videoplay?docid=-8860158196198824415"
],
[
"http://www.reddit.com/r/askscience/comments/m5cum/what_is_the_best_scientific_paper_you_have_read/c2ya51g"
],
[
"http://www.google.com/url?sa=t&rct=j&q=education%20research%20hardest%20science%20of%20all&source=web&cd=1&ved=0CBsQFjAA&url=http%3A%2F%2Fciteseerx.ist.psu.edu%2Fviewdoc%2Fdownload%3Fdoi%3D10.1.1.64.2102%26rep%3Drep1%26type%3Dpdf&ei=up66To26KYi22gXhv4S7Bw&usg=AFQjCNFvT-B41SJbTSdOznKU4Dcfvf1BQQ&cad=rja",
"http://www.nature.com/nature/journal/v302/n5909/abs/302575a0.html"
],
[
"http://www.scielo.br/scielo.php?pid=S0100-84551997000100023&script=sci_arttext",
"http://www.jstor.org/pss/2744104"
],
[
"http://nature.berkeley.edu/~bingxu/UU/geocomp/Readings/MandelbrotScience1967.pdf"
],
[
"http://www.sba.oakland.edu/Faculty/york/Readings434/Readings/On%20the%20folly.pdf"
],
[
"http://www.phrack.org/issues.html?issue=49&id=14#article"
],
[
"http://www.megaupload.com/?d=4FM6JGKF"
],
[
"http://www.megaupload.com/?d=4FM6JGKF"
],
[],
[],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC528642/"
],
[
"http://www.fourmilab.ch/etexts/einstein/specrel/www/"
],
[
"http://pubs.acs.org/doi/full/10.1021/nn202625c>"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC300808/pdf/32701459.pdf"
],
[
"http://colinallen.dnsalias.org/Secure/1948-Tolman.pdf",
"http://www.cs.virginia.edu/~evans/cs1120-f09/ps/ps3/mental-rotation.pdf",
"http://enfascination.com/wiki/Weblog:A_snippet_from_my_collection_of_bad_science_writing"
],
[],
[
"http://www.nature.com/nature/dna50/watsoncrick.pdf"
],
[
"http://en.wikipedia.org/wiki/The_Hallmarks_of_Cancer",
"http://www.weizmann.ac.il/home/fedomany/Bioinfo05/lecture6_Hanahan.pdf"
],
[
"http://www.plosmedicine.org/article/info:doi/10.1371/journal.pmed.0020124"
],
[],
[
"http://www.pnas.org/content/87/12/4576.full.pdf+html",
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC432104/?tool=pmcentrez",
"http://blumwald.ucdavis.edu/publications/Alpi%202007.pdf",
"http://www.linv.org/images/about_pdf/Trends%202007%20Trewavas.pdf",
"http://www.mediafire.com/?8d4p7dygrum1oaf",
"http://homepages.ed.ac.uk/snee/publications.htm",
"http://homepages.ed.ac.uk/snee/chain.pdf"
],
[
"http://prola.aps.org/abstract/PR/v76/i8/p1256_2"
],
[
"http://www.fourmilab.ch/etexts/einstein/specrel/www/"
],
[
"http://www.myscp.org/pdf/short%20articles/JCPS_10-00088_180.pdf",
"http://dx.doi.org/10.1111/j.1749-6632.2010.05446.x",
"http://www.sciencemag.org/cgi/content/abstract/293/5539/2425",
"http://prefrontal.org/files/posters/Bennett-Salmon-2009.pdf",
"http://www.amazon.com/Talking-Nets-History-Neural-Networks/dp/0262011670"
],
[
"http://webs.wofford.edu/pechwj/Choices,%20Values,%20and%20Frames.pdf"
],
[
"http://www.nature.com/nature/journal/v460/n7257/full/nature08187.html"
],
[
"http://cogprints.org/499/1/turing.html"
],
[
"http://www.sfn.org/skins/main/pdf/HistoryofNeuroscience/hodgkin5.pdf"
],
[
"http://www.nature.com/nature/history/century.html"
],
[
"http://cogprints.org/730/1/miller.html"
],
[
"http://robotics.cs.tamu.edu/dshell/cs689/papers/anderson72more_is_different.pdf"
],
[
"http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.152.2513&rep=rep1&type=pdf"
],
[
"http://www.ncbi.nlm.nih.gov/pubmed/11751349"
],
[
"http://www.jstor.org/pss/25064859"
],
[
"http://xroads.virginia.edu/~HYPER/DETOC/assoc/bowling.html"
],
[],
[
"http://cdp.sagepub.com/content/13/4/145.short"
],
[
"http://scholar.googleusercontent.com/scholar?q=cache:3f8TlWK12EIJ:scholar.google.com/+platt,+strong+inference&hl=en&as_sdt=0,33",
"http://www.csus.edu/indiv/b/baxterj/bio160/readings/Schwenk%201994.pdf"
],
[
"http://www.aaas.org/spp/dser/03_Areas/evolution/perspectives/Gould_Lewontin_1979.shtml"
],
[],
[
"http://www.nature.com/nature/journal/v205/n4972/abs/205698a0.html"
],
[
"http://www.nature.com/nature/journal/v391/n6669/full/391806a0.html"
],
[],
[
"http://www.sciencemag.org/content/162/3859/1243"
],
[
"http://pubs.acs.org/doi/abs/10.1021/jo00800a036"
],
[
"http://condor.wesleyan.edu/courses/2004s/ees227/01/spandrels.html"
],
[
"http://arxiv.org/abs/astro-ph/0401445"
],
[
"http://cm.bell-labs.com/cm/ms/what/shannonday/shannon1948.pdf"
],
[
"http://www.bmj.com/content/327/7429/1459.abstract"
],
[
"http://www.damtp.cam.ac.uk/user/gold/pdfs/purcell.pdf"
],
[],
[
"http://www.ncbi.nlm.nih.gov/pubmed/16904174"
],
[
"http://www.nature.com/nature/journal/v391/n6669/pdf/391806a0.pdf"
],
[],
[
"http://yjsy.nenu.edu.cn/downloads/jiao%27an/Writing%20a%20Paper.pdf"
],
[
"http://en.wikipedia.org/wiki/Nothing_in_Biology_Makes_Sense_Except_in_the_Light_of_Evolution"
],
[
"http://www.ncbi.nlm.nih.gov/pubmed/6334504"
],
[
"http://people.csail.mit.edu/brooks/papers/representation.pdf"
],
[
"http://www.princeton.edu/~icouzin/Couzinetal2005.pdf"
],
[
"http://www.esp.org/foundations/genetics/classical/gm-65-a.pdf"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2038856/"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC528093/"
],
[
"http://f1000.com/"
],
[
"http://math.stanford.edu/~lekheng/flt/wiles.pdf"
],
[
"http://www.math.mcgill.ca/vetta/CS764.dir/judgement.pdf"
],
[
"http://prefrontal.org/files/posters/Bennett-Salmon-2009.jpg"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2492027/"
],
[
"http://prl.aps.org/abstract/PRL/v5/i4/p147_1"
],
[
"http://lib.store.yahoo.net/lib/paulgraham/jmc.ps",
"http://www.cs.nccu.edu.tw/~chenk/Courses/PL/Papers/Mccarthy-Lisp60.pdf"
],
[],
[
"http://dl.dropbox.com/u/1117606/Purcell_life_at_low_reynolds_number.pdf",
"http://dl.dropbox.com/u/1117606/weisskopf-simplicity.pdf",
"http://jila.colorado.edu/perkinsgroup/Purcell_life_at_low_reynolds_number.pdf"
],
[
"http://scq.ubc.ca/papers/TimberPaper.pdf"
],
[
"http://www.nmr.nl/nmr/binary/retrieveFile?instanceid=16&itemid=2574"
],
[
"http://jcs.biologists.org/content/121/11/1771.full.pdf"
],
[
"http://www.macroevolution.narod.ru/river/river.html",
"http://www.macroevolution.narod.ru/gene/gene30.htm",
"http://www.google.ca/url?sa=t&rct=j&q=arms%20races%20between%20and%20within%20species%20filetype%3Apdf&source=web&cd=1&ved=0CB8QFjAA&url=http%3A%2F%2Fwww.oeb.harvard.edu%2Ffaculty%2Fpringle%2Fjc%2FDawkins%2520and%2520Krebs1979.pdf&ei=mfe5TqHMF4Ts2QW28Ji6Bw&usg=AFQjCNEHHyHoQr1oevG3B1CVhGv5T8Tg6A&cad=rja"
],
[
"http://osulibrary.oregonstate.edu/specialcollections/coll/pauling/bond/papers/1931p.3.html"
],
[],
[
"http://www.google.com/url?sa=t&rct=j&q=notes%2Bbalinese%2Bcockfight&source=web&cd=1&ved=0CB0QFjAA&url=http%3A%2F%2Frfrost.people.si.umich.edu%2Fcourses%2FMatCult%2Fcontent%2FGeertz.pdf&ei=Nvy5ToD2IcTDgQe1kNHlCA&usg=AFQjCNGcJOllPpmzN9m-ARwPM1Msna7jew"
],
[
"http://www.scribd.com/doc/35730924/Feline-high-rise-syndrome-119-cases-1998%E2%80%932001"
],
[
"http://www.informatics.sussex.ac.uk/courses/ModDis/Internal/SimonAoC.pdf"
],
[
"http://www.ditext.com/gettier/gettier.html"
],
[
"http://www.scribd.com/doc/30525496/Binford-1962-Archaeology-as-Anthropology"
],
[],
[
"http://www.pnas.org/content/99/19/12252.full.pdf+html"
],
[
"http://tnt.phys.uniroma1.it/twiki/pub/TNTgroup/AngeloVulpiani/lorenz.pdf"
],
[
"http://books.google.com/books?hl=en&lr=&id=hkaigWlUSsoC&oi=fnd&pg=PA201&dq=The+market+for+lemons&ots=7VwqleIJ7Q&sig=4K7gJlMue3po82ZLdCaGgLEuJy8#v=onepage&q=The%20market%20for%20lemons&f=false"
],
[
"http://mysite.science.uottawa.ca/rsmith43/Zombies.pdf"
],
[
"http://hep.ucsb.edu/courses/ph125_02/mermin.pdf"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1311997/pdf/jaba00061-0143a.pdf"
],
[
"http://www.nature.com/nature/journal/v226/n5248/abs/226869a0.html"
],
[
"http://www.intechopen.com/articles/show/title/geminoid__teleoperated_android_of_an_existing_person"
],
[],
[],
[
"http://rstl.royalsocietypublishing.org/",
"http://rstl.royalsocietypublishing.org/content/47/565.full.pdf+html?sid=491066f9-1f77-4232-a45c-3e859a60867e",
"http://rstl.royalsocietypublishing.org/content/6/69-80/3075.full.pdf+html?sid=0d477dd8-8dec-4ac3-8187-b6df96d4d670"
],
[
"http://wings.buffalo.edu/academic/department/eng/mae/cmrl/Interface%20between%20steel%20rebar%20and%20concrete,%20studied%20by%20electromechanical%20pull-out%20testing.pdf"
],
[
"http://www.staff.science.uu.nl/~stief101/epr_latex.pdf"
],
[
"http://www.google.com/url?sa=t&rct=j&q=&esrc=s&source=web&cd=1&ved=0CCAQFjAA&url=http%3A%2F%2Fpersonal.stevens.edu%2F~ysakamot%2F730%2Fpaper%2Fsimple%2520writing.pdf&ei=-I66ToXINOe62wWukb2fBw&usg=AFQjCNEO1mrPKwyEFwxuei-25QArSHR5Yw"
],
[
"http://mitpress.mit.edu/books/chapters/0262610620chap1.pdf"
],
[
"http://rspa.royalsocietypublishing.org/content/464/2099/3055.full"
],
[
"http://www.nature.com/physics/looking-back/kroto/kroto.pdf"
],
[
"http://www.sciencedirect.com/science?_ob=MiamiImageURL&_cid=272196&_user=655046&_pii=S0092867406009615&_check=y&_coverDate=2006-08-25&view=c&_gw=y&wchp=dGLbVlS-zSkzS&md5=378a9d3770e4afcb3787320cb0eace50/1-s2.0-S0092867406009615-main.pdf"
],
[
"http://greatexperimentsblog.blogspot.com/"
],
[
"http://cs.au.dk/~hosc/local/HOSC-12-3-pp221-236.pdf",
"http://video.google.com/videoplay?docid=-8860158196198824415"
],
[
"http://www.reddit.com/r/askscience/comments/m5cum/what_is_the_best_scientific_paper_you_have_read/c2ya51g"
],
[
"http://www.google.com/url?sa=t&rct=j&q=education%20research%20hardest%20science%20of%20all&source=web&cd=1&ved=0CBsQFjAA&url=http%3A%2F%2Fciteseerx.ist.psu.edu%2Fviewdoc%2Fdownload%3Fdoi%3D10.1.1.64.2102%26rep%3Drep1%26type%3Dpdf&ei=up66To26KYi22gXhv4S7Bw&usg=AFQjCNFvT-B41SJbTSdOznKU4Dcfvf1BQQ&cad=rja",
"http://www.nature.com/nature/journal/v302/n5909/abs/302575a0.html"
],
[
"http://www.scielo.br/scielo.php?pid=S0100-84551997000100023&script=sci_arttext",
"http://www.jstor.org/pss/2744104"
],
[
"http://nature.berkeley.edu/~bingxu/UU/geocomp/Readings/MandelbrotScience1967.pdf"
],
[
"http://www.sba.oakland.edu/Faculty/york/Readings434/Readings/On%20the%20folly.pdf"
],
[
"http://www.phrack.org/issues.html?issue=49&id=14#article"
],
[
"http://www.megaupload.com/?d=4FM6JGKF"
],
[
"http://www.megaupload.com/?d=4FM6JGKF"
],
[],
[],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC528642/"
],
[
"http://www.fourmilab.ch/etexts/einstein/specrel/www/"
],
[
"http://pubs.acs.org/doi/full/10.1021/nn202625c>"
],
[
"http://www.ncbi.nlm.nih.gov/pmc/articles/PMC300808/pdf/32701459.pdf"
],
[
"http://colinallen.dnsalias.org/Secure/1948-Tolman.pdf",
"http://www.cs.virginia.edu/~evans/cs1120-f09/ps/ps3/mental-rotation.pdf",
"http://enfascination.com/wiki/Weblog:A_snippet_from_my_collection_of_bad_science_writing"
]
]
|
|
eqs5re | why are other standards for data transfer used at all (hdmi, usb, sata, etc), when ethernet cables have higher bandwidth, are cheap, and can be 100s of meters long? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/eqs5re/eli5_why_are_other_standards_for_data_transfer/ | {
"a_id": [
"fewk0kl",
"fewkm9u",
"fewknis",
"fewkozd",
"fewle91",
"fewma2m",
"fewma92",
"fewmfah",
"fewomkr",
"fewq7di",
"fewt7fa",
"fewxsid",
"fexeiuc",
"fexf5mv",
"fexg1ul",
"fexhm70",
"fexkt44",
"fexmjwa",
"fexqpx5",
"fexw6n0",
"feybu38",
"feycc5p",
"feykez6",
"feyyaqk",
"fezbzrm",
"fezlsa8",
"fezuemc",
"ff04n3b",
"ff08dnr",
"ff0pt11"
],
"score": [
2115,
8062,
76,
695,
2,
7,
237,
143,
2,
2,
7,
45,
5,
2,
2,
2,
15,
2,
2,
6,
2,
6,
2,
2,
2,
2,
2,
2,
2,
2
],
"text": [
"You had the misconception of ethernet cables having higher bandwidth. That's where your root of your confusion.",
"USB cabling and receptacle buses are cheaper than ethernet cables.\n\nUSB has greater port density, and will fit cleanly into thinner form factor platforms.\n\nUSB 3.0 has ~5 gbps transfer rate, whereas cat5e gets stable 1gbps. Getting 10Gbps typically requires cat6e ethernet cables or fiber, which are not exactly flexible and definitely not as cheap.\n\nCopper ethernet is also rated for 100 meters; you would not get very good throughput at 100s of meters on copper. Granted, this isn't typically a requirement for USB based eqpt either.\n\nEli5 edit:\n1. USB cable and especially the equipment you plug into (buses/controllers) cheaper than ethernet\n2. Fit more USB ports in tiny space (known as port density)\n3. USB faster than ethernet for price, especially on modern solutions like USB-C\n4. Ethernet is better at longer distances, which is why networking equipment uses it, but your keyboard does not need to",
"Ethernet generally cannot transmit power, or requires quite a bit of componentry on both ends to do so. It therefore doesn't work well for things like keyboards, mice, flash drives that require a power source.\n\nIt doesn't have the sheer bandwidth needed for HDMI or displayport, or the very low latency and, until recently, high bandwidth needed to run SATA.\n\n10Gb/s ethernet endpoints are still very expensive and power consuming.",
"Gigabit ethernet max. transfer speed: ca. 1 Gb/sec\n\nHDMI 2.1 max. transfer speed: ca. 42 Gb/sec",
"Because you need 100m ethernet cables. That's basically it. And they are cheap because you need a few hundred meters to wire up something, and the bigger the production the cheaper the cost of a single unit. Pair that with a cheap connecter, and you have Ethernet Cables.",
"There are many advantages and disadvantages to each type of transportation. Since every industry is unique and has different costs and profit margins, companies choose the method that fits them best. \nFor example, HDMI works best for transferring videos, USB works best for transferring files to small portable devices such as flash drives. SATA works best for external hard drives.",
"So what is being conflated here is Ethernet cables and Ethernet, HDMI cables and HDMI, etc. We need to talk about the physical layer and the protocols separately. \n\nEthernet is a protocol that can be run on top of a number of physical layers. Most people think of Ethernet cable as twisted shielded pair. \n\nThis is a type of transmission line that has an impedance of about 100 ohms. Depending on a number of factors like the dielectric loss, and how uniform the impedance of the line is different sorts of transmission lines have different bandwidths. The usable bandwidth of a CAT6A cable is about 500 MHz. The rest of the bandwidth comes from additional channels or QAM modulation techniques. \n\nNow what are SATA cables? Well they are differential pair signals as well. So is HDMI, copper differential signal pairs.\n\nNow imagine you want to send a signal down a transmission line and you want it to switch on and off at 20 GHz. Well you can actually do that on any sort of cable, the question really is just how much of the signal will actually make it to the other end and what it will look like. If its just loss and not lots of horrific reflections then you just need to just put repeaters in the cable or make it short enough. If the transmission line has a lot of dispersion then the shape of the signal will get lost and it will become hard to \"see\". These factors are often shown with something called an eye diagram, the more open the eye is the better the signal integrity of the communication channel. \n\nThe fact that Ethernet can be 100 m long means that the dispersion and the loss of the cable have to be low at the frequencies that protocol is used at. As others have pointed out HDMI has a lot more bandwidth so the cables can't be as long or the transmission line quality has to be better. Cheap cables mean lower transmission line quality. \n\nThe very best cables that are not optical (in terms of bandwidth) tend to be rigid pipes that are quite a lot like coax but have the center conductor basically floating in air with little spacers, these get up above 100 GHz.",
