content
stringlengths
1
1.04M
input_ids
listlengths
1
774k
ratio_char_token
float64
0.38
22.9
token_count
int64
1
774k
import os import h5py import numpy as np import torch from torch.utils.data import Dataset
[ 11748, 28686, 198, 198, 11748, 289, 20, 9078, 198, 11748, 299, 32152, 355, 45941, 198, 11748, 28034, 198, 6738, 28034, 13, 26791, 13, 7890, 1330, 16092, 292, 316, 628, 198 ]
3.133333
30
class DivideByZeroException(ArithmeticException): """ The exception that is thrown when there is an attempt to divide an integral or decimal value by zero. DivideByZeroException() DivideByZeroException(message: str) DivideByZeroException(message: str,innerException: Exception) """ def ZZZ(self): """hardcoded/mock instance of the class""" return DivideByZeroException() instance=ZZZ() """hardcoded/returns an instance of the class""" def __init__(self,*args): """ x.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signaturex.__init__(...) initializes x; see x.__class__.__doc__ for signature """ pass @staticmethod def __new__(self,message=None,innerException=None): """ __new__(cls: type) __new__(cls: type,message: str) __new__(cls: type,message: str,innerException: Exception) __new__(cls: type,info: SerializationInfo,context: StreamingContext) """ pass SerializeObjectState=None
[ 4871, 46894, 3886, 28667, 16922, 7, 3163, 29848, 16922, 2599, 201, 198, 37227, 201, 198, 383, 6631, 326, 318, 8754, 618, 612, 318, 281, 2230, 284, 14083, 281, 19287, 393, 32465, 1988, 416, 6632, 13, 201, 201, 198, 220, 201, 201, 198, 46894, 3886, 28667, 16922, 3419, 201, 201, 198, 46894, 3886, 28667, 16922, 7, 20500, 25, 965, 8, 201, 201, 198, 46894, 3886, 28667, 16922, 7, 20500, 25, 965, 11, 5083, 16922, 25, 35528, 8, 201, 198, 37227, 201, 198, 825, 1168, 30148, 7, 944, 2599, 201, 198, 220, 37227, 10424, 40976, 14, 76, 735, 4554, 286, 262, 1398, 37811, 201, 198, 220, 1441, 46894, 3886, 28667, 16922, 3419, 201, 198, 4554, 28, 30148, 57, 3419, 201, 198, 37227, 10424, 40976, 14, 7783, 82, 281, 4554, 286, 262, 1398, 37811, 201, 198, 825, 11593, 15003, 834, 7, 944, 11, 9, 22046, 2599, 201, 198, 220, 37227, 2124, 13, 834, 15003, 834, 7, 23029, 4238, 4340, 2124, 26, 766, 2124, 13, 834, 4871, 834, 13, 834, 15390, 834, 329, 9877, 87, 13, 834, 15003, 834, 7, 23029, 4238, 4340, 2124, 26, 766, 2124, 13, 834, 4871, 834, 13, 834, 15390, 834, 329, 9877, 87, 13, 834, 15003, 834, 7, 23029, 4238, 4340, 2124, 26, 766, 2124, 13, 834, 4871, 834, 13, 834, 15390, 834, 329, 9877, 37227, 201, 198, 220, 1208, 201, 198, 2488, 12708, 24396, 201, 198, 825, 11593, 3605, 834, 7, 944, 11, 20500, 28, 14202, 11, 5083, 16922, 28, 14202, 2599, 201, 198, 220, 37227, 201, 198, 220, 11593, 3605, 834, 7, 565, 82, 25, 2099, 8, 201, 201, 198, 220, 11593, 3605, 834, 7, 565, 82, 25, 2099, 11, 20500, 25, 965, 8, 201, 201, 198, 220, 11593, 3605, 834, 7, 565, 82, 25, 2099, 11, 20500, 25, 965, 11, 5083, 16922, 25, 35528, 8, 201, 201, 198, 220, 11593, 3605, 834, 7, 565, 82, 25, 2099, 11, 10951, 25, 23283, 1634, 12360, 11, 22866, 25, 43124, 21947, 8, 201, 198, 220, 37227, 201, 198, 220, 1208, 201, 198, 23283, 1096, 10267, 9012, 28, 14202, 201, 198, 201, 198 ]
3.014577
343
#!/usr/bin/env python # coding=utf-8 """ core.tenhou.log """ __author__ = 'Rnd495' import os import json import datetime import urllib from core.configs import Configs configs = Configs.instance() class Log(object): """ Log """ @property @property @property @property @property @property @property @property @property @property @property @property @property @property @staticmethod @staticmethod @staticmethod class StatisticForSubLog(object): """ StatisticForSubLog """ @property @property @property @property @property @property @property @property @property @property @property @property @property @property def get_results(ref_list, player_name): """ do statistics on given refs for given player result dict format (example value is avg value on data set 2015/05/15) : { fulu_chong : 0.3940, dama : 0.1165, win_time : 11.50, chong : 0.1347, win : 0.2484, win_point : 6690, ends_listening : 0.5170, fulu : 0.3717, after_richi : 0.0288, now_line_days : 3.71, max_line_days : 16.67, first_richi : 0.1597, count : 1000, } :param ref_list: ref list :param player_name: player name :return: result dict """ counter = {} adder = {} game_date_text_set = set() ref_counter = 0 for ref in ref_list: ref_counter += 1 log = Log(ref) game_date_text_set.add(log.time.strftime("%Y%m%d")) player_index = log.get_player_index(player_name) if player_index < 0: # should not be here continue for sub_log in log.sub_log: statistics = StatisticForSubLog(sub_log) results = statistics.get_result(player_index) for key, value in results.iteritems(): if value is not None: counter[key] = counter.get(key, 0) + 1 adder[key] = adder.get(key, 0) + value results = {} for key, value in counter.iteritems(): results[key] = (adder[key] / float(value)) if value else 0 max_line_days = now_line_days = 0 last_date = None for date_text in sorted(game_date_text_set): now_date = datetime.datetime.strptime(date_text, "%Y%m%d") if last_date: if int((now_date - last_date).days) <= 1: now_line_days += 1 max_line_days = max(max_line_days, now_line_days) else: now_line_days = 1 last_date = now_date results['max_line_days'] = max_line_days results['now_line_days'] = now_line_days results['count'] = ref_counter return results if __name__ == '__main__': import time from sqlalchemy import func, desc from core.models import get_new_session, PlayerLog session = get_new_session() counter = func.count(PlayerLog.name) query = session.query(PlayerLog.name).filter((PlayerLog.lobby == '0000') & (PlayerLog.name != 'NoName')) \ .group_by(PlayerLog.name).having(counter >= 50).order_by(desc(counter)) results = {} for name in (row[0] for row in query): start_time = time.time() query = session.query(PlayerLog.ref).filter((PlayerLog.name == name) & (PlayerLog.lobby == '0000')) refs = [row[0] for row in query] results[name] = get_results(refs, name) size = len(refs) time_cost = time.time() - start_time hz = size / time_cost print '%6d' % size, '%.2fs' % time_cost, '%.2fHz' % hz, name session.close() data_lists = {} for row in results.itervalues(): for key, value in row.iteritems(): data_lists.setdefault(key, []).append(value) print '' print '%20s' % 'type', '%6s' % 'avg', '%6s' % 'max', '%6s' % 'min', '%6s' % 'mu' # import numpy as np from scipy.stats import norm # import matplotlib.pyplot as plt for key, data_list in data_lists.iteritems(): avg = sum(data_list) / float(len(data_list)) mu, std = norm.fit(data_list) print '%20s' % key, format_data(avg), format_data(max(data_list)), format_data(min(data_list)), format_data( mu), std # # # Plot the histogram. # plt.hist(data_list, bins=25, normed=True, alpha=0.6, color='g') # # # Plot the PDF. # xmin, xmax = plt.xlim() # x = np.linspace(xmin, xmax, 100) # p = norm.pdf(x, mu, std) # plt.plot(x, p, 'k', linewidth=2) # title = "%s fit results: mu = %.2f, std = %.2f" % (key, mu, std) # plt.title(title) # # plt.show()
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 198, 2, 19617, 28, 40477, 12, 23, 198, 198, 37811, 198, 7295, 13, 1452, 15710, 13, 6404, 198, 37811, 198, 198, 834, 9800, 834, 796, 705, 49, 358, 33781, 6, 198, 198, 11748, 28686, 198, 11748, 33918, 198, 11748, 4818, 8079, 198, 11748, 2956, 297, 571, 198, 198, 6738, 4755, 13, 11250, 82, 1330, 17056, 82, 198, 198, 11250, 82, 796, 17056, 82, 13, 39098, 3419, 628, 198, 4871, 5972, 7, 15252, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 5972, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 12708, 24396, 628, 220, 220, 220, 2488, 12708, 24396, 628, 220, 220, 220, 2488, 12708, 24396, 628, 198, 4871, 5133, 2569, 1890, 7004, 11187, 7, 15252, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 5133, 2569, 1890, 7004, 11187, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 220, 220, 220, 2488, 26745, 628, 198, 4299, 651, 62, 43420, 7, 5420, 62, 4868, 11, 2137, 62, 3672, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 466, 7869, 319, 1813, 1006, 82, 329, 1813, 2137, 198, 220, 220, 220, 1255, 8633, 5794, 357, 20688, 1988, 318, 42781, 1988, 319, 1366, 900, 1853, 14, 2713, 14, 1314, 8, 1058, 198, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 277, 15712, 62, 354, 506, 1058, 657, 13, 2670, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 288, 1689, 1058, 657, 13, 1157, 2996, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1592, 62, 2435, 1058, 220, 1367, 13, 1120, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 442, 506, 1058, 657, 13, 1485, 2857, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1592, 1058, 657, 13, 1731, 5705, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1592, 62, 4122, 1058, 220, 220, 718, 35844, 11, 198, 220, 220, 220, 220, 220, 5645, 62, 4868, 3101, 1058, 657, 13, 20, 17279, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 277, 15712, 1058, 657, 13, 2718, 1558, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 706, 62, 7527, 72, 1058, 657, 13, 15, 25270, 11, 198, 220, 220, 220, 220, 220, 220, 783, 62, 1370, 62, 12545, 1058, 220, 220, 513, 13, 4869, 11, 198, 220, 220, 220, 220, 220, 220, 3509, 62, 1370, 62, 12545, 1058, 220, 1467, 13, 3134, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 717, 62, 7527, 72, 1058, 657, 13, 1314, 5607, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 954, 1058, 220, 220, 8576, 11, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 1058, 17143, 1006, 62, 4868, 25, 1006, 1351, 198, 220, 220, 220, 1058, 17143, 2137, 62, 3672, 25, 2137, 1438, 198, 220, 220, 220, 1058, 7783, 25, 1255, 8633, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 3753, 796, 23884, 198, 220, 220, 220, 751, 263, 796, 23884, 198, 220, 220, 220, 983, 62, 4475, 62, 5239, 62, 2617, 796, 900, 3419, 198, 220, 220, 220, 1006, 62, 24588, 796, 657, 198, 220, 220, 220, 329, 1006, 287, 1006, 62, 4868, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1006, 62, 24588, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 2604, 796, 5972, 7, 5420, 8, 198, 220, 220, 220, 220, 220, 220, 220, 983, 62, 4475, 62, 5239, 62, 2617, 13, 2860, 7, 6404, 13, 2435, 13, 2536, 31387, 7203, 4, 56, 4, 76, 4, 67, 48774, 198, 220, 220, 220, 220, 220, 220, 220, 2137, 62, 9630, 796, 2604, 13, 1136, 62, 7829, 62, 9630, 7, 7829, 62, 3672, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2137, 62, 9630, 1279, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 815, 407, 307, 994, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 329, 850, 62, 6404, 287, 2604, 13, 7266, 62, 6404, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7869, 796, 5133, 2569, 1890, 7004, 11187, 7, 7266, 62, 6404, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2482, 796, 7869, 13, 1136, 62, 20274, 7, 7829, 62, 9630, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1994, 11, 1988, 287, 2482, 13, 2676, 23814, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1988, 318, 407, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3753, 58, 2539, 60, 796, 3753, 13, 1136, 7, 2539, 11, 657, 8, 1343, 352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 751, 263, 58, 2539, 60, 796, 751, 263, 13, 1136, 7, 2539, 11, 657, 8, 1343, 1988, 198, 220, 220, 220, 2482, 796, 23884, 198, 220, 220, 220, 329, 1994, 11, 1988, 287, 3753, 13, 2676, 23814, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 2482, 58, 2539, 60, 796, 357, 26676, 58, 2539, 60, 1220, 12178, 7, 8367, 4008, 611, 1988, 2073, 657, 198, 220, 220, 220, 3509, 62, 1370, 62, 12545, 796, 783, 62, 1370, 62, 12545, 796, 657, 198, 220, 220, 220, 938, 62, 4475, 796, 6045, 198, 220, 220, 220, 329, 3128, 62, 5239, 287, 23243, 7, 6057, 62, 4475, 62, 5239, 62, 2617, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 783, 62, 4475, 796, 4818, 8079, 13, 19608, 8079, 13, 2536, 457, 524, 7, 4475, 62, 5239, 11, 36521, 56, 4, 76, 4, 67, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 611, 938, 62, 4475, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 493, 19510, 2197, 62, 4475, 532, 938, 62, 4475, 737, 12545, 8, 19841, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 783, 62, 1370, 62, 12545, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3509, 62, 1370, 62, 12545, 796, 3509, 7, 9806, 62, 1370, 62, 12545, 11, 783, 62, 1370, 62, 12545, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 783, 62, 1370, 62, 12545, 796, 352, 198, 220, 220, 220, 220, 220, 220, 220, 938, 62, 4475, 796, 783, 62, 4475, 198, 220, 220, 220, 2482, 17816, 9806, 62, 1370, 62, 12545, 20520, 796, 3509, 62, 1370, 62, 12545, 198, 220, 220, 220, 2482, 17816, 2197, 62, 1370, 62, 12545, 20520, 796, 783, 62, 1370, 62, 12545, 198, 220, 220, 220, 2482, 17816, 9127, 20520, 796, 1006, 62, 24588, 198, 220, 220, 220, 1441, 2482, 628, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 1330, 640, 198, 220, 220, 220, 422, 44161, 282, 26599, 1330, 25439, 11, 1715, 198, 220, 220, 220, 422, 4755, 13, 27530, 1330, 651, 62, 3605, 62, 29891, 11, 7853, 11187, 628, 220, 220, 220, 6246, 796, 651, 62, 3605, 62, 29891, 3419, 198, 220, 220, 220, 3753, 796, 25439, 13, 9127, 7, 14140, 11187, 13, 3672, 8, 198, 220, 220, 220, 12405, 796, 6246, 13, 22766, 7, 14140, 11187, 13, 3672, 737, 24455, 19510, 14140, 11187, 13, 75, 11369, 6624, 705, 2388, 11537, 1222, 357, 14140, 11187, 13, 3672, 14512, 705, 2949, 5376, 6, 4008, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 764, 8094, 62, 1525, 7, 14140, 11187, 13, 3672, 737, 40965, 7, 24588, 18189, 2026, 737, 2875, 62, 1525, 7, 20147, 7, 24588, 4008, 198, 220, 220, 220, 2482, 796, 23884, 198, 220, 220, 220, 329, 1438, 287, 357, 808, 58, 15, 60, 329, 5752, 287, 12405, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 923, 62, 2435, 796, 640, 13, 2435, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 12405, 796, 6246, 13, 22766, 7, 14140, 11187, 13, 5420, 737, 24455, 19510, 14140, 11187, 13, 3672, 6624, 1438, 8, 1222, 357, 14140, 11187, 13, 75, 11369, 6624, 705, 2388, 6, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 1006, 82, 796, 685, 808, 58, 15, 60, 329, 5752, 287, 12405, 60, 198, 220, 220, 220, 220, 220, 220, 220, 2482, 58, 3672, 60, 796, 651, 62, 43420, 7, 5420, 82, 11, 1438, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2546, 796, 18896, 7, 5420, 82, 8, 198, 220, 220, 220, 220, 220, 220, 220, 640, 62, 15805, 796, 640, 13, 2435, 3419, 532, 923, 62, 2435, 198, 220, 220, 220, 220, 220, 220, 220, 289, 89, 796, 2546, 1220, 640, 62, 15805, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 705, 4, 21, 67, 6, 4064, 2546, 11, 705, 7225, 17, 9501, 6, 4064, 640, 62, 15805, 11, 705, 7225, 17, 69, 7399, 6, 4064, 289, 89, 11, 1438, 198, 220, 220, 220, 6246, 13, 19836, 3419, 198, 220, 220, 220, 1366, 62, 20713, 796, 23884, 198, 220, 220, 220, 329, 5752, 287, 2482, 13, 270, 712, 282, 947, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1994, 11, 1988, 287, 5752, 13, 2676, 23814, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1366, 62, 20713, 13, 2617, 12286, 7, 2539, 11, 17635, 737, 33295, 7, 8367, 8, 628, 220, 220, 220, 3601, 10148, 198, 220, 220, 220, 3601, 705, 4, 1238, 82, 6, 4064, 705, 4906, 3256, 705, 4, 21, 82, 6, 4064, 705, 615, 70, 3256, 705, 4, 21, 82, 6, 4064, 705, 9806, 3256, 705, 4, 21, 82, 6, 4064, 705, 1084, 3256, 705, 4, 21, 82, 6, 4064, 705, 30300, 6, 628, 220, 220, 220, 1303, 1330, 299, 32152, 355, 45941, 198, 220, 220, 220, 422, 629, 541, 88, 13, 34242, 1330, 2593, 198, 220, 220, 220, 1303, 1330, 2603, 29487, 8019, 13, 9078, 29487, 355, 458, 83, 628, 220, 220, 220, 329, 1994, 11, 1366, 62, 4868, 287, 1366, 62, 20713, 13, 2676, 23814, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 42781, 796, 2160, 7, 7890, 62, 4868, 8, 1220, 12178, 7, 11925, 7, 7890, 62, 4868, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 38779, 11, 14367, 796, 2593, 13, 11147, 7, 7890, 62, 4868, 8, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 705, 4, 1238, 82, 6, 4064, 1994, 11, 5794, 62, 7890, 7, 615, 70, 828, 5794, 62, 7890, 7, 9806, 7, 7890, 62, 4868, 36911, 5794, 62, 7890, 7, 1084, 7, 7890, 62, 4868, 36911, 5794, 62, 7890, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 38779, 828, 14367, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 1303, 28114, 262, 1554, 21857, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 458, 83, 13, 10034, 7, 7890, 62, 4868, 11, 41701, 28, 1495, 11, 2593, 276, 28, 17821, 11, 17130, 28, 15, 13, 21, 11, 3124, 11639, 70, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 1303, 28114, 262, 12960, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 2124, 1084, 11, 2124, 9806, 796, 458, 83, 13, 87, 2475, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 2124, 796, 45941, 13, 21602, 10223, 7, 87, 1084, 11, 2124, 9806, 11, 1802, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 279, 796, 2593, 13, 12315, 7, 87, 11, 38779, 11, 14367, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 458, 83, 13, 29487, 7, 87, 11, 279, 11, 705, 74, 3256, 9493, 413, 5649, 28, 17, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 3670, 796, 36521, 82, 4197, 2482, 25, 38779, 796, 4064, 13, 17, 69, 11, 220, 14367, 796, 4064, 13, 17, 69, 1, 4064, 357, 2539, 11, 38779, 11, 14367, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 458, 83, 13, 7839, 7, 7839, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 458, 83, 13, 12860, 3419, 198 ]
2.122761
2,289
import pytest from eth_abi import decode_single from eth_tester.exceptions import TransactionFailed # web3 returns f"execution reverted: {err_str}" # TODO move exception string parsing logic into assert_tx_failed invalid_code = [ """ @external def test(a: int128) -> int128: assert a > 1, "" return 1 + a """, """ @external def test(a: int128) -> int128: raise "" """, """ @external def test(): assert create_forwarder_to(self) """, ] @pytest.mark.parametrize("code", invalid_code) valid_code = [ """ @external def mint(_to: address, _value: uint256): raise """, """ @internal def ret1() -> int128: return 1 @external def test(): assert self.ret1() == 1 """, """ @internal def valid_address(sender: address) -> bool: selfdestruct(sender) @external def test(): assert self.valid_address(msg.sender) """, """ @external def test(): assert raw_call(msg.sender, b'', max_outsize=1, gas=10, value=1000*1000) == b'' """, """ @external def test(): assert create_forwarder_to(self) == self """, ] @pytest.mark.parametrize("code", valid_code)
[ 11748, 12972, 9288, 198, 6738, 4555, 62, 17914, 1330, 36899, 62, 29762, 198, 6738, 4555, 62, 4879, 353, 13, 1069, 11755, 1330, 45389, 37, 6255, 628, 198, 2, 3992, 18, 5860, 277, 1, 18558, 1009, 50239, 25, 1391, 8056, 62, 2536, 36786, 198, 2, 16926, 46, 1445, 6631, 4731, 32096, 9156, 656, 6818, 62, 17602, 62, 47904, 628, 628, 198, 259, 12102, 62, 8189, 796, 685, 198, 220, 220, 220, 37227, 198, 31, 22615, 198, 4299, 1332, 7, 64, 25, 493, 12762, 8, 4613, 493, 12762, 25, 198, 220, 220, 220, 6818, 257, 1875, 352, 11, 13538, 198, 220, 220, 220, 1441, 352, 1343, 257, 198, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 37227, 198, 31, 22615, 198, 4299, 1332, 7, 64, 25, 493, 12762, 8, 4613, 493, 12762, 25, 198, 220, 220, 220, 5298, 13538, 198, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 37227, 198, 31, 22615, 198, 4299, 1332, 33529, 198, 220, 220, 220, 6818, 2251, 62, 11813, 263, 62, 1462, 7, 944, 8, 198, 220, 220, 220, 13538, 1600, 198, 60, 628, 198, 31, 9078, 9288, 13, 4102, 13, 17143, 316, 380, 2736, 7203, 8189, 1600, 12515, 62, 8189, 8, 628, 198, 12102, 62, 8189, 796, 685, 198, 220, 220, 220, 37227, 198, 31, 22615, 198, 4299, 21043, 28264, 1462, 25, 2209, 11, 4808, 8367, 25, 20398, 11645, 2599, 198, 220, 220, 220, 5298, 198, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 37227, 198, 31, 32538, 198, 4299, 1005, 16, 3419, 4613, 493, 12762, 25, 198, 220, 220, 220, 1441, 352, 198, 31, 22615, 198, 4299, 1332, 33529, 198, 220, 220, 220, 6818, 2116, 13, 1186, 16, 3419, 6624, 352, 198, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 37227, 198, 31, 32538, 198, 4299, 4938, 62, 21975, 7, 82, 2194, 25, 2209, 8, 4613, 20512, 25, 198, 220, 220, 220, 2116, 35678, 7, 82, 2194, 8, 198, 31, 22615, 198, 4299, 1332, 33529, 198, 220, 220, 220, 6818, 2116, 13, 12102, 62, 21975, 7, 19662, 13, 82, 2194, 8, 198, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 37227, 198, 31, 22615, 198, 4299, 1332, 33529, 198, 220, 220, 220, 6818, 8246, 62, 13345, 7, 19662, 13, 82, 2194, 11, 275, 6, 3256, 3509, 62, 5269, 1096, 28, 16, 11, 3623, 28, 940, 11, 1988, 28, 12825, 9, 12825, 8, 6624, 275, 7061, 198, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 37227, 198, 31, 22615, 198, 4299, 1332, 33529, 198, 220, 220, 220, 6818, 2251, 62, 11813, 263, 62, 1462, 7, 944, 8, 6624, 2116, 198, 220, 220, 220, 13538, 1600, 198, 60, 628, 198, 31, 9078, 9288, 13, 4102, 13, 17143, 316, 380, 2736, 7203, 8189, 1600, 4938, 62, 8189, 8, 628, 628, 198 ]
2.520697
459
#!/usr/bin/python # -*- coding: utf-8; -*- # # All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # # @author: Eduardo S. Scarpellini # @author: Luiz Ozaki __copyright__ = "Copyright 2012, Locaweb IDC" from netl2api.l2api.exceptions import * from netl2api.l2api.autocache import L2APIAutoCache from netl2api.l2api.transport import SysSSHTransport #, TransportManager __all__ = ["L2API"] class L2API(L2APIAutoCache): """ Base class for L2 operations. Vendor-specific classes should extend this, declare 'self.__VENDOR__' (vendor str), 'self.__HWTYPE__' (hardware type str), 'self.prompt_mark', 'self.error_mark' and 'self.config_term_cmd' (see transport classes for understand these three last parameters). Ex.: class ExampleVendorAPI(L2API): def __init__(self, *args, **kwargs): self.__VENDOR__ = "ExampleVendor" self.__HWTYPE__ = "stackable_switch" self.prompt_mark = "#" self.error_mark = "% Error:" self.config_term_cmd = "terminal length 0" super(ExampleVendorAPI, self).__init__(*args, **kwargs) ... def show_version(self): ... def show_interfaces(self): .... """ # def __del__(self): # if self.transport is not None: # try: # self.transport.close() # except Exception: # pass
[ 2, 48443, 14629, 14, 8800, 14, 29412, 198, 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 26, 532, 9, 12, 198, 2, 198, 2, 1439, 6923, 33876, 13, 198, 2, 198, 2, 220, 220, 220, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 220, 220, 220, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 220, 220, 220, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 220, 220, 220, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 220, 220, 220, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 220, 220, 220, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 220, 220, 220, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 220, 220, 220, 11247, 739, 262, 13789, 13, 198, 2, 198, 2, 2488, 9800, 25, 40766, 13109, 311, 13, 12089, 23506, 5362, 198, 2, 2488, 9800, 25, 6026, 528, 18024, 8182, 628, 198, 834, 22163, 4766, 834, 796, 366, 15269, 2321, 11, 15181, 707, 1765, 4522, 34, 1, 628, 198, 6738, 2010, 75, 17, 15042, 13, 75, 17, 15042, 13, 1069, 11755, 1330, 1635, 198, 6738, 2010, 75, 17, 15042, 13, 75, 17, 15042, 13, 2306, 420, 4891, 1330, 406, 17, 2969, 3539, 9390, 30562, 198, 6738, 2010, 75, 17, 15042, 13, 75, 17, 15042, 13, 7645, 634, 1330, 311, 893, 5432, 39, 8291, 634, 1303, 11, 19940, 13511, 628, 198, 834, 439, 834, 796, 14631, 43, 17, 17614, 8973, 628, 198, 4871, 406, 17, 17614, 7, 43, 17, 2969, 3539, 9390, 30562, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 7308, 1398, 329, 406, 17, 4560, 13, 198, 220, 220, 220, 39896, 12, 11423, 6097, 815, 9117, 428, 11, 13627, 705, 944, 13, 834, 53, 10619, 1581, 834, 6, 357, 85, 18738, 965, 828, 198, 220, 220, 220, 705, 944, 13, 834, 39, 54, 25216, 834, 6, 357, 10424, 1574, 2099, 965, 828, 705, 944, 13, 16963, 457, 62, 4102, 3256, 705, 944, 13, 18224, 62, 4102, 6, 290, 198, 220, 220, 220, 705, 944, 13, 11250, 62, 4354, 62, 28758, 6, 357, 3826, 4839, 6097, 329, 1833, 777, 1115, 938, 10007, 737, 628, 220, 220, 220, 1475, 11207, 198, 220, 220, 220, 1398, 17934, 53, 18738, 17614, 7, 43, 17, 17614, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 825, 11593, 15003, 834, 7, 944, 11, 1635, 22046, 11, 12429, 46265, 22046, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 834, 53, 10619, 1581, 834, 220, 220, 220, 220, 220, 796, 366, 16281, 53, 18738, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 834, 39, 54, 25216, 834, 220, 220, 220, 220, 220, 796, 366, 25558, 540, 62, 31943, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 16963, 457, 62, 4102, 220, 220, 220, 220, 796, 25113, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18224, 62, 4102, 220, 220, 220, 220, 220, 796, 36521, 13047, 11097, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 11250, 62, 4354, 62, 28758, 796, 366, 23705, 282, 4129, 657, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2208, 7, 16281, 53, 18738, 17614, 11, 2116, 737, 834, 15003, 834, 46491, 22046, 11, 12429, 46265, 22046, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2644, 628, 220, 220, 220, 220, 220, 220, 220, 825, 905, 62, 9641, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2644, 628, 220, 220, 220, 220, 220, 220, 220, 825, 905, 62, 3849, 32186, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19424, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 1303, 825, 11593, 12381, 834, 7, 944, 2599, 198, 220, 220, 220, 1303, 220, 220, 220, 220, 611, 2116, 13, 7645, 634, 318, 407, 6045, 25, 198, 220, 220, 220, 1303, 220, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 1303, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 7645, 634, 13, 19836, 3419, 198, 220, 220, 220, 1303, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 35528, 25, 198, 220, 220, 220, 1303, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1208, 198 ]
2.441574
813
# # This file is part of the PyMeasure package. # # Copyright (c) 2013-2022 PyMeasure Developers # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. # from pymeasure.instruments import Instrument from pymeasure.instruments.validators import truncated_range, strict_discrete_set class Agilent8257D(Instrument): """Represents the Agilent 8257D Signal Generator and provides a high-level interface for interacting with the instrument. .. code-block:: python generator = Agilent8257D("GPIB::1") generator.power = 0 # Sets the output power to 0 dBm generator.frequency = 5 # Sets the output frequency to 5 GHz generator.enable() # Enables the output """ power = Instrument.control( ":POW?;", ":POW %g dBm;", """ A floating point property that represents the output power in dBm. This property can be set. """ ) frequency = Instrument.control( ":FREQ?;", ":FREQ %e Hz;", """ A floating point property that represents the output frequency in Hz. This property can be set. """ ) start_frequency = Instrument.control( ":SOUR:FREQ:STAR?", ":SOUR:FREQ:STAR %e Hz", """ A floating point property that represents the start frequency in Hz. This property can be set. """ ) center_frequency = Instrument.control( ":SOUR:FREQ:CENT?", ":SOUR:FREQ:CENT %e Hz;", """ A floating point property that represents the center frequency in Hz. This property can be set. """ ) stop_frequency = Instrument.control( ":SOUR:FREQ:STOP?", ":SOUR:FREQ:STOP %e Hz", """ A floating point property that represents the stop frequency in Hz. This property can be set. """ ) start_power = Instrument.control( ":SOUR:POW:STAR?", ":SOUR:POW:STAR %e dBm", """ A floating point property that represents the start power in dBm. This property can be set. """ ) stop_power = Instrument.control( ":SOUR:POW:STOP?", ":SOUR:POW:STOP %e dBm", """ A floating point property that represents the stop power in dBm. This property can be set. """ ) dwell_time = Instrument.control( ":SOUR:SWE:DWEL1?", ":SOUR:SWE:DWEL1 %.3f", """ A floating point property that represents the settling time in seconds at the current frequency or power setting. This property can be set. """ ) step_points = Instrument.control( ":SOUR:SWE:POIN?", ":SOUR:SWE:POIN %d", """ An integer number of points in a step sweep. This property can be set. """ ) is_enabled = Instrument.measurement( ":OUTPUT?", """ Reads a boolean value that is True if the output is on. """, cast=bool ) has_modulation = Instrument.measurement( ":OUTPUT:MOD?", """ Reads a boolean value that is True if the modulation is enabled. """, cast=bool ) ######################## # Amplitude modulation # ######################## has_amplitude_modulation = Instrument.measurement( ":SOUR:AM:STAT?", """ Reads a boolean value that is True if the amplitude modulation is enabled. """, cast=bool ) amplitude_depth = Instrument.control( ":SOUR:AM:DEPT?", ":SOUR:AM:DEPT %g", """ A floating point property that controls the amplitude modulation in precent, which can take values from 0 to 100 %. """, validator=truncated_range, values=[0, 100] ) AMPLITUDE_SOURCES = { 'internal': 'INT', 'internal 2': 'INT2', 'external': 'EXT', 'external 2': 'EXT2' } amplitude_source = Instrument.control( ":SOUR:AM:SOUR?", ":SOUR:AM:SOUR %s", """ A string property that controls the source of the amplitude modulation signal, which can take the values: 'internal', 'internal 2', 'external', and 'external 2'. """, validator=strict_discrete_set, values=AMPLITUDE_SOURCES, map_values=True ) #################### # Pulse modulation # #################### has_pulse_modulation = Instrument.measurement( ":SOUR:PULM:STAT?", """ Reads a boolean value that is True if the pulse modulation is enabled. """, cast=bool ) PULSE_SOURCES = { 'internal': 'INT', 'external': 'EXT', 'scalar': 'SCAL' } pulse_source = Instrument.control( ":SOUR:PULM:SOUR?", ":SOUR:PULM:SOUR %s", """ A string property that controls the source of the pulse modulation signal, which can take the values: 'internal', 'external', and 'scalar'. """, validator=strict_discrete_set, values=PULSE_SOURCES, map_values=True ) PULSE_INPUTS = { 'square': 'SQU', 'free-run': 'FRUN', 'triggered': 'TRIG', 'doublet': 'DOUB', 'gated': 'GATE' } pulse_input = Instrument.control( ":SOUR:PULM:SOUR:INT?", ":SOUR:PULM:SOUR:INT %s", """ A string property that controls the internally generated modulation input for the pulse modulation, which can take the values: 'square', 'free-run', 'triggered', 'doublet', and 'gated'. """, validator=strict_discrete_set, values=PULSE_INPUTS, map_values=True ) pulse_frequency = Instrument.control( ":SOUR:PULM:INT:FREQ?", ":SOUR:PULM:INT:FREQ %g", """ A floating point property that controls the pulse rate frequency in Hertz, which can take values from 0.1 Hz to 10 MHz. """, validator=truncated_range, values=[0.1, 10e6] ) ######################## # Low-Frequency Output # ######################## low_freq_out_amplitude = Instrument.control( ":SOUR:LFO:AMPL? ", ":SOUR:LFO:AMPL %g VP", """A floating point property that controls the peak voltage (amplitude) of the low frequency output in volts, which can take values from 0-3.5V""", validator=truncated_range, values=[0, 3.5] ) LOW_FREQUENCY_SOURCES = { 'internal': 'INT', 'internal 2': 'INT2', 'function': 'FUNC', 'function 2': 'FUNC2' } low_freq_out_source = Instrument.control( ":SOUR:LFO:SOUR?", ":SOUR:LFO:SOUR %s", """A string property which controls the source of the low frequency output, which can take the values 'internal [2]' for the inernal source, or 'function [2]' for an internal function generator which can be configured.""", validator=strict_discrete_set, values=LOW_FREQUENCY_SOURCES, map_values=True ) def enable_low_freq_out(self): """Enables low frequency output""" self.write(":SOUR:LFO:STAT ON") def disable_low_freq_out(self): """Disables low frequency output""" self.write(":SOUR:LFO:STAT OFF") def config_low_freq_out(self, source='internal', amplitude=3): """ Configures the low-frequency output signal. :param source: The source for the low-frequency output signal. :param amplitude: Amplitude of the low-frequency output """ self.enable_low_freq_out() self.low_freq_out_source = source self.low_freq_out_amplitude = amplitude ####################### # Internal Oscillator # ####################### internal_frequency = Instrument.control( ":SOUR:AM:INT:FREQ?", ":SOUR:AM:INT:FREQ %g", """ A floating point property that controls the frequency of the internal oscillator in Hertz, which can take values from 0.5 Hz to 1 MHz. """, validator=truncated_range, values=[0.5, 1e6] ) INTERNAL_SHAPES = { 'sine': 'SINE', 'triangle': 'TRI', 'square': 'SQU', 'ramp': 'RAMP', 'noise': 'NOIS', 'dual-sine': 'DUAL', 'swept-sine': 'SWEP' } internal_shape = Instrument.control( ":SOUR:AM:INT:FUNC:SHAP?", ":SOUR:AM:INT:FUNC:SHAP %s", """ A string property that controls the shape of the internal oscillations, which can take the values: 'sine', 'triangle', 'square', 'ramp', 'noise', 'dual-sine', and 'swept-sine'. """, validator=strict_discrete_set, values=INTERNAL_SHAPES, map_values=True ) def enable(self): """ Enables the output of the signal. """ self.write(":OUTPUT ON;") def disable(self): """ Disables the output of the signal. """ self.write(":OUTPUT OFF;") def disable_modulation(self): """ Disables the signal modulation. """ self.write(":OUTPUT:MOD OFF;") self.write(":lfo:stat off;") def config_amplitude_modulation(self, frequency=1e3, depth=100.0, shape='sine'): """ Configures the amplitude modulation of the output signal. :param frequency: A modulation frequency for the internal oscillator :param depth: A linear depth precentage :param shape: A string that describes the shape for the internal oscillator """ self.enable_amplitude_modulation() self.amplitude_source = 'internal' self.internal_frequency = frequency self.internal_shape = shape self.amplitude_depth = depth def enable_amplitude_modulation(self): """ Enables amplitude modulation of the output signal. """ self.write(":SOUR:AM:STAT ON") def disable_amplitude_modulation(self): """ Disables amplitude modulation of the output signal. """ self.write(":SOUR:AM:STAT OFF") def config_pulse_modulation(self, frequency=1e3, input='square'): """ Configures the pulse modulation of the output signal. :param frequency: A pulse rate frequency in Hertz :param input: A string that describes the internal pulse input """ self.enable_pulse_modulation() self.pulse_source = 'internal' self.pulse_input = input self.pulse_frequency = frequency def enable_pulse_modulation(self): """ Enables pulse modulation of the output signal. """ self.write(":SOUR:PULM:STAT ON") def disable_pulse_modulation(self): """ Disables pulse modulation of the output signal. """ self.write(":SOUR:PULM:STAT OFF") def config_step_sweep(self): """ Configures a step sweep through frequency """ self.write(":SOUR:FREQ:MODE SWE;" ":SOUR:SWE:GEN STEP;" ":SOUR:SWE:MODE AUTO;") def start_step_sweep(self): """ Starts a step sweep. """ self.write(":SOUR:SWE:CONT:STAT ON") def stop_step_sweep(self): """ Stops a step sweep. """ self.write(":SOUR:SWE:CONT:STAT OFF") def shutdown(self): """ Shuts down the instrument by disabling any modulation and the output signal. """ self.disable_modulation() self.disable()
[ 2, 198, 2, 770, 2393, 318, 636, 286, 262, 9485, 47384, 5301, 13, 198, 2, 198, 2, 15069, 357, 66, 8, 2211, 12, 1238, 1828, 9485, 47384, 34152, 198, 2, 198, 2, 2448, 3411, 318, 29376, 7520, 11, 1479, 286, 3877, 11, 284, 597, 1048, 16727, 257, 4866, 198, 2, 286, 428, 3788, 290, 3917, 10314, 3696, 357, 1169, 366, 25423, 12340, 284, 1730, 198, 2, 287, 262, 10442, 1231, 17504, 11, 1390, 1231, 17385, 262, 2489, 198, 2, 284, 779, 11, 4866, 11, 13096, 11, 20121, 11, 7715, 11, 14983, 11, 850, 43085, 11, 290, 14, 273, 3677, 198, 2, 9088, 286, 262, 10442, 11, 290, 284, 8749, 6506, 284, 4150, 262, 10442, 318, 198, 2, 30760, 284, 466, 523, 11, 2426, 284, 262, 1708, 3403, 25, 198, 2, 198, 2, 383, 2029, 6634, 4003, 290, 428, 7170, 4003, 2236, 307, 3017, 287, 198, 2, 477, 9088, 393, 8904, 16690, 286, 262, 10442, 13, 198, 2, 198, 2, 3336, 47466, 3180, 36592, 2389, 1961, 366, 1921, 3180, 1600, 42881, 34764, 56, 3963, 15529, 509, 12115, 11, 7788, 32761, 6375, 198, 2, 8959, 49094, 11, 47783, 2751, 21728, 5626, 40880, 5390, 3336, 34764, 11015, 3963, 34482, 3398, 1565, 5603, 25382, 11, 198, 2, 376, 46144, 7473, 317, 16652, 2149, 37232, 33079, 48933, 5357, 44521, 1268, 10913, 2751, 12529, 13, 3268, 8005, 49261, 50163, 3336, 198, 2, 37195, 20673, 6375, 27975, 38162, 9947, 367, 15173, 4877, 9348, 43031, 19146, 7473, 15529, 47666, 3955, 11, 29506, 25552, 6375, 25401, 198, 2, 43031, 25382, 11, 7655, 2767, 16879, 3268, 3537, 40282, 3963, 27342, 10659, 11, 309, 9863, 6375, 25401, 54, 24352, 11, 5923, 1797, 2751, 16034, 11, 198, 2, 16289, 3963, 6375, 3268, 7102, 45, 24565, 13315, 3336, 47466, 6375, 3336, 23210, 6375, 25401, 5550, 1847, 20754, 3268, 198, 2, 3336, 47466, 13, 198, 2, 198, 198, 6738, 12972, 1326, 5015, 13, 259, 2536, 2886, 1330, 42410, 198, 6738, 12972, 1326, 5015, 13, 259, 2536, 2886, 13, 12102, 2024, 1330, 40122, 515, 62, 9521, 11, 7646, 62, 15410, 8374, 62, 2617, 628, 198, 4871, 2449, 346, 298, 23, 28676, 35, 7, 818, 43872, 2599, 198, 220, 220, 220, 37227, 6207, 6629, 262, 2449, 346, 298, 807, 28676, 35, 26484, 35986, 290, 198, 220, 220, 220, 3769, 257, 1029, 12, 5715, 7071, 329, 24986, 351, 198, 220, 220, 220, 262, 8875, 13, 628, 220, 220, 220, 11485, 2438, 12, 9967, 3712, 21015, 628, 220, 220, 220, 220, 220, 220, 220, 17301, 796, 2449, 346, 298, 23, 28676, 35, 7203, 16960, 9865, 3712, 16, 4943, 628, 220, 220, 220, 220, 220, 220, 220, 17301, 13, 6477, 796, 657, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 21394, 262, 5072, 1176, 284, 657, 30221, 76, 198, 220, 220, 220, 220, 220, 220, 220, 17301, 13, 35324, 796, 642, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 21394, 262, 5072, 8373, 284, 642, 26499, 198, 220, 220, 220, 220, 220, 220, 220, 17301, 13, 21633, 3419, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2039, 2977, 262, 5072, 628, 220, 220, 220, 37227, 628, 220, 220, 220, 1176, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 47, 3913, 30, 26, 1600, 366, 25, 47, 3913, 4064, 70, 30221, 76, 26, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 5072, 1176, 198, 220, 220, 220, 220, 220, 220, 220, 287, 30221, 76, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 8373, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 37, 2200, 48, 30, 26, 1600, 366, 25, 37, 2200, 48, 4064, 68, 26109, 26, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 5072, 8373, 198, 220, 220, 220, 220, 220, 220, 220, 287, 26109, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 923, 62, 35324, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 37, 2200, 48, 25, 46678, 35379, 366, 25, 50, 11698, 25, 37, 2200, 48, 25, 46678, 4064, 68, 26109, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 923, 8373, 198, 220, 220, 220, 220, 220, 220, 220, 287, 26109, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 3641, 62, 35324, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 37, 2200, 48, 25, 43960, 35379, 366, 25, 50, 11698, 25, 37, 2200, 48, 25, 43960, 4064, 68, 26109, 26, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 3641, 8373, 198, 220, 220, 220, 220, 220, 220, 220, 287, 26109, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 2245, 62, 35324, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 37, 2200, 48, 25, 2257, 3185, 35379, 366, 25, 50, 11698, 25, 37, 2200, 48, 25, 2257, 3185, 4064, 68, 26109, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 2245, 8373, 198, 220, 220, 220, 220, 220, 220, 220, 287, 26109, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 923, 62, 6477, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 47, 3913, 25, 46678, 35379, 366, 25, 50, 11698, 25, 47, 3913, 25, 46678, 4064, 68, 30221, 76, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 923, 1176, 198, 220, 220, 220, 220, 220, 220, 220, 287, 30221, 76, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 2245, 62, 6477, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 47, 3913, 25, 2257, 3185, 35379, 366, 25, 50, 11698, 25, 47, 3913, 25, 2257, 3185, 4064, 68, 30221, 76, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 2245, 1176, 198, 220, 220, 220, 220, 220, 220, 220, 287, 30221, 76, 13, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 14046, 62, 2435, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 50, 8845, 25, 42955, 3698, 16, 35379, 366, 25, 50, 11698, 25, 50, 8845, 25, 42955, 3698, 16, 4064, 13, 18, 69, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6870, 262, 25446, 640, 198, 220, 220, 220, 220, 220, 220, 220, 287, 4201, 379, 262, 1459, 8373, 393, 1176, 4634, 13, 198, 220, 220, 220, 220, 220, 220, 220, 770, 3119, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 2239, 62, 13033, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 50, 8845, 25, 16402, 1268, 35379, 366, 25, 50, 11698, 25, 50, 8845, 25, 16402, 1268, 4064, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 1052, 18253, 1271, 286, 2173, 287, 257, 2239, 16085, 13, 770, 3119, 198, 220, 220, 220, 220, 220, 220, 220, 460, 307, 900, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 318, 62, 25616, 796, 42410, 13, 1326, 5015, 434, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 2606, 7250, 3843, 35379, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4149, 82, 257, 25131, 1988, 326, 318, 6407, 611, 262, 5072, 318, 319, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 3350, 28, 30388, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 468, 62, 4666, 1741, 796, 42410, 13, 1326, 5015, 434, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 2606, 7250, 3843, 25, 33365, 35379, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4149, 82, 257, 25131, 1988, 326, 318, 6407, 611, 262, 39007, 318, 9343, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 3350, 28, 30388, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 1303, 14468, 4242, 21017, 198, 220, 220, 220, 1303, 44074, 3984, 39007, 1303, 198, 220, 220, 220, 1303, 14468, 4242, 21017, 628, 220, 220, 220, 468, 62, 321, 489, 3984, 62, 4666, 1741, 796, 42410, 13, 1326, 5015, 434, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 2390, 25, 35744, 35379, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4149, 82, 257, 25131, 1988, 326, 318, 6407, 611, 262, 37188, 39007, 318, 9343, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 3350, 28, 30388, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 37188, 62, 18053, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 2390, 25, 7206, 11571, 35379, 366, 25, 50, 11698, 25, 2390, 25, 7206, 11571, 4064, 70, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6973, 262, 37188, 39007, 198, 220, 220, 220, 220, 220, 220, 220, 287, 662, 1087, 11, 543, 460, 1011, 3815, 422, 657, 284, 1802, 4064, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 2213, 19524, 515, 62, 9521, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 41888, 15, 11, 1802, 60, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 3001, 6489, 2043, 52, 7206, 62, 50, 2606, 7397, 1546, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 32538, 10354, 705, 12394, 3256, 705, 32538, 362, 10354, 705, 12394, 17, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 22615, 10354, 705, 13918, 3256, 705, 22615, 362, 10354, 705, 13918, 17, 6, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 37188, 62, 10459, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 2390, 25, 50, 11698, 35379, 366, 25, 50, 11698, 25, 2390, 25, 50, 11698, 4064, 82, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 4731, 3119, 326, 6973, 262, 2723, 286, 262, 37188, 39007, 198, 220, 220, 220, 220, 220, 220, 220, 6737, 11, 543, 460, 1011, 262, 3815, 25, 705, 32538, 3256, 705, 32538, 362, 3256, 705, 22615, 3256, 290, 198, 220, 220, 220, 220, 220, 220, 220, 705, 22615, 362, 4458, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 301, 2012, 62, 15410, 8374, 62, 2617, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 28, 2390, 6489, 2043, 52, 7206, 62, 50, 2606, 7397, 1546, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3975, 62, 27160, 28, 17821, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 1303, 14468, 21017, 198, 220, 220, 220, 1303, 25062, 39007, 1303, 198, 220, 220, 220, 1303, 14468, 21017, 628, 220, 220, 220, 468, 62, 79, 9615, 62, 4666, 1741, 796, 42410, 13, 1326, 5015, 434, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 5105, 31288, 25, 35744, 35379, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4149, 82, 257, 25131, 1988, 326, 318, 6407, 611, 262, 19445, 39007, 318, 9343, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 3350, 28, 30388, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 350, 6239, 5188, 62, 50, 2606, 7397, 1546, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 32538, 10354, 705, 12394, 3256, 705, 22615, 10354, 705, 13918, 3256, 705, 1416, 282, 283, 10354, 705, 6173, 1847, 6, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 19445, 62, 10459, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 5105, 31288, 25, 50, 11698, 35379, 366, 25, 50, 11698, 25, 5105, 31288, 25, 50, 11698, 4064, 82, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 4731, 3119, 326, 6973, 262, 2723, 286, 262, 19445, 39007, 198, 220, 220, 220, 220, 220, 220, 220, 6737, 11, 543, 460, 1011, 262, 3815, 25, 705, 32538, 3256, 705, 22615, 3256, 290, 198, 220, 220, 220, 220, 220, 220, 220, 705, 1416, 282, 283, 4458, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 301, 2012, 62, 15410, 8374, 62, 2617, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 28, 5105, 43, 5188, 62, 50, 2606, 7397, 1546, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3975, 62, 27160, 28, 17821, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 350, 6239, 5188, 62, 1268, 30076, 50, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 23415, 10354, 705, 50, 10917, 3256, 705, 5787, 12, 5143, 10354, 705, 10913, 4944, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 2213, 328, 10446, 10354, 705, 5446, 3528, 3256, 705, 23352, 83, 10354, 705, 35, 2606, 33, 3256, 705, 70, 515, 10354, 705, 38, 6158, 6, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 19445, 62, 15414, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 5105, 31288, 25, 50, 11698, 25, 12394, 35379, 366, 25, 50, 11698, 25, 5105, 31288, 25, 50, 11698, 25, 12394, 4064, 82, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 4731, 3119, 326, 6973, 262, 20947, 7560, 39007, 198, 220, 220, 220, 220, 220, 220, 220, 5128, 329, 262, 19445, 39007, 11, 543, 460, 1011, 262, 3815, 25, 705, 23415, 3256, 705, 5787, 12, 5143, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 2213, 328, 10446, 3256, 705, 23352, 83, 3256, 290, 705, 70, 515, 4458, 198, 220, 220, 220, 220, 220, 220, 220, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 301, 2012, 62, 15410, 8374, 62, 2617, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 28, 5105, 43, 5188, 62, 1268, 30076, 50, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3975, 62, 27160, 28, 17821, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 19445, 62, 35324, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 5105, 31288, 25, 12394, 25, 37, 2200, 48, 35379, 366, 25, 50, 11698, 25, 5105, 31288, 25, 12394, 25, 37, 2200, 48, 4064, 70, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6973, 262, 19445, 2494, 8373, 287, 40030, 89, 11, 198, 220, 220, 220, 220, 220, 220, 220, 543, 460, 1011, 3815, 422, 657, 13, 16, 26109, 284, 838, 19805, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 2213, 19524, 515, 62, 9521, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 41888, 15, 13, 16, 11, 838, 68, 21, 60, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 1303, 14468, 4242, 21017, 198, 220, 220, 220, 1303, 7754, 12, 37, 28707, 25235, 1303, 198, 220, 220, 220, 1303, 14468, 4242, 21017, 628, 220, 220, 220, 1877, 62, 19503, 80, 62, 448, 62, 321, 489, 3984, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 43, 6080, 25, 2390, 6489, 30, 33172, 366, 25, 50, 11698, 25, 43, 6080, 25, 2390, 6489, 4064, 70, 23342, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 32, 12462, 966, 3119, 326, 6973, 262, 9103, 15004, 357, 321, 489, 3984, 8, 286, 262, 198, 220, 220, 220, 220, 220, 220, 220, 1877, 8373, 5072, 287, 46297, 11, 543, 460, 1011, 3815, 422, 657, 12, 18, 13, 20, 53, 15931, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 2213, 19524, 515, 62, 9521, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 41888, 15, 11, 513, 13, 20, 60, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 46663, 62, 37, 2200, 10917, 45155, 62, 50, 2606, 7397, 1546, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 32538, 10354, 705, 12394, 3256, 705, 32538, 362, 10354, 705, 12394, 17, 3256, 705, 8818, 10354, 705, 42296, 34, 3256, 705, 8818, 362, 10354, 705, 42296, 34, 17, 6, 198, 220, 220, 220, 1782, 628, 220, 220, 220, 1877, 62, 19503, 80, 62, 448, 62, 10459, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 43, 6080, 25, 50, 11698, 35379, 366, 25, 50, 11698, 25, 43, 6080, 25, 50, 11698, 4064, 82, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 32, 4731, 3119, 543, 6973, 262, 2723, 286, 262, 1877, 8373, 5072, 11, 543, 198, 220, 220, 220, 220, 220, 220, 220, 460, 1011, 262, 3815, 705, 32538, 685, 17, 49946, 329, 262, 287, 35220, 2723, 11, 393, 705, 8818, 685, 17, 49946, 329, 281, 5387, 198, 220, 220, 220, 220, 220, 220, 220, 2163, 17301, 543, 460, 307, 17839, 32203, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 301, 2012, 62, 15410, 8374, 62, 2617, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 28, 43, 3913, 62, 37, 2200, 10917, 45155, 62, 50, 2606, 7397, 1546, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3975, 62, 27160, 28, 17821, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 825, 7139, 62, 9319, 62, 19503, 80, 62, 448, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4834, 2977, 1877, 8373, 5072, 37811, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 43, 6080, 25, 35744, 6177, 4943, 628, 220, 220, 220, 825, 15560, 62, 9319, 62, 19503, 80, 62, 448, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 7279, 2977, 1877, 8373, 5072, 37811, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 43, 6080, 25, 35744, 18562, 4943, 628, 220, 220, 220, 825, 4566, 62, 9319, 62, 19503, 80, 62, 448, 7, 944, 11, 2723, 11639, 32538, 3256, 37188, 28, 18, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 17056, 942, 262, 1877, 12, 35324, 5072, 6737, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 2723, 25, 383, 2723, 329, 262, 1877, 12, 35324, 5072, 6737, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 37188, 25, 44074, 3984, 286, 262, 1877, 12, 35324, 5072, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 21633, 62, 9319, 62, 19503, 80, 62, 448, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 9319, 62, 19503, 80, 62, 448, 62, 10459, 796, 2723, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 9319, 62, 19503, 80, 62, 448, 62, 321, 489, 3984, 796, 37188, 628, 220, 220, 220, 1303, 14468, 4242, 2235, 198, 220, 220, 220, 1303, 18628, 440, 22360, 1352, 1303, 198, 220, 220, 220, 1303, 14468, 4242, 2235, 628, 220, 220, 220, 5387, 62, 35324, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 2390, 25, 12394, 25, 37, 2200, 48, 35379, 366, 25, 50, 11698, 25, 2390, 25, 12394, 25, 37, 2200, 48, 4064, 70, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 12462, 966, 3119, 326, 6973, 262, 8373, 286, 262, 5387, 198, 220, 220, 220, 220, 220, 220, 220, 24969, 1352, 287, 40030, 89, 11, 543, 460, 1011, 3815, 422, 657, 13, 20, 26109, 284, 352, 19805, 13, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 2213, 19524, 515, 62, 9521, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 41888, 15, 13, 20, 11, 352, 68, 21, 60, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 23255, 45, 1847, 62, 9693, 2969, 1546, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 82, 500, 10354, 705, 50, 8881, 3256, 705, 28461, 9248, 10354, 705, 5446, 40, 3256, 705, 23415, 10354, 705, 50, 10917, 3256, 705, 81, 696, 10354, 705, 49, 23518, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 3919, 786, 10354, 705, 15285, 1797, 3256, 705, 646, 282, 12, 82, 500, 10354, 705, 35, 25620, 3256, 705, 46280, 457, 12, 82, 500, 10354, 705, 50, 8845, 47, 6, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 5387, 62, 43358, 796, 42410, 13, 13716, 7, 198, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 2390, 25, 12394, 25, 42296, 34, 25, 9693, 2969, 35379, 366, 25, 50, 11698, 25, 2390, 25, 12394, 25, 42296, 34, 25, 9693, 2969, 4064, 82, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 317, 4731, 3119, 326, 6973, 262, 5485, 286, 262, 5387, 24969, 602, 11, 198, 220, 220, 220, 220, 220, 220, 220, 543, 460, 1011, 262, 3815, 25, 705, 82, 500, 3256, 705, 28461, 9248, 3256, 705, 23415, 3256, 705, 81, 696, 3256, 705, 3919, 786, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 646, 282, 12, 82, 500, 3256, 290, 705, 46280, 457, 12, 82, 500, 4458, 13538, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 4938, 1352, 28, 301, 2012, 62, 15410, 8374, 62, 2617, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3815, 28, 1268, 31800, 1847, 62, 9693, 2969, 1546, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3975, 62, 27160, 28, 17821, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 825, 7139, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 2039, 2977, 262, 5072, 286, 262, 6737, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 2606, 7250, 3843, 6177, 26, 4943, 628, 220, 220, 220, 825, 15560, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 3167, 2977, 262, 5072, 286, 262, 6737, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 2606, 7250, 3843, 18562, 26, 4943, 628, 220, 220, 220, 825, 15560, 62, 4666, 1741, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 3167, 2977, 262, 6737, 39007, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 2606, 7250, 3843, 25, 33365, 18562, 26, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 1652, 78, 25, 14269, 572, 26, 4943, 628, 220, 220, 220, 825, 4566, 62, 321, 489, 3984, 62, 4666, 1741, 7, 944, 11, 8373, 28, 16, 68, 18, 11, 6795, 28, 3064, 13, 15, 11, 5485, 11639, 82, 500, 6, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 17056, 942, 262, 37188, 39007, 286, 262, 5072, 6737, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 8373, 25, 317, 39007, 8373, 329, 262, 5387, 24969, 1352, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 6795, 25, 317, 14174, 6795, 662, 1087, 496, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 5485, 25, 317, 4731, 326, 8477, 262, 5485, 329, 262, 5387, 24969, 1352, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 21633, 62, 321, 489, 3984, 62, 4666, 1741, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 321, 489, 3984, 62, 10459, 796, 705, 32538, 6, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32538, 62, 35324, 796, 8373, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32538, 62, 43358, 796, 5485, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 321, 489, 3984, 62, 18053, 796, 6795, 628, 220, 220, 220, 825, 7139, 62, 321, 489, 3984, 62, 4666, 1741, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 2039, 2977, 37188, 39007, 286, 262, 5072, 6737, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 2390, 25, 35744, 6177, 4943, 628, 220, 220, 220, 825, 15560, 62, 321, 489, 3984, 62, 4666, 1741, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 3167, 2977, 37188, 39007, 286, 262, 5072, 6737, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 2390, 25, 35744, 18562, 4943, 628, 220, 220, 220, 825, 4566, 62, 79, 9615, 62, 4666, 1741, 7, 944, 11, 8373, 28, 16, 68, 18, 11, 5128, 11639, 23415, 6, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 17056, 942, 262, 19445, 39007, 286, 262, 5072, 6737, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 8373, 25, 317, 19445, 2494, 8373, 287, 40030, 89, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 5128, 25, 317, 4731, 326, 8477, 262, 5387, 19445, 5128, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 21633, 62, 79, 9615, 62, 4666, 1741, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 79, 9615, 62, 10459, 796, 705, 32538, 6, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 79, 9615, 62, 15414, 796, 5128, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 79, 9615, 62, 35324, 796, 8373, 628, 220, 220, 220, 825, 7139, 62, 79, 9615, 62, 4666, 1741, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 2039, 2977, 19445, 39007, 286, 262, 5072, 6737, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 5105, 31288, 25, 35744, 6177, 4943, 628, 220, 220, 220, 825, 15560, 62, 79, 9615, 62, 4666, 1741, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 3167, 2977, 19445, 39007, 286, 262, 5072, 6737, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 5105, 31288, 25, 35744, 18562, 4943, 628, 220, 220, 220, 825, 4566, 62, 9662, 62, 46280, 538, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 17056, 942, 257, 2239, 16085, 832, 8373, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 37, 2200, 48, 25, 49058, 311, 8845, 26033, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 50, 8845, 25, 35353, 49154, 26033, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25, 50, 11698, 25, 50, 8845, 25, 49058, 47044, 46, 26, 4943, 628, 220, 220, 220, 825, 923, 62, 9662, 62, 46280, 538, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 50181, 257, 2239, 16085, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 50, 8845, 25, 37815, 25, 35744, 6177, 4943, 628, 220, 220, 220, 825, 2245, 62, 9662, 62, 46280, 538, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 520, 2840, 257, 2239, 16085, 13, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13564, 7, 1298, 50, 11698, 25, 50, 8845, 25, 37815, 25, 35744, 18562, 4943, 628, 220, 220, 220, 825, 18325, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 911, 5500, 866, 262, 8875, 416, 34909, 597, 39007, 198, 220, 220, 220, 220, 220, 220, 220, 290, 262, 5072, 6737, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 40223, 62, 4666, 1741, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 40223, 3419, 198 ]
2.482474
4,850
# -*- coding: utf-8 -*- # # Copyright 2020 Google LLC. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """S3 API-specific resource subclasses.""" from __future__ import absolute_import from __future__ import division from __future__ import unicode_literals import collections from googlecloudsdk.api_lib.storage import errors from googlecloudsdk.command_lib.storage.resources import resource_reference from googlecloudsdk.command_lib.storage.resources import resource_util _INCOMPLETE_OBJECT_METADATA_WARNING = ( 'Use "-j", the JSON flag, to view additional S3 metadata.') def _json_dump_recursion_helper(metadata): """See _get_json_dump docstring.""" if isinstance(metadata, list): return [_json_dump_recursion_helper(item) for item in metadata] if not isinstance(metadata, dict): return resource_util.convert_to_json_parsable_type(metadata) # Sort by key to make sure dictionary always prints in correct order. formatted_dict = collections.OrderedDict(sorted(metadata.items())) for key, value in formatted_dict.items(): if isinstance(value, dict): # Recursively handle dictionaries. formatted_dict[key] = _json_dump_recursion_helper(value) elif isinstance(value, list): # Recursively handled lists, which may contain more dicts, like ACLs. formatted_list = [_json_dump_recursion_helper(item) for item in value] if formatted_list: # Ignore empty lists. formatted_dict[key] = formatted_list elif value or resource_util.should_preserve_falsy_metadata_value(value): formatted_dict[key] = resource_util.convert_to_json_parsable_type(value) return formatted_dict def _get_json_dump(resource): """Formats S3 resource metadata as JSON. Args: resource (S3BucketResource|S3ObjectResource): Resource object. Returns: Formatted JSON string. """ return resource_util.configured_json_dumps( collections.OrderedDict([ ('url', resource.storage_url.url_string), ('type', resource.TYPE_STRING), ('metadata', _json_dump_recursion_helper(resource.metadata)), ])) def _get_error_or_exists_string(value): """Returns error if value is error or existence string.""" if isinstance(value, errors.S3ApiError): return value else: return resource_util.get_exists_string(value) def _get_formatted_acl_section(acl_metadata): """Returns formatted ACLs, error, or formatted none value.""" if isinstance(acl_metadata, errors.S3ApiError): return resource_util.get_padded_metadata_key_value_line('ACL', acl_metadata) elif acl_metadata: return resource_util.get_metadata_json_section_string( 'ACL', acl_metadata, _json_dump_recursion_helper) else: return resource_util.get_padded_metadata_key_value_line('ACL', '[]') def _get_full_bucket_metadata_string(resource): """Formats S3 resource metadata as string with rows. Args: resource (S3BucketResource): Resource with metadata. Returns: Formatted multi-line string. """ # Hardcoded strings found in Boto docs: # https://boto3.amazonaws.com/v1/documentation/api/latest/reference/services/s3.html logging_enabled_value = _get_error_or_exists_string( resource.metadata['LoggingEnabled']) website_value = _get_error_or_exists_string(resource.metadata['Website']) cors_value = _get_error_or_exists_string(resource.metadata['CORSRules']) encryption_value = _get_error_or_exists_string( resource.metadata['ServerSideEncryptionConfiguration']) lifecycle_configuration_value = _get_error_or_exists_string( resource.metadata['LifecycleConfiguration']) if isinstance(resource.metadata['Versioning'], errors.S3ApiError): versioning_enabled_value = resource.metadata['Versioning'] else: versioning_status = resource.metadata['Versioning'].get('Status') if versioning_status == 'Enabled': versioning_enabled_value = True elif versioning_status == 'Suspended': versioning_enabled_value = False else: versioning_enabled_value = None if isinstance(resource.metadata['Payer'], errors.S3ApiError): requester_pays_value = resource.metadata['Payer'] elif resource.metadata['Payer'] == 'Requester': requester_pays_value = True elif resource.metadata['Payer'] == 'BucketOwner': requester_pays_value = False else: requester_pays_value = None return ( '{bucket_url}:\n' '{location_constraint_line}' '{versioning_enabled_line}' '{logging_config_line}' '{website_config_line}' '{cors_config_line}' '{encryption_config_line}' '{lifecycle_config_line}' '{requester_pays_line}' '{acl_section}' ).format( bucket_url=resource.storage_url.versionless_url_string, location_constraint_line=resource_util.get_padded_metadata_key_value_line( 'Location Constraint', resource.metadata['LocationConstraint']), versioning_enabled_line=resource_util.get_padded_metadata_key_value_line( 'Versioning Enabled', versioning_enabled_value), logging_config_line=resource_util.get_padded_metadata_key_value_line( 'Logging Configuration', logging_enabled_value), website_config_line=resource_util.get_padded_metadata_key_value_line( 'Website Configuration', website_value), cors_config_line=resource_util.get_padded_metadata_key_value_line( 'CORS Configuration', cors_value), encryption_config_line=resource_util.get_padded_metadata_key_value_line( 'Encryption Configuration', encryption_value), lifecycle_config_line=resource_util.get_padded_metadata_key_value_line( 'Lifecycle Configuration', lifecycle_configuration_value), requester_pays_line=resource_util.get_padded_metadata_key_value_line( 'Requester Pays Enabled', requester_pays_value), # Remove ending newline character because this is the last list item. acl_section=_get_formatted_acl_section(resource.metadata['ACL'])[:-1]) def _get_full_object_metadata_string(resource): """Formats S3 resource metadata as string with rows. Args: resource (S3ObjectResource): Resource with metadata. Returns: Formatted multi-line string. """ # Hardcoded strings found in Boto docs: # https://boto3.amazonaws.com/v1/documentation/api/latest/reference/services/s3.html if 'LastModified' in resource.metadata: optional_time_updated_line = resource_util.get_padded_metadata_time_line( 'Update Time', resource.metadata['LastModified']) else: optional_time_updated_line = '' if 'StorageClass' in resource.metadata: optional_storage_class_line = resource_util.get_padded_metadata_key_value_line( 'Storage Class', resource.metadata['StorageClass']) else: optional_storage_class_line = '' if 'CacheControl' in resource.metadata: optional_cache_control_line = resource_util.get_padded_metadata_key_value_line( 'Cache-Control', resource.metadata['CacheControl']) else: optional_cache_control_line = '' if 'CacheDisposition' in resource.metadata: optional_content_disposition_line = resource_util.get_padded_metadata_key_value_line( 'Cache-Disposition', resource.metadata['CacheDisposition']) else: optional_content_disposition_line = '' if 'ContentEncoding' in resource.metadata: optional_content_encoding_line = resource_util.get_padded_metadata_key_value_line( 'Content-Encoding', resource.metadata['ContentEncoding']) else: optional_content_encoding_line = '' if 'ContentLanguage' in resource.metadata: optional_content_language_line = resource_util.get_padded_metadata_key_value_line( 'Content-Language', resource.metadata['ContentLanguage']) else: optional_content_language_line = '' if 'PartsCount' in resource.metadata: optional_component_count_line = ( resource_util.get_padded_metadata_key_value_line( 'Component-Count', resource.metadata['PartsCount'])) else: optional_component_count_line = '' if resource.md5_hash is not None: optional_md5_line = resource_util.get_padded_metadata_key_value_line( 'Hash (MD5)', resource.md5_hash) elif 'SSECustomerAlgorithm' in resource.metadata: optional_md5_line = resource_util.get_padded_metadata_key_value_line( 'Hash (MD5)', 'Underlying data encrypted') else: optional_md5_line = '' if 'SSECustomerAlgorithm' in resource.metadata: optional_encryption_algorithm_line = ( resource_util.get_padded_metadata_key_value_line( 'Encryption Algorithm', resource.metadata['SSECustomerAlgorithm'])) else: optional_encryption_algorithm_line = '' if resource.generation: optional_generation_line = resource_util.get_padded_metadata_key_value_line( 'Generation', resource.generation) else: optional_generation_line = '' return ( '{object_url}:\n' '{optional_time_updated_line}' '{optional_storage_class_line}' '{optional_cache_control_line}' '{optional_content_disposition_line}' '{optional_content_encoding_line}' '{optional_content_language_line}' '{content_length_line}' '{content_type_line}' '{optional_component_count_line}' '{optional_md5_line}' '{optional_encryption_algorithm_line}' '{etag_line}' '{optional_generation_line}' '{acl_section}' ' {incomplete_warning}').format( object_url=resource.storage_url.versionless_url_string, optional_time_updated_line=optional_time_updated_line, optional_storage_class_line=optional_storage_class_line, optional_cache_control_line=optional_cache_control_line, optional_content_disposition_line=optional_content_disposition_line, optional_content_encoding_line=optional_content_encoding_line, optional_content_language_line=optional_content_language_line, content_length_line=resource_util.get_padded_metadata_key_value_line( 'Content-Length', resource.size), content_type_line=resource_util.get_padded_metadata_key_value_line( 'Content-Type', resource.metadata.get('ContentType')), optional_component_count_line=optional_component_count_line, optional_md5_line=optional_md5_line, optional_encryption_algorithm_line=optional_encryption_algorithm_line, etag_line=resource_util.get_padded_metadata_key_value_line( 'ETag', resource.etag), optional_generation_line=optional_generation_line, acl_section=_get_formatted_acl_section(resource.metadata.get('ACL')), incomplete_warning=_INCOMPLETE_OBJECT_METADATA_WARNING) class S3BucketResource(resource_reference.BucketResource): """API-specific subclass for handling metadata.""" class S3ObjectResource(resource_reference.ObjectResource): """API-specific subclass for handling metadata.""" def __init__(self, storage_url_object, content_type=None, creation_time=None, etag=None, crc32c_hash=None, md5_hash=None, metadata=None, metageneration=None, size=None): """Initializes resource. Args are a subset of attributes.""" super(S3ObjectResource, self).__init__( storage_url_object, content_type=content_type, creation_time=creation_time, etag=etag, crc32c_hash=None, md5_hash=md5_hash, metadata=metadata, metageneration=metageneration, size=size)
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 1303, 198, 2, 15069, 12131, 3012, 11419, 13, 1439, 6923, 33876, 13, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 11247, 739, 262, 13789, 13, 198, 37811, 50, 18, 7824, 12, 11423, 8271, 850, 37724, 526, 15931, 198, 198, 6738, 11593, 37443, 834, 1330, 4112, 62, 11748, 198, 6738, 11593, 37443, 834, 1330, 7297, 198, 6738, 11593, 37443, 834, 1330, 28000, 1098, 62, 17201, 874, 198, 198, 11748, 17268, 198, 198, 6738, 23645, 17721, 21282, 74, 13, 15042, 62, 8019, 13, 35350, 1330, 8563, 198, 6738, 23645, 17721, 21282, 74, 13, 21812, 62, 8019, 13, 35350, 13, 37540, 1330, 8271, 62, 35790, 198, 6738, 23645, 17721, 21282, 74, 13, 21812, 62, 8019, 13, 35350, 13, 37540, 1330, 8271, 62, 22602, 628, 198, 62, 1268, 41335, 9328, 62, 9864, 23680, 62, 47123, 2885, 13563, 62, 31502, 796, 357, 198, 220, 220, 220, 705, 11041, 27444, 73, 1600, 262, 19449, 6056, 11, 284, 1570, 3224, 311, 18, 20150, 2637, 8, 628, 198, 4299, 4808, 17752, 62, 39455, 62, 8344, 24197, 62, 2978, 525, 7, 38993, 2599, 198, 220, 37227, 6214, 4808, 1136, 62, 17752, 62, 39455, 2205, 8841, 526, 15931, 198, 220, 611, 318, 39098, 7, 38993, 11, 1351, 2599, 198, 220, 220, 220, 1441, 685, 62, 17752, 62, 39455, 62, 8344, 24197, 62, 2978, 525, 7, 9186, 8, 329, 2378, 287, 20150, 60, 628, 220, 611, 407, 318, 39098, 7, 38993, 11, 8633, 2599, 198, 220, 220, 220, 1441, 8271, 62, 22602, 13, 1102, 1851, 62, 1462, 62, 17752, 62, 79, 945, 540, 62, 4906, 7, 38993, 8, 628, 220, 1303, 33947, 416, 1994, 284, 787, 1654, 22155, 1464, 20842, 287, 3376, 1502, 13, 198, 220, 39559, 62, 11600, 796, 17268, 13, 35422, 1068, 35, 713, 7, 82, 9741, 7, 38993, 13, 23814, 3419, 4008, 198, 220, 329, 1994, 11, 1988, 287, 39559, 62, 11600, 13, 23814, 33529, 198, 220, 220, 220, 611, 318, 39098, 7, 8367, 11, 8633, 2599, 198, 220, 220, 220, 220, 220, 1303, 3311, 1834, 2280, 5412, 48589, 3166, 13, 198, 220, 220, 220, 220, 220, 39559, 62, 11600, 58, 2539, 60, 796, 4808, 17752, 62, 39455, 62, 8344, 24197, 62, 2978, 525, 7, 8367, 8, 198, 220, 220, 220, 1288, 361, 318, 39098, 7, 8367, 11, 1351, 2599, 198, 220, 220, 220, 220, 220, 1303, 3311, 1834, 2280, 12118, 8341, 11, 543, 743, 3994, 517, 8633, 82, 11, 588, 17382, 82, 13, 198, 220, 220, 220, 220, 220, 39559, 62, 4868, 796, 685, 62, 17752, 62, 39455, 62, 8344, 24197, 62, 2978, 525, 7, 9186, 8, 329, 2378, 287, 1988, 60, 198, 220, 220, 220, 220, 220, 611, 39559, 62, 4868, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 41032, 6565, 8341, 13, 198, 220, 220, 220, 220, 220, 220, 220, 39559, 62, 11600, 58, 2539, 60, 796, 39559, 62, 4868, 198, 220, 220, 220, 1288, 361, 1988, 393, 8271, 62, 22602, 13, 21754, 62, 18302, 3760, 62, 69, 874, 88, 62, 38993, 62, 8367, 7, 8367, 2599, 198, 220, 220, 220, 220, 220, 39559, 62, 11600, 58, 2539, 60, 796, 8271, 62, 22602, 13, 1102, 1851, 62, 1462, 62, 17752, 62, 79, 945, 540, 62, 4906, 7, 8367, 8, 628, 220, 1441, 39559, 62, 11600, 628, 198, 4299, 4808, 1136, 62, 17752, 62, 39455, 7, 31092, 2599, 198, 220, 37227, 8479, 1381, 311, 18, 8271, 20150, 355, 19449, 13, 628, 220, 943, 14542, 25, 198, 220, 220, 220, 8271, 357, 50, 18, 33, 38811, 26198, 91, 50, 18, 10267, 26198, 2599, 20857, 2134, 13, 628, 220, 16409, 25, 198, 220, 220, 220, 5178, 16898, 19449, 4731, 13, 198, 220, 37227, 198, 220, 1441, 8271, 62, 22602, 13, 11250, 1522, 62, 17752, 62, 67, 8142, 7, 198, 220, 220, 220, 220, 220, 17268, 13, 35422, 1068, 35, 713, 26933, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19203, 6371, 3256, 8271, 13, 35350, 62, 6371, 13, 6371, 62, 8841, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19203, 4906, 3256, 8271, 13, 25216, 62, 18601, 2751, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19203, 38993, 3256, 4808, 17752, 62, 39455, 62, 8344, 24197, 62, 2978, 525, 7, 31092, 13, 38993, 36911, 198, 220, 220, 220, 220, 220, 2361, 4008, 628, 198, 4299, 4808, 1136, 62, 18224, 62, 273, 62, 1069, 1023, 62, 8841, 7, 8367, 2599, 198, 220, 37227, 35561, 4049, 611, 1988, 318, 4049, 393, 6224, 4731, 526, 15931, 198, 220, 611, 318, 39098, 7, 8367, 11, 8563, 13, 50, 18, 32, 14415, 12331, 2599, 198, 220, 220, 220, 1441, 1988, 198, 220, 2073, 25, 198, 220, 220, 220, 1441, 8271, 62, 22602, 13, 1136, 62, 1069, 1023, 62, 8841, 7, 8367, 8, 628, 198, 4299, 4808, 1136, 62, 687, 16898, 62, 37779, 62, 5458, 7, 37779, 62, 38993, 2599, 198, 220, 37227, 35561, 39559, 17382, 82, 11, 4049, 11, 393, 39559, 4844, 1988, 526, 15931, 198, 220, 611, 318, 39098, 7, 37779, 62, 38993, 11, 8563, 13, 50, 18, 32, 14415, 12331, 2599, 198, 220, 220, 220, 1441, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 10786, 2246, 43, 3256, 257, 565, 62, 38993, 8, 198, 220, 1288, 361, 257, 565, 62, 38993, 25, 198, 220, 220, 220, 1441, 8271, 62, 22602, 13, 1136, 62, 38993, 62, 17752, 62, 5458, 62, 8841, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 2246, 43, 3256, 257, 565, 62, 38993, 11, 4808, 17752, 62, 39455, 62, 8344, 24197, 62, 2978, 525, 8, 198, 220, 2073, 25, 198, 220, 220, 220, 1441, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 10786, 2246, 43, 3256, 705, 21737, 11537, 628, 198, 4299, 4808, 1136, 62, 12853, 62, 27041, 316, 62, 38993, 62, 8841, 7, 31092, 2599, 198, 220, 37227, 8479, 1381, 311, 18, 8271, 20150, 355, 4731, 351, 15274, 13, 628, 220, 943, 14542, 25, 198, 220, 220, 220, 8271, 357, 50, 18, 33, 38811, 26198, 2599, 20857, 351, 20150, 13, 628, 220, 16409, 25, 198, 220, 220, 220, 5178, 16898, 5021, 12, 1370, 4731, 13, 198, 220, 37227, 198, 220, 1303, 6912, 40976, 13042, 1043, 287, 347, 2069, 34165, 25, 198, 220, 1303, 3740, 1378, 65, 2069, 18, 13, 33103, 8356, 13, 785, 14, 85, 16, 14, 22897, 341, 14, 15042, 14, 42861, 14, 35790, 14, 30416, 14, 82, 18, 13, 6494, 198, 220, 18931, 62, 25616, 62, 8367, 796, 4808, 1136, 62, 18224, 62, 273, 62, 1069, 1023, 62, 8841, 7, 198, 220, 220, 220, 220, 220, 8271, 13, 38993, 17816, 11187, 2667, 20491, 6, 12962, 198, 220, 3052, 62, 8367, 796, 4808, 1136, 62, 18224, 62, 273, 62, 1069, 1023, 62, 8841, 7, 31092, 13, 38993, 17816, 33420, 6, 12962, 198, 220, 269, 669, 62, 8367, 796, 4808, 1136, 62, 18224, 62, 273, 62, 1069, 1023, 62, 8841, 7, 31092, 13, 38993, 17816, 44879, 12562, 5028, 6, 12962, 198, 220, 15835, 62, 8367, 796, 4808, 1136, 62, 18224, 62, 273, 62, 1069, 1023, 62, 8841, 7, 198, 220, 220, 220, 220, 220, 8271, 13, 38993, 17816, 10697, 24819, 27195, 13168, 38149, 6, 12962, 198, 220, 3868, 47510, 62, 11250, 3924, 62, 8367, 796, 4808, 1136, 62, 18224, 62, 273, 62, 1069, 1023, 62, 8841, 7, 198, 220, 220, 220, 220, 220, 8271, 13, 38993, 17816, 43, 361, 47510, 38149, 6, 12962, 628, 220, 611, 318, 39098, 7, 31092, 13, 38993, 17816, 14815, 278, 6, 4357, 8563, 13, 50, 18, 32, 14415, 12331, 2599, 198, 220, 220, 220, 2196, 278, 62, 25616, 62, 8367, 796, 8271, 13, 38993, 17816, 14815, 278, 20520, 198, 220, 2073, 25, 198, 220, 220, 220, 2196, 278, 62, 13376, 796, 8271, 13, 38993, 17816, 14815, 278, 6, 4083, 1136, 10786, 19580, 11537, 198, 220, 220, 220, 611, 2196, 278, 62, 13376, 6624, 705, 20491, 10354, 198, 220, 220, 220, 220, 220, 2196, 278, 62, 25616, 62, 8367, 796, 6407, 198, 220, 220, 220, 1288, 361, 2196, 278, 62, 13376, 6624, 705, 50, 17723, 1631, 10354, 198, 220, 220, 220, 220, 220, 2196, 278, 62, 25616, 62, 8367, 796, 10352, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 2196, 278, 62, 25616, 62, 8367, 796, 6045, 628, 220, 611, 318, 39098, 7, 31092, 13, 38993, 17816, 47, 2794, 6, 4357, 8563, 13, 50, 18, 32, 14415, 12331, 2599, 198, 220, 220, 220, 1038, 7834, 62, 79, 592, 62, 8367, 796, 8271, 13, 38993, 17816, 47, 2794, 20520, 198, 220, 1288, 361, 8271, 13, 38993, 17816, 47, 2794, 20520, 6624, 705, 16844, 7834, 10354, 198, 220, 220, 220, 1038, 7834, 62, 79, 592, 62, 8367, 796, 6407, 198, 220, 1288, 361, 8271, 13, 38993, 17816, 47, 2794, 20520, 6624, 705, 33, 38811, 42419, 10354, 198, 220, 220, 220, 1038, 7834, 62, 79, 592, 62, 8367, 796, 10352, 198, 220, 2073, 25, 198, 220, 220, 220, 1038, 7834, 62, 79, 592, 62, 8367, 796, 6045, 628, 220, 1441, 357, 198, 220, 220, 220, 220, 220, 705, 90, 27041, 316, 62, 6371, 92, 7479, 77, 6, 198, 220, 220, 220, 220, 220, 705, 90, 24886, 62, 1102, 2536, 2913, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 9641, 278, 62, 25616, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 6404, 2667, 62, 11250, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 732, 12485, 62, 11250, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 66, 669, 62, 11250, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 12685, 13168, 62, 11250, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 36195, 47510, 62, 11250, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 8897, 7834, 62, 79, 592, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 37779, 62, 5458, 92, 6, 198, 220, 6739, 18982, 7, 198, 220, 220, 220, 220, 220, 19236, 62, 6371, 28, 31092, 13, 35350, 62, 6371, 13, 9641, 1203, 62, 6371, 62, 8841, 11, 198, 220, 220, 220, 220, 220, 4067, 62, 1102, 2536, 2913, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 14749, 1482, 2536, 2913, 3256, 8271, 13, 38993, 17816, 14749, 3103, 2536, 2913, 20520, 828, 198, 220, 220, 220, 220, 220, 2196, 278, 62, 25616, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 14815, 278, 37344, 3256, 2196, 278, 62, 25616, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 18931, 62, 11250, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 11187, 2667, 28373, 3256, 18931, 62, 25616, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 3052, 62, 11250, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 33420, 28373, 3256, 3052, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 269, 669, 62, 11250, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 34, 20673, 28373, 3256, 269, 669, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 15835, 62, 11250, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 27195, 13168, 28373, 3256, 15835, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 3868, 47510, 62, 11250, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 43, 361, 47510, 28373, 3256, 3868, 47510, 62, 11250, 3924, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 1038, 7834, 62, 79, 592, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 16844, 7834, 350, 592, 37344, 3256, 1038, 7834, 62, 79, 592, 62, 8367, 828, 198, 220, 220, 220, 220, 220, 1303, 17220, 7464, 649, 1370, 2095, 780, 428, 318, 262, 938, 1351, 2378, 13, 198, 220, 220, 220, 220, 220, 257, 565, 62, 5458, 28, 62, 1136, 62, 687, 16898, 62, 37779, 62, 5458, 7, 31092, 13, 38993, 17816, 2246, 43, 6, 12962, 58, 21912, 16, 12962, 628, 198, 4299, 4808, 1136, 62, 12853, 62, 15252, 62, 38993, 62, 8841, 7, 31092, 2599, 198, 220, 37227, 8479, 1381, 311, 18, 8271, 20150, 355, 4731, 351, 15274, 13, 628, 220, 943, 14542, 25, 198, 220, 220, 220, 8271, 357, 50, 18, 10267, 26198, 2599, 20857, 351, 20150, 13, 628, 220, 16409, 25, 198, 220, 220, 220, 5178, 16898, 5021, 12, 1370, 4731, 13, 198, 220, 37227, 198, 220, 1303, 6912, 40976, 13042, 1043, 287, 347, 2069, 34165, 25, 198, 220, 1303, 3740, 1378, 65, 2069, 18, 13, 33103, 8356, 13, 785, 14, 85, 16, 14, 22897, 341, 14, 15042, 14, 42861, 14, 35790, 14, 30416, 14, 82, 18, 13, 6494, 198, 220, 611, 705, 5956, 5841, 1431, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 2435, 62, 43162, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2435, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 10260, 3862, 3256, 8271, 13, 38993, 17816, 5956, 5841, 1431, 6, 12962, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 2435, 62, 43162, 62, 1370, 796, 10148, 628, 220, 611, 705, 31425, 9487, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 35350, 62, 4871, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 31425, 5016, 3256, 8271, 13, 38993, 17816, 31425, 9487, 6, 12962, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 35350, 62, 4871, 62, 1370, 796, 10148, 628, 220, 611, 705, 30562, 15988, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 23870, 62, 13716, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 30562, 12, 15988, 3256, 8271, 13, 38993, 17816, 30562, 15988, 6, 12962, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 23870, 62, 13716, 62, 1370, 796, 10148, 628, 220, 611, 705, 30562, 7279, 9150, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 11299, 62, 6381, 9150, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 30562, 12, 7279, 9150, 3256, 8271, 13, 38993, 17816, 30562, 7279, 9150, 6, 12962, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 11299, 62, 6381, 9150, 62, 1370, 796, 10148, 628, 220, 611, 705, 19746, 27195, 7656, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 11299, 62, 12685, 7656, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 19746, 12, 27195, 7656, 3256, 8271, 13, 38993, 17816, 19746, 27195, 7656, 6, 12962, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 11299, 62, 12685, 7656, 62, 1370, 796, 10148, 628, 220, 611, 705, 19746, 32065, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 11299, 62, 16129, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 19746, 12, 32065, 3256, 8271, 13, 38993, 17816, 19746, 32065, 6, 12962, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 11299, 62, 16129, 62, 1370, 796, 10148, 628, 220, 611, 705, 42670, 12332, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 42895, 62, 9127, 62, 1370, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 21950, 12, 12332, 3256, 8271, 13, 38993, 17816, 42670, 12332, 20520, 4008, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 42895, 62, 9127, 62, 1370, 796, 10148, 628, 220, 611, 8271, 13, 9132, 20, 62, 17831, 318, 407, 6045, 25, 198, 220, 220, 220, 11902, 62, 9132, 20, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 26257, 357, 12740, 20, 8, 3256, 8271, 13, 9132, 20, 62, 17831, 8, 198, 220, 1288, 361, 705, 5432, 2943, 1824, 263, 2348, 42289, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 9132, 20, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 26257, 357, 12740, 20, 8, 3256, 705, 9203, 3157, 1366, 19365, 11537, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 9132, 20, 62, 1370, 796, 10148, 628, 220, 611, 705, 5432, 2943, 1824, 263, 2348, 42289, 6, 287, 8271, 13, 38993, 25, 198, 220, 220, 220, 11902, 62, 12685, 13168, 62, 282, 42289, 62, 1370, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 27195, 13168, 978, 42289, 3256, 8271, 13, 38993, 17816, 5432, 2943, 1824, 263, 2348, 42289, 20520, 4008, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 12685, 13168, 62, 282, 42289, 62, 1370, 796, 10148, 628, 220, 611, 8271, 13, 20158, 25, 198, 220, 220, 220, 11902, 62, 20158, 62, 1370, 796, 8271, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 705, 8645, 341, 3256, 8271, 13, 20158, 8, 198, 220, 2073, 25, 198, 220, 220, 220, 11902, 62, 20158, 62, 1370, 796, 10148, 628, 220, 1441, 357, 198, 220, 220, 220, 220, 220, 705, 90, 15252, 62, 6371, 92, 7479, 77, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 2435, 62, 43162, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 35350, 62, 4871, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 23870, 62, 13716, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 11299, 62, 6381, 9150, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 11299, 62, 12685, 7656, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 11299, 62, 16129, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 11299, 62, 13664, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 11299, 62, 4906, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 42895, 62, 9127, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 9132, 20, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 12685, 13168, 62, 282, 42289, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 316, 363, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 25968, 62, 20158, 62, 1370, 92, 6, 198, 220, 220, 220, 220, 220, 705, 90, 37779, 62, 5458, 92, 6, 198, 220, 220, 220, 220, 220, 705, 220, 1391, 259, 20751, 62, 43917, 92, 27691, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2134, 62, 6371, 28, 31092, 13, 35350, 62, 6371, 13, 9641, 1203, 62, 6371, 62, 8841, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 2435, 62, 43162, 62, 1370, 28, 25968, 62, 2435, 62, 43162, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 35350, 62, 4871, 62, 1370, 28, 25968, 62, 35350, 62, 4871, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 23870, 62, 13716, 62, 1370, 28, 25968, 62, 23870, 62, 13716, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 11299, 62, 6381, 9150, 62, 1370, 28, 25968, 62, 11299, 62, 6381, 9150, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 11299, 62, 12685, 7656, 62, 1370, 28, 25968, 62, 11299, 62, 12685, 7656, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 11299, 62, 16129, 62, 1370, 28, 25968, 62, 11299, 62, 16129, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2695, 62, 13664, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 19746, 12, 24539, 3256, 8271, 13, 7857, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2695, 62, 4906, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 19746, 12, 6030, 3256, 8271, 13, 38993, 13, 1136, 10786, 19746, 6030, 11537, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 42895, 62, 9127, 62, 1370, 28, 25968, 62, 42895, 62, 9127, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 9132, 20, 62, 1370, 28, 25968, 62, 9132, 20, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 12685, 13168, 62, 282, 42289, 62, 1370, 28, 25968, 62, 12685, 13168, 62, 282, 42289, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2123, 363, 62, 1370, 28, 31092, 62, 22602, 13, 1136, 62, 79, 29373, 62, 38993, 62, 2539, 62, 8367, 62, 1370, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 2767, 363, 3256, 8271, 13, 316, 363, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11902, 62, 20158, 62, 1370, 28, 25968, 62, 20158, 62, 1370, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 257, 565, 62, 5458, 28, 62, 1136, 62, 687, 16898, 62, 37779, 62, 5458, 7, 31092, 13, 38993, 13, 1136, 10786, 2246, 43, 11537, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17503, 62, 43917, 28, 62, 1268, 41335, 9328, 62, 9864, 23680, 62, 47123, 2885, 13563, 62, 31502, 8, 628, 198, 4871, 311, 18, 33, 38811, 26198, 7, 31092, 62, 35790, 13, 33, 38811, 26198, 2599, 198, 220, 37227, 17614, 12, 11423, 47611, 329, 9041, 20150, 526, 15931, 628, 198, 4871, 311, 18, 10267, 26198, 7, 31092, 62, 35790, 13, 10267, 26198, 2599, 198, 220, 37227, 17614, 12, 11423, 47611, 329, 9041, 20150, 526, 15931, 628, 220, 825, 11593, 15003, 834, 7, 944, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6143, 62, 6371, 62, 15252, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2695, 62, 4906, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6282, 62, 2435, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2123, 363, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1067, 66, 2624, 66, 62, 17831, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45243, 20, 62, 17831, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 20150, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1138, 363, 877, 341, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2546, 28, 14202, 2599, 198, 220, 220, 220, 37227, 24243, 4340, 8271, 13, 943, 14542, 389, 257, 24637, 286, 12608, 526, 15931, 198, 220, 220, 220, 2208, 7, 50, 18, 10267, 26198, 11, 2116, 737, 834, 15003, 834, 7, 198, 220, 220, 220, 220, 220, 220, 220, 6143, 62, 6371, 62, 15252, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2695, 62, 4906, 28, 11299, 62, 4906, 11, 198, 220, 220, 220, 220, 220, 220, 220, 6282, 62, 2435, 28, 38793, 62, 2435, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2123, 363, 28, 316, 363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 1067, 66, 2624, 66, 62, 17831, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 45243, 20, 62, 17831, 28, 9132, 20, 62, 17831, 11, 198, 220, 220, 220, 220, 220, 220, 220, 20150, 28, 38993, 11, 198, 220, 220, 220, 220, 220, 220, 220, 1138, 363, 877, 341, 28, 4164, 363, 877, 341, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2546, 28, 7857, 8, 198 ]
2.696754
4,498
import typing from apistar import Settings from apistar.interfaces import Auth from apistar.types import ReturnValue from raven import Client __version__ = "0.2.0"
[ 11748, 19720, 198, 198, 6738, 2471, 47229, 1330, 16163, 198, 6738, 2471, 47229, 13, 3849, 32186, 1330, 26828, 198, 6738, 2471, 47229, 13, 19199, 1330, 8229, 11395, 198, 6738, 37735, 1330, 20985, 198, 198, 834, 9641, 834, 796, 366, 15, 13, 17, 13, 15, 1, 628, 628, 198 ]
3.541667
48
# import necessary libraries # from models import create_classes import pandas as pd import os import sqlalchemy from sqlalchemy.ext.automap import automap_base from sqlalchemy.orm import Session from sqlalchemy import create_engine, func from sqlite3 import connect import json from flask import ( Flask, render_template, jsonify, request, redirect, jsonify) # Read data from csv #csv_file = "data/Chicago Health Atlas.csv" #df = pd.read_csv(csv_file) #df.head() #df.rename(columns={"VRDIBR_2015-2019":"VRDIBR_2015_2019","VRDIAR_2015-2018":"VRDIAR_2015_2018","VRDTH_2015-2019":"VRDTH_2015_2019","VRCAR_2015-2019":"VRCAR_2015_2019","VRADR_2015-2019":"VRADR_2015_2019","HDX_2015-2019":"HDX_2015_2019"},inplace=True) #creating sqlite engine to create database #engine = create_engine('sqlite:///data/Chicago_Health_database.db') #engine = create_engine('sqlite:///C:/Users/doyel/Desktop/project3_flask_ex1/data/mydatabase.db') #Table name : Chicago_Health_Atlas #df.to_sql('Chicago_Health_Atlas',con=engine,if_exists='replace') ##################################################################### engine = create_engine("sqlite:///data/mydatabase.db") # reflect an existing database into a new model Base = automap_base() # reflect the tables Base.prepare(engine, reflect=True) # Save reference to the table print(Base.classes.keys()) Healthatlas = Base.classes.healthatlas #Actors = Base.classes.actors ################################################# # Flask Setup ################################################# app = Flask(__name__) # --------------------------------------------------------- # Web site @app.route("/") @app.route("/data.html") @app.route("/templates/map.html") @app.route("/templates/d3_chart.html") # --------------------------------------------------------- # API to call "when data.html" page is loading with community information table @app.route("/api/community") # API to call when a disease is selectd from list by user in "data.html" page @app.route("/api/deceases/<decease>") @app.route("/api/geojson") @app.route('/api/d3_chart/<field_x>/<field_y>') if __name__ == "__main__": app.run()
[ 2, 1330, 3306, 12782, 198, 2, 422, 4981, 1330, 2251, 62, 37724, 198, 11748, 19798, 292, 355, 279, 67, 198, 11748, 28686, 198, 11748, 44161, 282, 26599, 198, 6738, 44161, 282, 26599, 13, 2302, 13, 2306, 296, 499, 1330, 3557, 499, 62, 8692, 198, 6738, 44161, 282, 26599, 13, 579, 1330, 23575, 198, 6738, 44161, 282, 26599, 1330, 2251, 62, 18392, 11, 25439, 198, 6738, 44161, 578, 18, 1330, 2018, 220, 198, 11748, 33918, 198, 198, 6738, 42903, 1330, 357, 198, 220, 220, 220, 46947, 11, 198, 220, 220, 220, 8543, 62, 28243, 11, 198, 220, 220, 220, 33918, 1958, 11, 198, 220, 220, 220, 2581, 11, 198, 220, 220, 220, 18941, 11, 198, 220, 220, 220, 33918, 1958, 8, 198, 198, 2, 4149, 1366, 422, 269, 21370, 198, 2, 40664, 62, 7753, 796, 366, 7890, 14, 25705, 3893, 22494, 13, 40664, 1, 198, 2, 7568, 796, 279, 67, 13, 961, 62, 40664, 7, 40664, 62, 7753, 8, 198, 2, 7568, 13, 2256, 3419, 198, 2, 7568, 13, 918, 480, 7, 28665, 82, 28, 4895, 13024, 35, 9865, 49, 62, 4626, 12, 23344, 2404, 13024, 35, 9865, 49, 62, 4626, 62, 23344, 2430, 13024, 17931, 1503, 62, 4626, 12, 7908, 2404, 13024, 17931, 1503, 62, 4626, 62, 7908, 2430, 13024, 35, 4221, 62, 4626, 12, 23344, 2404, 13024, 35, 4221, 62, 4626, 62, 23344, 2430, 53, 7397, 1503, 62, 4626, 12, 23344, 2404, 53, 7397, 1503, 62, 4626, 62, 23344, 2430, 13024, 2885, 49, 62, 4626, 12, 23344, 2404, 13024, 2885, 49, 62, 4626, 62, 23344, 2430, 10227, 55, 62, 4626, 12, 23344, 2404, 10227, 55, 62, 4626, 62, 23344, 25719, 259, 5372, 28, 17821, 8, 198, 198, 2, 20123, 278, 44161, 578, 3113, 284, 2251, 6831, 198, 2, 18392, 796, 2251, 62, 18392, 10786, 25410, 578, 1378, 14, 7890, 14, 25705, 62, 18081, 62, 48806, 13, 9945, 11537, 198, 2, 18392, 796, 2251, 62, 18392, 10786, 25410, 578, 1378, 14, 34, 14079, 14490, 14, 67, 726, 417, 14, 36881, 14, 16302, 18, 62, 2704, 2093, 62, 1069, 16, 14, 7890, 14, 1820, 48806, 13, 9945, 11537, 198, 2, 10962, 1438, 1058, 4842, 62, 18081, 62, 2953, 21921, 198, 198, 2, 7568, 13, 1462, 62, 25410, 10786, 25705, 62, 18081, 62, 2953, 21921, 3256, 1102, 28, 18392, 11, 361, 62, 1069, 1023, 11639, 33491, 11537, 198, 29113, 29113, 4242, 2, 198, 18392, 796, 2251, 62, 18392, 7203, 25410, 578, 1378, 14, 7890, 14, 1820, 48806, 13, 9945, 4943, 198, 198, 2, 4079, 281, 4683, 6831, 656, 257, 649, 2746, 198, 14881, 796, 3557, 499, 62, 8692, 3419, 198, 2, 4079, 262, 8893, 198, 14881, 13, 46012, 533, 7, 18392, 11, 4079, 28, 17821, 8, 198, 198, 2, 12793, 4941, 284, 262, 3084, 198, 4798, 7, 14881, 13, 37724, 13, 13083, 28955, 198, 198, 18081, 265, 21921, 796, 7308, 13, 37724, 13, 13948, 265, 21921, 198, 2, 32, 5217, 796, 7308, 13, 37724, 13, 529, 669, 198, 198, 29113, 14468, 2, 198, 2, 46947, 31122, 198, 29113, 14468, 2, 198, 1324, 796, 46947, 7, 834, 3672, 834, 8, 198, 2, 20368, 22369, 12, 198, 2, 5313, 2524, 198, 31, 1324, 13, 38629, 7203, 14, 4943, 198, 198, 31, 1324, 13, 38629, 7203, 14, 7890, 13, 6494, 4943, 198, 198, 31, 1324, 13, 38629, 7203, 14, 11498, 17041, 14, 8899, 13, 6494, 4943, 198, 198, 31, 1324, 13, 38629, 7203, 14, 11498, 17041, 14, 67, 18, 62, 40926, 13, 6494, 4943, 628, 628, 198, 2, 20368, 22369, 12, 198, 198, 2, 7824, 284, 869, 366, 12518, 1366, 13, 6494, 1, 2443, 318, 11046, 351, 2055, 1321, 3084, 198, 31, 1324, 13, 38629, 7203, 14, 15042, 14, 28158, 4943, 198, 198, 2, 7824, 284, 869, 618, 257, 4369, 318, 2922, 67, 422, 1351, 416, 2836, 287, 366, 7890, 13, 6494, 1, 2443, 198, 31, 1324, 13, 38629, 7203, 14, 15042, 14, 2934, 344, 1386, 14, 27, 2934, 344, 589, 29, 4943, 198, 198, 31, 1324, 13, 38629, 7203, 14, 15042, 14, 469, 13210, 1559, 4943, 198, 198, 31, 1324, 13, 38629, 10786, 14, 15042, 14, 67, 18, 62, 40926, 14, 27, 3245, 62, 87, 29, 14, 27, 3245, 62, 88, 29, 11537, 628, 628, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 220, 598, 13, 5143, 3419, 198 ]
3.056259
711
import logging from models import tag as Tag, business as Business, business_tag_join_table logging.getLogger().setLevel(logging.INFO) def business_exists(yelp_id, conn): """Return True if the business exists.""" return conn.execute(Business.select().where(Business.c.yelp_id == yelp_id))\ .first() is not None def delete_business(yelp_id, conn): """Delete the business with the given yelp id.""" return conn.execute(Business.delete().where(Business.c.yelp_id == yelp_id))
[ 11748, 18931, 198, 198, 6738, 4981, 1330, 7621, 355, 17467, 11, 1597, 355, 7320, 11, 1597, 62, 12985, 62, 22179, 62, 11487, 198, 198, 6404, 2667, 13, 1136, 11187, 1362, 22446, 2617, 4971, 7, 6404, 2667, 13, 10778, 8, 628, 198, 198, 4299, 1597, 62, 1069, 1023, 7, 88, 417, 79, 62, 312, 11, 48260, 2599, 198, 220, 220, 220, 37227, 13615, 6407, 611, 262, 1597, 7160, 526, 15931, 198, 220, 220, 220, 1441, 48260, 13, 41049, 7, 24749, 13, 19738, 22446, 3003, 7, 24749, 13, 66, 13, 88, 417, 79, 62, 312, 6624, 331, 417, 79, 62, 312, 4008, 59, 198, 220, 220, 220, 220, 220, 220, 220, 764, 11085, 3419, 318, 407, 6045, 628, 198, 4299, 12233, 62, 22680, 7, 88, 417, 79, 62, 312, 11, 48260, 2599, 198, 220, 220, 220, 37227, 38727, 262, 1597, 351, 262, 1813, 331, 417, 79, 4686, 526, 15931, 198, 220, 220, 220, 1441, 48260, 13, 41049, 7, 24749, 13, 33678, 22446, 3003, 7, 24749, 13, 66, 13, 88, 417, 79, 62, 312, 6624, 331, 417, 79, 62, 312, 4008, 628, 628, 628, 198 ]
2.802198
182
from random import random from random import choice import numpy as np import plotly.express as px import struct import operator ### # Broadly the same as "basic_functions.py" but updated to include motility # intentionally trying to keep them separate so as not to slow down the basic version ###
[ 6738, 4738, 1330, 4738, 198, 6738, 4738, 1330, 3572, 198, 11748, 299, 32152, 355, 45941, 198, 11748, 7110, 306, 13, 42712, 355, 279, 87, 198, 11748, 2878, 198, 11748, 10088, 198, 198, 21017, 198, 2, 9765, 306, 262, 976, 355, 366, 35487, 62, 12543, 2733, 13, 9078, 1, 475, 6153, 284, 2291, 2369, 879, 198, 2, 16464, 2111, 284, 1394, 606, 4553, 523, 355, 407, 284, 3105, 866, 262, 4096, 2196, 198, 21017, 628, 628, 628, 628, 628, 628, 628, 628, 628 ]
3.853659
82
import pandas as pd
[ 11748, 19798, 292, 355, 279, 67 ]
3.166667
6
""" TSP SIMULATED ANNEALING """ # Imports import matplotlib.pyplot as plt import pandas as pd import numpy as np # read data from file filename = "eil51.tsp" f = open(f"TSP-configurations/{filename}.txt", "r") network = f.readlines()[6:-1] # create dictionary to store coordinates nodes = dict() # split data and put in dict for node in network: node = [int(x) for x in node.rstrip().split(' ')] nodes[node[0]] = node[1:] x = [x[0] for x in nodes.values()] y = [y[1] for y in nodes.values()] # load in data of optimal path data = pd.read_csv("data/eil51.tsp.tsp-batch-20.txt", sep="\t") colname = "428.87" z = list(map(float,list(data[f'{colname}-19']))) # optimum so far (costs = 428.87175639203394) # r= [1.0, 32, 11, 38, 5, 37, 17, 4, 18, 47, 12, 46, 51.0, 27, 6, 48, 23, 7, 43, 24, 14, 25, 13, 41, 40, 19, 42, 44, 15, 45, 33, 39, 10, 49, 9, 30, 34, 21, 50, 16, 2, 29, 20, 35, 36, 3, 28, 31, 26, 8, 22, 1.0] temp = [] # get coordinates of each point for item in z: temp.append(nodes[item]) temp = np.array(temp) # path = [temp[i:i+2] for i in range(len(temp)-2+1)] # print(path) # Plot the nodes and coordinates fig, ax = plt.subplots() ax.scatter(x, y, color="deeppink") for i, txt in enumerate(nodes.keys()): ax.annotate(txt, (x[i], y[i])) ax.plot(*temp.T, color="deeppink", alpha=0.5) ax.set_title(f"Shortest Route: {filename}, costs: {colname}", fontsize=16) # plt.savefig("plots/eil51-opt-route-3.png") plt.show()
[ 37811, 309, 4303, 23749, 6239, 11617, 3537, 12161, 1847, 2751, 37227, 198, 198, 2, 1846, 3742, 198, 11748, 2603, 29487, 8019, 13, 9078, 29487, 355, 458, 83, 198, 11748, 19798, 292, 355, 279, 67, 198, 11748, 299, 32152, 355, 45941, 628, 198, 2, 1100, 1366, 422, 2393, 198, 34345, 796, 366, 68, 346, 4349, 13, 912, 79, 1, 198, 69, 796, 1280, 7, 69, 1, 51, 4303, 12, 11250, 20074, 14, 90, 34345, 27422, 14116, 1600, 366, 81, 4943, 198, 27349, 796, 277, 13, 961, 6615, 3419, 58, 21, 21912, 16, 60, 198, 198, 2, 2251, 22155, 284, 3650, 22715, 198, 77, 4147, 796, 8633, 3419, 198, 198, 2, 6626, 1366, 290, 1234, 287, 8633, 198, 1640, 10139, 287, 3127, 25, 198, 220, 220, 220, 10139, 796, 685, 600, 7, 87, 8, 329, 2124, 287, 10139, 13, 81, 36311, 22446, 35312, 10786, 705, 15437, 198, 220, 220, 220, 13760, 58, 17440, 58, 15, 11907, 796, 10139, 58, 16, 47715, 198, 198, 87, 796, 685, 87, 58, 15, 60, 329, 2124, 287, 13760, 13, 27160, 3419, 60, 198, 88, 796, 685, 88, 58, 16, 60, 329, 331, 287, 13760, 13, 27160, 3419, 60, 198, 198, 2, 3440, 287, 1366, 286, 16586, 3108, 198, 7890, 796, 279, 67, 13, 961, 62, 40664, 7203, 7890, 14, 68, 346, 4349, 13, 912, 79, 13, 912, 79, 12, 43501, 12, 1238, 13, 14116, 1600, 41767, 2625, 59, 83, 4943, 198, 4033, 3672, 796, 366, 40173, 13, 5774, 1, 198, 89, 796, 1351, 7, 8899, 7, 22468, 11, 4868, 7, 7890, 58, 69, 6, 90, 4033, 3672, 92, 12, 1129, 20520, 22305, 198, 198, 2, 39475, 523, 1290, 357, 15805, 82, 796, 45063, 13, 5774, 1558, 3980, 2670, 1238, 2091, 5824, 8, 198, 2, 374, 28, 685, 16, 13, 15, 11, 3933, 11, 1367, 11, 4353, 11, 642, 11, 5214, 11, 1596, 11, 604, 11, 1248, 11, 6298, 11, 1105, 11, 6337, 11, 6885, 13, 15, 11, 2681, 11, 718, 11, 4764, 11, 2242, 11, 767, 11, 5946, 11, 1987, 11, 1478, 11, 1679, 11, 1511, 11, 6073, 11, 2319, 11, 678, 11, 5433, 11, 5846, 11, 1315, 11, 4153, 11, 4747, 11, 5014, 11, 838, 11, 5125, 11, 860, 11, 1542, 11, 4974, 11, 2310, 11, 2026, 11, 1467, 11, 362, 11, 2808, 11, 1160, 11, 3439, 11, 4570, 11, 513, 11, 2579, 11, 3261, 11, 2608, 11, 807, 11, 2534, 11, 352, 13, 15, 60, 198, 198, 29510, 796, 17635, 198, 2, 651, 22715, 286, 1123, 966, 198, 1640, 2378, 287, 1976, 25, 198, 220, 220, 220, 20218, 13, 33295, 7, 77, 4147, 58, 9186, 12962, 198, 198, 29510, 796, 45941, 13, 18747, 7, 29510, 8, 198, 2, 3108, 796, 685, 29510, 58, 72, 25, 72, 10, 17, 60, 329, 1312, 287, 2837, 7, 11925, 7, 29510, 13219, 17, 10, 16, 15437, 198, 2, 3601, 7, 6978, 8, 198, 198, 2, 28114, 262, 13760, 290, 22715, 198, 5647, 11, 7877, 796, 458, 83, 13, 7266, 489, 1747, 3419, 198, 897, 13, 1416, 1436, 7, 87, 11, 331, 11, 3124, 2625, 67, 1453, 381, 676, 4943, 198, 198, 1640, 1312, 11, 256, 742, 287, 27056, 378, 7, 77, 4147, 13, 13083, 3419, 2599, 198, 220, 220, 220, 7877, 13, 34574, 378, 7, 14116, 11, 357, 87, 58, 72, 4357, 331, 58, 72, 60, 4008, 198, 198, 897, 13, 29487, 46491, 29510, 13, 51, 11, 3124, 2625, 67, 1453, 381, 676, 1600, 17130, 28, 15, 13, 20, 8, 198, 897, 13, 2617, 62, 7839, 7, 69, 1, 16438, 395, 18956, 25, 1391, 34345, 5512, 3484, 25, 1391, 4033, 3672, 92, 1600, 10369, 7857, 28, 1433, 8, 198, 2, 198, 489, 83, 13, 21928, 5647, 7203, 489, 1747, 14, 68, 346, 4349, 12, 8738, 12, 38629, 12, 18, 13, 11134, 4943, 198, 489, 83, 13, 12860, 3419, 628, 628 ]
2.300633
632
import astropy.units as u import pytest from benchmark import Benchmark, benchmark @benchmark( { "log.initial.system.Age": {"value": 3.155760e13, "unit": u.sec}, "log.initial.system.Time": {"value": 0.000000, "unit": u.sec}, "log.initial.system.TotAngMom": { "value": 6.747268e40, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.system.TotEnergy": {"value": -2.482441e43, "unit": u.Joule}, "log.initial.system.PotEnergy": {"value": -2.482440e43, "unit": u.Joule}, "log.initial.system.KinEnergy": {"value": 5.347271e34, "unit": u.Joule}, "log.initial.system.DeltaTime": {"value": 0.000000, "unit": u.sec}, "log.initial.star.Mass": {"value": 1.988416e30, "unit": u.kg}, "log.initial.star.Obliquity": {"value": 0.000000, "unit": u.rad}, "log.initial.star.PrecA": {"value": 0.000000, "unit": u.rad}, "log.initial.star.Xobl": {"value": 0.000000}, "log.initial.star.Yobl": {"value": 0.000000}, "log.initial.star.Zobl": {"value": 1.000000}, "log.initial.star.Radius": {"value": 6.378100e06, "unit": u.m}, "log.initial.star.RadGyra": {"value": 0.500000}, "log.initial.star.RotAngMom": { "value": 1.470605e39, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.star.RotKinEnergy": {"value": 5.347271e34, "unit": u.Joule}, "log.initial.star.RotVel": {"value": 463.828521, "unit": u.m / u.sec}, "log.initial.star.BodyType": {"value": 0.000000}, "log.initial.star.RotRate": {"value": 7.272205e-05, "unit": 1 / u.sec}, "log.initial.star.RotPer": {"value": 8.640000e04, "unit": u.sec}, "log.initial.star.Density": {"value": 1.829552e09, "unit": u.kg / u.m ** 3}, "log.initial.star.SurfEnFluxTotal": { "value": 4.474499e-12, "unit": u.kg / u.sec ** 3, }, "log.initial.star.TidalQ": {"value": 1.000000e06}, "log.initial.star.ImK2": {"value": -5.000000e-07}, "log.initial.star.K2": {"value": 0.500000}, "log.initial.star.K2Man": {"value": 0.010000}, "log.initial.star.Imk2Man": {"value": 0.000000}, "log.initial.star.TidalQMantle": {"value": 100.000000}, "log.initial.star.HEcc": {"value": 0.000000}, "log.initial.star.HZLimitDryRunaway": {"value": 3.036202e09, "unit": u.m}, "log.initial.star.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m}, "log.initial.star.HZLimRunaway": {"value": 3.267138e09, "unit": u.m}, "log.initial.star.HZLimMoistGreenhouse": {"value": 3.310536e09, "unit": u.m}, "log.initial.star.HZLimMaxGreenhouse": {"value": 5.611497e09, "unit": u.m}, "log.initial.star.HZLimEarlyMars": {"value": 6.122597e09, "unit": u.m}, "log.initial.star.Instellation": { "value": -1.000000, "unit": u.kg / u.sec ** 3, }, "log.initial.star.KEcc": {"value": 0.000000}, "log.initial.star.Eccentricity": {"value": -1.000000}, "log.initial.star.OrbEnergy": {"value": 0.000000, "unit": u.Joule}, "log.initial.star.MeanMotion": {"value": -1.000000, "unit": 1 / u.sec}, "log.initial.star.OrbPeriod": {"value": -1.000000, "unit": u.sec}, "log.initial.star.SemiMajorAxis": {"value": -1.000000, "unit": u.m}, "log.initial.star.CriticalSemiMajorAxis": {"value": -1.000000, "unit": u.m}, "log.initial.star.COPP": {"value": 0.000000}, "log.initial.star.OrbAngMom": { "value": 0.000000, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.star.LongP": {"value": 0.000000, "unit": u.rad}, "log.initial.star.LXUVTot": {"value": 1.923000e20, "unit": u.kg / u.sec ** 3}, "log.initial.star.TotOrbEnergy": {"value": -2.119237e35, "unit": u.Joule}, "log.initial.star.OrbPotEnergy": {"value": -1.000000, "unit": u.Joule}, "log.initial.star.LostEnergy": {"value": 5.562685e-309, "unit": u.Joule}, "log.initial.star.LostAngMom": { "value": 5.562685e-309, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.star.LockTime": {"value": -1.000000, "unit": u.sec}, "log.initial.star.BodyDsemiDtEqtide": {"value": -1.000000}, "log.initial.star.BodyDeccDt": {"value": -1.000000}, "log.initial.star.DOblDtEqtide": {"value": 0.000000, "unit": u.rad / u.sec}, "log.initial.star.DRotPerDtEqtide": {"value": 2.054554e-27}, "log.initial.star.DRotRateDtEqtide": { "value": -1.729298e-36, "unit": 1 / u.sec ** 2, }, "log.initial.star.EqRotRateDiscrete": { "value": 6.296062e-06, "unit": 1 / u.sec, }, "log.initial.star.EqRotPerDiscrete": {"value": 9.979547e05, "unit": u.sec}, "log.initial.star.EqRotRateCont": {"value": 8.688566e-06, "unit": 1 / u.sec}, "log.initial.star.EqRotPerCont": {"value": 7.231556e05, "unit": u.sec}, "log.initial.star.EqRotPer": {"value": 9.979547e05, "unit": u.sec}, "log.initial.star.EqTidePower": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.star.GammaRot": {"value": -1.000000, "unit": u.sec}, "log.initial.star.GammaOrb": {"value": -1.000000, "unit": u.sec}, "log.initial.star.OceanK2": {"value": 0.010000}, "log.initial.star.EnvTidalQ": {"value": -1.000000}, "log.initial.star.OceanTidalQ": {"value": -1.000000}, "log.initial.star.TideLock": {"value": 0.000000}, "log.initial.star.RotTimeEqtide": {"value": 0.000000, "unit": u.sec}, "log.initial.star.EnvK2": {"value": 0.010000}, "log.initial.star.OblTimeEqtide": {"value": -1.000000}, "log.initial.star.PowerEqtide": {"value": 2287.372458, "unit": u.W}, "log.initial.star.SurfEnFluxEqtide": { "value": 4.474499e-12, "unit": u.kg / u.sec ** 3, }, "log.initial.star.Luminosity": {"value": 1.923000e23, "unit": u.W}, "log.initial.star.LXUVStellar": {"value": 1.923000e20, "unit": u.W}, "log.initial.star.Temperature": {"value": 5778.000000, "unit": u.K}, "log.initial.star.LXUVFrac": {"value": 0.001000}, "log.initial.star.RossbyNumber": {"value": 0.078260}, "log.initial.star.DRotPerDtStellar": {"value": 6.530034e-18}, "log.initial.auto.Mass": {"value": 2.000000, "unit": u.Mearth}, "log.initial.auto.Obliquity": {"value": 0.785398, "unit": u.rad}, "log.initial.auto.PrecA": {"value": 0.000000, "unit": u.rad}, "log.initial.auto.Xobl": {"value": 0.707107}, "log.initial.auto.Yobl": {"value": 0.000000}, "log.initial.auto.Zobl": {"value": 0.707107}, "log.initial.auto.Radius": {"value": 2.096446e08, "unit": u.m}, "log.initial.auto.RadGyra": {"value": 0.400000}, "log.initial.auto.RotAngMom": { "value": 1.221650e37, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.auto.RotKinEnergy": {"value": 8.884088e32, "unit": u.Joule}, "log.initial.auto.RotVel": {"value": 3.049157e04, "unit": u.m / u.sec}, "log.initial.auto.BodyType": {"value": 0.000000}, "log.initial.auto.RotRate": {"value": 0.000145, "unit": 1 / u.sec}, "log.initial.auto.RotPer": {"value": 0.500000, "unit": u.day}, "log.initial.auto.Density": {"value": 0.309474, "unit": u.kg / u.m ** 3}, "log.initial.auto.SurfEnFluxTotal": { "value": 2.324795e04, "unit": u.kg / u.sec ** 3, }, "log.initial.auto.TidalQ": {"value": -1.000000e05}, "log.initial.auto.ImK2": {"value": -5.000000e-06}, "log.initial.auto.K2": {"value": 0.500000}, "log.initial.auto.K2Man": {"value": 0.300000}, "log.initial.auto.Imk2Man": {"value": -0.003000}, "log.initial.auto.TidalQMantle": {"value": 100.000000}, "log.initial.auto.HEcc": {"value": 0.000000}, "log.initial.auto.HZLimitDryRunaway": {"value": 3.098811e09, "unit": u.m}, "log.initial.auto.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m}, "log.initial.auto.HZLimRunaway": {"value": 3.267138e09, "unit": u.m}, "log.initial.auto.HZLimMoistGreenhouse": {"value": 3.310536e09, "unit": u.m}, "log.initial.auto.HZLimMaxGreenhouse": {"value": 5.611497e09, "unit": u.m}, "log.initial.auto.HZLimEarlyMars": {"value": 6.122597e09, "unit": u.m}, "log.initial.auto.Instellation": { "value": 69.788358, "unit": u.kg / u.sec ** 3, }, "log.initial.auto.KEcc": {"value": 0.200000}, "log.initial.auto.Eccentricity": {"value": 0.200000}, "log.initial.auto.OrbEnergy": {"value": -5.298093e34, "unit": u.Joule}, "log.initial.auto.MeanMotion": {"value": 6.296062e-06, "unit": 1 / u.sec}, "log.initial.auto.OrbPeriod": {"value": 9.979547e05, "unit": u.sec}, "log.initial.auto.SemiMajorAxis": {"value": 0.100000, "unit": u.au}, "log.initial.auto.CriticalSemiMajorAxis": {"value": -1.000000, "unit": u.m}, "log.initial.auto.COPP": {"value": 0.000000}, "log.initial.auto.OrbAngMom": { "value": 1.648983e40, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.auto.LongP": {"value": 0.000000, "unit": u.rad}, "log.initial.auto.LXUVTot": {"value": -1.000000, "unit": u.kg / u.sec ** 3}, "log.initial.auto.TotOrbEnergy": {"value": -2.119237e35, "unit": u.Joule}, "log.initial.auto.OrbPotEnergy": {"value": -1.059619e35, "unit": u.Joule}, "log.initial.auto.LostEnergy": {"value": 5.562685e-309, "unit": u.Joule}, "log.initial.auto.TidalRadius": {"value": 2.096446e08, "unit": u.m}, "log.initial.auto.DsemiDtEqtide": {"value": 0.000192, "unit": u.m / u.sec}, "log.initial.auto.DeccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.auto.DMeanMotionDtEqtide": { "value": -1.211805e-19, "unit": 1 / u.sec ** 2, }, "log.initial.auto.DOrbPerDtEqtide": {"value": 1.920766e-08}, "log.initial.auto.EccTimeEqtide": {"value": 4.954969e13, "unit": u.sec}, "log.initial.auto.SemiTimeEqtide": {"value": 7.793412e13, "unit": u.sec}, "log.initial.auto.DHEccDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.auto.DKEccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.auto.DXoblDtEqtide": {"value": 1.462258e-12, "unit": 1 / u.sec}, "log.initial.auto.DYoblDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.auto.DZoblDtEqtide": {"value": -1.462258e-12, "unit": 1 / u.sec}, "log.initial.auto.LockTime": {"value": -1.000000, "unit": u.sec}, "log.initial.auto.BodyDsemiDtEqtide": {"value": -1.000000}, "log.initial.auto.BodyDeccDt": {"value": -1.000000}, "log.initial.auto.DOblDtEqtide": {"value": 2.067945e-12, "unit": u.rad / u.sec}, "log.initial.auto.DRotPerDtEqtide": {"value": 3.287202e-07}, "log.initial.auto.DRotRateDtEqtide": { "value": -1.106722e-15, "unit": 1 / u.sec ** 2, }, "log.initial.auto.EqRotRateDiscrete": { "value": 6.296062e-06, "unit": 1 / u.sec, }, "log.initial.auto.EqRotPerDiscrete": {"value": 9.979547e05, "unit": u.sec}, "log.initial.auto.EqRotRateCont": {"value": 8.688566e-06, "unit": 1 / u.sec}, "log.initial.auto.EqRotPerCont": {"value": 7.231556e05, "unit": u.sec}, "log.initial.auto.EqRotPer": {"value": 9.979547e05, "unit": u.sec}, "log.initial.auto.EqTidePower": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.auto.GammaRot": {"value": -1.000000, "unit": u.sec}, "log.initial.auto.GammaOrb": {"value": -1.000000, "unit": u.sec}, "log.initial.auto.OceanK2": {"value": 0.010000}, "log.initial.auto.EnvTidalQ": {"value": -1.000000}, "log.initial.auto.OceanTidalQ": {"value": -1.000000}, "log.initial.auto.TideLock": {"value": 0.000000}, "log.initial.auto.RotTimeEqtide": {"value": 1.314188e11, "unit": u.sec}, "log.initial.auto.EnvK2": {"value": 0.500000}, "log.initial.auto.OblTimeEqtide": {"value": -1.000000}, "log.initial.auto.PowerEqtide": {"value": 1.284046e22, "unit": u.W}, "log.initial.auto.SurfEnFluxEqtide": { "value": 2.324895e04, "unit": u.kg / u.sec ** 3, }, "log.initial.auto.SurfWaterMass": {"value": 0.000000, "unit": u.kg}, "log.initial.auto.EnvelopeMass": {"value": 1.000000, "unit": u.Mearth}, "log.initial.auto.OxygenMass": {"value": 0.000000, "unit": u.kg}, "log.initial.auto.RGLimit": {"value": 3.099115e09, "unit": u.m}, "log.initial.auto.XO": {"value": 0.000000}, "log.initial.auto.EtaO": {"value": 0.000000}, "log.initial.auto.PlanetRadius": {"value": 32.869442, "unit": u.Rearth}, "log.initial.auto.OxygenMantleMass": {"value": 0.000000, "unit": u.kg}, "log.initial.auto.RadXUV": {"value": -1.000000, "unit": u.m}, "log.initial.auto.RadSolid": {"value": -1.000000, "unit": u.m}, "log.initial.auto.PresXUV": {"value": 5.000000}, "log.initial.auto.ScaleHeight": {"value": -1.000000, "unit": u.m}, "log.initial.auto.ThermTemp": {"value": 400.000000, "unit": u.K}, "log.initial.auto.AtmGasConst": {"value": 4124.000000}, "log.initial.auto.PresSurf": {"value": -1.000000, "unit": u.Pa}, "log.initial.auto.DEnvMassDt": {"value": -2.508715e09, "unit": u.kg / u.sec}, "log.initial.auto.FXUV": {"value": 0.069788, "unit": u.W / u.m ** 2}, "log.initial.auto.AtmXAbsEffH2O": {"value": 0.300000}, "log.initial.auto.RocheRadius": {"value": 1.885546e08, "unit": u.m}, "log.initial.auto.BondiRadius": {"value": 7.899468e08, "unit": u.m}, "log.initial.auto.HEscapeRegime": {"value": 3.000000}, "log.initial.auto.RRCriticalFlux": {"value": 0.000139, "unit": u.W / u.m ** 2}, "log.initial.auto.KTide": {"value": 1.000000}, "log.initial.auto.RGDuration": {"value": 1.00000e06, "unit": u.yr}, "log.initial.bondi.Mass": {"value": 2.000000, "unit": u.Mearth}, "log.initial.bondi.Obliquity": {"value": 0.785398, "unit": u.rad}, "log.initial.bondi.PrecA": {"value": 0.000000, "unit": u.rad}, "log.initial.bondi.Xobl": {"value": 0.707107}, "log.initial.bondi.Yobl": {"value": 0.000000}, "log.initial.bondi.Zobl": {"value": 0.707107}, "log.initial.bondi.Radius": {"value": 2.096446e08, "unit": u.m}, "log.initial.bondi.RadGyra": {"value": 0.400000}, "log.initial.bondi.RotAngMom": { "value": 1.221650e37, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.bondi.RotKinEnergy": {"value": 8.884088e32, "unit": u.Joule}, "log.initial.bondi.RotVel": {"value": 3.049157e04, "unit": u.m / u.sec}, "log.initial.bondi.BodyType": {"value": 0.000000}, "log.initial.bondi.RotRate": {"value": 0.000145, "unit": 1 / u.sec}, "log.initial.bondi.RotPer": {"value": 0.500000, "unit": u.day}, "log.initial.bondi.Density": {"value": 0.309474, "unit": u.kg / u.m ** 3}, "log.initial.bondi.SurfEnFluxTotal": { "value": 2.324795e04, "unit": u.kg / u.sec ** 3, }, "log.initial.bondi.TidalQ": {"value": -1.000000e05}, "log.initial.bondi.ImK2": {"value": -5.000000e-06}, "log.initial.bondi.K2": {"value": 0.500000}, "log.initial.bondi.K2Man": {"value": 0.300000}, "log.initial.bondi.Imk2Man": {"value": -0.003000}, "log.initial.bondi.TidalQMantle": {"value": 100.000000}, "log.initial.bondi.HEcc": {"value": 0.000000}, "log.initial.bondi.HZLimitDryRunaway": {"value": 3.098811e09, "unit": u.m}, "log.initial.bondi.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m}, "log.initial.bondi.HZLimRunaway": {"value": 3.267138e09, "unit": u.m}, "log.initial.bondi.HZLimMoistGreenhouse": {"value": 3.310536e09, "unit": u.m}, "log.initial.bondi.HZLimMaxGreenhouse": {"value": 5.611497e09, "unit": u.m}, "log.initial.bondi.HZLimEarlyMars": {"value": 6.122597e09, "unit": u.m}, "log.initial.bondi.Instellation": { "value": 69.788358, "unit": u.kg / u.sec ** 3, }, "log.initial.bondi.KEcc": {"value": 0.200000}, "log.initial.bondi.Eccentricity": {"value": 0.200000}, "log.initial.bondi.OrbEnergy": {"value": -5.298093e34, "unit": u.Joule}, "log.initial.bondi.MeanMotion": {"value": 6.296062e-06, "unit": 1 / u.sec}, "log.initial.bondi.OrbPeriod": {"value": 9.979547e05, "unit": u.sec}, "log.initial.bondi.SemiMajorAxis": {"value": 0.100000, "unit": u.au}, "log.initial.bondi.CriticalSemiMajorAxis": {"value": -1.000000, "unit": u.m}, "log.initial.bondi.COPP": {"value": 0.000000}, "log.initial.bondi.OrbAngMom": { "value": 1.648983e40, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.bondi.LongP": {"value": 0.000000, "unit": u.rad}, "log.initial.bondi.LXUVTot": {"value": -1.000000, "unit": u.kg / u.sec ** 3}, "log.initial.bondi.TotOrbEnergy": {"value": -2.119237e35, "unit": u.Joule}, "log.initial.bondi.OrbPotEnergy": {"value": -1.059619e35, "unit": u.Joule}, "log.initial.bondi.LostEnergy": {"value": 5.562685e-309, "unit": u.Joule}, "log.initial.bondi.TidalRadius": {"value": 2.096446e08, "unit": u.m}, "log.initial.bondi.DsemiDtEqtide": {"value": 0.000192, "unit": u.m / u.sec}, "log.initial.bondi.DeccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.bondi.DMeanMotionDtEqtide": { "value": -1.211805e-19, "unit": 1 / u.sec ** 2, }, "log.initial.bondi.DOrbPerDtEqtide": {"value": 1.920766e-08}, "log.initial.bondi.EccTimeEqtide": {"value": 4.954969e13, "unit": u.sec}, "log.initial.bondi.SemiTimeEqtide": {"value": 7.793412e13, "unit": u.sec}, "log.initial.bondi.DHEccDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.bondi.DKEccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.bondi.DXoblDtEqtide": {"value": 1.462258e-12, "unit": 1 / u.sec}, "log.initial.bondi.DYoblDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.bondi.DZoblDtEqtide": {"value": -1.462258e-12, "unit": 1 / u.sec}, "log.initial.bondi.LockTime": {"value": -1.000000, "unit": u.sec}, "log.initial.bondi.BodyDsemiDtEqtide": {"value": -1.000000}, "log.initial.bondi.BodyDeccDt": {"value": -1.000000}, "log.initial.bondi.DOblDtEqtide": { "value": 2.067945e-12, "unit": u.rad / u.sec, }, "log.initial.bondi.DRotPerDtEqtide": {"value": 3.287202e-07}, "log.initial.bondi.DRotRateDtEqtide": { "value": -1.106722e-15, "unit": 1 / u.sec ** 2, }, "log.initial.bondi.EqRotRateDiscrete": { "value": 6.296062e-06, "unit": 1 / u.sec, }, "log.initial.bondi.EqRotPerDiscrete": {"value": 9.979547e05, "unit": u.sec}, "log.initial.bondi.EqRotRateCont": {"value": 8.688566e-06, "unit": 1 / u.sec}, "log.initial.bondi.EqRotPerCont": {"value": 7.231556e05, "unit": u.sec}, "log.initial.bondi.EqRotPer": {"value": 9.979547e05, "unit": u.sec}, "log.initial.bondi.EqTidePower": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.bondi.GammaRot": {"value": -1.000000, "unit": u.sec}, "log.initial.bondi.GammaOrb": {"value": -1.000000, "unit": u.sec}, "log.initial.bondi.OceanK2": {"value": 0.010000}, "log.initial.bondi.EnvTidalQ": {"value": -1.000000}, "log.initial.bondi.OceanTidalQ": {"value": -1.000000}, "log.initial.bondi.TideLock": {"value": 0.000000}, "log.initial.bondi.RotTimeEqtide": {"value": 1.314188e11, "unit": u.sec}, "log.initial.bondi.EnvK2": {"value": 0.500000}, "log.initial.bondi.OblTimeEqtide": {"value": -1.000000}, "log.initial.bondi.PowerEqtide": {"value": 1.284046e22, "unit": u.W}, "log.initial.bondi.SurfEnFluxEqtide": { "value": 2.324895e04, "unit": u.kg / u.sec ** 3, }, "log.initial.bondi.SurfWaterMass": {"value": 0.000000, "unit": u.kg}, "log.initial.bondi.EnvelopeMass": {"value": 1.000000, "unit": u.Mearth}, "log.initial.bondi.OxygenMass": {"value": 0.000000, "unit": u.kg}, "log.initial.bondi.RGLimit": {"value": 3.099115e09, "unit": u.m}, "log.initial.bondi.XO": {"value": 0.000000}, "log.initial.bondi.EtaO": {"value": 0.000000}, "log.initial.bondi.PlanetRadius": {"value": 32.869442, "unit": u.Rearth}, "log.initial.bondi.OxygenMantleMass": {"value": 0.000000, "unit": u.kg}, "log.initial.bondi.RadXUV": {"value": -1.000000, "unit": u.m}, "log.initial.bondi.RadSolid": {"value": -1.000000, "unit": u.m}, "log.initial.bondi.PresXUV": {"value": 5.000000}, "log.initial.bondi.ScaleHeight": {"value": -1.000000, "unit": u.m}, "log.initial.bondi.ThermTemp": {"value": 400.000000, "unit": u.K}, "log.initial.bondi.AtmGasConst": {"value": 4124.000000}, "log.initial.bondi.PresSurf": {"value": -1.000000, "unit": u.Pa}, "log.initial.bondi.DEnvMassDt": {"value": -1.230386e15, "unit": u.kg / u.sec}, "log.initial.bondi.FXUV": {"value": 0.069788, "unit": u.W / u.m ** 2}, "log.initial.bondi.AtmXAbsEffH2O": {"value": 0.300000}, "log.initial.bondi.RocheRadius": {"value": 1.885546e08, "unit": u.m}, "log.initial.bondi.BondiRadius": {"value": 7.899468e08, "unit": u.m}, "log.initial.bondi.HEscapeRegime": {"value": 5.000000}, "log.initial.bondi.RRCriticalFlux": {"value": 0.000139, "unit": u.W / u.m ** 2}, "log.initial.bondi.KTide": {"value": 1.000000}, "log.initial.bondi.RGDuration": {"value": 1.00000e06, "unit": u.yr}, "log.initial.el.Mass": {"value": 2.000000, "unit": u.Mearth}, "log.initial.el.Obliquity": {"value": 0.410152, "unit": u.rad}, "log.initial.el.PrecA": {"value": 0.000000, "unit": u.rad}, "log.initial.el.Xobl": {"value": 0.398749}, "log.initial.el.Yobl": {"value": 0.000000}, "log.initial.el.Zobl": {"value": 0.917060}, "log.initial.el.Radius": {"value": 2.096446e08, "unit": u.m}, "log.initial.el.RadGyra": {"value": 0.400000}, "log.initial.el.RotAngMom": { "value": 6.108249e36, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.el.RotKinEnergy": {"value": 2.221022e32, "unit": u.Joule}, "log.initial.el.RotVel": {"value": 1.524578e04, "unit": u.m / u.sec}, "log.initial.el.BodyType": {"value": 0.000000}, "log.initial.el.RotRate": {"value": 7.272205e-05, "unit": 1 / u.sec}, "log.initial.el.RotPer": {"value": 1.000000, "unit": u.day}, "log.initial.el.Density": {"value": 0.309474, "unit": u.kg / u.m ** 3}, "log.initial.el.SurfEnFluxTotal": { "value": 1.100803e04, "unit": u.kg / u.sec ** 3, }, "log.initial.el.TidalQ": {"value": -1.000000e05}, "log.initial.el.ImK2": {"value": -5.000000e-06}, "log.initial.el.K2": {"value": 0.500000}, "log.initial.el.K2Man": {"value": 0.300000}, "log.initial.el.Imk2Man": {"value": -0.003000}, "log.initial.el.TidalQMantle": {"value": 100.000000}, "log.initial.el.HEcc": {"value": 0.000000}, "log.initial.el.HZLimitDryRunaway": {"value": 3.098811e09, "unit": u.m}, "log.initial.el.