text
stringlengths 199
648k
| id
stringlengths 47
47
| dump
stringclasses 1
value | url
stringlengths 14
419
| file_path
stringlengths 139
140
| language
stringclasses 1
value | language_score
float64 0.65
1
| token_count
int64 50
235k
| score
float64 2.52
5.34
| int_score
int64 3
5
|
|---|---|---|---|---|---|---|---|---|---|
Children are taught today that racism is a thing of the past. A disease which we have overcome and destroyed. Something that was rampant throughout much of history, and with the courageous leaders during the Civil Rights Movement, it was ended. However, shown in several polls is the opinion that racism is still very much a problem in the United States. In a CNN article, a poll showed that “Most Americans see lingering racism”. In a New York Times Blog, The Caucus, a poll showed that Americans today believe racism is a bigger problem than sexism.
But why, wasn’t the majority of racism proven wrong and demolished within our political system during the 60’s and 70’s? A quote from the CNN article holds the key.
“And experts say racism has evolved from the days of Jim Crow to the point that people may not even recognize it in themselves…University of Connecticut professor Jack Dovidio, who has researched racism for more than 30 years, estimates up to 80 percent of white Americans have racist feelings they may not even recognize.’We’ve reached a point that racism is like a virus that has mutated into a new form that we don’t recognize,’ Dovidio said. He added that 21st-century racism is different from that of the past. ‘Contemporary racism is not conscious, and it is not accompanied by dislike, so it gets expressed in indirect, subtle ways,’ he said.”
Racism has taken a new face in the 21st Century, one that is just as ugly and grotesque as before. A face that has changed as our times have. One that has morphed and conformed to our communities so that we don’t even know it’s there. What does this new face look like and how did it happen?
Shortly after the end of the Civil Rights Movement in 1968, in 1969 in a message to Congress, President Richard Nixon spoke of drug abuse as “a serious national threat.” He then called for a national anti-drug policy. In June of 1971 Nixon officially declares a “war on drugs,” identifying drug abuse as “public enemy No. 1.“
How are these seeming independent events connected? That is the main point of the a book by Michelle Alexander, entitled, “The New Jim Crow: Mass Incarceration in the Age of Colorblindness” These two events are connected she says because the Drug War is simply the “New Jim Crow”. That while the more overt and blatant racism of the 60’s: the lynchings, the “no blacks allowed” signs, the sit-ins and the freedom riders, simply disappeared. A different kind of racism has taken it’s place. One entitled, “The War on Drugs.”
A by-product of the drug war, is the ever increasing incarceration rates in the United States. The incarceration rate which is the highest in the world is a direct product of the drug war. Statistics show that incarceration rates have skyrocketed, specifically due to the drug war and the arrest of thousands of non-violent offenders.
Racisim is inherent in the drug war in it’s inception, execution and disportionality of arrests. Earning the drug wars title as the New Jim Crow. The Drug War, the New Jim Crow, Institutionalized Racism, any name you want to give it. It still shows that while the face of racism has changed, it still remains imbedded in our political structure.
The racism today is subtle, and for many whites or middle-class Americans, pretty much non existent. We thought it ended with the Civil Rights Movement, but instead it has been enabled through the drug war. The fight against racism in our lifetime is far from over. While scientifically speaking there is no such thing as race, only superficial skin tone, it’s hard for many to reach past the cultural differences and embrace people of other colors as their own. As the future generation it is up to us, to break the barrier and to begin to look at other people as just people. Who have flaws and who have talents, who can be horrible and can be wonderful. Regardless of what color their skin is.
“The concept of ‘race’ is flawed,” he added. “Our differences as human beings are what make this world exciting and interesting. If we were all of the same culture, how boring would that be? The world needs to take a page from the atmosphere in Hawaii — the most racially diverse place in which I have lived.” A CNN.com reader, Mark Boyle of Muncie Indiana. | <urn:uuid:520a3f9c-b3e7-4805-a986-0c1a009c5f60> | CC-MAIN-2016-26 | http://libertythinkers.com/education/racism-in-the-21st-century/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399385.17/warc/CC-MAIN-20160624154959-00159-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.969358 | 979 | 3.484375 | 3 |
LASP carries out frontier research in planetary sciences, atmospheric sciences, space plasma physics, and solar influences.
- define key science questions,
- design, fabricate, and fly airborne, rocket, and spacecraft experiments that make pertinent measurements,
- analyze data and carry out theoretical and laboratory investigations to understand the results, and
- simulate results with a variety of models to gain an understanding of the process.
The Solar Influences Group is devoted to measuring the Sun’s irradiance over a broad wavelength range, from soft X-rays through the near infrared. The scientific objectives are to measure irradiance with state of the art accuracy and precision and to understand solar variability and its influence on the terrestrial environment with emphasis on atmospheric processes and climate. Research highlights include improved understanding of the solar variations in the visible and near infrared, flare-induced variations in ultraviolet radiation, the first detection of flares in the total solar irradiance (TSI), and advances in irradiance accuracy. A data center has been developed for all of these solar irradiance data sets, called the LASP Interactive Solar Irradiance Datacenter (LISIRD). While most research is focused on data analysis, there have also been recent advances in solar irradiance modeling.
To learn more, visit: Solar Influences at LASP
To access data, visit: LISIRD: LASP Interactive Solar Irradiance Datacenter
LASP scientists pursue investigations in atmospheric science that span the troposphere through the thermosphere and they are world renowned for their theoretical work on clouds and aerosols as well as analyses of solar variability influences on the atmosphere, including both radiation and particle effects. LASP scientists build aircraft instruments and participate in and lead major airborne field campaigns. They also participate in global climate modeling through collaborations with NCAR on development and validation of their Whole Atmosphere Community Climate Model (WACCM).
To learn more, visit: Atmospheric Science at LASP
LASP has been involved in missions to all the planets in the solar system. Research highlights include observing Saturn’s rings and the thin atmospheres of its satellites, the connection between planetary dynamics and planetary formation through data analysis and theory, and involvement in many current missions to Mars, as well as planning and proposing future spacecraft investigations. Other areas of research include the geophysics of ice on Mars and the history of martian climate, the geology and geophysics of icy satellites, planetary magnetospheres and solar wind interactions, and the occurrence and physics of dust and dusty plasmas.
To learn more, visit: Planetary Science at LASP
The space physics group at LASP is engaged in research aimed at understanding the Sun–Earth connections. It has developed strength in concentrated areas including Earth’s magnetosphere, its radiation belts, magnetospheric substorms, and the aurora. The Center for Integrated Space Weather Modeling (CISM) resides within this group; it is part of a national consortium of scientists trying to understand the nature and impact of space weather. The combination of the strong research group and LASP’s engineering expertise is viewed as having great potential in the expanding the Sun Earth Connections and Space Weather programs.
To learn more, visit: Space Physics at LASP | <urn:uuid:2b06fc4d-ac37-40c0-81dc-60cf46b5b856> | CC-MAIN-2016-26 | http://lasp.colorado.edu/home/scrc/facilities/science/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395613.65/warc/CC-MAIN-20160624154955-00038-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.92134 | 676 | 2.78125 | 3 |
Did you know: For the first time in 2008 the world’s city dwellers outnumbered those in the countryside. The share of urbanites is projected to continue increasing, so that by 2030 some 60 percent of the world’s population will live in cities. For more information view the text and data in Chapter 6 of Plan B 4.0: Mobilizing to Save Civilization.
The U.S. state of Iowa is an agricultural superpower, simultaneously eclipsing Canada in grain production and challenging China in soybean production. No, these are not mathematical errors.
Last year Iowa’s farmers harvested 55 million tons of grain while Canada’s farmers harvested only 45 million tons. Over the last five years, Iowa has averaged 57 million tons a year to Canada’s 49 million tons.
While Canada has more than 30 million acres in grain, mostly wheat, Iowa has only 13 million acres in grain, almost entirely corn. The difference in yield per acre is huge, just 1.4 tons in Canada against more than 4 tons in Iowa.
With soybeans, Iowa produced 13 million tons in 2010 while China produced 15 million tons, mirroring their average production figures over the past five years. While Iowa has less than 10 million acres in soybeans, China has 22 million acres. Yield per acre in Iowa is 1.4 tons, exactly double the 0.7 tons of China.
The bottom line: Iowa is at the heart of the U.S. Corn Belt, a phenomenally productive piece of agricultural real estate. It enables the United States, with only 4 percent of the world’s people, to produce 40 percent of the world’s corn, the leading grain, and 35 percent of its soybeans.
Copyright © 2011 Earth Policy Institute | <urn:uuid:110cbc59-ac96-4e7e-8b4e-449abbac4638> | CC-MAIN-2016-26 | http://www.earthpolicy.org/data_highlights/2011/highlights16 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397567.28/warc/CC-MAIN-20160624154957-00145-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.920761 | 365 | 3.1875 | 3 |
Heart Disease Prevention
Heart disease prevention is a major goal of the University of Chicago Medicine. Our heart specialists develop individualized heart disease prevention plans for people at risk for heart disease or those who have had a heart attack, stroke, or other type of heart or circulation problem. Our physicians regularly help patients with high cholesterol, high blood pressure, and those with a family history of heart disease.
Here, the physicians who treat patients at risk for heart disease are the same physicians who are unlocking the mysteries of how heart problems develop. Our physicians performed groundbreaking research into the biochemical makeup of cholesterol, which led to a better understanding of how fats are transported through the bloodstream.
Listen: Cardiovascular Disease & Diabetes | <urn:uuid:bfd8e54c-7175-4b1b-afa0-b72a785b9a98> | CC-MAIN-2016-26 | http://www.uchospitals.edu/specialties/heart/services/prevention/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393442.26/warc/CC-MAIN-20160624154953-00134-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.91055 | 141 | 2.625 | 3 |
In the Garden:
'Snow Queen' and 'King George' heaths are suitable companions, providing cheerful winter color in a sunny bed.
Heaths and Heathers
Winter can be a long and dreary season around here, yet there is no time between November and June when I can't gather sprays of the bell-shaped blossoms from my winter-flowering heaths in shades of pink, rose, light purple, lilac, lavender, orchid, and white.
Heaths and heathers grow very well in our climate. They love the moisture and the mild winters. The plants grow in a mounding habit, forming thick mats of evergreen foliage. In some varieties, leaves turn golden yellow or deep bronze in winter. Heathers generally flower in midsummer, but the heaths may bloom at any time of the year, depending on variety and climatic conditions.
Heaths versus Heathers
Many gardeners confuse heaths and heathers. I've found it's easy to distinguish between them by examining the small leaves. Heathers have very short scale-like leaves that clasp the stem, giving the stem a fairly smooth texture. Heaths have longer needle-like leaves that point outward, giving the twig a spiny texture. The flowers of both are small but are borne in such profusion that the plants become a mass of color whenever they're in bloom.
When I first discovered these wonderful plants, I was smitten and acquired many, planting them all together in a single bed. I thought they'd provide a succession of blooms all year round. However, within two years the faster-growing heaths crowded out the heathers. I was also disappointed in the overall appearance of the bed. Instead of a continual display of colorful blooms, I found the random blooming of some varieties made those not in bloom look forlorn and out of place. I remedied the situation by separating the winter-blooming heaths from their summer-blooming cousins. In its own bed each type can perform without distraction.
Like other Ericaceae, heaths and heathers prefer an acid soil that retains moisture but is not heavy and compacted. Before planting I amend the soil with a generous supply of peat moss to help retain moisture. I also mound the bed to ensure good drainage. Although the plants look as though they might thrive under arid conditions, they definitely require regular watering during the summer months. And while they will grow in full sun, light shade provides the best growing conditions and produces the most flowers. Shearing back these shrubby perennials to just below the point where the blooms form stimulates new growth in the center and helps keep plants compact.
Care to share your gardening thoughts, insights, triumphs, or disappointments with your fellow gardening enthusiasts? Join the lively discussions on our FaceBook page and receive free daily tips! | <urn:uuid:6aa68435-a386-4783-8e13-9ed6b087be86> | CC-MAIN-2016-26 | http://garden.org/regional/report/arch/inmygarden/16 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399425.79/warc/CC-MAIN-20160624154959-00091-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.945745 | 594 | 2.53125 | 3 |
Looks like you are using an old version of Internet Explorer - Please update your browser
From Check This Out
The term race is often used to classify people based almost solely on physical characteristics. According to evolutionary ideas, these so-called races descended from different ancestors separated by location and time. However, based on biblical history, the term race must be incorrect. We are all one race (“one blood” in Acts 17:26), the human race.
It’s not just “black” and “white.” A person’s skin shade (what is on the outside) should in no way invoke any sort of prejudice or racist comments. What a difference we would see in our world if people reacted in accord with biblical principles, understanding all humans are equal before God, and all are sinners in need of salvation.
In the U.S. culture we are racially programmed, particularly in regard to the skin color issue. Because of our culture’s racist roots, the way the world thinks, and the influence of Darwinian thinking, we have been programmed to look at the exterior rather than the interior of a person. We need to begin to see as God sees.
A significant number of Christians would claim that such “interracial” marriages directly violate God’s principles in the Bible and should not be allowed. Does the Word of God really condemn the marriages mentioned above? Is there ultimately any such thing as interracial marriage?
Charles Darwin’s evolutionary philosophy was fertile soil in which the atrocity of racism quickly took root and grew.
The Tower of Babel, where God divided the languages, is the correct starting point for understanding the origin of language, culture, and the people groups.
We reap the consequences of unquestioned evolutionary belief every day in the form of prejudice, racism, and hate. This needs to stop!
Bill Nye recently said, “We’re all the same . . . from a scientific standpoint there’s no such thing as race”—a biblical, not an evolutionary, view of humanity.
Pastor Fredrick Boyd, who leads an inner-city ministry in south Indianapolis, has been a keen observer of racial conflict in America.
The Singerl twins are a vivid reminder that we are all members of one race.
The truths found in Genesis are essential for effective prison ministry.
Out of Britain comes more news that upsets the idea of “race.”
Appendix B: Misconceptions and/or Common Mistakes about Reconciliation
A special exhibition on racism and the “races” is traveling across America. While interesting, there some glaring oversights included.
Barack Obama’s campaign and election as the first black president of the United States has sparked much discussion about race. But what is race, really?
Once again, scientific research backs up the Bible—and it’s nothing new that it supports the Bible’s description of humanity as a single race.
A prominent Associated Press article takes a look at religion and racism in America—including a profile of an individual whose views on race were transformed through an old AiG book, One Blood.
In one of the most ironic science stories in recent memory (if not of all time!), the Caucasian scientist who lamented what he implied as lower African intelligence may himself actually be, at least partly, black!
The Nobel Prize-winning co-discoverer of DNA has caused considerable outrage by asserting that testing shows Africans’ intelligence to be inferior to that of whites.
During his visit to Britain this month, Dr. Watson created a storm when he made comments on genetics that contained connotations of racism.
The terms “stone age,” “primitive,” and “savage” are offensive and “should not be used to describe living peoples,” reports the BBC on an Association of Social Anthropologists ruling.
While the eleven o’clock hour on Sunday morning may still be the most segregated hour of the week in our nation according to many, it certainly wasn’t the case last Sunday in Cincinnati.
Actor Morgan Freeman’s comments about the state of race relations in the United States had already become well known a few days before his interview was broadcast to millions of Americans
So what can Christians in today’s culture do to bring about racial reconciliation?
Actually, Duane had sent me the AARP magazine because one of its articles attempted to present an evolutionary explanation of why racism exists all over the globe.
Since joining Answers in Genesis, I’ve been giving my own version of this message, titled, “The Origin of the so-called Races,” across the UK.
People were stunned and thrilled to hear of the way in which science confirms the Bible’s teaching that we are all astonishingly closely related.
The concept of human “races” is an illusion, and the racism that's tearing apart our world is based on a lie.
Ken Ham, president of AiG–US, was sobered by what he saw in a church graveyard near where he was speaking recently
On 60 billboards around Cincinnati, Ohio, we have advertised our new Web site OneHumanRace.com to educate citizens about ‘races’ and racism in the wake of the recent Cincinnati ‘race riots.’
Twenty more billboards that proclaim the real answer to racial problems were posted recently throughout racially torn Cincinnati, Ohio, USA by AiG!
AiG's recording artist Buddy Davis has released his sixth album entitled 'One Blood: 14 Original Songs that Praise and Teach.'
The famous physicist, Stephen Hawking, reportedly believes that genetic engineers will create 'improved' superintelligent human beings within a few hundred years.
Billboards created by Answers in Genesis-US are going up today, May 21, throughout racially torn Cincinnati, Ohio USA to proclaim the real answer to the city's racial problems.
Hundreds of Christian leaders from across America—including prominent black leaders—heard Ken Ham declare that the Bible has the answer to the problem of racism. | <urn:uuid:01bef047-f2b0-4ebb-b17c-e66fddc57793> | CC-MAIN-2016-26 | https://answersingenesis.org/racism/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400572.45/warc/CC-MAIN-20160624155000-00025-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.952292 | 1,274 | 2.859375 | 3 |
Compare and contrast Coxe and Williams
instructor's notes, January 30th 2003
Switzerland -- Coxe and Williams: the first serious travel books (but cf. Moore).
Sublime: challenge? Move to a landscape that, unlike England of Lewesdon or the Wye Valley, clearly not accommodated to human habitation; picturesque, but primarily sublime (e.g., Rhine Falls, ascent up the Reuss Valley; Glaciers) - perspective on human littleness, human vulnerability. . .
Change. But anticipates values of Romantic travel to come. Travellers that publish accounts, help to change perception of places visited; encourage more travel, change places. (First real guide: John Murray, A Handbook for Travellers in Switzerland 1838) Cf. changes now to bypass Urner Loch, 70 yard tunnel above Devil's Bridge (Coxe 160; 163-4). - built in 1707; still the route in 1885, according to a Baedeker. Or Gondo Ravine. What values are in question? Is the sublime what we should foster?
Edenic: pre-lapsarian views of first travellers -- "the uncorrupted simplicity of this people" (Williams, Introduction); always remains a desire. (Inhabitants spoiled by visitors…) -- Williams's conclusion: "there is always a resource against every feeling of dislike, or of weariness, in the meditation of that glorious scenery, the view of which renders the mind insensible to human evils, by lifting it beyond their reach" (276-7) -- imagines a chateau "seated at the foot of an Alpine hill, a torrent stream rolls invisibly past the dwelling, and an enormous glacier lifts its snows in the neighbourhood."
Gender? Women writers more particularly -- creation of a subjective aesthetics, impressionism. Cf. emotions of opening paragraph of Williams (discuss). And consider expectations of 2nd para. -- liberty not profaned; smiles on the vallies, etc. Is this right? --
The picturesque manner of viewing has been, from its inception, a practice culturally coded 'male' -- and so, for that matter, has the Continental tour and the whole process of acculturation it represents. . . . The picturesque retained the assumptions of gender given to it by its founders, who imagined a male art of seeing that could correct and complete what a feminized landscape held forth. -- James Buzard, The Beaten Track (1993), p. 16.
Participatory. Interconnection between the observer and the observed; One Mind theory; is this stronger in Williams? Cf. Rhine Falls (c. 61). Does it hold any meaning? Opposing view (New Historicist):
there is no nature except as it is constituted by acts of political definition made possible by particular forms of government. When the governmental understructure changes, nature changes. Each time a nation suffers an invasion, civil war, major change of ministry, or some other crisis, national or international, it must revise its landscape, the image of its own nature. -- Alan Liu, Wordsworth: The Sense of History (1989), p. 104. | <urn:uuid:ff3e9e97-daca-4c8d-84bb-1c4bba3d47b5> | CC-MAIN-2016-26 | http://www.ualberta.ca/~dmiall/Travel/Coxe_notes.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395548.53/warc/CC-MAIN-20160624154955-00198-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.895334 | 660 | 2.5625 | 3 |
Sir Daniel Gooch
According to Marshall Daniel Gooch was born at Bedlington in Northumberland on 24 August 1816. His parents were cousins and Gooch was very proud that the "blood of Alfred the Great ran in their veins". His elder brother John Viret does not appear to have been close,
First locomotive superintendent of the Great Western Railway, Daniel Gooch developed the basic Stephenson locomotive into a broad gauge machine which, for the 1840s, could achieve astonishing performances. His Great Britain 8ft single-driver, for example, hauled a 100-ton train at over a fifty mile/h average for seventy-seven miles. He also initiated the new Swindon Works, was an effective proponent of the 7ft gauge in the 'Battle of the Gauges'. His dynamometer car for measuring locomotive performance is believed to have been the world's first and involved cooperation with Charles Babbage. The data on the resistance to railway trains at different velocities were presented at evening meetings of the Instiution of Mechanical Engineers on 18 April, 16 and 23 May and 6 June 1848. Ellis notes that "he shared with George Stephenson a faith in the ultimate triumph of electric power". He laid the first successful Atlantic cable, for which he was made a baronet. In 1865, when the Great Western Railway's finances were at a low ebb Gooch was appointed Chairman, a position he retained until his death at his home Clewer Park on 15 October 1889. In 1865 he had been elected as an MP for Cricklade.
Rogers (Chapelon biography) summaries Gooch's contribution: Daniel Gooch of the Great Western was probably the first of the great railway company locomotive engineers. In the years 1840-2 105 six-wheeled tender engines were built for his company to his own designs, the first standardisation on an extensive scale for any railway. Of these, 62 were 2-2-2 express passenger locomotives with 7ft driving wheels, which were derived from the earlier Star class engines supplied by Stephenson. They put the Great Western ahead of any other company in Great Britain in locomotive power. In 1846 he produced the first of his famous 8ft singles which were the most powerful express passenger engines in the country and which hauled the most important express trains on the broad gauge until its abolition in 1892. When they were built Gooch's eight-foot single drivers were ahead of any other locomotives in the world and they put his company in the forefront of railway speed.
Le Fleming stated that Gooch was the first locomotive superintendent of the Great Western Rly. from 1837 to 1864 and chairman of the company from 1866 to 1889. He was a great protagonist of the broad gauge (7 ft), the famous 8-ft singles (4-2-2 type) first appeared in 1846, and by attaining speeds of 60 m.p.h. in the 1840'S, earned for their designer the sobriquet of "father of express trains". Lord of the Isles, of this class, was one of the star attractions of the Great Exhibition of 1851 in London. The stationary link valve gear was brought out in 1843 and engines with condensing apparatus for underground work in 1862. Gooch was one of the earliest to insist upon interchangeability and standardization of engine parts and built the first dynamometer car for road testing in 1846. In 1865-66 he directed the laying of the first transatlantic cables in the great steamship Great Eastern. During this time the GWR ran into difficulties and the Board elected him chairman on his return.
Brian Reed noted Gooch's early adoption of templates to ensure consistency in manufacture using several suppliers.
It may be noted that R.B. Longridge of Bedlington developed expertise in constructing broad gauge locomotives.
Memoirs & diary; edited by
Roger Burdett Wilson. Newton Abbot: David & Charles,
The memoirs to 1846; the memoirs 1847-65; The memoirs 1865-7, and diaries for the remainder of his life. All are interesting; some tell a tale of adventure, and some sections are highly pertinent in terms of early locomotive construction, early railway operations, and of the broad gauge affair.
Memoirs & Diary
Some commentators have been rather carping about Gooch's Memoirs and Diary, but it does provide an unusual glimpse into the life of a highly eminent engineer and business tycoon. The version put together by Roger Burdett Wilson was obviously a highly skilled operation and is greatly enhanced by its copious notes. Even the most superficial inspection shows that Gooch had a great breadth of vision which is surprising for someone associated as being a great engineer and railway manager. He also lived in a highly adventurous manner, and both of these aspects are present during the great cable laying venture in the 1860s. During his later life he used up what now be termed as his "airmiles" travelling mainly for pleasure when his observational powers remain, even if his views can sometimes seem somewhat prejudiced. Nevertheless, great buildings have the power to extract powerful responses from the great man. He was the GWR's first locomotive engineer and its Chairman for many years. He was responsible for using the Great Eastern to lay the trans-Atlantic cable and other long distance submarine telegraph cables. He was a Freemason and he suffered from the early loss of his wife. He was very proud of his ancestry.
In February 1831 my father left Bedlington to go to Tredegar iron works in Monmouthshire, and took his family with him. I remember well what a pleasant journey it was. We had a kind of omnnibus built, with curtains round it, in which we all travelled, posting. I do not know bow many days it took us to make the journey, but I well remember it, and the beautiful view as we crossed the Malvern hills; it was a bright moon light evening.
When we were settled at Tredegar I began my professional career by working in the works. Mr Saml Homfray was the managing partner. I went first into the moulding dept. commencing work at 6 oclock in the morning. The first few months I was chiefly employed in making cores, but after that was entrusted to mould tram wheels. This was a very heavy job for me; the wheel pattern weighed 50 or 60 lbs, and I had nine boxes to mould twice a day, the first lot before 9 oclock in the morning, when the furnace was run off and they were cast. During this time I went to my breakfast for a couple of hours, when I returned and opened the boxes, tamped my sand and moulded the 2nd set. This was generally finished between 4 & 5 odock. I had an hour for dinner. As this work was done in the atmosphere of the furnace house and the work was very hard I began to feel the effects of it in my health, and was sent a voyage to sea for a few weeks.
The last observation shows how fortunate Daniel was to be within the care of the emrgent middle class rather than being a typical employee at the works. Whilst working at Tredegar he had many adventures, several of which could have been fatal: probably the two most serious were when he was caught inside the blowing engine when lime had been applied to keep the leather bellows air-tight and the engine was started, but he managed to get out. A more needless adventure was when he challenged himself to be lowered into a 30 yards deep pit holding onto the end of the chain when he barely managed to hold on for the return. He has graphic deatils of being forced to participate in the riots at Rhymney and was fortunate in not being shot: earlier 21 had been killed when the troops opened fire.
19 July 1969
[whilst still at sea]: "but Sunday is a wretched day for travel and it will be a long journey by a Sunday trainbut its end will be home.
15 August 1869.
reached Weymouth (from cable-laying across Atlantic)
"After landing I went to the station to see about the times of trains, and then had a walk on the beach until the train started at 10.30. It is a dreadful day, a Sunday, to travel on a long journey; this train did not reach Windsor until 6.30pm."
8520 29 May 1840 Wheels and locomotive engines to be used on railways. via Woodcroft
See : E. T. McDermot, History of the Great Western Railway
H. Ellis, Twenty Locomotive Men (1958)
E. L. Ahrons, The British Railway Steam Locomotive 1825-1925 (1927).
Williams: Stars of Steam
Geoffrey Channon excellent biography Oxford Dictionary of National Biography
extensive bibliography in Marshall.
John Viret Gooch
Marshall notes that John Viret Gooch was born in Bedlingon on 29 June 1812 and died in Bracknell on 8 June 1900. Elder brother of Daniel (above) and judging by lack of mention in Diaries not at all close. Second Locomotive Superintendent of the LSWR (see Bradley, Webb and Ellis) was appointed in 1841. He left for the Eastern Counties Railway in 1850 and was there until 1856. Whilst there he started locomotive copnstruction at Stratford with six 2-2-2WTs, some of which were constructed by Longridge of Bedlington. These were followed by a further ten plus five 0-6-0 tender locomotives.. On the LSWR he was followed by Beattie. On the London & Southampton the 2-2-2s for which he was responsible for purchasing were notable for their speed. Elk ran from Southampton to Nine Elms in 93 minutes. See Peter Howard Baker John Viret Gooch: civil engineer, locomotive superintendent and entrepreneur. Backtrack, 9, 271-4 for some irregular financial transactions in which he was involved on the ECR..
Thomas Longridge Gooch
Born in Brompton, Kensington on 1 November 1808. Family moved to Bedlington in 1816. In October 1826 Gooch started work for George Stephenson at Liverpool as Secretary and Draughtsman. In April 1829 he was appointed resident engineer of the Bolton & Leigh Railway. He assisted in surveying the London & Birmingham Railway and was resident engineer for the section between Kilsby Tunnel and Birmingham. He died in Gateshead on 23 November 1882, but was buried in Kensal Green Cemetry.
See Robbins. Trans. Newcomen
Soc., 56, 59 et seq.
Bailey, Michael R. in Chrimes: includes list of works.
Carpenter, George W. biography Oxford Dictionary of National Biography
William Frederick Gooch
Born in Bedlington, Northumberland, on 19 April 1825; died St Leonards-on-Sea 6 August 1915 aged 90. Fifth son and tenthh and youngest child of John Gooch. Worked for a time on the South Devon Railway. Became works manager at Swindon, GWR, in 1857 under his brother Daniel who hoped William would succeed him as locomotive superintendent, but Joseph Armstrong was appointed and, in 1864, William Gooch left Swindon to become managing director of the Vulcan Foundry at Newton-le-Willows. He retired in 1892. | <urn:uuid:f9ae054f-fcdc-4de8-b942-f609dc28621e> | CC-MAIN-2016-26 | http://www.steamindex.com/people/gooch.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783400572.45/warc/CC-MAIN-20160624155000-00099-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.98318 | 2,385 | 2.984375 | 3 |
Here Are More Than 177,000 Ways To Tie A Tie
Published 7:47 pm, Thursday, February 13, 2014
A group of mathematicians and hackers have discovered that there are more than 177,000 ways to tie a tie.
In a preprint posted on the math and science repository arXiv.org, they built off of an earlier work that identified 85 distinct tie knots. Those knots, however, are variations on a normal tie knot with a flat facade, tied with the broader end of the tie.
The process of tying a tie is essentially just a series of moves. The tie wearer's shirt is broken up into three regions — left, right, and center. At each step, the blade of the tie starts in one of those regions and moves into one of the other regions, alternating between going over and under the existing knot.
At certain points, it is also possible to tuck the blade of the tie under a fold of cloth in the knot. For conventional tie knots, this is only done at the end to secure the knot. For the expanded universe of knots developed in the paper, tucks are possible throughout the process, leading to more complex textures.
The mathematicians, led by Mikael Vejdemo-Johansson of the KTH Royal Institute of Technology in Stockholm, made a rigorous formal language to describe the moves involved in tying a knot. The letter "T" represents a "turnwise" move — taking the tie blade and moving it to the region clockwise in the mirror of its current region. If the tie end is in the center region, near the wearer's neck, a turnwise move sends it to the right. If the end is on the right, it goes over or under the knot to the left.
"W" means "widdershins" — a counterclockwise move going in the opposite direction. These moves can be seen in the image below, taken from the paper:
The formal alphabet is completed with "U" is for tucking the tie "under" some previous bow, or fold, in the knot.
With this alphabet in place, a tie knot can be described by a sequence of these symbols. The authors of the paper introduce a few rules for making knots — because of practical considerations, only sequences of up to eleven T and W winding moves are allowed. They also observe that a tuck needs to have two moves in the same direction (either TT or WW) immediately before it, so that there is a fold of cloth to tuck the blade into.
One of the advantages of using these notations to describe the knot-tying process is that it lends itself well to mathematical analysis. Counting sequences like this is a fairly straightforward process. The authors found 2046 valid sequences of T and W winding moves, and by including optional tucks, a total of 177,147 possible ways to knot a tie.
Another advantage is that it is possible for a computer program to actually write out all of these tie knots. The authors made such a program, in the form of a random tie knot generator that includes a knot sequence chosen from the 177,147 possibilities, along with pictures to help guide the process.
The majority of these knots, like the Trinity and Elderidge knots that inspired them, are tied using the thin blade as the active blade. Many of the knots look pretty strange.
We took a few of the random knots from the generator and tried them out:
And here's how it turned out:
Here's another one:
And the result:
- Here's A Full List Of Medal Winners At The Sochi Olympics
- Here's Why New York City Doesn't Cancel School, Even In Brutal Snowstorms
- COMCAST TO BUY TIME WARNER CABLE FOR $159 PER SHARE | <urn:uuid:3be4f0db-2af6-4fd8-a0a8-0a74ff597c75> | CC-MAIN-2016-26 | http://www.timesunion.com/technology/businessinsider/article/Here-Are-More-Than-177-000-Ways-To-Tie-A-Tie-5233745.php | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396106.25/warc/CC-MAIN-20160624154956-00183-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.944963 | 784 | 3.375 | 3 |
Broadleaf Plantain is a perennial broadleaf plant that grows in many locations from spring to autumn. Not only is this a vital wild edible plant for overall good health, this wild weed can be used to treat chronic diarrhea as well as digestive tract disorders. Broadleaf plantain is packed with nutrients and is safe to ingest. If a person chomps on some fresh leaves, these can be applied to the skin to treat minor burns, insect bites or open wounds.
Distinguishing Features: Broadleaf plantain has green, oval to egg-shaped leaves that grow in a rosette. These leaves have thick stems that meet at a base. When these stems are broken, they reveal string-like veins that resemble those in celery. Long-pointed, green, petite flowers grow from the base; these also contain a small pod housing dark seeds.
Leaves: The leaves grow in a rosette and can range from 5 to 30 cm in length. Plantain leaves have stems that contain string-like veins and these veins are seen on the leaf. There are five to seven prominent parallel veins from the base. Leaves are generally broadly lance-shaped to egg-shaped, are hairless or sparsely short haired.
Height: Can grow to a height of 12cm.
Habitat: Can be found growing throughout Ontario and most of North America as well as in Europe and Asia in meadows, pastures, lawns, roadsides, gardens, and waste places.
Edible parts: The entire plant. Young leaves can be eaten raw or cooked. They are somewhat bitter and tedious to prepare because it’s generally preferable (though not required) to remove the fibrous strands before use. Many people blanch the leaves in boiling water before using them in salads in order to make them more tender. Once blanched, plantain can be frozen then used later in a sauté, soup or stew. Seeds can be eaten raw or cooked and can be tedious to harvest. The seed can be ground into a meal and mixed with flour. Dried leaves make a healthy herbal tea.
EdibleWildFood.com is informational in nature. While we strive to be 100% accurate, it is solely up to the reader to ensure proper plant identification. Some wild plants are poisonous or can have serious adverse health effects.
We are not health professionals, medical doctors, nor are we nutritionists. It is up to the reader to verify nutritional information and health benefits with qualified professionals for all edible plants listed in this web site. Please click here for more information. | <urn:uuid:00fe7d6c-8702-4df8-add5-1c1d99d6c2b8> | CC-MAIN-2016-26 | http://www.ediblewildfood.com/broadleaf-plantain.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393997.50/warc/CC-MAIN-20160624154953-00081-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.943485 | 532 | 2.890625 | 3 |
8 November 2010
Foreign Affairs, Defence and Security Section
The sinking of the Montevideo Maru in 1942 and the consequent loss of over 1000 Australian soldiers and civilians is the greatest loss of Australian lives at sea in war or peace. The concealment of the facts of the sinking by the Japanese military has led some to doubt the veracity of the accounts given of the events, and resulted in great uncertainty about who was actually onboard. This Background Note will outline the history of the sinking of the Montevideo Maru and tell the story of the search to find the truth about the sinking, and just who was on board the vessel when she went down.
The Montevideo Maru was an unmarked Japanese transport freighter which sank on 1 July 1942 while taking 1051 Australian soldiers and civilian Prisoners of War (POWs) to Hainan Island, which was then occupied by the Japanese. The Montevideo Maru was torpedoed and sunk in the South China Sea, approximately 100 km west of the Philippines’ Cape Luzon by the USS Sturgeon, a United States submarine, captained by Lieutenant Commander William Wright. The ship was torpedoed at 2.29 am and sank stern-first 11 minutes later. There were no Australian survivors. This was the biggest single loss of life in Australia’s wartime history, with up to 845 soldiers and 206 civilians believed to have been locked in the ship’s hold when it sank. This number also included the crew of the Norwegian registered MS Herstein, a cargo vessel which had been destroyed by Japanese bombers during the invasion of Rabaul. It is accepted that Lieutenant Commander Wright could not have known its holds were full of people.
Many of the Australians who died were members of Lark Force.
Garrisoned in Rabaul, on the tip of the eastern province of Papua New Guinea (PNG), Lark Force consisted of the 2/22nd Battalion AIF (Australian Imperial Force) and supporting units. It comprised 1400 Australian Army soldiers and ‘… represented Australia’s cursory first line of defence in PNG after Japan entered the war’. According to Norm Furness, a former member of Lark Force who has devoted over 50 years to the cause of gaining recognition for Lark Force:
We were poorly equipped, mainly with stuff from World War I that had been packed in grease for 20 years ... we were supposed to be a garrison force and build up the fortress to protect the base and the airfields, but the extra equipment and reinforcements never came. We had two field guns and one was cracked ... and our airforce consisted of 10 Wirraways and two Lockheed bombers - trainer planes really.
… We were supposed to defend 35km of beach with antiquated equipment. If the Japanese landing parties attracted any flak, they would just go another 500 yards up the beach … I remember looking in the bay and there were 25 Japanese ships, including two aircraft carriers.
The Australian army garrison was inadequate for the task it faced and was quickly overrun by an estimated 15 000–20 000 Japanese soldiers in January 1942. Unfortunately, the garrison was not reinforced nor was it ordered to withdraw. The difficulties of sending reinforcements by sea and maintaining the additional forces when they were there meant that the Australian Chiefs of Staff decided that reinforcements were not possible. Much of Australia’s fighting force was still focused on the war with Germany and this, plus the relentless advance of the Japanese down the Malayan Peninsula and the resultant fall of Singapore on 15 February 1942, must inevitably have drawn the attention of the Chiefs of Staff away from the situation in Rabaul.
Only hours into the invasion, the commanding officer, seeing the futility of the situation, ordered ‘every man for himself’. Approximately 400 Australians fled into the jungle, but many were subsequently recaptured and over 130 were tortured and killed. About 300 men survived a punishing trek to avoid capture and returned safely to Australia. The rest were taken prisoner and a few months later were marched from their compound, minus some officers, to a transport ship—the Montevideo Maru. Before boarding many of the prisoners were allowed to write letters to their loved ones. These were subsequently airdropped over Port Moresby. According to one witness, the departing soldiers were ‘… half-starved and ill ... with a smile and a cheery wave for those remaining, the stronger supporting the weaker, arm in arm’.
The families of those on the Montevideo Maru, unaware of the ship’s loss, continued to send letters to their loved ones in the belief they were being held as prisoners of war. It was not until after the war that families discovered the fate of those lost on the Montevideo Maru.
Some have claimed that even after the Japanese were defeated in New Guinea in 1945, the Australian authorities did little to determine what had happened to the people of Rabaul until the war ended. Norm Furness, the former Lark Force member, says he gave up asking the Government to search for the ship:
I’m not writing any more letters. I’ve written to Prime Ministers and Defence Ministers and Opposition Leaders. I’ve written to local members and look where it’s gotten me.
For many years there was speculation as to whether the Montevideo Maru actually existed. Some believed that the Japanese had actually executed all the POWs and fabricated the sinking in an attempt to avoid charges of war crimes. While it is generally accepted from the first-hand accounts of people on the wharf, that the Montevideo Maru sailed from Rabaul with Australian POWs on board in July 1942, some descendents continue to resist the official version, believing the Australians were executed in New Guinea and that the passenger list of the Montevideo Maru was ‘padded’ by the Japanese in an attempt to conceal war crimes. There is still confusion over the nominal roll, which was ‘… apparently lost from the national archives after being brought back from Japan by post-war investigators’.
The Australian War Memorial’s website Remembering 1942: The sinking of the Montevideo Maru, 1 July 1942 includes the transcript of a 2002 talk by historian Ian Hodges in which he described the loss of the ship and argued that ‘there is little evidence’ to support the theories that the ship did not exist. In fact, he says, ‘the existence of the ship is beyond doubt’. The War Memorial site also includes a copy of the 6 October 1945 report by Major H.S. Williams, the Australian officer attached to the Recovered Personnel Division in Tokyo after the end of the war. This report describes the sinking of the Montevideo Maru and also details the lack of information on POWs from Rabaul provided by the Japanese during the war. The War Memorial site also has a copy of a list of passengers believed to have left New Britain on the Montevideo Maru. This list, also dated 6 October 1945, was compiled in New Guinea after the war by two ‘recovered POWs’ then believed to be at Lae, and contained only 168 names.