"This comes down to the intended use of the Device more than anything else. HDMI to Ethernet adapters do exist, and Ethernet can obviously handle the bandwidth required for a 1080p video stream, but a lot of the \"extra pins\" HDMI has cover audio, error detection, frame timing etc. Classically the interface to provide a usable signal on the video output end is provided by the input device, and monitors, TV's, etc tend to follow this pattern.\n\nIn the case of USB, the devices themselves have to be smart enough to tell the computer how they're connecting and what sort of functionality they'll perform.\n\nBandwidth isn't the end all consideration when determining what the most efficient way to transmit information is. While transmitting the required signals via ethernet may be possible it wasn't designed to support the wide array of applications better suited to specific connector types.",
"Ethernet is the slowest of Transfer standards you mentioned. That's why a USB to Ethernet dongle works at full speed, but HDMI over Ethernet works only with compression.",
"Follow up eli5. \nWhy is one connector/ cable give better or worse speed? My understanding is that a conductor is a conductor, obviously less resistance based on wire guage, and type of metal, and stranded vs solidcore would be parameters that would effect how much current it can use etc. Also i imagine the specific impedance or capacitance of the wire at that guage and length could affect its ability to transmit frequencies cleanly. And Obviously you would need the correct number of conductors for a particular data protocal. But how would the shape of the connector type at the end have anything to do with transfer speeds? Can't one easily convert any wire to any connector type with similar number of conductors? Shielding and wire guage options aside what is the physics that allow one wire or connector standard to transfer at twice the speed of the next? Also why does the twisted pair or cat5 wires have any affect on transfer speeds vs non twisted 8 conductor wire?",
"In addition to things others have mentioned, the RJ45 connectors you are probably thinking of aren’t very durable (the clips tend to break off if you unplug and plug back in often). Unlike USBc they also aren’t reversible.",
"I know this comment will never be seen, but Ill try anyway. Data bandwidth is not the only measurement for a cable, and many cables are used because they fill a role no other cable will fill properly. HDMI for instance was shoved down our collective throats by the media 'powers that be'. It has 19 wires inside it, and performs a massive series of handshakes both to negotiate things like display resolution (through EDID) and copyright protection (HDCP). An ethernet cable cant pass this signal without a translation device (which exists and is known as an HDMI extender). Meanwhile, HDMI wires are notoriously finicky over medium to long distances. \n\n\nRG6 with a BNC connector is often used because the actual termination (bit on the end) can be secured. BNC was actually created by the British Navy iirc for that express purpose. The equipment it is used on does not require ethernet throughput. \n\n\nFiber is frankly very high on the list of wires that are great. Extreme data transmission speeds are possible, and you can run it for extremely long distances without issue. There are also secure connectors that pretty much assure the thing will not pop out by accident. The downsides are its fragility, and lack of easily available equipment for it to be used with.\n\n & #x200B;\n\nTLDR; \nWires are used for all kinds of reasons, not just data throughput.",
"for HDMI, it is lossless and has 48Gbps bandwidth (with [hdmi 2.1](_URL_0_)). So it's not quite like you've thought",
"Ethernet at those rates requires high powered high speed data management as well as a hardware interface and network layer computing where as others use more like a hardware chip to do the handling and stream pretty simple digital data streams that talk more on a hardware interface.",
"HDMI is up to 48GB/s. The fastest attainable ethernet you can get in your home is 10GB/s, and that's a signficant cost. Normally, people have 1gbps. 40 and 100 gb ethernet are used in and between datacenters.\n\nEach of these cables has a specific purpose that ethernet cannot nessecarily match. Sometimes it's high bandwidth, sometimes low latency.",
"Ethernet cables can not be 100s of meters long. They can be up to 100m, a singular hundred.",
"The easiest answer is that USB has built in standards for device detection, drivers, and is designed to handle a much broader range of devices.\n\nHDMI has built in negotiated standards for DRM, and the port is meant to be easier to install in tighter places.\n\nWith the addition of Thunderbolt to the USB 4.0 specification, fiber optics are now used for handling stuff previously relegated to PCI cards inside computers.\n\nFinally, power. HDMI includes Ethernet for transport. USB can handle up to 100W of power with the proper Type-C cable\n\nBottom line, Ethernet is designed to do one thing - networking. We can sometimes shoehorn it to do these other tasks, but imagine an Ethernet port on a thin tablet today.",
"DisplayPort 1.4 is something like 32.4 Gbps. HDMI 2.0 is 14.4 Gbps (a new version is slowly coming out with bandwidth even higher than DisplayPort 1.4). These also require relatively short cables. Ethernet in real use and inexpensively acquired by consumers don't really come close to those speeds.\n\nTo put that in perspective of what you can do with that, DisplayPort 1.4 can easily do 4k/60fps/4:4:4 chroma/10 or 12bit color. I'm not sure exactly what it maxes out at, but at some point you have to start compromising on something. For example the current mainstream HDMI spec, which as stated already has higher bandwidth than what most consumers have access to as far at network gear, is already hitting it's limit with 4k forcing you to choose between 4k/60fps/4:2:2 chroma/10 or 12bit color, 4k/60fps/4:4:4 chroma/8bit color, or 4k/30fps/4:4:4 chroma/10 or 12 bit color. Basically you have to compromise on resolution, chroma subsampling, refresh rate, or color depth. The more you make one go up, the less you can have of the others.\n\nPlease disregard any typos or technical errors. The gist of this reply is to point out that even at really high bandwidths, higher than what most of us have access to with networking gear, compromises have to be made. My current display is a 3440x1440@144hz, 10bit color, 4:4:4 chroma subsampling using DisplayPort. I am not sure the current mainstream HDMI can handle that.",
"**Summary/TL;DR**: Different standards exist, because it is impossible to meet all design requirements in one standard that is also inexpensive enough for consumer use. In some cases, it's even impossible to meet them all, period. Like with cabling. Some applications need stable cabling, others need flexible cabling. And some design criteria have only been recently met by Ethernet, whereas other standards have been meeting them for over a decade now.\n\nOkay lets unwrap this a bit:\n\n**USB** was originally designed to be a standard to connect inexpensive peripherals in a way that is unified and easier to handle than previous options. Compared to Ethernet (or really just about anything else) USB has always been both dirt cheap and dead simple to implement. It is also designed to be easy to handle for people with physical disabilities. USB connectors being simple and sliding in and out of their receptacles easily isn't a mistake, it's a deliberate design choice. Same with the cables being thinner and easier to bend. USB also comes with a set of standard drivers that do away with the need to write your own driver software for all but the most unusual devices.\n\n* (+) Much cheaper on the hardware side\n* (+) Simpler to implement, hardware wise\n* (+) Small. Many USB devices are smaller than even an RJ45 socket\n* (+) Connectors specified for a high number of connect/disconnect cycles, almost unbreakable, simple, easy to handle, even for people with physical disabilities\n* (+) Cheaper on the software side as well. (usually no extra drivers needed, can do lots of things)\n* (+) Still cheaper for similar bandwidth for high bandwidth\n* (-) Plugs unplug themselves all the time\n* (-) Historically, relatively low bandwith\n\n**SATA** was specified as point to point high bandwidth low latency short distance bus. Until 10G Ethernet, SATA has been much faster than Ethernet, and because of the point to point design (i.e. there are never more than one receiver and one sender on a connection), things like arbitration (figuring out who gets to send next) are unnecessary, very *very* greatly improving latency, which is what you need for access to local storage devices. The short distance design also makes cables and transceivers (the send/receiver chips at the end) much cheaper to implement.\n\n* (+) Much cheaper on the hardware side\n* (+) Lower latency (Important for storage)\n* (+) Less complexity, one sender, one receiver per cable\n* (+) Until very recently, faster than Ethernet\n* (+) Cheaper per bandwidth unit\n* (-) Single purpose\n\n**HDMI** is actually not that different from SATA, conceptually, but it has a few extra features added. Specifically it is designed for very low latency, it features very high bandwidth (even current 10G Ethernet is slower than an HDMI connection, starting from HDMI 1.3, which was specified in *2006*). Essentially it is designed to meet all needs of a digital A/V connection, which actually aren't that easy to meet with a general purpose network standard. On the other hand, as point to point short range standard it lacks a few of the design requirements of Ethernet, which makes it cheaper to implement. (Btw, pretty much this entire section is also valid for **DisplayPort** and **Thunderbolt**, with with not that very many differences, with Thunderbolt having a few extra features that go beyond what HDMI and DP do)\n\n* (+) Cheaper to implement\n* (+) Much lower, and dependably low latency (important for A/V)\n* (+) Historically, and currently *much* faster than Ethernet\n* (+) Cheaper per bandwidth unit\n* (+) Has special features for A/V transport that aren't easy to implement\n* (-) Single/low number purpose\n\n**Ethernet** was specified to serve a very different purpose than any of these standards. Ethernet's claim to fame is long distance ( > 10m) high bandwidth, something none of the other standards can do. On the other hand it's more expensive to implement, the drivers are clunkier (and don't cover many use cases, i.e. you need lots of stuff on top to cover things like storage or A/V), and Ethernet does not have a guaranteed latency at all, something it inherits from its past of being a shared medium (10Base-2). And lastly, the cabling is rigid, awkward to handle, not specified to me moved around all the time (even flexible Cat cable isn't, really, not the way you move around a mouse cable for instance)\n\n* (-) More expensive to implement (for anything > 1GB still *much* more expensive)\n* (-) Hardware (necessary chips) needs much more space than USB\n* (+/-) Lots of cabling options - > flexibility, but also incompatibility\n* (-) No guaranteed latency\n* (+) Can do much longer distances at high bandwidth than the other options\n* (-) Driver situation is a bit of a mixed bag for anything above layer 2.\n* (-) More expensive per bandwidth unit\n* (-/+) Cabling rigid and hard to move around. Can be a good thing for solidity, but is a bad thing for things like mice or USB sticks",
"ELI5 answer: Because it's easier to have different types of plugs for different things.\n\nAs for a more technical explanation, I'm copy/pasting what I've put elsewhere (only slightly edited)\n\n----\n\n200 meters is the limit for Cat5, 100 for Cat7. The bandwidth for Cat7 which is 10 Gbps which beats USB 3 hands down while the newest standard for HDMI is 18Gbps.\n\nThe form factor of RJ45 is only that way because of standards. It doesn't have to be the size or shape that it is but good luck getting every computer and NIC manufacturer to adopt a new one.\n\nAs for the max length of a cable, there are such things as \"repeaters\" which are insanely cheap these days. \n\nAdditionally, AWS 24 ethernet cables have been used for VGA cables in the past. [Here's a link to a converter just for this purpose](_URL_1_)\n\nHDMI nowadays has bandwidth up to 18 Gbps but previous versions went up to 10 Gbps, same as Cat7. In fact, [there are converters just for this purpose](_URL_0_)\n\nSo, now that you've read all of this, the reason is because of technical standards. After all, it would be hella confusing if everything plugged into the back of your computer via RJ45. On the other hand, it's only eight wires and it's extremely easy to wire in another plug on the cable and save yourself some money.\n\n----\n\nEdit: To add some history as to why we have different plugs: Computers didn't always have standards when it came to hardware. Anyone could make a component and as long as it fit the motherboard, you could sell it even if the drivers, software, and cables were completely proprietary. Along came modems, printers, and sound cards and it became such a nightmare to support that eventually standards for things were introduced and manufacturers were expected to conform. By then, we had so many pieces of hardware out there that the most popular ones were (mostly) the ones who benefited since they had the largest market share and had the highest financial agility to adopt or influence the standards. Because of this, those different cable types were kind of cemented in place and became commonly used, spreading forward to the plethora of cable ends we have now.\n\nSometimes, however, technology advances and we can get more into a smaller area. We see this mostly commonly with USB plug types. Sometimes we only need a limited amount of bandwidth or we just plainly have a very small amount of room. For example, could you imagine using one of [these](_URL_2_) on your PlayStation controller???\n\nSo we have different cable connector types for historical, bandwidth, expense, power requirements, or space reasons.",