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m}, "log.initial.el.HZLimRunaway": {"value": 3.267138e09, "unit": u.m}, "log.initial.el.HZLimMoistGreenhouse": {"value": 3.310536e09, "unit": u.m}, "log.initial.el.HZLimMaxGreenhouse": {"value": 5.611497e09, "unit": u.m}, "log.initial.el.HZLimEarlyMars": {"value": 6.122597e09, "unit": u.m}, "log.initial.el.Instellation": {"value": 69.788358, "unit": u.kg / u.sec ** 3}, "log.initial.el.KEcc": {"value": 0.200000}, "log.initial.el.Eccentricity": {"value": 0.200000}, "log.initial.el.OrbEnergy": {"value": -5.298093e34, "unit": u.Joule}, "log.initial.el.MeanMotion": {"value": 6.296062e-06, "unit": 1 / u.sec}, "log.initial.el.OrbPeriod": {"value": 9.979547e05, "unit": u.sec}, "log.initial.el.SemiMajorAxis": {"value": 0.100000, "unit": u.au}, "log.initial.el.CriticalSemiMajorAxis": {"value": -1.000000, "unit": u.m}, "log.initial.el.COPP": {"value": 0.000000}, "log.initial.el.OrbAngMom": { "value": 1.648983e40, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.el.LongP": {"value": 0.000000, "unit": u.rad}, "log.initial.el.LXUVTot": {"value": -1.000000, "unit": u.kg / u.sec ** 3}, "log.initial.el.TotOrbEnergy": {"value": -2.119237e35, "unit": u.Joule}, "log.initial.el.OrbPotEnergy": {"value": -1.059619e35, "unit": u.Joule}, "log.initial.el.LostEnergy": {"value": 5.562685e-309, "unit": u.Joule}, "log.initial.el.TidalRadius": {"value": 2.096446e08, "unit": u.m}, "log.initial.el.DsemiDtEqtide": {"value": 0.000192, "unit": u.m / u.sec}, "log.initial.el.DeccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.el.DMeanMotionDtEqtide": { "value": -1.211805e-19, "unit": 1 / u.sec ** 2, }, "log.initial.el.DOrbPerDtEqtide": {"value": 1.920766e-08}, "log.initial.el.EccTimeEqtide": {"value": 4.954969e13, "unit": u.sec}, "log.initial.el.SemiTimeEqtide": {"value": 7.793412e13, "unit": u.sec}, "log.initial.el.DHEccDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.el.DKEccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.el.DXoblDtEqtide": {"value": 2.139632e-12, "unit": 1 / u.sec}, "log.initial.el.DYoblDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.el.DZoblDtEqtide": {"value": -9.303384e-13, "unit": 1 / u.sec}, "log.initial.el.LockTime": {"value": -1.000000, "unit": u.sec}, "log.initial.el.BodyDsemiDtEqtide": {"value": -1.000000}, "log.initial.el.BodyDeccDt": {"value": -1.000000}, "log.initial.el.DOblDtEqtide": {"value": 2.333143e-12, "unit": u.rad / u.sec}, "log.initial.el.DRotPerDtEqtide": {"value": 1.314881e-06}, "log.initial.el.DRotRateDtEqtide": { "value": -1.106722e-15, "unit": 1 / u.sec ** 2, }, "log.initial.el.EqRotRateDiscrete": {"value": 6.296062e-06, "unit": 1 / u.sec}, "log.initial.el.EqRotPerDiscrete": {"value": 9.979547e05, "unit": u.sec}, "log.initial.el.EqRotRateCont": {"value": 8.688566e-06, "unit": 1 / u.sec}, "log.initial.el.EqRotPerCont": {"value": 7.231556e05, "unit": u.sec}, "log.initial.el.EqRotPer": {"value": 9.979547e05, "unit": u.sec}, "log.initial.el.EqTidePower": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.el.GammaRot": {"value": -1.000000, "unit": u.sec}, "log.initial.el.GammaOrb": {"value": -1.000000, "unit": u.sec}, "log.initial.el.OceanK2": {"value": 0.010000}, "log.initial.el.EnvTidalQ": {"value": -1.000000}, "log.initial.el.OceanTidalQ": {"value": -1.000000}, "log.initial.el.TideLock": {"value": 0.000000}, "log.initial.el.RotTimeEqtide": {"value": 6.570938e10, "unit": u.sec}, "log.initial.el.EnvK2": {"value": 0.500000}, "log.initial.el.OblTimeEqtide": {"value": -1.000000}, "log.initial.el.PowerEqtide": {"value": 6.080320e21, "unit": u.W}, "log.initial.el.SurfEnFluxEqtide": { "value": 1.100903e04, "unit": u.kg / u.sec ** 3, }, "log.initial.el.SurfWaterMass": {"value": 0.000000, "unit": u.kg}, "log.initial.el.EnvelopeMass": {"value": 1.000000, "unit": u.Mearth}, "log.initial.el.OxygenMass": {"value": 0.000000, "unit": u.kg}, "log.initial.el.RGLimit": {"value": 3.099115e09, "unit": u.m}, "log.initial.el.XO": {"value": 0.000000}, "log.initial.el.EtaO": {"value": 0.000000}, "log.initial.el.PlanetRadius": {"value": 32.869442, "unit": u.Rearth}, "log.initial.el.OxygenMantleMass": {"value": 0.000000, "unit": u.kg}, "log.initial.el.RadXUV": {"value": -1.000000, "unit": u.m}, "log.initial.el.RadSolid": {"value": -1.000000, "unit": u.m}, "log.initial.el.PresXUV": {"value": 5.000000}, "log.initial.el.ScaleHeight": {"value": -1.000000, "unit": u.m}, "log.initial.el.ThermTemp": {"value": 400.000000, "unit": u.K}, "log.initial.el.AtmGasConst": {"value": 4124.000000}, "log.initial.el.PresSurf": {"value": -1.000000, "unit": u.Pa}, "log.initial.el.DEnvMassDt": {"value": -2.508715e09, "unit": u.kg / u.sec}, "log.initial.el.FXUV": {"value": 0.069788, "unit": u.W / u.m ** 2}, "log.initial.el.AtmXAbsEffH2O": {"value": 0.300000}, "log.initial.el.RocheRadius": {"value": 1.885546e08, "unit": u.m}, "log.initial.el.BondiRadius": {"value": 7.899468e08, "unit": u.m}, "log.initial.el.HEscapeRegime": {"value": 3.000000}, "log.initial.el.RRCriticalFlux": {"value": 0.000139, "unit": u.W / u.m ** 2}, "log.initial.el.KTide": {"value": 1.000000}, "log.initial.el.RGDuration": {"value": 1.00000e06, "unit": u.yr}, "log.initial.rr.Mass": {"value": 2.000000, "unit": u.Mearth}, "log.initial.rr.Obliquity": {"value": 0.785398, "unit": u.rad}, "log.initial.rr.PrecA": {"value": 0.000000, "unit": u.rad}, "log.initial.rr.Xobl": {"value": 0.707107}, "log.initial.rr.Yobl": {"value": 0.000000}, "log.initial.rr.Zobl": {"value": 0.707107}, "log.initial.rr.Radius": {"value": 2.096446e08, "unit": u.m}, "log.initial.rr.RadGyra": {"value": 0.400000}, "log.initial.rr.RotAngMom": { "value": 1.221650e37, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.rr.RotKinEnergy": {"value": 8.884088e32, "unit": u.Joule}, "log.initial.rr.RotVel": {"value": 3.049157e04, "unit": u.m / u.sec}, "log.initial.rr.BodyType": {"value": 0.000000}, "log.initial.rr.RotRate": {"value": 0.000145, "unit": 1 / u.sec}, "log.initial.rr.RotPer": {"value": 0.500000, "unit": u.day}, "log.initial.rr.Density": {"value": 0.309474, "unit": u.kg / u.m ** 3}, "log.initial.rr.SurfEnFluxTotal": { "value": 2.324795e04, "unit": u.kg / u.sec ** 3, }, "log.initial.rr.TidalQ": {"value": -1.000000e05}, "log.initial.rr.ImK2": {"value": -5.000000e-06}, "log.initial.rr.K2": {"value": 0.500000}, "log.initial.rr.K2Man": {"value": 0.300000}, "log.initial.rr.Imk2Man": {"value": -0.003000}, "log.initial.rr.TidalQMantle": {"value": 100.000000}, "log.initial.rr.HEcc": {"value": 0.000000}, "log.initial.rr.HZLimitDryRunaway": {"value": 3.098811e09, "unit": u.m}, "log.initial.rr.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m}, "log.initial.rr.HZLimRunaway": {"value": 3.267138e09, "unit": u.m}, "log.initial.rr.HZLimMoistGreenhouse": {"value": 3.310536e09, "unit": u.m}, "log.initial.rr.HZLimMaxGreenhouse": {"value": 5.611497e09, "unit": u.m}, "log.initial.rr.HZLimEarlyMars": {"value": 6.122597e09, "unit": u.m}, "log.initial.rr.Instellation": {"value": 69.788358, "unit": u.kg / u.sec ** 3}, "log.initial.rr.KEcc": {"value": 0.200000}, "log.initial.rr.Eccentricity": {"value": 0.200000}, "log.initial.rr.OrbEnergy": {"value": -5.298093e34, "unit": u.Joule}, "log.initial.rr.MeanMotion": {"value": 6.296062e-06, "unit": 1 / u.sec}, "log.initial.rr.OrbPeriod": {"value": 9.979547e05, "unit": u.sec}, "log.initial.rr.SemiMajorAxis": {"value": 0.100000, "unit": u.au}, "log.initial.rr.CriticalSemiMajorAxis": {"value": -1.000000, "unit": u.m}, "log.initial.rr.COPP": {"value": 0.000000}, "log.initial.rr.OrbAngMom": { "value": 1.648983e40, "unit": (u.kg * u.m ** 2) / u.sec, }, "log.initial.rr.LongP": {"value": 0.000000, "unit": u.rad}, "log.initial.rr.LXUVTot": {"value": -1.000000, "unit": u.kg / u.sec ** 3}, "log.initial.rr.TotOrbEnergy": {"value": -2.119237e35, "unit": u.Joule}, "log.initial.rr.OrbPotEnergy": {"value": -1.059619e35, "unit": u.Joule}, "log.initial.rr.LostEnergy": {"value": 5.562685e-309, "unit": u.Joule}, "log.initial.rr.TidalRadius": {"value": 2.096446e08, "unit": u.m}, "log.initial.rr.DsemiDtEqtide": {"value": 0.000192, "unit": u.m / u.sec}, "log.initial.rr.DeccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.rr.DMeanMotionDtEqtide": { "value": -1.211805e-19, "unit": 1 / u.sec ** 2, }, "log.initial.rr.DOrbPerDtEqtide": {"value": 1.920766e-08}, "log.initial.rr.EccTimeEqtide": {"value": 4.954969e13, "unit": u.sec}, "log.initial.rr.SemiTimeEqtide": {"value": 7.793412e13, "unit": u.sec}, "log.initial.rr.DHEccDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.rr.DKEccDtEqtide": {"value": 4.036352e-15, "unit": 1 / u.sec}, "log.initial.rr.DXoblDtEqtide": {"value": 1.462258e-12, "unit": 1 / u.sec}, "log.initial.rr.DYoblDtEqtide": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.rr.DZoblDtEqtide": {"value": -1.462258e-12, "unit": 1 / u.sec}, "log.initial.rr.LockTime": {"value": -1.000000, "unit": u.sec}, "log.initial.rr.BodyDsemiDtEqtide": {"value": -1.000000}, "log.initial.rr.BodyDeccDt": {"value": -1.000000}, "log.initial.rr.DOblDtEqtide": {"value": 2.067945e-12, "unit": u.rad / u.sec}, "log.initial.rr.DRotPerDtEqtide": {"value": 3.287202e-07}, "log.initial.rr.DRotRateDtEqtide": { "value": -1.106722e-15, "unit": 1 / u.sec ** 2, }, "log.initial.rr.EqRotRateDiscrete": {"value": 6.296062e-06, "unit": 1 / u.sec}, "log.initial.rr.EqRotPerDiscrete": {"value": 9.979547e05, "unit": u.sec}, "log.initial.rr.EqRotRateCont": {"value": 8.688566e-06, "unit": 1 / u.sec}, "log.initial.rr.EqRotPerCont": {"value": 7.231556e05, "unit": u.sec}, "log.initial.rr.EqRotPer": {"value": 9.979547e05, "unit": u.sec}, "log.initial.rr.EqTidePower": {"value": 0.000000, "unit": 1 / u.sec}, "log.initial.rr.GammaRot": {"value": -1.000000, "unit": u.sec}, "log.initial.rr.GammaOrb": {"value": -1.000000, "unit": u.sec}, "log.initial.rr.OceanK2": {"value": 0.010000}, "log.initial.rr.EnvTidalQ": {"value": -1.000000}, "log.initial.rr.OceanTidalQ": {"value": -1.000000}, "log.initial.rr.TideLock": {"value": 0.000000}, "log.initial.rr.RotTimeEqtide": {"value": 1.314188e11, "unit": u.sec}, "log.initial.rr.EnvK2": {"value": 0.500000}, "log.initial.rr.OblTimeEqtide": {"value": -1.000000}, "log.initial.rr.PowerEqtide": {"value": 1.284046e22, "unit": u.W}, "log.initial.rr.SurfEnFluxEqtide": { "value": 2.324895e04, "unit": u.kg / u.sec ** 3, }, "log.initial.rr.SurfWaterMass": {"value": 0.000000, "unit": u.kg}, "log.initial.rr.EnvelopeMass": {"value": 1.000000, "unit": u.Mearth}, "log.initial.rr.OxygenMass": {"value": 0.000000, "unit": u.kg}, "log.initial.rr.RGLimit": {"value": 3.099115e09, "unit": u.m}, "log.initial.rr.XO": {"value": 0.000000}, "log.initial.rr.EtaO": {"value": 0.000000}, "log.initial.rr.PlanetRadius": {"value": 32.869442, "unit": u.Rearth}, "log.initial.rr.OxygenMantleMass": {"value": 0.000000, "unit": u.kg}, "log.initial.rr.RadXUV": {"value": -1.000000, "unit": u.m}, "log.initial.rr.RadSolid": {"value": -1.000000, "unit": u.m}, "log.initial.rr.PresXUV": {"value": 5.000000}, "log.initial.rr.ScaleHeight": {"value": -1.000000, "unit": u.m}, "log.initial.rr.ThermTemp": {"value": 400.000000, "unit": u.K}, "log.initial.rr.AtmGasConst": {"value": 4124.000000}, "log.initial.rr.PresSurf": {"value": -1.000000, "unit": u.Pa}, "log.initial.rr.DEnvMassDt": {"value": -1.119308e08, "unit": u.kg / u.sec}, "log.initial.rr.FXUV": {"value": 0.069788, "unit": u.W / u.m ** 2}, "log.initial.rr.AtmXAbsEffH2O": {"value": 0.300000}, "log.initial.rr.RocheRadius": {"value": 1.885546e08, "unit": u.m}, "log.initial.rr.BondiRadius": {"value": 7.899468e08, "unit": u.m}, "log.initial.rr.HEscapeRegime": {"value": 6.000000}, "log.initial.rr.RRCriticalFlux": {"value": 0.000139, "unit": u.W / u.m ** 2}, "log.initial.rr.KTide": {"value": 1.000000}, "log.initial.rr.RGDuration": {"value": 1.00000e06, "unit": u.yr}, "log.final.system.Age": {"value": 6.311520e13, "unit": u.sec, "rtol": 1e-4}, "log.final.system.Time": {"value": 3.155760e13, "unit": u.sec, "rtol": 1e-4}, "log.final.system.TotAngMom": { "value": 5.425277e40, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.system.TotEnergy": { "value": -2.482441e43, "unit": u.Joule, "rtol": 1e-4, }, "log.final.system.PotEnergy": { "value": -2.482440e43, "unit": u.Joule, "rtol": 1e-4, }, "log.final.system.KinEnergy": { "value": 5.347271e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.system.DeltaTime": { "value": 4.863245e08, "unit": u.sec, "rtol": 1e-4, }, "log.final.star.Mass": {"value": 1.988416e30, "unit": u.kg, "rtol": 1e-4}, "log.final.star.Obliquity": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.star.PrecA": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.star.Xobl": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.Yobl": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.Zobl": {"value": 1.000000, "rtol": 1e-4}, "log.final.star.Radius": {"value": 6.378100e06, "unit": u.m, "rtol": 1e-4}, "log.final.star.RadGyra": {"value": 0.500000, "rtol": 1e-4}, "log.final.star.RotAngMom": { "value": 1.470605e39, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.star.RotKinEnergy": { "value": 5.347271e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.star.RotVel": { "value": 463.828520, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.star.BodyType": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.RotRate": { "value": 7.272205e-05, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.star.RotPer": {"value": 8.640000e04, "unit": u.sec, "rtol": 1e-4}, "log.final.star.Density": { "value": 1.829552e09, "unit": u.kg / u.m ** 3, "rtol": 1e-4, }, "log.final.star.SurfEnFluxTotal": { "value": 3.025764e-12, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.star.TidalQ": {"value": 1.000000e06, "rtol": 1e-4}, "log.final.star.ImK2": {"value": -5.000000e-07, "rtol": 1e-4}, "log.final.star.K2": {"value": 0.500000, "rtol": 1e-4}, "log.final.star.K2Man": {"value": 0.010000, "rtol": 1e-4}, "log.final.star.Imk2Man": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.TidalQMantle": {"value": 100.000000, "rtol": 1e-4}, "log.final.star.HEcc": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.HZLimitDryRunaway": { "value": 3.036202e09, "unit": u.m, "rtol": 1e-4, }, "log.final.star.HZLimRecVenus": { "value": 2.502002e09, "unit": u.m, "rtol": 1e-4, }, "log.final.star.HZLimRunaway": { "value": 3.267138e09, "unit": u.m, "rtol": 1e-4, }, "log.final.star.HZLimMoistGreenhouse": { "value": 3.310536e09, "unit": u.m, "rtol": 1e-4, }, "log.final.star.HZLimMaxGreenhouse": { "value": 5.611497e09, "unit": u.m, "rtol": 1e-4, }, "log.final.star.HZLimEarlyMars": { "value": 6.122597e09, "unit": u.m, "rtol": 1e-4, }, "log.final.star.Instellation": { "value": -1.000000, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.star.KEcc": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.Eccentricity": {"value": -1.000000, "rtol": 1e-4}, "log.final.star.OrbEnergy": {"value": 0.000000, "unit": u.Joule, "rtol": 1e-4}, "log.final.star.MeanMotion": { "value": -1.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.star.OrbPeriod": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.star.SemiMajorAxis": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.star.CriticalSemiMajorAxis": { "value": -1.000000, "unit": u.m, "rtol": 1e-4, }, "log.final.star.COPP": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.OrbAngMom": { "value": 0.000000, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.star.LongP": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.star.LXUVTot": { "value": 1.923000e20, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.star.TotOrbEnergy": { "value": -1.740032e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.star.OrbPotEnergy": { "value": -1.000000, "unit": u.Joule, "rtol": 1e-4, }, "log.final.star.LostEnergy": { "value": 2.550749e26, "unit": u.Joule, "rtol": 1e-4, }, "log.final.star.LostAngMom": { "value": 3.507532e30, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.star.LockTime": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.star.BodyDsemiDtEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.star.BodyDeccDt": {"value": -1.000000, "rtol": 1e-4}, "log.final.star.DOblDtEqtide": { "value": 0.000000, "unit": u.rad / u.sec, "rtol": 1e-4, }, "log.final.star.DRotPerDtEqtide": {"value": 1.380178e-27, "rtol": 1e-4}, "log.final.star.DRotRateDtEqtide": { "value": -1.161683e-36, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.star.EqRotRateDiscrete": { "value": 6.510710e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.star.EqRotPerDiscrete": { "value": 9.650538e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.star.EqRotRateCont": { "value": 7.554427e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.star.EqRotPerCont": { "value": 8.317222e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.star.EqRotPer": {"value": 9.650538e05, "unit": u.sec, "rtol": 1e-4}, "log.final.star.EqTidePower": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.star.GammaRot": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.star.GammaOrb": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.star.OceanK2": {"value": 0.010000, "rtol": 1e-4}, "log.final.star.EnvTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.star.OceanTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.star.TideLock": {"value": 0.000000, "rtol": 1e-4}, "log.final.star.RotTimeEqtide": { "value": 2.047960e-37, "unit": u.sec, "rtol": 1e-4, }, "log.final.star.EnvK2": {"value": 0.010000, "rtol": 1e-4}, "log.final.star.OblTimeEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.star.PowerEqtide": {"value": 1546.776661, "unit": u.W, "rtol": 1e-4}, "log.final.star.SurfEnFluxEqtide": { "value": 3.025764e-12, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.star.Luminosity": {"value": 1.923000e23, "unit": u.W, "rtol": 1e-4}, "log.final.star.LXUVStellar": {"value": 1.923000e20, "unit": u.W, "rtol": 1e-4}, "log.final.star.Temperature": {"value": 5778.000000, "unit": u.K, "rtol": 1e-4}, "log.final.star.LXUVFrac": {"value": 0.001000, "rtol": 1e-4}, "log.final.star.RossbyNumber": {"value": 0.078260, "rtol": 1e-4}, "log.final.star.DRotPerDtStellar": {"value": 6.530034e-18, "rtol": 1e-4}, "log.final.auto.Mass": {"value": 1.411359, "unit": u.Mearth, "rtol": 1e-4}, "log.final.auto.Obliquity": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.auto.PrecA": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.auto.Xobl": {"value": 1.570471e-162, "rtol": 1e-4}, "log.final.auto.Yobl": {"value": 0.000000, "rtol": 1e-4}, "log.final.auto.Zobl": {"value": 1.000002, "rtol": 1e-4}, "log.final.auto.Radius": {"value": 1.630278e08, "unit": u.m, "rtol": 1e-4}, "log.final.auto.RadGyra": {"value": 0.400000, "rtol": 1e-4}, "log.final.auto.RotAngMom": { "value": 2.333687e35, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.auto.RotKinEnergy": { "value": 7.596980e29, "unit": u.Joule, "rtol": 1e-4, }, "log.final.auto.RotVel": { "value": 1061.426957, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.auto.BodyType": {"value": 0.000000, "rtol": 1e-4}, "log.final.auto.RotRate": { "value": 6.510710e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.RotPer": {"value": 11.169604, "unit": u.day, "rtol": 1e-4}, "log.final.auto.Density": { "value": 0.464405, "unit": u.kg / u.m ** 3, "rtol": 1e-4, }, "log.final.auto.SurfEnFluxTotal": { "value": 52.542587, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.auto.TidalQ": {"value": -1.000000e05, "rtol": 1e-4}, "log.final.auto.ImK2": {"value": -5.000000e-06, "rtol": 1e-4}, "log.final.auto.K2": {"value": 0.500000, "rtol": 1e-4}, "log.final.auto.K2Man": {"value": 0.300000, "rtol": 1e-4}, "log.final.auto.Imk2Man": {"value": -0.003000, "rtol": 1e-4}, "log.final.auto.TidalQMantle": {"value": 100.000000, "rtol": 1e-4}, "log.final.auto.HEcc": {"value": 0.000000, "rtol": 1e-4}, "log.final.auto.HZLimitDryRunaway": { "value": 3.062148e09, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.HZLimRecVenus": { "value": 2.502002e09, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.HZLimRunaway": { "value": 3.267138e09, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.HZLimMoistGreenhouse": { "value": 3.310536e09, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.HZLimMaxGreenhouse": { "value": 5.611497e09, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.HZLimEarlyMars": { "value": 6.122597e09, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.Instellation": { "value": 72.115242, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.auto.KEcc": {"value": 0.129902, "rtol": 1e-4}, "log.final.auto.Eccentricity": {"value": 0.129902, "rtol": 1e-4}, "log.final.auto.OrbEnergy": { "value": -3.823257e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.auto.MeanMotion": { "value": 6.510710e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.OrbPeriod": {"value": 9.650538e05, "unit": u.sec, "rtol": 1e-4}, "log.final.auto.SemiMajorAxis": {"value": 0.097790, "unit": u.au, "rtol": 1e-4}, "log.final.auto.CriticalSemiMajorAxis": { "value": -1.000000, "unit": u.m, "rtol": 1e-4, }, "log.final.auto.COPP": {"value": 0.000000, "rtol": 1e-4}, "log.final.auto.OrbAngMom": { "value": 1.164500e40, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.auto.LongP": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.auto.LXUVTot": { "value": -1.000000, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.auto.TotOrbEnergy": { "value": -1.740032e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.auto.OrbPotEnergy": { "value": -7.646514e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.auto.LostEnergy": { "value": 1.264526e33, "unit": u.Joule, "rtol": 1e-4, }, "log.final.auto.TidalRadius": {"value": 1.630278e08, "unit": u.m, "rtol": 1e-4}, "log.final.auto.DsemiDtEqtide": { "value": -6.842553e-06, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.auto.DeccDtEqtide": { "value": -1.800337e-15, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.DMeanMotionDtEqtide": { "value": 4.567924e-21, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.auto.DOrbPerDtEqtide": {"value": -6.770832e-10, "rtol": 1e-4}, "log.final.auto.EccTimeEqtide": { "value": 7.215422e13, "unit": u.sec, "rtol": 1e-4, }, "log.final.auto.SemiTimeEqtide": { "value": 2.137966e15, "unit": u.sec, "rtol": 1e-4, }, "log.final.auto.DHEccDtEqtide": { "value": -0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.DKEccDtEqtide": { "value": -1.800337e-15, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.DXoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.DYoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.DZoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.LockTime": {"value": 2.398144e11, "unit": u.sec, "rtol": 1e-4}, "log.final.auto.BodyDsemiDtEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.auto.BodyDeccDt": {"value": -1.000000, "rtol": 1e-4}, "log.final.auto.DOblDtEqtide": { "value": 0.000000, "unit": u.rad / u.sec, "rtol": 1e-4, }, "log.final.auto.DRotPerDtEqtide": {"value": -8.245322e-298, "rtol": 1e-4}, "log.final.auto.DRotRateDtEqtide": { "value": 5.562685e-309, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.auto.EqRotRateDiscrete": { "value": 6.510710e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.EqRotPerDiscrete": { "value": 9.650538e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.auto.EqRotRateCont": { "value": 7.554427e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.EqRotPerCont": { "value": 8.317222e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.auto.EqRotPer": {"value": 9.650538e05, "unit": u.sec, "rtol": 1e-4}, "log.final.auto.EqTidePower": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.auto.GammaRot": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.auto.GammaOrb": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.auto.OceanK2": {"value": 0.010000, "rtol": 1e-4}, "log.final.auto.EnvTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.auto.OceanTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.auto.TideLock": {"value": 1.000000, "rtol": 1e-4}, "log.final.auto.RotTimeEqtide": { "value": 1.170426e303, "unit": u.sec, "rtol": 1e-4, }, "log.final.auto.EnvK2": {"value": 0.500000, "rtol": 1e-4}, "log.final.auto.OblTimeEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.auto.PowerEqtide": {"value": 1.788269e19, "unit": u.W, "rtol": 1e-4}, "log.final.auto.SurfEnFluxEqtide": { "value": 53.542587, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.auto.SurfWaterMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.auto.EnvelopeMass": { "value": 0.411359, "unit": u.Mearth, "rtol": 1e-4, }, "log.final.auto.OxygenMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.auto.RGLimit": {"value": 3.141989e09, "unit": u.m, "rtol": 1e-4}, "log.final.auto.XO": {"value": 0.000000, "rtol": 1e-4}, "log.final.auto.EtaO": {"value": 0.000000, "rtol": 1e-4}, "log.final.auto.PlanetRadius": { "value": 25.560564, "unit": u.Rearth, "rtol": 1e-4, }, "log.final.auto.OxygenMantleMass": { "value": 0.000000, "unit": u.kg, "rtol": 1e-4, }, "log.final.auto.RadXUV": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.auto.RadSolid": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.auto.PresXUV": {"value": 5.000000, "rtol": 1e-4}, "log.final.auto.ScaleHeight": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.auto.ThermTemp": {"value": 400.000000, "unit": u.K, "rtol": 1e-4}, "log.final.auto.AtmGasConst": {"value": 4124.000000, "rtol": 1e-4}, "log.final.auto.PresSurf": {"value": -1.000000, "unit": u.Pa, "rtol": 1e-4}, "log.final.auto.DEnvMassDt": { "value": -7.802590e07, "unit": u.kg / u.sec, "rtol": 1e-4, }, "log.final.auto.FXUV": { "value": 0.072115, "unit": u.W / u.m ** 2, "rtol": 1e-4, }, "log.final.auto.AtmXAbsEffH2O": {"value": 0.300000, "rtol": 1e-4}, "log.final.auto.RocheRadius": {"value": 1.641596e08, "unit": u.m, "rtol": 1e-4}, "log.final.auto.BondiRadius": {"value": 5.637137e08, "unit": u.m, "rtol": 1e-4}, "log.final.auto.HEscapeRegime": {"value": 6.000000, "rtol": 1e-4}, "log.final.auto.RRCriticalFlux": { "value": 1.470664e-06, "unit": u.W / u.m ** 2, "rtol": 1e-4, }, "log.final.auto.KTide": {"value": 0.100000, "rtol": 1e-4}, "log.final.auto.RGDuration": {"value": 1.00000e06, "unit": u.yr, "rtol": 1e-4}, "log.final.bondi.Mass": {"value": 1.000000, "unit": u.Mearth, "rtol": 1e-4}, "log.final.bondi.Obliquity": { "value": 2.992105e-54, "unit": u.rad, "rtol": 1e-4, }, "log.final.bondi.PrecA": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.bondi.Xobl": {"value": 2.992105e-54, "rtol": 1e-4}, "log.final.bondi.Yobl": {"value": 0.000000, "rtol": 1e-4}, "log.final.bondi.Zobl": {"value": 1.000000, "rtol": 1e-4}, "log.final.bondi.Radius": {"value": 6.378100e06, "unit": u.m, "rtol": 1e-4}, "log.final.bondi.RadGyra": {"value": 0.400000, "rtol": 1e-4}, "log.final.bondi.RotAngMom": { "value": 2.447267e32, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.bondi.RotKinEnergy": { "value": 7.703654e26, "unit": u.Joule, "rtol": 1e-4, }, "log.final.bondi.RotVel": { "value": 40.154732, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.bondi.BodyType": {"value": 0.000000, "rtol": 1e-4}, "log.final.bondi.RotRate": { "value": 6.295720e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.RotPer": {"value": 11.551030, "unit": u.day, "rtol": 1e-4}, "log.final.bondi.Density": { "value": 5495.038549, "unit": u.kg / u.m ** 3, "rtol": 1e-4, }, "log.final.bondi.SurfEnFluxTotal": { "value": 3.855526, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.bondi.TidalQ": {"value": -100.000000, "rtol": 1e-4}, "log.final.bondi.ImK2": {"value": -0.003000, "rtol": 1e-4}, "log.final.bondi.K2": {"value": 0.500000, "rtol": 1e-4}, "log.final.bondi.K2Man": {"value": 0.300000, "rtol": 1e-4}, "log.final.bondi.Imk2Man": {"value": -0.003000, "rtol": 1e-4}, "log.final.bondi.TidalQMantle": {"value": 100.000000, "rtol": 1e-4}, "log.final.bondi.HEcc": {"value": 0.000000, "rtol": 1e-4}, "log.final.bondi.HZLimitDryRunaway": { "value": 3.098815e09, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.HZLimRecVenus": { "value": 2.502002e09, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.HZLimRunaway": { "value": 3.267138e09, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.HZLimMoistGreenhouse": { "value": 3.310536e09, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.HZLimMaxGreenhouse": { "value": 5.611497e09, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.HZLimEarlyMars": { "value": 6.122597e09, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.Instellation": { "value": 69.783534, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.bondi.KEcc": {"value": 0.200007, "rtol": 1e-4}, "log.final.bondi.Eccentricity": {"value": 0.200007, "rtol": 1e-4}, "log.final.bondi.OrbEnergy": { "value": -2.648953e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.bondi.MeanMotion": { "value": 6.295720e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.OrbPeriod": { "value": 9.980090e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.bondi.SemiMajorAxis": { "value": 0.100004, "unit": u.au, "rtol": 1e-4, }, "log.final.bondi.CriticalSemiMajorAxis": { "value": -1.000000, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.COPP": {"value": 0.000000, "rtol": 1e-4}, "log.final.bondi.OrbAngMom": { "value": 8.245061e39, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.bondi.LongP": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.bondi.LXUVTot": { "value": -1.000000, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.bondi.TotOrbEnergy": { "value": -1.740032e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.bondi.OrbPotEnergy": { "value": -5.297906e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.bondi.LostEnergy": { "value": 3.022858e31, "unit": u.Joule, "rtol": 1e-4, }, "log.final.bondi.TidalRadius": { "value": 6.378100e06, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.DsemiDtEqtide": { "value": -1.113122e-09, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.bondi.DeccDtEqtide": { "value": -1.860062e-19, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.DMeanMotionDtEqtide": { "value": 7.026492e-25, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.bondi.DOrbPerDtEqtide": {"value": -1.113852e-13, "rtol": 1e-4}, "log.final.bondi.EccTimeEqtide": { "value": 1.075269e18, "unit": u.sec, "rtol": 1e-4, }, "log.final.bondi.SemiTimeEqtide": { "value": 1.343996e19, "unit": u.sec, "rtol": 1e-4, }, "log.final.bondi.DHEccDtEqtide": { "value": -0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.DKEccDtEqtide": { "value": -1.860062e-19, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.DXoblDtEqtide": { "value": -1.366908e-65, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.DYoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.DZoblDtEqtide": { "value": 4.089932e-119, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.LockTime": {"value": 4.919130e12, "unit": u.sec, "rtol": 1e-4}, "log.final.bondi.BodyDsemiDtEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.bondi.BodyDeccDt": {"value": -1.000000, "rtol": 1e-4}, "log.final.bondi.DOblDtEqtide": { "value": -1.366908e-65, "unit": u.rad / u.sec, "rtol": 1e-4, }, "log.final.bondi.DRotPerDtEqtide": {"value": -8.818069e-298, "rtol": 1e-4}, "log.final.bondi.DRotRateDtEqtide": { "value": 5.562685e-309, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.bondi.EqRotRateDiscrete": { "value": 6.295720e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.EqRotPerDiscrete": { "value": 9.980090e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.bondi.EqRotRateCont": { "value": 8.688253e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.EqRotPerCont": { "value": 7.231816e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.bondi.EqRotPer": {"value": 9.980090e05, "unit": u.sec, "rtol": 1e-4}, "log.final.bondi.EqTidePower": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.bondi.GammaRot": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.bondi.GammaOrb": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.bondi.OceanK2": {"value": 0.010000, "rtol": 1e-4}, "log.final.bondi.EnvTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.bondi.OceanTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.bondi.TideLock": {"value": 1.000000, "rtol": 1e-4}, "log.final.bondi.RotTimeEqtide": { "value": 1.131777e303, "unit": u.sec, "rtol": 1e-4, }, "log.final.bondi.EnvK2": {"value": 0.500000, "rtol": 1e-4}, "log.final.bondi.OblTimeEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.bondi.PowerEqtide": { "value": 1.970952e15, "unit": u.W, "rtol": 1e-4, }, "log.final.bondi.SurfEnFluxEqtide": { "value": 3.855526, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.bondi.SurfWaterMass": { "value": 0.000000, "unit": u.kg, "rtol": 1e-4, }, "log.final.bondi.EnvelopeMass": { "value": 0.000000, "unit": u.Mearth, "rtol": 1e-4, }, "log.final.bondi.OxygenMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.bondi.RGLimit": {"value": 3.147864e09, "unit": u.m, "rtol": 1e-4}, "log.final.bondi.XO": {"value": 0.000000, "rtol": 1e-4}, "log.final.bondi.EtaO": {"value": 0.000000, "rtol": 1e-4}, "log.final.bondi.PlanetRadius": { "value": 1.000000, "unit": u.Rearth, "rtol": 1e-4, }, "log.final.bondi.OxygenMantleMass": { "value": 0.000000, "unit": u.kg, "rtol": 1e-4, }, "log.final.bondi.RadXUV": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.bondi.RadSolid": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.bondi.PresXUV": {"value": 5.000000, "rtol": 1e-4}, "log.final.bondi.ScaleHeight": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.bondi.ThermTemp": {"value": 400.000000, "unit": u.K, "rtol": 1e-4}, "log.final.bondi.AtmGasConst": {"value": 4124.000000, "rtol": 1e-4}, "log.final.bondi.PresSurf": {"value": -1.000000, "unit": u.Pa, "rtol": 1e-4}, "log.final.bondi.DEnvMassDt": { "value": 5.562685e-309, "unit": u.kg / u.sec, "rtol": 1e-4, }, "log.final.bondi.FXUV": { "value": 0.069784, "unit": u.W / u.m ** 2, "rtol": 1e-4, }, "log.final.bondi.AtmXAbsEffH2O": {"value": 0.300000, "rtol": 1e-4}, "log.final.bondi.RocheRadius": { "value": 1.496611e08, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.BondiRadius": { "value": 3.949665e08, "unit": u.m, "rtol": 1e-4, }, "log.final.bondi.HEscapeRegime": {"value": 8.000000, "rtol": 1e-4}, "log.final.bondi.RRCriticalFlux": { "value": 1.080455, "unit": u.W / u.m ** 2, "rtol": 1e-4, }, "log.final.bondi.KTide": {"value": 0.936113, "rtol": 1e-4}, "log.final.bondi.RGDuration": {"value": 1.00000e06, "unit": u.yr, "rtol": 1e-4}, "log.final.el.Mass": {"value": 1.986370, "unit": u.Mearth, "rtol": 1e-4}, "log.final.el.Obliquity": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.el.PrecA": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.el.Xobl": {"value": 1.563609e-162, "rtol": 1e-4}, "log.final.el.Yobl": {"value": 0.000000, "rtol": 1e-4}, "log.final.el.Zobl": {"value": 1.000000, "rtol": 1e-4}, "log.final.el.Radius": {"value": 2.084572e08, "unit": u.m, "rtol": 1e-4}, "log.final.el.RadGyra": {"value": 0.400000, "rtol": 1e-4}, "log.final.el.RotAngMom": { "value": 5.470333e35, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.el.RotKinEnergy": { "value": 1.814054e30, "unit": u.Joule, "rtol": 1e-4, }, "log.final.el.RotVel": { "value": 1382.558099, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.el.BodyType": {"value": 0.000000, "rtol": 1e-4}, "log.final.el.RotRate": { "value": 6.632335e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.RotPer": {"value": 10.964773, "unit": u.day, "rtol": 1e-4}, "log.final.el.Density": { "value": 0.312647, "unit": u.kg / u.m ** 3, "rtol": 1e-4, }, "log.final.el.SurfEnFluxTotal": { "value": 33.098849, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.el.TidalQ": {"value": -1.000000e05, "rtol": 1e-4}, "log.final.el.ImK2": {"value": -5.000000e-06, "rtol": 1e-4}, "log.final.el.K2": {"value": 0.500000, "rtol": 1e-4}, "log.final.el.K2Man": {"value": 0.300000, "rtol": 1e-4}, "log.final.el.Imk2Man": {"value": -0.003000, "rtol": 1e-4}, "log.final.el.TidalQMantle": {"value": 100.000000, "rtol": 1e-4}, "log.final.el.HEcc": {"value": 0.000000, "rtol": 1e-4}, "log.final.el.HZLimitDryRunaway": { "value": 3.043341e09, "unit": u.m, "rtol": 1e-4, }, "log.final.el.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m, "rtol": 1e-4}, "log.final.el.HZLimRunaway": {"value": 3.267138e09, "unit": u.m, "rtol": 1e-4}, "log.final.el.HZLimMoistGreenhouse": { "value": 3.310536e09, "unit": u.m, "rtol": 1e-4, }, "log.final.el.HZLimMaxGreenhouse": { "value": 5.611497e09, "unit": u.m, "rtol": 1e-4, }, "log.final.el.HZLimEarlyMars": { "value": 6.122597e09, "unit": u.m, "rtol": 1e-4, }, "log.final.el.Instellation": { "value": 73.462978, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.el.KEcc": {"value": 0.068456, "rtol": 1e-4}, "log.final.el.Eccentricity": {"value": 0.068456, "rtol": 1e-4}, "log.final.el.OrbEnergy": { "value": -5.447720e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.el.MeanMotion": { "value": 6.632335e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.OrbPeriod": {"value": 9.473564e05, "unit": u.sec, "rtol": 1e-4}, "log.final.el.SemiMajorAxis": {"value": 0.096591, "unit": u.au, "rtol": 1e-4}, "log.final.el.CriticalSemiMajorAxis": { "value": -1.000000, "unit": u.m, "rtol": 1e-4, }, "log.final.el.COPP": {"value": 0.000000, "rtol": 1e-4}, "log.final.el.OrbAngMom": { "value": 1.638922e40, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.el.LongP": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.el.LXUVTot": { "value": -1.000000, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.el.TotOrbEnergy": { "value": -1.740032e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.el.OrbPotEnergy": { "value": -1.089544e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.el.LostEnergy": { "value": 2.085924e33, "unit": u.Joule, "rtol": 1e-4, }, "log.final.el.TidalRadius": {"value": 2.084572e08, "unit": u.m, "rtol": 1e-4}, "log.final.el.DsemiDtEqtide": { "value": -4.938887e-06, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.el.DeccDtEqtide": { "value": -2.496493e-15, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.DMeanMotionDtEqtide": { "value": 3.400372e-21, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.el.DOrbPerDtEqtide": {"value": -4.857058e-10, "rtol": 1e-4}, "log.final.el.EccTimeEqtide": { "value": 2.742067e13, "unit": u.sec, "rtol": 1e-4, }, "log.final.el.SemiTimeEqtide": { "value": 2.925710e15, "unit": u.sec, "rtol": 1e-4, }, "log.final.el.DHEccDtEqtide": { "value": -0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.DKEccDtEqtide": { "value": -2.496493e-15, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.DXoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.DYoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.DZoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.LockTime": {"value": 8.193554e10, "unit": u.sec, "rtol": 1e-4}, "log.final.el.BodyDsemiDtEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.el.BodyDeccDt": {"value": -1.000000, "rtol": 1e-4}, "log.final.el.DOblDtEqtide": { "value": 0.000000, "unit": u.rad / u.sec, "rtol": 1e-4, }, "log.final.el.DRotPerDtEqtide": {"value": -7.945685e-298, "rtol": 1e-4}, "log.final.el.DRotRateDtEqtide": { "value": 5.562685e-309, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.el.EqRotRateDiscrete": { "value": 6.632335e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.EqRotPerDiscrete": { "value": 9.473564e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.el.EqRotRateCont": { "value": 6.927597e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.EqRotPerCont": { "value": 9.069791e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.el.EqRotPer": {"value": 9.473564e05, "unit": u.sec, "rtol": 1e-4}, "log.final.el.EqTidePower": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.el.GammaRot": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.el.GammaOrb": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.el.OceanK2": {"value": 0.010000, "rtol": 1e-4}, "log.final.el.EnvTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.el.OceanTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.el.TideLock": {"value": 1.000000, "rtol": 1e-4}, "log.final.el.RotTimeEqtide": { "value": 1.192290e303, "unit": u.sec, "rtol": 1e-4, }, "log.final.el.EnvK2": {"value": 0.500000, "rtol": 1e-4}, "log.final.el.OblTimeEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.el.PowerEqtide": {"value": 1.862016e19, "unit": u.W, "rtol": 1e-4}, "log.final.el.SurfEnFluxEqtide": { "value": 34.098849, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.el.SurfWaterMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.el.EnvelopeMass": { "value": 0.986370, "unit": u.Mearth, "rtol": 1e-4, }, "log.final.el.OxygenMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.el.RGLimit": {"value": 3.127704e09, "unit": u.m, "rtol": 1e-4}, "log.final.el.XO": {"value": 0.000000, "rtol": 1e-4}, "log.final.el.EtaO": {"value": 0.000000, "rtol": 1e-4}, "log.final.el.PlanetRadius": { "value": 32.683276, "unit": u.Rearth, "rtol": 1e-4, }, "log.final.el.OxygenMantleMass": { "value": 0.000000, "unit": u.kg, "rtol": 1e-4, }, "log.final.el.RadXUV": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.el.RadSolid": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.el.PresXUV": {"value": 5.000000, "rtol": 1e-4}, "log.final.el.ScaleHeight": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.el.ThermTemp": {"value": 400.000000, "unit": u.K, "rtol": 1e-4}, "log.final.el.AtmGasConst": {"value": 4124.000000, "rtol": 1e-4}, "log.final.el.PresSurf": {"value": -1.000000, "unit": u.Pa, "rtol": 1e-4}, "log.final.el.DEnvMassDt": { "value": -2.614005e09, "unit": u.kg / u.sec, "rtol": 1e-4, }, "log.final.el.FXUV": {"value": 0.073463, "unit": u.W / u.m ** 2, "rtol": 1e-4}, "log.final.el.AtmXAbsEffH2O": {"value": 0.300000, "rtol": 1e-4}, "log.final.el.RocheRadius": {"value": 1.817114e08, "unit": u.m, "rtol": 1e-4}, "log.final.el.BondiRadius": {"value": 7.982897e08, "unit": u.m, "rtol": 1e-4}, "log.final.el.HEscapeRegime": {"value": 3.000000, "rtol": 1e-4}, "log.final.el.RRCriticalFlux": { "value": 0.000139, "unit": u.W / u.m ** 2, "rtol": 1e-4, }, "log.final.el.KTide": {"value": 1.000000, "rtol": 1e-4}, "log.final.el.RGDuration": {"value": 1.00000e06, "unit": u.yr, "rtol": 1e-4}, "log.final.rr.Mass": {"value": 1.999399, "unit": u.Mearth, "rtol": 1e-4}, "log.final.rr.Obliquity": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.rr.PrecA": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.rr.Xobl": {"value": 1.563665e-162, "rtol": 1e-4}, "log.final.rr.Yobl": {"value": 0.000000, "rtol": 1e-4}, "log.final.rr.Zobl": {"value": 1.000000, "rtol": 1e-4}, "log.final.rr.Radius": {"value": 2.095926e08, "unit": u.m, "rtol": 1e-4}, "log.final.rr.RadGyra": {"value": 0.400000, "rtol": 1e-4}, "log.final.rr.RotAngMom": { "value": 5.561691e35, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.rr.RotKinEnergy": { "value": 1.842803e30, "unit": u.Joule, "rtol": 1e-4, }, "log.final.rr.RotVel": { "value": 1388.922578, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.rr.BodyType": {"value": 0.000000, "rtol": 1e-4}, "log.final.rr.RotRate": { "value": 6.626773e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.RotPer": {"value": 10.973977, "unit": u.day, "rtol": 1e-4}, "log.final.rr.Density": { "value": 0.309611, "unit": u.kg / u.m ** 3, "rtol": 1e-4, }, "log.final.rr.SurfEnFluxTotal": { "value": 33.332187, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.rr.TidalQ": {"value": -1.000000e05, "rtol": 1e-4}, "log.final.rr.ImK2": {"value": -5.000000e-06, "rtol": 1e-4}, "log.final.rr.K2": {"value": 0.500000, "rtol": 1e-4}, "log.final.rr.K2Man": {"value": 0.300000, "rtol": 1e-4}, "log.final.rr.Imk2Man": {"value": -0.003000, "rtol": 1e-4}, "log.final.rr.TidalQMantle": {"value": 100.000000, "rtol": 1e-4}, "log.final.rr.HEcc": {"value": 0.000000, "rtol": 1e-4}, "log.final.rr.HZLimitDryRunaway": { "value": 3.043303e09, "unit": u.m, "rtol": 1e-4, }, "log.final.rr.HZLimRecVenus": {"value": 2.502002e09, "unit": u.m, "rtol": 1e-4}, "log.final.rr.HZLimRunaway": {"value": 3.267138e09, "unit": u.m, "rtol": 1e-4}, "log.final.rr.HZLimMoistGreenhouse": { "value": 3.310536e09, "unit": u.m, "rtol": 1e-4, }, "log.final.rr.HZLimMaxGreenhouse": { "value": 5.611497e09, "unit": u.m, "rtol": 1e-4, }, "log.final.rr.HZLimEarlyMars": { "value": 6.122597e09, "unit": u.m, "rtol": 1e-4, }, "log.final.rr.Instellation": { "value": 73.379922, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.rr.KEcc": {"value": 0.068275, "rtol": 1e-4}, "log.final.rr.Eccentricity": {"value": 0.068275, "rtol": 1e-4}, "log.final.rr.OrbEnergy": { "value": -5.480386e34, "unit": u.Joule, "rtol": 1e-4, }, "log.final.rr.MeanMotion": { "value": 6.626773e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.OrbPeriod": {"value": 9.481516e05, "unit": u.sec, "rtol": 1e-4}, "log.final.rr.SemiMajorAxis": {"value": 0.096645, "unit": u.au, "rtol": 1e-4}, "log.final.rr.CriticalSemiMajorAxis": { "value": -1.000000, "unit": u.m, "rtol": 1e-4, }, "log.final.rr.COPP": {"value": 0.000000, "rtol": 1e-4}, "log.final.rr.OrbAngMom": { "value": 1.650154e40, "unit": (u.kg * u.m ** 2) / u.sec, "rtol": 1e-4, }, "log.final.rr.LongP": {"value": 0.000000, "unit": u.rad, "rtol": 1e-4}, "log.final.rr.LXUVTot": { "value": -1.000000, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.rr.TotOrbEnergy": { "value": -1.740032e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.rr.OrbPotEnergy": { "value": -1.096077e35, "unit": u.Joule, "rtol": 1e-4, }, "log.final.rr.LostEnergy": { "value": 2.725921e33, "unit": u.Joule, "rtol": 1e-4, }, "log.final.rr.TidalRadius": {"value": 2.095926e08, "unit": u.m, "rtol": 1e-4}, "log.final.rr.DsemiDtEqtide": { "value": -4.999833e-06, "unit": u.m / u.sec, "rtol": 1e-4, }, "log.final.rr.DeccDtEqtide": { "value": -2.532564e-15, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.DMeanMotionDtEqtide": { "value": 3.437522e-21, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.rr.DOrbPerDtEqtide": {"value": -4.918370e-10, "rtol": 1e-4}, "log.final.rr.EccTimeEqtide": { "value": 2.695885e13, "unit": u.sec, "rtol": 1e-4, }, "log.final.rr.SemiTimeEqtide": { "value": 2.891664e15, "unit": u.sec, "rtol": 1e-4, }, "log.final.rr.DHEccDtEqtide": { "value": -0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.DKEccDtEqtide": { "value": -2.532564e-15, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.DXoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.DYoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.DZoblDtEqtide": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.LockTime": {"value": 1.711407e11, "unit": u.sec, "rtol": 1e-4}, "log.final.rr.BodyDsemiDtEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.rr.BodyDeccDt": {"value": -1.000000, "rtol": 1e-4}, "log.final.rr.DOblDtEqtide": { "value": 0.000000, "unit": u.rad / u.sec, "rtol": 1e-4, }, "log.final.rr.DRotPerDtEqtide": {"value": -7.959031e-298, "rtol": 1e-4}, "log.final.rr.DRotRateDtEqtide": { "value": 5.562685e-309, "unit": 1 / u.sec ** 2, "rtol": 1e-4, }, "log.final.rr.EqRotRateDiscrete": { "value": 6.626773e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.EqRotPerDiscrete": { "value": 9.481516e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.rr.EqRotRateCont": { "value": 6.920233e-06, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.EqRotPerCont": { "value": 9.079442e05, "unit": u.sec, "rtol": 1e-4, }, "log.final.rr.EqRotPer": {"value": 9.481516e05, "unit": u.sec, "rtol": 1e-4}, "log.final.rr.EqTidePower": { "value": 0.000000, "unit": 1 / u.sec, "rtol": 1e-4, }, "log.final.rr.GammaRot": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.rr.GammaOrb": {"value": -1.000000, "unit": u.sec, "rtol": 1e-4}, "log.final.rr.OceanK2": {"value": 0.010000, "rtol": 1e-4}, "log.final.rr.EnvTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.rr.OceanTidalQ": {"value": -1.000000, "rtol": 1e-4}, "log.final.rr.TideLock": {"value": 1.000000, "rtol": 1e-4}, "log.final.rr.RotTimeEqtide": { "value": 1.191290e303, "unit": u.sec, "rtol": 1e-4, }, "log.final.rr.EnvK2": {"value": 0.500000, "rtol": 1e-4}, "log.final.rr.OblTimeEqtide": {"value": -1.000000, "rtol": 1e-4}, "log.final.rr.PowerEqtide": {"value": 1.895236e19, "unit": u.W, "rtol": 1e-4}, "log.final.rr.SurfEnFluxEqtide": { "value": 34.332187, "unit": u.kg / u.sec ** 3, "rtol": 1e-4, }, "log.final.rr.SurfWaterMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.rr.EnvelopeMass": { "value": 0.999399, "unit": u.Mearth, "rtol": 1e-4, }, "log.final.rr.OxygenMass": {"value": 0.000000, "unit": u.kg, "rtol": 1e-4}, "log.final.rr.RGLimit": {"value": 3.127270e09, "unit": u.m, "rtol": 1e-4}, "log.final.rr.XO": {"value": 0.000000, "rtol": 1e-4}, "log.final.rr.EtaO": {"value": 0.000000, "rtol": 1e-4}, "log.final.rr.PlanetRadius": { "value": 32.861293, "unit": u.Rearth, "rtol": 1e-4, }, "log.final.rr.OxygenMantleMass": { "value": 0.000000, "unit": u.kg, "rtol": 1e-4, }, "log.final.rr.RadXUV": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.rr.RadSolid": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.rr.PresXUV": {"value": 5.000000, "rtol": 1e-4}, "log.final.rr.ScaleHeight": {"value": -1.000000, "unit": u.m, "rtol": 1e-4}, "log.final.rr.ThermTemp": {"value": 400.000000, "unit": u.K, "rtol": 1e-4}, "log.final.rr.AtmGasConst": {"value": 4124.000000, "rtol": 1e-4}, "log.final.rr.PresSurf": {"value": -1.000000, "unit": u.Pa, "rtol": 1e-4}, "log.final.rr.DEnvMassDt": { "value": -1.147322e08, "unit": u.kg / u.sec, "rtol": 1e-4, }, "log.final.rr.FXUV": {"value": 0.073380, "unit": u.W / u.m ** 2, "rtol": 1e-4}, "log.final.rr.AtmXAbsEffH2O": {"value": 0.300000, "rtol": 1e-4}, "log.final.rr.RocheRadius": {"value": 1.822097e08, "unit": u.m, "rtol": 1e-4}, "log.final.rr.BondiRadius": {"value": 8.033012e08, "unit": u.m, "rtol": 1e-4}, "log.final.rr.HEscapeRegime": {"value": 6.000000, "rtol": 1e-4}, "log.final.rr.RRCriticalFlux": { "value": 0.000139, "unit": u.W / u.m ** 2, "rtol": 1e-4, }, "log.final.rr.KTide": {"value": 1.000000, "rtol": 1e-4}, "log.final.rr.RGDuration": {"value": 1.00000e06, "unit": u.yr, "rtol": 1e-4}, } )
[ 11748, 6468, 28338, 13, 41667, 355, 334, 198, 11748, 12972, 9288, 198, 6738, 18335, 1330, 25187, 4102, 11, 18335, 628, 198, 31, 26968, 4102, 7, 198, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 23396, 1298, 19779, 8367, 1298, 513, 13, 1314, 3553, 1899, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 7575, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 51, 313, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 48882, 25022, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 51, 313, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 2780, 1731, 3901, 68, 3559, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 25396, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 2780, 1731, 1821, 68, 3559, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 49681, 28925, 1298, 19779, 8367, 1298, 642, 13, 30995, 28977, 68, 2682, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 10057, 13, 42430, 7575, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 20273, 1298, 19779, 8367, 1298, 352, 13, 24, 3459, 35218, 68, 1270, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 55, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 57, 45292, 1298, 19779, 8367, 1298, 352, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 15546, 3754, 1298, 19779, 8367, 1298, 718, 13, 30695, 3064, 68, 3312, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 27790, 32417, 68, 2670, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 24864, 49681, 28925, 1298, 19779, 8367, 1298, 642, 13, 30995, 28977, 68, 2682, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 24864, 46261, 1298, 19779, 8367, 1298, 604, 5066, 13, 23, 26279, 2481, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 24864, 32184, 1298, 19779, 8367, 1298, 767, 13, 1983, 17572, 20, 68, 12, 2713, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 24864, 5990, 1298, 19779, 8367, 1298, 807, 13, 2414, 2388, 68, 3023, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 35, 6377, 1298, 19779, 8367, 1298, 352, 13, 23, 1959, 40427, 68, 2931, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 604, 13, 2857, 2598, 2079, 68, 12, 1065, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 352, 13, 10535, 68, 3312, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 2998, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 48597, 19004, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 19779, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 19779, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 39, 57, 19352, 20457, 43725, 1298, 19779, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 5574, 65, 28925, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 5308, 272, 45740, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 43, 55, 31667, 51, 313, 1298, 19779, 8367, 1298, 352, 13, 24, 1954, 830, 68, 1238, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 51, 313, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 16315, 24693, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 5574, 65, 25396, 28925, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 31042, 28925, 1298, 19779, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 31042, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 25392, 7575, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 362, 13, 2713, 2231, 4051, 68, 12, 1983, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 48555, 27728, 68, 12, 2623, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 80, 24864, 32184, 4264, 1298, 19779, 8367, 1298, 807, 13, 3104, 5332, 2791, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 80, 24864, 5990, 4264, 1298, 19779, 8367, 1298, 767, 13, 1954, 1314, 3980, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 36, 80, 51, 485, 13434, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 24864, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 362, 27800, 13, 2718, 1731, 3365, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 604, 13, 2857, 2598, 2079, 68, 12, 1065, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 43, 7230, 16579, 1298, 19779, 8367, 1298, 352, 13, 24, 1954, 830, 68, 1954, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 43, 55, 31667, 7447, 297, 283, 1298, 19779, 8367, 1298, 352, 13, 24, 1954, 830, 68, 1238, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 42492, 1298, 19779, 8367, 1298, 642, 39761, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 43, 55, 31667, 6732, 330, 1298, 19779, 8367, 1298, 657, 13, 8298, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 38328, 1525, 15057, 1298, 19779, 8367, 1298, 657, 13, 2998, 6469, 1899, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 7364, 13, 7707, 313, 5990, 35, 83, 7447, 297, 283, 1298, 19779, 8367, 1298, 718, 13, 4310, 405, 2682, 68, 12, 1507, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 20273, 1298, 19779, 8367, 1298, 362, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 41172, 31952, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 55, 45292, 1298, 19779, 8367, 1298, 657, 13, 24038, 15982, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 57, 45292, 1298, 19779, 8367, 1298, 657, 13, 24038, 15982, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1828, 1433, 1120, 68, 2718, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 24864, 49681, 28925, 1298, 19779, 8367, 1298, 807, 13, 3459, 1821, 3459, 68, 2624, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 24864, 46261, 1298, 19779, 8367, 1298, 513, 13, 15, 2920, 18458, 68, 3023, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 24864, 32184, 1298, 19779, 8367, 1298, 657, 13, 18005, 2231, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 24864, 5990, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 20850, 1298, 334, 13, 820, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 6377, 1298, 19779, 8367, 1298, 657, 13, 26895, 38652, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 33916, 41544, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 2931, 3459, 1157, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 19779, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 19779, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 39, 57, 19352, 20457, 43725, 1298, 19779, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 8644, 13, 22, 3459, 31128, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 20, 13, 1959, 1795, 6052, 68, 2682, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 5308, 272, 45740, 1298, 19779, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 3064, 830, 11, 366, 20850, 1298, 334, 13, 559, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 34287, 4089, 18, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 43, 55, 31667, 51, 313, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 51, 313, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 16315, 24693, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 5574, 65, 25396, 28925, 1298, 19779, 8367, 1298, 532, 16, 13, 2713, 4846, 1129, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 31042, 28925, 1298, 19779, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 18005, 5892, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 21895, 28256, 68, 12, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 24, 22745, 2791, 68, 12, 2919, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 535, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 3865, 2920, 3388, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 767, 13, 3720, 2682, 1065, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 3510, 18182, 23, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 3510, 18182, 23, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 25392, 7575, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 362, 13, 15, 37601, 2231, 68, 12, 1065, 11, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 513, 13, 27800, 19004, 68, 12, 2998, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 940, 3134, 1828, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 80, 24864, 32184, 4264, 1298, 19779, 8367, 1298, 807, 13, 3104, 5332, 2791, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 80, 24864, 5990, 4264, 1298, 19779, 8367, 1298, 767, 13, 1954, 1314, 3980, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 80, 51, 485, 13434, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 24864, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 33638, 20356, 68, 1157, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 2078, 1821, 3510, 68, 1828, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 18, 23045, 3865, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 4834, 1091, 68, 20273, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 15, 2079, 15363, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 41801, 15546, 3754, 1298, 19779, 8367, 1298, 3933, 13, 23, 3388, 39506, 11, 366, 20850, 1298, 334, 13, 49, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 35, 4834, 85, 20273, 35, 83, 1298, 19779, 8367, 1298, 532, 17, 13, 1120, 5774, 1314, 68, 2931, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 17213, 31667, 1298, 19779, 8367, 1298, 657, 13, 3312, 5607, 3459, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 3459, 2816, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 767, 13, 44093, 38472, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 513, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 49, 7397, 36487, 37, 22564, 1298, 19779, 8367, 1298, 657, 13, 18005, 2670, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 42176, 485, 1298, 19779, 8367, 1298, 352, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 23736, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 20273, 1298, 19779, 8367, 1298, 362, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 41172, 31952, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 55, 45292, 1298, 19779, 8367, 1298, 657, 13, 24038, 15982, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 57, 45292, 1298, 19779, 8367, 1298, 657, 13, 24038, 15982, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1828, 1433, 1120, 68, 2718, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 24864, 49681, 28925, 1298, 19779, 8367, 1298, 807, 13, 3459, 1821, 3459, 68, 2624, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 24864, 46261, 1298, 19779, 8367, 1298, 513, 13, 15, 2920, 18458, 68, 3023, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 24864, 32184, 1298, 19779, 8367, 1298, 657, 13, 18005, 2231, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 24864, 5990, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 20850, 1298, 334, 13, 820, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 6377, 1298, 19779, 8367, 1298, 657, 13, 26895, 38652, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 33916, 41544, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 2931, 3459, 1157, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 19779, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 19779, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 39, 57, 19352, 20457, 43725, 1298, 19779, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 8644, 13, 22, 3459, 31128, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 20, 13, 1959, 1795, 6052, 68, 2682, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 5308, 272, 45740, 1298, 19779, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 3064, 830, 11, 366, 20850, 1298, 334, 13, 559, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 34287, 4089, 18, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 43, 55, 31667, 51, 313, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 51, 313, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 16315, 24693, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 5574, 65, 25396, 28925, 1298, 19779, 8367, 1298, 532, 16, 13, 2713, 4846, 1129, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 31042, 28925, 1298, 19779, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 18005, 5892, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 21895, 28256, 68, 12, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 24, 22745, 2791, 68, 12, 2919, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 535, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 3865, 2920, 3388, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 767, 13, 3720, 2682, 1065, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 3510, 18182, 23, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 3510, 18182, 23, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 25392, 7575, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 15, 37601, 2231, 68, 12, 1065, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 513, 13, 27800, 19004, 68, 12, 2998, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 940, 3134, 1828, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 80, 24864, 32184, 4264, 1298, 19779, 8367, 1298, 807, 13, 3104, 5332, 2791, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 80, 24864, 5990, 4264, 1298, 19779, 8367, 1298, 767, 13, 1954, 1314, 3980, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 80, 51, 485, 13434, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 24864, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 33638, 20356, 68, 1157, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 2078, 1821, 3510, 68, 1828, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 18, 23045, 3865, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 4834, 1091, 68, 20273, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 15, 2079, 15363, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 41801, 15546, 3754, 1298, 19779, 8367, 1298, 3933, 13, 23, 3388, 39506, 11, 366, 20850, 1298, 334, 13, 49, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 35, 4834, 85, 20273, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 19214, 21734, 68, 1314, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 17213, 31667, 1298, 19779, 8367, 1298, 657, 13, 3312, 5607, 3459, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 3459, 2816, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 767, 13, 44093, 38472, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 642, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 49, 7397, 36487, 37, 22564, 1298, 19779, 8367, 1298, 657, 13, 18005, 2670, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 42176, 485, 1298, 19779, 8367, 1298, 352, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 65, 623, 72, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 20273, 1298, 19779, 8367, 1298, 362, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 3901, 486, 4309, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 55, 45292, 1298, 19779, 8367, 1298, 657, 13, 2670, 5774, 2920, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 57, 45292, 1298, 19779, 8367, 1298, 657, 13, 24, 17279, 1899, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 15711, 21626, 68, 2623, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 24864, 49681, 28925, 1298, 19779, 8367, 1298, 362, 13, 1828, 940, 1828, 68, 2624, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 24864, 46261, 1298, 19779, 8367, 1298, 352, 13, 48057, 38907, 68, 3023, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 24864, 32184, 1298, 19779, 8367, 1298, 767, 13, 1983, 17572, 20, 68, 12, 2713, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 24864, 5990, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 20850, 1298, 334, 13, 820, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 6377, 1298, 19779, 8367, 1298, 657, 13, 26895, 38652, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 3064, 43564, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 2931, 3459, 1157, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 19779, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 19779, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 39, 57, 19352, 20457, 43725, 1298, 19779, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 6310, 28828, 1298, 19779, 8367, 1298, 8644, 13, 22, 3459, 31128, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 20, 13, 1959, 1795, 6052, 68, 2682, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 5308, 272, 45740, 1298, 19779, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 3064, 830, 11, 366, 20850, 1298, 334, 13, 559, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 34287, 4089, 18, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 43, 55, 31667, 51, 313, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 51, 313, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 16315, 24693, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 5574, 65, 25396, 28925, 1298, 19779, 8367, 1298, 532, 16, 13, 2713, 4846, 1129, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 31042, 28925, 1298, 19779, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 18005, 5892, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 21895, 28256, 68, 12, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 24, 22745, 2791, 68, 12, 2919, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 535, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 3865, 2920, 3388, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 767, 13, 3720, 2682, 1065, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 362, 13, 1485, 4846, 2624, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 24, 13, 1270, 2091, 5705, 68, 12, 1485, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 25392, 7575, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 362, 13, 20370, 21139, 68, 12, 1065, 11, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 33638, 3459, 16, 68, 12, 3312, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 940, 3134, 1828, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 19779, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 80, 24864, 32184, 4264, 1298, 19779, 8367, 1298, 807, 13, 3104, 5332, 2791, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 80, 24864, 5990, 4264, 1298, 19779, 8367, 1298, 767, 13, 1954, 1314, 3980, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 80, 51, 485, 13434, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 24864, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 718, 13, 20, 31495, 2548, 68, 940, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 718, 13, 33057, 19504, 68, 2481, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 3064, 24, 3070, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 4834, 1091, 68, 20273, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 15, 2079, 15363, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 41801, 15546, 3754, 1298, 19779, 8367, 1298, 3933, 13, 23, 3388, 39506, 11, 366, 20850, 1298, 334, 13, 49, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 35, 4834, 85, 20273, 35, 83, 1298, 19779, 8367, 1298, 532, 17, 13, 1120, 5774, 1314, 68, 2931, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 17213, 31667, 1298, 19779, 8367, 1298, 657, 13, 3312, 5607, 3459, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 3459, 2816, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 767, 13, 44093, 38472, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 513, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 49, 7397, 36487, 37, 22564, 1298, 19779, 8367, 1298, 657, 13, 18005, 2670, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 42176, 485, 1298, 19779, 8367, 1298, 352, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 417, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 20273, 1298, 19779, 8367, 1298, 362, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 41172, 31952, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 55, 45292, 1298, 19779, 8367, 1298, 657, 13, 24038, 15982, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 57, 45292, 1298, 19779, 8367, 1298, 657, 13, 24038, 15982, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1828, 1433, 1120, 68, 2718, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 24864, 49681, 28925, 1298, 19779, 8367, 1298, 807, 13, 3459, 1821, 3459, 68, 2624, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 24864, 46261, 1298, 19779, 8367, 1298, 513, 13, 15, 2920, 18458, 68, 3023, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 24864, 32184, 1298, 19779, 8367, 1298, 657, 13, 18005, 2231, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 24864, 5990, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 20850, 1298, 334, 13, 820, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 6377, 1298, 19779, 8367, 1298, 657, 13, 26895, 38652, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 33916, 41544, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 2931, 3459, 1157, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 19779, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 19779, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 39, 57, 19352, 20457, 43725, 1298, 19779, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 6310, 28828, 1298, 19779, 8367, 1298, 8644, 13, 22, 3459, 31128, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 33470, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 20, 13, 1959, 1795, 6052, 68, 2682, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 5308, 272, 45740, 1298, 19779, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 3064, 830, 11, 366, 20850, 1298, 334, 13, 559, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 34287, 4089, 18, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 43, 55, 31667, 51, 313, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 51, 313, 5574, 65, 28925, 1298, 19779, 8367, 1298, 532, 17, 13, 16315, 24693, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 5574, 65, 25396, 28925, 1298, 19779, 8367, 1298, 532, 16, 13, 2713, 4846, 1129, 68, 2327, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 31042, 28925, 1298, 19779, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 2414, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 18005, 5892, 11, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 21895, 28256, 68, 12, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 24, 22745, 2791, 68, 12, 2919, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 535, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 3865, 2920, 3388, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 767, 13, 3720, 2682, 1065, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 604, 13, 48597, 33394, 68, 12, 1314, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 3510, 18182, 23, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 3510, 18182, 23, 68, 12, 1065, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 25392, 7575, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 362, 13, 15, 37601, 2231, 68, 12, 1065, 11, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 513, 13, 27800, 19004, 68, 12, 2998, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 940, 3134, 1828, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 19779, 8367, 1298, 718, 13, 1959, 1899, 5237, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 80, 24864, 32184, 4264, 1298, 19779, 8367, 1298, 807, 13, 3104, 5332, 2791, 68, 12, 3312, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 80, 24864, 5990, 4264, 1298, 19779, 8367, 1298, 767, 13, 1954, 1314, 3980, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 24, 41544, 2857, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 80, 51, 485, 13434, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 24864, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 33638, 20356, 68, 1157, 11, 366, 20850, 1298, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 2078, 1821, 3510, 68, 1828, 11, 366, 20850, 1298, 334, 13, 54, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 18, 23045, 3865, 68, 3023, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 4834, 1091, 68, 20273, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 15, 2079, 15363, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 41801, 15546, 3754, 1298, 19779, 8367, 1298, 3933, 13, 23, 3388, 39506, 11, 366, 20850, 1298, 334, 13, 49, 16442, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 35, 4834, 85, 20273, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 16315, 21495, 68, 2919, 11, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 17213, 31667, 1298, 19779, 8367, 1298, 657, 13, 3312, 5607, 3459, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 3459, 2816, 3510, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 767, 13, 44093, 38472, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 718, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 49, 7397, 36487, 37, 22564, 1298, 19779, 8367, 1298, 657, 13, 18005, 2670, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 42176, 485, 1298, 19779, 8367, 1298, 352, 13, 10535, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 36733, 13, 21062, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 23396, 1298, 19779, 8367, 1298, 718, 13, 18, 15363, 1238, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 7575, 1298, 19779, 8367, 1298, 513, 13, 1314, 3553, 1899, 68, 1485, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 51, 313, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 32114, 27019, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 51, 313, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 2780, 1731, 3901, 68, 3559, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 25396, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 2780, 1731, 1821, 68, 3559, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 49681, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 30995, 28977, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 10057, 13, 42430, 7575, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 604, 13, 4521, 18, 22995, 68, 2919, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 20273, 1298, 19779, 8367, 1298, 352, 13, 24, 3459, 35218, 68, 1270, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 55, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 57, 45292, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 15546, 3754, 1298, 19779, 8367, 1298, 718, 13, 30695, 3064, 68, 3312, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 27790, 32417, 68, 2670, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 24864, 49681, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 30995, 28977, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 24864, 46261, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 604, 5066, 13, 23, 26279, 1238, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 24864, 32184, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 1983, 17572, 20, 68, 12, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 24864, 5990, 1298, 19779, 8367, 1298, 807, 13, 2414, 2388, 68, 3023, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 35, 6377, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 23, 1959, 40427, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 15, 28676, 2414, 68, 12, 1065, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 352, 13, 10535, 68, 3312, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 2998, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 48597, 19004, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 39, 57, 19352, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 39, 57, 19352, 20457, 43725, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 5574, 65, 28925, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 5308, 272, 45740, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 43, 55, 31667, 51, 313, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 24, 1954, 830, 68, 1238, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 51, 313, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4524, 405, 2624, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 5574, 65, 25396, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 31042, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 22730, 22, 2920, 68, 2075, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 31042, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 1120, 2425, 2624, 68, 1270, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 25392, 7575, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 2548, 486, 3695, 68, 12, 1983, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 1433, 1433, 5999, 68, 12, 2623, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 20, 15982, 940, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 17544, 49561, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 80, 24864, 32184, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 2816, 2598, 1983, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 80, 24864, 5990, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 807, 13, 34125, 23148, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 17544, 49561, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 36, 80, 51, 485, 13434, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 24864, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 15, 31714, 1899, 68, 12, 2718, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 1315, 3510, 13, 3324, 2791, 5333, 11, 366, 20850, 1298, 334, 13, 54, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 15, 28676, 2414, 68, 12, 1065, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 43, 7230, 16579, 1298, 19779, 8367, 1298, 352, 13, 24, 1954, 830, 68, 1954, 11, 366, 20850, 1298, 334, 13, 54, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 43, 55, 31667, 7447, 297, 283, 1298, 19779, 8367, 1298, 352, 13, 24, 1954, 830, 68, 1238, 11, 366, 20850, 1298, 334, 13, 54, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 42492, 1298, 19779, 8367, 1298, 642, 39761, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 43, 55, 31667, 6732, 330, 1298, 19779, 8367, 1298, 657, 13, 8298, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 38328, 1525, 15057, 1298, 19779, 8367, 1298, 657, 13, 2998, 6469, 1899, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 7364, 13, 7707, 313, 5990, 35, 83, 7447, 297, 283, 1298, 19779, 8367, 1298, 718, 13, 4310, 405, 2682, 68, 12, 1507, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 20273, 1298, 19779, 8367, 1298, 352, 13, 42224, 30743, 11, 366, 20850, 1298, 334, 13, 44, 16442, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 55, 45292, 1298, 19779, 8367, 1298, 352, 13, 39254, 38339, 68, 12, 25061, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 57, 45292, 1298, 19779, 8367, 1298, 352, 13, 20483, 17, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 30005, 25870, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 2091, 2623, 5774, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 24864, 49681, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 3270, 3388, 1795, 68, 1959, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 24864, 46261, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 838, 5333, 13, 19, 26276, 3553, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 24864, 32184, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 20, 15982, 940, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 24864, 5990, 1298, 19779, 8367, 1298, 1367, 13, 22172, 31916, 11, 366, 20850, 1298, 334, 13, 820, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 6377, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 44578, 26598, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 6740, 13, 4051, 1495, 5774, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 3312, 17, 18294, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 39, 57, 19352, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 39, 57, 19352, 20457, 43725, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 7724, 13, 15363, 27877, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 1065, 2079, 2999, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 1065, 2079, 2999, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 18, 13, 23, 1954, 28676, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 5308, 272, 45740, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 20, 15982, 940, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 17544, 49561, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 2931, 3324, 3829, 11, 366, 20850, 1298, 334, 13, 559, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1433, 2231, 405, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 43, 55, 31667, 51, 313, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 51, 313, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4524, 405, 2624, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 5574, 65, 25396, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 22, 13, 2414, 2996, 1415, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 31042, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 2075, 2231, 2075, 68, 2091, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 30005, 25870, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 21, 13, 5705, 1495, 4310, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 7410, 31496, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 604, 13, 20, 37601, 1731, 68, 12, 2481, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 21, 13, 22, 32583, 2624, 68, 12, 940, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 535, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 17, 21526, 1828, 68, 1485, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 1485, 3720, 2791, 68, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 15, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 7410, 31496, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 25392, 7575, 1298, 19779, 8367, 1298, 362, 13, 31952, 18444, 68, 1157, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 23, 13, 1731, 4310, 1828, 68, 12, 27728, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 20, 15982, 940, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 17544, 49561, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 80, 24864, 32184, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 2816, 2598, 1983, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 80, 24864, 5990, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 807, 13, 34125, 23148, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 17544, 49561, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 80, 51, 485, 13434, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 24864, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1558, 3023, 2075, 68, 22572, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 22, 3459, 26276, 68, 1129, 11, 366, 20850, 1298, 334, 13, 54, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 7192, 13, 4051, 1495, 5774, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 4834, 1091, 68, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 42224, 30743, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 44, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 1415, 25475, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 41801, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 1679, 13, 20, 32417, 2414, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 49, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 35, 4834, 85, 20273, 35, 83, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 22, 13, 1795, 1495, 3829, 68, 2998, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 17213, 31667, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 2998, 17, 15363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 2414, 1314, 4846, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 642, 13, 21, 2718, 19708, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 718, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 49, 7397, 36487, 37, 22564, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 27790, 21, 2414, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 42176, 485, 1298, 19779, 8367, 1298, 657, 13, 3064, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 23736, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 20273, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 20850, 1298, 334, 13, 44, 16442, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 46, 2436, 1557, 414, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 41561, 13348, 68, 12, 4051, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 55, 45292, 1298, 19779, 8367, 1298, 362, 13, 41561, 13348, 68, 12, 4051, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 57, 45292, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 15546, 3754, 1298, 19779, 8367, 1298, 718, 13, 30695, 3064, 68, 3312, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 34825, 25674, 68, 2624, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 24864, 49681, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 2154, 2623, 4051, 68, 2075, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 24864, 46261, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 2319, 13, 1314, 2857, 2624, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 24864, 32184, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1959, 3553, 1238, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 24864, 5990, 1298, 19779, 8367, 1298, 1367, 13, 2816, 940, 1270, 11, 366, 20850, 1298, 334, 13, 820, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 6377, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 33781, 13, 15, 27203, 2920, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 23, 31046, 2075, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 3064, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 2931, 3459, 1314, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 39, 57, 19352, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 39, 57, 19352, 20457, 43725, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 8644, 13, 3695, 2327, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 2167, 25816, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 2167, 25816, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 34287, 49649, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 5308, 272, 45740, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1959, 3553, 1238, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 5574, 65, 5990, 2101, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 4089, 405, 3829, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 13900, 72, 24206, 31554, 271, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 49388, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 559, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 807, 13, 1731, 1120, 5333, 68, 2670, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 43, 55, 31667, 51, 313, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 51, 313, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4524, 405, 2624, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 5574, 65, 25396, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 20, 13, 1959, 3720, 3312, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 31042, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 15, 23815, 3365, 68, 3132, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 51, 11624, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 30695, 3064, 68, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 16616, 18376, 68, 12, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4521, 405, 5237, 68, 12, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 45987, 40256, 68, 12, 1495, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 1157, 2548, 4309, 68, 12, 1485, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 535, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 46396, 26276, 68, 1507, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 2682, 28771, 21, 68, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 15, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4521, 405, 5237, 68, 12, 1129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 2623, 3388, 2919, 68, 12, 2996, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 604, 13, 2919, 2079, 2624, 68, 12, 16315, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 25392, 7575, 1298, 19779, 8367, 1298, 604, 13, 24, 1129, 12952, 68, 1065, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 2623, 3388, 2919, 68, 12, 2996, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 23, 13, 23, 1507, 3312, 24, 68, 12, 27728, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1959, 3553, 1238, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 4089, 405, 3829, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 80, 24864, 32184, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 807, 13, 34427, 28592, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 80, 24864, 5990, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 767, 13, 1954, 1507, 1433, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 4089, 405, 3829, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 80, 51, 485, 13434, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 24864, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1485, 1558, 3324, 68, 22572, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 13434, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 43587, 49234, 68, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 23, 31046, 2075, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 14214, 69, 19184, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 4834, 1091, 68, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 44, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 1415, 3695, 2414, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 41801, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 49, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 35, 4834, 85, 20273, 35, 83, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 17213, 31667, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 3312, 32196, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 49, 30848, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 2920, 2791, 1157, 68, 2919, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 33, 623, 72, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 48581, 36879, 68, 2919, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 807, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 49, 7397, 36487, 37, 22564, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 33057, 30505, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 42176, 485, 1298, 19779, 8367, 1298, 657, 13, 24, 2623, 16616, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 65, 623, 72, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 20273, 1298, 19779, 8367, 1298, 352, 13, 4089, 5066, 2154, 11, 366, 20850, 1298, 334, 13, 44, 16442, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 55, 45292, 1298, 19779, 8367, 1298, 352, 13, 3980, 15277, 24, 68, 12, 25061, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 57, 45292, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2919, 2231, 4761, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 27790, 20370, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 24864, 49681, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 23, 1415, 2713, 19, 68, 1270, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 24864, 46261, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 1511, 6469, 13, 2816, 1795, 2079, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 24864, 32184, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 5066, 1954, 2327, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 24864, 5990, 1298, 19779, 8367, 1298, 838, 13, 24, 2414, 46871, 11, 366, 20850, 1298, 334, 13, 820, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 6377, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 27970, 33981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 4747, 13, 2931, 3459, 2920, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 3023, 2091, 3901, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 39, 57, 19352, 20457, 43725, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 8854, 13, 3510, 1959, 3695, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 15, 3104, 29228, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 15, 3104, 29228, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 20, 13, 2598, 3324, 1238, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 5308, 272, 45740, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 5066, 1954, 2327, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 2857, 2327, 2414, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 2931, 2996, 6420, 11, 366, 20850, 1298, 334, 13, 559, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 21, 29769, 1828, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 43, 55, 31667, 51, 313, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 51, 313, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4524, 405, 2624, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 5574, 65, 25396, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 2919, 3865, 2598, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 31042, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 2919, 3270, 1731, 68, 2091, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2919, 2231, 4761, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 19, 13, 24, 2548, 46660, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 2920, 2414, 6052, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 7029, 36720, 68, 12, 2481, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 19, 13, 5332, 2154, 3365, 68, 12, 940, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 535, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 4524, 1238, 3134, 68, 1485, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 24, 28676, 940, 68, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 15, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 2920, 2414, 6052, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 25392, 7575, 1298, 19779, 8367, 1298, 807, 13, 1129, 2327, 4051, 68, 940, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 22, 13, 24, 2231, 35978, 68, 12, 27728, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 5066, 1954, 2327, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 2857, 2327, 2414, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 80, 24864, 32184, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 24, 1983, 43239, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 80, 24864, 5990, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 3312, 24, 3720, 16, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 2857, 2327, 2414, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 80, 51, 485, 13434, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 24864, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1129, 1828, 3829, 68, 22572, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 4521, 5304, 68, 1129, 11, 366, 20850, 1298, 334, 13, 54, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 4974, 13, 2931, 3459, 2920, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 4834, 1091, 68, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 4089, 5066, 2154, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 44, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 16799, 32869, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 41801, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 3933, 13, 47521, 27988, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 49, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 35, 4834, 85, 20273, 35, 83, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 46841, 22544, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 17213, 31667, 1298, 19779, 8367, 1298, 657, 13, 2998, 2682, 5066, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 23, 1558, 16562, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 767, 13, 4089, 2078, 5607, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 513, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 49, 7397, 36487, 37, 22564, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 18005, 2670, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 42176, 485, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 417, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 20273, 1298, 19779, 8367, 1298, 352, 13, 2079, 6052, 2079, 11, 366, 20850, 1298, 334, 13, 44, 16442, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 46, 2436, 1557, 414, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 6719, 66, 32, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 55, 45292, 1298, 19779, 8367, 1298, 352, 13, 3980, 2623, 2996, 68, 12, 25061, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 56, 45292, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 57, 45292, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 3270, 2075, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 15546, 44802, 430, 1298, 19779, 8367, 1298, 657, 13, 7029, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 24864, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 1433, 6420, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 24864, 49681, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 23, 3682, 43564, 68, 1270, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 24864, 46261, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 1511, 3459, 13, 5892, 1495, 3695, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 25842, 6030, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 24864, 32184, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 45191, 46871, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 24864, 5990, 1298, 19779, 8367, 1298, 838, 13, 5607, 2670, 3324, 11, 366, 20850, 1298, 334, 13, 820, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 6377, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 1270, 4846, 1157, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 76, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 14214, 69, 4834, 37, 22564, 14957, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 4747, 13, 32148, 23451, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 68, 2713, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 3546, 42, 17, 1298, 19779, 8367, 1298, 532, 20, 13, 10535, 68, 12, 3312, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 42, 17, 5124, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 3546, 74, 17, 5124, 1298, 19779, 8367, 1298, 532, 15, 13, 11245, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 51, 11624, 48, 44, 16941, 1298, 19779, 8367, 1298, 1802, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 13909, 535, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 39, 57, 39184, 35, 563, 10987, 8272, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 48768, 22572, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 39, 57, 19352, 6690, 37522, 385, 1298, 19779, 8367, 1298, 362, 13, 1120, 16942, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 39, 57, 19352, 10987, 8272, 1298, 19779, 8367, 1298, 513, 13, 25674, 20107, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 39, 57, 19352, 16632, 396, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 18, 13348, 2623, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 39, 57, 19352, 11518, 13719, 4803, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 21, 1157, 38073, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 39, 57, 19352, 20457, 43725, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 1065, 1495, 5607, 68, 2931, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 6310, 28828, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 8854, 13, 2718, 2079, 1828, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 7336, 535, 1298, 19779, 8367, 1298, 657, 13, 15, 3104, 23195, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 535, 22317, 414, 1298, 19779, 8367, 1298, 657, 13, 15, 3104, 23195, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 20, 13, 22148, 21734, 68, 2682, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 5308, 272, 45740, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 45191, 46871, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 5574, 65, 5990, 2101, 1298, 19779, 8367, 1298, 860, 13, 2780, 1314, 1433, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 13900, 72, 24206, 31554, 271, 1298, 19779, 8367, 1298, 657, 13, 2931, 2791, 2231, 11, 366, 20850, 1298, 334, 13, 559, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 41000, 13900, 72, 24206, 31554, 271, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 34, 3185, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 5574, 65, 13450, 29252, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 2996, 486, 4051, 68, 1821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 357, 84, 13, 10025, 1635, 334, 13, 76, 12429, 362, 8, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 14617, 47, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 6335, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 43, 55, 31667, 51, 313, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 51, 313, 5574, 65, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 4524, 405, 2624, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 5574, 65, 25396, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 2931, 1899, 3324, 68, 2327, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 31042, 28925, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 22, 25191, 2481, 68, 2091, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 41, 280, 293, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 51, 11624, 15546, 3754, 1298, 19779, 8367, 1298, 362, 13, 2931, 3270, 2075, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 19, 13, 2079, 4089, 2091, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 76, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 5005, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 4310, 1495, 2414, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 5308, 272, 45740, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 513, 13, 3559, 2425, 1828, 68, 12, 2481, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 5574, 65, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 19, 13, 24, 1507, 20167, 68, 12, 940, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 535, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 3388, 3365, 5332, 68, 1485, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 13900, 72, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 362, 13, 4531, 1433, 2414, 68, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 13909, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 15, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 7336, 535, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 17, 13, 4310, 1495, 2414, 68, 12, 1314, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36227, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 56, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 57, 45292, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 25392, 7575, 1298, 19779, 8367, 1298, 352, 13, 22, 1157, 30120, 68, 1157, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 25842, 35, 325, 11632, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 25842, 5005, 535, 35, 83, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 18227, 2436, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 6335, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 7707, 313, 5990, 35, 83, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 22, 13, 24, 3270, 43637, 68, 12, 27728, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 7707, 313, 32184, 35, 83, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 642, 13, 3980, 2075, 5332, 68, 12, 26895, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 80, 24864, 32184, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 45191, 46871, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 80, 24864, 5990, 15642, 8374, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 2780, 1314, 1433, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 80, 24864, 32184, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 718, 13, 37128, 25429, 68, 12, 3312, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 80, 24864, 5990, 4264, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 860, 13, 2998, 24, 39506, 68, 2713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 80, 24864, 5990, 1298, 19779, 8367, 1298, 860, 13, 2780, 1314, 1433, 68, 2713, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 80, 51, 485, 13434, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 352, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 34777, 2611, 24864, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 34777, 2611, 5574, 65, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 2363, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 46607, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 486, 2388, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 4834, 85, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 46607, 51, 11624, 48, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 51, 485, 25392, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 24864, 7575, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 352, 13, 1129, 1065, 3829, 68, 22572, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 4834, 85, 42, 17, 1298, 19779, 8367, 1298, 657, 13, 4059, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 46, 2436, 7575, 36, 39568, 485, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 13434, 36, 39568, 485, 1298, 19779, 8367, 1298, 352, 13, 23, 3865, 24940, 68, 1129, 11, 366, 20850, 1298, 334, 13, 54, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 14214, 69, 4834, 37, 22564, 36, 39568, 485, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 4974, 13, 32148, 23451, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 12429, 513, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 14214, 69, 19184, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 4834, 1091, 68, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 2079, 6052, 2079, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 44, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 46, 5431, 5235, 20273, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 20850, 1298, 334, 13, 10025, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 49, 8763, 320, 270, 1298, 19779, 8367, 1298, 513, 13, 16799, 20233, 68, 2931, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 55, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 36, 8326, 46, 1298, 19779, 8367, 1298, 657, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 41801, 15546, 3754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 3933, 13, 4521, 1065, 6052, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 49, 16442, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 46, 5431, 5235, 44, 16941, 20273, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 10535, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 15546, 55, 31667, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 15546, 46933, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 25460, 55, 31667, 1298, 19779, 8367, 1298, 642, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 29990, 23106, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35048, 76, 30782, 1298, 19779, 8367, 1298, 7337, 13, 10535, 11, 366, 20850, 1298, 334, 13, 42, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 2953, 76, 39699, 34184, 1298, 19779, 8367, 1298, 604, 17464, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 25460, 14214, 69, 1298, 19779, 8367, 1298, 532, 16, 13, 10535, 11, 366, 20850, 1298, 334, 13, 28875, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 35, 4834, 85, 20273, 35, 83, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 532, 16, 13, 1415, 4790, 1828, 68, 2919, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 10025, 1220, 334, 13, 2363, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 17213, 31667, 1298, 19779, 8367, 1298, 657, 13, 2998, 2091, 1795, 11, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 2953, 76, 55, 24849, 36, 487, 39, 17, 46, 1298, 19779, 8367, 1298, 657, 13, 6200, 830, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 49, 30848, 15546, 3754, 1298, 19779, 8367, 1298, 352, 13, 6469, 1238, 5607, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 33, 623, 72, 15546, 3754, 1298, 19779, 8367, 1298, 807, 13, 44427, 30206, 68, 2919, 11, 366, 20850, 1298, 334, 13, 76, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 13909, 6794, 8081, 524, 1298, 19779, 8367, 1298, 718, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 49, 7397, 36487, 37, 22564, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1298, 657, 13, 18005, 2670, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1298, 334, 13, 54, 1220, 334, 13, 76, 12429, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17034, 349, 1298, 352, 68, 12, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 42176, 485, 1298, 19779, 8367, 1298, 352, 13, 10535, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 366, 6404, 13, 20311, 13, 21062, 13, 48192, 26054, 1298, 19779, 8367, 1298, 352, 13, 20483, 68, 3312, 11, 366, 20850, 1298, 334, 13, 2417, 11, 366, 17034, 349, 1298, 352, 68, 12, 19, 5512, 198, 220, 220, 220, 1782, 198, 8, 198 ]
1.754299
51,404
#!/usr/bin/python # Copyright (c) 2013, 2014-2017 Oracle and/or its affiliates. All rights reserved. """Provide Module Description """ # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~# __author__ = "Andrew Hopkinson (Oracle Cloud Solutions A-Team)" __copyright__ = "Copyright (c) 2013, 2014-2017 Oracle and/or its affiliates. All rights reserved." __ekitversion__ = "@VERSION@" __ekitrelease__ = "@RELEASE@" __version__ = "1.0.0.0" __date__ = "@BUILDDATE@" __status__ = "Development" __module__ = "upload_storage_object" # ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~# import datetime import getopt import hashlib import json import locale import logging import multiprocessing import operator import os import requests import shutil import subprocess import sys import tempfile from contextlib import closing # Import utility methods from oscsutils import callRESTApi from oscsutils import getPassword from oscsutils import printJSON from authenticate_oscs import authenticate from oc_exceptions import REST401Exception # Define methods # Read Module Arguments # Main processing function # Main function to kick off processing if __name__ == "__main__": main(sys.argv[1:])
[ 2, 48443, 14629, 14, 8800, 14, 29412, 198, 2, 15069, 357, 66, 8, 2211, 11, 1946, 12, 5539, 18650, 290, 14, 273, 663, 29116, 13, 1439, 2489, 10395, 13, 628, 198, 37811, 15946, 485, 19937, 12489, 198, 37811, 198, 198, 2, 220, 27156, 27156, 27156, 27156, 27156, 8728, 4907, 2, 198, 834, 9800, 834, 796, 366, 20508, 21183, 261, 357, 48625, 10130, 23555, 317, 12, 15592, 16725, 198, 834, 22163, 4766, 834, 796, 366, 15269, 357, 66, 8, 2211, 11, 1946, 12, 5539, 18650, 290, 14, 273, 663, 29116, 13, 1439, 2489, 10395, 526, 198, 834, 988, 270, 9641, 834, 796, 44212, 43717, 31, 1, 198, 834, 988, 270, 20979, 834, 796, 44212, 2200, 22781, 31, 1, 198, 834, 9641, 834, 796, 366, 16, 13, 15, 13, 15, 13, 15, 1, 198, 834, 4475, 834, 796, 44212, 19499, 4146, 16458, 6158, 31, 1, 198, 834, 13376, 834, 796, 366, 41206, 1, 198, 834, 21412, 834, 796, 366, 25850, 62, 35350, 62, 15252, 1, 198, 2, 220, 27156, 27156, 27156, 27156, 27156, 8728, 4907, 2, 628, 198, 11748, 4818, 8079, 198, 11748, 651, 8738, 198, 11748, 12234, 8019, 198, 11748, 33918, 198, 11748, 36693, 198, 11748, 18931, 198, 11748, 18540, 305, 919, 278, 198, 11748, 10088, 198, 11748, 28686, 198, 11748, 7007, 198, 11748, 4423, 346, 198, 11748, 850, 14681, 198, 11748, 25064, 198, 11748, 20218, 7753, 198, 6738, 4732, 8019, 1330, 9605, 198, 198, 2, 17267, 10361, 5050, 628, 198, 6738, 267, 1416, 82, 26791, 1330, 869, 19535, 5603, 14415, 198, 6738, 267, 1416, 82, 26791, 1330, 651, 35215, 198, 6738, 267, 1416, 82, 26791, 1330, 3601, 40386, 198, 6738, 8323, 5344, 62, 418, 6359, 1330, 8323, 5344, 198, 6738, 267, 66, 62, 1069, 11755, 1330, 30617, 21844, 16922, 198, 198, 2, 2896, 500, 5050, 628, 628, 628, 198, 198, 2, 4149, 19937, 20559, 2886, 628, 198, 2, 8774, 7587, 2163, 628, 198, 2, 8774, 2163, 284, 4829, 572, 7587, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 220, 1388, 7, 17597, 13, 853, 85, 58, 16, 25, 12962, 198 ]
3.699422
346