Some commentators have suggested that rather than being sunk by the USS Sturgeon, ‘… the ship indeed left Rabaul on June 22 with its cargo of prisoners [but] returned empty two days later, the Japanese having executed them all’. These commentators say this alternative scenario is supported by ‘compelling evidence’—one Rabaul local said the Montevideo Maru, after steaming for nine days, should have been a long distance from the point where it was thought to have been sunk. Further, the commentators have suggested that the ‘cover-up theory’ gains further strength from the accounts of Major Williams:
Major Williams discovered that the Japanese navy had notified the Prisoner of War Information Bureau in Tokyo of the loss of the Montevideo Maru in January 1943. But the Information Bureau failed to pass on the news to Allied authorities as it was obliged to. After pressuring the Japanese for some time, Major Williams unearthed a list supposedly containing the names of those on board buried in files in Tokyo in September 1945. Cover-up theorists regard this as evidence supporting their belief the Japanese attempted to hide the true fate of the men who boarded the ship in Rabaul. In the atmosphere of retribution that existed after the war, Australian military authorities found no evidence to support a war crimes inquiry into the fate of those captured at Rabaul.
According to media reports:
Only one eyewitness account has ever emerged and then only after 60 years when the sole surviving Japanese sailor revealed heart-wrenching details of the “death cries” of trapped Australians going down with the ship while others sung Auld Lang Syne.
This eyewitness, former Japanese sailor Yoshiaki Yamaji, contradicted the post-war account of the Australian Government that all prisoners perished at sea, by revealing that he saw dozens of Australians alive in the water. Unfortunately, no evidence appears to exist which would substantiate this claim.
While World War II historian Dr John Knott, of the School of Social Sciences at the Australian National University, admits that ‘… there is a great deal of mystery surrounding all that happened in Rabaul from the time the Japanese arrived until the end of the war …’ he nevertheless supports the official history of the Montevideo Maru.
Margaret Reeson, author of A Very Long War: the Families Who Waited, has examined the transport of POWs from New Guinea and accepts that the likely scenario is that the Montevideo Maru did sink with over 1050 Australians on board:
The question of who died on the Montevideo Maru may never be answered…There were a number of lists of names compiled, some clearly contained names of men who couldn’t have been on the ship. One of them, for instance, seems to have been a list of the names of the men in the prison camp at Rabaul.
Some commentators have suggested that the discovery of the HMAS Sydney in 2008 has ‘… added to the sense of loss and abandonment felt by thousands more Australians whose loved ones disappeared without trace …’ on the Montevideo Maru in 1942 and that ‘… the families of those who died felt forgotten by their country every time HMAS Sydney was mentioned’.
According to an article in the Canberra Times, Associate Professor Mark Staniforth, a maritime archaeologist from Flinders University has said:
… $500,000 would buy a base suite of equipment, including multi-beam echo sounder, sonar sounder and magnetometer. Marine archaeologists would then be able to locate wrecks in up to 500 metres of water … (including) … the Montevideo Maru.
The article suggests that the money spent by the Government on the discovery of the HMAS Sydney off the coast of Western Australia is ‘… dead money because no infrastructure remains in Government hands … (as) the technology used to find the ship had to be imported’. According to Professor Staniforth, the Government spends only $400 000 a year to preserve Australia’s 5500 shipwrecks and none of this money is spent on infrastructure.
A spokeswoman for the Prime Minister said on 23 April 2008 that the Rudd Government, after receiving a letter from Sydney historian and Montevideo Maru campaigner Albert Speer would consider an appeal to provide funds to find the ship:
The Rudd Government understands the desire of relatives to know the resting place of their loved ones who tragically lost their lives at sea.
We will consider all applications on merit. If merit is found, a proposal will then be put forward to the Government for consideration.
Also in April 2008, former Defence Minister Kim Beazley, whose uncle was lost when the Montevideo Maru went down, said that, given the discovery of the HMAS Sydney, an effort should be made to find the Montevideo Maru:
I think it would be a very good thing, given it was Australia’s greatest sea disaster. I don’t think we have lost as many people at sea before.
According to David Mearns, the US shipwreck hunter who led the search for the HMAS Sydney and the German raider Kormoran, the 3.7 kilometre depth at the site of the Montevideo Maru would not prohibit a search:
Such a depth is not a barrier to a search like the one we conducted for Sydney. It just ensures that the expedition will be costly and run into millions of dollars.
The Montevideo Maru Memorial Committee (MMMC) was set up in early 2009 by relatives of the men who lost their lives in the sinking. The objectives of the Committee are listed in the first edition of their newsletter as:
1. To secure national recognition of the Montevideo Maru tragedy.
2. To facilitate comfort and closure in the minds of the victims’ relatives.
3. To locate the nominal roll brought back from Japan that was deposited with Central Army Records.
4. To stimulate action to provide greater knowledge of the events that led to Montevideo Maru tragedy including the official handling of the Rabaul evacuation in January 1942.
5. To encourage government action to ensure the story of the tragedy is a significant part of Australia’s social history and to enhance knowledge in the community of the role of and sacrifices made by Australians in PNG.
The current patron of the Committee is the Minister for School Education, Early Childhood and Youth, Peter Garrett, whose grandfather, Tom Garrett, went down with the vessel.
Another body, the Montevideo Maru Foundation appears to be a recently established, as yet unincorporated body, whose aim is to help raise awareness of the loss of the Montevideo Maru as Australia’s worst maritime disaster. Its co-patrons are the Member for Fadden, Stuart Robert, and the Member for Moncrieff, Steven Ciobo.
The Rabaul and Montevideo Maru Society was established to ensure national recognition of the fall of Rabaul and Australia’s greatest maritime disaster. Its president is Keith Jackson.
The following petitions on the Montevideo Maru have been presented in the Australian Parliament:
- 13 October 2003—Steven Ciobo, MP, presented two petitions to the House of Representatives, one of which was from 473 citizens calling for the House to support any investigations into the Montevideo Maru. The other petition, signed by 475 citizens, proposed a search to discover the burial places of servicemen still missing in New Guinea.
- 16 February 2004—Steven Ciobo, MP, presented a petition to the House of Representatives from 15 citizens requesting that the House support any investigation into the sinking of the Montevideo Maru.
- 21 June 2009—Steven Ciobo, MP, presented three petitions to the House of Representatives, one of which was from 913 citizens calling for the House to support any investigations into the sinking of the Montevideo Maru. The other petitions, signed by a total of 381 citizens, proposed a search to discover the burial places of servicemen still missing in New Guinea.
- 8 February 2010—Julia Irwin MP, presented a petition to the House of Representatives from 239 citizens requesting that the House support any investigation into the identity of the ship thought to be the Montevideo Maru.
On 8 April 2010, the House of Representatives Standing Committee on Petitions took evidence from three members of the Montevideo Maru Foundation who submitted that a number of deaths attributed to the sinking of the Montevideo Maru had not in fact occurred then. The Montevideo Maru Foundation told the Committee that it ‘is asking for financial and technical support to identify the final resting place of several people who were understood to have been buried near Rabaul but who have been declared lost with the Montevideo Maru’.
Albert Speer, former PNG administrator and a Montevideo Maru campaigner would like the Government to consider funding a search for the ship. Mr Speer has written to the Prime Minister calling for action for ‘the sake of historical truth, certainty and peace of mind of the families’ of the victims, urging the Government to fund the search for the Montevideo Maru and recover the captain’s safe, which will presumably contain the passenger manifest:
The continuing existence of doubts still obscuring truth and causing anguish to all families of Australians who lost their lives in the Pacific War should be of concern to all Australians. It is surely the duty of the Australian government to do all in its power to remove those doubts, just as it has done in other cases no more or less deserving.
Cynthia Schmidt, a researcher for the Montevideo Maru Foundation, who directs a campaign to find missing soldiers killed in South-East Asia during World War II, has asked the Federal Government to use the technology utilised to find the HMAS Sydney to search for the Montevideo Maru.
On 1 July 2009, the 67th anniversary commemoration of the sinking of the Montevideo Maru, the Minister for Veterans Affairs, Alan Griffin MP announced some measures the Government was taking to honour the victims of the sinking of the Montevideo Maru:
“Today the Australian Ambassador to the Philippines, Mr Rod Smith, will unveil a plaque commemorating those on board the Montevideo Maru on behalf of the Papua New Guinea Volunteer Rifles Association at the Hellships Memorial, established in memory of all the ships that carried POWs,” he said.
Mr Griffin also confirmed he has approved a $7200 grant to enhance the central plinth at Subic Bay. “Later in the year, under a grant made by the Australian Government to the RSL Angeles Sub-branch in the Philippines, commemoration of the Montevideo Maru at the Hellships memorial will be further enhanced and an interpretation will be placed in a nearby museum.” The funds have been granted through the Overseas Privately-Constructed Memorial Restoration Program, which recognises the contribution that organisations around the world make to honouring Australia’s war time heritage.
One of the Australians who attended the commemoration ceremony, Andrea Williams, a member of the MMMC whose grandfather and great uncle both died on board the vessel, continued to maintain pressure on the Australian Government to do more to investigate the fate of the Montevideo Maru:
“There is a fair amount of literature on the Montevideo sinking but there are some nagging specifics, like why there was no inquiry into the fate of these men,” she said. Australian archives had several passenger lists but they were inconsistent and there was no passenger manifest, she said. “What has happened to the nominal roll of the men apparently on board?”
However, as the Minister for Veterans’ Affairs told the Sydney Morning Herald at the time:
... he was not aware of any claims regarding lost documents or a cover-up”, and there were no plans to organise a search for the ship. “Through official commemoration and an ongoing program of publications, the Government recognises and honours those lost on the Montevideo Maru, bringing the disaster to the nation’s attention.”
More recently, in August 2009 the Minister for Defence, John Faulkner, also explicitly rejected any suggestion that the Australian Government should fund a search for the Montevideo Maru. In response to a petition sent to him by Julia Irwin MP, Senator Faulkner wrote:
While the sinking of the Montevideo Maru was a national tragedy, an international search for the vessel is not possible at this time. Unlike HMAS Sydney II, an Australian vessel located in Australian waters, the Montevideo Maru is an unflagged vessel and lies in the Philippine Exclusive Economic Zone. The Australian Government can protect vessels lying in Australian waters under the Historic Shipwrecks Act 1976, but cannot protect vessels lying outside Australian waters. Regrettably, the Philippine Government does not have similar legislation that could protect the Montevideo Maru if it were found.
Any search for the Montevideo Maru would alert shipwreck looters to the possible location of the wreck, which would threaten the wreck and the remains of those onboard. This would be unacceptable to the Australian Government, and forms the basis of the decision not to search for the Montevideo Maru at the present time.
However, on 11 November 2009 (Remembrance Day), the Minister for Veterans’ Affairs raised the possibility of declaring the site an official war grave:
“I think we all agree now that the detail and the significance of the event have not received appropriate recognition in the past.” He said the Government would investigate the possibility of declaring the site of the sinking, off the Philippines, an official war grave, and assist family and friends in raising funds for a memorial in Canberra.
Media reports stated that the Australian War Memorial would set up a permanent display on the sinking of the Montevideo Maru and that the Government ‘will renew the search’ for the Japanese records which contain the names of those who died. There were no details about how the Government would go about this, but given Senator Faulkner’s comments it would seem that the close cooperation of the Philippines Government might assist.
On 21 June 2010 the Minister for Veterans’ Affairs made a Ministerial Statement to the House of Representatives concerning the Montevideo Maru. The statement did not announce new policy but set out the facts and fully acknowledged the suffering of the relatives of those people who perished on the Montevideo Maru:
As we stand here today, I would like to formally mark the great loss of the Montevideo Maru and honour those who died. Australia is forever grateful for their service in defence of our nation during the Second World War. I would especially like to acknowledge the great emotional suffering of the families and friends they left behind. These people endured many long and painful years waiting for news of their loved ones and they deserve to be remembered. The fortitude needed to survive the three years it took for the tragic news of the death of their loved ones to reach them is exemplary. And I extend to them my wholehearted condolences. Their experience is an integral part of our wartime history.
As mentioned above, a roll of those persons who had embarked on the Montevideo Maru was discovered in Tokyo by Major Williams in 1945. The roll was taken by the Japanese at an unspecified time, but probably well before the Montevideo Maru left Rabaul on its ill-fated final voyage. The 48 page roll was in Katakana (Japanese script) and was partially translated by Major Williams and then completed in Australia. The roll was then checked against personnel records and this was the basis on which next of kin were informed of the suspected death of their loved ones. It should be noted that the process of translation would not have been easy, and given that the Japanese roll was an attempt to render English names into Katakana in the first place the process of double translation must give rise to some doubts about the accuracy of parts of the list.
There is still confusion over the whereabouts of the original roll, which was ‘… apparently lost from the national archives after being brought back from Japan by post-war investigators’. This statement reflects what has become received wisdom on this issue but even this is somewhat confusing. On his website Montevideo Maru, Rod Miller states that it is the original Katakana roll which is lost and not the English translation.
How the roll was lost and what, if anything, has been done to retrieve it has also been something of a mystery. However, during a meeting of the House of Representatives Standing Committee on Petitions held in November 2009, Brigadier David Mulhall informed the Committee:
There is a document called the Katakana roll, which we believe to be the most reliable record of who may have been on the Montevideo Maru when it was sunk. That document has been searched for for many years now. We believe that we may have found a copy of it, but right now we are in the process of trying to verify the authenticity of that document. That is being worked on actively and we hope to be able to give some advice in due course.
In a book entitled Heroes at Sea the late Don Wall published an ‘Honour Roll’ in which he lists the people who died when the Montevideo Maru went down. Unfortunately, Mr Wall does not provide any information on the provenance of the roll.
It is possible that Mr Wall derived his information from the Australian War Memorial Roll of Honour. Since this can be searched online by entering the date of death, it is possible to retrieve the names of Australian military personnel who died on a particular day. A search using 1 July 1942 as the date of death retrieves 871 names which must, in the main, be the AIF personnel thought to have perished on the Montevideo Maru. The Montevideo Maru is not mentioned on any of these records, with place of death listed as ‘At sea (South West Pacific Area)’ and cause of death described as ‘presumed’.
The War Memorial website has a copy of a list of passengers believed to have left New Britain on the Montevideo Maru. This list, dated 6 October 1945, was compiled in New Guinea after the war by two ‘recovered POW’ then believed to be at Lae, and contained only 168 names. No explanation is given as to the method used by the compilers to create the list.
On the balance of evidence, it seems that the story of the sinking of the Montevideo Maru by the Sturgeon is more likely than not. Given the speed with which the vessel went down it is not surprising that there were so few survivors from the crew and none at all from those locked below decks.
The Katakana roll provides a list of the people most likely to have been on board the Montevideo Maru but it is not certain that it is accurate or even that all those on the roll actually boarded the ship. The discovery of the roll and some analysis of it, in addition to any further research that might be done in the Japanese war archives, may be fruitful, but it might also be that a degree of uncertainty and doubt will remain.
The National Archives of Australia holds a number of files with data about individual people thought to have died on the Montevideo Maru. This can be accessed on the NAA website at http://naa12.naa.gov.au/scripts/ResearcherScreen.asp.
There is a memorial to the Montevideo Maru in the POW Memorial at Ballarat and the Australian War Memorial has a website on the Montevideo Maru at http://www.awm.gov.au/atwar/remembering1942/montevideo/
For copyright reasons some linked items are only available to members of Parliament. | <urn:uuid:231cfd3d-7036-42bc-ac74-f8ffc44aa569> | CC-MAIN-2016-26 | http://www.aph.gov.au/About_Parliament/Parliamentary_Departments/Parliamentary_Library/pubs/BN/1011/MontevideoMaru | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398216.41/warc/CC-MAIN-20160624154958-00057-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.968339 | 5,531 | 2.6875 | 3 |
Agarose gel electrophoresis
Electrophoresis is a technique that separates large molecules by size using an applied electrical field and a sieving matrix. DNA, RNA and proteins are the molecules most often studied with this technique; agarose and acrylamide gels are the two most common sieves. The molecules to be separated enter the matrix through a well at one end and are pulled through the matrix when a current is applied across it. The larger molecules get entwined in the matrix and retarded; the smaller molecules wind through the matrix more easily and travel further from the well. Molecules of the same size and charge migrate the same distance from the well and collect into a band.
DNA and RNA are negatively charged molecules due to their phosphate backbone, and they naturally travel toward the positive charge at the far end of the gel. They are typically examined with agarose gels. Proteins are composed of amino acids that can be positively, negatively or uncharged. To give proteins a uniformly negative charge, they are coated with a detergent, SDS, prior to running them on a gel. Protein samples are also boiled to remove any secondary structure that might make two molecules of the same size migrate differently. Polyacrylamide is the matrix commonly used to separate proteins.
These gels are typically run vertically while agarose gels are run horizontally but gravity has nothing to do with the separation.
Today you will separate DNA fragments using an agarose matrix. Agarose is a polymer that comes from seaweed and if you’ve ever made Jell-O™, then you already have all the skills for pouring an agarose gel. To prepare these gels, agarose and buffer are microwaved until the agarose is melted. The molten agar is then poured into a horizontal casting tray, and a comb is added. Once the agar has solidified, the comb is removed, leaving wells into which the DNA sample can be loaded.
The distance a DNA fragment travels is inversely proportional to its length. Over time fragments of similar length accumulate into “bands” in the gel. Higher concentrations of agarose can be used to resolve smaller DNA fragments. The figure below (far right) shows the same DNA fragments resolved with three agarose concentrations. The 1000 base pair fragment is indicated in each.
Agarose gel electrophoresis
Scanning EM image of agarose polymer
Agarose gel data analysis
Ethidium Bromide is a fluorescent dye that is commonly added to agarose gels. This dye intercalates between the bases of DNA, allowing DNA fragments to be located in the gel under UV light and photographed. The intensity of the band reflects the concentration of molecules that size, although there are upper and lower limits to the sensitivity of dyes. Because of its interaction with DNA, ethidium bromide is a powerful mutagen and will interact with the DNA in your body just as it does with any DNA on a gel. You should always handle all gels and gel equipment with nitrile gloves. Agarose gels with Ethidium Bromide must be disposed of as hazardous waste.
Today you will run your digested plasmid backbone and the digested PCR product on an agarose gel. You will then cut the relevant bands of DNA out of your gel and proceed to purify them from the agarose. Next time you will mix them in a ligation reaction.
Part 1: Running your gel
You will use a 1% agarose gel (prepared by the teaching faculty), running seven samples as well as a reference lane of molecular weight markers (also called a DNA ladder).
- Add 20 μL of sterile water to the 5 μL PCR aliquots (not the PCR double digest) you stored after Mod1 Day2.
- Add 4 μL of 6X loading dye to the PCR aliquots, as well as to the pCX-NNX digested by XbaI and/or EcoRI, and the PCR product digested by XbaI/EcoRI.
- Loading dye contains bromophenol blue as a tracking dye to follow the progress of the electrophoresis (so you don’t run the smallest fragments off the end of your gel!) as well as glycerol to help the samples sink into the well.
- Xylene cyanol may also be used as a tracking dye, but does note migrate as far across the gel.
- Flick the eppendorf tubes to mix the contents, then quick spin them in the microfuge to bring the contents of the tubes to the bottom.
- Load the gel in the order shown in the table below.
- To load your samples, draw the volume listed on the table below into the tip of your P200. Lower the tip below the surface of the buffer and directly over the well. You risk puncturing the bottom of the well if you lower the tip too far into the well itself (puncturing well = bad!). Expel your sample into the well. Do not release the pipet plunger until after you have removed the tip from the gel box (or you'll draw your sample back into the tip!).
- Once all the samples have been loaded, attach the gel box to the power supply and run the gel at 125 V for no more than 45 minutes.
- While the gels run, we will have our pre-lab lecture. Please also find some time to pre-weigh and label two eppendorf tubes before your gel is done!
- You will be shown how to photograph your gel and excise the relevant bands of DNA.
|| Volume to load
|| Uncut pCX-NNX^
|| 10 μL^
|| pCX-NNX XbaI
|| 5 μL
|| pCX-NNX EcoRI
|| 5 μL
|| pCX-NNX XbaI + EcoRI
|| 25 μL
|| 1Kb DNA Ladder
|| 20 μL
|| PCR Product XbaI + EcoRI
|| 25 μL
|| PCR Product Uncut
|| 25 μL
|| PCR no-template-control
|| 25 μL
^Available from the teaching faculty
Part 2: Visit from Environment, Health & Safety (EHS)
Starting between 3 and 3:15 pm, we will have a visit from EHS to discuss Biosafety in preparation for doing tissue culture.
Ideally, you will have cut the bands out of your gel by then, but will not yet have purified them.
Part 3: Isolating/Purifying DNA
To purify your DNA from the agarose, you will use another kit sold by Qiagen. Again the reagents have uninformative names and their contents are proprietary. Like the PCR Clean-up kit, the Agarose Purification kit requires binding the DNA to a spin-column with a silica-gel membrane, washing away salts and eluting the DNA from the membrane.
- Estimate the volume of your gel slices by weighing them.
- Add 3 volumes of QG for every 1 volume of agarose. (The maximum advised volume is 550 ul. Continue for now, but read step 5 carefully.)
- Incubate in the 50°C water bath for 10 minutes, until the agarose is completely dissolved. Every few minutes, you can remove your tubes from the 50°C heat to flick the contents. This agitation will help dissolve the agarose.
- Add 125 μL of isopropanol to each eppendorf tube.
- Get two QIAquick columns and two collection tubes from the teaching faculty. Label the spin-column (not the collection tubes!) either “bkb” or “frag” then pipet the appropriate dissolved agarose mixture to the top. Microfuge the column in the collection tube for 60 seconds. The maximum capacity of the QIAquick columns is 800 uL! If you have more than 800 uL in your mixture, you will need to repeat this step on the same column.
- Discard the flow-through in a temporary waste container (such as a 15 mL conical tube) and replace the spin-columns in their collection tubes. Add 750 ul of PE to the top of the column and spin as before.
- Discard the flow-through in your waste container and replace the spin-columns in their collection tubes. Add nothing to the top but spin for 60 seconds more to dry the membrane.
- Trim the cap off two new eppendorf tubes and label the sides with your team color, the date, and either “bkb” or “frag.” Place the spin-column in the correct trimmed eppendorf tube and add 30 ul of EB to the center of the membrane.
- Allow the columns to sit at room temperature for one minute and then spin as before. The material that collects in the bottom of the eppendorf tubes is your purified plasmid backbone or insert, ready to be ligated.
- At the end of the day, dump your waste tube into the chaotropic salt/ethanol waste in the fume hood, and save the tube for another day.
Part 4: Evaluate recovery
Ligations generally work best when there is a 1:4 molar ratio of backbone to insert. You will ligate your fragments next time, but before you do, run a small amount out of the purified products on a gel. This will allow you
- to check that you purified your DNA from the agarose
- to assess the quality of the DNA (that it’s not degraded or contaminated)
- to adjust the amount of backbone and fragment in your ligations for an ~1:4 ratio.
- Move 5 μL of each sample into an eppendorf tube labeled “purif bkb” or “purif frag.” Add 15 μL sterile water to each tube and 3 μl loading dye. Use a colored label to identify your team color and give the samples to the TA. The TA will run a 1% agarose gel for you and the result will be posted. Once it is posted, you may complete the FNT #2 to prepare for the ligation you will do in lab next time.
- Freeze the remainder of your purified DNAs at –20°C.
For next time
Part 1 of this assignment is also due on Stellar.
- In addition to the methods section that you began last time, you will document the work you do during Module 1 in a formal written summary. To help you pace your work, as well as give you feedback early on, you will be required to draft small portions of the summary as homework assignments. For next time, you should prepare a page on today's experimental outcomes.
- Begin by reading, under Logistics, Guidelines on Formatting and Length. Next, skim the Content Guidelines, paying particular attention to those relevant for M1D3.
- You should present both the purification gel and the recovery gel, each in a well-labeled figure with an appropriate figure caption. Be sure to follow our written guidelines as well as the suggestions presented by your writing instructor during class.
- Below the figures, interpret the outcomes in concise language. Consider reviewing slides 30 and 31 in the Writing Lab talk titled EBICS REU Poster Best Practices DMC SWO 1 to learn how to turn bulky sentences into succinct bullets. It's also okay to use complete sentences when they more clearly make your point.
- To prepare for our next lab session, calculate the amounts of DNA you will use in the ligation by following the steps below.
- Separately calculate the concentration of backbone and of insert based on the recovery gel posted on today's Talk page. Refer to the NEB marker definitions to estimate the ng of DNA in each lane, and refer to your notebook/protocol for the relevant volume basis. Note that the ng listed are for 10 μL of ladder.
- You may convert the mass concentration to a molar concentration, using the fact that a typical DNA base is 500 g/mol. This conversion will mostly cancel out between the insert and the backbone, except for the difference in number of bases. Feel free to either omit steps that will cancel if you are comfortable doing so, or to keep them if you follow the lab math better that way.
- Ideally, you will use 50-100 ng of backbone in the upcoming ligation. Referring to the mass concentration, what volume of DNA will this amount require?
- Ideally, you will use a 4:1 molar ratio of insert to backbone. Referring to the molar concentrations, how much insert do you need per μL of backbone?
- A 15 μL scale ligation should not include more than 13.5 μL of DNA. If your backbone and insert volumes total to greater than this amount, you must (1) scale down both DNA amounts, using less than 50 ng backbone and/or (2) stray from the ideal 4:1 molar ratio. You may ask the teaching faculty for advice during class if you are unsure what choice is best, but make and submit an initial ligation plan for now.
- NEB Loading Dye (link)
- 2.5% Ficoll®-400
- 11mM EDTA
- 3.3mM Tris-HCl
- 0.017% SDS
- 0.015% bromophenol blue
- pH 8.0@25°C
- 1X TAE
- 40 mM Tris
- 20 mM Acetic Acid
- 1 mM EDTA, pH 8.3
- QIAquick gel extraction kit | <urn:uuid:74fb4ce1-d411-4291-b2a7-87186ed598ba> | CC-MAIN-2016-26 | http://www.openwetware.org/wiki/20.109(F13):_Mod_1_Day_3_Agarose_gel_electrophoresis | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398075.47/warc/CC-MAIN-20160624154958-00104-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.903577 | 2,899 | 3.828125 | 4 |
Reputation Management and Social Media
Background information and a note about methodology
Managing an online identity has become a multimedia affair. Not only can internet searchers type in queries about someone who has aroused their curiosity, they also can seek pictures, videos, and real-time status updates online. Location-based awareness in mobile devices adds another layer of information that can be searched. Avid users of mobile devices may voluntarily reveal their identity and location to certain websites, thereby allowing almost anyone to learn their whereabouts. Surveillance, even the most benign kind, has moved out of the realm of private investigators and into the hands of the general public.
Much has changed since our 2007 Digital Footprints report. At the time, the idea of the then-new facial recognition technology being touted by photo search services like Polar Rose seemed radical. Today, facial recognition technology is standard in many new digital cameras, and applications like Polar Rose are soon going to be fused with the cameras and internet connections on users’ phones. Google Goggles, a service that lets you use pictures taken with your mobile device to search the Web, doesn’t offer facial recognition for now, but the underlying capability is there.1 As with any major technological advance, there are great potential benefits and risks associated with how these tools ultimately get used. See someone at a conference that you recognize but can’t remember his name? Aim your camera at him and instantly pull up the search results connected with his image online. Having a drink at a bar? Would you mind if another patron who took a liking to you could snap a picture and look you up? Planning on attending a political protest? Would you reconsider if you knew you could instantly be identified by the counter-protesters?
Even those who choose to be relatively conservative with the information they share on the internet—favoring usernames in lieu of real names when posting comments or creating an online profile—are becoming easier and easier to identify. According to one prominent study from the field of re-identification research, the vast majority of Americans (87%) can be identified with only three pieces of information: gender, zip code and date of birth.2 Given that this information is easily gleaned from many online profiles created for popular sites like Facebook, users may be more exposed than they realize. Other new studies have shown that seemingly anonymous profiles that express unique preferences—such as movie lists on Netflix—can be used to identify users.
Recent changes in the default settings associated with Facebook and the launch of Google Buzz have prompted a heated public discussion about whether or not the public cares about “privacy” at all.3 But as prominent legal scholars and social media experts have repeatedly argued, a user’s sensitivity to specific privacy concerns is highly dependent on context and is often oversimplified.4 For instance, a user of a social networking site may not care if friends and family know that she is a fan of a certain political candidate on Facebook, but she may prefer not to broadcast those preferences to her employer or neighbors.
One of the interesting tensions inherent in the realm of online reputation management is that users want to have a sense of control over their information, but they sometimes take the path of least resistance when making choices about how they manage their profiles and other content connected to their name online. Whether that means accepting the default privacy settings of an application or skipping over the fine print in a “terms of service” agreement, decisions about how one’s identity is communicated to the world can be made in haste and under the assumption that everyone experiences some level of “privacy through obscurity.”
Popular media coverage of young adults and technology use has often suggested that younger generations have little regard for practicing discretion when sharing information online.5 However, the findings in this report suggest that, when compared with older users, young adults are more active online reputation managers in several dimensions. When compared with older users, they more often customize what they share and limit whom they share it with. Other recent research has also disputed the notion that young adults and even teenagers simply “don’t care” about privacy.6
Personal information has become a form of currency that is shared and exchanged in the social marketplace today. Yet, while the management of users’ online identities has arguably become more complex and multi-faceted over time, internet users have become less likely to worry about the amount of information available about them online.
However, it is important to note that the results from this survey do not indicate that internet users care any less about retaining control over their personal information online. Many people simply are not aware of what is actually available about them; the overall drop in those who say they worry is primarily among those who have never used a search engine to look up their own names online. Likewise, a general lack of concern about the amount of information connected to one’s name online does not preclude a user from having a wide range of specific concerns about how that information might be used—whether those worries relate to the security of financial information, advertisers’ access to personal information shared on a social networking site, or government surveillance of online activities. For example, recent research has suggested that the majority of American adults do not want internet marketers to tailor advertising to their interests—particularly when that involves online data collection and monitoring.7
While online advertising plays an increasingly influential role in the way that internet users’ information is gathered, stored and sold, this survey did not address specific concerns about data collection by marketers. Instead, this report examines the everyday choices that internet users make about communicating their identity to the world and the ways in which they consume the information that others share about themselves. At the heart of the social media explosion are millions of individual users, each contributing their share of content, and each with a reputation at stake.
This report is based on the findings of a daily tracking survey on Americans’ use of the internet. The results in this report are based on data from telephone interviews conducted by Princeton Survey Research Associates International between August 18 to September 14, 2009, among a total sample of 2,253 adults, age 18 and older including 560 cell phone interviews. Interviews were conducted in both English (n=2,179) and Spanish (n=74) and all interviews were conducted via telephone. For results based on the total sample, one can say with 95% confidence that the error attributable to sampling and other random effects is plus or minus 2.3 percentage points. For results based on internet users (n=1,698), the margin of sampling error is plus or minus 2.7 percentage points. In addition to sampling error, question wording and practical difficulties in conducting telephone surveys may introduce some error or bias into the findings of opinion polls.
A combination of landline and cellular random digit dial (RDD) samples was used to represent all adults in the continental United States who have access to either a landline or cellular telephone. Both samples were provided by Survey Sampling International, LLC (SSI) according to PSRAI specifications. A more detailed discussion of the sampling methods used for this survey is provided in the last section of this report.
- Google has publicly stated that they have made a deliberate decision to withhold facial recognition features from the public version of Google Goggles for now, but prominent technology experts like Tim O’Reilly have had “full versions” of the Google Nexus One phone demonstrated to them, showing the ability of the phone’s camera to detect and accurately identify an individual. See: http://radar.oreilly.com/2010/01/the-nexus-one-vs-iphone.html ↩
- See “Computational Disclosure Control,” by Latanya Sweeney. Available at: http://groups.csail.mit.edu/mac/classes/6.805/articles/privacy/sweeney-thesis-draft.pdf ↩
- For instance, see: “Beyond Google and Evil: How Policy Makers, Journalists and Consumers Should Talk Differently About Google and Privacy” by Chris Hoofnagle (http://firstmonday.org/htbin/cgiwrap/bin/ojs/index.php/fm/article/view/2326/2156) ↩
- For example, see: Understanding Privacy by Dan Solove (http://www.danah.org/papers/talks/2010/SXSW2010.html). ↩
- See, for instance: “Kids, the Internet, and the End of Privacy: The Greatest Generation Gap Since Rock and Roll,” by Emily Nussbaum. New York Magazine. Available at: http://nymag.com/news/features/27341/. See also, a quote from the forthcoming book by David Kirkpatrick, The Facebook Effect: “The older you are, the more likely you are to find Facebook’s exposure of personal information intrusive and excessive.” ↩
- See “How Different are Young Adults from Older Adults When it Comes to Information Privacy Attitudes and Policies,” Chris Hoofnagle et al. Available at: http://papers.ssrn.com/sol3/papers.cfm?abstract_id=1589864. See also: “Youth, Privacy and Reputation,” Alice E. Marwick, et al. Available at: http://cyber.law.harvard.edu/publications/2010/Youth_Privacy_Reputation_Lit_Review ↩
- See, for instance, a recent and detailed study of Americans’ views towards privacy and tailored advertising online: Joseph Turow et al., “Americans Reject Tailored Advertising and Three Activities that Enable It.” Available at: http://papers.ssrn.com/sol3/papers.cfm?abstract_id=1478214 ↩ | <urn:uuid:ecc781f6-cc25-42ff-ab74-e070bcad4340> | CC-MAIN-2016-26 | http://www.pewinternet.org/2010/05/26/introduction-4/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00169-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.932126 | 2,045 | 2.84375 | 3 |
Childhood disorders, often labeled as developmental disorders or learning disorders, most often occur and are diagnosed when the child is of school-age. Although some adults may also relate to some of the symptoms of these disorders, typically the disorder’s symptoms need to have first appeared at some point in the person’s childhood.
Some of these issue are essentially disorders of the brain, while others are more behavioral in nature. Mind based disoders are caused by neurochemical issues or basic variations from the cerebrum's norm. They can be innate (i.e., showing up at or not long after birth); or they may come about because of a physical stretch, for example, sickness or damage, or a passionate anxiety, for example, injury or misfortune.
Related Journals of Childhood Disorders
Child and Adolescent Behaviour, Psychological Abnormalities in Children, Contemporary Issues in Early Childhood, Early Childhood Education Journal, Early Childhood Research and Practice, European Early Childhood Education Research Journal, Journal of Autism and Childhood Schizophrenia, Archives of Disease in Childhood | <urn:uuid:ec9a6271-968b-4b40-94b5-7229c0335699> | CC-MAIN-2016-26 | http://www.omicsonline.org/scholarly/childhood-disorders-journals-articles-ppts-list.php | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404405.88/warc/CC-MAIN-20160624155004-00059-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.936814 | 215 | 3.296875 | 3 |
NPR reports the foods and flavors mothers eat show up distinctively in amniotic fluid. What's more interesting is the reaction to the same foods after birth. Researchers tested babies who had been exposed to carrots in the womb against those who didn't, and, when fed carrots for the first time, those who hadn't had carrots had a negative reaction. Exposure to flavors early on greatly increases the chance that a child will like certain types of food.
Now, does that mean if you eat lots of Brussels sprouts while pregnant your toddler will gobble them up? Not necessarily. Many other factors come into play as kids grow. The researchers in this story urge parents to keep at it and eventually their kids' taste buds will come around.
• Read more: Baby's Palate And Food Memories Shaped Before Birth
(Image: Maggie Starbard/NPR) | <urn:uuid:ebf03d44-f470-466f-9975-602171078e2a> | CC-MAIN-2016-26 | http://www.thekitchn.com/new-research-shows-food-memori-153222 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392159.3/warc/CC-MAIN-20160624154952-00022-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.971685 | 175 | 2.71875 | 3 |
Bryn Mawr Classical Review 2006.03.21
Philippa Lang (ed.), Re-Inventions: Essays on Hellenistic and Early Roman Science. Apeiron 37.4. Kelowna, BC: Academic Printing and Publishing, 2004. Pp. vi, 135. ISBN 0-920980-89-9. $22.95 (pb).
Reviewed by Paul T. Keyser
Word count: 1683 words
What's new in the past? The past that we study is largely a human production of words and deeds, thoughts and theories, and thus the human past, like the present and future, contains almost boundless potential to elicit reflection and reaction. A few years ago I was in the audience at Emory when speakers in a conference entitled Reinventions propounded some novelties in the history of Hellenistic science. The five papers of this volume include three of those papers, joined with two new contributions. The goal was to open up the discussion on ancient science by looking at the relatively neglected period that followed Aristotle and preceded Ptolemy and Galen, and by recasting the questions to produce new results. Conference proceedings, like Festschriften, because heterogeneous, can remain under-appreciated -- I hope that the papers of this volume will be more widely and deeply received, especially the far-reaching and innovative contribution of G. E. R. Lloyd.
The keynote address by Lloyd appears here as the lead paper, "New Issues in the History of Science" pp. 9-27), presenting his call for an "ecumenical" history of science. Even in the best of circumstances, the past provides a narrative without a causal account, which upon reflection elicits from those studying the narrative a desire to create such an account. It is all too easy to read the narrative as inevitable. Lloyd offers an exciting alternative by challenging historians of science to discover how things developed in other places as the best way to test their explanations of how things developed in the place under study. That is probably the closest one can come to a control experiment in the study of history -- so long as such comparison is possible. If we are to study the past or other people at all, we must assume some commensurability, and Lloyd makes good use of several points of contact. His chosen comparanda here are ancient Greece and ancient China, within the fields of mathematics, astronomy, and harmonics. Chinese mathematics have been contrasted with Greek mathematics by describing the Chinese system as less axiomatic and more practical. Lloyd (12-15) accepts the former and rejects the latter: Chinese mathematicians sought to develop a systematic method to analyze and solve problems that went far beyond the practical. Not only did they calculate pi using inscribed polygons of hundreds of sides, they in general sought to establish connections between categories of problems, an approach that was "not deductive, but analogical" (15). Such analogic moves are highly productive in modern mathematics and mathematical sciences, and were probably an important ingredient in ancient Greek medical and biological practice as well. In the study of nature, whereas Greeks had a concept of phusis, the Chinese did not (15-16); moreover, they did not seek the ultimate constituents of things, and instead sought an understanding of the processes of change without postulating a radical separation between perception and reality (17-18). The material to observe was the same, but the style of inquiry differed (18). As in mathematics, so in astronomy -- Greeks sought a deductive explanation validated by prediction, whereas Chinese sought to determine patterns (e.g., eclipse cycles) in order to facilitate prediction: in both cases astrology provided a key impetus (19). In harmonics too there were common concerns, such as to elucidate the regularities of scales, but Chinese omitted the methodological debate over perception versus reason as tools of harmonic analysis (20). Science, as Lloyd would define it, is a matter of aims -- to comprehend and explain natural phenomena -- and that common ground of commensurability allows analysis (22). Moreover, although lacking an explicit concept analogous to phusis, it is clear that the Chinese saw themselves as studying a world of "natural" phenomena, in contrast to the phenomena of spirits and deities, and that too provides a ground of commensurability. As Lloyd argues, the primary referents of natural phenomena themselves provide a shared reality -- but do not wholly determine the mode of inquiry (23). We as students should be limited neither to our own perspective nor to an ancient perspective, whether purely Greek or purely Chinese (24-25). It is to be hoped that the ecumenism advocated by Lloyd will continue to bear fruit, and that others will take up the task of learning Chinese (or Sanskrit), so as to read the texts with a wider vision.
Karin Tybjerg's paper, "Hero of Alexandria's Mechanical Geometry" (29-56) substitutes for her conference contribution "Texts and Machines: Hellenistic and Early Roman Mechanical Treatises"; she here reconsiders the mathematics of this neglected author, whose five Teubner volumes are rarely read or translated. The works offer a view of geometry and mechanics interacting in ways seen in few Greek texts: Hero's demonstrations combine numerical examples with mechanical methods and instruments, resulting in a melding of geometry and mechanics (34, 36), in a manner seemingly opposed to Aristotle, who insisted on a radical distinction (Physics 2.2 [193b32-194a13]). Hero transforms Archimedes' solutions into mechanical systems and describes physical procedures for performing numerical integration of surface areas or volumes of irregular shapes (40-41). When doubling cubes or other solids, various forms of "slide rule", analogous to Eratosthenes' device, are employed (41-43). Hero is dealing with the irregularity and complexity of the world within which Plato and Euclid sought to find an underlying regularity and simplicity -- or as Tybjerg puts it, Hero "prioritizes completeness over purity of method" (43). In other treatises, Hero performs the converse, and geometrizes his devices, describing their construction as if describing the construction of a diagram (46-51).