"Those other cables do not meet the safety requirements from the insurance industry or government to ensure buildings are safe and cheap. Etherlink usually does meet the safety requirements so it's ok to use inside the walls and ceiling of a building. New cables can and do get invented from time to time but proving they are safe is very expensive, so everyone still uses ethernet.",
"In addition to what everyone has already said, Ethernet cables are extremely inflexible. None of those could be reasonably routed inside of a PC case (ie SATA replacement) and would be clunky and fragile to carry around with you constantly.",
"Mostly it comes down to money, and what tech available at the time was not suitable, or it was just an upgrade. \nHDMI came along cause dvi was big, clunky, and did not support audio, and became a defacto standard for such and today got a nearly 50 gbps. \nUSB came along as a method to connect peripherals, be it mouse, keyboard, and so much more, and with it's 5 voltage it became a nice standard for giving power to peripherals as well as becoming an eventual charging standard thanks to the EU. \nSATA is just an upgraded edition of PATA like HDMI and DisplayPort is an upgraded version of DVI and VGAm, and it was generally faster then ethernet was at the same time. \nLastly there is the ethernet cable itself, the third most sold cable after power and phone, and will probably rise above phone any minute now. \nEthernet cables are big, they are chonky, and the good cables are fairly expensive to make as well. \nSo to summarize, each form of data transfer was made for a certain purpose in mind, and at the time it fit that purpose better then all alternatives, pluss money had quite a bit to say about it. \nIt was a tool fit for it's purpose, however all of them could be used as hammers, but hammers are better hammers then non-hammers even when non-hammers can be used as hammers. \nOh and whats more, the highest bandwidth today on ethernet cable is at a slow 400 gbit/s. \nIn comparison PCI express 5.0 is already up into 512 Gbit/s, while NVLink 1.0 is at 640 Gbit/s NVLink 2.0 at 1.2 Tbit/s, and then you got Infinity Fabric, which is part of HT for communications between cpu and gpu and has a max theoretical bandwidth of 4096 Tbit/s",
"Ethernet plugs are brittle, they're not made to be plugged and unplugged several times. USB and HDMI are designed specifically with this in mind.\n\nas for SATA plugs, it's easier and cheaper to just keep using them, than try to adapt everything to a new standard",
"I think a lot of people on here are caught in the bandwidth of the cable but that's not the answer. The answer is simply that ethernet is made for networking devices. An HDMI for example does that but also a bunch of other stuff because it has 19 pins. If you used ethernet you'd have to add a process that decide what a packet was intended for and that will add latency and cost of manufacturing a new TV or dvd player which would be present with HDMI.",
"Well:\n\n- USB is cheaper.\n\n- USB can transmit power, and a lot of it in certain cases.\n\n- Even USB 3.0 ports can deliver 5Gb speeds, while CAT 5E can only do 1GB.",
"A similar question I always wondered is why we developed all these other cables when regular coax cables have high enough bandwidth for HD signals and fast internet. Also, same question with VGA vs HDMI or Displayport. You could run an HD resolution on a CRT monitor with just a VGA cable 20 years ago. Why did we change these things? I'm sure that they would eventually not be enough, but it seems like we changed them decades before it was necessary.",
"In addition to what everyone else said Ethernet cables are usually solid core wire which doesn't flex very well and would probably work harden and break pretty quick when put in the same usage conditions as a USB cable for a phone or something. The RJ45 connector is also much larger and less durable than any of the standards you mentioned.",
" > can be hundreds of meters long\n\nUh... No? They start to degrade the signal after about 300 feet; which is just under 100 meters. It's gonna be the same for any copper cable.\n\nSource: I install internet for a living. After 300 feet of cable, we have to use switches or repeaters then run more cable from that. Though typically, if we have to move it more than 300ft, we just use a PTP system to deliver it wirelessly.",
"Besides the bits explained already, the biggest advantage HDMI had over other connection forms was that it was built to be HDCP-ready. IE, it was more about control than technical specs."
]
} | []
| []
| [
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[
"https://www.hdmi.org/spec/hdmi2_1"
],
[],
[],
[],
[],
[],
[],
[
"https://www.amazon.com/Q4Tech-Ethernet-Adapter-Extender-Sockets/dp/B01N99EYH7",
"https://www.amazon.com/Converter-MACTIS-Ethernet-Adapter-Female/dp/B074P2SSLX",
"https://images-na.ssl-images-amazon.com/images/I/71FYdynJYsL._AC_SX466_.jpg"
],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[]
]
|
||
2i4ze3 | how do the moon's phases work | I have heard so many conflicting views and evidence I don't know what to believe. | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2i4ze3/eli5_how_do_the_moons_phases_work/ | {
"a_id": [
"ckyv4uv"
],
"score": [
2
],
"text": [
"The bright part of the moon is simply light reflecting off the sun. So the phase completely depends on the angle between the sun, earth, and moon. So you'll notice on a night with a full moon, the moon is approximately on the complete opposite side of the earth. During a new moon, it's approxmiately in the same area of the sky as the sun. All other phases are simply breaking down the angle. If the sun-earth-moon angle is acute, it'll be a crescent. If it's obtuse, it'll be a gibbeous. At a right angle, it's a half moon.\n\nedit: I say approximately, as they don't always line up perfectly. When they do, we get an eclipse."
]
} | []
| []
| [
[]
]
|
|
3x37yd | what is so special about the blu-ray format? | What is it that makes Blu-Ray Blu-Ray? And what differs it from regular 1080p video? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3x37yd/eli5_what_is_so_special_about_the_bluray_format/ | {
"a_id": [
"cy12u5z"
],
"score": [
7
],
"text": [
"Blu Ray isn't a type of video. It is a type of data storage system.\n\nBlu-Ray just uses lower wavelength (bluer) light in the laser it uses to read the disk when compared to a DVD. This lets the system read smaller spots on the disk. The ability to read smaller spots means that a disk of a given size can have more distinct spots (more memory) using blu-ray than using a typical DVD system. The ability to have a single disk with much more memory lets us fit long stretches of high quality video (e.g. 1080p) on a single disk."
]
} | []
| []
| [
[]
]
|
|
f12kb | I've always wondered: if I am in an airplane that is traveling JUST under the speed of sound, and I sprint down the aisle, would I break the sound barrier? | I know this sounds like a "troll physics" suggestion and I'm SURE there's some obvious loophole I'm missing, but I know that if I am driving a car at x speed and hit a tree, causing the car to immediately stop, I would continue traveling at x speed (at least momentarily).
Likewise, in an airplane traveling x speed, are not the passengers, in reality, also traveling at x speed? Thus, if the plane were to maintain a speed just below the sound barrier, wouldn't a person sprinting down the aisle break the sound barrier?
I'm sacrificing my intellectual pride (even though I am by no means a scientist) to finally obtain an answer to a question that has long puzzled me.
EDIT: Thanks, everyone. It makes perfect sense to me now. Basically, you WOULD be breaking the "sound barrier" from the perspective of someone on the ground, but you wouldn't cause a sonic boom, because you would need to move faster than the sound waves WITHIN the airplane (so I would need to run down the aisle at 769 mph, IN ADDITION to whatever speed the plane would be traveling [just below the speed of sound in this case, but that's irrelevant]). I did actually know that the pressure around the plane caused the sonic boom, so I never really believed running down the aisle would have caused one, but I couldn't have explained why. It's nice to know I wasn't completely off base. I WOULD, in fact, be running faster than the speed of sound, in general (from the perspective of an outside observer), even if I weren't actually breaking the sound barrier within the plane.
I appreciate the answers, though I shouldn't have asked this while at work, because I spent a lot of time reading all of the answers and Wikipedia entries provided, and thinking up additional stupid scenarios (e.g. "So, if I were driving a convertible just below the speed of sound, and were to bang my head particularly vigorously, my head would cause a sonic boom and break the sound barrier, while the rest of my body would not...). | askscience | http://www.reddit.com/r/askscience/comments/f12kb/ive_always_wondered_if_i_am_in_an_airplane_that/ | {
"a_id": [
"c1ch900",
"c1chbgp",
"c1chcup",
"c1chz63",
"c1ci0qt",
"c1cifwp",
"c1cjlpa",
"c1cjqqd"
],
"score": [
100,
34,
4,
9,
2,
2,
2,
2
],
"text": [
"No because the air that you're in is moving as fast as you are so your person is never near the speed in its immediate surroundings to break the sound barrier.\n\nNow if you were on the wing or top of said aircraft somehow and could run against the wind, I hypothesize that you would break the sound barrier. ",
"The \"sound barrier\" is merely the speed of sound... or ~340 meters per second.\n\nIf your plane is going 339 m/s and you run down the aisle at 1 m/s in the same direction as the plane is going in... congratulations, you've broken the sound barrier.\n\nBut I suspect what you're thinking of is sonic boom, and that would not happen. From wikipedia:\n\n > When an object passes through the air, it creates a series of pressure waves in front of it and behind it, similar to the bow and stern waves created by a boat. These waves travel at the speed of sound, and as the speed of the object increases, the waves are forced together, or compressed, because they cannot \"get out of the way\" of each other, eventually merging into a single shock wave at the speed of sound. This critical speed is known as Mach 1 and is approximately 1,225 km/h (761 mph) at sea level and 20 °C (68 °F).\n\nThe hull of the aircraft you're traveling in is what is going to be subject to those pressure waves. Being inside the cabin, you're not subjected to the same forces the outside of the aircraft is. So you won't generate a sonic boom.\n\nEDIT: Forgot two words",
"Here's a really shit answer:\r\n\r\nYou would have to be going faster than the sounds you are making yourself to make a sonic boom.\r\n\r\nSound is the energy of the air molecules dancing about, the speed of sound is the rate at which that a dance is propegated to neighbouring molecules.\r\n\r\nIf the nose of a jet makes a noise and that propegates at 10 molecules a second and before the dance is spread ten molecules in radius the nose is already there at number 9, number 9 gets twice the dance. By 50 the dance will be an outright hootenanny. \r\n\r\nInside the plane the air is travelling and dancing at the same relative speed to you as it would be anywhere without a breeze.\r\n\r\nThese should do the trick, read in this order:\r\n\r\n_URL_1_\r\n\r\n_URL_2_\r\n\r\n_URL_0_\r\n\r\n\r\nInterestingly, as the sonic boom proves an object has gone faster than sound, feedback through a microphone and speaker proves electricity has gone faster than sound. A noise is made, recorded and played back over the sound itself and they add together and increase in frequency/amplitude until it's at the threshold of the devices.",
"Furthermore, we are all technically traveling faster than the speed of sound right now. Someone orbiting space would see you spinning below. Someone standing on the sun would see the earth rotating around the sun. Someone in another galaxy would see our solar system whirling through space.\n\nIt's all relative. As others have mentioned, the sonic boom effect happens because you are traveling at the same speed as the sound you are making.\n\nHere's how I like to explain it. Imagine you have a bunch of little toy robots that make noise. They walk with a speed of 2 mph. If you set them down periodically, one by one, someone standing on the other side of the room would hear the slow steady roar of these robots. Now, If you keep setting them down periodically but you are walking in the same direction at a speed of 2 mph you'll be surrounded by noisy robots. Once you get to that person across the room it's going to be really loud all of a sudden. That's how a sonic boom works.",
"What you're referring to is called [transonic flight](_URL_0_), where parts of the aircraft have broken the sound barrier, and other parts haven't.\n\nAn easy to understand example would be a helicopter flying near the speed of sound where the portion of the rotors moving in the direction of flight are going faster than sound, and the other bits aren't. This is bad, so it doesn't happen much.\n\nIn your example, you're completely shielded from the outside air, so your speed doesn't matter. Nothing will happen, though the stewardess might give you a look.",
"You will be moving faster than sound as measured from the ground.\n\nYou will not move faster than sound as measured from your plane seat (or the air inside the plane).",
"You mixed up i.e. and e.g.",
"It's easier to think about it in terms of reference frames. The air in the airplane is traveling the same speed as you are, so you wouldn't break the sound barrier."