''' Module for SNooPy to download/parse data from the Open Supernova Catalog. ''' from __future__ import print_function import six import json if six.PY3: import urllib.request as urllib else: import urllib from astropy.coordinates import Angle from snpy import sn,lc,fset from numpy import array,log10 import astropy.units as u from snpy.filters import spectrum from snpy.specobj import timespec # Some well-known publications and their mappings: pubs = { '1999AJ....117..707R': # Riess et al. (1999) Standard Photometry CfAbands, '2006AJ....131..527J': # Jha et al. (2006) Standard Photometry CfAbands, '2009ApJ...700..331H': # Hicken et al. (2009) CfA3 Natural Photometry CfAbands, '2012ApJS..200...12H': # Hicken et al. (2012) CfA4 Natural Photometry CfAbands } # telescope,band --> SNooPy filter database # We do this by matching (band,system,telescope,observatory) info from the # database to SNooPy filters. ftrans = {} ftrans_standard = {} standard_warnings = {} for band in ['u','g','r','i','B','V','Y','J','H','K']: ftrans[(band,"CSP",'',"LCO")] = band for band in ['U','B','V','R','I']: ftrans[(band,'','kait2','')] = band+'kait' for band in ['U','B','V','R','I']: ftrans[(band,'','kait3','')] = band+'kait' for band in ['J','H','Ks']: ftrans[(band,'','PAIRITEL','')] = band+'2m' for band in ['B','V','R','I']: ftrans[(band,'','kait4', '')] = band+'kait' for band in ['U','V','B']: ftrans[(band, 'Vega','Swift','')] = band+"_UVOT" for band in ['UVW1','UVW2','UVM2']: ftrans[(band, 'Vega','Swift','')] = band for band in ['g','r','i','z']: ftrans[(band, '', 'PS1','')] = "ps1_"+band # These are for data in (what I'm assuming) would be standard filters. # We will issue a warning, though. for band in ['U','B','V','R','I']: ftrans_standard[(band,'','','')] = band+"s" standard_warnings[band] = "Johnson/Kron/Cousins " for band in ['u','g','r','i','z']: ftrans_standard[(band,'','','')] = band+"_40" standard_warnings[band] = "Sloan (APO) " for band in ["u'","g'","r'","i'","z'"]: ftrans_standard[(band,'','','')] = band[0]+"_40" standard_warnings[band] = "Sloan (USNO-40) " for band in ["J","H","Ks"]: ftrans_standard[(band[0],'','','')] = band+"2m" standard_warnings[band[0]] = "2MASS " # Our own photometric systems: def CSP_systems(filt, MJD): '''Given a filter name and MJD date, output the correct telescope and system information.''' if filt == "V": if MJD < 53748.0: return (dict(telescope='Swope',instrument='Site2',band='V-3014', zeropoint="{:.4f}".format(fset['V0'].zp))) elif MJD < 53759.0: return (dict(telescope='Swope',instrument='Site2',band='V-3009', zeropoint="{:.4f}".format(fset['V1'].zp))) elif MJD < 56566.0: return (dict(telescope='Swope',instrument='Site2',band='V-9844', zeropoint="{:.4f}".format(fset['V'].zp))) else: return (dict(telescope='Swope',instrument='e2v',band='V-9844', zeropoint="{:.4f}".format(fset['V2'].zp))) if filt == "Jrc2": return (dict(telescope='Swope',instrument='RetroCam',band='J', zeropoint="{:.4f}".format(fset[filt].zp))) if filt in ['u','g','r','i','B']: if MJD < 56566.0: return (dict(telescope='Swope',instrument='Site2',band=filt, zeropoint="{:.4f}".format(fset[filt].zp))) else: return (dict(telescope='Swope',instrument='e2v',band=filt, zeropoint="{:.4f}".format(fset[filt+'2'].zp))) if filt in ['Y','J','H']: if MJD < 55743.0: return (dict(telescope='Swope',instrument='RetroCam',band=filt, zeropoint="{:.4f}".format(fset[filt].zp))) else: return (dict(telescope='DuPont',instrument='RetroCam',band=filt, zeropoint="{:.4f}".format(fset[filt+'d'].zp))) return({}) MJD_offsets = { 'MJD':0, 'JD':-2400000.5 } warning_message = { 'upperlims_noerr':'Warning: Data lacking errorbars or with upper-limits not imported', 'upperlims':'Warning: Data with upper-limits not imported', } OSC_template = '''https://sne.space/astrocats/astrocats/supernovae/output/json/{}.json''' def get_obj(url, full_data=True, allow_no_errors=False, missing_error=0.01): '''Attempt to build a SNooPy object from a Open Supernova Catalog server URL.''' if url.find('osc:') == 0: # Try to construct a url based only on a name. url = OSC_template.format(url.split(':')[1]) try: uf = urllib.urlopen(url) except: return None,"Invalid URL" try: d = json.load(uf) except: uf.close() if full_data: return None,"Failed to decode JSON",None return None,"Failed to decode JSON" else: uf.close() # We now have the JSON data. Get the info we need d = list(d.values())[0] name = d['name'] if 'redshift' not in d or 'ra' not in d or 'dec' not in d: return None,"No redshift, RA, or DEC found" zhel = float(d['redshift'][0]['value']) ra = Angle(" ".join([d['ra'][0]['value'],d['ra'][0]['u_value']])).degree decl = Angle(" ".join([d['dec'][0]['value'],d['dec'][0]['u_value']])).degree snobj = sn(name, ra=ra, dec=decl, z=zhel) # All primary sources all_sources_dict = [item for item in d['sources'] \ if not item.get('secondary',False)] all_sources_dict2 = [item for item in d['sources'] \ if item.get('secondary',False)] all_sources = {} for source in all_sources_dict: all_sources[source['alias']] = (source.get('bibcode',''), source.get('reference','')) all_sources2 = {} for source in all_sources_dict2: all_sources2[source['alias']] = (source.get('bibcode',''), source.get('reference','')) # Next, the photometry. used_sources = [] MJD = {} mags = {} emags = {} sids = {} known_unknowns = [] unknown_unknowns = [] warnings = [] photometry = d.get('photometry', []) for p in photometry: if p.get('upperlimit',False): continue t = (p.get('band',''),p.get('system',''),p.get('telescope',''), p.get('observatory','')) # Deal with source of photometry ss = p.get('source').split(',') this_source = None for s in ss: if s in all_sources: this_source = all_sources[s] break if this_source is None: for s in ss: if s in all_sources2: this_source = all_sources2[s] if this_source is None: print("Warning: no primary source, skipping") continue bibcode = this_source[0] if bibcode in pubs: b = pubs[bibcode](t[0],float(p['time'])) elif t in ftrans: b = ftrans[t] elif t in ftrans_standard: b = ftrans_standard[t] if t not in known_unknowns: known_unknowns.append(t) print("Warning: no telescope/system info, assuming ", \ standard_warnings[b[0]], b[0]) elif (t[0],"","","") in ftrans_standard: b = ftrans_standard[(t[0],"","","")] if t not in known_unknowns: known_unknowns.append(t) print("Warning: telescope/system defined by %s/%s/%s not "\ "recognized, assuming %s %s" %\ (t[1],t[2],t[3],standard_warnings[t[0]],t[0])) else: # No idea if t not in unknown_unknowns: unknown_unknowns.append(t) print("Warning: telescope/system defined by %s/%s/%s not "\ "recognized and can't figure out the filter %s" % \ (t[1],t[2],t[3],t[0])) unknown_unknowns.append(t) continue if b not in MJD: MJD[b] = [] mags[b] = [] emags[b] = [] sids[b] = [] if 'time' in p and 'magnitude' in p: if not allow_no_errors and 'e_magnitude' not in p and\ 'e_lower_magnitude' not in p and 'e_upper_magnitude' not in p: if 'upperlims' not in warnings: warnings.append('upperlims') continue MJD[b].append(float(p['time'])) mags[b].append(float(p['magnitude'])) if 'e_magnitude' in p: emags[b].append(float(p['e_magnitude'])) elif 'e_lower_magnitude' in p and 'e_upper_magnitude' in p: emags[b].append((float(p['e_lower_magnitude']) +\ float(p['e_upper_magnitude']))/2) else: emags[b].append(missing_error) elif 'time' in p and 'countrate' in p and 'zeropoint' in p: if not allow_no_errors and 'e_countrate' not in p: if 'upperlims' not in warnings: warnings.append('upperlims') continue if float(p['countrate']) < 0: continue MJD[b].append(float(p['time'])) mags[b].append(-2.5*log10(float(p['countrate'])) + \ float(p['zeropoint'])) ec = p.get('e_countrate',None) if ec is not None: emags[b].append(1.087*float(p['e_countrate'])/float(p['countrate'])) else: emags[b].append(missing_error) else: if 'upperlims_noerr' not in warnings: warnings.append('upperlims_noerr') continue if this_source not in used_sources: used_sources.append(this_source) # At this point we're actually using the photometry, so find source sid = used_sources.index(this_source) sids[b].append(sid) for b in MJD: if len(MJD[b]) > 0: snobj.data[b] = lc(snobj, b, array(MJD[b]), array(mags[b]), array(emags[b]), sids=array(sids[b], dtype=int)) snobj.data[b].time_sort() snobj.sources = used_sources snobj.get_restbands() if len(unknown_unknowns) > 0: unknown_unknowns = list(set(unknown_unknowns)) print("Warning: the following photometry was not recognized by SNooPy") print("and was not imported:") for item in unknown_unknowns: print(item) if warnings: for warning in warnings: print(warning_message[warning]) # lastly, the spectroscopy if d.get('spectra',None) is not None: spectra = [] dates = [] sids = [] for s in d['spectra']: wu = s.get('u_wavelengths', 'Agnstrom') fu = s.get('u_fluxes', 'Uncalibrated') try: wu = u.Unit(wu) except ValueError: print("Warning: unrecognized unit for wavelength: {}".format(wu)) print(" assuming Angstroms") wu = u.Angstrom if fu == 'Uncalibrated': fluxed = False fu = u.dimensionless_unscaled else: try: fu = u.Unit(fu) fluxed = True except ValueError: print("Warning: unrecognized unit for flux: {}".format(fu)) fluxed = False fu = u.dimensionless_unscaled tu = s.get('u_time', 'MJD') t = float(s['time']) if tu not in MJD_offsets: print("Warning: unrecognized time unit: {}".format(tu)) if len(s['time'].split('.')[0]) == 7 and s['time'][0] == '2': print(" assuming JD") t = t - 2400000.5 elif len(s['time'].split('.')[0]) == 5 and s['time'][0] == '5': print(" assuming MJD") else: print(" skipping this spectrum.") continue w = array([float(item[0]) for item in s['data']])*wu f = array([float(item[1]) for item in s['data']])*fu dr = s.get('deredshifted', False) if dr: w = w*(1+zhel) # At this point, we should be able to convert to the units we want w = w.to('Angstrom').value if fluxed: f = f.to('erg / (s cm2 Angstrom)') f = f.value # source reference srcs = s.get('source','').split(',') this_source = None for src in srcs: if src in all_sources: this_source = all_sources[src] break if this_source is None: print("Warning: spectrum has no source") if this_source not in used_sources: used_sources.append(this_source) # At this point we're actually using the spectroscopy, so find source sid = used_sources.index(this_source) sids.append(sid) spectra.append(spectrum(wave=w, flux=f, fluxed=fluxed, name="Spectrum MJD={:.1f}".format(t))) dates.append(t) snobj.sdata = timespec(snobj, dates, spectra) snobj.sdata.sids = sids if full_data: # make a dictionary of the remaining OSC meta data and make it a member # variable snobj.osc_meta = {} for key in d.keys(): if key not in ['name','redshift','ra','dec','sources','photometry', 'spectra']: snobj.osc_meta[key] = d[key] return(snobj,'Success') def to_osc(s, ref=None, bibcode=None, source=1): '''Given a supernova object, s, output to JSON format suitable for upload to the OSC.''' data = {s.name:{"name":s.name}} if ref or bibcode: sources = [dict(bibcode=bibcode, name=ref, alias=str(source))] data['sources'] = sources phot = [] for filt in s.data: for i in range(len(s.data[filt].MJD)): datum = dict(survey='CSP', observatory='LCO') datum.update(CSP_systems(filt, s.data[filt].MJD[i])) datum['time'] = "{:.3f}".format(s.data[filt].MJD[i]) datum['u_time'] = "MJD" datum['magnitude'] = "{:.3f}".format(s.data[filt].mag[i]) flux,eflux = s.data[filt].flux[i],s.data[filt].e_flux[i] datum['flux'] = "{:.5f}".format(flux) datum['u_flux'] = "s^-1 cm^-2" datum['e_flux'] = "{:.5f}".format(eflux) datum['e_upper_magnitude'] = "{:.3f}".format( -2.5*log10((flux-eflux)/flux)) datum['e_lower_magnitude'] = "{:.3f}".format( -2.5*log10(flux/(flux+eflux))) datum['source'] = "{}".format(source) phot.append(datum) data['photometry'] = phot return json.dumps(data, indent=4)
[ 7061, 6, 198, 26796, 329, 11346, 2238, 20519, 284, 4321, 14, 29572, 1366, 422, 262, 4946, 3115, 38438, 44515, 13, 198, 7061, 6, 198, 198, 6738, 11593, 37443, 834, 1330, 3601, 62, 8818, 198, 11748, 2237, 198, 11748, 33918, 198, 361, 2237, 13, 47, 56, 18, 25, 198, 220, 220, 1330, 2956, 297, 571, 13, 25927, 355, 2956, 297, 571, 198, 17772, 25, 198, 220, 220, 1330, 2956, 297, 571, 198, 6738, 6468, 28338, 13, 37652, 17540, 1330, 42375, 198, 6738, 3013, 9078, 1330, 3013, 11, 44601, 11, 69, 2617, 198, 6738, 299, 32152, 1330, 7177, 11, 6404, 940, 198, 11748, 6468, 28338, 13, 41667, 355, 334, 198, 6738, 3013, 9078, 13, 10379, 1010, 1330, 10958, 198, 6738, 3013, 9078, 13, 16684, 26801, 1330, 1661, 43106, 198, 198, 2, 2773, 880, 12, 4002, 16125, 290, 511, 285, 39242, 25, 198, 12984, 82, 796, 1391, 198, 220, 220, 705, 18946, 32, 41, 1106, 17657, 492, 24038, 49, 10354, 220, 1303, 30385, 408, 2123, 435, 13, 357, 18946, 8, 8997, 5919, 15748, 198, 220, 220, 220, 220, 220, 43216, 4826, 1746, 11, 198, 220, 220, 705, 13330, 32, 41, 1106, 22042, 492, 20, 1983, 41, 10354, 220, 1303, 449, 3099, 2123, 435, 13, 357, 13330, 8, 8997, 5919, 15748, 198, 220, 220, 220, 220, 220, 43216, 4826, 1746, 11, 198, 220, 220, 705, 10531, 25189, 41, 986, 9879, 492, 31697, 39, 10354, 220, 1303, 367, 5973, 2123, 435, 13, 357, 10531, 8, 43216, 32, 18, 12068, 5919, 15748, 198, 220, 220, 220, 220, 220, 43216, 4826, 1746, 11, 198, 220, 220, 705, 6999, 25189, 20120, 492, 2167, 986, 1065, 39, 10354, 220, 1303, 367, 5973, 2123, 435, 13, 357, 6999, 8, 43216, 32, 19, 12068, 5919, 15748, 198, 220, 220, 220, 220, 220, 43216, 4826, 1746, 198, 220, 220, 220, 220, 220, 1782, 198, 198, 2, 24344, 11, 3903, 14610, 11346, 2238, 20519, 8106, 6831, 198, 2, 775, 466, 428, 416, 12336, 357, 3903, 11, 10057, 11, 37524, 3798, 3008, 11, 672, 3168, 2870, 8, 7508, 422, 262, 220, 198, 2, 6831, 284, 11346, 2238, 20519, 16628, 13, 220, 198, 701, 26084, 796, 23884, 198, 701, 26084, 62, 20307, 796, 23884, 198, 20307, 62, 40539, 654, 796, 23884, 198, 1640, 4097, 287, 37250, 84, 41707, 70, 41707, 81, 41707, 72, 41707, 33, 41707, 53, 41707, 56, 41707, 41, 41707, 39, 41707, 42, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 553, 34, 4303, 1600, 7061, 553, 5639, 46, 4943, 60, 796, 4097, 198, 1640, 4097, 287, 37250, 52, 41707, 33, 41707, 53, 41707, 49, 41707, 40, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 4032, 41707, 74, 4548, 17, 3256, 7061, 15437, 796, 4097, 10, 6, 74, 4548, 6, 198, 1640, 4097, 287, 37250, 52, 41707, 33, 41707, 53, 41707, 49, 41707, 40, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 4032, 41707, 74, 4548, 18, 3256, 7061, 15437, 796, 4097, 10, 6, 74, 4548, 6, 198, 1640, 4097, 287, 37250, 41, 41707, 39, 41707, 42, 82, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 4032, 41707, 4537, 4663, 2043, 3698, 3256, 7061, 15437, 796, 4097, 10, 6, 17, 76, 6, 198, 1640, 4097, 287, 37250, 33, 41707, 53, 41707, 49, 41707, 40, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 4032, 41707, 74, 4548, 19, 3256, 10148, 15437, 796, 4097, 10, 6, 74, 4548, 6, 198, 1640, 4097, 287, 37250, 52, 41707, 53, 41707, 33, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 11, 705, 53, 26470, 41707, 10462, 2135, 3256, 7061, 15437, 796, 4097, 10, 1, 62, 31667, 2394, 1, 198, 1640, 4097, 287, 37250, 52, 30133, 16, 41707, 52, 30133, 17, 41707, 52, 15996, 17, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 11, 705, 53, 26470, 41707, 10462, 2135, 3256, 7061, 15437, 796, 4097, 198, 1640, 4097, 287, 37250, 70, 41707, 81, 41707, 72, 41707, 89, 6, 5974, 198, 220, 220, 277, 7645, 58, 7, 3903, 11, 705, 3256, 705, 3705, 16, 3256, 7061, 15437, 796, 366, 862, 16, 62, 1, 10, 3903, 198, 198, 2, 2312, 389, 329, 1366, 287, 357, 10919, 314, 1101, 13148, 8, 561, 307, 3210, 16628, 13, 198, 2, 775, 481, 2071, 257, 6509, 11, 996, 13, 198, 1640, 4097, 287, 37250, 52, 41707, 33, 41707, 53, 41707, 49, 41707, 40, 6, 5974, 198, 220, 220, 277, 7645, 62, 20307, 58, 7, 3903, 4032, 41707, 3256, 7061, 15437, 796, 4097, 10, 1, 82, 1, 198, 220, 220, 3210, 62, 40539, 654, 58, 3903, 60, 796, 366, 25378, 14, 42, 1313, 14, 34, 516, 1040, 366, 198, 1640, 4097, 287, 37250, 84, 41707, 70, 41707, 81, 41707, 72, 41707, 89, 6, 5974, 198, 220, 220, 277, 7645, 62, 20307, 58, 7, 3903, 4032, 41707, 3256, 7061, 15437, 796, 4097, 10, 1, 62, 1821, 1, 198, 220, 220, 3210, 62, 40539, 654, 58, 3903, 60, 796, 366, 50, 5439, 272, 357, 2969, 46, 8, 366, 198, 1640, 4097, 287, 14631, 84, 6, 2430, 70, 6, 2430, 81, 6, 2430, 72, 6, 2430, 89, 29653, 5974, 198, 220, 220, 277, 7645, 62, 20307, 58, 7, 3903, 4032, 41707, 3256, 7061, 15437, 796, 4097, 58, 15, 48688, 1, 62, 1821, 1, 198, 220, 220, 3210, 62, 40539, 654, 58, 3903, 60, 796, 366, 50, 5439, 272, 357, 2937, 15285, 12, 1821, 8, 366, 198, 1640, 4097, 287, 14631, 41, 2430, 39, 2430, 42, 82, 1, 5974, 198, 220, 220, 277, 7645, 62, 20307, 58, 7, 3903, 58, 15, 60, 4032, 41707, 3256, 7061, 15437, 796, 4097, 10, 1, 17, 76, 1, 198, 220, 220, 3210, 62, 40539, 654, 58, 3903, 58, 15, 11907, 796, 366, 17, 44, 10705, 366, 198, 198, 2, 3954, 898, 2825, 16996, 3341, 25, 198, 4299, 327, 4303, 62, 10057, 82, 7, 69, 2326, 11, 33974, 35, 2599, 198, 220, 220, 705, 7061, 15056, 257, 8106, 1438, 290, 33974, 35, 3128, 11, 5072, 262, 3376, 24344, 290, 198, 220, 220, 1080, 1321, 2637, 7061, 198, 220, 220, 611, 1226, 83, 6624, 366, 53, 1298, 198, 220, 220, 220, 220, 220, 611, 33974, 35, 1279, 642, 2718, 2780, 13, 15, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 29123, 17, 3256, 3903, 11639, 53, 12, 18938, 19, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 17816, 53, 15, 6, 4083, 89, 79, 22305, 198, 220, 220, 220, 220, 220, 1288, 361, 33974, 35, 1279, 7192, 38314, 13, 15, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 29123, 17, 3256, 3903, 11639, 53, 12, 6200, 24, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 17816, 53, 16, 6, 4083, 89, 79, 22305, 198, 220, 220, 220, 220, 220, 1288, 361, 33974, 35, 1279, 642, 2996, 2791, 13, 15, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 29123, 17, 3256, 3903, 11639, 53, 12, 4089, 2598, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 17816, 53, 6, 4083, 89, 79, 22305, 198, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 68, 17, 85, 3256, 3903, 11639, 53, 12, 4089, 2598, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 17816, 53, 17, 6, 4083, 89, 79, 22305, 198, 220, 220, 611, 1226, 83, 6624, 366, 41, 6015, 17, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 9781, 305, 21701, 3256, 3903, 11639, 41, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 58, 69, 2326, 4083, 89, 79, 22305, 198, 220, 220, 611, 1226, 83, 287, 37250, 84, 41707, 70, 41707, 81, 41707, 72, 41707, 33, 6, 5974, 198, 220, 220, 220, 220, 220, 611, 33974, 35, 1279, 642, 2996, 2791, 13, 15, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 29123, 17, 3256, 3903, 28, 69, 2326, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 58, 69, 2326, 4083, 89, 79, 22305, 198, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 68, 17, 85, 3256, 3903, 28, 69, 2326, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 58, 69, 2326, 10, 6, 17, 6, 4083, 89, 79, 22305, 198, 220, 220, 611, 1226, 83, 287, 37250, 56, 41707, 41, 41707, 39, 6, 5974, 198, 220, 220, 220, 220, 220, 611, 33974, 35, 1279, 642, 3553, 3559, 13, 15, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 10462, 3008, 3256, 259, 43872, 11639, 9781, 305, 21701, 3256, 3903, 28, 69, 2326, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 58, 69, 2326, 4083, 89, 79, 22305, 198, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 11600, 7, 37524, 3798, 3008, 11639, 35660, 48039, 3256, 259, 43872, 11639, 9781, 305, 21701, 3256, 3903, 28, 69, 2326, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1976, 263, 404, 1563, 2625, 90, 25, 13, 19, 69, 92, 1911, 18982, 7, 69, 2617, 58, 69, 2326, 10, 6, 67, 6, 4083, 89, 79, 22305, 198, 220, 220, 1441, 15090, 30072, 198, 198, 44, 37882, 62, 8210, 1039, 796, 1391, 198, 220, 220, 220, 220, 220, 705, 44, 37882, 10354, 15, 11, 198, 220, 220, 220, 220, 220, 705, 37882, 10354, 12, 1731, 20483, 13, 20, 198, 220, 220, 220, 220, 220, 1782, 628, 198, 43917, 62, 20500, 796, 1391, 198, 220, 220, 220, 220, 220, 705, 45828, 2475, 82, 62, 3919, 8056, 10354, 6, 20361, 25, 6060, 14394, 4049, 34046, 393, 351, 6727, 12, 49196, 407, 17392, 3256, 198, 220, 220, 220, 220, 220, 705, 45828, 2475, 82, 10354, 6, 20361, 25, 6060, 351, 6727, 12, 49196, 407, 17392, 3256, 198, 220, 220, 220, 220, 220, 1782, 198, 198, 2640, 34, 62, 28243, 796, 705, 7061, 5450, 1378, 82, 710, 13, 13200, 14, 459, 12204, 1381, 14, 459, 12204, 1381, 14, 16668, 37302, 3609, 14, 22915, 14, 17752, 14, 90, 27422, 17752, 7061, 6, 198, 198, 4299, 651, 62, 26801, 7, 6371, 11, 1336, 62, 7890, 28, 17821, 11, 1249, 62, 3919, 62, 48277, 28, 25101, 11, 4814, 62, 18224, 28, 15, 13, 486, 2599, 198, 220, 220, 705, 7061, 37177, 284, 1382, 257, 11346, 2238, 20519, 2134, 422, 257, 4946, 3115, 38438, 44515, 4382, 198, 220, 220, 10289, 2637, 7061, 628, 220, 220, 611, 19016, 13, 19796, 10786, 17500, 25, 11537, 6624, 657, 25, 198, 220, 220, 220, 220, 220, 1303, 9993, 284, 5678, 257, 19016, 1912, 691, 319, 257, 1438, 13, 198, 220, 220, 220, 220, 220, 19016, 796, 440, 6173, 62, 28243, 13, 18982, 7, 6371, 13, 35312, 7, 10354, 11537, 58, 16, 12962, 628, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 334, 69, 796, 2956, 297, 571, 13, 6371, 9654, 7, 6371, 8, 198, 220, 220, 2845, 25, 198, 220, 220, 220, 220, 220, 1441, 6045, 553, 44651, 10289, 1, 198, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 288, 796, 33918, 13, 2220, 7, 3046, 8, 198, 220, 220, 2845, 25, 198, 220, 220, 220, 220, 220, 334, 69, 13, 19836, 3419, 198, 220, 220, 220, 220, 220, 611, 1336, 62, 7890, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 553, 37, 6255, 284, 36899, 19449, 1600, 14202, 198, 220, 220, 220, 220, 220, 1441, 6045, 553, 37, 6255, 284, 36899, 19449, 1, 198, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 334, 69, 13, 19836, 3419, 198, 220, 220, 220, 198, 220, 220, 1303, 775, 783, 423, 262, 19449, 1366, 13, 3497, 262, 7508, 356, 761, 198, 220, 220, 288, 796, 1351, 7, 67, 13, 27160, 28955, 58, 15, 60, 198, 220, 220, 1438, 796, 288, 17816, 3672, 20520, 198, 220, 220, 611, 705, 445, 30846, 6, 407, 287, 288, 393, 705, 430, 6, 407, 287, 288, 393, 705, 12501, 6, 407, 287, 288, 25, 198, 220, 220, 220, 220, 220, 1441, 6045, 553, 2949, 2266, 30846, 11, 17926, 11, 393, 27196, 1043, 1, 198, 220, 220, 1976, 2978, 796, 12178, 7, 67, 17816, 445, 30846, 6, 7131, 15, 7131, 6, 8367, 6, 12962, 198, 220, 220, 2179, 796, 42375, 7203, 27071, 22179, 26933, 67, 17816, 430, 6, 7131, 15, 7131, 6, 8367, 6, 4357, 67, 17816, 430, 6, 7131, 15, 7131, 6, 84, 62, 8367, 6, 11907, 29720, 16863, 198, 220, 220, 2377, 796, 42375, 7203, 27071, 22179, 26933, 67, 17816, 12501, 6, 7131, 15, 7131, 6, 8367, 6, 4357, 67, 17816, 12501, 6, 7131, 15, 7131, 6, 84, 62, 8367, 6, 11907, 29720, 16863, 628, 220, 220, 3013, 26801, 796, 3013, 7, 3672, 11, 2179, 28, 430, 11, 875, 28, 32446, 11, 1976, 28, 89, 2978, 8, 198, 220, 220, 1303, 1439, 4165, 4237, 198, 220, 220, 477, 62, 82, 2203, 62, 11600, 796, 685, 9186, 329, 2378, 287, 288, 17816, 82, 2203, 20520, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2378, 13, 1136, 10786, 38238, 3256, 25101, 15437, 198, 220, 220, 477, 62, 82, 2203, 62, 11600, 17, 796, 685, 9186, 329, 2378, 287, 288, 17816, 82, 2203, 20520, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2378, 13, 1136, 10786, 38238, 3256, 25101, 15437, 198, 220, 220, 477, 62, 82, 2203, 796, 23884, 198, 220, 220, 329, 2723, 287, 477, 62, 82, 2203, 62, 11600, 25, 198, 220, 220, 220, 220, 220, 477, 62, 82, 2203, 58, 10459, 17816, 26011, 6, 11907, 796, 357, 10459, 13, 1136, 10786, 65, 571, 8189, 3256, 7061, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2723, 13, 1136, 10786, 35790, 3256, 7061, 4008, 198, 220, 220, 477, 62, 82, 2203, 17, 796, 23884, 198, 220, 220, 329, 2723, 287, 477, 62, 82, 2203, 62, 11600, 17, 25, 198, 220, 220, 220, 220, 220, 477, 62, 82, 2203, 17, 58, 10459, 17816, 26011, 6, 11907, 796, 357, 10459, 13, 1136, 10786, 65, 571, 8189, 3256, 7061, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2723, 13, 1136, 10786, 35790, 3256, 7061, 4008, 628, 220, 220, 1303, 7406, 11, 262, 2825, 15748, 13, 198, 220, 220, 973, 62, 82, 2203, 796, 17635, 198, 220, 220, 33974, 35, 796, 23884, 198, 220, 220, 2153, 82, 796, 23884, 198, 220, 220, 795, 3775, 796, 23884, 198, 220, 220, 264, 2340, 796, 23884, 198, 220, 220, 1900, 62, 34680, 82, 796, 17635, 198, 220, 220, 6439, 62, 34680, 82, 796, 17635, 198, 220, 220, 14601, 796, 17635, 198, 220, 220, 2825, 15748, 796, 288, 13, 1136, 10786, 38611, 15748, 3256, 685, 12962, 198, 220, 220, 329, 279, 287, 2825, 15748, 25, 198, 220, 220, 220, 220, 220, 611, 279, 13, 1136, 10786, 45828, 32374, 3256, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 256, 796, 357, 79, 13, 1136, 10786, 3903, 3256, 7061, 828, 79, 13, 1136, 10786, 10057, 3256, 7061, 828, 79, 13, 1136, 10786, 37524, 3798, 3008, 3256, 7061, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 279, 13, 1136, 10786, 672, 3168, 2870, 3256, 7061, 4008, 628, 220, 220, 220, 220, 220, 1303, 15138, 351, 2723, 286, 2825, 15748, 198, 220, 220, 220, 220, 220, 37786, 796, 279, 13, 1136, 10786, 10459, 27691, 35312, 7, 3256, 11537, 198, 220, 220, 220, 220, 220, 428, 62, 10459, 796, 6045, 198, 220, 220, 220, 220, 220, 329, 264, 287, 37786, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 264, 287, 477, 62, 82, 2203, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 428, 62, 10459, 796, 477, 62, 82, 2203, 58, 82, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2270, 198, 220, 220, 220, 220, 220, 611, 428, 62, 10459, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 329, 264, 287, 37786, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 264, 287, 477, 62, 82, 2203, 17, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 428, 62, 10459, 796, 477, 62, 82, 2203, 17, 58, 82, 60, 628, 220, 220, 220, 220, 220, 611, 428, 62, 10459, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 220, 645, 4165, 2723, 11, 31017, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 628, 220, 220, 220, 220, 220, 275, 571, 8189, 796, 428, 62, 10459, 58, 15, 60, 198, 220, 220, 220, 220, 220, 611, 275, 571, 8189, 287, 46972, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 275, 796, 46972, 58, 65, 571, 8189, 16151, 83, 58, 15, 4357, 22468, 7, 79, 17816, 2435, 20520, 4008, 198, 220, 220, 220, 220, 220, 1288, 361, 256, 287, 277, 7645, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 275, 796, 277, 7645, 58, 83, 60, 198, 220, 220, 220, 220, 220, 1288, 361, 256, 287, 277, 7645, 62, 20307, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 275, 796, 277, 7645, 62, 20307, 58, 83, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 256, 407, 287, 1900, 62, 34680, 82, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1900, 62, 34680, 82, 13, 33295, 7, 83, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 220, 645, 24344, 14, 10057, 7508, 11, 13148, 33172, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3210, 62, 40539, 654, 58, 65, 58, 15, 60, 4357, 275, 58, 15, 12962, 198, 220, 220, 220, 220, 220, 1288, 361, 357, 83, 58, 15, 17241, 2430, 2430, 4943, 287, 277, 7645, 62, 20307, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 275, 796, 277, 7645, 62, 20307, 58, 7, 83, 58, 15, 17241, 2430, 2430, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 256, 407, 287, 1900, 62, 34680, 82, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1900, 62, 34680, 82, 13, 33295, 7, 83, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 24344, 14, 10057, 5447, 416, 4064, 82, 14, 4, 82, 14, 4, 82, 407, 37082, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 26243, 1143, 11, 13148, 4064, 82, 4064, 82, 1, 4064, 59, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 83, 58, 16, 4357, 83, 58, 17, 4357, 83, 58, 18, 4357, 20307, 62, 40539, 654, 58, 83, 58, 15, 60, 4357, 83, 58, 15, 60, 4008, 198, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1400, 2126, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 256, 407, 287, 6439, 62, 34680, 82, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6439, 62, 34680, 82, 13, 33295, 7, 83, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 24344, 14, 10057, 5447, 416, 4064, 82, 14, 4, 82, 14, 4, 82, 407, 37082, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 26243, 1143, 290, 460, 470, 3785, 503, 262, 8106, 4064, 82, 1, 4064, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 83, 58, 16, 4357, 83, 58, 17, 4357, 83, 58, 18, 4357, 83, 58, 15, 60, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 6439, 62, 34680, 82, 13, 33295, 7, 83, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 611, 275, 407, 287, 33974, 35, 25, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 33974, 35, 58, 65, 60, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2153, 82, 58, 65, 60, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 220, 795, 3775, 58, 65, 60, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 220, 264, 2340, 58, 65, 60, 796, 17635, 198, 220, 220, 220, 220, 220, 611, 705, 2435, 6, 287, 279, 290, 705, 76, 4660, 3984, 6, 287, 279, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 1249, 62, 3919, 62, 48277, 290, 705, 68, 62, 76, 4660, 3984, 6, 407, 287, 279, 290, 59, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 68, 62, 21037, 62, 76, 4660, 3984, 6, 407, 287, 279, 290, 705, 68, 62, 45828, 62, 76, 4660, 3984, 6, 407, 287, 279, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 705, 45828, 2475, 82, 6, 407, 287, 14601, 25, 14601, 13, 33295, 10786, 45828, 2475, 82, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 220, 33974, 35, 58, 65, 4083, 33295, 7, 22468, 7, 79, 17816, 2435, 20520, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2153, 82, 58, 65, 4083, 33295, 7, 22468, 7, 79, 17816, 76, 4660, 3984, 20520, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 705, 68, 62, 76, 4660, 3984, 6, 287, 279, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 795, 3775, 58, 65, 4083, 33295, 7, 22468, 7, 79, 17816, 68, 62, 76, 4660, 3984, 20520, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1288, 361, 705, 68, 62, 21037, 62, 76, 4660, 3984, 6, 287, 279, 290, 705, 68, 62, 45828, 62, 76, 4660, 3984, 6, 287, 279, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 795, 3775, 58, 65, 4083, 33295, 19510, 22468, 7, 79, 17816, 68, 62, 21037, 62, 76, 4660, 3984, 6, 12962, 1343, 59, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12178, 7, 79, 17816, 68, 62, 45828, 62, 76, 4660, 3984, 20520, 4008, 14, 17, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 795, 3775, 58, 65, 4083, 33295, 7, 45688, 62, 18224, 8, 198, 220, 220, 220, 220, 220, 1288, 361, 705, 2435, 6, 287, 279, 290, 705, 9127, 4873, 6, 287, 279, 290, 705, 9107, 404, 1563, 6, 287, 279, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 1249, 62, 3919, 62, 48277, 290, 705, 68, 62, 9127, 4873, 6, 407, 287, 279, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 705, 45828, 2475, 82, 6, 407, 287, 14601, 25, 14601, 13, 33295, 10786, 45828, 2475, 82, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 12178, 7, 79, 17816, 9127, 4873, 6, 12962, 1279, 657, 25, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 220, 33974, 35, 58, 65, 4083, 33295, 7, 22468, 7, 79, 17816, 2435, 20520, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2153, 82, 58, 65, 4083, 33295, 32590, 17, 13, 20, 9, 6404, 940, 7, 22468, 7, 79, 17816, 9127, 4873, 20520, 4008, 1343, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12178, 7, 79, 17816, 9107, 404, 1563, 20520, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 9940, 796, 279, 13, 1136, 10786, 68, 62, 9127, 4873, 3256, 14202, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 9940, 318, 407, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 795, 3775, 58, 65, 4083, 33295, 7, 16, 13, 2919, 22, 9, 22468, 7, 79, 17816, 68, 62, 9127, 4873, 6, 12962, 14, 22468, 7, 79, 17816, 9127, 4873, 20520, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 795, 3775, 58, 65, 4083, 33295, 7, 45688, 62, 18224, 8, 198, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 705, 45828, 2475, 82, 62, 3919, 8056, 6, 407, 287, 14601, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14601, 13, 33295, 10786, 45828, 2475, 82, 62, 3919, 8056, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 611, 428, 62, 10459, 407, 287, 973, 62, 82, 2203, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 973, 62, 82, 2203, 13, 33295, 7, 5661, 62, 10459, 8, 198, 220, 220, 220, 220, 220, 1303, 1629, 428, 966, 356, 821, 1682, 1262, 262, 2825, 15748, 11, 523, 1064, 2723, 198, 220, 220, 220, 220, 220, 9785, 796, 973, 62, 82, 2203, 13, 9630, 7, 5661, 62, 10459, 8, 198, 220, 220, 220, 220, 220, 264, 2340, 58, 65, 4083, 33295, 7, 30255, 8, 198, 220, 220, 329, 275, 287, 33974, 35, 25, 198, 220, 220, 220, 220, 220, 611, 18896, 7, 44, 37882, 58, 65, 12962, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 3013, 26801, 13, 7890, 58, 65, 60, 796, 300, 66, 7, 16184, 26801, 11, 275, 11, 7177, 7, 44, 37882, 58, 65, 46570, 7177, 7, 76, 3775, 58, 65, 46570, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 7, 368, 3775, 58, 65, 46570, 264, 2340, 28, 18747, 7, 82, 2340, 58, 65, 4357, 288, 4906, 28, 600, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 3013, 26801, 13, 7890, 58, 65, 4083, 2435, 62, 30619, 3419, 198, 220, 220, 3013, 26801, 13, 82, 2203, 796, 973, 62, 82, 2203, 198, 220, 220, 3013, 26801, 13, 1136, 62, 2118, 21397, 3419, 628, 220, 220, 611, 18896, 7, 34680, 62, 34680, 82, 8, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 6439, 62, 34680, 82, 796, 1351, 7, 2617, 7, 34680, 62, 34680, 82, 4008, 198, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 220, 262, 1708, 2825, 15748, 373, 407, 8018, 416, 11346, 2238, 20519, 4943, 198, 220, 220, 220, 220, 220, 3601, 7203, 392, 373, 407, 17392, 25, 4943, 198, 220, 220, 220, 220, 220, 329, 2378, 287, 6439, 62, 34680, 82, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 9186, 8, 198, 220, 220, 611, 14601, 25, 198, 220, 220, 220, 220, 220, 329, 6509, 287, 14601, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 43917, 62, 20500, 58, 43917, 12962, 628, 220, 220, 1303, 938, 306, 11, 262, 5444, 45943, 11081, 198, 220, 220, 611, 288, 13, 1136, 10786, 4443, 430, 3256, 14202, 8, 318, 407, 6045, 25, 198, 220, 220, 220, 220, 220, 5444, 430, 796, 17635, 198, 220, 220, 220, 220, 220, 9667, 796, 17635, 198, 220, 220, 220, 220, 220, 264, 2340, 796, 17635, 198, 220, 220, 220, 220, 220, 329, 264, 287, 288, 17816, 4443, 430, 6, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 266, 84, 796, 264, 13, 1136, 10786, 84, 62, 10247, 26623, 82, 3256, 705, 32, 4593, 20282, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 14035, 796, 264, 13, 1136, 10786, 84, 62, 69, 22564, 274, 3256, 705, 3118, 9948, 2889, 515, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 266, 84, 796, 334, 13, 26453, 7, 43812, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 11052, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 220, 43483, 1143, 4326, 329, 28400, 25, 23884, 1911, 18982, 7, 43812, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 220, 13148, 2895, 20282, 82, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 266, 84, 796, 334, 13, 13450, 20282, 198, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 14035, 6624, 705, 3118, 9948, 2889, 515, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28462, 276, 796, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14035, 796, 334, 13, 46156, 1203, 62, 403, 1416, 3021, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14035, 796, 334, 13, 26453, 7, 20942, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28462, 276, 796, 6407, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 11052, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 220, 43483, 1143, 4326, 329, 28462, 25, 23884, 1911, 18982, 7, 20942, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28462, 276, 796, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14035, 796, 334, 13, 46156, 1203, 62, 403, 1416, 3021, 198, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 12777, 796, 264, 13, 1136, 10786, 84, 62, 2435, 3256, 705, 44, 37882, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 256, 796, 12178, 7, 82, 17816, 2435, 6, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 12777, 407, 287, 33974, 35, 62, 8210, 1039, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 220, 43483, 1143, 640, 4326, 25, 23884, 1911, 18982, 7, 28047, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 82, 17816, 2435, 6, 4083, 35312, 10786, 2637, 38381, 15, 12962, 6624, 767, 290, 264, 17816, 2435, 6, 7131, 15, 60, 6624, 705, 17, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 220, 220, 13148, 28591, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 256, 796, 256, 532, 1987, 20483, 13, 20, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1288, 361, 18896, 7, 82, 17816, 2435, 6, 4083, 35312, 10786, 2637, 38381, 15, 12962, 6624, 642, 290, 264, 17816, 2435, 6, 7131, 15, 60, 6624, 705, 20, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 220, 220, 13148, 33974, 35, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 220, 220, 31017, 428, 10958, 19570, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 266, 796, 7177, 26933, 22468, 7, 9186, 58, 15, 12962, 329, 2378, 287, 264, 17816, 7890, 6, 11907, 27493, 43812, 198, 220, 220, 220, 220, 220, 220, 220, 220, 277, 796, 7177, 26933, 22468, 7, 9186, 58, 16, 12962, 329, 2378, 287, 264, 17816, 7890, 6, 11907, 27493, 20942, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1553, 796, 264, 13, 1136, 10786, 67, 1068, 1477, 21715, 3256, 10352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1553, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 266, 796, 266, 9, 7, 16, 10, 89, 2978, 8, 198, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1629, 428, 966, 11, 356, 815, 307, 1498, 284, 10385, 284, 262, 4991, 356, 765, 198, 220, 220, 220, 220, 220, 220, 220, 220, 266, 796, 266, 13, 1462, 10786, 13450, 20282, 27691, 8367, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 28462, 276, 25, 277, 796, 277, 13, 1462, 10786, 6422, 1220, 357, 82, 12067, 17, 2895, 20282, 8, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 277, 796, 277, 13, 8367, 198, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2723, 4941, 198, 220, 220, 220, 220, 220, 220, 220, 220, 12351, 82, 796, 264, 13, 1136, 10786, 10459, 3256, 7061, 737, 35312, 7, 3256, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 428, 62, 10459, 796, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 220, 329, 12351, 287, 12351, 82, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 12351, 287, 477, 62, 82, 2203, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 428, 62, 10459, 796, 477, 62, 82, 2203, 58, 10677, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2270, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 428, 62, 10459, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20361, 25, 10958, 468, 645, 2723, 4943, 198, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 428, 62, 10459, 407, 287, 973, 62, 82, 2203, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 973, 62, 82, 2203, 13, 33295, 7, 5661, 62, 10459, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1629, 428, 966, 356, 821, 1682, 1262, 262, 5444, 45943, 11081, 11, 523, 1064, 2723, 198, 220, 220, 220, 220, 220, 220, 220, 220, 9785, 796, 973, 62, 82, 2203, 13, 9630, 7, 5661, 62, 10459, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 264, 2340, 13, 33295, 7, 30255, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 5444, 430, 13, 33295, 7, 4443, 6582, 7, 19204, 28, 86, 11, 28462, 28, 69, 11, 28462, 276, 28, 69, 22564, 276, 11, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 2625, 49738, 6582, 33974, 35, 34758, 25, 13, 16, 69, 92, 1911, 18982, 7, 83, 22305, 198, 220, 220, 220, 220, 220, 220, 220, 220, 9667, 13, 33295, 7, 83, 8, 198, 220, 220, 220, 220, 220, 3013, 26801, 13, 82, 7890, 796, 1661, 43106, 7, 16184, 26801, 11, 9667, 11, 5444, 430, 8, 198, 220, 220, 220, 220, 220, 3013, 26801, 13, 82, 7890, 13, 82, 2340, 796, 264, 2340, 628, 220, 220, 611, 1336, 62, 7890, 25, 198, 220, 220, 220, 220, 220, 1303, 787, 257, 22155, 286, 262, 5637, 440, 6173, 13634, 1366, 290, 787, 340, 257, 2888, 220, 198, 220, 220, 220, 220, 220, 1303, 7885, 198, 220, 220, 220, 220, 220, 3013, 26801, 13, 17500, 62, 28961, 796, 23884, 198, 220, 220, 220, 220, 220, 329, 1994, 287, 288, 13, 13083, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1994, 407, 287, 37250, 3672, 41707, 445, 30846, 41707, 430, 41707, 12501, 41707, 82, 2203, 41707, 38611, 15748, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4443, 430, 6, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3013, 26801, 13, 17500, 62, 28961, 58, 2539, 60, 796, 288, 58, 2539, 60, 628, 220, 220, 1441, 7, 16184, 26801, 4032, 33244, 11537, 198, 198, 4299, 284, 62, 17500, 7, 82, 11, 1006, 28, 14202, 11, 275, 571, 8189, 28, 14202, 11, 2723, 28, 16, 2599, 198, 220, 220, 705, 7061, 15056, 257, 2208, 38438, 2134, 11, 264, 11, 5072, 284, 19449, 5794, 11080, 329, 9516, 284, 198, 220, 220, 262, 440, 6173, 2637, 7061, 198, 220, 220, 220, 198, 220, 220, 1366, 796, 1391, 82, 13, 3672, 25, 4895, 3672, 1298, 82, 13, 3672, 11709, 628, 220, 220, 611, 1006, 393, 275, 571, 8189, 25, 198, 220, 220, 220, 220, 220, 4237, 796, 685, 11600, 7, 65, 571, 8189, 28, 65, 571, 8189, 11, 1438, 28, 5420, 11, 16144, 28, 2536, 7, 10459, 4008, 60, 198, 220, 220, 220, 220, 220, 1366, 17816, 82, 2203, 20520, 796, 4237, 198, 220, 220, 2825, 796, 17635, 198, 220, 220, 329, 1226, 83, 287, 264, 13, 7890, 25, 198, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 11925, 7, 82, 13, 7890, 58, 69, 2326, 4083, 44, 37882, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 796, 8633, 7, 11793, 3304, 11639, 34, 4303, 3256, 3799, 2870, 11639, 5639, 46, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 13, 19119, 7, 34, 4303, 62, 10057, 82, 7, 69, 2326, 11, 264, 13, 7890, 58, 69, 2326, 4083, 44, 37882, 58, 72, 60, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 2435, 20520, 796, 45144, 25, 13, 18, 69, 92, 1911, 18982, 7, 82, 13, 7890, 58, 69, 2326, 4083, 44, 37882, 58, 72, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 84, 62, 2435, 20520, 796, 366, 44, 37882, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 76, 4660, 3984, 20520, 796, 45144, 25, 13, 18, 69, 92, 1911, 18982, 7, 82, 13, 7890, 58, 69, 2326, 4083, 19726, 58, 72, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 28462, 11, 891, 22564, 796, 264, 13, 7890, 58, 69, 2326, 4083, 69, 22564, 58, 72, 4357, 82, 13, 7890, 58, 69, 2326, 4083, 68, 62, 69, 22564, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 69, 22564, 20520, 796, 45144, 25, 13, 20, 69, 92, 1911, 18982, 7, 69, 22564, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 84, 62, 69, 22564, 20520, 796, 366, 82, 61, 12, 16, 12067, 61, 12, 17, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 68, 62, 69, 22564, 20520, 796, 45144, 25, 13, 20, 69, 92, 1911, 18982, 7, 891, 22564, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 68, 62, 45828, 62, 76, 4660, 3984, 20520, 796, 45144, 25, 13, 18, 69, 92, 1911, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 17, 13, 20, 9, 6404, 940, 19510, 69, 22564, 12, 891, 22564, 20679, 69, 22564, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 68, 62, 21037, 62, 76, 4660, 3984, 20520, 796, 45144, 25, 13, 18, 69, 92, 1911, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 17, 13, 20, 9, 6404, 940, 7, 69, 22564, 29006, 69, 22564, 10, 891, 22564, 22305, 198, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 388, 17816, 10459, 20520, 796, 45144, 92, 1911, 18982, 7, 10459, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 2825, 13, 33295, 7, 19608, 388, 8, 198, 220, 220, 1366, 17816, 38611, 15748, 20520, 796, 2825, 628, 220, 220, 1441, 33918, 13, 67, 8142, 7, 7890, 11, 33793, 28, 19, 8, 628 ]
2.044028
7,041
from menu import Menu, MenuItem from coffee_maker import CoffeeMaker from money_machine import MoneyMachine money_machine = MoneyMachine() coffee_maker = CoffeeMaker() menu = Menu() coffee_maker.report() money_machine.report() coffee_machine_is_on = True while coffee_machine_is_on: choices = menu.get_items() user_order = input(f'Please choose a coffee: ({choices})>>> ') if user_order == 'off': coffee_machine_is_on = False elif user_order == 'report': coffee_maker.report() money_machine.report() else: drink = menu.find_drink(user_order) if coffee_maker.is_resource_sufficient(drink) and money_machine.make_payment(drink.cost): coffee_maker.make_coffee(drink)
[ 6738, 6859, 1330, 21860, 11, 21860, 7449, 198, 6738, 6891, 62, 10297, 1330, 19443, 48890, 198, 6738, 1637, 62, 30243, 1330, 12911, 37573, 198, 198, 26316, 62, 30243, 796, 12911, 37573, 3419, 198, 1073, 5853, 62, 10297, 796, 19443, 48890, 3419, 198, 198, 26272, 796, 21860, 3419, 198, 1073, 5853, 62, 10297, 13, 13116, 3419, 198, 26316, 62, 30243, 13, 13116, 3419, 198, 198, 1073, 5853, 62, 30243, 62, 271, 62, 261, 796, 6407, 198, 198, 4514, 6891, 62, 30243, 62, 271, 62, 261, 25, 198, 220, 220, 220, 7747, 796, 6859, 13, 1136, 62, 23814, 3419, 198, 220, 220, 220, 2836, 62, 2875, 796, 5128, 7, 69, 6, 5492, 3853, 257, 6891, 25, 37913, 6679, 1063, 30072, 33409, 705, 8, 628, 220, 220, 220, 611, 2836, 62, 2875, 6624, 705, 2364, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 6891, 62, 30243, 62, 271, 62, 261, 796, 10352, 628, 220, 220, 220, 1288, 361, 2836, 62, 2875, 6624, 705, 13116, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 6891, 62, 10297, 13, 13116, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 1637, 62, 30243, 13, 13116, 3419, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 4144, 796, 6859, 13, 19796, 62, 7109, 676, 7, 7220, 62, 2875, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 6891, 62, 10297, 13, 271, 62, 31092, 62, 46790, 7, 7109, 676, 8, 290, 1637, 62, 30243, 13, 15883, 62, 37301, 7, 7109, 676, 13, 15805, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6891, 62, 10297, 13, 15883, 62, 1073, 5853, 7, 7109, 676, 8, 628, 198 ]
2.657143
280
# Copyright (c) 2013-2018, Rethink Robotics Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import errno import rospy import intera_dataflow from intera_core_msgs.msg import ( DigitalIOState, DigitalOutputCommand, ) class DigitalIO(object): """ DEPRECATION WARNING: This interface will likely be removed in the future. Transition to using the IO Framework and the wrapper classes: gripper.py, cuff.py, camera.py Interface class for a simple Digital Input and/or Output on the Intera robots. Input - read input state Output - turn output On/Off - read current output state """ def __init__(self, component_id): """ Constructor. @param component_id: unique id of the digital component """ self._id = component_id self._component_type = 'digital_io' self._is_output = False self._state = None self.state_changed = intera_dataflow.Signal() type_ns = '/robot/' + self._component_type topic_base = type_ns + '/' + self._id self._sub_state = rospy.Subscriber( topic_base + '/state', DigitalIOState, self._on_io_state) intera_dataflow.wait_for( lambda: self._state != None, timeout=2.0, timeout_msg="Failed to get current digital_io state from %s" \ % (topic_base,), ) # check if output-capable before creating publisher if self._is_output: self._pub_output = rospy.Publisher( type_ns + '/command', DigitalOutputCommand, queue_size=10) def _on_io_state(self, msg): """ Updates the internally stored state of the Digital Input/Output. """ new_state = (msg.state == DigitalIOState.PRESSED) if self._state is None: self._is_output = not msg.isInputOnly old_state = self._state self._state = new_state # trigger signal if changed if old_state is not None and old_state != new_state: self.state_changed(new_state) @property def is_output(self): """ Accessor to check if IO is capable of output. """ return self._is_output @property def state(self): """ Current state of the Digital Input/Output. """ return self._state @state.setter def state(self, value): """ Control the state of the Digital Output. (is_output must be True) @type value: bool @param value: new state to output {True, False} """ self.set_output(value) def set_output(self, value, timeout=2.0): """ Control the state of the Digital Output. Use this function for finer control over the wait_for timeout. @type value: bool @param value: new state {True, False} of the Output. @type timeout: float @param timeout: Seconds to wait for the io to reflect command. If 0, just command once and return. [0] """ if not self._is_output: raise IOError(errno.EACCES, "Component is not an output [%s: %s]" % (self._component_type, self._id)) cmd = DigitalOutputCommand() cmd.name = self._id cmd.value = value self._pub_output.publish(cmd) if not timeout == 0: intera_dataflow.wait_for( test=lambda: self.state == value, timeout=timeout, rate=100, timeout_msg=("Failed to command digital io to: %r" % (value,)), body=lambda: self._pub_output.publish(cmd) )
[ 2, 15069, 357, 66, 8, 2211, 12, 7908, 11, 371, 2788, 676, 47061, 3457, 13, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 11247, 739, 262, 13789, 13, 198, 198, 11748, 11454, 3919, 198, 198, 11748, 686, 2777, 88, 198, 198, 11748, 987, 64, 62, 7890, 11125, 198, 198, 6738, 987, 64, 62, 7295, 62, 907, 14542, 13, 19662, 1330, 357, 198, 220, 220, 220, 10231, 9399, 9012, 11, 198, 220, 220, 220, 10231, 26410, 21575, 11, 198, 8, 628, 198, 4871, 10231, 9399, 7, 15252, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 5550, 47, 38827, 6234, 39410, 25, 770, 7071, 481, 1884, 307, 4615, 287, 198, 220, 220, 220, 262, 2003, 13, 40658, 284, 1262, 262, 24418, 25161, 290, 262, 29908, 198, 220, 220, 220, 6097, 25, 11120, 2848, 13, 9078, 11, 47291, 13, 9078, 11, 4676, 13, 9078, 628, 220, 220, 220, 26491, 1398, 329, 257, 2829, 10231, 23412, 290, 14, 273, 25235, 319, 262, 198, 220, 220, 220, 4225, 64, 14193, 13, 628, 220, 220, 220, 23412, 198, 220, 220, 220, 220, 220, 532, 1100, 5128, 1181, 198, 220, 220, 220, 25235, 198, 220, 220, 220, 220, 220, 532, 1210, 5072, 1550, 14, 9362, 198, 220, 220, 220, 220, 220, 532, 1100, 1459, 5072, 1181, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 825, 11593, 15003, 834, 7, 944, 11, 7515, 62, 312, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 28407, 273, 13, 628, 220, 220, 220, 220, 220, 220, 220, 2488, 17143, 7515, 62, 312, 25, 3748, 4686, 286, 262, 4875, 7515, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 312, 796, 7515, 62, 312, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 42895, 62, 4906, 796, 705, 34725, 62, 952, 6, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 271, 62, 22915, 796, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 5219, 796, 6045, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 5219, 62, 40985, 796, 987, 64, 62, 7890, 11125, 13, 11712, 282, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 2099, 62, 5907, 796, 31051, 305, 13645, 14, 6, 1343, 2116, 13557, 42895, 62, 4906, 198, 220, 220, 220, 220, 220, 220, 220, 7243, 62, 8692, 796, 2099, 62, 5907, 1343, 31051, 6, 1343, 2116, 13557, 312, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 7266, 62, 5219, 796, 686, 2777, 88, 13, 7004, 1416, 24735, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7243, 62, 8692, 1343, 31051, 5219, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10231, 9399, 9012, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 261, 62, 952, 62, 5219, 8, 628, 220, 220, 220, 220, 220, 220, 220, 987, 64, 62, 7890, 11125, 13, 17077, 62, 1640, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 37456, 25, 2116, 13557, 5219, 14512, 6045, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26827, 28, 17, 13, 15, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26827, 62, 19662, 2625, 37, 6255, 284, 651, 1459, 4875, 62, 952, 1181, 422, 4064, 82, 1, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4064, 357, 26652, 62, 8692, 11, 828, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 2198, 611, 5072, 12, 11128, 540, 878, 4441, 9991, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13557, 271, 62, 22915, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 12984, 62, 22915, 796, 686, 2777, 88, 13, 46471, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2099, 62, 5907, 1343, 31051, 21812, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10231, 26410, 21575, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16834, 62, 7857, 28, 940, 8, 628, 220, 220, 220, 825, 4808, 261, 62, 952, 62, 5219, 7, 944, 11, 31456, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 28090, 262, 20947, 8574, 1181, 286, 262, 10231, 23412, 14, 26410, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 649, 62, 5219, 796, 357, 19662, 13, 5219, 6624, 10231, 9399, 9012, 13, 32761, 1961, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13557, 5219, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 271, 62, 22915, 796, 407, 31456, 13, 271, 20560, 10049, 198, 220, 220, 220, 220, 220, 220, 220, 1468, 62, 5219, 796, 2116, 13557, 5219, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 5219, 796, 649, 62, 5219, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 7616, 6737, 611, 3421, 198, 220, 220, 220, 220, 220, 220, 220, 611, 1468, 62, 5219, 318, 407, 6045, 290, 1468, 62, 5219, 14512, 649, 62, 5219, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 5219, 62, 40985, 7, 3605, 62, 5219, 8, 628, 220, 220, 220, 2488, 26745, 198, 220, 220, 220, 825, 318, 62, 22915, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8798, 273, 284, 2198, 611, 24418, 318, 6007, 286, 5072, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13557, 271, 62, 22915, 628, 220, 220, 220, 2488, 26745, 198, 220, 220, 220, 825, 1181, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 9236, 1181, 286, 262, 10231, 23412, 14, 26410, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13557, 5219, 628, 220, 220, 220, 2488, 5219, 13, 2617, 353, 198, 220, 220, 220, 825, 1181, 7, 944, 11, 1988, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6779, 262, 1181, 286, 262, 10231, 25235, 13, 357, 271, 62, 22915, 1276, 307, 6407, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2488, 4906, 1988, 25, 20512, 198, 220, 220, 220, 220, 220, 220, 220, 2488, 17143, 1988, 25, 649, 1181, 284, 5072, 1391, 17821, 11, 10352, 92, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2617, 62, 22915, 7, 8367, 8, 628, 220, 220, 220, 825, 900, 62, 22915, 7, 944, 11, 1988, 11, 26827, 28, 17, 13, 15, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6779, 262, 1181, 286, 262, 10231, 25235, 13, 628, 220, 220, 220, 220, 220, 220, 220, 5765, 428, 2163, 329, 38575, 1630, 625, 262, 4043, 62, 1640, 26827, 13, 628, 220, 220, 220, 220, 220, 220, 220, 2488, 4906, 1988, 25, 20512, 198, 220, 220, 220, 220, 220, 220, 220, 2488, 17143, 1988, 25, 649, 1181, 1391, 17821, 11, 10352, 92, 286, 262, 25235, 13, 198, 220, 220, 220, 220, 220, 220, 220, 2488, 4906, 26827, 25, 12178, 198, 220, 220, 220, 220, 220, 220, 220, 2488, 17143, 26827, 25, 40876, 284, 4043, 329, 262, 33245, 284, 4079, 3141, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 657, 11, 655, 3141, 1752, 290, 1441, 13, 685, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2116, 13557, 271, 62, 22915, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 24418, 12331, 7, 8056, 3919, 13, 36, 26861, 1546, 11, 366, 21950, 318, 407, 281, 5072, 685, 4, 82, 25, 4064, 82, 30866, 4064, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 944, 13557, 42895, 62, 4906, 11, 2116, 13557, 312, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 23991, 796, 10231, 26410, 21575, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 23991, 13, 3672, 796, 2116, 13557, 312, 198, 220, 220, 220, 220, 220, 220, 220, 23991, 13, 8367, 796, 1988, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 12984, 62, 22915, 13, 12984, 1836, 7, 28758, 8, 628, 220, 220, 220, 220, 220, 220, 220, 611, 407, 26827, 6624, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 987, 64, 62, 7890, 11125, 13, 17077, 62, 1640, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1332, 28, 50033, 25, 2116, 13, 5219, 6624, 1988, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26827, 28, 48678, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2494, 28, 3064, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26827, 62, 19662, 28, 7203, 37, 6255, 284, 3141, 4875, 33245, 284, 25, 4064, 81, 1, 4064, 357, 8367, 35751, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1767, 28, 50033, 25, 2116, 13557, 12984, 62, 22915, 13, 12984, 1836, 7, 28758, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198 ]
2.363787
1,806
# -*- coding: utf-8 -*- # Copyright 2016 Yelp Inc. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, # software distributed under the License is distributed on an # "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY # KIND, either express or implied. See the License for the # specific language governing permissions and limitations # under the License. from __future__ import absolute_import from __future__ import unicode_literals import pytest from replication_handler.models.mysql_dumps import MySQLDumps @pytest.mark.itest @pytest.mark.itest_db
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 2, 15069, 1584, 44628, 3457, 13, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 198, 2, 3788, 9387, 739, 262, 13789, 318, 9387, 319, 281, 198, 2, 366, 1921, 3180, 1, 29809, 1797, 11, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 198, 2, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 220, 4091, 262, 13789, 329, 262, 198, 2, 2176, 3303, 15030, 21627, 290, 11247, 198, 2, 739, 262, 13789, 13, 198, 6738, 11593, 37443, 834, 1330, 4112, 62, 11748, 198, 6738, 11593, 37443, 834, 1330, 28000, 1098, 62, 17201, 874, 198, 198, 11748, 12972, 9288, 198, 198, 6738, 30330, 62, 30281, 13, 27530, 13, 28744, 13976, 62, 67, 8142, 1330, 33476, 35, 8142, 628, 198, 31, 9078, 9288, 13, 4102, 13, 270, 395, 198, 31, 9078, 9288, 13, 4102, 13, 270, 395, 62, 9945, 198 ]
3.5
228
# import dependencies from flask import Flask, jsonify, render_template, request, redirect from sqlalchemy.ext.automap import automap_base from sqlalchemy.orm import Session from sqlalchemy import create_engine, func, inspect import pandas as pd import numpy as np import datetime as dt # database setup using automap engine = create_engine("sqlite:///chi_db.sqlite") Base = automap_base() # reflect the tables Base.prepare(engine, reflect=True) # Save references to the tables AllCrime = Base.classes.all_crime # Create our session (link) from Python to the DB session = Session(engine) # initialize Flask app = Flask(__name__) app.config['SQLALCHEMY_DATABASE_URI'] = "sqlite:///chi_db.sqlite" @app.route("/crimehistory") if __name__ == "__main__": app.run(debug=True)
[ 2, 1330, 20086, 198, 6738, 42903, 1330, 46947, 11, 33918, 1958, 11, 8543, 62, 28243, 11, 2581, 11, 18941, 198, 6738, 44161, 282, 26599, 13, 2302, 13, 2306, 296, 499, 1330, 3557, 499, 62, 8692, 198, 6738, 44161, 282, 26599, 13, 579, 1330, 23575, 198, 6738, 44161, 282, 26599, 1330, 2251, 62, 18392, 11, 25439, 11, 10104, 220, 198, 198, 11748, 19798, 292, 355, 279, 67, 198, 11748, 299, 32152, 355, 45941, 220, 198, 11748, 4818, 8079, 355, 288, 83, 220, 220, 220, 220, 198, 198, 2, 6831, 9058, 1262, 3557, 499, 198, 18392, 796, 2251, 62, 18392, 7203, 25410, 578, 1378, 14, 11072, 62, 9945, 13, 25410, 578, 4943, 198, 198, 14881, 796, 3557, 499, 62, 8692, 3419, 198, 198, 2, 4079, 262, 8893, 198, 14881, 13, 46012, 533, 7, 18392, 11, 4079, 28, 17821, 8, 198, 198, 2, 12793, 10288, 284, 262, 8893, 198, 3237, 45580, 796, 7308, 13, 37724, 13, 439, 62, 28126, 198, 198, 2, 13610, 674, 6246, 357, 8726, 8, 422, 11361, 284, 262, 20137, 198, 29891, 796, 23575, 7, 18392, 8, 628, 198, 2, 41216, 46947, 198, 1324, 796, 46947, 7, 834, 3672, 834, 8, 198, 1324, 13, 11250, 17816, 17861, 1847, 3398, 3620, 56, 62, 35, 1404, 6242, 11159, 62, 47269, 20520, 796, 366, 25410, 578, 1378, 14, 11072, 62, 9945, 13, 25410, 578, 1, 198, 198, 31, 1324, 13, 38629, 7203, 14, 28126, 23569, 4943, 198, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 220, 598, 13, 5143, 7, 24442, 28, 17821, 8 ]
3.070039
257
# -*- coding: utf-8 -*- import os import sys from logging import getLogger from typing import Any, List, Tuple import cv2 import numpy as np import torch from bidi.algorithm import get_display from .detection import get_detector, get_textbox from .imgproc import loadImage from .recognition import get_recognizer, get_text from .settings import * from .utils import calculate_md5, download_and_unzip, get_image_list, get_paragraph, group_text_box if sys.version_info[0] == 2: from io import open from six.moves.urllib.request import urlretrieve from pathlib2 import Path else: from urllib.request import urlretrieve from pathlib import Path LOGGER = getLogger(__name__)
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 198, 11748, 28686, 198, 11748, 25064, 198, 6738, 18931, 1330, 651, 11187, 1362, 198, 6738, 19720, 1330, 4377, 11, 7343, 11, 309, 29291, 198, 198, 11748, 269, 85, 17, 198, 11748, 299, 32152, 355, 45941, 198, 11748, 28034, 198, 6738, 8406, 72, 13, 282, 42289, 1330, 651, 62, 13812, 198, 198, 6738, 764, 15255, 3213, 1330, 651, 62, 15255, 9250, 11, 651, 62, 5239, 3524, 198, 6738, 764, 9600, 36942, 1330, 3440, 5159, 198, 6738, 764, 26243, 653, 1330, 651, 62, 26243, 7509, 11, 651, 62, 5239, 198, 6738, 764, 33692, 1330, 1635, 198, 6738, 764, 26791, 1330, 15284, 62, 9132, 20, 11, 4321, 62, 392, 62, 403, 13344, 11, 651, 62, 9060, 62, 4868, 11, 651, 62, 20360, 11, 1448, 62, 5239, 62, 3524, 198, 198, 361, 25064, 13, 9641, 62, 10951, 58, 15, 60, 6624, 362, 25, 198, 220, 220, 220, 422, 33245, 1330, 1280, 198, 220, 220, 220, 422, 2237, 13, 76, 5241, 13, 333, 297, 571, 13, 25927, 1330, 19016, 1186, 30227, 198, 220, 220, 220, 422, 3108, 8019, 17, 1330, 10644, 198, 17772, 25, 198, 220, 220, 220, 422, 2956, 297, 571, 13, 25927, 1330, 19016, 1186, 30227, 198, 220, 220, 220, 422, 3108, 8019, 1330, 10644, 198, 198, 25294, 30373, 796, 651, 11187, 1362, 7, 834, 3672, 834, 8, 628, 198 ]
3.017316
231
# local from src.utils.images import ImagesHelper from src.dtypes import ImagesInner
[ 2, 1957, 198, 6738, 12351, 13, 26791, 13, 17566, 1330, 5382, 47429, 198, 6738, 12351, 13, 67, 19199, 1330, 5382, 818, 1008, 628 ]
3.73913
23
import sys import os sys.path.append(os.path.abspath(".")) sys.dont_write_bytecode = True __author__ = "bigfatnoob" import copy import signal import time import re import rpy2 import rpy2.robjects as robjects from rpy2 import rinterface from rpy2.robjects import pandas2ri from rpy2.robjects.functions import SignatureTranslatedFunction from collections import OrderedDict from analysis.helpers import constants as a_consts from analysis import execute from misconceptions.common import datatypes from misconceptions.rUtils import generator, dataframer from utils import cache pandas2ri.activate() rinterface.set_writeconsole_warnerror(None) rinterface.set_writeconsole_regular(None) r_source = robjects.r['source'] R_GEN_PREFIX = "gen_func_r_" FUNC_BODY_REGEX = r'function\s*\(.*?\)\s*((.|\s)+)' FUNCTION_STORE = "/Users/panzer/Raise/ProgramRepair/CodeSeer/code/src/main/python/expt/r_functions.pkl"
[ 11748, 25064, 198, 11748, 28686, 198, 198, 17597, 13, 6978, 13, 33295, 7, 418, 13, 6978, 13, 397, 2777, 776, 7203, 526, 4008, 198, 17597, 13, 67, 756, 62, 13564, 62, 26327, 8189, 796, 6407, 198, 198, 834, 9800, 834, 796, 366, 14261, 17359, 3919, 672, 1, 628, 198, 11748, 4866, 198, 11748, 6737, 198, 11748, 640, 198, 11748, 302, 198, 11748, 374, 9078, 17, 198, 11748, 374, 9078, 17, 13, 22609, 752, 82, 355, 3857, 752, 82, 198, 6738, 374, 9078, 17, 1330, 374, 39994, 198, 6738, 374, 9078, 17, 13, 22609, 752, 82, 1330, 19798, 292, 17, 380, 198, 6738, 374, 9078, 17, 13, 22609, 752, 82, 13, 12543, 2733, 1330, 34894, 8291, 17249, 22203, 198, 6738, 17268, 1330, 14230, 1068, 35, 713, 628, 198, 6738, 3781, 13, 16794, 364, 1330, 38491, 355, 257, 62, 1102, 6448, 198, 6738, 3781, 1330, 12260, 198, 6738, 45679, 13, 11321, 1330, 4818, 265, 9497, 198, 6738, 45679, 13, 81, 18274, 4487, 1330, 17301, 11, 1366, 19298, 263, 198, 6738, 3384, 4487, 1330, 12940, 198, 198, 79, 392, 292, 17, 380, 13, 39022, 3419, 198, 81, 39994, 13, 2617, 62, 13564, 41947, 62, 5767, 1008, 1472, 7, 14202, 8, 198, 81, 39994, 13, 2617, 62, 13564, 41947, 62, 16338, 7, 14202, 8, 198, 81, 62, 10459, 796, 3857, 752, 82, 13, 81, 17816, 10459, 20520, 198, 198, 49, 62, 35353, 62, 47, 31688, 10426, 796, 366, 5235, 62, 20786, 62, 81, 62, 1, 198, 42296, 34, 62, 33, 33076, 62, 31553, 6369, 796, 374, 6, 8818, 59, 82, 9, 59, 7, 15885, 30, 59, 19415, 82, 9, 19510, 13, 91, 59, 82, 8, 28988, 6, 198, 42296, 4177, 2849, 62, 2257, 6965, 796, 12813, 14490, 14, 6839, 9107, 14, 21762, 786, 14, 15167, 6207, 958, 14, 10669, 4653, 263, 14, 8189, 14, 10677, 14, 12417, 14, 29412, 14, 1069, 457, 14, 81, 62, 12543, 2733, 13, 79, 41582, 1, 628, 628, 628, 628, 628, 628, 628, 628, 628 ]
2.840491
326
from __future__ import annotations from typing import Match import pyjokes from bot.config import Config from bot.data import command from bot.data import esc from bot.data import format_msg @command('!joke', '!yoke')
[ 6738, 11593, 37443, 834, 1330, 37647, 198, 198, 6738, 19720, 1330, 13225, 198, 198, 11748, 12972, 73, 3369, 198, 198, 6738, 10214, 13, 11250, 1330, 17056, 198, 6738, 10214, 13, 7890, 1330, 3141, 198, 6738, 10214, 13, 7890, 1330, 3671, 198, 6738, 10214, 13, 7890, 1330, 5794, 62, 19662, 628, 198, 31, 21812, 10786, 0, 73, 2088, 3256, 705, 0, 88, 2088, 11537, 198 ]
3.484375
64
#!/usr/bin/env python import os import sys import logging import argparse import time import ngskit.barcodes as barcodes from ngskit.utils import fasta_tools, fastq_tools #import barcodes #from utils import fasta_tools, fastq_tools def trimming(demultiplexed_fastq, barcode, quality_threshold, trgt_len, output_fmt, output_folder): """Extract seq from the FASTAQ demultiplexed files. Trim barcodes + Constant Parameters ---------- demultiplexed_fastq : str Path of the demultiplexed fastq file barcode : barcode.object Barcode object wiht info about barcode and constant regions quality_threshold : int reading quality Threshold, any sequence will be trimmed under that level trgt_len : int length in bases of the target sequences. output_fmt : str Output format, by default fasta working_folder : str Output folder to save files with trimmed sequences Returns ------- output format save fasta or fastq Notes ----- Result str, in Fasta format >FASTAQ_ID+ length + Quality ATGATGGTAGTAGTAGAAAGATAGATGATGATGAT it will be storage: /data_path/Sequences/Sample_id.fasta """ # Init the output format, retunr a function logger = logging.getLogger(__name__) create_folder(output_folder) # if output_fmt == 'fasta': save_seq = fasta_tools.write_fasta_sequence filehdl_output = open(output_folder+'/'+barcode.id+'.fasta','a') logger.info('Output file: %s' % (output_folder+'/'+barcode.id+'.fasta')) if output_fmt == 'fastq': save_seq = fastq_tools.write_fastq_sequence filehdl_output = open(output_folder+'/'+barcode.id+'.fastq','a') logger.info('Output file: %s' % (output_folder+'/'+barcode.id+'.fastq')) # check barcodes integrity, peplength, fastq # barcodes_list = barcodes.read(barcode_file) # Stats nseqs = 0 ntrimed = 0 # Open Fastq file with open(demultiplexed_fastq, 'r') as read1: for read1_id in read1: # Read 4 by 4 # ID lane info, seq info etc # Read seq and Quality info read1_seq, read1_strand, read1_qual = [next(read1) for _ in range(3)] #Translate the Quality to a list of Integers qual = [ord(c)-33 for c in read1_qual.strip()] target_sequence = read1_seq[barcode.b1_len+barcode.c1_len: barcode.b1_len+barcode.c1_len+trgt_len] #remove the quality of the barcode and the constant region target_qual = qual[barcode.b1_len+barcode.c1_len: barcode.b1_len+barcode.c1_len+trgt_len] nseqs += 1 # Control try: avg_quality = sum(target_qual)/float(len(target_qual)) except ZeroDivisionError: logger.error('Sequence with no lenght or no score', exc_info=True) logger.error(read1_seq,read1_qual,target_qual,target_qual,trgt_len) sys.exit() if len(target_sequence) == trgt_len and avg_quality >= quality_threshold: ntrimed += 1 # save output format # attach Qavgm and length origin to the id seq_id = '{}_Q:{:.2f}_F:{}'.format(read1_id.strip(), avg_quality, trgt_len) save_seq([seq_id, target_sequence, target_qual], file_output=filehdl_output) # save else: # Stats pass logger.info('Read %i Sequences' % (nseqs)) logger.info('Trimmed %i Sequences' % (ntrimed)) filehdl_output.close() def get_options(): """Get arguments from command line. Parameters ---------- Returns ------- """ parser = argparse.ArgumentParser(description=""" Trimming Fastq sequences tool Usage Trimming: %prog -d [demultiplexed Folder]-b [BarCode_file.inp] -q [Quality threshold]\ -m [method] --output_fmt fasta """) parser.add_argument('-d', '--input_folder', action="store", dest="input_folder", default=False, help='Folder \ contains demultiplexed folders and files', required=True) parser.add_argument('-b', '--barcode_file', action="store", dest="barcode_file", default=False, help='File that \ contains barcodes and cosntant regions', required=True) parser.add_argument('-o', '--out_folder', action="store", dest="out_folder", default='Sequences', help='Output folder, called \ Sequences by default') # optional Arguments parser.add_argument('-m', '--trimming_method', action="store", dest="trimming_method", default='standard', type=str, choices=['standard', 'dynamic'], help="""standard Trimm sequences according barcode file configuration, ignores float window output files\n dynamic Trimm sequences using file lenght label, or output of float window demultiplex """) # Default 1 parser.add_argument('-q', '--quality', action="store", dest="quality", default=30, type=int, help='Quality reading threshold \ (default 30)') parser.add_argument('--output_fmt', help='Output format, default fasta', dest='output_fmt', default='fasta', action='store') parser.add_argument('--force-lenght', help='force a lenght and ignore file label, overwrites dynamic option', dest='force_lenght', default=False, action='store') options = parser.parse_args() return options def main(): """Pipeline Control. Parameters ---------- opts """ opts = get_options() # init logging time_stamp = time.ctime() seconds_time = int(time.time()) logging.basicConfig(level=logging.INFO, format='%(asctime)s - %(name)s - %(levelname)s - %(message)s', datefmt='%m-%d %H:%M', filename= opts.input_folder+ '/Logs/Trimming_'+opts.input_folder.rpartition('/')[-1]+'_'+opts.barcode_file+'_{}.log'.format(seconds_time), filemode='w') logger = logging.getLogger(__name__) logger.info('JOB START {4} {1} {2} {0} {3}'.format(*time_stamp.split())) # DEMULTIPLEX # Check inputs # Load Barcodes info # check barcodes integrity, peplength, fastq barcodes_list = barcodes.read(opts.barcode_file) # make output folder # Init Logging logger.info('#### TRIMMING ####') # incompatible logger.info('Method: {}'.format(opts.trimming_method)) logger.info('Quality threshold: {}'.format(opts.quality)) logger.info('Output format: {}'.format(opts.output_fmt)) # logger.info('Barcode file: {}'.format(opts.barcode_file)) logger.info('Input folder: {}'.format(opts.input_folder)) output_folder = opts.input_folder+'/'+opts.out_folder logger.info('Output folder: {}'.format(output_folder)) logger.info('Force target lenght: %s', opts.force_lenght) # foreach sample in barcodes for barcode in barcodes_list: logger.info('Triming Sample: {}'.format(barcode.id)) # folder must == sample id in the barcode # TODO: need to improve this line, it can be problematic working_folder = './'+opts.input_folder+'/'+barcode.id+'/' # get all fastq under the folder for demultiplexed_fastq in os.listdir(working_folder): # ToDO: only get fastq files #ToDo: only those I want (target lenthg) # if method is dynamic, get all the files in the folder if opts.trimming_method == 'dynamic': # To do # read lenght from the filename seq_length = get_length_label(demultiplexed_fastq) # modifiy target size # Skip empty vectors if seq_length: # modify output folder dir_emultiplexed_fastq = working_folder+demultiplexed_fastq # trim! trimming(dir_emultiplexed_fastq, barcode, quality_threshold= opts.quality, trgt_len= seq_length, output_fmt= opts.output_fmt, output_folder=output_folder+'_'+str(seq_length)) # raw_name = demultiplexed_file.replace('_F.fastq','') # read the length from the file elif opts.trimming_method == 'standard': # Trim time dir_emultiplexed_fastq = working_folder+demultiplexed_fastq # ignore files from dynamic target seq_length = get_length_label(demultiplexed_fastq) if seq_length != barcode.trgt_len: logger.info("file label and barcode lenght are different: %s SKIPPING FILE", demultiplexed_fastq) continue else: logger.info('Triming file: {}'.format(demultiplexed_fastq)) trimming(dir_emultiplexed_fastq, barcode, quality_threshold= opts.quality, trgt_len= barcode.trgt_len, output_fmt= opts.output_fmt, output_folder=output_folder) # add here, multilenghts trimmming elif opts.trimming_method == 'force': # Todo: this option can be useful in the future continue else: # unknow method pass # DONE time_stamp = time.ctime() logger.info('JOB ENDS {4} {1} {2} {0} {3}'.format(*time_stamp.split())) return # def main(): # # Read argtments # opts = get_options() # # init logging # time_stamp = time.ctime() # logging.basicConfig(level=logging.INFO, # format='%(asctime)s - %(name)s - %(levelname)s - %(message)s', # datefmt='%m-%d %H:%M', # filename= 'Trimming_'+opts.input_folder+'_'+opts.barcode_file+'_{4}_{1}_{2}_{0}_{3}.log'.format(*time_stamp.split()), # filemode='w') # logger = logging.getLogger(__name__) # logger.info('JOB START {4} {1} {2} {0} {3}'.format(*time_stamp.split())) # # DEMULTIPLEX # workflow(opts) # # DONE # time_stamp = time.ctime() # logger.info('JOB ENDS {4} {1} {2} {0} {3}'.format(*time_stamp.split())) if __name__ == '__main__': main()
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 198, 11748, 28686, 198, 11748, 25064, 198, 11748, 18931, 198, 11748, 1822, 29572, 198, 11748, 640, 198, 198, 11748, 23370, 8135, 270, 13, 65, 5605, 4147, 355, 2318, 40148, 198, 6738, 23370, 8135, 270, 13, 26791, 1330, 3049, 64, 62, 31391, 11, 3049, 80, 62, 31391, 198, 198, 2, 11748, 2318, 40148, 198, 2, 6738, 3384, 4487, 1330, 3049, 64, 62, 31391, 11, 3049, 80, 62, 31391, 628, 198, 4299, 15797, 2229, 7, 9536, 586, 2480, 87, 276, 62, 7217, 80, 11, 2318, 8189, 11, 3081, 62, 400, 10126, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 491, 13655, 62, 11925, 11, 5072, 62, 69, 16762, 11, 5072, 62, 43551, 2599, 198, 220, 220, 220, 37227, 11627, 974, 33756, 422, 262, 376, 1921, 5603, 48, 1357, 586, 2480, 87, 276, 3696, 13, 833, 320, 2318, 40148, 1343, 20217, 628, 220, 220, 220, 40117, 198, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 1357, 586, 2480, 87, 276, 62, 7217, 80, 1058, 965, 198, 220, 220, 220, 220, 220, 220, 220, 10644, 286, 262, 1357, 586, 2480, 87, 276, 3049, 80, 2393, 198, 220, 220, 220, 2318, 8189, 1058, 2318, 8189, 13, 15252, 198, 220, 220, 220, 220, 220, 220, 220, 2409, 8189, 2134, 45967, 4352, 7508, 546, 2318, 8189, 290, 6937, 7652, 198, 220, 220, 220, 3081, 62, 400, 10126, 1058, 493, 198, 220, 220, 220, 220, 220, 220, 220, 3555, 3081, 536, 10126, 11, 597, 8379, 481, 307, 40325, 739, 326, 1241, 198, 220, 220, 220, 491, 13655, 62, 11925, 1058, 493, 198, 220, 220, 220, 220, 220, 220, 220, 4129, 287, 12536, 286, 262, 2496, 16311, 13, 198, 220, 220, 220, 5072, 62, 69, 16762, 1058, 220, 965, 198, 220, 220, 220, 220, 220, 220, 220, 25235, 5794, 11, 416, 4277, 3049, 64, 198, 220, 220, 220, 1762, 62, 43551, 1058, 965, 198, 220, 220, 220, 220, 220, 220, 220, 25235, 9483, 284, 3613, 3696, 351, 40325, 16311, 628, 220, 220, 220, 16409, 198, 220, 220, 220, 35656, 198, 220, 220, 220, 5072, 5794, 3613, 3049, 64, 393, 3049, 80, 628, 198, 220, 220, 220, 11822, 198, 220, 220, 220, 37404, 628, 220, 220, 220, 25414, 965, 11, 287, 12549, 64, 5794, 198, 220, 220, 220, 1875, 37, 1921, 5603, 48, 62, 2389, 10, 4129, 1343, 14156, 198, 220, 220, 220, 5161, 38, 1404, 11190, 42197, 42197, 42197, 3838, 4760, 1404, 4760, 1404, 38, 1404, 38, 1404, 38, 1404, 198, 220, 220, 220, 340, 481, 307, 6143, 25, 198, 220, 220, 220, 1220, 7890, 62, 6978, 14, 44015, 3007, 14, 36674, 62, 312, 13, 7217, 64, 628, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 1303, 44707, 262, 5072, 5794, 11, 1005, 403, 81, 257, 2163, 198, 220, 220, 220, 49706, 796, 18931, 13, 1136, 11187, 1362, 7, 834, 3672, 834, 8, 198, 220, 220, 220, 2251, 62, 43551, 7, 22915, 62, 43551, 8, 198, 220, 220, 220, 1303, 198, 220, 220, 220, 611, 5072, 62, 69, 16762, 6624, 705, 7217, 64, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 3613, 62, 41068, 796, 3049, 64, 62, 31391, 13, 13564, 62, 7217, 64, 62, 43167, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 71, 25404, 62, 22915, 796, 1280, 7, 22915, 62, 43551, 10, 26488, 6, 10, 65, 5605, 1098, 13, 312, 10, 4458, 7217, 64, 41707, 64, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 10786, 26410, 2393, 25, 4064, 82, 6, 4064, 357, 22915, 62, 43551, 10, 26488, 6, 10, 65, 5605, 1098, 13, 312, 10, 4458, 7217, 64, 6, 4008, 628, 220, 220, 220, 611, 5072, 62, 69, 16762, 6624, 705, 7217, 80, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 3613, 62, 41068, 796, 3049, 80, 62, 31391, 13, 13564, 62, 7217, 80, 62, 43167, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 71, 25404, 62, 22915, 796, 1280, 7, 22915, 62, 43551, 10, 26488, 6, 10, 65, 5605, 1098, 13, 312, 10, 4458, 7217, 80, 41707, 64, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 10786, 26410, 2393, 25, 4064, 82, 6, 4064, 357, 22915, 62, 43551, 10, 26488, 6, 10, 65, 5605, 1098, 13, 312, 10, 4458, 7217, 80, 6, 4008, 198, 220, 220, 220, 1303, 2198, 2318, 40148, 11540, 11, 613, 489, 3286, 11, 3049, 80, 198, 220, 220, 220, 1303, 2318, 40148, 62, 4868, 796, 2318, 40148, 13, 961, 7, 65, 5605, 1098, 62, 7753, 8, 628, 220, 220, 220, 1303, 20595, 198, 220, 220, 220, 299, 41068, 82, 796, 657, 198, 220, 220, 220, 299, 2213, 320, 276, 796, 657, 198, 220, 220, 220, 1303, 4946, 12549, 80, 2393, 198, 220, 220, 220, 351, 1280, 7, 9536, 586, 2480, 87, 276, 62, 7217, 80, 11, 705, 81, 11537, 355, 1100, 16, 25, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1100, 16, 62, 312, 287, 1100, 16, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 4149, 604, 416, 604, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 4522, 11193, 7508, 11, 33756, 7508, 3503, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 4149, 33756, 290, 14156, 7508, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1100, 16, 62, 41068, 11, 1100, 16, 62, 2536, 392, 11, 1100, 16, 62, 13255, 796, 685, 19545, 7, 961, 16, 8, 329, 4808, 287, 2837, 7, 18, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 8291, 17660, 262, 14156, 284, 257, 1351, 286, 15995, 364, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4140, 796, 685, 585, 7, 66, 13219, 2091, 329, 269, 287, 1100, 16, 62, 13255, 13, 36311, 3419, 60, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2496, 62, 43167, 796, 1100, 16, 62, 41068, 58, 65, 5605, 1098, 13, 65, 16, 62, 11925, 10, 65, 5605, 1098, 13, 66, 16, 62, 11925, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2318, 8189, 13, 65, 16, 62, 11925, 10, 65, 5605, 1098, 13, 66, 16, 62, 11925, 10, 2213, 13655, 62, 11925, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 28956, 262, 3081, 286, 262, 2318, 8189, 290, 262, 6937, 3814, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2496, 62, 13255, 796, 4140, 58, 65, 5605, 1098, 13, 65, 16, 62, 11925, 10, 65, 5605, 1098, 13, 66, 16, 62, 11925, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2318, 8189, 13, 65, 16, 62, 11925, 10, 65, 5605, 1098, 13, 66, 16, 62, 11925, 10, 2213, 13655, 62, 11925, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 299, 41068, 82, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 6779, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 42781, 62, 13237, 796, 2160, 7, 16793, 62, 13255, 20679, 22468, 7, 11925, 7, 16793, 62, 13255, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 12169, 24095, 1166, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 18224, 10786, 44015, 594, 351, 645, 18896, 456, 83, 393, 645, 4776, 3256, 2859, 62, 10951, 28, 17821, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 18224, 7, 961, 16, 62, 41068, 11, 961, 16, 62, 13255, 11, 16793, 62, 13255, 11, 16793, 62, 13255, 11, 2213, 13655, 62, 11925, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25064, 13, 37023, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 16793, 62, 43167, 8, 6624, 491, 13655, 62, 11925, 290, 42781, 62, 13237, 18189, 3081, 62, 400, 10126, 25, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 299, 2213, 320, 276, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3613, 5072, 5794, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 10199, 1195, 615, 39870, 290, 4129, 8159, 284, 262, 4686, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 33756, 62, 312, 796, 705, 90, 92, 62, 48, 29164, 25, 13, 17, 69, 92, 62, 37, 29164, 92, 4458, 18982, 7, 961, 16, 62, 312, 13, 36311, 22784, 42781, 62, 13237, 11, 491, 13655, 62, 11925, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3613, 62, 41068, 26933, 41068, 62, 312, 11, 2496, 62, 43167, 11, 2496, 62, 13255, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2393, 62, 22915, 28, 7753, 71, 25404, 62, 22915, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3613, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 20595, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1208, 628, 220, 220, 220, 49706, 13, 10951, 10786, 5569, 4064, 72, 24604, 3007, 6, 4064, 357, 77, 41068, 82, 4008, 198, 220, 220, 220, 49706, 13, 10951, 10786, 2898, 320, 1150, 4064, 72, 24604, 3007, 6, 4064, 357, 429, 3036, 276, 4008, 198, 220, 220, 220, 2393, 71, 25404, 62, 22915, 13, 19836, 3419, 628, 198, 198, 4299, 651, 62, 25811, 33529, 198, 220, 220, 220, 37227, 3855, 7159, 422, 3141, 1627, 13, 628, 220, 220, 220, 40117, 198, 220, 220, 220, 24200, 438, 628, 220, 220, 220, 16409, 198, 220, 220, 220, 35656, 628, 220, 220, 220, 37227, 198, 220, 220, 220, 30751, 796, 1822, 29572, 13, 28100, 1713, 46677, 7, 11213, 2625, 15931, 198, 220, 220, 220, 833, 27428, 12549, 80, 16311, 2891, 628, 220, 220, 220, 29566, 833, 27428, 25, 198, 220, 220, 220, 4064, 1676, 70, 532, 67, 685, 9536, 586, 2480, 87, 276, 48107, 45297, 65, 685, 10374, 10669, 62, 7753, 13, 259, 79, 60, 220, 532, 80, 685, 35013, 11387, 60, 59, 198, 220, 220, 220, 532, 76, 685, 24396, 60, 1377, 22915, 62, 69, 16762, 3049, 64, 628, 220, 220, 220, 13538, 4943, 628, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 12, 67, 3256, 705, 438, 15414, 62, 43551, 3256, 2223, 2625, 8095, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2244, 2625, 15414, 62, 43551, 1600, 4277, 28, 25101, 11, 1037, 11639, 41092, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4909, 1357, 586, 2480, 87, 276, 24512, 290, 3696, 3256, 2672, 28, 17821, 8, 628, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 12, 65, 3256, 705, 438, 65, 5605, 1098, 62, 7753, 3256, 2223, 2625, 8095, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2244, 2625, 65, 5605, 1098, 62, 7753, 1600, 4277, 28, 25101, 11, 1037, 11639, 8979, 326, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4909, 2318, 40148, 290, 8615, 429, 415, 7652, 3256, 2672, 28, 17821, 8, 628, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 12, 78, 3256, 705, 438, 448, 62, 43551, 3256, 2223, 2625, 8095, 1600, 2244, 2625, 448, 62, 43551, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4277, 11639, 44015, 3007, 3256, 1037, 11639, 26410, 9483, 11, 1444, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 24604, 3007, 416, 4277, 11537, 628, 220, 220, 220, 1303, 11902, 20559, 2886, 198, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 12, 76, 3256, 705, 438, 2213, 27428, 62, 24396, 3256, 2223, 2625, 8095, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2244, 2625, 2213, 27428, 62, 24396, 1600, 4277, 11639, 20307, 3256, 2099, 28, 2536, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7747, 28, 17816, 20307, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 67, 28995, 6, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1037, 2625, 15931, 20307, 833, 8608, 16311, 1864, 2318, 8189, 2393, 8398, 11, 24245, 12178, 4324, 5072, 3696, 59, 77, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8925, 220, 833, 8608, 16311, 1262, 2393, 18896, 456, 83, 6167, 11, 393, 5072, 286, 12178, 4324, 1357, 586, 2480, 87, 13538, 4943, 198, 220, 220, 220, 1303, 15161, 352, 198, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 12, 80, 3256, 705, 438, 13237, 3256, 2223, 2625, 8095, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2244, 2625, 13237, 1600, 4277, 28, 1270, 11, 2099, 28, 600, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1037, 11639, 35013, 3555, 11387, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 12286, 1542, 8, 11537, 628, 198, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 438, 22915, 62, 69, 16762, 3256, 1037, 11639, 26410, 5794, 11, 4277, 3049, 64, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2244, 11639, 22915, 62, 69, 16762, 3256, 4277, 11639, 7217, 64, 3256, 2223, 11639, 8095, 11537, 628, 198, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 438, 3174, 12, 11925, 456, 83, 3256, 1037, 11639, 3174, 257, 18896, 456, 83, 290, 8856, 2393, 6167, 11, 6993, 23156, 8925, 3038, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2244, 11639, 3174, 62, 11925, 456, 83, 3256, 4277, 28, 25101, 11, 2223, 11639, 8095, 11537, 628, 628, 198, 220, 220, 220, 3689, 796, 30751, 13, 29572, 62, 22046, 3419, 628, 220, 220, 220, 1441, 3689, 198, 198, 4299, 1388, 33529, 198, 220, 220, 220, 37227, 47, 541, 4470, 6779, 13, 628, 220, 220, 220, 40117, 198, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 2172, 82, 628, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 2172, 82, 796, 651, 62, 25811, 3419, 628, 220, 220, 220, 1303, 2315, 18931, 198, 220, 220, 220, 640, 62, 301, 696, 796, 640, 13, 310, 524, 3419, 198, 220, 220, 220, 4201, 62, 2435, 796, 493, 7, 2435, 13, 2435, 28955, 198, 220, 220, 220, 18931, 13, 35487, 16934, 7, 5715, 28, 6404, 2667, 13, 10778, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5794, 11639, 4, 7, 292, 310, 524, 8, 82, 532, 4064, 7, 3672, 8, 82, 532, 4064, 7, 5715, 3672, 8, 82, 532, 4064, 7, 20500, 8, 82, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3128, 69, 16762, 11639, 4, 76, 12, 4, 67, 4064, 39, 25, 4, 44, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 29472, 28, 220, 2172, 82, 13, 15414, 62, 43551, 10, 31051, 11187, 82, 14, 2898, 27428, 62, 6, 10, 404, 912, 13, 15414, 62, 43551, 13, 81, 3911, 653, 10786, 14, 11537, 58, 12, 16, 48688, 6, 62, 6, 10, 404, 912, 13, 65, 5605, 1098, 62, 7753, 10, 6, 23330, 27422, 6404, 4458, 18982, 7, 43012, 62, 2435, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2393, 14171, 11639, 86, 11537, 198, 220, 220, 220, 49706, 796, 18931, 13, 1136, 11187, 1362, 7, 834, 3672, 834, 8, 628, 220, 220, 220, 49706, 13, 10951, 10786, 41, 9864, 33303, 1391, 19, 92, 1391, 16, 92, 1391, 17, 92, 1391, 15, 92, 1391, 18, 92, 4458, 18982, 46491, 2435, 62, 301, 696, 13, 35312, 3419, 4008, 198, 220, 220, 220, 1303, 40101, 16724, 4061, 2538, 55, 198, 220, 220, 220, 1303, 6822, 17311, 198, 220, 220, 220, 1303, 8778, 2409, 40148, 7508, 198, 220, 220, 220, 1303, 2198, 2318, 40148, 11540, 11, 613, 489, 3286, 11, 3049, 80, 198, 220, 220, 220, 2318, 40148, 62, 4868, 796, 2318, 40148, 13, 961, 7, 404, 912, 13, 65, 5605, 1098, 62, 7753, 8, 198, 220, 220, 220, 1303, 787, 5072, 9483, 198, 220, 220, 220, 1303, 44707, 5972, 2667, 198, 220, 220, 220, 49706, 13, 10951, 10786, 4242, 7579, 3955, 44, 2751, 1303, 21017, 11537, 198, 220, 220, 220, 1303, 27294, 628, 198, 220, 220, 220, 49706, 13, 10951, 10786, 17410, 25, 23884, 4458, 18982, 7, 404, 912, 13, 2213, 27428, 62, 24396, 4008, 198, 220, 220, 220, 49706, 13, 10951, 10786, 35013, 11387, 25, 23884, 4458, 18982, 7, 404, 912, 13, 13237, 4008, 198, 220, 220, 220, 49706, 13, 10951, 10786, 26410, 5794, 25, 23884, 4458, 18982, 7, 404, 912, 13, 22915, 62, 69, 16762, 4008, 198, 220, 220, 220, 1303, 198, 220, 220, 220, 49706, 13, 10951, 10786, 33, 5605, 1098, 2393, 25, 23884, 4458, 18982, 7, 404, 912, 13, 65, 5605, 1098, 62, 7753, 4008, 198, 220, 220, 220, 49706, 13, 10951, 10786, 20560, 9483, 25, 23884, 4458, 18982, 7, 404, 912, 13, 15414, 62, 43551, 4008, 198, 220, 220, 220, 5072, 62, 43551, 796, 2172, 82, 13, 15414, 62, 43551, 10, 26488, 6, 10, 404, 912, 13, 448, 62, 43551, 198, 220, 220, 220, 49706, 13, 10951, 10786, 26410, 9483, 25, 23884, 4458, 18982, 7, 22915, 62, 43551, 4008, 198, 220, 220, 220, 49706, 13, 10951, 10786, 10292, 2496, 18896, 456, 83, 25, 4064, 82, 3256, 220, 2172, 82, 13, 3174, 62, 11925, 456, 83, 8, 628, 198, 220, 220, 220, 1303, 1674, 620, 6291, 287, 2318, 40148, 198, 220, 220, 220, 329, 2318, 8189, 287, 2318, 40148, 62, 4868, 25, 198, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 10786, 2898, 320, 278, 27565, 25, 23884, 4458, 18982, 7, 65, 5605, 1098, 13, 312, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 9483, 1276, 6624, 6291, 4686, 287, 262, 2318, 8189, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 16926, 46, 25, 761, 284, 2987, 428, 1627, 11, 340, 460, 307, 15833, 198, 220, 220, 220, 220, 220, 220, 220, 1762, 62, 43551, 796, 705, 19571, 6, 10, 404, 912, 13, 15414, 62, 43551, 10, 26488, 6, 10, 65, 5605, 1098, 13, 312, 10, 26488, 6, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 651, 477, 3049, 80, 739, 262, 9483, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1357, 586, 2480, 87, 276, 62, 7217, 80, 287, 28686, 13, 4868, 15908, 7, 16090, 62, 43551, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1675, 18227, 25, 691, 651, 3049, 80, 3696, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2514, 5211, 25, 691, 883, 314, 765, 357, 16793, 300, 7944, 70, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 611, 2446, 318, 8925, 11, 651, 477, 262, 3696, 287, 262, 9483, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2172, 82, 13, 2213, 27428, 62, 24396, 6624, 705, 67, 28995, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1675, 466, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1100, 18896, 456, 83, 422, 262, 29472, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 33756, 62, 13664, 796, 651, 62, 13664, 62, 18242, 7, 9536, 586, 2480, 87, 276, 62, 7217, 80, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 953, 361, 7745, 2496, 2546, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 32214, 6565, 30104, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 33756, 62, 13664, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 13096, 5072, 9483, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26672, 62, 368, 586, 2480, 87, 276, 62, 7217, 80, 796, 1762, 62, 43551, 10, 9536, 586, 2480, 87, 276, 62, 7217, 80, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 15797, 0, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15797, 2229, 7, 15908, 62, 368, 586, 2480, 87, 276, 62, 7217, 80, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2318, 8189, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3081, 62, 400, 10126, 28, 2172, 82, 13, 13237, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 491, 13655, 62, 11925, 28, 33756, 62, 13664, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5072, 62, 69, 16762, 28, 2172, 82, 13, 22915, 62, 69, 16762, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5072, 62, 43551, 28, 22915, 62, 43551, 10, 6, 62, 6, 10, 2536, 7, 41068, 62, 13664, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 8246, 62, 3672, 796, 1357, 586, 2480, 87, 276, 62, 7753, 13, 33491, 10786, 62, 37, 13, 7217, 80, 3256, 7061, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1100, 262, 4129, 422, 262, 2393, 628, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1288, 361, 2172, 82, 13, 2213, 27428, 62, 24396, 6624, 705, 20307, 10354, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 833, 320, 640, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26672, 62, 368, 586, 2480, 87, 276, 62, 7217, 80, 796, 1762, 62, 43551, 10, 9536, 586, 2480, 87, 276, 62, 7217, 80, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 8856, 3696, 422, 8925, 2496, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 33756, 62, 13664, 796, 651, 62, 13664, 62, 18242, 7, 9536, 586, 2480, 87, 276, 62, 7217, 80, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 33756, 62, 13664, 14512, 2318, 8189, 13, 2213, 13655, 62, 11925, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 7203, 7753, 6167, 290, 2318, 8189, 18896, 456, 83, 389, 1180, 25, 220, 4064, 82, 14277, 31444, 2751, 45811, 1600, 1357, 586, 2480, 87, 276, 62, 7217, 80, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 10786, 2898, 320, 278, 2393, 25, 23884, 4458, 18982, 7, 9536, 586, 2480, 87, 276, 62, 7217, 80, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15797, 2229, 7, 15908, 62, 368, 586, 2480, 87, 276, 62, 7217, 80, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2318, 8189, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3081, 62, 400, 10126, 28, 2172, 82, 13, 13237, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 491, 13655, 62, 11925, 28, 2318, 8189, 13, 2213, 13655, 62, 11925, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5072, 62, 69, 16762, 28, 2172, 82, 13, 22915, 62, 69, 16762, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5072, 62, 43551, 28, 22915, 62, 43551, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 751, 994, 11, 1963, 346, 268, 456, 912, 491, 8608, 2229, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1288, 361, 2172, 82, 13, 2213, 27428, 62, 24396, 6624, 705, 3174, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 309, 24313, 25, 428, 3038, 460, 307, 4465, 287, 262, 2003, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 220, 39472, 2446, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1208, 198, 220, 220, 220, 220, 628, 220, 220, 220, 1303, 360, 11651, 198, 220, 220, 220, 640, 62, 301, 696, 796, 640, 13, 310, 524, 3419, 198, 220, 220, 220, 49706, 13, 10951, 10786, 41, 9864, 12964, 5258, 1391, 19, 92, 1391, 16, 92, 1391, 17, 92, 1391, 15, 92, 1391, 18, 92, 4458, 18982, 46491, 2435, 62, 301, 696, 13, 35312, 3419, 4008, 198, 220, 220, 220, 1441, 198, 2, 825, 1388, 33529, 198, 2, 220, 220, 220, 220, 1303, 4149, 1822, 83, 902, 198, 2, 220, 220, 220, 220, 2172, 82, 796, 651, 62, 25811, 3419, 198, 198, 2, 220, 220, 220, 220, 1303, 2315, 18931, 198, 2, 220, 220, 220, 220, 640, 62, 301, 696, 796, 640, 13, 310, 524, 3419, 198, 2, 220, 220, 220, 220, 18931, 13, 35487, 16934, 7, 5715, 28, 6404, 2667, 13, 10778, 11, 198, 2, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5794, 11639, 4, 7, 292, 310, 524, 8, 82, 532, 4064, 7, 3672, 8, 82, 532, 4064, 7, 5715, 3672, 8, 82, 532, 4064, 7, 20500, 8, 82, 3256, 198, 2, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3128, 69, 16762, 11639, 4, 76, 12, 4, 67, 4064, 39, 25, 4, 44, 3256, 198, 2, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 29472, 28, 705, 2898, 27428, 62, 6, 10, 404, 912, 13, 15414, 62, 43551, 10, 6, 62, 6, 10, 404, 912, 13, 65, 5605, 1098, 62, 7753, 10, 6, 23330, 19, 92, 23330, 16, 92, 23330, 17, 92, 23330, 15, 92, 23330, 18, 27422, 6404, 4458, 18982, 46491, 2435, 62, 301, 696, 13, 35312, 3419, 828, 198, 2, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2393, 14171, 11639, 86, 11537, 198, 2, 220, 220, 220, 220, 49706, 796, 18931, 13, 1136, 11187, 1362, 7, 834, 3672, 834, 8, 198, 198, 2, 220, 220, 220, 220, 49706, 13, 10951, 10786, 41, 9864, 33303, 1391, 19, 92, 1391, 16, 92, 1391, 17, 92, 1391, 15, 92, 1391, 18, 92, 4458, 18982, 46491, 2435, 62, 301, 696, 13, 35312, 3419, 4008, 198, 2, 220, 220, 220, 220, 1303, 40101, 16724, 4061, 2538, 55, 198, 2, 220, 220, 220, 220, 30798, 7, 404, 912, 8, 198, 2, 220, 220, 220, 220, 1303, 360, 11651, 198, 2, 220, 220, 220, 220, 640, 62, 301, 696, 796, 640, 13, 310, 524, 3419, 198, 2, 220, 220, 220, 220, 49706, 13, 10951, 10786, 41, 9864, 12964, 5258, 1391, 19, 92, 1391, 16, 92, 1391, 17, 92, 1391, 15, 92, 1391, 18, 92, 4458, 18982, 46491, 2435, 62, 301, 696, 13, 35312, 3419, 4008, 628, 198, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 1388, 3419 ]
2.057078
5,326
from checkov.yaml_doc.base_registry import Registry registry = Registry()
[ 6738, 2198, 709, 13, 88, 43695, 62, 15390, 13, 8692, 62, 2301, 4592, 1330, 33432, 198, 198, 2301, 4592, 796, 33432, 3419, 198 ]
3.26087
23
""" Internal api methods for current service. Example: from anthill.platform.api.internal import as_internal, InternalAPI @as_internal() async def your_internal_api_method(api: InternalAPI, *params, **options): # current_service = api.service ... """ from anthill.platform.api.internal import as_internal, InternalAPI @as_internal() @as_internal()
[ 37811, 198, 37693, 40391, 5050, 329, 1459, 2139, 13, 198, 198, 16281, 25, 628, 220, 220, 220, 422, 26794, 359, 13, 24254, 13, 15042, 13, 32538, 1330, 355, 62, 32538, 11, 18628, 17614, 628, 220, 220, 220, 2488, 292, 62, 32538, 3419, 198, 220, 220, 220, 30351, 825, 534, 62, 32538, 62, 15042, 62, 24396, 7, 15042, 25, 18628, 17614, 11, 1635, 37266, 11, 12429, 25811, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 1459, 62, 15271, 796, 40391, 13, 15271, 198, 220, 220, 220, 220, 220, 220, 220, 2644, 198, 37811, 198, 6738, 26794, 359, 13, 24254, 13, 15042, 13, 32538, 1330, 355, 62, 32538, 11, 18628, 17614, 628, 198, 31, 292, 62, 32538, 3419, 628, 198, 31, 292, 62, 32538, 3419, 198 ]
3.039683
126
#!/usr/bin/env mdl # -*- coding: utf-8 -*- # ======================================= # File Name : # Purpose : # Creation Date : # Last Modified : # Created By : sunpeiqin # ======================================= import os import sys import argparse import magic import keyword import importlib import collections import re import tabulate import numpy as np import tensorflow as tf def import_python_source_as_module(fpath, mod_name=None): """ import a python source as a module; its directory is added to ``sys.path`` during importing, and ``sys.path`` would be restored afterwards. Modules newly loaded in the same directory as *fpath* would have an attribute `__dynamic_loaded_by_spq__` set to 1, and fpath itself would have that value set to 2. :type fpath: str :param fpath: python source file path :type mod_name: str or None :param mod_name: target module name; if it exists in `sys.modules`, the corresponding module would be directly returned; otherwise it is added to ``sys.modules`` afterward. If it is None, module name would be derived from *fpath* by replacing '/' to '.' and special chars to '_' """ fpath = os.path.realpath(fpath) if mod_name is None: # automatically generate mod_name mod_name = [] for i in fpath.split(os.path.sep): v = '' for j in i: if not j.isidentifier() and not j.isdigit(): j = '_' v += j if not v.isidentifier() or keyword.iskeyword(v): v = '_' + v assert v.isidentifier() and not keyword.iskeyword(v), ( 'failed to convert to python identifier: in={} out={}'.format( i, v)) mod_name.append(v) mod_name = '_'.join(mod_name) if mod_name in sys.modules: return sys.modules[mod_name] old_path = sys.path[:] mod_dir = os.path.dirname(fpath) sys.path.append(mod_dir) old_mod_names = set(sys.modules.keys()) try: final_mod = importlib.machinery.SourceFileLoader( mod_name, fpath).load_module() finally: sys.path.remove(mod_dir) sys.modules[mod_name] = final_mod for name, mod in list(sys.modules.items()): if name in old_mod_names: continue try: fpath = getattr(mod, '__file__', None) except Exception as exc: print('caught exception {} while trying to get ' 'read __file__ attr from {}'.format(repr(exc), name)) continue if fpath is not None and ( os.path.dirname(os.path.realpath(fpath)).startswith(mod_dir)): try: mod.__dynamic_loaded_by_spq__ = 1 except Exception: pass try: final_mod.__dynamic_loaded_by_spq__ = 2 except Exception: pass return final_mod def load_network(network, get_kwargs={}): '''load a model defined by model.py''' network = os.path.realpath(network) mf = magic.from_file(network, mime=True) mf = mf.decode('utf-8') if isinstance(mf, bytes) else mf if mf.startswith('text'): return import_python_source_as_module(network).Model().build() else: print('Only supports a model.py which defines a network') exit(0) if __name__ == "__main__": actions = [InfoAction,] parser = argparse.ArgumentParser() parser.add_argument('network') subparsers = parser.add_subparsers(help='action') for i in actions: i.add_subparser(subparsers) args = parser.parse_args() # load network load_network(args.network) if hasattr(args, 'func'): args.func(args) else: print('no action given')
[ 2, 48443, 14629, 14, 8800, 14, 24330, 285, 25404, 198, 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 2, 46111, 50155, 198, 2, 9220, 6530, 1058, 198, 2, 32039, 1058, 198, 2, 21582, 7536, 1058, 198, 2, 4586, 40499, 1058, 198, 2, 15622, 2750, 1058, 4252, 431, 25011, 259, 198, 2, 46111, 50155, 198, 198, 11748, 28686, 198, 11748, 25064, 198, 11748, 1822, 29572, 198, 11748, 5536, 198, 11748, 21179, 198, 11748, 1330, 8019, 198, 11748, 17268, 198, 11748, 302, 198, 11748, 7400, 5039, 198, 11748, 299, 32152, 355, 45941, 198, 198, 11748, 11192, 273, 11125, 355, 48700, 628, 198, 4299, 1330, 62, 29412, 62, 10459, 62, 292, 62, 21412, 7, 69, 6978, 11, 953, 62, 3672, 28, 14202, 2599, 198, 220, 220, 220, 37227, 1330, 257, 21015, 2723, 355, 257, 8265, 26, 663, 8619, 318, 2087, 284, 198, 220, 220, 220, 7559, 17597, 13, 6978, 15506, 1141, 33332, 11, 290, 7559, 17597, 13, 6978, 15506, 561, 307, 15032, 198, 220, 220, 220, 12979, 13, 628, 220, 220, 220, 3401, 5028, 8308, 9639, 287, 262, 976, 8619, 355, 1635, 69, 6978, 9, 561, 423, 281, 198, 220, 220, 220, 11688, 4600, 834, 67, 28995, 62, 14578, 62, 1525, 62, 2777, 80, 834, 63, 900, 284, 352, 11, 290, 277, 6978, 2346, 561, 198, 220, 220, 220, 423, 326, 1988, 900, 284, 362, 13, 628, 220, 220, 220, 1058, 4906, 277, 6978, 25, 965, 198, 220, 220, 220, 1058, 17143, 277, 6978, 25, 21015, 2723, 2393, 3108, 198, 220, 220, 220, 1058, 4906, 953, 62, 3672, 25, 965, 393, 6045, 198, 220, 220, 220, 1058, 17143, 953, 62, 3672, 25, 2496, 8265, 1438, 26, 611, 340, 7160, 287, 4600, 17597, 13, 18170, 47671, 262, 198, 220, 220, 220, 220, 220, 220, 220, 11188, 8265, 561, 307, 3264, 4504, 26, 4306, 340, 318, 2087, 198, 220, 220, 220, 220, 220, 220, 220, 284, 7559, 17597, 13, 18170, 15506, 20875, 13, 1002, 340, 318, 6045, 11, 8265, 1438, 561, 307, 198, 220, 220, 220, 220, 220, 220, 220, 10944, 422, 1635, 69, 6978, 9, 416, 13586, 31051, 6, 284, 705, 2637, 290, 2041, 34534, 284, 705, 62, 6, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 277, 6978, 796, 28686, 13, 6978, 13, 5305, 6978, 7, 69, 6978, 8, 628, 220, 220, 220, 611, 953, 62, 3672, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 6338, 7716, 953, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 953, 62, 3672, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 277, 6978, 13, 35312, 7, 418, 13, 6978, 13, 325, 79, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 410, 796, 10148, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 474, 287, 1312, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 474, 13, 271, 738, 7483, 3419, 290, 407, 474, 13, 9409, 328, 270, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 474, 796, 705, 62, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 410, 15853, 474, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 410, 13, 271, 738, 7483, 3419, 393, 21179, 13, 271, 2539, 4775, 7, 85, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 410, 796, 705, 62, 6, 1343, 410, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6818, 410, 13, 271, 738, 7483, 3419, 290, 407, 21179, 13, 271, 2539, 4775, 7, 85, 828, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 47904, 284, 10385, 284, 21015, 27421, 25, 287, 34758, 92, 503, 34758, 92, 4458, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 11, 410, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 953, 62, 3672, 13, 33295, 7, 85, 8, 198, 220, 220, 220, 220, 220, 220, 220, 953, 62, 3672, 796, 705, 62, 4458, 22179, 7, 4666, 62, 3672, 8, 628, 220, 220, 220, 611, 953, 62, 3672, 287, 25064, 13, 18170, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 25064, 13, 18170, 58, 4666, 62, 3672, 60, 628, 220, 220, 220, 1468, 62, 6978, 796, 25064, 13, 6978, 58, 47715, 198, 220, 220, 220, 953, 62, 15908, 796, 28686, 13, 6978, 13, 15908, 3672, 7, 69, 6978, 8, 198, 220, 220, 220, 25064, 13, 6978, 13, 33295, 7, 4666, 62, 15908, 8, 198, 220, 220, 220, 1468, 62, 4666, 62, 14933, 796, 900, 7, 17597, 13, 18170, 13, 13083, 28955, 628, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2457, 62, 4666, 796, 1330, 8019, 13, 76, 620, 15451, 13, 37226, 17401, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 953, 62, 3672, 11, 277, 6978, 737, 2220, 62, 21412, 3419, 198, 220, 220, 220, 3443, 25, 198, 220, 220, 220, 220, 220, 220, 220, 25064, 13, 6978, 13, 28956, 7, 4666, 62, 15908, 8, 628, 220, 220, 220, 25064, 13, 18170, 58, 4666, 62, 3672, 60, 796, 2457, 62, 4666, 628, 220, 220, 220, 329, 1438, 11, 953, 287, 1351, 7, 17597, 13, 18170, 13, 23814, 3419, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 611, 1438, 287, 1468, 62, 4666, 62, 14933, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 628, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 277, 6978, 796, 651, 35226, 7, 4666, 11, 705, 834, 7753, 834, 3256, 6045, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2845, 35528, 355, 2859, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 10786, 66, 3413, 6631, 23884, 981, 2111, 284, 651, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 961, 11593, 7753, 834, 708, 81, 422, 23884, 4458, 18982, 7, 260, 1050, 7, 41194, 828, 1438, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 628, 220, 220, 220, 220, 220, 220, 220, 611, 277, 6978, 318, 407, 6045, 290, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28686, 13, 6978, 13, 15908, 3672, 7, 418, 13, 6978, 13, 5305, 6978, 7, 69, 6978, 29720, 9688, 2032, 342, 7, 4666, 62, 15908, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 953, 13, 834, 67, 28995, 62, 14578, 62, 1525, 62, 2777, 80, 834, 796, 352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 35528, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1208, 628, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2457, 62, 4666, 13, 834, 67, 28995, 62, 14578, 62, 1525, 62, 2777, 80, 834, 796, 362, 198, 220, 220, 220, 2845, 35528, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1208, 198, 220, 220, 220, 1441, 2457, 62, 4666, 628, 198, 4299, 3440, 62, 27349, 7, 27349, 11, 651, 62, 46265, 22046, 34758, 92, 2599, 198, 220, 220, 220, 705, 7061, 2220, 257, 2746, 5447, 416, 2746, 13, 9078, 7061, 6, 198, 220, 220, 220, 3127, 796, 28686, 13, 6978, 13, 5305, 6978, 7, 27349, 8, 198, 220, 220, 220, 285, 69, 796, 5536, 13, 6738, 62, 7753, 7, 27349, 11, 285, 524, 28, 17821, 8, 198, 220, 220, 220, 285, 69, 796, 285, 69, 13, 12501, 1098, 10786, 40477, 12, 23, 11537, 611, 318, 39098, 7, 76, 69, 11, 9881, 8, 2073, 285, 69, 198, 220, 220, 220, 611, 285, 69, 13, 9688, 2032, 342, 10786, 5239, 6, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 1330, 62, 29412, 62, 10459, 62, 292, 62, 21412, 7, 27349, 737, 17633, 22446, 11249, 3419, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 10786, 10049, 6971, 257, 2746, 13, 9078, 543, 15738, 257, 3127, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 8420, 7, 15, 8, 628, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 220, 4028, 796, 685, 12360, 12502, 11, 60, 628, 220, 220, 220, 30751, 796, 1822, 29572, 13, 28100, 1713, 46677, 3419, 198, 220, 220, 220, 30751, 13, 2860, 62, 49140, 10786, 27349, 11537, 198, 220, 220, 220, 22718, 945, 364, 796, 30751, 13, 2860, 62, 7266, 79, 945, 364, 7, 16794, 11639, 2673, 11537, 628, 220, 220, 220, 329, 1312, 287, 4028, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 2860, 62, 7266, 48610, 7, 7266, 79, 945, 364, 8, 628, 220, 220, 220, 26498, 796, 30751, 13, 29572, 62, 22046, 3419, 628, 220, 220, 220, 1303, 3440, 3127, 198, 220, 220, 220, 3440, 62, 27349, 7, 22046, 13, 27349, 8, 628, 220, 220, 220, 611, 468, 35226, 7, 22046, 11, 705, 20786, 6, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 26498, 13, 20786, 7, 22046, 8, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 10786, 3919, 2223, 1813, 11537, 628 ]
2.335583
1,630
# -*- coding: utf-8 -*- import numpy as np import random #Load embedding vocabulary #Load embedding vocabulary #Load embeddings filtered by pre-given vocabulary #Load embedding matrices input/output #Split training and development data
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 11748, 299, 32152, 355, 45941, 198, 11748, 4738, 198, 198, 2, 8912, 11525, 12083, 25818, 198, 198, 2, 8912, 11525, 12083, 25818, 628, 198, 2, 8912, 11525, 67, 654, 29083, 416, 662, 12, 35569, 25818, 198, 198, 2, 8912, 11525, 12083, 2603, 45977, 5128, 14, 22915, 198, 198, 2, 41205, 3047, 290, 2478, 1366, 198 ]
3.507246
69
import discord from discord.ext import commands from discord.ext.commands import Cog from helpers.checks import check_if_staff from helpers.userlogs import setwatch
[ 11748, 36446, 198, 6738, 36446, 13, 2302, 1330, 9729, 198, 6738, 36446, 13, 2302, 13, 9503, 1746, 1330, 327, 519, 198, 6738, 49385, 13, 42116, 1330, 2198, 62, 361, 62, 28120, 198, 6738, 49385, 13, 7220, 6404, 82, 1330, 900, 8340, 628, 198 ]
3.883721
43
# Copyright 2020 Google LLC # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # https://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Tests for candidate_sampler_config_builder.""" from research.carls.candidate_sampling import candidate_sampler_config_builder as cs_config_builder from research.carls.candidate_sampling import candidate_sampler_config_pb2 as cs_config_pb2 import tensorflow as tf if __name__ == '__main__': tf.test.main()
[ 2, 15069, 12131, 3012, 11419, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 3740, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 11247, 739, 262, 13789, 13, 198, 37811, 51, 3558, 329, 4540, 62, 37687, 20053, 62, 11250, 62, 38272, 526, 15931, 198, 198, 6738, 2267, 13, 66, 7063, 82, 13, 46188, 20540, 62, 37687, 11347, 1330, 4540, 62, 37687, 20053, 62, 11250, 62, 38272, 355, 50115, 62, 11250, 62, 38272, 198, 6738, 2267, 13, 66, 7063, 82, 13, 46188, 20540, 62, 37687, 11347, 1330, 4540, 62, 37687, 20053, 62, 11250, 62, 40842, 17, 355, 50115, 62, 11250, 62, 40842, 17, 198, 198, 11748, 11192, 273, 11125, 355, 48700, 628, 198, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 48700, 13, 9288, 13, 12417, 3419, 198 ]
3.545817
251
from context import ROOT_DIR, nnUtils, train_came, came import tensorflow as tf import numpy as np import argparse import os import progressbar import random os.environ['TF_CPP_MIN_LOG_LEVEL']='2' if __name__ == "__main__": args = parse_args() data_x, data_y = train_came.build_dataset(train_came.training_systems, args.antipattern, args.history_length) data_x, data_y = nnUtils.shuffle(data_x, data_y) bar = progressbar.ProgressBar(maxval=args.n_test, \ widgets=['Performing cross validation: ' ,progressbar.Percentage()]) bar.start() output_file_path = os.path.join(ROOT_DIR, 'experiments', 'tuning', 'results', 'came_' + args.antipattern + '_' + str(args.history_length) + '.csv') params = [] perfs = [] for i in range(args.n_test): learning_rate, beta, gamma, nb_filters, kernel_sizes, pool_sizes, dense_sizes = generateRandomHyperParameters(args.history_length) params.append([learning_rate, beta, gamma, nb_filters, kernel_sizes, pool_sizes, dense_sizes]) predictions = np.empty(shape=[0, 1]) for j in range(args.n_fold): x_train, y_train, x_test, y_test = get_cross_validation_dataset(data_x, data_y, j, args.n_fold) # New graph tf.reset_default_graph() # Create model model = came.CAME( nb_metrics=x_train.shape[-1], history_length=args.history_length, filters=nb_filters, kernel_sizes=kernel_sizes, pool_sizes=pool_sizes, dense_sizes=dense_sizes) with tf.Session() as session: # Initialize the variables of the TensorFlow graph. session.run(tf.global_variables_initializer()) train( session=session, model=model, x_train=x_train, y_train=y_train, num_step=args.n_step, lr=learning_rate, beta=beta, gamma=gamma) predictions = np.concatenate((predictions, session.run(model.inference, feed_dict={model.input_x: x_test})), axis=0) perfs.append(nnUtils.f_measure(predictions, data_y)) indexes = np.argsort(np.array(perfs)) with open(output_file_path, 'w') as file: file.write("Learning rate;Beta;Gamma;Filters;Kernel;Pool;Dense;F-measure\n") for j in reversed(indexes): for k in range(len(params[j])): file.write(str(params[j][k]) + ';') file.write(str(perfs[j]) + '\n') bar.update(i+1) bar.finish()
[ 6738, 4732, 1330, 15107, 2394, 62, 34720, 11, 299, 77, 18274, 4487, 11, 4512, 62, 66, 480, 11, 1625, 198, 198, 11748, 11192, 273, 11125, 220, 220, 220, 220, 220, 220, 220, 355, 48700, 198, 11748, 299, 32152, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 355, 45941, 198, 198, 11748, 1822, 29572, 198, 11748, 28686, 198, 11748, 4371, 5657, 198, 11748, 4738, 198, 418, 13, 268, 2268, 17816, 10234, 62, 8697, 47, 62, 23678, 62, 25294, 62, 2538, 18697, 20520, 11639, 17, 6, 198, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 197, 22046, 796, 21136, 62, 22046, 3419, 628, 197, 7890, 62, 87, 11, 1366, 62, 88, 796, 4512, 62, 66, 480, 13, 11249, 62, 19608, 292, 316, 7, 27432, 62, 66, 480, 13, 34409, 62, 10057, 82, 11, 26498, 13, 415, 541, 265, 759, 11, 26498, 13, 23569, 62, 13664, 8, 198, 197, 7890, 62, 87, 11, 1366, 62, 88, 796, 299, 77, 18274, 4487, 13, 1477, 18137, 7, 7890, 62, 87, 11, 1366, 62, 88, 8, 628, 197, 5657, 796, 4371, 5657, 13, 32577, 10374, 7, 9806, 2100, 28, 22046, 13, 77, 62, 9288, 11, 3467, 198, 197, 197, 28029, 11407, 28, 17816, 5990, 15464, 3272, 21201, 25, 705, 837, 33723, 5657, 13, 31905, 496, 3419, 12962, 198, 197, 5657, 13, 9688, 3419, 628, 197, 22915, 62, 7753, 62, 6978, 796, 28686, 13, 6978, 13, 22179, 7, 13252, 2394, 62, 34720, 11, 705, 23100, 6800, 3256, 705, 28286, 278, 3256, 705, 43420, 3256, 705, 66, 480, 62, 6, 1343, 26498, 13, 415, 541, 265, 759, 1343, 705, 62, 6, 1343, 965, 7, 22046, 13, 23569, 62, 13664, 8, 1343, 45302, 40664, 11537, 628, 197, 37266, 796, 17635, 198, 197, 525, 9501, 220, 796, 17635, 198, 197, 1640, 1312, 287, 2837, 7, 22046, 13, 77, 62, 9288, 2599, 198, 197, 197, 40684, 62, 4873, 11, 12159, 11, 34236, 11, 299, 65, 62, 10379, 1010, 11, 9720, 62, 82, 4340, 11, 5933, 62, 82, 4340, 11, 15715, 62, 82, 4340, 796, 7716, 29531, 38197, 48944, 7, 22046, 13, 23569, 62, 13664, 8, 198, 197, 197, 37266, 13, 33295, 26933, 40684, 62, 4873, 11, 12159, 11, 34236, 11, 299, 65, 62, 10379, 1010, 11, 9720, 62, 82, 4340, 11, 5933, 62, 82, 4340, 11, 15715, 62, 82, 4340, 12962, 628, 197, 197, 28764, 9278, 796, 45941, 13, 28920, 7, 43358, 41888, 15, 11, 352, 12962, 198, 197, 197, 1640, 474, 287, 2837, 7, 22046, 13, 77, 62, 11379, 2599, 198, 197, 197, 197, 87, 62, 27432, 11, 331, 62, 27432, 11, 2124, 62, 9288, 11, 331, 62, 9288, 796, 651, 62, 19692, 62, 12102, 341, 62, 19608, 292, 316, 7, 7890, 62, 87, 11, 1366, 62, 88, 11, 474, 11, 26498, 13, 77, 62, 11379, 8, 628, 197, 197, 197, 2, 968, 4823, 198, 197, 197, 197, 27110, 13, 42503, 62, 12286, 62, 34960, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 197, 197, 197, 2, 13610, 2746, 198, 197, 197, 197, 19849, 796, 1625, 13, 34, 10067, 7, 198, 197, 197, 197, 197, 46803, 62, 4164, 10466, 28, 87, 62, 27432, 13, 43358, 58, 12, 16, 4357, 198, 197, 197, 197, 197, 23569, 62, 13664, 28, 22046, 13, 23569, 62, 13664, 11, 198, 197, 197, 197, 197, 10379, 1010, 28, 46803, 62, 10379, 1010, 11, 198, 197, 197, 197, 197, 33885, 62, 82, 4340, 28, 33885, 62, 82, 4340, 11, 198, 197, 197, 197, 197, 7742, 62, 82, 4340, 28, 7742, 62, 82, 4340, 11, 198, 197, 197, 197, 197, 67, 1072, 62, 82, 4340, 28, 67, 1072, 62, 82, 4340, 8, 198, 197, 197, 197, 628, 197, 197, 197, 4480, 48700, 13, 36044, 3419, 355, 6246, 25, 198, 197, 197, 197, 197, 2, 20768, 1096, 262, 9633, 286, 262, 309, 22854, 37535, 4823, 13, 198, 197, 197, 197, 197, 29891, 13, 5143, 7, 27110, 13, 20541, 62, 25641, 2977, 62, 36733, 7509, 28955, 628, 197, 197, 197, 197, 27432, 7, 198, 197, 197, 197, 197, 197, 29891, 28, 29891, 11, 198, 197, 197, 197, 197, 197, 19849, 28, 19849, 11, 198, 197, 197, 197, 197, 197, 87, 62, 27432, 28, 87, 62, 27432, 11, 198, 197, 197, 197, 197, 197, 88, 62, 27432, 28, 88, 62, 27432, 11, 198, 197, 197, 197, 197, 197, 22510, 62, 9662, 28, 22046, 13, 77, 62, 9662, 11, 198, 197, 197, 197, 197, 197, 14050, 28, 40684, 62, 4873, 11, 198, 197, 197, 197, 197, 197, 31361, 28, 31361, 11, 198, 197, 197, 197, 197, 197, 28483, 2611, 28, 28483, 2611, 8, 628, 197, 197, 197, 197, 28764, 9278, 796, 45941, 13, 1102, 9246, 268, 378, 19510, 28764, 9278, 11, 6246, 13, 5143, 7, 19849, 13, 259, 4288, 11, 3745, 62, 11600, 34758, 19849, 13, 15414, 62, 87, 25, 2124, 62, 9288, 30072, 828, 16488, 28, 15, 8, 198, 197, 197, 198, 197, 197, 525, 9501, 13, 33295, 7, 20471, 18274, 4487, 13, 69, 62, 1326, 5015, 7, 28764, 9278, 11, 1366, 62, 88, 4008, 198, 197, 197, 9630, 274, 796, 45941, 13, 22046, 419, 7, 37659, 13, 18747, 7, 525, 9501, 4008, 198, 197, 197, 4480, 1280, 7, 22915, 62, 7753, 62, 6978, 11, 705, 86, 11537, 355, 2393, 25, 198, 197, 197, 197, 7753, 13, 13564, 7203, 41730, 2494, 26, 43303, 26, 34777, 2611, 26, 11928, 1010, 26, 42, 7948, 26, 27201, 26, 35, 1072, 26, 37, 12, 1326, 5015, 59, 77, 4943, 198, 197, 197, 197, 1640, 474, 287, 17687, 7, 9630, 274, 2599, 198, 197, 197, 197, 197, 1640, 479, 287, 2837, 7, 11925, 7, 37266, 58, 73, 12962, 2599, 198, 197, 197, 197, 197, 197, 7753, 13, 13564, 7, 2536, 7, 37266, 58, 73, 7131, 74, 12962, 1343, 705, 26, 11537, 198, 197, 197, 197, 197, 7753, 13, 13564, 7, 2536, 7, 525, 9501, 58, 73, 12962, 1343, 705, 59, 77, 11537, 198, 197, 197, 5657, 13, 19119, 7, 72, 10, 16, 8, 198, 197, 5657, 13, 15643, 680, 3419 ]
2.303303
999
import typing import pytest from genshin import paginators @pytest.fixture(name="counting_paginator")
[ 11748, 19720, 198, 198, 11748, 12972, 9288, 198, 198, 6738, 308, 641, 20079, 1330, 279, 23183, 2024, 628, 198, 198, 31, 9078, 9288, 13, 69, 9602, 7, 3672, 2625, 9127, 278, 62, 79, 363, 20900, 4943, 628, 628, 628, 628 ]
2.85
40
import os import errno from twitter.common import log from twitter.common.recordio import ThriftRecordReader from gen.twitter.thermos.ttypes import RunnerCkpt
[ 11748, 28686, 198, 11748, 11454, 3919, 198, 198, 6738, 17044, 13, 11321, 1330, 2604, 198, 6738, 17044, 13, 11321, 13, 22105, 952, 1330, 16283, 2135, 23739, 33634, 198, 6738, 2429, 13, 6956, 13, 490, 16785, 13, 83, 19199, 1330, 21529, 34, 74, 457, 628 ]
3.659091
44
# Copyright 2017 Lenovo # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import codecs import confluent.discovery.handlers.bmc as bmchandler import pyghmi.exceptions as pygexc import pyghmi.ipmi.private.util as pygutil import confluent.util as util import struct
[ 2, 15069, 2177, 40269, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 11247, 739, 262, 13789, 13, 198, 198, 11748, 40481, 82, 198, 11748, 1013, 28216, 13, 67, 40821, 13, 4993, 8116, 13, 20475, 66, 355, 275, 76, 354, 392, 1754, 198, 11748, 12972, 456, 11632, 13, 1069, 11755, 355, 12972, 469, 25306, 198, 11748, 12972, 456, 11632, 13, 541, 11632, 13, 19734, 13, 22602, 355, 12972, 70, 22602, 198, 11748, 1013, 28216, 13, 22602, 355, 7736, 198, 11748, 2878, 628 ]
3.628571
210
"""add country code to table Revision ID: 0367b739bb81 Revises: 1e09924c1938 Create Date: 2022-01-27 16:10:57.297020 """ from alembic import op import sqlalchemy as sa # revision identifiers, used by Alembic. revision = '0367b739bb81' down_revision = '1e09924c1938' branch_labels = None depends_on = None
[ 37811, 2860, 1499, 2438, 284, 3084, 198, 198, 18009, 1166, 4522, 25, 657, 27824, 65, 22, 2670, 11848, 6659, 198, 18009, 2696, 25, 352, 68, 15, 2079, 1731, 66, 1129, 2548, 198, 16447, 7536, 25, 33160, 12, 486, 12, 1983, 1467, 25, 940, 25, 3553, 13, 1959, 2154, 1238, 198, 198, 37811, 198, 6738, 31341, 2022, 291, 1330, 1034, 198, 11748, 44161, 282, 26599, 355, 473, 628, 198, 2, 18440, 42814, 11, 973, 416, 9300, 2022, 291, 13, 198, 260, 10178, 796, 705, 15, 27824, 65, 22, 2670, 11848, 6659, 6, 198, 2902, 62, 260, 10178, 796, 705, 16, 68, 15, 2079, 1731, 66, 1129, 2548, 6, 198, 1671, 3702, 62, 23912, 1424, 796, 6045, 198, 10378, 2412, 62, 261, 796, 6045, 628, 198 ]
2.508065
124
#!/usr/bin/env python import os import smach_based_introspection_framework.offline_part.visualize_dataset as m if __name__ == "__main__": m.run()
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 198, 198, 11748, 28686, 198, 11748, 895, 620, 62, 3106, 62, 600, 305, 31308, 62, 30604, 13, 2364, 1370, 62, 3911, 13, 41464, 1096, 62, 19608, 292, 316, 355, 285, 198, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 220, 285, 13, 5143, 3419, 198 ]
2.576271
59
from core.loggers import log, dlog from core import messages from core.vectors import ModuleExec from core.module import Module from core.config import base_path from http.server import HTTPServer, BaseHTTPRequestHandler from tempfile import gettempdir from socketserver import ThreadingMixIn from urllib.parse import urlparse, urlunparse, ParseResult from io import StringIO from http.client import HTTPResponse import threading import re import os import sys import socket import ssl import select import http.client import urllib.parse import threading import time import json import re from http.server import HTTPServer, BaseHTTPRequestHandler from socketserver import ThreadingMixIn from io import BytesIO from subprocess import Popen, PIPE from html.parser import HTMLParser from tempfile import mkdtemp re_valid_ip = re.compile( "^(([0-9]|[1-9][0-9]|1[0-9]{2}|2[0-4][0-9]|25[0-5])\.){3}([0-9]|[1-9][0-9]|1[0-9]{2}|2[0-4][0-9]|25[0-5])$") re_valid_hostname = re.compile("^(([a-zA-Z0-9\-]+)\.)*([A-Za-z]|[A-Za-z][A-Za-z0-9\-]*[A-Za-z0-9])$") temp_certdir = mkdtemp() lock = threading.Lock() # Create path for the CA certificates and keys cert_folder = os.path.join(base_path, 'certs') try: os.makedirs(cert_folder) except: pass # # Most of the Proxy part has been taken from https://github.com/inaz2/proxy2 # class Proxy(Module): """Run local proxy to pivot HTTP/HTTPS browsing through the target."""