Ian Mueller's wide-ranging paper, "Remarks on Physics and Mathematical Astronomy and Optics in Epicurus, Sextus Empiricus, and some Stoics" (57-87), is also a substitute for the paper given at Emory, "Stars and the Weather" (p. 2 offers an explanation). His aim is to elucidate how mathematics and physics were distinguished in the Hellenistic era, using astronomy and optics as examples. Epicurus' rejection of the possibility of conclusive demonstration regarding "things on high" (58-61), and the rejection by both Epicurus and Sextus of most of the topics of paideia (61-64), serve to open a larger discussion of mathematics and physics in several Stoic texts by or related to Poseidonios/ Geminus (64-85). Mueller reads the difficult passage in Simplicius In Phys. 2.2 (pp. 292-293) in a way consonant with that of Bowen and Todd, Cleomedes' Lectures (2004) 193-204: Poseidonios/ Geminus associates causal explanation with "physics" and denies it to "astronomy", because there the hypothesized causes (geometrical models) are not better known than the observed effect (66-69). Here there is an interesting opportunity for resonance with Lloyd's work: is it possible that an analogous (but implicit?) epistemological move lies behind the Chinese preference for pattern-recognition over hidden causes in physical explanation? Passages in Strabo (2.5.2) and Proclus that may go back to Poseidonios/ Geminus seem to disclose a similar point of view (72-82), whereas a neglected extract on optics may attribute causal explanation to hypothesis-based geometrical optics (82-85).
James Allen's subtle paper, "Experience as a Source and Ground of Theory in Epicureanism" (89-106), given at Emory, aims to use texts showing how the medical Empiricists viewed experience to elucidate the view of experience among Epicureans. The Empiricists distinguished peira from empeiria as knowledge based on a single observation from knowledge or memory of repeated observations. This "generous ... conception of experience" nonetheless confines experience to knowing that phenomena occur, and does not include any causal account (89-92). Allen notes that this is consistent with the Aristotelian framework in Metaphysics A.1 (980-981), and then argues that Epicureans took a position inconsistent with that framework (92-93). The Epicurean method by which theories are falsified or supported involves the "evident", or ways of grasping it (93-96). For Epicurus, to reject any theory that could explain the phenomena is in effect to reject the phenomena (96-98). That is because the grasp of the evident is ipso facto a (partial) grasp of how even non-evident things can and must occur (98-99). Epicurean epilogismos proceeds from phenomena to other phenomena -- unlike the empiricist epilogismos which proceeds to the non-evident (101-104). Again, a possible resonance with Lloyd's work: could it be that Chinese thinkers analogously eschewed epilogismos to the non-evident?
Finally, the editor's own paper, "Medical and Ethnic Identities in Hellenistic Egypt" (107-131), studies how Greek medicine plays a role in expressing Greek identity among bicultural residents of Ptolemaic Egypt, and how they perceived medicine. Several points of contrast between Greek and Egyptian medicine are surveyed: Egyptian medicine in all its practices was strongly tied to the civil and religious apparatus of the state, and valued "continuity and authority", against the "competitive renovation" of Greek medicine (108-112). Egyptian medicine did not conceive a radical distinction between the activities of gods and spirits, on the one hand, and forces of nature, on the other (112-113). Lang argues that the lack of such a distinction contributed to the absence of elaborate medical theory and apparent avoidance of surgery (113-117). Lang studies taxation policy of the Ptolemies in three aspects: (i) residents categorized as "Hellenes", and thus exempt from the obol-tax, (ii) exemptions from the salt-tax, and (iii) levying of the "medical" (iatrikon) tax, from 310-175 BCE (pp. 117-125). From this she elicits conclusions about the role of Greek doctors in the Egyptian countryside: the Greek doctors paid from the iatrikon receipts formed part of the civil definition of Hellenicity. Nonetheless, the drugs, amulets, and incantations of Greek and Egyptian practice would likely often have overlapped, rendering rigid distinction impossible (125-130).
Rigid distinctions are rarely possible in history, for no practice or people is an island cut off from the world. The history of scholarship, modern or ancient, shows that fields of study are often defined by their early practitioners, and thus exclude material whose irrelevance they assumed but never established. Just as Lang does with Egyptian and Greek medicine, or Allen does with Epicurus and Empiricists, or Mueller does with mathematics and physics, or Tybjerg does with mathematics and mechanics, so too does Lloyd with Greek science and Chinese science. Hybrid scholarship, like hybrid plants and animals, is the more vigorous and fertile. | <urn:uuid:4721c104-6f17-43a8-89b5-968afb0896bb> | CC-MAIN-2016-26 | http://bmcr.brynmawr.edu/2006/2006-03-21.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395679.92/warc/CC-MAIN-20160624154955-00198-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.931408 | 2,417 | 2.6875 | 3 |
Hubble Detects the First Extrasolar Planetary Atmosphere!
To date, 76 extrasolar planets are known. Yesterday, the first detection of an extrasolar planetary atmosphere was announced! As well, this is the first chemical analysis to be done on the atmosphere of a planet outside our own solar system!
News story originally written on November 28, 2001
HD209458b is a Jupiter-like planet that orbits around a star named HD209458. HD209458 is considered a near-by star at about 150 light years away from our solar system. HD209458b is a huge planet (0.7 times the mass of Jupiter) that orbits very, very close to its star (inside where the orbit of Mercury would be in our own solar system!). Because it is so close to its star, HD209458b has an atmosphere that is probably close to 1,000 degrees Celsius.
Seven hours of exposure time using the STIS instrument onboard the Hubble Space Telescope (HST) in April and May 2000, resulted in the detection of the atmosphere of HD209458b. The STIS instrument is the Space Telescope Imaging Spectrograph. It provides spectral signatures in the ultraviolet and visible wavelengths.
Specifically, the atmosphere was detected using the transit method and spectroscopy (see the image on this page). HD209458b takes about 3 hours to pass across the star and the light brightness we see from Earth dims for the period of the 3 hours (because the planet blocks some of the light). When HD209458b was transiting the star, the STIS looked at the light from the star as it passed through HD209458b's atmosphere. And so STIS could process a spectral signature from HD209458b's atmosphere. Spectroscopy depends on the fact that different chemical compounds have different spectral signatures. Scientists looked and found the prominent signature of sodium. Scientists only found half the amount of sodium that models predict, but they did find sodium! Scientists looked for the sodium spectral signature because it is so prominent (and because sodium’s spectral signature is in the visible region where the STIS instrument can measure).
The HST was not specifically designed for this type of measurement. In fact, the HST was launched before any extrasolar planets were known. So, it is impressive that we can look at the atmosphere of a planet that is so far away! Future space missions specifically designed for this type of measurement will no doubt discover many more exciting things about extrasolar planetary atmospheres, but HST has laid the groundwork.
In the next decade, scientists will likely want to: | <urn:uuid:942d1b00-0906-41f4-af87-4c92b7657400> | CC-MAIN-2016-26 | http://www.windows2universe.org/headline_universe/extrasolar.html&edu=high&dev=1 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396106.71/warc/CC-MAIN-20160624154956-00042-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.938734 | 531 | 3.46875 | 3 |
It just seems too good to be true. Study after research study consistently promoting the endless benefits of exercise.
Couch potatoes everywhere are waiting for the other shoe to drop, telling us that all of those scientists were wrong and we should remain as sedentary as possible.
Yet four additional studies released recently each give the same prescription for improving some aspect of your health: exercise.
They add to recent evidence that regular workouts can improve old brains, raise kids' academic performance and give a brain boost to everyone in between.
One study illustrates the effect of exercise on preventing or limiting osteoporosis, which affects more than 200 million people worldwide.
Researchers at the University of Missouri found that while both resistance training (lifting weights) and high impact exercise (running) both help build needed bone mineral density (BMD), running is the better choice.
"Exercise programs to increase bone strength should be designed using what is known about how bones respond to exercise," said Pam Hinton, associate professor and lead author.
"Only the skeletal sites that experience increased stress from exercise will become stronger. High-impact, dynamic, multi-directional activities result in greater gains in bone strength."
The study was published in the February issue of the Journal of Strength Conditioning.
In a related study, exercise seemed to be one of the few successful remedies for those that suffer from low-back pain.
In the February issue of the Spine Journal, University of Washington physicians summarized 20 different clinical trials that promoted different solutions to alleviating pain.
"Strong and consistent evidence finds many popular prevention methods to fail while exercise has a significant impact, both in terms of preventing symptoms and reducing back pain-related work loss," said Dr. Stanley J. Bigos, professor emeritus of orthopaedic surgery and environmental health. "Passive interventions such as lumbar belts and shoe inserts do not appear to work."
Better eye health
Also, vigorous exercise has now been linked with significantly reduced onset of cataracts and age-related muscular degeneration. In the study, detailed in Investigative Ophthalmology and Visual Science, researchers reviewed the eye health of 41,000 runners over seven years and found that both men and women had significantly lower rates of these two diseases than the general public.
Men who logged more than 5.7 miles per day had a 35 percent lower risk than those that ran less than 1.4 miles per day. While the correlation is strong, the reason is not clear.
"We know some of the physiological benefits of exercise, and we know about the physiological background of these diseases, so we need to better understand where there's an overlap," said Paul Williams, an epidemiologist in the Lawrence Berkeley National Laboratory Life Sciences Division.
Each year in the U.S., more 100,000 people are diagnosed with colon cancer. To see what effect exercise has on lowering this rate, researchers at Washington University and Harvard University combined to review 52 studies over the last 25 years which linked exercise and the incidence of cancer.
Overall, they found that those that exercised the most (5-6 hours of brisk walking per week) were 24 percent less likely to develop the disease than those that exercised the least (less than 30 minutes per week).
"The beneficial effect of exercise holds across all sorts of activities," said lead study author Kathleen Y. Wolin, Sc.D. of Washington University. "And it holds for both men and women.
"There is an ever-growing body of evidence that the behavior choices we make affect our cancer risk. Physical activity is at the top of the list of ways that you can reduce your risk of colon cancer."
So, are there any studies out there that link exercise with a negative outcome?
In a recent study published in the journal Obesity, Dolores Albarracín, professor of psychology at the University of Illinois, did find that people who are shown posters with messages like "join a gym" or "take a walk" actually ate more after viewing these messages than those that saw messages like "make friends."
"Viewers of the exercise messages ate significantly more (than their peers, who viewed other types of messages)," Albarracín said. "They ate one-third more when exposed to the exercise ads."
Please visit my other sports science articles at LiveScience.com | <urn:uuid:e7057411-8234-4de2-bb10-a66fcac85c3a> | CC-MAIN-2016-26 | http://bleacherreport.com/articles/139740-exercise-wins-again | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783391519.0/warc/CC-MAIN-20160624154951-00179-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.960603 | 886 | 2.875 | 3 |
... the Buddha Nature or Buddha Principle (Buddha-dhatu) is taught to be a truly real, but internally hidden, eternal potency [or entity] or immortal element within the purest depths of the mind, present in all sentient beings, for awakening and becoming a Buddha. In some Mahayana sutras it is equated with the eternal Buddhic Self, the Essence (svabhava) or Soul (atman) which is nothing less than the uncreated and deathless Buddha himself. ... The Buddha-nature is taught by the Buddha to be incorruptible, uncreated, and indestructible. It is eternal bodhi ("Awake-ness") ... and thus opens up the immanent possibility of Liberation from all suffering and impermanence.
The eternality, unshakeability and changelessness of the Buddha-nature (often referred to as "Tathagatagarbha") is described in one Sutra: " TheTathagatagarbha is not born, does not die, does not transfer [Tib], does not arise. ... it is permanent, stable and changeless."
A central aspect of the Buddha-dhatu (sometimes called the Tathagata-dhatu) is that it is utterly indestructible, invulnerable to all harm and contamination, and truly everlasting. It is the innermost, irreducible pure core within the being that cannot be eradicated or killed.
This does not violate the Buddhist concept of Anatman because, unlike the Western concept of Soul or some interpretations of the Indian Atman, Buddha-nature is not presented in the primary Buddha-nature sutras as an isolated essence of a particular individual, but rather as a single unified essence shared by all beings with the Buddha himself. | <urn:uuid:6f4874e9-27ef-4fc8-a3fe-3337267e6357> | CC-MAIN-2016-26 | http://www.treeleaf.org/forums/showthread.php?5120-Zen-and-Taoism&p=5468&viewfull=1 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392069.78/warc/CC-MAIN-20160624154952-00200-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.922725 | 375 | 2.6875 | 3 |
Fifth-year chemical engineering student Devyesh Rana has some creative ideas for constructing buildings to withstand sun and earthquake damage.
So how do you hope to revolutionize the way buildings are made?
What I’m imagining — in the simplest sense — are plant structures. A little farfetched, I know. But it would be a building that would be able to regenerate after radiation damage from the sun or structural breaks from earthquakes. I’m going for bio-metallic buildings, which Wikipedia defines as a “living machine.” Earth is, fundamentally, a living machine.
Plant buildings? Where did you come up with that idea?
Working with professor (Carolyn) Lee-Parsons and professor (Albert) Sacco. In professor Lee-Parsons’s lab I was working with genetic mutations in plants, and it got me thinking: What if we could do that on a grander scale? Like for the materials used to construct buildings. Professor Sacco’s research in environmental remediation inspired me to think about how a structure built from organic materials might help clean the air inside a building.
Do you really think these ideas could work?
Well, no one’s figured out how yet — not that I know of. That’s why I’m applying to graduate schools with materials-science programs and active research on thin-film technologies. If I can understand how this stuff works, I’m sure I could elaborate on the technologies and incorporate it into bigger applications.
So do you envision yourself as some sort of mad architect creating living, breathing cities?
What I would really like to work on is creating materials for space and underwater exploration. There are a lot of problems that limit our ability to travel and live in these harsh environments — radiation, energy sustainability and storage, and access to food, air, and water. In an underwater facility, for example, I could see creating a thin biometal layer to prevent corrosion and radiation damage. I want to work on problems like these and try to solve them. | <urn:uuid:067e469e-5166-440a-bc7c-bf9350d0f1ac> | CC-MAIN-2016-26 | http://www.northeastern.edu/news/2011/03/student/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395346.72/warc/CC-MAIN-20160624154955-00085-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.947435 | 431 | 3.390625 | 3 |
You know plenty of words that have double letters in them such as tt and ee. How many words do you know that have these pairs of letters in them?
aa ii hh kk uu vv ww
Think about that question. There might be some English words in your list. There could be some non-English words which we use.
If you live in Australia or New Zealand, you think straight away of yakka.
It is sometimes spelt yacker, yakker or yaker, and comes from an Aboriginal
word. It means work and often appears in the phrase ‘hard yakka’. And everyone
knows aardvark, the name of the mammal that lives in southern Africa. It
comes from words meaning ‘earth-pig’. However, the question now arises: are
these English words?
Aardvark was borrowed about 200 years ago from Afrikaans, the Dutch-based language of some of the white settlers in South Africa. Yakka was borrowed by white settlers from an Australian Aboriginal language over 100 years ago. As far as the English language is concerned, they are young very words. Work has a history of over 1,500 years. Earth appeared in written documents over 1,000 years ago, in its earlier form eorđe, eorthe. Pig has been around for over 800 years.
Right, you've seen just a few samples. Before you continue, have a good think, compare notes with someone, do a bit of research... and see what other words you can find. Then scroll down.
Here are a few other words with unusual pairs of letters. Some of them are not really ‘English’ but have been borrowed and are in general use. Some have several different forms — your dictionary might show them as a single word, two words joined by a hyphen, or two separate words. You can see from the notes how words came into English at different times, related to exploration and the development of science — when something ‘new’ is discovered, we need a word for it!
A market or area of small stalls. The word came into English in the 16th century from Persian.
A village of huts in southern Africa. The Afrikaans word came into English in the 18th century. It originates from Portuguese curral, pen, which also gave rise to corral in North America.
A Muslim form of greeting, comprising a word and a bow. From Arabic salam, peace. Related to Hebrew shalom, peace. It has been used in English for about 400 years.
An area of an enemy beach that has been captured, ready for the landing of military forces. This is a 20th century word, adapted from bridgehead, a fortified area.
Some dictionaries have fish-hook. A hook used on a line when angling for fish. It first appeared in print over 600 years ago as fisch-hook.
To travel by getting free rides in passing vehicles. It first appeared in print less than 100 years ago.
Some dictionaries have rough-house. Rough behaviour in games, fighting, etc. It was coined late in the 19th century.
To hold back, to refuse to give. It appeared in print over 800 years ago as wiđhalt, withhalt.
This is the plural of genius when that word refers to a person’s guiding spirit or angel. From ancient Roman mythology. A Latin word which appeared in English books about 400 years ago. Because of its appearance and spelling, the singular version genius became genie. We now use genius to denote a very clever person, and genie for a spirit or angel.
The plural of radius, a straight line from the centre of a circle to any point on its circumference; half of the diameter of the circle. A Latin word adopted about 400 years ago.
A knife with a blade which is hinged to fold back into the handle. Jack in many phrases seems to have come from the use of the French Jacques to denote an ordinary man. A jack-knife was a working man’s knife in the United States in the early 18th century.
Some dictionaries have knick-knack or nick-nack. A small or cheap ornament. It came into English in the 17th century, but originally meant a trick or a subterfuge.
Also spelt pucka. Correctly or properly done; genuine. A Hindu word which came into English in the 17th century.
In Australia, a type of small wallaby, now rare. An Aboriginal word which first appeared in print in the middle of the 19th century.
From trek, a long or difficult journey. An Afrikaans word which came into English from South Africa in the middle of the 19th century.
In science, a continuous series. Adopted into English in the 17th century. A Latin word.
A space in which there is no matter. A Latin word which was adopted into English for scientific purposes in the 16th century.
In some dictionaries, muu-muu. A loose, brightly coloured dress. A Hawaiian word that has been used in English for less than 100 years.
A slang abbreviation of dividend first used in the 19th century.
In Australia, a cotton shirt with long sleeves and a polo neck. Mainly in Britain, a menial female servant. Mainly in the USA, a man's t-shirt. The origin of this 20th century word is not known.
Mainly in Britain, a slang word for a labourer on a building site. In Australia, a labourer on roads, railways, etc. Adapted from navigator in the 19th century.
Some dictionaries have bow-wow. An infant or childish word for a dog, or the bark of a dog. It was first used in print, meaning the sound of a barking dog, about 400 years ago.
A talk or conference. Adopted into English in the 17th century from a North American Indian word.
In some dictionaries, slow worm. A type of legless lizard, also called a blindworm. It appeared in writing over 1,000 years ago as slawerm.
Back to Home Page
Back to Detailed Menu | <urn:uuid:687f68ba-9a1c-400e-8dd6-ab95a6b85dde> | CC-MAIN-2016-26 | http://home.alphalink.com.au/~umbidas/unusual_pairs.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395346.72/warc/CC-MAIN-20160624154955-00086-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.954028 | 1,314 | 3.21875 | 3 |
grade 4 writing and reading
Can ewe right the write words? Weight, I mean you! Wait, now I'm just confused... Learn about homophones with this fun worksheet.
Written passages look pretty silly without punctuation, and sometimes they're difficult to read! Practice punctuating this excerpt from classic literature.
Wrap up your summer by reflecting on your favorite friends, fun, and even food with this printable.
Does your child know where her toys come from before they're in the toy store? Get your student ready to research with this fun worksheet and activity.
Reading primary sources doesn't have to be a bore! Learn to gather information from records using data given by celebrity whom you just might know.
What would happen if Baba Yaga had a hoarding intervention? Get to know a famous and eerie Russian folktale with this creative writing exercise.
What would happen if La Llorona went to anger management? Engage your young writer with this fun twist on a classic and spooky ghost story.
Imagine if Count Dracula had an advice column! What kinds of zany advice would he give out?
Young writers can learn to use better adjectives with this vocabulary building worksheet. He'll discover 24 synonyms for the word "happy."
How many words can you think of that mean "home"? Your fourth grader will learn 24 words that will add accuracy and intrigue to his writing. | <urn:uuid:99507835-2639-487e-9600-c27df174a23c> | CC-MAIN-2016-26 | http://www.education.com/collection/pam4412/grade-4-writing-reading/?page=8 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396887.54/warc/CC-MAIN-20160624154956-00123-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.95122 | 294 | 3.84375 | 4 |
Recycle PE Foam Program
Thank you for visiting our site. The fact that you are here demonstrates your concern for protecting the environment by recycling.
What is Polyethylene Foam?
Polyethylene foam, also known as PE foam, is most commonly used to cushion products in packaging applications. PE foams are designed to provide maximum protection with a minimum use of material, reducing the amount of packaging required.
What is the Recycle PE Foam Program?
Polyethylene manufacturers and fabricators have an ongoing commitment to the environment. As part of that commitment, Sealed Air Corporation and AFP, Inc. have spearheaded a group of dedicated fabricators in North America to create the Recycle PE Foam program. This program is intended to provide a simple way for the consumer to recycle polyethylene foam they receive as protective packaging with products they purchase. The goal of this program is to increase recycling awareness and simplify the recycling process, while we continue to pursue the most environmentally sound practices in our manufacturing process of PE foam.
How Does the Program Work?
The Recycle PE Foam program is driven by the involvement of consumers and fabricators. These simple steps outline the recycle flow of PE foam.
- Fabricators may stamp PE foams manufactured by Sealed Air with the #4 recycle symbol
- Consumers send their PE foam material to a participating fabricator.
- The fabricator separates the usable product for recycling.
Please click the How to Recycle tab above to find a Recycle PE Foam return location near you and begin recycling! | <urn:uuid:1c6835d5-ae5d-4961-921a-2da23aed5e64> | CC-MAIN-2016-26 | http://recyclepefoam.com/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395166.84/warc/CC-MAIN-20160624154955-00030-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.911102 | 319 | 2.59375 | 3 |
There are special service registers storing the reports about various events. Any program analyzing the status of the processor functioning may send a request to these registers if necessary.
Moreover, both, Intel and AMD, have programs like that. Intel’s software is called VTune, and AMD’s – Code Analyst. The major task of this software tool is to analyze the processor operation and give some recommendations to the code developers. This actually means that there are software emulators of the corresponding processors integrated into these programs.
Of course, VTune uses event counters to evaluate the efficiency of this or that code.
However, everything is not that simple here. That thing is that a lot of counters in VTune are undocumented. To be more exact, a small part of the counters is documented (besides it is really hard to call a counter documented if we only know its name). In reality all the documentation does exist in the corporation. But unfortunately, it is not available for the public. I doubt that Intel’s division working on VTune development didn’t know the purpose of these counters. But the truth is that most users have no idea what these counters actually do.
To tell the truth, we were very excited about this great number of counters that we discovered. It made us think whether we really understand correctly what’s going on inside Pentium 4 processor. The number of counters we found turned out somewhat too big for the events we knew about.
Maybe there is something else inside the processor that we didn’t see?
Let me answer this question now: yes, there is. And there are quite a lot of things, actually. The ongoing chapters of our article will be devoted to these particular things. And in the meanwhile, let’s return to our event counters.
As we have already said, we discovered a lot of undocumented counters. So we asked ourselves: what do they actually do?
So, we decided to check their behavior during the execution of a special code we developed. If you have vivid imagination, you can get an idea of the fun we had comparing the registers (if the result stored got increased by one point or not) and figuring out if this counter increase corresponds to what we know about the Pentium 4 architecture.
So, we managed to check the operation of documented counters: they measure understandable parameters and their functioning corresponds to what the whitepapers say.
However, another pretty big group of counters measured some unknown parameters. We managed to find out what that actually was a bit later, when we had discovered something new (see Chapter IX for details). | <urn:uuid:2e693c12-b6d8-4c0d-9119-f984dcc72342> | CC-MAIN-2016-26 | http://www.xbitlabs.com/articles/cpu/display/netburst-2_4.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393463.1/warc/CC-MAIN-20160624154953-00145-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.950656 | 535 | 2.609375 | 3 |
An object 5 cm high is located 75 cm from a converging lens (X1 = 75 cm) of focal length f1 = 50 cm. A second converging lens of focal length f2 is located 200 cm from the first lens (X2 = 200 cm). An image of the object is to be formed on a screen 200 cm from the second lens (X3 = 200 cm). What must be the focal length f2 of the second lens so that the final image appears on the screen?
f2 = cm | <urn:uuid:d1124cb3-8ddb-4cc3-9d11-d1fe8d84aae2> | CC-MAIN-2016-26 | http://www.chegg.com/homework-help/questions-and-answers/object-5-cm-high-located-75-cm-converging-lens-x1-75-cm-focal-length-f1-50-cm-second-conve-q3374276 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396872.10/warc/CC-MAIN-20160624154956-00026-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.939327 | 107 | 3.25 | 3 |
VEREIN FÜR JÜDISCHE GESCHICHTE UND LITERATUR:
By: Gotthard Deutsch
Name of societies founded in many German cities since about 1890 for the spread of the study of Jewish history and literature. Although certain societies of the kind had existed earlier, the first impetus was given to the popular study of these subjects through the awakening of Jewish sensibilities by the growing anti-Semitic movement. It was chiefly felt in Jewish student circles. The growth of the movement began when Gustav Karpeles, after having founded such a society in Berlin (Jan. 2, 1892), organized the various societies into a union known as Verband der Vereine für Jüdische Geschichte und Literatur in Deutschland (Dec. 26, 1893). This association furnishes lists of speakers to the constituent societies, issues pamphlets, and has published since 1898 the "Jahrbuch für Jüdische Geschichte und Literatur," of which up to the present (1905) seven volumes have appeared. These contain popular scientific essays and some fiction; and among the contributors are to be found the most eminent representatives of Jewish literature.
There are about 200 societies, with about 15,000 members, in Germany. The Jewish Chautauqua Society in the United States, the Jewish Study Circles in England, and the Université Juive in France have followed somewhat similar courses. An older organization of the same kind is the Afiḳe Yehudah of Prague.
- Jahrbuch für Jüdische Geschichte und Literatur, Berlin, 1898 et seq. | <urn:uuid:6317e268-7a75-4d02-b7fb-4d76e1dc451f> | CC-MAIN-2016-26 | http://jewishencyclopedia.com/articles/14679-verein-fur-judische-geschichte-und-literatur | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783392159.3/warc/CC-MAIN-20160624154952-00025-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.887182 | 350 | 2.9375 | 3 |
To use all functions of this page, please activate cookies in your browser.
With an accout for my.chemeurope.com you can always see everything at a glance – and you can configure your own website and individual newsletter.
- My watch list
- My saved searches
- My saved topics
- My newsletter
Brinelling, or true brinelling, is surface damage caused by repeated overload, reminiscent of the damage caused by the Brinell hardness test; false brinelling is damage caused by fretting corrosion that causes similar-looking damage via a different mechanism.
The basic cause of false brinelling is that lubricant is pushed out of a loaded region. Without lubricant, wear is increased. The resulting wear debris oxidizes to form an abrasive compound which further accelerates wear.
In normal operation, a rolling-element bearing has the rollers and races separated by a thin layer of lubricant such as grease or oil. Although these lubricants normally appear liquid (not solids), under high pressure they act as solids and keep the bearing and race from touching.
If the lubricant is removed, the bearings and races can touch directly. And while bearings and races appear smooth to the eye, they are microscopically rough. Thus, high points of each surface can touch, but "valleys" do not. The bearing load is thus spread over much less area, and forces are much higher, causing pieces of each surface to break off or to become pressure-welded then break off when the bearing rolls on.
The broken-off pieces are also called wear debris. Wear debris is bad because it is lumpy and thus creates more regions of high contact force. Worse, the steel in ordinary bearings can oxidize (rust), producing a further hard abrasive compound which accelerates wear.
In normal operation, bearings remain lubricated. However, if a bearing is mostly stationary but subject to a very small oscillating or vibrating load, lubricant may be pushed out of the loaded area; but since the bearing is rolling only small distances, there is no action or movement that replaces the displaced lubricant.
With the lubricant gone, the damage described above creates wear debris; and since there is a small motion in the bearing, the damage is ongoing, creating more and more wear debris; and the wear debris acts as an abrasive to further damage the bearing surfaces. Typically the races are most damaged by this action and the appearance is similar to that of brinelling (overload) damage. Thus, the damage is often described as false brinelling.
The discovery of false brinelling is unclear but one story describes how, in the 1930s, new automobiles were loaded on to trains for delivery; when they were unloaded, some would show severe wheel bearing damage. On further inspection, it turned out that many wheel bearings were slightly damaged. The damage was eventually traced to rocking of the autos and the regular impact every time a railroad car wheel passed a track joint. These forces led to false brinelling.
Although the auto-delivery problem has been solved, there are many modern examples. For example, generators or pumps may fail or need service, so it is common to have a nearby spare unit which is left off most of the time but brought in to service when needed. Surprisingly, however, vibration from the operating unit can cause bearing failure in the unit which is switched off. When that unit is turned on, the bearings may be noisy due to damage, and may fail completely within a few days or weeks even though the unit and its bearings are otherwise new. Common solutions include: keeping the spare unit at a distance from the one which is on and vibrating; manually rotating shafts of the spare units on a regular (for example, weekly) basis; or regularly switching between the units so that both are in regular (for example, weekly) operation.
False brinelling has also been observed in unmounted stationary bearings exposed to vibration: the weight of the bearing pieces bring enough load to cause failure.
The process of false brinelling is not yet completely understood: for example, an oxygen-free environment can reduce, or even eliminate, false brinelling. The detailed reasons for this are unknown.
|This article is licensed under the GNU Free Documentation License. It uses material from the Wikipedia article "False_brinelling". A list of authors is available in Wikipedia.| | <urn:uuid:0a0ebda1-c165-4c67-bd87-b99e3a6ae826> | CC-MAIN-2016-26 | http://www.chemeurope.com/en/encyclopedia/False_brinelling.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396100.16/warc/CC-MAIN-20160624154956-00097-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.953964 | 913 | 3.1875 | 3 |
|Atlanta Travel Guide|
The region where Atlanta and its suburbs were built was originally Creek and Cherokee Indian territory. After these tribes were deported along the Trail of Tears to Oklahoma by the Federal government, white settlement in the area increased rapidly.
Atlanta was first planned in 1836 as a terminus on the Western & Atlantic Railroad, for lines connecting from Birmingham, Chattanooga, Macon, and Athens. The terminus was originally planned for Decatur, but its citizens did not want it. Another spot was arbitrarily picked, around which the village of Terminus grew up in expectation of railroad traffic. Besides Decatur, several other suburbs of Atlanta predate the city by several years, including Marietta and Lawrenceville. As the population grew, it was eventually decided that a better name for the town should be found, since Terminus was more or less a technical term.
Originally it was suggested that the town be named after former governor and then-mayor of Terminus, Wilson Lumpkin. Already having a city and a county named after him, the Governor refused and suggested that the city be named after his daughter, Martha, instead. Therefore, starting in 1843, Terminus was known as Marthasville. The origins of the modern name are somewhat difficult to describe.
In 1845, the Chief Engineer of Georgia Railroad, John E. Thomson, suggested the name Atlanta for the town. The motives behind the change are unclear, as is the source behind the name. Thomson himself reportedly told different stories about the source of the name. One story suggests that the name is a feminization of Western and Atlantic Railroad, while another claims that the name is a variation of Martha Lumpkin's middle name, Atalanta. Whatever the case may be, Marthasville was renamed Atlanta in 1845 and was incorporated as such in 1847.
In 1864, the city became the target of a major Union invasion in the American Civil War, the Atlanta Campaign, later immortalized in the novel and film Gone With the Wind. The area now covered by Atlanta was the scene of several battles including the Battle of Peachtree Creek, the Battle of Atlanta, and the Battle of Ezra Church. On September 1, 1864, Confederate General John Bell Hood evacuated Atlanta after a four-month siege mounted by Union General William T. Sherman, and ordered all public buildings and possible union assets destroyed. The next day, mayor James Calhoun surrendered the city, and on September 7 Sherman ordered the civilian population to evacuate.
He then ordered Atlanta burned to the ground on November 11 in preparation for his punitive march south. After a plea by Father Thomas O'Reilly of Immaculate Conception Catholic Church, Sherman did not burn the city's churches or hospitals. The remaining war resources were then destroyed in the aftermath and in Sherman's March to the Sea. The fall of Atlanta was a critical point in the Civil War, giving the North more confidence, and leading to the re-election of Abraham Lincoln and the eventual surrender of the Confederacy.
After the war, Atlanta was gradually rebuilt and soon became the industrial and commercial center of the South. From 1867 until 1888, US Army soldiers occupied McPherson Barracks (later renamed Fort McPherson) in southwest Atlanta to ensure Reconstruction era reforms. To help the newly freed slaves the federal government set up a Freedmen's Bureau which helped establish what is now Clark Atlanta University, one of several historically black colleges in Atlanta.
In 1868, Atlanta became the fifth city to serve as the state capital. Henry W. Grady, the editor of the Atlanta Constitution, promoted the city to investors as a city of the "New South," by which he meant a diversification of the economy away from agriculture and a shift from the "Old South" attitudes of slavery and rebellion.
As Atlanta grew, ethnic and racial tensions mounted. A race riot in 1906 left at least twelve dead and over seventy injured. In 1913, Leo Frank, a Jewish supervisor at an Atlanta factory, was put on trial for raping and murdering a thirteen-year old white employee. After doubts about Frank's guilt led his death sentence to be commuted in 1915, riots broke out in Atlanta and Frank was lynched.
In the 1930s, the Great Depression hit Atlanta. With the city government nearing bankruptcy, The Coca-Cola Company had to help bail out the city's deficit. The federal government stepped in to help Atlantans by establishing Techwood Homes, the nation's first federal housing project in 1935.
With the entry of the United States into World War II, soldiers from around the southeast went through Atlanta to train and later be discharged at Fort McPherson. War-related manufacturing such as the Bell Aircraft factory in the suburb of Marietta helped boost the city's population and economy. Shortly after the war in 1946, the Communicable Disease Center, later called the Centers for Disease Control was founded in Atlanta from the old Malaria Control in War Areas offices and staff.
In the 1960s, Atlanta was a major organizing center of the civil rights movement, with Dr. Martin Luther King and students from Atlanta's historically black colleges playing major roles in the movement's leadership. On October 19, 1960, a sit-in at the lunch counters of several Atlanta department stores led to the arrest of Dr. King and several students, drawing attention from the national media and from presidential candidate John F. Kennedy. Despite this incident, Atlanta's political and business leaders fostered Atlanta's image as "the city too busy to hate" by avoiding the types of violent confrontations that took place in Selma, Alabama and Birmingham.
In 1990, the International Olympic Committee selected Atlanta as the site for the 1996 Summer Olympics. Following the announcement, Atlanta undertook several major construction projects to improve the city's parks, sports facilities, and transportation. The games themselves were marred by the Centennial Olympic Park bombing, which resulted in the death of two people and injured several others. | <urn:uuid:4be91b03-3da1-4a86-b207-e9cff3974127> | CC-MAIN-2016-26 | http://www.bestcitiestravel.com/atlanta/history.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393533.44/warc/CC-MAIN-20160624154953-00102-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.973996 | 1,218 | 3.765625 | 4 |
This summer a group of 17 students from the U.Va. Engineering School’s Rodman Scholars honors program traveled to Germany on an engineering mission: to design a vehicle that allows drivers to use the Internet without losing focus on the road.
As part of the Volkswagen Global Ingenuity Program, the students worked from the car company’s Wolfsburg/Braunschweig research and development facility to solve the design challenge. At the end of the program, they presented a design for a system that integrates a customized Internet application into vehicles.
Their finished design for a smarter and safer Internet-equipped vehicle was well received by their German engineer hosts. But the completion of the research was just one of the trip’s success stories. Throughout their two weeks in Germany, the students took advantage of opportunities to immerse themselves in the country’s culture by working alongside students from the nearby Braunschweig University and to take excursions to Dresden and Berlin. They visited a research facility for autonomous city cars that can drive by sensing their proximity to other cars on the road. They also stopped by the Transparent Factory, where VW’s luxury car, the Phaeton, is built.
To address the research problem, the students set up a think tank at the R&D facility. It was essentially a room with whiteboards, tables and Internet access where students could collaborate for long hours. Food was delivered to the room or consumed at a nearby cafeteria where the students went for breaks. For most of the two-week trip, they were working, sometimes late into the night. Daniel Amante, a third-year biomedical engineering student who was among those on the trip, describes it as a “monastic” endeavor.
The product of the think tank was a plan for integrating a modified form of the Internet that could respond to cues in the vehicle’s immediate environment and deliver relevant information to the driver. Based on a driver’s unique profile, the application would notify the driver whenever the vehicle was approaching a museum or restaurant that might be of interest to that person. Also, the amount of access to the Internet would be determined by the cognitive requirements of a given driving condition. Driving through a congested city street in the rain would limit access; a calm suburban street would allow for more.
The think tank allowed the U.Va. students to directly apply — in a real-world setting — the problem-solving and collaboration skills they had developed back at the Engineering School. The international aspect of the project heightened the importance of collaboration and solid communication skills.
“We’re all engineers, but we all have our own specialties,” Amante said. “Figuring out our individual strengths and accounting for the difference in our languages helped us structure our groups to facilitate discussion and progress.”
Achieving that productive and collaborative workflow took some time. For the first few days, the think tank interactions were contentious. Everyone had ideas, but there was a lack of unified movement toward a common goal. Success seemed out of reach, given the short, two-week time frame.
Then, after a reflective three-day trip to Dresden, the students were eager to get back to the whiteboards and hash out a solution to the problem. The change in momentum and agreement among team members was palpable.
In a congratulatory letter to the students at the end of the program, Dana Elzey, the group’s faculty advisor and director of International Programs at the Engineering School, described the shift:
“It felt as if someone had flipped a switch to ‘ON’,” Elzey wrote. “After long hours of frustrating uncertainty, conflicting ideas and lack of consensus, the tone suddenly changed from cacophony to symphony, and out of the chaos of ideas a coherent vision began to emerge. There was a collective sigh of relief, followed by a rapid reorganization into highly focused sub-teams.”
This international research project offered Elzey and the Scholars a unique bonding experience as they worked toward the common design goal. They were able to relate on a personal level and overcome organizational titles and relationships.
“Being in a strange environment and strange setting upsets your internal gyrocompass,” Elzey said. “In that condition of lowered defenses and heightened alerts, you’re open to new learning experiences in a way that is exceptional and very difficult to create in a classroom.”
Amante believes the experience will benefit him throughout the rest of his time at the Engineering School and in his future career.
“A lot of it comes down to group dynamics and figuring out how to structure groups based on each other’s strengths,” Amante said. “In this case, it was about as challenging as it could get. You are working with 20 to 30 people who don’t know each other, are from different engineering disciplines, countries and cultures, and you put them in a room and need them to do one thing. After that, getting four people to work together on a calculus assignment or write a program doesn’t seem so bad. ”
The Volkswagen Global Ingenuity Program was made possible with a gift of $500,000 from Volkswagen Group of America Inc. The money, which will be distributed over the next four years, also supports graduate fellowships at the U.Va. Engineering School.Share | <urn:uuid:d1efb520-dca1-4543-bf86-6fc635eec988> | CC-MAIN-2016-26 | http://www.seas.virginia.edu/pubs/enews/enews_sept10/rodman.php | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397865.91/warc/CC-MAIN-20160624154957-00090-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.971866 | 1,128 | 2.59375 | 3 |
University of Missouri
Home | People | Locations | Program index | Calendar | News | Publications
Continuing education Seminars Courses
mu extension > news > display story
MU news media
Linda GeistWriterUniversity of Missouri ExtensionPhone: 573-406-4933Email: [email protected]
Photo available for this release:
The true armyworm is distinguished by triangular markings on the four prolegs in the middle of its body.
Credit: MU Extension
Published: Tuesday, May 20, 2014
Wayne C. Bailey, 573-864-9905
COLUMBIA, Mo. – Armyworms that can strip pastures and hayfields have begun their march through Missouri’s tall fescue fields, warns University of Missouri Extension entomologist Wayne Bailey.
Farmers should scout for true armyworms now, especially in southern Missouri, Bailey said. MU Extension agriculture business specialist Stacy Hambelton reports that true armyworms populations are two to three times the economic threshold in fescue fields in the Ozark County area. Early detection makes control easier.
The worms quickly strip foliage from the leaves of fescue, wheat and occasionally corn. They don’t bother legumes such as alfalfa and clover. Fescue fields are the earliest indicator of presence. Once armyworms have stripped a field, they continue their path of destruction to the next field.