]
} | []
| []
| [
[],
[],
[
"http://en.wikipedia.org/wiki/Sonic_boom",
"http://en.wikipedia.org/wiki/Doppler_effect",
"http://en.wikipedia.org/wiki/Sound_barrier"
],
[],
[
"http://en.wikipedia.org/wiki/Transonic"
],
[],
[],
[]
]
|
|
20gj0v | Can a beam of light bend if the source rotates or moves in the same way water does from a rotating sprinkler? | askscience | http://www.reddit.com/r/askscience/comments/20gj0v/can_a_beam_of_light_bend_if_the_source_rotates_or/ | {
"a_id": [
"cg3nxvm"
],
"score": [
2
],
"text": [
"I am as far from an expert on this subject as you can get, but I'm pretty sure that once water or a laser beam, or any other sort of \"stream\" of particles or molecules leaves whatever source releases it, the source no longer has any effect on it. The water stream bends because gravity pulls it down, and it only seems to turn with the sprinkler because more water is constantly being released. The water that already was released remains on the same trajectory as which it started.\n\nLight beams can be \"bent\" or redirected by objects in their path, but any motion of their source after they have left it should have no effect on them whatsoever."
]
} | []
| []
| [
[]
]
|
||
1hs9zm | i'm 27 and i'm starting to notice something. are adults looking and acting younger? or is it my perspective on age that's changing? | As I become more of an adult I see what seems like grown people look less like grown people to me. A forty year old looks a lot younger than what a forty year old looked like to me at fifteen. Even when I look at older pictures of forty year olds from the past they look older. Not that I don't see forty year olds who look run down and disinterested in life (something I used to assume they all were).
Not only that, but it seems like more adults are into things I used to associate with young people. Sometimes it seems like more than ever people are trying to hold on to that feeling of nostalgia and being young. Is it a cultural thing? I've heard many people talk about the divide between baby boomers and adults over 45 and those like me under 45.
Or is it my own changing perspective of age as I get older? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1hs9zm/eli5_im_27_and_im_starting_to_notice_something/ | {
"a_id": [
"caxdu3l",
"caxdyci",
"caxed42",
"caxh0ce",
"caxia3y",
"caxj8lm",
"caxllne",
"caxm7x9",
"caxmd1q",
"caxmkvd",
"caxmxlf"
],
"score": [
6,
70,
3,
2,
3,
31,
3,
12,
6,
6,
3
],
"text": [
"That's just ageing. Everyone notices that sooner or later. I'll be 40 this year, and the local university students look like they shouldn't even be able to drive yet. I can remember thinking my parents were old at an time when, in retrospect, they were a fair amount younger than I am now. Then again, that might have been the 70s and 80s fashions :)\n\nDon't worry about it :)",
"I think it's the fact that you're aging. I'm in my early 40's and I see little kids driving cars and working, having spouses and even babies! Little kids I say.\n\nThe \"hot\" young guys look like *potentially* hot men. I don't look at them and think, \"Hmm, I could eat him up.\" Instead, I think he will be a good looking man when he grows up.\n\nI look in the mirror these days and wonder who the heck is looking back at me, and where this roll of belly fat came from (cause my size 0 jeans don't fit for the first time in my life). \n\nI see men in their late 40's, with gray hair and wrinkles, and I think of them as the opposite sex instead of my dad's buddies.\n\nI read what utes say about politics on the internet, and chuckle because I used to think that way too.\n\nYou're only 27. Just wait, it gets funner! (Ok, not really funner...)",
"Tastes change over time, and often those tastes associated with \"young\" people get locked into a set of ages and are just carried on through. Rock n' Roll is generally now considered something older folks listen to. But, long ago, it was considered soemthing radical and only young folks listened to it. Tastes in clothing do tend to get \"older\" but this is also a function of taste. Most of the things common to a generation are created during that generations teens and early twenties. \n\nCurrently thirty-forty somethings play the most video games. Younger kids are picking them up, but often not the same kinds. \n\nWho knows what kids will pick up in twenty years. ",
"Your perspective is changing. Do you remember TGIF, I know right!! ",
"It's two things, the first is fashions are changing. You look at top hats and think they were always an older person's style or white wigs and in fact they were the height of fashion even for young people, now it's...oh blast what do the young people wear these days? Eh Hardy and backwards caps. The second is that the people you identified as old are only looking older to you now as you both age so your visual clues of what old looks like is progressing while your internal view of yourself is more or less staying still except for the aha moments where you look in a mirror and say \"Where the fuck did that come from?\"",
"I think that you associate things you did as a kid as things children do, but really, you keep doing those things as you get older, and the new generations have new fads. \n\nFor example: I am 36, and all my friends still play video games and listen to rap music. As a child, I would have never expected to see full grown adults doing those things. My dad, who is 65, hunts and fishes for fun, and listens to country music, which is what he was doing 30 years ago. But he also did those things as a kid, because they didn't have video games or rap music. My friends kids are wearing skinny jeans and listening to dubstep. They will probably be doing that into their 30s, and then into their 60s. ",
"Opinion having also noticed this as well. I think its a combo of things. What we perceive as attractive matures as we do making younger generations appear too young to be as appealing as they used to be (to most). People stay indoors more often and wear more sunscreen making the aging process a bit more forgiving than it used to be. What we do as kids/teenagers are seen as things kids do only but we take some of it with us (yay video games!), making it more of a generational thing later on. Nostalgia happens to everyone but because the generations that are just starting to have these feelings (30 somethings) are more widely integrated into social media than those before them its more easily recognized by the public now than it was before.",
"It's your perspective. I'm 63, and every damn cop in the country looks like an adolescent with a gun. On the other hand, the range of beautiful women keeps increasing. (While my interest decreases.)",
"Culture changes over time. When you're young, the 'equilibrium/balance point' of the dominant culture around you is many years older than you are. But as you get older you converge on that balance point until you look around you and feel like the world seems to mostly reflect your own values. And then you diverge from it as you continue to age and you may start complaining about 'the youth of today...' \n\nIt's not that old people are acting younger. It's that your youth (that defined your values) is now shared by many more people and you feel more affinity with them. ",
"I think part of this is due to social media...follow me for a second. People in their forties and fifties are more in contact with newer fads and styles because they are plugged into FB and Twitter just like their younger counterparts. They aren't disconnected from younger social circles immediately after high school/college like they were fifty years ago. A person in their forties now has similar clothing fashions and hair styles as a person in their early twenties.\n\nAdditionally they have grown up with similar technologies and are attuned to current advances the same, or maybe more so, as younger generations. A forty year old may be more capable of affording the newest iPhone than someone starting out in their twenties. Having access to the newest, most advanced gadgets would be inspiration to stay on top of what said gadget can do. When I was younger, people twenty years older than me swore by older tech...like VHS and cassettes. Now they have the cool new stuff and know how to use it. ",
"* you are getting older, and your perspective is changing\n* adults tend to be more responsible and act more grown up around children and especially teens\n* society is becoming less formal\n* people are waiting longer to have children, and having less of them\n* every generation takes things associated with their childhood and tries to bring them into their adulthood...my dad likes to watch Bugs Bunny cartoons, I still play video game"
]
} | []
| []
| [
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[]
]
|
|
4ja8zo | how can margins of error be trusted? | I am not sure how to explain this. I was recently in a wiki hole when I came across two different measurements of Pluto's diameter.
< > Current New Horizons Measurement puts Pluto at 2372±4 km
"After New Horizons measured Pluto's diameter as 2372±4 km in July 2015, it was determined that Eris is slightly smaller in diameter than Pluto.[25]"
_URL_1_
< > In 1993 Millis put it at 2306±20
"The correct interpretation of 2306 +/- 20 km is that 2306 km is the most likely value, but, within a certain range of probability, the value could be as low as 2286 or as high as 2326 km"
_URL_0_
There is clearly a conflict. What was the point of even putting a margin of error?
*edit Sources | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/4ja8zo/eli5_how_can_margins_of_error_be_trusted/ | {
"a_id": [
"d34zy4j",
"d350njv"
],
"score": [
14,
5
],
"text": [
"The margin of error isn't \"We know we're only possibly wrong by this much\" it's \"This is the known accuracy of our instrument under what we believe are operational conditions.\"\n\nYou can still be wrong.",
"Physics has certain ways to calculate uncertainties such as that.\n\nLet's say you've got a ruler and you use it to measure a piece of wood. Your ruler has 1mm divisions in it, and the piece of wood comes up to the line marked \"195mm\". Now, because the smallest division your ruler has is 1mm, it could be anywhere between 194.5mm or 195.5mm. Without using a more precise tool, you can't get more accurate than that, so you record the length of your piece of wood at 195.0mm +/- 0.5mm. \n\nBut let's say you buy a new, more expensive ruler. The first thing you notice is that your old ruler was marked wrong. It should actually have said 200mm. The divisions in your new ruler are the same, so you say the length of your piece of wood is 200.0mm +/- 0.5mm. This is outside the original uncertainty in your first measurement, but that's because you had no way of knowing that it would be that inaccurate.\n\nSo yeah. In physics, uncertainties tend to be more about how good your measurement tools and techniques are. "
]
} | []
| [
"http://www.mikebrownsplanets.com/2010/11/how-big-is-pluto-anyway.html",
"https://en.wikipedia.org/wiki/Pluto#Mass_and_size"
]
| [
[],
[]
]
|
|
3vgiyq | in the u.s. why are female locker rooms (showers etc.) so private when male locker rooms are almost always wide open practically forcing young boys and men into group showering etc.? | I work in schools a lot, from middle schools to colleges, and I am yet to see a female locker room with the wide open, group shower situation as the boys/men. In fact, I have been in over 200 locker rooms in the past 2 years and have not seen a single locker room, for boys or adult males, that gives the privacy that females get, which is almost always private (I have seen one that isn't and this school was old as hell).
So why the hell do we do this in the US? Especially making Jr. High boys shower together side by side like it's jail. And student athletes are almost always required to shower before they leave. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/3vgiyq/eli5_in_the_us_why_are_female_locker_rooms/ | {
"a_id": [
"cxnc5c2"
],
"score": [
4
],
"text": [
"As a guy who found the shower situation in highschool to be extremely awkward, I think men are just raised to be cool with it. I was never cool with it but my class mates had absolutely no problem with it. I was unaware the girls showers were different. We had a square room with shower heads lining the walls, I thought it was normal and I was the weird one for not being okay with it."
]
} | []
| []
| [
[]
]
|
|
465wv3 | what will happen with opec planning to halt production? how does it affect oil prices? who is winning and losing? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/465wv3/eli5_what_will_happen_with_opec_planning_to_halt/ | {
"a_id": [
"d02p8zz",
"d03p80g"
],
"score": [
2,
2
],
"text": [
"No one is planning to halt production. Saudi Arabia and Russia have agreed to freeze production at current levels. Considering Russia is already running 100% production and Saudi Arabia is damn near 100% and neither Iraq nor Iran will agree to the freeze it is unlikely to mean much of anything.",
"Picture this oil gig as one big race, where different oil producing nations are runners.\n\nRight now, some nations are much faster than others - because they can produce at lower costs. Saudi Arabia (the Usain Bolt of oil production) and Iran (also probably very fast - and a newcomer to the race- previously kept out by sanctions, who is going to run extra hard in an effort to catch up) just about lead the pack. Also, they *really* hate each other, which means both are very keen for the other not to win and would love to see their enemy fail.\n\nBut neither of them are going to agree to slow down and allow their slower rivals to catch up and possibly overtake them. They both want other nations to drop out of the race because global interest in this race is waning (fewer people can afford to go, and people are starting to test out other sports - which may someday render the oil race obsolete). Both Saudi Arabia and Iran want fewer nations in this race, to increase their own chances.\n\nAny country that slows down (by cutting production) right now risks being left far behind - and during a similar race in the 80s this is exactly what happened to Saudi Arabia. It was part of a team (OPEC) and they all agreed to run at similar speeds, except it turned out all but the Saudis cheated, and so the Saudis were left far behind in the dust. They ran like mad to catch up, and eventually overtook the others and regained their position, at great cost (oil plunged to $10 a barrel - down from over $100).\n\nSo - no one is going to agree to a cut (they haven't actually agreed to anything in this \"historic OPEC/Russia summit\" except to \"freeze production\" at already record highs and only if Iran comes to the table. Iran has made certain comments suggesting it \"supports\" the deal, but won't participate in it - which is really just waffle. They're really just saying they don't disagree with it - and what could they do if they did? They 'welcome' the deal but have no intention to be part of it, and will not cap their own output, which is about to flood an already flooded market. So we are *firmly* on square one - and if anything we've gone backwards as it very firmly demonstrates an agreement on this is a pipe dream). Really all any of these countries agreeing to a freeze have done (and by the way they've only agreed to one if other countries agree) is rephrased \"we're not going to cut production\" and paid a bit of lip service to their competitors. Also, even if all of OPEC and Russia did freeze, that's a whisker over 50% of the global market - so if other countries don't agree to cut (and let's face it, that's not feasible) nothing useful will come of this but those countries who refuse gaining ground.\n\nCountries like Russia and Venezuela are only calling for a cut now because they are some of the slower members in this race, and are dangerously close to falling behind their break-even prices. And at the end of the day, none of that matters - because a race is a race. Saudi Arabia and Iran would be beyond stupid to slow down now. They want to win."