[ 6738, 4755, 13, 6404, 5355, 1330, 2604, 11, 288, 6404, 198, 6738, 4755, 1330, 6218, 198, 6738, 4755, 13, 303, 5217, 1330, 19937, 23002, 198, 6738, 4755, 13, 21412, 1330, 19937, 198, 6738, 4755, 13, 11250, 1330, 2779, 62, 6978, 198, 6738, 2638, 13, 15388, 1330, 38288, 18497, 11, 7308, 40717, 18453, 25060, 198, 6738, 20218, 7753, 1330, 651, 29510, 15908, 198, 6738, 37037, 18497, 1330, 14122, 278, 35608, 818, 198, 6738, 2956, 297, 571, 13, 29572, 1330, 19016, 29572, 11, 19016, 403, 29572, 11, 2547, 325, 23004, 198, 6738, 33245, 1330, 10903, 9399, 198, 6738, 2638, 13, 16366, 1330, 7154, 51, 4805, 9774, 2591, 198, 11748, 4704, 278, 198, 11748, 302, 198, 11748, 28686, 198, 11748, 25064, 198, 11748, 17802, 198, 11748, 264, 6649, 198, 11748, 2922, 198, 11748, 2638, 13, 16366, 198, 11748, 2956, 297, 571, 13, 29572, 198, 11748, 4704, 278, 198, 11748, 640, 198, 11748, 33918, 198, 11748, 302, 198, 6738, 2638, 13, 15388, 1330, 38288, 18497, 11, 7308, 40717, 18453, 25060, 198, 6738, 37037, 18497, 1330, 14122, 278, 35608, 818, 198, 6738, 33245, 1330, 2750, 4879, 9399, 198, 6738, 850, 14681, 1330, 8099, 268, 11, 350, 4061, 36, 198, 6738, 27711, 13, 48610, 1330, 11532, 46677, 198, 6738, 20218, 7753, 1330, 33480, 67, 29510, 198, 198, 260, 62, 12102, 62, 541, 796, 302, 13, 5589, 576, 7, 198, 220, 220, 220, 366, 61, 19510, 58, 15, 12, 24, 60, 91, 58, 16, 12, 24, 7131, 15, 12, 24, 60, 91, 16, 58, 15, 12, 24, 60, 90, 17, 92, 91, 17, 58, 15, 12, 19, 7131, 15, 12, 24, 60, 91, 1495, 58, 15, 12, 20, 12962, 59, 2014, 90, 18, 92, 26933, 15, 12, 24, 60, 91, 58, 16, 12, 24, 7131, 15, 12, 24, 60, 91, 16, 58, 15, 12, 24, 60, 90, 17, 92, 91, 17, 58, 15, 12, 19, 7131, 15, 12, 24, 60, 91, 1495, 58, 15, 12, 20, 12962, 3, 4943, 198, 260, 62, 12102, 62, 4774, 3672, 796, 302, 13, 5589, 576, 7203, 61, 19510, 58, 64, 12, 89, 32, 12, 57, 15, 12, 24, 41441, 48688, 19415, 2014, 9, 26933, 32, 12, 57, 64, 12, 89, 60, 91, 58, 32, 12, 57, 64, 12, 89, 7131, 32, 12, 57, 64, 12, 89, 15, 12, 24, 41441, 60, 9, 58, 32, 12, 57, 64, 12, 89, 15, 12, 24, 12962, 3, 4943, 198, 198, 29510, 62, 22583, 15908, 796, 33480, 67, 29510, 3419, 198, 198, 5354, 796, 4704, 278, 13, 25392, 3419, 628, 198, 198, 2, 13610, 3108, 329, 262, 7257, 20835, 290, 8251, 198, 22583, 62, 43551, 796, 28686, 13, 6978, 13, 22179, 7, 8692, 62, 6978, 11, 705, 22583, 82, 11537, 198, 28311, 25, 198, 220, 220, 220, 28686, 13, 76, 4335, 17062, 7, 22583, 62, 43551, 8, 198, 16341, 25, 198, 220, 220, 220, 1208, 628, 628, 198, 2, 198, 2, 4042, 286, 262, 38027, 636, 468, 587, 2077, 422, 3740, 1378, 12567, 13, 785, 14, 259, 1031, 17, 14, 36436, 17, 198, 2, 628, 628, 198, 4871, 38027, 7, 26796, 2599, 198, 220, 220, 220, 37227, 10987, 1957, 15741, 284, 30355, 14626, 14, 6535, 28820, 23182, 832, 262, 2496, 526, 15931, 198 ]
2.721591
528
from .construct import GraspConstruct, MultiStartGraspConstruct
[ 6738, 764, 41571, 1330, 1902, 5126, 42316, 11, 15237, 10434, 8642, 5126, 42316, 201, 198 ]
4.333333
15
import pytest
[ 11748, 12972, 9288, 628 ]
3.75
4
# Copyright 2021 UW-IT, University of Washington # SPDX-License-Identifier: Apache-2.0 from django.conf import settings from django.http import HttpResponse from django.views.decorators.cache import never_cache from django.utils.decorators import method_decorator from uw_saml.decorators import group_required from course_grader.views.rest_dispatch import RESTDispatch from course_grader.models import ( SubmittedGradeRoster as SubmittedGradeRosterModel) from course_grader.dao.person import person_from_regid, person_display_name from course_grader.dao.section import section_from_label from course_grader.dao.term import term_from_param from uw_sws_graderoster.models import GradeRoster from lxml import etree from logging import getLogger import csv logger = getLogger(__name__) @method_decorator(group_required(settings.GRADEPAGE_SUPPORT_GROUP), name='dispatch') @method_decorator(never_cache, name='dispatch') @method_decorator(group_required(settings.GRADEPAGE_SUPPORT_GROUP), name='dispatch') @method_decorator(never_cache, name='dispatch')
[ 2, 15069, 33448, 33436, 12, 2043, 11, 2059, 286, 2669, 198, 2, 30628, 55, 12, 34156, 12, 33234, 7483, 25, 24843, 12, 17, 13, 15, 198, 198, 6738, 42625, 14208, 13, 10414, 1330, 6460, 198, 6738, 42625, 14208, 13, 4023, 1330, 367, 29281, 31077, 198, 6738, 42625, 14208, 13, 33571, 13, 12501, 273, 2024, 13, 23870, 1330, 1239, 62, 23870, 198, 6738, 42625, 14208, 13, 26791, 13, 12501, 273, 2024, 1330, 2446, 62, 12501, 273, 1352, 198, 6738, 334, 86, 62, 37687, 75, 13, 12501, 273, 2024, 1330, 1448, 62, 35827, 198, 6738, 1781, 62, 2164, 5067, 13, 33571, 13, 2118, 62, 6381, 17147, 1330, 30617, 49354, 198, 6738, 1781, 62, 2164, 5067, 13, 27530, 1330, 357, 198, 220, 220, 220, 3834, 3291, 42233, 49, 6197, 355, 3834, 3291, 42233, 49, 6197, 17633, 8, 198, 6738, 1781, 62, 2164, 5067, 13, 67, 5488, 13, 6259, 1330, 1048, 62, 6738, 62, 2301, 312, 11, 1048, 62, 13812, 62, 3672, 198, 6738, 1781, 62, 2164, 5067, 13, 67, 5488, 13, 5458, 1330, 2665, 62, 6738, 62, 18242, 198, 6738, 1781, 62, 2164, 5067, 13, 67, 5488, 13, 4354, 1330, 3381, 62, 6738, 62, 17143, 198, 6738, 334, 86, 62, 2032, 82, 62, 2164, 5067, 6197, 13, 27530, 1330, 22653, 49, 6197, 198, 6738, 300, 19875, 1330, 2123, 631, 198, 6738, 18931, 1330, 651, 11187, 1362, 198, 11748, 269, 21370, 198, 198, 6404, 1362, 796, 651, 11187, 1362, 7, 834, 3672, 834, 8, 628, 198, 31, 24396, 62, 12501, 273, 1352, 7, 8094, 62, 35827, 7, 33692, 13, 10761, 19266, 4537, 8264, 62, 40331, 15490, 62, 46846, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 11639, 6381, 17147, 11537, 198, 31, 24396, 62, 12501, 273, 1352, 7, 12081, 62, 23870, 11, 1438, 11639, 6381, 17147, 11537, 628, 198, 31, 24396, 62, 12501, 273, 1352, 7, 8094, 62, 35827, 7, 33692, 13, 10761, 19266, 4537, 8264, 62, 40331, 15490, 62, 46846, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 11639, 6381, 17147, 11537, 198, 31, 24396, 62, 12501, 273, 1352, 7, 12081, 62, 23870, 11, 1438, 11639, 6381, 17147, 11537, 198 ]
2.948787
371
import json import os.path import subprocess import boto3 # This is all cribbed from the django branch's cluster_management/deployment_helpers folder # TODO once the branches are merged, use that code and NOT this code
[ 11748, 33918, 201, 198, 11748, 28686, 13, 6978, 201, 198, 11748, 850, 14681, 201, 198, 201, 198, 11748, 275, 2069, 18, 201, 198, 201, 198, 2, 770, 318, 477, 48083, 3077, 422, 262, 42625, 14208, 8478, 338, 13946, 62, 27604, 14, 2934, 1420, 434, 62, 16794, 364, 9483, 201, 198, 2, 16926, 46, 1752, 262, 13737, 389, 23791, 11, 779, 326, 2438, 290, 5626, 428, 2438, 201, 198, 201, 198, 201, 198, 201, 198, 201, 198, 201, 198 ]
3.064103
78
"""Boundarys for Responses from TelescopeController (TC) and Requests to TC. Data entry and exit point into use_cases layer. """ class TelescopeControllerResponseBoundary: """Contains Responses from TelescopeController Device. """ def __init__( self, ra_response = None, dec_response = None, validate_response = None): """Store Responses of Telescope Controller as floats. """ self.ra_response = ra_response self.dec_response = dec_response self.validate_response = validate_response def set_ra_response(self, ra): """Set ra response. Input: ra as float in hours """ self.ra_response = ra def set_dec_response(self, dec): """Set dec response. Input: dec as float in degrees """ self.dec_response = dec def set_validate_response(self, valid): """Set validate response. Input: valid as boolean (accounts for Returns of Telesope Controllere to set_target etc) """ self.validate_response = valid def reset_responses(self): """Reset all responses to None. """ self.ra_response = None self.dec_response = None self.validate_response = None def retrieve_position(self): """Returns ra and dec_responses. """ return (self.ra_response, self.dec_response) class TelescopeControllerRequestBoundary: """Interface for commands to TelescopeController Device. """
[ 37811, 49646, 560, 82, 329, 20549, 274, 422, 36789, 22130, 357, 4825, 8, 290, 9394, 3558, 284, 17283, 13, 198, 220, 220, 6060, 5726, 290, 8420, 966, 656, 779, 62, 33964, 7679, 13, 198, 37811, 198, 198, 4871, 36789, 22130, 31077, 49646, 560, 25, 198, 220, 220, 220, 37227, 4264, 1299, 20549, 274, 422, 36789, 22130, 16232, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 825, 11593, 15003, 834, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2179, 62, 26209, 796, 6045, 11, 198, 220, 220, 220, 220, 220, 220, 220, 875, 62, 26209, 796, 6045, 11, 198, 220, 220, 220, 220, 220, 220, 220, 26571, 62, 26209, 796, 6045, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 22658, 20549, 274, 286, 36789, 22741, 355, 36016, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 430, 62, 26209, 796, 2179, 62, 26209, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12501, 62, 26209, 796, 875, 62, 26209, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12102, 378, 62, 26209, 796, 26571, 62, 26209, 198, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 825, 900, 62, 430, 62, 26209, 7, 944, 11, 2179, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 7248, 2179, 2882, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 23412, 25, 2179, 355, 12178, 287, 2250, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 430, 62, 26209, 796, 2179, 198, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 825, 900, 62, 12501, 62, 26209, 7, 944, 11, 875, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 7248, 875, 2882, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 23412, 25, 875, 355, 12178, 287, 7370, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12501, 62, 26209, 796, 875, 198, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 825, 900, 62, 12102, 378, 62, 26209, 7, 944, 11, 4938, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 7248, 26571, 2882, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 23412, 25, 4938, 355, 25131, 357, 23317, 82, 329, 16409, 286, 12088, 274, 3008, 6779, 293, 260, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 284, 900, 62, 16793, 3503, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12102, 378, 62, 26209, 796, 4938, 198, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 825, 13259, 62, 16733, 274, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4965, 316, 477, 9109, 284, 6045, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 430, 62, 26209, 796, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12501, 62, 26209, 796, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12102, 378, 62, 26209, 796, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 825, 19818, 62, 9150, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 35561, 2179, 290, 875, 62, 16733, 274, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 944, 13, 430, 62, 26209, 11, 2116, 13, 12501, 62, 26209, 8, 198, 220, 220, 220, 220, 198, 4871, 36789, 22130, 18453, 49646, 560, 25, 198, 220, 220, 220, 37227, 39317, 329, 9729, 284, 36789, 22130, 16232, 13, 198, 220, 220, 220, 37227, 198 ]
2.229249
759
# -*- coding: utf-8 -*- """ Created on Tue Feb 25 18:04:32 2020 @author: Dragana """ import mne import microstates as mst import numpy as np HC_RS_path = 'C:/Users/.../Documents/RS_EEG/' subj_folder = ['subj01', 'subj02', 'subj03', 'subj04', 'subj05'] # Parameteres setting up chan_to_drop = ['E67', 'E73', 'E247', 'E251', 'E256', 'E243', 'E246', 'E250', 'E255', 'E82', 'E91', 'E254', 'E249', 'E245', 'E242', 'E253', 'E252', 'E248', 'E244', 'E241', 'E92', 'E102', 'E103', 'E111', 'E112', 'E120', 'E121', 'E133', 'E134', 'E145', 'E146', 'E156', 'E165', 'E166', 'E174', 'E175', 'E187', 'E188', 'E199', 'E200', 'E208', 'E209', 'E216', 'E217', 'E228', 'E229', 'E232', 'E233', 'E236', 'E237', 'E240', 'E218', 'E227', 'E231', 'E235', 'E239', 'E219', 'E225', 'E226', 'E230', 'E234', 'E238'] pax = len(subj_folder) # number of participants n_states = 4 n_inits = 10 EGI256 = True if EGI256 == True: n_channels = 256 - len(chan_to_drop) grouped_maps = np.array([], dtype=np.int64).reshape(0, n_channels) for i, f in enumerate(subj_folder): fname = HC_RS_path + f + '/' + f +'_clean-epo.fif' epochs = mne.read_epochs(fname, preload=True) if EGI256 == True: epochs.drop_channels(chan_to_drop) data = epochs.get_data() # Segment the data in microstates maps, segmentation, gev, gfp_peaks = mst.segment(data, n_states, n_inits) grouped_maps = np.concatenate((grouped_maps, maps), axis=0) # Transpose the maps from maps(n_maps, n_channels) to maps(n_channels, n_maps) # and treat the n_maps as a sample in time. grouped_maps_T = grouped_maps.transpose() # Find the group maps using k-means clustering group_maps, group_gev = mst.segment(grouped_maps_T, n_states, n_inits, use_peaks=False) # Plot the maps mst.viz.plot_maps(group_maps, epochs.info) # Fitting the maps back to the original epoched data by subject grouped_segment, all_p = [], [] for i, f in enumerate(subj_folder): fname = HC_RS_path + f + '/' + f +'_clean-epo.fif' epochs = mne.read_epochs(fname, preload=True) if EGI256 == True: epochs.drop_channels(chan_to_drop) data = epochs.get_data() n_epochs, n_chans, n_samples = data.shape # Make the data 2D data = np.hstack(data) # Compute final microstate segmentations on the original data activation = group_maps.dot(data) segmentation = np.argmax(np.abs(activation), axis=0) # Add all the per subject segmentations in one array # (n_times, subjects) grouped_segment.append(segmentation) # Plot the segmentation per subject sfreq = epochs.info['sfreq'] times = np.arange(0, len(data[1])/sfreq, 1/sfreq) mst.viz.plot_segmentation(segmentation[:500], data[:, :500], times[:500]) # p_empirical epoched_data = True p_hat = mst.analysis.p_empirical(segmentation, n_epochs, n_samples, n_states, epoched_data) all_p.append(p_hat) # p_empirical printing print("\n\t Empirical symbol distribution (RTT) per subject:\n") for i in range(pax): print("\n Subject", i) for j in range(n_states): print("\n\t\t p", j, " = {0:.5f}".format(all_p[i][j])) all_p = np.vstack(all_p) all_p /= pax all_p_sum = np.sum(all_p, axis=0) print("\n\t Empirical symbol distribution (RTT) for all subjects:\n") for i in range(n_states): print("\n\t\t p", i, " = {0:.5f}".format(all_p_sum[i]))
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 37811, 198, 41972, 319, 30030, 3158, 1679, 1248, 25, 3023, 25, 2624, 12131, 198, 198, 31, 9800, 25, 12697, 2271, 198, 37811, 198, 11748, 285, 710, 198, 11748, 4580, 27219, 355, 285, 301, 198, 11748, 299, 32152, 355, 45941, 198, 198, 16045, 62, 6998, 62, 6978, 796, 705, 34, 14079, 14490, 14, 986, 14, 38354, 14, 6998, 62, 6500, 38, 14, 6, 198, 198, 7266, 73, 62, 43551, 796, 37250, 7266, 73, 486, 3256, 705, 7266, 73, 2999, 3256, 705, 7266, 73, 3070, 3256, 705, 7266, 73, 3023, 3256, 705, 7266, 73, 2713, 20520, 198, 198, 2, 25139, 14471, 411, 4634, 510, 198, 198, 3147, 62, 1462, 62, 14781, 796, 37250, 36, 3134, 3256, 220, 705, 36, 4790, 3256, 220, 705, 36, 23753, 3256, 705, 36, 28072, 3256, 705, 36, 11645, 3256, 705, 36, 26660, 3256, 705, 36, 26912, 3256, 705, 36, 9031, 3256, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 13381, 3256, 705, 36, 6469, 3256, 220, 705, 36, 6420, 3256, 220, 705, 36, 24970, 3256, 705, 36, 21626, 3256, 705, 36, 22995, 3256, 705, 36, 27877, 3256, 705, 36, 28592, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 22800, 3256, 705, 36, 23045, 3256, 705, 36, 25707, 3256, 705, 36, 28872, 3256, 705, 36, 5892, 3256, 220, 705, 36, 15377, 3256, 705, 36, 15197, 3256, 705, 36, 16243, 3256, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 14686, 3256, 705, 36, 10232, 3256, 705, 36, 19244, 3256, 705, 36, 16945, 3256, 705, 36, 19880, 3256, 705, 36, 18781, 3256, 705, 36, 20964, 3256, 705, 36, 21599, 3256, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 20986, 3256, 705, 36, 23055, 3256, 705, 36, 22985, 3256, 705, 36, 17430, 3256, 705, 36, 23451, 3256, 705, 36, 20356, 3256, 705, 36, 19104, 3256, 705, 36, 2167, 3256, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 21315, 3256, 705, 36, 22567, 3256, 705, 36, 20666, 3256, 705, 36, 24591, 3256, 705, 36, 23815, 3256, 705, 36, 23539, 3256, 705, 36, 24339, 3256, 705, 36, 25429, 3256, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 24940, 3256, 705, 36, 24693, 3256, 705, 36, 16102, 3256, 705, 36, 28727, 3256, 705, 36, 24403, 3256, 705, 36, 25667, 3256, 705, 36, 22370, 3256, 705, 36, 23516, 3256, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 36, 28896, 3256, 705, 36, 18182, 3256, 705, 36, 24909, 3256, 705, 36, 19214, 3256, 705, 36, 24409, 3256, 705, 36, 23721, 20520, 198, 198, 79, 897, 796, 18896, 7, 7266, 73, 62, 43551, 8, 1303, 1271, 286, 6809, 198, 77, 62, 27219, 796, 604, 198, 77, 62, 259, 896, 796, 838, 198, 7156, 40, 11645, 796, 6407, 198, 198, 361, 412, 18878, 11645, 6624, 6407, 25, 198, 220, 220, 220, 299, 62, 354, 8961, 796, 17759, 532, 18896, 7, 3147, 62, 1462, 62, 14781, 8, 198, 198, 8094, 276, 62, 31803, 796, 45941, 13, 18747, 26933, 4357, 288, 4906, 28, 37659, 13, 600, 2414, 737, 3447, 1758, 7, 15, 11, 299, 62, 354, 8961, 8, 198, 1640, 1312, 11, 277, 287, 27056, 378, 7, 7266, 73, 62, 43551, 2599, 198, 220, 220, 220, 277, 3672, 796, 27327, 62, 6998, 62, 6978, 1343, 277, 1343, 31051, 6, 1343, 277, 1343, 6, 62, 27773, 12, 538, 78, 13, 32041, 6, 198, 220, 220, 220, 36835, 82, 796, 285, 710, 13, 961, 62, 538, 5374, 82, 7, 69, 3672, 11, 662, 2220, 28, 17821, 8, 198, 220, 220, 220, 611, 412, 18878, 11645, 6624, 6407, 25, 198, 220, 220, 220, 220, 220, 220, 220, 36835, 82, 13, 14781, 62, 354, 8961, 7, 3147, 62, 1462, 62, 14781, 8, 198, 220, 220, 220, 1366, 796, 36835, 82, 13, 1136, 62, 7890, 3419, 198, 220, 220, 220, 1303, 1001, 5154, 262, 1366, 287, 4580, 27219, 198, 220, 220, 220, 8739, 11, 10618, 341, 11, 308, 1990, 11, 308, 46428, 62, 431, 4730, 796, 285, 301, 13, 325, 5154, 7, 7890, 11, 299, 62, 27219, 11, 299, 62, 259, 896, 8, 198, 220, 220, 220, 32824, 62, 31803, 796, 45941, 13, 1102, 9246, 268, 378, 19510, 8094, 276, 62, 31803, 11, 8739, 828, 16488, 28, 15, 8, 198, 198, 2, 3602, 3455, 262, 8739, 422, 8739, 7, 77, 62, 31803, 11, 299, 62, 354, 8961, 8, 284, 8739, 7, 77, 62, 354, 8961, 11, 299, 62, 31803, 8, 198, 2, 290, 2190, 262, 299, 62, 31803, 355, 257, 6291, 287, 640, 13, 220, 198, 8094, 276, 62, 31803, 62, 51, 796, 32824, 62, 31803, 13, 7645, 3455, 3419, 198, 198, 2, 9938, 262, 1448, 8739, 1262, 479, 12, 1326, 504, 32966, 1586, 198, 8094, 62, 31803, 11, 1448, 62, 469, 85, 796, 285, 301, 13, 325, 5154, 7, 8094, 276, 62, 31803, 62, 51, 11, 299, 62, 27219, 11, 299, 62, 259, 896, 11, 779, 62, 431, 4730, 28, 25101, 8, 198, 198, 2, 28114, 262, 8739, 198, 76, 301, 13, 85, 528, 13, 29487, 62, 31803, 7, 8094, 62, 31803, 11, 36835, 82, 13, 10951, 8, 198, 198, 2, 376, 2535, 262, 8739, 736, 284, 262, 2656, 2462, 420, 704, 1366, 416, 2426, 220, 198, 8094, 276, 62, 325, 5154, 11, 477, 62, 79, 796, 685, 4357, 17635, 198, 1640, 1312, 11, 277, 287, 27056, 378, 7, 7266, 73, 62, 43551, 2599, 198, 220, 220, 220, 277, 3672, 796, 27327, 62, 6998, 62, 6978, 1343, 277, 1343, 31051, 6, 1343, 277, 1343, 6, 62, 27773, 12, 538, 78, 13, 32041, 6, 198, 220, 220, 220, 36835, 82, 796, 285, 710, 13, 961, 62, 538, 5374, 82, 7, 69, 3672, 11, 662, 2220, 28, 17821, 8, 198, 220, 220, 220, 611, 412, 18878, 11645, 6624, 6407, 25, 198, 220, 220, 220, 220, 220, 220, 220, 36835, 82, 13, 14781, 62, 354, 8961, 7, 3147, 62, 1462, 62, 14781, 8, 198, 220, 220, 220, 1366, 796, 36835, 82, 13, 1136, 62, 7890, 3419, 198, 220, 220, 220, 299, 62, 538, 5374, 82, 11, 299, 62, 354, 504, 11, 299, 62, 82, 12629, 796, 1366, 13, 43358, 198, 220, 220, 220, 1303, 6889, 262, 1366, 362, 35, 198, 220, 220, 220, 1366, 796, 45941, 13, 71, 25558, 7, 7890, 8, 198, 220, 220, 220, 1303, 3082, 1133, 2457, 4580, 5219, 10618, 602, 319, 262, 2656, 1366, 198, 220, 220, 220, 14916, 796, 1448, 62, 31803, 13, 26518, 7, 7890, 8, 198, 220, 220, 220, 10618, 341, 796, 45941, 13, 853, 9806, 7, 37659, 13, 8937, 7, 48545, 828, 16488, 28, 15, 8, 198, 220, 220, 220, 1303, 3060, 477, 262, 583, 2426, 10618, 602, 287, 530, 7177, 198, 220, 220, 220, 1303, 357, 77, 62, 22355, 11, 7481, 8, 198, 220, 220, 220, 32824, 62, 325, 5154, 13, 33295, 7, 325, 5154, 341, 8, 198, 220, 220, 220, 1303, 28114, 262, 10618, 341, 583, 2426, 198, 220, 220, 220, 264, 19503, 80, 796, 36835, 82, 13, 10951, 17816, 82, 19503, 80, 20520, 198, 220, 220, 220, 1661, 796, 45941, 13, 283, 858, 7, 15, 11, 18896, 7, 7890, 58, 16, 12962, 14, 82, 19503, 80, 11, 352, 14, 82, 19503, 80, 8, 198, 220, 220, 220, 285, 301, 13, 85, 528, 13, 29487, 62, 325, 5154, 341, 7, 325, 5154, 341, 58, 25, 4059, 4357, 1366, 58, 45299, 1058, 4059, 4357, 1661, 58, 25, 4059, 12962, 198, 220, 220, 220, 220, 198, 220, 220, 220, 1303, 279, 62, 368, 4063, 605, 220, 198, 220, 220, 220, 2462, 420, 704, 62, 7890, 796, 6407, 198, 220, 220, 220, 279, 62, 5183, 796, 285, 301, 13, 20930, 13, 79, 62, 368, 4063, 605, 7, 325, 5154, 341, 11, 299, 62, 538, 5374, 82, 11, 299, 62, 82, 12629, 11, 299, 62, 27219, 11, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2462, 420, 704, 62, 7890, 8, 198, 220, 220, 220, 477, 62, 79, 13, 33295, 7, 79, 62, 5183, 8, 198, 198, 2, 279, 62, 368, 4063, 605, 13570, 198, 4798, 7203, 59, 77, 59, 83, 2295, 4063, 605, 6194, 6082, 357, 14181, 51, 8, 583, 2426, 7479, 77, 4943, 198, 1640, 1312, 287, 2837, 7, 79, 897, 2599, 198, 220, 220, 220, 3601, 7203, 59, 77, 15540, 1600, 1312, 8, 198, 220, 220, 220, 329, 474, 287, 2837, 7, 77, 62, 27219, 2599, 220, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 59, 77, 59, 83, 59, 83, 279, 1600, 474, 11, 366, 796, 1391, 15, 25, 13, 20, 69, 92, 1911, 18982, 7, 439, 62, 79, 58, 72, 7131, 73, 60, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 198, 439, 62, 79, 796, 45941, 13, 85, 25558, 7, 439, 62, 79, 8, 198, 439, 62, 79, 1220, 28, 279, 897, 198, 439, 62, 79, 62, 16345, 796, 45941, 13, 16345, 7, 439, 62, 79, 11, 16488, 28, 15, 8, 198, 198, 4798, 7203, 59, 77, 59, 83, 2295, 4063, 605, 6194, 6082, 357, 14181, 51, 8, 329, 477, 7481, 7479, 77, 4943, 198, 1640, 1312, 287, 2837, 7, 77, 62, 27219, 2599, 220, 198, 220, 220, 220, 3601, 7203, 59, 77, 59, 83, 59, 83, 279, 1600, 1312, 11, 366, 796, 1391, 15, 25, 13, 20, 69, 92, 1911, 18982, 7, 439, 62, 79, 62, 16345, 58, 72, 60, 4008 ]
2.134592
1,642
# # Copyright 2011 Shopzilla.com # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this 1 except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. # """The base Controller API Provides the BaseController class for subclassing. """ from pylons.controllers import WSGIController from pylons.templating import render_mako as render
[ 2, 198, 2, 15069, 2813, 13705, 16496, 13, 785, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 352, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 11247, 739, 262, 13789, 13, 198, 2, 198, 37811, 464, 2779, 22741, 7824, 198, 198, 15946, 1460, 262, 7308, 22130, 1398, 329, 47611, 278, 13, 198, 37811, 198, 6738, 279, 2645, 684, 13, 3642, 36667, 1330, 25290, 38, 2149, 756, 10646, 198, 6738, 279, 2645, 684, 13, 11498, 489, 803, 1330, 8543, 62, 76, 25496, 355, 8543, 198 ]
3.707317
205
from . import DATA_DIR import sys import glob from .background_systems import BackgroundSystemModel from .export import ExportInventory from inspect import currentframe, getframeinfo from pathlib import Path from scipy import sparse import csv import itertools import numexpr as ne import numpy as np import xarray as xr REMIND_FILES_DIR = DATA_DIR / "IAM" class InventoryCalculation: """ Build and solve the inventory for results characterization and inventory export Vehicles to be analyzed can be filtered by passing a `scope` dictionary. Some assumptions in the background system can also be adjusted by passing a `background_configuration` dictionary. .. code-block:: python scope = { 'powertrain':['BEV', 'FCEV', 'ICEV-p'], } bc = {'country':'CH', # considers electricity network losses for Switzerland 'custom electricity mix' : [[1,0,0,0,0,0,0,0,0,0], # in this case, 100% hydropower for the first year [0,1,0,0,0,0,0,0,0,0], [0,0,1,0,0,0,0,0,0,0], [0,0,0,1,0,0,0,0,0,0], ], # in this case, 100% nuclear for the second year 'fuel blend':{ 'cng':{ #specify fuel bland for compressed gas 'primary fuel':{ 'type':'biogas', 'share':[0.9, 0.8, 0.7, 0.6] # shares per year. Must total 1 for each year. }, 'secondary fuel':{ 'type':'syngas', 'share': [0.1, 0.2, 0.3, 0.4] } }, 'diesel':{ 'primary fuel':{ 'type':'synthetic diesel', 'share':[0.9, 0.8, 0.7, 0.6] }, 'secondary fuel':{ 'type':'biodiesel - cooking oil', 'share': [0.1, 0.2, 0.3, 0.4] } }, 'petrol':{ 'primary fuel':{ 'type':'petrol', 'share':[0.9, 0.8, 0.7, 0.6] }, 'secondary fuel':{ 'type':'bioethanol - wheat straw', 'share': [0.1, 0.2, 0.3, 0.4] } }, 'hydrogen':{ 'primary fuel':{'type':'electrolysis', 'share':[1, 0, 0, 0]}, 'secondary fuel':{'type':'smr - natural gas', 'share':[0, 1, 1, 1]} } }, 'energy storage': { 'electric': { 'type':'NMC', 'origin': 'NO' }, 'hydrogen': { 'type':'carbon fiber' } } } InventoryCalculation(CarModel.array, background_configuration=background_configuration, scope=scope, scenario="RCP26") The `custom electricity mix` key in the background_configuration dictionary defines an electricity mix to apply, under the form of one or several array(s), depending on teh number of years to analyze, that should total 1, of which the indices correspond to: - [0]: hydro-power - [1]: nuclear - [2]: natural gas - [3]: solar power - [4]: wind power - [5]: biomass - [6]: coal - [7]: oil - [8]: geothermal - [9]: waste incineration If none is given, the electricity mix corresponding to the country specified in `country` will be selected. If no country is specified, Europe applies. The `primary` and `secondary` fuel keys contain an array with shares of alternative petrol fuel for each year, to create a custom blend. If none is provided, a blend provided by the Integrated Assessment model REMIND is used, which will depend on the REMIND energy scenario selected. Here is a list of available fuel pathways: Hydrogen technologies -------------------- electrolysis smr - natural gas smr - natural gas with CCS smr - biogas smr - biogas with CCS coal gasification wood gasification wood gasification with CCS Natural gas technologies ------------------------ cng biogas syngas Diesel technologies ------------------- diesel biodiesel - algae biodiesel - cooking oil synthetic diesel Petrol technologies ------------------- petrol bioethanol - wheat straw bioethanol - maize starch bioethanol - sugarbeet bioethanol - forest residues synthetic gasoline :ivar array: array from the CarModel class :vartype array: CarModel.array :ivar scope: dictionary that contains filters for narrowing the analysis :ivar background_configuration: dictionary that contains choices for background system :ivar scenario: REMIND energy scenario to use ("SSP2-Baseline": business-as-usual, "SSP2-PkBudg1100": limits cumulative GHG emissions to 1,100 gigatons by 2100, "static": no forward-looking modification of the background inventories). "SSP2-Baseline" selected by default. .. code-block:: python """ def __getitem__(self, key): """ Make class['foo'] automatically filter for the parameter 'foo' Makes the model code much cleaner :param key: Parameter name :type key: str :return: `array` filtered after the parameter selected """ return self.temp_array.sel(parameter=key) def get_results_table(self, split, sensitivity=False): """ Format an xarray.DataArray array to receive the results. :param split: "components" or "impact categories". Split by impact categories only applicable when "endpoint" level is applied. :return: xarrray.DataArray """ if split == "components": cat = [ "direct - exhaust", "direct - non-exhaust", "energy chain", "maintenance", "glider", "EoL", "powertrain", "energy storage", "road", ] dict_impact_cat = list(self.impact_categories.keys()) if sensitivity == False: response = xr.DataArray( np.zeros( ( self.B.shape[1], len(self.scope["size"]), len(self.scope["powertrain"]), len(self.scope["year"]), len(cat), self.iterations, ) ), coords=[ dict_impact_cat, self.scope["size"], self.scope["powertrain"], self.scope["year"], cat, np.arange(0, self.iterations), ], dims=[ "impact_category", "size", "powertrain", "year", "impact", "value", ], ) else: params = [a for a in self.array.value.values] response = xr.DataArray( np.zeros( ( self.B.shape[1], len(self.scope["size"]), len(self.scope["powertrain"]), len(self.scope["year"]), self.iterations, ) ), coords=[ dict_impact_cat, self.scope["size"], self.scope["powertrain"], self.scope["year"], params, ], dims=["impact_category", "size", "powertrain", "year", "parameter"], ) return response def get_split_indices(self): """ Return list of indices to split the results into categories. :return: list of indices :rtype: list """ filename = "dict_split.csv" filepath = DATA_DIR / filename if not filepath.is_file(): raise FileNotFoundError("The dictionary of splits could not be found.") with open(filepath) as f: csv_list = [[val.strip() for val in r.split(";")] for r in f.readlines()] (_, _, *header), *data = csv_list csv_dict = {} for row in data: key, sub_key, *values = row if key in csv_dict: if sub_key in csv_dict[key]: csv_dict[key][sub_key].append( {"search by": values[0], "search for": values[1]} ) else: csv_dict[key][sub_key] = [ {"search by": values[0], "search for": values[1]} ] else: csv_dict[key] = { sub_key: [{"search by": values[0], "search for": values[1]}] } flatten = itertools.chain.from_iterable d = {} l = [] d['direct - exhaust'] = [] d['direct - exhaust'].append( self.inputs[("Carbon dioxide, fossil", ("air",), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Carbon dioxide, from soil or biomass stock", ("air",), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Cadmium", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Copper", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Chromium", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Nickel", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Selenium", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Zinc", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].append( self.inputs[("Chromium VI", ("air", "urban air close to ground"), "kilogram")] ) d['direct - exhaust'].extend(self.index_emissions) d['direct - exhaust'].extend(self.index_noise) l.append(d['direct - exhaust']) for cat in csv_dict["components"]: d[cat] = list( flatten( [ self.get_index_of_flows([l["search for"]], l["search by"]) for l in csv_dict["components"][cat] ] ) ) l.append(d[cat]) list_ind = [d[x] for x in d] maxLen = max(map(len, list_ind)) for row in list_ind: while len(row) < maxLen: row.extend([len(self.inputs) - 1]) return list(d.keys()), list_ind def get_A_matrix(self): """ Load the A matrix. The A matrix contains exchanges of products (rows) between activities (columns). :return: A matrix with three dimensions of shape (number of values, number of products, number of activities). :rtype: numpy.ndarray """ filename = "A_matrix.csv" filepath = ( Path(getframeinfo(currentframe()).filename) .resolve() .parent.joinpath("data/" + filename) ) if not filepath.is_file(): raise FileNotFoundError("The technology matrix could not be found.") initial_A = np.genfromtxt(filepath, delimiter=";") new_A = np.identity(len(self.inputs)) new_A[0 : np.shape(initial_A)[0], 0 : np.shape(initial_A)[0]] = initial_A # Resize the matrix to fit the number of iterations in `array` new_A = np.resize(new_A, (self.array.shape[1], new_A.shape[0], new_A.shape[1])) return new_A def get_B_matrix(self): """ Load the B matrix. The B matrix contains impact assessment figures for a give impact assessment method, per unit of activity. Its length column-wise equals the length of the A matrix row-wise. Its length row-wise equals the number of impact assessment methods. :param method: only "recipe" and "ilcd" available at the moment. :param level: only "midpoint" available at the moment. :return: an array with impact values per unit of activity for each method. :rtype: numpy.ndarray """ if self.method == "recipe": if self.method_type == "midpoint": list_file_names = glob.glob( str(REMIND_FILES_DIR) + "/*recipe_midpoint*{}*.csv".format(self.scenario) ) B = np.zeros((len(list_file_names), 21, len(self.inputs))) else: list_file_names = glob.glob( str(REMIND_FILES_DIR) + "/*recipe_endpoint*{}*.csv".format(self.scenario) ) B = np.zeros((len(list_file_names), 3, len(self.inputs))) else: list_file_names = glob.glob( str(REMIND_FILES_DIR) + "/*ilcd*{}*.csv".format(self.scenario) ) B = np.zeros((len(list_file_names), 19, len(self.inputs))) for f in list_file_names: initial_B = np.genfromtxt(f, delimiter=";") new_B = np.zeros((np.shape(initial_B)[0], len(self.inputs),)) new_B[0 : np.shape(initial_B)[0], 0 : np.shape(initial_B)[1]] = initial_B B[list_file_names.index(f), :, :] = new_B list_impact_categories = list(self.impact_categories.keys()) if self.scenario != "static": response = xr.DataArray( B, coords=[ [2005, 2010, 2020, 2030, 2040, 2050], list_impact_categories, list(self.inputs.keys()), ], dims=["year", "category", "activity"], ) else: response = xr.DataArray( B, coords=[ [2020], list_impact_categories, list(self.inputs.keys()), ], dims=["year", "category", "activity"], ) return response def get_dict_input(self): """ Load a dictionary with tuple ("name of activity", "location", "unit", "reference product") as key, row/column indices as values. :return: dictionary with `label:index` pairs. :rtype: dict """ filename = "dict_inputs_A_matrix.csv" filepath = DATA_DIR / filename if not filepath.is_file(): raise FileNotFoundError( "The dictionary of activity labels could not be found." ) csv_dict = {} count = 0 with open(filepath) as f: input_dict = csv.reader(f, delimiter=";") for row in input_dict: if "(" in row[1]: new_str = row[1].replace("(", "") new_str = new_str.replace(")", "") new_str = [s.strip() for s in new_str.split(",") if s] t = () for s in new_str: if "low population" in s: s = "low population density, long-term" t += (s,) break else: t += (s.replace("'", ""),) csv_dict[(row[0], t, row[2])] = count else: csv_dict[(row[0], row[1], row[2], row[3])] = count count += 1 return csv_dict def get_dict_impact_categories(self): """ Load a dictionary with available impact assessment methods as keys, and assessment level and categories as values. ..code-block:: python {'recipe': {'midpoint': ['freshwater ecotoxicity', 'human toxicity', 'marine ecotoxicity', 'terrestrial ecotoxicity', 'metal depletion', 'agricultural land occupation', 'climate change', 'fossil depletion', 'freshwater eutrophication', 'ionising radiation', 'marine eutrophication', 'natural land transformation', 'ozone depletion', 'particulate matter formation', 'photochemical oxidant formation', 'terrestrial acidification', 'urban land occupation', 'water depletion', 'human noise', 'primary energy, non-renewable', 'primary energy, renewable'] } } :return: dictionary :rtype: dict """ filename = "dict_impact_categories.csv" filepath = DATA_DIR / filename if not filepath.is_file(): raise FileNotFoundError( "The dictionary of impact categories could not be found." ) csv_dict = {} with open(filepath) as f: input_dict = csv.reader(f, delimiter=";") for row in input_dict: if row[0] == self.method and row[3] == self.method_type: csv_dict[row[2]] = {'method':row[1], 'category':row[2], 'type':row[3], 'abbreviation':row[4], 'unit':row[5], 'source':row[6]} return csv_dict def get_rev_dict_input(self): """ Reverse the self.inputs dictionary. :return: reversed dictionary :rtype: dict """ return {v: k for k, v in self.inputs.items()} def get_index_vehicle_from_array( self, items_to_look_for, items_to_look_for_also=None, method="or" ): """ Return list of row/column indices of self.array of labels that contain the string defined in `items_to_look_for`. :param items_to_look_for: string to search for :return: list """ if not isinstance(items_to_look_for, list): items_to_look_for = [items_to_look_for] if not items_to_look_for_also is None: if not isinstance(items_to_look_for_also, list): items_to_look_for_also = [items_to_look_for_also] list_vehicles = self.array.desired.values.tolist() if method == "or": return [ list_vehicles.index(c) for c in list_vehicles if set(items_to_look_for).intersection(c) ] if method == "and": return [ list_vehicles.index(c) for c in list_vehicles if set(items_to_look_for).intersection(c) and set(items_to_look_for_also).intersection(c) ] def get_index_of_flows(self, items_to_look_for, search_by="name"): """ Return list of row/column indices of self.A of labels that contain the string defined in `items_to_look_for`. :param items_to_look_for: string :param search_by: "name" or "compartment" (for elementary flows) :return: list of row/column indices :rtype: list """ if search_by == "name": return [ int(self.inputs[c]) for c in self.inputs if all(ele in c[0].lower() for ele in items_to_look_for) ] if search_by == "compartment": return [ int(self.inputs[c]) for c in self.inputs if all(ele in c[1] for ele in items_to_look_for) ] def export_lci( self, presamples=True, ecoinvent_compatibility=True, ecoinvent_version="3.6", db_name="carculator db", ): """ Export the inventory as a dictionary. Also return a list of arrays that contain pre-sampled random values if :meth:`stochastic` of :class:`CarModel` class has been called. :param presamples: boolean. :param ecoinvent_compatibility: bool. If True, compatible with ecoinvent. If False, compatible with REMIND-ecoinvent. :param ecoinvent_version: str. "3.5", "3.6" or "uvek" :return: inventory, and optionally, list of arrays containing pre-sampled values. :rtype: list """ # Create electricity and fuel market datasets self.create_electricity_market_for_fuel_prep() # Create electricity market dataset for battery production self.create_electricity_market_for_battery_production() self.set_inputs_in_A_matrix(self.array.values) if presamples == True: lci, array = ExportInventory( self.A, self.rev_inputs, db_name=db_name ).write_lci(presamples, ecoinvent_compatibility, ecoinvent_version) return (lci, array) else: lci = ExportInventory(self.A, self.rev_inputs, db_name=db_name).write_lci( presamples, ecoinvent_compatibility, ecoinvent_version ) return lci def export_lci_to_bw( self, presamples=True, ecoinvent_compatibility=True, ecoinvent_version="3.6", db_name="carculator db", ): """ Export the inventory as a `brightway2` bw2io.importers.base_lci.LCIImporter object with the inventory in the `data` attribute. .. code-block:: python # get the inventory i, _ = ic.export_lci_to_bw() # import it in a Brightway2 project i.match_database('ecoinvent 3.6 cutoff', fields=('name', 'unit', 'location', 'reference product')) i.match_database("biosphere3", fields=('name', 'unit', 'categories')) i.match_database(fields=('name', 'unit', 'location', 'reference product')) i.match_database(fields=('name', 'unit', 'categories')) # Create an additional biosphere database for the few flows that do not # exist in "biosphere3" i.create_new_biosphere("additional_biosphere", relink=True) # Check if all exchanges link i.statistics() # Register the database i.write_database() :return: LCIImport object that can be directly registered in a `brightway2` project. :rtype: bw2io.importers.base_lci.LCIImporter """ # Create electricity and fuel market datasets self.create_electricity_market_for_fuel_prep() # Create electricity market dataset for battery production self.create_electricity_market_for_battery_production() self.set_inputs_in_A_matrix(self.array.values) if presamples == True: lci, array = ExportInventory( self.A, self.rev_inputs, db_name=db_name ).write_lci_to_bw(presamples, ecoinvent_compatibility, ecoinvent_version) return (lci, array) else: lci = ExportInventory( self.A, self.rev_inputs, db_name=db_name ).write_lci_to_bw(presamples, ecoinvent_compatibility, ecoinvent_version) return lci def export_lci_to_excel( self, directory=None, ecoinvent_compatibility=True, ecoinvent_version="3.6", software_compatibility="brightway2", filename=None, ): """ Export the inventory as an Excel file (if the destination software is Brightway2) or a CSV file (if the destination software is Simapro) file. Also return the file path where the file is stored. :param directory: directory where to save the file. :type directory: str :param ecoinvent_compatibility: If True, compatible with ecoinvent. If False, compatible with REMIND-ecoinvent. :param ecoinvent_version: "3.6", "3.5" or "uvek" :param software_compatibility: "brightway2" or "simapro" :return: file path where the file is stored. :rtype: str """ if software_compatibility not in ("brightway2", "simapro"): raise NameError( "The destination software argument is not valid. Choose between 'brightway2' or 'simapro'." ) # Simapro inventory only for ecoinvent 3.5 or UVEK if software_compatibility == "simapro": if ecoinvent_version == "3.6": print( "Simapro-compatible inventory export is only available for ecoinvent 3.5 or UVEK." ) return ecoinvent_compatibility = True ecoinvent_version = "3.5" # Create electricity and fuel market datasets self.create_electricity_market_for_fuel_prep() # Create electricity market dataset for battery production self.create_electricity_market_for_battery_production() self.set_inputs_in_A_matrix(self.array.values) fp = ExportInventory( self.A, self.rev_inputs, db_name=filename or "carculator db" ).write_lci_to_excel( directory, ecoinvent_compatibility, ecoinvent_version, software_compatibility, filename, ) return fp def define_electricity_mix_for_fuel_prep(self): """ This function defines a fuel mix based either on user-defined mix, or on default mixes for a given country. The mix is calculated as the average mix, weighted by the distribution of annually driven kilometers. :return: """ try: losses_to_low = float(self.bs.losses[self.country]["LV"]) except KeyError: # If losses for the country are not found, assume EU average losses_to_low = float(self.bs.losses["RER"]["LV"]) if "custom electricity mix" in self.background_configuration: # If a special electricity mix is specified, we use it mix = self.background_configuration["custom electricity mix"] else: use_year = [ int(i) for i in ( self.array.values[ self.array_inputs["lifetime kilometers"], :, self.get_index_vehicle_from_array( [ "BEV", "FCEV", "PHEV-p", "PHEV-d", "ICEV-p", "ICEV-d", "HEV-p", "HEV-d", "ICEV-g", ] ), ] / self.array.values[ self.array_inputs["kilometers per year"], :, self.get_index_vehicle_from_array( [ "BEV", "FCEV", "PHEV-p", "PHEV-d", "ICEV-p", "ICEV-d", "HEV-p", "HEV-d", "ICEV-g", ] ), ] ) .mean(axis=1) .reshape(-1, len(self.scope["year"])) .mean(axis=0) ] mix = [ self.bs.electricity_mix.sel( country=self.country, variable=[ "Hydro", "Nuclear", "Gas", "Solar", "Wind", "Biomass", "Coal", "Oil", "Geothermal", "Waste", ], ) .interp( year=np.arange(y, y + use_year[self.scope["year"].index(y)]), kwargs={"fill_value": "extrapolate"}, ) .mean(axis=0) .values if y + use_year[self.scope["year"].index(y)] <= 2050 else self.bs.electricity_mix.sel( country=self.country, variable=[ "Hydro", "Nuclear", "Gas", "Solar", "Wind", "Biomass", "Coal", "Oil", "Geothermal", "Waste", ], ) .interp(year=np.arange(y, 2051), kwargs={"fill_value": "extrapolate"}) .mean(axis=0) .values for y in self.scope["year"] ] return mix def create_electricity_market_for_fuel_prep(self): """ This function fills the electricity market that supplies battery charging operations and hydrogen production through electrolysis. """ try: losses_to_low = float(self.bs.losses[self.country]["LV"]) except KeyError: # If losses for the country are not found, assume EU average losses_to_low = float(self.bs.losses["RER"]["LV"]) # Fill the electricity markets for battery charging and hydrogen production for y in self.scope["year"]: m = np.array(self.mix[self.scope["year"].index(y)]).reshape(-1, 10, 1) # Add electricity technology shares self.A[ np.ix_( np.arange(self.iterations), [self.inputs[self.elec_map[t]] for t in self.elec_map], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ) ] = (m * -1 * losses_to_low) # Add transmission network for high and medium voltage self.A[ :, self.inputs[ ( "transmission network construction, electricity, high voltage", "CH", "kilometer", "transmission network, electricity, high voltage", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ] = (6.58e-9 * -1 * losses_to_low) self.A[ :, self.inputs[ ( "transmission network construction, electricity, medium voltage", "CH", "kilometer", "transmission network, electricity, medium voltage", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ] = (1.86e-8 * -1 * losses_to_low) self.A[ :, self.inputs[ ( "transmission network construction, long-distance", "UCTE", "kilometer", "transmission network, long-distance", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ] = (3.17e-10 * -1 * losses_to_low) # Add distribution network, low voltage self.A[ :, self.inputs[ ( "distribution network construction, electricity, low voltage", "CH", "kilometer", "distribution network, electricity, low voltage", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ] = (8.74e-8 * -1 * losses_to_low) # Add supply of sulfur hexafluoride for transformers self.A[ :, self.inputs[ ( "market for sulfur hexafluoride, liquid", "RER", "kilogram", "sulfur hexafluoride, liquid", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ] = ((5.4e-8 + 2.99e-9) * -1 * losses_to_low) # Add SF_6 leakage self.A[ :, self.inputs[("Sulfur hexafluoride", ("air",), "kilogram")], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for fuel preparation" in i[0] ], ] = ((5.4e-8 + 2.99e-9) * -1 * losses_to_low) def create_electricity_market_for_battery_production(self): """ This function fills in the column in `self.A` concerned with the electricity mix used for manufacturing battery cells :return: """ battery_tech = self.background_configuration["energy storage"]["electric"][ "type" ] battery_origin = self.background_configuration["energy storage"]["electric"][ "origin" ] try: losses_to_low = float(self.bs.losses[battery_origin]["LV"]) except KeyError: losses_to_low = float(self.bs.losses["CN"]["LV"]) mix_battery_manufacturing = ( self.bs.electricity_mix.sel( country=battery_origin, variable=[ "Hydro", "Nuclear", "Gas", "Solar", "Wind", "Biomass", "Coal", "Oil", "Geothermal", "Waste", ], ) .interp(year=self.scope["year"], kwargs={"fill_value": "extrapolate"}) .values ) # Fill the electricity markets for battery production for y in self.scope["year"]: m = np.array( mix_battery_manufacturing[self.scope["year"].index(y)] ).reshape(-1, 10, 1) self.A[ np.ix_( np.arange(self.iterations), [self.inputs[self.elec_map[t]] for t in self.elec_map], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ) ] = (m * losses_to_low * -1) # Add transmission network for high and medium voltage self.A[ :, self.inputs[ ( "transmission network construction, electricity, high voltage", "CH", "kilometer", "transmission network, electricity, high voltage", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ] = (6.58e-9 * -1 * losses_to_low) self.A[ :, self.inputs[ ( "transmission network construction, electricity, medium voltage", "CH", "kilometer", "transmission network, electricity, medium voltage", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ] = (1.86e-8 * -1 * losses_to_low) self.A[ :, self.inputs[ ( "transmission network construction, long-distance", "UCTE", "kilometer", "transmission network, long-distance", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ] = (3.17e-10 * -1 * losses_to_low) # Add distribution network, low voltage self.A[ :, self.inputs[ ( "distribution network construction, electricity, low voltage", "CH", "kilometer", "distribution network, electricity, low voltage", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ] = (8.74e-8 * -1 * losses_to_low) # Add supply of sulfur hexafluoride for transformers self.A[ :, self.inputs[ ( "market for sulfur hexafluoride, liquid", "RER", "kilogram", "sulfur hexafluoride, liquid", ) ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ] = ((5.4e-8 + 2.99e-9) * -1 * losses_to_low) # Add SF_6 leakage self.A[ :, self.inputs[("Sulfur hexafluoride", ("air",), "kilogram")], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], ] = ((5.4e-8 + 2.99e-9) * -1 * losses_to_low) def set_actual_range(self): """ Set the actual range considering the blend. Liquid bio-fuels and synthetic fuels typically have a lower calorific value. Hence, the need to recalculate the vehicle range. Modifies parameter `range` of `array` in place """ if {"ICEV-p", "HEV-p", "PHEV-p"}.intersection(set(self.scope["powertrain"])): for y in self.scope["year"]: share_primary = self.fuel_blends["petrol"]["primary"]["share"][ self.scope["year"].index(y) ] lhv_primary = self.fuel_blends["petrol"]["primary"]["lhv"] share_secondary = self.fuel_blends["petrol"]["secondary"]["share"][ self.scope["year"].index(y) ] lhv_secondary = self.fuel_blends["petrol"]["secondary"]["lhv"] index = self.get_index_vehicle_from_array( ["ICEV-p", "HEV-p", "PHEV-p"], y, method="and" ) self.array.values[self.array_inputs["range"], :, index] = ( ( ( self.array.values[self.array_inputs["fuel mass"], :, index] * share_primary * lhv_primary ) + ( self.array.values[self.array_inputs["fuel mass"], :, index] * share_secondary * lhv_secondary ) ) * 1000 / self.array.values[self.array_inputs["TtW energy"], :, index] ) if {"ICEV-d", "HEV-d", "PHEV-d"}.intersection(set(self.scope["powertrain"])): for y in self.scope["year"]: share_primary = self.fuel_blends["diesel"]["primary"]["share"][ self.scope["year"].index(y) ] lhv_primary = self.fuel_blends["diesel"]["primary"]["lhv"] share_secondary = self.fuel_blends["diesel"]["secondary"]["share"][ self.scope["year"].index(y) ] lhv_secondary = self.fuel_blends["diesel"]["secondary"]["lhv"] index = self.get_index_vehicle_from_array( ["ICEV-d", "PHEV-d", "HEV-d"], y, method="and" ) self.array.values[self.array_inputs["range"], :, index] = ( ( ( self.array.values[self.array_inputs["fuel mass"], :, index] * share_primary * lhv_primary ) + ( self.array.values[self.array_inputs["fuel mass"], :, index] * share_secondary * lhv_secondary ) ) * 1000 / self.array.values[self.array_inputs["TtW energy"], :, index] ) def define_fuel_blends(self): """ This function defines fuel blends from what is passed in `background_configuration`. It populates a dictionary `self.fuel_blends` that contains the respective shares, lower heating values and CO2 emission factors of the fuels used. :return: """ fuels_lhv = { "petrol": 42.4, "bioethanol - wheat straw": 26.8, "bioethanol - maize starch": 26.8, "bioethanol - sugarbeet": 26.8, "bioethanol - forest residues": 26.8, "synthetic gasoline": 42.4, "diesel": 42.8, "biodiesel - cooking oil": 31.7, "biodiesel - algae": 31.7, "synthetic diesel": 43.3, "cng": 55.5, "biogas": 55.5, "syngas": 55.5 } fuels_CO2 = { "petrol": 3.18, "bioethanol - wheat straw": 1.91, "bioethanol - maize starch": 1.91, "bioethanol - sugarbeet": 1.91, "bioethanol - forest residues": 1.91, "synthetic gasoline": 3.18, "diesel": 3.14, "biodiesel - cooking oil": 2.85, "biodiesel - algae": 2.85, "synthetic diesel": 3.16, "cng": 2.65, "biogas": 2.65, "syngas": 2.65 } if {"ICEV-p", "HEV-p", "PHEV-p"}.intersection(set(self.scope["powertrain"])): fuel_type = "petrol" primary, secondary, primary_share, secondary_share = self.find_fuel_shares( fuel_type ) self.create_fuel_markets( fuel_type, primary, secondary, primary_share, secondary_share ) self.fuel_blends[fuel_type] = { "primary": { "type": primary, "share": primary_share, "lhv": fuels_lhv[primary], "CO2": fuels_CO2[primary], }, "secondary": { "type": secondary, "share": secondary_share, "lhv": fuels_lhv[secondary], "CO2": fuels_CO2[secondary], }, } if {"ICEV-d", "HEV-d", "PHEV-d"}.intersection(set(self.scope["powertrain"])): fuel_type = "diesel" primary, secondary, primary_share, secondary_share = self.find_fuel_shares( fuel_type ) self.create_fuel_markets( fuel_type, primary, secondary, primary_share, secondary_share ) self.fuel_blends[fuel_type] = { "primary": { "type": primary, "share": primary_share, "lhv": fuels_lhv[primary], "CO2": fuels_CO2[primary], }, "secondary": { "type": secondary, "share": secondary_share, "lhv": fuels_lhv[secondary], "CO2": fuels_CO2[secondary], }, } if {"ICEV-g"}.intersection(set(self.scope["powertrain"])): fuel_type = "cng" primary, secondary, primary_share, secondary_share = self.find_fuel_shares( fuel_type ) self.create_fuel_markets( fuel_type, primary, secondary, primary_share, secondary_share ) self.fuel_blends[fuel_type] = { "primary": {"type": primary, "share": primary_share, "lhv": fuels_lhv[primary], "CO2": fuels_CO2[primary]}, "secondary": {"type": secondary, "share": secondary_share, "lhv": fuels_lhv[primary], "CO2": fuels_CO2[primary]}, } if {"FCEV"}.intersection(set(self.scope["powertrain"])): fuel_type = "hydrogen" primary, secondary, primary_share, secondary_share = self.find_fuel_shares( fuel_type ) self.create_fuel_markets( fuel_type, primary, secondary, primary_share, secondary_share ) self.fuel_blends[fuel_type] = { "primary": {"type": primary, "share": primary_share}, "secondary": {"type": secondary, "share": secondary_share}, } if {"BEV", "PHEV-p", "PHEV-d"}.intersection(set(self.scope["powertrain"])): fuel_type = "electricity" self.create_fuel_markets(fuel_type) def create_fuel_markets( self, fuel_type, primary=None, secondary=None, primary_share=None, secondary_share=None, ): """ This function creates markets for fuel, considering a given blend, a given fuel type and a given year. It also adds separate electricity input in case hydrogen from electrolysis is needed somewhere in the fuel supply chain. :return: """ d_fuels = { "electrolysis": { "name": ( "Hydrogen, gaseous, 700 bar, from electrolysis, at H2 fuelling station", "RER", "kilogram", "Hydrogen, gaseous, 700 bar, from electrolysis, at H2 fuelling station", ), "additional electricity": 58, }, "smr - natural gas": { "name": ( "Hydrogen, gaseous, 700 bar, from SMR NG w/o CCS, at H2 fuelling station", "RER", "kilogram", "Hydrogen, gaseous, 700 bar, from SMR NG w/o CCS, at H2 fuelling station", ), "additional electricity": 0, }, "smr - natural gas with CCS": { "name": ( "Hydrogen, gaseous, 700 bar, from SMR NG w CCS, at H2 fuelling station", "RER", "kilogram", "Hydrogen, gaseous, 700 bar, from SMR NG w CCS, at H2 fuelling station", ), "additional electricity": 0, }, "smr - biogas": { "name": ( "Hydrogen, gaseous, 700 bar, from SMR of biogas, at H2 fuelling station", "RER", "kilogram", "Hydrogen, gaseous, 700 bar, from SMR of biogas, at H2 fuelling station", ), "additional electricity": 0, }, "smr - biogas with CCS": { "name": ( "Hydrogen, gaseous, 700 bar, from SMR of biogas with CCS, at H2 fuelling station", "RER", "kilogram", "Hydrogen, gaseous, 700 bar, from SMR of biogas with CCS, at H2 fuelling station", ), "additional electricity": 0, }, "coal gasification": { "name": ( "Hydrogen, gaseous, 700 bar, from coal gasification, at H2 fuelling station", "RER", "kilogram", "Hydrogen, gaseous, 700 bar, from coal gasification, at H2 fuelling station", ), "additional electricity": 0, }, "wood gasification": { "name": ( "Hydrogen, gaseous, 700 bar, from dual fluidised bed gasification of woody biomass, at H2 fuelling station", "CH", "kilogram", "Hydrogen, gaseous, 700 bar", ), "additional electricity": 0, }, "wood gasification with CCS": { "name": ( "Hydrogen, gaseous, 700 bar, from dual fluidised bed gasification of woody biomass with CCS, at H2 fuelling station", "CH", "kilogram", "Hydrogen, gaseous, 700 bar", ), "additional electricity": 0, }, "cng": { "name": ( "market for natural gas, from high pressure network (1-5 bar), at service station", "GLO", "kilogram", "natural gas, from high pressure network (1-5 bar), at service station", ), "additional electricity": 0, }, "biogas": { "name": ( "biogas upgrading - sewage sludge - amine scrubbing - best", "CH", "kilogram", "biogas upgrading - sewage sludge - amine scrubbing - best", ), "additional electricity": 0, }, "syngas": { "name": ( "Methane production, synthetic, from electrochemical methanation", "RER", "kilogram", "Methane, synthetic", ), "additional electricity": 58 * 0.50779661, }, "diesel": { "name": ( "market for diesel", "Europe without Switzerland", "kilogram", "diesel", ), "additional electricity": 0, }, "biodiesel - algae": { "name": ( "Biodiesel from algae", "RER", "kilogram", "Biodiesel from algae", ), "additional electricity": 0, }, "biodiesel - cooking oil": { "name": ( "Biodiesel from cooking oil", "RER", "kilogram", "Biodiesel from cooking oil", ), "additional electricity": 0, }, "synthetic diesel": { "name": ( "Diesel production, synthetic, Fischer Tropsch process", "RER", "kilogram", "Diesel, synthetic", ), "additional electricity": 58 * 0.2875, }, "petrol": { "name": ( "market for petrol, low-sulfur", "Europe without Switzerland", "kilogram", "petrol, low-sulfur", ), "additional electricity": 0, }, "bioethanol - wheat straw": { "name": ( "Ethanol from wheat straw pellets", "RER", "kilogram", "Ethanol from wheat straw pellets", ), "additional electricity": 0, }, "bioethanol - forest residues": { "name": ( "Ethanol from forest residues", "RER", "kilogram", "Ethanol from forest residues", ), "additional electricity": 0, }, "bioethanol - sugarbeet": { "name": ( "Ethanol from sugarbeet", "RER", "kilogram", "Ethanol from sugarbeet", ), "additional electricity": 0, }, "bioethanol - maize starch": { "name": ( "Ethanol from maize starch", "RER", "kilogram", "Ethanol from maize starch", ), "additional electricity": 0, }, "synthetic gasoline": { "name": ( "Gasoline production, synthetic, from methanol", "RER", "kilogram", "Gasoline, synthetic", ), "additional electricity": 58 * 0.328, }, } d_dataset_name = { "petrol": "fuel supply for gasoline vehicles, ", "diesel": "fuel supply for diesel vehicles, ", "cng": "fuel supply for gas vehicles, ", "hydrogen": "fuel supply for hydrogen vehicles, ", "electricity": "electricity supply for electric vehicles, ", } if fuel_type != "electricity": for y in self.scope["year"]: dataset_name = d_dataset_name[fuel_type] + str(y) fuel_market_index = [ self.inputs[i] for i in self.inputs if i[0] == dataset_name ][0] primary_fuel_activity_index = self.inputs[d_fuels[primary]["name"]] secondary_fuel_activity_index = self.inputs[d_fuels[secondary]["name"]] self.A[:, primary_fuel_activity_index, fuel_market_index] = ( -1 * primary_share[self.scope["year"].index(y)] ) self.A[:, secondary_fuel_activity_index, fuel_market_index] = ( -1 * secondary_share[self.scope["year"].index(y)] ) additional_electricity = ( d_fuels[primary]["additional electricity"] * primary_share[self.scope["year"].index(y)] ) + ( d_fuels[secondary]["additional electricity"] * secondary_share[self.scope["year"].index(y)] ) if additional_electricity > 0: electricity_mix_index = [ self.inputs[i] for i in self.inputs if i[0] == "electricity market for fuel preparation, " + str(y) ][0] self.A[:, electricity_mix_index, fuel_market_index] = ( -1 * additional_electricity ) else: for y in self.scope["year"]: dataset_name = d_dataset_name[fuel_type] + str(y) electricity_market_index = [ self.inputs[i] for i in self.inputs if i[0] == dataset_name ][0] electricity_mix_index = [ self.inputs[i] for i in self.inputs if i[0] == "electricity market for fuel preparation, " + str(y) ][0] self.A[:, electricity_mix_index, electricity_market_index] = -1 def set_inputs_in_A_matrix(self, array): """ Fill-in the A matrix. Does not return anything. Modifies in place. Shape of the A matrix (values, products, activities). :param array: :attr:`array` from :class:`CarModel` class """ # Glider self.A[ :, self.inputs[ ( "market for glider, passenger car", "GLO", "kilogram", "glider, passenger car", ) ], -self.number_of_cars :, ] = ( (array[self.array_inputs["glider base mass"], :]) / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ("Glider lightweighting", "GLO", "kilogram", "Glider lightweighting") ], -self.number_of_cars :, ] = ( ( array[self.array_inputs["lightweighting"], :] * array[self.array_inputs["glider base mass"], :] ) / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ( "maintenance, passenger car", "RER", "unit", "passenger car maintenance", ) ], -self.number_of_cars :, ] = (array[self.array_inputs["curb mass"], :] / 1240 / 150000 * -1) # Glider EoL self.A[ :, self.inputs[ ( "market for manual dismantling of used electric passenger car", "GLO", "unit", "manual dismantling of used electric passenger car", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["curb mass"], :] * (1 - array[self.array_inputs["combustion power share"], :]) / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ( "market for manual dismantling of used passenger car with internal combustion engine", "GLO", "unit", "manual dismantling of used passenger car with internal combustion engine", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["curb mass"], :] * array[self.array_inputs["combustion power share"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) # Powertrain components self.A[ :, self.inputs[ ( "market for charger, electric passenger car", "GLO", "kilogram", "charger, electric passenger car", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["charger mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ( "market for converter, for electric passenger car", "GLO", "kilogram", "converter, for electric passenger car", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["converter mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ( "market for electric motor, electric passenger car", "GLO", "kilogram", "electric motor, electric passenger car", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["electric engine mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ( "market for inverter, for electric passenger car", "GLO", "kilogram", "inverter, for electric passenger car", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["inverter mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[ ( "market for power distribution unit, for electric passenger car", "GLO", "kilogram", "power distribution unit, for electric passenger car", ) ], -self.number_of_cars :, ] = ( array[self.array_inputs["power distribution unit mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) l_elec_pt = [ "charger mass", "converter mass", "inverter mass", "power distribution unit mass", "electric engine mass", "fuel cell stack mass", "fuel cell ancillary BoP mass", "fuel cell essential BoP mass", "battery cell mass", "battery BoP mass", ] self.A[ :, self.inputs[ ( "market for used powertrain from electric passenger car, manual dismantling", "GLO", "kilogram", "used powertrain from electric passenger car, manual dismantling", ) ], -self.number_of_cars :, ] = ( array[[self.array_inputs[l] for l in l_elec_pt], :].sum(axis=0) / array[self.array_inputs["lifetime kilometers"], :] ) self.A[ :, self.inputs[ ( "market for internal combustion engine, passenger car", "GLO", "kilogram", "internal combustion engine, for passenger car", ) ], -self.number_of_cars :, ] = ( ( array[ [ self.array_inputs[l] for l in ["combustion engine mass", "powertrain mass"] ], :, ].sum(axis=0) ) / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[("Ancillary BoP", "GLO", "kilogram", "Ancillary BoP")], -self.number_of_cars :, ] = ( array[self.array_inputs["fuel cell ancillary BoP mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[("Essential BoP", "GLO", "kilogram", "Essential BoP")], -self.number_of_cars :, ] = ( array[self.array_inputs["fuel cell essential BoP mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) self.A[ :, self.inputs[("Stack", "GLO", "kilowatt", "Stack")], -self.number_of_cars :, ] = ( array[self.array_inputs["fuel cell stack mass"], :] / array[self.array_inputs["lifetime kilometers"], :] * -1 ) # Start of printout print( "****************** IMPORTANT BACKGROUND PARAMETERS ******************", end="\n * ", ) # Energy storage print( "The country of use is " + self.country, end="\n * ", ) battery_tech = self.background_configuration["energy storage"]["electric"][ "type" ] battery_origin = self.background_configuration["energy storage"]["electric"][ "origin" ] print( "Power and energy batteries produced in " + battery_origin + " using " + battery_tech + " chemistry.", end="\n * ", ) # Use the NMC inventory of Schmidt et al. 2019 self.A[ :, self.inputs[("Battery BoP", "GLO", "kilogram", "Battery BoP")], -self.number_of_cars :, ] = ( ( array[self.array_inputs["battery BoP mass"], :] * (1 + array[self.array_inputs["battery lifetime replacements"], :]) ) / array[self.array_inputs["lifetime kilometers"], :] * -1 ) battery_cell_label = ( "Battery cell, " + battery_tech, "GLO", "kilogram", "Battery cell", ) self.A[:, self.inputs[battery_cell_label], -self.number_of_cars :,] = ( ( array[self.array_inputs["battery cell mass"], :] * (1 + array[self.array_inputs["fuel cell lifetime replacements"], :]) ) / array[self.array_inputs["lifetime kilometers"], :] * -1 ) # Set an input of electricity, given the country of manufacture self.A[ :, self.inputs[ ( "market group for electricity, medium voltage", "World", "kilowatt hour", "electricity, medium voltage", ) ], self.inputs[battery_cell_label], ] = 0 for y in self.scope["year"]: index = self.get_index_vehicle_from_array(y) self.A[ np.ix_( np.arange(self.iterations), [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity market for energy storage production" in i[0] ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] ], ) ] = ( array[ self.array_inputs["battery cell production electricity"], :, index ].T * self.A[ :, self.inputs[battery_cell_label], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] ], ] ).reshape( self.iterations, 1, -1 ) index_A = [ self.inputs[c] for c in self.inputs if any( ele in c[0] for ele in ["ICEV-d", "ICEV-p", "HEV-p", "PHEV-p", "PHEV-d", "HEV-d"] ) ] index = self.get_index_vehicle_from_array( ["ICEV-d", "ICEV-p", "HEV-p", "PHEV-p", "PHEV-d", "HEV-d"] ) self.A[ :, self.inputs[ ( "polyethylene production, high density, granulate", "RER", "kilogram", "polyethylene, high density, granulate", ) ], index_A, ] = ( array[self.array_inputs["fuel tank mass"], :, index] / array[self.array_inputs["lifetime kilometers"], :, index] * -1 ).T index = self.get_index_vehicle_from_array("ICEV-g") self.A[ :, self.inputs[ ( "glass fibre reinforced plastic production, polyamide, injection moulded", "RER", "kilogram", "glass fibre reinforced plastic, polyamide, injection moulded", ) ], self.index_cng, ] = ( array[self.array_inputs["fuel tank mass"], :, index] / array[self.array_inputs["lifetime kilometers"], :, index] * -1 ).T if "hydrogen" in self.background_configuration["energy storage"]: # If a customization dict is passed hydro_tank_technology = self.background_configuration["energy storage"][ "hydrogen" ]["type"] else: hydro_tank_technology = "carbon fiber" dict_tank_map = { "carbon fiber": ( "Fuel tank, compressed hydrogen gas, 700bar", "GLO", "kilogram", "Fuel tank, compressed hydrogen gas, 700bar", ), "hdpe": ( "Fuel tank, compressed hydrogen gas, 700bar, with HDPE liner", "RER", "kilogram", "Hydrogen tank", ), "aluminium": ( "Fuel tank, compressed hydrogen gas, 700bar, with aluminium liner", "RER", "kilogram", "Hydrogen tank", ), } index = self.get_index_vehicle_from_array("FCEV") self.A[ :, self.inputs[dict_tank_map[hydro_tank_technology]], self.index_fuel_cell, ] = ( array[self.array_inputs["fuel tank mass"], :, index] / array[self.array_inputs["lifetime kilometers"], :, index] * -1 ).T for y in self.scope["year"]: sum_renew, co2_intensity_tech = self.define_renewable_rate_in_mix() if self.scope["year"].index(y) + 1 == len(self.scope["year"]): end_str = "\n * " else: end_str = "\n \t * " print( "in " + str(y) + ", % of renewable: " + str(np.round(sum_renew * 100, 0)) + "%" + ", GHG intensity per kWh: " + str( int( np.sum( co2_intensity_tech * self.mix[self.scope["year"].index(y)] ) ) ) + " g. CO2-eq.", end=end_str, ) if any( True for x in ["BEV", "PHEV-p", "PHEV-d"] if x in self.scope["powertrain"] ): for y in self.scope["year"]: index = self.get_index_vehicle_from_array( ["BEV", "PHEV-p", "PHEV-d"], y, method="and" ) self.A[ np.ix_( np.arange(self.iterations), [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "electricity supply for electric vehicles" in i[0] ], [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] and any( True for x in ["BEV", "PHEV-p", "PHEV-d"] if x in i[0] ) ], ) ] = ( array[self.array_inputs["electricity consumption"], :, index] * -1 ).T.reshape( self.iterations, 1, -1 ) if "FCEV" in self.scope["powertrain"]: index = self.get_index_vehicle_from_array("FCEV") print( "{} is completed by {}.".format( self.fuel_blends["hydrogen"]["primary"]["type"], self.fuel_blends["hydrogen"]["secondary"]["type"], ), end="\n \t * ", ) for y in self.scope["year"]: if self.scope["year"].index(y) + 1 == len(self.scope["year"]): end_str = "\n * " else: end_str = "\n \t * " print( "in " + str(y) + " _________________________________________ " + str( np.round( self.fuel_blends["hydrogen"]["secondary"]["share"][ self.scope["year"].index(y) ] * 100, 0, ) ) + "%", end=end_str, ) # Primary fuel share for y in self.scope["year"]: ind_A = [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] and "FCEV" in i[0] ] ind_array = [ x for x in self.get_index_vehicle_from_array(y) if x in index ] self.A[ :, [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "fuel supply for hydrogen vehicles" in i[0] ], ind_A, ] = ( array[self.array_inputs["fuel mass"], :, ind_array] / array[self.array_inputs["range"], :, ind_array] * -1 ).T if "ICEV-g" in self.scope["powertrain"]: index = self.get_index_vehicle_from_array("ICEV-g") print( "{} is completed by {}.".format( self.fuel_blends["cng"]["primary"]["type"], self.fuel_blends["cng"]["secondary"]["type"], ), end="\n \t * ", ) for y in self.scope["year"]: if self.scope["year"].index(y) + 1 == len(self.scope["year"]): end_str = "\n * " else: end_str = "\n \t * " print( "in " + str(y) + " _________________________________________ " + str( np.round( self.fuel_blends["cng"]["secondary"]["share"][ self.scope["year"].index(y) ] * 100, 0, ) ) + "%", end=end_str, ) # Primary fuel share for y in self.scope["year"]: ind_A = [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] and "ICEV-g" in i[0] ] ind_array = [ x for x in self.get_index_vehicle_from_array(y) if x in index ] self.A[ :, [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "fuel supply for gas vehicles" in i[0] ], ind_A, ] = ( (array[self.array_inputs["fuel mass"], :, ind_array]) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Fuel-based emissions from CNG, CO2 # The share and CO2 emissions factor of CNG is retrieved, if used share_fossil = 0 CO2_fossil = 0 if self.fuel_blends["cng"]["primary"]["type"] == "cng": share_fossil += self.fuel_blends["cng"]["primary"]["share"][ self.scope["year"].index(y) ] CO2_fossil = self.fuel_blends["cng"]["primary"]["CO2"] if self.fuel_blends["cng"]["secondary"]["type"] == "cng": share_fossil += self.fuel_blends["cng"]["secondary"]["share"][ self.scope["year"].index(y) ] CO2_fossil = self.fuel_blends["cng"]["primary"]["CO2"] self.A[ :, self.inputs[("Carbon dioxide, fossil", ("air",), "kilogram")], ind_A, ] = ( array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil * CO2_fossil / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Fuel-based CO2 emission from alternative petrol # The share of non-fossil gas in the blend is retrieved # As well as the CO2 emission factor of the fuel share_non_fossil = 0 CO2_non_fossil = 0 if self.fuel_blends["cng"]["primary"]["type"] != "cng": share_non_fossil += self.fuel_blends["cng"]["primary"]["share"][ self.scope["year"].index(y) ] CO2_non_fossil = self.fuel_blends["cng"]["primary"]["CO2"] if self.fuel_blends["cng"]["secondary"]["type"] != "cng": share_non_fossil += self.fuel_blends["cng"]["secondary"]["share"][ self.scope["year"].index(y) ] CO2_non_fossil = self.fuel_blends["cng"]["secondary"]["CO2"] self.A[ :, self.inputs[("Carbon dioxide, from soil or biomass stock", ("air",), "kilogram")], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_non_fossil * CO2_non_fossil) ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T if [i for i in self.scope["powertrain"] if i in ["ICEV-d", "PHEV-d", "HEV-d"]]: index = self.get_index_vehicle_from_array(["ICEV-d", "PHEV-d", "HEV-d"]) print( "{} is completed by {}.".format( self.fuel_blends["diesel"]["primary"]["type"], self.fuel_blends["diesel"]["secondary"]["type"], ), end="\n \t * ", ) for y in self.scope["year"]: if self.scope["year"].index(y) + 1 == len(self.scope["year"]): end_str = "\n * " else: end_str = "\n \t * " print( "in " + str(y) + " _________________________________________ " + str( np.round( self.fuel_blends["diesel"]["secondary"]["share"][ self.scope["year"].index(y) ] * 100, 0, ) ) + "%", end=end_str, ) for y in self.scope["year"]: ind_A = [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] and any(x in i[0] for x in ["ICEV-d", "PHEV-d", "HEV-d"]) ] ind_array = [ x for x in self.get_index_vehicle_from_array(y) if x in index ] # Fuel supply self.A[ :, [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "fuel supply for diesel vehicles" in i[0] ], ind_A, ] = ( (array[self.array_inputs["fuel mass"], :, ind_array]) / array[self.array_inputs["range"], :, ind_array] * -1 ).T share_fossil = 0 CO2_fossil = 0 # Fuel-based CO2 emission from conventional petrol if self.fuel_blends["diesel"]["primary"]["type"] == "diesel": share_fossil += self.fuel_blends["diesel"]["primary"]["share"][ self.scope["year"].index(y) ] CO2_fossil = self.fuel_blends["diesel"]["primary"]["CO2"] if self.fuel_blends["diesel"]["secondary"]["type"] == "diesel": share_fossil += self.fuel_blends["diesel"]["secondary"]["share"][ self.scope["year"].index(y) ] CO2_fossil = self.fuel_blends["diesel"]["secondary"]["CO2"] self.A[ :, self.inputs[("Carbon dioxide, fossil", ("air",), "kilogram")], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil * CO2_fossil) ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T share_non_fossil = 0 CO2_non_fossil = 0 # Fuel-based CO2 emission from alternative petrol # The share of non-fossil fuel in the blend is retrieved # As well as the CO2 emission factor of the fuel if self.fuel_blends["diesel"]["primary"]["type"] != "diesel": share_non_fossil += self.fuel_blends["diesel"]["primary"]["share"][ self.scope["year"].index(y) ] CO2_non_fossil = self.fuel_blends["diesel"]["primary"]["CO2"] if self.fuel_blends["diesel"]["secondary"]["type"] != "diesel": share_non_fossil += self.fuel_blends["diesel"]["secondary"]["share"][ self.scope["year"].index(y) ] CO2_non_fossil = self.fuel_blends["diesel"]["secondary"]["CO2"] self.A[ :, self.inputs[("Carbon dioxide, from soil or biomass stock", ("air",), "kilogram")], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_non_fossil * CO2_non_fossil) ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Heavy metals emissions from conventional diesel # Emission factors from Spielmann et al., Transport Services Data v.2 (2007) # Cadmium, 0.01 mg/kg diesel self.A[ :, self.inputs[ ("Cadmium", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Copper, 1.7 mg/kg diesel self.A[ :, self.inputs[ ("Copper", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.7e-6 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Chromium, 0.05 mg/kg diesel self.A[ :, self.inputs[ ("Chromium", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 5.0e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Nickel, 0.07 mg/kg diesel self.A[ :, self.inputs[ ("Nickel", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 7.0e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Selenium, 0.01 mg/kg diesel self.A[ :, self.inputs[ ("Selenium", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.0e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Zinc, 1 mg/kg diesel self.A[ :, self.inputs[ ("Zinc", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.0e-6 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Chromium VI, 0.0001 mg/kg diesel self.A[ :, self.inputs[ ( "Chromium VI", ("air", "urban air close to ground"), "kilogram", ) ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.0e-10 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T if [i for i in self.scope["powertrain"] if i in ["ICEV-p", "HEV-p", "PHEV-p"]]: index = self.get_index_vehicle_from_array(["ICEV-p", "HEV-p", "PHEV-p"]) print( "{} is completed by {}.".format( self.fuel_blends["petrol"]["primary"]["type"], self.fuel_blends["petrol"]["secondary"]["type"], ), end="\n \t * ", ) for y in self.scope["year"]: if self.scope["year"].index(y) + 1 == len(self.scope["year"]): end_str = "\n * " else: end_str = "\n \t * " print( "in " + str(y) + " _________________________________________ " + str( np.round( self.fuel_blends["petrol"]["secondary"]["share"][ self.scope["year"].index(y) ] * 100, 0, ) ) + "%", end=end_str, ) for y in self.scope["year"]: ind_A = [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "Passenger" in i[0] and any(x in i[0] for x in ["ICEV-p", "HEV-p", "PHEV-p"]) ] ind_array = [ x for x in self.get_index_vehicle_from_array(y) if x in index ] # Fuel supply self.A[ :, [ self.inputs[i] for i in self.inputs if str(y) in i[0] and "fuel supply for gasoline vehicles" in i[0] ], ind_A, ] = ( (array[self.array_inputs["fuel mass"], :, ind_array]) / array[self.array_inputs["range"], :, ind_array] * -1 ).T share_fossil = 0 CO2_fossil = 0 # Fuel-based CO2 emission from conventional petrol if self.fuel_blends["petrol"]["primary"]["type"] == "petrol": share_fossil += self.fuel_blends["petrol"]["primary"]["share"][ self.scope["year"].index(y) ] CO2_fossil = self.fuel_blends["petrol"]["primary"]["CO2"] if self.fuel_blends["petrol"]["secondary"]["type"] == "petrol": share_fossil += self.fuel_blends["petrol"]["secondary"]["share"][ self.scope["year"].index(y) ] CO2_fossil = self.fuel_blends["petrol"]["secondary"]["CO2"] self.A[ :, self.inputs[("Carbon dioxide, fossil", ("air",), "kilogram")], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil * CO2_fossil) ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T share_non_fossil = 0 CO2_non_fossil = 0 # Fuel-based CO2 emission from alternative petrol # The share of non-fossil fuel in the blend is retrieved # As well as the CO2 emission factor of the fuel if self.fuel_blends["petrol"]["primary"]["type"] != "petrol": share_non_fossil += self.fuel_blends["petrol"]["primary"]["share"][ self.scope["year"].index(y) ] CO2_non_fossil = self.fuel_blends["petrol"]["primary"]["CO2"] if self.fuel_blends["petrol"]["secondary"]["type"] != "petrol": share_non_fossil += self.fuel_blends["petrol"]["secondary"]["share"][ self.scope["year"].index(y) ] CO2_non_fossil = self.fuel_blends["petrol"]["secondary"]["CO2"] self.A[ :, self.inputs[("Carbon dioxide, from soil or biomass stock", ("air",), "kilogram")], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_non_fossil * CO2_non_fossil) ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Heavy metals emissions from conventional petrol # Cadmium, 0.01 mg/kg gasoline self.A[ :, self.inputs[ ("Cadmium", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Copper, 1.7 mg/kg gasoline self.A[ :, self.inputs[ ("Copper", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.7e-6 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Chromium, 0.05 mg/kg gasoline self.A[ :, self.inputs[ ("Chromium", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 5.0e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Nickel, 0.07 mg/kg gasoline self.A[ :, self.inputs[ ("Nickel", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 7.0e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Selenium, 0.01 mg/kg gasoline self.A[ :, self.inputs[ ("Selenium", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.0e-8 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Zinc, 1 mg/kg gasoline self.A[ :, self.inputs[ ("Zinc", ("air", "urban air close to ground"), "kilogram") ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.0e-6 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Chromium VI, 0.0001 mg/kg gasoline self.A[ :, self.inputs[ ( "Chromium VI", ("air", "urban air close to ground"), "kilogram", ) ], ind_A, ] = ( ( (array[self.array_inputs["fuel mass"], :, ind_array] * share_fossil) * 1.0e-10 ) / array[self.array_inputs["range"], :, ind_array] * -1 ).T # Non-exhaust emissions self.A[ :, self.inputs[ ( "market for road wear emissions, passenger car", "GLO", "kilogram", "road wear emissions, passenger car", ) ], -self.number_of_cars :, ] = (array[self.array_inputs["driving mass"], :] * 1e-08) self.A[ :, self.inputs[ ( "market for tyre wear emissions, passenger car", "GLO", "kilogram", "tyre wear emissions, passenger car", ) ], -self.number_of_cars :, ] = (array[self.array_inputs["driving mass"], :] * 6e-08) self.A[ :, self.inputs[ ( "market for brake wear emissions, passenger car", "GLO", "kilogram", "brake wear emissions, passenger car", ) ], -self.number_of_cars :, ] = (array[self.array_inputs["driving mass"], :] * 5e-09) # Infrastructure self.A[ :, self.inputs[("market for road", "GLO", "meter-year", "road")], -self.number_of_cars :, ] = (5.37e-7 * array[self.array_inputs["driving mass"], :] * -1) # Infrastructure maintenance self.A[ :, self.inputs[ ("market for road maintenance", "RER", "meter-year", "road maintenance") ], -self.number_of_cars :, ] = (1.29e-3 * -1) # Exhaust emissions # Non-fuel based emissions self.A[:, self.index_emissions, -self.number_of_cars :] = ( array[ [ self.array_inputs[self.map_non_fuel_emissions[self.rev_inputs[x]]] for x in self.index_emissions ] ] * -1 ).transpose([1, 0, 2]) # Noise emissions self.A[:, self.index_noise, -self.number_of_cars :] = ( array[ [ self.array_inputs[self.map_noise_emissions[self.rev_inputs[x]]] for x in self.index_noise ] ] * -1 ).transpose([1, 0, 2]) print("*********************************************************************")
[ 6738, 764, 1330, 42865, 62, 34720, 198, 11748, 25064, 198, 11748, 15095, 198, 6738, 764, 25249, 62, 10057, 82, 1330, 25353, 11964, 17633, 198, 6738, 764, 39344, 1330, 36472, 818, 17158, 198, 6738, 10104, 1330, 1459, 14535, 11, 651, 14535, 10951, 198, 6738, 3108, 8019, 1330, 10644, 198, 6738, 629, 541, 88, 1330, 29877, 198, 11748, 269, 21370, 198, 11748, 340, 861, 10141, 198, 11748, 997, 31937, 355, 497, 198, 11748, 299, 32152, 355, 45941, 198, 11748, 2124, 18747, 355, 2124, 81, 198, 198, 40726, 12115, 62, 46700, 1546, 62, 34720, 796, 42865, 62, 34720, 1220, 366, 40, 2390, 1, 628, 198, 4871, 35772, 9771, 14902, 25, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 10934, 290, 8494, 262, 13184, 329, 2482, 32799, 290, 13184, 10784, 628, 220, 220, 220, 31365, 284, 307, 15475, 460, 307, 29083, 416, 6427, 257, 4600, 29982, 63, 22155, 13, 198, 220, 220, 220, 2773, 14895, 287, 262, 4469, 1080, 460, 635, 307, 12328, 416, 6427, 257, 4600, 25249, 62, 11250, 3924, 63, 22155, 13, 628, 220, 220, 220, 11485, 2438, 12, 9967, 3712, 21015, 628, 220, 220, 220, 220, 220, 220, 220, 8354, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 6477, 27432, 10354, 17816, 12473, 53, 3256, 705, 4851, 20114, 3256, 705, 8476, 53, 12, 79, 6, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 47125, 796, 1391, 6, 19315, 10354, 6, 3398, 3256, 1303, 14358, 8744, 3127, 9089, 329, 14679, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 23144, 8744, 5022, 6, 1058, 16410, 16, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 4357, 1303, 287, 428, 1339, 11, 1802, 4, 7409, 1773, 789, 329, 262, 717, 614, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 15, 11, 16, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 15, 11, 15, 11, 16, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 15, 11, 15, 11, 15, 11, 16, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 11, 15, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 1303, 287, 428, 1339, 11, 1802, 4, 4523, 329, 262, 1218, 614, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 25802, 13516, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 66, 782, 10354, 90, 1303, 16684, 1958, 5252, 34377, 329, 25388, 3623, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39754, 5252, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 8482, 519, 292, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20077, 10354, 58, 15, 13, 24, 11, 657, 13, 23, 11, 657, 13, 22, 11, 657, 13, 21, 60, 1303, 7303, 583, 614, 13, 12039, 2472, 352, 329, 1123, 614, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 38238, 5252, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 1837, 782, 292, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20077, 10354, 685, 15, 13, 16, 11, 657, 13, 17, 11, 657, 13, 18, 11, 657, 13, 19, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 25990, 417, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39754, 5252, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 1837, 429, 6587, 21866, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20077, 10354, 58, 15, 13, 24, 11, 657, 13, 23, 11, 657, 13, 22, 11, 657, 13, 21, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 38238, 5252, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 65, 2101, 29893, 532, 10801, 3056, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20077, 10354, 685, 15, 13, 16, 11, 657, 13, 17, 11, 657, 13, 18, 11, 657, 13, 19, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 6449, 3225, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39754, 5252, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 6449, 3225, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20077, 10354, 58, 15, 13, 24, 11, 657, 13, 23, 11, 657, 13, 22, 11, 657, 13, 21, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 38238, 5252, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 65, 952, 2788, 22012, 532, 17135, 14787, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20077, 10354, 685, 15, 13, 16, 11, 657, 13, 17, 11, 657, 13, 18, 11, 657, 13, 19, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 15511, 8648, 10354, 90, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39754, 5252, 10354, 90, 6, 4906, 10354, 6, 9509, 305, 306, 13429, 3256, 705, 20077, 10354, 58, 16, 11, 657, 11, 657, 11, 657, 60, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 38238, 5252, 10354, 90, 6, 4906, 10354, 6, 5796, 81, 532, 3288, 3623, 3256, 705, 20077, 10354, 58, 15, 11, 352, 11, 352, 11, 352, 48999, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 22554, 6143, 10354, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 31067, 10354, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 45, 9655, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 47103, 10354, 705, 15285, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 15511, 8648, 10354, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 6, 29255, 13608, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 35772, 9771, 14902, 7, 9914, 17633, 13, 18747, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4469, 62, 11250, 3924, 28, 25249, 62, 11250, 3924, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8354, 28, 29982, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8883, 2625, 7397, 47, 2075, 4943, 628, 220, 220, 220, 383, 4600, 23144, 8744, 5022, 63, 1994, 287, 262, 4469, 62, 11250, 3924, 22155, 15738, 281, 8744, 5022, 284, 4174, 11, 198, 220, 220, 220, 739, 262, 1296, 286, 530, 393, 1811, 7177, 7, 82, 828, 6906, 319, 573, 71, 1271, 286, 812, 284, 16602, 11, 198, 220, 220, 220, 326, 815, 2472, 352, 11, 286, 543, 262, 36525, 6053, 284, 25, 628, 220, 220, 220, 220, 220, 220, 220, 532, 685, 15, 5974, 17173, 12, 6477, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 16, 5974, 4523, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 17, 5974, 3288, 3623, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 18, 5974, 6591, 1176, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 19, 5974, 2344, 1176, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 20, 5974, 42584, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 21, 5974, 5655, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 22, 5974, 3056, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 23, 5974, 4903, 49723, 198, 220, 220, 220, 220, 220, 220, 220, 532, 685, 24, 5974, 7030, 48244, 341, 628, 220, 220, 220, 1002, 4844, 318, 1813, 11, 262, 8744, 5022, 11188, 284, 262, 1499, 7368, 287, 4600, 19315, 63, 481, 307, 6163, 13, 198, 220, 220, 220, 1002, 645, 1499, 318, 7368, 11, 2031, 8991, 13, 628, 220, 220, 220, 383, 4600, 39754, 63, 290, 4600, 38238, 63, 5252, 8251, 3994, 281, 7177, 351, 7303, 286, 5559, 34139, 5252, 329, 1123, 614, 11, 284, 2251, 257, 2183, 13516, 13, 198, 220, 220, 220, 1002, 4844, 318, 2810, 11, 257, 13516, 2810, 416, 262, 35432, 25809, 2746, 22657, 12115, 318, 973, 11, 543, 481, 4745, 319, 262, 22657, 12115, 2568, 8883, 6163, 13, 628, 220, 220, 220, 3423, 318, 257, 1351, 286, 1695, 5252, 22963, 25, 628, 198, 220, 220, 220, 15084, 8648, 8514, 198, 220, 220, 220, 41436, 198, 220, 220, 220, 39450, 13429, 198, 220, 220, 220, 895, 81, 532, 3288, 3623, 198, 220, 220, 220, 895, 81, 532, 3288, 3623, 351, 327, 7902, 198, 220, 220, 220, 895, 81, 532, 3182, 519, 292, 198, 220, 220, 220, 895, 81, 532, 3182, 519, 292, 351, 327, 7902, 198, 220, 220, 220, 5655, 3623, 2649, 198, 220, 220, 220, 4898, 3623, 2649, 198, 220, 220, 220, 4898, 3623, 2649, 351, 327, 7902, 628, 220, 220, 220, 12068, 3623, 8514, 198, 220, 220, 220, 220, 22369, 198, 220, 220, 220, 269, 782, 198, 220, 220, 220, 3182, 519, 292, 198, 220, 220, 220, 827, 782, 292, 628, 220, 220, 220, 42718, 8514, 198, 220, 220, 220, 34400, 6329, 198, 220, 220, 220, 21866, 198, 220, 220, 220, 32449, 29893, 532, 33773, 198, 220, 220, 220, 32449, 29893, 532, 10801, 3056, 198, 220, 220, 220, 18512, 21866, 628, 220, 220, 220, 4767, 3225, 8514, 198, 220, 220, 220, 34400, 6329, 198, 220, 220, 220, 34139, 198, 220, 220, 220, 13401, 2788, 22012, 532, 17135, 14787, 198, 220, 220, 220, 13401, 2788, 22012, 532, 49235, 39515, 198, 220, 220, 220, 13401, 2788, 22012, 532, 7543, 1350, 316, 198, 220, 220, 220, 13401, 2788, 22012, 532, 8222, 47185, 198, 220, 220, 220, 18512, 21408, 628, 220, 220, 220, 1058, 452, 283, 7177, 25, 7177, 422, 262, 1879, 17633, 1398, 198, 220, 220, 220, 1058, 85, 433, 2981, 7177, 25, 1879, 17633, 13, 18747, 198, 220, 220, 220, 1058, 452, 283, 8354, 25, 22155, 326, 4909, 16628, 329, 46426, 262, 3781, 198, 220, 220, 220, 1058, 452, 283, 4469, 62, 11250, 3924, 25, 22155, 326, 4909, 7747, 329, 4469, 1080, 198, 220, 220, 220, 1058, 452, 283, 8883, 25, 22657, 12115, 2568, 8883, 284, 779, 5855, 50, 4303, 17, 12, 15522, 4470, 1298, 1597, 12, 292, 12, 37850, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 50, 4303, 17, 12, 47, 38841, 463, 70, 42060, 1298, 7095, 23818, 24739, 38, 8971, 284, 352, 11, 3064, 12526, 265, 684, 416, 38123, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12708, 1298, 645, 2651, 12, 11534, 17613, 286, 262, 4469, 8067, 1749, 737, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 50, 4303, 17, 12, 15522, 4470, 1, 6163, 416, 4277, 13, 628, 220, 220, 220, 11485, 2438, 12, 9967, 3712, 21015, 628, 220, 220, 220, 37227, 628, 220, 220, 220, 825, 11593, 1136, 9186, 834, 7, 944, 11, 1994, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6889, 1398, 17816, 21943, 20520, 6338, 8106, 329, 262, 11507, 705, 21943, 6, 198, 220, 220, 220, 220, 220, 220, 220, 27433, 262, 2746, 2438, 881, 21723, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 1994, 25, 25139, 2357, 1438, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 4906, 1994, 25, 965, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 4600, 18747, 63, 29083, 706, 262, 11507, 6163, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13, 29510, 62, 18747, 13, 741, 7, 17143, 2357, 28, 2539, 8, 628, 220, 220, 220, 825, 651, 62, 43420, 62, 11487, 7, 944, 11, 220, 6626, 11, 14233, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 18980, 281, 2124, 18747, 13, 6601, 19182, 7177, 284, 3328, 262, 2482, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 6626, 25, 366, 5589, 3906, 1, 393, 366, 48240, 9376, 1911, 27758, 416, 2928, 9376, 691, 9723, 618, 366, 437, 4122, 1, 1241, 318, 5625, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 2124, 3258, 2433, 13, 6601, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 611, 6626, 6624, 366, 5589, 3906, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3797, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12942, 532, 12142, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12942, 532, 1729, 12, 1069, 42456, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 22554, 6333, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12417, 8219, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4743, 1304, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 78, 43, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6477, 27432, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 22554, 6143, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6344, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 8633, 62, 48240, 62, 9246, 796, 1351, 7, 944, 13, 48240, 62, 66, 26129, 13, 13083, 28955, 628, 220, 220, 220, 220, 220, 220, 220, 611, 14233, 6624, 10352, 25, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2882, 796, 2124, 81, 13, 6601, 19182, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 9107, 418, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 33, 13, 43358, 58, 16, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 944, 13, 29982, 14692, 7857, 8973, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 9246, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2676, 602, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 763, 3669, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8633, 62, 48240, 62, 9246, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 7857, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 6477, 27432, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3797, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 283, 858, 7, 15, 11, 2116, 13, 2676, 602, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 48240, 62, 22872, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6477, 27432, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1941, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 48240, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8367, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 42287, 796, 685, 64, 329, 257, 287, 2116, 13, 18747, 13, 8367, 13, 27160, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2882, 796, 2124, 81, 13, 6601, 19182, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 9107, 418, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 33, 13, 43358, 58, 16, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 944, 13, 29982, 14692, 7857, 8973, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2676, 602, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 763, 3669, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8633, 62, 48240, 62, 9246, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 7857, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 6477, 27432, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 42287, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 28, 14692, 48240, 62, 22872, 1600, 366, 7857, 1600, 366, 6477, 27432, 1600, 366, 1941, 1600, 366, 17143, 2357, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 2882, 628, 220, 220, 220, 825, 651, 62, 35312, 62, 521, 1063, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8229, 1351, 286, 36525, 284, 6626, 262, 2482, 656, 9376, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 1351, 286, 36525, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 1351, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 29472, 796, 366, 11600, 62, 35312, 13, 40664, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 6978, 796, 42865, 62, 34720, 1220, 29472, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2393, 6978, 13, 271, 62, 7753, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 9220, 3673, 21077, 12331, 7203, 464, 22155, 286, 30778, 714, 407, 307, 1043, 19570, 628, 220, 220, 220, 220, 220, 220, 220, 351, 1280, 7, 7753, 6978, 8, 355, 277, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 4868, 796, 16410, 2100, 13, 36311, 3419, 329, 1188, 287, 374, 13, 35312, 7203, 26, 4943, 60, 329, 374, 287, 277, 13, 961, 6615, 3419, 60, 198, 220, 220, 220, 220, 220, 220, 220, 44104, 11, 4808, 11, 1635, 25677, 828, 1635, 7890, 796, 269, 21370, 62, 4868, 628, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 796, 23884, 198, 220, 220, 220, 220, 220, 220, 220, 329, 5752, 287, 1366, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1994, 11, 850, 62, 2539, 11, 1635, 27160, 796, 5752, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1994, 287, 269, 21370, 62, 11600, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 850, 62, 2539, 287, 269, 21370, 62, 11600, 58, 2539, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 58, 2539, 7131, 7266, 62, 2539, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19779, 12947, 416, 1298, 3815, 58, 15, 4357, 366, 12947, 329, 1298, 3815, 58, 16, 48999, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 58, 2539, 7131, 7266, 62, 2539, 60, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19779, 12947, 416, 1298, 3815, 58, 15, 4357, 366, 12947, 329, 1298, 3815, 58, 16, 48999, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 58, 2539, 60, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 850, 62, 2539, 25, 685, 4895, 12947, 416, 1298, 3815, 58, 15, 4357, 366, 12947, 329, 1298, 3815, 58, 16, 48999, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 27172, 268, 796, 340, 861, 10141, 13, 7983, 13, 6738, 62, 2676, 540, 628, 220, 220, 220, 220, 220, 220, 220, 288, 796, 23884, 198, 220, 220, 220, 220, 220, 220, 220, 300, 796, 17635, 628, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 20520, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 12584, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 422, 9260, 393, 42584, 4283, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 34, 324, 76, 1505, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 7222, 2848, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 1925, 398, 1505, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 30403, 7750, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 48767, 47477, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 57, 1939, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 33295, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 1925, 398, 1505, 13889, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 2302, 437, 7, 944, 13, 9630, 62, 368, 7717, 8, 198, 220, 220, 220, 220, 220, 220, 220, 288, 17816, 12942, 532, 12142, 6, 4083, 2302, 437, 7, 944, 13, 9630, 62, 3919, 786, 8, 628, 220, 220, 220, 220, 220, 220, 220, 300, 13, 33295, 7, 67, 17816, 12942, 532, 12142, 6, 12962, 628, 198, 220, 220, 220, 220, 220, 220, 220, 329, 3797, 287, 269, 21370, 62, 11600, 14692, 5589, 3906, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 288, 58, 9246, 60, 796, 1351, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27172, 268, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 1136, 62, 9630, 62, 1659, 62, 44041, 26933, 75, 14692, 12947, 329, 8973, 4357, 300, 14692, 12947, 416, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 300, 287, 269, 21370, 62, 11600, 14692, 5589, 3906, 1, 7131, 9246, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 13, 33295, 7, 67, 58, 9246, 12962, 628, 628, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 521, 796, 685, 67, 58, 87, 60, 329, 2124, 287, 288, 60, 198, 220, 220, 220, 220, 220, 220, 220, 3509, 30659, 796, 3509, 7, 8899, 7, 11925, 11, 1351, 62, 521, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 329, 5752, 287, 1351, 62, 521, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 981, 18896, 7, 808, 8, 1279, 3509, 30659, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 13, 2302, 437, 26933, 11925, 7, 944, 13, 15414, 82, 8, 532, 352, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 1351, 7, 67, 13, 13083, 3419, 828, 1351, 62, 521, 628, 220, 220, 220, 825, 651, 62, 32, 62, 6759, 8609, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8778, 262, 317, 17593, 13, 383, 317, 17593, 4909, 14525, 286, 3186, 357, 8516, 8, 1022, 4568, 357, 28665, 82, 737, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 317, 17593, 351, 1115, 15225, 286, 5485, 357, 17618, 286, 3815, 11, 1271, 286, 3186, 11, 1271, 286, 4568, 737, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 299, 32152, 13, 358, 18747, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 29472, 796, 366, 32, 62, 6759, 8609, 13, 40664, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 6978, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10644, 7, 1136, 14535, 10951, 7, 14421, 14535, 3419, 737, 34345, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 411, 6442, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 8000, 13, 22179, 6978, 7203, 7890, 30487, 1343, 29472, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2393, 6978, 13, 271, 62, 7753, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 9220, 3673, 21077, 12331, 7203, 464, 3037, 17593, 714, 407, 307, 1043, 19570, 628, 220, 220, 220, 220, 220, 220, 220, 4238, 62, 32, 796, 45941, 13, 5235, 6738, 14116, 7, 7753, 6978, 11, 46728, 2676, 2625, 26, 4943, 628, 220, 220, 220, 220, 220, 220, 220, 649, 62, 32, 796, 45941, 13, 738, 414, 7, 11925, 7, 944, 13, 15414, 82, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 649, 62, 32, 58, 15, 1058, 45941, 13, 43358, 7, 36733, 62, 32, 38381, 15, 4357, 657, 1058, 45941, 13, 43358, 7, 36733, 62, 32, 38381, 15, 11907, 796, 4238, 62, 32, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 1874, 1096, 262, 17593, 284, 4197, 262, 1271, 286, 34820, 287, 4600, 18747, 63, 198, 220, 220, 220, 220, 220, 220, 220, 649, 62, 32, 796, 45941, 13, 411, 1096, 7, 3605, 62, 32, 11, 357, 944, 13, 18747, 13, 43358, 58, 16, 4357, 649, 62, 32, 13, 43358, 58, 15, 4357, 649, 62, 32, 13, 43358, 58, 16, 60, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 649, 62, 32, 628, 220, 220, 220, 825, 651, 62, 33, 62, 6759, 8609, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8778, 262, 347, 17593, 13, 383, 347, 17593, 4909, 2928, 8922, 5538, 329, 257, 1577, 2928, 8922, 2446, 11, 198, 220, 220, 220, 220, 220, 220, 220, 583, 4326, 286, 3842, 13, 6363, 4129, 5721, 12, 3083, 21767, 262, 4129, 286, 262, 317, 17593, 5752, 12, 3083, 13, 198, 220, 220, 220, 220, 220, 220, 220, 6363, 4129, 5752, 12, 3083, 21767, 262, 1271, 286, 2928, 8922, 5050, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 2446, 25, 691, 366, 29102, 431, 1, 290, 366, 346, 10210, 1, 1695, 379, 262, 2589, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 1241, 25, 691, 366, 13602, 4122, 1, 1695, 379, 262, 2589, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 281, 7177, 351, 2928, 3815, 583, 4326, 286, 3842, 329, 1123, 2446, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 299, 32152, 13, 358, 18747, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 24396, 6624, 366, 29102, 431, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 24396, 62, 4906, 6624, 366, 13602, 4122, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 7753, 62, 14933, 796, 15095, 13, 4743, 672, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 965, 7, 40726, 12115, 62, 46700, 1546, 62, 34720, 8, 1343, 12813, 9, 29102, 431, 62, 13602, 4122, 9, 90, 92, 24620, 40664, 1911, 18982, 7, 944, 13, 1416, 39055, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 347, 796, 45941, 13, 9107, 418, 19510, 11925, 7, 4868, 62, 7753, 62, 14933, 828, 2310, 11, 18896, 7, 944, 13, 15414, 82, 22305, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 7753, 62, 14933, 796, 15095, 13, 4743, 672, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 965, 7, 40726, 12115, 62, 46700, 1546, 62, 34720, 8, 1343, 12813, 9, 29102, 431, 62, 437, 4122, 9, 90, 92, 24620, 40664, 1911, 18982, 7, 944, 13, 1416, 39055, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 347, 796, 45941, 13, 9107, 418, 19510, 11925, 7, 4868, 62, 7753, 62, 14933, 828, 513, 11, 18896, 7, 944, 13, 15414, 82, 22305, 628, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 7753, 62, 14933, 796, 15095, 13, 4743, 672, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 965, 7, 40726, 12115, 62, 46700, 1546, 62, 34720, 8, 1343, 12813, 9, 346, 10210, 9, 90, 92, 24620, 40664, 1911, 18982, 7, 944, 13, 1416, 39055, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 347, 796, 45941, 13, 9107, 418, 19510, 11925, 7, 4868, 62, 7753, 62, 14933, 828, 678, 11, 18896, 7, 944, 13, 15414, 82, 22305, 628, 220, 220, 220, 220, 220, 220, 220, 329, 277, 287, 1351, 62, 7753, 62, 14933, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4238, 62, 33, 796, 45941, 13, 5235, 6738, 14116, 7, 69, 11, 46728, 2676, 2625, 26, 4943, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 33, 796, 45941, 13, 9107, 418, 19510, 37659, 13, 43358, 7, 36733, 62, 33, 38381, 15, 4357, 18896, 7, 944, 13, 15414, 82, 828, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 33, 58, 15, 1058, 45941, 13, 43358, 7, 36733, 62, 33, 38381, 15, 4357, 657, 1058, 45941, 13, 43358, 7, 36733, 62, 33, 38381, 16, 11907, 796, 4238, 62, 33, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 347, 58, 4868, 62, 7753, 62, 14933, 13, 9630, 7, 69, 828, 1058, 11, 1058, 60, 796, 649, 62, 33, 628, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 48240, 62, 66, 26129, 796, 1351, 7, 944, 13, 48240, 62, 66, 26129, 13, 13083, 28955, 628, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 1416, 39055, 14512, 366, 12708, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2882, 796, 2124, 81, 13, 6601, 19182, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 347, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 763, 3669, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 14315, 11, 3050, 11, 12131, 11, 25054, 11, 1160, 1821, 11, 32215, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 48240, 62, 66, 26129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 7, 944, 13, 15414, 82, 13, 13083, 3419, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 28, 14692, 1941, 1600, 366, 22872, 1600, 366, 21797, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2882, 796, 2124, 81, 13, 6601, 19182, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 347, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 763, 3669, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 42334, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 48240, 62, 66, 26129, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 7, 944, 13, 15414, 82, 13, 13083, 3419, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 28, 14692, 1941, 1600, 366, 22872, 1600, 366, 21797, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 2882, 628, 220, 220, 220, 825, 651, 62, 11600, 62, 15414, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8778, 257, 22155, 351, 46545, 5855, 3672, 286, 3842, 1600, 366, 24886, 1600, 366, 20850, 1600, 366, 35790, 1720, 4943, 355, 1994, 11, 5752, 14, 28665, 198, 220, 220, 220, 220, 220, 220, 220, 36525, 355, 3815, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 22155, 351, 4600, 18242, 25, 9630, 63, 14729, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 8633, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 29472, 796, 366, 11600, 62, 15414, 82, 62, 32, 62, 6759, 8609, 13, 40664, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 6978, 796, 42865, 62, 34720, 1220, 29472, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2393, 6978, 13, 271, 62, 7753, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 9220, 3673, 21077, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 464, 22155, 286, 3842, 14722, 714, 407, 307, 1043, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 796, 23884, 198, 220, 220, 220, 220, 220, 220, 220, 954, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 351, 1280, 7, 7753, 6978, 8, 355, 277, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5128, 62, 11600, 796, 269, 21370, 13, 46862, 7, 69, 11, 46728, 2676, 2625, 26, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 5752, 287, 5128, 62, 11600, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 366, 7203, 287, 5752, 58, 16, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 2536, 796, 5752, 58, 16, 4083, 33491, 7203, 7, 1600, 366, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 2536, 796, 649, 62, 2536, 13, 33491, 7, 4943, 1600, 366, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 2536, 796, 685, 82, 13, 36311, 3419, 329, 264, 287, 649, 62, 2536, 13, 35312, 7, 2430, 8, 611, 264, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 256, 796, 7499, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 264, 287, 649, 62, 2536, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 366, 9319, 3265, 1, 287, 264, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 264, 796, 366, 9319, 3265, 12109, 11, 890, 12, 4354, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 256, 15853, 357, 82, 35751, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2270, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 256, 15853, 357, 82, 13, 33491, 7203, 6, 1600, 366, 12340, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 58, 7, 808, 58, 15, 4357, 256, 11, 5752, 58, 17, 12962, 60, 796, 954, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 58, 7, 808, 58, 15, 4357, 5752, 58, 16, 4357, 5752, 58, 17, 4357, 5752, 58, 18, 12962, 60, 796, 954, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 954, 15853, 352, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 269, 21370, 62, 11600, 628, 220, 220, 220, 825, 651, 62, 11600, 62, 48240, 62, 66, 26129, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8778, 257, 22155, 351, 1695, 2928, 8922, 5050, 355, 8251, 11, 290, 8922, 1241, 290, 9376, 355, 3815, 13, 628, 220, 220, 220, 220, 220, 220, 220, 11485, 8189, 12, 9967, 3712, 21015, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1391, 6, 29102, 431, 10354, 1391, 6, 13602, 4122, 10354, 37250, 48797, 7050, 9940, 313, 44086, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 10734, 28152, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 42380, 9940, 313, 44086, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 353, 23522, 9940, 313, 44086, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 28469, 42435, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 363, 1173, 8596, 1956, 13755, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 42570, 1487, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 69, 793, 346, 42435, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 48797, 7050, 304, 315, 10051, 3299, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 295, 1710, 11881, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 42380, 304, 315, 10051, 3299, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 11802, 1956, 13389, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 8590, 505, 42435, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 3911, 291, 5039, 2300, 9978, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 38611, 32864, 18762, 415, 9978, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 353, 23522, 7408, 2649, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 32679, 1956, 13755, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 7050, 42435, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 10734, 7838, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39754, 2568, 11, 1729, 12, 918, 413, 540, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39754, 2568, 11, 15713, 20520, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 22155, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 8633, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 29472, 796, 366, 11600, 62, 48240, 62, 66, 26129, 13, 40664, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 6978, 796, 42865, 62, 34720, 1220, 29472, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2393, 6978, 13, 271, 62, 7753, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 9220, 3673, 21077, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 464, 22155, 286, 2928, 9376, 714, 407, 307, 1043, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 796, 23884, 628, 220, 220, 220, 220, 220, 220, 220, 351, 1280, 7, 7753, 6978, 8, 355, 277, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5128, 62, 11600, 796, 269, 21370, 13, 46862, 7, 69, 11, 46728, 2676, 2625, 26, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 5752, 287, 5128, 62, 11600, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 5752, 58, 15, 60, 6624, 2116, 13, 24396, 290, 5752, 58, 18, 60, 6624, 2116, 13, 24396, 62, 4906, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 21370, 62, 11600, 58, 808, 58, 17, 11907, 796, 1391, 6, 24396, 10354, 808, 58, 16, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 22872, 10354, 808, 58, 17, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 808, 58, 18, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 397, 4679, 47625, 10354, 808, 58, 19, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 20850, 10354, 808, 58, 20, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 10459, 10354, 808, 58, 21, 48999, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 269, 21370, 62, 11600, 628, 220, 220, 220, 825, 651, 62, 18218, 62, 11600, 62, 15414, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 31849, 262, 2116, 13, 15414, 82, 22155, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 17687, 22155, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 8633, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 1391, 85, 25, 479, 329, 479, 11, 410, 287, 2116, 13, 15414, 82, 13, 23814, 3419, 92, 628, 220, 220, 220, 825, 651, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 3709, 62, 1462, 62, 5460, 62, 1640, 11, 3709, 62, 1462, 62, 5460, 62, 1640, 62, 14508, 28, 14202, 11, 2446, 2625, 273, 1, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8229, 1351, 286, 5752, 14, 28665, 36525, 286, 2116, 13, 18747, 286, 14722, 326, 3994, 262, 4731, 5447, 287, 4600, 23814, 62, 1462, 62, 5460, 62, 1640, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 3709, 62, 1462, 62, 5460, 62, 1640, 25, 4731, 284, 2989, 329, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 1351, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 39098, 7, 23814, 62, 1462, 62, 5460, 62, 1640, 11, 1351, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3709, 62, 1462, 62, 5460, 62, 1640, 796, 685, 23814, 62, 1462, 62, 5460, 62, 1640, 60, 628, 220, 220, 220, 220, 220, 220, 220, 611, 407, 3709, 62, 1462, 62, 5460, 62, 1640, 62, 14508, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 39098, 7, 23814, 62, 1462, 62, 5460, 62, 1640, 62, 14508, 11, 1351, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3709, 62, 1462, 62, 5460, 62, 1640, 62, 14508, 796, 685, 23814, 62, 1462, 62, 5460, 62, 1640, 62, 14508, 60, 628, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 33892, 2983, 796, 2116, 13, 18747, 13, 8906, 1202, 13, 27160, 13, 83, 349, 396, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 611, 2446, 6624, 366, 273, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 33892, 2983, 13, 9630, 7, 66, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 269, 287, 1351, 62, 33892, 2983, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 900, 7, 23814, 62, 1462, 62, 5460, 62, 1640, 737, 3849, 5458, 7, 66, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 611, 2446, 6624, 366, 392, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1351, 62, 33892, 2983, 13, 9630, 7, 66, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 269, 287, 1351, 62, 33892, 2983, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 900, 7, 23814, 62, 1462, 62, 5460, 62, 1640, 737, 3849, 5458, 7, 66, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 900, 7, 23814, 62, 1462, 62, 5460, 62, 1640, 62, 14508, 737, 3849, 5458, 7, 66, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 825, 651, 62, 9630, 62, 1659, 62, 44041, 7, 944, 11, 3709, 62, 1462, 62, 5460, 62, 1640, 11, 2989, 62, 1525, 2625, 3672, 1, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 8229, 1351, 286, 5752, 14, 28665, 36525, 286, 2116, 13, 32, 286, 14722, 326, 3994, 262, 4731, 5447, 287, 4600, 23814, 62, 1462, 62, 5460, 62, 1640, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 3709, 62, 1462, 62, 5460, 62, 1640, 25, 4731, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 2989, 62, 1525, 25, 366, 3672, 1, 393, 366, 5589, 1823, 1, 357, 1640, 19823, 15623, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 1351, 286, 5752, 14, 28665, 36525, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 1351, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2989, 62, 1525, 6624, 366, 3672, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 493, 7, 944, 13, 15414, 82, 58, 66, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 269, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 477, 7, 11129, 287, 269, 58, 15, 4083, 21037, 3419, 329, 9766, 287, 3709, 62, 1462, 62, 5460, 62, 1640, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2989, 62, 1525, 6624, 366, 5589, 1823, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 493, 7, 944, 13, 15414, 82, 58, 66, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 269, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 477, 7, 11129, 287, 269, 58, 16, 60, 329, 9766, 287, 3709, 62, 1462, 62, 5460, 62, 1640, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 825, 10784, 62, 75, 979, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 906, 12629, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 5589, 25901, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 9641, 2625, 18, 13, 21, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 20613, 62, 3672, 2625, 7718, 3129, 1352, 20613, 1600, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 36472, 262, 13184, 355, 257, 22155, 13, 4418, 1441, 257, 1351, 286, 26515, 326, 3994, 662, 12, 37687, 10137, 4738, 3815, 611, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 76, 2788, 25, 63, 301, 5374, 3477, 63, 286, 1058, 4871, 25, 63, 9914, 17633, 63, 1398, 468, 587, 1444, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 906, 12629, 25, 25131, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 304, 3630, 1151, 62, 5589, 25901, 25, 20512, 13, 1002, 6407, 11, 11670, 351, 304, 3630, 1151, 13, 1002, 10352, 11, 11670, 351, 22657, 12115, 12, 721, 36743, 1151, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 304, 3630, 1151, 62, 9641, 25, 965, 13, 366, 18, 13, 20, 1600, 366, 18, 13, 21, 1, 393, 366, 45177, 74, 1, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 13184, 11, 290, 42976, 11, 1351, 286, 26515, 7268, 662, 12, 37687, 10137, 3815, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 1351, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 8744, 290, 5252, 1910, 40522, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 31067, 414, 62, 10728, 62, 1640, 62, 25802, 62, 46012, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 8744, 1910, 27039, 329, 6555, 3227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 31067, 414, 62, 10728, 62, 1640, 62, 65, 16296, 62, 25493, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2617, 62, 15414, 82, 62, 259, 62, 32, 62, 6759, 8609, 7, 944, 13, 18747, 13, 27160, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 906, 12629, 6624, 6407, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 979, 11, 7177, 796, 36472, 818, 17158, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 11, 2116, 13, 18218, 62, 15414, 82, 11, 20613, 62, 3672, 28, 9945, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 13564, 62, 75, 979, 7, 18302, 12629, 11, 304, 3630, 1151, 62, 5589, 25901, 11, 304, 3630, 1151, 62, 9641, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 75, 979, 11, 7177, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 979, 796, 36472, 818, 17158, 7, 944, 13, 32, 11, 2116, 13, 18218, 62, 15414, 82, 11, 20613, 62, 3672, 28, 9945, 62, 3672, 737, 13564, 62, 75, 979, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 906, 12629, 11, 304, 3630, 1151, 62, 5589, 25901, 11, 304, 3630, 1151, 62, 9641, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 300, 979, 628, 220, 220, 220, 825, 10784, 62, 75, 979, 62, 1462, 62, 65, 86, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 906, 12629, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 5589, 25901, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 9641, 2625, 18, 13, 21, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 20613, 62, 3672, 2625, 7718, 3129, 1352, 20613, 1600, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 36472, 262, 13184, 355, 257, 4600, 29199, 1014, 17, 63, 275, 86, 17, 952, 13, 320, 1819, 1010, 13, 8692, 62, 75, 979, 13, 5639, 40, 3546, 26634, 2134, 198, 220, 220, 220, 220, 220, 220, 220, 351, 262, 13184, 287, 262, 4600, 7890, 63, 11688, 13, 628, 220, 220, 220, 220, 220, 220, 220, 11485, 2438, 12, 9967, 3712, 21015, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 651, 262, 13184, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 11, 4808, 796, 14158, 13, 39344, 62, 75, 979, 62, 1462, 62, 65, 86, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1330, 340, 287, 257, 17558, 1014, 17, 1628, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 15699, 62, 48806, 10786, 721, 36743, 1151, 513, 13, 21, 45616, 3256, 7032, 28, 10786, 3672, 3256, 705, 20850, 3256, 705, 24886, 3256, 705, 35790, 1720, 6, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 15699, 62, 48806, 7203, 8482, 22829, 18, 1600, 7032, 28, 10786, 3672, 3256, 705, 20850, 3256, 705, 66, 26129, 6, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 15699, 62, 48806, 7, 25747, 28, 10786, 3672, 3256, 705, 20850, 3256, 705, 24886, 3256, 705, 35790, 1720, 6, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 15699, 62, 48806, 7, 25747, 28, 10786, 3672, 3256, 705, 20850, 3256, 705, 66, 26129, 6, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 281, 3224, 3182, 22829, 6831, 329, 262, 1178, 15623, 326, 466, 407, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2152, 287, 366, 8482, 22829, 18, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 17953, 62, 3605, 62, 8482, 22829, 7203, 2860, 1859, 62, 8482, 22829, 1600, 823, 676, 28, 17821, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 6822, 611, 477, 14525, 2792, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 14269, 3969, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 17296, 262, 6831, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 13, 13564, 62, 48806, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 22228, 40, 20939, 2134, 326, 460, 307, 3264, 6823, 287, 257, 4600, 29199, 1014, 17, 63, 1628, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 275, 86, 17, 952, 13, 320, 1819, 1010, 13, 8692, 62, 75, 979, 13, 5639, 40, 3546, 26634, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 8744, 290, 5252, 1910, 40522, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 31067, 414, 62, 10728, 62, 1640, 62, 25802, 62, 46012, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 8744, 1910, 27039, 329, 6555, 3227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 31067, 414, 62, 10728, 62, 1640, 62, 65, 16296, 62, 25493, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2617, 62, 15414, 82, 62, 259, 62, 32, 62, 6759, 8609, 7, 944, 13, 18747, 13, 27160, 8, 628, 220, 220, 220, 220, 220, 220, 220, 611, 906, 12629, 6624, 6407, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 979, 11, 7177, 796, 36472, 818, 17158, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 11, 2116, 13, 18218, 62, 15414, 82, 11, 20613, 62, 3672, 28, 9945, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 13564, 62, 75, 979, 62, 1462, 62, 65, 86, 7, 18302, 12629, 11, 304, 3630, 1151, 62, 5589, 25901, 11, 304, 3630, 1151, 62, 9641, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 357, 75, 979, 11, 7177, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 979, 796, 36472, 818, 17158, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 11, 2116, 13, 18218, 62, 15414, 82, 11, 20613, 62, 3672, 28, 9945, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 13564, 62, 75, 979, 62, 1462, 62, 65, 86, 7, 18302, 12629, 11, 304, 3630, 1151, 62, 5589, 25901, 11, 304, 3630, 1151, 62, 9641, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 300, 979, 628, 220, 220, 220, 825, 10784, 62, 75, 979, 62, 1462, 62, 1069, 5276, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8619, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 5589, 25901, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 9641, 2625, 18, 13, 21, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 3788, 62, 5589, 25901, 2625, 29199, 1014, 17, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 29472, 28, 14202, 11, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 36472, 262, 13184, 355, 281, 24134, 2393, 357, 361, 262, 10965, 3788, 318, 17558, 1014, 17, 8, 393, 257, 44189, 2393, 357, 361, 262, 10965, 3788, 318, 3184, 499, 305, 8, 2393, 13, 198, 220, 220, 220, 220, 220, 220, 220, 4418, 1441, 262, 2393, 3108, 810, 262, 2393, 318, 8574, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 8619, 25, 8619, 810, 284, 3613, 262, 2393, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 4906, 8619, 25, 965, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 304, 3630, 1151, 62, 5589, 25901, 25, 1002, 6407, 11, 11670, 351, 304, 3630, 1151, 13, 1002, 10352, 11, 11670, 351, 22657, 12115, 12, 721, 36743, 1151, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 304, 3630, 1151, 62, 9641, 25, 366, 18, 13, 21, 1600, 366, 18, 13, 20, 1, 393, 366, 45177, 74, 1, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 3788, 62, 5589, 25901, 25, 366, 29199, 1014, 17, 1, 393, 366, 14323, 499, 305, 1, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 2393, 3108, 810, 262, 2393, 318, 8574, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 81, 4906, 25, 965, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 611, 3788, 62, 5589, 25901, 407, 287, 5855, 29199, 1014, 17, 1600, 366, 14323, 499, 305, 1, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 6530, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 464, 10965, 3788, 4578, 318, 407, 4938, 13, 17489, 1022, 705, 29199, 1014, 17, 6, 393, 705, 14323, 499, 305, 30827, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 3184, 499, 305, 13184, 691, 329, 304, 3630, 1151, 513, 13, 20, 393, 471, 6089, 42, 198, 220, 220, 220, 220, 220, 220, 220, 611, 3788, 62, 5589, 25901, 6624, 366, 14323, 499, 305, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 304, 3630, 1151, 62, 9641, 6624, 366, 18, 13, 21, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8890, 499, 305, 12, 38532, 13184, 10784, 318, 691, 1695, 329, 304, 3630, 1151, 513, 13, 20, 393, 471, 6089, 42, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 5589, 25901, 796, 6407, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 9641, 796, 366, 18, 13, 20, 1, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 8744, 290, 5252, 1910, 40522, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 31067, 414, 62, 10728, 62, 1640, 62, 25802, 62, 46012, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 8744, 1910, 27039, 329, 6555, 3227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 31067, 414, 62, 10728, 62, 1640, 62, 65, 16296, 62, 25493, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2617, 62, 15414, 82, 62, 259, 62, 32, 62, 6759, 8609, 7, 944, 13, 18747, 13, 27160, 8, 198, 220, 220, 220, 220, 220, 220, 220, 277, 79, 796, 36472, 818, 17158, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 11, 2116, 13, 18218, 62, 15414, 82, 11, 20613, 62, 3672, 28, 34345, 393, 366, 7718, 3129, 1352, 20613, 1, 198, 220, 220, 220, 220, 220, 220, 220, 6739, 13564, 62, 75, 979, 62, 1462, 62, 1069, 5276, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8619, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 5589, 25901, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 304, 3630, 1151, 62, 9641, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3788, 62, 5589, 25901, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 29472, 11, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 277, 79, 628, 220, 220, 220, 825, 8160, 62, 31067, 414, 62, 19816, 62, 1640, 62, 25802, 62, 46012, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 15738, 257, 5252, 5022, 1912, 2035, 319, 2836, 12, 23211, 5022, 11, 393, 319, 4277, 33237, 329, 257, 1813, 1499, 13, 198, 220, 220, 220, 220, 220, 220, 220, 383, 5022, 318, 10488, 355, 262, 2811, 5022, 11, 26356, 416, 262, 6082, 286, 13844, 7986, 18212, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9089, 62, 1462, 62, 9319, 796, 12178, 7, 944, 13, 1443, 13, 22462, 274, 58, 944, 13, 19315, 7131, 1, 30976, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2845, 7383, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1002, 9089, 329, 262, 1499, 389, 407, 1043, 11, 7048, 4576, 2811, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9089, 62, 1462, 62, 9319, 796, 12178, 7, 944, 13, 1443, 13, 22462, 274, 14692, 49, 1137, 1, 7131, 1, 30976, 8973, 8, 628, 220, 220, 220, 220, 220, 220, 220, 611, 366, 23144, 8744, 5022, 1, 287, 2116, 13, 25249, 62, 11250, 3924, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1002, 257, 2041, 8744, 5022, 318, 7368, 11, 356, 779, 340, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5022, 796, 2116, 13, 25249, 62, 11250, 3924, 14692, 23144, 8744, 5022, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 779, 62, 1941, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 493, 7, 72, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12473, 53, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4851, 20114, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11909, 20114, 12, 79, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11909, 20114, 12, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8476, 53, 12, 79, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8476, 53, 12, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 13909, 53, 12, 79, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 13909, 53, 12, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8476, 53, 12, 70, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 2116, 13, 18747, 13, 27160, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 62, 15414, 82, 14692, 34553, 40077, 583, 614, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12473, 53, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4851, 20114, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11909, 20114, 12, 79, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11909, 20114, 12, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8476, 53, 12, 79, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8476, 53, 12, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 13909, 53, 12, 79, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 13909, 53, 12, 67, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8476, 53, 12, 70, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 32604, 7, 22704, 28, 16, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 3447, 1758, 32590, 16, 11, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 32604, 7, 22704, 28, 15, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5022, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 1443, 13, 31067, 414, 62, 19816, 13, 741, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1499, 28, 944, 13, 19315, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7885, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 305, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 45, 4016, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39699, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38825, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8731, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 23286, 296, 562, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7222, 282, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44142, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10082, 49723, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 54, 4594, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 3849, 79, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 614, 28, 37659, 13, 283, 858, 7, 88, 11, 331, 1343, 779, 62, 1941, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 479, 86, 22046, 28, 4895, 20797, 62, 8367, 1298, 366, 2302, 2416, 27976, 25719, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 32604, 7, 22704, 28, 15, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 27160, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 331, 1343, 779, 62, 1941, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 19841, 32215, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 2116, 13, 1443, 13, 31067, 414, 62, 19816, 13, 741, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1499, 28, 944, 13, 19315, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7885, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 305, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 45, 4016, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39699, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38825, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8731, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 23286, 296, 562, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7222, 282, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44142, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10082, 49723, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 54, 4594, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 3849, 79, 7, 1941, 28, 37659, 13, 283, 858, 7, 88, 11, 1160, 4349, 828, 479, 86, 22046, 28, 4895, 20797, 62, 8367, 1298, 366, 2302, 2416, 27976, 20662, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 32604, 7, 22704, 28, 15, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 27160, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 5022, 628, 220, 220, 220, 825, 2251, 62, 31067, 414, 62, 10728, 62, 1640, 62, 25802, 62, 46012, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 770, 2163, 23816, 262, 8744, 1910, 326, 9416, 6555, 11642, 4560, 198, 220, 220, 220, 220, 220, 220, 220, 290, 17669, 3227, 832, 39450, 13429, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9089, 62, 1462, 62, 9319, 796, 12178, 7, 944, 13, 1443, 13, 22462, 274, 58, 944, 13, 19315, 7131, 1, 30976, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2845, 7383, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1002, 9089, 329, 262, 1499, 389, 407, 1043, 11, 7048, 4576, 2811, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9089, 62, 1462, 62, 9319, 796, 12178, 7, 944, 13, 1443, 13, 22462, 274, 14692, 49, 1137, 1, 7131, 1, 30976, 8973, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 27845, 262, 8744, 5939, 329, 6555, 11642, 290, 17669, 3227, 198, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 285, 796, 45941, 13, 18747, 7, 944, 13, 19816, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 737, 3447, 1758, 32590, 16, 11, 838, 11, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 8744, 3037, 7303, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 844, 41052, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 283, 858, 7, 944, 13, 2676, 602, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 944, 13, 15414, 82, 58, 944, 13, 11129, 66, 62, 8899, 58, 83, 11907, 329, 256, 287, 2116, 13, 11129, 66, 62, 8899, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 76, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 11478, 3127, 329, 1029, 290, 7090, 15004, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 5103, 11, 8744, 11, 1029, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 11, 8744, 11, 1029, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 21, 13, 3365, 68, 12, 24, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 5103, 11, 8744, 11, 7090, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 11, 8744, 11, 7090, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 16, 13, 4521, 68, 12, 23, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 5103, 11, 890, 12, 30246, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 18415, 36, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 11, 890, 12, 30246, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 18, 13, 1558, 68, 12, 940, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 6082, 3127, 11, 1877, 15004, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17080, 3890, 3127, 5103, 11, 8744, 11, 1877, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17080, 3890, 3127, 11, 8744, 11, 1877, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 23, 13, 4524, 68, 12, 23, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 5127, 286, 37402, 17910, 1878, 2290, 273, 485, 329, 6121, 364, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 37402, 17910, 1878, 2290, 273, 485, 11, 8122, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 82, 4754, 333, 17910, 1878, 2290, 273, 485, 11, 8122, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 14808, 20, 13, 19, 68, 12, 23, 1343, 362, 13, 2079, 68, 12, 24, 8, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 14362, 62, 21, 47988, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 50, 4754, 333, 17910, 1878, 2290, 273, 485, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 5252, 11824, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 14808, 20, 13, 19, 68, 12, 23, 1343, 362, 13, 2079, 68, 12, 24, 8, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 825, 2251, 62, 31067, 414, 62, 10728, 62, 1640, 62, 65, 16296, 62, 25493, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 23816, 287, 262, 5721, 287, 4600, 944, 13, 32, 63, 5213, 351, 262, 8744, 5022, 973, 329, 9138, 6555, 4778, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 6555, 62, 13670, 796, 2116, 13, 25249, 62, 11250, 3924, 14692, 22554, 6143, 1, 7131, 1, 31067, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4906, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 6555, 62, 47103, 796, 2116, 13, 25249, 62, 11250, 3924, 14692, 22554, 6143, 1, 7131, 1, 31067, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 47103, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9089, 62, 1462, 62, 9319, 796, 12178, 7, 944, 13, 1443, 13, 22462, 274, 58, 65, 16296, 62, 47103, 7131, 1, 30976, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2845, 7383, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9089, 62, 1462, 62, 9319, 796, 12178, 7, 944, 13, 1443, 13, 22462, 274, 14692, 44175, 1, 7131, 1, 30976, 8973, 8, 628, 220, 220, 220, 220, 220, 220, 220, 5022, 62, 65, 16296, 62, 48119, 870, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 1443, 13, 31067, 414, 62, 19816, 13, 741, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1499, 28, 65, 16296, 62, 47103, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7885, 41888, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 305, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 45, 4016, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39699, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38825, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8731, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 23286, 296, 562, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7222, 282, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44142, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10082, 49723, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 54, 4594, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 3849, 79, 7, 1941, 28, 944, 13, 29982, 14692, 1941, 33116, 479, 86, 22046, 28, 4895, 20797, 62, 8367, 1298, 366, 2302, 2416, 27976, 20662, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 27160, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 27845, 262, 8744, 5939, 329, 6555, 3227, 198, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 285, 796, 45941, 13, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5022, 62, 65, 16296, 62, 48119, 870, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 3447, 1758, 32590, 16, 11, 838, 11, 352, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 844, 41052, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 283, 858, 7, 944, 13, 2676, 602, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 944, 13, 15414, 82, 58, 944, 13, 11129, 66, 62, 8899, 58, 83, 11907, 329, 256, 287, 2116, 13, 11129, 66, 62, 8899, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 76, 1635, 9089, 62, 1462, 62, 9319, 1635, 532, 16, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 11478, 3127, 329, 1029, 290, 7090, 15004, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 5103, 11, 8744, 11, 1029, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 11, 8744, 11, 1029, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 21, 13, 3365, 68, 12, 24, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 5103, 11, 8744, 11, 7090, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 11, 8744, 11, 7090, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 16, 13, 4521, 68, 12, 23, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 5103, 11, 890, 12, 30246, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 18415, 36, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 7645, 3411, 3127, 11, 890, 12, 30246, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 18, 13, 1558, 68, 12, 940, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 6082, 3127, 11, 1877, 15004, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17080, 3890, 3127, 5103, 11, 8744, 11, 1877, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 15635, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 17080, 3890, 3127, 11, 8744, 11, 1877, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 23, 13, 4524, 68, 12, 23, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 5127, 286, 37402, 17910, 1878, 2290, 273, 485, 329, 6121, 364, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 37402, 17910, 1878, 2290, 273, 485, 11, 8122, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 82, 4754, 333, 17910, 1878, 2290, 273, 485, 11, 8122, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 14808, 20, 13, 19, 68, 12, 23, 1343, 362, 13, 2079, 68, 12, 24, 8, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3060, 14362, 62, 21, 47988, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 50, 4754, 333, 17910, 1878, 2290, 273, 485, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 14808, 20, 13, 19, 68, 12, 23, 1343, 362, 13, 2079, 68, 12, 24, 8, 1635, 532, 16, 1635, 9089, 62, 1462, 62, 9319, 8, 628, 220, 220, 220, 825, 900, 62, 50039, 62, 9521, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5345, 262, 4036, 2837, 6402, 262, 13516, 13, 198, 220, 220, 220, 220, 220, 220, 220, 21020, 13401, 12, 20942, 1424, 290, 18512, 18017, 6032, 423, 257, 2793, 2386, 273, 811, 1988, 13, 16227, 11, 262, 761, 284, 42653, 3129, 378, 198, 220, 220, 220, 220, 220, 220, 220, 262, 4038, 2837, 13, 198, 220, 220, 220, 220, 220, 220, 220, 3401, 6945, 11507, 4600, 9521, 63, 286, 4600, 18747, 63, 287, 1295, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 39754, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 71, 85, 62, 39754, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 75, 71, 85, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 38238, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 71, 85, 62, 38238, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 75, 71, 85, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14631, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 33116, 331, 11, 2446, 2625, 392, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 6376, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 2648, 62, 39754, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 300, 71, 85, 62, 39754, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 2648, 62, 38238, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 300, 71, 85, 62, 38238, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 8576, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 51, 83, 54, 2568, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 8476, 53, 12, 67, 1600, 366, 13909, 53, 12, 67, 1600, 366, 11909, 20114, 12, 67, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 39754, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 71, 85, 62, 39754, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 75, 71, 85, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 38238, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 300, 71, 85, 62, 38238, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 75, 71, 85, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14631, 8476, 53, 12, 67, 1600, 366, 11909, 20114, 12, 67, 1600, 366, 13909, 53, 12, 67, 33116, 331, 11, 2446, 2625, 392, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 6376, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 2648, 62, 39754, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 300, 71, 85, 62, 39754, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 2648, 62, 38238, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 300, 71, 85, 62, 38238, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 8576, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 2116, 13, 18747, 13, 27160, 58, 944, 13, 18747, 62, 15414, 82, 14692, 51, 83, 54, 2568, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 825, 8160, 62, 25802, 62, 2436, 2412, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 15738, 5252, 32067, 422, 644, 318, 3804, 287, 4600, 25249, 62, 11250, 3924, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 632, 1461, 15968, 257, 22155, 4600, 944, 13, 25802, 62, 2436, 2412, 63, 326, 4909, 262, 11756, 7303, 11, 2793, 16930, 3815, 198, 220, 220, 220, 220, 220, 220, 220, 290, 7375, 17, 25592, 5087, 286, 262, 18017, 973, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 18017, 62, 75, 71, 85, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6449, 3225, 1298, 5433, 13, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 17135, 14787, 1298, 2608, 13, 23, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 49235, 39515, 1298, 2608, 13, 23, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 7543, 1350, 316, 1298, 2608, 13, 23, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 8222, 47185, 1298, 2608, 13, 23, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 429, 6587, 21408, 1298, 5433, 13, 19, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25990, 417, 1298, 5433, 13, 23, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 2101, 29893, 532, 10801, 3056, 1298, 3261, 13, 22, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 2101, 29893, 532, 33773, 1298, 3261, 13, 22, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 429, 6587, 21866, 1298, 5946, 13, 18, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 66, 782, 1298, 5996, 13, 20, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8482, 519, 292, 1298, 5996, 13, 20, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 782, 292, 1298, 5996, 13, 20, 198, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 18017, 62, 8220, 17, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6449, 3225, 1298, 513, 13, 1507, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 17135, 14787, 1298, 352, 13, 6420, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 49235, 39515, 1298, 352, 13, 6420, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 7543, 1350, 316, 1298, 352, 13, 6420, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 8222, 47185, 1298, 352, 13, 6420, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 429, 6587, 21408, 1298, 513, 13, 1507, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25990, 417, 1298, 513, 13, 1415, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 2101, 29893, 532, 10801, 3056, 1298, 362, 13, 5332, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 2101, 29893, 532, 33773, 1298, 362, 13, 5332, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 429, 6587, 21866, 1298, 513, 13, 1433, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 66, 782, 1298, 362, 13, 2996, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8482, 519, 292, 1298, 362, 13, 2996, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 782, 292, 1298, 362, 13, 2996, 198, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 796, 366, 6449, 3225, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 796, 2116, 13, 19796, 62, 25802, 62, 1477, 3565, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 25802, 62, 34162, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 11, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 58, 25802, 62, 4906, 60, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4906, 1298, 4165, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20077, 1298, 4165, 62, 20077, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 75, 71, 85, 1298, 18017, 62, 75, 71, 85, 58, 39754, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8220, 17, 1298, 18017, 62, 8220, 17, 58, 39754, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38238, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4906, 1298, 9233, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20077, 1298, 9233, 62, 20077, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 75, 71, 85, 1298, 18017, 62, 75, 71, 85, 58, 38238, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8220, 17, 1298, 18017, 62, 8220, 17, 58, 38238, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 8476, 53, 12, 67, 1600, 366, 13909, 53, 12, 67, 1600, 366, 11909, 20114, 12, 67, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 796, 366, 25990, 417, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 796, 2116, 13, 19796, 62, 25802, 62, 1477, 3565, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 25802, 62, 34162, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 11, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 58, 25802, 62, 4906, 60, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39754, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4906, 1298, 4165, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20077, 1298, 4165, 62, 20077, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 75, 71, 85, 1298, 18017, 62, 75, 71, 85, 58, 39754, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8220, 17, 1298, 18017, 62, 8220, 17, 58, 39754, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38238, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4906, 1298, 9233, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20077, 1298, 9233, 62, 20077, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 75, 71, 85, 1298, 18017, 62, 75, 71, 85, 58, 38238, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8220, 17, 1298, 18017, 62, 8220, 17, 58, 38238, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 8476, 53, 12, 70, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 796, 366, 66, 782, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 796, 2116, 13, 19796, 62, 25802, 62, 1477, 3565, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 25802, 62, 34162, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 11, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 58, 25802, 62, 4906, 60, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39754, 1298, 19779, 4906, 1298, 4165, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20077, 1298, 4165, 62, 20077, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 75, 71, 85, 1298, 18017, 62, 75, 71, 85, 58, 39754, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8220, 17, 1298, 18017, 62, 8220, 17, 58, 39754, 60, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38238, 1298, 19779, 4906, 1298, 9233, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20077, 1298, 9233, 62, 20077, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 75, 71, 85, 1298, 18017, 62, 75, 71, 85, 58, 39754, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8220, 17, 1298, 18017, 62, 8220, 17, 58, 39754, 60, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 4851, 20114, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 796, 366, 15511, 8648, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 796, 2116, 13, 19796, 62, 25802, 62, 1477, 3565, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 25802, 62, 34162, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 11, 4165, 11, 9233, 11, 4165, 62, 20077, 11, 9233, 62, 20077, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 58, 25802, 62, 4906, 60, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39754, 1298, 19779, 4906, 1298, 4165, 11, 366, 20077, 1298, 4165, 62, 20077, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 38238, 1298, 19779, 4906, 1298, 9233, 11, 366, 20077, 1298, 9233, 62, 20077, 5512, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 611, 19779, 12473, 53, 1600, 366, 11909, 20114, 12, 79, 1600, 366, 11909, 20114, 12, 67, 20662, 13, 3849, 5458, 7, 2617, 7, 944, 13, 29982, 14692, 6477, 27432, 8973, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 796, 366, 31067, 414, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 17953, 62, 25802, 62, 34162, 7, 25802, 62, 4906, 8, 628, 220, 220, 220, 825, 2251, 62, 25802, 62, 34162, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 4906, 11, 198, 220, 220, 220, 220, 220, 220, 220, 4165, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 9233, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 4165, 62, 20077, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 9233, 62, 20077, 28, 14202, 11, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 8075, 5939, 329, 5252, 11, 6402, 257, 1813, 13516, 11, 257, 1813, 5252, 2099, 290, 257, 1813, 614, 13, 198, 220, 220, 220, 220, 220, 220, 220, 632, 635, 6673, 4553, 8744, 5128, 287, 1339, 17669, 422, 39450, 13429, 318, 2622, 7382, 287, 262, 5252, 5127, 6333, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 7783, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 288, 62, 20942, 1424, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 9509, 305, 306, 13429, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 39450, 13429, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 39450, 13429, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 7618, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 5796, 81, 532, 3288, 3623, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 39058, 266, 14, 78, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 39058, 266, 14, 78, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 5796, 81, 532, 3288, 3623, 351, 327, 7902, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 39058, 266, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 39058, 266, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 5796, 81, 532, 3182, 519, 292, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 286, 3182, 519, 292, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 286, 3182, 519, 292, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 5796, 81, 532, 3182, 519, 292, 351, 327, 7902, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 286, 3182, 519, 292, 351, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 9447, 49, 286, 3182, 519, 292, 351, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25140, 3623, 2649, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 5655, 3623, 2649, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 5655, 3623, 2649, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3822, 3623, 2649, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 10668, 11711, 1417, 3996, 3623, 2649, 286, 4898, 88, 42584, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3822, 3623, 2649, 351, 327, 7902, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 11, 422, 10668, 11711, 1417, 3996, 3623, 2649, 286, 4898, 88, 42584, 351, 327, 7902, 11, 379, 367, 17, 37911, 2680, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 11, 308, 589, 516, 11, 13037, 2318, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 66, 782, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 3288, 3623, 11, 422, 1029, 3833, 3127, 357, 16, 12, 20, 2318, 828, 379, 2139, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11802, 3623, 11, 422, 1029, 3833, 3127, 357, 16, 12, 20, 2318, 828, 379, 2139, 4429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8482, 519, 292, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8482, 519, 292, 25485, 532, 34939, 1017, 12587, 532, 716, 500, 27268, 4623, 532, 1266, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3398, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8482, 519, 292, 25485, 532, 34939, 1017, 12587, 532, 716, 500, 27268, 4623, 532, 1266, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 782, 292, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44, 2788, 1531, 3227, 11, 18512, 11, 422, 15206, 31379, 1138, 7637, 341, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44, 2788, 1531, 11, 18512, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 7618, 1635, 657, 13, 1120, 40393, 47159, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25990, 417, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 21866, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 16112, 1231, 14679, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25990, 417, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 2101, 29893, 532, 33773, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 33, 2101, 29893, 422, 33773, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 33, 2101, 29893, 422, 33773, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 2101, 29893, 532, 10801, 3056, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 33, 2101, 29893, 422, 10801, 3056, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 33, 2101, 29893, 422, 10801, 3056, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 429, 6587, 21866, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 35, 29893, 3227, 11, 18512, 11, 30901, 8498, 862, 354, 1429, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 35, 29893, 11, 18512, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 7618, 1635, 657, 13, 2078, 2425, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6449, 3225, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 34139, 11, 1877, 12, 82, 4754, 333, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 16112, 1231, 14679, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6449, 3225, 11, 1877, 12, 82, 4754, 333, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 17135, 14787, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 17135, 14787, 43677, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 17135, 14787, 43677, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 8222, 47185, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 8222, 47185, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 8222, 47185, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 7543, 1350, 316, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 7543, 1350, 316, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 7543, 1350, 316, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 952, 2788, 22012, 532, 49235, 39515, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 49235, 39515, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 36, 14813, 349, 422, 49235, 39515, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1837, 429, 6587, 21408, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 3672, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39699, 14453, 3227, 11, 18512, 11, 422, 1138, 7637, 349, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 39699, 14453, 11, 18512, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 2860, 1859, 8744, 1298, 7618, 1635, 657, 13, 34256, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 288, 62, 19608, 292, 316, 62, 3672, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6449, 3225, 1298, 366, 25802, 5127, 329, 21408, 5672, 11, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25990, 417, 1298, 366, 25802, 5127, 329, 21866, 5672, 11, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 66, 782, 1298, 366, 25802, 5127, 329, 3623, 5672, 11, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 15511, 8648, 1298, 366, 25802, 5127, 329, 17669, 5672, 11, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 31067, 414, 1298, 366, 31067, 414, 5127, 329, 5186, 5672, 11, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 611, 5252, 62, 4906, 14512, 366, 31067, 414, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27039, 62, 3672, 796, 288, 62, 19608, 292, 316, 62, 3672, 58, 25802, 62, 4906, 60, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5252, 62, 10728, 62, 9630, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 329, 1312, 287, 2116, 13, 15414, 82, 611, 1312, 58, 15, 60, 6624, 27039, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41832, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4165, 62, 25802, 62, 21797, 62, 9630, 796, 2116, 13, 15414, 82, 58, 67, 62, 20942, 1424, 58, 39754, 7131, 1, 3672, 8973, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9233, 62, 25802, 62, 21797, 62, 9630, 796, 2116, 13, 15414, 82, 58, 67, 62, 20942, 1424, 58, 38238, 7131, 1, 3672, 8973, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 4165, 62, 25802, 62, 21797, 62, 9630, 11, 5252, 62, 10728, 62, 9630, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 16, 1635, 4165, 62, 20077, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 9233, 62, 25802, 62, 21797, 62, 9630, 11, 5252, 62, 10728, 62, 9630, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 16, 1635, 9233, 62, 20077, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3224, 62, 31067, 414, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 288, 62, 20942, 1424, 58, 39754, 7131, 1, 2860, 1859, 8744, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 4165, 62, 20077, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 1343, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 288, 62, 20942, 1424, 58, 38238, 7131, 1, 2860, 1859, 8744, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 9233, 62, 20077, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 3224, 62, 31067, 414, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8744, 62, 19816, 62, 9630, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1312, 58, 15, 60, 6624, 366, 31067, 414, 1910, 329, 5252, 11824, 11, 366, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41832, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 8744, 62, 19816, 62, 9630, 11, 5252, 62, 10728, 62, 9630, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 16, 1635, 3224, 62, 31067, 414, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27039, 62, 3672, 796, 288, 62, 19608, 292, 316, 62, 3672, 58, 25802, 62, 4906, 60, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8744, 62, 10728, 62, 9630, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 329, 1312, 287, 2116, 13, 15414, 82, 611, 1312, 58, 15, 60, 6624, 27039, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41832, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8744, 62, 19816, 62, 9630, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1312, 58, 15, 60, 6624, 366, 31067, 414, 1910, 329, 5252, 11824, 11, 366, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41832, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 8744, 62, 19816, 62, 9630, 11, 8744, 62, 10728, 62, 9630, 60, 796, 532, 16, 628, 220, 220, 220, 825, 900, 62, 15414, 82, 62, 259, 62, 32, 62, 6759, 8609, 7, 944, 11, 7177, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 27845, 12, 259, 262, 317, 17593, 13, 8314, 407, 1441, 1997, 13, 3401, 6945, 287, 1295, 13, 198, 220, 220, 220, 220, 220, 220, 220, 25959, 286, 262, 317, 17593, 357, 27160, 11, 3186, 11, 4568, 737, 628, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 7177, 25, 1058, 35226, 25, 63, 18747, 63, 422, 1058, 4871, 25, 63, 9914, 17633, 63, 1398, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 2671, 1304, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 1278, 1304, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4743, 1304, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 4743, 1304, 2779, 2347, 33116, 1058, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 9861, 1304, 18700, 278, 1600, 366, 8763, 46, 1600, 366, 34553, 21857, 1600, 366, 9861, 1304, 18700, 278, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 2971, 6551, 278, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 4743, 1304, 2779, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 12417, 8219, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6603, 6540, 1097, 9262, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 66, 5945, 2347, 33116, 1058, 60, 1220, 1105, 1821, 1220, 1315, 2388, 1635, 532, 16, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 2671, 1304, 412, 78, 43, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 10107, 41928, 286, 973, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 805, 723, 41928, 286, 973, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 66, 5945, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 357, 16, 532, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 24011, 436, 295, 1176, 2648, 33116, 1058, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 10107, 41928, 286, 973, 11849, 1097, 351, 5387, 33607, 3113, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20850, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 805, 723, 41928, 286, 973, 11849, 1097, 351, 5387, 33607, 3113, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 66, 5945, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 24011, 436, 295, 1176, 2648, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 4333, 27432, 6805, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 31894, 11, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11121, 263, 11, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 11121, 263, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 38394, 11, 329, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1102, 332, 353, 11, 329, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 1102, 332, 353, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 5186, 5584, 11, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 31067, 5584, 11, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 31067, 3113, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 40631, 353, 11, 329, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 332, 353, 11, 329, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 259, 332, 353, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 1176, 6082, 4326, 11, 329, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6477, 6082, 4326, 11, 329, 5186, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 6477, 6082, 4326, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 300, 62, 11129, 66, 62, 457, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 11121, 263, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1102, 332, 353, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 332, 353, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6477, 6082, 4326, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 31067, 3113, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25802, 2685, 8931, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25802, 2685, 281, 66, 15856, 3248, 47, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 25802, 2685, 6393, 3248, 47, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 16296, 2685, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 65, 16296, 3248, 47, 2347, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 973, 1176, 27432, 422, 5186, 11849, 1097, 11, 10107, 41928, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1484, 1176, 27432, 422, 5186, 11849, 1097, 11, 10107, 41928, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 30109, 944, 13, 18747, 62, 15414, 82, 58, 75, 60, 329, 300, 287, 300, 62, 11129, 66, 62, 457, 4357, 1058, 4083, 16345, 7, 22704, 28, 15, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 5387, 33607, 3113, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 32538, 33607, 3113, 11, 329, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 62, 15414, 82, 58, 75, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 300, 287, 14631, 24011, 436, 295, 3113, 2347, 1600, 366, 6477, 27432, 2347, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 20740, 16345, 7, 22704, 28, 15, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 2025, 66, 15856, 3248, 47, 1600, 366, 8763, 46, 1600, 366, 34553, 21857, 1600, 366, 2025, 66, 15856, 3248, 47, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2685, 281, 66, 15856, 3248, 47, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 29508, 1843, 3248, 47, 1600, 366, 8763, 46, 1600, 366, 34553, 21857, 1600, 366, 29508, 1843, 3248, 47, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2685, 6393, 3248, 47, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 25896, 1600, 366, 8763, 46, 1600, 366, 34553, 322, 1078, 1600, 366, 25896, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2685, 8931, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 7253, 286, 3601, 448, 628, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8412, 1174, 30023, 9863, 8643, 28767, 46025, 29463, 2390, 2767, 4877, 220, 8412, 1174, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 2625, 59, 77, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 6682, 6143, 628, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 464, 1499, 286, 779, 318, 366, 1343, 2116, 13, 19315, 11, 886, 2625, 59, 77, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 6555, 62, 13670, 796, 2116, 13, 25249, 62, 11250, 3924, 14692, 22554, 6143, 1, 7131, 1, 31067, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 4906, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 6555, 62, 47103, 796, 2116, 13, 25249, 62, 11250, 3924, 14692, 22554, 6143, 1, 7131, 1, 31067, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 47103, 1, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 13434, 290, 2568, 13591, 4635, 287, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 6555, 62, 47103, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 1262, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 6555, 62, 13670, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 16585, 33283, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 2625, 59, 77, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 5765, 262, 399, 9655, 13184, 286, 24740, 2123, 435, 13, 13130, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 47006, 3248, 47, 1600, 366, 8763, 46, 1600, 366, 34553, 21857, 1600, 366, 47006, 3248, 47, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 65, 16296, 3248, 47, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 357, 16, 1343, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 65, 16296, 10869, 36205, 33116, 1058, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 6555, 62, 3846, 62, 18242, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 47006, 2685, 11, 366, 1343, 6555, 62, 13670, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 47006, 2685, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 2116, 13, 15414, 82, 58, 65, 16296, 62, 3846, 62, 18242, 4357, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 65, 16296, 2685, 2347, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 357, 16, 1343, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2685, 10869, 36205, 33116, 1058, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 5345, 281, 5128, 286, 8744, 11, 1813, 262, 1499, 286, 6161, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 1448, 329, 8744, 11, 7090, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10603, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 322, 1078, 1711, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 31067, 414, 11, 7090, 15004, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 65, 16296, 62, 3846, 62, 18242, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 88, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 844, 41052, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 283, 858, 7, 944, 13, 2676, 602, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 1910, 329, 2568, 6143, 3227, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 62, 15414, 82, 14692, 65, 16296, 2685, 3227, 8744, 33116, 1058, 11, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 20740, 51, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 65, 16296, 62, 3846, 62, 18242, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 3447, 1758, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2676, 602, 11, 352, 11, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 6376, 62, 32, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 66, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 269, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 597, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9766, 287, 269, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 9766, 287, 14631, 8476, 53, 12, 67, 1600, 366, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 1600, 366, 11909, 20114, 12, 67, 1600, 366, 13909, 53, 12, 67, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14631, 8476, 53, 12, 67, 1600, 366, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 1600, 366, 11909, 20114, 12, 67, 1600, 366, 13909, 53, 12, 67, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 35428, 21610, 1734, 3227, 11, 1029, 12109, 11, 19468, 5039, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 35428, 21610, 1734, 11, 1029, 12109, 11, 19468, 5039, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 6873, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7203, 8476, 53, 12, 70, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20721, 33073, 23738, 7309, 3227, 11, 7514, 37905, 11, 16954, 35370, 276, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 20721, 33073, 23738, 7309, 11, 7514, 37905, 11, 16954, 35370, 276, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 9630, 62, 66, 782, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 6873, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 611, 366, 15511, 8648, 1, 287, 2116, 13, 25249, 62, 11250, 3924, 14692, 22554, 6143, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1002, 257, 31344, 8633, 318, 3804, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17173, 62, 28451, 62, 45503, 796, 2116, 13, 25249, 62, 11250, 3924, 14692, 22554, 6143, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 15511, 8648, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 14692, 4906, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17173, 62, 28451, 62, 45503, 796, 366, 29255, 13608, 1, 628, 220, 220, 220, 220, 220, 220, 220, 8633, 62, 28451, 62, 8899, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 29255, 13608, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 42663, 6873, 11, 25388, 17669, 3623, 11, 13037, 5657, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 42663, 6873, 11, 25388, 17669, 3623, 11, 13037, 5657, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 31298, 431, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 42663, 6873, 11, 25388, 17669, 3623, 11, 13037, 5657, 11, 351, 5572, 11401, 35940, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 6873, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 282, 35241, 1298, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 42663, 6873, 11, 25388, 17669, 3623, 11, 13037, 5657, 11, 351, 40412, 35940, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 49, 1137, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 40436, 8648, 6873, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 1782, 628, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7203, 4851, 20114, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 2116, 13, 15414, 82, 58, 11600, 62, 28451, 62, 8899, 58, 15511, 305, 62, 28451, 62, 45503, 60, 4357, 2116, 13, 9630, 62, 25802, 62, 3846, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 6873, 2347, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 36195, 8079, 18212, 33116, 1058, 11, 6376, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2160, 62, 918, 413, 11, 763, 17, 62, 47799, 62, 13670, 796, 2116, 13, 13086, 62, 918, 413, 540, 62, 4873, 62, 259, 62, 19816, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 1343, 352, 6624, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 3467, 83, 1635, 366, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 33172, 4064, 286, 15713, 25, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 37659, 13, 744, 7, 16345, 62, 918, 413, 1635, 1802, 11, 657, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 36521, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 33172, 24739, 38, 12245, 583, 49223, 25, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 493, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 16345, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 763, 17, 62, 47799, 62, 13670, 1635, 2116, 13, 19816, 58, 944, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 308, 13, 7375, 17, 12, 27363, 33283, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 28, 437, 62, 2536, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 611, 597, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6407, 329, 2124, 287, 14631, 12473, 53, 1600, 366, 11909, 20114, 12, 79, 1600, 366, 11909, 20114, 12, 67, 8973, 611, 2124, 287, 2116, 13, 29982, 14692, 6477, 27432, 8973, 198, 220, 220, 220, 220, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14631, 12473, 53, 1600, 366, 11909, 20114, 12, 79, 1600, 366, 11909, 20114, 12, 67, 33116, 331, 11, 2446, 2625, 392, 1, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 844, 41052, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 283, 858, 7, 944, 13, 2676, 602, 828, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 31067, 414, 5127, 329, 5186, 5672, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 597, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6407, 329, 2124, 287, 14631, 12473, 53, 1600, 366, 11909, 20114, 12, 79, 1600, 366, 11909, 20114, 12, 67, 8973, 611, 2124, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 31067, 414, 7327, 33116, 1058, 11, 6376, 60, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 13, 3447, 1758, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2676, 602, 11, 352, 11, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 611, 366, 4851, 20114, 1, 287, 2116, 13, 29982, 14692, 6477, 27432, 1, 5974, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7203, 4851, 20114, 4943, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45144, 92, 318, 5668, 416, 23884, 526, 13, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 15511, 8648, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 15511, 8648, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 2625, 59, 77, 3467, 83, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 1343, 352, 6624, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 3467, 83, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 220, 10221, 2602, 62, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 744, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 15511, 8648, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 1802, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 36521, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 28, 437, 62, 2536, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 21087, 5252, 2648, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 290, 366, 4851, 20114, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 18747, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2124, 329, 2124, 287, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 88, 8, 611, 2124, 287, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 25802, 5127, 329, 17669, 5672, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 611, 366, 8476, 53, 12, 70, 1, 287, 2116, 13, 29982, 14692, 6477, 27432, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7203, 8476, 53, 12, 70, 4943, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45144, 92, 318, 5668, 416, 23884, 526, 13, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 2625, 59, 77, 3467, 83, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 1343, 352, 6624, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 3467, 83, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 220, 10221, 2602, 62, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 744, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 1802, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 36521, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 28, 437, 62, 2536, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 21087, 5252, 2648, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 290, 366, 8476, 53, 12, 70, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 18747, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2124, 329, 2124, 287, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 88, 8, 611, 2124, 287, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 290, 366, 25802, 5127, 329, 3623, 5672, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 12, 3106, 8971, 422, 327, 10503, 11, 7375, 17, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 383, 2648, 290, 7375, 17, 8971, 5766, 286, 327, 10503, 318, 29517, 11, 611, 973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 220, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 8973, 6624, 366, 66, 782, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 8973, 6624, 366, 66, 782, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 12584, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 1635, 7375, 17, 62, 69, 793, 346, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 12, 3106, 7375, 17, 25592, 422, 5559, 34139, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 383, 2648, 286, 1729, 12, 69, 793, 346, 3623, 287, 262, 13516, 318, 29517, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1081, 880, 355, 262, 7375, 17, 25592, 5766, 286, 262, 5252, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 8973, 14512, 366, 66, 782, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 8973, 14512, 366, 66, 782, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 66, 782, 1, 7131, 1, 38238, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 422, 9260, 393, 42584, 4283, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 13159, 62, 69, 793, 346, 1635, 7375, 17, 62, 13159, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 611, 685, 72, 329, 1312, 287, 2116, 13, 29982, 14692, 6477, 27432, 8973, 611, 1312, 287, 14631, 8476, 53, 12, 67, 1600, 366, 11909, 20114, 12, 67, 1600, 366, 13909, 53, 12, 67, 8973, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 14692, 8476, 53, 12, 67, 1600, 366, 11909, 20114, 12, 67, 1600, 366, 13909, 53, 12, 67, 8973, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45144, 92, 318, 5668, 416, 23884, 526, 13, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 2625, 59, 77, 3467, 83, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 1343, 352, 6624, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 3467, 83, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 220, 10221, 2602, 62, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 744, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 1802, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 36521, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 28, 437, 62, 2536, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 597, 7, 87, 287, 1312, 58, 15, 60, 329, 2124, 287, 14631, 8476, 53, 12, 67, 1600, 366, 11909, 20114, 12, 67, 1600, 366, 13909, 53, 12, 67, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 18747, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2124, 329, 2124, 287, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 88, 8, 611, 2124, 287, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 5127, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 290, 366, 25802, 5127, 329, 21866, 5672, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 12, 3106, 7375, 17, 25592, 422, 10224, 34139, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 8973, 6624, 366, 25990, 417, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 8973, 6624, 366, 25990, 417, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 12584, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 1635, 7375, 17, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 12, 3106, 7375, 17, 25592, 422, 5559, 34139, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 383, 2648, 286, 1729, 12, 69, 793, 346, 5252, 287, 262, 13516, 318, 29517, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1081, 880, 355, 262, 7375, 17, 25592, 5766, 286, 262, 5252, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 8973, 14512, 366, 25990, 417, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 8973, 14512, 366, 25990, 417, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 25990, 417, 1, 7131, 1, 38238, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 422, 9260, 393, 42584, 4283, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 13159, 62, 69, 793, 346, 1635, 7375, 17, 62, 13159, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 14089, 21782, 8971, 422, 10224, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2295, 1480, 5087, 422, 34841, 9038, 2123, 435, 1539, 19940, 6168, 6060, 410, 13, 17, 357, 12726, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 20517, 76, 1505, 11, 657, 13, 486, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 34, 324, 76, 1505, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 27157, 11, 352, 13, 22, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 7222, 2848, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 22, 68, 12, 21, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 18255, 1505, 11, 657, 13, 2713, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 1925, 398, 1505, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 642, 13, 15, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 38398, 11, 657, 13, 2998, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 30403, 7750, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 767, 13, 15, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 15300, 47477, 11, 657, 13, 486, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 48767, 47477, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 15, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1168, 1939, 11, 352, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 57, 1939, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 15, 68, 12, 21, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 18255, 1505, 13889, 11, 657, 13, 18005, 10527, 14, 10025, 21866, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1925, 398, 1505, 13889, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 15, 68, 12, 940, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 611, 685, 72, 329, 1312, 287, 2116, 13, 29982, 14692, 6477, 27432, 8973, 611, 1312, 287, 14631, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 8973, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 14692, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 8973, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45144, 92, 318, 5668, 416, 23884, 526, 13, 18982, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 33116, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 2625, 59, 77, 3467, 83, 1635, 33172, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 1343, 352, 6624, 18896, 7, 944, 13, 29982, 14692, 1941, 8973, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 62, 2536, 796, 37082, 77, 3467, 83, 1635, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 259, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 366, 220, 10221, 2602, 62, 366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 965, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45941, 13, 744, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 1802, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 657, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 36521, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 886, 28, 437, 62, 2536, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 331, 287, 2116, 13, 29982, 14692, 1941, 1, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 14478, 6540, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 597, 7, 87, 287, 1312, 58, 15, 60, 329, 2124, 287, 14631, 8476, 53, 12, 79, 1600, 366, 13909, 53, 12, 79, 1600, 366, 11909, 20114, 12, 79, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 18747, 796, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2124, 329, 2124, 287, 2116, 13, 1136, 62, 9630, 62, 33892, 1548, 62, 6738, 62, 18747, 7, 88, 8, 611, 2124, 287, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 5127, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 72, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2116, 13, 15414, 82, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 965, 7, 88, 8, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 366, 25802, 5127, 329, 21408, 5672, 1, 287, 1312, 58, 15, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 12, 3106, 7375, 17, 25592, 422, 10224, 34139, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 8973, 6624, 366, 6449, 3225, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 8973, 6624, 366, 6449, 3225, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 12584, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 1635, 7375, 17, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 25483, 12, 3106, 7375, 17, 25592, 422, 5559, 34139, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 383, 2648, 286, 1729, 12, 69, 793, 346, 5252, 287, 262, 13516, 318, 29517, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1081, 880, 355, 262, 7375, 17, 25592, 5766, 286, 262, 5252, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 4906, 8973, 14512, 366, 6449, 3225, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 39754, 1, 7131, 1, 8220, 17, 8973, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 4906, 8973, 14512, 366, 6449, 3225, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2648, 62, 13159, 62, 69, 793, 346, 15853, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 20077, 1, 7131, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29982, 14692, 1941, 1, 4083, 9630, 7, 88, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7375, 17, 62, 13159, 62, 69, 793, 346, 796, 2116, 13, 25802, 62, 2436, 2412, 14692, 6449, 3225, 1, 7131, 1, 38238, 1, 7131, 1, 8220, 17, 8973, 628, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 9914, 4189, 17556, 11, 422, 9260, 393, 42584, 4283, 1600, 5855, 958, 1600, 828, 366, 34553, 21857, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 13159, 62, 69, 793, 346, 1635, 7375, 17, 62, 13159, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 14089, 21782, 8971, 422, 10224, 34139, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 20517, 76, 1505, 11, 657, 13, 486, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 34, 324, 76, 1505, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 27157, 11, 352, 13, 22, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 7222, 2848, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 22, 68, 12, 21, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 18255, 1505, 11, 657, 13, 2713, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 1925, 398, 1505, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 642, 13, 15, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 38398, 11, 657, 13, 2998, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 30403, 7750, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 767, 13, 15, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 15300, 47477, 11, 657, 13, 486, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 48767, 47477, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 15, 68, 12, 23, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1168, 1939, 11, 352, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 57, 1939, 1600, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 366, 34553, 21857, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 15, 68, 12, 21, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 18255, 1505, 13889, 11, 657, 13, 18005, 10527, 14, 10025, 21408, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 1925, 398, 1505, 13889, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 958, 1600, 366, 32679, 1633, 1969, 284, 2323, 12340, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 773, 62, 32, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 25802, 2347, 33116, 1058, 11, 773, 62, 18747, 60, 1635, 2648, 62, 69, 793, 346, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 352, 13, 15, 68, 12, 940, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1220, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 9521, 33116, 1058, 11, 773, 62, 18747, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6739, 51, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 8504, 12, 1069, 42456, 8971, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 2975, 5806, 8971, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 6344, 5806, 8971, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 24255, 2347, 33116, 1058, 60, 1635, 352, 68, 12, 2919, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 48216, 5806, 8971, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 774, 260, 5806, 8971, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 24255, 2347, 33116, 1058, 60, 1635, 718, 68, 12, 2919, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 10728, 329, 20439, 5806, 8971, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 8763, 46, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 34553, 21857, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 16057, 365, 5806, 8971, 11, 11849, 1097, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 18747, 58, 944, 13, 18747, 62, 15414, 82, 14692, 24255, 2347, 33116, 1058, 60, 1635, 642, 68, 12, 2931, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 33709, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 7203, 10728, 329, 2975, 1600, 366, 8763, 46, 1600, 366, 27231, 12, 1941, 1600, 366, 6344, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 20, 13, 2718, 68, 12, 22, 1635, 7177, 58, 944, 13, 18747, 62, 15414, 82, 14692, 24255, 2347, 33116, 1058, 60, 1635, 532, 16, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 33709, 9262, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 15414, 82, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5855, 10728, 329, 2975, 9262, 1600, 366, 49, 1137, 1600, 366, 27231, 12, 1941, 1600, 366, 6344, 9262, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16589, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 11, 198, 220, 220, 220, 220, 220, 220, 220, 2361, 796, 357, 16, 13, 1959, 68, 12, 18, 1635, 532, 16, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 1475, 42456, 8971, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 8504, 12, 25802, 1912, 8971, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 2116, 13, 9630, 62, 368, 7717, 11, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 62, 15414, 82, 58, 944, 13, 8899, 62, 13159, 62, 25802, 62, 368, 7717, 58, 944, 13, 18218, 62, 15414, 82, 58, 87, 11907, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 2124, 287, 2116, 13, 9630, 62, 368, 7717, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 6739, 7645, 3455, 26933, 16, 11, 657, 11, 362, 12962, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 30964, 8971, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32, 58, 45299, 2116, 13, 9630, 62, 3919, 786, 11, 532, 944, 13, 17618, 62, 1659, 62, 37993, 1058, 60, 796, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 18747, 62, 15414, 82, 58, 944, 13, 8899, 62, 3919, 786, 62, 368, 7717, 58, 944, 13, 18218, 62, 15414, 82, 58, 87, 11907, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 2124, 287, 2116, 13, 9630, 62, 3919, 786, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 6739, 7645, 3455, 26933, 16, 11, 657, 11, 362, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 17174, 17174, 35625, 4943, 198 ]
1.66917
61,923
# Django settings for gtd project. import os from django.contrib.messages import constants as message_constants DEBUG = get_debug_settings() BASE_DIR = os.path.dirname(os.path.dirname(__file__)) # Local time zone for this installation. Choices can be found here: # http://en.wikipedia.org/wiki/List_of_tz_zones_by_name # although not all choices may be available on all operating systems. # If running in a Windows environment this must be set to the same as your # system time zone. TIME_ZONE = "America/Los_Angeles" # Language code for this installation. All choices can be found here: # http://www.i18nguy.com/unicode/language-identifiers.html LANGUAGE_CODE = "en-us" SITE_ID = 1 # If you set this to False, Django will make some optimizations so as not # to load the internationalization machinery. USE_I18N = True MIDDLEWARE = [ "django.middleware.security.SecurityMiddleware", "django.contrib.sessions.middleware.SessionMiddleware", "django.middleware.common.CommonMiddleware", "django.middleware.csrf.CsrfViewMiddleware", "django.contrib.auth.middleware.AuthenticationMiddleware", "django.contrib.messages.middleware.MessageMiddleware", "django.middleware.clickjacking.XFrameOptionsMiddleware", ] ROOT_URLCONF = "project.urls" LOGIN_URL = "/login" LOGIN_REDIRECT_URL = "todo:lists" LOGOUT_REDIRECT_URL = "home" SESSION_EXPIRE_AT_BROWSER_CLOSE = True SESSION_SECURITY_WARN_AFTER = 5 SESSION_SECURITY_EXPIRE_AFTER = 12 # See: https://docs.djangoproject.com/en/dev/ref/settings/#wsgi-application WSGI_APPLICATION = "project.wsgi.application" INSTALLED_APPS = ( "django.contrib.admin", "django.contrib.admindocs", "django.contrib.auth", "django.contrib.contenttypes", "django.contrib.flatpages", "django.contrib.messages", "django.contrib.sessions", "django.contrib.sites", "django.contrib.staticfiles", "todo", "django_extensions", ) # Static files and uploads STATIC_URL = "/static/" STATICFILES_DIRS = [os.path.join(BASE_DIR, "project", "static")] STATIC_ROOT = os.path.join(BASE_DIR, "static") # Uploaded media MEDIA_ROOT = os.path.join(BASE_DIR, "media") MEDIA_URL = "/media/" # Without this, uploaded files > 4MB end up with perm 0600, unreadable by web server process FILE_UPLOAD_PERMISSIONS = 0o644 TEMPLATES = [ { "BACKEND": "django.template.backends.django.DjangoTemplates", "DIRS": [os.path.join(BASE_DIR, "project", "templates")], "APP_DIRS": True, "OPTIONS": { "context_processors": [ "django.template.context_processors.debug", "django.template.context_processors.request", "django.contrib.auth.context_processors.auth", "django.template.context_processors.i18n", "django.template.context_processors.media", "django.template.context_processors.static", "django.template.context_processors.tz", "django.contrib.messages.context_processors.messages", # Your stuff: custom template context processors go here ] }, } ] # Override CSS class for the ERROR tag level to match Bootstrap class name MESSAGE_TAGS = {message_constants.ERROR: "danger"} #################################################################### # Environment specific settings #################################################################### SECRET_KEY = os.environ.get('SECRET_KEY', 'lksdf98wrhkjs88dsf8-324ksdm') # DEBUG = True ALLOWED_HOSTS = ["*"] DATABASES = get_db_settings() EMAIL_BACKEND = 'django.core.mail.backends.console.EmailBackend' # TODO-specific settings TODO_STAFF_ONLY = False TODO_DEFAULT_LIST_SLUG = 'tickets' TODO_DEFAULT_ASSIGNEE = None TODO_PUBLIC_SUBMIT_REDIRECT = '/' #################################################################### # ####################################################################
[ 2, 37770, 6460, 329, 308, 8671, 1628, 13, 198, 11748, 28686, 198, 198, 6738, 42625, 14208, 13, 3642, 822, 13, 37348, 1095, 1330, 38491, 355, 3275, 62, 9979, 1187, 198, 198, 30531, 796, 651, 62, 24442, 62, 33692, 3419, 198, 198, 33, 11159, 62, 34720, 796, 28686, 13, 6978, 13, 15908, 3672, 7, 418, 13, 6978, 13, 15908, 3672, 7, 834, 7753, 834, 4008, 198, 198, 2, 10714, 640, 6516, 329, 428, 9988, 13, 10031, 1063, 460, 307, 1043, 994, 25, 198, 2, 2638, 1378, 268, 13, 31266, 13, 2398, 14, 15466, 14, 8053, 62, 1659, 62, 22877, 62, 89, 1952, 62, 1525, 62, 3672, 198, 2, 3584, 407, 477, 7747, 743, 307, 1695, 319, 477, 5361, 3341, 13, 198, 2, 1002, 2491, 287, 257, 3964, 2858, 428, 1276, 307, 900, 284, 262, 976, 355, 534, 198, 2, 1080, 640, 6516, 13, 198, 34694, 62, 57, 11651, 796, 366, 18165, 14, 28903, 62, 33246, 274, 1, 198, 198, 2, 15417, 2438, 329, 428, 9988, 13, 1439, 7747, 460, 307, 1043, 994, 25, 198, 2, 2638, 1378, 2503, 13, 72, 1507, 782, 4669, 13, 785, 14, 46903, 1098, 14, 16129, 12, 738, 13350, 13, 6494, 198, 43, 15567, 52, 11879, 62, 34, 16820, 796, 366, 268, 12, 385, 1, 198, 198, 50, 12709, 62, 2389, 796, 352, 198, 198, 2, 1002, 345, 900, 428, 284, 10352, 11, 37770, 481, 787, 617, 41446, 523, 355, 407, 198, 2, 284, 3440, 262, 3230, 1634, 20230, 13, 198, 19108, 62, 40, 1507, 45, 796, 6407, 628, 198, 44, 2389, 35, 2538, 33746, 796, 685, 198, 220, 220, 220, 366, 28241, 14208, 13, 27171, 1574, 13, 12961, 13, 24074, 34621, 1574, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 82, 6202, 13, 27171, 1574, 13, 36044, 34621, 1574, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 27171, 1574, 13, 11321, 13, 17227, 34621, 1574, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 27171, 1574, 13, 6359, 41871, 13, 34, 27891, 69, 7680, 34621, 1574, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 18439, 13, 27171, 1574, 13, 47649, 3299, 34621, 1574, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 37348, 1095, 13, 27171, 1574, 13, 12837, 34621, 1574, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 27171, 1574, 13, 12976, 73, 5430, 13, 55, 19778, 29046, 34621, 1574, 1600, 198, 60, 198, 198, 13252, 2394, 62, 4261, 5639, 1340, 37, 796, 366, 16302, 13, 6371, 82, 1, 198, 25294, 1268, 62, 21886, 796, 12813, 38235, 1, 198, 25294, 1268, 62, 22083, 40, 23988, 62, 21886, 796, 366, 83, 24313, 25, 20713, 1, 198, 25294, 12425, 62, 22083, 40, 23988, 62, 21886, 796, 366, 11195, 1, 198, 198, 50, 47621, 62, 6369, 11901, 2200, 62, 1404, 62, 11473, 22845, 1137, 62, 32737, 796, 6407, 198, 50, 47621, 62, 23683, 4261, 9050, 62, 37771, 62, 8579, 5781, 796, 642, 198, 50, 47621, 62, 23683, 4261, 9050, 62, 6369, 11901, 2200, 62, 8579, 5781, 796, 1105, 198, 198, 2, 4091, 25, 3740, 1378, 31628, 13, 28241, 648, 404, 305, 752, 13, 785, 14, 268, 14, 7959, 14, 5420, 14, 33692, 31113, 18504, 12397, 12, 31438, 198, 19416, 18878, 62, 2969, 31484, 6234, 796, 366, 16302, 13, 18504, 12397, 13, 31438, 1, 198, 198, 38604, 7036, 1961, 62, 2969, 3705, 796, 357, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 28482, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 324, 10155, 420, 82, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 18439, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 11299, 19199, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 38568, 31126, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 37348, 1095, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 82, 6202, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 49315, 1600, 198, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 12708, 16624, 1600, 198, 220, 220, 220, 366, 83, 24313, 1600, 198, 220, 220, 220, 366, 28241, 14208, 62, 2302, 5736, 1600, 198, 8, 198, 198, 2, 36125, 3696, 290, 9516, 82, 198, 198, 35744, 2149, 62, 21886, 796, 12813, 12708, 30487, 198, 35744, 2149, 46700, 1546, 62, 34720, 50, 796, 685, 418, 13, 6978, 13, 22179, 7, 33, 11159, 62, 34720, 11, 366, 16302, 1600, 366, 12708, 4943, 60, 198, 35744, 2149, 62, 13252, 2394, 796, 28686, 13, 6978, 13, 22179, 7, 33, 11159, 62, 34720, 11, 366, 12708, 4943, 198, 198, 2, 36803, 276, 2056, 198, 30733, 3539, 62, 13252, 2394, 796, 28686, 13, 6978, 13, 22179, 7, 33, 11159, 62, 34720, 11, 366, 11431, 4943, 198, 30733, 3539, 62, 21886, 796, 12813, 11431, 30487, 198, 198, 2, 9170, 428, 11, 19144, 3696, 1875, 604, 10744, 886, 510, 351, 9943, 657, 8054, 11, 555, 46155, 416, 3992, 4382, 1429, 198, 25664, 62, 52, 6489, 41048, 62, 18973, 44, 16744, 11053, 796, 657, 78, 29173, 198, 198, 51, 3620, 6489, 29462, 796, 685, 198, 220, 220, 220, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 366, 31098, 10619, 1298, 366, 28241, 14208, 13, 28243, 13, 1891, 2412, 13, 28241, 14208, 13, 35, 73, 14208, 12966, 17041, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 366, 34720, 50, 1298, 685, 418, 13, 6978, 13, 22179, 7, 33, 11159, 62, 34720, 11, 366, 16302, 1600, 366, 11498, 17041, 4943, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 366, 24805, 62, 34720, 50, 1298, 6407, 11, 198, 220, 220, 220, 220, 220, 220, 220, 366, 3185, 51, 11053, 1298, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 22866, 62, 14681, 669, 1298, 685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 28243, 13, 22866, 62, 14681, 669, 13, 24442, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 28243, 13, 22866, 62, 14681, 669, 13, 25927, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 18439, 13, 22866, 62, 14681, 669, 13, 18439, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 28243, 13, 22866, 62, 14681, 669, 13, 72, 1507, 77, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 28243, 13, 22866, 62, 14681, 669, 13, 11431, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 28243, 13, 22866, 62, 14681, 669, 13, 12708, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 28243, 13, 22866, 62, 14681, 669, 13, 22877, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 28241, 14208, 13, 3642, 822, 13, 37348, 1095, 13, 22866, 62, 14681, 669, 13, 37348, 1095, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3406, 3404, 25, 2183, 11055, 4732, 20399, 467, 994, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2361, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 1782, 198, 60, 198, 198, 2, 3827, 13154, 17391, 1398, 329, 262, 33854, 7621, 1241, 284, 2872, 18892, 26418, 1398, 1438, 198, 44, 1546, 4090, 8264, 62, 42197, 50, 796, 1391, 20500, 62, 9979, 1187, 13, 24908, 25, 366, 38537, 20662, 198, 198, 29113, 29113, 4242, 198, 2, 9344, 2176, 6460, 198, 29113, 29113, 4242, 198, 198, 23683, 26087, 62, 20373, 796, 28686, 13, 268, 2268, 13, 1136, 10786, 23683, 26087, 62, 20373, 3256, 705, 75, 591, 7568, 4089, 86, 17179, 74, 8457, 3459, 9310, 69, 23, 12, 33916, 591, 36020, 11537, 198, 198, 2, 16959, 796, 6407, 198, 7036, 3913, 1961, 62, 39, 10892, 50, 796, 14631, 9, 8973, 198, 198, 35, 1404, 6242, 1921, 1546, 796, 651, 62, 9945, 62, 33692, 3419, 198, 198, 27630, 4146, 62, 31098, 10619, 796, 705, 28241, 14208, 13, 7295, 13, 4529, 13, 1891, 2412, 13, 41947, 13, 15333, 7282, 437, 6, 198, 198, 2, 16926, 46, 12, 11423, 6460, 198, 51, 3727, 46, 62, 2257, 32, 5777, 62, 1340, 11319, 796, 10352, 198, 51, 3727, 46, 62, 7206, 38865, 62, 45849, 62, 8634, 7340, 796, 705, 83, 15970, 6, 198, 51, 3727, 46, 62, 7206, 38865, 62, 10705, 16284, 6500, 796, 6045, 198, 51, 3727, 46, 62, 5105, 32936, 62, 50, 10526, 36393, 62, 22083, 40, 23988, 796, 31051, 6, 198, 198, 29113, 29113, 4242, 198, 2, 198, 29113, 29113, 4242, 198 ]
2.633199
1,494
from flask_restful import Resource import requests import json import os import redis HEADER = { 'User-Agent': 'CompuServe Classic/1.22', 'Accept': 'application/json', 'Host': os.getenv("HOST"), 'Authorization': f'Bearer {os.getenv("ACESS_TOKEN")}' } class Search(Resource): """Recurso responsável por retornar lista de artistas, para o usuário escolher""" def get(self, artist_name): """ Retorna lista de artistas """ querystring = {"q": artist_name} url = f"https://{os.getenv('HOST')}/search" try: response = requests.get(url=url, headers=HEADER, params=querystring) if response.status_code != '200': return json.loads(response.text), response.status_code except Exception as e: print(e) return {"message": "Internal server error."}, 500 data = json.loads(response.text) return data, 200
[ 6738, 42903, 62, 2118, 913, 1330, 20857, 198, 198, 11748, 7007, 198, 11748, 33918, 198, 11748, 28686, 198, 11748, 2266, 271, 628, 198, 37682, 1137, 796, 1391, 198, 220, 220, 220, 705, 12982, 12, 36772, 10354, 705, 7293, 84, 50, 3760, 13449, 14, 16, 13, 1828, 3256, 198, 220, 220, 220, 705, 38855, 10354, 705, 31438, 14, 17752, 3256, 198, 220, 220, 220, 705, 17932, 10354, 28686, 13, 1136, 24330, 7203, 39, 10892, 12340, 198, 220, 220, 220, 705, 13838, 1634, 10354, 277, 6, 3856, 11258, 1391, 418, 13, 1136, 24330, 7203, 2246, 7597, 62, 10468, 43959, 4943, 92, 6, 198, 92, 198, 198, 4871, 11140, 7, 26198, 2599, 198, 220, 220, 220, 37227, 6690, 333, 568, 2424, 6557, 626, 16964, 1005, 1211, 283, 1351, 64, 390, 6802, 292, 11, 31215, 267, 514, 84, 6557, 27250, 3671, 349, 372, 37811, 628, 220, 220, 220, 825, 651, 7, 944, 11, 6802, 62, 3672, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4990, 1211, 64, 1351, 64, 390, 6802, 292, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 198, 220, 220, 220, 220, 220, 220, 220, 12405, 8841, 796, 19779, 80, 1298, 6802, 62, 3672, 92, 198, 220, 220, 220, 220, 220, 220, 220, 19016, 796, 277, 1, 5450, 1378, 90, 418, 13, 1136, 24330, 10786, 39, 10892, 11537, 92, 14, 12947, 1, 628, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2882, 796, 7007, 13, 1136, 7, 6371, 28, 6371, 11, 24697, 28, 37682, 1137, 11, 42287, 28, 22766, 8841, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 2882, 13, 13376, 62, 8189, 14512, 705, 2167, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 33918, 13, 46030, 7, 26209, 13, 5239, 828, 2882, 13, 13376, 62, 8189, 628, 220, 220, 220, 220, 220, 220, 220, 2845, 35528, 355, 304, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 68, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 19779, 20500, 1298, 366, 37693, 4382, 4049, 526, 5512, 5323, 628, 220, 220, 220, 220, 220, 220, 220, 1366, 796, 33918, 13, 46030, 7, 26209, 13, 5239, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 1366, 11, 939 ]
2.33414
413
# https://leetcode.com/problems/first-unique-character-in-a-string/
[ 2, 3740, 1378, 293, 316, 8189, 13, 785, 14, 1676, 22143, 14, 11085, 12, 34642, 12, 22769, 12, 259, 12, 64, 12, 8841, 14, 198 ]
2.72
25
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import models, migrations
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 6738, 11593, 37443, 834, 1330, 28000, 1098, 62, 17201, 874, 198, 198, 6738, 42625, 14208, 13, 9945, 1330, 4981, 11, 15720, 602, 628 ]
2.891892
37
# Copyright (c) OpenMMLab. All rights reserved. from mmdet.datasets import DATASETS from .coco_video_dataset import CocoVideoDataset @DATASETS.register_module() class YouTubeVISDataset(CocoVideoDataset): """YouTube VIS dataset for video instance segmentation.""" CLASSES_2019_version = ('person', 'giant_panda', 'lizard', 'parrot', 'skateboard', 'sedan', 'ape', 'dog', 'snake', 'monkey', 'hand', 'rabbit', 'duck', 'cat', 'cow', 'fish', 'train', 'horse', 'turtle', 'bear', 'motorbike', 'giraffe', 'leopard', 'fox', 'deer', 'owl', 'surfboard', 'airplane', 'truck', 'zebra', 'tiger', 'elephant', 'snowboard', 'boat', 'shark', 'mouse', 'frog', 'eagle', 'earless_seal', 'tennis_racket') CLASSES_2021_version = ('airplane', 'bear', 'bird', 'boat', 'car', 'cat', 'cow', 'deer', 'dog', 'duck', 'earless_seal', 'elephant', 'fish', 'flying_disc', 'fox', 'frog', 'giant_panda', 'giraffe', 'horse', 'leopard', 'lizard', 'monkey', 'motorbike', 'mouse', 'parrot', 'person', 'rabbit', 'shark', 'skateboard', 'snake', 'snowboard', 'squirrel', 'surfboard', 'tennis_racket', 'tiger', 'train', 'truck', 'turtle', 'whale', 'zebra') @classmethod
[ 2, 15069, 357, 66, 8, 4946, 44, 5805, 397, 13, 1439, 2489, 10395, 13, 198, 6738, 8085, 15255, 13, 19608, 292, 1039, 1330, 360, 1404, 1921, 32716, 198, 198, 6738, 764, 66, 25634, 62, 15588, 62, 19608, 292, 316, 1330, 48222, 10798, 27354, 292, 316, 628, 198, 31, 35, 1404, 1921, 32716, 13, 30238, 62, 21412, 3419, 198, 4871, 7444, 29817, 27354, 292, 316, 7, 34, 25634, 10798, 27354, 292, 316, 2599, 198, 220, 220, 220, 37227, 33869, 50035, 27039, 329, 2008, 4554, 10618, 341, 526, 15931, 628, 220, 220, 220, 42715, 1546, 62, 23344, 62, 9641, 796, 19203, 6259, 3256, 705, 70, 3014, 62, 79, 5282, 3256, 705, 75, 8669, 3256, 705, 1845, 10599, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 8135, 378, 3526, 3256, 705, 36622, 272, 3256, 705, 1758, 3256, 705, 9703, 3256, 705, 16184, 539, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 49572, 3256, 705, 4993, 3256, 705, 81, 14229, 3256, 705, 646, 694, 3256, 705, 9246, 3256, 705, 8232, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 11084, 3256, 705, 27432, 3256, 705, 30527, 3256, 705, 83, 17964, 3256, 705, 33227, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 76, 20965, 32256, 3256, 705, 70, 343, 21223, 3256, 705, 293, 15478, 3256, 705, 12792, 3256, 705, 2934, 263, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4883, 3256, 705, 11793, 69, 3526, 3256, 705, 958, 14382, 3256, 705, 83, 30915, 3256, 705, 89, 37052, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 83, 8254, 3256, 705, 11129, 33959, 3256, 705, 82, 2197, 3526, 3256, 705, 24482, 3256, 705, 1477, 668, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 35888, 3256, 705, 49956, 3256, 705, 68, 19345, 3256, 705, 451, 1203, 62, 325, 282, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 1452, 21361, 62, 81, 8317, 11537, 628, 220, 220, 220, 42715, 1546, 62, 1238, 2481, 62, 9641, 796, 19203, 958, 14382, 3256, 705, 33227, 3256, 705, 16944, 3256, 705, 24482, 3256, 705, 7718, 3256, 705, 9246, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 8232, 3256, 705, 2934, 263, 3256, 705, 9703, 3256, 705, 646, 694, 3256, 705, 451, 1203, 62, 325, 282, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 11129, 33959, 3256, 705, 11084, 3256, 705, 45928, 62, 15410, 3256, 705, 12792, 3256, 705, 49956, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 70, 3014, 62, 79, 5282, 3256, 705, 70, 343, 21223, 3256, 705, 30527, 3256, 705, 293, 15478, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 75, 8669, 3256, 705, 49572, 3256, 705, 76, 20965, 32256, 3256, 705, 35888, 3256, 705, 1845, 10599, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 6259, 3256, 705, 81, 14229, 3256, 705, 1477, 668, 3256, 705, 8135, 378, 3526, 3256, 705, 16184, 539, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 82, 2197, 3526, 3256, 705, 16485, 22793, 3256, 705, 11793, 69, 3526, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 1452, 21361, 62, 81, 8317, 3256, 705, 83, 8254, 3256, 705, 27432, 3256, 705, 83, 30915, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 83, 17964, 3256, 705, 1929, 1000, 3256, 705, 89, 37052, 11537, 628, 220, 220, 220, 2488, 4871, 24396, 198 ]
1.804299
884
# SPDX-FileCopyrightText: 2021 easyDiffraction contributors <[email protected]> # SPDX-License-Identifier: BSD-3-Clause # © 2021 Contributors to the easyDiffraction project <https://github.com/easyScience/easyDiffractionApp> __author__ = 'github.com/andrewsazonov' __version__ = '0.0.1' from random import random from PySide2.QtCore import QPointF from PySide2.QtCharts import QtCharts
[ 2, 30628, 55, 12, 8979, 15269, 8206, 25, 33448, 2562, 28813, 7861, 20420, 1279, 11284, 31, 38171, 26069, 7861, 13, 2398, 29, 198, 2, 30628, 55, 12, 34156, 12, 33234, 7483, 25, 347, 10305, 12, 18, 12, 2601, 682, 198, 2, 10673, 33448, 25767, 669, 284, 262, 2562, 28813, 7861, 1628, 1279, 5450, 1378, 12567, 13, 785, 14, 38171, 26959, 14, 38171, 28813, 7861, 4677, 29, 198, 198, 834, 9800, 834, 796, 705, 12567, 13, 785, 14, 392, 1809, 82, 5168, 709, 6, 198, 834, 9641, 834, 796, 705, 15, 13, 15, 13, 16, 6, 198, 198, 6738, 4738, 1330, 4738, 198, 198, 6738, 9485, 24819, 17, 13, 48, 83, 14055, 1330, 1195, 12727, 37, 198, 6738, 9485, 24819, 17, 13, 48, 83, 1925, 5889, 1330, 33734, 1925, 5889, 628, 198 ]