Bailey suggests that farmers scout fields several times weekly by looking at the plant canopy up close and down low. Armyworms do not like light, so he recommends scouting at dusk, dawn or on cloudy days. He also suggests careful examination of leaf litter.
By the time the worms are visible from a distance, it’s too late. “If farmers drive by in their pickups, fescue may look beautiful,” he said. “Then, as the armyworms reach the top of the canopy, they defoliate the entire field and it is completely destroyed.”
Armyworms feed on the bottom of a plant first and move up the stem. They quickly consume more foliage as they become older and larger.
“Not every field will have them, but there’s a potential that many will,” Bailey said.
Infested fescue fields can be cut. Regrowth can be sprayed with insecticides labeled for control. Treat fields when an average of four or more half-grown or larger worms (1/2 to 1 1/2 inches) per square foot are present during late spring and before 2 to 3 percent of seed heads are cut from stems in tall fescue.
Bailey recommends foliar application of insecticide. Use enough water to penetrate the canopy of the plant.
Moths usually fly into Missouri from tropical areas, and this year’s abundant spring storms created ideal conditions for a major infestation. Each moth can lay up to 1,300 eggs that hatch into foliage-munching worms.
True armyworms got their name because they can march in a mass. They move in lines from one field to the next and destroy each as they go. While there are two or three generations of the insect each year, the first generation causes the most damage to field and forage crops. True armyworms differ from fall armyworms, which show up toward the middle of the growing season.
When small, armyworms tend to be green, but they turn a tan to grayish color as they grow, with tan stripes and one orange stripe down their sides. Four pairs of fleshy prolegs in the midsection with a black triangle on the side of the feet distinguish the true armyworm from other armyworms.
Missouri’s last major infestation was in 2010. Bailey says the worms appear about every three to four years. “We were due for an infestation,” he said.
The MU Pest Monitoring Network has monitoring reports and information on scouting and identifying true armyworms at ipm.missouri.edu/pestmonitoring/taw.
Additional information is available in the MU Extension publication “Management of the Armyworm Complex in Missouri Field Crops” (G7115), available for free download at www.extension.missouri.edu/G7115.
About | Jobs | Extension councils |
For faculty and staff | For researchers | Giving | Ask an expert | Contact
to 2015 Curators of the University
of Missouri, all rights reserved, DMCA
and other copyright information
University of Missouri Extension is an equal opportunity/ADA institution.
University of Missouri Extension
to 2015 Curators of the University of Missouri, all rights reserved | <urn:uuid:12de8002-c776-4d40-ba38-a3420795f62c> | CC-MAIN-2016-26 | http://extension.missouri.edu/news/DisplayStory.aspx?N=2218 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396455.95/warc/CC-MAIN-20160624154956-00180-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.91712 | 972 | 2.921875 | 3 |
- Describe the protist kingdom.
- Outline the evolution of protists.
- Identify protist characteristics.
cilia (singular, cilium)
short, hairlike projections, similar to flagella, that allow some cells to move
the ability to move
kingdom in the domain Eukarya that includes all eukaryotes except plants, animals, and fungi
temporary, foot-like extension of the cytoplasm that some cells use for movement or feeding
Protists are the simplest eukaryotes. They are easiest to define by what they are not. Protists are not animals, plants, or fungi.
The protist kingdom is sometimes called the “trash can” kingdom. It includes all eukaryotes that don’t fit in one of the other three eukaryote kingdoms: Animalia, Plantae, or Fungi. There are thought to be between 60,000 and 200,000 protist species. Many have yet to be identified. The protist kingdom is very diverse, as shown in Figure below.
Protists range from single-celled amoebas to multicellular seaweed. Protists may be similar to animals, plants, or fungi.
Evolution of Protists
Scientists think that protists are the oldest eukaryotes. If so, they must have evolved from prokaryotic cells. How did this happen? The endosymbiotic theory provides the most widely-accepted explanation. That’s because it is well supported by evidence.
The First Eukaryotic Cells
According to the endosymbiotic theory, the first eukaryotic cells evolved from a symbiotic relationship between two or more prokaryotic cells. Smaller prokaryotic cells were engulfed by (or invaded) larger prokaryotic cells. The small cells (now called endosymbionts) benefited from the relationship by getting a safe home and nutrients. The large cells (now called hosts) benefited by getting some of the organic molecules or energy released by the endosymbionts. Eventually, the endosymbionts evolved into organelles of the host cells. After that, neither could live without the other.
As shown in Figure below, some of the endosymbionts were aerobic bacteria. They were specialized to break down chemicals and release energy. They evolved into the mitochondria of eukaryotic cells. Some of the small cells were cyanobacteria. They were specialized for photosynthesis. They evolved into the chloroplasts of eukaryotic cells.
Endosymbiotic theory explains how eukaryotic cells arose.
Evidence for the Endosymbiotic Theory
Many pieces of evidence support the endosymbiotic theory. For example:
- Mitochondria and chloroplasts contain DNA that is different from the DNA found in the cell nucleus. Instead, it is similar to the circular DNA of bacteria.
- Mitochondria and chloroplasts are surrounded by their own plasma membranes, which are similar to bacterial membranes.
- New mitochondria and chloroplasts are produced through a process similar to binary fission. Bacteria also reproduce through binary fission.
- The internal structure and biochemistry of chloroplasts is very similar to that of cyanobacteria.
Characteristics of Protists
Like all other eukaryotes, protists have a nucleus containing their DNA. They also have other membrane-bound organelles, such as mitochondria. Most protists are single-celled. Some are multicellular. Because the protist kingdom is so diverse, their ways of getting food and reproducing vary widely.
Most protists are aquatic organisms. They need a moist environment to survive. They are found mainly in damp soil, marshes, puddles, lakes, and the ocean. Some protists are free-living organisms. Others are involved in symbiotic relationships. They live in or on other organisms, including humans.
Motility of Protists
Most protists have motility. This is the ability to move. Protists have three types of appendages for movement. As shown in Figure below, they may have flagella, cilia, or pseudopods (“false feet”). There may be one or more whip-like flagella. Cilia are similar to flagella, except they are shorter and there are more of them. They may completely cover the surface of the protist cell. Pseudopods are temporary, foot-like extensions of the cytoplasm.
Protists use flagella, cilia, or pseudopods to move.
Protists have complex life cycles. Many have both asexual and sexual reproduction. An example is a protist called Spirogyra, a type of algae, shown Figure below. It usually exists as haploid cells that reproduce by binary fission. In a stressful environment, such as one that is very dry, Spirogyra may produce tough spores that can withstand harsh conditions. Spores are reproductive cells produced by protists (and other organisms). If two protist spores are close together, they can fuse to form a diploid zygote. This is a type of sexual reproduction. The zygote then undergoes meiosis, producing haploid cells that repeat the cycle.
Spirogyra is a genus of algae with a complex life cycle. Each organism consists of rectangular cells connected end-to-end in long filaments.
Protists get food in one of three ways. They may ingest, absorb, or make their own organic molecules.
- Ingestive protists ingest, or engulf, bacteria and other small particles. They extend their cell wall and cell membrane around the food item, forming a food vacuole. Then enzymes digest the food in the vacuole.
- Absorptive protists absorb food molecules across their cell membranes. This occurs by diffusion. These protists are important decomposers.
- Photosynthetic protists use light energy to make food. They are major producers in aquatic ecosystems.
- Kingdom Protista includes all eukaryotes that are not animals, plants, or fungi. It is a very diverse kingdom. It consists of both single-celled and multicellular organisms.
- Scientists think that protists are the oldest eukaryotes. They most likely evolved from prokaryotic cells, as explained by the endosymbiotic theory. This theory is well-supported by evidence.
- Protists have nuclear membranes around their DNA. They also have other membrane-bound organelles. Many live in aquatic habitats, and most are motile, or able to move. Protists have complex life cycles that may include both sexual and asexual reproduction. They get food through ingestion, absorption, or photosynthesis.
Lesson Review Questions
1. What are protists?
2. How did the first eukaryotic cells evolve, according to endosymbiotic theory?
3. Identify three structures that protists use to move.
4. Describe three ways that protists get food.
5. A mystery organism consists of one cell. It could be a protist or a prokaryote. What single fact about the mystery cell would allow you to determine which type of organism it is? Explain your answer.
6. Identify one piece of evidence for endosymbiotic theory. Explain how this evidence supports the theory.
7. Compare and contrast asexual and sexual reproduction in protists.
Points to Consider
Protists are traditionally classified as animal-like, plant-like, or fungi-like. You will read more about each of these types of protists in the next lesson.
- Based on what you already know about animals, plants, and fungi (such as mushrooms), how might the three types of protists differ?
- Why do you think these protists are not classified with the organisms they resemble? For example, why aren’t animal-like protists classified as animals? What sets protists apart from other eukaryotes? | <urn:uuid:86d0b638-60d5-4c69-b6c9-18268e06a499> | CC-MAIN-2016-26 | http://www.ck12.org/book/Biology-%2528CA-DTI3%25292/r3/section/14.1/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395620.56/warc/CC-MAIN-20160624154955-00188-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.935669 | 1,708 | 4.1875 | 4 |
In the backdropof UN campaign for ending hunger, the MILLENNIUM DEVELOPMENT GOALS (MDG) REPORT CARD: MEASURING PROGRESS ACROSS COUNTRIES commissioned by the Bill & Melinda Gates Foundation and the UN Millennium Campaign is already out. Let us examine the shortfalls and potential pitfalls:
1. Poverty: In African countries, the proportion of the population living below $1.25 a day has increased in 21% countries (in 8 out of 38 countries). Nigeria’s poverty increased from 49% to 77% in the 18 years from 1990. In Latin America, results are more uneven: whopping 41% (7 countries out of 17) countries, including upper-middle-income countries such as Venezuela and low-middle-income countries such as Bolivia, have experienced an increased or unchanged rate of income poverty.
2. Healthcare: Under-five mortality increased in six Sub-Saharan African countries during the period under study, namely Central African Republic, Zambia, Chad, Cameroon, Congo and Kenya. Kenya regressed most strongly in absolute terms, with under-five mortality increasing from 97 to 121 per 1,000 live births between 1990 and 2007. The number of adults living with HIV/AIDS in Mozambique increased from 10% to 12% in seven years. In the CIS, the number of adults living with HIV has increased in three out of four countries (Moldova, Russia and Ukraine). Only one country in Latin America (Honduras) has recorded a reduction in HIV/AIDS prevalence, whereas eight countries have suffered an increase in infection rates. In South-Eastern Asia, infections have increased in Lao PDR, Indonesia, Malaysia and Viet Nam.
3. Hunger: In Democratic Republic of Congo, prevalence of hunger more than doubled between 1990 and 2004.
4. Primary education: Primary education in Congo fallen from 87% in 1991 to 59% in 2007.
5. Partnership: A close look at ‘The Millennium Development Goals Report 2010’ also stressed upon the MDG framework for accountability derived from the Declaration that has generated an unprecedented level of commitment and partnership in building decent, healthier lives for billions of people and in creating an environment that contributes to peace and security. However, the economic slowdown has put pressure on government budgets in the developed countries. Although the majority of the initial commitments are still in force, some of the big donors have reduced or postponed the pledges they made for 2010. The shortfall in aid affects Africa in particular. At the 2005 Gleneagles Summit, G-8 members projected that their commitments, combined with those of other donors, would double ODA to Africa by 2010. Preliminary data for 2009 show that bilateral ODA to Africa as a whole rose by 3 per cent in real terms. For sub-Saharan Africa, bilateral aid increased by 5.1 per cent in real terms over 2008. It is estimated that Africa will receive only about $11 billion out of the $25 billion increase envisaged at Gleneagles, due mainly to the underperformance of some European donors who earmark large shares of their aid to Africa. Aid remains well below the United Nations target of 0.7 per cent of gross national income for most donors. In 2009, the only countries to reach or exceed the target were Denmark, Luxembourg, the Netherlands, Norway and Sweden.
6. Good Governance: Another important issue that I have raised time and again in different forum including ID4D is proper governance; it is the key to achieve the goals of MDGs regionally and ultimately globally. Many of the African problems may be ascribed to poor governance. Transparency, opening of trade and proper synergy of different governmental schemes is also essential which again can only stems from good governance.
MDGs framework for accountability derived from the declaration that has generated an unprecedented level of global commitment. All the eight goals are, in fact, interrelated. Each one has some precursor for achieving other and together has tremendous potential for fueling growth. MDGs arguably have given us one last chance to make this world beautiful. Let’s harness it to the fullest. | <urn:uuid:d0311e4a-e94d-4460-b55f-56d9e4f9b37c> | CC-MAIN-2016-26 | http://www.southsouth.info/profiles/blogs/mdgs-reminder-of-shortfalls | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397864.87/warc/CC-MAIN-20160624154957-00085-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.937227 | 840 | 2.984375 | 3 |
Philosophical Melancholy and Delirium
Hume's Pathology of Philosophy
By demonstrating how a philosophical method can be used to expose the political motivations behind intellectual positions, historical events, and their subsequent interpretations, Livingston revitalizes Hume's thought and reveals its relevance for contemporary dicussions of politics, nationalism, and ideology for the first time.
List of Abbreviations
Pt. 1: Humean Reflections
1: Is Hume an Empiricist?
2: The Dialectic of True and False Philosophy
3: The Origin of the Philosophical Act in Human Nature
4: The Ancient Philosophy
5: Philosophy and Christendom
6: The Modern Philosophy
7: True Philosophy and the Skeptical Tradition
8: True Philosophy and Civilization
9: False Philosophy and Barbarism
10: English Barbarism: "Wilkes and Liberty!"
11: English Barbarism: "The Poor Infatuated Americans"
Pt. 2: Humean Intimations
12: Hume and America
13: The Right of Resistance: A Humean Free State versus a Modern Consolidated Leviathan
14: The Right of Resistance: Secession and the Modern State
15: Preserving One's Humanity in the First Philosophic Age | <urn:uuid:7bbc04c6-4793-42b7-bb8e-a533b7452c9a> | CC-MAIN-2016-26 | http://www.press.uchicago.edu/ucp/books/book/chicago/P/bo3617799.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393997.50/warc/CC-MAIN-20160624154953-00075-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.786571 | 263 | 2.671875 | 3 |
Although the popularly held belief is that Columbus discovered America… it seems that he wasn’t actually the first to make it there from across the ocean. That’s right – the chickens beat him to it.
Well, actually both the chickens and the Polynesians arrived at the same time, according to ancient DNA evidence. It turns out that the ancient Polynesians were much better sailors than anyone gave them credit for, and somehow managed to beat Christopher Columbus to the Americas by at least a century, arriving in the early 1400s, if not before.
So, not only did the Polynesians colonize nearly every island in the South Pacific – and there’s plenty of evidence for their existence on these islands – but they apparently figured that journeys of several thousand miles weren’t enough. They wanted to sail even further, which brought them to: South America.
Ancient chicken bones found along the coast of Chile were DNA analyzed and compared with the DNA of other chickens found at archaeological sites across the Polynesian islands. The results? The chickens’ genetic stock was Polynesian and not European… and since chickens have a bit of problem when it comes to sailing across the open Pacific on their own, they must have arrived on the ships of Polynesian sailors.
The chicken bones dated to sometime between 1320-1410 AD, which fits with the time when Polynesians probably would have been expected to reach the American continent, although until now, there was no evidence that they actually did so. It is likely that they traveled here from Easter Island, and made their way across the ocean to Chile.
The Mapuche people living in Chile today, coincidently, have quite a number of Polynesian words in their language, and some of their tools are very similar to Polynesian items. While this may be a direct link between these people and the ancient sailor, there is not enough evidence to be %100 certain.
At the very least, there can be no doubt that Polynesian chickens – and humans – discovered America well before Christopher Columbus ever knew of its existence.
Want to read more?
Tomorrow: Sailing Obelisks | <urn:uuid:969bb3f1-992b-4b6c-9c8b-ff4f3b99f50f> | CC-MAIN-2016-26 | http://ancientstandard.com/2007/10/25/when-chickens-discovered-america-ca-1400-ad/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397842.93/warc/CC-MAIN-20160624154957-00153-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.979633 | 448 | 3.59375 | 4 |
Book DetailAuthor/Editor(s): World Health Organization
Publication Date: July 2010
Publisher: World Health Organization
Size: 1.68 MB
Book DescriptionThis book 'Equity, Social Determinants and Public Health Programmes' was commissioned by the Department of Ethics, Equity, Trade and Human Rights as part of the work undertaken by the Priority Public Health Conditions Knowledge Network of the Commission on Social Determinants of Health, in collaboration with 16 of the major public health programs of WHO: alcohol-related disorders, cardiovascular diseases, child health, diabetes, food safety, HIV/AIDS, maternal health, malaria, mental health, neglected tropical diseases, nutrition, oral health, sexual and reproductive health, tobacco and health, tuberculosis, and violence and injuries.
In addition to this, through collaboration with the Special Programme of Research, Development and Research Training in Human Reproduction, the Special Programme for Research and Training in Tropical Diseases, and the Alliance for Health Policy and Systems Research, 13 case studies were commissioned to examine the implementation challenges in addressing social determinants of health in low-and middle-income settings. The Priority Public Health Conditions Knowledge Network has analyzed the impact of social determinants on specific health conditions, identified possible entry-points, and explored possible interventions to improve health equity by addressing social determinants of health. | <urn:uuid:c1b28201-8337-4ded-8ec9-f4cc2a155390> | CC-MAIN-2016-26 | http://www.1001ebook.net/2013/03/Equity-Social-Determinants-and-Public-Health-Programmes-Free-Ebook-Download.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00058-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.900239 | 268 | 2.65625 | 3 |
RG-36. RECORDS OF THE LEGISLATIVE REFERENCE BUREAU
Legislation passed in 1909 originally provided for a Legislative Reference Bureau to be maintained by the trustees of the Pennsylvania State Library. A new bureau independent of the State Library was created in 1921, and it remained an agency of the executive branch with a director appointed by the governor. In 1923, it was abolished and a new Legislative Reference Bureau was established under the legislature with a director elected by the General Assembly. Though created to serve the members of the legislature, the heads of state agencies, and in some cases private citizens, the basic function of the Legislative Reference Bureau is the drafting of bills and other instruments needed by the General Assembly. The bureau acts as a legal advisor to the legislature and its members, prepares digests, analyzes bills, compiles and edits the Pennsylvania Code, Pennsylvania Bulletin and Pennsylvania Consolidated Statutes, and oversees publication of the Pamphlet Laws. Under the Commonwealth Documents Law passed in 1968, administrative regulations are not valid until filed with the bureau.
DOCUMENTS LAW SECTION
Rules and Regulations Issued by State Agencies Originally Filed with Department of State, 1931-1969. (7 cartons, 1 box) Arranged in chronological order by year and thereafter by rule/regulation number. Rules and regulations adopted by state agencies. Among these are two reports used in drafting legislation that document the African American experience in Pennsylvania: "Governor’s Commonwealth Conference on Higher Education, July 28, 1966" lists college presidents and administrators, including those at Lincoln University, Cheyney University, and Crozier Theological Seminary; and "Employment Practices in Pennsylvania, February 1953" is a report of the Governor’s Commission on Industrial Race Relations. | <urn:uuid:2b1b1424-c548-4f12-a201-bbc4dee38ae8> | CC-MAIN-2016-26 | http://www.phmc.state.pa.us/bah/aaGuide/AA-RG-36.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399385.17/warc/CC-MAIN-20160624154959-00199-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.942939 | 361 | 2.640625 | 3 |
Skin and other allergic responses pose the most important risk to hair dye users. It’s tough to say how many hair dye users suffer with allergic responses, as most don’t seek medical aid. But there are numerous cases where allergic reactions to hair dyes have been dreadful or maybe lethal. Signals of a mild reaction may only be irritation of the higher eyelids or edges of the ears, but in more terrible reactions, the entire head or body might be concerned. A grim kind of allergenic reaction is shock. When this occurs, the mouth and tongue swell and the airways confine. Anaphylaxis can be quickly deadly, and there were isolated cases of hair dyes causing shock. Skin reactions can happen on a person’s first exposure to hair dye, or can all of a sudden happen in somebody who has been using them long term. A patch test before each dyeing is necessary to help perceive skin allergies, but extraordinarily time dye is applied to the skin, the immune response may become sensitized, enlarging the chance of future allergenic response. Working as a hairstylist is associated with an elevated risk of skin allergies. One review found that 17-80% of stylists suffered from allergic responses on contact with hair dye ( Khumalo et al, 2006 ).
- The side effects of free speech | <urn:uuid:da9e9092-0c1c-4af1-8c25-9afcacb52bb3> | CC-MAIN-2016-26 | http://www.sideeffects.com/hair-dye.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399117.38/warc/CC-MAIN-20160624154959-00193-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.94425 | 275 | 2.6875 | 3 |
In a NUCLEAR REACTOR, a spontaneous nuclear process results in a net decrease in the net mass of all the particles involved. The "missing mass" appears as the kinetic energy of the reaction products, which is dissipated by what amounts to friction and generates heat that boils water; the steam is used to spin turbines that run generators that send electrical power down the wires.
This leads to an obvious question: can we do the opposite? Can we take electrical power out of the wires, use it to raise the kinetic energy of some particles to enormous values, smack the particles together and generate some extra mass? Yes! This is what a PARTICLE ACCELERATOR like TRIUMF24.12 does. Every such accelerator is a sort of "reactor in reverse," taking electrical power out of the grid and turning it into mass.
Such things happen naturally, too. Gamma rays of sufficient energy often convert into electron-positron pairs when they have a glancing collision with a heavy nucleus. This is pictured in Figs. 24.3 and 24.4.
There is a neat, compact way of representing such reactions by FEYNMAN DIAGRAMS24.13 I will draw them "left to right" but the convention is actually to draw them "down to up." I don't know why.
The convention in FEYNMAN DIAGRAMS is that antiparticle lines (e+, for instance) are drawn in the "backward" sense as if they were propagating backward in time. This allows all "electron lines" to be unbroken, a graphical expression of the CONSERVATION OF ELECTRONS.24.14 There are lots more elegant graphical features to FEYNMAN DIAGRAMS, but I will wait until we discuss QUANTUM FIELD THEORY in the Chapter on Elementary Particles to discuss them further.
The main point here is that the incoming particle(s) [ or e-] must have at least 1.022 MeV of kinetic energy to create a positron and an electron, both of which have rest masses of 0.511 MeV/c2. With an accelerator one can give the original projectile(s) more energy [there seems to be no limit on how much, except for mundane concerns about funding resources and real estate] and thus facilitiate the creation of heavier particles. At TRIUMF, for instance, we accelerate protons to 520 MeV [just over half their rest mass energy of 938 MeV], which is enough to create MESONS [mass = 139 MeV/c2] with reasonable efficiency; the high intensity24.15 of the TRIUMF cyclotron qualifies it for the elite club of " MESON FACTORIES," so named because they "mass produce" mesons (or PIONS) in unprecedented numbers.
Since heavier particles can in principle decay into lighter particles like gamma rays, neutrinos, antineutrinos, electrons and positrons, almost of these "manufactured" particles are unstable. Nevertheless, they hang around long enough to be studied and sometimes their very instability is what makes them interesting, if only because it precludes finding a cache of them in a more Natural setting.
I have gotten far beyond the terms of reference of this Chapter here, but I wanted to "preview" some of the phenomenology of Elementary Particle Physics while focussing your attention on the simple motive for building higher- and higher-energy accelerators:
The more kinetic energy is available, the more mass can be created. The heavier the particle, the more options it is apt to have for other lighter particles to decay into, and the more unstable it can be expected to be; hence the less likely we are to observe it in Nature.24.16 And the heavier the particle, the more exotic its properties might be.
So far this simple strategy has paid off in many new discoveries; of course, it may not keep working indefinitely . . . . | <urn:uuid:238d7127-7899-4261-ab06-19a45d897dee> | CC-MAIN-2016-26 | http://www.jick.net/~jess/hr/skept/EMC2/node9.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00092-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.931478 | 824 | 3.40625 | 3 |
Evan-Moor® History Pockets, Ancient Egypt, Grades 4-6 Item # 656925
Thank you, you will now be redirected to comparisons.
Just a moment while we prepare the page
Check In-Store Availability
Contains 9 memorable discovery pockets
- Introduction pocket gives an overview of the civilization. Each of the pockets includes a reproducible pocket label a bookmark of short, fun facts about the subject, an art reference page, a fact sheet of background information for teacher and students, arts and crafts projects and writing activities.
- Other pockets give a comprehensive view of life in ancient Egypt. The book includes the following pockets: Introduction to Ancient Egypt, Military Power, Daily Life, Government, Religion and Mythology, Work and School, Art and Architecture, Language and Literature, and Sports and Entertainment.
- Evaluation forms for teacher and student assessment purposes.
|grade||4th grade; 5th grade; 6th grade| | <urn:uuid:09612920-f1b5-43bd-9adf-fa6dbbb445c3> | CC-MAIN-2016-26 | http://officedepot.com/a/products/656925/Evan-Moor-History-Pockets-Ancient-Egypt/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397696.49/warc/CC-MAIN-20160624154957-00147-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.799087 | 196 | 3.359375 | 3 |
A colony of 500 rhesus monkeys will soon be able to cross between two Chinese mountains using a pair of footbridges.
The monkeys, who live in a nature reserve at Taihang mountain in Henan province, will be divided later this year by a new 12 mile-long water reservoir.
More than 3,000 Chinese villagers have already been moved out of the area in order to accommodate the reservoir, receiving a total of £900,000 in compensation for their flooded homes.
But the local government will now spend more than half as much again - another £500,000 - on two footbridges so that the monkeys can move freely around their habitat.
"The bridges are just for the monkeys, no humans allowed," said Wang Xiangdong, a director at the nature reserve.
Asked whether he thought the monkeys would actually use the 800ft-long bridges, Wang said they would monitor the situation. "Every animal has its own habits," he said. "All we can do is offer them a channel."
Wang said the bridges were only part of the monkey protection plan, which also included constant patrols of the area and monitoring by experts.
"We hired a professional design company to build the bridges. The bridges can bear the weight of 150 monkeys at a time, and will be at least 30ft above the water at their lowest point," he said.
"We have decided on a very humane initiative. I could not say what would happen to the monkeys if we had not decided to build the bridges. We just want to minimise the impact of the reservoir on the lives of the monkeys." | <urn:uuid:99455b2a-6b1c-4f5a-9059-693e3976732d> | CC-MAIN-2016-26 | http://www.thedailystar.net/footbridges-only-for-monkeys-37067 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397873.63/warc/CC-MAIN-20160624154957-00106-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.974135 | 331 | 2.875 | 3 |
The only African American of the 19th century that was more prominent and
influential than John Mercer Langston was Frederick Douglass. John Mercer
Langston was the first Black American elected to public office in the United
States and was twice suggested as a candidate for vice-president of the
United States on the republican ticket. During his lifetime, Langston's
career would involve education, law and politics.
John Mercer Langston was born free in 1829 and was an orphan by his fifth birthday. As an orphan, Langston was raised in both black and white households. By the age of fourteen, Langston began study at Oberlin College where he obtained both a Bachelors and Master of Arts degree. By his eighteenth birthday he was a speaker at the first national black convention in 1848 on the subject of aid to fugitive slaves.
Langston was elected town clerk and allied himself with the Republican Party as was common among Blacks in the 19th century. He said that "if the republican party is not anti-slavery enough, take hold of it and make it so." Langston is given credit for shaping the character of the Republican party in the 19th century in terms of its then progressive relationship to African Americans. He was responsible for organizing black political clubs across the country. As a result of his political contacts Langston was chosen to lead the western recruitment of black soldiers to fight in the Civil War. He also actively worked for the fair and equal treatment of black soldiers in the Union Army. After the Civil War, Langston worked both independently and with the Republican Party for the redistribution of wealth and power in the country. Both before and after the Civil War along with many others, he struggled for black voting rights.
Langston spent six and a half years at Howard University where he served as a Law professor, Dean of the Law Department, vice-president and acting president. The white conservative trustee board of Howard University had problems with his progressive views and were troubled with Langston's desire to expand the Law Department. Langston knew that the life of the Blacks in this country could be changed if laws were changed. The trustees forced him out of Howard, but the entire Law Department resigned in protest of the actions of the board of trustees.
Langston was appointed to the diplomatic corps and served in Haiti for eight years. He left in protest when the new democratic administration reduced his salary by 30%. Langston ran for Congress in the state of Virginia and won. He fought an eighteen month battle to be seated in congress because of attempts to rig the polls on election day. After serving in Congress for only three months (because of the attempt to steal his seat) Langston spent the rest of his life in Washington where he continued to fight for justice for African Americans. | <urn:uuid:173d9fc4-b093-4d71-a8e9-3859cd7abec6> | CC-MAIN-2016-26 | http://www.brightmoments.com/blackhistory/njmlangst.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399106.96/warc/CC-MAIN-20160624154959-00034-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.985133 | 572 | 4.28125 | 4 |
Cutaway view of the possible internal structure of Europa The surface of the satellite is a mosaic of images obtained in 1979 by NASA's Voyager spacecraft. The interior characteristics are inferred from gravity field and magnetic field measurements by NASA's Galileo spacecraft. Europa's radius is 1565 km, not too much smaller than our Moon's radius. Europa has a metallic (iron, nickel) core (shown in gray) drawn to the correct relative size. The core is surrounded by a rock shell (shown in brown). The rock layer of Europa (drawn to correct relative scale) is in turn surrounded by a shell of water in ice or liquid form (shown in blue and white and drawn to the correct relative scale). The surface layer of Europa is shown as white to indicate that it may differ from the underlying layers. Galileo images of Europa suggest that a liquid water ocean might now underlie a surface ice layer several to ten kilometers thick. However, this evidence is also consistent with the existence of a liquid water ocean in the past. It is not certain if there is a liquid water ocean on Europa at present.
The Jet Propulsion Laboratory, Pasadena, CA manages the mission for NASA's Office of Space Science, Washington, DC.
This image and other images and data received from Galileo are posted on the World Wide Web, on the Galileo mission home page at URL http://www.jpl.nasa.gov/galileo/sepo. | <urn:uuid:6d39bc88-1825-4351-85a6-e337db420003> | CC-MAIN-2016-26 | http://photojournal.jpl.nasa.gov/catalog/PIA01130 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393146.70/warc/CC-MAIN-20160624154953-00019-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.898139 | 290 | 4.125 | 4 |
DONETSK, Ukraine — Galina Chumak is proud to be Greek, however foolish she knows that pride may be. It wasn’t anything she did, she points out, just the circumstance of birth into what may be Ukraine’s oldest existing ethnic group.
The Greeks arrived in present-day Ukraine before the Tatars, before the Russians, before the Jews, possibly even before the Ukrainians themselves.
They were settlers from the civilization that we think of today as ancient Greece. They came to the Crimea — a dramatically mountainous peninsula that juts into the Black Sea — in the fifth century B.C., or maybe even the seventh, or just possibly, says Chumak, who once worked on archeological digs there, the ninth.
There are about 91,000 Greeks in Ukraine, according to the last census, but they don’t live in the Crimea anymore. That fact lies at the heart of one of those arguments that Ukrainian Greeks love to bat around, and have been doing so ever since they left there in 1778: Can their Greek heritage survive the modern era?
The Crimean Greeks lived for about 300 years under the rule of the Muslim Khanate, and when imperial Russia made a move to conquer the Crimea they asked Catherine the Great, fellow Orthodox Christian, to offer them her protection.
Sure, she said (or words to that effect). You’ll be best off if you leave your homes of the past two millenniums and set up shop in this other land I’ve just acquired, far to the east.
‘‘She awarded lands to the Greeks,’’ exclaimed Yelena Prodan, head of the Donetsk Greek Society, at a board meeting one night recently. ‘‘Orthodox Greeks were rescued from the Muslims.’’
“We were deported,” Chumak replied. ‘‘People died from the cold, the lack of shelter.’’
Starting on the shores of the Sea of Azov, the Greeks settled in villages on the steppe. They were exempt from conscription, which was a plus, and they prospered. When the city of Donetsk was founded in 1869 by the Welshman John Hughes, as a coal center, they began migrating into town.
They kept their native language — or, actually, languages. Those whose families came from the coastal towns of the Crimea spoke a Greek that was heavily influenced by the Turkic language of the Khans. Those whose roots were in the remote mountains spoke a language that’s descended directly from ancient Greek — closer to it, probably, than you would hear in Athens today.
In the 1920s, in the first blush of the proletarian revolution, the early Soviet Union strongly encouraged the development of ethnic cultures, a sort of de-Russification after czarist rule. Here, a Greek theater opened, as did Greek schools and Greek newspapers. Greek poets flourished.
Then in 1937, Joseph Stalin decided that this was, in fact, criminal behavior. About 20,000 Greeks were executed, Prodan said, others deported to Kazakhstan or Siberia.
‘‘After 1937, people were afraid of saying they were Greeks,’’ Prodan said. But deep in the villages, within their own homes, families kept the old memories, and the old languages, alive.
With the collapse of the Soviet Union, suddenly all the walls were down. Schools opened to teach Greek to a younger generation — but they teach modern Greek, to foster ties to the people of the ancient homeland.
Museums and cultural festivals have sprung up to revivify Greek identity here — yet there’s a real danger that in the slowly dying villages, the indigenous Greek dialects, with centuries of history behind them, could wither away to nothing. | <urn:uuid:7320addc-77d2-4b56-acbd-6d228862bda8> | CC-MAIN-2016-26 | http://www.bostonglobe.com/news/world/2012/11/22/after-surviving-tatars-and-commissars-ukrainian-greek-culture-faces-threat-modernity/ytcRh1jR3Xtjxq1ox6acMN/story.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398869.97/warc/CC-MAIN-20160624154958-00184-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.970835 | 792 | 2.84375 | 3 |
When President Bush, in September 2005, signed a presidential directive instructing government agencies to conserve natural gas, electricity, gasoline and diesel fuel to the maximum extent possible, the U.S. General Services Administration’s (GSA) Energy Center of Expertise, originally established in 1997, became even more important for federal agencies and non-profit organizations.
When President Bush, in September 2005, signed a presidential directive instructing government agencies to conserve natural gas, electricity, gasoline and diesel fuel to the maximum extent possible, the U.S. General Services Administration’s (GSA) Energy Center of Expertise, originally established in 1997, became even more important for federal agencies and non-profit organizations. (For a discussion of the more recent energy-efficiency related Executive Order 13423 signed on Jan. 24, see “The Latest Executive Push,” p. 34.)
As a result of the directive, GSA, the public agency responsible for the design, construction, operation and maintenance of thousands of federally owned facilities, came up with an initial action plan:
Internal Public Building Services (PBS) facility operations and projects withquick payback.
Customer outreach initiatives to reduce energy consumed by building mechanical and lighting equipment.
Suggested workplace practices for tenants.
Within the GSA, the Energy Center of Expertise offers strategic energy management programs to increase net operating income and enhance the asset value of properties. By sharing its energy management strategies and success stories, the center has proven to be a valuable mechanism for honoring GSA’s commitment to protect the environment, conserve natural resources and ensure a quality workspace for the federal community—the nation’s largest single energy consumer.
For its projects, GSA determines payback in years by dividing the total project cost by the annual savings in dollars. Energy prices for simple payback calculations are based on the current price the site pays for the various forms of energy. When the life-cycle cost analysis is performed, the actual rates are entered and the escalation of prices is built into the National Institute of Standards and Technology program that is used to perform the analysis.
In addition, a major GSA focus in recent years has been to serve as a role model, with a benchmark energy program that encourages energy efficiency by using sustainable design principles, cost-effective utility purchases and renewable energy for the planning, design, construction, operation, maintenance and leasing provisions of all federal buildings.
Take, for example, GSA’s consideration of opportunities for solar and other renewable energy in its building design and retrofit programs. The Facility Standards for Public Buildings, commonly known as P100, establishes design standards and criteria for new buildings, major and minor alterations and work on historic structures for GSA’s PBS. P100 is maintained by the GSA Office of Chief Architect, and is reviewed and revised approximately every two years. A wide range of areas of expertise contribute to recommended revisions, and the committee decides which are to be included. P100 incorporates language for solar and other renewable energy sources.
A look back
GSA’s overall energy program actually began much earlier—back in 1973. Since that time, cost-avoidance and energy-conservation measures have produced more than $2.25 billion in savings. But looking back into the not-so-distant past, GSA has played a significant role in implementing the Energy Policy Act of 1992 and former President Clinton’s 1993 Executive Order, “Energy Efficiency and Water Conservation at Federal Facilities.”
PBS has reported to the U.S. Dept. of Energy (DOE), as of FY 2006, energy usage has been reduced, in BTUs per gross square foot, 4.7% from the new 2003 baseline established in the Energy Policy Act of 2005. Looking into the future, this act also requires more solar energy systems, energy metering and an overall energy consumption reduction of 20% per sq. ft. in federal buildings by 2015. In fact, Executive Order 13423, signed by President Bush on Jan. 24, consolidates all the earlier EOs on the environment, and goes even further than EPAct 2005 by requesting a 3% annual reduction in energy consumption of federal buildings, or a 30% reduction by the end of fiscal year 2015.
How did the Energy Center of Expertise begin? The center was the result of a competition among the GSA regions to seek out the strongest energy program. The winner was the Heartland Region—serving Iowa, Kansas, Missouri and Nebraska—which then officially became the Energy Center of Expertise.
The only problem was that maintaining offices in Kansas City, Mo., didn’t bode well for integration of the center with PBS, so the decision was made to relocate the program to Washington, D.C. Another factor in this decision was the National Capital Region’s (NCR) success in the area of energy, which was anticipated to have national implications as a result of its extremely large inventory of buildings and the fact that D.C. is by far the biggest GSA energy user in the country.
In addition to providing national expertise for all GSA regions, the center also serves NCR, where GSA’s public utilities professionals are now housed as well, so that the energy supply and demand specialists are physically located together. This has proved beneficial in closing the loop on energy investment decisions and developing future market strategies.
How it’s done
So just how does GSA manage to achieve such significant energy savings? Through a number of established programs, the center’s energy expertise and resources are leveraged to GSA facilities, providing them with the tools to competitively procure energy, effectively work with public utilities, track energy use, manage energy and water data andexecute life-cycle cost studies. Program highlights include:
• Competitive energy procurements. Federal facilities are provided with strategies for energy commodity procurements in deregulated markets. GSA’s energy experts develop procurement strategies for natural gas, electricity and green power to achieve the best competitive price, concurrent with the facility’s organizational goals, which may include budget stability, energy reliability and security.
• Utility negotiations. To negotiate the best rates, GSA awards large public utilities area-wide contracts for electricity, natural gas, steam, chilled water, and water and sewage services that are regulated by either public utility commissions, utility cooperatives or municipal utility companies. In many cases, these contracts allow for demand-side management services, which include alternative financing for energy projects. In addition, the center provides leadership in developing contracting vehicles, allowing end users to meet multiple federal energy requirements.
• Energy tracking. Through the administration of a comprehensive energy usage and analysis system, energy consumption in every GSA-owned and leased facility is carefully tracked. This system allows GSA associates from multiple disciplines determine the status of energy trends as they relate to past or future building actions related to leasing, design, project management, planningand operations.
• Energy and water management data. This program is responsible for utility use and cost data in all GSA-managed buildings nationwide. The center’s staff reviews approximately 5,500 utility billings and payments as part of its administration of the energy usage and analysis system, or EUAS.
• Energy efficiency. GSA continuously conducts energy audits and retro-commissioning studies of its inventory to identify life-cycle cost-effective energy conservation measures, such as cutting-edge lighting controls, HVAC efficiency upgrades, BAS improvements and distributed generation projects. These measures are then funded through dedicated energy program funding, regional repair and alteration budgets or financing mechanisms, when appropriate.
Through its programs and resources, the Energy Center of Expertise has successfully helped numerous facilities make significant dents in their energy usage. For example, New York’s Binghamton Federal Building is the nation’s first federal facility powered by 100% renewable energy. The power flows from a new wind turbine installed at the Fenner Wind Farm in Fenner, N.Y. (shown on p. 32).In addition to achieving energy independence and environmental stewardship, the project spurred economic growth of a new industry in a small community economy.
Yet another boon for renewable energy was the GSA’s awarding of a contract to Pepco Energy Services, Arlington, Va., to supply the National Park Service’s Statue of Liberty and Ellis Island with electricity generated from 100% wind resources. The three-year contract will supply approximately 28 million kW-h of renewable energy to the two landmark sites. Through this procurement, GSA and the National Park Service were able to demonstrate environmental leadership and generate a significant amount of positive interest in the purchase of renewable energy.