]
} | []
| []
| [
[],
[]
]
|
||
62w1df | why aren't our pupils always dilated so that we see more all the time? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/62w1df/eli5_why_arent_our_pupils_always_dilated_so_that/ | {
"a_id": [
"dfphwys",
"dfpir6t"
],
"score": [
34,
3
],
"text": [
"Stare into a bright light. How much can you see?\n\nWhen your pupils dilate it is to allow more light into your eyes. Letting in more light in dark situations helps you see better, but letting in more light in a bright situation makes it harder to see and can damage your eyes.",
"Pupils dilate to let more light in, that only means you see more if you are in an area with dim lighting. If you are in an area with bright lighting it means you will see less because you will be blinded. "
]
} | []
| []
| [
[],
[]
]
|
||
6rq8s0 | how can there be cameras with large resolutions like 42mp and be just a couple thousand dollars, yet a video camera of that resolution be $40-70,000? why does it seem to be so much more difficult to make? | I'm comparing something like the a7rii vs a RED Helium. | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/6rq8s0/eli5_how_can_there_be_cameras_with_large/ | {
"a_id": [
"dl6ypte",
"dl733tn",
"dl74rv2"
],
"score": [
6,
2,
2
],
"text": [
" Take your phone into a dim room and take a picture. Now take a video. The picture will be brighter and more detailed even though it's using the exact same sensor. It requires a lot more light sensitivity to take 30 pictures a second than one picture. \n\nIt also takes a lot faster data transfer. (Even if you set your phone to save photos on an SD card, videos will still be recorded on the faster phone memory and transferred later) one photo can fit on a small memory chip and slowly transfer to the removable card. A video doesn't have that luxury because there are continual pictures coming. ",
"Sensor size isn't the most important feature of a camera. The optics and the data processing are typically more important. As evidenced by OP's question, large sensor sizes can be made relatively inexpensively but the rest of the features are costly.",
"Sensor size + quality (greatly contributes to how much light is being captured by camera), DRAM (How many frames you can shoot per second: the camera has to process the images, so you can't take 5000fps videos even if your smartphone can have a shutter speed of 1/5000s)\n\nRED is also known to be quite expensive"
]
} | []
| []
| [
[],
[],
[]
]
|
|
681wvm | How wide are rainbows if we consider all wavelengths? | askscience | https://www.reddit.com/r/askscience/comments/681wvm/how_wide_are_rainbows_if_we_consider_all/ | {
"a_id": [
"dgwgyw5"
],
"score": [
2
],
"text": [
"This has been asked before: _URL_0_\n\nThe gist of it is that water absorbs most light below about 200nm and above perhaps 2000nm, so the edges of the rainbow beyond the visible spectrum start to get dimmer. "
]
} | []
| []
| [
[
"https://www.reddit.com/r/askscience/comments/1iatme/do_rainbows_have_ultraviolet_and_infrared_bands/cb2pspf/"
]
]
|
||
au1umt | why dont car batteries need recharging? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/au1umt/eli5_why_dont_car_batteries_need_recharging/ | {
"a_id": [
"eh4yuig",
"eh4yye9",
"eh4yz41",
"eh4z2sd"
],
"score": [
5,
2,
2,
2
],
"text": [
"The alternator uses engine power to charge it while you’re driving. So it is being recharged, but you don’t need to plug it in. ",
"They actually do have to be recharged, and they get recharged while the car is running by a belt moved by what's called the \"alternator\". \n\nHere's a video made by an overly excited guy who does a really great job explaining everything in more detail: _URL_0_",
"The alternator recharged them but it works by converting the engines movement into electricity to charge the battery. Which is why the battery can die if you leave your lights on while not moving",
"The engine constantly charges them while driving along. As long as you have a decent battery and don't leave electrics running for long periods while stationary that's enough to keep it fully charged. "
]
} | []
| []
| [
[],
[
"https://www.youtube.com/watch?v=nuLl_Z9_T9E"
],
[],
[]
]
|
||
8tpl4i | AskScience AMA Series: I'm Andrew Revkin, the strategic advisor for environmental and science journalism at the National Geographic Society-AMA! | Hi, my name's Andrew Revkin and I've been writing about global environmental change and risk for more than 30 years. I've reported from all kinds of places, including the North Pole, the White House, the Amazon, and the Vatican. Before becoming a strategic advisor at the National Geographic Society, I worked at the nonprofit investigative newsroom ProPublica and the New York Times.
You can read about my long climate journey in this Twitter thread: _URL_0_
And my latest piece for National Geographic Magazine here: _URL_1_
Another interesting tidbit, here's an article about the moment in 2009, when Rush Limbaugh suggested I "help the planet by dying" _URL_2_
I'll be on at 12pm EST (17 UT), AMA!
| askscience | https://www.reddit.com/r/askscience/comments/8tpl4i/askscience_ama_series_im_andrew_revkin_the/ | {
"a_id": [
"e199794",
"e199a55",
"e19cyde",
"e19e99s",
"e19ebmn",
"e19eo5b",
"e19evsr",
"e19flq6",
"e19g0i8",
"e19g1s3",
"e19hstj",
"e19jukd",
"e19latw",
"e19ne6n",
"e19qjqe",
"e19r374",
"e19td9a",
"e19vsgs"
],
"score": [
12,
6,
8,
6,
5,
4,
3,
6,
3,
5,
2,
2,
2,
2,
2,
2,
2,
3
],
"text": [
"I feel like [this article](_URL_0_) from 2010 was a wake-up call to the poor state of science journalism. Do you think things have gotten better or worse since then?",
"How, from your experience, has the awareness and care about the climate and the environment changed in individuals over the last 30 years? Is the amount of people (even very influencial ones) saying climate change is a hoax an increasing trend, or is that just an effect of the current means of communication that has made it so much easier for people to reach an audience with their (informed or uninformed) opinions? (To illustrate, until about 5 years ago i had never heard anyone question climate change). Thank you for your work and doing this AMA, in my humble opinion you are definitely worth more to the environment alive than dead if it is any consolidation. ",
"What is one thing that regular people don't realize is a major problem and what can they do to help solve it? ",
"What’s a very special element of your job that not many other jobs have? ",
"How has Fox's purchase of NG affected the culture? Have we missed out on any stories due to the new management rejecting certain narratives? ",
"Can you describe the planning and bureaucracy that has gone into your work, and/or the major complications that prevent you from doing more for your work?\n\nWhat research/ers do you have an ill bias towards and why?\n\nEveryone’s heard of global warming and climate change, but as someone who hasn’t been well informed, what significant changes and/or developments have been found that aren’t highlighted enough in media, and can you provide names or links to find out more about them?",
"The chlorofluorocarbon ban shows that the world *can* come together and really do something - the ozone hole is recovering. What do you think is the chance that something similar will happen with climate change in the next decades?",
"What are some of the most drastic changes you’ve seen over your years of reporting, either in terms of environmental changes or attitudes towards the environment? Has anything surprised you? ",
"Hi there, thanks for doing this AMA! After 30 years in the field, where do you think the future of climate change and environmental communication is headed, especially as we continue into tougher times?",
"What would you most like to tell us that no one has asked about? ",
"Do you think journalists should be neutral or objective?",
"Who's been your favorite climate scientist to interview over the years and why? What makes for a good interview in your opinion?",
"I think for many scientists, science journalism is an important part of making the case for the necessity and importance of science to the public; which hopefully motivates science funding \n\nWith the changes to journalism and print of the past two decades (social media, shifts in funding structure, decline in total market), do you think the realtionship between scientists, science journalists, and the public has changed? Does it need to evolve further? I would love to hear how you percieve both the upsides and the downsides of how these relationships have evolved.",
"What is the single most impactful thing I can personally do in the fight against climate change? ",
"What was the most effective thing you've done that you think changed people's minds about a science issue? \n\nOr--what's the most effective thing you've seen, that should be replicated on other hot [so to speak] topics?",
"I see this as a hopeless, unsolvable problem. Too many of the global-scale changes that apparently need to happen immediately would result in entities accustomed to making billions and billions and billions and billions of dollars from fossil fuels having to settle for merely making billions and billions and billions.",
"Do you think we will be able to solve the problem of climate change , and how we should do it ? And what must be the responsibility of current journos and social media influencer in the same ?",
"Thanks, all, for tuning in. Here at the Aspen Ideas Festival, I have to go interview Brock Long, the director of FEMA. Stay in touch via @revkin on Twitter or follow [me on Facebook here.](_URL_0_)"
]
} | []
| [
"https://twitter.com/Revkin/status/994752818287439872",
"https://on.natgeo.com/2IiICR4",
"https://www.npr.org/templates/story/story.php?storyId=114029917"
]
| [
[
"https://www.theguardian.com/science/the-lay-scientist/2010/sep/24/1"
],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[],
[
"http://fb.com/andrew.revkin.5"
]
]
|
|
24jiw1 | What kind of sounds does a human fetus hear in the womb? | I imagine a lot of low thrumming sounds and muffled environmental sounds.
Would it hear anything that sounds like white noise, a vacuum, or a hair dryer?
Would it hear any high frequency sounds? | askscience | http://www.reddit.com/r/askscience/comments/24jiw1/what_kind_of_sounds_does_a_human_fetus_hear_in/ | {
"a_id": [
"ch7v92k",
"ch7w9zf"
],
"score": [
201,
48
],
"text": [
"Babies hear the lower end of the frequency spectrum when they're in the womb. They can get a lot out of that, though. Byers-Heinlein 2010 presents some compelling evidence that newborns of bilingual mothers actually come out of the womb with an ability to distinguish their mother's two languages. They can do that because even when you filter out frequencies above 200-300 Hz, the frequencies that really contain most of the information we need to process speech, there is still find a lot of stuff particular to certain languages or speakers. You can distinguish between voiced stuff (vowels, consonants like d, z, n, r, l) and not-voiced stuff (consonants like t, s). You get intonational contours and pause durations, too.",
"Human fetuses are basically floating in a shallow pond, so sounds are filtered both by the abdominal wall and the impedance difference between air and water. In effect, they are living in a low-pass filtered environment. (This is why as rusoved noted, they can hear voiced sounds, but not unvoiced sounds. Voice sounds have most of their energy in lower frequency harmonics near the fundamentals.) This allows them to hear either very loud lower frequency sounds from the external environment, or similar frequency sounds (but with a much broader sensitivity range) coming directly from the mother. This includes some speech sounds, respiratory and heartbeat sounds and other internal sounds like borborygmy. \n\nHowever they absolutely *cannot* hear ultrasound. Ultrasonic examination uses sounds in the megacycle range. The \"swimming away\" motion referred to by opalrising has nothing to do with hearing and if it happens at all may be due to deformation of the uterine wall from pressure."
]
} | []
| []
| [
[],
[]
]
|
|
3j99br | Concerning the SR-71 Blackbird: What did the USSR know about the plane? What did they think it was capable of? Did they attempt any similar designs of their own? | Specifically:
1. What did the USSR know about the plane and its capabilities? Did they believe it also functioned as a nuclear bomber / space plane / experimental weapons platform? Did they vastly overestimate its speed and ceiling or other capabilities?
2. Many Soviet plane designs often take after US bombers and fighters. Did the Soviets ever attempt to develop their own high altitude reconaissance planes, especially one of similar construction?
3. What did the average Soviet soldier or citizen think the plane could do? Would they even be aware of its existence? To some extent, were they afraid of it / what it could do at all?
4. What rumors, if any, were circulated about the plane, either by Soviet soldiers (such as those who would fire missiles at it, who would then see it escape the missile and begin to wonder how it missed) or perhaps by US spies (who could spread disinformation, like the plane being able to fire nuclear missiles, etc.)?