3.061069
131
# -*- coding: utf-8 -*- # python imports import os import subprocess import sys, traceback from flask.ext.migrate import MigrateCommand from flask.ext.script import Manager from database import manager as database_manager try: from project import app from project.application import configure_app from project.config import DefaultConfig, DevelopmentConfig, ProductionConfig except ImportError: print ' *** please install/update requirements or fix the problem ***' traceback.print_exc(file=sys.stdout) exit(0) manager = Manager(app) manager.add_command('database', database_manager) manager.add_command('migration', MigrateCommand) fwpath = os.path.abspath(os.path.dirname(__file__)) venv_dir = os.path.join(fwpath, 'venv') @manager.command @manager.command @manager.command @manager.command if __name__ == '__main__': manager.run()
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 198, 2, 21015, 17944, 198, 11748, 28686, 198, 11748, 850, 14681, 198, 11748, 25064, 11, 12854, 1891, 198, 6738, 42903, 13, 2302, 13, 76, 42175, 1330, 337, 42175, 21575, 198, 6738, 42903, 13, 2302, 13, 12048, 1330, 9142, 198, 6738, 6831, 1330, 4706, 355, 6831, 62, 37153, 198, 198, 28311, 25, 198, 220, 220, 220, 422, 1628, 1330, 598, 198, 220, 220, 220, 422, 1628, 13, 31438, 1330, 17425, 62, 1324, 198, 220, 220, 220, 422, 1628, 13, 11250, 1330, 15161, 16934, 11, 7712, 16934, 11, 19174, 16934, 198, 16341, 17267, 12331, 25, 198, 220, 220, 220, 3601, 705, 17202, 3387, 2721, 14, 19119, 5359, 393, 4259, 262, 1917, 17202, 6, 198, 220, 220, 220, 12854, 1891, 13, 4798, 62, 41194, 7, 7753, 28, 17597, 13, 19282, 448, 8, 198, 220, 220, 220, 8420, 7, 15, 8, 198, 198, 37153, 796, 9142, 7, 1324, 8, 198, 37153, 13, 2860, 62, 21812, 10786, 48806, 3256, 6831, 62, 37153, 8, 198, 37153, 13, 2860, 62, 21812, 10786, 76, 4254, 3256, 337, 42175, 21575, 8, 198, 198, 44482, 6978, 796, 28686, 13, 6978, 13, 397, 2777, 776, 7, 418, 13, 6978, 13, 15908, 3672, 7, 834, 7753, 834, 4008, 198, 574, 85, 62, 15908, 796, 28686, 13, 6978, 13, 22179, 7, 44482, 6978, 11, 705, 574, 85, 11537, 628, 198, 31, 37153, 13, 21812, 628, 198, 31, 37153, 13, 21812, 628, 198, 31, 37153, 13, 21812, 198, 198, 31, 37153, 13, 21812, 628, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 4706, 13, 5143, 3419, 198 ]
3.193431
274
"""PROV model fpr GitLab2PROV.""" __author__ = "Claas de Boer, Andreas Schreiber, Lynn von Kurnatowski" __copyright__ = "Copyright 2020, German Aerospace Center (DLR) and individual contributors" __license__ = "MIT" __version__ = "0.5" __status__ = "Development" from prov.model import ProvDocument from prov.constants import PROV_LABEL from prov.dot import prov_to_dot add = ProvDocument() add.set_default_namespace("gitlab2prov:") add.activity("Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""}) add.activity("Parent Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""}) add.agent("Committer", other_attributes={"prov:type": "user", "prov:role": "committer", "name": "", "email": ""}) add.agent("Author", other_attributes={"prov:type": "user", "prov:role": "author", "name": "", "email": ""}) add.entity("File", other_attributes={"prov:type": "file", "path_at_addition": ""}) add.entity("File Version", other_attributes={"prov:type": "file_version", "old_path": "", "new_path": ""}) add.wasInformedBy("Commit", "Parent Commit") add.wasAssociatedWith("Commit", "Committer") add.wasAssociatedWith("Commit", "Author") add.wasGeneratedBy("File", "Commit") add.wasGeneratedBy("File Version", "Commit") add.wasAttributedTo("File", "Author") add.wasAttributedTo("File Version", "Author") add.specializationOf("File Version", "File") mod = ProvDocument() mod.set_default_namespace("gitlab2prov:") mod.activity("Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""},) mod.activity("Parent Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""},) mod.agent("Committer", other_attributes={"prov:type": "user", "prov:role": "committer", "name": "", "email": ""}) mod.agent("Author", other_attributes={"prov:type": "user", "prov:role": "author", "name": "", "email": "",}) mod.entity("File", other_attributes={"prov:type": "file", "path_at_addition": ""}) mod.entity("File Version N", other_attributes={"prov:type": "file_version", "new_path": "", "old_path": ""}) mod.entity("File Version N-1", other_attributes={"prov:type": "file_version", "new_path": "", "old_path": ""}) mod.wasInformedBy("Commit", "Parent Commit") mod.wasAssociatedWith("Commit", "Author") mod.wasAssociatedWith("Commit", "Committer") mod.used("Commit", "File Version N-1") mod.wasGeneratedBy("File Version N", "Commit") mod.wasRevisionOf("File Version N", "File Version N-1") mod.specializationOf("File Version N", "File") mod.specializationOf("File Version N-1", "File") mod.wasAttributedTo("File Version N", "Author") rem = ProvDocument() rem.set_default_namespace("gitlab2prov:") rem.activity("Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""}) rem.activity("Parent Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""}) rem.agent("Committer", other_attributes={"prov:type": "user", "prov:role": "committer", "name": "", "email": ""}) rem.agent("Author", other_attributes={"prov:type": "user", "prov:role": "author", "name": "", "email": ""}) rem.entity("File", other_attributes={"prov:type": "file", "path_at_addition": ""}) rem.entity("File Version", other_attributes={"prov:type": "file_version", "new_path": "", "old_path": ""}) rem.wasInformedBy("Commit", "Parent Commit") rem.wasAssociatedWith("Commit", "Committer") rem.wasAssociatedWith("Commit", "Author") rem.wasInvalidatedBy("File Version", "Commit") rem.specializationOf("File Version", "File") com = ProvDocument() com.set_default_namespace("gitlab2prov:") com.agent("Creator", other_attributes={"prov:type": "user", "prov:role": "creator", "name": ""}) com.agent("Annotator", other_attributes={"prov:type": "user", "prov:role": "initiator", "name": ""}) com.activity("Commit Creation", other_attributes={"prov:type": "creation", "prov:startedAt": "", "prov:endedAt": ""}) com.activity("Commit Annotation", other_attributes={"prov:type": "event", "prov:startedAt": "", "prov:endedAt": "", "event": ""}) com.activity("Git Commit", other_attributes={"prov:type": "commit", "title": "", "message": "", "id": "", "short_id": "", "prov:startedAt": "", "prov:endedAt": ""}) com.wasInformedBy("Commit Creation", "Git Commit") com.entity("Commit", other_attributes={"prov:type": "commit_resource", "title": "", "message": "", "short_id": "", "id": ""}) com.entity("Commit Version", other_attributes={"prov:type": "commit_resource_version"}) com.entity("Annotated Commit Version", other_attributes={"prov:type": "commit_resource_version"},) com.wasAssociatedWith("Commit Creation", "Creator") com.wasAttributedTo("Commit", "Creator") com.wasAttributedTo("Commit Version", "Creator") com.wasGeneratedBy("Commit", "Commit Creation") com.wasGeneratedBy("Commit Version", "Commit Creation") com.wasAttributedTo("Annotated Commit Version", "Annotator") com.wasAssociatedWith("Commit Annotation", "Annotator") com.used("Commit Annotation", "Commit Version") com.wasInformedBy("Commit Annotation", "Commit Creation") com.wasGeneratedBy("Annotated Commit Version", "Commit Annotation") com.specializationOf("Commit Version", "Commit") com.specializationOf("Annotated Commit Version", "Commit") com.wasDerivedFrom("Annotated Commit Version", "Commit Version") mr = ProvDocument() mr.set_default_namespace("gitlab2prov:") mr.agent("Creator", other_attributes={"prov:type": "user", "prov:role": "creator", "name": ""},) mr.agent("Annotator", other_attributes={"prov:type": "user", "prov:role": "initiator", "name": ""}) mr.activity("Merge Request Creation", other_attributes={"prov:type": "merge_request_creation", "prov:startedAt": "", "prov:endedAt": ""}) mr.activity("Merge Request Annotation", other_attributes={"prov:type": "event", "prov:startedAt": "", "prov:endedAt": "", "event": ""}) mr.entity("Merge Request", other_attributes={"prov:type": "merge_request_resource", "id": "", "iid": "", "title": "", "description": "", "web_url": "", "project_id": "", "source_branch": "", "target_branch": "", "source_project_url": "", "target_project_url": ""}) mr.entity("Merge Request Version", other_attributes={"prov:type": "merge_request_resource_version"},) mr.entity("Annotated Merge Request Version", other_attributes={"prov:type": "merge_request_resource_version"},) mr.wasInformedBy("Merge Request Annotation", "Merge Request Creation") mr.wasGeneratedBy("Merge Request", "Merge Request Creation") mr.wasGeneratedBy("Merge Request Version", "Merge Request Creation") mr.wasGeneratedBy("Annotated Merge Request Version", "Merge Request Annotation") mr.used("Merge Request Annotation", "Merge Request Version") mr.specializationOf("Merge Request Version", "Merge Request") mr.specializationOf("Annotated Merge Request Version", "Merge Request") mr.wasDerivedFrom("Annotated Merge Request Version", "Merge Request Version") mr.wasAttributedTo("Annotated Merge Request Version", "Annotator") mr.wasAttributedTo("Merge Request Version", "Creator") mr.wasAttributedTo("Merge Request", "Creator") mr.wasAssociatedWith("Merge Request Creation", "Creator") mr.wasAssociatedWith("Merge Request Annotation", "Annotator") iss = ProvDocument() iss.set_default_namespace("gitlab2prov:") iss.agent("Creator", other_attributes={"prov:type": "user", "prov:role": "creator", "name": ""}) iss.agent("Annotator", other_attributes={"prov:type": "user", "prov:role": "initiator", "name": ""}) iss.activity("Issue Creation", other_attributes={"prov:type": "issue_creation", "prov:startedAt": "", "prov:endedAt": ""}) iss.activity("Issue Annotation", other_attributes={"prov:type": "event", "prov:startedAt": "", "prov:endedAt": "", "event": ""}) iss.entity("Issue", other_attributes={"prov:type": "issue_resource", "id": "", "iid": "", "title": "", "description": "", "project_id": "", "web_url": ""}) iss.entity("Issue Version", other_attributes={"prov:type": "issue_resource_version"}) iss.entity("Annotated Issue Version", other_attributes={"prov:type": "issue_resource_version"}) iss.wasInformedBy("Issue Annotation", "Issue Creation") iss.wasGeneratedBy("Issue", "Issue Creation") iss.wasGeneratedBy("Issue Version", "Issue Creation") iss.wasGeneratedBy("Annotated Issue Version", "Issue Annotation") iss.used("Issue Annotation", "Issue Version") iss.specializationOf("Issue Version", "Issue") iss.specializationOf("Annotated Issue Version", "Issue") iss.wasDerivedFrom("Annotated Issue Version", "Issue Version") iss.wasAttributedTo("Annotated Issue Version", "Annotator") iss.wasAttributedTo("Issue Version", "Creator") iss.wasAttributedTo("Issue", "Creator") iss.wasAssociatedWith("Issue Creation", "Creator") iss.wasAssociatedWith("Issue Annotation", "Annotator") release_tag_model = ProvDocument() release_tag_model.set_default_namespace("gitlab2prov:") release_tag_model.agent("User", {"name": "", "email": ""}) release_tag_model.activity("Release_Event") release_tag_model.activity("Tag_Event") release_tag_model.activity("Commit_Event") release_tag_model.entity("Tag", {"prov:type": "prov:Collection", "name": "", "message": "", "commit": "", "target_commit": ""}) release_tag_model.entity("Release", {"prov:type": "prov:Collection", "name": "", "tag_name": "", "description": "", "created_at": "", "released_at": "", "commit_path": "", "tag_path": ""}) release_tag_model.entity("Commit", {"id": "", "short_id": "", "title": "", "message": "", "web_url": "", "created_at": ""}) release_tag_model.entity("Release_Evidence", {"sha": "", "filepath": "", "collected_at": ""}) release_tag_model.entity("Release_Asset", {"uri": "", "format": "", "filepath": ""}) release_tag_model.hadMember("Release_Asset", "Release") release_tag_model.hadMember("Release_Evidence", "Release") release_tag_model.hadMember("Tag", "Release") release_tag_model.hadMember("Commit", "Tag") release_tag_model.wasAssociatedWith("Commit_Event", "User") release_tag_model.wasAssociatedWith("Release_Event", "User") release_tag_model.wasAssociatedWith("Tag_Event", "User") release_tag_model.wasAttributedTo("Release", "User") release_tag_model.wasAttributedTo("Tag", "User") release_tag_model.wasAttributedTo("Commit", "User") release_tag_model.wasGeneratedBy("Release", "Release_Event") release_tag_model.wasGeneratedBy("Tag", "Tag_Event") release_tag_model.wasGeneratedBy("Commit", "Commit_Event") for title, doc in [ ("git_commit_model_add", add), ("git_commit_model_mod", mod), ("git_commit_model_del", rem), ("gitlab_commit_model", com), ("gitlab_issue_model", iss), ("gitlab_merge_request_model", mr), ("gitlab_release_tag_model", release_tag_model) ]: prov_to_dot(doc, show_nary=False, use_labels=False, direction="BT").write_pdf( f"pdfs/{title}.pdf" ) prov_to_dot(doc, show_nary=False, use_labels=False, direction="BT").write_svg( f"svgs/{title}.svg" )
[ 37811, 41283, 2746, 277, 1050, 15151, 17822, 17, 41283, 526, 15931, 198, 198, 834, 9800, 834, 796, 366, 47404, 292, 390, 3248, 263, 11, 33728, 3059, 260, 1856, 11, 24868, 18042, 509, 700, 265, 12079, 1, 198, 834, 22163, 4766, 834, 796, 366, 15269, 12131, 11, 2679, 43226, 3337, 357, 19260, 49, 8, 290, 1981, 20420, 1, 198, 834, 43085, 834, 796, 366, 36393, 1, 198, 834, 9641, 834, 796, 366, 15, 13, 20, 1, 198, 834, 13376, 834, 796, 366, 41206, 1, 628, 198, 6738, 899, 13, 19849, 1330, 7518, 24941, 198, 6738, 899, 13, 9979, 1187, 1330, 36592, 62, 48780, 3698, 198, 6738, 899, 13, 26518, 1330, 899, 62, 1462, 62, 26518, 628, 198, 2860, 796, 7518, 24941, 3419, 198, 2860, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 2860, 13, 21797, 7203, 6935, 270, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 2860, 13, 21797, 7203, 24546, 35910, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 2860, 13, 25781, 7203, 6935, 1967, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 9503, 1967, 1600, 366, 3672, 1298, 366, 1600, 366, 12888, 1298, 13538, 30072, 198, 2860, 13, 25781, 7203, 13838, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 9800, 1600, 366, 3672, 1298, 366, 1600, 366, 12888, 1298, 13538, 30072, 198, 2860, 13, 26858, 7203, 8979, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 1600, 366, 6978, 62, 265, 62, 2860, 653, 1298, 13538, 30072, 198, 2860, 13, 26858, 7203, 8979, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 62, 9641, 1600, 366, 727, 62, 6978, 1298, 366, 1600, 366, 3605, 62, 6978, 1298, 13538, 30072, 198, 2860, 13, 9776, 818, 12214, 3886, 7203, 6935, 270, 1600, 366, 24546, 35910, 4943, 198, 2860, 13, 9776, 29014, 3152, 7203, 6935, 270, 1600, 366, 6935, 1967, 4943, 198, 2860, 13, 9776, 29014, 3152, 7203, 6935, 270, 1600, 366, 13838, 4943, 198, 2860, 13, 9776, 8645, 515, 3886, 7203, 8979, 1600, 366, 6935, 270, 4943, 198, 2860, 13, 9776, 8645, 515, 3886, 7203, 8979, 10628, 1600, 366, 6935, 270, 4943, 198, 2860, 13, 9776, 8086, 6169, 2514, 7203, 8979, 1600, 366, 13838, 4943, 198, 2860, 13, 9776, 8086, 6169, 2514, 7203, 8979, 10628, 1600, 366, 13838, 4943, 198, 2860, 13, 20887, 1634, 5189, 7203, 8979, 10628, 1600, 366, 8979, 4943, 628, 198, 4666, 796, 7518, 24941, 3419, 198, 4666, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 4666, 13, 21797, 7203, 6935, 270, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 5512, 8, 198, 4666, 13, 21797, 7203, 24546, 35910, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 5512, 8, 198, 4666, 13, 25781, 7203, 6935, 1967, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 9503, 1967, 1600, 366, 3672, 1298, 366, 1600, 366, 12888, 1298, 13538, 30072, 198, 4666, 13, 25781, 7203, 13838, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 9800, 1600, 366, 3672, 1298, 366, 1600, 366, 12888, 1298, 366, 1600, 30072, 198, 4666, 13, 26858, 7203, 8979, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 1600, 366, 6978, 62, 265, 62, 2860, 653, 1298, 13538, 30072, 198, 4666, 13, 26858, 7203, 8979, 10628, 399, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 62, 9641, 1600, 366, 3605, 62, 6978, 1298, 366, 1600, 366, 727, 62, 6978, 1298, 13538, 30072, 198, 4666, 13, 26858, 7203, 8979, 10628, 399, 12, 16, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 62, 9641, 1600, 366, 3605, 62, 6978, 1298, 366, 1600, 366, 727, 62, 6978, 1298, 13538, 30072, 198, 4666, 13, 9776, 818, 12214, 3886, 7203, 6935, 270, 1600, 366, 24546, 35910, 4943, 198, 4666, 13, 9776, 29014, 3152, 7203, 6935, 270, 1600, 366, 13838, 4943, 198, 4666, 13, 9776, 29014, 3152, 7203, 6935, 270, 1600, 366, 6935, 1967, 4943, 198, 4666, 13, 1484, 7203, 6935, 270, 1600, 366, 8979, 10628, 399, 12, 16, 4943, 198, 4666, 13, 9776, 8645, 515, 3886, 7203, 8979, 10628, 399, 1600, 366, 6935, 270, 4943, 198, 4666, 13, 9776, 18009, 1166, 5189, 7203, 8979, 10628, 399, 1600, 366, 8979, 10628, 399, 12, 16, 4943, 198, 4666, 13, 20887, 1634, 5189, 7203, 8979, 10628, 399, 1600, 366, 8979, 4943, 198, 4666, 13, 20887, 1634, 5189, 7203, 8979, 10628, 399, 12, 16, 1600, 366, 8979, 4943, 198, 4666, 13, 9776, 8086, 6169, 2514, 7203, 8979, 10628, 399, 1600, 366, 13838, 4943, 628, 198, 2787, 796, 7518, 24941, 3419, 198, 2787, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 2787, 13, 21797, 7203, 6935, 270, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 2787, 13, 21797, 7203, 24546, 35910, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 2787, 13, 25781, 7203, 6935, 1967, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 9503, 1967, 1600, 366, 3672, 1298, 366, 1600, 366, 12888, 1298, 13538, 30072, 198, 2787, 13, 25781, 7203, 13838, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 9800, 1600, 366, 3672, 1298, 366, 1600, 366, 12888, 1298, 13538, 30072, 198, 2787, 13, 26858, 7203, 8979, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 1600, 366, 6978, 62, 265, 62, 2860, 653, 1298, 13538, 30072, 198, 2787, 13, 26858, 7203, 8979, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7753, 62, 9641, 1600, 366, 3605, 62, 6978, 1298, 366, 1600, 366, 727, 62, 6978, 1298, 13538, 30072, 198, 2787, 13, 9776, 818, 12214, 3886, 7203, 6935, 270, 1600, 366, 24546, 35910, 4943, 198, 2787, 13, 9776, 29014, 3152, 7203, 6935, 270, 1600, 366, 6935, 1967, 4943, 198, 2787, 13, 9776, 29014, 3152, 7203, 6935, 270, 1600, 366, 13838, 4943, 198, 2787, 13, 9776, 44651, 515, 3886, 7203, 8979, 10628, 1600, 366, 6935, 270, 4943, 198, 2787, 13, 20887, 1634, 5189, 7203, 8979, 10628, 1600, 366, 8979, 4943, 628, 198, 785, 796, 7518, 24941, 3419, 198, 785, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 785, 13, 25781, 7203, 16719, 273, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 45382, 1600, 366, 3672, 1298, 13538, 30072, 198, 785, 13, 25781, 7203, 2025, 1662, 1352, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 259, 8846, 1352, 1600, 366, 3672, 1298, 13538, 30072, 198, 785, 13, 21797, 7203, 6935, 270, 21582, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 38793, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 785, 13, 21797, 7203, 6935, 270, 1052, 38983, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 15596, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 366, 1600, 366, 15596, 1298, 13538, 30072, 198, 785, 13, 21797, 7203, 38, 270, 35910, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 785, 13, 9776, 818, 12214, 3886, 7203, 6935, 270, 21582, 1600, 366, 38, 270, 35910, 4943, 198, 785, 13, 26858, 7203, 6935, 270, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 62, 31092, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 312, 1298, 13538, 30072, 198, 785, 13, 26858, 7203, 6935, 270, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 62, 31092, 62, 9641, 20662, 8, 198, 785, 13, 26858, 7203, 2025, 1662, 515, 35910, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 41509, 62, 31092, 62, 9641, 25719, 8, 198, 785, 13, 9776, 29014, 3152, 7203, 6935, 270, 21582, 1600, 366, 16719, 273, 4943, 198, 785, 13, 9776, 8086, 6169, 2514, 7203, 6935, 270, 1600, 366, 16719, 273, 4943, 198, 785, 13, 9776, 8086, 6169, 2514, 7203, 6935, 270, 10628, 1600, 366, 16719, 273, 4943, 198, 785, 13, 9776, 8645, 515, 3886, 7203, 6935, 270, 1600, 366, 6935, 270, 21582, 4943, 198, 785, 13, 9776, 8645, 515, 3886, 7203, 6935, 270, 10628, 1600, 366, 6935, 270, 21582, 4943, 198, 785, 13, 9776, 8086, 6169, 2514, 7203, 2025, 1662, 515, 35910, 10628, 1600, 366, 2025, 1662, 1352, 4943, 198, 785, 13, 9776, 29014, 3152, 7203, 6935, 270, 1052, 38983, 1600, 366, 2025, 1662, 1352, 4943, 198, 785, 13, 1484, 7203, 6935, 270, 1052, 38983, 1600, 366, 6935, 270, 10628, 4943, 198, 785, 13, 9776, 818, 12214, 3886, 7203, 6935, 270, 1052, 38983, 1600, 366, 6935, 270, 21582, 4943, 198, 785, 13, 9776, 8645, 515, 3886, 7203, 2025, 1662, 515, 35910, 10628, 1600, 366, 6935, 270, 1052, 38983, 4943, 198, 785, 13, 20887, 1634, 5189, 7203, 6935, 270, 10628, 1600, 366, 6935, 270, 4943, 198, 785, 13, 20887, 1634, 5189, 7203, 2025, 1662, 515, 35910, 10628, 1600, 366, 6935, 270, 4943, 198, 785, 13, 9776, 28532, 1572, 4863, 7203, 2025, 1662, 515, 35910, 10628, 1600, 366, 6935, 270, 10628, 4943, 628, 198, 43395, 796, 7518, 24941, 3419, 198, 43395, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 43395, 13, 25781, 7203, 16719, 273, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 45382, 1600, 366, 3672, 1298, 13538, 5512, 8, 198, 43395, 13, 25781, 7203, 2025, 1662, 1352, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 259, 8846, 1352, 1600, 366, 3672, 1298, 13538, 30072, 198, 43395, 13, 21797, 7203, 13102, 469, 19390, 21582, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 647, 469, 62, 25927, 62, 38793, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 43395, 13, 21797, 7203, 13102, 469, 19390, 1052, 38983, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 15596, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 366, 1600, 366, 15596, 1298, 13538, 30072, 198, 43395, 13, 26858, 7203, 13102, 469, 19390, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 647, 469, 62, 25927, 62, 31092, 1600, 366, 312, 1298, 366, 1600, 366, 72, 312, 1298, 366, 1600, 366, 7839, 1298, 366, 1600, 366, 11213, 1298, 366, 1600, 366, 12384, 62, 6371, 1298, 366, 1600, 366, 16302, 62, 312, 1298, 366, 1600, 366, 10459, 62, 1671, 3702, 1298, 366, 1600, 366, 16793, 62, 1671, 3702, 1298, 366, 1600, 366, 10459, 62, 16302, 62, 6371, 1298, 366, 1600, 366, 16793, 62, 16302, 62, 6371, 1298, 13538, 30072, 198, 43395, 13, 26858, 7203, 13102, 469, 19390, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 647, 469, 62, 25927, 62, 31092, 62, 9641, 25719, 8, 198, 43395, 13, 26858, 7203, 2025, 1662, 515, 39407, 19390, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 647, 469, 62, 25927, 62, 31092, 62, 9641, 25719, 8, 198, 43395, 13, 9776, 818, 12214, 3886, 7203, 13102, 469, 19390, 1052, 38983, 1600, 366, 13102, 469, 19390, 21582, 4943, 198, 43395, 13, 9776, 8645, 515, 3886, 7203, 13102, 469, 19390, 1600, 366, 13102, 469, 19390, 21582, 4943, 198, 43395, 13, 9776, 8645, 515, 3886, 7203, 13102, 469, 19390, 10628, 1600, 366, 13102, 469, 19390, 21582, 4943, 198, 43395, 13, 9776, 8645, 515, 3886, 7203, 2025, 1662, 515, 39407, 19390, 10628, 1600, 366, 13102, 469, 19390, 1052, 38983, 4943, 198, 43395, 13, 1484, 7203, 13102, 469, 19390, 1052, 38983, 1600, 366, 13102, 469, 19390, 10628, 4943, 198, 43395, 13, 20887, 1634, 5189, 7203, 13102, 469, 19390, 10628, 1600, 366, 13102, 469, 19390, 4943, 198, 43395, 13, 20887, 1634, 5189, 7203, 2025, 1662, 515, 39407, 19390, 10628, 1600, 366, 13102, 469, 19390, 4943, 198, 43395, 13, 9776, 28532, 1572, 4863, 7203, 2025, 1662, 515, 39407, 19390, 10628, 1600, 366, 13102, 469, 19390, 10628, 4943, 198, 43395, 13, 9776, 8086, 6169, 2514, 7203, 2025, 1662, 515, 39407, 19390, 10628, 1600, 366, 2025, 1662, 1352, 4943, 198, 43395, 13, 9776, 8086, 6169, 2514, 7203, 13102, 469, 19390, 10628, 1600, 366, 16719, 273, 4943, 198, 43395, 13, 9776, 8086, 6169, 2514, 7203, 13102, 469, 19390, 1600, 366, 16719, 273, 4943, 198, 43395, 13, 9776, 29014, 3152, 7203, 13102, 469, 19390, 21582, 1600, 366, 16719, 273, 4943, 198, 43395, 13, 9776, 29014, 3152, 7203, 13102, 469, 19390, 1052, 38983, 1600, 366, 2025, 1662, 1352, 4943, 628, 198, 747, 796, 7518, 24941, 3419, 198, 747, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 747, 13, 25781, 7203, 16719, 273, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 45382, 1600, 366, 3672, 1298, 13538, 30072, 198, 747, 13, 25781, 7203, 2025, 1662, 1352, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 7220, 1600, 366, 15234, 25, 18090, 1298, 366, 259, 8846, 1352, 1600, 366, 3672, 1298, 13538, 30072, 198, 747, 13, 21797, 7203, 45147, 21582, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 21949, 62, 38793, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 13538, 30072, 198, 747, 13, 21797, 7203, 45147, 1052, 38983, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 15596, 1600, 366, 15234, 25, 46981, 2953, 1298, 366, 1600, 366, 15234, 25, 1631, 2953, 1298, 366, 1600, 366, 15596, 1298, 13538, 30072, 198, 747, 13, 26858, 7203, 45147, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 21949, 62, 31092, 1600, 366, 312, 1298, 366, 1600, 366, 72, 312, 1298, 366, 1600, 366, 7839, 1298, 366, 1600, 366, 11213, 1298, 366, 1600, 366, 16302, 62, 312, 1298, 366, 1600, 366, 12384, 62, 6371, 1298, 13538, 30072, 198, 747, 13, 26858, 7203, 45147, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 21949, 62, 31092, 62, 9641, 20662, 8, 198, 747, 13, 26858, 7203, 2025, 1662, 515, 18232, 10628, 1600, 584, 62, 1078, 7657, 28, 4895, 15234, 25, 4906, 1298, 366, 21949, 62, 31092, 62, 9641, 20662, 8, 198, 747, 13, 9776, 818, 12214, 3886, 7203, 45147, 1052, 38983, 1600, 366, 45147, 21582, 4943, 198, 747, 13, 9776, 8645, 515, 3886, 7203, 45147, 1600, 366, 45147, 21582, 4943, 198, 747, 13, 9776, 8645, 515, 3886, 7203, 45147, 10628, 1600, 366, 45147, 21582, 4943, 198, 747, 13, 9776, 8645, 515, 3886, 7203, 2025, 1662, 515, 18232, 10628, 1600, 366, 45147, 1052, 38983, 4943, 198, 747, 13, 1484, 7203, 45147, 1052, 38983, 1600, 366, 45147, 10628, 4943, 198, 747, 13, 20887, 1634, 5189, 7203, 45147, 10628, 1600, 366, 45147, 4943, 198, 747, 13, 20887, 1634, 5189, 7203, 2025, 1662, 515, 18232, 10628, 1600, 366, 45147, 4943, 198, 747, 13, 9776, 28532, 1572, 4863, 7203, 2025, 1662, 515, 18232, 10628, 1600, 366, 45147, 10628, 4943, 198, 747, 13, 9776, 8086, 6169, 2514, 7203, 2025, 1662, 515, 18232, 10628, 1600, 366, 2025, 1662, 1352, 4943, 198, 747, 13, 9776, 8086, 6169, 2514, 7203, 45147, 10628, 1600, 366, 16719, 273, 4943, 198, 747, 13, 9776, 8086, 6169, 2514, 7203, 45147, 1600, 366, 16719, 273, 4943, 198, 747, 13, 9776, 29014, 3152, 7203, 45147, 21582, 1600, 366, 16719, 273, 4943, 198, 747, 13, 9776, 29014, 3152, 7203, 45147, 1052, 38983, 1600, 366, 2025, 1662, 1352, 4943, 628, 198, 20979, 62, 12985, 62, 19849, 796, 7518, 24941, 3419, 198, 20979, 62, 12985, 62, 19849, 13, 2617, 62, 12286, 62, 14933, 10223, 7203, 18300, 23912, 17, 15234, 25, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 25781, 7203, 12982, 1600, 19779, 3672, 1298, 366, 1600, 366, 12888, 1298, 13538, 30072, 198, 20979, 62, 12985, 62, 19849, 13, 21797, 7203, 26362, 62, 9237, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 21797, 7203, 24835, 62, 9237, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 21797, 7203, 6935, 270, 62, 9237, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 26858, 7203, 24835, 1600, 19779, 15234, 25, 4906, 1298, 366, 15234, 25, 36307, 1600, 366, 3672, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 41509, 1298, 366, 1600, 366, 16793, 62, 41509, 1298, 13538, 30072, 198, 20979, 62, 12985, 62, 19849, 13, 26858, 7203, 26362, 1600, 19779, 15234, 25, 4906, 1298, 366, 15234, 25, 36307, 1600, 366, 3672, 1298, 366, 1600, 366, 12985, 62, 3672, 1298, 366, 1600, 366, 11213, 1298, 366, 1600, 366, 25598, 62, 265, 1298, 366, 1600, 366, 30147, 62, 265, 1298, 366, 1600, 366, 41509, 62, 6978, 1298, 366, 1600, 366, 12985, 62, 6978, 1298, 13538, 30072, 198, 20979, 62, 12985, 62, 19849, 13, 26858, 7203, 6935, 270, 1600, 19779, 312, 1298, 366, 1600, 366, 19509, 62, 312, 1298, 366, 1600, 366, 7839, 1298, 366, 1600, 366, 20500, 1298, 366, 1600, 366, 12384, 62, 6371, 1298, 366, 1600, 366, 25598, 62, 265, 1298, 13538, 30072, 198, 20979, 62, 12985, 62, 19849, 13, 26858, 7203, 26362, 62, 46785, 1600, 19779, 26270, 1298, 366, 1600, 366, 7753, 6978, 1298, 366, 1600, 366, 4033, 12609, 62, 265, 1298, 13538, 30072, 198, 20979, 62, 12985, 62, 19849, 13, 26858, 7203, 26362, 62, 45869, 1600, 19779, 9900, 1298, 366, 1600, 366, 18982, 1298, 366, 1600, 366, 7753, 6978, 1298, 13538, 30072, 198, 20979, 62, 12985, 62, 19849, 13, 18108, 27608, 7203, 26362, 62, 45869, 1600, 366, 26362, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 18108, 27608, 7203, 26362, 62, 46785, 1600, 366, 26362, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 18108, 27608, 7203, 24835, 1600, 366, 26362, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 18108, 27608, 7203, 6935, 270, 1600, 366, 24835, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 29014, 3152, 7203, 6935, 270, 62, 9237, 1600, 366, 12982, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 29014, 3152, 7203, 26362, 62, 9237, 1600, 366, 12982, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 29014, 3152, 7203, 24835, 62, 9237, 1600, 366, 12982, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 8086, 6169, 2514, 7203, 26362, 1600, 366, 12982, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 8086, 6169, 2514, 7203, 24835, 1600, 366, 12982, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 8086, 6169, 2514, 7203, 6935, 270, 1600, 366, 12982, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 8645, 515, 3886, 7203, 26362, 1600, 366, 26362, 62, 9237, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 8645, 515, 3886, 7203, 24835, 1600, 366, 24835, 62, 9237, 4943, 198, 20979, 62, 12985, 62, 19849, 13, 9776, 8645, 515, 3886, 7203, 6935, 270, 1600, 366, 6935, 270, 62, 9237, 4943, 628, 198, 1640, 3670, 11, 2205, 287, 685, 198, 220, 220, 220, 5855, 18300, 62, 41509, 62, 19849, 62, 2860, 1600, 751, 828, 198, 220, 220, 220, 5855, 18300, 62, 41509, 62, 19849, 62, 4666, 1600, 953, 828, 198, 220, 220, 220, 5855, 18300, 62, 41509, 62, 19849, 62, 12381, 1600, 816, 828, 198, 220, 220, 220, 5855, 18300, 23912, 62, 41509, 62, 19849, 1600, 401, 828, 198, 220, 220, 220, 5855, 18300, 23912, 62, 21949, 62, 19849, 1600, 1189, 828, 198, 220, 220, 220, 5855, 18300, 23912, 62, 647, 469, 62, 25927, 62, 19849, 1600, 285, 81, 828, 198, 220, 220, 220, 5855, 18300, 23912, 62, 20979, 62, 12985, 62, 19849, 1600, 2650, 62, 12985, 62, 19849, 8, 198, 5974, 198, 220, 220, 220, 899, 62, 1462, 62, 26518, 7, 15390, 11, 905, 62, 77, 560, 28, 25101, 11, 779, 62, 23912, 1424, 28, 25101, 11, 4571, 2625, 19313, 11074, 13564, 62, 12315, 7, 198, 220, 220, 220, 220, 220, 220, 220, 277, 1, 12315, 82, 14, 90, 7839, 27422, 12315, 1, 198, 220, 220, 220, 1267, 198, 220, 220, 220, 899, 62, 1462, 62, 26518, 7, 15390, 11, 905, 62, 77, 560, 28, 25101, 11, 779, 62, 23912, 1424, 28, 25101, 11, 4571, 2625, 19313, 11074, 13564, 62, 21370, 70, 7, 198, 220, 220, 220, 220, 220, 220, 220, 277, 1, 21370, 14542, 14, 90, 7839, 27422, 21370, 70, 1, 198, 220, 220, 220, 1267, 198 ]
2.971809
3,760
import json import requests from requests.adapters import HTTPAdapter from urllib3.util.retry import Retry from enum import Enum # This is a hard coded list of evidence, better organized for readability ev_all = ['EXP', 'IDA', 'IMP', 'IGI', 'IPI', 'IEP', 'IGC', 'RCA', 'IBA', 'IKR', 'IC', 'NAS', 'ND', 'TAS', 'HDA', 'HEP', 'HGI', 'HMP', 'ISA', 'ISM', 'ISO', 'ISS', 'IEA'] # This is a hard coded list of reference genomes that should always be present in a GO release REFERENCE_GENOME_IDS = [ "NCBITaxon:9606", "NCBITaxon:10116", "NCBITaxon:10090", "NCBITaxon:3702", "NCBITaxon:7955", "NCBITaxon:6239", "NCBITaxon:559292", "NCBITaxon:7227", "NCBITaxon:44689", "NCBITaxon:4896", "NCBITaxon:83333" ] BP_TERM_ID = "GO:0008150" MF_TERM_ID = "GO:0003674" CC_TERM_ID = "GO:0005575" # useful grouping of evidences as discussed with Pascale EVIDENCE_GROUPS = { "EXP": ["EXP", "IDA", "IEP", "IGI", "IMP", "IPI"], "HTP": ["HDA", "HEP", "HGI", "HMP", "HTP"], "PHYLO": ["IBA", "IRD", "IKR", "IMR"], "IEA": ["IEA"], "ND": ["ND"], "OTHER": ["IC", "IGC", "ISA", "ISM", "ISO", "ISS", "NAS", "RCA", "TAS"] } EVIDENCE_MIN_GROUPS = { "EXPERIMENTAL" : EVIDENCE_GROUPS["EXP"] + EVIDENCE_GROUPS["HTP"], "COMPUTATIONAL" : EVIDENCE_GROUPS["PHYLO"] + EVIDENCE_GROUPS["IEA"] + EVIDENCE_GROUPS["OTHER"] } global_session = None def fetch(url): """ Error proof method to get data from HTTP request If an error occured, return None """ global global_session # Ensure we are using the same session - creating too many sessions could crash this script if global_session is None: global_session = requests_retry(global_session) try: r = global_session.get(url) return r except Exception as x: print("Query GET " , url , " failed: ", x) return None def golr_fetch(golr_base_url, select_query): """ Error proof method to get data from GOLr If an HTTP error occurs, return None, otherwise return the json object """ r = fetch(golr_base_url + select_query) if r is None: return None response = r.json() return response # utility function to build a list from a solr/golr facet array # utility function to transform a list [A, 1, B, 2] into a map {A: 1, B: 2} # utility function to build a reverse map: { "a": 1, "b": 1, "c": 2 } -> {1: ["a", "b"], 2: ["c"]} # utility function to cluster elements of an input map based on another map of synonyms # similar as above but the value of each key is also a map # reorder map (python 3.6 keeps order in which items are inserted in map: https://stackoverflow.com/questions/613183/how-do-i-sort-a-dictionary-by-value) def bioentity_type(str_type): """ In a nutshell, collapse all RNA related types into RNA """ if "RNA" in str_type or "ribozyme" in str_type or "transcript" in str_type: return "RNA_cluster" return str_type def sum_map_values(map): """ Utility function to sum up the values of a map. Assume the map values are all numbers """ total = 0 for key, val in map.items(): total += val return total
[ 11748, 33918, 198, 11748, 7007, 198, 6738, 7007, 13, 324, 12126, 1330, 14626, 47307, 198, 6738, 2956, 297, 571, 18, 13, 22602, 13, 1186, 563, 1330, 4990, 563, 198, 6738, 33829, 1330, 2039, 388, 198, 198, 2, 770, 318, 257, 1327, 30817, 1351, 286, 2370, 11, 1365, 8389, 329, 1100, 1799, 198, 1990, 62, 439, 796, 37250, 49864, 3256, 705, 41957, 3256, 705, 3955, 47, 3256, 705, 3528, 40, 3256, 220, 705, 4061, 40, 3256, 705, 40, 8905, 3256, 705, 3528, 34, 3256, 705, 7397, 32, 3256, 705, 40, 4339, 3256, 705, 18694, 49, 3256, 705, 2149, 3256, 705, 18293, 3256, 705, 8575, 3256, 705, 51, 1921, 3256, 705, 39, 5631, 3256, 705, 39, 8905, 3256, 705, 39, 18878, 3256, 705, 39, 7378, 3256, 705, 22312, 3256, 705, 31125, 3256, 705, 40734, 3256, 705, 16744, 3256, 705, 10008, 32, 20520, 628, 198, 2, 770, 318, 257, 1327, 30817, 1351, 286, 4941, 42136, 326, 815, 1464, 307, 1944, 287, 257, 10351, 2650, 198, 2200, 24302, 18310, 62, 35353, 13649, 62, 14255, 796, 685, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 24, 33206, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 8784, 1433, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 3064, 3829, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 20167, 17, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 3720, 2816, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 21, 23516, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 38605, 32759, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 22, 24403, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 2598, 40523, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 2780, 4846, 1600, 198, 220, 220, 220, 366, 7792, 26094, 897, 261, 25, 23, 24840, 1, 198, 60, 198, 198, 20866, 62, 5781, 44, 62, 2389, 796, 366, 11230, 25, 830, 6659, 1120, 1, 198, 49800, 62, 5781, 44, 62, 2389, 796, 366, 11230, 25, 830, 2623, 4524, 1, 198, 4093, 62, 5781, 44, 62, 2389, 796, 366, 11230, 25, 830, 2816, 2425, 1, 198, 198, 2, 4465, 36115, 286, 25568, 3007, 355, 6693, 351, 350, 3372, 1000, 198, 36, 11008, 18310, 62, 10761, 2606, 3705, 796, 1391, 198, 220, 220, 220, 366, 49864, 1298, 14631, 49864, 1600, 366, 41957, 1600, 366, 40, 8905, 1600, 366, 3528, 40, 1600, 366, 3955, 47, 1600, 366, 4061, 40, 33116, 198, 220, 220, 220, 366, 6535, 47, 1298, 14631, 39, 5631, 1600, 366, 39, 8905, 1600, 366, 39, 18878, 1600, 366, 39, 7378, 1600, 366, 6535, 47, 33116, 198, 220, 220, 220, 366, 11909, 56, 21982, 1298, 14631, 40, 4339, 1600, 366, 46833, 1600, 366, 18694, 49, 1600, 366, 3955, 49, 33116, 198, 220, 220, 220, 366, 10008, 32, 1298, 14631, 10008, 32, 33116, 198, 220, 220, 220, 366, 8575, 1298, 14631, 8575, 33116, 198, 220, 220, 220, 366, 31858, 1298, 14631, 2149, 1600, 366, 3528, 34, 1600, 366, 22312, 1600, 366, 31125, 1600, 366, 40734, 1600, 366, 16744, 1600, 366, 18293, 1600, 366, 7397, 32, 1600, 366, 51, 1921, 8973, 198, 92, 198, 198, 36, 11008, 18310, 62, 23678, 62, 10761, 2606, 3705, 796, 1391, 198, 220, 220, 220, 366, 6369, 18973, 3955, 3525, 1847, 1, 1058, 8696, 2389, 18310, 62, 10761, 2606, 3705, 14692, 49864, 8973, 1343, 8696, 2389, 18310, 62, 10761, 2606, 3705, 14692, 6535, 47, 33116, 198, 220, 220, 220, 366, 9858, 30076, 29912, 1, 1058, 8696, 2389, 18310, 62, 10761, 2606, 3705, 14692, 11909, 56, 21982, 8973, 1343, 8696, 2389, 18310, 62, 10761, 2606, 3705, 14692, 10008, 32, 8973, 1343, 8696, 2389, 18310, 62, 10761, 2606, 3705, 14692, 31858, 8973, 198, 92, 628, 198, 20541, 62, 29891, 796, 6045, 628, 198, 4299, 21207, 7, 6371, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 13047, 6617, 2446, 284, 651, 1366, 422, 14626, 2581, 198, 220, 220, 220, 1002, 281, 4049, 1609, 1522, 11, 1441, 6045, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 3298, 3298, 62, 29891, 628, 220, 220, 220, 1303, 48987, 356, 389, 1262, 262, 976, 6246, 532, 4441, 1165, 867, 10991, 714, 7014, 428, 4226, 198, 220, 220, 220, 611, 3298, 62, 29891, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3298, 62, 29891, 796, 7007, 62, 1186, 563, 7, 20541, 62, 29891, 8, 198, 220, 220, 220, 220, 198, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 374, 796, 3298, 62, 29891, 13, 1136, 7, 6371, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 374, 198, 220, 220, 220, 2845, 35528, 355, 2124, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 7203, 20746, 17151, 366, 837, 19016, 837, 366, 4054, 25, 33172, 2124, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 220, 198, 198, 4299, 43791, 81, 62, 69, 7569, 7, 70, 349, 81, 62, 8692, 62, 6371, 11, 2922, 62, 22766, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 13047, 6617, 2446, 284, 651, 1366, 422, 402, 3535, 81, 198, 220, 220, 220, 1002, 281, 14626, 4049, 8833, 11, 1441, 6045, 11, 4306, 1441, 262, 33918, 2134, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 374, 796, 21207, 7, 70, 349, 81, 62, 8692, 62, 6371, 1343, 2922, 62, 22766, 8, 198, 220, 220, 220, 611, 374, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 2882, 796, 374, 13, 17752, 3419, 198, 220, 220, 220, 1441, 2882, 198, 198, 2, 10361, 2163, 284, 1382, 257, 1351, 422, 257, 1540, 81, 14, 70, 349, 81, 39144, 7177, 198, 198, 2, 10361, 2163, 284, 6121, 257, 1351, 685, 32, 11, 352, 11, 347, 11, 362, 60, 656, 257, 3975, 1391, 32, 25, 352, 11, 347, 25, 362, 92, 198, 198, 2, 10361, 2163, 284, 1382, 257, 9575, 3975, 25, 1391, 366, 64, 1298, 352, 11, 366, 65, 1298, 352, 11, 366, 66, 1298, 362, 1782, 4613, 1391, 16, 25, 14631, 64, 1600, 366, 65, 33116, 362, 25, 14631, 66, 8973, 92, 198, 198, 2, 10361, 2163, 284, 13946, 4847, 286, 281, 5128, 3975, 1912, 319, 1194, 3975, 286, 6171, 43612, 198, 198, 2, 2092, 355, 2029, 475, 262, 1988, 286, 1123, 1994, 318, 635, 257, 3975, 628, 198, 2, 302, 2875, 3975, 357, 29412, 513, 13, 21, 7622, 1502, 287, 543, 3709, 389, 18846, 287, 3975, 25, 3740, 1378, 25558, 2502, 11125, 13, 785, 14, 6138, 507, 14, 47512, 24839, 14, 4919, 12, 4598, 12, 72, 12, 30619, 12, 64, 12, 67, 14188, 12, 1525, 12, 8367, 8, 628, 198, 198, 4299, 13401, 26858, 62, 4906, 7, 2536, 62, 4906, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 554, 257, 43875, 11, 9807, 477, 25897, 3519, 3858, 656, 25897, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 366, 27204, 1, 287, 965, 62, 4906, 393, 366, 822, 78, 24266, 1, 287, 965, 62, 4906, 393, 366, 7645, 6519, 1, 287, 965, 62, 4906, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 366, 27204, 62, 565, 5819, 1, 198, 220, 220, 220, 1441, 965, 62, 4906, 198, 198, 4299, 2160, 62, 8899, 62, 27160, 7, 8899, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 34030, 2163, 284, 2160, 510, 262, 3815, 286, 257, 3975, 13, 2195, 2454, 262, 3975, 3815, 389, 477, 3146, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 2472, 796, 657, 198, 220, 220, 220, 329, 1994, 11, 1188, 287, 3975, 13, 23814, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 2472, 15853, 1188, 198, 220, 220, 220, 1441, 2472, 628 ]
2.47907
1,290
from django.urls import reverse
[ 6738, 42625, 14208, 13, 6371, 82, 1330, 9575, 628 ]
3.666667
9
num_list = [1,2,3,4] months = ['Jan', 'Feb', 'Mar', 'Apr'] months_dict = dict(zip(months, num_list))
[ 22510, 62, 4868, 796, 685, 16, 11, 17, 11, 18, 11, 19, 60, 198, 198, 41537, 796, 37250, 12128, 3256, 705, 15146, 3256, 705, 7676, 3256, 705, 13680, 20520, 198, 198, 41537, 62, 11600, 796, 8633, 7, 13344, 7, 41537, 11, 997, 62, 4868, 4008 ]
2.266667
45
# SPDX-License-Identifier: MIT """The application's interfaces that are used to connect the different components. Notes ----- This package's code is not really specific to the Django framework. It is an abstraction layer. Primary focus is the provision of a plugin API, that allows the app to be extendable with third-party applications. """
[ 2, 30628, 55, 12, 34156, 12, 33234, 7483, 25, 17168, 198, 198, 37811, 464, 3586, 338, 20314, 326, 389, 973, 284, 2018, 262, 1180, 6805, 13, 198, 198, 16130, 198, 30934, 198, 1212, 5301, 338, 2438, 318, 407, 1107, 2176, 284, 262, 37770, 9355, 13, 632, 318, 281, 198, 397, 301, 7861, 7679, 13, 198, 198, 35170, 2962, 318, 262, 8287, 286, 257, 13877, 7824, 11, 326, 3578, 262, 598, 284, 307, 198, 2302, 437, 540, 351, 2368, 12, 10608, 5479, 13, 198, 37811, 198 ]
4.058824
85
# =================================== # Name: Edward (Eddie) Guo # ID: 1576381 # Partner: Jason Kim # CMPUT 275, Fall 2020 # # Final Assignment: EEG Visualizer # =================================== """ Contains the QApplication which holds the PlotWindow QMainWindow object. The controller class is here for convenient additions of extra QMainWindows. """ import sys # for UI from PyQt5 import QtCore, QtWidgets from plot_window import PlotWindow class Controller: """Controller class for slave QMainWindows. Used for expandability in case the user wishes to create additional windows for the program (ex: home window). """ def show_plot_window(self): """Creates the main window (EEG and FFT plots) from plot_window.py. """ self.plot_window = QtWidgets.QMainWindow() self.ui = PlotWindow() self.ui.setup_ui(self.plot_window) self.plot_window.setWindowFlags(QtCore.Qt.Window) self.plot_window.show() app.aboutToQuit.connect(self.close_threads) def close_threads(self): """Helper function that closes all running threads when the application is about to quit. """ self.ui.close_threads() if __name__ == '__main__': app = QtWidgets.QApplication(sys.argv) controller = Controller() controller.show_plot_window() sys.exit(app.exec_())
[ 2, 46111, 855, 198, 2, 220, 220, 6530, 25, 10443, 357, 36, 1860, 494, 8, 1962, 78, 198, 2, 220, 220, 4522, 25, 1315, 4304, 36626, 198, 2, 220, 220, 35532, 25, 8982, 6502, 198, 2, 220, 220, 327, 7378, 3843, 25829, 11, 7218, 12131, 198, 2, 198, 2, 220, 220, 8125, 50144, 25, 48749, 15612, 7509, 198, 2, 46111, 855, 198, 198, 37811, 198, 4264, 1299, 262, 1195, 23416, 543, 6622, 262, 28114, 27703, 1195, 13383, 27703, 2134, 13, 383, 198, 36500, 1398, 318, 994, 329, 11282, 19885, 286, 3131, 1195, 13383, 11209, 13, 198, 37811, 198, 198, 11748, 25064, 198, 198, 2, 329, 12454, 198, 6738, 9485, 48, 83, 20, 1330, 33734, 14055, 11, 33734, 54, 312, 11407, 198, 6738, 7110, 62, 17497, 1330, 28114, 27703, 628, 198, 4871, 22741, 25, 628, 220, 220, 220, 37227, 22130, 1398, 329, 11778, 1195, 13383, 11209, 13, 16718, 329, 4292, 1799, 287, 1339, 198, 220, 220, 220, 262, 2836, 12802, 284, 2251, 3224, 9168, 329, 262, 1430, 357, 1069, 25, 1363, 198, 220, 220, 220, 4324, 737, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 825, 905, 62, 29487, 62, 17497, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16719, 274, 262, 1388, 4324, 357, 6500, 38, 290, 376, 9792, 21528, 8, 422, 7110, 62, 17497, 13, 9078, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29487, 62, 17497, 796, 33734, 54, 312, 11407, 13, 48, 13383, 27703, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 9019, 796, 28114, 27703, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 9019, 13, 40406, 62, 9019, 7, 944, 13, 29487, 62, 17497, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29487, 62, 17497, 13, 2617, 27703, 40053, 7, 48, 83, 14055, 13, 48, 83, 13, 27703, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 29487, 62, 17497, 13, 12860, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 598, 13, 10755, 2514, 4507, 270, 13, 8443, 7, 944, 13, 19836, 62, 16663, 82, 8, 628, 198, 220, 220, 220, 825, 1969, 62, 16663, 82, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 47429, 2163, 326, 20612, 477, 2491, 14390, 618, 262, 3586, 198, 220, 220, 220, 220, 220, 220, 220, 318, 546, 284, 11238, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 9019, 13, 19836, 62, 16663, 82, 3419, 628, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 598, 796, 33734, 54, 312, 11407, 13, 48, 23416, 7, 17597, 13, 853, 85, 8, 198, 220, 220, 220, 10444, 796, 22741, 3419, 198, 220, 220, 220, 10444, 13, 12860, 62, 29487, 62, 17497, 3419, 198, 220, 220, 220, 25064, 13, 37023, 7, 1324, 13, 18558, 62, 28955, 198 ]
2.80202
495
# -*- coding: utf-8 -*- """Test Code in __init__.""" __all__ = [ "test_get_path_to_file", ] ############################################################################## # IMPORTS # BUILT-IN import os.path # PROJECT-SPECIFIC from utilipy.data_utils.utils import get_path_to_file ############################################################################## # PARAMETERS ############################################################################## # CODE ############################################################################## # /def # ------------------------------------------------------------------- ############################################################################## # END
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 198, 37811, 14402, 6127, 287, 11593, 15003, 834, 526, 15931, 198, 198, 834, 439, 834, 796, 685, 198, 220, 220, 220, 366, 9288, 62, 1136, 62, 6978, 62, 1462, 62, 7753, 1600, 198, 60, 628, 198, 29113, 29113, 7804, 4242, 2235, 198, 2, 30023, 33002, 198, 198, 2, 20571, 4146, 51, 12, 1268, 198, 11748, 28686, 13, 6978, 198, 198, 2, 21965, 23680, 12, 48451, 30643, 198, 6738, 7736, 541, 88, 13, 7890, 62, 26791, 13, 26791, 1330, 651, 62, 6978, 62, 1462, 62, 7753, 198, 198, 29113, 29113, 7804, 4242, 2235, 198, 2, 29463, 2390, 2767, 4877, 628, 198, 29113, 29113, 7804, 4242, 2235, 198, 2, 42714, 198, 29113, 29113, 7804, 4242, 2235, 628, 198, 198, 2, 1220, 4299, 628, 198, 2, 16529, 6329, 628, 198, 29113, 29113, 7804, 4242, 2235, 198, 2, 23578, 198 ]
4.793333
150
# Generated by Django 3.1.7 on 2021-04-20 16:20 from django.db import migrations, models import django.db.models.deletion
[ 2, 2980, 515, 416, 37770, 513, 13, 16, 13, 22, 319, 33448, 12, 3023, 12, 1238, 1467, 25, 1238, 198, 198, 6738, 42625, 14208, 13, 9945, 1330, 15720, 602, 11, 4981, 198, 11748, 42625, 14208, 13, 9945, 13, 27530, 13, 2934, 1616, 295, 628 ]
2.818182
44
# Copyright 2021 The Kubeflow Authors # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. """Classes and methods that supports argument for ParallelFor.""" import re from typing import Any, Dict, List, Optional, Tuple, Union, get_type_hints from kfp.v2.components.experimental import pipeline_channel ItemList = List[Union[int, float, str, Dict[str, Any]]] def _get_loop_item_type(type_name: str) -> Optional[str]: """Extracts the loop item type. This method is used for extract the item type from a collection type. For example: List[str] -> str typing.List[int] -> int typing.Sequence[str] -> str List -> None str -> None Args: type_name: The collection type name, like `List`, Sequence`, etc. Returns: The collection item type or None if no match found. """ match = re.match('(typing\.)?(?:\w+)(?:\[(?P<item_type>.+)\])', type_name) if match: return match.group('item_type').lstrip().rstrip() else: return None def _get_subvar_type(type_name: str) -> Optional[str]: """Extracts the subvar type. This method is used for extract the value type from a dictionary type. For example: Dict[str, int] -> int typing.Mapping[str, float] -> float Args: type_name: The dictionary type. Returns: The dictionary value type or None if no match found. """ match = re.match( '(typing\.)?(?:\w+)(?:\[\s*(?:\w+)\s*,\s*(?P<value_type>.+)\])', type_name) if match: return match.group('value_type').lstrip().rstrip() else: return None class LoopArgument(pipeline_channel.PipelineChannel): """Represents the argument that are looped over in a ParallelFor loop. The class shouldn't be instantiated by the end user, rather it is created automatically by a ParallelFor ops group. To create a LoopArgument instance, use one of its factory methods:: LoopArgument.from_pipeline_channel(...) LoopArgument.from_raw_items(...) Attributes: items_or_pipeline_channel: The raw items or the PipelineChannel object this LoopArgument is associated to. """ LOOP_ITEM_NAME_BASE = 'loop-item' LOOP_ITEM_PARAM_NAME_BASE = 'loop-item-param' def __init__( self, items: Union[ItemList, pipeline_channel.PipelineChannel], name_code: Optional[str] = None, name_override: Optional[str] = None, **kwargs, ): """Initializes a LoopArguments object. Args: items: List of items to loop over. If a list of dicts then, all dicts must have the same keys and every key must be a legal Python variable name. name_code: A unique code used to identify these loop arguments. Should match the code for the ParallelFor ops_group which created these LoopArguments. This prevents parameter name collisions. name_override: The override name for PipelineChannel. **kwargs: Any other keyword arguments passed down to PipelineChannel. """ if (name_code is None) == (name_override is None): raise ValueError( 'Expect one and only one of `name_code` and `name_override` to ' 'be specified.') if name_override is None: super().__init__(name=self._make_name(name_code), **kwargs) else: super().__init__(name=name_override, **kwargs) if not isinstance(items, (list, tuple, pipeline_channel.PipelineChannel)): raise TypeError( f'Expected list, tuple, or PipelineChannel, got {items}.') if isinstance(items, tuple): items = list(items) self.items_or_pipeline_channel = items self._referenced_subvars: Dict[str, LoopArgumentVariable] = {} if isinstance(items, list) and isinstance(items[0], dict): subvar_names = set(items[0].keys()) # then this block creates loop_arg.variable_a and loop_arg.variable_b for subvar_name in subvar_names: loop_arg_var = LoopArgumentVariable( loop_argument=self, subvar_name=subvar_name, ) self._referenced_subvars[subvar_name] = loop_arg_var setattr(self, subvar_name, loop_arg_var) def _make_name(self, code: str): """Makes a name for this loop argument from a unique code.""" return '{}-{}'.format(self.LOOP_ITEM_PARAM_NAME_BASE, code) @classmethod def from_pipeline_channel( cls, channel: pipeline_channel.PipelineChannel, ) -> 'LoopArgument': """Creates a LoopArgument object from a PipelineChannel object.""" return LoopArgument( items=channel, name_override=channel.name + '-' + cls.LOOP_ITEM_NAME_BASE, task_name=channel.task_name, channel_type=_get_loop_item_type(channel.channel_type), ) @classmethod def from_raw_items( cls, raw_items: ItemList, name_code: str, ) -> 'LoopArgument': """Creates a LoopArgument object from raw item list.""" if len(raw_items) == 0: raise ValueError('Got an empty item list for loop argument.') return LoopArgument( items=raw_items, name_code=name_code, channel_type=type(raw_items[0]).__name__, ) @classmethod def name_is_loop_argument(cls, name: str) -> bool: """Returns True if the given channel name looks like a loop argument. Either it came from a withItems loop item or withParams loop item. """ return ('-' + cls.LOOP_ITEM_NAME_BASE) in name \ or (cls.LOOP_ITEM_PARAM_NAME_BASE + '-') in name class LoopArgumentVariable(pipeline_channel.PipelineChannel): """Represents a subvariable for a loop argument. This is used for cases where we're looping over maps, each of which contains several variables. If the user ran: with dsl.ParallelFor([{'a': 1, 'b': 2}, {'a': 3, 'b': 4}]) as item: ... Then there's one LoopArgumentVariable for 'a' and another for 'b'. Attributes: loop_argument: The original LoopArgument object this subvariable is attached to. subvar_name: The subvariable name. """ SUBVAR_NAME_DELIMITER = '-subvar-' LEGAL_SUBVAR_NAME_REGEX = re.compile(r'^[a-zA-Z_][0-9a-zA-Z_]*$') def __init__( self, loop_argument: LoopArgument, subvar_name: str, ): """Initializes a LoopArgumentVariable instance. Args: loop_argument: The LoopArgument object this subvariable is based on a subvariable to. subvar_name: The name of this subvariable, which is the name of the dict key that spawned this subvariable. Raises: ValueError is subvar name is illegal. """ if not self._subvar_name_is_legal(subvar_name): raise ValueError( f'Tried to create subvariable named {subvar_name}, but that is ' 'not a legal Python variable name.') self.subvar_name = subvar_name self.loop_argument = loop_argument super().__init__( name=self._get_name_override( loop_arg_name=loop_argument.name, subvar_name=subvar_name, ), task_name=loop_argument.task_name, channel_type=_get_subvar_type(loop_argument.channel_type), ) def _subvar_name_is_legal(self, proposed_variable_name: str) -> bool: """Returns True if the subvar name is legal.""" return re.match(self.LEGAL_SUBVAR_NAME_REGEX, proposed_variable_name) is not None def _get_name_override(self, loop_arg_name: str, subvar_name: str) -> str: """Gets the name. Args: loop_arg_name: the name of the loop argument parameter that this LoopArgumentVariable is attached to. subvar_name: The name of this subvariable. Returns: The name of this loop arg variable. """ return f'{loop_arg_name}{self.SUBVAR_NAME_DELIMITER}{subvar_name}'
[ 2, 15069, 33448, 383, 24921, 891, 9319, 46665, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 198, 2, 345, 743, 407, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 198, 2, 921, 743, 7330, 257, 4866, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 198, 2, 42881, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 198, 2, 4091, 262, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 198, 2, 11247, 739, 262, 13789, 13, 198, 37811, 9487, 274, 290, 5050, 326, 6971, 4578, 329, 42945, 1890, 526, 15931, 198, 198, 11748, 302, 198, 6738, 19720, 1330, 4377, 11, 360, 713, 11, 7343, 11, 32233, 11, 309, 29291, 11, 4479, 11, 651, 62, 4906, 62, 71, 29503, 198, 198, 6738, 479, 46428, 13, 85, 17, 13, 5589, 3906, 13, 23100, 9134, 1330, 11523, 62, 17620, 198, 198, 7449, 8053, 796, 7343, 58, 38176, 58, 600, 11, 12178, 11, 965, 11, 360, 713, 58, 2536, 11, 4377, 11907, 60, 628, 198, 4299, 4808, 1136, 62, 26268, 62, 9186, 62, 4906, 7, 4906, 62, 3672, 25, 965, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 11627, 974, 82, 262, 9052, 2378, 2099, 13, 628, 220, 220, 220, 770, 2446, 318, 973, 329, 7925, 262, 2378, 2099, 422, 257, 4947, 2099, 13, 198, 220, 220, 220, 1114, 1672, 25, 628, 220, 220, 220, 220, 220, 220, 220, 7343, 58, 2536, 60, 4613, 965, 198, 220, 220, 220, 220, 220, 220, 220, 19720, 13, 8053, 58, 600, 60, 4613, 493, 198, 220, 220, 220, 220, 220, 220, 220, 19720, 13, 44015, 594, 58, 2536, 60, 4613, 965, 198, 220, 220, 220, 220, 220, 220, 220, 7343, 4613, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 965, 4613, 6045, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2099, 62, 3672, 25, 383, 4947, 2099, 1438, 11, 588, 4600, 8053, 47671, 45835, 47671, 3503, 13, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 383, 4947, 2378, 2099, 393, 6045, 611, 645, 2872, 1043, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 2872, 796, 302, 13, 15699, 10786, 7, 774, 13886, 59, 2014, 30, 7, 30, 7479, 86, 10, 5769, 30, 7479, 58, 7, 30, 47, 27, 9186, 62, 4906, 28401, 10, 19415, 12962, 3256, 2099, 62, 3672, 8, 198, 220, 220, 220, 611, 2872, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2872, 13, 8094, 10786, 9186, 62, 4906, 27691, 75, 36311, 22446, 81, 36311, 3419, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 198, 4299, 4808, 1136, 62, 7266, 7785, 62, 4906, 7, 4906, 62, 3672, 25, 965, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 11627, 974, 82, 262, 850, 7785, 2099, 13, 628, 220, 220, 220, 770, 2446, 318, 973, 329, 7925, 262, 1988, 2099, 422, 257, 22155, 2099, 13, 198, 220, 220, 220, 1114, 1672, 25, 628, 220, 220, 220, 220, 220, 220, 220, 360, 713, 58, 2536, 11, 493, 60, 4613, 493, 198, 220, 220, 220, 220, 220, 220, 220, 19720, 13, 44, 5912, 58, 2536, 11, 12178, 60, 4613, 12178, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2099, 62, 3672, 25, 383, 22155, 2099, 13, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 383, 22155, 1988, 2099, 393, 6045, 611, 645, 2872, 1043, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 2872, 796, 302, 13, 15699, 7, 198, 220, 220, 220, 220, 220, 220, 220, 29513, 774, 13886, 59, 2014, 30, 7, 30, 7479, 86, 10, 5769, 30, 7479, 58, 59, 82, 9, 7, 30, 7479, 86, 10, 19415, 82, 25666, 59, 82, 9, 7, 30, 47, 27, 8367, 62, 4906, 28401, 10, 19415, 12962, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 2099, 62, 3672, 8, 198, 220, 220, 220, 611, 2872, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2872, 13, 8094, 10786, 8367, 62, 4906, 27691, 75, 36311, 22446, 81, 36311, 3419, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 198, 4871, 26304, 28100, 1713, 7, 79, 541, 4470, 62, 17620, 13, 47, 541, 4470, 29239, 2599, 198, 220, 220, 220, 37227, 6207, 6629, 262, 4578, 326, 389, 9052, 276, 625, 287, 257, 42945, 1890, 9052, 13, 628, 220, 220, 220, 383, 1398, 6584, 470, 307, 9113, 12931, 416, 262, 886, 2836, 11, 2138, 340, 318, 198, 220, 220, 220, 2727, 6338, 416, 257, 42945, 1890, 39628, 1448, 13, 628, 220, 220, 220, 1675, 2251, 257, 26304, 28100, 1713, 4554, 11, 779, 530, 286, 663, 8860, 5050, 3712, 628, 220, 220, 220, 220, 220, 220, 220, 26304, 28100, 1713, 13, 6738, 62, 79, 541, 4470, 62, 17620, 7, 23029, 198, 220, 220, 220, 220, 220, 220, 220, 26304, 28100, 1713, 13, 6738, 62, 1831, 62, 23814, 7, 23029, 628, 198, 220, 220, 220, 49213, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3709, 62, 273, 62, 79, 541, 4470, 62, 17620, 25, 383, 8246, 3709, 393, 262, 37709, 29239, 2134, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 428, 26304, 28100, 1713, 318, 3917, 284, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 17579, 3185, 62, 2043, 3620, 62, 20608, 62, 33, 11159, 796, 705, 26268, 12, 9186, 6, 198, 220, 220, 220, 17579, 3185, 62, 2043, 3620, 62, 27082, 2390, 62, 20608, 62, 33, 11159, 796, 705, 26268, 12, 9186, 12, 17143, 6, 628, 220, 220, 220, 825, 11593, 15003, 834, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 3709, 25, 4479, 58, 7449, 8053, 11, 11523, 62, 17620, 13, 47, 541, 4470, 29239, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 8189, 25, 32233, 58, 2536, 60, 796, 6045, 11, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 2502, 13154, 25, 32233, 58, 2536, 60, 796, 6045, 11, 198, 220, 220, 220, 220, 220, 220, 220, 12429, 46265, 22046, 11, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 24243, 4340, 257, 26304, 28100, 2886, 2134, 13, 628, 220, 220, 220, 220, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3709, 25, 7343, 286, 3709, 284, 9052, 625, 13, 220, 1002, 257, 1351, 286, 8633, 82, 788, 11, 477, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8633, 82, 1276, 423, 262, 976, 8251, 290, 790, 1994, 1276, 307, 257, 2742, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11361, 7885, 1438, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 8189, 25, 317, 3748, 2438, 973, 284, 5911, 777, 9052, 7159, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10358, 2872, 262, 2438, 329, 262, 42945, 1890, 39628, 62, 8094, 543, 2727, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 777, 26304, 28100, 2886, 13, 770, 15174, 11507, 1438, 31998, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 2502, 13154, 25, 383, 20957, 1438, 329, 37709, 29239, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12429, 46265, 22046, 25, 4377, 584, 21179, 7159, 3804, 866, 284, 37709, 29239, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 357, 3672, 62, 8189, 318, 6045, 8, 6624, 357, 3672, 62, 2502, 13154, 318, 6045, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 3109, 806, 530, 290, 691, 530, 286, 4600, 3672, 62, 8189, 63, 290, 4600, 3672, 62, 2502, 13154, 63, 284, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 1350, 7368, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 611, 1438, 62, 2502, 13154, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2208, 22446, 834, 15003, 834, 7, 3672, 28, 944, 13557, 15883, 62, 3672, 7, 3672, 62, 8189, 828, 12429, 46265, 22046, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2208, 22446, 834, 15003, 834, 7, 3672, 28, 3672, 62, 2502, 13154, 11, 12429, 46265, 22046, 8, 628, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 39098, 7, 23814, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 4868, 11, 46545, 11, 11523, 62, 17620, 13, 47, 541, 4470, 29239, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 5994, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 277, 6, 3109, 7254, 1351, 11, 46545, 11, 393, 37709, 29239, 11, 1392, 1391, 23814, 92, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 611, 318, 39098, 7, 23814, 11, 46545, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3709, 796, 1351, 7, 23814, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 23814, 62, 273, 62, 79, 541, 4470, 62, 17620, 796, 3709, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 5420, 14226, 771, 62, 7266, 85, 945, 25, 360, 713, 58, 2536, 11, 26304, 28100, 1713, 43015, 60, 796, 23884, 628, 220, 220, 220, 220, 220, 220, 220, 611, 318, 39098, 7, 23814, 11, 1351, 8, 290, 318, 39098, 7, 23814, 58, 15, 4357, 8633, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 14933, 796, 900, 7, 23814, 58, 15, 4083, 13083, 28955, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 788, 428, 2512, 8075, 9052, 62, 853, 13, 45286, 62, 64, 290, 9052, 62, 853, 13, 45286, 62, 65, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 850, 7785, 62, 3672, 287, 850, 7785, 62, 14933, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 853, 62, 7785, 796, 26304, 28100, 1713, 43015, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 49140, 28, 944, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 3672, 28, 7266, 7785, 62, 3672, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 5420, 14226, 771, 62, 7266, 85, 945, 58, 7266, 7785, 62, 3672, 60, 796, 9052, 62, 853, 62, 7785, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 900, 35226, 7, 944, 11, 850, 7785, 62, 3672, 11, 9052, 62, 853, 62, 7785, 8, 628, 220, 220, 220, 825, 4808, 15883, 62, 3672, 7, 944, 11, 2438, 25, 965, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 44, 1124, 257, 1438, 329, 428, 9052, 4578, 422, 257, 3748, 2438, 526, 15931, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 705, 90, 92, 12, 90, 92, 4458, 18982, 7, 944, 13, 21982, 3185, 62, 2043, 3620, 62, 27082, 2390, 62, 20608, 62, 33, 11159, 11, 2438, 8, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 422, 62, 79, 541, 4470, 62, 17620, 7, 198, 220, 220, 220, 220, 220, 220, 220, 537, 82, 11, 198, 220, 220, 220, 220, 220, 220, 220, 6518, 25, 11523, 62, 17620, 13, 47, 541, 4470, 29239, 11, 198, 220, 220, 220, 1267, 4613, 705, 39516, 28100, 1713, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16719, 274, 257, 26304, 28100, 1713, 2134, 422, 257, 37709, 29239, 2134, 526, 15931, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 26304, 28100, 1713, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3709, 28, 17620, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 2502, 13154, 28, 17620, 13, 3672, 1343, 705, 19355, 1343, 537, 82, 13, 21982, 3185, 62, 2043, 3620, 62, 20608, 62, 33, 11159, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4876, 62, 3672, 28, 17620, 13, 35943, 62, 3672, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6518, 62, 4906, 28, 62, 1136, 62, 26268, 62, 9186, 62, 4906, 7, 17620, 13, 17620, 62, 4906, 828, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 422, 62, 1831, 62, 23814, 7, 198, 220, 220, 220, 220, 220, 220, 220, 537, 82, 11, 198, 220, 220, 220, 220, 220, 220, 220, 8246, 62, 23814, 25, 9097, 8053, 11, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 8189, 25, 965, 11, 198, 220, 220, 220, 1267, 4613, 705, 39516, 28100, 1713, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16719, 274, 257, 26304, 28100, 1713, 2134, 422, 8246, 2378, 1351, 526, 15931, 198, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 1831, 62, 23814, 8, 6624, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 10786, 30074, 281, 6565, 2378, 1351, 329, 9052, 4578, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 26304, 28100, 1713, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3709, 28, 1831, 62, 23814, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 62, 8189, 28, 3672, 62, 8189, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6518, 62, 4906, 28, 4906, 7, 1831, 62, 23814, 58, 15, 35944, 834, 3672, 834, 11, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 1438, 62, 271, 62, 26268, 62, 49140, 7, 565, 82, 11, 1438, 25, 965, 8, 4613, 20512, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 35561, 6407, 611, 262, 1813, 6518, 1438, 3073, 588, 257, 9052, 4578, 13, 628, 220, 220, 220, 220, 220, 220, 220, 15467, 340, 1625, 422, 257, 351, 23022, 9052, 2378, 393, 351, 10044, 4105, 9052, 198, 220, 220, 220, 220, 220, 220, 220, 2378, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 220, 19203, 19355, 1343, 537, 82, 13, 21982, 3185, 62, 2043, 3620, 62, 20608, 62, 33, 11159, 8, 287, 1438, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 393, 357, 565, 82, 13, 21982, 3185, 62, 2043, 3620, 62, 27082, 2390, 62, 20608, 62, 33, 11159, 1343, 705, 12, 11537, 287, 1438, 628, 198, 4871, 26304, 28100, 1713, 43015, 7, 79, 541, 4470, 62, 17620, 13, 47, 541, 4470, 29239, 2599, 198, 220, 220, 220, 37227, 6207, 6629, 257, 850, 45286, 329, 257, 9052, 4578, 13, 628, 220, 220, 220, 770, 318, 973, 329, 2663, 810, 356, 821, 9052, 278, 625, 8739, 11, 1123, 286, 543, 4909, 198, 220, 220, 220, 1811, 9633, 13, 1002, 262, 2836, 4966, 25, 628, 220, 220, 220, 220, 220, 220, 220, 351, 288, 6649, 13, 10044, 29363, 1890, 26933, 90, 6, 64, 10354, 352, 11, 705, 65, 10354, 362, 5512, 1391, 6, 64, 10354, 513, 11, 705, 65, 10354, 604, 92, 12962, 355, 2378, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2644, 628, 220, 220, 220, 3244, 612, 338, 530, 26304, 28100, 1713, 43015, 329, 705, 64, 6, 290, 1194, 329, 705, 65, 4458, 628, 220, 220, 220, 49213, 25, 198, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 49140, 25, 383, 2656, 26304, 28100, 1713, 2134, 428, 850, 45286, 318, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7223, 284, 13, 198, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 3672, 25, 383, 850, 45286, 1438, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 28932, 53, 1503, 62, 20608, 62, 35, 3698, 3955, 2043, 1137, 796, 705, 12, 7266, 7785, 19355, 198, 220, 220, 220, 20978, 1847, 62, 50, 10526, 53, 1503, 62, 20608, 62, 31553, 6369, 796, 302, 13, 5589, 576, 7, 81, 6, 61, 58, 64, 12, 89, 32, 12, 57, 62, 7131, 15, 12, 24, 64, 12, 89, 32, 12, 57, 62, 60, 9, 3, 11537, 628, 220, 220, 220, 825, 11593, 15003, 834, 7, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 11, 198, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 49140, 25, 26304, 28100, 1713, 11, 198, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 3672, 25, 965, 11, 198, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 24243, 4340, 257, 26304, 28100, 1713, 43015, 4554, 13, 628, 220, 220, 220, 220, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 49140, 25, 383, 26304, 28100, 1713, 2134, 428, 850, 45286, 318, 1912, 319, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 257, 850, 45286, 284, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 3672, 25, 383, 1438, 286, 428, 850, 45286, 11, 543, 318, 262, 1438, 286, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8633, 1994, 326, 29013, 428, 850, 45286, 13, 628, 220, 220, 220, 220, 220, 220, 220, 7567, 2696, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11052, 12331, 318, 850, 7785, 1438, 318, 5293, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 2116, 13557, 7266, 7785, 62, 3672, 62, 271, 62, 18011, 7, 7266, 7785, 62, 3672, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 277, 6, 51, 2228, 284, 2251, 850, 45286, 3706, 1391, 7266, 7785, 62, 3672, 5512, 475, 326, 318, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 1662, 257, 2742, 11361, 7885, 1438, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 7266, 7785, 62, 3672, 796, 850, 7785, 62, 3672, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 26268, 62, 49140, 796, 9052, 62, 49140, 628, 220, 220, 220, 220, 220, 220, 220, 2208, 22446, 834, 15003, 834, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1438, 28, 944, 13557, 1136, 62, 3672, 62, 2502, 13154, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 853, 62, 3672, 28, 26268, 62, 49140, 13, 3672, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 3672, 28, 7266, 7785, 62, 3672, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4876, 62, 3672, 28, 26268, 62, 49140, 13, 35943, 62, 3672, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6518, 62, 4906, 28, 62, 1136, 62, 7266, 7785, 62, 4906, 7, 26268, 62, 49140, 13, 17620, 62, 4906, 828, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 825, 4808, 7266, 7785, 62, 3672, 62, 271, 62, 18011, 7, 944, 11, 5150, 62, 45286, 62, 3672, 25, 965, 8, 4613, 20512, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 35561, 6407, 611, 262, 850, 7785, 1438, 318, 2742, 526, 15931, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 302, 13, 15699, 7, 944, 13, 2538, 38, 1847, 62, 50, 10526, 53, 1503, 62, 20608, 62, 31553, 6369, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5150, 62, 45286, 62, 3672, 8, 318, 407, 6045, 628, 220, 220, 220, 825, 4808, 1136, 62, 3672, 62, 2502, 13154, 7, 944, 11, 9052, 62, 853, 62, 3672, 25, 965, 11, 850, 7785, 62, 3672, 25, 965, 8, 4613, 965, 25, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 38, 1039, 262, 1438, 13, 628, 220, 220, 220, 220, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9052, 62, 853, 62, 3672, 25, 262, 1438, 286, 262, 9052, 4578, 11507, 326, 428, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 26304, 28100, 1713, 43015, 318, 7223, 284, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 850, 7785, 62, 3672, 25, 383, 1438, 286, 428, 850, 45286, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 383, 1438, 286, 428, 9052, 1822, 7885, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 277, 6, 90, 26268, 62, 853, 62, 3672, 18477, 944, 13, 50, 10526, 53, 1503, 62, 20608, 62, 35, 3698, 3955, 2043, 1137, 18477, 7266, 7785, 62, 3672, 92, 6, 198 ]
2.337441
3,814
#!/usr/bin/env python # -*- coding: utf-8 -*- import os import datetime os.chdir(os.path.abspath(os.path.dirname(__file__))) LINUX_DISTROS = [ "almalinux-8", "amazon-2", "arch", "centos-7", "centos-8", "debian-10", "debian-11", "debian-9", "fedora-33", "fedora-34", "fedora-35", "gentoo", "gentoo-systemd", "opensuse-15", "opensuse-tumbleweed", "oraclelinux-7", "oraclelinux-8", "rockylinux-8", "ubuntu-1804", "ubuntu-2004", "ubuntu-2104", ] OSX = WINDOWS = [] STABLE_DISTROS = [ "amazon-2", "centos-7", "centos-8", "debian-10", "debian-11", "debian-9", "fedora-33", "fedora-34", "fedora-35", "gentoo", "gentoo-systemd", "oraclelinux-7", "oraclelinux-8", "ubuntu-1804", "ubuntu-2004", "ubuntu-2104", ] PY2_BLACKLIST = [ "almalinux-8", "centos-8", "debian-10", "debian-11", "fedora-33", "fedora-34", "fedora-35", "gentoo", "gentoo-systemd", "opensuse-15", "opensuse-tumbleweed", "oraclelinux-8", "rockylinux-8", "ubuntu-2004", "ubuntu-2104", ] BLACKLIST_3000 = [ "almalinux-8", "debian-11", "fedora-33", "fedora-34", "fedora-35", "opensuse-tumbleweed", "rockylinux-8", "ubuntu-2004", "ubuntu-2104", ] BLACKLIST_3001 = [ "almalinux-8", "debian-11", "rockylinux-8", "ubuntu-2104", ] BLACKLIST_3001_0 = [ "almalinux-8", "debian-11", "gentoo", "gentoo-systemd", "rockylinux-8", "ubuntu-2104", ] BLACKLIST_3002_0 = [ "almalinux-8", "debian-11", "gentoo", "gentoo-systemd", "rockylinux-8", "ubuntu-2104", ] SALT_BRANCHES = [ "3000", "3001", "3001-0", "3002", "3002-0", "master", "latest", ] BRANCH_DISPLAY_NAMES = { "3000": "v3000", "3001": "v3001", "3001-0": "v3001.0", "3002": "v3002", "3002-0": "v3002.0", "master": "Master", "latest": "Latest", } STABLE_BRANCH_BLACKLIST = [] LATEST_PKG_BLACKLIST = [] DISTRO_DISPLAY_NAMES = { "almalinux-8": "AlmaLinux 8", "amazon-2": "Amazon 2", "arch": "Arch", "centos-7": "CentOS 7", "centos-8": "CentOS 8", "debian-10": "Debian 10", "debian-11": "Debian 11", "debian-9": "Debian 9", "fedora-33": "Fedora 33", "fedora-34": "Fedora 34", "fedora-35": "Fedora 35", "gentoo": "Gentoo", "gentoo-systemd": "Gentoo (systemd)", "opensuse-15": "Opensuse 15", "opensuse-tumbleweed": "Opensuse Tumbleweed", "oraclelinux-7": "Oracle Linux 7", "oraclelinux-8": "Oracle Linux 8", "rockylinux-8": "Rocky Linux 8", "ubuntu-1804": "Ubuntu 18.04", "ubuntu-2004": "Ubuntu 20.04", "ubuntu-2104": "Ubuntu 21.04", } TIMEOUT_DEFAULT = 20 TIMEOUT_OVERRIDES = { "gentoo": 90, "gentoo-systemd": 90, } BRANCH_ONLY_OVERRIDES = [ "gentoo", "gentoo-systemd", ] if __name__ == "__main__": generate_test_jobs()
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 198, 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 11748, 28686, 198, 11748, 4818, 8079, 198, 198, 418, 13, 354, 15908, 7, 418, 13, 6978, 13, 397, 2777, 776, 7, 418, 13, 6978, 13, 15908, 3672, 7, 834, 7753, 834, 22305, 198, 198, 34509, 31235, 62, 26288, 5446, 2640, 796, 685, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 33103, 12, 17, 1600, 198, 220, 220, 220, 366, 998, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 22, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 940, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 24689, 12, 24, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2091, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2682, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2327, 1600, 198, 220, 220, 220, 366, 6783, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1600, 198, 220, 220, 220, 366, 44813, 1904, 12, 1314, 1600, 198, 220, 220, 220, 366, 44813, 1904, 12, 83, 10344, 39054, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 22, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 23, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 1507, 3023, 1600, 198, 220, 220, 220, 366, 32230, 12, 15724, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 2640, 55, 796, 370, 12115, 22845, 796, 17635, 198, 198, 2257, 17534, 62, 26288, 5446, 2640, 796, 685, 198, 220, 220, 220, 366, 33103, 12, 17, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 22, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 940, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 24689, 12, 24, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2091, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2682, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2327, 1600, 198, 220, 220, 220, 366, 6783, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 22, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 1507, 3023, 1600, 198, 220, 220, 220, 366, 32230, 12, 15724, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 198, 47, 56, 17, 62, 9148, 8120, 45849, 796, 685, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 940, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2091, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2682, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2327, 1600, 198, 220, 220, 220, 366, 6783, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1600, 198, 220, 220, 220, 366, 44813, 1904, 12, 1314, 1600, 198, 220, 220, 220, 366, 44813, 1904, 12, 83, 10344, 39054, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 23, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 15724, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 198, 9148, 8120, 45849, 62, 23924, 796, 685, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2091, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2682, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2327, 1600, 198, 220, 220, 220, 366, 44813, 1904, 12, 83, 10344, 39054, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 15724, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 198, 9148, 8120, 45849, 62, 6200, 16, 796, 685, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 198, 9148, 8120, 45849, 62, 6200, 16, 62, 15, 796, 685, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 6783, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 198, 9148, 8120, 45849, 62, 6200, 17, 62, 15, 796, 685, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1600, 198, 220, 220, 220, 366, 6783, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1600, 198, 60, 198, 198, 50, 31429, 62, 11473, 1565, 3398, 1546, 796, 685, 198, 220, 220, 220, 366, 23924, 1600, 198, 220, 220, 220, 366, 6200, 16, 1600, 198, 220, 220, 220, 366, 6200, 16, 12, 15, 1600, 198, 220, 220, 220, 366, 6200, 17, 1600, 198, 220, 220, 220, 366, 6200, 17, 12, 15, 1600, 198, 220, 220, 220, 366, 9866, 1600, 198, 220, 220, 220, 366, 42861, 1600, 198, 60, 198, 198, 11473, 1565, 3398, 62, 26288, 31519, 62, 45, 29559, 796, 1391, 198, 220, 220, 220, 366, 23924, 1298, 366, 85, 23924, 1600, 198, 220, 220, 220, 366, 6200, 16, 1298, 366, 85, 6200, 16, 1600, 198, 220, 220, 220, 366, 6200, 16, 12, 15, 1298, 366, 85, 6200, 16, 13, 15, 1600, 198, 220, 220, 220, 366, 6200, 17, 1298, 366, 85, 6200, 17, 1600, 198, 220, 220, 220, 366, 6200, 17, 12, 15, 1298, 366, 85, 6200, 17, 13, 15, 1600, 198, 220, 220, 220, 366, 9866, 1298, 366, 18254, 1600, 198, 220, 220, 220, 366, 42861, 1298, 366, 39478, 1600, 198, 92, 198, 198, 2257, 17534, 62, 11473, 1565, 3398, 62, 9148, 8120, 45849, 796, 17635, 198, 198, 43, 1404, 6465, 62, 40492, 38, 62, 9148, 8120, 45849, 796, 17635, 198, 198, 26288, 5446, 46, 62, 26288, 31519, 62, 45, 29559, 796, 1391, 198, 220, 220, 220, 366, 282, 7617, 259, 2821, 12, 23, 1298, 366, 2348, 2611, 19314, 807, 1600, 198, 220, 220, 220, 366, 33103, 12, 17, 1298, 366, 24888, 362, 1600, 198, 220, 220, 220, 366, 998, 1298, 366, 19895, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 22, 1298, 366, 19085, 2640, 767, 1600, 198, 220, 220, 220, 366, 1087, 418, 12, 23, 1298, 366, 19085, 2640, 807, 1600, 198, 220, 220, 220, 366, 24689, 12, 940, 1298, 366, 16587, 666, 838, 1600, 198, 220, 220, 220, 366, 24689, 12, 1157, 1298, 366, 16587, 666, 1367, 1600, 198, 220, 220, 220, 366, 24689, 12, 24, 1298, 366, 16587, 666, 860, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2091, 1298, 366, 42268, 5799, 4747, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2682, 1298, 366, 42268, 5799, 4974, 1600, 198, 220, 220, 220, 366, 19082, 5799, 12, 2327, 1298, 366, 42268, 5799, 3439, 1600, 198, 220, 220, 220, 366, 6783, 2238, 1298, 366, 38, 298, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1298, 366, 38, 298, 2238, 357, 10057, 67, 42501, 198, 220, 220, 220, 366, 44813, 1904, 12, 1314, 1298, 366, 18257, 641, 1904, 1315, 1600, 198, 220, 220, 220, 366, 44813, 1904, 12, 83, 10344, 39054, 1298, 366, 18257, 641, 1904, 309, 10344, 39054, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 22, 1298, 366, 48625, 7020, 767, 1600, 198, 220, 220, 220, 366, 273, 6008, 23289, 12, 23, 1298, 366, 48625, 7020, 807, 1600, 198, 220, 220, 220, 366, 10823, 2645, 259, 2821, 12, 23, 1298, 366, 19665, 88, 7020, 807, 1600, 198, 220, 220, 220, 366, 32230, 12, 1507, 3023, 1298, 366, 36609, 11157, 1248, 13, 3023, 1600, 198, 220, 220, 220, 366, 32230, 12, 15724, 1298, 366, 36609, 11157, 1160, 13, 3023, 1600, 198, 220, 220, 220, 366, 32230, 12, 17, 13464, 1298, 366, 36609, 11157, 2310, 13, 3023, 1600, 198, 92, 198, 198, 34694, 12425, 62, 7206, 38865, 796, 1160, 198, 34694, 12425, 62, 41983, 49, 42538, 796, 1391, 198, 220, 220, 220, 366, 6783, 2238, 1298, 4101, 11, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1298, 4101, 11, 198, 92, 198, 11473, 1565, 3398, 62, 1340, 11319, 62, 41983, 49, 42538, 796, 685, 198, 220, 220, 220, 366, 6783, 2238, 1600, 198, 220, 220, 220, 366, 6783, 2238, 12, 10057, 67, 1600, 198, 60, 628, 198, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 220, 7716, 62, 9288, 62, 43863, 3419, 198 ]
1.901078
1,577
# -*- coding: utf-8 -*- # This code is part of Qiskit. # # (C) Copyright IBM Corp. 2017 and later. # # This code is licensed under the Apache License, Version 2.0. You may # obtain a copy of this license in the LICENSE.txt file in the root directory # of this source tree or at http://www.apache.org/licenses/LICENSE-2.0. # # Any modifications or derivative works of this code must retain this # copyright notice, and modified files need to carry a notice indicating # that they have been altered from the originals. """ The Shor's Factoring algorithm. """ import math import array import fractions import logging import numpy as np from qiskit import ClassicalRegister, QuantumCircuit, QuantumRegister from qiskit.aqua.utils.arithmetic import is_power from qiskit.aqua import AquaError, Pluggable from qiskit.aqua.utils import get_subsystem_density_matrix from qiskit.aqua.algorithms import QuantumAlgorithm from qiskit.aqua.circuits import FourierTransformCircuits as ftc from qiskit.aqua.circuits.gates import mcu1 from qiskit.aqua.utils import summarize_circuits logger = logging.getLogger(__name__) class Shor(QuantumAlgorithm): """ The Shor's Factoring algorithm. Adapted from https://github.com/ttlion/ShorAlgQiskit """ PROP_N = 'N' PROP_A = 'a' CONFIGURATION = { 'name': 'Shor', 'description': "The Shor's Factoring Algorithm", 'input_schema': { '$schema': 'http://json-schema.org/schema#', 'id': 'shor_schema', 'type': 'object', 'properties': { PROP_N: { 'type': 'integer', 'default': 15, 'minimum': 3 }, PROP_A: { 'type': 'integer', 'default': 2, 'minimum': 2 }, }, 'additionalProperties': False }, 'problems': ['factoring'], } def __init__(self, N=15, a=2): """ Constructor. Args: N (int): The integer to be factored. a (int): A random integer a that satisfies a < N and gcd(a, N) = 1 """ self.validate(locals()) super().__init__() # check the input integer if N < 1 or N % 2 == 0: raise AquaError('The input needs to be an odd integer greater than 1.') self._N = N if a >= N or math.gcd(a, self._N) != 1: raise AquaError('The integer a needs to satisfy a < N and gcd(a, N) = 1.') self._a = a self._ret = {'factors': []} # check if the input integer is a power tf, b, p = is_power(N, return_decomposition=True) if tf: logger.info('The input integer is a power: {}={}^{}.'.format(N, b, p)) self._ret['factors'].append(b) @classmethod def init_params(cls, params, algo_input): """ Initialize via parameters dictionary and algorithm input instance. Args: params: parameters dictionary algo_input: input instance """ if algo_input is not None: raise AquaError("Input instance not supported.") shor_params = params.get(Pluggable.SECTION_KEY_ALGORITHM) N = shor_params.get(Shor.PROP_N) return cls(N) def _get_angles(self, a): """ Calculate the array of angles to be used in the addition in Fourier Space """ s = bin(int(a))[2:].zfill(self._n + 1) angles = np.zeros([self._n + 1]) for i in range(0, self._n + 1): for j in range(i, self._n + 1): if s[j] == '1': angles[self._n - i] += math.pow(2, -(j - i)) angles[self._n - i] *= np.pi return angles def _phi_add(self, circuit, q, inverse=False): """ Creation of the circuit that performs addition by a in Fourier Space Can also be used for subtraction by setting the parameter inverse=True """ angle = self._get_angles(self._N) for i in range(0, self._n + 1): circuit.u1(-angle[i] if inverse else angle[i], q[i]) def _controlled_phi_add(self, circuit, q, ctl, inverse=False): """ Single controlled version of the _phi_add circuit """ angles = self._get_angles(self._N) for i in range(0, self._n + 1): angle = (-angles[i] if inverse else angles[i]) / 2 circuit.u1(angle, ctl) circuit.cx(ctl, q[i]) circuit.u1(-angle, q[i]) circuit.cx(ctl, q[i]) circuit.u1(angle, q[i]) def _controlled_controlled_phi_add(self, circuit, q, ctl1, ctl2, a, inverse=False): """ Doubly controlled version of the _phi_add circuit """ angle = self._get_angles(a) for i in range(self._n + 1): # ccphase(circuit, -angle[i] if inverse else angle[i], ctl1, ctl2, q[i]) circuit.mcu1(-angle[i] if inverse else angle[i], [ctl1, ctl2], q[i]) def _controlled_controlled_phi_add_mod_N(self, circuit, q, ctl1, ctl2, aux, a): """ Circuit that implements doubly controlled modular addition by a """ self._controlled_controlled_phi_add(circuit, q, ctl1, ctl2, a) self._phi_add(circuit, q, inverse=True) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False, inverse=True ) circuit.cx(q[self._n], aux) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False ) self._controlled_phi_add(circuit, q, aux) self._controlled_controlled_phi_add(circuit, q, ctl1, ctl2, a, inverse=True) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False, inverse=True ) circuit.u3(np.pi, 0, np.pi, q[self._n]) circuit.cx(q[self._n], aux) circuit.u3(np.pi, 0, np.pi, q[self._n]) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False ) self._controlled_controlled_phi_add(circuit, q, ctl1, ctl2, a) def _controlled_controlled_phi_add_mod_N_inv(self, circuit, q, ctl1, ctl2, aux, a): """ Circuit that implements the inverse of doubly controlled modular addition by a """ self._controlled_controlled_phi_add(circuit, q, ctl1, ctl2, a, inverse=True) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False, inverse=True ) circuit.u3(np.pi, 0, np.pi, q[self._n]) circuit.cx(q[self._n], aux) circuit.u3(np.pi, 0, np.pi, q[self._n]) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False ) self._controlled_controlled_phi_add(circuit, q, ctl1, ctl2, a) self._controlled_phi_add(circuit, q, aux, inverse=True) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False, inverse=True ) circuit.cx(q[self._n], aux) ftc.construct_circuit( circuit=circuit, qubits=[q[i] for i in reversed(range(self._n + 1))], do_swaps=False ) self._phi_add(circuit, q) self._controlled_controlled_phi_add(circuit, q, ctl1, ctl2, a, inverse=True) def _controlled_multiple_mod_N(self, circuit, ctl, q, aux, a): """ Circuit that implements single controlled modular multiplication by a """ ftc.construct_circuit( circuit=circuit, qubits=[aux[i] for i in reversed(range(self._n + 1))], do_swaps=False ) for i in range(0, self._n): self._controlled_controlled_phi_add_mod_N( circuit, aux, q[i], ctl, aux[self._n + 1], (2 ** i) * a % self._N ) ftc.construct_circuit( circuit=circuit, qubits=[aux[i] for i in reversed(range(self._n + 1))], do_swaps=False, inverse=True ) for i in range(0, self._n): circuit.cswap(ctl, q[i], aux[i]) a_inv = modinv(a, self._N) ftc.construct_circuit( circuit=circuit, qubits=[aux[i] for i in reversed(range(self._n + 1))], do_swaps=False ) for i in reversed(range(self._n)): self._controlled_controlled_phi_add_mod_N_inv( circuit, aux, q[i], ctl, aux[self._n + 1], math.pow(2, i) * a_inv % self._N ) ftc.construct_circuit( circuit=circuit, qubits=[aux[i] for i in reversed(range(self._n + 1))], do_swaps=False, inverse=True ) def construct_circuit(self): """Construct circuit. Returns: QuantumCircuit: quantum circuit. """ # Get n value used in Shor's algorithm, to know how many qubits are used self._n = math.ceil(math.log(self._N, 2)) # quantum register where the sequential QFT is performed self._up_qreg = QuantumRegister(2 * self._n, name='up') # quantum register where the multiplications are made self._down_qreg = QuantumRegister(self._n, name='down') # auxilliary quantum register used in addition and multiplication self._aux_qreg = QuantumRegister(self._n + 2, name='aux') # Create Quantum Circuit circuit = QuantumCircuit(self._up_qreg, self._down_qreg, self._aux_qreg) # Initialize down register to 1 and create maximal superposition in top register circuit.u2(0, np.pi, self._up_qreg) circuit.u3(np.pi, 0, np.pi, self._down_qreg[0]) # Apply the multiplication gates as showed in the report in order to create the exponentiation for i in range(0, 2 * self._n): self._controlled_multiple_mod_N( circuit, self._up_qreg[i], self._down_qreg, self._aux_qreg, int(pow(self._a, pow(2, i))) ) # Apply inverse QFT ftc.construct_circuit(circuit=circuit, qubits=self._up_qreg, do_swaps=True, inverse=True) logger.info(summarize_circuits(circuit)) return circuit def _get_factors(self, output_desired, t_upper): """ Apply the continued fractions to find r and the gcd to find the desired factors. """ x_value = int(output_desired, 2) logger.info('In decimal, x_final value for this result is: {0}.'.format(x_value)) if x_value <= 0: self._ret['results'][output_desired] = 'x_value is <= 0, there are no continued fractions.' return False logger.debug('Running continued fractions for this case.') # Calculate T and x/T T = pow(2, t_upper) x_over_T = x_value / T # Cycle in which each iteration corresponds to putting one more term in the # calculation of the Continued Fraction (CF) of x/T # Initialize the first values according to CF rule i = 0 b = array.array('i') t = array.array('f') b.append(math.floor(x_over_T)) t.append(x_over_T - b[i]) while i >= 0: # From the 2nd iteration onwards, calculate the new terms of the CF based # on the previous terms as the rule suggests if i > 0: b.append(math.floor(1 / t[i - 1])) t.append((1 / t[i - 1]) - b[i]) # Calculate the CF using the known terms aux = 0 j = i while j > 0: aux = 1 / (b[j] + aux) j = j - 1 aux = aux + b[0] # Get the denominator from the value obtained frac = fractions.Fraction(aux).limit_denominator() denominator = frac.denominator logger.debug('Approximation number {0} of continued fractions:'.format(i + 1)) logger.debug("Numerator:{0} \t\t Denominator: {1}.".format(frac.numerator, frac.denominator)) # Increment i for next iteration i = i + 1 if denominator % 2 == 1: if i >= self._N: self._ret['results'][output_desired] = 'unable to find factors after too many attempts.' return False logger.debug('Odd denominator, will try next iteration of continued fractions.') continue # If denominator even, try to get factors of N # Get the exponential a^(r/2) exponential = 0 if denominator < 1000: exponential = pow(self._a, denominator / 2) # Check if the value is too big or not if math.isinf(exponential) or exponential > 1000000000: self._ret['results'][output_desired] = 'denominator of continued fraction is too big.' return False # If the value is not to big (infinity), then get the right values and do the proper gcd() putting_plus = int(exponential + 1) putting_minus = int(exponential - 1) one_factor = math.gcd(putting_plus, self._N) other_factor = math.gcd(putting_minus, self._N) # Check if the factors found are trivial factors or are the desired factors if one_factor == 1 or one_factor == self._N or other_factor == 1 or other_factor == self._N: logger.debug('Found just trivial factors, not good enough.') # Check if the number has already been found, use i-1 because i was already incremented if t[i - 1] == 0: self._ret['results'][output_desired] = 'the continued fractions found exactly x_final/(2^(2n)).' return False if i >= self._N: self._ret['results'][output_desired] = 'unable to find factors after too many attempts.' return False else: logger.debug('The factors of {0} are {1} and {2}.'.format(self._N, one_factor, other_factor)) logger.debug('Found the desired factors.') self._ret['results'][output_desired] = (one_factor, other_factor) factors = sorted((one_factor, other_factor)) if factors not in self._ret['factors']: self._ret['factors'].append(factors) return True
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 198, 2, 770, 2438, 318, 636, 286, 1195, 1984, 270, 13, 198, 2, 198, 2, 357, 34, 8, 15069, 19764, 11421, 13, 2177, 290, 1568, 13, 198, 2, 198, 2, 770, 2438, 318, 11971, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 13, 921, 743, 198, 2, 7330, 257, 4866, 286, 428, 5964, 287, 262, 38559, 24290, 13, 14116, 2393, 287, 262, 6808, 8619, 198, 2, 286, 428, 2723, 5509, 393, 379, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 13, 198, 2, 198, 2, 4377, 19008, 393, 27255, 2499, 286, 428, 2438, 1276, 12377, 428, 198, 2, 6634, 4003, 11, 290, 9518, 3696, 761, 284, 3283, 257, 4003, 12739, 198, 2, 326, 484, 423, 587, 14294, 422, 262, 47324, 13, 198, 37811, 198, 464, 911, 273, 338, 19020, 3255, 11862, 13, 198, 37811, 198, 198, 11748, 10688, 198, 11748, 7177, 198, 11748, 49876, 198, 11748, 18931, 198, 11748, 299, 32152, 355, 45941, 198, 198, 6738, 10662, 1984, 270, 1330, 43680, 38804, 11, 29082, 31560, 5013, 11, 29082, 38804, 198, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 13, 26791, 13, 283, 29848, 1330, 318, 62, 6477, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 1330, 24838, 12331, 11, 1345, 6837, 540, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 13, 26791, 1330, 651, 62, 7266, 10057, 62, 43337, 62, 6759, 8609, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 13, 282, 7727, 907, 1330, 29082, 2348, 42289, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 13, 21170, 15379, 1330, 34296, 5277, 41762, 31560, 15379, 355, 10117, 66, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 13, 21170, 15379, 13, 70, 689, 1330, 285, 27399, 16, 198, 6738, 10662, 1984, 270, 13, 36129, 64, 13, 26791, 1330, 35743, 62, 21170, 15379, 628, 198, 6404, 1362, 796, 18931, 13, 1136, 11187, 1362, 7, 834, 3672, 834, 8, 628, 198, 4871, 911, 273, 7, 24915, 388, 2348, 42289, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 383, 911, 273, 338, 19020, 3255, 11862, 13, 628, 220, 220, 220, 30019, 276, 422, 3740, 1378, 12567, 13, 785, 14, 926, 75, 295, 14, 2484, 273, 2348, 70, 48, 1984, 270, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 4810, 3185, 62, 45, 796, 705, 45, 6, 198, 220, 220, 220, 4810, 3185, 62, 32, 796, 705, 64, 6, 628, 220, 220, 220, 25626, 4261, 6234, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 3672, 10354, 705, 2484, 273, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 11213, 10354, 366, 464, 911, 273, 338, 19020, 3255, 978, 42289, 1600, 198, 220, 220, 220, 220, 220, 220, 220, 705, 15414, 62, 15952, 2611, 10354, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 3, 15952, 2611, 10354, 705, 4023, 1378, 17752, 12, 15952, 2611, 13, 2398, 14, 15952, 2611, 2, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 312, 10354, 705, 1477, 273, 62, 15952, 2611, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 705, 15252, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 48310, 10354, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4810, 3185, 62, 45, 25, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 705, 41433, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 12286, 10354, 1315, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39504, 10354, 513, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4810, 3185, 62, 32, 25, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 10354, 705, 41433, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 12286, 10354, 362, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 39504, 10354, 362, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 2860, 1859, 2964, 18200, 10354, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 8964, 198, 220, 220, 220, 220, 220, 220, 220, 705, 1676, 22143, 10354, 37250, 22584, 3255, 6, 4357, 198, 220, 220, 220, 1782, 628, 220, 220, 220, 825, 11593, 15003, 834, 7, 944, 11, 399, 28, 1314, 11, 257, 28, 17, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 28407, 273, 13, 628, 220, 220, 220, 220, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 399, 357, 600, 2599, 383, 18253, 284, 307, 1109, 1850, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 257, 357, 600, 2599, 317, 4738, 18253, 257, 326, 45104, 257, 1279, 399, 290, 308, 10210, 7, 64, 11, 399, 8, 796, 352, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 12102, 378, 7, 17946, 874, 28955, 198, 220, 220, 220, 220, 220, 220, 220, 2208, 22446, 834, 15003, 834, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 2198, 262, 5128, 18253, 198, 220, 220, 220, 220, 220, 220, 220, 611, 399, 1279, 352, 393, 399, 4064, 362, 6624, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 24838, 12331, 10786, 464, 5128, 2476, 284, 307, 281, 5629, 18253, 3744, 621, 352, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 45, 796, 399, 628, 220, 220, 220, 220, 220, 220, 220, 611, 257, 18189, 399, 393, 10688, 13, 70, 10210, 7, 64, 11, 2116, 13557, 45, 8, 14512, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 24838, 12331, 10786, 464, 18253, 257, 2476, 284, 15959, 257, 1279, 399, 290, 308, 10210, 7, 64, 11, 399, 8, 796, 352, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 64, 796, 257, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 796, 1391, 6, 22584, 669, 10354, 17635, 92, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 2198, 611, 262, 5128, 18253, 318, 257, 1176, 198, 220, 220, 220, 220, 220, 220, 220, 48700, 11, 275, 11, 279, 796, 318, 62, 6477, 7, 45, 11, 1441, 62, 12501, 296, 9150, 28, 17821, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 48700, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 10786, 464, 5128, 18253, 318, 257, 1176, 25, 23884, 34758, 92, 36796, 92, 2637, 13, 18982, 7, 45, 11, 275, 11, 279, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 22584, 669, 6, 4083, 33295, 7, 65, 8, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 2315, 62, 37266, 7, 565, 82, 11, 42287, 11, 435, 2188, 62, 15414, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 20768, 1096, 2884, 10007, 22155, 290, 11862, 5128, 4554, 13, 628, 220, 220, 220, 220, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 42287, 25, 10007, 22155, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 435, 2188, 62, 15414, 25, 5128, 4554, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 611, 435, 2188, 62, 15414, 318, 407, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 24838, 12331, 7203, 20560, 4554, 407, 4855, 19570, 628, 220, 220, 220, 220, 220, 220, 220, 427, 273, 62, 37266, 796, 42287, 13, 1136, 7, 3646, 6837, 540, 13, 50, 24565, 62, 20373, 62, 1847, 38, 1581, 10554, 44, 8, 198, 220, 220, 220, 220, 220, 220, 220, 399, 796, 427, 273, 62, 37266, 13, 1136, 7, 2484, 273, 13, 4805, 3185, 62, 45, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 537, 82, 7, 45, 8, 628, 220, 220, 220, 825, 4808, 1136, 62, 27787, 7, 944, 11, 257, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 27131, 378, 262, 7177, 286, 18333, 284, 307, 973, 287, 262, 3090, 287, 34296, 5277, 4687, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 264, 796, 9874, 7, 600, 7, 64, 4008, 58, 17, 25, 4083, 89, 20797, 7, 944, 13557, 77, 1343, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 18333, 796, 45941, 13, 9107, 418, 26933, 944, 13557, 77, 1343, 352, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 15, 11, 2116, 13557, 77, 1343, 352, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 474, 287, 2837, 7, 72, 11, 2116, 13557, 77, 1343, 352, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 264, 58, 73, 60, 6624, 705, 16, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18333, 58, 944, 13557, 77, 532, 1312, 60, 15853, 10688, 13, 79, 322, 7, 17, 11, 532, 7, 73, 532, 1312, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 18333, 58, 944, 13557, 77, 532, 1312, 60, 1635, 28, 45941, 13, 14415, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 18333, 628, 220, 220, 220, 825, 4808, 34846, 62, 2860, 7, 944, 11, 10349, 11, 10662, 11, 34062, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 21582, 286, 262, 10349, 326, 17706, 3090, 416, 257, 287, 34296, 5277, 4687, 198, 220, 220, 220, 220, 220, 220, 220, 1680, 635, 307, 973, 329, 13284, 7861, 416, 4634, 262, 11507, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 9848, 796, 2116, 13557, 1136, 62, 27787, 7, 944, 13557, 45, 8, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 15, 11, 2116, 13557, 77, 1343, 352, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 16, 32590, 9248, 58, 72, 60, 611, 34062, 2073, 9848, 58, 72, 4357, 10662, 58, 72, 12962, 628, 220, 220, 220, 825, 4808, 14401, 62, 34846, 62, 2860, 7, 944, 11, 10349, 11, 10662, 11, 269, 28781, 11, 34062, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 14206, 6856, 2196, 286, 262, 4808, 34846, 62, 2860, 10349, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 18333, 796, 2116, 13557, 1136, 62, 27787, 7, 944, 13557, 45, 8, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 15, 11, 2116, 13557, 77, 1343, 352, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9848, 796, 13841, 27787, 58, 72, 60, 611, 34062, 2073, 18333, 58, 72, 12962, 1220, 362, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 16, 7, 9248, 11, 269, 28781, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 87, 7, 34168, 11, 10662, 58, 72, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 16, 32590, 9248, 11, 10662, 58, 72, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 87, 7, 34168, 11, 10662, 58, 72, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 16, 7, 9248, 11, 10662, 58, 72, 12962, 628, 220, 220, 220, 825, 4808, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 944, 11, 10349, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 11, 34062, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5728, 36874, 6856, 2196, 286, 262, 4808, 34846, 62, 2860, 10349, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 9848, 796, 2116, 13557, 1136, 62, 27787, 7, 64, 8, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 944, 13557, 77, 1343, 352, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 36624, 40715, 7, 21170, 5013, 11, 532, 9248, 58, 72, 60, 611, 34062, 2073, 9848, 58, 72, 4357, 269, 28781, 16, 11, 269, 28781, 17, 11, 10662, 58, 72, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 23209, 84, 16, 32590, 9248, 58, 72, 60, 611, 34062, 2073, 9848, 58, 72, 4357, 685, 34168, 16, 11, 269, 28781, 17, 4357, 10662, 58, 72, 12962, 628, 220, 220, 220, 825, 4808, 14401, 62, 14401, 62, 34846, 62, 2860, 62, 4666, 62, 45, 7, 944, 11, 10349, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 27506, 11, 257, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 13588, 326, 23986, 3385, 306, 6856, 26507, 3090, 416, 257, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 34062, 28, 17821, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 87, 7, 80, 58, 944, 13557, 77, 4357, 27506, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 27506, 8, 628, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 11, 34062, 28, 17821, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 18, 7, 37659, 13, 14415, 11, 657, 11, 45941, 13, 14415, 11, 10662, 58, 944, 13557, 77, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 87, 7, 80, 58, 944, 13557, 77, 4357, 27506, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 18, 7, 37659, 13, 14415, 11, 657, 11, 45941, 13, 14415, 11, 10662, 58, 944, 13557, 77, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 8, 628, 220, 220, 220, 825, 4808, 14401, 62, 14401, 62, 34846, 62, 2860, 62, 4666, 62, 45, 62, 16340, 7, 944, 11, 10349, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 27506, 11, 257, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 13588, 326, 23986, 262, 34062, 286, 3385, 306, 6856, 26507, 3090, 416, 257, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 11, 34062, 28, 17821, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 18, 7, 37659, 13, 14415, 11, 657, 11, 45941, 13, 14415, 11, 10662, 58, 944, 13557, 77, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 87, 7, 80, 58, 944, 13557, 77, 4357, 27506, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 18, 7, 37659, 13, 14415, 11, 657, 11, 45941, 13, 14415, 11, 10662, 58, 944, 13557, 77, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 27506, 11, 34062, 28, 17821, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 87, 7, 80, 58, 944, 13557, 77, 4357, 27506, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 80, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 7, 21170, 5013, 11, 10662, 11, 269, 28781, 16, 11, 269, 28781, 17, 11, 257, 11, 34062, 28, 17821, 8, 628, 220, 220, 220, 825, 4808, 14401, 62, 48101, 62, 4666, 62, 45, 7, 944, 11, 10349, 11, 269, 28781, 11, 10662, 11, 27506, 11, 257, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 13588, 326, 23986, 2060, 6856, 26507, 48473, 416, 257, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 14644, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 15, 11, 2116, 13557, 77, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 62, 4666, 62, 45, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10662, 58, 72, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 28781, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 58, 944, 13557, 77, 1343, 352, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 357, 17, 12429, 1312, 8, 1635, 257, 4064, 2116, 13557, 45, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 14644, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 15, 11, 2116, 13557, 77, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 66, 2032, 499, 7, 34168, 11, 10662, 58, 72, 4357, 27506, 58, 72, 12962, 628, 220, 220, 220, 220, 220, 220, 220, 257, 62, 16340, 796, 953, 16340, 7, 64, 11, 2116, 13557, 45, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 14644, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 14401, 62, 34846, 62, 2860, 62, 4666, 62, 45, 62, 16340, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10662, 58, 72, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 269, 28781, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 58, 944, 13557, 77, 1343, 352, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10688, 13, 79, 322, 7, 17, 11, 1312, 8, 1635, 257, 62, 16340, 4064, 2116, 13557, 45, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 28, 21170, 5013, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 627, 9895, 41888, 14644, 58, 72, 60, 329, 1312, 287, 17687, 7, 9521, 7, 944, 13557, 77, 1343, 352, 4008, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 466, 62, 2032, 1686, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34062, 28, 17821, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 825, 5678, 62, 21170, 5013, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 42316, 10349, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 29082, 31560, 5013, 25, 14821, 10349, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 3497, 299, 1988, 973, 287, 911, 273, 338, 11862, 11, 284, 760, 703, 867, 627, 9895, 389, 973, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 77, 796, 10688, 13, 344, 346, 7, 11018, 13, 6404, 7, 944, 13557, 45, 11, 362, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 14821, 7881, 810, 262, 35582, 1195, 9792, 318, 6157, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 929, 62, 80, 2301, 796, 29082, 38804, 7, 17, 1635, 2116, 13557, 77, 11, 1438, 11639, 929, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 14821, 7881, 810, 262, 15082, 3736, 389, 925, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 2902, 62, 80, 2301, 796, 29082, 38804, 7, 944, 13557, 77, 11, 1438, 11639, 2902, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 27506, 359, 8042, 14821, 7881, 973, 287, 3090, 290, 48473, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14644, 62, 80, 2301, 796, 29082, 38804, 7, 944, 13557, 77, 1343, 362, 11, 1438, 11639, 14644, 11537, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 13610, 29082, 13588, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 796, 29082, 31560, 5013, 7, 944, 13557, 929, 62, 80, 2301, 11, 2116, 13557, 2902, 62, 80, 2301, 11, 2116, 13557, 14644, 62, 80, 2301, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 20768, 1096, 866, 7881, 284, 352, 290, 2251, 40708, 2208, 9150, 287, 1353, 7881, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 17, 7, 15, 11, 45941, 13, 14415, 11, 2116, 13557, 929, 62, 80, 2301, 8, 198, 220, 220, 220, 220, 220, 220, 220, 10349, 13, 84, 18, 7, 37659, 13, 14415, 11, 657, 11, 45941, 13, 14415, 11, 2116, 13557, 2902, 62, 80, 2301, 58, 15, 12962, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 27967, 262, 48473, 17435, 355, 3751, 287, 262, 989, 287, 1502, 284, 2251, 262, 28622, 3920, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 15, 11, 362, 1635, 2116, 13557, 77, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14401, 62, 48101, 62, 4666, 62, 45, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10349, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 929, 62, 80, 2301, 58, 72, 4357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 2902, 62, 80, 2301, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 14644, 62, 80, 2301, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 493, 7, 79, 322, 7, 944, 13557, 64, 11, 7182, 7, 17, 11, 1312, 22305, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 27967, 34062, 1195, 9792, 198, 220, 220, 220, 220, 220, 220, 220, 10117, 66, 13, 41571, 62, 21170, 5013, 7, 21170, 5013, 28, 21170, 5013, 11, 627, 9895, 28, 944, 13557, 929, 62, 80, 2301, 11, 466, 62, 2032, 1686, 28, 17821, 11, 34062, 28, 17821, 8, 628, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 7, 16345, 3876, 1096, 62, 21170, 15379, 7, 21170, 5013, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 10349, 628, 220, 220, 220, 825, 4808, 1136, 62, 22584, 669, 7, 944, 11, 5072, 62, 8906, 1202, 11, 256, 62, 45828, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 27967, 262, 3767, 49876, 284, 1064, 374, 290, 262, 308, 10210, 284, 1064, 262, 10348, 5087, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2124, 62, 8367, 796, 493, 7, 22915, 62, 8906, 1202, 11, 362, 8, 198, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 10951, 10786, 818, 32465, 11, 2124, 62, 20311, 1988, 329, 428, 1255, 318, 25, 1391, 15, 92, 2637, 13, 18982, 7, 87, 62, 8367, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 611, 2124, 62, 8367, 19841, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 43420, 6, 7131, 22915, 62, 8906, 1202, 60, 796, 705, 87, 62, 8367, 318, 19841, 657, 11, 612, 389, 645, 3767, 49876, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 10352, 628, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 10786, 28768, 3767, 49876, 329, 428, 1339, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 27131, 378, 309, 290, 2124, 14, 51, 198, 220, 220, 220, 220, 220, 220, 220, 309, 796, 7182, 7, 17, 11, 256, 62, 45828, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2124, 62, 2502, 62, 51, 796, 2124, 62, 8367, 1220, 309, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 26993, 287, 543, 1123, 24415, 24866, 284, 5137, 530, 517, 3381, 287, 262, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 17952, 286, 262, 22168, 376, 7861, 357, 22495, 8, 286, 2124, 14, 51, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 20768, 1096, 262, 717, 3815, 1864, 284, 18551, 3896, 198, 220, 220, 220, 220, 220, 220, 220, 1312, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 275, 796, 7177, 13, 18747, 10786, 72, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 256, 796, 7177, 13, 18747, 10786, 69, 11537, 628, 220, 220, 220, 220, 220, 220, 220, 275, 13, 33295, 7, 11018, 13, 28300, 7, 87, 62, 2502, 62, 51, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 256, 13, 33295, 7, 87, 62, 2502, 62, 51, 532, 275, 58, 72, 12962, 628, 220, 220, 220, 220, 220, 220, 220, 981, 1312, 18189, 657, 25, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3574, 262, 362, 358, 24415, 31719, 11, 15284, 262, 649, 2846, 286, 262, 18551, 1912, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 319, 262, 2180, 2846, 355, 262, 3896, 5644, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1312, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 275, 13, 33295, 7, 11018, 13, 28300, 7, 16, 1220, 256, 58, 72, 532, 352, 60, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 256, 13, 33295, 19510, 16, 1220, 256, 58, 72, 532, 352, 12962, 532, 275, 58, 72, 12962, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 27131, 378, 262, 18551, 1262, 262, 1900, 2846, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 474, 796, 1312, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 981, 474, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 796, 352, 1220, 357, 65, 58, 73, 60, 1343, 27506, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 474, 796, 474, 532, 352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27506, 796, 27506, 1343, 275, 58, 15, 60, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3497, 262, 31457, 1352, 422, 262, 1988, 6492, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1216, 330, 796, 49876, 13, 37, 7861, 7, 14644, 737, 32374, 62, 6559, 6351, 1352, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 31457, 1352, 796, 1216, 330, 13, 6559, 6351, 1352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 10786, 4677, 13907, 18991, 1271, 1391, 15, 92, 286, 3767, 49876, 25, 4458, 18982, 7, 72, 1343, 352, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 7203, 45, 6975, 1352, 29164, 15, 92, 3467, 83, 59, 83, 5601, 6351, 1352, 25, 1391, 16, 92, 526, 13, 18982, 7, 31944, 13, 77, 6975, 1352, 11, 1216, 330, 13, 6559, 6351, 1352, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 10791, 434, 1312, 329, 1306, 24415, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 796, 1312, 1343, 352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 31457, 1352, 4064, 362, 6624, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1312, 18189, 2116, 13557, 45, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 43420, 6, 7131, 22915, 62, 8906, 1202, 60, 796, 705, 403, 540, 284, 1064, 5087, 706, 1165, 867, 6370, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 10786, 46, 1860, 31457, 1352, 11, 481, 1949, 1306, 24415, 286, 3767, 49876, 2637, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1002, 31457, 1352, 772, 11, 1949, 284, 651, 5087, 286, 399, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 3497, 262, 39682, 257, 61, 7, 81, 14, 17, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 39682, 796, 657, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 31457, 1352, 1279, 8576, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 39682, 796, 7182, 7, 944, 13557, 64, 11, 31457, 1352, 1220, 362, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 6822, 611, 262, 1988, 318, 1165, 1263, 393, 407, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 10688, 13, 271, 10745, 7, 11201, 35470, 8, 393, 39682, 1875, 1802, 24598, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 43420, 6, 7131, 22915, 62, 8906, 1202, 60, 796, 705, 6559, 6351, 1352, 286, 3767, 13390, 318, 1165, 1263, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 10352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 1002, 262, 1988, 318, 407, 284, 1263, 357, 10745, 6269, 828, 788, 651, 262, 826, 3815, 290, 466, 262, 1774, 308, 10210, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5137, 62, 9541, 796, 493, 7, 11201, 35470, 1343, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5137, 62, 40191, 796, 493, 7, 11201, 35470, 532, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 530, 62, 31412, 796, 10688, 13, 70, 10210, 7, 1996, 889, 62, 9541, 11, 2116, 13557, 45, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 584, 62, 31412, 796, 10688, 13, 70, 10210, 7, 1996, 889, 62, 40191, 11, 2116, 13557, 45, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 6822, 611, 262, 5087, 1043, 389, 20861, 5087, 393, 389, 262, 10348, 5087, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 530, 62, 31412, 6624, 352, 393, 530, 62, 31412, 6624, 2116, 13557, 45, 393, 584, 62, 31412, 6624, 352, 393, 584, 62, 31412, 6624, 2116, 13557, 45, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 10786, 21077, 655, 20861, 5087, 11, 407, 922, 1576, 2637, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 6822, 611, 262, 1271, 468, 1541, 587, 1043, 11, 779, 1312, 12, 16, 780, 1312, 373, 1541, 1253, 12061, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 256, 58, 72, 532, 352, 60, 6624, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 43420, 6, 7131, 22915, 62, 8906, 1202, 60, 796, 705, 1169, 3767, 49876, 1043, 3446, 2124, 62, 20311, 29006, 17, 61, 7, 17, 77, 29720, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 1312, 18189, 2116, 13557, 45, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 43420, 6, 7131, 22915, 62, 8906, 1202, 60, 796, 705, 403, 540, 284, 1064, 5087, 706, 1165, 867, 6370, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 10352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 10786, 464, 5087, 286, 1391, 15, 92, 389, 1391, 16, 92, 290, 1391, 17, 92, 2637, 13, 18982, 7, 944, 13557, 45, 11, 530, 62, 31412, 11, 584, 62, 31412, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 49706, 13, 24442, 10786, 21077, 262, 10348, 5087, 2637, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 43420, 6, 7131, 22915, 62, 8906, 1202, 60, 796, 357, 505, 62, 31412, 11, 584, 62, 31412, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5087, 796, 23243, 19510, 505, 62, 31412, 11, 584, 62, 31412, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 5087, 407, 287, 2116, 13557, 1186, 17816, 22584, 669, 6, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 1186, 17816, 22584, 669, 6, 4083, 33295, 7, 22584, 669, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 6407, 198 ]