In the area of energy and water management, GSA’s Charles E. Bennett Federal Building in Jacksonville, Fla., was recognized with a DOE Federal Energy and Water Management Award for its holistic redesign effort. With the A/E team and GSA staff working side-by-side to evaluate energy saving merits of various design strategies—including energy- and climate-responsive HVAC systems and web-based automation systems—post-renovation building energy consumption for FY 2005 dropped more than 60%, as compared with its last year of operation prior to vacating it. Usage was reduced by 23,781 million British Thermal Units (MMBTUs), compared to 2002, which is enough energy to power 208 homes for one year.
Also in the southeast region, the John J. Duncan Federal Building in Knoxville, Tenn., successfully attained an Energy Star rating of 94 and qualified for LEED certification by the U.S. Green Building Council. Through the execution of a comprehensive building recommissioning and installation of a new building control system, along with lighting upgrades and motion sensors, this resulted in savings of approximately 1.7 billion BTU in FY 2005, exceeding FY 2005 energy reduction goals by 33%. The restrooms also were retrofitted with water-saving equipment, and new secondary meters were placed on water supplies to reduce water sewage and runoff charges, saving 400,000 gallons of water on a yearly basis.
In addition to renewable energy projects, building controls and lighting upgrades, the center has also helped federal facilities with sustainable technologies such as geothermal installations and combined heat and power (CHP) projects. For example, the U.S. Custom House in Portland won an Energy Efficiency/Energy Program Management Award for upgrading its HVAC system with a geothermal heat pump. This turned out to be an ideal approach for the facility, because it helped maintain the building’s historic architecture, save energy and address the site’s environmental and indoor air quality issues. As a result of the geothermal installation and an electrical service upgrade, energy consumption in FY 2003 decreased 49%—by more than 1.1 billion BTU. Furthermore, health risks posed by the original HVAC system were eliminated and carbon emissions at the historic site were reduced by almost 250,000 metric tons annually.
And when it comes to implementing CHP systems, the Food and Drug Administration Office in White Oak, Md., is an ideal case study. GSA worked with Sempra Energy Solutions to implement an energy savings performance contract to install a 5.8-MW CHP facility as part of the first phase of the campus build-out. As a result, in FY 2003 GSA saved more than 37 million kW-h, $1.4 million in energy costs and $2.1 million in annual operation and maintenance costs. The plant provides reliable, uninterrupted on-site electricity generation capability for three facilities on campus—a laboratory, office building and multi-use facility. Heat is recovered from the generating process to produce hot water and chilled water in absorption chillers, further increasing the thermal efficiency of the plant by 30% and significantly reducing pollution emissions. Furthermore, planned expansion of the CHP system will support 100% power generation for the entire campus after the remaining build-out is complete, keeping the local utility from having to accommodate the 25-MW load that would otherwise be required.
The bottom line
While looking back at successful projects is certainly encouraging, the most important thing is that GSA’s Energy Center of Expertise continues to proactively work with its facilities to find more and more ways to save energy and act as good environmental stewards. From the construction of a new federal building to utilizing alternative energy sources to installing energy-efficient building systems, the goal remains the same—to conserve natural resources and operate energy-efficient facilities.
As a benchmark of its effectiveness in reaching out to federal facilities, the U.S. General Services Administration’s Energy Center of Expertise:
• Reduced the overall energy consumption of its federal inventory, as of 2006, by 4.7%, as compared to 2003, in response to goals set in the Energy Policy Act of 2005. The agency achieved this reduction by directly investing in energy and water conservation opportunities with paybacks of 10 years or less.
• Completed the deployment of an advanced metering analytical software program to give GSA the ability to monitor all advanced meters in their inventory from an enterprise-wide web-based tool.
• Over the last four years, GSA has purchased a total of 949,984 MW-h of energy from renewable sources through competitive power contracts and through the use of green power programs offered by local distribution companies.
• In FY 2006, GSA received an estimated 3,285 MMBTU (million British thermal units) in energy use from self-generated renewable projects. Approximately 543.7 MW of the total came from GSA’s 12 solar photovoltaic installations, 600 MMBTUs from GSA’s two solar thermal projects and 830 MMBTUs from the one completed geothermal project.
• In FY 2006, GSA funded two new PV systems. The first is a 40-kW array at the Trenton Courthouse Annex in New Jersey, and the second is a 300-kW building-integrated PV system at the National Archives and Records Administration facility inWaltham, Mass.
The Latest Executive Push
Executive Order 13423, signed by President Bush on Jan. 24, consolidates a number of earlier EOs on the environment: 13101, 13123, 13134, 13148 and 13149. Entitled “Strengthening Federal Environmental, Energy, and Transportation Management,” it requests a 3% annual reduction in energy consumption of federal buildings, or a 30% reduction by the end of fiscal year 2015, compliant with the Energy Policy Act of 2005. The earlier EPAct 1992 had called for 20% energy-efficiency improvements by 2015.
Other new developments leading to EO 13423 include a new agriculture law that encouraged development of biobased products, and memorandums of understanding, including an MOU on green building in the federal government. In addition to the 30% energy reduction by 2015, EO 13423 requires federal agencies to achieve numerous other performance goals, including the following:
• Reducing water consumption intensity 2% a year through 2015
• Building or renovating government buildings in accordance with sustainability
• Expanding purchases of environmentally preferable products
• Making at least 50% of current renewable energy purchases from new renewable sources.
A New Era of Energy Efficiency
Designed in the 1960s as part of Cleveland’s urban renewal project, the Anthony J. Celebrezze Federal Building exterior has held up well, but inside, the 32-story building was beginning to show its age. The HVAC system was not only inefficient, but uncomfortable. Tenants complained that the fan coil units, located in offices around the perimeter of the building, were disruptive and provided ineffectual heating and cooling.
Cleveland-based Westlake Reed and Leskosky, the same firm that originally designed the building, forty years later assessed the building’s mechanical systems to determine how to improve costs and tenant comfort. “Because of the sheer volume of the units to be replaced—4,640—we specified a customized unit that would both simplify the renovation and create a comfortable, energy-efficient work space,” said Mitch Lyles, P.E. “This included having the piping, controls and insulation all in one box, as well as custom cabinetry.”
The designers chose custom-designed fan coil units from Minneapolis-based McQuay International. “Everything was built for efficiency to streamline the installation process,” Lyles said. On each floor, four-pipe fan coil units supply zoned heating and cooling to offices on the perimeter of the building. The four-pipe system (hot and cold water supply and return) allows some units to be in heating mode while others are in cooling. It also allows for reheating of cold dehumidified air before it enters the work place. Depending on room size, each office has four, six or eight fan coil units. Air-handling units located in the basement circulate conditioned air to central spaces throughout the building. Chilled water for the system comes from an off-site, central chilling system operated by Cleveland Thermal Energy.
The project was registered in Dec. 2006 for LEED certification under the Existing Buildings, Version 2.0 program. | <urn:uuid:a6141ecc-aff5-4a19-9720-8e54f43d0da5> | CC-MAIN-2016-26 | http://www.controleng.com/single-article/energy-experts/71f5ad8e453f1d8eac70ab920905504c.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395679.18/warc/CC-MAIN-20160624154955-00131-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.946746 | 3,547 | 2.609375 | 3 |
Animals can use their circadian clocks to determine direction from the position of the sun. In a particular experiment conducted in Iceland, a bird, kept in a cage open to the sky, was trained to seek food on the western side. Its circadian rhythm was then phase-delayed by 6 hours and after phase shifting, the bird was returned to its open cage at 12.00 noon real time. It was observed to seek food in the:
I think that if its circadian rhythm was phase delayed by six hours, at noon, it will feel that it is still 6 a.m. So, the sun will be located in its "east" and it will try to seek food in the "west" but its"west" will be our south. So, answer should be south. Is my reasoning correct ? | <urn:uuid:334b08b0-b467-4e90-b987-5f1083572907> | CC-MAIN-2016-26 | http://biology.stackexchange.com/questions/14503/circadian-rhythm-in-birds | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783391634.7/warc/CC-MAIN-20160624154951-00143-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.987176 | 165 | 3.65625 | 4 |
The ability to comprehend receptive language and use expressive language to communicate. A student who has good spoken language skills will more easily master reading and writing skills.
(14 Jan 2009)
Language Of Temporal Ordering Specification, language Requirement, language-sensitive editor < Prev | Next >
languages of choice, language test
© mondofacto 2008-10 | about us | advertise with us | disclaimer | privacy & cookies | contact us | <urn:uuid:397881e6-deea-4c50-9e06-f0721dc35f96> | CC-MAIN-2016-26 | http://www.mondofacto.com/facts/dictionary?language+skills | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396538.42/warc/CC-MAIN-20160624154956-00092-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.838497 | 93 | 3.15625 | 3 |
Search the Health Library
Get the facts on diseases, conditions, tests and procedures.
I Want To...
Find a Doctor
I Want To...
Find Research Faculty
Enter the last name, specialty or keyword for your search below.
Drug from Mediterranean Weed Kills Tumor Cells in Mice - 07/09/2012
Drug from Mediterranean Weed Kills Tumor Cells in Mice
Scientists at the Johns Hopkins Kimmel Cancer Center, working with Danish researchers, have developed a novel anticancer drug designed to travel -- undetected by normal cells -- through the bloodstream until activated by specific cancer proteins. The drug, made from a weedlike plant, has been shown to destroy cancers and their direct blood supplies, acting like a “molecular grenade,” and sparing healthy blood vessels and tissues.
In laboratory studies, researchers said they found that a three-day course of the drug, called G202, reduced the size of human prostate tumors grown in mice by an average of 50 percent within 30 days. In a direct comparison, G202 outperformed the chemotherapy drug docetaxel, reducing seven of nine human prostate tumors in mice by more than 50 percent in 21 days. Docetaxel reduced one of eight human prostate tumors in mice by more than 50 percent in the same time period.
In a report June 27 in the journal Science Translational Medicine, the researchers also reported that G202 produced at least 50 percent regression in models of human breast cancer, kidney cancer and bladder cancer.
Based on these results, Johns Hopkins physicians have performed a phase I clinical trial to assess safety of the drug and have thus far treated 29 patients with advanced cancer. In addition to Johns Hopkins, the University of Wisconsin and the University of Texas-San Antonio are participating in the trial. A phase II trial to test the drug in patients with prostate cancer and liver cancer is planned.
The drug G202 is chemically derived from a weed called Thapsia garganica that grows naturally in the Mediterranean region. The plant makes a product, dubbed thapsigargin, that since the time of ancient Greece has been known to be toxic to animals. In Arab caravans, the plant was known as the “death carrot” because it would kill camels if they ate it, the researchers noted.
“Our goal was to try to re-engineer this very toxic natural plant product into a drug we might use to treat human cancer,” says lead study author Samuel Denmeade, M.D., professor of oncology, urology, pharmacology and molecular sciences. “We achieved this by creating a format that requires modification by cells to release the active drug.”
By disassembling thapsigargin and chemically modifying it, the researchers created a form that Denmeade likens to a hand grenade with an intact pin. The drug can be injected and can travel through the bloodstream until it finds the site of cancer cells and hits a protein called prostate-specific membrane antigen (PSMA). PSMA is released by cells lining tumors of the prostate and other areas, and in effect “pulls the pin” on G202, releasing cell-killing agents into the tumor and the blood vessels that feed it, as well as to other cells in the vicinity.
Specifically, G202 blocks the function of a protein called the SERCA pump, a housekeeping protein necessary for cell survival that keeps the level of calcium in the cell at the correct level, the researchers report.
“The exciting thing is that the cancer itself is activating its own demise,” says senior study author John Isaacs, Ph.D., professor of oncology, urology, chemical and biomedical engineering at Johns Hopkins.
Because the drug is targeted to the SERCA pump, which all cells need to stay alive, researchers say it will be difficult for tumor cells to become resistant to the drug, because they cannot stop making the protein.
The study’s co-authors were Annastasiah M. Mhaka, D. Marc Rosen, W. Nathaniel Brennen, Susan Dalrymple, Bora Gurel, Angelo M. DeMarzo, and Michael Carducci of Johns Hopkins; Ingrid Dach, Claus Olesen, Jesper V. Møller, and Poul Nissen of the Danish National Research Foundation and Aarhus University; and Craig A. Dionne of GenSpera Inc.; and S. Brøgger Christensen of the University of Copenhagen.
The work was supported by the Department of Defense Prostate Cancer Research Program, the Prostate Cancer Foundation and David Koch, the Danish Cancer Society, the Danish Research Council for Strategic Research, the Danish National Research Foundation, the Danish Medical Research Council, the Aarhus University Research Foundation, and the National Institute of Health’s National Cancer Institute Specialized Program of Research Excellence (CA058236 and CA006973).
Denmeade and Isaacs are consultants for GenSpera Inc. and have received equity and financial compensation. This relationship has been disclosed and is under the management of the Johns Hopkins University School of Medicine Conflict of Interest Committee.
For the Media
Johns Hopkins Kimmel Cancer Center
Office of Public Affairs
Media Contact: Vanessa Wasta | <urn:uuid:00379e90-b08b-4e0f-8745-d1663d46cb13> | CC-MAIN-2016-26 | http://www.hopkinsmedicine.org/news/media/releases/drug_from_mediterranean_weed_kills_tumor_cells_in_mice | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399117.38/warc/CC-MAIN-20160624154959-00119-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.927522 | 1,090 | 2.578125 | 3 |
Whether you're planting a lawn that's new or renovating an old one, some important elements should be considered before just throwing some grass seed around. The type of lawn seed you choose is very important, and planting it properly is the only way you'll have a healthy lawn. You'll also want to keep pests away from those growing green blades. Read on to learn dozens of helpful tips.
Starting a Lawn from Seed
First, decide what type of grass you want to grow. Most lawn grasses are cool-season grasses that green up early and may go semi-dormant in hot, dry summer weather. Warm-season grasses such as Zoysia green up later but sail through the hottest summer weather.
There are basically two types of lawn grasses; those that bunch and those that creep. Bunching-type grasses spread slowly outward from new shoots at the base of the plant. Creeping grasses, as most lawn varieties are, spread by sending out rhizomes or stolons -- stems that creep along or just below ground level, forming a new plant at the tip.
Both grasses form thick mats if they're properly cared for. Creeping grasses form a better turf for high-traffic areas. You'll also have to consider the climatic zone you live in. Not all varieties will grow under all conditions.
Next, have your soil tested. Inform the soil test lab which type of grass you intend to grow, and they will recommend what soil amendments may be needed. Add lime and fertilizer if called for by the soil test report.
Grade the soil; level hills, and add top soil to low spots. Don't use subsoil on the top surface; turf grasses need a well-drained soil for roots to grow. Construction debris under the surface prevents roots from growing deeply, creating dead spots in the lawn. Cultivate the soil thoroughly, and remove rocks, roots, clods, and debris. Use a garden rake to fine-grade the area and roll the soil lightly to prevent uneven sinking. If you're renovating small patches of an old lawn, follow the same steps on a lesser scale.
Once the soil is graded, you're ready to sow seed. Sow cool-season grass in the early fall so the grass will have four to six weeks to establish before frost. Spread the seed with a hand spreader at the recommended rate found on the package.
Use a garden rake to gently work the seed into the top 1/8 inch of soil; seed that is planted too deeply will not germinate. Roll the area with a lawn roller to ensure good contact between the soil and the seed.
Using clean, weed-seed-free straw, lightly mulch the seedbed, light enough that half the soil is left exposed. The straw will help shade the soil and your seedlings, preventing them from drying too quickly.
Keep the top layer of soil evenly and constantly moist. Heavy watering with a sprinkler is not useful because seed will easily wash away. Water with a fine spray several times a day until the seedlings become strong enough to withstand regular irrigation.
In the next section, you'll learn how to use sod to start a lawn.
For more information on lawn care and related topics, try these: | <urn:uuid:3ceeefce-b3b6-46c3-af88-dd2b9823254c> | CC-MAIN-2016-26 | http://home.howstuffworks.com/how-to-grow-a-lawn7.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398216.41/warc/CC-MAIN-20160624154958-00141-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.947752 | 679 | 3.109375 | 3 |
The National Curriculum Statement Grades R-12 gives expression to the knowledge, skills and values worth learning in South African schools. This curriculum aims to ensure that children acquire and apply knowledge and skills in ways that are meaningful to their own lives. In this regard, the curriculum promotes knowledge in local contexts, while being sensitive to global imperatives.
The National Curriculum Statement Grades R-12 serves the purposes of:
- equipping learners, irrespective of their socio-economic background, race, gender, physical ability or intellectual ability, with the knowledge, skills and values necessary for self-fulfilment, and meaningful participation in society as citizens of a free country;
- providing access to higher education;
- facilitating the transition of learners from education institutions to the workplace; and
- providing employers with a sufficient profile of a learner’s competences.
The National Curriculum Statement Grades R-12 is based on the following principles:
- Social transformation: ensuring that the educational imbalances of the past are redressed, and that equal educational opportunities are provided for all sections of the population;
- Active and critical learning: encouraging an active and critical approach to learning, rather than rote and uncritical learning of given truths;
- High knowledge and high skills: the minimum standards of knowledge and skills to be achieved at each grade are specified and set high, achievable standards in all subjects;
- Progression: content and context of each grade shows progression from simple to complex; ENGLISH HOME LANGUAGE GRADES R-3 CAPS 5
- Human rights, inclusivity, environmental and social justice: infusing the principles and practices of social and environmental justice and human rights as defined in the Constitution of the Republic of South Africa. The National Curriculum Statement Grades R-12 is sensitive to issues of diversity such as poverty, inequality, race, gender, language, age, disability and other factors;
- Valuing indigenous knowledge systems: acknowledging the rich history and heritage of this country as important contributors to nurturing the values contained in the Constitution; and
- Credibility, quality and efficiency: providing an education that is comparable in quality, breadth and depth to those of other countries.
The National Curriculum Statement Grades R-12 aims to produce learners that are able to:
- identify and solve problems and make decisions using critical and creative thinking;
- work effectively as individuals and with others as members of a team;
- organise and manage themselves and their activities responsibly and effectively;
- collect, analyse, organise and critically evaluate information;
- communicate effectively using visual, symbolic and/or language skills in various modes;
- use science and technology effectively and critically showing responsibility towards the environment and the health of others; and
- demonstrate an understanding of the world as a set of related systems by recognising that problem solving contexts do not exist in isolation.
Inclusivity should become a central part of the organisation, planning and teaching at each school. This can only happen if all teachers have a sound understanding of how to recognise and address barriers to learning, and how to plan for diversity. The key to managing inclusivity is ensuring that barriers are identified and addressed by all the relevant support structures within the school community, including teachers, District-Based Support Teams, Institutional-Level Support Teams, parents and Special Schools as Resource Centres. To address barriers in the classroom, teachers should use various curriculum differentiation strategies such as those included in the Department of Basic Education’s Guidelines for Inclusive Teaching and Learning (2010). | <urn:uuid:7d479a1c-663f-42fc-9f74-912a101157f1> | CC-MAIN-2016-26 | http://www.education.gov.za/Curriculum/CurriculumAssessmentPolicyStatements/tabid/419/Default.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396100.16/warc/CC-MAIN-20160624154956-00067-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.928445 | 738 | 3.765625 | 4 |
Foster Kamer points out an interesting statistic reported in the New York Times that half of families with incomes over $75,000 have used internet-capable mobile devices to download applications for their children, while just one of 8 families with incomes under $30,000 have. There’s always a tendency to assume when one set of people has or can afford something and other people can’t that the thing is important, and particularly so if it’s something that’s billed as good for childhood development. And I get that impulse — nobody wants their children to be deprived, whether of educational advantages or of pleasure.
But I think it’s pretty early to worry that an app gap is going to cause lasting educational deficiencies for poorer children. The American Academy of Pediatrics is clear about the lack of benefits of screen time for children under 2. And there doesn’t seem to be particularly definitive evidence that apps give children who use them an advantage in literacy or other kinds of learning. According to a white paper from the Arizona State University College of Teacher Education and Leadership:
It is difficult to gauge what is actually happening, because the little that is known about the effects of digital media on emergent literacy skills development comes from educational television and computer studies, as well as from a few studies of other media and surveys…Digital media may be transforming the language and cultural practices that enable the development of emergent literacy skills. A new generation of young children is experiencing a new kind of interconnectedness in the language they see, hear, and use.
It may be that the optimism of folks like GeekDad or app evangelists may be justified. But until it’s proved to be so, it’s probably not worth a panic. That doesn’t mean that it’s worth doing nothing, either — it would, of course, be too bad if it turns out apps are a critical development tool and a lot of kids had been missing out. But I wonder if the best way to go about it is for developers to think beyond the Apple App store. You’re not going to get everyone to come to Apple, nor should you. If we’re worried about a digital gap, we should meet people where they’re at. And more parents should probably be getting the Academy of Pediatrics warnings through their doctors. That only 14 percent of them are getting that information from their doctors may actually be a more worrying suggestion that medicine isn’t adapting to the digital age as well as we might wish. | <urn:uuid:0e5b8078-d56d-439b-93d5-a27bd87e6052> | CC-MAIN-2016-26 | http://thinkprogress.org/alyssa/2011/10/27/353979/how-much-does-the-app-gap-matter/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395039.24/warc/CC-MAIN-20160624154955-00091-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.953898 | 521 | 2.546875 | 3 |
Western and Eastern medical practitioners consider good breathing habits to be essential components of health. Unfortunately, the most people have poor breathing habits. They take shallow breaths, only use a portion of their lungs, even when they believe they are taking deep breaths, and hold their breath--especially when they become nervous or tense.
Breathing well is vitally important to your health. No other health practice is capable of producing such dramatic and life-changing results, for the amount of effort put in, as the conscious practice of learning to breathe with your entire body in a relaxed, circular manner, without holding your breath. Breathing with the whole body has been used for millennia to enhance the ability to dissolve and release energy blockages in the mind/body, enhancing well-being and spiritual awareness.
Eastern medical systems have brought two major breathing systems to the West: one is pranayama or yogic breathing and the other is Taoist breathing. These systems have many similarities, including:
However, they also have fundamental differences. Unlike pranayama, Taoist breathing emphasizes kidney breathing and lower/upper back breathing. The breath is alway done with both nostrils and there is no breathing into the front of the chest.
The major difference is that many core pranayama breathing techniques involve holding the breath. In Taoist breathing, you never hold or restrict the breath since it can create tension and thereby negatively pattern the nervous system--the exact opposite of Taoist breathing goals.
Energy Arts teaches a Taoist breathing system based on ancient, time-tested techniques used for centuries to improve the quality of your breath, help you feel more alive and build your chi.
The basic techniques of Taoist Longevity Breathing get everything inside your body moving and in synch with the rhythm of your breathing. It wakes up the inside of your body and makes it incredibly healthy. The methodology cultivates your ability to relax at any time and concentrate for long periods.
Taoist Longevity Breathing:
The oxygen in your blood powers your metabolism, circulation and your ability to heal. Decreasing levels of oxygen make you prone to illness, morbid emotions and weak physical and mental performance. Most Western doctors recommend aerobic exercise as the best way to increase the volume of oxygen in your body.
Taoist Longevity Breathing does the same. When qigong is practiced along with Taoist Longevity Breathing, the flow of oxygen will become smooth and balanced throughout your body.
Taoist Longevity Breathing gets rid of carbon dioxide and increases the usable oxygen that you inhale. Even if you can inhale sufficiently to pull in enough oxygen to your system, you might not exhale deeply or long enough to get rid of all the carbon dioxide in your body. For most people, a quarter or so reserve at the bottom of the lungs is always filled with carbon dioxide.
This leaves only three quarters of the lungs free for oxygen intake on the next inhale. This causes the exhale to become even weaker, diminishing the body's ability to procure oxygen from the air. Exhaling insufficiently:
Taoist Longevity Breathing helps you create and stabilize a strong, steady breathing pattern that will mitigate excessive emotional swings. It retrains your nervous system to relax and make your thoughts smoother and more comfortable. Studying your breathing patterns can make you aware of the ways your moods and emotions change.
For example, fear tends to produce erratic, strained or weak breathing patterns. Holding the breath is often a preceded by violent, angry explosions. Likewise, holding the breath without realizing it is part of a reaction to stress and tends to increase its severity. Shallow breathing makes people prone to lung weaknesses in the face of environmental problems, such as polluted air, and can also lead to depression.
According to Traditional Chinese Medicine, the ability of your breathing to improve the functioning of your internal organs--liver, kidneys, heart, spleen and lungs--is as valuable as increasing oxygen intake. Taoist Longevity Breathing methods transfer the pressure from air coming into the lungs to the internal organs, especially the heart. This provides a gentle yet firm massage for the organs while increasing blood and chi flow that helps to optimize their natural range of movement.
When the range of motion of your internal organs diminish, blood flow to your internal organs also diminishes, blocking the smooth flow of energy. Other effects include the gradual shortening of your ligaments and restricted movement of your organs. Bodily functions will gradually weaken and disease will eventually strike
Breathing well throughout your day is the best prevention!
I want to thank you so much for the wonderful opportunity to attend the Wu style short form. It is no exaggeration to say that what I learnt in one week, I couldn’t have learnt anywhere else in a lifetime. | <urn:uuid:d0bfb1fc-221d-40e8-ab50-4447422b238d> | CC-MAIN-2016-26 | http://www.energyarts.com/taoist-breathing | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397111.67/warc/CC-MAIN-20160624154957-00111-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.940626 | 1,009 | 2.515625 | 3 |
Investing in Transportation Could Save Billions in Energy Costs
February 20, 2013
An investment of $79 billion in transportation could translate to $218 billion in energy savings by 2030, according to a report released last week by the Alliance Commission on National Energy Efficiency.
The Alliance's report encourages investment in more productive transportation systems to reduce energy costs and waste.
Alliance Chairs Senator Mark Warner (D-Virginia) and National Grid US President Thomas King emphasized the report's goal of doubling energy productivity by 2030. If achieved, the nation could add 1.3 million jobs, cut average household energy costs, reduce energy imports by more than $100 billion a year, and reduce CO2 emissions by one-third.
"Doubling our energy productivity will yield huge returns for our economy and increase our competitiveness," Warner said in a statement.
The report states that transportation accounts for "28% of U.S energy use and 71% of its oil consumption. The transportation sector has large effects on national energy productivity, environmental protection, and energy security."
Through these measures, the United States can lower its dependence on foreign oil, reduce CO2 levels affecting climate change, and bring the national transportation infrastructure system into the 21st century, according to the report.
The report also addresses cost savings in manufacturing, power grids, and other forms of energy conservation.
Finally, the report suggests congressional action to direct U.S. Department of Transportation and the Environmental Protection Agency to create long-term transportation plans for metropolitan areas so that those communities can use energy more efficiently and encourage other forms of transportation such as safe walking, biking, and public transportation.
The 34-page report, "Energy 2030: Doubling U.S Energy Productivity by 2030," is available here.
Published with permission from the AASHTO Journal's Weekly Transportation Report. | <urn:uuid:21940d88-c098-42a8-ace4-3d19d2f11439> | CC-MAIN-2016-26 | http://www.truckinginfo.com/channel/fleet-management/news/story/2013/02/investing-in-transportation-could-save-billions-in-energy-costs.aspx | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393146.70/warc/CC-MAIN-20160624154953-00187-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.930007 | 375 | 2.625 | 3 |
Big question: Why do we still have the Electoral College?
Established in 1787, the Electoral College is as old as the U.S. Constitution. Marquette Magazine asked Dr. Paul Nolette, assistant professor in the department of political science, why, after 225 years, we still use the Electoral College system to elect our president instead of the popular vote?
Turn on your favorite TV news program and you're likely to hear about how each presidential candidate is faring among "Wal-Mart Moms," "NASCAR Dads," or another critical voting group. As Americans were reminded in 2000, however, this presidential election will ultimately be decided by the 538 members of the Electoral College. Why is the Electoral College part of the Constitution? And why does it still exist today?
During the debates over the Constitution, Alexander Hamilton's defense of the Electoral College suggested that electors would bring greater wisdom to presidential selection. “A small number of persons, selected by their fellow-citizens from the general mass, will be most likely to possess the information and discernment requisite to such complicated investigations,” he wrote in “Federalist #68.” Several of the Constitution's framers viewed the Electoral College as a protection of state power. Individual states would send electors who would presumably prevent the election of a candidate threatening to centralize power in the federal government.
Many of the original justifications for the Electoral College have less force today. Other constitutional features meant to protect the states have since changed. The 17th Amendment, for example, shifted the selection of senators from state legislatures to popular election. The notion that electors have better deliberative capacity than the general populace is now passé, especially since electors today are partisan activists who commit themselves to a candidate well before Election Day. So why do we keep the Electoral College?
One argument is that the Electoral College ensures more attention to less populous states otherwise at risk of being ignored by presidential candidates. If people directly elected the president, candidates would focus their attention on population-rich states like California, New York and Texas rather than smaller states such as New Mexico, Nevada and Wisconsin. The problem is that under the current system, the vast majority of states are already ignored by candidates — including not only most of the smallest but several of the largest as well. The lion's share of the attention goes to an increasingly small number of swing states that could realistically favor either candidate. This may be to our benefit here in the Badger State, but not so for those in Nebraska, Rhode Island or any of the 40 other non-competitive states.
Perhaps a better contemporary argument for the Electoral College is that it has a tendency to produce clear winners. This contrasts with the popular vote, which remains relatively close in nearly all presidential contests. In 2008, for example, Obama won only 53 percent of the popular vote but more than two-thirds of the electoral vote. The Electoral College, as it typically does, helped to magnify the scope of the incoming president's victory. For someone taking on the highest-profile job in the world, this additional legitimacy boost may be no small thing. | <urn:uuid:197fb3e8-55d0-4cfe-b59d-f8a766cc6776> | CC-MAIN-2016-26 | http://www.mu.edu/magazine/recent.php?subaction=showfull&id=1351616400&archive=&start_from=&ucat=12 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397636.15/warc/CC-MAIN-20160624154957-00104-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.961789 | 636 | 3.5 | 4 |
How Tied Chambers Affect States
Do tied chambers complicate or facilitate getting legislative business done?
About 61 state legislative chambers across the United States have an even number of legislators, making them ripe for a tie. In fact, historically speaking, ties are quite common, according to the National Conference of State Legislatures (NCSL). A majority of states have had at least one tied chamber since 1966, and every even-year election since 1984 has produced at least one. Today, the Oregon House is evenly divided, as is the Alaska Senate, though Democrats and some Republicans in Alaska have formed a majority coalition to run the chamber.
For obvious reasons, a tie can greatly complicate legislative business, robbing a chamber of clear lines of authority over floor procedure and committee operations.
Yet despite the challenges, tied chambers are often successful at getting legislative business done. "It hasn't always been the case, but many times these have turned out to be extremely productive sessions," says Tim Storey, a political analyst with NCSL.
Here are some examples:
- In 2005 and 2009, the Montana House of Representatives was tied. "In both cases, prior to each session, the two caucuses negotiated rules to deal with a variety of issues, such as which party chaired each committee, the process by which bills were referred to committee and what happened to bills with a tie vote in committee," says Democratic state Sen. David Wanzenried, who served in 2005's tied chamber. "There were a few glitches, but the agreed-upon processes, while slightly different, functioned well. Members, for the most part, quickly adapted to the circumstances and successfully completed the public's work in the allotted time."
- For the 2001-2002 legislative sessions, the tied Arizona Senate split control by selecting moderate Republican Randall Gnant as senate president and by giving Democrats preferential treatment in obtaining choice committee chairmanships. "While not always smooth from a policy perspective, the political trains managed to run on time," says Stuart Goodman, a Republican principal with the firm Goodman Schwartz Public Affairs in Phoenix.
- The 2002 elections produced a 15-15 Senate tie in Oregon. The chamber installed a Democratic president, Peter Courtney, and a Republican president pro-tem, Lenn Hannon, both of whom were considered more moderate than other potential contenders for the top slots. The two parties split the committees, and installed a vice chair from the opposite party and an equal number of Democrats and Republicans on each committee. "It was no worse a session than most of our others, and better than the one before it," says David Sarasohn, a political columnist for the Portland Oregonian.
- In 2003 and 2004, the North Carolina House was tied, due to a Republican member's switch to support the Democratic leadership. The long-term consequences of this episode were problematic for long-serving Democratic Speaker Jim Black. The power struggle led to his downfall, culminating in a prison sentence for corruption-related charges. But in the short term, the tied chamber, led by co-speakers from each party, worked well, with the need for cross-party cooperation keeping the focus on areas of broad agreement. "In terms of the functioning of the House itself, it worked fairly well in handling the state's budget and other matters," says Ferrel Guillory, who founded the Program on Public Life at the University of North Carolina.
Models for Cooperation
Chambers grappling with a tie have a number of models for organizing themselves, according to NCSL.
Some are as simple as a coin toss, which was used by Wyoming to untie a chamber in 1974. In Idaho and Pennsylvania, the vote of a lieutenant governor was used to break partisan deadlocks during the organizational process. In Indiana, Montana and South Dakota, the party of the governor determined a tied chamber's top leader.
More common are variations on power-sharing agreements. In some cases, chambers have allowed one party to lead for a set period before turning over the reins to the other party. Chambers in Indiana, Nevada and Washington state switched control daily; Michigan switched monthly, while New Jersey switched every two months. In the Florida Senate in 1992, one leader served for 11 months before submitting a pre-planned resignation in favor of the other party. A similar system prevailed in Maine.
In the tied Iowa Senate in 2005 and 2006, the parties switched on a weekly basis. "Both sides tried to game the arrangement somewhat," says a journalist who covered the sessions. "When the Democrats were in control, they tried to move their bills, get favorable rulings on whether issues were germane, and so on. But overall, it went well. Everything required at least one vote from the other side of the aisle."
A related solution offers shared leadership positions while divvying up other slots, such as committee chairmanships. This system has been used in such states as Arizona, Minnesota and Virginia.
Sometimes chambers have established creative rules to make the process work. The Oklahoma Senate, which found itself tied after the 2006 election, decreed that each party should have a limited number of "silver bullets" -- privileges to force votes -- for bills that were stalled due to partisan disagreements.
Oklahoma Republicans, for instance, used one of theirs on a bill to enforce voter-identification requirements at the polls. Democrats used one on a drug reimportation measure.
Ultimately, Democratic Lt. Gov. Jari Askins cast only two tie-breaking votes, which suggests that most of the legislation that passed did so with a measure of bipartisanship. In fact, the number of bills passed rose from 336 in 2006 -- before the tie -- to 370 in 2007 and 447 in 2008.
Ties that Bind
The key to making a tied chamber work, experts say, is simple: establishing and maintaining trust.
"I am firmly convinced that trust between the leadership of the two parties is by far the most important factor," says Thom Little, a University of North Carolina-Greensboro political scientist who consults with the State Legislative Leaders Foundation. "No matter what the rules are, if the two leaders don't trust each other, it will be a disaster."
Trust has certainly emerged in the Oregon House, where the co-speakers - Republican Bruce Hanna and Democrat Arnie Roblan - share common ground due to their bordering districts. A New York Times dispatch in April had some fun with their fastidious efforts to schedule joint interviews as well as their tendency to finish each other's sentences.
The co-speakers "have worked closely together, and apart from a few hiccups, the House has functioned pretty smoothly," says Randy Stapilus, a writer, editor and publisher who follows legislatures in the Northwest. "Oregon's Republicans are managing the neat trick of cooperating with Democrats without fielding lots of complaints that they've become traitors."
Alaska, the other state with a tied chamber, operates in a distinctly different manner. Though the chamber is equally divided between Republicans and Democrats, the Senate Bipartisan Working Group of 10 Democrats and 6 Republicans is in firm numerical control, many of them sharing a rural base and a cross-party desire for spending on infrastructure. The four remaining Republicans comprise the minority.
Tensions have risen in recent months between the Legislature and Republican Gov. Sean Parnell, who succeeded Sarah Palin after her mid-term resignation and then won a term of his own in 2010. For years, legislators worked together fairly smoothly, says Rebecca Braun, editor and publisher of the Alaska Budget Report, in part because legislators agreed to minimize conflict over emotionally charged social issues.
"It's a marriage of convenience, but it's worked," Braun says. How long it remains that way remains open to question, however: The current round of redistricting is expected to boost more conservative areas, potentially making it easier for the GOP to consolidate power under a unified banner.
At least most states that have dealt with a tied chamber haven't faced the additional challenges that New Jersey did in 2002. At the time, New Jersey had no lieutenant governor, a position that was later established by ballot measure. When Christine Todd Whitman left to join President George W. Bush's cabinet in 2001, state Senate president Donald DiFrancesco took over as acting governor.
Due to a constitutional quirk, DiFrancesco's term ended on Jan. 8, 2002. The newly elected governor, Jim McGreevey, wasn't scheduled to be sworn in until Jan. 15, leaving one week without a governor -- and a tied Senate chamber that was charged with filling the governor's chair in the meantime.
Senate co-presidents Richard J. Codey, a Democrat, and John O. Bennett, a Republican, solved the problem by agreeing to serve as acting governor in succession, for three and a half days each. Both men went all out, ordering gubernatorial stationery and pens (on their own dime) and using Drumthwacket, the gubernatorial mansion in Princeton, to host receptions.
Codey and Bennett even came to an agreement on how to handle that year's State of the State speech. Codey told the Bergen Record that he let Bennett give it because he knew his colleague had been fantasizing about doing it for months.
Join the Discussion
After you comment, click Post. You can enter an anonymous Display Name or connect to a social profile.
Domestic Abusers Can Lose Gun Rights, Rules High Court11 hours ago
SCOTUS Overturns Ex-Gov. Bob McDonnell's Conviction14 hours ago
Bob McDonnell and the Illusion of Ethics Reform14 hours ago
5 States Where the Abortion Ruling Could Spur More Lawsuits14 hours ago
Hawaii Becomes First State to Track Gun Owners in FBI Database16 hours ago
After Dozens Die in West Virginia Flooding, Obama Signs Disaster Declaration16 hours ago | <urn:uuid:22e95842-1dc5-4e3c-b0b3-bdb048f62b63> | CC-MAIN-2016-26 | http://www.governing.com/blogs/politics/how-tied-chambers-affect-states.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396872.10/warc/CC-MAIN-20160624154956-00076-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.962274 | 2,009 | 2.796875 | 3 |
Linguists have developed ways to reconstruct dead languages like Proto Indo-European, the language from which many of the languages of western Eurasia, including Celtic, Latin, Sanskrit etc are descended. Not the whole language perhaps. But lots of words and some idea of the society they represent.
Pretty nifty. So how do they do it?
Linguists rely on the theory that changes in sounds tend to be systematic. The case of Proto Indo-European is the most famous with some 5000 words now established. Especially impressive is that linguists can make predictions that have been confirmed when new inscriptions have been discovered.
So the question is are there systematic changes in cuisine or in elements of cuisine? Do tastes change in systematic ways? Is it possible that there are general human preferences for soft, sweet, warm, crunchy, salty foods? Could we thus make predictions (or better retrodictions) to earlier cuisines?
And could we confirm these retrodictions using residue analysis, for example? A long shot, but wouldn’t that be something? | <urn:uuid:02ac4c90-9186-45c4-b4cd-66fbb9d15d4f> | CC-MAIN-2016-26 | http://www.rachellaudan.com/2011/02/cuisine-and-language-9-can-we-reconstruct-dead-cuisines.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783391766.5/warc/CC-MAIN-20160624154951-00122-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.940216 | 218 | 3.265625 | 3 |
- IBS is a collection of symptoms, not a clearly defined physical condition. The symptoms vary from one person to the next, making IBS difficult to diagnose.
- Proper diagnosis is crucial to proper treatment.
- Many tests are used to diagnose IBS, including blood tests, stool tests, flexible sigmoidoscopy, colonoscopy, and CT scans.
An estimated 10-15 percent of American adults suffer from irritable bowel syndrome (IBS). However, only half of those people receive a diagnosis and seek medical attention. Proper diagnosis from a medical professional is important for getting proper treatment and relief.
IBS is a collection of symptoms, not a clearly defined physical condition. Symptoms vary from one person to the next. This makes IBS difficult to diagnose. To help make a proper diagnosis, your doctor may use a variety of tests.