(One caveat, I do not know the timeline for when the Blackbird was revealed to the public. I know it was retired under Clinton around '95 but was started in the late 60's)
Thank you for your answers | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/3j99br/concerning_the_sr71_blackbird_what_did_the_ussr/ | {
"a_id": [
"cungfg6",
"cunmoh0",
"cunw6h4"
],
"score": [
38,
706,
49
],
"text": [
"You might consider asking r/aviation too.",
"Finally something I can help answer! My senior thesis was done on the A-12 program. \n\nSo firstly, I need to mention that the SR-71 was a variant of the A-12 Oxcart program developed by Lockheed for the CIA. Most of my information is coming from the development of the A-12.\n\nFor your first question. The USSR was aware of the capabilities of the SR-71 as a result over overhead satellite reconnaissance that the Soviet Union carried out over important military installations. In this case being the Nevada Test and Training Range and Groom Lake. Around 1964 the Ambassador to the USSR in Moscow was given a sketch of the A-12's top down silhouette that had been drawn after space based infa-red cameras had gotten a picture on the runway. (Interesting note. The ground crews would draw absurd plane shapes on the runway and heat them up with lamps to mess with Soviet intelligence when the A-12 project was temporarily grounded after this incident) \n\nThe soviets also had a trawler monitoring A-12 reconnaissance flights leaving Japan during overflight of Vietnam and North Korea during the USS Pueblo incident. The Advanced notice of the trawler allowed SAM crews in Vietnam to successfully track the A-12s overflight even though they couldn't engage it.\n\nCan't speak on 2 or 3 because I don't know that much about soviet black projects. But there was an incident before the Gary Powers shoot down where Khrushchev threatened to shoot down the next U-2 that the CIA sent over Russia.\n\nStealth edit while I sit in the waiting room of the dentist. There actually was a nuclear interceptor variant of the blackbird ordered by the air force known as the YF-12 that would have carried 2 nuclear weapons. The initial order of 12 was either included in the first batch or SR-71s or canceled in favor of the 71. Its difficult to find any information on them other than that it was planned.\n\nSources are from the Official CIA release of A-12 program documents. [link](_URL_0_)\n\nI will be happy to answer other questions relating to this wonderful plane. \n\n",
"Modified from an [earlier answer on Soviet aerial reconnaissance](_URL_0_)\n\nCompared to the US, the Soviets' recce aircraft were largely converted or modified versions of frontline aircraft. The Yak-25RV, for example, took the Yak-25 interceptor and added a longer straight wing for high-altitude reconnaissance. The resulting aircraft was less than satisfactory; its interceptor engines were too overpowered for the type of high-altitude work and could easily push the Yak-25RV past its safe speed limit. Yet for most of the 1960s the Yak-25RV was the only dedicated reconnaissance aircraft the Soviets deployed. It saw action over the Soviet borders in China, India, and Pakistan and Yak-25RV units were stationed in East Germany and Hungary, although they probably never overflew West Germany. The Soviets also modified Tu-16 bombers to serve as reconnaissance role. Two of the Badgers actually overflew a portion of southwest Alaska in March 1963 which prompted a the US to strengthen Alaska's air defenses. Tu-16s also performed maritime reconnaissance in the Atlantic and over Egypt. The Mikoyan-Gurevich OKB also developed several tactical reconnaissance versions of the MiG-21 with uprated engines. Because of the the limited size, these MiG-21s often had their recon equipment stored in a streamlined belly fairing. These versions of the venerable MiG became some of the backbone of tactical reconnaissance and saw action throughout the 1970s and 80s in the Middle East and in Afghanistan. In the former case, Arab pilots usually flew these missions, but sometimes the job would fall on the shoulders of Soviet advisers.\n\nThe most capable recon platform deployed by the Soviets was the multiple versions of the MiG-25. Unlike the Yak-25RV, the virtues of the MiG-25 as an interceptor greatly enhanced its role as a fast short-range reconnaissance aircraft. Development converting the Ye-155 into a reconnaissance aircraft started in 1961 and the lower nose had a interchangeable payload for different missions like photo recon or signals intelligence. The initial version, the MiG-25R, deployed to Egypt in the aftermath of the Six-Day War to give Egypt a strategic reconnaissance asset. Some commentators claim that early versions of the Foxbat might have flown over the Israeli Dimona nuclear reactor in May 1967. But Michael Oren argues that the aircraft in question were MiG-21s, while the book *Foxbats over Dimona* cites interviews that claim they were MiG-25s. That assertion rests on relatively thin evidence, especially given that had they been Mig-25s, they would have been prototypes of the reconnaissance models as the Soviets were still undergoing flight-testing at this stage. The famous July 1967 Moscow flypast were all relatively new prototypes. The later detachment to Egypt was a dedicated reconnaissance unit, the 63rd Independent Air Detachment (Det 63), and manned by experience Soviet personnel. Det 63 started sorties over Israel and the Sinai in May 1971 and evaded Israeli defenses, prompting a complaint by Israel to the UN about Soviet overflights. Det 63's successes was a vindication for the MiG-25 program and added impetus to developing the MiG-25R into a dual reconnaissance-strike aircraft, the MiG-25RB/K/RBSh. The Soviets would export MiG-25Rs to several client states and they saw action there. Iraq's MiG-25s provided the Iraqis much needed intelligence prior to its invasion of Kuwait. The Soviets also used the MiG-25 as in Afghanistan as well as patrolling the Soviet border and monitoring the Chinese.\n\nDespite these developments, there were a number of factors that mitigated against a manned reconnaissance program on the scale of the USAF and CIA. One problem working against the Soviets was a technological gap in aerospace. Although this narrowed over time, Soviet aerospace could not produce the aircraft with the performance (speed and range) equivalent to their US counterparts. For example, the MiG-25 became the basis for the main reconnaissance aircraft, and while its speed approached SR-71 levels, the MiG's range was quite terrible compared to either the U-2 or SR-71 (and to be fair, the MiG-25 was designed for a different purpose). The Soviets never developed the tanker infrastructure to support the global operations undertaken by the US. \n\nThe Soviets at one point in the early 1960s had an equivalent to the SR-71 in development, the Tsybin RSR. While not quite as bleeding edge as Lockheed's aircraft, the RSR was a large dedicated strategic reconnaissance aircraft. But the Tsybin design bureau ran afoul of both the Tupolev and Mikoyan bureaus who wanted to use the resources demanded by the development of the RSR. The failure of the RSR illustrates a structural hindrance to the development of a manned strategic reconnaissance program: the nature of Soviet military procurement. As it evolved in the 1930s and ossified in the Stalin Era, aerospace design bureaus had become powerful constituencies within the Soviet state. The state compounded this problem further by designating certain bureaus as their go-to for certain aircraft types (Tupolev= bombers, Sukhoi= ground attack/strike, Mikoyan = fighters, etc.). This squashed innovation to a degree, so a Soviet analogue to the Skunkworks had to fight an uphill battle against an entrenched bureaucracy. \n\nFinally, the Soviets, like the US, tended to shift towards satellite reconnaissance for overflights. This was partly because of the Soviet's intensive development of SAM systems rendered overflights very hazardous. Even the SR-71s did not risk direct overflights of the USSR, and while it could handle the SA-2s that downed Francis Gary Powers, the USAF brass was less confident that it could beat the 1970s generation of air defense missiles. In the runup for Operation Eldorado Canyon, there was a serious concern that the Libyan's SA-5s posed a risk to SR-71 operations. Although the SR-71 proved to be more than capable in Libya, there was a persistent concern in the 1980s that a skilled air defense network could defeat the SR-71. \n\n*Sources*\n\nButtler, Tony, and E. Gordon. *Soviet Secret Projects: Bombers Since 1945*. Leicester: Midland, 2004.\n\nCrickmore, Paul F. *Lockheed Blackbird: Beyond the Secret Missions*. Oxford: Osprey, 2004. \n\nGordon, Yefim. *MiG-25 'Foxbat', MiG-31 'Foxhound': Russia's Defensive Front Line*. Leicester: Aerofax, 1997.\n\n_. *Soviet Spyplanes of the Cold War*. London: Pen and Sword Aviation, 2013.\n"
]
} | []
| []
| [
[],
[
"http://www.foia.cia.gov/collection/12-oxcart-reconnaissance-aircraft-documentation"
],
[
"https://www.reddit.com/r/AskHistorians/comments/306pav/what_was_soviet_aerial_reconnaissance_like/"
]
]
|
|
5qq755 | Why is it impossible for objects weighing less than 0.02 milligrams to form a black hole? | Whats so special about that mass that you cant form a black hole below it? | askscience | https://www.reddit.com/r/askscience/comments/5qq755/why_is_it_impossible_for_objects_weighing_less/ | {
"a_id": [
"dd17q82"
],
"score": [
709
],
"text": [
"A black hole of mass less than around .02 milligrams or so would have a Schwarzschild radius of around a Planck length or less. At this scale, general relativity cannot be trusted; we need a theory that incorporates general relativity and quantum field theory. Thus, at the very least, we can say that such a black hole could not be described by general relativity. \n\nBut we can go further. Quantum mechanics tells us that an object with such a mass would have a Compton wavelength greater than its Schwarzschild radius, which would make it not possible to constrain this mass to be in a small enough region to form a black hole. It is reasonable to expect this to hold even in the eventual quantum theory that incorporates gravity, and if so, that would preclude the formation of a black hole with such a mass.\n"
]
} | []
| []
| [
[]
]
|
|
2lnwvz | why are humans and most other species dependant on water? is it just coincidence that 70% of earth is covered in it? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/2lnwvz/eli5_why_are_humans_and_most_other_species/ | {
"a_id": [
"clwj3y9",
"clwjasb",
"clwqoyo",
"clwqtwr",
"clwr7ga",
"clx84n9"
],
"score": [
3,
25,
2,
5,
3,
2
],
"text": [
"If 70% of earth was covered in liquid methane, it's likely we would have evolved to drink methane.",
"We need a liquid that can act as a medium for our bodies to do all the important things it does. \n\nWater is an easily accessible one that is made up of two commonly found atoms. It's electrically neutral, non corrosive/toxic/flammable and doesn't react with a lot of stuffs. It's melting and boiling temperature range is just right to not damage the structure of cells at the distance that the Earth is from the sun. \n\nThere is no other liquid that fulfills all of the aforementioned criteria. ",
"Evolution. If it were another liquid substance primarily on earth perhaps we'd require that. ",
"Our bodies are basically space ships for single celled organisms that are supposed to live in water.",
"it's important to understand that we evolved on this planet. evolution will increase our ability to survive our environment, and the environment happens to be water-rich. in simpler terms, we (living beings) use water because it's abundant",
"Hydrogen is abundant in our galaxy, the Milky Way and our sun is mostly and produces lots and lots of the stuff, paired with two oxygen atoms, another abundant element, creates a polar molecule with properties that are convenient for reactions and stuff due to its bent structure, electron configuration of the molecule (I forget the term for that), mass, etc. \n\nWater is especially handy in keeping things alive because of its chemistry and reactivity. Life anywhere in any case would require consistent conditions, and water is especially good at it because it takes a decent amount of energy to increase the energy between molecules and raise its temperature (specific heat capacity). Water is also pretty light in mass, so for things like a brain or veins water is not extremely large or massive, so it won't clog or land in a spot. Water is also polar, meaning it has a difference in positive charge and negative charge and it can attract or separate other polar molecules, which is useful for rxns."
]
} | []
| []
| [
[],
[],
[],
[],
[],
[]
]
|
||
4uv4jt | How well does the movie "Master and Commander" portray the life of 19th century British sailors? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/4uv4jt/how_well_does_the_movie_master_and_commander/ | {
"a_id": [
"d5t3cre"
],
"score": [
28
],
"text": [
"Pretty well, actually. The costumes, props, sets, everything was pretty meticulously researched and they do a very good job of avoiding anachronisms or introducing stuff that's just flat out fiction. About the only thing that *really* made me raise my eyebrows was the fact that the *Acheron* was supposedly a \"44 gun privateer, Boston-built\". That means it would have construction very similar to the *USS Constitution*, which needed a crew of about 450, including a complement of Marines. That's obscenely huge for a truly independent privateer, unless the term privateer was supposed to be a colloquialism for an actual French warship operating independently in foreign waters. \n\nThe clothes, the battle scenes, and how the men conducted themselves on the ship day-to-day is spot on. They did a great job showing how cramped, wet, dirty, and smelly life aboard a sloop or sixth-rate frigate would be. The little things, like a servant for every officer during the dinner scene in Aubrey's cabin, and how messy and disgusting the surgery scenes in the wardroom were during the battles were excellent. Showing the separate room for the lantern adjacent to the magazine, and the powder room sailors going barefoot were good too. The *Rose* is a replica of the *HMS Rose* of the era, so the construction of the ship is about as accurate as we'll get without using the *Victory* to film scenes, or going back in time. \n\nPeople like to complain about little technicalities, like the amount of live-fire gunnery practice they did halfway through the movie, in the middle of nowhere, with no chance of re-supply. That's a needless and expensive expenditure of shot and powder; the vast majority of gun exercises would have been \"dry runs\", where everybody went through the motions but didn't actually touch off any rounds. However, it's a movie and they needed to fold that \"getting better\" montage in somewhere sensible, so I get it. \n\n**TL;DR-** A few minor, minor quibbles, but the movie is pretty spot. \n\n"
]
} | []
| []
| [
[]
]
|
||
7a4hzm | Musketball vs. Bayonet | Are there any statistics or anything likewise that would tell us which was the primary cause of injury and death during early modern battles? Whether it was the musket or the bayonet that caused more casualties? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/7a4hzm/musketball_vs_bayonet/ | {
"a_id": [
"dp70376"
],
"score": [
7
],
"text": [
"You may be interested in [this older answer](_URL_0_) from u/PartyMoses on bayonets and their (non)use in warfare, which posits that bayonets were never much actually used for stabbing, but for intimidation. "
]
} | []
| []
| [
[
"https://www.reddit.com/r/AskHistorians/comments/5i0pkg/why_were_bayonets_underused_in_the_american_civil/db52r6p/"
]
]
|
|
1ukwox | why do middle/high schools start so early when students are going through growth spurts and need the most sleep? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1ukwox/eli5_why_do_middlehigh_schools_start_so_early/ | {
"a_id": [
"cej3xit",
"cej49wr"
],
"score": [
4,
9
],
"text": [
"It's mostly for extra-curricular activities. Most sports need reasonable daylight hours, and it would be tough to get faculty to work later through normal dinner / family hours.\n\nIt students need more sleep, they can go to bed earlier.",
"I was once told that elementary, middle and high school start time were offset so they could use the same buses for all three. \n\nAs to why the older students get the earliest start? I'd guess it's because older students can take care of themselves for the time between when they get off school and their parents get off work. "
]
} | []
| []
| [
[],
[]
]
|
||
a4nmr5 | how do you order complex numbers? | More specifically:
If imaginary numbers don't belong to the real number line, does it make sense to say 3i > 2i? This is talking about pure imaginary numbers, but I extend the question further with ''mixed'' complex numbers. Does it make sense to say 2+i < 2+3i? Or 3+i > 2+i? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/a4nmr5/eli5_how_do_you_order_complex_numbers/ | {
"a_id": [
"ebg1fj9",
"ebg3gvj",
"ebg50ya"
],
"score": [
3,
2,
7
],
"text": [
"There's no total order for complex numbers, at least not one that is consistent with the arithmetic operations on the complex numbers. ",
"I suppose if you want order, the magnitude would help not only with purely imaginary numbers following the real numbers (i, 2i, 3i...) But also with complex numbers with real and imaginary parts. ",
"Only one-dimensional quantities have the property of 'order' you're talking about.\n\nAs a result, if you want to 'order' a multi-dimensional value you first need to project it into a single dimension. The common ways to do this for complex numbers would be to either take the magnitude (distance away from the origin) or the angle (rotation off the x-axis)."