2.070417
7,342
import re import bz2 import pygame import public import sprites import functions import dictionaries import random # :^)
[ 11748, 302, 198, 11748, 275, 89, 17, 198, 11748, 12972, 6057, 198, 11748, 1171, 198, 11748, 42866, 198, 11748, 5499, 198, 11748, 48589, 3166, 198, 11748, 4738, 628, 628, 198, 2, 1058, 61, 8, 198 ]
3.571429
35
# -*- coding: utf-8 -*- """ Reads an `html` formatted table. """ import numpy as np from bs4 import BeautifulSoup import requests from selenium import webdriver from selenium.webdriver.firefox.options import Options as FirefoxOptions from selenium.webdriver.chrome.options import Options as ChromeOptions from selenium.webdriver.edge.options import Options as EdgeOptions from selenium.webdriver.ie.options import Options as IeOptions import copy import logging from tabledataextractor.exceptions import InputError log = logging.getLogger(__name__) def makearray(html_table): """ Creates a numpy array from an `.html` file, taking `rowspan` and `colspan` into account. Modified from: John Ricco, https://johnricco.github.io/2017/04/04/python-html/, *Using Python to scrape HTML tables with merged cells* Added functionality for duplicating cell content for cells with `rowspan`/`colspan`. The table has to be :math:`n*m`, rectangular, with the same number of columns in every row. """ n_cols = 0 n_rows = 0 for row in html_table.findAll("tr"): col_tags = row.find_all(["td", "th"]) if len(col_tags) > 0: n_rows += 1 if len(col_tags) > n_cols: n_cols = len(col_tags) # according to numpy documentation fill_value should be of type Union[int, float, complex] # however, 'str' works just fine array = np.full((n_rows, n_cols), fill_value="", dtype='<U60') # list to store rowspan values skip_index = [0 for i in range(0, n_cols)] # iterating over each row in the table row_counter = 0 for row in html_table.findAll("tr"): # skip row if it's empty if len(row.find_all(["td", "th"])) == 0: continue else: # get all the cells containing data in this row columns = row.find_all(["td", "th"]) col_dim = [] row_dim = [] col_dim_counter = -1 row_dim_counter = -1 col_counter = -1 this_skip_index = copy.deepcopy(skip_index) for col in columns: # determine all cell dimensions colspan = col.get("colspan") if not colspan: col_dim.append(1) else: col_dim.append(int(colspan)) col_dim_counter += 1 rowspan = col.get("rowspan") if not rowspan: row_dim.append(1) else: row_dim.append(int(rowspan)) row_dim_counter += 1 # adjust column counter if col_counter == -1: col_counter = 0 else: col_counter = col_counter + col_dim[col_dim_counter - 1] while skip_index[col_counter] > 0: col_counter += 1 # get cell contents cell_data = col.get_text() # insert data into cell array[row_counter, col_counter] = cell_data # Insert data into neighbouring rowspan/colspan cells if colspan: for spanned_col in range(col_counter+1, col_counter + int(colspan)): array[row_counter, spanned_col] = cell_data if rowspan: for spanned_row in range(row_counter+1, row_counter + int(rowspan)): array[spanned_row, col_counter] = cell_data #record column skipping index if row_dim[row_dim_counter] > 1: this_skip_index[col_counter] = row_dim[row_dim_counter] # adjust row counter row_counter += 1 # adjust column skipping index skip_index = [i - 1 if i > 0 else i for i in this_skip_index] return array def read_file(file_path, table_number=1): """Reads an .html file and returns a numpy array.""" file = open(file_path, encoding='UTF-8') html_soup = BeautifulSoup(file, features='lxml') file.close() html_table = html_soup.find_all("table")[table_number-1] array = makearray(html_table) return array def configure_selenium(browser='Firefox'): """ Configuration for `Selenium <https://selenium-python.readthedocs.io/>`_. Sets the path to ``geckodriver.exe`` :param browser: Which browser to use :type browser: str :return: Selenium driver """ if browser == 'Firefox': options = FirefoxOptions() options.headless = True driver = webdriver.Firefox(options=options, executable_path=r'C:\Users\juras\System\geckodriver\geckodriver.exe') return driver else: return None def read_url(url, table_number=1): """ Reads in a table from an URL and returns a numpy array. Will try `Requests <http://docs.python-requests.org/en/master/>`_ first. If it doesn't succeed, `Selenium <https://selenium-python.readthedocs.io/>`_ will be used. :param url: Url of the page where the table is located :type url: str :param table_number: Number of Table on the web page. :type table_number: int """ if not isinstance(table_number, int): msg = 'Table number is not valid.' log.critical(msg) raise TypeError(msg) # first try the requests package, if it fails do the selenium, which is much slower try: html_file = requests.get(url) html_soup = BeautifulSoup(html_file.text, features='lxml') html_table = html_soup.find_all("table")[table_number - 1] array = makearray(html_table) log.info("Package 'requests' was used.") return array except Exception: driver = configure_selenium() driver.get(url) html_file = driver.page_source html_soup = BeautifulSoup(html_file, features='lxml') try: html_table = html_soup.find_all("table")[table_number-1] except IndexError: raise InputError("table_number={} is out of range".format(table_number)) else: array = makearray(html_table) log.info("Package 'selenium' was used.") return array
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 37811, 198, 5569, 82, 281, 4600, 6494, 63, 39559, 3084, 13, 198, 37811, 628, 198, 11748, 299, 32152, 355, 45941, 198, 6738, 275, 82, 19, 1330, 23762, 50, 10486, 198, 11748, 7007, 198, 6738, 384, 11925, 1505, 1330, 3992, 26230, 198, 6738, 384, 11925, 1505, 13, 12384, 26230, 13, 6495, 12792, 13, 25811, 1330, 18634, 355, 16802, 29046, 198, 6738, 384, 11925, 1505, 13, 12384, 26230, 13, 46659, 13, 25811, 1330, 18634, 355, 13282, 29046, 198, 6738, 384, 11925, 1505, 13, 12384, 26230, 13, 14907, 13, 25811, 1330, 18634, 355, 13113, 29046, 198, 6738, 384, 11925, 1505, 13, 12384, 26230, 13, 494, 13, 25811, 1330, 18634, 355, 314, 68, 29046, 198, 11748, 4866, 198, 11748, 18931, 198, 6738, 256, 4510, 1045, 2302, 40450, 13, 1069, 11755, 1330, 23412, 12331, 198, 198, 6404, 796, 18931, 13, 1136, 11187, 1362, 7, 834, 3672, 834, 8, 628, 198, 4299, 787, 18747, 7, 6494, 62, 11487, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 7921, 274, 257, 299, 32152, 7177, 422, 281, 4600, 13, 6494, 63, 2393, 11, 2263, 4600, 808, 12626, 63, 290, 4600, 4033, 12626, 63, 656, 1848, 13, 628, 220, 220, 220, 40499, 422, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1757, 15868, 1073, 11, 3740, 1378, 30686, 1173, 1073, 13, 12567, 13, 952, 14, 5539, 14, 3023, 14, 3023, 14, 29412, 12, 6494, 47454, 1635, 12814, 11361, 284, 42778, 11532, 8893, 351, 23791, 4778, 9, 628, 220, 220, 220, 10687, 11244, 329, 14184, 12364, 2685, 2695, 329, 4778, 351, 4600, 808, 12626, 63, 14, 63, 4033, 12626, 44646, 198, 220, 220, 220, 383, 3084, 468, 284, 307, 1058, 11018, 25, 63, 77, 9, 76, 47671, 36954, 11, 351, 262, 976, 1271, 286, 15180, 287, 790, 5752, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 299, 62, 4033, 82, 796, 657, 198, 220, 220, 220, 299, 62, 8516, 796, 657, 628, 220, 220, 220, 329, 5752, 287, 27711, 62, 11487, 13, 19796, 3237, 7203, 2213, 1, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 951, 62, 31499, 796, 5752, 13, 19796, 62, 439, 7, 14692, 8671, 1600, 366, 400, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 4033, 62, 31499, 8, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 299, 62, 8516, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 4033, 62, 31499, 8, 1875, 299, 62, 4033, 82, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 299, 62, 4033, 82, 796, 18896, 7, 4033, 62, 31499, 8, 628, 220, 220, 220, 1303, 1864, 284, 299, 32152, 10314, 6070, 62, 8367, 815, 307, 286, 2099, 4479, 58, 600, 11, 12178, 11, 3716, 60, 198, 220, 220, 220, 1303, 2158, 11, 705, 2536, 6, 2499, 655, 3734, 198, 220, 220, 220, 7177, 796, 45941, 13, 12853, 19510, 77, 62, 8516, 11, 299, 62, 4033, 82, 828, 6070, 62, 8367, 2625, 1600, 288, 4906, 11639, 27, 52, 1899, 11537, 628, 220, 220, 220, 1303, 1351, 284, 3650, 5752, 12626, 3815, 198, 220, 220, 220, 14267, 62, 9630, 796, 685, 15, 329, 1312, 287, 2837, 7, 15, 11, 299, 62, 4033, 82, 15437, 628, 220, 220, 220, 1303, 11629, 803, 625, 1123, 5752, 287, 262, 3084, 198, 220, 220, 220, 5752, 62, 24588, 796, 657, 198, 220, 220, 220, 329, 5752, 287, 27711, 62, 11487, 13, 19796, 3237, 7203, 2213, 1, 2599, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 14267, 5752, 611, 340, 338, 6565, 198, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 808, 13, 19796, 62, 439, 7, 14692, 8671, 1600, 366, 400, 8973, 4008, 6624, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 628, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 651, 477, 262, 4778, 7268, 1366, 287, 428, 5752, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15180, 796, 5752, 13, 19796, 62, 439, 7, 14692, 8671, 1600, 366, 400, 8973, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 27740, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 62, 27740, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 27740, 62, 24588, 796, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 62, 27740, 62, 24588, 796, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 24588, 796, 532, 16, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 428, 62, 48267, 62, 9630, 796, 4866, 13, 22089, 30073, 7, 48267, 62, 9630, 8, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 951, 287, 15180, 25, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 5004, 477, 2685, 15225, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 12626, 796, 951, 13, 1136, 7203, 4033, 12626, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 951, 12626, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 27740, 13, 33295, 7, 16, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 27740, 13, 33295, 7, 600, 7, 4033, 12626, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 27740, 62, 24588, 15853, 352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 12626, 796, 951, 13, 1136, 7203, 808, 12626, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 5752, 12626, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 62, 27740, 13, 33295, 7, 16, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 62, 27740, 13, 33295, 7, 600, 7, 808, 12626, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5752, 62, 27740, 62, 24588, 15853, 352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 4532, 5721, 3753, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 951, 62, 24588, 6624, 532, 16, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 24588, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 24588, 796, 951, 62, 24588, 1343, 951, 62, 27740, 58, 4033, 62, 27740, 62, 24588, 532, 352, 60, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 981, 14267, 62, 9630, 58, 4033, 62, 24588, 60, 1875, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 951, 62, 24588, 15853, 352, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 651, 2685, 10154, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2685, 62, 7890, 796, 951, 13, 1136, 62, 5239, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 7550, 1366, 656, 2685, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 808, 62, 24588, 11, 951, 62, 24588, 60, 796, 2685, 62, 7890, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 35835, 1366, 656, 29272, 5752, 12626, 14, 4033, 12626, 4778, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 951, 12626, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 599, 3577, 62, 4033, 287, 2837, 7, 4033, 62, 24588, 10, 16, 11, 951, 62, 24588, 1343, 493, 7, 4033, 12626, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 808, 62, 24588, 11, 599, 3577, 62, 4033, 60, 796, 2685, 62, 7890, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 5752, 12626, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 599, 3577, 62, 808, 287, 2837, 7, 808, 62, 24588, 10, 16, 11, 5752, 62, 24588, 1343, 493, 7, 808, 12626, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 58, 2777, 3577, 62, 808, 11, 951, 62, 24588, 60, 796, 2685, 62, 7890, 628, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 22105, 5721, 31017, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 5752, 62, 27740, 58, 808, 62, 27740, 62, 24588, 60, 1875, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 428, 62, 48267, 62, 9630, 58, 4033, 62, 24588, 60, 796, 5752, 62, 27740, 58, 808, 62, 27740, 62, 24588, 60, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 4532, 5752, 3753, 198, 220, 220, 220, 220, 220, 220, 220, 5752, 62, 24588, 15853, 352, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 4532, 5721, 31017, 6376, 198, 220, 220, 220, 220, 220, 220, 220, 14267, 62, 9630, 796, 685, 72, 532, 352, 611, 1312, 1875, 657, 2073, 1312, 329, 1312, 287, 428, 62, 48267, 62, 9630, 60, 628, 220, 220, 220, 1441, 7177, 628, 198, 4299, 1100, 62, 7753, 7, 7753, 62, 6978, 11, 3084, 62, 17618, 28, 16, 2599, 198, 220, 220, 220, 37227, 5569, 82, 281, 764, 6494, 2393, 290, 5860, 257, 299, 32152, 7177, 526, 15931, 198, 220, 220, 220, 2393, 796, 1280, 7, 7753, 62, 6978, 11, 21004, 11639, 48504, 12, 23, 11537, 198, 220, 220, 220, 27711, 62, 82, 10486, 796, 23762, 50, 10486, 7, 7753, 11, 3033, 11639, 75, 19875, 11537, 198, 220, 220, 220, 2393, 13, 19836, 3419, 198, 220, 220, 220, 27711, 62, 11487, 796, 27711, 62, 82, 10486, 13, 19796, 62, 439, 7203, 11487, 4943, 58, 11487, 62, 17618, 12, 16, 60, 198, 220, 220, 220, 7177, 796, 787, 18747, 7, 6494, 62, 11487, 8, 198, 220, 220, 220, 1441, 7177, 628, 198, 4299, 17425, 62, 741, 47477, 7, 40259, 11639, 13543, 12792, 6, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 28373, 329, 4600, 48767, 47477, 1279, 5450, 1378, 741, 47477, 12, 29412, 13, 961, 83, 704, 420, 82, 13, 952, 15913, 63, 44807, 21394, 262, 3108, 284, 7559, 469, 694, 375, 38291, 13, 13499, 15506, 628, 220, 220, 220, 1058, 17143, 6444, 25, 9022, 6444, 284, 779, 198, 220, 220, 220, 1058, 4906, 6444, 25, 965, 198, 220, 220, 220, 1058, 7783, 25, 15300, 47477, 4639, 628, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 6444, 6624, 705, 13543, 12792, 10354, 198, 220, 220, 220, 220, 220, 220, 220, 3689, 796, 16802, 29046, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 3689, 13, 2256, 1203, 796, 6407, 198, 220, 220, 220, 220, 220, 220, 220, 4639, 796, 3992, 26230, 13, 13543, 12792, 7, 25811, 28, 25811, 11, 28883, 62, 6978, 28, 81, 6, 34, 7479, 14490, 59, 73, 17786, 59, 11964, 59, 469, 694, 375, 38291, 59, 469, 694, 375, 38291, 13, 13499, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 4639, 198, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 198, 4299, 1100, 62, 6371, 7, 6371, 11, 3084, 62, 17618, 28, 16, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 4149, 82, 287, 257, 3084, 422, 281, 10289, 290, 5860, 257, 299, 32152, 7177, 13, 2561, 1949, 4600, 16844, 3558, 1279, 4023, 1378, 31628, 13, 29412, 12, 8897, 3558, 13, 2398, 14, 268, 14, 9866, 15913, 63, 62, 717, 13, 1002, 340, 1595, 470, 6758, 11, 4600, 48767, 47477, 1279, 5450, 1378, 741, 47477, 12, 29412, 13, 961, 83, 704, 420, 82, 13, 952, 15913, 63, 62, 481, 307, 973, 13, 628, 220, 220, 220, 1058, 17143, 19016, 25, 8799, 75, 286, 262, 2443, 810, 262, 3084, 318, 5140, 198, 220, 220, 220, 1058, 4906, 19016, 25, 965, 198, 220, 220, 220, 1058, 17143, 3084, 62, 17618, 25, 7913, 286, 8655, 319, 262, 3992, 2443, 13, 198, 220, 220, 220, 1058, 4906, 3084, 62, 17618, 25, 493, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 611, 407, 318, 39098, 7, 11487, 62, 17618, 11, 493, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 31456, 796, 705, 10962, 1271, 318, 407, 4938, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 2604, 13, 34666, 7, 19662, 8, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 5994, 12331, 7, 19662, 8, 628, 220, 220, 220, 1303, 717, 1949, 262, 7007, 5301, 11, 611, 340, 10143, 466, 262, 384, 11925, 1505, 11, 543, 318, 881, 13611, 198, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 27711, 62, 7753, 796, 7007, 13, 1136, 7, 6371, 8, 198, 220, 220, 220, 220, 220, 220, 220, 27711, 62, 82, 10486, 796, 23762, 50, 10486, 7, 6494, 62, 7753, 13, 5239, 11, 3033, 11639, 75, 19875, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 27711, 62, 11487, 796, 27711, 62, 82, 10486, 13, 19796, 62, 439, 7203, 11487, 4943, 58, 11487, 62, 17618, 532, 352, 60, 198, 220, 220, 220, 220, 220, 220, 220, 7177, 796, 787, 18747, 7, 6494, 62, 11487, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2604, 13, 10951, 7203, 27813, 705, 8897, 3558, 6, 373, 973, 19570, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 7177, 198, 220, 220, 220, 2845, 35528, 25, 198, 220, 220, 220, 220, 220, 220, 220, 4639, 796, 17425, 62, 741, 47477, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 4639, 13, 1136, 7, 6371, 8, 198, 220, 220, 220, 220, 220, 220, 220, 27711, 62, 7753, 796, 4639, 13, 7700, 62, 10459, 198, 220, 220, 220, 220, 220, 220, 220, 27711, 62, 82, 10486, 796, 23762, 50, 10486, 7, 6494, 62, 7753, 11, 3033, 11639, 75, 19875, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 27711, 62, 11487, 796, 27711, 62, 82, 10486, 13, 19796, 62, 439, 7203, 11487, 4943, 58, 11487, 62, 17618, 12, 16, 60, 198, 220, 220, 220, 220, 220, 220, 220, 2845, 12901, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 23412, 12331, 7203, 11487, 62, 17618, 34758, 92, 318, 503, 286, 2837, 1911, 18982, 7, 11487, 62, 17618, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7177, 796, 787, 18747, 7, 6494, 62, 11487, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2604, 13, 10951, 7203, 27813, 705, 741, 47477, 6, 373, 973, 19570, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 7177, 198 ]
2.246492
2,779
import numpy as np test_data = np.array([16, 1, 2, 0, 4, 2, 7, 1, 2, 14]) np_data = np.loadtxt("data.txt", delimiter=",", dtype=int) def one(data: np.ndarray) -> int: """ Determine the horizontal position that the crabs can align to using the least fuel possible. How much fuel must they spend to align to that position? """ median = np.median(data).astype(int) return np.absolute(data - median).sum() def two(data: np.ndarray) -> int: """ Determine the horizontal position that the crabs can align to using the least fuel possible so they can make you an escape route! How much fuel must they spend to align to that position? """ mean = np.mean(data).astype(int) diff = np.absolute(data - mean) # 'Factorial for addition' is the same as (X^2 + X) / 2 return ((diff * diff + diff) / 2).astype(int).sum() print(f"1. {one(np_data)}") print(f"2. {two(np_data)}")
[ 11748, 299, 32152, 355, 45941, 198, 198, 9288, 62, 7890, 796, 45941, 13, 18747, 26933, 1433, 11, 352, 11, 362, 11, 657, 11, 604, 11, 362, 11, 767, 11, 352, 11, 362, 11, 1478, 12962, 198, 37659, 62, 7890, 796, 45941, 13, 2220, 14116, 7203, 7890, 13, 14116, 1600, 46728, 2676, 28, 2430, 11, 288, 4906, 28, 600, 8, 628, 198, 4299, 530, 7, 7890, 25, 45941, 13, 358, 18747, 8, 4613, 493, 25, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 45559, 3810, 262, 16021, 2292, 326, 262, 49172, 460, 10548, 284, 1262, 262, 1551, 5252, 1744, 13, 1374, 881, 5252, 1276, 484, 198, 220, 220, 220, 4341, 284, 10548, 284, 326, 2292, 30, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 14288, 796, 45941, 13, 1150, 666, 7, 7890, 737, 459, 2981, 7, 600, 8, 198, 220, 220, 220, 1441, 45941, 13, 48546, 7, 7890, 532, 14288, 737, 16345, 3419, 628, 198, 4299, 734, 7, 7890, 25, 45941, 13, 358, 18747, 8, 4613, 493, 25, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 45559, 3810, 262, 16021, 2292, 326, 262, 49172, 460, 10548, 284, 1262, 262, 1551, 5252, 1744, 523, 484, 460, 787, 345, 281, 198, 220, 220, 220, 6654, 6339, 0, 1374, 881, 5252, 1276, 484, 4341, 284, 10548, 284, 326, 2292, 30, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 1612, 796, 45941, 13, 32604, 7, 7890, 737, 459, 2981, 7, 600, 8, 198, 220, 220, 220, 814, 796, 45941, 13, 48546, 7, 7890, 532, 1612, 8, 628, 220, 220, 220, 1303, 705, 29054, 5132, 329, 3090, 6, 318, 262, 976, 355, 357, 55, 61, 17, 1343, 1395, 8, 1220, 362, 198, 220, 220, 220, 1441, 14808, 26069, 1635, 814, 1343, 814, 8, 1220, 362, 737, 459, 2981, 7, 600, 737, 16345, 3419, 628, 198, 4798, 7, 69, 1, 16, 13, 1391, 505, 7, 37659, 62, 7890, 38165, 4943, 198, 4798, 7, 69, 1, 17, 13, 1391, 11545, 7, 37659, 62, 7890, 38165, 4943, 198 ]
2.774775
333
# Copyright (c) 2018 Arista Networks, Inc. All rights reserved. # Arista Networks, Inc. Confidential and Proprietary. # # DON'T EDIT THIS FILE. It was generated by # /usr/local/lib/python2.7/dist-packages/CTypeGen.py # Please see AID/3558 for details on the contents of this file # from ctypes import * # pylint: disable=wildcard-import from CTypeGenRun import * # pylint: disable=wildcard-import # pylint: disable=unnecessary-pass,protected-access Callback = CFUNCTYPE( c_int, c_int , c_int ) functionTypes = { 'callme': CFUNCTYPE( c_int, c_int , c_int , Callback ), } if __name__ == "__main__": test_classes()
[ 2, 15069, 357, 66, 8, 2864, 943, 12523, 27862, 11, 3457, 13, 220, 1439, 2489, 10395, 13, 198, 2, 943, 12523, 27862, 11, 3457, 13, 7326, 35599, 290, 1041, 3448, 8527, 13, 198, 2, 198, 2, 23917, 6, 51, 48483, 12680, 45811, 13, 632, 373, 7560, 416, 198, 2, 1220, 14629, 14, 12001, 14, 8019, 14, 29412, 17, 13, 22, 14, 17080, 12, 43789, 14, 4177, 2981, 13746, 13, 9078, 198, 2, 4222, 766, 317, 2389, 14, 2327, 3365, 329, 3307, 319, 262, 10154, 286, 428, 2393, 198, 2, 198, 6738, 269, 19199, 1330, 1635, 1303, 279, 2645, 600, 25, 15560, 28, 21992, 9517, 12, 11748, 198, 6738, 327, 6030, 13746, 10987, 1330, 1635, 1303, 279, 2645, 600, 25, 15560, 28, 21992, 9517, 12, 11748, 198, 2, 279, 2645, 600, 25, 15560, 28, 403, 49986, 12, 6603, 11, 24326, 12, 15526, 628, 198, 198, 47258, 796, 18551, 4944, 4177, 56, 11401, 7, 269, 62, 600, 11, 269, 62, 600, 198, 220, 220, 220, 220, 220, 837, 269, 62, 600, 198, 220, 220, 220, 220, 220, 1267, 628, 198, 8818, 31431, 796, 1391, 198, 220, 220, 705, 13345, 1326, 10354, 18551, 4944, 4177, 56, 11401, 7, 269, 62, 600, 11, 269, 62, 600, 198, 220, 220, 220, 220, 220, 837, 269, 62, 600, 198, 220, 220, 220, 220, 220, 837, 4889, 1891, 198, 220, 220, 220, 220, 220, 10612, 198, 92, 628, 198, 361, 11593, 3672, 834, 6624, 366, 834, 12417, 834, 1298, 198, 220, 220, 1332, 62, 37724, 3419, 198 ]
2.624
250
from netapp.connection import NaErrorResponse, NaPagedResponse from netapp.net import NetConnection from netapp.net.net_port_info import NetPortInfo conn = NetConnection("192.168.135.100", "admin", "mehmeh123") print "LISTING ALL PORTS:" print "-----------------------------------------------" query = NetPortInfo(node="radontap-02") response = conn.net_port_get_iter( desired_attributes="node,port".split(","), query=query ) if isinstance(response, NaPagedResponse): for npi in response.output: print "{}: {}".format( npi.port, npi ) while response.has_more(): next = response.next() if isinstance(next.result, NaErrorResponse): print "There was an error: {} : {}".format( next.result.error_code, next.result.reason ) else: for npi in next.output: print "{}: {}".format( npi.port, npi ) elif isinstance(response, NaErrorResponse): print "There was an error: {} : {}".format( response.error_code, response.reason ) else: for npi in response: print "{}: {}".format( npi.port, npi ) print "GET A SINGLE PORT:" print "-----------------------------------------------" port_info = conn.net_port_get( node="radontap-02", port="e0c", desired_attributes="node,port".split(",") ) print port_info
[ 6738, 2010, 1324, 13, 38659, 1330, 11013, 12331, 31077, 11, 11013, 47, 1886, 31077, 198, 6738, 2010, 1324, 13, 3262, 1330, 3433, 32048, 198, 6738, 2010, 1324, 13, 3262, 13, 3262, 62, 634, 62, 10951, 1330, 3433, 13924, 12360, 198, 198, 37043, 796, 3433, 32048, 7203, 17477, 13, 14656, 13, 17059, 13, 3064, 1600, 366, 28482, 1600, 366, 1326, 71, 1326, 71, 10163, 4943, 198, 198, 4798, 366, 45849, 2751, 11096, 350, 33002, 11097, 198, 4798, 366, 3880, 24305, 1, 198, 198, 22766, 796, 3433, 13924, 12360, 7, 17440, 2625, 6335, 756, 499, 12, 2999, 4943, 198, 198, 26209, 796, 48260, 13, 3262, 62, 634, 62, 1136, 62, 2676, 7, 10348, 62, 1078, 7657, 2625, 17440, 11, 634, 1911, 35312, 7, 2430, 828, 12405, 28, 22766, 1267, 198, 198, 361, 318, 39098, 7, 26209, 11, 11013, 47, 1886, 31077, 2599, 198, 220, 220, 220, 220, 198, 220, 220, 220, 329, 299, 14415, 287, 2882, 13, 22915, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 45144, 38362, 23884, 1911, 18982, 7, 299, 14415, 13, 634, 11, 299, 14415, 1267, 628, 220, 220, 220, 981, 2882, 13, 10134, 62, 3549, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 1306, 796, 2882, 13, 19545, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 611, 318, 39098, 7, 19545, 13, 20274, 11, 11013, 12331, 31077, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 366, 1858, 373, 281, 4049, 25, 23884, 1058, 23884, 1911, 18982, 7, 1306, 13, 20274, 13, 18224, 62, 8189, 11, 1306, 13, 20274, 13, 41181, 1267, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 329, 299, 14415, 287, 1306, 13, 22915, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 45144, 38362, 23884, 1911, 18982, 7, 299, 14415, 13, 634, 11, 299, 14415, 1267, 198, 198, 417, 361, 318, 39098, 7, 26209, 11, 11013, 12331, 31077, 2599, 198, 220, 220, 220, 3601, 366, 1858, 373, 281, 4049, 25, 23884, 1058, 23884, 1911, 18982, 7, 2882, 13, 18224, 62, 8189, 11, 2882, 13, 41181, 1267, 198, 17772, 25, 198, 220, 220, 220, 329, 299, 14415, 287, 2882, 25, 198, 220, 220, 220, 220, 220, 220, 220, 3601, 45144, 38362, 23884, 1911, 18982, 7, 299, 14415, 13, 634, 11, 299, 14415, 1267, 198, 198, 4798, 366, 18851, 317, 311, 2751, 2538, 350, 9863, 11097, 198, 4798, 366, 3880, 24305, 1, 198, 198, 634, 62, 10951, 796, 48260, 13, 3262, 62, 634, 62, 1136, 7, 10139, 2625, 6335, 756, 499, 12, 2999, 1600, 2493, 2625, 68, 15, 66, 1600, 10348, 62, 1078, 7657, 2625, 17440, 11, 634, 1911, 35312, 7, 2430, 8, 1267, 198, 4798, 2493, 62, 10951 ]
2.781116
466
# type: ignore[attr-defined] from .core import unify, reify # noqa: F403 from .more import unifiable # noqa: F403 from .variable import var, isvar, vars, variables, Var # noqa: F403
[ 2, 2099, 25, 8856, 58, 35226, 12, 23211, 60, 198, 6738, 764, 7295, 1330, 555, 1958, 11, 302, 1958, 220, 1303, 645, 20402, 25, 376, 31552, 198, 6738, 764, 3549, 1330, 555, 16823, 220, 1303, 645, 20402, 25, 376, 31552, 198, 6738, 764, 45286, 1330, 1401, 11, 318, 7785, 11, 410, 945, 11, 9633, 11, 12372, 220, 1303, 645, 20402, 25, 376, 31552, 198 ]
2.890625
64
############################################################################### # Copyright 2012 FastSoft Inc. # Copyright 2012 Devin Anderson <danderson (at) fastsoft (dot) com> # # Licensed under the Apache License, Version 2.0 (the "License"); you may not # use this file except in compliance with the License. You may obtain a copy # of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations under # the License. ############################################################################### from psinsights.rule import Rule as _Rule
[ 29113, 29113, 7804, 4242, 21017, 198, 2, 15069, 2321, 12549, 18380, 3457, 13, 198, 2, 15069, 2321, 37081, 9918, 1279, 67, 392, 882, 357, 265, 8, 3049, 4215, 357, 26518, 8, 401, 29, 198, 2, 198, 2, 49962, 739, 262, 24843, 13789, 11, 10628, 362, 13, 15, 357, 1169, 366, 34156, 15341, 345, 743, 407, 198, 2, 779, 428, 2393, 2845, 287, 11846, 351, 262, 13789, 13, 220, 921, 743, 7330, 257, 4866, 198, 2, 286, 262, 13789, 379, 198, 2, 198, 2, 220, 220, 220, 220, 2638, 1378, 2503, 13, 43073, 13, 2398, 14, 677, 4541, 14, 43, 2149, 24290, 12, 17, 13, 15, 198, 2, 198, 2, 17486, 2672, 416, 9723, 1099, 393, 4987, 284, 287, 3597, 11, 3788, 198, 2, 9387, 739, 262, 13789, 318, 9387, 319, 281, 366, 1921, 3180, 1, 29809, 1797, 11, 42881, 198, 2, 34764, 11015, 6375, 7102, 49828, 11053, 3963, 15529, 509, 12115, 11, 2035, 4911, 393, 17142, 13, 220, 4091, 262, 198, 2, 13789, 329, 262, 2176, 3303, 15030, 21627, 290, 11247, 739, 198, 2, 262, 13789, 13, 198, 29113, 29113, 7804, 4242, 21017, 198, 198, 6738, 26692, 1040, 2337, 13, 25135, 1330, 14330, 355, 4808, 31929, 198 ]
4.314721
197
''' Faça um programa que leia o salário de um trabalhador e o valor da prestação de um empréstimo. Se a prestação for maior que 20% do salário imprima: “Empréstimo não concedido”; caso contrário imprima: “Empréstimo concedido”. ''' # entrada de dados salarao = float(input('Digite o valor do salario: ')) prestacao = float(input('Digite o valor da prestacao: ')) # condicional if (prestacao > 0.2*salarao): print('Emprestimo nao concedido!') else: print('Emprestimo concedido!') # mensagem de término de algoritmo print('Fim do algoritmo!')
[ 7061, 6, 198, 50110, 50041, 23781, 1430, 64, 8358, 443, 544, 267, 3664, 6557, 27250, 390, 23781, 491, 44349, 71, 7079, 304, 267, 1188, 273, 198, 6814, 16153, 64, 16175, 28749, 390, 23781, 795, 1050, 2634, 301, 25147, 13, 1001, 257, 16153, 64, 16175, 28749, 329, 17266, 1504, 8358, 1160, 4, 198, 4598, 3664, 6557, 27250, 848, 3036, 64, 25, 564, 250, 10161, 1050, 2634, 301, 25147, 299, 28749, 15096, 17305, 447, 251, 26, 6124, 78, 3445, 6557, 27250, 848, 3036, 64, 25, 564, 250, 10161, 1050, 2634, 301, 25147, 15096, 17305, 447, 251, 13, 198, 7061, 6, 198, 198, 2, 24481, 4763, 390, 9955, 418, 198, 21680, 3301, 78, 796, 12178, 7, 15414, 10786, 19511, 578, 267, 1188, 273, 466, 3664, 4982, 25, 705, 4008, 198, 79, 2118, 330, 5488, 796, 12178, 7, 15414, 10786, 19511, 578, 267, 1188, 273, 12379, 16153, 330, 5488, 25, 705, 4008, 198, 198, 2, 1779, 291, 1538, 198, 361, 357, 79, 2118, 330, 5488, 1875, 657, 13, 17, 9, 21680, 3301, 78, 2599, 198, 220, 220, 220, 3601, 10786, 36, 3149, 2118, 25147, 299, 5488, 15096, 17305, 0, 11537, 198, 17772, 25, 198, 220, 220, 220, 3601, 10786, 36, 3149, 2118, 25147, 15096, 17305, 0, 11537, 198, 198, 2, 285, 641, 363, 368, 390, 256, 42445, 1084, 78, 390, 435, 7053, 270, 5908, 220, 198, 4798, 10786, 37, 320, 466, 435, 7053, 270, 5908, 0, 11537 ]
2.369099
233
""" Firefly Security and Monitoring This is the core Firefly Security and Monitoring Service. There should be almost zero config to the user and firefly will monitor the entire house. - Alarm System (Away) - Alarm System (Night) - Vacation Lighting - Battery Monitor - Smoke Alerts - Flooding Alerts """ from Firefly import logging, scheduler, aliases from Firefly.const import COMMAND_NOTIFY, EVENT_TYPE_BROADCAST, FIREFLY_SECURITY_MONITORING, SERVICE_NOTIFICATION, SOURCE_LOCATION, TYPE_DEVICE, WATER, SENSOR_DRY, SENSOR_WET from Firefly.helpers.device import BATTERY, CONTACT, CONTACT_CLOSE, CONTACT_OPEN, MOTION, MOTION_ACTIVE, MOTION_INACTIVE from Firefly.helpers.events import Command, Event from Firefly.services.firefly_security_and_monitoring.battery_monitor import check_battery_from_event, generate_battery_notification_message from Firefly.services.firefly_security_and_monitoring.secueity_settings import FireflySecuritySettings from Firefly.services.firefly_security_and_monitoring.security_monitor import (check_all_security_contact_sensors, check_all_security_motion_sensors, generate_contact_warning_message, process_contact_change, process_motion_change) from Firefly.util.firefly_util import command_from_dict from .const import ALARM_ARMED_MESSAGE_MOTION, ALARM_ARMED_MESSAGE_NO_MOTION, BATTERY_LOW, BATTERY_NO_NOTIFY_STATES, STATUS_TEMPLATE ALARM_DISARMED = 'disarmed' ALARM_ARMED = 'armed' ALARM_ARMED_MOTION = 'armed_motion' ALARM_ARMED_NO_MOTION = 'armed_no_motion' ALARM_TRIGGERED = 'triggered' SYSTEM_DISABLED = 'system_diabled'
[ 37811, 198, 13543, 12254, 4765, 290, 37484, 198, 198, 1212, 318, 262, 4755, 40374, 4765, 290, 37484, 4809, 13, 1318, 815, 307, 2048, 6632, 4566, 284, 262, 2836, 290, 2046, 12254, 481, 5671, 262, 2104, 2156, 13, 198, 12, 978, 1670, 4482, 357, 32, 1014, 8, 198, 12, 978, 1670, 4482, 357, 24732, 8, 198, 12, 25709, 341, 43150, 198, 12, 23490, 18289, 198, 12, 25416, 23276, 82, 198, 12, 25588, 278, 23276, 82, 198, 37811, 198, 6738, 40374, 1330, 18931, 11, 6038, 18173, 11, 47217, 198, 6738, 40374, 13, 9979, 1330, 22240, 6981, 62, 11929, 5064, 56, 11, 49261, 62, 25216, 62, 11473, 41048, 44647, 11, 39110, 3697, 56, 62, 23683, 4261, 9050, 62, 27857, 2043, 1581, 2751, 11, 47453, 62, 11929, 30643, 6234, 11, 311, 31033, 62, 29701, 6234, 11, 41876, 62, 7206, 27389, 11, 370, 23261, 11, 311, 16938, 1581, 62, 7707, 56, 11, 311, 16938, 1581, 62, 54, 2767, 198, 6738, 40374, 13, 16794, 364, 13, 25202, 1330, 37421, 5781, 56, 11, 22904, 10659, 11, 22904, 10659, 62, 32737, 11, 22904, 10659, 62, 3185, 1677, 11, 42982, 2849, 11, 42982, 2849, 62, 10659, 9306, 11, 42982, 2849, 62, 1268, 10659, 9306, 198, 6738, 40374, 13, 16794, 364, 13, 31534, 1330, 9455, 11, 8558, 198, 6738, 40374, 13, 30416, 13, 6495, 12254, 62, 12961, 62, 392, 62, 41143, 278, 13, 65, 16296, 62, 41143, 1330, 2198, 62, 65, 16296, 62, 6738, 62, 15596, 11, 7716, 62, 65, 16296, 62, 1662, 2649, 62, 20500, 198, 6738, 40374, 13, 30416, 13, 6495, 12254, 62, 12961, 62, 392, 62, 41143, 278, 13, 2363, 518, 414, 62, 33692, 1330, 40374, 24074, 26232, 198, 6738, 40374, 13, 30416, 13, 6495, 12254, 62, 12961, 62, 392, 62, 41143, 278, 13, 12961, 62, 41143, 1330, 357, 9122, 62, 439, 62, 12961, 62, 32057, 62, 82, 641, 669, 11, 2198, 62, 439, 62, 12961, 62, 38714, 62, 82, 641, 669, 11, 7716, 62, 32057, 62, 43917, 62, 20500, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1429, 62, 32057, 62, 3803, 11, 1429, 62, 38714, 62, 3803, 8, 198, 6738, 40374, 13, 22602, 13, 6495, 12254, 62, 22602, 1330, 3141, 62, 6738, 62, 11600, 198, 6738, 764, 9979, 1330, 8355, 33456, 62, 1503, 30733, 62, 44, 1546, 4090, 8264, 62, 44, 2394, 2849, 11, 8355, 33456, 62, 1503, 30733, 62, 44, 1546, 4090, 8264, 62, 15285, 62, 44, 2394, 2849, 11, 37421, 5781, 56, 62, 43, 3913, 11, 37421, 5781, 56, 62, 15285, 62, 11929, 5064, 56, 62, 2257, 29462, 11, 15486, 2937, 62, 51, 3620, 6489, 6158, 198, 198, 1847, 33456, 62, 26288, 1503, 30733, 796, 705, 6381, 12026, 6, 198, 1847, 33456, 62, 1503, 30733, 796, 705, 12026, 6, 198, 1847, 33456, 62, 1503, 30733, 62, 44, 2394, 2849, 796, 705, 12026, 62, 38714, 6, 198, 1847, 33456, 62, 1503, 30733, 62, 15285, 62, 44, 2394, 2849, 796, 705, 12026, 62, 3919, 62, 38714, 6, 198, 1847, 33456, 62, 5446, 3528, 30373, 1961, 796, 705, 2213, 328, 10446, 6, 198, 198, 23060, 25361, 62, 26288, 6242, 30465, 796, 705, 10057, 62, 10989, 4510, 6, 628 ]
2.804795
584
# standard gravitational parameter for Earth = G*M EARTH_GRAV_CONST = 3.986005e5 # (km^3/s^2) # Earth Radius EARTH_RADIUS = 6378.137 # (km) # Earth rotation speed (calculated from sideral period) EARTH_ROT_RATE = 6.300387486749 / 86164 # (rad/s) # Earth gravitation at sea leve EARTH_GRAV_SEA_LVL = 9.80665 # (m^2/s)
[ 2, 3210, 29973, 11507, 329, 3668, 796, 402, 9, 44, 198, 17133, 4221, 62, 38, 3861, 53, 62, 10943, 2257, 796, 513, 13, 4089, 8054, 20, 68, 20, 220, 1303, 357, 13276, 61, 18, 14, 82, 61, 17, 8, 198, 198, 2, 3668, 48838, 198, 17133, 4221, 62, 49, 2885, 40, 2937, 796, 718, 30695, 13, 19708, 220, 1303, 357, 13276, 8, 198, 198, 2, 3668, 13179, 2866, 357, 9948, 49262, 422, 264, 1304, 282, 2278, 8, 198, 17133, 4221, 62, 49, 2394, 62, 49, 6158, 796, 718, 13, 6200, 32220, 2780, 3134, 2920, 1220, 9849, 23237, 220, 1303, 357, 6335, 14, 82, 8, 198, 198, 2, 3668, 9067, 3780, 379, 5417, 34002, 198, 17133, 4221, 62, 38, 3861, 53, 62, 46887, 62, 30976, 43, 796, 860, 13, 1795, 36879, 220, 1303, 357, 76, 61, 17, 14, 82, 8, 198 ]
2.314286
140
'''Some helper functions for PyTorch, including: - get_mean_and_std: calculate the mean and std value of dataset. - msr_init: net parameter initialization. - progress_bar: progress bar mimic xlua.progress. ''' import errno import os import sys import time import math import torch.nn as nn import torch.nn.init as init from torch.autograd import Variable import numpy as np import pdb import torch __all__ = ['get_mean_and_std', 'init_params', 'mkdir_p', 'AverageMeter', 'MovingAverage', 'AverageMeter_Mat', 'Timer'] def get_mean_and_std(dataset): '''Compute the mean and std value of dataset.''' dataloader = trainloader = torch.utils.data.DataLoader(dataset, batch_size=1, shuffle=True, num_workers=2) mean = torch.zeros(3) std = torch.zeros(3) print('==> Computing mean and std..') for inputs, targets in dataloader: for i in range(3): mean[i] += inputs[:,i,:,:].mean() std[i] += inputs[:,i,:,:].std() mean.div_(len(dataset)) std.div_(len(dataset)) return mean, std def init_params(net): '''Init layer parameters.''' for m in net.modules(): if isinstance(m, nn.Conv2d): init.kaiming_normal(m.weight, mode='fan_out') if m.bias: init.constant(m.bias, 0) elif isinstance(m, nn.BatchNorm2d): init.constant(m.weight, 1) init.constant(m.bias, 0) elif isinstance(m, nn.Linear): init.normal(m.weight, std=1e-3) if m.bias: init.constant(m.bias, 0) def mkdir_p(path): '''make dir if not exist''' try: os.makedirs(path) except OSError as exc: # Python >2.5 if exc.errno == errno.EEXIST and os.path.isdir(path): pass else: raise class AverageMeter(object): """Computes and stores the average and current value Imported from https://github.com/pytorch/examples/blob/master/imagenet/main.py#L247-L262 """
[ 7061, 6, 4366, 31904, 5499, 329, 9485, 15884, 354, 11, 1390, 25, 198, 220, 220, 220, 532, 651, 62, 32604, 62, 392, 62, 19282, 25, 15284, 262, 1612, 290, 14367, 1988, 286, 27039, 13, 198, 220, 220, 220, 532, 13845, 81, 62, 15003, 25, 2010, 11507, 37588, 13, 198, 220, 220, 220, 532, 4371, 62, 5657, 25, 4371, 2318, 26332, 2124, 40211, 13, 33723, 13, 198, 7061, 6, 198, 11748, 11454, 3919, 198, 11748, 28686, 198, 11748, 25064, 198, 11748, 640, 198, 11748, 10688, 198, 198, 11748, 28034, 13, 20471, 355, 299, 77, 198, 11748, 28034, 13, 20471, 13, 15003, 355, 2315, 198, 6738, 28034, 13, 2306, 519, 6335, 1330, 35748, 198, 11748, 299, 32152, 355, 45941, 198, 11748, 279, 9945, 198, 11748, 28034, 198, 198, 834, 439, 834, 796, 37250, 1136, 62, 32604, 62, 392, 62, 19282, 3256, 705, 15003, 62, 37266, 3256, 705, 28015, 15908, 62, 79, 3256, 705, 26287, 44, 2357, 3256, 705, 33622, 26287, 3256, 705, 26287, 44, 2357, 62, 19044, 3256, 705, 48801, 20520, 628, 198, 4299, 651, 62, 32604, 62, 392, 62, 19282, 7, 19608, 292, 316, 2599, 198, 220, 220, 220, 705, 7061, 7293, 1133, 262, 1612, 290, 14367, 1988, 286, 27039, 2637, 7061, 198, 220, 220, 220, 4818, 282, 1170, 263, 796, 4512, 29356, 796, 28034, 13, 26791, 13, 7890, 13, 6601, 17401, 7, 19608, 292, 316, 11, 15458, 62, 7857, 28, 16, 11, 36273, 28, 17821, 11, 997, 62, 22896, 28, 17, 8, 628, 220, 220, 220, 1612, 796, 28034, 13, 9107, 418, 7, 18, 8, 198, 220, 220, 220, 14367, 796, 28034, 13, 9107, 418, 7, 18, 8, 198, 220, 220, 220, 3601, 10786, 855, 29, 38589, 1612, 290, 14367, 492, 11537, 198, 220, 220, 220, 329, 17311, 11, 6670, 287, 4818, 282, 1170, 263, 25, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 18, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1612, 58, 72, 60, 15853, 17311, 58, 45299, 72, 11, 45299, 25, 4083, 32604, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14367, 58, 72, 60, 15853, 17311, 58, 45299, 72, 11, 45299, 25, 4083, 19282, 3419, 198, 220, 220, 220, 1612, 13, 7146, 41052, 11925, 7, 19608, 292, 316, 4008, 198, 220, 220, 220, 14367, 13, 7146, 41052, 11925, 7, 19608, 292, 316, 4008, 198, 220, 220, 220, 1441, 1612, 11, 14367, 198, 198, 4299, 2315, 62, 37266, 7, 3262, 2599, 198, 220, 220, 220, 705, 7061, 31768, 7679, 10007, 2637, 7061, 198, 220, 220, 220, 329, 285, 287, 2010, 13, 18170, 33529, 198, 220, 220, 220, 220, 220, 220, 220, 611, 318, 39098, 7, 76, 11, 299, 77, 13, 3103, 85, 17, 67, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2315, 13, 74, 1385, 278, 62, 11265, 7, 76, 13, 6551, 11, 4235, 11639, 24408, 62, 448, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 285, 13, 65, 4448, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2315, 13, 9979, 415, 7, 76, 13, 65, 4448, 11, 657, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1288, 361, 318, 39098, 7, 76, 11, 299, 77, 13, 33, 963, 35393, 17, 67, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2315, 13, 9979, 415, 7, 76, 13, 6551, 11, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2315, 13, 9979, 415, 7, 76, 13, 65, 4448, 11, 657, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1288, 361, 318, 39098, 7, 76, 11, 299, 77, 13, 14993, 451, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2315, 13, 11265, 7, 76, 13, 6551, 11, 14367, 28, 16, 68, 12, 18, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 285, 13, 65, 4448, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2315, 13, 9979, 415, 7, 76, 13, 65, 4448, 11, 657, 8, 198, 198, 4299, 33480, 15908, 62, 79, 7, 6978, 2599, 198, 220, 220, 220, 705, 7061, 15883, 26672, 611, 407, 2152, 7061, 6, 198, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 28686, 13, 76, 4335, 17062, 7, 6978, 8, 198, 220, 220, 220, 2845, 440, 5188, 81, 1472, 355, 2859, 25, 220, 1303, 11361, 1875, 17, 13, 20, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2859, 13, 8056, 3919, 6624, 11454, 3919, 13, 36, 6369, 8808, 290, 28686, 13, 6978, 13, 9409, 343, 7, 6978, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1208, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 198, 198, 4871, 13475, 44, 2357, 7, 15252, 2599, 198, 220, 220, 220, 37227, 7293, 1769, 290, 7000, 262, 2811, 290, 1459, 1988, 198, 220, 220, 220, 220, 220, 220, 1846, 9213, 422, 3740, 1378, 12567, 13, 785, 14, 9078, 13165, 354, 14, 1069, 12629, 14, 2436, 672, 14, 9866, 14, 320, 11286, 316, 14, 12417, 13, 9078, 2, 43, 23753, 12, 43, 29119, 198, 220, 220, 220, 37227, 198 ]
2.227933
895
import numpy as np np.random.seed(111) ''' The data is generated adding noise to the values from y = 0.8x + 2 equation Therefore the expectation of the auto encoder is to get the values w and b closer to 0.8 and 2 respectively ''' '''generate random x values''' X_train = np.random.random((1, 50))[0] '''get the reference y value''' y_reference = 0.8*X_train + 2 '''add noise to the reference y value''' y_train = y_reference + np.sqrt(0.01)*np.random.random((1, 50))[0] W = np.random.random() b = np.random.random() '''number of training examples''' m = len(X_train) '''parameters''' learning_rate = 0.01 epochs = 5000 '''send data to the gradient optimizer to optimize values for W and b''' gradient_descent(X_train, y_train) print('\nGradient optimization completed') print('W Expected : 0.8' + ' Learned : ' + str(W)) print('b Expected : 2.0' + ' Learned : ' + str(b))
[ 11748, 299, 32152, 355, 45941, 198, 198, 37659, 13, 25120, 13, 28826, 7, 16243, 8, 198, 198, 7061, 6, 198, 464, 1366, 318, 7560, 4375, 7838, 284, 262, 3815, 422, 220, 331, 796, 657, 13, 23, 87, 1343, 362, 16022, 198, 26583, 262, 17507, 286, 262, 8295, 2207, 12342, 318, 284, 651, 262, 3815, 266, 290, 275, 5699, 284, 657, 13, 23, 290, 362, 8148, 198, 7061, 6, 198, 198, 7061, 6, 8612, 378, 4738, 2124, 3815, 7061, 6, 198, 55, 62, 27432, 796, 45941, 13, 25120, 13, 25120, 19510, 16, 11, 2026, 4008, 58, 15, 60, 198, 198, 7061, 6, 1136, 262, 4941, 331, 1988, 7061, 6, 198, 88, 62, 35790, 796, 657, 13, 23, 9, 55, 62, 27432, 1343, 362, 198, 198, 7061, 6, 2860, 7838, 284, 262, 4941, 331, 1988, 7061, 6, 198, 88, 62, 27432, 796, 331, 62, 35790, 1343, 45941, 13, 31166, 17034, 7, 15, 13, 486, 27493, 37659, 13, 25120, 13, 25120, 19510, 16, 11, 2026, 4008, 58, 15, 60, 198, 198, 54, 796, 45941, 13, 25120, 13, 25120, 3419, 198, 65, 796, 45941, 13, 25120, 13, 25120, 3419, 198, 198, 7061, 6, 17618, 286, 3047, 6096, 7061, 6, 198, 76, 796, 18896, 7, 55, 62, 27432, 8, 198, 198, 7061, 6, 17143, 7307, 7061, 6, 198, 40684, 62, 4873, 796, 657, 13, 486, 198, 538, 5374, 82, 796, 23336, 628, 198, 7061, 6, 21280, 1366, 284, 262, 31312, 6436, 7509, 284, 27183, 3815, 329, 370, 290, 275, 7061, 6, 198, 49607, 62, 8906, 1087, 7, 55, 62, 27432, 11, 331, 62, 27432, 8, 198, 198, 4798, 10786, 59, 77, 42731, 1153, 23989, 5668, 11537, 198, 4798, 10786, 54, 1475, 7254, 1058, 657, 13, 23, 6, 1343, 705, 220, 38514, 1058, 705, 1343, 965, 7, 54, 4008, 198, 4798, 10786, 65, 1475, 7254, 1058, 362, 13, 15, 6, 1343, 705, 220, 38514, 1058, 705, 1343, 965, 7, 65, 4008 ]
2.812698
315
#Faça um programa que leia um ângulo qualquer e mostre na tela #o valor do seno,cosseno e tangente desse ângulo. from math import radians, sin, cos, tan angulo = int(input('Digite um ângulo: ')) sen = sin(radians(angulo)) cos = cos(radians(angulo)) tan = tan(radians(angulo)) print('O seno do ângulo {} é {:.2f}'.format(angulo, sen)) print('O Cosseno do ângulo {} é {:.2f}'.format(angulo, cos)) print('A tangente do ângulo {} é {:.2f}'.format(angulo, tan))
[ 2, 50110, 50041, 23781, 1430, 64, 8358, 443, 544, 23781, 6184, 95, 782, 43348, 4140, 10819, 304, 749, 260, 12385, 256, 10304, 198, 2, 78, 1188, 273, 466, 3308, 78, 11, 66, 793, 23397, 304, 13875, 21872, 748, 325, 6184, 95, 782, 43348, 13, 198, 198, 6738, 10688, 1330, 2511, 1547, 11, 7813, 11, 8615, 11, 25706, 198, 648, 43348, 796, 493, 7, 15414, 10786, 19511, 578, 23781, 6184, 95, 782, 43348, 25, 705, 4008, 198, 6248, 796, 7813, 7, 6335, 1547, 7, 648, 43348, 4008, 198, 6966, 796, 8615, 7, 6335, 1547, 7, 648, 43348, 4008, 198, 38006, 796, 25706, 7, 6335, 1547, 7, 648, 43348, 4008, 198, 4798, 10786, 46, 3308, 78, 466, 6184, 95, 782, 43348, 23884, 38251, 46110, 13, 17, 69, 92, 4458, 18982, 7, 648, 43348, 11, 3308, 4008, 198, 4798, 10786, 46, 327, 793, 23397, 466, 6184, 95, 782, 43348, 23884, 38251, 46110, 13, 17, 69, 92, 4458, 18982, 7, 648, 43348, 11, 8615, 4008, 198, 4798, 10786, 32, 13875, 21872, 466, 6184, 95, 782, 43348, 23884, 38251, 46110, 13, 17, 69, 92, 4458, 18982, 7, 648, 43348, 11, 25706, 4008, 198 ]
2.43617
188
#!/usr/bin/env python """stereograph.py: Compute length of a geodesic in the unit sphere. """ from sympy import (symbols, Function, Matrix, factor, simplify, latex, sqrt) from sympy.abc import (t, xi, eta) from sympy.printing import print_latex if __name__ == '__main__': main()
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 198, 37811, 301, 567, 2384, 13, 9078, 25, 3082, 1133, 4129, 286, 257, 4903, 4147, 291, 287, 262, 4326, 16558, 13, 198, 37811, 198, 198, 6738, 10558, 88, 1330, 357, 1837, 2022, 10220, 11, 15553, 11, 24936, 11, 5766, 11, 30276, 11, 47038, 11, 19862, 17034, 8, 198, 6738, 10558, 88, 13, 39305, 1330, 357, 83, 11, 2124, 72, 11, 2123, 64, 8, 198, 6738, 10558, 88, 13, 4798, 278, 1330, 3601, 62, 17660, 87, 198, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 1388, 3419, 198 ]
2.794118
102
# from visdialch.decoders.gen import GenerativeDecoder #from visdialch.decoders.disc import DiscriminativeDecoder from visdialch.decoders.decoder import DiscriminativeDecoder
[ 2, 422, 1490, 38969, 354, 13, 12501, 375, 364, 13, 5235, 1330, 2980, 876, 10707, 12342, 198, 2, 6738, 1490, 38969, 354, 13, 12501, 375, 364, 13, 15410, 1330, 8444, 3036, 259, 876, 10707, 12342, 198, 6738, 1490, 38969, 354, 13, 12501, 375, 364, 13, 12501, 12342, 1330, 8444, 3036, 259, 876, 10707, 12342, 198 ]
3.181818
55
import pytest from ansiblediscover.graph.node import Node @pytest.mark.parametrize('this, other, equal', [ (('myname', 'mytype', 'mypath'), ('myname', 'mytype', 'mypath'), True), (('myname', 'mytype', 'mypath'), ('othername', 'mytype', 'mypath'), False), (('myname', 'mytype', 'mypath'), ('myname', 'othertype', 'mypath'), False), (('myname', 'mytype', 'mypath'), ('myname', 'othertype', 'otherpath'), False), ]) @pytest.mark.parametrize('other', [ None, [], ('myname', 'mytype', 'mypath'), ])
[ 11748, 12972, 9288, 198, 198, 6738, 9093, 571, 992, 29392, 13, 34960, 13, 17440, 1330, 19081, 628, 628, 628, 198, 198, 31, 9078, 9288, 13, 4102, 13, 17143, 316, 380, 2736, 10786, 5661, 11, 584, 11, 4961, 3256, 685, 198, 220, 220, 220, 357, 10786, 1820, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 19203, 1820, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 6407, 828, 198, 220, 220, 220, 357, 10786, 1820, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 19203, 847, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 10352, 828, 198, 220, 220, 220, 357, 10786, 1820, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 19203, 1820, 3672, 3256, 705, 847, 4906, 3256, 705, 1820, 6978, 33809, 10352, 828, 198, 220, 220, 220, 357, 10786, 1820, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 19203, 1820, 3672, 3256, 705, 847, 4906, 3256, 705, 847, 6978, 33809, 10352, 828, 198, 12962, 628, 198, 31, 9078, 9288, 13, 4102, 13, 17143, 316, 380, 2736, 10786, 847, 3256, 685, 198, 220, 220, 220, 6045, 11, 198, 220, 220, 220, 685, 4357, 198, 220, 220, 220, 19203, 1820, 3672, 3256, 705, 1820, 4906, 3256, 705, 1820, 6978, 33809, 198, 12962, 198 ]
2.509434
212
import datetime from Models.Submission import Submission from Core.Database import Database from Core.Scorer import Scorer from Core.Executer import Executer from Core.Parser import Parser
[ 11748, 4818, 8079, 198, 6738, 32329, 13, 7004, 3411, 1330, 42641, 198, 6738, 7231, 13, 38105, 1330, 24047, 198, 6738, 7231, 13, 3351, 11934, 1330, 1446, 11934, 198, 6738, 7231, 13, 23002, 11894, 1330, 8393, 11894, 198, 6738, 7231, 13, 46677, 1330, 23042, 263, 628 ]
4.222222
45
from copy import copy import torch from nitorch.core.py import make_list from nitorch.core import dtypes from nitorch.spatial import affine_sub, affine_permute, voxel_size as affvx from nitorch.io.utils.indexing import (expand_index, guess_shape, compose_index, neg2pos, is_droppedaxis, is_newaxis, is_sliceaxis, invert_permutation, invert_slice, slice_navigator) from ..utils import volutils from ..mapping import MappedFile class MappedArray(MappedFile): """Base class for mapped arrays. Mapped arrays are usually stored on-disk, along with (diverse) metadata. They can be symbolically sliced, allowing for partial reading and (sometimes) writing of data from/to disk. Chaining of symbolic slicing operations is implemented in this base class. The actual io must be implemented by the child class. Abstract Methods ---------------- Child classes MUST implement: * self.data(...) Child classes SHOULD implement: * self.metadata(...) default -> returns empty dict Child classes MAY implement: * self.set_data(...) default -> raises cls.FailedWriteError * self.set_metadata(...) default -> raises cls.FailedWriteError * cls.save_new(...) default -> raises cls.FailedWriteError * cls.savef_new(...) default -> raises cls.FailedWriteError Child classes SHOULD register themselves in `readers.reader_classes`. If they implement `save_new`, child classes SHOULD register themselves in `writers.writer_classes`. Properties ---------- dtype : np.dtype On-disk data type slope : float Intensity slope from on-disk to unit inter : float Intensity shift from on-disk to unit affine : tensor Orientation matrix: maps spatial axes to 'world' spatial : tuple[bool] Mask of 'spatial' axes (x, y, z, ...) slicer : tuple[index_like] Indexing into the full on-disk array permutation : tuple[int] Permutation of the original in-disk axes. dim : int Number of axes voxel_size : tuple[float] World size of the spatial dimensions readable : AccessType See `AccessType` writable : AccessType See `AccessType` Types ----- FailedReadError Error raised when failing to load FailedWriteError Error raised when failing to save Methods ------- slice(tuple[index_like]) Subslice the array permute(tuple[int]) Permute axes transpose(int, int) Permute two axes unsqueeze(int) Insert singleton dimension squeeze(int) Remove singleton dimension unbind -> tuple Unstack arrays along a dimension chunk -> tuple Unstack arrays along a dimension by chunks split -> tuple Unstack arrays along a dimension by chunks data(...) -> tensor Load raw data to memory fdata(...) -> tensor Load scaled floating-point data to memory metadata(...) -> dict Load metadata to memory set_data(dat, ...) Write raw data to disk set_fdata(dat, ...) Write scaled floating-point data to disk set_metadata(**meta) Write metadata to disk Class methods ------------- save_new(dat, file_like) Write new file populated with `dat` savef_new(dat, file_like) Write new file populated with (scaled) `dat` External functions ------------------ map(file_like) -> MappedArray Build a MappedArray load(file_like) -> tensor Load raw data to memory from a file loadf(file_like) -> tensor Load scaled data to memory from a file save(dat, file_like) -> Save raw data into a new file savef(dat, file_like) -> Save scaled data into a new file cat(tuple[MappedArray]) Concatenate arrays along a dimension Syntaxic sugar -------------- __call__ -> fdata Load scaled floating-point data to memory __array__ -> fdata Load scaled floating-point data to memory __getitem__ -> slice Subslice the array __setitem__ -> set_fdata Write scaled floating-point data to disk __len__ Size of the first dimension (or 0 if scalar) """ fname: str = None # filename (can be None if in-memory proxy) fileobj = None # file-like object (`write`, `seek`, etc) is_compressed: bool = None # is compressed dtype: torch.dtype = None # on-disk data type slope: float = 1 # intensity slope inter: float = 0 # intensity shift affine = None # sliced voxel-to-world _affine = None # original voxel-to-world spatial: tuple = None # sliced spatial mask (len -> dim) _spatial: tuple = None # original spatial mask (len -> _dim) shape: tuple = None # sliced shape (len -> dim) _shape: tuple = None # original shape (len -> _dim) slicer: tuple = None # indexing into the parent permutation: tuple = None # permutation of original dim (len -> _dim) dim = property(lambda self: len(self.shape)) # Nb of sliced dimensions _dim = property(lambda self: len(self._shape)) # Nb of original dimensions voxel_size = property(lambda self: affvx(self.affine)) __repr__ = __str__ @classmethod def possible_extensions(cls): """List all possible extensions""" return tuple() def __getitem__(self, index): """Extract a sub-part of the array. Indices can only be slices, ellipses, integers or None. Parameters ---------- index : tuple[slice or ellipsis or int or None] Returns ------- subarray : type(self) MappedArray object, with the indexing operations and affine matrix relating to the new sub-array. """ return self.slice(index) def slice(self, index, new_shape=None, _pre_expanded=False): """Extract a sub-part of the array. Indices can only be slices, ellipses, integers or None. Parameters ---------- index : tuple[slice or ellipsis or int or None] Other Parameters ---------------- new_shape : sequence[int], optional Output shape of the sliced object _pre_expanded : bool, default=False Set to True of `expand_index` has already been called on `index` Returns ------- subarray : type(self) MappedArray object, with the indexing operations and affine matrix relating to the new sub-array. """ index = expand_index(index, self.shape) new_shape = guess_shape(index, self.shape) if any(isinstance(idx, list) for idx in index) > 1: raise ValueError('List indices not currently supported ' '(otherwise we enter advanced indexing ' 'territory and it becomes too complicated).') new = copy(self) new.shape = new_shape # compute new affine if self.affine is not None: spatial_shape = [sz for sz, msk in zip(self.shape, self.spatial) if msk] spatial_index = [idx for idx in index if not is_newaxis(idx)] spatial_index = [idx for idx, msk in zip(spatial_index, self.spatial) if msk] affine, _ = affine_sub(self.affine, spatial_shape, tuple(spatial_index)) else: affine = None new.affine = affine # compute new slicer perm_shape = [self._shape[d] for d in self.permutation] new.slicer = compose_index(self.slicer, index, perm_shape) # compute new spatial mask spatial = [] i = 0 for idx in new.slicer: if is_newaxis(idx): spatial.append(False) else: # original axis if not is_droppedaxis(idx): spatial.append(self._spatial[self.permutation[i]]) i += 1 new.spatial = tuple(spatial) return new def __setitem__(self, index, value): """Write scaled data to disk. Parameters ---------- index : tuple Tuple of indices (see `__getitem__`) value : array or tensor Array-like with shape `self[index].shape` Returns ------- self : type(self) """ if isinstance(value, MappedArray): raise NotImplementedError else: self.__getitem__(index).set_fdata(value) return self def __call__(self, *args, **kwargs): """Get floating point data. See `fdata()`""" return self.fdata(*args, **kwargs) def __array__(self, dtype=None): """Convert to numpy array""" return self.fdata(dtype=dtype, numpy=True) def permute(self, dims): """Permute dimensions Parameters ---------- dims : sequence[int] A permutation of `range(self.dim)` Returns ------- permarray : type(self) MappedArray object, with the indexing operations and affine matrix reflecting the permutation. """ dims = list(dims) if len(dims) != self.dim or len(dims) != len(set(dims)): raise ValueError('there should be as many (unique) dimensions ' 'as the array\'s dimension. Got {} and {}.' .format(len(set(dims)), self.dim)) # permute tuples that relate to the current spatial dimensions # (that part is easy) shape = tuple(self.shape[d] for d in dims) spatial = tuple(self.spatial[d] for d in dims) # permute slicer # 1) permute non-dropped dimensions slicer_nodrop = list(filter(lambda x: not is_droppedaxis(x), self.slicer)) slicer_nodrop = [slicer_nodrop[d] for d in dims] # 2) insert dropped dimensions slicer = [] for idx in self.slicer: if is_droppedaxis(idx): slicer.append(idx) else: new_idx, *slicer_nodrop = slicer_nodrop slicer.append(new_idx) # permute permutation # 1) insert None where new axes and remove dropped axes old_perm = self.permutation new_perm = [] drop_perm = [] for idx in self.slicer: if is_newaxis(idx): new_perm.append(None) continue p, *old_perm = old_perm if not is_droppedaxis(idx): new_perm.append(p) else: drop_perm.append(p) # 2) permute new_perm = [new_perm[d] for d in dims] # 3) insert back dropped axes and remove new axes perm = [] for idx in self.slicer: if is_droppedaxis(idx): p, *drop_perm = drop_perm perm.append(p) continue p, *new_perm = new_perm if not is_newaxis(p): perm.append(p) # permute affine # (it's a bit more complicated: we need to find the # permutation of the *current* *spatial* dimensions) perm_spatial = [p for p in dims if self.spatial[p]] perm_spatial = sorted(range(len(perm_spatial)), key=lambda k: perm_spatial[k]) affine, _ = affine_permute(self.affine, perm_spatial, self.shape) # create new object new = copy(self) new.shape = shape new.spatial = spatial new.permutation = tuple(perm) new.slicer = tuple(slicer) new.affine = affine return new def transpose(self, dim0, dim1): """Transpose two dimensions Parameters ---------- dim0 : int First dimension dim1 : int Second dimension Returns ------- permarray : type(self) MappedArray object, with the indexing operations and affine matrix reflecting the transposition. """ permutation = list(range(self.dim)) permutation[dim0] = dim1 permutation[dim1] = dim0 return self.permute(permutation) def data(self, dtype=None, device=None, casting='unsafe', rand=True, cutoff=None, dim=None, numpy=False): """Load the array in memory Parameters ---------- dtype : type or torch.dtype or np.dtype, optional Output data type. By default, keep the on-disk data type. device : torch.device, default='cpu' Output device. rand : bool, default=False If the on-disk dtype is not floating point, sample noise in the uncertainty interval. cutoff : float or (float, float), default=(0, 1) Percentile cutoff. If only one value is provided, it is assumed to relate to the upper percentile. dim : int or list[int], optional Dimensions along which to compute percentiles. By default, they are computed on the flattened array. casting : {'no', 'equiv', 'safe', 'same_kind', 'unsafe', 'rescale'}, default='unsafe' Controls what kind of data casting may occur: * 'no': the data types should not be cast at all. * 'equiv': only byte-order changes are allowed. * 'safe': only casts which can preserve values are allowed. * 'same_kind': only safe casts or casts within a kind, like float64 to float32, are allowed. * 'unsafe': any data conversions may be done. * 'rescale': the input data is rescaled to match the dynamic range of the output type. The minimum value in the data is mapped to the minimum value of the data type and the maximum value in the data is mapped to the maximum value of the data type. * 'rescale_zero': the input data is rescaled to match the dynamic range of the output type, but ensuring that zero maps to zero. > If the data is signed and cast to a signed datatype, zero maps to zero, and the scaling is chosen so that both the maximum and minimum value in the data fit in the output dynamic range. > If the data is signed and cast to an unsigned datatype, negative values "wrap around" (as with an unsafe cast). > If the data is unsigned and cast to a signed datatype, values are kept positive (the negative range is unused). numpy : bool, default=False Return a numpy array rather than a torch tensor. Returns ------- dat : tensor[dtype] """ pass def fdata(self, dtype=None, device=None, rand=False, cutoff=None, dim=None, numpy=False): """Load the scaled array in memory This function differs from `data` in several ways: * The output data type should be a floating point type. * If an affine scaling (slope, intercept) is defined in the file, it is applied to the data. * the default output data type is `torch.get_default_dtype()`. Parameters ---------- dtype : dtype_like, optional Output data type. By default, use `torch.get_default_dtype()`. Should be a floating point type. device : torch.device, default='cpu' Output device. rand : bool, default=False If the on-disk dtype is not floating point, sample noise in the uncertainty interval. cutoff : float or (float, float), default=(0, 1) Percentile cutoff. If only one value is provided, it is assumed to relate to the upper percentile. dim : int or list[int], optional Dimensions along which to compute percentiles. By default, they are computed on the flattened array. numpy : bool, default=False Return a numpy array rather than a torch tensor. Returns ------- dat : tensor[dtype] """ # --- sanity check --- dtype = torch.get_default_dtype() if dtype is None else dtype info = dtypes.dtype(dtype) if not info.is_floating_point: raise TypeError('Output data type should be a floating point ' 'type but got {}.'.format(dtype)) # --- get unscaled data --- dat = self.data(dtype=dtype, device=device, rand=rand, cutoff=cutoff, dim=dim, numpy=numpy) # --- scale --- if self.slope != 1: dat *= float(self.slope) if self.inter != 0: dat += float(self.inter) return dat def set_data(self, dat, casting='unsafe'): """Write (partial) data to disk. Parameters ---------- dat : tensor Tensor to write on disk. It should have shape `self.shape`. casting : {'no', 'equiv', 'safe', 'same_kind', 'unsafe', 'rescale'}, default='unsafe' Controls what kind of data casting may occur: * 'no': the data types should not be cast at all. * 'equiv': only byte-order changes are allowed. * 'safe': only casts which can preserve values are allowed. * 'same_kind': only safe casts or casts within a kind, like float64 to float32, are allowed. * 'unsafe': any data conversions may be done. * 'rescale': the input data is rescaled to match the dynamic range of the output type. The minimum value in the data is mapped to the minimum value of the data type and the maximum value in the data is mapped to the maximum value of the data type. * 'rescale_zero': the input data is rescaled to match the dynamic range of the output type, but ensuring that zero maps to zero. > If the data is signed and cast to a signed datatype, zero maps to zero, and the scaling is chosen so that both the maximum and minimum value in the data fit in the output dynamic range. > If the data is signed and cast to an unsigned datatype, negative values "wrap around" (as with an unsafe cast). > If the data is unsigned and cast to a signed datatype, values are kept positive (the negative range is unused). Returns ------- self : type(self) """ raise self.FailedWriteError("Method not implemented in class {}." .format(type(self).__name__)) def set_fdata(self, dat): """Write (partial) scaled data to disk. Parameters ---------- dat : tensor Tensor to write on disk. It should have shape `self.shape` and a floating point data type. Returns ------- self : type(self) """ # --- sanity check --- info = dtypes.dtype(dat.dtype) if not info.is_floating_point: raise TypeError('Input data type should be a floating point ' 'type but got {}.'.format(dat.dtype)) if dat.shape != self.shape: raise TypeError('Expected input shape {} but got {}.' .format(self.shape, dat.shape)) # --- detach --- if torch.is_tensor(dat): dat = dat.detach() # --- unscale --- if self.inter != 0 or self.slope != 1: dat = dat.clone() if torch.is_tensor(dat) else dat.copy() if self.inter != 0: dat -= float(self.inter) if self.slope != 1: dat /= float(self.slope) # --- set unscaled data --- self.set_data(dat) return self def metadata(self, keys=None): """Read metadata .. note:: The values returned by this function always relate to the full volume, even if we're inside a view. That is, we always return the affine of the original volume. To get an affine matrix that relates to the view, use `self.affine`. Parameters ---------- keys : sequence[str], optional List of metadata to load. They can either be one of the generic metadata keys define in `io.metadata`, or a format-specific metadata key. By default, all generic keys that are found in the file are returned. Returns ------- metadata : dict A dictionary of metadata """ return dict() def set_metadata(self, **meta): """Write metadata Parameters ---------- meta : dict, optional Dictionary of metadata. Fields that are absent from the dictionary or that have value `None` are kept untouched. Returns ------- self : type(self) """ raise NotImplementedError("Method not implemented in class {}." .format(type(self).__name__)) @classmethod def save_new(cls, dat, file_like, like=None, casting='unsafe', **metadata): """Write an array to disk. This function makes educated choices for the file format and its metadata based on the file extension, the data type and the other options provided. Parameters ---------- dat : tensor or array or MappedArray Data to write file_like : str or file object Path to file or file object (with methods `seek`, `read`). If the extension is known, it gets priority over `like` when choosing the output format. like : file or MappedArray An array on-disk that should be used as a template for the new file. Its metadata/layout/etc will be mimicked as much as possible. casting : {'no', 'equiv', 'safe', 'same_kind', 'unsafe', 'rescale'}, default='unsafe' Controls what kind of data casting may occur. See `MappedArray.set_data` metadata : dict Metadata to store on disk. Values provided there will have priority over `like`. Returns ------- dat : array or tensor The array loaded in memory attributes : dict, if attributes is not None Dictionary of attributes loaded as well """ raise cls.FailedWriteError("Method not implemented in class {}." .format(cls.__name__)) @classmethod def savef_new(cls, dat, file_like, like=None, **metadata): """Write a scaled array to disk. This function makes educated choices for the file format and its metadata based on the file extension, the data type and the other options provided. The input data type must be a floating point type. Parameters ---------- dat : tensor or array or MappedArray Data to write file_like : str or file object Path to file or file object (with methods `seek`, `read`). If the extension is known, it gets priority over `like` when choosing the output format. like : file or MappedArray An array on-disk that should be used as a template for the new file. Its metadata/layout/etc will be mimicked as much as possible. metadata : dict Metadata to store on disk. Values provided there will have priority over `like`. Returns ------- dat : array or tensor The array loaded in memory attributes : dict, if attributes is not None Dictionary of attributes loaded as well """ raise cls.FailedWriteError("Method not implemented in class {}." .format(cls.__name__)) def unsqueeze(self, dim, ndim=1): """Add a dimension of size 1 in position `dim`. Parameters ---------- dim : int The dimension is added to the right of `dim` if `dim < 0` else it is added to the left of `dim`. Returns ------- MappedArray """ index = [slice(None)] * self.dim if dim < 0: dim = self.dim + dim + 1 index = index[:dim] + ([None] * ndim) + index[dim:] return self[tuple(index)] def squeeze(self, dim): """Remove all dimensions of size 1. Parameters ---------- dim : int or sequence[int], optional If provided, only this dimension is squeezed. It *must* be a dimension of size 1. Returns ------- MappedArray """ if dim is None: dim = [d for d in range(self.dim) if self.shape[d] == 1] dim = make_list(dim) ndim = len(self.shape) dim = [ndim + d if d < 0 else d for d in dim] if any(self.shape[d] != 1 for d in dim): raise ValueError('Impossible to squeeze non-singleton dimensions.') index = [slice(None) if d not in dim else 0 for d in range(self.dim)] return self[tuple(index)] def unbind(self, dim=0, keepdim=False): """Extract all arrays along dimension `dim` and drop that dimension. Parameters ---------- dim : int, default=0 Dimension along which to unstack. keepdim : bool, default=False Do not drop the unstacked dimension. Returns ------- list[MappedArray] """ index = [slice(None)] * self.dim if keepdim: index = index[:dim+1] + [None] + index[dim+1:] out = [] for i in range(self.shape[dim]): index[dim] = i out.append(self[tuple(index)]) return out def chunk(self, chunks, dim=0): """Split the array into smaller arrays of size `chunk` along `dim`. Parameters ---------- chunks : int Number of chunks. dim : int, default=0 Dimensions along which to split. Returns ------- list[MappedArray] """ index = [slice(None)] * self.dim out = [] for i in range(self.shape[dim]): index[dim] = slice(i*chunks, (i+1)*chunks) out.append(self[tuple(index)]) return out def split(self, chunks, dim=0): """Split the array into smaller arrays along `dim`. Parameters ---------- chunks : int or list[int] If `int`: Number of chunks (see `self.chunk`) Else: Size of each chunk. Must sum to `self.shape[dim]`. dim : int, default=0 Dimensions along which to split. Returns ------- list[MappedArray] """ if isinstance(chunks, int): return self.chunk(chunks, dim) chunks = make_list(chunks) if sum(chunks) != self.shape[dim]: raise ValueError('Chunks must cover the full dimension. ' 'Got {} and {}.' .format(sum(chunks), self.shape[dim])) index = [slice(None)] * self.dim previous_chunks = 0 out = [] for chunk in chunks: index[dim] = slice(previous_chunks, previous_chunks+chunk) out.append(self[tuple(index)]) previous_chunks += chunk return out def channel_first(self, atleast=0): """Permute the dimensions such that all spatial axes are on the right. Parameters ---------- atleast : int, default=0 Make sure that at least this number of non-spatial dimensions exist (new axes are inserted accordingly). Returns ------- MappedArray """ # 1) move spatial dimensions to the right perm = [] spatial = [] for d, is_spatial in enumerate(self.spatial): if is_spatial: spatial.append(d) else: perm.append(d) nb_channels = len(perm) perm = perm + spatial new = self.permute(perm) # 2) add channel axes add_channels = max(0, atleast - nb_channels) if add_channels: index = [slice(None)] * nb_channels \ + [None] * add_channels \ + [Ellipsis] new = new.slice(tuple(index)) return new def channel_last(self, atleast=0): """Permute the dimensions such that all spatial axes are on the left. Parameters ---------- atleast : int, default=0 Make sure that at least this number of non-spatial dimensions exist (new axes are inserted accordingly). Returns ------- MappedArray """ # 1) move spatial dimensions to the right perm = [] spatial = [] for d, is_spatial in enumerate(self.spatial): if is_spatial: spatial.append(d) else: perm.append(d) nb_channels = len(perm) perm = spatial + perm new = self.permute(perm) # 2) add channel axes add_channels = max(0, atleast - nb_channels) if add_channels: index = [Ellipsis] + [None] * add_channels new = new.slice(tuple(index)) return new class CatArray(MappedArray): """A concatenation of mapped arrays. This is largely inspired by virtual concatenation of file_array in SPM: https://github.com/spm/spm12/blob/master/@file_array/cat.m """ _arrays: tuple = [] _dim_cat: int = None # defer attributes fname = property(lambda self: tuple(a.fname for a in self._arrays)) fileobj = property(lambda self: tuple(a.fileobj for a in self._arrays)) is_compressed = property(lambda self: tuple(a.is_compressed for a in self._arrays)) dtype = property(lambda self: tuple(a.dtype for a in self._arrays)) slope = property(lambda self: tuple(a.slope for a in self._arrays)) inter = property(lambda self: tuple(a.inter for a in self._arrays)) _shape = property(lambda self: tuple(a._shape for a in self._arrays)) _dim = property(lambda self: tuple(a._dim for a in self._arrays)) affine = property(lambda self: tuple(a.affine for a in self._arrays)) _affine = property(lambda self: tuple(a._affine for a in self._arrays)) spatial = property(lambda self: tuple(a.spatial for a in self._arrays)) _spatial = property(lambda self: tuple(a._spatial for a in self._arrays)) slicer = property(lambda self: tuple(a.slicer for a in self._arrays)) permutation = property(lambda self: tuple(a.permutation for a in self._arrays)) voxel_size = property(lambda self: tuple(a.voxel_size for a in self._arrays)) def __init__(self, arrays, dim=0): """ Parameters ---------- arrays : sequence[MappedArray] Arrays to concatenate. Their shapes should be identical except along dimension `dim`. dim : int, default=0 Dimension along white to concatenate the arrays """ super().__init__() arrays = list(arrays) dim = dim or 0 self._dim_cat = dim # sanity checks shapes = [] for i, array in enumerate(arrays): if not isinstance(array, MappedArray): raise TypeError('Input arrays should be `MappedArray` ' 'instances. Got {}.',format(type(array))) shape = list(array.shape) del shape[dim] shapes.append(shape) shape0, *shapes = shapes if not all(shape == shape0 for shape in shapes): raise ValueError('Shapes of all concatenated arrays should ' 'be equal except in the concatenation dimension.') # compute output shape shape = list(arrays[0].shape) dims = [array.shape[dim] for array in arrays] shape[dim] = sum(dims) self.shape = tuple(shape) # concatenate self._arrays = tuple(arrays) __repr__ = __str__ def cat(arrays, dim=0): """Concatenate mapped arrays along a dimension. Parameters ---------- arrays : sequence[MappedArray] Arrays to concatenate. Their shapes should be identical except along dimension `dim`. dim : int, default=0 Dimension along white to concatenate the arrays Returns ------- CatArray A symbolic concatenation of all input arrays. Its shape along dimension `dim` is the sum of all input shapes along dimension `dim`. """ return CatArray(arrays, dim) def stack(arrays, dim=0): """Stack mapped arrays along a dimension. Parameters ---------- arrays : sequence[MappedArray] Arrays to concatenate. Their shapes should be identical except along dimension `dim`. dim : int, default=0 Dimension along white to concatenate the arrays Returns ------- CatArray A symbolic stack of all input arrays. """ arrays = [array.unsqueeze(dim=dim) for array in arrays] return cat(arrays, dim=dim)
[ 6738, 4866, 1330, 4866, 198, 11748, 28034, 198, 6738, 299, 2072, 354, 13, 7295, 13, 9078, 1330, 787, 62, 4868, 198, 6738, 299, 2072, 354, 13, 7295, 1330, 288, 19199, 198, 6738, 299, 2072, 354, 13, 2777, 34961, 1330, 1527, 500, 62, 7266, 11, 1527, 500, 62, 16321, 1133, 11, 410, 1140, 417, 62, 7857, 355, 1527, 85, 87, 198, 6738, 299, 2072, 354, 13, 952, 13, 26791, 13, 9630, 278, 1330, 357, 11201, 392, 62, 9630, 11, 4724, 62, 43358, 11, 36664, 62, 9630, 11, 2469, 17, 1930, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 318, 62, 22285, 1496, 22704, 11, 318, 62, 3605, 22704, 11, 318, 62, 48369, 22704, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 287, 1851, 62, 16321, 7094, 11, 287, 1851, 62, 48369, 11, 16416, 62, 28341, 23823, 8, 198, 6738, 11485, 26791, 1330, 2322, 26791, 198, 6738, 11485, 76, 5912, 1330, 337, 6320, 8979, 628, 198, 4871, 337, 6320, 19182, 7, 44, 6320, 8979, 2599, 198, 220, 220, 220, 37227, 14881, 1398, 329, 27661, 26515, 13, 628, 220, 220, 220, 337, 6320, 26515, 389, 3221, 8574, 319, 12, 39531, 11, 1863, 351, 357, 67, 3997, 8, 20150, 13, 628, 220, 220, 220, 1119, 460, 307, 6194, 1146, 26790, 11, 5086, 329, 13027, 3555, 290, 198, 220, 220, 220, 357, 29810, 8, 3597, 286, 1366, 422, 14, 1462, 11898, 13, 198, 220, 220, 220, 609, 1397, 286, 18975, 49289, 4560, 318, 9177, 287, 428, 2779, 198, 220, 220, 220, 1398, 13, 383, 4036, 33245, 1276, 307, 9177, 416, 262, 1200, 1398, 13, 628, 220, 220, 220, 27741, 25458, 198, 220, 220, 220, 34400, 628, 220, 220, 220, 5932, 6097, 17191, 3494, 25, 198, 220, 220, 220, 1635, 2116, 13, 7890, 7, 23029, 628, 220, 220, 220, 5932, 6097, 40312, 3494, 25, 198, 220, 220, 220, 1635, 2116, 13, 38993, 7, 23029, 220, 220, 220, 220, 220, 220, 220, 220, 4277, 4613, 5860, 6565, 8633, 628, 220, 220, 220, 5932, 6097, 26720, 3494, 25, 198, 220, 220, 220, 1635, 2116, 13, 2617, 62, 7890, 7, 23029, 220, 220, 220, 220, 220, 220, 220, 220, 4277, 4613, 12073, 537, 82, 13, 37, 6255, 16594, 12331, 198, 220, 220, 220, 1635, 2116, 13, 2617, 62, 38993, 7, 23029, 220, 220, 220, 220, 4277, 4613, 12073, 537, 82, 13, 37, 6255, 16594, 12331, 198, 220, 220, 220, 1635, 537, 82, 13, 21928, 62, 3605, 7, 23029, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4277, 4613, 12073, 537, 82, 13, 37, 6255, 16594, 12331, 198, 220, 220, 220, 1635, 537, 82, 13, 21928, 69, 62, 3605, 7, 23029, 220, 220, 220, 220, 220, 220, 220, 220, 4277, 4613, 12073, 537, 82, 13, 37, 6255, 16594, 12331, 628, 220, 220, 220, 5932, 6097, 40312, 7881, 2405, 287, 4600, 961, 364, 13, 46862, 62, 37724, 44646, 198, 220, 220, 220, 1002, 484, 3494, 4600, 21928, 62, 3605, 47671, 1200, 6097, 40312, 7881, 198, 220, 220, 220, 2405, 287, 4600, 34422, 13, 16002, 62, 37724, 44646, 628, 220, 220, 220, 24946, 198, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 288, 4906, 1058, 45941, 13, 67, 4906, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1550, 12, 39531, 1366, 2099, 198, 220, 220, 220, 22638, 1058, 12178, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2558, 6377, 22638, 422, 319, 12, 39531, 284, 4326, 198, 220, 220, 220, 987, 1058, 12178, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2558, 6377, 6482, 422, 319, 12, 39531, 284, 4326, 198, 220, 220, 220, 1527, 500, 1058, 11192, 273, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 35275, 341, 17593, 25, 8739, 21739, 34197, 284, 705, 6894, 6, 198, 220, 220, 220, 21739, 1058, 46545, 58, 30388, 60, 220, 220, 220, 220, 220, 220, 18007, 286, 705, 2777, 34961, 6, 34197, 357, 87, 11, 331, 11, 1976, 11, 2644, 8, 198, 220, 220, 220, 14369, 263, 1058, 46545, 58, 9630, 62, 2339, 60, 220, 12901, 278, 656, 262, 1336, 319, 12, 39531, 7177, 198, 220, 220, 220, 9943, 7094, 1058, 46545, 58, 600, 60, 220, 220, 220, 2448, 76, 7094, 286, 262, 2656, 287, 12, 39531, 34197, 13, 198, 220, 220, 220, 5391, 1058, 493, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7913, 286, 34197, 198, 220, 220, 220, 410, 1140, 417, 62, 7857, 1058, 46545, 58, 22468, 60, 220, 220, 2159, 2546, 286, 262, 21739, 15225, 198, 220, 220, 220, 31744, 1058, 8798, 6030, 220, 220, 220, 220, 220, 220, 4091, 4600, 15457, 6030, 63, 198, 220, 220, 220, 1991, 540, 1058, 8798, 6030, 220, 220, 220, 220, 220, 220, 4091, 4600, 15457, 6030, 63, 628, 220, 220, 220, 24897, 198, 220, 220, 220, 37404, 198, 220, 220, 220, 22738, 5569, 12331, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 13047, 4376, 618, 9894, 284, 3440, 198, 220, 220, 220, 22738, 16594, 12331, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 13047, 4376, 618, 9894, 284, 3613, 628, 220, 220, 220, 25458, 198, 220, 220, 220, 35656, 198, 220, 220, 220, 16416, 7, 83, 29291, 58, 9630, 62, 2339, 12962, 220, 220, 220, 3834, 48369, 262, 7177, 198, 220, 220, 220, 9943, 1133, 7, 83, 29291, 58, 600, 12962, 220, 220, 220, 220, 220, 220, 220, 220, 2448, 76, 1133, 34197, 198, 220, 220, 220, 1007, 3455, 7, 600, 11, 493, 8, 220, 220, 220, 220, 220, 220, 220, 220, 2448, 76, 1133, 734, 34197, 198, 220, 220, 220, 5576, 421, 1453, 2736, 7, 600, 8, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 35835, 2060, 1122, 15793, 198, 220, 220, 220, 21229, 7, 600, 8, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17220, 2060, 1122, 15793, 198, 220, 220, 220, 555, 21653, 4613, 46545, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 791, 25558, 26515, 1863, 257, 15793, 198, 220, 220, 220, 16058, 4613, 46545, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 791, 25558, 26515, 1863, 257, 15793, 416, 22716, 198, 220, 220, 220, 6626, 4613, 46545, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 791, 25558, 26515, 1863, 257, 15793, 416, 22716, 628, 220, 220, 220, 1366, 7, 23029, 4613, 11192, 273, 220, 220, 220, 220, 220, 220, 220, 220, 8778, 8246, 1366, 284, 4088, 198, 220, 220, 220, 277, 7890, 7, 23029, 4613, 11192, 273, 220, 220, 220, 220, 220, 220, 220, 8778, 27464, 12462, 12, 4122, 1366, 284, 4088, 198, 220, 220, 220, 20150, 7, 23029, 4613, 8633, 220, 220, 220, 220, 220, 220, 8778, 20150, 284, 4088, 198, 220, 220, 220, 900, 62, 7890, 7, 19608, 11, 2644, 8, 220, 220, 220, 220, 220, 220, 220, 220, 220, 19430, 8246, 1366, 284, 11898, 198, 220, 220, 220, 900, 62, 69, 7890, 7, 19608, 11, 2644, 8, 220, 220, 220, 220, 220, 220, 220, 220, 19430, 27464, 12462, 12, 4122, 1366, 284, 11898, 198, 220, 220, 220, 900, 62, 38993, 7, 1174, 28961, 8, 220, 220, 220, 220, 220, 220, 220, 19430, 20150, 284, 11898, 628, 220, 220, 220, 5016, 5050, 198, 220, 220, 220, 220, 32501, 198, 220, 220, 220, 3613, 62, 3605, 7, 19608, 11, 2393, 62, 2339, 8, 220, 220, 220, 19430, 649, 2393, 22331, 351, 4600, 19608, 63, 198, 220, 220, 220, 3613, 69, 62, 3605, 7, 19608, 11, 2393, 62, 2339, 8, 220, 220, 19430, 649, 2393, 22331, 351, 357, 1416, 3021, 8, 4600, 19608, 63, 628, 220, 220, 220, 34579, 5499, 198, 220, 220, 220, 34400, 438, 198, 220, 220, 220, 3975, 7, 7753, 62, 2339, 8, 4613, 337, 6320, 19182, 220, 220, 10934, 257, 337, 6320, 19182, 198, 220, 220, 220, 3440, 7, 7753, 62, 2339, 8, 4613, 11192, 273, 220, 220, 220, 220, 220, 220, 8778, 8246, 1366, 284, 4088, 422, 257, 2393, 198, 220, 220, 220, 3440, 69, 7, 7753, 62, 2339, 8, 4613, 11192, 273, 220, 220, 220, 220, 220, 8778, 27464, 1366, 284, 4088, 422, 257, 2393, 198, 220, 220, 220, 3613, 7, 19608, 11, 2393, 62, 2339, 8, 4613, 220, 220, 220, 220, 220, 220, 220, 220, 12793, 8246, 1366, 656, 257, 649, 2393, 198, 220, 220, 220, 3613, 69, 7, 19608, 11, 2393, 62, 2339, 8, 4613, 220, 220, 220, 220, 220, 220, 220, 12793, 27464, 1366, 656, 257, 649, 2393, 198, 220, 220, 220, 3797, 7, 83, 29291, 58, 44, 6320, 19182, 12962, 220, 220, 220, 220, 220, 220, 220, 220, 1482, 9246, 268, 378, 26515, 1863, 257, 15793, 628, 220, 220, 220, 26375, 897, 291, 7543, 198, 220, 220, 220, 220, 26171, 198, 220, 220, 220, 11593, 13345, 834, 220, 220, 220, 4613, 277, 7890, 220, 220, 220, 220, 220, 220, 220, 8778, 27464, 12462, 12, 4122, 1366, 284, 4088, 198, 220, 220, 220, 11593, 18747, 834, 220, 220, 4613, 277, 7890, 220, 220, 220, 220, 220, 220, 220, 8778, 27464, 12462, 12, 4122, 1366, 284, 4088, 198, 220, 220, 220, 11593, 1136, 9186, 834, 4613, 16416, 220, 220, 220, 220, 220, 220, 220, 3834, 48369, 262, 7177, 198, 220, 220, 220, 11593, 2617, 9186, 834, 4613, 900, 62, 69, 7890, 220, 220, 220, 19430, 27464, 12462, 12, 4122, 1366, 284, 11898, 198, 220, 220, 220, 11593, 11925, 834, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12849, 286, 262, 717, 15793, 357, 273, 657, 611, 16578, 283, 8, 628, 220, 220, 220, 37227, 628, 220, 220, 220, 277, 3672, 25, 965, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 29472, 357, 5171, 307, 6045, 611, 287, 12, 31673, 15741, 8, 198, 220, 220, 220, 2393, 26801, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2393, 12, 2339, 2134, 357, 63, 13564, 47671, 4600, 36163, 47671, 3503, 8, 198, 220, 220, 220, 318, 62, 5589, 2790, 25, 20512, 796, 6045, 220, 220, 220, 1303, 318, 25388, 198, 220, 220, 220, 288, 4906, 25, 28034, 13, 67, 4906, 796, 6045, 220, 220, 220, 220, 1303, 319, 12, 39531, 1366, 2099, 198, 220, 220, 220, 22638, 25, 12178, 796, 352, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 12245, 22638, 198, 220, 220, 220, 987, 25, 12178, 796, 657, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 12245, 6482, 628, 220, 220, 220, 1527, 500, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 26790, 410, 1140, 417, 12, 1462, 12, 6894, 198, 220, 220, 220, 4808, 2001, 500, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2656, 410, 1140, 417, 12, 1462, 12, 6894, 198, 220, 220, 220, 21739, 25, 46545, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 26790, 21739, 9335, 357, 11925, 4613, 5391, 8, 198, 220, 220, 220, 4808, 2777, 34961, 25, 46545, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 1303, 2656, 21739, 9335, 357, 11925, 4613, 4808, 27740, 8, 198, 220, 220, 220, 5485, 25, 46545, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 26790, 5485, 357, 11925, 4613, 5391, 8, 198, 220, 220, 220, 4808, 43358, 25, 46545, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2656, 5485, 357, 11925, 4613, 4808, 27740, 8, 198, 220, 220, 220, 14369, 263, 25, 46545, 796, 6045, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 6376, 278, 656, 262, 2560, 198, 220, 220, 220, 9943, 7094, 25, 46545, 796, 6045, 220, 220, 220, 220, 1303, 9943, 7094, 286, 2656, 5391, 357, 11925, 4613, 4808, 27740, 8, 628, 220, 220, 220, 5391, 796, 3119, 7, 50033, 2116, 25, 18896, 7, 944, 13, 43358, 4008, 220, 220, 220, 1303, 399, 65, 286, 26790, 15225, 198, 220, 220, 220, 4808, 27740, 796, 3119, 7, 50033, 2116, 25, 18896, 7, 944, 13557, 43358, 4008, 220, 1303, 399, 65, 286, 2656, 15225, 198, 220, 220, 220, 410, 1140, 417, 62, 7857, 796, 3119, 7, 50033, 2116, 25, 1527, 85, 87, 7, 944, 13, 2001, 500, 4008, 628, 220, 220, 220, 11593, 260, 1050, 834, 796, 11593, 2536, 834, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 1744, 62, 2302, 5736, 7, 565, 82, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 8053, 477, 1744, 18366, 37811, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 46545, 3419, 628, 220, 220, 220, 825, 11593, 1136, 9186, 834, 7, 944, 11, 6376, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 11627, 974, 257, 850, 12, 3911, 286, 262, 7177, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1423, 1063, 460, 691, 307, 24314, 11, 30004, 2419, 274, 11, 37014, 393, 6045, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 1058, 46545, 58, 48369, 393, 30004, 2419, 271, 393, 493, 393, 6045, 60, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 850, 18747, 1058, 2099, 7, 944, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 2134, 11, 351, 262, 6376, 278, 4560, 290, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17593, 11270, 284, 262, 649, 850, 12, 18747, 13, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13, 48369, 7, 9630, 8, 628, 220, 220, 220, 825, 16416, 7, 944, 11, 6376, 11, 649, 62, 43358, 28, 14202, 11, 4808, 3866, 62, 11201, 12249, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 11627, 974, 257, 850, 12, 3911, 286, 262, 7177, 13, 628, 220, 220, 220, 220, 220, 220, 220, 1423, 1063, 460, 691, 307, 24314, 11, 30004, 2419, 274, 11, 37014, 393, 6045, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 1058, 46545, 58, 48369, 393, 30004, 2419, 271, 393, 493, 393, 6045, 60, 628, 220, 220, 220, 220, 220, 220, 220, 3819, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 34400, 198, 220, 220, 220, 220, 220, 220, 220, 649, 62, 43358, 1058, 8379, 58, 600, 4357, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25235, 5485, 286, 262, 26790, 2134, 198, 220, 220, 220, 220, 220, 220, 220, 4808, 3866, 62, 11201, 12249, 1058, 20512, 11, 4277, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5345, 284, 6407, 286, 4600, 11201, 392, 62, 9630, 63, 468, 1541, 587, 1444, 319, 4600, 9630, 63, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 850, 18747, 1058, 2099, 7, 944, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 2134, 11, 351, 262, 6376, 278, 4560, 290, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17593, 11270, 284, 262, 649, 850, 12, 18747, 13, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 4292, 62, 9630, 7, 9630, 11, 2116, 13, 43358, 8, 198, 220, 220, 220, 220, 220, 220, 220, 649, 62, 43358, 796, 4724, 62, 43358, 7, 9630, 11, 2116, 13, 43358, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 597, 7, 271, 39098, 7, 312, 87, 11, 1351, 8, 329, 4686, 87, 287, 6376, 8, 1875, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 10786, 8053, 36525, 407, 3058, 4855, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 29513, 847, 3083, 356, 3802, 6190, 6376, 278, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 353, 799, 652, 290, 340, 4329, 1165, 8253, 737, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 649, 796, 4866, 7, 944, 8, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 43358, 796, 649, 62, 43358, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 24061, 649, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 2001, 500, 318, 407, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 62, 43358, 796, 685, 82, 89, 329, 264, 89, 11, 285, 8135, 287, 19974, 7, 944, 13, 43358, 11, 2116, 13, 2777, 34961, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 285, 8135, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 62, 9630, 796, 685, 312, 87, 329, 4686, 87, 287, 6376, 611, 407, 318, 62, 3605, 22704, 7, 312, 87, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 62, 9630, 796, 685, 312, 87, 329, 4686, 87, 11, 285, 8135, 287, 19974, 7, 2777, 34961, 62, 9630, 11, 2116, 13, 2777, 34961, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 285, 8135, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1527, 500, 11, 4808, 796, 1527, 500, 62, 7266, 7, 944, 13, 2001, 500, 11, 21739, 62, 43358, 11, 46545, 7, 2777, 34961, 62, 9630, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1527, 500, 796, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 2001, 500, 796, 1527, 500, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 24061, 649, 14369, 263, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 62, 43358, 796, 685, 944, 13557, 43358, 58, 67, 60, 329, 288, 287, 2116, 13, 16321, 7094, 60, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 82, 677, 263, 796, 36664, 62, 9630, 7, 944, 13, 82, 677, 263, 11, 6376, 11, 9943, 62, 43358, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 24061, 649, 21739, 9335, 198, 220, 220, 220, 220, 220, 220, 220, 21739, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 1312, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 329, 4686, 87, 287, 649, 13, 82, 677, 263, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 318, 62, 3605, 22704, 7, 312, 87, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 13, 33295, 7, 25101, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 2656, 16488, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 62, 22285, 1496, 22704, 7, 312, 87, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 13, 33295, 7, 944, 13557, 2777, 34961, 58, 944, 13, 16321, 7094, 58, 72, 11907, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1312, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 2777, 34961, 796, 46545, 7, 2777, 34961, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 649, 628, 220, 220, 220, 825, 11593, 2617, 9186, 834, 7, 944, 11, 6376, 11, 1988, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16594, 27464, 1366, 284, 11898, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 1058, 46545, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 309, 29291, 286, 36525, 357, 3826, 4600, 834, 1136, 9186, 834, 63, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 1058, 7177, 393, 11192, 273, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15690, 12, 2339, 351, 5485, 4600, 944, 58, 9630, 4083, 43358, 63, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 1058, 2099, 7, 944, 8, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 318, 39098, 7, 8367, 11, 337, 6320, 19182, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 1892, 3546, 1154, 12061, 12331, 198, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 834, 1136, 9186, 834, 7, 9630, 737, 2617, 62, 69, 7890, 7, 8367, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 628, 220, 220, 220, 825, 11593, 13345, 834, 7, 944, 11, 1635, 22046, 11, 12429, 46265, 22046, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 3855, 12462, 966, 1366, 13, 4091, 4600, 69, 7890, 3419, 63, 37811, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13, 69, 7890, 46491, 22046, 11, 12429, 46265, 22046, 8, 628, 220, 220, 220, 825, 11593, 18747, 834, 7, 944, 11, 288, 4906, 28, 14202, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 3103, 1851, 284, 299, 32152, 7177, 37811, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13, 69, 7890, 7, 67, 4906, 28, 67, 4906, 11, 299, 32152, 28, 17821, 8, 628, 220, 220, 220, 825, 9943, 1133, 7, 944, 11, 5391, 82, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 5990, 76, 1133, 15225, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 1058, 8379, 58, 600, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 317, 9943, 7094, 286, 4600, 9521, 7, 944, 13, 27740, 8, 63, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 583, 3876, 2433, 1058, 2099, 7, 944, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 2134, 11, 351, 262, 6376, 278, 4560, 290, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17593, 20252, 262, 9943, 7094, 13, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 796, 1351, 7, 67, 12078, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 18896, 7, 67, 12078, 8, 14512, 2116, 13, 27740, 393, 18896, 7, 67, 12078, 8, 14512, 18896, 7, 2617, 7, 67, 12078, 8, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 10786, 8117, 815, 307, 355, 867, 357, 34642, 8, 15225, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 292, 262, 7177, 43054, 82, 15793, 13, 11853, 23884, 290, 23884, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 11925, 7, 2617, 7, 67, 12078, 36911, 2116, 13, 27740, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 9943, 1133, 12777, 2374, 326, 15124, 284, 262, 1459, 21739, 15225, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 357, 5562, 636, 318, 2562, 8, 198, 220, 220, 220, 220, 220, 220, 220, 5485, 796, 46545, 7, 944, 13, 43358, 58, 67, 60, 329, 288, 287, 5391, 82, 8, 198, 220, 220, 220, 220, 220, 220, 220, 21739, 796, 46545, 7, 944, 13, 2777, 34961, 58, 67, 60, 329, 288, 287, 5391, 82, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 9943, 1133, 14369, 263, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 352, 8, 9943, 1133, 1729, 12, 22285, 1496, 15225, 198, 220, 220, 220, 220, 220, 220, 220, 14369, 263, 62, 77, 375, 1773, 796, 1351, 7, 24455, 7, 50033, 2124, 25, 407, 318, 62, 22285, 1496, 22704, 7, 87, 828, 2116, 13, 82, 677, 263, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 14369, 263, 62, 77, 375, 1773, 796, 685, 82, 677, 263, 62, 77, 375, 1773, 58, 67, 60, 329, 288, 287, 5391, 82, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 362, 8, 7550, 5710, 15225, 198, 220, 220, 220, 220, 220, 220, 220, 14369, 263, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 4686, 87, 287, 2116, 13, 82, 677, 263, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 318, 62, 22285, 1496, 22704, 7, 312, 87, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14369, 263, 13, 33295, 7, 312, 87, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 312, 87, 11, 1635, 82, 677, 263, 62, 77, 375, 1773, 796, 14369, 263, 62, 77, 375, 1773, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14369, 263, 13, 33295, 7, 3605, 62, 312, 87, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 9943, 1133, 9943, 7094, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 352, 8, 7550, 6045, 810, 649, 34197, 290, 4781, 5710, 34197, 198, 220, 220, 220, 220, 220, 220, 220, 1468, 62, 16321, 796, 2116, 13, 16321, 7094, 198, 220, 220, 220, 220, 220, 220, 220, 649, 62, 16321, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 4268, 62, 16321, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 4686, 87, 287, 2116, 13, 82, 677, 263, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 318, 62, 3605, 22704, 7, 312, 87, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 16321, 13, 33295, 7, 14202, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 279, 11, 1635, 727, 62, 16321, 796, 1468, 62, 16321, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 62, 22285, 1496, 22704, 7, 312, 87, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 62, 16321, 13, 33295, 7, 79, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4268, 62, 16321, 13, 33295, 7, 79, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 362, 8, 9943, 1133, 198, 220, 220, 220, 220, 220, 220, 220, 649, 62, 16321, 796, 685, 3605, 62, 16321, 58, 67, 60, 329, 288, 287, 5391, 82, 60, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 513, 8, 7550, 736, 5710, 34197, 290, 4781, 649, 34197, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 4686, 87, 287, 2116, 13, 82, 677, 263, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 318, 62, 22285, 1496, 22704, 7, 312, 87, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 279, 11, 1635, 14781, 62, 16321, 796, 4268, 62, 16321, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9943, 13, 33295, 7, 79, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2555, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 