Your doctor will begin by compiling your complete medical history and performing a physical examination. To learn more about your health, they will ask you questions about:
- possible stressors in your life
- past or current infections
- past or current symptoms
- family history of the condition
- medications that might make your symptoms worse
It’s important to tell your doctor when your symptoms started and how frequently you experience them. This will help identify patterns between your behavior and discomfort.
Your doctor may order a variety of diagnostic tests if you’re experiencing severe or additional symptoms such as weight loss, anemia, and blood in your stool. Although these tests are not required for a diagnosis of IBS, they can rule out other potentially serious conditions.
A blood test can help rule out the possibility of celiac disease. This a wheat allergy that produces symptoms similar to IBS such as cramping and intestinal distress.
A stool sample can check for the presence of blood or parasites, which can indicate infection.
Lower GI Series
For this test, your doctor uses an X-ray of your intestines to check for possible blockages. Before the test, your doctor will insert barium into your intestines through a tube in your anus. Barium is a liquid that makes the intestines more visible on the X-ray.
You’re usually required to undergo a liquid diet and enema before the examination. A sedative can help you relax during the procedure. You may have some discomfort and discolored stools for a day or two after this exam.
Flexible Sigmoidoscopy or Colonoscopy
These tests allow your doctor to view your rectum and colon with a small camera attached to a thin tube. The tube is gently inserted into your anus. As with the lower GI series test, this test usually requires a liquid diet and enema before examination. Taking a sedative may also be an option.
Your doctor may recommend a colonoscopy to rule out the possibility of colon cancer if you fall into a certain risk group based on age, race, or family history.
A CT scan of your pelvic region can help rule out other possible causes of your discomfort, such as pancreatic or gall bladder problems.
Lactose Intolerance Tests
If you’re unable to digest dairy products, you may experience symptoms similar to IBS, such abdominal bloating, gas, and diarrhea. Lactose intolerance can be diagnosed through a breath test or by eliminating dairy products from your diet for several weeks.
Causes of IBS aren’t always clear, so diagnosis can be difficult. A proper diagnosis is crucial for proper treatment. It will also rule out other diseases and conditions.
There are many tests and methods used to diagnose IBS. Be sure to talk to your doctor about which are best for you. | <urn:uuid:77dd481d-2d78-4a61-870f-02658fc87a46> | CC-MAIN-2016-26 | http://www.healthline.com/health/irritable-bowel-syndrome/tests-diagnosis | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397695.90/warc/CC-MAIN-20160624154957-00133-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.923971 | 764 | 2.9375 | 3 |
The management of groundwater on mine sites has become of greater importance in recent years. Proper management is particularly important from the aspect of environmental concerns as well as its impact on slope stability and dewatering of open pits. Extending the life of existing mines is causing the need for open pits to be deeper and tailings storage facilities to be larger. This short course covers the aspects of groundwater modeling as related to problems encountered typically at mine sites.
Significant advances have been made in the application of numerical models to practical problems in geotechnical engineering. The mining area is a particular area in which numerical modeling can be challenging. Complex 3D geometries are often associated with the numerical modeling of tailings ponds, earth dams and other earth structures.
The first day of the course will start with a basic overview / refresher of groundwater seepage flow theory. The fundamentals of setting up a seepage model as well as the common issues related to 2D / 3D seepage modeling will be covered. Model setup related to typical scenarios encountered at a mine site will be covered as both 2D and 3D numerical models. Methods of representing 3D geometry for 3D modeling will be covered.
The second day will focus on unsaturated groundwater seepage, coupled climatic analysis, and large-strain consolidation analysis. The basics of performing an unsaturated analysis as well as methods for determining unsaturated soil properties will be covered. A particular focus will be the 1-D analysis of earth cover designs for the remediation of waste rock and mine tailings structures. New methodologies for analyzing large-strain consolidation of mine tailings in 1D/2D/3D will also be covered.
The applications of automatic mesh refinement techniques to practical problems in order to improve convergence and improve the accuracy of calculations will be discussed.
This course intends to provide the user with an overview of the practical applications of probabilistic principles in groundwater modeling of complex earth structures. Attendees will be provided with complimentary trial versions of the SVOffice – SVFlux groundwater software such that they can follow along during software demonstrations.
Prior to the course, registered delegates have access to online e-learning material consisting of two introductory courses in English, titled Groundwater in Mining and Introduction to Groundwater Modeling for Mines and Mining.
Certificate in Mining Studies
This course qualifies for two days of short course credit for the Certificate in Mining Studies (CMS), a continuing education program of accredited short courses, webcasts and online courses for lifelong learning in mining, supported by University of British Columbia and University of Arizona. more details »
Continuing Professional Development (CPD)
Registered participants who attend the entire short course and complete an evaluation at the end of the course will receive a Certificate of Attendance, confirming the Professional Development Hours (PDH)/Continuing Education Units (CEU) earned. Please confirm with your employer and/or professional association that this course qualifies for CPD.
Who Should Attend?
The course will be of benefit and interest to geologists; groundwater modelers; geochemists; civil or geotechnical engineers; hydraulic specialists; and mining professional, engineering, or technical specialists.
Instruction will take place from 9:00AM to 5:00PM on both days, with a lunch break from 12:30PM to 1:30PM and 15 minute breaks in mid-morning and mid-afternoon.
The course includes the following topics:
The first day of the course will start with a basic overview / refresher of groundwater seepage flow theory. The fundamentals of setting up a seepage model as well as the common issues related to 2D / 3D seepage modeling will be covered. Model setup related to typical scenarios encountered at a mine site will be covered as both 2D and 3D numerical models. Methods of representing 3D geometry for 3D modeling will be covered. Specific topics covered the first day will be:
- Basic seepage theory overview
- Modeling techniques
- Seepage modeling basics
- Typical 2D seepage models (earth dam, tailings, etc.)
- Flow through tailings
- 3D seepage modeling (open pit, tailings facility, waste rock)
The second day will focus on unsaturated groundwater seepage, coupled climatic analysis, and large-strain consolidation analysis. The basics of performing an unsaturated analysis as well as methods for determining unsaturated soil properties will be covered. A particular focus will be the 1-D analysis of earth cover designs for the remediation of waste rock and mine tailings structures. New methodologies for analyzing large-strain consolidation of mine tailings in 1D/2D/3D will also be covered. Topics covered the second day will include:
- Unsaturated vs. Saturated Flow
- Unsaturated soil property estimation
- Cover design - 1D coupled climatic flow
- Consolidation modeling of tailings
How to Register
To register yourself, click the ‘Register Now’ button and complete the online registration form.
To register on behalf of someone else, or to register groups of 2 or more, please contact us; discounts may apply.
Questions? Please contact EduMine: +1 604 683 2037 or [email protected] and we will get back to you during regular business hours, Monday - Friday, 8:00am to 5:00pm Pacific Time.
The full fee for the two day program is CAD 1,700 + 5% tax. The fee covers the lecture, a comprehensive set of course notes, access to pre-course e-learning, a certificate of attendance, and catered breakfast and lunches including light refreshments. The fee does not cover accommodation.
Early Bird: there is a 10% discount if you register at least 30 days prior to the course start date. A 10% discount is offered for groups of 3 or more OR if you provide your Annual EduMine subscription User ID at time of registration. The maximum discount that can be applied is 20%.
The course will be held at InfoMine Inc, Vancouver, Canada, Suite 640 - 580 Hornby Street, Vancouver, BC. Detailed arrival instructions will be sent to all participants 10-14 days prior to the commencement of the course.
If you need to make hotel reservations, we recommend the following hotels. Each hotel is within a 5-15 minute walking distance of the course venue and provides convenient access to transportation and 'Canada Line' rapid transit to/from Vancouver International Airport.
When making reservations make sure to ask for the "InfoMine corporate rate".
- Executive Hotel Le Soleil, named by Resorts & Great Hotels Magazine as "One of the Top 100 Hotels in the World," has been recipient of the American Automobile Association's (AAA) 4-Diamond rating since its opening. Executive Hotel Le Soleil differentiates itself with a unique mixture of stylish sophistication and old world elegance. Featuring 119 luxury boutique lodging accommodations, it is conveniently located across the street from the InfoMine/EduMine offices. Experience Copper Chimney restaurant's award winning chefs and enter into an exotic world of Indian fusion food.
The Hotel Le Soleil's website is: http://www.hotellesoleil.com.
- Metropolitan Hotel Vancouver: make yourself at home in one of the Metropolitan Hotel's 197 elegantly appointed guestrooms and suites. Enjoy the Metropolitan's 24-hour Business Center; fully-equipped Health Club with indoor pool, whirlpool, sauna, and squash court; and the Diva at the Met restaurant, a AAA 4-Diamond rated restaurant featuring Vancouver's finest cuisine, celebrated Chef's table, and distinguished wine cellar. The Metropolitan has received a "4 Green Keys" rating through the Green Key Eco-Rating Program.
To book your room online with our personal InfoMine corporate rate link go to: http://private.metropolitan.com/VDZKNSEDL2.
The Metropolitan Hotel's website is: http://www.metropolitan.com/vanc/.
- Vancouver’s most art-full hotel, the Listel Hotel is a cultural tourist’s dream and a showcase for eco-friendly practices. Packed with original art, this 129 room boutique hotel boasts comfortable, contemporary furnishings and a perfect location in the West End, the city’s most eclectic shopping and dining neighbourhood. The hotel is also home to Forage, a pioneer in sustainable restaurant operations and home to Chef Chris Whittaker’s award-winning farm-to-table fare. Forage is known for its small plate dining and BC wine and craft beer on tap.
The Listel Hotel's website is: http://www.thelistelhotel.com.
- Days Inn Downtown Vancouver Hotel: experience the modern comforts of the historic full-service business hotel located in the core of downtown Vancouver. Their West Coast hospitality will ensure your stay is as comfortable as possible. Discover true value at the Days Inn Downtown Vancouver Hotel as they provide FREE Wireless Internet, Bottled Water / Tea & Small Business Center. InfoMine’s corporate rate includes $10.00 breakfast voucher, best available room at check-in, Day Pass to Health and Fitness Centre around the corner.
The Days Inn Downtown's website is: http://www.daysinnvancouver.com/.
For further information about hotels in Downtown Vancouver, see the following website: http://www.hotels-vancouver.ca/hotels/Downtown.
Terms and Conditions
By submitting a short course registration form, you agree to pay the associated fees in full before the course start date.
Notice of cancellation must be given in writing by letter, fax or email and action will be taken to recover, from the delegates or their employers, that portion of the fee owing at the time of cancellation.
A 10% administration fee will be levied for cancellations made 10 or more business days prior to the first day of the course. Cancellations thereafter will be liable for the loss of the full fee.
EduMine reserves the right to cancel an advertised course on short notice. It will endeavour to provide participants with as much notice as possible, but will not accept liability for costs incurred by participants or their organisations as a result of the course being cancelled or postponed. If a course is cancelled, fees will be refunded in full. EduMine also reserves the right to postpone or make such alterations to the content of a course as may be necessary. | <urn:uuid:05c5c956-bbe8-4a1b-905e-99d457b2859b> | CC-MAIN-2016-26 | http://www.edumine.com/courses/short-courses/groundwater-modelling-for-mining/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393463.1/warc/CC-MAIN-20160624154953-00102-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.91123 | 2,177 | 2.65625 | 3 |
of Mecklenburg County, North Carolina
and Early Tennessee
Compiled by C. Hammett, 2001
for TNGenWeb (TNGenNet) and Giles County in the Revolution
DAN ALEXANDER applied for his Revolutionary War pension while living in Marion County, Tennessee, in April 1833. He enlisted in Mecklenburg, County, North Carolina, in the spring of 1781, under Lieut. Ezekial POLK, Capt. Peter BURNS, Maj. Moore, Col. Wade HAMPTON and Gen. SUMPTER. He fought in the battle of Eutaw Springs. His discharge was burned when his home was burned. He was born 15 Feb 1764 in Mecklenburg County, North Carolina and removed from there to Haywood County, North Carolina, and then in 1832 to Marion County, Tennessee where he died on 1 Oct 1839. His widow, Sarah Alexander, applied for pension on 25 Feb 1853 while living in Dade County, Georgia.
DAN ALEXANDER applied for his revolutionary pension while living in Hardeman County and his name appears on the 1832 List. He was born in Mecklenburg County, North Carolina, 1757. He volunteered under Capt. ALEXANDER and Genenal ERWIN. The Captain was nicknamed "Black Alexander." Col. GATES wore velvet breeches and a pale blue coat with epaulettes. He rode a bay horse.
ELIJAH ALEXANDER applied for his revolutionary pension while living in Maury County, Tennessee, September 11, 1832, age 72. He declared he was born in Mechlinburg [Mecklenburg] County, North Carolina, in 1760, as recorded in his father's family Bible. He remained in Mechlinburg County until 1819 when he moved to Maury County, Tennessee. In March 1780, Colonel Thomas POLK made a demand on nearby companies of men to guard a magazine. With the consent of Elijah ALEXANDER's father Elijah entered the service under Captain Thomas ALEXANDER and served three months. Shortly after that the father, William ALEXANDER, sent Elijah to Maryland. After returning he enlisted again in February, 1781. Smallpox appeared in camp and Moses ALEXANDER, brother of the Governor of North Carolina, died. Elijah ALEXANDER was sent home to be inoculated. He enlisted again and rendezvoused at Charlotte under Colonel Thomas POLK and Captain James JACK in March, 1781. Sarah ALEXANDER, widow of Elijah ALEXANDER, applied for widow's pension November 21, 1850, while living in Giles County, Tennessee, aged 88 years. She stated that Elijah ALEXANDER died in Giles County, November 11, 1850. She stated that she was married to the soldier at the home of her grandfather, in Mechlinburg County, North Carolina in June, 1783, by (???) Giles, a Justice of the Peace. She stated that her late husband's sister, Ruth Clark, living in Iowa, 86 years of age in 1850, was present at the wedding. In 1855 Mrs. Sarah Alexander had removed from Tennessee to Mississippi. (Rev War Pension W5201)
In 1835, Elijah ALEXANDER was on the Pension Rolls as "Elijah Alexander, Maury County, Tennessee, Private, North Carolina Line, $20.00 Annual Allowance, $60.00 Amount Received, May 3 1833 Pension Started, Age 74."
"According to Zella Armstrong in her series, Some Tennessee Heroes of the Revolution, compiled from Pension Statements (originally Published in Five Pamphlets, Chattanooga, Tennessee, 1933, reprinted Genealogical Publishing Company, Baltimore, Maryland, 1975), "This is one of the most interesting pension declarations as Elijah's statement is entirely in his own handwriting. The widow stated that they lived together for sixty-six years but no children are mentioned."
CAPTAIN WILLIAM ALEXANDER applied for his revolutionary pension while living in Mechlenburg County, North Carolina. He entered service in that county under Captain Adam ALEXANDER. He was commanded by General Griffith RUTHERFORD in an attack on the Indians. He served under Captain Ezekial POLK in pursuit of the Tory William CUNNINGHAM. He served under General Thomas SUMTER in the battles of Rocky Mount, Hanging Rock and Gates Defeat. He was associated with Colonel Wade HAMPTON in the battles of Monk's Corner, Eutaw Springs, and the taking of Friday's Fort.
Note: Capt. William ALEXANDER did not apparently ever reside in Tennessee, but has been included here due to his possible relationship with other Mecklenburg County Alexanders.
Armstrong, Zella, Some Tennessee Heroes of the Revolution, compiled from Pension Statements, Originally Published in Five Pamphlets in Chattanooga, Tennessee in 1933, reprinted Genealogical Publishing Co., Inc., Baltimore, Maryland, 1975)
White, Virgil, Genealogical Abstracts of Revolutionary War Pension Abstract Files, National Historical Publishing Company, Waynesboro, 1990
Giles County in the Revolution
Tennesseans in the Revolutionary War
The TNGenWeb Project
Or Click Back to Return
Tennesseans in the Revolutionary War is
(Click Image to Visit USGenNet)
©2001 - present, TNGenNet, Inc., a public benefit corporation, dedicated to nonprofit, freely-accessible Tennessee genealogy and history on the Internet
NOTICE: This Research Report has been provided for the free use of those engaged in non-commercial genealogical research. Any and all commercial use is strictly prohibited. Researchers are encouraged to copy and distribute this work freely, but with the proviso that it may only be copied and circulated in its entirety -- including this notice, and all sources, bibliographies and credits; excepting electronically in which case permission is freely granted to hot link to this site instead.
Tennesseans in the Revolutionary War is a Special Project of TNGenNet, the volunteer organization of the TNGenWeb Project.
TNGenNet is a service mark of the Tennessee Genealogical Network, a nonprofit public benefit corporation registered in the State of Tennessee. See also TNGenNet's Bylaws and the History of TNGenWeb. | <urn:uuid:925f93ca-60ba-4513-b2dd-ebdacc5d9d26> | CC-MAIN-2016-26 | http://www.tngenweb.org/revwar/records/a/alexander.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397111.67/warc/CC-MAIN-20160624154957-00073-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.943271 | 1,313 | 2.828125 | 3 |
Can New Super Mario Bros. Wii teach a group of coworkers to cooperate? Instructional technologist and games-based learning specialist Jason Drysdale puts it to the test in an office environment.
No one likes group work. Okay, maybe a few people -- freeloaders -- but most people would rather spend a bit of extra time to ensure quality work, rather than cobble together a complete picture with pieces from four different puzzles.
Sometimes, the people are the problem -- but not usually. I blame our process of establishing and training groups. You've been there: Some manager has a project, takes a look at who is busy and who is qualified on paper, and voila! Group. It's no wonder most people hate group work; we don't build functional, intentional groups.
Cooperative video games may be the answer. Co-op video games don't just teach us about how to build a well-functioning group; they can facilitate the process.
Video games in eLearning aren't really new anymore -- many businesses and educational institutions for adults have designed and implemented games in eLearning modules for a variety of instructional purposes. However, these games tend to be game-skinned quizzes, not really games at all, such as matching games or multiple-choice games.
Most corporate games-based learning focuses on either demonstrating competencies through the application of knowledge acquired in a game, or by assessing knowledge acquired outside of a game. This implementation of games-based training is counter-intuitive for the medium: Games act as a mode of experiential learning -- constructivism, to the education lingo savvy -- wherein the activity itself is both learning and assessment.
Developing these games in-house can be costly -- not everyone who could benefit from using games for training has the resources necessary to make it happen. So, rather than spending the resources to build a game, why not use commercial games with collaborative dynamics?
I thought this constructivist implementation of games-based learning might solve the problem of poorly functioning groups for businesses of small and large budgets alike. The low cost and wide exposure made it a pretty enticing prospect. So -- with the help of Mario and Luigi (and a fair amount of planning) -- I put it to the test with a group of business professionals.
First some groundwork: what makes a game collaborative? Jane McGonigal describes it best in Reality Is Broken, when she distinguishes between cooperation, coordination, and collaboration. The key component of collaboration, according to McGonigal, is cocreation: working together to produce something.
Additionally, James Gee describes the game design process as collaborative in his work Learning by Design: Games as Learning Machines, since without a player to interact with the designed world, the world doesn't exist. Tyria, Azeroth, and Pulse don't exist without players to bring it to life. By playing a game, then, we are actively producing something -- in solo games, with just the game designer, and in multiplayer games, with our fellow gamers. So games -- by their nature -- are collaborative.
However, we're seeking for collaboration between gamers, not just with the designers. Just being a multiplayer game isn't enough. Take Call of Duty: Modern Warfare 3's multiplayer as an example. There are several different multiplayer modes, such as deathmatch, kill confirmed, and team defender. In each of these modes, players earn boons based on performance: get three or more kills in a row, and you get a leg up on your opposition. Capture the flag and keep it to get double points on your kills.
These bonuses don't always benefit the entire team, other than improving the overall team score (by way of individual advancement). So, MW3's multiplayer focus is on individual performance: improve yourself and your team benefits. Even in team deathmatch rounds, the game is designed to focus on individual outcomes: gaining levels, earning achievements, and so on. There is collaboration with the game designers, yes, but not with fellow players. We play MW3 together in order to advance individually. As such, the result is collaborative, but the goal isn't. The instructional value of games hinges on this distinction: is the goal collaborative, or just the result?
This doesn't necessarily mean that collaborative games can't also be competitive. Take, for example, Worms 2: Armageddon. Up to four players are pitted against each other in mortal, wormy combat. Whoever still has a worm left at the end of the game wins. At first glance, the goal of Worms is to win. But get four people in a room, and the real goal quickly becomes apparent: having fun. Worms has some of the most ostentatious weapons this side of the Ratchet & Clank series. Exploding sheep and giant concrete donkeys wreak havoc on the map and, even when your own worms go the way of the buffalo, you have fun. Winning is the non-collaborative result; fun is the collaborative goal.
For an example of a collaborative goal, take a look at Guild Wars 2. Events occur throughout each zone of Tyria in which multiple players engage at any given time. If a co-player is downed during the battle, you can revive them -- you don't get a reward for this beyond an arbitrary amount of experience points, but you are more likely to succeed in winning the event with more people helping out.
So, instead of being solely invested in your own success (e.g. "I won't help my teammate because I'll get more points on my own"), you are also invested in the success of your temporary teammates, because of your shared investment in the outcome: you work together to overcome an obstacle for the mutual benefit of each other. In this situation, the goal is collaborative (work together to defeat an enemy) as is the result (defeat the enemy). For the purposes of team building with collaborative games, the ideal games have both collaborative goals and collaborative results -- Guild Wars 2 is a useful and fun collaborative game. | <urn:uuid:12b91a4a-0f50-448b-82cb-d3efcc1f10e3> | CC-MAIN-2016-26 | http://www.gamasutra.com/view/feature/184563/team_building_with_mario_and_luigi.php | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397748.48/warc/CC-MAIN-20160624154957-00067-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.964737 | 1,239 | 2.53125 | 3 |
SAINT, TROUBADOUR, revolutionary, fanatic, clown – whatever impression we may have of Francis of Assisi, no one can deny the inspiration that he has been down the centuries. Europe in the time of Francis (1182-1226) was a place of deep divisions. Towns and kingdoms nourished ancient feuds with their rivals, while the established princes struggled against the growing power of the merchants. Many people lived in poverty, while those at the top fared sumptuously but even the ordinary poor were not so wretched as the lepers, the ultimate outcasts of those days. Meanwhile the witness of the Church was weak, and Francis responded to the call from God to ‘rebuild my church’, with Clare, by founding a religious Order at that time.
Francis and Clare, with their brothers and sisters, met the evident needs of the people by sharing food and shelter, and through preaching and living reconciliation, based on prayer and an active love for Christ. They answered the pain of the outcasts by making them their friends, such as the lepers, and shared the reproaches hurled at them. Their witness incorporated a spirit of conversion and penitence, fortified by times of quiet and withdrawal. Today within the Anglican Church there are three related Franciscan Orders which all started in the early years of the 20th Century:
- The First Order, consisting of men and women who live in community under a rule based on the traditional vows of poverty, chastity and obedience. They give expression to their mission by a variety of activities, seeking to maintain a balance, corporately and individually, between prayer, study and active work.
- The Second Order, the Community of Saint Clare, which is composed of women who feel called by God to an enclosed life of contemplative prayer, coupled with work to be self supporting.
- The Third Order, which is open to men and women, ordained or lay, married or single who feel that God is calling them to live out their Franciscan vocation in the world. While committed to family responsibilities and engaged in the ordinary tasks of life, the Third Order offers a life of challenge and support for those who are called to a deeper commitment to Christ, their Lord and Master, to a life under vow. There are currently nearly 2,000 members of the Third Order (called Tertiaries) in the European Province throughout England, Ireland, Scotland, Wales and Sweden. There are Tertiaries also in other Provinces across the world.
We welcome you to our site and we hope that you will consider, as you explore it, whether God is calling you to the life that we share in the Third Order.
The Third Order, Society of St Francis is a Registered Charity, No. 1064356.
All opinions expressed on this website are those of the authors and contributors and not necessarily those of the European Province of the Third Order, Society of Saint Francis.
Cookies: By continuing to use this site, your permission is granted for the use of unobtrusive cookies. For full details please see our Privacy Statement. | <urn:uuid:f73e41bf-04c5-4bd0-a8c7-1a1763f8200e> | CC-MAIN-2016-26 | http://tssf.org.uk/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397744.64/warc/CC-MAIN-20160624154957-00050-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.969307 | 637 | 3.28125 | 3 |
Individual differences |
Methods | Statistics | Clinical | Educational | Industrial | Professional items | World psychology |
Keystroke-level model, sometimes referred to as KLM or KLM-GOMS, is an approach to human–computer interaction (HCI), developed by David Kieras and based on CMN-GOMS. CMN-GOMS for its part was developed by Card, Moran, and Newell, and explained in their book The Psychology of Human-Computer Interaction, 1983. The model is an 11-step method that can be used by individuals or companies seeking ways to estimate the time it takes to complete simple data input tasks using a computer and mouse. By using KLM-GOMS, individuals often find more efficient or better ways to complete a task simply by analyzing the steps required in the process and rearranging or eliminating unneeded steps.
It is designed to be easier to use than other GOMS methods, such that companies who cannot afford human–computer interaction specialists can use it. KLM-GOMS is usually applied in situations that require minimal amounts of work and interaction with a computer interface or software design. The calculations and the number of steps required to accurately compute the overall task time increase quickly as the number of tasks involved increases. Thus, KLM-GOMS is best suited to evaluate and time specific tasks that require, on average, less than 5 minutes to complete.
The KLM-GOMS model is designed to be as straightforward as possible. The sequence of operations is modeled as a sequence of a small number of operations. Each operation is assigned a duration, which is intended to model the average amount of time an experienced user would take to perform it.
Kieras (1993, 2001) defines the following operations:
- K, key press and release (keyboard)
Best Typist (135 wpm) --- 0.08 seconds Good Typist (90 wpm) --- 0.12 seconds Poor Typist (40 wpm) --- 0.28 seconds Average Skilled Typist (55 wpm) --- 0.20 seconds Average Non-secretary Typist (40 wpm) --- 0.28 seconds Typing Random Letters --- 0.50 seconds Typing Complex Codes --- 0.75 seconds Worst Typist (unfamiliar with keyboard) --- 1.20 seconds
- P, Point the mouse to an object on screen --- 1.10 seconds
- B, Button press or release (mouse) --- 0.10 seconds
- H, Hand from keyboard to mouse or vice versa --- 0.40 seconds
- M, Mental preparation --- 1.20 seconds
- T(n), Type string of characters (n * K sec.)
- W(t), User waiting for the system to respond
- D(n0,l0), Draw n0 straight line segment with mouse of total length l0 centimeters
A mouse click would be written "BB" (button press, button release) while a sequence of 3 keyboard key presses is "AAA" or "T(n)" ("T" stands for "type").
A common operation that involves pointing and clicking something on the screen would be written "MPBB" (think, point, press, release).
KLM is not the only technique for evaluating interfaces, but it can be used to compare the speed of two different interfaces designed to accomplish the same task.
The following 11 steps were developed based upon the methodologies and ideas of Kieras and Olson-Olson and describe the proper approach to calculate the time it takes to complete a task by using a computer interface and hardware.
Step 1--Obtain a working prototype of computer interface or a step by step operational description of a task.
Step 2--Identify the goals or the desired outcome of work .
Step 3--For each of these goals, find subgoals or tasks that achieve the main goals.
Step 4--Identify methods to main goals and all subgoals.
Step 5--Convert description of methods to pseudo-code (the terminology that is described above).
Step 6--State any and all assumptions used in the making of pseudo-code and goals.
Step 7--Determine appropriate mental or keystroke operators for each step.
Step 8--Assign time values to mental or keystroke operators.
Step 9--Add up execution times for operators.
Step 10-Adjust total time of task to be sensitive by age of expected.
Age Time Adjustment Multiplier (Multiply task time by this value) Use as is 30–40 ??? 40–55 By 1.4 55–60 By 1.7 > 65 By 2.2
Step 11-Verify validity of results
Change the code in Line 512 from "hte" to "the" ('the'the' in computer language) and then press Enter Key
" Change 512 'hte'the' "
- Mentally prepare
- 6 average speed keystrokes (for word "change")
- 1 average speed keystrokes for space bar
- 3 keystrokes for pressing numbers "512"
- 1 average speed keystrokes for space bar
- Mentally Prepare by reading what needs to be changed
- 6 average keystrokes for typing Template:Not a typo and the
- 3 keystrokes to press the 3 " ' "
- 1 keystroke to press Return Key
K1 = average speed keystrokes (0.20 seconds)
K2 = typing random letters (0.50 seconds)
M = Mentally Prepare (1.35 seconds)
Put above steps into formula: M + 6K1 + K1 + 3K2 + K2 + M + 3K1 + K2 + 3K1 + K2 = 2M + 14K1 + 6K2 = 9.82 seconds
This method assumes that operator times are invariant and do not depend on the previous sequence of events. New physical operators can be added if their timing can be represented as a simple context-free function. KLM-GOMS does not account for either slips or mistakes automatically—the analyst must create separate models of error sequences and perform their own sensitivity analysis.
The placement of the keystrokes and pointer operations are straightforward, but the placement of the mental operations is not. Mental operations are placed by a set of rules that require some interpretation, such as determining a conceptual "cognitive unit" or grouping of actions. For instance, pressing ctrl and c simultaneously to perform a "copy" would be considered a single cognitive unit. Mental operations are inserted before each cognitive unit to account for cognitive preparation and decision-making.
The main reason a designer or analysts would use this technique is that it is a very fast. Different designs or systems can be compared against one another quickly. It does not require that the evaluator be an expert in GOMS because the procedure is an explicitly laid out recipe. A major caution is that the algorithm is designed to estimate the execution time for an expert user, which is typically faster than the time for a new user or an unfamiliar task.
See also Edit
- The CogTool project at Carnegie Mellon University has developed an open-source tool to support KLM-GOMS analysis.
- GOMS by Lorin Hochstein
- This article incorporates text from Dr. G. Abowd: GOMS Analysis Techniques – Final Essay, which has been released into GFDL by its author (see ).
- Card, S.K.; Thomas, T.P.; Newall, A. (1983), The Psychology of Human-Computer Interaction, London: Lawrence Erlbaum Associates, ISBN 0-89859-243-7
- Kieras, D. (1993, 2001), Using the Keystroke-Level Model to Estimate Execution Times, On-line handout, http://www.ict.griffith.edu.au/marilyn/uidweek10/klm.pdf
|This page uses Creative Commons Licensed content from Wikipedia (view authors).| | <urn:uuid:f5047acd-0ac1-4e37-92f7-3a5b0aecc496> | CC-MAIN-2016-26 | http://psychology.wikia.com/wiki/KLM_(human-computer_interaction) | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395560.14/warc/CC-MAIN-20160624154955-00052-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.893133 | 1,678 | 3.078125 | 3 |
Human Anatomy, Physiology, and Medicine. Anything human!
Thanks Nadas, to awake my stultified mind, I have made a glossary of the terms used in MF's Find. I do this to learn, and also, dive us all, a "building blocks" understanding, of a very complex issue, with plentiful tangential diversion. All definitions are from Biology Onlines Dictionary
(Science: molecular biology) A small, independently replicating, piece of extrachromosomal cytoplasmic dNA that can be transferred from one organism to another. linear or circular DNA molecules found in both pro and eukaryotes capable of autonomous replication.
stringent plasmids occur at low copy number in cells, relaxed plasmids at high copy number, ca 10 to 30. plasmids can become incorporated into the genome of the host or can remain independent. An example is the f factor of e. Coli. May transfer genes and plasmids carrying antibiotic resistant genes can spread this trait rapidly through the population.
Described largely from bacteria and protozoa. Some plasmids are capable of integrating into the host genome. A number of artificially constructed plasmids are used as cloning vectors
(Science: enzyme molecular biology) class of bacterial enzymes that cut dNA at specific sites. In bacteria their function is to destroy foreign DNA, such as that of bacteriophages (host DNA is specifically modified at these sites).
type I restriction endonucleases occur as a complex with the methylase and a polypeptide that binds to the recognition site on dNA. They are often not very specific and cut at a remote site.
type II restriction endonucleases are the classic experimental tools. They have very specific recognition and cutting sites. The recognition sites are short, 4-8 nucleotides and are usually palindromic sequences. Because both strands have the same sequence running in opposite directions the enzymes make double stranded breaks, which, if the site of cleavage is off centre, generates fragments with short single stranded tails, these can hybridise to the tails of other fragments and are called sticky ends.
They are generally named according to the bacterium from which they were isolated (first letter of genus name and the first two letters of the specific name). The bacterial strain is identified next and multiple enzymes are given roman numerals. For example the two enzymes isolated from the R strain of e. Coli are designated eco RI and eco RII.
Retrieved from "http://www.biology-online.org/dictionary/Restriction_enzymes"
The sustained heating of a material such as steel or glass at aspecific high temperature, followed by gradual cooling, this is done to eliminate weakness or to produce other qualities.
The pairing of complementary dna or rna sequences, via hydrogenbonding, to form a double-stranded molecule. Mostoften used to describe the binding of a short primer or probe.
(Science: biochemistry) a protein molecule produced by living organisms that catalyses chemical reactions of other substances without itself being destroyed or altered upon completion of the reactions.They are also called organic catalyst.Enzymes are found in saliva and salivary glands.
enzymes are classified according to the recommendations of the nomenclature Committee of the international union of biochemistry. Each enzyme is assigned a recommended name and an enzyme Commission (EC) number.
They are divided into six main groups, oxidoreductases, transferases, hydrolases, lyases, isomerases and ligases. Any of several complex proteins that are produced by cells and act as catalysts in specific biochemical reactions.A type of protein that catalyses biological reactions. enzymes have to operate in certain environment conditions (such as a thirty seven degree Celsius temperature in humans) to operate optimally.There can be factors, like a change in temperature or the absence of a coenzyme that will reduce the effectiveness of an enzymes reaction.
long story short, enzymes speed up chemical reactions. however, substrates, the reactants that change inside the enzyme, must fit like a lock and key: only certain amounts and kinds of substrates fit inside an enzyme. Things like high temperature and ph not of the optimal amount can change the shape of the enzyme and the substrates wont fit perfectly anymore, which is why extremely high temperatures can be dangerous to people and other organisms.
basic amino acid
An amino acid containing a second basic group (usually an amino group); e.g., lysine, arginine, ornithine.
Synonym: dibasic amino acid.
Retrieved from "http://www.biology-online.org/dictionary/Basic_amino_acids"
Al, I actually have a copy of the book that your link refers to, (The Kybalion). Yes, I agree it is rather intriguing and enlightening. Here is an Amazon link to a couple of other books I have which just might make you go "hmmmmm".
http://www.amazon.com/gp/reader/1585090 ... eader-link
http://www.amazon.com/gp/reader/0521398 ... eader-link
What a wide scope this encompasses, the depths are staggering. . .
now I'm very afraid:
http://www.us-government-torture.com/La ... 20Edit.pdf
thanks for the proper term index...
i coming at this from arcana .. its a another world in it self with
being out of context but in perceptive range.
and while "Things like high temperature and ph not of the optimal amount can change the shape of the enzyme and the substrates"
under many conditions .... FIRE / MAKES
toast that localized pseudomold biofilm
creat some instant aerobic mold spores dispersing
"Godel Escher Bach"
by D. Hoffstader
Here's one for you guys:
On page 649 of my Tormont Webster's Illustrated Encyclopedic Dictionary, I find the third definition for the word, "Fodder" as follows:
3. People viewed as raw material for the achievement of a specified commercial, political, or military end. See cannon fodder.
What the &$#! Yes, there it is folks, spelled out in plain English by none other than good ole' Webster himself.
So, I gather that must be what they consider us; nothing more than cannon fodder. That really sucks.
Thanks for input.
Thanks for reminding me of this. Excellent.
To Print: Click your browser's PRINT button.
NOTE: To view the article with Web enhancements, go to:
Rhinosporidium seeberi: A Human Pathogen From a Novel Group of Aquatic Protistan Parasites
David N. Fredricks,*†Jennifer A. Jolley,* Paul W. Lepp,* Jon C. Kosek,†David A. Relman*†
* Stanford University, Stanford, California, USA
† Veterans Affairs, Palo Alto Health Care System, Palo Alto, California, USA
Emerg Infect Dis 6(3), 2000. © 2000 Centers for Disease Control and Prevention (CDC)
Abstract and Introduction
Rhinosporidium seeberi, a microorganism that can infect the mucosal surfaces of humans and animals, has been classified as a fungus on the basis of morphologic and histochemical characteristics. Using consensus polymerase chain reaction (PCR), we amplified a portion of the R. seeberi 18S rRNA gene directly from infected tissue. Analysis of the aligned sequence and inference of phylogenetic relationships showed that R. seeberi is a protist from a novel clade of parasites that infect fish and amphibians. Fluorescence in situ hybridization and R. seeberi-specific PCR showed that this unique 18S rRNA sequence is also present in other tissues infected with R. seeberi. Our data support the R. seeberi phylogeny recently suggested by another group. R. seeberi is not a classic fungus, but rather the first known human pathogen from the DRIPs clade, a novel clade of aquatic protistan parasites (Ichthyosporea).
Rhinosporidiosis manifests as slow-growing, tumorlike masses, usually of the nasal mucosa or ocular conjunctivae of humans and animals. Patients with nasal involvement often have unilateral nasal obstruction or bleeding due to polyp formation. The diagnosis is established by observing the characteristic appearance of the organism in tissue biopsies (Figure 1). Treatment consists of surgical excision, but relapse occurs in approximately 10% of patients; antimicrobial therapy is not effective. Rhinosporidiosis occurs in the Americas, Europe, Africa, and Asia but is most common in the tropics, with the highest prevalence in southern India and Sri Lanka. A survey of schoolchildren from Pallam, India, found 11 cases in 781 children examined (prevalence 1.4%). Autochthonous cases have been reported from the southeastern United States. Studies have linked infection to swimming or bathing in freshwater ponds, lakes, or rivers[2,5].
Figure 1. Histology of rhinosporidiosis. A formaldehyde-fixed section of human nasal polyp was stained with Periodic acid-Schiff (PAS) and visualized by bright-field microscopy at 400X magnification. The thick walls of immature R. seeberi trophocytes stain with PAS (pink), and the spherical organisms are surrounded by inflammatory cells.*
The etiologic agent of rhinosporidiosis, Rhinosporidium seeberi, is an enigmatic microbe that has been difficult to classify. Recently, R. seeberi has been considered a fungus, but it was originally thought to be a protozoan parasite. Its morphologic characteristics resemble those of Coccidioides immitis: both organisms have mature stages that consist of large, thick-walled, spherical structures containing smaller daughter cells (endospores). In addition, R. seeberi is visualized with fungal stains such as methenamine silver and Periodic acid-Schiff, as well as mucicarmine, which stains the fungus Cryptococcus neoformans. R. seeberi has not been detected in the environment, and its natural host or reservoir is unknown. Attempts to propagate this organism on artificial media have failed, as has continuous cocultivation with human cell lines.
We report a molecular approach for establishing the phylogenetic relationships R. seeberi to other eukaryotes. This approach is based on amplification of the small subunit rRNA gene sequence from infected tissue, as in the method used to identify the culture-resistant bacillus of Whipple disease. The sequence of the small subunit rRNA gene has proven to be a useful gauge of evolutionary relationships for many organisms from diverse taxonomic groups.
Materials and Methods
We obtained a sample of frozen, minced, infected canine nasal polyp in tissue culture media that had been used for the limited propagation of R. seeberi in cell culture. After thawing and a 1-minute centrifugation at 500 x g, approximately 0.2 g of the tissue pellet was digested by mechanical disruption and the DNA was purified by adsorption to glass milk in the presence of a chaotropic agent, according to the manufacturer's instructions (Fast Prep, Bio 101, Vista, CA). The DNA was resuspended in 100µL of 10 mM Tris, 1 mM EDTA buffer at pH 8.5.
Three blocks of fixed, paraffin-embedded nasal polyps from unrelated patients with histologically confirmed rhinosporidiosis were obtained. One tissue sample came from a patient born in southern Asia but living in the United States, and two samples came from patients living in Spain. Twenty-three blocks of fixed, paraffin-embedded nasal polyps from patients without rhinosporidiosis were obtained from 12 consecutive patients at the Palo Alto Veterans Affairs (VA) hospital who had undergone nasal polypectomy. Two 25-µm sections were cut from each block, and the sections were deparaffinized and digested. DNA from the digests was then purified by the Isoquick method (ORCA Research, Inc., Bothell, WA), and the DNA was resuspended in 25µL of Tris/EDTA buffer. Sections from a block of fixed, paraffin-embedded human lymph node (histologically normal) were also used in some experiments as negative controls. Tissue sections of C. immitis in bone were obtained from a patient with disseminated coccidioidomycosis at the Palo Alto VA hospital and used for fluorescence in situ hybridization (FISH). Samples of Rosette agent and Dermocystidium salmonis DNA were obtained from the Bodega Marine Laboratory of the University of California, Davis.