]
} | []
| []
| [
[],
[],
[]
]
|
|
1yuuzq | what is groundhog day and why is it important? (i'm from the uk) | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1yuuzq/eli5_what_is_groundhog_day_and_why_is_it/ | {
"a_id": [
"cfnyx2e",
"cfnz2c6"
],
"score": [
5,
3
],
"text": [
"It's February 2nd. If the groundhog sees its shadow (i.e. if it's sunny), then there will be six more weeks of winter, otherwise spring will come early. It is not important whatsoever.",
"Groundhog day is a movie directed by Harold Ramis (who died today) and stars Bill Murray (Reddit Royalty) and also has Stephen Tobolowsky in it who recently did a AMA. It is said to be \"culturally, historically, or aesthetically significant\". "
]
} | []
| []
| [
[],
[]
]
|
||
8ae7be | What is the current state of Japanese historical scholarship in Japan itself? | I am kind of curious, because when people ask questions about Japan the topics that often most reliably answered tend to be those for which Europeans were around in some form, leaving records, letters and transcripts there were passed down and interpreted by western historians.
There seems to be less ability to reliably answer questions about popular subjects such about the Sengoku era (Someone recently remarked there essentially were no reliable English scholars for matters concerning Ninja/Shinobi). Is this because Japanese records for these periods are not translated, or simply are not there?
I suppose I am asking because I really have no idea how comprehensive Japan's own historical record is compared to say, China's, and how many primary sources they have available for many periods of their history (Meiji, Sengoku, Heian). What resources do modern Japanese historians have to work with, how rigorous are the history programs at Japanese Universities, and how much access do Western (English-speaking, primarily) historians have to Japanese primary sources? | AskHistorians | https://www.reddit.com/r/AskHistorians/comments/8ae7be/what_is_the_current_state_of_japanese_historical/ | {
"a_id": [
"dwxyx6p",
"dwyf3d3"
],
"score": [
7,
4
],
"text": [
" > how much access do Western (English-speaking, primarily) historians have to Japanese primary sources?\n\nAre you asking how easy is it for foreign historians to gain physical access to Japanese primary sources or are you asking to what extent have Japanese primary sources been translated into foreign languages?",
"This is a really good question and there are a few things going on here. First of all, I'm not a historian and I don't read Japanese, so this answer will also explain how I go about things as an educator who stumbled on a lot of peoples hunger for reliable answers about Japanese history. I began explaining the academic work I was consuming, and here I am five years later. I'm sure a real Bakumatsu historian could do a better job at answering questions, but I like to think I know *how* to explain and teach.\n\n**i.** The first issue is why so many questions are answered with reference to Western observations. This isn't because there are no Japanese historical accounts, or that English-language historians of Japan don't have access to primary sources. Its because Western observers had very different priorities for what they recorded than did Japanese people. Westerners like Louis Frois or Engelbert Kaempfer were interested in recording everything about the customs of Japan, their clothing, hair, material goods etc. and how they differed from the West. A lot of this is the stuff that their contemporary Japanese counterparts would have seen no reason to document. There is, of course, plenty of evidence in Japanese sources for these subjects, as well as the archaeological record and survival of art and material culture, but these Western ethnographies are a really good eyewitness report of things that often aren't addressed head on. So, for example, Louis Frois wrote\n\n > Because of our buttons and lacings, we cannot easily keep our hands close to our bodies; since Japanese men and women are not thus restricted, they always leave their sleeves hanging empty and pull their hands in close to their bodies, especially in winter.\n\nThis observation of a behaviour that was completely normal to anyone in Japan over most of its history isn't the sort of thing that'd make it into a Sengoku chronicle. \n\nWestern accounts are Japan seen through the eye of a stranger, and may be confused and biased and wrong, but they are really valuable just for bringing that perspective of a stranger.\n\n**ii.** There absolutely is a lack of translated Japanese texts and translations of Japanese historical works. Even if translated, many texts are very diffiult to access. This isn't the biggest problem for historians. To be a real historian of Japanese history, I think you should be able to read Japanese. Professional English language historians communicate with their Japanese counterparts, work together on projects, and learn from each other. International cmmunication among historians has lots of problems, and often the English language and Japanese historians don't communicate as well as they could, but there's not a void between English and Japanese history. If you pick up any English academic book about Japanese history, it'll cite Japanese work, thank Japanese colleagues etc. Respected English language scholars do research in Japanese archives; they don't stay at home and just read translations of Japanese work. Luke S. Roberts, for instance, is a *master* of the Tosa domain archives. \n\nBut for the English-language reader, the gaps in the translations are *huge*. Important Japanese historical work, if it's ever translated at all, is translated many years after. There are so many untranslated primary documents. The amateur history-lover or undergraduate student is definitely restricted. This is my position. I'm in the very lucky position of having access to a university library and its databases, but I only read English. I'm not a historian, though I've had some good training from history professors and a talent for remembering and searching up stuff. Answering questions here to the best of my ability involves using English resources. This can be rather frustrating when I know from conversations or google-translate that there is an easy answer to be found in Japanese materials, but I don't have enough knowledge to properly reference it. \n\nThe translation gap is much more significant for older eras. There is a *lot* of stuff about the Edo Period in English, never as much as I'd like, but translations, analysis of data, amazing articles and books about many subjects. For the Sengoku, on the other hand, good up-to-date English academic work is way scarcer. Historical research in all areas of Japan is proceeding at a fast clip, and I'd say translations are coming out and becoming more widely available (via ebook format etc.) so the future looks bright, but it's still a challenge.\n\n**iii.** There are of course way fewer primary sources as you go backwards in Japanese history, and the type of sources preserved will depend on the era's priorities. Even a Japanese scholar immersed in medieval sources will be very aware of the large gaps in the record. A closer example to our time: we have many, many records of the Late Edo Period, most of which take no interest in the ordinary lives of women. To reconstruct their lives, we have to search for sources, and tease out information from censuses, legal proceedings, satirical literature etc. Writing around the unknown, piecing together clues to construct fragments of an uncompletable puzzle, is the work of the historian. "
]
} | []
| []
| [
[],
[]
]
|
|
2zty7o | In one my my professor's lectures, he mentioned that Japan tried to surrender before Hiroshima, and the US rejected the proposal. After Nagasaki, they accepted a nearly identical proposal to the one they rejected. Is this true? | This was years ago and I just assumed it was a little-known fact among historians. The other day I was trying to find more information about the treaty that was rejected, and I wasn't able to find out if the version of events he told was true or not.
I think that this article may have summed the story up:
_URL_0_
Basically saying the idea that Japan may have tried to surrender before Hiroshima was an appealing story after WW2 that became popular during the Vietnam War, but that the story was inaccurate. However, I'm not familiar with the site or that author, so I'm not sure if he's using choice quotes out of context and misrepresenting the debate.
Is there any truth to the claim that Japan tried to surrender before Hiroshima or Nagasaki? | AskHistorians | http://www.reddit.com/r/AskHistorians/comments/2zty7o/in_one_my_my_professors_lectures_he_mentioned/ | {
"a_id": [
"cpmevmu",
"cpmf6j7",
"cpmtzv8"
],
"score": [
1187,
74,
22
],
"text": [
"Like most stuff that gets introduced in lecture courses, it's mostly right, but more complicated.\n\nPrior to the decision to drop the bomb, some members of the Japanese political leadership were working behind the scenes to try to negotiate a conditional surrender whose terms did (in many ways) closely resemble the unconditional terms of peace that was later accepted.\n\nBut both the American public and the American government were hostile to the idea of a conditional Japanese surrender, while the Japanese public and military were vehemently opposed to the idea of an unconditional surrender. \n\nSo much so, in fact, that even if U.S. forces had been willing to consider a conditional surrender and it had been a politically feasible option, U.S. military strategists believed that, even if Japan's political elite were acting in good faith during negotiations, they would never be able to convince the Japanese hardliners in the military to accept the negotiated outcome and actually surrender.\n\nSo your prof is right in that there were negotiations and discussions on the table to end the war without the bomb, largely on terms that wound up being acceptable after the bomb. But whether or not that alone made the bomb unnecessary depends on whether or not one believes that those negotiations would have been politically feasible to the people and powers that be on either side of the Pacific without the bomb.\n\nIf you're looking for sources on it, \"Marshall, Truman, and the Decision to Drop the Bomb\" by Gar Alperovitz, Robert L. Messer and Barton J. Bernstein talks about this a bit, as does (iirc) John Chappell's *Before the Bomb*.",
"Someone else has mentioned that the Japanese offered conditional surrender before the bombings - the most important condition being that **the Emperor was spared**. The U.S., meanwhile, were adamant about only accepting unconditional surrender.\n\n\"The Potsdam declaration in July, demand[ed] that Japan surrender unconditionally or face 'prompt and utter destruction.' MacArthur was appalled. He knew that the Japanese would never renounce their emperor, and that without him an orderly transition to peace would be impossible anyhow, because his people would never submit to Allied occupation unless he ordered it. Ironically, when the surrender did come, it was conditional, and the condition was a continuation of the imperial reign. Had the General's advice been followed, the resort to atomic weapons at Hiroshima and Nagasaki might have been unnecessary.\" (from a biography about McArthur - \"American Caesar: Douglas MacArthur\" by William Manchester).\n",
"Yes, there is some truth to the statement, but as others have already said it was more complicated, and hinged on the question of whether it was a conditional or an unconditional surrender. Despite the fact that the final surrender was unconditional, the terms imposed by the US were rather similar to the conditional surrender that the peace faction of the Japanese leadership had imagined.\n\nSince it is topical, allow me to re-post a more in depth timeline of the surrender decision, cobbled together from some posts that I wrote a while back.\n\nThe best English language book on the Japanese side of the decision to surrender is Hasegawa's [Racing the Enemy](_URL_1_). \n\nHe uses the diaries of key decision makers among the big six, the recollections of people close to them, and the minutes of their meetings, to argue that the Japanese leadership was more concerned with the Soviets declaring war than they were with the atomic bombs. Illogical as it might sound, the Japanese leadership hoped to secure Soviet mediation to gain a more favorable surrender. The goal of this surrender was always preserving the *kokutai* (国体 - national polity / national essence - which can mean anything from the national structure to the mythic godhood of the Japanese Emperor and his unity with the people) Second, they didn't know about the longer term effects of atomic bombs, and Japanese cities being destroyed wasn't a new thing; 1 bomb instead of thousands, but the end result looked similar in terms of death toll and destruction.\n\nHere is a breakdown of the Japanese activity in the final months. Page numbers are from Hasegawa.\n\nAlthough the Soviet Union had renounced the Japanese neutrality pact in April of 1945, and the Japanese ambassador knew that looking for soviet mediation in the surrender was a lost cause, Japanese leaders largely ignored their ambassador's advice and insisted on pursuing the possibility of Soviet mediation. \n\nJune 18th, the [Supreme War Council](_URL_0_) decided to pursue \"option 3,\" seeking Soviet mediation, and Hirohito endorsed this action in a meeting with the Big 6(The Supreme War Council, minus the Emperor) on June 22nd (106). \n\nJune 30th, Sato, Ambassador to Moscow, telegrammed Togo, the Minister of Foreign Affairs, to tell him that the plan \"...is nothing but pinning our hopes to the utterly impossible.\" Togo told him to do it anyway (123). Clearly, they were looking for a way to surrender months before they actually did, but they wanted it on their terms.\n\nJuly 12, Not to be deterred, Hirohito decided that Japan should try harder if negotiations weren't going well, and appointed Prince Konoe special envoy to Moscow to secure Soviet mediation. The same day Togo Telegrammed Sato and asked him to relay their intentions to Molotov, but Sato was unable to contact him before he departed for Potsdam. Even though their ambassador had been rebuffed, the Japanese high command either did not relay the full message up to the Emperor, or they did not understand the gravity of the situation (123-124). Sato's messages of the impossibility of this task continued through the rest of July, and Togo responded by telling him that seeking Soviet mediation was the imperial will (144).\n\nAugust 2nd, Togo continued to reject advice that Japan should accept the Potsdam Procalmation, and told Sato that the Emperor was concerned with the progress of the Moscow negotiations, adding that \"the Premier and the leaders of the Army are now concentrating all their attention on this one point\"(172).\n\nAug. 7, After the Hiroshima bomb, Togo telegramed Sato in Moscow regarding the Konoe mission, stating that the situation was getting desperate and that \"We must know the Soviet's attitude immediately\" (185). Obviously, they still hadn't given up hope on Soviet aid, and the possibility of Soviet mediation still seemed to be an alternative to surrendering unconditionally, even to the peace party. Molotov and Sato met on the 8th, and Molotov read him the declaration of war against Japan. Sato's telegram informing Tokyo never arrived.