279, 11, 1635, 3605, 62, 16321, 796, 649, 62, 16321, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 62, 3605, 22704, 7, 79, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9943, 13, 33295, 7, 79, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 9943, 1133, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 357, 270, 338, 257, 1643, 517, 8253, 25, 356, 761, 284, 1064, 262, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 220, 9943, 7094, 286, 262, 1635, 14421, 9, 1635, 2777, 34961, 9, 15225, 8, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 62, 2777, 34961, 796, 685, 79, 329, 279, 287, 5391, 82, 611, 2116, 13, 2777, 34961, 58, 79, 11907, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 62, 2777, 34961, 796, 23243, 7, 9521, 7, 11925, 7, 16321, 62, 2777, 34961, 36911, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1994, 28, 50033, 479, 25, 9943, 62, 2777, 34961, 58, 74, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 1527, 500, 11, 4808, 796, 1527, 500, 62, 16321, 1133, 7, 944, 13, 2001, 500, 11, 9943, 62, 2777, 34961, 11, 2116, 13, 43358, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 2251, 649, 2134, 198, 220, 220, 220, 220, 220, 220, 220, 649, 796, 4866, 7, 944, 8, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 43358, 796, 5485, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 2777, 34961, 796, 21739, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 16321, 7094, 796, 46545, 7, 16321, 8, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 82, 677, 263, 796, 46545, 7, 82, 677, 263, 8, 198, 220, 220, 220, 220, 220, 220, 220, 649, 13, 2001, 500, 796, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 649, 628, 220, 220, 220, 825, 1007, 3455, 7, 944, 11, 5391, 15, 11, 5391, 16, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 8291, 3455, 734, 15225, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 15, 1058, 493, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3274, 15793, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 16, 1058, 493, 198, 220, 220, 220, 220, 220, 220, 220, 5498, 15793, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 583, 3876, 2433, 1058, 2099, 7, 944, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 2134, 11, 351, 262, 6376, 278, 4560, 290, 1527, 500, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 17593, 20252, 262, 1007, 9150, 13, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 7094, 796, 1351, 7, 9521, 7, 944, 13, 27740, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 7094, 58, 27740, 15, 60, 796, 5391, 16, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 7094, 58, 27740, 16, 60, 796, 5391, 15, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13, 16321, 1133, 7, 16321, 7094, 8, 628, 220, 220, 220, 825, 1366, 7, 944, 11, 288, 4906, 28, 14202, 11, 3335, 28, 14202, 11, 13092, 11639, 13271, 8635, 3256, 43720, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45616, 28, 14202, 11, 5391, 28, 14202, 11, 299, 32152, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 8912, 262, 7177, 287, 4088, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 288, 4906, 1058, 2099, 393, 28034, 13, 67, 4906, 393, 45941, 13, 67, 4906, 11, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25235, 1366, 2099, 13, 2750, 4277, 11, 1394, 262, 319, 12, 39531, 1366, 2099, 13, 198, 220, 220, 220, 220, 220, 220, 220, 3335, 1058, 28034, 13, 25202, 11, 4277, 11639, 36166, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25235, 3335, 13, 198, 220, 220, 220, 220, 220, 220, 220, 43720, 1058, 20512, 11, 4277, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 262, 319, 12, 39531, 288, 4906, 318, 407, 12462, 966, 11, 6291, 7838, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 287, 262, 13479, 16654, 13, 198, 220, 220, 220, 220, 220, 220, 220, 45616, 1058, 12178, 393, 357, 22468, 11, 12178, 828, 4277, 16193, 15, 11, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 22512, 576, 45616, 13, 1002, 691, 530, 1988, 318, 2810, 11, 340, 318, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9672, 284, 15124, 284, 262, 6727, 37894, 13, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 393, 1351, 58, 600, 4357, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41265, 1863, 543, 284, 24061, 1411, 2915, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2750, 4277, 11, 484, 389, 29231, 319, 262, 45096, 7177, 13, 198, 220, 220, 220, 220, 220, 220, 220, 13092, 1058, 1391, 6, 3919, 3256, 705, 4853, 452, 3256, 705, 21230, 3256, 705, 31642, 62, 11031, 3256, 705, 13271, 8635, 3256, 705, 411, 38765, 6, 5512, 4277, 11639, 13271, 8635, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 36357, 644, 1611, 286, 1366, 13092, 743, 3051, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 3919, 10354, 262, 1366, 3858, 815, 407, 307, 3350, 379, 477, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 4853, 452, 10354, 691, 18022, 12, 2875, 2458, 389, 3142, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 21230, 10354, 691, 26217, 543, 460, 12201, 3815, 389, 3142, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 31642, 62, 11031, 10354, 691, 3338, 26217, 393, 26217, 1626, 257, 1611, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 588, 12178, 2414, 284, 12178, 2624, 11, 389, 3142, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 13271, 8635, 10354, 597, 1366, 32626, 743, 307, 1760, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 411, 38765, 10354, 262, 5128, 1366, 318, 6811, 3021, 284, 2872, 262, 8925, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2837, 286, 262, 5072, 2099, 13, 383, 5288, 1988, 287, 262, 1366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 318, 27661, 284, 262, 5288, 1988, 286, 262, 1366, 2099, 290, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5415, 1988, 287, 262, 1366, 318, 27661, 284, 262, 5415, 1988, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 286, 262, 1366, 2099, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 411, 38765, 62, 22570, 10354, 262, 5128, 1366, 318, 6811, 3021, 284, 2872, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8925, 2837, 286, 262, 5072, 2099, 11, 475, 13359, 326, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6632, 8739, 284, 6632, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1875, 1002, 262, 1366, 318, 4488, 290, 3350, 284, 257, 4488, 4818, 265, 2981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6632, 8739, 284, 6632, 11, 290, 262, 20796, 318, 7147, 523, 326, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1111, 262, 5415, 290, 5288, 1988, 287, 262, 1366, 4197, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 287, 262, 5072, 8925, 2837, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1875, 1002, 262, 1366, 318, 4488, 290, 3350, 284, 281, 22165, 4818, 265, 2981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4633, 3815, 366, 37150, 1088, 1, 357, 292, 351, 281, 21596, 3350, 737, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1875, 1002, 262, 1366, 318, 22165, 290, 3350, 284, 257, 4488, 4818, 265, 2981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3815, 389, 4030, 3967, 357, 1169, 4633, 2837, 318, 21958, 737, 198, 220, 220, 220, 220, 220, 220, 220, 299, 32152, 1058, 20512, 11, 4277, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8229, 257, 299, 32152, 7177, 2138, 621, 257, 28034, 11192, 273, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 11192, 273, 58, 67, 4906, 60, 628, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1208, 628, 220, 220, 220, 825, 277, 7890, 7, 944, 11, 288, 4906, 28, 14202, 11, 3335, 28, 14202, 11, 43720, 28, 25101, 11, 45616, 28, 14202, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 28, 14202, 11, 299, 32152, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 8912, 262, 27464, 7177, 287, 4088, 628, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 24242, 422, 4600, 7890, 63, 287, 1811, 2842, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 383, 5072, 1366, 2099, 815, 307, 257, 12462, 966, 2099, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 1002, 281, 1527, 500, 20796, 357, 6649, 3008, 11, 15788, 8, 318, 5447, 287, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2393, 11, 340, 318, 5625, 284, 262, 1366, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 262, 4277, 5072, 1366, 2099, 318, 4600, 13165, 354, 13, 1136, 62, 12286, 62, 67, 4906, 3419, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 288, 4906, 1058, 288, 4906, 62, 2339, 11, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25235, 1366, 2099, 13, 2750, 4277, 11, 779, 4600, 13165, 354, 13, 1136, 62, 12286, 62, 67, 4906, 3419, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10358, 307, 257, 12462, 966, 2099, 13, 198, 220, 220, 220, 220, 220, 220, 220, 3335, 1058, 28034, 13, 25202, 11, 4277, 11639, 36166, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25235, 3335, 13, 198, 220, 220, 220, 220, 220, 220, 220, 43720, 1058, 20512, 11, 4277, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 262, 319, 12, 39531, 288, 4906, 318, 407, 12462, 966, 11, 6291, 7838, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 287, 262, 13479, 16654, 13, 198, 220, 220, 220, 220, 220, 220, 220, 45616, 1058, 12178, 393, 357, 22468, 11, 12178, 828, 4277, 16193, 15, 11, 352, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 22512, 576, 45616, 13, 1002, 691, 530, 1988, 318, 2810, 11, 340, 318, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9672, 284, 15124, 284, 262, 6727, 37894, 13, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 393, 1351, 58, 600, 4357, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41265, 1863, 543, 284, 24061, 1411, 2915, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2750, 4277, 11, 484, 389, 29231, 319, 262, 45096, 7177, 13, 198, 220, 220, 220, 220, 220, 220, 220, 299, 32152, 1058, 20512, 11, 4277, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8229, 257, 299, 32152, 7177, 2138, 621, 257, 28034, 11192, 273, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 11192, 273, 58, 67, 4906, 60, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 34182, 2198, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 288, 4906, 796, 28034, 13, 1136, 62, 12286, 62, 67, 4906, 3419, 611, 288, 4906, 318, 6045, 2073, 288, 4906, 198, 220, 220, 220, 220, 220, 220, 220, 7508, 796, 288, 19199, 13, 67, 4906, 7, 67, 4906, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 7508, 13, 271, 62, 48679, 803, 62, 4122, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 5994, 12331, 10786, 26410, 1366, 2099, 815, 307, 257, 12462, 966, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 475, 1392, 23884, 2637, 13, 18982, 7, 67, 4906, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 651, 28594, 3021, 1366, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 796, 2116, 13, 7890, 7, 67, 4906, 28, 67, 4906, 11, 3335, 28, 25202, 11, 43720, 28, 25192, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 45616, 28, 8968, 2364, 11, 5391, 28, 27740, 11, 299, 32152, 28, 77, 32152, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 5046, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 6649, 3008, 14512, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 1635, 28, 12178, 7, 944, 13, 6649, 3008, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 3849, 14512, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 15853, 12178, 7, 944, 13, 3849, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 4818, 628, 220, 220, 220, 825, 900, 62, 7890, 7, 944, 11, 4818, 11, 13092, 11639, 13271, 8635, 6, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16594, 357, 47172, 8, 1366, 284, 11898, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 11192, 273, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 309, 22854, 284, 3551, 319, 11898, 13, 632, 815, 423, 5485, 4600, 944, 13, 43358, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 13092, 1058, 1391, 6, 3919, 3256, 705, 4853, 452, 3256, 705, 21230, 3256, 705, 31642, 62, 11031, 3256, 705, 13271, 8635, 3256, 705, 411, 38765, 6, 5512, 4277, 11639, 13271, 8635, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 36357, 644, 1611, 286, 1366, 13092, 743, 3051, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 3919, 10354, 262, 1366, 3858, 815, 407, 307, 3350, 379, 477, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 4853, 452, 10354, 691, 18022, 12, 2875, 2458, 389, 3142, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 21230, 10354, 691, 26217, 543, 460, 12201, 3815, 389, 3142, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 31642, 62, 11031, 10354, 691, 3338, 26217, 393, 26217, 1626, 257, 1611, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 588, 12178, 2414, 284, 12178, 2624, 11, 389, 3142, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 13271, 8635, 10354, 597, 1366, 32626, 743, 307, 1760, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 411, 38765, 10354, 262, 5128, 1366, 318, 6811, 3021, 284, 2872, 262, 8925, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2837, 286, 262, 5072, 2099, 13, 383, 5288, 1988, 287, 262, 1366, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 318, 27661, 284, 262, 5288, 1988, 286, 262, 1366, 2099, 290, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5415, 1988, 287, 262, 1366, 318, 27661, 284, 262, 5415, 1988, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 286, 262, 1366, 2099, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1635, 705, 411, 38765, 62, 22570, 10354, 262, 5128, 1366, 318, 6811, 3021, 284, 2872, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8925, 2837, 286, 262, 5072, 2099, 11, 475, 13359, 326, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6632, 8739, 284, 6632, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1875, 1002, 262, 1366, 318, 4488, 290, 3350, 284, 257, 4488, 4818, 265, 2981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6632, 8739, 284, 6632, 11, 290, 262, 20796, 318, 7147, 523, 326, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1111, 262, 5415, 290, 5288, 1988, 287, 262, 1366, 4197, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 287, 262, 5072, 8925, 2837, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1875, 1002, 262, 1366, 318, 4488, 290, 3350, 284, 281, 22165, 4818, 265, 2981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4633, 3815, 366, 37150, 1088, 1, 357, 292, 351, 281, 21596, 3350, 737, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1875, 1002, 262, 1366, 318, 22165, 290, 3350, 284, 257, 4488, 4818, 265, 2981, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3815, 389, 4030, 3967, 357, 1169, 4633, 2837, 318, 21958, 737, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 1058, 2099, 7, 944, 8, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 2116, 13, 37, 6255, 16594, 12331, 7203, 17410, 407, 9177, 287, 1398, 23884, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 4906, 7, 944, 737, 834, 3672, 834, 4008, 628, 220, 220, 220, 825, 900, 62, 69, 7890, 7, 944, 11, 4818, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16594, 357, 47172, 8, 27464, 1366, 284, 11898, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 11192, 273, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 309, 22854, 284, 3551, 319, 11898, 13, 632, 815, 423, 5485, 4600, 944, 13, 43358, 63, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 290, 257, 12462, 966, 1366, 2099, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 1058, 2099, 7, 944, 8, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 34182, 2198, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 7508, 796, 288, 19199, 13, 67, 4906, 7, 19608, 13, 67, 4906, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 7508, 13, 271, 62, 48679, 803, 62, 4122, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 5994, 12331, 10786, 20560, 1366, 2099, 815, 307, 257, 12462, 966, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 4906, 475, 1392, 23884, 2637, 13, 18982, 7, 19608, 13, 67, 4906, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 611, 4818, 13, 43358, 14512, 2116, 13, 43358, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 5994, 12331, 10786, 3109, 7254, 5128, 5485, 23884, 475, 1392, 23884, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 944, 13, 43358, 11, 4818, 13, 43358, 4008, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 48224, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 611, 28034, 13, 271, 62, 83, 22854, 7, 19608, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 796, 4818, 13, 15255, 620, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 555, 9888, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 3849, 14512, 657, 393, 2116, 13, 6649, 3008, 14512, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 796, 4818, 13, 21018, 3419, 611, 28034, 13, 271, 62, 83, 22854, 7, 19608, 8, 2073, 4818, 13, 30073, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 3849, 14512, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 48185, 12178, 7, 944, 13, 3849, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 6649, 3008, 14512, 352, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4818, 1220, 28, 12178, 7, 944, 13, 6649, 3008, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 11420, 900, 28594, 3021, 1366, 11420, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 2617, 62, 7890, 7, 19608, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 628, 220, 220, 220, 825, 20150, 7, 944, 11, 8251, 28, 14202, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 5569, 20150, 628, 220, 220, 220, 220, 220, 220, 220, 11485, 3465, 3712, 383, 3815, 4504, 416, 428, 2163, 1464, 15124, 284, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 262, 1336, 6115, 11, 772, 611, 356, 821, 2641, 257, 1570, 13, 1320, 318, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 356, 1464, 1441, 262, 1527, 500, 286, 262, 2656, 6115, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1675, 651, 281, 1527, 500, 17593, 326, 18436, 284, 262, 1570, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 779, 4600, 944, 13, 2001, 500, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 8251, 1058, 8379, 58, 2536, 4357, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7343, 286, 20150, 284, 3440, 13, 1119, 460, 2035, 307, 530, 286, 262, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 14276, 20150, 8251, 8160, 287, 4600, 952, 13, 38993, 47671, 393, 257, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5794, 12, 11423, 20150, 1994, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2750, 4277, 11, 477, 14276, 8251, 326, 389, 1043, 287, 262, 2393, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 389, 4504, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 20150, 1058, 8633, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 317, 22155, 286, 20150, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 8633, 3419, 628, 220, 220, 220, 825, 900, 62, 38993, 7, 944, 11, 12429, 28961, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16594, 20150, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 13634, 1058, 8633, 11, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28261, 286, 20150, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 23948, 326, 389, 13717, 422, 262, 22155, 393, 326, 423, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1988, 4600, 14202, 63, 389, 4030, 36519, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 1058, 2099, 7, 944, 8, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 1892, 3546, 1154, 12061, 12331, 7203, 17410, 407, 9177, 287, 1398, 23884, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 4906, 7, 944, 737, 834, 3672, 834, 4008, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 3613, 62, 3605, 7, 565, 82, 11, 4818, 11, 2393, 62, 2339, 11, 588, 28, 14202, 11, 13092, 11639, 13271, 8635, 3256, 12429, 38993, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16594, 281, 7177, 284, 11898, 13, 628, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 1838, 15657, 7747, 329, 262, 2393, 5794, 290, 198, 220, 220, 220, 220, 220, 220, 220, 663, 20150, 1912, 319, 262, 2393, 7552, 11, 262, 1366, 2099, 290, 262, 198, 220, 220, 220, 220, 220, 220, 220, 584, 3689, 2810, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 11192, 273, 393, 7177, 393, 337, 6320, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6060, 284, 3551, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 62, 2339, 1058, 965, 393, 2393, 2134, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10644, 284, 2393, 393, 2393, 2134, 357, 4480, 5050, 4600, 36163, 47671, 4600, 961, 63, 737, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 262, 7552, 318, 1900, 11, 340, 3011, 8475, 625, 4600, 2339, 63, 618, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11236, 262, 5072, 5794, 13, 198, 220, 220, 220, 220, 220, 220, 220, 588, 1058, 2393, 393, 337, 6320, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1052, 7177, 319, 12, 39531, 326, 815, 307, 973, 355, 257, 11055, 329, 262, 649, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2393, 13, 6363, 20150, 14, 39786, 14, 14784, 481, 307, 17007, 9484, 355, 881, 355, 1744, 13, 198, 220, 220, 220, 220, 220, 220, 220, 13092, 1058, 1391, 6, 3919, 3256, 705, 4853, 452, 3256, 705, 21230, 3256, 705, 31642, 62, 11031, 3256, 705, 13271, 8635, 3256, 705, 411, 38765, 6, 5512, 4277, 11639, 13271, 8635, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 36357, 644, 1611, 286, 1366, 13092, 743, 3051, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4091, 4600, 44, 6320, 19182, 13, 2617, 62, 7890, 63, 198, 220, 220, 220, 220, 220, 220, 220, 20150, 1058, 8633, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3395, 14706, 284, 3650, 319, 11898, 13, 27068, 2810, 612, 481, 423, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8475, 625, 4600, 2339, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 7177, 393, 11192, 273, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 383, 7177, 9639, 287, 4088, 198, 220, 220, 220, 220, 220, 220, 220, 12608, 1058, 8633, 11, 611, 12608, 318, 407, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28261, 286, 12608, 9639, 355, 880, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 537, 82, 13, 37, 6255, 16594, 12331, 7203, 17410, 407, 9177, 287, 1398, 23884, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 565, 82, 13, 834, 3672, 834, 4008, 628, 220, 220, 220, 2488, 4871, 24396, 198, 220, 220, 220, 825, 3613, 69, 62, 3605, 7, 565, 82, 11, 4818, 11, 2393, 62, 2339, 11, 588, 28, 14202, 11, 12429, 38993, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 16594, 257, 27464, 7177, 284, 11898, 13, 628, 220, 220, 220, 220, 220, 220, 220, 770, 2163, 1838, 15657, 7747, 329, 262, 2393, 5794, 290, 198, 220, 220, 220, 220, 220, 220, 220, 663, 20150, 1912, 319, 262, 2393, 7552, 11, 262, 1366, 2099, 290, 262, 198, 220, 220, 220, 220, 220, 220, 220, 584, 3689, 2810, 13, 628, 220, 220, 220, 220, 220, 220, 220, 383, 5128, 1366, 2099, 1276, 307, 257, 12462, 966, 2099, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 11192, 273, 393, 7177, 393, 337, 6320, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6060, 284, 3551, 198, 220, 220, 220, 220, 220, 220, 220, 2393, 62, 2339, 1058, 965, 393, 2393, 2134, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10644, 284, 2393, 393, 2393, 2134, 357, 4480, 5050, 4600, 36163, 47671, 4600, 961, 63, 737, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 262, 7552, 318, 1900, 11, 340, 3011, 8475, 625, 4600, 2339, 63, 618, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 11236, 262, 5072, 5794, 13, 198, 220, 220, 220, 220, 220, 220, 220, 588, 1058, 2393, 393, 337, 6320, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1052, 7177, 319, 12, 39531, 326, 815, 307, 973, 355, 257, 11055, 329, 262, 649, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2393, 13, 6363, 20150, 14, 39786, 14, 14784, 481, 307, 17007, 9484, 355, 881, 355, 1744, 13, 198, 220, 220, 220, 220, 220, 220, 220, 20150, 1058, 8633, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3395, 14706, 284, 3650, 319, 11898, 13, 27068, 2810, 612, 481, 423, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 8475, 625, 4600, 2339, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 4818, 1058, 7177, 393, 11192, 273, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 383, 7177, 9639, 287, 4088, 198, 220, 220, 220, 220, 220, 220, 220, 12608, 1058, 8633, 11, 611, 12608, 318, 407, 6045, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 28261, 286, 12608, 9639, 355, 880, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 537, 82, 13, 37, 6255, 16594, 12331, 7203, 17410, 407, 9177, 287, 1398, 23884, 526, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 565, 82, 13, 834, 3672, 834, 4008, 628, 220, 220, 220, 825, 5576, 421, 1453, 2736, 7, 944, 11, 5391, 11, 299, 27740, 28, 16, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 4550, 257, 15793, 286, 2546, 352, 287, 2292, 4600, 27740, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 383, 15793, 318, 2087, 284, 262, 826, 286, 4600, 27740, 63, 611, 4600, 27740, 1279, 657, 63, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 340, 318, 2087, 284, 262, 1364, 286, 4600, 27740, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 48369, 7, 14202, 15437, 1635, 2116, 13, 27740, 198, 220, 220, 220, 220, 220, 220, 220, 611, 5391, 1279, 657, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 796, 2116, 13, 27740, 1343, 5391, 1343, 352, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 6376, 58, 25, 27740, 60, 1343, 29565, 14202, 60, 1635, 299, 27740, 8, 1343, 6376, 58, 27740, 47715, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 58, 83, 29291, 7, 9630, 15437, 628, 220, 220, 220, 825, 21229, 7, 944, 11, 5391, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 27914, 477, 15225, 286, 2546, 352, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 393, 8379, 58, 600, 4357, 11902, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 2810, 11, 691, 428, 15793, 318, 29650, 13, 632, 1635, 27238, 9, 307, 257, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15793, 286, 2546, 352, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 5391, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5391, 796, 685, 67, 329, 288, 287, 2837, 7, 944, 13, 27740, 8, 611, 2116, 13, 43358, 58, 67, 60, 6624, 352, 60, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 796, 787, 62, 4868, 7, 27740, 8, 198, 220, 220, 220, 220, 220, 220, 220, 299, 27740, 796, 18896, 7, 944, 13, 43358, 8, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 796, 685, 358, 320, 1343, 288, 611, 288, 1279, 657, 2073, 288, 329, 288, 287, 5391, 60, 198, 220, 220, 220, 220, 220, 220, 220, 611, 597, 7, 944, 13, 43358, 58, 67, 60, 14512, 352, 329, 288, 287, 5391, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 10786, 26950, 4733, 284, 21229, 1729, 12, 12215, 10565, 15225, 2637, 8, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 48369, 7, 14202, 8, 611, 288, 407, 287, 5391, 2073, 657, 329, 288, 287, 2837, 7, 944, 13, 27740, 15437, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 58, 83, 29291, 7, 9630, 15437, 628, 220, 220, 220, 825, 555, 21653, 7, 944, 11, 5391, 28, 15, 11, 1394, 27740, 28, 25101, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 11627, 974, 477, 26515, 1863, 15793, 4600, 27740, 63, 290, 4268, 326, 15793, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34024, 1863, 543, 284, 15014, 441, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1394, 27740, 1058, 20512, 11, 4277, 28, 25101, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2141, 407, 4268, 262, 15014, 6021, 15793, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 1351, 58, 44, 6320, 19182, 60, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 48369, 7, 14202, 15437, 1635, 2116, 13, 27740, 198, 220, 220, 220, 220, 220, 220, 220, 611, 1394, 27740, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 6376, 58, 25, 27740, 10, 16, 60, 1343, 685, 14202, 60, 1343, 6376, 58, 27740, 10, 16, 47715, 198, 220, 220, 220, 220, 220, 220, 220, 503, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 944, 13, 43358, 58, 27740, 60, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 58, 27740, 60, 796, 1312, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 503, 13, 33295, 7, 944, 58, 83, 29291, 7, 9630, 8, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 503, 628, 220, 220, 220, 825, 16058, 7, 944, 11, 22716, 11, 5391, 28, 15, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 41205, 262, 7177, 656, 4833, 26515, 286, 2546, 4600, 354, 2954, 63, 1863, 4600, 27740, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 22716, 1058, 493, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 7913, 286, 22716, 13, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41265, 1863, 543, 284, 6626, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 1351, 58, 44, 6320, 19182, 60, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 48369, 7, 14202, 15437, 1635, 2116, 13, 27740, 198, 220, 220, 220, 220, 220, 220, 220, 503, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 287, 2837, 7, 944, 13, 43358, 58, 27740, 60, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 58, 27740, 60, 796, 16416, 7, 72, 9, 354, 14125, 11, 357, 72, 10, 16, 27493, 354, 14125, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 503, 13, 33295, 7, 944, 58, 83, 29291, 7, 9630, 8, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 503, 628, 220, 220, 220, 825, 6626, 7, 944, 11, 22716, 11, 5391, 28, 15, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 41205, 262, 7177, 656, 4833, 26515, 1863, 4600, 27740, 44646, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 22716, 1058, 493, 393, 1351, 58, 600, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1002, 4600, 600, 63, 25, 7913, 286, 22716, 357, 3826, 4600, 944, 13, 354, 2954, 63, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 25974, 25, 12849, 286, 1123, 16058, 13, 12039, 2160, 284, 4600, 944, 13, 43358, 58, 27740, 60, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 41265, 1863, 543, 284, 6626, 13, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 1351, 58, 44, 6320, 19182, 60, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 611, 318, 39098, 7, 354, 14125, 11, 493, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1441, 2116, 13, 354, 2954, 7, 354, 14125, 11, 5391, 8, 198, 220, 220, 220, 220, 220, 220, 220, 22716, 796, 787, 62, 4868, 7, 354, 14125, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2160, 7, 354, 14125, 8, 14512, 2116, 13, 43358, 58, 27740, 5974, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 10786, 1925, 14125, 1276, 3002, 262, 1336, 15793, 13, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 30074, 23884, 290, 23884, 2637, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 764, 18982, 7, 16345, 7, 354, 14125, 828, 2116, 13, 43358, 58, 27740, 60, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 48369, 7, 14202, 15437, 1635, 2116, 13, 27740, 198, 220, 220, 220, 220, 220, 220, 220, 2180, 62, 354, 14125, 796, 657, 198, 220, 220, 220, 220, 220, 220, 220, 503, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 16058, 287, 22716, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 58, 27740, 60, 796, 16416, 7, 3866, 1442, 62, 354, 14125, 11, 2180, 62, 354, 14125, 10, 354, 2954, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 503, 13, 33295, 7, 944, 58, 83, 29291, 7, 9630, 8, 12962, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2180, 62, 354, 14125, 15853, 16058, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 503, 628, 220, 220, 220, 825, 6518, 62, 11085, 7, 944, 11, 379, 293, 459, 28, 15, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 5990, 76, 1133, 262, 15225, 884, 326, 477, 21739, 34197, 389, 319, 262, 826, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 379, 293, 459, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6889, 1654, 326, 379, 1551, 428, 1271, 286, 1729, 12, 2777, 34961, 15225, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2152, 357, 3605, 34197, 389, 18846, 16062, 737, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 352, 8, 1445, 21739, 15225, 284, 262, 826, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 21739, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 288, 11, 318, 62, 2777, 34961, 287, 27056, 378, 7, 944, 13, 2777, 34961, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 318, 62, 2777, 34961, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 13, 33295, 7, 67, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9943, 13, 33295, 7, 67, 8, 198, 220, 220, 220, 220, 220, 220, 220, 299, 65, 62, 354, 8961, 796, 18896, 7, 16321, 8, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 796, 9943, 1343, 21739, 198, 220, 220, 220, 220, 220, 220, 220, 649, 796, 2116, 13, 16321, 1133, 7, 16321, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 362, 8, 751, 6518, 34197, 198, 220, 220, 220, 220, 220, 220, 220, 751, 62, 354, 8961, 796, 3509, 7, 15, 11, 379, 293, 459, 532, 299, 65, 62, 354, 8961, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 751, 62, 354, 8961, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 48369, 7, 14202, 15437, 1635, 299, 65, 62, 354, 8961, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 685, 14202, 60, 1635, 751, 62, 354, 8961, 3467, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1343, 685, 30639, 2419, 271, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 796, 649, 13, 48369, 7, 83, 29291, 7, 9630, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 649, 628, 220, 220, 220, 825, 6518, 62, 12957, 7, 944, 11, 379, 293, 459, 28, 15, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 5990, 76, 1133, 262, 15225, 884, 326, 477, 21739, 34197, 389, 319, 262, 1364, 13, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 379, 293, 459, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6889, 1654, 326, 379, 1551, 428, 1271, 286, 1729, 12, 2777, 34961, 15225, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2152, 357, 3605, 34197, 389, 18846, 16062, 737, 628, 220, 220, 220, 220, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 35656, 198, 220, 220, 220, 220, 220, 220, 220, 337, 6320, 19182, 628, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 352, 8, 1445, 21739, 15225, 284, 262, 826, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 21739, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 288, 11, 318, 62, 2777, 34961, 287, 27056, 378, 7, 944, 13, 2777, 34961, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 318, 62, 2777, 34961, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 21739, 13, 33295, 7, 67, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2073, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 9943, 13, 33295, 7, 67, 8, 198, 220, 220, 220, 220, 220, 220, 220, 299, 65, 62, 354, 8961, 796, 18896, 7, 16321, 8, 198, 220, 220, 220, 220, 220, 220, 220, 9943, 796, 21739, 1343, 9943, 198, 220, 220, 220, 220, 220, 220, 220, 649, 796, 2116, 13, 16321, 1133, 7, 16321, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 362, 8, 751, 6518, 34197, 198, 220, 220, 220, 220, 220, 220, 220, 751, 62, 354, 8961, 796, 3509, 7, 15, 11, 379, 293, 459, 532, 299, 65, 62, 354, 8961, 8, 198, 220, 220, 220, 220, 220, 220, 220, 611, 751, 62, 354, 8961, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 6376, 796, 685, 30639, 2419, 271, 60, 1343, 685, 14202, 60, 1635, 751, 62, 354, 8961, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 649, 796, 649, 13, 48369, 7, 83, 29291, 7, 9630, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 649, 628, 198, 4871, 5181, 19182, 7, 44, 6320, 19182, 2599, 198, 220, 220, 220, 37227, 32, 1673, 36686, 341, 286, 27661, 26515, 13, 628, 220, 220, 220, 770, 318, 5688, 7867, 416, 7166, 1673, 36686, 341, 286, 2393, 62, 18747, 287, 198, 220, 220, 220, 311, 5868, 25, 3740, 1378, 12567, 13, 785, 14, 2777, 76, 14, 2777, 76, 1065, 14, 2436, 672, 14, 9866, 14, 31, 7753, 62, 18747, 14, 9246, 13, 76, 628, 220, 220, 220, 37227, 628, 220, 220, 220, 4808, 3258, 592, 25, 46545, 796, 17635, 198, 220, 220, 220, 4808, 27740, 62, 9246, 25, 493, 796, 6045, 628, 220, 220, 220, 1303, 29135, 12608, 198, 220, 220, 220, 277, 3672, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 69, 3672, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 2393, 26801, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 7753, 26801, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 318, 62, 5589, 2790, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 271, 62, 5589, 2790, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 288, 4906, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 67, 4906, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 22638, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 6649, 3008, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 987, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 3849, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 4808, 43358, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13557, 43358, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 4808, 27740, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13557, 27740, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 1527, 500, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 2001, 500, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 4808, 2001, 500, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13557, 2001, 500, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 21739, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 2777, 34961, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 4808, 2777, 34961, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13557, 2777, 34961, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 14369, 263, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 82, 677, 263, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 9943, 7094, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 16321, 7094, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 198, 220, 220, 220, 410, 1140, 417, 62, 7857, 796, 3119, 7, 50033, 2116, 25, 46545, 7, 64, 13, 85, 1140, 417, 62, 7857, 329, 257, 287, 2116, 13557, 3258, 592, 4008, 628, 220, 220, 220, 825, 11593, 15003, 834, 7, 944, 11, 26515, 11, 5391, 28, 15, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 628, 220, 220, 220, 220, 220, 220, 220, 40117, 198, 220, 220, 220, 220, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 26515, 1058, 8379, 58, 44, 6320, 19182, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 943, 20477, 284, 1673, 36686, 378, 13, 5334, 15268, 815, 307, 10411, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 1863, 15793, 4600, 27740, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34024, 1863, 2330, 284, 1673, 36686, 378, 262, 26515, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2208, 22446, 834, 15003, 834, 3419, 628, 220, 220, 220, 220, 220, 220, 220, 26515, 796, 1351, 7, 3258, 592, 8, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 796, 5391, 393, 657, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 27740, 62, 9246, 796, 5391, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 34182, 8794, 198, 220, 220, 220, 220, 220, 220, 220, 15268, 796, 17635, 198, 220, 220, 220, 220, 220, 220, 220, 329, 1312, 11, 7177, 287, 27056, 378, 7, 3258, 592, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 611, 407, 318, 39098, 7, 18747, 11, 337, 6320, 19182, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 5994, 12331, 10786, 20560, 26515, 815, 307, 4600, 44, 6320, 19182, 63, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 8625, 1817, 13, 11853, 23884, 2637, 11, 18982, 7, 4906, 7, 18747, 22305, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5485, 796, 1351, 7, 18747, 13, 43358, 8, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1619, 5485, 58, 27740, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15268, 13, 33295, 7, 43358, 8, 198, 220, 220, 220, 220, 220, 220, 220, 5485, 15, 11, 1635, 1477, 7916, 796, 15268, 198, 220, 220, 220, 220, 220, 220, 220, 611, 407, 477, 7, 43358, 6624, 5485, 15, 329, 5485, 287, 15268, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 5298, 11052, 12331, 10786, 2484, 7916, 286, 477, 1673, 36686, 515, 26515, 815, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 1350, 4961, 2845, 287, 262, 1673, 36686, 341, 15793, 2637, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 24061, 5072, 5485, 198, 220, 220, 220, 220, 220, 220, 220, 5485, 796, 1351, 7, 3258, 592, 58, 15, 4083, 43358, 8, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 82, 796, 685, 18747, 13, 43358, 58, 27740, 60, 329, 7177, 287, 26515, 60, 198, 220, 220, 220, 220, 220, 220, 220, 5485, 58, 27740, 60, 796, 2160, 7, 67, 12078, 8, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 43358, 796, 46545, 7, 43358, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 1673, 36686, 378, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13557, 3258, 592, 796, 46545, 7, 3258, 592, 8, 628, 220, 220, 220, 11593, 260, 1050, 834, 796, 11593, 2536, 834, 628, 198, 4299, 3797, 7, 3258, 592, 11, 5391, 28, 15, 2599, 198, 220, 220, 220, 37227, 3103, 9246, 268, 378, 27661, 26515, 1863, 257, 15793, 13, 628, 220, 220, 220, 40117, 198, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 26515, 1058, 8379, 58, 44, 6320, 19182, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 943, 20477, 284, 1673, 36686, 378, 13, 5334, 15268, 815, 307, 10411, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 1863, 15793, 4600, 27740, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34024, 1863, 2330, 284, 1673, 36686, 378, 262, 26515, 628, 220, 220, 220, 16409, 198, 220, 220, 220, 35656, 198, 220, 220, 220, 5181, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 317, 18975, 1673, 36686, 341, 286, 477, 5128, 26515, 13, 198, 220, 220, 220, 220, 220, 220, 220, 6363, 5485, 1863, 15793, 4600, 27740, 63, 318, 262, 2160, 286, 477, 5128, 15268, 198, 220, 220, 220, 220, 220, 220, 220, 1863, 15793, 4600, 27740, 44646, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 1441, 5181, 19182, 7, 3258, 592, 11, 5391, 8, 628, 198, 4299, 8931, 7, 3258, 592, 11, 5391, 28, 15, 2599, 198, 220, 220, 220, 37227, 25896, 27661, 26515, 1863, 257, 15793, 13, 628, 220, 220, 220, 40117, 198, 220, 220, 220, 24200, 438, 198, 220, 220, 220, 220, 220, 220, 220, 26515, 1058, 8379, 58, 44, 6320, 19182, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 943, 20477, 284, 1673, 36686, 378, 13, 5334, 15268, 815, 307, 10411, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2845, 1863, 15793, 4600, 27740, 44646, 198, 220, 220, 220, 220, 220, 220, 220, 5391, 1058, 493, 11, 4277, 28, 15, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 34024, 1863, 2330, 284, 1673, 36686, 378, 262, 26515, 628, 220, 220, 220, 16409, 198, 220, 220, 220, 35656, 198, 220, 220, 220, 5181, 19182, 198, 220, 220, 220, 220, 220, 220, 220, 317, 18975, 8931, 286, 477, 5128, 26515, 13, 628, 220, 220, 220, 37227, 198, 220, 220, 220, 26515, 796, 685, 18747, 13, 13271, 421, 1453, 2736, 7, 27740, 28, 27740, 8, 329, 7177, 287, 26515, 60, 198, 220, 220, 220, 1441, 3797, 7, 3258, 592, 11, 5391, 28, 27740, 8, 198 ]
2.262884
15,155
""" blit.py Call if you want to run everything """ import json import os import sys import integrate if __name__ == '__main__': sys.exit(main(sys.argv))
[ 37811, 198, 2436, 270, 13, 9078, 198, 198, 14134, 611, 345, 765, 284, 1057, 2279, 198, 37811, 628, 198, 11748, 33918, 198, 11748, 28686, 198, 11748, 25064, 628, 198, 11748, 19386, 628, 628, 198, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 25064, 13, 37023, 7, 12417, 7, 17597, 13, 853, 85, 4008, 198 ]
2.737705
61
from random import randint numeros = [] # programa principal sorteia() somapar()
[ 6738, 4738, 1330, 43720, 600, 198, 77, 6975, 418, 796, 17635, 198, 2, 1430, 64, 10033, 198, 30619, 68, 544, 3419, 198, 82, 296, 499, 283, 3419 ]
2.962963
27
import pickle import numpy as np #비선형 퍼셉트론 import matplotlib.pylab as plt import sys, os sys.path.append(os.pardir) from dataset.mnist import load_mnist from PIL import Image def step_function(x): ''' y = x > 0 return y.astype(np.int) #np.int와 dtype=int의 역할은 같다. ''' return np.array(x>0, dtype=int) #dtype의 역할은 출력 결과를 dtype=int등으로 통해 원하는 자료형으로 변형하는 것 ''' network=init_network() x=np.array([100,40]) y=forward(network, x) print(y) #print(y) #plt.plot(x,y) #plt.ylim(-0.1,1.1) #plt.show() ''' x_test,t_test = get_data() network=init_networrk_mnist() batch_size=100 accuracy_ct=0 for i in range(0, len(x_test), batch_size):#x_train의 실제 개수 몰라도 len함수 쓰면 된다 x_batch = x_test[i:i+batch_size] y_batch = predict(network, x_batch) p = np.argmax(y_batch, axis=1) #가장 확률이 높은 원소 가져오기? print(np.sum(p == t_test[i:i+batch_size])) accuracy_ct += np.sum(p == t_test[i:i+batch_size]) ''' y=predict(network, x_test[i]) p=np.argmax(y) if p==t_test[i] : accuracy_ct+=1 ''' print("Accuracy:",str(float(accuracy_ct)/len(x_test))) print(accuracy_ct) ''' img = x_train[0] label = t_train[0] print(label) print(img.shape) img = img.reshape(28,28) #이거 패턴화 28,28로 안하면 원하는 이미지 안나온다.-> 이거 이용해서 암호화나 용량 줄이기도 가능? print(img.shape) img_show(img) '''
[ 11748, 2298, 293, 198, 198, 11748, 299, 32152, 355, 45941, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 167, 117, 226, 168, 226, 254, 169, 246, 243, 220, 169, 235, 120, 168, 227, 231, 169, 232, 116, 167, 94, 254, 198, 11748, 2603, 29487, 8019, 13, 79, 2645, 397, 355, 458, 83, 198, 11748, 25064, 11, 28686, 198, 17597, 13, 6978, 13, 33295, 7, 418, 13, 26037, 343, 8, 198, 6738, 27039, 13, 10295, 396, 1330, 3440, 62, 10295, 396, 198, 6738, 350, 4146, 1330, 7412, 198, 4299, 2239, 62, 8818, 7, 87, 2599, 198, 220, 220, 220, 705, 7061, 198, 220, 220, 220, 331, 796, 2124, 1875, 657, 198, 220, 220, 220, 1441, 331, 13, 459, 2981, 7, 37659, 13, 600, 8, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 37659, 13, 600, 168, 247, 222, 288, 4906, 28, 600, 35975, 246, 23821, 245, 255, 47991, 254, 35975, 222, 220, 166, 108, 247, 46695, 97, 13, 198, 220, 220, 220, 705, 7061, 198, 220, 220, 220, 1441, 45941, 13, 18747, 7, 87, 29, 15, 11, 288, 4906, 28, 600, 8, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 67, 4906, 35975, 246, 23821, 245, 255, 47991, 254, 35975, 222, 23821, 114, 250, 167, 254, 98, 220, 166, 110, 108, 166, 111, 120, 167, 98, 120, 288, 4906, 28, 600, 167, 241, 109, 168, 250, 120, 167, 94, 250, 220, 169, 228, 113, 47991, 112, 23821, 249, 238, 47991, 246, 167, 232, 242, 23821, 252, 238, 167, 96, 234, 169, 246, 243, 168, 250, 120, 167, 94, 250, 31619, 111, 222, 169, 246, 243, 47991, 246, 167, 232, 242, 220, 166, 110, 225, 628, 198, 7061, 6, 198, 27349, 28, 15003, 62, 27349, 3419, 198, 198, 87, 28, 37659, 13, 18747, 26933, 3064, 11, 1821, 12962, 198, 88, 28, 11813, 7, 27349, 11, 2124, 8, 198, 4798, 7, 88, 8, 628, 198, 198, 2, 4798, 7, 88, 8, 628, 198, 198, 2, 489, 83, 13, 29487, 7, 87, 11, 88, 8, 198, 2, 489, 83, 13, 88, 2475, 32590, 15, 13, 16, 11, 16, 13, 16, 8, 198, 2, 489, 83, 13, 12860, 3419, 198, 7061, 6, 198, 87, 62, 9288, 11, 83, 62, 9288, 796, 651, 62, 7890, 3419, 198, 27349, 28, 15003, 62, 3262, 86, 38890, 74, 62, 10295, 396, 3419, 198, 198, 43501, 62, 7857, 28, 3064, 198, 4134, 23843, 62, 310, 28, 15, 198, 198, 1640, 1312, 287, 2837, 7, 15, 11, 18896, 7, 87, 62, 9288, 828, 15458, 62, 7857, 2599, 2, 87, 62, 27432, 35975, 246, 23821, 233, 97, 168, 254, 250, 220, 166, 108, 250, 168, 230, 246, 31619, 103, 108, 167, 251, 120, 167, 237, 226, 18896, 47991, 101, 168, 230, 246, 23821, 241, 108, 167, 102, 112, 31619, 238, 250, 46695, 97, 198, 220, 220, 220, 2124, 62, 43501, 796, 2124, 62, 9288, 58, 72, 25, 72, 10, 43501, 62, 7857, 60, 198, 220, 220, 220, 331, 62, 43501, 796, 4331, 7, 27349, 11, 2124, 62, 43501, 8, 198, 220, 220, 220, 279, 796, 45941, 13, 853, 9806, 7, 88, 62, 43501, 11, 16488, 28, 16, 8, 1303, 166, 108, 222, 168, 252, 98, 220, 169, 247, 243, 167, 98, 254, 35975, 112, 31619, 10253, 35975, 222, 23821, 249, 238, 168, 228, 234, 220, 166, 108, 222, 168, 254, 116, 168, 246, 97, 166, 116, 108, 30, 198, 220, 220, 220, 3601, 7, 37659, 13, 16345, 7, 79, 6624, 256, 62, 9288, 58, 72, 25, 72, 10, 43501, 62, 7857, 60, 4008, 198, 220, 220, 220, 9922, 62, 310, 15853, 45941, 13, 16345, 7, 79, 6624, 256, 62, 9288, 58, 72, 25, 72, 10, 43501, 62, 7857, 12962, 628, 220, 220, 220, 705, 7061, 198, 220, 220, 220, 331, 28, 79, 17407, 7, 27349, 11, 2124, 62, 9288, 58, 72, 12962, 198, 220, 220, 220, 279, 28, 37659, 13, 853, 9806, 7, 88, 8, 628, 220, 220, 220, 611, 279, 855, 83, 62, 9288, 58, 72, 60, 1058, 198, 220, 220, 220, 220, 220, 220, 220, 9922, 62, 310, 47932, 16, 198, 220, 220, 220, 705, 7061, 198, 4798, 7203, 17320, 23843, 25, 1600, 2536, 7, 22468, 7, 4134, 23843, 62, 310, 20679, 11925, 7, 87, 62, 9288, 22305, 198, 4798, 7, 4134, 23843, 62, 310, 8, 198, 7061, 6, 198, 9600, 796, 2124, 62, 27432, 58, 15, 60, 198, 18242, 796, 256, 62, 27432, 58, 15, 60, 198, 4798, 7, 18242, 8, 198, 198, 4798, 7, 9600, 13, 43358, 8, 198, 9600, 796, 33705, 13, 3447, 1758, 7, 2078, 11, 2078, 8, 1303, 35975, 112, 166, 109, 108, 220, 169, 234, 101, 169, 226, 112, 169, 247, 242, 2579, 11, 2078, 167, 94, 250, 23821, 243, 230, 47991, 246, 167, 102, 112, 23821, 249, 238, 47991, 246, 167, 232, 242, 23821, 251, 112, 167, 107, 116, 168, 100, 222, 23821, 243, 230, 167, 224, 246, 168, 246, 101, 46695, 97, 13, 3784, 23821, 251, 112, 166, 109, 108, 23821, 251, 112, 168, 248, 102, 47991, 112, 168, 226, 250, 23821, 243, 242, 169, 246, 116, 169, 247, 242, 167, 224, 246, 23821, 248, 102, 167, 253, 231, 23821, 97, 226, 35975, 112, 166, 116, 108, 167, 237, 226, 220, 166, 108, 222, 167, 232, 98, 30, 198, 4798, 7, 9600, 13, 43358, 8, 198, 198, 9600, 62, 12860, 7, 9600, 8, 198, 7061, 6, 198 ]
1.481768
905
# coding=utf-8 import copy from flask import Markup, url_for from flask.ext.security import Security, MongoEngineUserDatastore, user_registered from flask.ext.security.core import _SecurityState from flask.ext.security.core import _context_processor as security_default_context_processor from flask.ext.security.views import create_blueprint as security_create_blueprint from flask.ext.security.views import send_confirmation as security_send_confirmation from flask.ext.security.utils import send_mail from slideatlas import models from . import forms, views, login_provider from .principal import register_principal ################################################################################ __all__ = ('blueprint', 'register_with_app') ################################################################################ ################################################################################ # TODO: find a way of automatically registering Shibboleth users with the # appropriate group, similar to facebook_id ################################################################################ def add_config(app): """ Set Flask application configuration options. These are options that should never change. """ # Flask-Security configuration app.config.update( ### Frontend ### SECURITY_FLASH_MESSAGES=True, SECURITY_LOGIN_URL='/login', SECURITY_LOGIN_USER_TEMPLATE='security/login.html', SECURITY_MSG_DISABLED_ACCOUNT=('Password login is disabled for this account.', 'error'), SECURITY_LOGOUT_URL='/logout', # TODO: change '/sessions' to an endpoint name SECURITY_POST_LOGIN_VIEW='/sessions', SECURITY_POST_LOGOUT_VIEW='home', ### Password login options ### SECURITY_DEFAULT_REMEMBER_ME=False, ## New account registration SECURITY_REGISTERABLE=True, SECURITY_REGISTER_URL='/login/password/register', SECURITY_REGISTER_USER_TEMPLATE='security/register.html', SECURITY_SEND_REGISTER_EMAIL=True, SECURITY_EMAIL_SUBJECT_REGISTER='SlideAtlas: Account Created', # uses 'welcome' email body template # TODO: change the email body template, as the default contains a password confirmation link, and we want non-password users to receive a welcome email too ## Confirmation of user's email address SECURITY_CONFIRMABLE=True, SECURITY_CONFIRM_URL='/login/password/confirm', SECURITY_SEND_CONFIRMATION_TEMPLATE='security/resend_confirmation.html', SECURITY_EMAIL_SUBJECT_CONFIRM='SlideAtlas: Account Confirmation', # uses 'confirmation_instructions' email body template SECURITY_CONFIRM_EMAIL_WITHIN='5 days', SECURITY_LOGIN_WITHOUT_CONFIRMATION=False, SECURITY_MSG_EMAIL_CONFIRMED=( Markup( 'Welcome to SlideAtlas! Your account has been confirmed.<br>' '<br>' 'Site administrators may now grant you access to additional content. ' 'You can also contact <a href="mailto:%(email)s">%(email)s</a> with any requests.' % {'email': app.config['SLIDEATLAS_ADMIN_EMAIL']} ), 'success'), ## Recover / reset a lost password SECURITY_RECOVERABLE=True, SECURITY_RESET_URL='/login/password/reset', SECURITY_FORGOT_PASSWORD_TEMPLATE='security/password_reset_1.html', # step 1 SECURITY_RESET_PASSWORD_TEMPLATE='security/password_reset_2.html', # step 2 SECURITY_EMAIL_SUBJECT_PASSWORD_RESET='SlideAtlas: Password Reset Instructions', # uses 'reset_instructions' email body template SECURITY_RESET_PASSWORD_WITHIN='5 days', SECURITY_SEND_PASSWORD_RESET_NOTICE_EMAIL=False, # TODO: do we want to send a confirmation email? SECURITY_EMAIL_SUBJECT_PASSWORD_NOTICE='SlideAtlas: Password Reset Successful', # uses 'reset_notice' email body template ## Change a password SECURITY_CHANGEABLE=True, SECURITY_CHANGE_URL='/login/password/change', SECURITY_CHANGE_PASSWORD_TEMPLATE='security/password_change.html', SECURITY_SEND_PASSWORD_CHANGE_EMAIL=False, # TODO: do we want to send a confirmation email? SECURITY_EMAIL_SUBJECT_PASSWORD_CHANGE_NOTICE='SlideAtlas: Password Change Successful', # uses 'change notice' email body template ### Other options ### SECURITY_TRACKABLE=True, # record login statistics in User model SECURITY_PASSWORDLESS=False, # an experimental feature # custom salts can also be set for several other tokens, but this shouldn't be necessary # TODO: there are a few other undocumented config settings in Flask-Security, explore them ) # Flask-Login configuration app.config.update( SESSION_PROTECTION='basic', # some extra security for cookies, see documentation for details REMEMBER_COOKIE_DOMAIN=app.session_interface.get_cookie_domain(app), REMEMBER_COOKIE_HTTPONLY=True, REMEMBER_COOKIE_SECURE=app.config['SLIDEATLAS_HTTPS'], ) ################################################################################ ################################################################################
[ 2, 19617, 28, 40477, 12, 23, 198, 198, 11748, 4866, 198, 198, 6738, 42903, 1330, 2940, 929, 11, 19016, 62, 1640, 198, 6738, 42903, 13, 2302, 13, 12961, 1330, 4765, 11, 42591, 13798, 12982, 27354, 459, 382, 11, 2836, 62, 33736, 198, 6738, 42903, 13, 2302, 13, 12961, 13, 7295, 1330, 4808, 24074, 9012, 198, 6738, 42903, 13, 2302, 13, 12961, 13, 7295, 1330, 4808, 22866, 62, 41341, 355, 2324, 62, 12286, 62, 22866, 62, 41341, 198, 6738, 42903, 13, 2302, 13, 12961, 13, 33571, 1330, 2251, 62, 17585, 4798, 355, 2324, 62, 17953, 62, 17585, 4798, 198, 6738, 42903, 13, 2302, 13, 12961, 13, 33571, 1330, 3758, 62, 10414, 36241, 355, 2324, 62, 21280, 62, 10414, 36241, 198, 6738, 42903, 13, 2302, 13, 12961, 13, 26791, 1330, 3758, 62, 4529, 198, 198, 6738, 10649, 265, 21921, 1330, 4981, 198, 6738, 764, 1330, 5107, 11, 5009, 11, 17594, 62, 15234, 1304, 198, 6738, 764, 1050, 1939, 8521, 1330, 7881, 62, 1050, 1939, 8521, 198, 198, 29113, 29113, 14468, 198, 834, 439, 834, 796, 19203, 17585, 4798, 3256, 705, 30238, 62, 4480, 62, 1324, 11537, 628, 198, 29113, 29113, 14468, 628, 198, 29113, 29113, 14468, 198, 2, 16926, 46, 25, 1064, 257, 835, 286, 6338, 28336, 44254, 45693, 400, 2985, 351, 262, 198, 2, 220, 220, 5035, 1448, 11, 2092, 284, 23960, 62, 312, 628, 198, 29113, 29113, 14468, 198, 4299, 751, 62, 11250, 7, 1324, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 5345, 46947, 3586, 8398, 3689, 13, 628, 220, 220, 220, 2312, 389, 3689, 326, 815, 1239, 1487, 13, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 1303, 46947, 12, 24074, 8398, 198, 220, 220, 220, 598, 13, 11250, 13, 19119, 7, 198, 220, 220, 220, 220, 220, 220, 220, 44386, 8880, 437, 44386, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 3697, 11211, 62, 44, 1546, 4090, 48075, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 25294, 1268, 62, 21886, 11639, 14, 38235, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 25294, 1268, 62, 29904, 62, 51, 3620, 6489, 6158, 11639, 12961, 14, 38235, 13, 6494, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 5653, 38, 62, 26288, 6242, 30465, 62, 26861, 28270, 28, 10786, 35215, 17594, 318, 10058, 329, 428, 1848, 2637, 11, 705, 18224, 33809, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 25294, 12425, 62, 21886, 11639, 14, 6404, 448, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 16926, 46, 25, 1487, 31051, 82, 6202, 6, 284, 281, 36123, 1438, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 32782, 62, 25294, 1268, 62, 28206, 11639, 14, 82, 6202, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 32782, 62, 25294, 12425, 62, 28206, 11639, 11195, 3256, 628, 220, 220, 220, 220, 220, 220, 220, 44386, 30275, 17594, 3689, 44386, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 7206, 38865, 62, 40726, 28952, 62, 11682, 28, 25101, 11, 628, 220, 220, 220, 220, 220, 220, 220, 22492, 968, 1848, 9352, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 31553, 41517, 17534, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 31553, 41517, 62, 21886, 11639, 14, 38235, 14, 28712, 14, 30238, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 31553, 41517, 62, 29904, 62, 51, 3620, 6489, 6158, 11639, 12961, 14, 30238, 13, 6494, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 50, 10619, 62, 31553, 41517, 62, 27630, 4146, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 27630, 4146, 62, 50, 10526, 23680, 62, 31553, 41517, 11639, 11122, 485, 2953, 21921, 25, 10781, 15622, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 3544, 705, 86, 9571, 6, 3053, 1767, 11055, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 16926, 46, 25, 1487, 262, 3053, 1767, 11055, 11, 355, 262, 4277, 4909, 257, 9206, 12641, 2792, 11, 290, 356, 765, 1729, 12, 28712, 2985, 284, 3328, 257, 7062, 3053, 1165, 628, 220, 220, 220, 220, 220, 220, 220, 22492, 7326, 36241, 286, 2836, 338, 3053, 2209, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 10943, 39776, 5673, 19146, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 10943, 39776, 44, 62, 21886, 11639, 14, 38235, 14, 28712, 14, 10414, 2533, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 50, 10619, 62, 10943, 39776, 44, 6234, 62, 51, 3620, 6489, 6158, 11639, 12961, 14, 411, 437, 62, 10414, 36241, 13, 6494, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 27630, 4146, 62, 50, 10526, 23680, 62, 10943, 39776, 44, 11639, 11122, 485, 2953, 21921, 25, 10781, 7326, 36241, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 3544, 705, 10414, 36241, 62, 259, 7249, 507, 6, 3053, 1767, 11055, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 10943, 39776, 44, 62, 27630, 4146, 62, 54, 10554, 1268, 11639, 20, 1528, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 25294, 1268, 62, 54, 10554, 12425, 62, 10943, 39776, 44, 6234, 28, 25101, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 5653, 38, 62, 27630, 4146, 62, 10943, 39776, 30733, 16193, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2940, 929, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 14618, 284, 37651, 2953, 21921, 0, 3406, 1848, 468, 587, 4999, 29847, 1671, 29, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 27, 1671, 29, 6, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 29123, 18618, 743, 783, 7264, 345, 1895, 284, 3224, 2695, 13, 705, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 1639, 460, 635, 2800, 1279, 64, 13291, 2625, 4529, 1462, 25, 4, 7, 12888, 8, 82, 5320, 4, 7, 12888, 8, 82, 3556, 64, 29, 351, 597, 7007, 2637, 4064, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1391, 6, 12888, 10354, 598, 13, 11250, 17816, 8634, 14114, 1404, 43, 1921, 62, 2885, 23678, 62, 27630, 4146, 20520, 92, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10612, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 13138, 33809, 628, 220, 220, 220, 220, 220, 220, 220, 22492, 49107, 1220, 13259, 257, 2626, 9206, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 2200, 8220, 5959, 17534, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 19535, 2767, 62, 21886, 11639, 14, 38235, 14, 28712, 14, 42503, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 13775, 38, 2394, 62, 47924, 54, 12532, 62, 51, 3620, 6489, 6158, 11639, 12961, 14, 28712, 62, 42503, 62, 16, 13, 6494, 3256, 220, 1303, 2239, 352, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 19535, 2767, 62, 47924, 54, 12532, 62, 51, 3620, 6489, 6158, 11639, 12961, 14, 28712, 62, 42503, 62, 17, 13, 6494, 3256, 220, 1303, 2239, 362, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 27630, 4146, 62, 50, 10526, 23680, 62, 47924, 54, 12532, 62, 19535, 2767, 11639, 11122, 485, 2953, 21921, 25, 30275, 30027, 27759, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 3544, 705, 42503, 62, 259, 7249, 507, 6, 3053, 1767, 11055, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 19535, 2767, 62, 47924, 54, 12532, 62, 54, 10554, 1268, 11639, 20, 1528, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 50, 10619, 62, 47924, 54, 12532, 62, 19535, 2767, 62, 11929, 8476, 62, 27630, 4146, 28, 25101, 11, 220, 1303, 16926, 46, 25, 466, 356, 765, 284, 3758, 257, 12641, 3053, 30, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 27630, 4146, 62, 50, 10526, 23680, 62, 47924, 54, 12532, 62, 11929, 8476, 11639, 11122, 485, 2953, 21921, 25, 30275, 30027, 16282, 913, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 3544, 705, 42503, 62, 42138, 6, 3053, 1767, 11055, 628, 220, 220, 220, 220, 220, 220, 220, 22492, 9794, 257, 9206, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 3398, 27746, 17534, 28, 17821, 11, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 3398, 27746, 62, 21886, 11639, 14, 38235, 14, 28712, 14, 3803, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 3398, 27746, 62, 47924, 54, 12532, 62, 51, 3620, 6489, 6158, 11639, 12961, 14, 28712, 62, 3803, 13, 6494, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 50, 10619, 62, 47924, 54, 12532, 62, 3398, 27746, 62, 27630, 4146, 28, 25101, 11, 220, 1303, 16926, 46, 25, 466, 356, 765, 284, 3758, 257, 12641, 3053, 30, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 27630, 4146, 62, 50, 10526, 23680, 62, 47924, 54, 12532, 62, 3398, 27746, 62, 11929, 8476, 11639, 11122, 485, 2953, 21921, 25, 30275, 9794, 16282, 913, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 3544, 705, 3803, 4003, 6, 3053, 1767, 11055, 628, 220, 220, 220, 220, 220, 220, 220, 44386, 3819, 3689, 44386, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 5446, 8120, 17534, 28, 17821, 11, 220, 1303, 1700, 17594, 7869, 287, 11787, 2746, 198, 220, 220, 220, 220, 220, 220, 220, 10729, 4261, 9050, 62, 47924, 54, 12532, 48481, 28, 25101, 11, 220, 1303, 281, 11992, 3895, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 2183, 37056, 460, 635, 307, 900, 329, 1811, 584, 16326, 11, 475, 428, 6584, 470, 307, 3306, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 16926, 46, 25, 612, 389, 257, 1178, 584, 21829, 4566, 6460, 287, 46947, 12, 24074, 11, 7301, 606, 198, 220, 220, 220, 1267, 628, 220, 220, 220, 1303, 46947, 12, 47790, 8398, 198, 220, 220, 220, 598, 13, 11250, 13, 19119, 7, 198, 220, 220, 220, 220, 220, 220, 220, 311, 47621, 62, 4805, 2394, 24565, 11639, 35487, 3256, 220, 1303, 617, 3131, 2324, 329, 14746, 11, 766, 10314, 329, 3307, 628, 220, 220, 220, 220, 220, 220, 220, 22657, 28952, 62, 34, 15308, 10008, 62, 39170, 29833, 28, 1324, 13, 29891, 62, 39994, 13, 1136, 62, 44453, 62, 27830, 7, 1324, 828, 628, 220, 220, 220, 220, 220, 220, 220, 22657, 28952, 62, 34, 15308, 10008, 62, 40717, 1340, 11319, 28, 17821, 11, 628, 220, 220, 220, 220, 220, 220, 220, 22657, 28952, 62, 34, 15308, 10008, 62, 23683, 11335, 28, 1324, 13, 11250, 17816, 8634, 14114, 1404, 43, 1921, 62, 6535, 28820, 6, 4357, 198, 220, 220, 220, 1267, 628, 198, 29113, 29113, 14468, 628, 198, 29113, 29113, 14468, 198 ]
2.77853
1,919
from django.shortcuts import render from django.urls import reverse from django.http import Http404, HttpResponseRedirect from flight.models import Flight, Passenger def index(request): ''' display all flights ''' context = { 'main_header': 'Flights', 'title': 'Flights', 'flights': Flight.objects.all() } return render(request, 'flight/index.html', context) def flight(request, flight_id): ''' return individual flight details and passengers on this flight''' try: flight = Flight.objects.get(pk=flight_id) except Flight.DoesNotExist: raise Http404(f'Flight {flight} does not exist.') context = { 'flight': flight, 'passengers': flight.passengers.all(), 'non_passengers': Passenger.objects.exclude(flight=flight).all(), 'number_of_passengers': flight.passengers.count() } return render(request, 'flight/flight.html', context)
[ 6738, 42625, 14208, 13, 19509, 23779, 1330, 8543, 198, 6738, 42625, 14208, 13, 6371, 82, 1330, 9575, 198, 6738, 42625, 14208, 13, 4023, 1330, 367, 29281, 26429, 11, 367, 29281, 31077, 7738, 1060, 198, 6738, 5474, 13, 27530, 1330, 13365, 11, 47239, 198, 198, 4299, 6376, 7, 25927, 2599, 198, 220, 220, 220, 705, 7061, 3359, 477, 13956, 705, 7061, 198, 220, 220, 220, 4732, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 12417, 62, 25677, 10354, 705, 7414, 2337, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 7839, 10354, 705, 7414, 2337, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 705, 2704, 2337, 10354, 13365, 13, 48205, 13, 439, 3419, 198, 220, 220, 220, 1782, 198, 220, 220, 220, 1441, 8543, 7, 25927, 11, 705, 22560, 14, 9630, 13, 6494, 3256, 4732, 8, 198, 198, 4299, 5474, 7, 25927, 11, 5474, 62, 312, 2599, 198, 220, 220, 220, 705, 7061, 1441, 1981, 5474, 3307, 290, 10405, 319, 428, 5474, 7061, 6, 198, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 5474, 796, 13365, 13, 48205, 13, 1136, 7, 79, 74, 28, 22560, 62, 312, 8, 198, 220, 220, 220, 2845, 13365, 13, 13921, 3673, 3109, 396, 25, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 367, 29281, 26429, 7, 69, 6, 43069, 1391, 22560, 92, 857, 407, 2152, 2637, 8, 198, 220, 220, 220, 4732, 796, 1391, 198, 220, 220, 220, 220, 220, 220, 220, 705, 22560, 10354, 5474, 11, 198, 220, 220, 220, 220, 220, 220, 220, 705, 6603, 9302, 10354, 5474, 13, 6603, 9302, 13, 439, 22784, 198, 220, 220, 220, 220, 220, 220, 220, 705, 13159, 62, 6603, 9302, 10354, 47239, 13, 48205, 13, 1069, 9152, 7, 22560, 28, 22560, 737, 439, 22784, 198, 220, 220, 220, 220, 220, 220, 220, 705, 17618, 62, 1659, 62, 6603, 9302, 10354, 5474, 13, 6603, 9302, 13, 9127, 3419, 198, 220, 220, 220, 1782, 628, 220, 220, 220, 1441, 8543, 7, 25927, 11, 705, 22560, 14, 22560, 13, 6494, 3256, 4732, 8, 198 ]
2.722543
346
from setuptools import setup, find_packages, Extension from torch.utils import cpp_extension setup( name='my_lib', version='0.0', description='Learning setup', packages=find_packages(), ext_package='trt_pose', ext_modules=[cpp_extension.CppExtension('plugins', [ 'Learn_cpp/learn.cpp', ])], cmdclass={'build_ext': cpp_extension.BuildExtension}, install_requires=[ ], )
[ 6738, 900, 37623, 10141, 1330, 9058, 11, 1064, 62, 43789, 11, 27995, 198, 6738, 28034, 13, 26791, 1330, 269, 381, 62, 2302, 3004, 628, 198, 40406, 7, 198, 220, 220, 220, 1438, 11639, 1820, 62, 8019, 3256, 198, 220, 220, 220, 2196, 11639, 15, 13, 15, 3256, 198, 220, 220, 220, 6764, 11639, 41730, 9058, 3256, 198, 220, 220, 220, 10392, 28, 19796, 62, 43789, 22784, 198, 220, 220, 220, 1070, 62, 26495, 11639, 2213, 83, 62, 3455, 3256, 198, 220, 220, 220, 1070, 62, 18170, 41888, 20322, 62, 2302, 3004, 13, 34, 381, 11627, 3004, 10786, 37390, 3256, 685, 198, 220, 220, 220, 220, 220, 220, 220, 705, 20238, 62, 20322, 14, 35720, 13, 20322, 3256, 198, 220, 220, 220, 33761, 4357, 198, 220, 220, 220, 23991, 4871, 34758, 6, 11249, 62, 2302, 10354, 269, 381, 62, 2302, 3004, 13, 15580, 11627, 3004, 5512, 198, 220, 220, 220, 2721, 62, 47911, 41888, 198, 220, 220, 220, 16589, 198, 8, 198 ]
2.602484
161
# -*- coding: utf-8 -*- from typing import Optional from pymarc import Field from unidecode import unidecode, UnidecodeError from bookops_callno.errors import CallNoConstructorError def remove_trailing_punctuation(value: str) -> str: """ Removes any trailing periods, commas, etc. Args: value: string to be processed Returns: value """ if not isinstance(value, str): raise CallNoConstructorError( "Invalid 'value' type used in argument. Must be a string." ) while value[-1] in ".,:;-() ": value = value[:-1] return value def normalize_value(value: str) -> str: """ Removes diacritics from string and changes to uppercase """ if not value: return "" elif not isinstance(value, str): raise CallNoConstructorError( "Invalid 'value' type used in argument. Must be a string." ) try: value = value.replace("\u02b9", "") # Russian: modifier letter prime value = value.replace("\u02bb", "") # Arabic modifier letter turned comma value = value.replace("'", "") value = unidecode(value, errors="strict") value = remove_trailing_punctuation(value).upper() return value except UnidecodeError as exc: raise CallNoConstructorError( f"Unsupported character encountered. Error: '{exc}'." ) def corporate_name_first_word(field: Field = None) -> Optional[str]: """ Returns the uppdercase first word of the corporate entity from the 110 MARC tag Args: field: pymarc.Field instance Returns: name """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "110": return None words = field["a"].strip().split(" ") name = normalize_value(words[0]) return name def corporate_name_full(field: Field = None) -> Optional[str]: """ Returns an uppercase full name of corporate entity. Uses the 110 MARC tag Args: field: pymarc.Field instance Returns: name """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag not in ("110", "610"): return None phrases = field["a"].strip().split("(") name = normalize_value(phrases[0]) return name def corporate_name_initial(field: Field = None) -> Optional[str]: """ Returns the uppercase first letter of the corporate entity based on the 110 MARC tag Args: field: pymarc.Field instance Returns: initial """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "110": return None name = field["a"] name = normalize_value(name) initial = name[0] return initial def personal_name_initial(field: Field = None) -> Optional[str]: """ Returns the first letter of the last name of a personal author Args: field: pymarc.Field instance Returns initial """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "100": return None name = field["a"].strip() name = normalize_value(name) initial = name[0] return initial def personal_name_surname(field: Field = None) -> Optional[str]: """ Returns an uppercase surname of personal author. Includes any numeration from the subield $b of 100 or 600 MARC tag. Args: field: pymarc.Field instance Returns: name """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag not in ("100", "600"): return None elif field.indicator1 not in ("0", "1"): return None sub_a = field["a"].strip() # include subfield $b if present try: sub_b = field["b"].strip() name = f"{sub_a} {sub_b}" except AttributeError: name = sub_a name = normalize_value(name) # stop at comma to select surname try: stop = name.index(",") name = name[:stop] except ValueError: pass return name def subject_corporate_name(field: Field = None) -> Optional[str]: """ Returns an uppercase corporate name to be used in subject segment of the call number based on MARC tag 610 Args: field: pymarc.Field instance Returns: name """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "610": return None name = corporate_name_full(field) return name def subject_family_name(field: Field = None) -> Optional[str]: """ Returns an uppercase family name based on the 600 MARC tag Args: field: pymarc.Field instance Returns: name """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "600": return None elif field.indicator1 != "3": return None try: stop = field["a"].index("family") name = field["a"][:stop] except ValueError: return None name = normalize_value(name) return name def subject_personal_name(field: Field = None) -> Optional[str]: """ Returns personal name to be used in subject segment of the call number. Use for biography or Dewey + Name patters, examples: biography: B LOUIS XIV C criticizm of works of an author: 813 ADAMS C Args: field: pymarc.Field instance Returns: name """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "600": return None name = personal_name_surname(field) return name def subject_topic(field: Field = None) -> Optional[str]: """ Returns an uppercase topic to be used in the subject segment of the call number based on MARC tag 650. Valid only for BPL call numbers. Examples: programming language, name of operating system, etc. Args: field: pymarc.Field instance Returns: topic """ pass def title_first_word(field: Field = None) -> Optional[str]: """ Returns an uppercase first word (skipping any articles) of the title field (245 MARC tag subfield $a). Args: field: pymarc.Field instance Returns: word """ pass def title_initial(field: Field = None) -> Optional[str]: """ Returns an uppercase initial (skipping any articles) of the title field (245 MARC tag subfield $a). Args: field: pymarc.Field instance Returns: initial """ if field is None: return None elif not isinstance(field, Field): raise CallNoConstructorError( "Invalid 'field' argument type. Must be pymarc.Field instance." ) if field.tag != "245": return None try: ind2 = int(field.indicator2) except ValueError: return None title = field["a"][ind2:] title = normalize_value(title) initial = title[0] return initial
[ 2, 532, 9, 12, 19617, 25, 3384, 69, 12, 23, 532, 9, 12, 198, 198, 6738, 19720, 1330, 32233, 198, 198, 6738, 12972, 3876, 66, 1330, 7663, 198, 6738, 555, 485, 8189, 1330, 555, 485, 8189, 11, 791, 485, 8189, 12331, 628, 198, 6738, 1492, 2840, 62, 13345, 3919, 13, 48277, 1330, 4889, 2949, 42316, 273, 12331, 628, 198, 4299, 4781, 62, 9535, 4386, 62, 79, 16260, 2288, 7, 8367, 25, 965, 8, 4613, 965, 25, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 3982, 5241, 597, 25462, 9574, 11, 725, 292, 11, 3503, 13, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4731, 284, 307, 13686, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 407, 318, 39098, 7, 8367, 11, 965, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 8367, 6, 2099, 973, 287, 4578, 13, 12039, 307, 257, 4731, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 981, 1988, 58, 12, 16, 60, 287, 366, 1539, 25, 26, 12, 3419, 366, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 796, 1988, 58, 21912, 16, 60, 198, 220, 220, 220, 1441, 1988, 628, 198, 4299, 3487, 1096, 62, 8367, 7, 8367, 25, 965, 8, 4613, 965, 25, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 3982, 5241, 2566, 330, 799, 873, 422, 4731, 290, 2458, 284, 334, 39921, 589, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 407, 1988, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 13538, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 8367, 11, 965, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 8367, 6, 2099, 973, 287, 4578, 13, 12039, 307, 257, 4731, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 796, 1988, 13, 33491, 7203, 59, 84, 2999, 65, 24, 1600, 366, 4943, 220, 1303, 3394, 25, 23157, 3850, 6994, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 796, 1988, 13, 33491, 7203, 59, 84, 2999, 11848, 1600, 366, 4943, 220, 1303, 17526, 23157, 3850, 2900, 39650, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 796, 1988, 13, 33491, 7203, 6, 1600, 366, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 796, 555, 485, 8189, 7, 8367, 11, 8563, 2625, 301, 2012, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 1988, 796, 4781, 62, 9535, 4386, 62, 79, 16260, 2288, 7, 8367, 737, 45828, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 1988, 198, 220, 220, 220, 2845, 791, 485, 8189, 12331, 355, 2859, 25, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 277, 1, 3118, 15999, 2095, 12956, 13, 13047, 25, 705, 90, 41194, 92, 30827, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 198, 4299, 6355, 62, 3672, 62, 11085, 62, 4775, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 262, 334, 381, 1082, 7442, 717, 1573, 286, 262, 6355, 9312, 422, 198, 220, 220, 220, 262, 9796, 18805, 34, 7621, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 11442, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 2456, 796, 2214, 14692, 64, 1, 4083, 36311, 22446, 35312, 7203, 366, 8, 198, 220, 220, 220, 1438, 796, 3487, 1096, 62, 8367, 7, 10879, 58, 15, 12962, 198, 220, 220, 220, 1441, 1438, 628, 198, 4299, 6355, 62, 3672, 62, 12853, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 1336, 1438, 286, 6355, 9312, 13, 198, 220, 220, 220, 36965, 262, 9796, 18805, 34, 7621, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 198, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 407, 287, 5855, 11442, 1600, 366, 39132, 1, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 20144, 796, 2214, 14692, 64, 1, 4083, 36311, 22446, 35312, 7203, 7, 4943, 198, 220, 220, 220, 1438, 796, 3487, 1096, 62, 8367, 7, 746, 81, 1386, 58, 15, 12962, 198, 220, 220, 220, 1441, 1438, 628, 198, 4299, 6355, 62, 3672, 62, 36733, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 262, 334, 39921, 589, 717, 3850, 286, 262, 6355, 9312, 198, 220, 220, 220, 1912, 319, 262, 9796, 18805, 34, 7621, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 4238, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 11442, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1438, 796, 2214, 14692, 64, 8973, 198, 220, 220, 220, 1438, 796, 3487, 1096, 62, 8367, 7, 3672, 8, 198, 220, 220, 220, 4238, 796, 1438, 58, 15, 60, 198, 220, 220, 220, 1441, 4238, 628, 198, 4299, 2614, 62, 3672, 62, 36733, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 262, 717, 3850, 286, 262, 938, 1438, 286, 257, 2614, 1772, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 198, 220, 220, 220, 220, 220, 220, 220, 4238, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 3064, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1438, 796, 2214, 14692, 64, 1, 4083, 36311, 3419, 198, 220, 220, 220, 1438, 796, 3487, 1096, 62, 8367, 7, 3672, 8, 198, 220, 220, 220, 4238, 796, 1438, 58, 15, 60, 198, 220, 220, 220, 1441, 4238, 628, 198, 4299, 2614, 62, 3672, 62, 82, 700, 480, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 40358, 286, 2614, 1772, 13, 29581, 597, 5470, 341, 422, 198, 220, 220, 220, 262, 850, 1164, 720, 65, 286, 1802, 393, 10053, 18805, 34, 7621, 13, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 407, 287, 5855, 3064, 1600, 366, 8054, 1, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 2214, 13, 521, 26407, 16, 407, 287, 5855, 15, 1600, 366, 16, 1, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 850, 62, 64, 796, 2214, 14692, 64, 1, 4083, 36311, 3419, 628, 220, 220, 220, 1303, 2291, 850, 3245, 720, 65, 611, 1944, 198, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 850, 62, 65, 796, 2214, 14692, 65, 1, 4083, 36311, 3419, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 796, 277, 1, 90, 7266, 62, 64, 92, 1391, 7266, 62, 65, 36786, 198, 220, 220, 220, 2845, 3460, 4163, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 796, 850, 62, 64, 628, 220, 220, 220, 1438, 796, 3487, 1096, 62, 8367, 7, 3672, 8, 628, 220, 220, 220, 1303, 2245, 379, 39650, 284, 2922, 40358, 198, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2245, 796, 1438, 13, 9630, 7, 2430, 8, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 796, 1438, 58, 25, 11338, 60, 198, 220, 220, 220, 2845, 11052, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1208, 628, 220, 220, 220, 1441, 1438, 628, 198, 4299, 2426, 62, 10215, 38133, 62, 3672, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 6355, 1438, 284, 307, 973, 287, 2426, 10618, 198, 220, 220, 220, 286, 262, 869, 1271, 1912, 319, 18805, 34, 7621, 44300, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 39132, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1438, 796, 6355, 62, 3672, 62, 12853, 7, 3245, 8, 198, 220, 220, 220, 1441, 1438, 628, 198, 4299, 2426, 62, 17989, 62, 3672, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 1641, 1438, 1912, 319, 262, 10053, 18805, 34, 7621, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 8054, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 2214, 13, 521, 26407, 16, 14512, 366, 18, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2245, 796, 2214, 14692, 64, 1, 4083, 9630, 7203, 17989, 4943, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 796, 2214, 14692, 64, 1, 7131, 25, 11338, 60, 198, 220, 220, 220, 2845, 11052, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1438, 796, 3487, 1096, 62, 8367, 7, 3672, 8, 198, 220, 220, 220, 1441, 1438, 628, 198, 4299, 2426, 62, 22682, 62, 3672, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 2614, 1438, 284, 307, 973, 287, 2426, 10618, 286, 262, 869, 198, 220, 220, 220, 1271, 13, 5765, 329, 26444, 393, 25075, 2959, 1343, 6530, 1458, 1010, 11, 6096, 25, 198, 220, 220, 220, 220, 220, 220, 220, 26444, 25, 347, 406, 2606, 1797, 42667, 327, 198, 220, 220, 220, 220, 220, 220, 220, 4014, 528, 76, 286, 2499, 286, 281, 1772, 25, 807, 1485, 5984, 40834, 327, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1438, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 8054, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1438, 796, 2614, 62, 3672, 62, 82, 700, 480, 7, 3245, 8, 198, 220, 220, 220, 1441, 1438, 628, 198, 4299, 2426, 62, 26652, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 7243, 284, 307, 973, 287, 262, 2426, 10618, 286, 262, 869, 198, 220, 220, 220, 1271, 1912, 319, 18805, 34, 7621, 22626, 13, 48951, 691, 329, 347, 6489, 869, 3146, 13, 198, 220, 220, 220, 21066, 25, 8300, 3303, 11, 1438, 286, 5361, 1080, 11, 3503, 13, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 7243, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 1208, 628, 198, 4299, 3670, 62, 11085, 62, 4775, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 717, 1573, 357, 20545, 2105, 597, 6685, 8, 286, 198, 220, 220, 220, 262, 3670, 2214, 357, 22995, 18805, 34, 7621, 850, 3245, 720, 64, 737, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1573, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 1208, 628, 198, 4299, 3670, 62, 36733, 7, 3245, 25, 7663, 796, 6045, 8, 4613, 32233, 58, 2536, 5974, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 16409, 281, 334, 39921, 589, 4238, 357, 20545, 2105, 597, 6685, 8, 286, 198, 220, 220, 220, 262, 3670, 2214, 357, 22995, 18805, 34, 7621, 850, 3245, 720, 64, 737, 628, 220, 220, 220, 943, 14542, 25, 198, 220, 220, 220, 220, 220, 220, 220, 2214, 25, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 12972, 3876, 66, 13, 15878, 4554, 628, 220, 220, 220, 16409, 25, 198, 220, 220, 220, 220, 220, 220, 220, 4238, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 611, 2214, 318, 6045, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 198, 220, 220, 220, 1288, 361, 407, 318, 39098, 7, 3245, 11, 7663, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 5298, 4889, 2949, 42316, 273, 12331, 7, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 366, 44651, 705, 3245, 6, 4578, 2099, 13, 12039, 307, 12972, 3876, 66, 13, 15878, 4554, 526, 198, 220, 220, 220, 220, 220, 220, 220, 1267, 628, 220, 220, 220, 611, 2214, 13, 12985, 14512, 366, 22995, 1298, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 1949, 25, 198, 220, 220, 220, 220, 220, 220, 220, 773, 17, 796, 493, 7, 3245, 13, 521, 26407, 17, 8, 198, 220, 220, 220, 2845, 11052, 12331, 25, 198, 220, 220, 220, 220, 220, 220, 220, 1441, 6045, 628, 220, 220, 220, 3670, 796, 2214, 14692, 64, 1, 7131, 521, 17, 47715, 198, 220, 220, 220, 3670, 796, 3487, 1096, 62, 8367, 7, 7839, 8, 198, 220, 220, 220, 4238, 796, 3670, 58, 15, 60, 198, 220, 220, 220, 1441, 4238, 198 ]
2.391628
3,488
'''O Sr. Manoel Joaquim expandiu seus negócios para além dos negócios de 1,99 e agora possui uma loja de conveniências. Faça um programa que implemente uma caixa registradora rudimentar. O programa deverá receber um número desconhecido de valores referentes aos preços das mercadorias. Um valor zero deve ser informado pelo operador para indicar o final da compra. O programa deve então mostrar o total da compra e perguntar o valor em dinheiro que o cliente forneceu, para então calcular e mostrar o valor do troco. Após esta operação, o programa deverá voltar ao ponto inicial, para registrar a próxima compra. A saída deve ser conforme o exemplo abaixo: ''' from time import sleep start = 1 while start == 1: #Reinicia o programa quando chega ao final. print('LOJAS TABAJARA') cont = 1 valor_produto = '' total_compra = 0 while valor_produto != 0: #Recebe valor dos produtos comprados. valor_produto = float(input(f'Produto {cont}: R$ ')) total_compra += valor_produto cont += 1 if valor_produto == 0: #Finaliza o programa. print(f'Total: R$ {total_compra:.2f}') dinheiro_cliente = float(input('Dinheiro: R$ ')) troco = dinheiro_cliente - total_compra print(f'Troco: R$ {troco:.2f}') sleep(3)
[ 7061, 6, 46, 21714, 13, 1869, 78, 417, 5302, 36129, 320, 4292, 16115, 384, 385, 2469, 10205, 979, 418, 31215, 435, 2634, 76, 23430, 2469, 10205, 979, 418, 390, 352, 11, 2079, 304, 556, 5799, 1184, 9019, 334, 2611, 2376, 6592, 390, 7292, 72, 25792, 77, 979, 292, 13, 18350, 50041, 23781, 1430, 64, 8358, 3494, 68, 334, 2611, 1275, 844, 64, 4214, 6335, 5799, 28906, 3681, 283, 13, 440, 1430, 64, 390, 332, 6557, 1407, 527, 23781, 299, 21356, 647, 78, 748, 1102, 258, 66, 17305, 390, 1188, 2850, 6773, 429, 274, 257, 418, 662, 16175, 418, 288, 292, 11991, 7079, 4448, 13, 21039, 1188, 273, 6632, 390, 303, 1055, 4175, 4533, 16176, 78, 1515, 7079, 31215, 2699, 283, 267, 2457, 12379, 552, 430, 13, 440, 1430, 64, 390, 303, 920, 28749, 749, 20040, 267, 2472, 12379, 552, 430, 304, 583, 70, 2797, 283, 267, 1188, 273, 795, 16278, 258, 7058, 8358, 267, 5456, 68, 329, 710, 344, 84, 11, 31215, 920, 28749, 2386, 10440, 304, 749, 20040, 267, 1188, 273, 466, 4161, 1073, 13, 5949, 10205, 82, 1556, 64, 27296, 16175, 28749, 11, 267, 1430, 64, 390, 332, 6557, 13161, 283, 257, 78, 279, 5957, 287, 6652, 11, 31215, 4214, 20040, 257, 778, 10205, 87, 8083, 552, 430, 13, 317, 473, 8836, 6814, 390, 303, 1055, 17216, 68, 267, 21433, 78, 450, 64, 844, 78, 25, 705, 7061, 198, 198, 6738, 640, 1330, 3993, 198, 198, 9688, 796, 352, 198, 4514, 923, 6624, 352, 25, 1303, 3041, 259, 33577, 267, 1430, 64, 627, 25440, 1125, 4908, 257, 78, 2457, 13, 198, 220, 220, 220, 3601, 10786, 21982, 41, 1921, 21664, 4339, 41, 24401, 11537, 198, 220, 220, 220, 542, 796, 352, 198, 220, 220, 220, 1188, 273, 62, 1676, 67, 9390, 796, 10148, 198, 220, 220, 220, 2472, 62, 5589, 430, 796, 657, 198, 220, 220, 220, 981, 1188, 273, 62, 1676, 67, 9390, 14512, 657, 25, 1303, 3041, 344, 1350, 1188, 273, 23430, 40426, 315, 418, 552, 6335, 418, 13, 198, 220, 220, 220, 220, 220, 220, 220, 1188, 273, 62, 1676, 67, 9390, 796, 12178, 7, 15414, 7, 69, 6, 2964, 67, 9390, 1391, 3642, 38362, 371, 3, 705, 4008, 220, 198, 220, 220, 220, 220, 220, 220, 220, 2472, 62, 5589, 430, 15853, 1188, 273, 62, 1676, 67, 9390, 198, 220, 220, 220, 220, 220, 220, 220, 542, 15853, 352, 198, 220, 220, 220, 220, 220, 220, 220, 611, 1188, 273, 62, 1676, 67, 9390, 6624, 657, 25, 1303, 19006, 23638, 267, 1430, 64, 13, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 69, 6, 14957, 25, 371, 3, 1391, 23350, 62, 5589, 430, 25, 13, 17, 69, 92, 11537, 220, 220, 220, 220, 220, 220, 220, 220, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 16278, 258, 7058, 62, 16366, 68, 796, 12178, 7, 15414, 10786, 35, 259, 258, 7058, 25, 371, 3, 705, 4008, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 4161, 1073, 796, 16278, 258, 7058, 62, 16366, 68, 532, 2472, 62, 5589, 430, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3601, 7, 69, 6, 44095, 1073, 25, 371, 3, 1391, 23528, 1073, 25, 13, 17, 69, 92, 11537, 198, 220, 220, 220, 3993, 7, 18, 8 ]
2.36036
555
from schnetkit.engine import Stateful models = [Dummy]
[ 6738, 264, 1349, 316, 15813, 13, 18392, 1330, 1812, 913, 628, 198, 198, 27530, 796, 685, 35, 13513, 60, 198 ]
2.9
20
import secrets from cryptography.hazmat.backends import default_backend from cryptography.hazmat.primitives import hashes from cryptography.hazmat.primitives import serialization from cryptography.hazmat.primitives.asymmetric import ec from cryptography.hazmat.primitives.ciphers.aead import AESGCM from cryptography.hazmat.primitives.kdf.hkdf import HKDF from zigbear.custom_protocol.scapy_layers import ZigbearSecurityLayer
[ 11748, 13141, 198, 198, 6738, 45898, 13, 71, 1031, 6759, 13, 1891, 2412, 1330, 4277, 62, 1891, 437, 198, 6738, 45898, 13, 71, 1031, 6759, 13, 19795, 20288, 1330, 46621, 198, 6738, 45898, 13, 71, 1031, 6759, 13, 19795, 20288, 1330, 11389, 1634, 198, 6738, 45898, 13, 71, 1031, 6759, 13, 19795, 20288, 13, 4107, 3020, 19482, 1330, 9940, 198, 6738, 45898, 13, 71, 1031, 6759, 13, 19795, 20288, 13, 66, 541, 7084, 13, 64, 1329, 1330, 34329, 15916, 44, 198, 6738, 45898, 13, 71, 1031, 6759, 13, 19795, 20288, 13, 74, 7568, 13, 71, 74, 7568, 1330, 31440, 8068, 198, 198, 6738, 1976, 328, 33227, 13, 23144, 62, 11235, 4668, 13, 1416, 12826, 62, 75, 6962, 1330, 24992, 33227, 24074, 49925, 628 ]
3.487805
123
#!/usr/bin/env python2 import os import json import logging from TrackDb import TrackDb from util import subtools from util import santitizer
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 17, 198, 11748, 28686, 198, 11748, 33918, 198, 11748, 18931, 198, 198, 6738, 17762, 43832, 1330, 17762, 43832, 198, 6738, 7736, 1330, 13284, 10141, 198, 6738, 7736, 1330, 264, 415, 3029, 263, 628, 198, 220, 220, 220, 220 ]
3.23913
46
# coding=UTF-8 from __future__ import absolute_import, division, print_function """ Provides reactors that can authenticate an AQMP session """ import six import typing as tp import copy import logging from coolamqp.framing.definitions import ConnectionStart, ConnectionStartOk, \ ConnectionTune, ConnectionTuneOk, ConnectionOpen, ConnectionOpenOk from coolamqp.framing.frames import AMQPMethodFrame from coolamqp.uplink.connection.states import ST_ONLINE from coolamqp.uplink.heartbeat import Heartbeater from coolamqp import __version__ PUBLISHER_CONFIRMS = b'publisher_confirms' CONSUMER_CANCEL_NOTIFY = b'consumer_cancel_notify' CONNECTION_BLOCKED = b'connection.blocked' SUPPORTED_EXTENSIONS = [ PUBLISHER_CONFIRMS, CONSUMER_CANCEL_NOTIFY, # half assed support - we just .cancel the consumer, see #12 CONNECTION_BLOCKED ] CLIENT_DATA = [ # because RabbitMQ is some kind of a fascist and does not allow # these fields to be of type short-string (b'product', (b'CoolAMQP', 'S')), (b'version', (__version__.encode('utf8'), 'S')), (b'copyright', (b'Copyright (C) 2016-2021 SMOK sp. z o.o.', 'S')), ( b'information', ( b'Licensed under the MIT License.\nSee https://github.com/smok-serwis/coolamqp for details', 'S')), (b'capabilities', ([(capa, (True, 't')) for capa in SUPPORTED_EXTENSIONS], 'F')), ] WATCHDOG_TIMEOUT = 10 logger = logging.getLogger(__name__) class Handshaker(object): """ Object that given a connection rolls the handshake. """ def __init__(self, connection, # type: coolamqp.uplink.connection.Connection node_definition, # type: coolamqp.objects.NodeDefinition on_success, # type: tp.Callable[[], None] extra_properties=None # type: tp.Dict[bytes, tp.Tuple[tp.Any, str]] ): """ :param connection: Connection instance to use :type node_definition: NodeDefinition :param on_success: callable/0, on success """ self.connection = connection self.login = node_definition.user.encode('utf8') self.password = node_definition.password.encode('utf8') self.virtual_host = node_definition.virtual_host.encode('utf8') self.heartbeat = node_definition.heartbeat or 0 self.connection.watch_for_method(0, ConnectionStart, self.on_connection_start) # Callbacks self.on_success = on_success self.EXTRA_PROPERTIES = extra_properties or [] # Called by internal setup def on_watchdog(self): """ Called WATCHDOG_TIMEOUT seconds after setup begins If we are not ST_ONLINE after that much, something is wrong and pwn this connection. """ # Not connected in 20 seconds - abort if self.connection.state != ST_ONLINE: # closing the connection this way will get to Connection by channels of ListenerThread self.connection.send(None)
[ 2, 19617, 28, 48504, 12, 23, 198, 6738, 11593, 37443, 834, 1330, 4112, 62, 11748, 11, 7297, 11, 3601, 62, 8818, 198, 198, 37811, 198, 15946, 1460, 28502, 326, 460, 8323, 5344, 281, 39514, 7378, 6246, 198, 37811, 198, 11748, 2237, 198, 11748, 19720, 355, 256, 79, 198, 11748, 4866, 198, 11748, 18931, 198, 6738, 3608, 321, 80, 79, 13, 19298, 278, 13, 4299, 50101, 1330, 26923, 10434, 11, 26923, 10434, 18690, 11, 3467, 198, 220, 220, 220, 26923, 51, 1726, 11, 26923, 51, 1726, 18690, 11, 26923, 11505, 11, 26923, 11505, 18690, 198, 6738, 3608, 321, 80, 79, 13, 19298, 278, 13, 37805, 1330, 3001, 48, 5868, 316, 2065, 19778, 198, 6738, 3608, 321, 80, 79, 13, 84, 489, 676, 13, 38659, 13, 27219, 1330, 3563, 62, 1340, 24027, 198, 6738, 3608, 321, 80, 79, 13, 84, 489, 676, 13, 11499, 12945, 1330, 8894, 1350, 729, 198, 6738, 3608, 321, 80, 79, 1330, 11593, 9641, 834, 198, 198, 5105, 9148, 1797, 16879, 62, 10943, 39776, 5653, 796, 275, 6, 12984, 8191, 62, 10414, 8789, 6, 198, 10943, 50, 5883, 1137, 62, 34, 20940, 3698, 62, 11929, 5064, 56, 796, 275, 6, 49827, 62, 66, 21130, 62, 1662, 1958, 6, 198, 10943, 45, 24565, 62, 9148, 11290, 1961, 796, 275, 6, 38659, 13, 2436, 3543, 6, 198, 198, 40331, 15490, 1961, 62, 13918, 16938, 11053, 796, 685, 198, 220, 220, 220, 24676, 9148, 1797, 16879, 62, 10943, 39776, 5653, 11, 198, 220, 220, 220, 39537, 5883, 1137, 62, 34, 20940, 3698, 62, 11929, 5064, 56, 11, 220, 220, 220, 220, 1303, 2063, 840, 276, 1104, 532, 356, 655, 764, 66, 21130, 262, 7172, 11, 766, 1303, 1065, 198, 220, 220, 220, 7102, 45, 24565, 62, 9148, 11290, 1961, 198, 60, 198, 198, 5097, 28495, 62, 26947, 796, 685, 198, 220, 220, 220, 1303, 780, 25498, 49215, 318, 617, 1611, 286, 257, 28342, 290, 857, 407, 1249, 198, 220, 220, 220, 1303, 777, 7032, 284, 307, 286, 2099, 1790, 12, 8841, 198, 220, 220, 220, 357, 65, 6, 11167, 3256, 357, 65, 6, 34530, 2390, 48, 47, 3256, 705, 50, 11537, 828, 198, 220, 220, 220, 357, 65, 1053, 3808, 295, 3256, 357, 834, 9641, 834, 13, 268, 8189, 10786, 40477, 23, 33809, 705, 50, 11537, 828, 198, 220, 220, 220, 357, 65, 6, 22163, 4766, 3256, 357, 65, 6, 15269, 357, 34, 8, 1584, 12, 1238, 2481, 9447, 11380, 599, 13, 1976, 267, 13, 78, 2637, 11, 705, 50, 11537, 828, 198, 220, 220, 220, 357, 198, 220, 220, 220, 220, 220, 220, 220, 275, 6, 17018, 3256, 357, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 275, 6, 26656, 15385, 739, 262, 17168, 13789, 13, 59, 77, 6214, 3740, 1378, 12567, 13, 785, 14, 5796, 482, 12, 2655, 86, 271, 14, 24494, 321, 80, 79, 329, 3307, 3256, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 705, 50, 11537, 828, 198, 220, 220, 220, 357, 65, 6, 11128, 5738, 3256, 198, 220, 220, 220, 220, 29565, 7, 11128, 64, 11, 357, 17821, 11, 705, 83, 6, 4008, 329, 1451, 64, 287, 43333, 1961, 62, 13918, 16938, 11053, 4357, 705, 37, 11537, 828, 198, 60, 198, 198, 35192, 35, 7730, 62, 34694, 12425, 796, 838, 198, 198, 6404, 1362, 796, 18931, 13, 1136, 11187, 1362, 7, 834, 3672, 834, 8, 628, 198, 4871, 7157, 1477, 3110, 7, 15252, 2599, 198, 220, 220, 220, 37227, 198, 220, 220, 220, 9515, 326, 1813, 257, 4637, 14088, 262, 42231, 13, 198, 220, 220, 220, 37227, 628, 220, 220, 220, 825, 11593, 15003, 834, 7, 944, 11, 4637, 11, 220, 1303, 2099, 25, 3608, 321, 80, 79, 13, 84, 489, 676, 13, 38659, 13, 32048, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 10139, 62, 46758, 11, 220, 1303, 2099, 25, 3608, 321, 80, 79, 13, 48205, 13, 19667, 36621, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 319, 62, 13138, 11, 220, 1303, 2099, 25, 256, 79, 13, 14134, 540, 30109, 4357, 6045, 60, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 3131, 62, 48310, 28, 14202, 220, 1303, 2099, 25, 256, 79, 13, 35, 713, 58, 33661, 11, 256, 79, 13, 51, 29291, 58, 34788, 13, 7149, 11, 965, 11907, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 15179, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 4637, 25, 26923, 4554, 284, 779, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 4906, 10139, 62, 46758, 25, 19081, 36621, 198, 220, 220, 220, 220, 220, 220, 220, 1058, 17143, 319, 62, 13138, 25, 869, 540, 14, 15, 11, 319, 1943, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 38659, 796, 4637, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 38235, 796, 10139, 62, 46758, 13, 7220, 13, 268, 8189, 10786, 40477, 23, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 28712, 796, 10139, 62, 46758, 13, 28712, 13, 268, 8189, 10786, 40477, 23, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 32844, 62, 4774, 796, 10139, 62, 46758, 13, 32844, 62, 4774, 13, 268, 8189, 10786, 40477, 23, 11537, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 11499, 12945, 796, 10139, 62, 46758, 13, 11499, 12945, 393, 657, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 38659, 13, 8340, 62, 1640, 62, 24396, 7, 15, 11, 26923, 10434, 11, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 261, 62, 38659, 62, 9688, 8, 628, 220, 220, 220, 220, 220, 220, 220, 1303, 4889, 10146, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 261, 62, 13138, 796, 319, 62, 13138, 198, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 13918, 3861, 62, 4805, 3185, 17395, 11015, 796, 3131, 62, 48310, 393, 17635, 628, 220, 220, 220, 1303, 34099, 416, 5387, 9058, 198, 220, 220, 220, 825, 319, 62, 8340, 9703, 7, 944, 2599, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 34099, 16518, 35, 7730, 62, 34694, 12425, 4201, 706, 9058, 6140, 628, 220, 220, 220, 220, 220, 220, 220, 1002, 356, 389, 407, 3563, 62, 1340, 24027, 706, 326, 881, 11, 1223, 318, 2642, 290, 279, 675, 428, 4637, 13, 198, 220, 220, 220, 220, 220, 220, 220, 37227, 198, 220, 220, 220, 220, 220, 220, 220, 1303, 1892, 5884, 287, 1160, 4201, 532, 15614, 198, 220, 220, 220, 220, 220, 220, 220, 611, 2116, 13, 38659, 13, 5219, 14512, 3563, 62, 1340, 24027, 25, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 1303, 9605, 262, 4637, 428, 835, 481, 651, 284, 26923, 416, 9619, 286, 7343, 877, 16818, 198, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 220, 2116, 13, 38659, 13, 21280, 7, 14202, 8, 198 ]
2.481663
1,227
# Copyright 2008 the V8 project authors. All rights reserved. # Redistribution and use in source and binary forms, with or without # modification, are permitted provided that the following conditions are # met: # # * Redistributions of source code must retain the above copyright # notice, this list of conditions and the following disclaimer. # * Redistributions in binary form must reproduce the above # copyright notice, this list of conditions and the following # disclaimer in the documentation and/or other materials provided # with the distribution. # * Neither the name of Google Inc. nor the names of its # contributors may be used to endorse or promote products derived # from this software without specific prior written permission. # # THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS # "AS IS" AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT # LIMITED TO, THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR # A PARTICULAR PURPOSE ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT # OWNER OR CONTRIBUTORS BE LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, # SPECIAL, EXEMPLARY, OR CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT # LIMITED TO, PROCUREMENT OF SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, # DATA, OR PROFITS; OR BUSINESS INTERRUPTION) HOWEVER CAUSED AND ON ANY # THEORY OF LIABILITY, WHETHER IN CONTRACT, STRICT LIABILITY, OR TORT # (INCLUDING NEGLIGENCE OR OTHERWISE) ARISING IN ANY WAY OUT OF THE USE # OF THIS SOFTWARE, EVEN IF ADVISED OF THE POSSIBILITY OF SUCH DAMAGE. import test import os from os.path import join, dirname, exists, splitext, isdir, basename import re import ast FLAGS_PATTERN = re.compile(r"//\s+Flags:(.*)") FILES_PATTERN = re.compile(r"//\s+Files:(.*)") chakraBannedFlags = ["--expose_externalize_string"]
[ 2, 15069, 3648, 262, 569, 23, 1628, 7035, 13, 1439, 2489, 10395, 13, 198, 2, 2297, 396, 3890, 290, 779, 287, 2723, 290, 13934, 5107, 11, 351, 393, 1231, 198, 2, 17613, 11, 389, 10431, 2810, 326, 262, 1708, 3403, 389, 198, 2, 1138, 25, 198, 2, 198, 2, 220, 220, 220, 220, 1635, 2297, 396, 2455, 507, 286, 2723, 2438, 1276, 12377, 262, 2029, 6634, 198, 2, 220, 220, 220, 220, 220, 220, 4003, 11, 428, 1351, 286, 3403, 290, 262, 1708, 37592, 13, 198, 2, 220, 220, 220, 220, 1635, 2297, 396, 2455, 507, 287, 13934, 1296, 1276, 22919, 262, 2029, 198, 2, 220, 220, 220, 220, 220, 220, 6634, 4003, 11, 428, 1351, 286, 3403, 290, 262, 1708, 198, 2, 220, 220, 220, 220, 220, 220, 37592, 287, 262, 10314, 290, 14, 273, 584, 5696, 2810, 198, 2, 220, 220, 220, 220, 220, 220, 351, 262, 6082, 13, 198, 2, 220, 220, 220, 220, 1635, 16126, 262, 1438, 286, 3012, 3457, 13, 4249, 262, 3891, 286, 663, 198, 2, 220, 220, 220, 220, 220, 220, 20420, 743, 307, 973, 284, 11438, 393, 7719, 3186, 10944, 198, 2, 220, 220, 220, 220, 220, 220, 422, 428, 3788, 1231, 2176, 3161, 3194, 7170, 13, 198, 2, 198, 2, 12680, 47466, 3180, 36592, 2389, 1961, 11050, 3336, 27975, 38162, 9947, 367, 15173, 4877, 5357, 27342, 9865, 3843, 20673, 198, 2, 366, 1921, 3180, 1, 5357, 15529, 7788, 32761, 6375, 8959, 49094, 34764, 11015, 11, 47783, 2751, 11, 21728, 5626, 198, 2, 40880, 5390, 11, 3336, 8959, 49094, 34764, 11015, 3963, 34482, 3398, 1565, 5603, 25382, 5357, 376, 46144, 7473, 198, 2, 317, 16652, 2149, 37232, 33079, 48933, 15986, 13954, 48778, 1961, 13, 3268, 8005, 49261, 50163, 3336, 27975, 38162, 9947, 198, 2, 47210, 21479, 6375, 27342, 9865, 3843, 20673, 9348, 43031, 19146, 7473, 15529, 42242, 11, 3268, 17931, 23988, 11, 19387, 25256, 1847, 11, 198, 2, 38846, 11, 7788, 3620, 6489, 13153, 11, 6375, 7102, 5188, 10917, 3525, 12576, 29506, 25552, 357, 1268, 39149, 2751, 11, 21728, 5626, 198, 2, 40880, 5390, 11, 41755, 11335, 10979, 3963, 28932, 2257, 2043, 37780, 21090, 50, 6375, 49254, 26, 406, 18420, 3963, 23210, 11, 198, 2, 42865, 11, 6375, 4810, 19238, 29722, 26, 6375, 43949, 44180, 23255, 49, 8577, 24131, 8, 29630, 36, 5959, 7257, 2937, 1961, 5357, 6177, 15529, 198, 2, 3336, 15513, 3963, 43031, 25382, 11, 7655, 2767, 16879, 3268, 27342, 10659, 11, 19269, 18379, 43031, 25382, 11, 6375, 309, 9863, 198, 2, 357, 1268, 39149, 2751, 399, 7156, 43, 3528, 18310, 6375, 25401, 54, 24352, 8, 5923, 1797, 2751, 3268, 15529, 34882, 16289, 3963, 3336, 23210, 198, 2, 3963, 12680, 47466, 11, 45886, 16876, 5984, 29817, 1961, 3963, 3336, 28069, 11584, 25382, 3963, 13558, 3398, 29506, 11879, 13, 198, 198, 11748, 1332, 198, 11748, 28686, 198, 6738, 28686, 13, 6978, 1330, 4654, 11, 26672, 3672, 11, 7160, 11, 4328, 578, 742, 11, 318, 15908, 11, 1615, 12453, 198, 11748, 302, 198, 11748, 6468, 628, 198, 38948, 50, 62, 47, 1404, 31800, 796, 302, 13, 5589, 576, 7, 81, 1, 1003, 59, 82, 10, 40053, 37498, 15885, 8, 4943, 198, 46700, 1546, 62, 47, 1404, 31800, 796, 302, 13, 5589, 576, 7, 81, 1, 1003, 59, 82, 10, 25876, 37498, 15885, 8, 4943, 198, 198, 354, 38004, 33, 3577, 40053, 796, 14631, 438, 1069, 3455, 62, 22615, 1096, 62, 8841, 8973, 198 ]
3.26738
561
""" 抽象工厂方法--对象创建型模式 1. 目标 定义一个用于创建对象的接口, 让子类决定实例化哪一个类, 使一个类的实例化延迟到子类。 """ if __name__ == '__main__': cream_cake_factory = CreamCakeFactory() cream_cake = cream_cake_factory.make_cake() print(cream_cake) fruit_cake_factory = FruitCakeFactory() fruit_cake = fruit_cake_factory.make_cake() print(fruit_cake)
[ 37811, 198, 162, 232, 121, 164, 109, 94, 32432, 98, 43889, 224, 43095, 37345, 243, 438, 43380, 117, 164, 109, 94, 26344, 249, 161, 119, 118, 161, 252, 233, 162, 101, 94, 28156, 237, 198, 198, 16, 13, 13328, 249, 106, 43718, 229, 198, 22522, 248, 20046, 231, 31660, 10310, 103, 18796, 101, 12859, 236, 26344, 249, 161, 119, 118, 43380, 117, 164, 109, 94, 21410, 162, 236, 98, 20998, 96, 171, 120, 234, 5525, 106, 102, 36310, 163, 109, 119, 37863, 111, 22522, 248, 22522, 252, 160, 122, 233, 44293, 244, 161, 241, 103, 31660, 10310, 103, 163, 109, 119, 171, 120, 234, 220, 45635, 31660, 10310, 103, 163, 109, 119, 21410, 22522, 252, 160, 122, 233, 44293, 244, 161, 119, 114, 32573, 253, 26344, 108, 36310, 163, 109, 119, 16764, 198, 198, 37811, 628, 628, 628, 198, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 220, 220, 8566, 62, 30560, 62, 69, 9548, 796, 19979, 34, 539, 22810, 3419, 198, 220, 220, 220, 8566, 62, 30560, 796, 8566, 62, 30560, 62, 69, 9548, 13, 15883, 62, 30560, 3419, 198, 220, 220, 220, 3601, 7, 36277, 62, 30560, 8, 628, 220, 220, 220, 8234, 62, 30560, 62, 69, 9548, 796, 22826, 34, 539, 22810, 3419, 198, 220, 220, 220, 8234, 62, 30560, 796, 8234, 62, 30560, 62, 69, 9548, 13, 15883, 62, 30560, 3419, 198, 220, 220, 220, 3601, 7, 34711, 62, 30560, 8 ]
1.408333
240
from django.db import models from django.contrib.auth.models import User # Create your models here.
[ 6738, 42625, 14208, 13, 9945, 1330, 4981, 198, 6738, 42625, 14208, 13, 3642, 822, 13, 18439, 13, 27530, 1330, 11787, 198, 2, 13610, 534, 4981, 994, 13, 628 ]
3.607143
28
#!/usr/bin/env python # Copyright 2019 The Chromium Authors. All rights reserved. # Use of this source code is governed by a BSD-style license that can be # found in the LICENSE file. """Concatenates D-Bus busconfig files.""" import sys import xml.etree.ElementTree _BUSCONFIG_FILE_HEADER = b"""<!DOCTYPE busconfig PUBLIC "-//freedesktop//DTD D-Bus Bus Configuration 1.0//EN" "http://www.freedesktop.org/standards/dbus/1.0/busconfig.dtd"> """ if __name__ == '__main__': main()
[ 2, 48443, 14629, 14, 8800, 14, 24330, 21015, 198, 2, 15069, 13130, 383, 18255, 1505, 46665, 13, 1439, 2489, 10395, 13, 198, 2, 5765, 286, 428, 2723, 2438, 318, 21825, 416, 257, 347, 10305, 12, 7635, 5964, 326, 460, 307, 198, 2, 1043, 287, 262, 38559, 24290, 2393, 13, 198, 198, 37811, 3103, 9246, 268, 689, 360, 12, 16286, 1323, 11250, 3696, 526, 15931, 198, 198, 11748, 25064, 198, 11748, 35555, 13, 316, 631, 13, 20180, 27660, 628, 198, 62, 45346, 10943, 16254, 62, 25664, 62, 37682, 1137, 796, 275, 37811, 27, 0, 18227, 4177, 56, 11401, 1323, 11250, 198, 220, 44731, 27444, 1003, 69, 15977, 274, 16201, 1003, 35, 21016, 360, 12, 16286, 5869, 28373, 352, 13, 15, 1003, 1677, 1, 198, 220, 366, 4023, 1378, 2503, 13, 69, 15977, 274, 16201, 13, 2398, 14, 1481, 1371, 14, 9945, 385, 14, 16, 13, 15, 14, 10885, 11250, 13, 67, 8671, 5320, 198, 37811, 628, 198, 361, 11593, 3672, 834, 6624, 705, 834, 12417, 834, 10354, 198, 220, 1388, 3419, 198 ]
2.859649
171
import sys; import numpy as np; import pandas as pd; np.set_printoptions(threshold=sys.maxsize) # replace the range, sample size with your custom numbers arr = np.array(np.random.choice(range(10000), 10000, replace=False)) print(arr) DF = pd.DataFrame(arr) DF.to_csv("temp.csv")
[ 11748, 25064, 26, 198, 11748, 299, 32152, 355, 45941, 26, 198, 11748, 19798, 292, 355, 279, 67, 26, 198, 198, 37659, 13, 2617, 62, 4798, 25811, 7, 400, 10126, 28, 17597, 13, 9806, 7857, 8, 198, 2, 6330, 262, 2837, 11, 6291, 2546, 351, 534, 2183, 3146, 220, 198, 3258, 796, 45941, 13, 18747, 7, 37659, 13, 25120, 13, 25541, 7, 9521, 7, 49388, 828, 33028, 11, 6330, 28, 25101, 4008, 220, 198, 4798, 7, 3258, 8, 198, 8068, 796, 279, 67, 13, 6601, 19778, 7, 3258, 8, 198, 8068, 13, 1462, 62, 40664, 7203, 29510, 13, 40664, 4943, 198 ]
2.82
100
import torch from sklearn.preprocessing import LabelEncoder from torch.utils.data import Dataset, DataLoader
[ 11748, 28034, 198, 6738, 1341, 35720, 13, 3866, 36948, 1330, 36052, 27195, 12342, 198, 6738, 28034, 13, 26791, 13, 7890, 1330, 16092, 292, 316, 11, 6060, 17401, 628, 198 ]
3.827586
29