Fungal specimens in culture were obtained from laboratories at Stanford University and the Palo Alto VA Health Care System. A cotton swab was used to transfer fungal cells from agar into a 1.5-mL microfuge tube containing 0.5 mL digestion buffer and 0.1 mL glass beads. Samples were incubated at 55°C overnight, and the proteinase k was inactivated at 95°C for 10 minutes and then subjected to two freeze-thaw cycles by immersing tubes in a dry ice-isopropranol bath followed by vortex mixing.
Consensus Polymerase Chain Reaction (PCR) of the 18S rRNA Gene
Broad-range fungal PCR primers were designed from a database of >4,000 small subunit rDNA sequences, with the ARB software package (Technical University, Munich, Germany). Primers were selected that would anneal to most fungal and some protist 18S rDNA but not to 18S rDNA from the chordata (F1-fw, F2-rev, F3-rev) (Table). When the specificity of the primer pairs was tested by using human lymphocyte DNA, no amplification was observed (data not shown). The broad range of primers F1-fw/F2-rev was tested by using DNA from several diverse fungi. Amplification products of the expected size were produced by using DNA from Aspergillus oryzae, Alternaria alternata, Candida albicans, Saccharomyces cerevisiae, Trichyphyton rubrum, Panus rudis, Neurospora crassa, Fusarium solani, Beauveria bassiana, Flammulina velutipes, Gibberella zeae, and Pleurotus ostreatus (data not shown).
PCR consisted of 40 cycles of amplification on a Perkin-Elmer GeneAmp 2400 thermal cycler. After an initial activation of Taq gold at 94°C for 10 minutes, each cycle consisted of 30 seconds of melting at 94°C, 30 seconds of annealing at 56°C, and 30 seconds of extension at 72°C. The last cycle was followed by an extension step at 72°C for 7 minutes. Amplification products were detected by electrophoresis on 2% agarose gels stained with ethidium bromide and visualized with a UV transilluminator.
On the basis of the sequences obtained by consensus PCR with primers F1-fw/F2-rev (~500 bp) and F1-fw/F3-rev (~1000 bp), primers Dermo-fw and Dermo-rev were designed (Table) and used in a PCR to amplify a more complete 18S rDNA sequence of R. seeberi.
A pair of PCR primers was designed from unique regions of the R. seeberi 18S rRNA gene sequence (Rhino-fw and Rhino-rev) (Table). These primers were used in a 50-µL PCR as described, except that AmpliTaq DNA polymerase (PE-ABI) was used at 1 unit per reaction, no dimethyl sulfoxide was added, 50 cycles of PCR were run with a 3-minute pre-melt at 94°C, and the annealing temperature was 55°C. To each 50-µL PCR reaction, 1µL or 5µL of purified DNA were added.
ß-globin PCR was performed on control tissues as described previously.
DNA Cloning, Sequencing, and Phylogenetic Analysis
Amplification products were cloned by using the Topo-TA cloning kit (Invitrogen, Carlsbad, CA), and three clones were sequenced. Each clone consisted of 1,750 bp of 18S rDNA. Priming sequences were removed for further analysis, yielding 1,699 bp of meaningful sequence. DNA sequencing was performed as described. A consensus sequence from the three clones was made to correct for any Taq polymerase incorporation errors. The 18S rDNA primers (Table) were used as sequencing primers.
The R. seeberi 18S rDNA sequence was aligned by using the automated aligner of the ARB software package. Ambiguously and incorrectly aligned positions were manually aligned on the basis of the conserved primary sequence and secondary structure. The phylogenetic relationship of R. seeberi to other eukaryotes was inferred from 1,350 unambiguously aligned (masked) positions with a maximum-likelihood algorithm[11,12], on the basis of a previously aligned dataset of the DRIPs clade (named after the organisms Dermocystidium, the Rosette agent, Ichthyophonus, and Psorospermium). The dataset was used to empirically determine nucleotide frequencies and instantaneous substitution rates with the restriction of a 2:1 transition to transversion ratio. The organisms used in our tree and the accession numbers for their small subunit rRNA sequences include Artemia salina (X01723), Xenopus laevis (X04025), Mytilus edulis (L24489), Tripedalia cystophora (L10829), Microciona prolifera (L10825), Diaphanoeca grandis (L10824), Rosette agent (L29455), R. seeberi (AF158369), Dermocystidium species (U21336), Dermocystidium salmonis (U21337), Psorospermium haeckelii (U33180), Ichthyophonus hoferi (D14358), Aspergillus fumagatus (M60300), Chytridium confervae (M59758), Mucor racemosus (X54863), Acanthamoeba castellanii (U07413), Zamia pumila (M20017), Porphyra spiralis (L26177), Lagenidium giganteum (X54266), Labyrinthuloides minuta (L27634), Perkinsus marinus (X75762), Sarcocystis muris (M64244). The tree topology was confirmed by using a neighbor-joining algorithm with Jukes-Cantor corrected distance values and a maximum-parsimony algorithm (ARB). The nucleotide sequence for the partial 18S rRNA gene of R. seeberi has been deposited in GenBank (accession number AF158369).
Fluorescence in Situ Hybridization (FISH)
Tissue sections on slides were dewaxed by immersion in 99% octane (Sigma, St. Louis, MO). Samples subjected to FISH included R. seeberi-infected human nasal polyps, C. immitis-infected bone, a Rosette agent-infected cell line, and smears of C. albicans. The Rhinosporidium probe was based on the Rhino-rev 18S rDNA primer and was biotinylated at both the 5' and 3' ends (Table). The control probe, which consisted of the complement of the Rhinosporidium probe, was also biotinylated at both ends. To each slide, 50 ng of biotinylated probe in 30 µL of hybridization buffer was added. Cover slips were placed, and the slides were incubated at 40°C overnight in a humid chamber. The hybridization buffer consisted of 10% dextran, 0.2% bovine serum albumin, and 0.01% polyadenosine, in 5X SET buffer; the 25X SET buffer consisted of 3.75M sodium chloride, 25 mM EDTA, and 0.5M Tris at pH 7.8. Cover slips were removed by immersion in 5X SET buffer at 4°C, and the slides were washed for 10 minutes per cycle, twice in 0.2X SET buffer at 25°C and once at 40°C. The slides were then subjected to tyramide signal amplification according to the manufacturer's instructions (TSA indirect, NEN Life Sciences, Boston, MA). Cy5-streptavidin (Amersham, Piscataway, NJ) at 1 mg/mL was diluted 1:500 and added to the slides for fluorescence signal detection. Tissue sections were visualized on a Bio Rad confocal microscope at 200X magnification after the application of 15-20µL of Vectashield mountant (Sigma) and a cover slip.
A portion of formalin-fixed, paraffin-embedded nasal polyp from a patient with rhinosporidiosis was removed from the block, dewaxed with xylene, rehydrated with ethanol, post-stained with 1.5% osmium tetroxide, then dehydrated with ethanol, transferred to propylene oxide followed by Epon 12 resin, heat-catalyzed at 65°C, and ultrasectioned at 50 nm. The grid-mounted sections were then serially stained with lead hydroxide and uranyl acetate and examined with a Phillips 201 electron microscope at 75KV.
Phylogenetic Classification of R. seeberi Inferred from the 18S rRNA Gene
Consensus PCR of the 18S rRNA gene with DNA from a digest of an R. seeberi-infected canine nasal polyp produced amplification products of the expected size visible on gel electrophoresis (primer pairs F1-fw/F2-rev = ~500 bp and F1-fw/F3-rev = ~1000 bp) (data not shown). No amplification product was detected by using control tissue and reagents. On the basis of the initial phylogenetic assessment of these sequences, primers Dermo-fw and Dermo-rev were designed for amplification of a more complete portion of the R. seeberi 18S rRNA gene. Our phylogenetic analysis of this gene suggests that R. seeberi is a member of the DRIPs clade of aquatic protistan parasites (Figure 2). The nearest evolutionary neighbors of R. seeberi for which a sequence is available are members of the Dermocystidium genus, which infect salmon and trout.
Figure 2A, 2B. Phylogeny of Rhinosporidium seeberi and the DRIPs clade of protists (Ichthyosporea). A. Phylogenetic tree inferred from the 18S rDNA sequences of R. seeberi and other selected eukaryotes by using a maximum likelihood algorithm; 1,350 masked positions were used for analysis. Bootstrap values were generated from 100 resamplings. The bar, which represents 0.1 base changes per nucleotide position, is a measure of evolutionary distance. B. Phylogenetic tree using the data from A, but with pruning and grouping to show the broader evolutionary position of the DRIPs clade.
Development and Use of a Rhinosporidium-Specific PCR Assay
A PCR assay specific for R. seeberi was developed. Primers were created by aligning 18S rDNA sequences from R. seeberi, members of the DRIPs clade, Saccharomyces cerevisiae, and humans. The Rhinosporidium primers (Rhino-fw, Rhino-rev) each have three nucleotide mismatches with the sequences from the nearest phylogenetic relatives in the Dermocystidium genus and multiple other mismatches with fungal and human 18S rDNA sequences. An assay sensitivity of 1-10 gene copies was demonstrated by using a dilution series of cloned R. seeberi 18S rDNA. The specificity of the assay was assessed with DNA from human lymphocytes, S. cerevisiae, D. salmonis, and the Rosette agent. No amplification was detected when these DNA samples were used in the specific PCR assay, although product was amplified from these samples with either ß-globin primers (lymphocytes) or broad-range 18S rDNA primers (F1-fw/F2-rev) (Table).
The original DNA sample from the infected canine nasal polyp yielded a product of the expected size with the Rhinosporidium-specific PCR assay (Figure 3). Purified DNA from the tissue blocks of human nasal polyps resected from three patients with rhinosporidiosis also yielded positive results in this PCR assay, with visible bands seen on gel electrophoresis (RS 1-3) (Figure 3). Direct sequencing of these PCR products demonstrated complete identity over the 377 bp with the cloned sequence from the canine polyp. DNA samples from 23 nasal polyp specimens resected from 12 patients without rhinosporidiosis were subjected to both Rhinosporidium-specific and ß-globin PCR assays. These uninfected polyps failed to yield visible amplicons after gel electrophoresis of the Rhinosporidium-specific PCR reactions (data not shown). However, all these samples yielded visible amplification products after ß-globin PCR, demonstrating that amplifiable DNA was present, without substantial PCR inhibition. These results confirmed that the presence of the putative R. seeberi 18S rDNA sequence correlated with the presence of disease (rhinosporidiosis).
Figure 3. Agarose gel electrophoresis of Rhinosporidium-specific PCR products. The specific amplification product is 377 bp. No amplification product is seen in the negative control samples consisting of water (reagent-only control), digestion buffer (DB), or lymph node tissue control (Tis Cnt). The human rhinosporidiosis samples (RS1-3) and the original canine nasal polyp show visible amplification products.
Fluorescence in Situ Hybridization
We sought to determine by using FISH if the R. seeberi 18S rDNA sequence was linked to visible pathology in tissue. The Rhinosporidium 18S rRNA probe but not the control probe bound to R. seeberi organisms in tissue, providing further evidence that the putative R. seeberi 18S rRNA sequence is present in R. seeberi organisms (Figure 4). To test the specificity of the hybridization, smears of the fungus C. albicans, cells infected with the Rosette agent, and tissue sections of C. immitis were subjected to FISH. No specific hybridization to these organisms was detected by using the Rhinosporidium 18S rRNA probe compared with the control probe (data not shown).
Figure 4A, 4B, 4C, 4D. An oligonucleotide probe complementary to a unique region of the Rhinosporidium seeberi 18S rRNA sequence localizes to visible organisms in human nasal tissue by using fluorescence in situ hybridization. Confocal micrographs at 200X magnification. The Cy-5-labeled Rhinosporidium probe (blue) hybridizes to spherical R. seeberi trophocytes (A) and a sporangium with endospores (B). A control probe consisting of the complement of the Rhinosporidium probe labeled with Cy-5 does not hybridize to the trophocytes (C) or a sporangium with endospores (D). Images were collected in two wave-length channels: the first for Texas Red (red) or FITC (green) displays tissue architecture through autofluorescence, and the second channel for Cy-5 (blue pseudocolor) displays the probe signal.
Transmission electron micrographs were taken of R. seeberi trophocytes in a human nasal polyp. Multiple mitochondria were visualized, showing that the cristae had tubulovesicular morphology (Figure 5), unlike the flat cristae found in fungi.
Figure 5. Transmission electron micrograph of a mitochondrion from Rhinosporidium seeberi. The cristae of this mitochondrion (arrows) have tubulovesicular morphology. Magnification 195,000X.
In the 1890s, first Malbran and then Seeber described an apparent sporozoan parasite in nasal polyps from patients living in Argentina. Seeber's teacher, Wernicke, named the organism Coccidium seeberia after the protozoal subdivision Coccidia and his pupil, Guillermo Seeber. In 1923, Ashworth described the life cycle of the organism, argued that it is a fungus, and proposed the name R. seeberi. Since then, the microbe has been considered a fungus by most microbiologists, although its taxonomy has been debated[1,2,16]. Using a consensus PCR approach, we amplified a unique 18S rDNA sequence from a canine nasal polyp infected with R. seeberi. To prove that this unique 18S rDNA sequence came from R. seeberi, we sought to fulfill sequence-based guidelines for microbial disease causation, since Koch's postulates cannot be fulfilled for uncultivated microbes. Using a Rhinosporidium-specific PCR assay, we showed that the unique rDNA sequence present in the canine polyp was also present in three human polyp samples from patients with rhinosporidiosis. We showed the specificity of this association by demonstrating that this rDNA sequence was not present in control nasal polyps from 12 patients without rhinosporidiosis. We also used FISH to link the putative R. seeberi 18S rRNA sequence to organisms visible in tissue. Although the Rhinosporidium probe localized to R. seeberi organisms in tissue using FISH, the probe did not localize to two fungal organisms or another member of the DRIPs clade (Rosette agent), suggesting some specificity to the hybridization.
Sequence-based data also provide support for a causal relationship when a microbial genotype (e.g., phylogenetic placement) correctly predicts microbial phenotype and host response. In other words, the nature of the pathogen inferred from phylogenetic analysis of its nucleic acid sequence should be consistent with the known biologic characteristics of closely related microbes and with the nature of the disease. Therefore, the nearest phylogenetic neighbors to R. seeberi could be predicted to have similarities in morphology, tissue histology, and pathogenesis. D. salmonis, the closest known relative to R. seeberi, has a large spherical structure containing endospore-like daughter cells. Histology of infected hosts shows gill inflammation and epithelial hyperplasia. The resemblance between R. seeberi and fish pathogens has been noted before. In 1960, Satyanarayana wrote in his review of 255 cases of rhinosporidiosis that since R. seeberi has a morphology similar to those of some fish parasites, it "..may also be a parasite or saprophyte of fish and that man, equines, and cattle obtain the infection through water in which fish harbouring the parasite live."
A recent independent report based on amplification of 18S rDNA from two human rhinosporidiosis tissue samples also concludes that R. seeberi is a member of the DRIPs clade of microbes. Our data support this conclusion and provide more evidence for a causal relationship. In addition, we describe a Rhinosporidium-specific PCR assay that can be used for detecting this organism in clinical and environmental samples. Our 18S rDNA sequence differs from the sequence determined by these investigators (GenBank AF118851) at a single position out of 1,699 common bases. We excluded from analysis sequence derived from our PCR primers, as amplicons will contain the primer sequences regardless of the target sequence as long as there is partial annealing during PCR, leading to potentially spurious conclusions about sequence in these regions. The 18S rDNA sequence of R. seeberi determined by this group includes the primer sequences.
Although we describe early trophocytes with mitochondrial cristae having vesicular ultrastructure, other investigators have found sporangia with mitochondrial cristae having a flat ultrastructure. The different mitochondrial morphologies observed may be due to differences in developmental stage of the organism or in methods of tissue preparation for electron microscopy. Nevertheless, another member of the DRIPs clade, Ichthyophonus hoferi, has vesicular mitochondrial cristae. Classic fungi (Eumycota) have flat mitochondrial cristae.
Knowledge of the molecular phylogeny of R. seeberi is more than an exercise in taxonomy. For organisms such as R. seeberi, which are difficult to grow in the laboratory, phylogenetic analysis provides some insight into the characteristics of the organism that can be used to further our understanding of disease pathogenesis and epidemiology, as well as to improve diagnosis and treatment. Knowing that R. seeberi is a member of the DRIPs clade of microbes allows hypotheses to be generated about how it causes human disease by analogy, drawing on the knowledge and experience of the veterinary sciences. The separate but linked observations that rhinosporidiosis in humans is associated with exposure to water and that R. seeberi belongs to a clade of aquatic parasites lead to a testable hypothesis: the natural hosts of R. seeberi are fish or other aquatic animals, and humans acquire infection when they come into contact with water containing these fish and their parasites. Investigators should therefore look for evidence of infection in fish in ponds and rivers in disease-endemic areas. From a public health perspective, the R. seeberi-specific PCR assay can be used to study environmental sources of infection (e.g., specific bodies of water) and may provide a means of preventing disease through identification of infected water.
Conversely, knowing that R. seeberi is a member of the DRIPs clade may help us understand this important, distinct group of microbes that appear to form the deepest branch in the animal lineage. R. seeberi is a member of a newly recognized group of human and animal pathogens; the name Ichthyosporea has been proposed for this expanding taxon of microbes. Little information is available about these organisms and how they cause disease. We hope that collaborations between researchers in human and animal medicine will correct this deficiency.
Multiple antimicrobials, including antifungal agents, have been used in the treatment of rhinosporidiosis, based on the belief that R. seeberi is a fungus. However, no antimicrobial agent is clearly effective. The medical treatment of rhinosporidiosis may be improved through screening antiparasitic drugs for an effect on disease in Dermocystidium-infected fish or infected cell lines.
In conclusion, phylogenetic analysis of the R. seeberi 18S rRNA gene suggests that this culture-resistant organism is not a member of the Eumycota, but rather is the first known human pathogen from a novel clade of aquatic protistan parasites that form a branch in the evolutionary tree near the animal-fungal divergence. R. seeberi-specific PCR and FISH confirm the association of this unique 18S rDNA sequence with the presence of rhinosporidiosis. This knowledge can be used to further our understanding of the natural reservoir of this organism and the risk factors, pathogenesis, and treatment of this disease. This discovery also expands our appreciation of the diversity among eukaryotic organisms that are pathogenic to humans and highlights the limitations of basing phylogenetic classification on morphology alone.
We thank Josh Fierer and Jesus Gonzales for providing human Rhinosporidium tissue blocks, Mike Levy for the canine nasal polyp used for consensus PCR, Kristin Arkush for the Dermocystidium salmonis and Rosette agent DNA, and Robin Gutell for the mask used for phylogenetic analysis of the DRIPs clade. Bob Metzenberg, Sara Fulz, Larry Mirels, and the staff of the clinical microbiology laboratories at Stanford and the Palo Alto VA hospitals supplied fungal isolates for testing broad-range 18S rDNA primers.
Table. Polymerase chain reaction primers, sequencing primers, and fluorescence in situ hybridization probes
Primer/Probe Nucleotide sequence (5'->3') SSU rRNA Positiona
F1-fwb CAAGTCTGGTGCCAGCAGCC 554-573
F2-revc GATTTCTCGTAAGGTGCCGA 1068-1087
F3-rev AATGCTCTATCCCCAMCACG 1531-1550
Rhino FISH probe BTGCTGATAGAGTCATTGAATTAACATCTACB
Control FISH probe BACGACTATCTCAGTAACTTAATTGTAGATGB
a SSU rRNA position based on S. cerevisiae 18S rRNA (GenBank JO1353).
b fw = forward primer.
c rev = reverse primer.
Satyanarayana C. Rhinosporidiosis with a record of 255 cases. Acta Oto-Laryng 1960;51:348-66.
Kwon-Chung KJ, Bennett JE. Rhinosporidiosis. In: Medical mycology. Philadelphia: Lea & Febiger; 1992. p. 695-706.
Moses JS, Shanmugham A. Epidemiological survey of rhinosporidiosis in man--a sample survey in a high school located in a hyperendemic area. Indian Vet J 1987;64:34-8.
Gaines JJ, Clay JR, Chandler FW, Powell ME, Sheffield PA, Keller A. Rhinosporidiosis: three domestic cases. South Med J 1996;89:65-7.
Kennedy FA, Buggage RR, Ajello L. Rhinosporidiosis: a description of an unprecedented outbreak in captive swans (Cygnus spp.) and a proposal for revision of the ontogenic nomenclature of Rhinosporidium seeberi. J Med Vet Mycol 1995;33:157-65.
Levy MG, Meuten DJ, Breitschwerdt EB. Cultivation of Rhinosporidium seeberi in vitro: interaction with epithelial cells. Science 1986;234:474-6.
Relman DA, Schmidt TM, MacDermott RP, Falkow S. Identification of the uncultured bacillus of Whipple's disease. N Engl J Med 1992; 327:293-301.
Pace NR. A molecular view of microbial diversity in the biosphere. Science 1997;276:734-40.
Fredricks DN, Relman DA. Paraffin removal from tissue sections for digestion and PCR analysis. Biotechniques 1999;26:198-200.
Fredricks DN, Relman DA. Improved amplification of microbial DNA from blood cultures by removal of the PCR inhibitor sodium polyanetholesulfonate. J Clin Microbiol 1998;36:2810-6.
Olsen GJ, Matsuda H, Hagstrom R, Overbeek R. fastDNAmL: a tool for construction of phylogenetic trees of DNA sequences using maximum likelihood. Comput Appl Biosci 1994;10:41-8.
Felsenstein J. Evolutionary trees from DNA sequences: a maximum likelihood approach. J Mol Evol 1981;17:368-76.
Ragan MA, Goggin CL, Cawthorn RJ, Cerenius L, Jamieson AV, Plourde SM, et al. A novel clade of protistan parasites near the animal-fungal divergence. Proc Natl Acad Sci U S A 1996;93:11907-12.
Seeber G. Un nuevo esporozuario parasito del hombre: dos casos encontrados en polipos nasales. Thesis, Universidad Nacional de Buenos Aires, 1900.
Ashworth JH. On Rhinosporidium seeberi with special reference to its sporulation and affinities. Trans R Soc Edinburgh 1923;53:302-42.
Kwon-Chung KJ. Phylogenetic spectrum of fungi that are pathogenic to humans. Clin Infect Dis 1994;19 Suppl 1:S1-7.
Fredricks DN, Relman DA. Sequence-based identification of microbial pathogens: a reconsideration of Koch's postulates. Clin Microbiol Rev 1996;9:18-33.
Olson RE, Dungan CF, Holt RA. Water-borne transmission of Dermocystidium salmonis in the laboratory. Dis Aquat Org 1991;12:41-8.
Herr RA, Ajello L, Taylor JW, Arseculeratne SN, Mendoza L. Phylogenetic analysis of Rhinosporidium seeberi's 18S small-subunit ribosomal DNA groups this pathogen among members of the protoctistan Mesomycetozoa clade. J Clin Microbiol 1999;37:2750-4.
Cavalier-Smith T. Neomonada and the origin of animals and fungi. In: Coombs G, Vickerman K, Sleigh M, Warren A, editors. Evolutionary relationships among protozoa. London: Chapman and Hall; 1998. p. 375-407.
This study was supported by grants from the National Institutes of Health (K11-AI01360 D.N.F.) and the Donald B. and Delia B. Baxter Foundation (D.A.R).
Dr. Fredricks is a research associate in the Division of Infectious Diseases, Stanford University. He studies the use of nucleic acid sequences to detect and identify microbial pathogens, including those that are novel or uncultivated. Address for correspondence: David N. Fredricks, Veterans Affairs, Palo Alto Health Care System, 154-T, 3801 Miranda Ave, Palo Alto, CA 94304, USA; fax: 650-852-3291; e-mail: [email protected].
Great links, Al. Nice follow up to Tamtam's post.
Very interesting material, which leaves me curious as to whether anyone has had close contact with fish; i.e. aquariums or preparing fresh fish for consumption?
Personally, I owned and operated a large pet store for 5 years before contacting this "disease". The store specialized in aquarium fish, mainly marine fish. My husband, at that time, developed Hepatitis from contaminated water containing snails. Plus one employee was hospitalized after his arm became infected while cleaning various customer's aquariums.
At that time, I had a 240 gallon marine tank at my home, along with a 110 gallon brackish tank. Although my husband helped with the major water changes, I was the one who did the regular maintenance and feeding which included live tubifex worms which smelled terrible.
Anyway, I sold my tanks soon after I began getting ill, since I had gotten a divorce and they were too much work for me to do alone. However, now I am wondering if there is some relevancy to my current condition. So if anyone has had close contact now, or in the past, with fish please post it for reference.
I realize there is probably nothing to this fish thing, but I can't help but continue searching for answers. . .
anyone know where Deena and Skytroll hauled off to? Hey you two, we miss you, please check in....it's the least you could do...worried about you guys here......
Look what I got for Christmas....
and this is on my Santa's list for next year.....
http://astore.amazon.com/solgelgateway/ ... 32-6403031
MSC, wanna read it??
Who is online
Users browsing this forum: No registered users and 2 guests | <urn:uuid:b54d6d3c-2143-4b07-879f-48bdbb0ed508> | CC-MAIN-2016-26 | http://www.biology-online.org/biology-forum/about1958-5868.html?hilit=Maim | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396455.95/warc/CC-MAIN-20160624154956-00125-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.906899 | 9,389 | 3.296875 | 3 |
Briefly to history:
The procedure of distillation was already the old Egyptians well-known.
The Arabs took over the knowledge. In the Arab one see the word al ko hul for particularly fine, pure!
During the crusades the knowledge arrived to Europe. In the monasteries the distilled alcohol for welfare purposes was used and
was the exclusive monopoly of the church. Later it became also privilege of physicians, pharmacists and Alchemisten, who the
production of the alcohol, also Branntwein mentioned, improved.
In 16. Century carried out
itself the transformation of the medicament to the daily beverage. Only by flaemische farmers, refugees, who received freedom of trade and
faith liberty from the cure prince from Brandenburg, the knowledge of distilling alcohol in broad sets became well-known and
Thus the monopoly of the monasteries, physicians and pharmacists was broken. With that dreissigjaehrigem war rose the
requirement and the production of the
Branntweins = fire-water =. Spirits =
Brandy etc. The war gentlemen had detected and gave the drug Branntwein these to the mercenaries and soldiers before the battles.
Afterwards one forbade the benefit of Branntwein under menace of punishment.
“well-being of the health of the people” ?
After the authority had detected that with the Branntwein cash is to be earned,
the state invented the Branntwein or alcohol control.
Today the state possesses the monopoly on Branntwein: “well-being of the health of the people”?
Without permission of the customs office one may not burn today no more.
For high-speed search to the directory, click on the word!
activated carbon for alcohol
alcohol = ethanol = Trinkbranntwein = fire-water
alcoholmeter , alcometer, spirit tester
basic knowledge of the distiller
distiller’s treasure trove
drinking strength or diluting
history of making alcohol
mash making with fruits
mash made with sugar
optimeter, optical saccharimeter | <urn:uuid:d162d60e-91cd-4653-8110-c52e43eae595> | CC-MAIN-2016-26 | http://www.distilling.net/distilling.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398516.82/warc/CC-MAIN-20160624154958-00063-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.882214 | 455 | 2.640625 | 3 |
Visit our sister site, BirdSong Nature Shop, for great prices on thousands of backyard birding items:
Courtesy G. Lumis
The seed is the part of the plant that contains the germ of life that has the capacity to grow into another plant like the one from which it came. Although differing in size and shape, all seeds contain small leaves and the beginning of a trunk and root. Another thing all seeds have in common is the need for heat and moisture to begin the 'sprouting' process.
For a time the young tree will live on nourishment enclosed in the seed coating, but soon the root will reach down into the ground and the leaves will expand into the air and from that time on the young 'seedling' makes its own food from the materials it finds.
In order to grow, seedlings must have water, heat, light and air. In nature seeds fall from the ripened trees laying on the forest floor until they begin to sprout. Commercially, the forester will collect these tree seeds and transport them to nurseries where they are planted and tended in seedbeds. Two years later these 'seedlings' are then taken from the seedbeds and planted into fields called transplant beds. They are allowed to stay there from one to three years before finally being set out in rows to form a plantation, where they will eventually grow to maturity. | <urn:uuid:5aa2bcff-eff9-4f7c-99a7-07dfa37d0b35> | CC-MAIN-2016-26 | http://www.treehelp.com/seeds-1/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398209.20/warc/CC-MAIN-20160624154958-00066-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.962424 | 283 | 3.859375 | 4 |
Photo Courtesy of Hergé MuseumThe Hergé Museum, located near Brussels, Belgium, celebrates artist Georges Remi (pen name Hergé) who was the creator behind the Tintin comic adventures. Although the idea to create a museum dedicated to the enigmatic artist and his work had been talked about for many years, it wasn’t until January of 2001 that definite plans to build the Hergé Museum began to take shape. With the help of the Hergé Foundation and architect Christian de Portzamparc, the museum opened in 2009 in Louvain-la-Neuve, Belgium.
With the Tintin comics, Hergé pioneered the ligne claire style of drawing, characterized by strong lines, bold colors, and limited contrast. His comics first began captivating audiences when he began working for the Belgian newspaper Le Vingtieme Siecle drawing cartoons for the children’s section. Tintin made his first appearance in 1929 after which he became an nearly overnight success in the artist’s home country as well as internationally.
Pritzker Prize-winning French architect Christian de Portzamparc took the job of honoring one of the world’s most iconic comic artists, integrating Hergé’s recognizable style into the foundation of the museum’s structure. The Hergé Museum contains more than 80 drawing, 800 photographs, and a menagerie of other objects and documents that honor the colorful world of Georges Remi.
To learn more visit MuseeHerge.com. | <urn:uuid:be2c89e2-88d4-4a34-bf29-fe915a4f9eac> | CC-MAIN-2016-26 | http://www.justluxe.com/lifestyle/arts/feature-1783951.php | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397744.64/warc/CC-MAIN-20160624154957-00086-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.945825 | 320 | 2.640625 | 3 |
THE RED MAN OF TO-DA Y.
ligence. They live in a style superior to that of the white settlers by whom they are surrounded. They are dressed in fashionable clothing, and understand not merely the comforts but the luxuries of civilized life. Their sons are sent east to be educated in the leading colleges, and their daughters sometimes reveal the work of the young ladies' finishing school. A lady from Fort Scott, Kansas, told the writer of a public banquet and ball tendered by the citizens of the place to an excursion of leading Creeks from the territory. The visitors wore full dress, and danced with an ease and elegance which the young men of Fort Scott hardly rivaled. They were courteous and accomplished, polished in manners and easy in conversation. Their dark skin and black hair and eyes gave them the appearance of distinguished foreigners, an illusion materially assisted by their accent.
Next to these civilized Indians come the semi-civilized. Unlike the former, these have not arrived at their present condition through intercourse with the whites. The Pueblos of New Mexico have considerable knowledge of the mechanic arts. They built houses, constructed irrigating canals, dug cisterns, planted trees, raised crops of grain, vegetables, and fruits, made pottery, wove cloth and blankets, long before the white invaders began to trouble them. Next to the Pueblos rank the Nava-joes, followed at a still greater distance by certain bands of the Apaches, whose home is in the mountains. Indeed, we have already passed the line of semi-civilization, and find ourselves among the genuine "wild Indians," to whom belong four-fifths of all living red men. Some of these we have already met. There are the Ojibwas in the north, around Lake Superior, the Sioux, Arrapahoes, and Cheyennes, known generally as the " Plains Indians," the Comanches and Kiowas of Texas, and the Digger Indians of California and the western coast. The latter are the lowest of all the tribes. The name is given promiscuously to the Utes, Shoshones, and others, who live on snakes, lizards, grasshoppers, and such roots as they can " dig," | <urn:uuid:26227757-37d1-4119-9b4a-7390f65736bc> | CC-MAIN-2016-26 | http://exploreuk.uky.edu/catalog/xt74mw289b35_995/text | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395346.6/warc/CC-MAIN-20160624154955-00100-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.970204 | 464 | 2.96875 | 3 |
Synopsis of the Books of the Bible, by John Nelson Darby, [1857-62], at sacred-texts.com
Introduction to Mark
The Gospel according to Mark has a character that differs in certain respects from all the others. Each Gospel, as we have seen, has its own character; each is occupied with the Person of the Lord in a different point of view: as a divine Person, the Son of God; as the Son of man; as the Son of David, the Messiah presented to the Jews, Emmanuel. But Mark is occupied with none of these titles. It is the Servant we find here and, in particular, His service as bearing the word the active service of Christ in the gospel. The glory of His divine Person shews itself, it is true, in a remarkable manner through His service, and, as it were, in spite of Himself, so that He avoids its consequences. But still service is the subject of the book. Doubtless, we shall find the character of His teaching developing itself (and truth consequently shaking off the Jewish forms under which it had been held), as well as the account of His death, on which all depended for the establishment of faith. But that which distinguishes this Gospel is the character of service and of Servant that is attached to the life of Jesus the work that He came to accomplish personally as living on the earth. On this account, the history of His birth is not found in Mark. It opens with the announcement of the beginning of the gospel. John the Baptist is the herald, the forerunner, of Him who brought this good news to man. | <urn:uuid:d55d2492-9ed2-430b-8212-c64369808b95> | CC-MAIN-2016-26 | http://sacred-texts.com/bib/cmt/darby/mar000.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402479.21/warc/CC-MAIN-20160624155002-00031-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.973108 | 332 | 2.8125 | 3 |
Associated with health and rebirth, some scholars even place the pomegranate in the
Garden of Eden, instead of an apple.
What it is: A fruit about the size of an orange that is grown on a bush in arid areas. (The name pomegranate derives from French, pomme garnete, literally meaning “seeded apple.” The pomegranate’s botanical name, Punica Granatum, translates as “apple with many seeds.”)
Where it comes from: The fruit has been widely cultivated through the Mediterranean and the Middle East. History credits Spanish padres with bringing pomegranates to California more than 200 years ago. Now California’s San Joaquin Valley is the heart of the United States’ commercial crops.
Properties: A seasonal fruit (available August through December), the outer shell of the pomegranate is typically yellow, turning a rich red color as it matures. Inside this inedible husk are membranous walls and white, bitter tissue that surround juicy seed kernels. The ruby-colored fruit we refer to as seeds are called arils. Each aril is a sac of juice that surrounds a seed. (The flavor of pomegranate juice is usually sweet with a hint of tartness.)
What it’s good for: Pomegranates are now being touted as one of the hot new “super foods” that both taste good and are good for you. High in vitamin C and potassium, pomegranate juice is a good source of fiber and it’s also low in calories. The juice is high in three different types of polyphenols (tannins, anthocyanins, and ellagic acid), a potent form of antioxidants. As antioxidants, they are credited with helping in the prevention of cancer and heart disease. The powerful antioxidants in the fruit also help retard aging and can neutralize almost twice as many free radicals as red wine and seven times as many as green tea.
Where you’ll find it: Cocktails and gourmet food preparations. Pomegranate extract is often used in both topical and oral skin care products as well.
Other uses: In addition to many medicinal purposes, pomegranate flowers are used to make a red dye. Pomegranate is used in traditional Jewish ceremonials as a symbol of fertility and prosperity. Pomegranate juice is used for the production of grenadine. | <urn:uuid:97187cd3-8ee0-4e69-b6c2-49d00ca6afdf> | CC-MAIN-2016-26 | http://www.nailsmag.com/article/81956/secret-ingredient-pomegranate | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397748.48/warc/CC-MAIN-20160624154957-00083-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.947865 | 517 | 2.875 | 3 |
1968 In both Europe and America Japanese imported
cars and other goods were continuing to rise and trouble the governments
of UK and USA as they worried about industries in their own countries
being effected and jobs lost. In the spring of 1968 The Rev Martin Luther
King was assassinated and Robert Kennedy was mortally wounded also the
peace movement had continued to grow and more and more Americans were
against the war in Vietnam, and once again more riots occurred throughout
cities in America. The music scene was once again set by the "Beatles"
and the "Rolling Stones" , and fashion flirted with see through
blouses and midis and maxis skirts joined the Mini Skirt as part of the
fashion trends. There is a Flu Pandemic in Hong Kong and the first Black
power salute is seen on Television worldwide during an Olympics medal
Cost of Living 1968
How Much things cost in 1968
Yearly Inflation Rate USA 4.27%
Year End Close Dow Jones Industrial Average 943
Average Cost of new house $14,950.00
Average Income per year $7,850.00
Average Monthly Rent $130.00
Gas per Gallon 34 cents
Average Cost of a new car $2,822.00
Movie Ticket $1.50
What Events Happened in 1968
War protests throughout the western world
North Vietnam and Viet Cong troops launch
the Tet offensive
Assassination of Martin Luther King Jr.
Leader of Negro Civil Rights Movement is killed by James Earl Ray which
leads to Violence and Race Riots in US Cities
Following the Assassination of Martin Luther
King Jr. President Lyndon Johnson signed the Civil Rights Act of
RMS Queen Elizabeth - retired from service
Senator Robert Kennedy is assassinated
at the Ambassador Hotel in Los Angeles
Earthquake in Sicily - 231 dead, 262 injured.
Enoch Powell's delivers his "Rivers of
Blood" anti immigration speech
The Third Heart transplant is performed in
South Africa By Dr Christian N Barnard
London Bridge sold for 1 million. and
later re-erected in Arizona.
President Johnson announces on nationwide
television he would not run for another term of office
50,000 people participated in " The Poor
Peoples March " on Washington, D.C.
Population in Europe reaches 455 million (
excluding USSR )
The Kray twins, arrested for the murders of
George Cornell and Jack 'The Hat' McVitie, members of the London underworld.
Televisions installed increases 25 million
US , 20.5 million Japan , 19 million Great Britain
Alec Rose completes his single-handed 354-day
Pierre Elliott Trudeau becomes the Prime Minister
Student Occupation at Columbia University
over Universities affiliation with the Institute for Defense Analyse
Aristotle Onassis and Jacqueline Kennedy marry
The Ferry "TEV Wahine" capsizes
in Wellington Harbour, New Zealand
Hong Kong Flu pandemic begins in Hong Kong.
Black power salute is seen on Television worldwide
after the gold and bronze medalists in Olympics show salute during medal
ceremony in Mexico City, Mexico
The Prague Spring in Czechoslovakia was to
provide political liberalization but was crushed by Warsaw Pact countries
The Soviet Union invades Czechoslovakia and
arrests President Dubcek "Prague Spring"
The Aswan Dam in Egypt is completed
The Gateway Arch in St. Louis is dedicated
Equatorial Gunea Gains Independence From Spain
The Winter Olympic Games are held in Grenoble,
800,000 teachers, workers and student
protesters marched through the French capital during a one day general
Popular Culture 1968
The first Big Mac goes on sale in McDonalds
Guess Who's Coming to Dinner
Bonnie and Clyde
Valley of the Dolls
The Odd Couple
Planet of the Apes
The Rolling Stones
The Beatles with " Hey Jude "
Gary Puckett and The Union Gap
The Grateful Dead
Simon and Garfunkel " Mrs Robinson "
The Beach Boys
The Bee Gees
The Jimi Hendrix Experience
The Doors " Hello I Love You "
Bobby Goldsboro " Honey "
Marvin Gaye " I heard it through the
Boeing 747 made
its maiden flight.
NASA launches Apollo 7, the first manned Apollo
Apollo 8 orbits the Moon, becoming the first
manned space mission to achieve the feat.
Dr. Christian Barnard performs the first successful
US Explodes experimental hydrogen Bomb.