\n\nAug. 9th, Japanese Domei News intercepted a radio broadcast of the Russian declaration of war and Tokyo learned of it. Early in the morning Togo and top foreign ministry officials met and decided there was no choice but to accept the terms of the Potsdam Proclamation (197). Togo then secured the agreement of Navy Minister Yonai and Prince Takamatsu. Hirohito independently learned of the Soviet entry to the war and summoned Kido at 9:55 am, telling him \"The Soviet Union declared war against us, and entered into a state of war as of today. Because of this it is necessary to study and decide on the termination of the war,\" according to Kido's Journal (198). Prime Minister Suzuki deferred to the Emperor's wishes and convened the War Council. Clearly, among the peace party, Soviet entry to the war swayed them to end the war not through Soviet mediation, but by accepting the Potsdam proclamation. \n\nThe war party was also shocked, as the diary of Army Deputy Chief Kawabe notes considerably more shock regarding the Soviets than it does regarding the bombing of Hiroshima. Nonetheless, Army Minister Amami was not ready to surrender.\n\nAt that meeting, the Big 6 learned of the Bombing of Nagasaki. According to the official history of the Imperial General Headquarters, \"There is no record in other materials that treated the effect [of the Nagasaki Bomb] seriously.\" Similarly, neither Togo nor Toyoda mention it in their memoirs of the meeting (204). In the meeting the war party continued to defend the idea of defending the home islands to force favorable terms, but slowly fell to the peace faction. By the end, they had agreed to accept Potsdam, but still debated 1 condition vs 4.\n\nAfter this, members of the peace faction arranged to meet with Kido urging him to urge the Emperor to support a single condition acceptance (\"preservation of the imperial house\" [peace] or \"preservation of the Emperor's status in national laws\" [war] depending on who phrased it). Kido then met with the Emperor, and afterward the Emperor agreed to call an imperial conference, at which he supported Togo's proposal, saying \"My opinion is the same as what the Foreign minister said.\" All the members, including the war party signed the document in the early hours of August 10th (213). With that, the basic outline of surrendering was complete, although they changed the single condition changed to acceptance \"on the understanding that the Allied Proclamation would not comprise any demand which would prejudice the prerogatives of His Majesty as a Sovereign Ruler,\" which became a sticking point in its potential to preserve the emperor's status as a god and commander of the military (212).\n\nOn the common debate about this \"sacred decision,\" it is true that the Emperor was the deciding \"vote,\" but the deliberations show his decision was shaped by those who were convinced to surrender by Soviet declaration of war to put his weight behind the plan they had laid out. His own statements also show the effect that Soviet Entry to the war was a major concern for him. Similarly, Soviet entry and lack of the possibility of negotiated peace weakened the war party's case. \n\nIn the intervening days between the 10th and the 15th things were fairly chaotic. The war faction got key members of the peace faction to agree that they would continue the war if the conditional acceptance were rejected. However, members of the Foreign Ministry believed they had to accept the Bynes note, informing them of the US rejection of the conditional acceptance, when they got it on the 12th. The army thought it was an unacceptable violation of their understanding of the *kokutai,* leading to a stalemate in the leadership. While leadership argued back and forth, members of the army General Staff plotted a coup on the 12th and 13th. Fearing Military action, Kido met with Hirohito on the morning of the 14th and convinced him to convene a combined conference of the Supreme War council and the Cabinet to impose his decision for unconditional acceptance of the Bynes note. \n\nThe decision to accept was made around 11:00 am on the 14th, starting debates about how to phrase the announcement to the people. Leadership feared that poor phrasing, especially regarding the *kokutai,* might result in army action against the decision. Meanwhile, the coup plotters planned to occupy the imperial palace and prevent the Emperor from informing the nation.\n\nThe Coup took place on the night of the 14th, with forged orders telling the imperial guards to protect the emperor. They occupied the palace and shut down all the communications in and out. Coup members who went to the Eastern Army for help found the army opposed and determined to put the coup down by force, which they apparently did successfully, as the coup was over by morning. When asked to support the coup a final time, Anami informed them that he was going to commit suicide, and did so.\n\nThe Emperor's speech was broadcast on Aug. 15th (planned for back on the 11th). It cited the bombs as a reason for surrender, but that is not sufficient evidence to determine the reasons for ending the war. First, that speech was carefully prepared and edited for public, military, and American consumption. Second, it is only one of several sources. Of the contemporary sources on why Japan surrendered, 3 (Konoe on Aug.9th, Suzuki's statements to his doctor on Aug. 13th, and Hirohito's Imperial Rescript to Soldiers and Officers on Aug. 17th) speak only of the Soviets, 2 (Hirohito's Imperial Rescript on the 15th and Suzuki's statements at the cabinet meeting of Aug. 13th) speak exclusively about the bombs, and 7 speak of both (297-298). Both played a role, but the deciding edge likely belonged to to Soviet entry."
]
} | []
| [
"http://www.americanthinker.com/articles/2008/08/hiroshima_hoax_japans_wllingne.html"
]
| [
[],
[],
[
"http://en.wikipedia.org/wiki/Supreme_War_Council_(Japan\\)",
"http://books.google.com/books/about/Racing_the_Enemy.html?id=iPju1MrqgU4C"
]
]
|
|
1sxrw4 | why did it snow recently in the middle east and why does it happen so rarely? | explainlikeimfive | http://www.reddit.com/r/explainlikeimfive/comments/1sxrw4/eli5eli5_why_did_it_snow_recently_in_the_middle/ | {
"a_id": [
"ce29xej",
"ce2a8mg",
"ce2azon"
],
"score": [
3,
2,
3
],
"text": [
"Deserts aren't big on precipitation of any kind. They also play host to violent temperature extremes. Below zero temperatures in winter nights contrast with sun hot enough to kill. The cold is just as bad for snow as the heat, as you need water in the air to form the snow, before it can fall.",
"Just a minor point: The Middle East isn't one big desert. It's a huge area with many different climates. ",
"On Earth we live at the bottom of a soup of gases, which are constantly moving in all directions, this is what makes up the atmosphere. The interaction between warm tropical air, the mid-latitude air (medium temperature air) and cold arctic air is what drives most of the weather in the Northern Hemisphere (top half of the planet). When the different sections of air meet, strong winds high above us called *jet streams* are created. \n\nThe jet stream does not move in a straight line. It goes up and down like the humps of a camel. The air can be pulled from different regions of the world because of the jet stream. When cold air was drawn to Western Europe because of changes to the jet stream, the right side of the big lump of cold polar air hit the Middle East region. Cold temperature and rain clouds passing by meant that higher regions encountered snow and lower regions had heavy rain."
]
} | []
| []
| [
[],
[],
[]
]
|
||
5nz8cg | if someone really did have multiple personalities and each personality had no idea what the others do, what would happen if one of the personalities murdered someone or committed another terrible crime? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/5nz8cg/eli5if_someone_really_did_have_multiple/ | {
"a_id": [
"dcfdubs",
"dcff3hs"
],
"score": [
9,
2
],
"text": [
"Realistically, if we're assuming this is in the United States, this condition would be brought forward and evaluated by a designated mental health official. If it was determined that the crime was committed as a result of these personalities, the individual would likely get to plead insanity and be admitted to a mental hospital for rehabilitation and treatment.",
"This has been answered fairly well by others, but for interest sake: \nThis condition is extremely rare. While dissociative experiences are common, experienced by more than half of the population at some point, the symptoms are vaguely experienced and poorly recalled (perhaps like when you auto-pilot your drive home and can't remember most of the drive and pray you didn't break any laws on the way). Many or most dissociative episodes are fleeting or do not cause significant distress or dysfunction, and therefore do not warrant a specific DSM-5 diagnosis. \n\nAccording to the DSM-5 (latest diagnostic book for psychiatric disorders), it is now dissociative identity disorder. To be diagnosed you need: two or more distinct personalities with noticeable shifts in memories, behaviour, and perceptions of reacting to self and the environment that are persistent. What is new is that the patient can self proclaim this shift rather than if needing to be reported by a third person. The difference between the above common fleeting episode would be the persistence of the different personality types. The second criteria is amnesia must occur, defined as gaps in the recall of everyday events, important personal information and/or traumatic events. The events cannot be brought on by drugs or alcohol, must not be related to culture or religion, and must cause distress. \n"
]
} | []
| []
| [
[],
[]
]
|
||
8j7jlm | what is that pressure sensation we feel in our chest when we get a spike of anxiety? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/8j7jlm/eli5_what_is_that_pressure_sensation_we_feel_in/ | {
"a_id": [
"dyxir0t",
"dyxku7f",
"dyxm77g"
],
"score": [
17,
4,
3
],
"text": [
"I believe it is adrenaline, the fight or flight reflex. But modern man doesn’t necessarily have the same fight or flight reflex as our ancestors - it’s more fight, flight or freeze. Most people freeze but the body still release the adrenaline used from the original fight or flight.",
"And in a real fight or flight scenario your last concern is going to be chest pain, it will be survival. After that your body will notice it’s in pain. Have you ever heard of someone chopping their finger off but not noticing? That’s because of the adrenaline.",
"Its literally blood being shunted to vital areas of the body as part of the fight or flight response, which is the body's automatic response to fear. Your sympathetic nervous system signals your heart and lungs through hormones like adrenaline to begin working harder to supply you with extra oxygen in important areas, just in case you actually need it to defend yourself or run away. Your blood pressure, pulse, and respirations will usually measure higher (sometimes dramatically) when you are scared or anxious. You may, in addition to the pressure in your chest, feel things like a cold knot in your stomach (from blood leaving the digestive system), jitteriness or shaking, and/or sweating."
]
} | []
| []
| [
[],
[],
[]
]
|
||
662tph | why are people so polarised? | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/662tph/eli5_why_are_people_so_polarised/ | {
"a_id": [
"dgf3wct",
"dgf8bl9"
],
"score": [
2,
2
],
"text": [
"In my opinion, that polarization has been there. The difference is that now everyone has an anonmomous voice and the more extreme elements are the ones that get all the attention. Not every Christian wants to kill abortion doctors. Not every Liberal is a Sociallist. Most people just want to live their lives. ",
"Are they? One argument is that re-sorting of political parties has led to the appearance of greater polarization. Actual political attitudes may not have shifted that dramatically. \n\n_URL_0_\n\n"
]
} | []
| []
| [
[],
[
"https://www.washingtonpost.com/news/monkey-cage/wp/2014/06/23/americans-have-not-become-more-politically-polarized/"
]
]
|
||
anfgg8 | how does removing a storage device from a computer too soon damage the files on the storage device? | [deleted] | explainlikeimfive | https://www.reddit.com/r/explainlikeimfive/comments/anfgg8/eli5_how_does_removing_a_storage_device_from_a/ | {
"a_id": [
"efsw72o",
"efsweie"
],
"score": [
3,
5
],
"text": [
"The computer could be in the middle of writing to the device and you'd get corrupted stuff. Especially bad if it was updating the file index which tells the computer where everything is on the drive.\n\nGenerally if you've written your files and give it maybe a second or two more it's perfectly safe. ",
"Imagine you are drinking water out of a cup through a straw and pull the straw out of the cup mid sip, you wont get all the water out. Now imagine you have different cups with different liquids. If you put the straw in the wrong cup, you might get koolaid instead of water. No big deal. However, you could also put it into poison and die. \n\nWith respect to the SD card or flash drive, if you pull it out while it is in the middle of writing data, you run the risk of corrupting the file because the transfer was incomplete because the device was removed. \n\nI am sure this is a terrible explanation, so I will wait until a better one comes along, lol. \n\n"
]
} | []
| []
| [
[],
[]
]
|
|
7zf0fz | Is there any evidence to suggest that biracial people are less susceptible to genetic diseases? | Being that they are created from very different gene pools. | askscience | https://www.reddit.com/r/askscience/comments/7zf0fz/is_there_any_evidence_to_suggest_that_biracial/ | {
"a_id": [
"dunle11",
"duoqi9z",
"dupx7yn"
],
"score": [
17,
4,
2
],
"text": [
"There are certain diseases that are more common in populations with more restricted gene pools--Tay-Sachs and Ashkenazi Jews, for example.\n\nHowever, keep in mind that what we think of as \"race\" is not a particularly useful concept in terms of genetics. [There's likely more genetic diversity *within* Sub-Saharan Africa](_URL_0_)(what we would call \"black people) than there is *outside* of it! A man from Nigeria and a woman from Lesotho might be more genetically different than a man from Nigeria and a woman from Germany. The idea of race looks at a specific set of obvious but fairly arbitrary phenotypes (skin colour, hair texture and colour, eye colour) and ignores other phenotypes, both obvious (like height!) and not visible (biochemistry).\n\n",
"Yes, but it depends on which genetic diseases.\n\nMany genetic diseases are found almost entirely in individuals from a specific geographical area or ethnicity. For example, hemochromatosis is a recessive genetic disease affecting iron metabolism that occurs almost entirely in people of Northern European or Celtic descent. A biracial individual with one parent from outside Northern Europe would be virtually guaranteed to avoid having hemochromatosis, since the non-European parent would almost certainly have a \"good\" version of the hemochromatosis gene.\n\nSome genetic diseases occur spontaneously. For example the most common form of Down Syndrome is caused by meiotic disjunction (chromosomes not separating properly) during gamete formation. In this case, being biracial makes no difference to the incidence of the disorder.",
"One of the challenges when it comes to multiracial people is that it can produce less common combinations of the various factors that play into transplantation. As I recall this is especially true in the case of bonemarrow transplants and/or stem cells. "
]
} | []
| []
| [
[
"https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2953791/"
],
[],
[]
]
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.