The Emergency 911 Telephone service
is started in the USA which provides a single number for reporting emergencies
and is manned 24 hrs per day 365 days per year
ATM First Philadelphia Bank installs the first automated teller machine
in the U.S. | <urn:uuid:cf5d2be1-0fa0-4d73-9fb8-aa38f1dc5055> | CC-MAIN-2016-26 | http://www.blueislanddde1968.com/class_history.cfm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396027.60/warc/CC-MAIN-20160624154956-00015-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.889546 | 1,002 | 2.53125 | 3 |
Using ‘Science’ to Push a Political Agenda
28 November 2006
The University of Oslo’s Natural Museum of History, in Norway, has opened a new exhibit called ‘Against Nature?’ The museum exhibit is aimed at providing scientific justification for homosexuality in both the animal world and humanity. Geir Soli, project leader, stated ‘The argument that a homosexual way of living cannot be accepted because it is against the “laws of nature” can now be rejected scientifically.’1 It certainly sounds scientific, but what’s the real story?
Science is always dependent on one’s starting points. Every scientist begins his/her investigation of the evidence through a particular lens. In the case of the museum exhibit ‘Against Nature?’, zoologist Petter Bockman revealed, ‘There is a political motive.’ Surprise, surprise. The museum says one of its aims is to ‘demystify homosexuality among people … we hope to reject the all too well-known argument that homosexual behavior is a crime against nature.’ So in fact, the Natural Museum of History in Oslo, Norway, is not just concerned about the scientific evidence. It is openly promoting homosexuality to the public. Science is being used to promote a particular philosophical worldview agenda.
The Oslo museum promotes a very specific worldview. It is a worldview that now dominates Western Europe and is becoming more potent in the United States. It is a worldview in which human beings are just highly evolved animals. Humans are merely advanced apes that evolved from simple chemicals over 4.5 billion years. We are not special creations, and we are not bound to any moral law. Moral truth is relative and simply dictated by biological operations. Such a worldview has come to thrive under the umbrella of Darwinian evolution. Museums, zoos, newspapers, magazines, public schools, and even many churches openly espouse evolution. However, this worldview is in direct conflict with biblical Christianity. A straightforward reading of the Bible teaches us that mankind is not simply a highly evolved animal. We were specially created in the image of God. The Bible teaches us that God instituted moral laws which we are to obey out of love and obedience to our Creator and fellow man (see The creation basis for morality and Bomb-building vs. the biblical foundation. And the Bible teaches that homosexuality is a sin—a perversion of both natural and moral law (see exegesis in Response to ‘gay marriage’ article objections). It thus may not be surprising that homosexuals are prone to diseases, gambling and other addictions; God made rules for our good (although health problems are a secondary argument; the primary one is what God’s Word forbids).
Homosexual Animals in Evolutionary Theory
It is true that many animals engage in homosexual behavior. It is also true that a very small percentage of human beings do as well. As Petter Bockman said, ‘Homosexuality has been observed in more than 1,500 species and the phenomenon has been well-described for 500 of them.’ In addition, the article states that a quarter of all swan families are parented by homosexual couples. However, for most scientists, homosexual behavior has been viewed as biologically deviant, since at the heart of evolution is sexual reproduction. Linda Wolfe, head of the anthropology department at East Carolina University, stated, ‘I think to some extent people don’t think it’s important because we went through all this time period in sociobiology where everything had to be tied to reproduction and reproductive success.’ Wolfe disagrees. ‘You can make up all kinds of stories: Oh it’s for dominance. It’s for this. It’s for that, but when it comes down to the bottom I think it’s just for sexual pleasure.’ This sounds much more like arbitrary opinion than scientific fact. On the other hand, there are some scientists who think that homosexuality in the animal kingdom does serve useful, evolutionary purposes. Homosexual behavior could be used for building alliances and gaining the protection of members of the same sex. And in heavily bisexual species, such as bonobos (pygmy chimpanzees, Pan paniscus), homosexual behavior may mean the difference between joining the pack and being ostracized. All of this actually creates problems for the theory of evolution. A viable scientific theory should not be making contradictory predictions. And a theory that is so flexible that it explains everything, in reality, explains nothing at all, as Philip Skell noted.
Animals in the Creation Model
|Animals also practice rape and cannibalism … is that ‘normal’ too?|
In the biblical creation model, animals and humans are distinct creations. Animals were created with mind, will, and emotion, while humans were created with mind, will, and emotion, and most importantly, a moral and spiritual capacity (see Man: The image of God). The book of Genesis also states that mankind was given dominion over the animals to care for them as good stewards of God’s creation. The empirical evidence supports the creation model. Although many animals express an array of emotions, use simple tools, solve problems, speak a few words, and mourn for their dead, they cannot match the intellectual, technological, and spiritual capacity of mankind. After all, we don’t see animals placing humans in zoos. We don’t see animals training humans to perform physical labor and mental tasks. We don’t see animals building great civilizations. We don’t see animals obeying moral laws, and we don’t see animals building churches to hear the teaching of the Gospel (or building public schools to indoctrinate young animals against the Gospel).
Justifying Homosexuality on Faulty Logic
Those who attempt to justify homosexuality in humanity by pointing to its existence in the animal kingdom have a logical problem. They argue that homosexual behaviour and relationships in animals makes it ‘right’ for the same sorts of things in humans, but animals also practice rape, wanton murder, incest, rampant theft, physical abuse, and cannibalism. By the same reasoning, therefore, we should accept and condone these sorts of things as ‘normal’ too. (See the formal logic of this reductio ad absurdum in Logic and Creation). In reality, there is a vast gulf between animals and humans, and apart from the false presumption of evolution, there is no basis for applying animal behaviour as the yardstick for humans. Our very social fabric and commonsense itself revolts against the notion of accepting rape and cannibalism as ‘natural and normal’, which is itself further confirmation of the reality that we are made in the image of God, not animals. We know that such things are wrong, regardless of what animals may or may not do (although evolutionists have a hard time justifying why they believe rape is morally wrong even though some of them claim it is in our genes—see Rape and evolution). Romans 2:15 refers to the law of God being written on our hearts.
Law and Gospel
The Bible explicitly forbids homosexual behaviour in both the Old and New Testaments. In addition, the Bible explicitly defines marriage as a man and a woman in both the Old and New Testaments (Matthew 19:3–6 citing Genesis 1:27 and 2:24). Homosexuality is a sin, plain and simple, and sin appalls a holy God. All sin grieves the Almighty, and we all stand condemned before His seat of righteous judgment (Romans 3:23). But there’s hope! The Lord Jesus Christ died for our sins according to the scriptures, and then conquered death (1 Corinthians 15:14), and when we place our trust in Him, we stand condemned no more (Romans 8:1)! Let us continue to stand on the truth of God’s Word, standing up for biblical morality and humbly exhorting those engaged in sinful lifestyles to seek forgiveness at the mercy seat of the only true God and Saviour, Jesus Christ (Titus 2:13).
- Sara Goudarzi, Homosexual Animals Out of the Closet, LiveScience.com, 16 November 2006. Return to text. | <urn:uuid:73f7b6f0-79cb-4fd1-ac9c-3e4202e653c1> | CC-MAIN-2016-26 | http://creation.com/homosexual-animals | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396224.52/warc/CC-MAIN-20160624154956-00163-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.938268 | 1,701 | 2.578125 | 3 |
Before the Hubble telescope, Victorian scientists used pencil and paper to record their observations of the stars. Their beautifully detailed drawings were the precursors of modern astronomy, and may even have inspired one of the most well-known works of Impressionist art, according to a new book.
Observing By Hand, a new book by Oxford University historian Dr Omar W Nasim, relates how these scientists used the most mundane equipment simple pencils and paper to record distant space phenomena. The book focuses on drawings of nebulae, the interstellar clouds of dust and gas where new stars are born.
'In the 18th and 19th centuries, nebulae were a very new and enigmatic phenomenon,' said Dr Nasim, a Newton International Fellow at Oxford Universitys Faculty of History and The Oxford Research Centre for the Humanities (TORCH). 'Scientists were used to observing round objects such as stars and planets, so the misty shapes of nebulae were astoundingly challenging.
'They made thousands of drawings to try and capture the shape and nature of these mysterious, ambiguous forms. They would usually work in pencil first, and later produce definitive ink drawings or prints. The physical act of drawing helped them understand the structure of these objects they observed.'
Dr Nasim believes that one drawing he studied was the inspiration behind Van Goghs painting Starry Night. The link between Van Gogh and Lord Rosse is not a new one, but Dr Nasim provides further context and insight into the connection.
Lord Rosse, an Irish aristocrat and astronomer, built the largest telescope in existence at the time, which had a mirror six feet in diameter and became known locally as the Leviathan of Parsonstown. With this instrument, he was able to observe and describe the Great Spiral, which we know today as the Whirlpool Galaxy. His engraving of 1850 was the first to define the spiral shape of the object.
Dr Nasim said: 'The Whirlpool Galaxy can clearly be seen at the centre of Van Goghs Starry Night, which seems to have been inspired by the artists knowledge of Camille Flammarion, a French writer who popularised Rosses vision. Flammarion described astronomical objects floating, as though lost in the depths of the sky, and was moved by the awe and terror they evoked even in a cold engraving.
'Van Gogh wrote of a similar sense of wonder shortly before he painted Starry Night. He paints the night sky as though newly discovered astronomical phenomena could be seen with the naked eye, expanding human imagination and perception by lending the viewer "telescopic eyes".'
Throughout the book, Dr Nasim describes a group of scientists who went to great lengths to pursue their study of the stars. John Herschel travelled as far as the Cape of Good Hope in search of clearer skies, while Wilhelm Tempel worked under poor conditions in a half-built and leaking observatory.
'Some of Tempels ideas turned out to be quite wrong, and he died in isolation but you see twentieth-century artists such as Max Ernst later paying homage to him,' said Dr Nasim.
From Observing by Hand to Observing by Light, Dr Nasim describes his next move: My next book will deal with the effect of photography, from when it arrives in the 19th century, up until the 1930s. Nineteenth-century photography of the nebulae has been described as "the only modern achievement of photography", and Ill examine that claim.'
Observing By Hand: Sketching the Nebulae in the Nineteenth Century by Omar Nasim
is available now from the University of Chicago Press. | <urn:uuid:eb4e33f7-1adb-43ac-874a-2ac6885afceb> | CC-MAIN-2016-26 | http://artdaily.com/news/72089/Victorian-scientists--drawings-of-nebulae-explored-in-new-book-by-Oxford-University-historian | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398075.47/warc/CC-MAIN-20160624154958-00170-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.966434 | 749 | 3.859375 | 4 |
BLOOD STAINS 101 the poorly marked reaction with group A serum or group B serum must be read as positive. It should be noted that dried serum retains its agglutinating property, and even though drying destroys the red Hood corpuscles it does not destroy their agglutinogens. Moreover, the group specific substances, viz. the ag- glutinogens (isogens) A and B are not confined only to the red blood cells, but are to be found also in the cells of almost all the tissues, organs and body fluids or secretions, such as saliva, nasal secretion, gastric juice, urine, vaginal secretion, semen, milk, bile, sweat, etc. ; they are not found in nerve tissue ; epithelium, skin appendages, bone, cartilage and cerebro-spinal fluid. The agglutinins a and b, on the other hand, besides being present in the serum, are also present in body fluids rich in serum proteins, e.g. milk, lymph, exudates, transudates, etc. Strictly speaking, the groups are not of the blood but of the whole tissue structure of the body. Thus, the group of a dead body may be determined by means of the serum agglutinins as long as any serum is available, and after that by means of the tissue ag- glutinogens. These persist and remain identifiable until putrefaction is far advanced. All individuals can be divided into two types, viz. secretors and non- secretors in accordance with the presence or absence of group specific sub- stances in their body fluids or secretions. In individuals, who are called secretors, these substances are present in high concentration in their secre- tions, such as saliva, gastric juice, semen, etc. In individuals, who are known as non-seeretors, these substances are absent from then? body fluids. The ability to secrete these substances in body fluids is inherited as a mendehan dominant, and remains constant throughout life. The medico-legal application of this test lies in the determination of cases of disputed paternity and in the grouping of blood stains in criminal cases. Cases of Disputed Paternity.—In 1910, Von Dungern and Hirschfeld showed from experiments that the agglutinogens A and B are Mendelian dominants, and are transmitted from parent to offspring according to the well-established laws of inheritance. Bernstein has demonstrated that O is recessive to both. Weiner31 has drawn up the following table showing the possible and impossible children occurring in various blood groups of parents: — Blood Groups of Parents. Possible blood groups of Children. Impossible blood groups of Children. o:x o 0 A, B, AB O.X A 0, A B, AB 0 X B 0, B A, AB A X A O, A B, AB A X B O, A, B, AB 3Tone B X B 0, B A, AB 0 X AB A, B O, AB A X AB A, B, AB 0 B X AB A, B, AB 0 AB X AB A, B, AB O Many thousands of families have been examined by the above described formula and no real exceptions have been discovered. It is obvious from the above-mentioned table that a specific agglutinogen cannot appear in a child unless it was present in at least one of its parents. For instance, if the iso-hsemagglutinogen (isogen) A is present in a child, but not in its 31. Amer. Jour. Med. Sc,, Aug. 1933, CLXXXVI, p. 257. | <urn:uuid:9cf0fef5-4e52-45ee-ad69-b3c06c68844f> | CC-MAIN-2016-26 | http://www.archive.org/stream/MedicalJurisprudenceAndToxicology/TXT/00000112.txt | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396100.16/warc/CC-MAIN-20160624154956-00028-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.932751 | 759 | 3.25 | 3 |
Over the last decade, the size of the hard drive that ships in a moderately-priced computer has grown from a paltry 1 GB, to 5 GB, 10 GB, 20 GB, 60 GB, all the way up to 160 GB in recent months. But even such a mammoth drive as the latter fills quickly nowadays, as the demand for storage continues to keep pace or even outpace gains in capacity. Along with bigger hard drives has come an explosion of files: more and more files are stored on a machine, and the files are larger and larger, in some cases up to hundreds of megabytes or larger per file. As implausible as it sounds, it is possible to quickly fill a 160 GB drive, especially if you’ve partitioned your system. And there’s nothing worse than a /home partition with a scant 5 MB of space left.
But what’s taking up all that space?
Longtime Linux users who proudly sport a BOUB (“Big Ol’ Unix Beard”) typically use some combination of command-line tools such as du, grep, and find to catalog disk contents. KDE folks can turn to KDirStat, a nice graphical tool that represents disk space usage in a colorful, easy-to-use display. The coolest and most useful graphical tool, however, belongs to GNOME, but will work in any desktop environment that has the essential GNOME libraries. It’s powerful, works on your local machine or over a network, provides a variety of ways to view your disk allocation, and lets you search for files on your system. It’s name? Baobab.
You can find Baobab at http://www.gnome.org/projects/baobab
. Debian users can pick it up with the simple apt-get install baobab
, and others can find a variety of packages and source code on the web site. Once installed, launch the program.
Baobab doesn’t look like much at first, but suspend your disbelief for a moment. Select “Actions& gt; Scan a selected directory” and when asked for a directory to scan, find your /home directory and press the Open button. Baobab instantly goes to work, parsing that directory and writing the results in the main Baobab window on the “Directory tree” tab. The more stuff in that directory, the longer the process takes. When it finishes, you’ll have an expandable tree structure showing you the size of each subdirectory and file in /home.
By default, Baobab sorts the results by name, which is useful is you want to know how big directory foo is compared to directory bar, but not so handy if you want to ferret out the disk hogs. To get that information, select the “Sort& gt; By size”.
Right-click on a directory to view a useful menu of options, including “Open” (which shows you the contents of the directory in your default file manager), “Delete” (which permanently destroys the directory, so be careful), “List all files in folder”, and, perhaps most useful, “Folder graphical map”. The latter option presents a visual representation of a directory, as shown in Figure One.
Baobab’s graphical map displays each subdirectory as a colored box, with the size of the box proportional to the size of the subdirectory. With just a glance, it’s incredibly simple to tell that a particular item is grotesquely overgrown in comparison to others. Hover your mouse over any box, and Baobab pops up the path for that subdirectory.
Choose the “Actions” menu to “Scan a selected directory”, “Scan the whole filesystem”, or even “Scan a remote folder”. The latter option is really cool, as Baobab supports SSH, FTP, Samba, and WebDAV.
Finally, the “Actions” menu also allows you to “Search for a file”, a useful feature. The results of the search include some nice metadata, including the file’s full path, modification date, owner, size, and file type. Nice! Baobab is a useful tool, and its network features make it especially powerful.
Even though disks are getting bigger, Penguinistas are still finding ways to fill them up. Baobab can help you tame the hard drive beast.
Scott Granneman teaches at Washington University in St. Louis, consults for WebSanity, and writes for SecurityFocus and Linux Magazine. His latest book, Don’t Click on the Blue E!:Switching to Firefox, is in stores now. You can reach Scott at | <urn:uuid:823d56cd-2de2-4f4a-a42e-7c7983b6f7fe> | CC-MAIN-2016-26 | http://www.linux-mag.com/id/2468/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399428.8/warc/CC-MAIN-20160624154959-00003-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.908223 | 1,004 | 2.5625 | 3 |
There is nothing so desperately monotonous as the sea, and I no longer wonder at the cruelty of pirates.James Russell Lowell
Pirates have been around since humans first built boats. Julius Caesar was twice captured by a group of Mediterranean pirates. He treated them with utter contempt and promised to crucify them when they let him go. They thought he was joking. Several days after his release, he returned and carried out his promise.
The Golden Age
During the Golden Age of Piracy, from the early 17th to the mid-18th century, the boundary between legitimate sacking of enemy ships – called privateering – and piracy wasn't clear. Sir Francis Drake was more ruthless than most pirates, but sailed under the Queen's protection. William Dampier (1651-1715) was a pirate, but his journals were so rich in natural history and geographical detail that Charles Darwin based his travels on them a century later.
Dampier also introduced many new words into English, including avocado, breadfruit, caress, cashew, chopsticks, petrel, posse, snug and barbecue, from the Arawak Indian word barbacoa. By odd coincidence, the French version of this word was boucan, which became "buccaneer". The early French settlers on the island of Hispaniola were nicknamed boucaniers because they had lived by hunting and smoking pigs in the native style until the invading Spaniards drove them out and forced them to take up piracy.
The most important source of pirate lore is the 1724 book A General History of the Robberies and Murders of the Most Notorious Pyrates by a "Captain Charles Johnson" (who was probably Daniel Defoe). The other source of popular pirate myths was Robert Louis Stevenson's Treasure Island (1883). Stevenson's novel introduced the pirate map (with X marking the spot), buried treasure and the ineluctable pirates' curse, the Black Spot. Stevenson also introduced several piratical expressions including "Avast!", "Yo-ho-ho" and "matey" – though "Shiver my timbers!" came from the pen of another Victorian novelist, Captain Frederick Marryat (1792-1848).
The 1724 book mentions the pirate's flag, the Jolly Roger, for the first time. It didn't always carry a skull and crossbones – Blackbeard's had a skeleton and a bleeding heart. Nor was it the most feared flag – that was the "Bloody Red", which signified "no quarter" i.e. that no life would be spared. No one knows where the term "Jolly Roger" originated, although it might be a parody of the French privateers' red ensign, known as the Jolie Rouge.
Only one pirate, William Kidd (c.1645-1701), is ever recorded as having buried any treasure. It is known that Kidd buried some of his wealth on Gardiners Island, off the coast of Long Island. He had hoped to use it as a bargaining tool to clear his name. However, he'd given the details to one of his backers, who dug it up and used it in evidence against him. Kidd was found guilty of piracy and murder and was hanged in Wapping. His body remained on show in a cage over the Thames for 20 years.
Hardly any pirate booty was "treasure". Most was food, water, alcohol, weapons and clothing. People were also "pirated" – during the 17th century, more than a million Europeans were captured and sold into slavery by "Barbary" pirates from Algiers.
Few pirates (or privateers) sailed in galleons. Most used galleys (with banks of oars rather than sails). Unlike the sailing ships that were their prey, these could be rowed against the wind and in any direction.
Two privateers (though no pirates) are known to have had wooden legs: the 16th-century Frenchman François Le Clerc, known as Jambe de Bois, and Cornelis Corneliszoon Jol (1597-1641), nicknamed Houtebeen ("Pegleg"). There is no historical evidence for any pirate ever owning a parrot.
The piratical "Arrrr!" was invented by the actor Robert Newton for his role as Long John Silver in the 1950 film of Treasure Island. It was a (bad) imitation of a West Country accent. Maritime Pidgin English, to give it its grown-up name, is celebrated every September 29 on International Talk Like a Pirate Day.
'1,227 QI Facts to Blow Your Socks Off' by John Lloyd, James Harkin & John Mitchinson (Faber & Faber) is available from Telegraph Books at £9.99+£1.10 p&p. Call 0844 871 1515.
Next week: QI ain’t gonna fly | <urn:uuid:9a35340b-2bbf-44aa-832c-c36436aa4da0> | CC-MAIN-2016-26 | http://www.telegraph.co.uk/men/the-filter/qi/9855397/QI-some-quite-interesting-facts-about-pirates.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397744.64/warc/CC-MAIN-20160624154957-00088-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.976093 | 1,012 | 3.015625 | 3 |
Bulbs and their tuber, corm, and rhizome relatives are a fascinating group of plants. In the Chicago area they can start blooming as early as February (winter aconite, snowdrop), really make an impact en masse in spring (narcissus, tulip, crocus), produce stunning specimens in summer (ornamental onion, fritillary, lily) and keep on enlivening gardens well into autumn (dahlia, autumn crocus). What other type of flowering plant can match that sequence? Whether cropping up through grass, appearing in rock gardens or taking center stage among the annuals and perennials, bulbs offer a versatility and a smashing swath of color in all gardens.
In addition to the true kings and queens of the bulb garden, there is a very interesting group of smaller bulbs, perhaps not as well-known, but containing many quite worthy little bulbs.
Some have an extended bloom time (windflower), some will tolerate shaded conditions (dogtooth violet, checkered lily, spring beauty) and most will naturalize over the years as long as the foliage is allowed to yellow and wither naturally, thus providing food for the blossoms to come.
All of the bulbs highlighted below are planted in the fall in well-drained soil. They should be planted at a depth of 4 inches to the tip of the bulb and watered well after planting. Since root development is crucial in the fall, sprinkle bulb booster or bone meal over the top player of soil. These contain phosphorus, an ingredient needed for good root growth. Bulbs can be fertilized again when their foliage appears—but this time with a balanced granular fertilizer spread over the soil surface and then watered in. Since bulbs generally like an even supply of moisture during their active growing stage, supplemental irrigation may be necessary during dry periods.
The bulbs listed below in the order of their appearance in the garden require very little care, are easy to plant and can mix and match beautifully with ground covers, annuals, perennials and their big-brother bulbs. And they are perfect in seasonal containers!
Little bulbs may produce little blossoms, but their delicacy, fragrance and charming ability to naturalize in a relatively carefree fashion should earn them a special place in your garden.
|Winter aconite (Eranthishyemalis)||3-6 inches tall||Fragrant yellow flowers||Late winter to very early spring||Sun, light shade; well-drained soil; |
soak tubers overnight before planting
|Glory-of-the-snow (Chionodoxaspp.)||6-10 inches||Starry white, pink, or blue flowers||Fast spreading in very early spring||Sun, light shade; well-drained soil|
|Snowdrop (Galanthusspp.)||4-9 inches||Nodding white flowers||Very early spring||Part shade; moist soil; do not fertilize|
|Spring beauty (Claytoniaspp.)||4-12 inches||White to pink flowers||Forms colonies in very early spring||Shade; moist soil|
|2-6 inches||White, purple, yellow combinations; striped, needlelike foliage||Early spring||Full sun, light shade; good drainage|
|White trout lily (Erythroniumalbidum)||4-6 inches||Nodding white recurved flowers; mottled foliage||Naturalizes in woodland setting in early spring||Part shade; organic, moist soil with good drainage|
|Windflower (Anemone blanda)||5-8 inches||Daisylike lavender/blue, pink, or white flowers||Spring; long bloom period||Full sun, good drainage; keep moist; |
soak tubers overnight before planting
|Spring snowflake (Leucojum vernum)||6-8 inches||White, bell-shaped flowers with a green dot on each petal||Spring||Full sun, light shade; best to have morning sun; dry soil; naturalizes|
|Summer snowflake (Leucojum aestivum)||8-15 inches||Nodding white flowers||Blooms a few weeks after L. vernum||Naturalizes in light shade|
|6-8 inches||Blue/white star-shaped flowers||Spring||Sun, light shade; well-drained, organic soil; naturalizes|
|Dwarf iris (Iris reticulata)||8 inches||Fragrant purple, blue, or burgundy flowers with yellow markings||Late spring||Full sun; well-draining soil|
|Ornamental onion (Allium)||8-12 inches||Yellow, silver/pink, blue, white||Depending on cultivar, late spring to summer||Full sun; rich soil with good drainage|
|Checkered lily (Fritillaria meleagris)||12 inches||Flowers checkered brown/purple with white resemble lampshades; unique bulb||Spring||Part shade; moist, well-drained soil|
|Autumn crocus (Colchicumgroup)||6-12 inches||Large purple, white, or pink flowers bloom without foliage in autumn. The following spring, leaves appear but die back by June.||Fall||Full sun| | <urn:uuid:7901cb1e-761c-41fe-b4a5-0e49f3ebc1ee> | CC-MAIN-2016-26 | https://www.chicagobotanic.org/plantinfo/little_bulbs | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395039.24/warc/CC-MAIN-20160624154955-00171-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.848406 | 1,120 | 3.171875 | 3 |
Neuropsychological Evaluation Help?
evaluation is critical for understanding which brain functions are impaired
and which remain intact. An effective evaluation can tell the
neuropsychologist how the injury specifically affects thinking and
behavior. Is the person able to concentrate on tasks? For how long? Under
what conditions? Does it matter whether the information is verbal or
nonverbal? Standard neurological or physical exams, and even neuroimaging
studies (CT scan, MRI), cannot provide this information.
evaluation may be essential to determine whether a person actually has a
brain injury. This is especially true following "mild" brain injury,
when effects of an injury may be subtle and easily confused with other
factors, such as stress, medications, or depression. Was the person's brain
really injured? How? Is impairment still evident? What is the cause of the
impairment? How do emotional or psychological factors influence performance
or concerns? Is the person's performance in the evaluation a true
reflection of how he or she will behave and think on a day-to-day basis? If
not, why not? These are the types of
diagnostic questions a neuropsychologist can answer.
injuries often occur in motor vehicle accident or are raised in issues
regarding benefit determinations, disability, criminal matters or civil
litigation the issue of the validity of the presentation or the test
results themselves is often in question. In these contexts inclusions of
neuropsychological tests of validity help assess if the results are valid
and help to assist in the determination of the validity of the presentation
A number of
real-life questions can be answered by neuropsychological evaluation. Is
the person who was injured competent? Can he or she be left alone? Drive?
Manage money? Live independently? Return to work or school? What type of
treatment or therapy will be needed?
evaluation is also critical in monitoring the course of recovery or the
effectiveness of rehabilitation. Is the person getting better? How much?
Has treatment been helpful? | <urn:uuid:899d0347-b346-4bd3-ae7a-b02ef250bab9> | CC-MAIN-2016-26 | http://www.neuropsychologycentral.com/interface/content/resources/page_material/resources_faq_pages/resources_eval_of_tbi_faq.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394414.43/warc/CC-MAIN-20160624154954-00097-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.890648 | 433 | 3.15625 | 3 |
Formulas as "Rewards" in Thermodynamics
The ESL game I encountered two weeks ago at a conference has got me thinking. Can we use the simple "beat the system" technique for something besides homework? The engineering course I'm developing includes (not surprisingly) a lot of formulas. Pages and pages of them in fact.
As an instructional designer attempting to think like a student, I kept wondering - what are they all for? It wasn't until I started working through some sample problems in the course that I began to understand their function (and began to realize which ones were actually time saving tricks).
If you're given a list of formulas, it's really very overwhelming. They are essentially pieces of random text you have to memorize, with weird symbols at that. Even though this class is designed for engineers, it has to still be a little confusing to wonder which formulas are the most important and when to use them.
But what if the formulas were presented sequentially as "rewards" for successful problem solving at the early level? First you're asked to solve problems (review perhaps) based on math you already know, but as you are required to solve more different or more complex problems, you might be given new formulas to unlock.
An Arithmetic Scenario
I thought I would write an arithmetic scenario to capture what I mean. Suppose you have learned to add and you solve a few addition problems like "What is the cost of one apple plus one orange plus two grapes." At some point a student might encounter a problem like "What is the cost of 6 apples" which is actually more quickly solved by multiplication.
Maybe at this point, the game could whisper "Hey kid, want a secret tool called multiplication?" This would open a mini lesson on multiplication with a secret reference source called a...multiplication table. Would this turn a multiplication table from a torture device to a secret weapon? Maybe, if the right real-world scenario were given.
Math in particular seems like a field in which "gaming levels" really apply. For instance, you need addition to do multiplication which leads to exponentiation then logarithms (not to mention basic algebra). Math is taught in a sequence because skills often build on each other (although it can be hard to see the payoff in high school).
I think there are K-12 math activities like this, but can we extend this to high school and college? I've seen "capstone" activities (e.g. design a survey in statistics) where you put what you learn into practice, but it still seems like we present math as an abstract tool you will use at some later date.
The statistics / romance manga is moving in the right direction in terms of adding a plot line, but I'm wondering if a game element can add more of a reward system to with the real world context. I suspect the original mathematicians thought the current formulas were a gift in comparison to the "old way." Can we share that same "gift" with our students?
Post Script - Mar 26, 2009
I just read post on the Kapp Notes blog about using a "survival" game to explore engineering formulas. It'll be interesting to see how it works out. | <urn:uuid:f51096e3-9c54-4e87-af16-6aecd794c342> | CC-MAIN-2016-26 | http://www.personal.psu.edu/ejp10/blogs/tlt/2009/03/formulas-as-rewards-in-thermod.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404382.73/warc/CC-MAIN-20160624155004-00147-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.973094 | 662 | 2.734375 | 3 |
Surname Origin: An Anglo-Norman French word "marche" meaning boundary. A name for someone who lived on a border such as the 'Welsh Marches'. Alternatively (Teutonic.) Maresche, Morass, a fen, a tract of low, wet land.
19th century distribution of the Marsh surname
Our Marsh family originate from Yorkshire and have been traced back to Sheffield at the end of the 18th Century. Daniel Marsh, was born in Sheffield in 1795, son of George and Rachel Marsh. He was christened in Sheffield parish church, later Sheffield Cathedral.
Little is known of Daniel's early life or that of his parents, but at some stage as a young man he moved from Sheffield to Liverpool (via the United States), where he practiced the trade of Butcher. He first appears in Liverpool in the trade directories between 1834-44 as a Butcher at Liverpool's St Martins Market. He is only shown in the 1841 census living with his wife Mary and mother-in-law Hannah Shaw.
In 1847 he and his new partner Maria are in Manchester and have their first child there. It is possible that Daniel had left his first wife in Liverpool and that Maria was his second wife. However there is no record of either marriage as yet. By 1848 the couple had moved to Kingston upon Hull and again Daniel is described as a butcher. Whilst here they have three further children, including Charles Marsh. The family remain in Great Passage Street, Hull for about 8 years before moving on again.
By 1858 our Marsh family had moved to Nottingham, where Daniel died in 1868. By 1871 Maria was living with her two older sons in Sneinton Nottingham. Alfred and Sarah had already left home and Charles was serving in the army posted to Hythe. On his discharge from the army in 1877 Charles returned to Nottingham and found employment as a lace maker. He and his wife Henrietta Marshall are married in 1880, shortly before the death of Maria. They settle in Nottingham and have nine children, including Hettie Marsh in 1886, Edith Marsh in 1899 and Ethel Marsh in 1902.
Edith meets and marries John Ambrose in 1921, but there marriage is short lived as John dies in 1922. Edith is left alone with a baby daughter and three years later meets and marries George Noble, a labourer from St Ann's Nottingham. The couple have two children before tragedy strikes again with the death of Edith in 1935. George Noble and the children, Miriam Ambrose, Ken Noble and Ray Noble, move in with their aunt Hetti (Kirkham) and her husband for support. They were also helped by another of Edith's sisters, aunt Ethel (Knutt).
Current Research : Further research required on the origins of the family in and around Sheffield. Also some more digging in Liverpool could discover whether the Mary Marsh living with Daniel in 1841 is his wife or sister.
Click here for full details of our Marsh ancestry | <urn:uuid:c7c99d31-5a56-44cf-809d-84a48640ffb8> | CC-MAIN-2016-26 | http://freepages.genealogy.rootsweb.ancestry.com/~noblefamilia/marsh/marsh.htm | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398209.20/warc/CC-MAIN-20160624154958-00024-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.982141 | 617 | 2.9375 | 3 |
Environment Headlines - 8 November, 2005
Click on the headline (link) for the full text.
Many more articles are available through the Energy Bulletin homepage
Ecological implications of the Amazonian drought affect all
Sue Branford, Guardian via Taipei Times
The rainy season can't come soon enough in the Amazon, but even the end of a drought has had terrible consequences for the area's plant and animal life
Not far from the mouth of the Amazon, dead animals, including manatees -- mammals up to 3m long with flat, paddle-shaped fins -- and distinctive pink dolphins, line the banks of some tributaries. Normally, you would have to take a boat to cross these rivers but today, because of the Amazon basin's worst drought in memory, they are little more than mudflats with a trickle of water in the middle.
So far, the drought has had its most serious impact in the upper reaches of the river and its hundreds of tributaries in Brazil, Colombia and Peru. There, along many stretches, the water has fallen to the lowest levels ever recorded and has become impassable even for canoes. Some 600 Brazilian schools in Amazonas state have had to be closed and many hamlets, whose only contact with the outside world is by river, are running short of food and medicines. Several districts have been declared disaster areas and the army is having to bring emergency supplies to 900 towns and villages.
The problems are expected to get worse before the drought eventually breaks, perhaps in the next month when the Amazon's rainy season usually comes.
... But what is worrying some scientists even more than the growing scale of the humanitarian crisis is a suspicion that this year's drought may be the harbinger of a much greater disaster that could push the whole Amazon forest to a critical flip-over point and into an unstoppable process of self-destruction.
This is how the theory goes: the Amazon river contains a fifth of the planet's fresh water. Over 300km wide at its estuary, it carries more water than the world's next nine largest rivers combined. In a remarkable process, much of this water is recycled within the forest.....
(5 November 2005)
Toxic legacy of home grown Weapons of Mass Destruction
John M.R. Bull, Daily Press
Weapons of mass destruction thrown into the sea years ago present danger now - and the Army doesn't know where they all are.
In the summer of 2004, a clam-dredging operation off New Jersey pulled up an old artillery shell. The long-submerged World War I-era explosive was filled with a black tarlike substance. Bomb disposal technicians from Dover Air Force Base, Del., were brought in to dismantle it. Three of them were injured - one hospitalized with large pus-filled blisters on an arm and hand. The shell was filled with mustard gas in solid form.
What was long feared by the few military officials in the know had come to pass: Chemical weapons that the Army dumped at sea decades ago finally ended up on shore in the United States.
It's long been known that some chemical weapons went into the ocean, but records obtained by the Daily Press show that the previously classified weapons-dumping program was far more extensive than ever suspected. ...
The Army now admits that it secretly dumped 64 million pounds of nerve and mustard agents into the sea, along with 400,000 chemical-filled bombs, land mines and rockets and more than 500 tons of radioactive waste - either tossed overboard or packed into the holds of scuttled vessels. ...
(30 October 2005)
How climate change is destroying the world's most spectacular landscapes
Joe Simpson, lndependent/UK via Common Dreams
On 23 July 1983 Ian Whittaker and I were inching our way up the Bonatti Pillar, a legendary Alpine climb up 2,000ft of golden granite on the south-west face of Les Drus, high above Chamonix in France.
...Once ensconced inside my bivouac bag I settled myself down on the comforting solidity of the ledge. Seconds later there was a heart-stopping downward lurch accompanied by the thunderous sound of tons of granite plunging into the abyss. I heard a cry of alarm and pain above the roar of falling rock. My arms were outside the bivouac bag as I fell and I flailed them blindly trying to grab something. It must have taken only a fraction of a second but it seemed to last forever.
We bounced on the springy stretch of rope. The handrail had held. I swung gently on the rope with my arms pinned to my sides. I had held the fall on my armpits and for a confused moment I desperately tried to remember whether I had clipped myself to the handrail.
In the sudden darkness, with the sounds of falling rock echoing up from the depths, I was momentarily disorientated. Where was Ian? I remembered that sudden yelp during the fall. Had he gone with it?
...Ironically, only a few days before the Bonatti Pillar disintegrated, a man regarded by some as a half-witted religious bigot announced at the G8 summit in Gleneagles that as far as he was concerned America did not regard global warming as important nor pressing. Leastways that is how I interpreted President George Bush's words.
Scientists now believe global warming is melting the Alps. The ice that for thousands of years had filled the deep cracks at the summit of the Dru has started to melt. The glue holding this rock tower together is leaking away.
More seriously, the crust of permafrost that binds the whole mountain range together is beginning to melt. The foundations of buildings, roads, mines, tunnels, cable-car stations and their supporting pylons are entirely dependent on the frozen solidity of this permafrost. As it steadily melts, the whole infrastructure of Alpine tourism is at risk, as well as a great many lives.
All the most famous ski resorts in Europe are situated in valleys overlooked by mountains held together by permafrost. The high altitude permafrost zones lie on steep slopes above these settlements, roads, railways and valleys. Massive slope failures and landslides leading to blocked rivers, dammed lakes and catastrophic flooding will be especially pronounced in the Alps, which has such steep topography and high population levels.
Already climatologists have predicted the complete failure of the Scottish ski industry due to lack of snow within 20 years and the Alpine ski industry within 50 years. Many Alpine ski resorts would already be out of business but for the snow machines.
Because the best Alpine ski fields and lift systems are above the crucial permafrost altitude of 8,202 feet, it could spell the end of the ski industry as we know it, let alone the more esoteric world of mountaineering. When you consider that one sixth of Austria's gross domestic product comes from Alpine tourism, the effects of permafrost meltdown could be far more wide-ranging than just screwing up our winter sports holidays.
Joe Simpson is a climber and author of 'Touching The Void'
(5 November 2005)
The Kyoto deal is changing too
Sanjay Suri, Inter Press Service
LONDON - Like U.S. President George W. Bush, more and more leaders now hear 'money' and 'markets' when they hear 'climate change'. And they could be going the Bush way rather than bring Bush the other way around.
Within the United States some states are introducing emission permit systems along the lines of emissions trading proposed under the Kyoto protocol, and under way in the European Union. But Americans could find several world leaders now joining the leader they are now turning their backs on.
Further signs of that were evident at a conference of environment ministers and other representatives from 20 countries at a conference called by the British government in London Tuesday and Wednesday this week.
No outcome to the meeting was announced. ''But what we are hearing in terms of the outcome from the London meeting so far are that there's a significant shift away from commitment to targets,'' Dr Camilla Toulmin, director of the International Institute for Environment and Development told IPS.
''Evidently Prime Minister Blair feels that targets and legally binding commitments frighten people away and they then feel nervous so that they want to go instead on much greater emphasis like technological development,'' she said.
...''I think there's a strong worry about the economic power and competition posed by both China and India,'' Toulmin said. ''A consequence of that is that people in UK, in Europe, in North America seem to be cutting back on environmental and other regulations because they think this will damage their capacity to compete effectively with India and China and that's one of the reasons we're seeing a move away from tighter regulations to much more what is thought to be a business friendly environment.''
This might well be an unfounded fear, she said. ''The interesting thing is that a lot of business in the UK and Europe are seeking tighter regulation. They want the government to tell them what the framework will be, so that they can plan. They need to be able to plan for the next five, ten, 15 years, and to know what the government has in mind.''
(5 November 2005)
Greenland's ice sheet growing thicker above 1500m
European Space Agency
Researchers have utilised more than a decade's worth of data from radar altimeters on ESA's ERS satellites to produce the most detailed picture yet of thickness changes in the Greenland Ice Sheet. ...
The result is a mixed picture, with a net increase of 6.4 centimetres per year in the interior area above 1500 metres elevation. Below that altitude, the elevation-change rate is minus 2.0 cm per year, broadly matching reported thinning in the ice-sheet margins. The trend below 1500 metres however does not include the steeply-sloping marginal areas where current altimeter data are unusable. ...
(4 November 2005)
Scientists gain new insights into 'frozen' methane beneath ocean floor
An international team of scientists supported by the Integrated Ocean Drilling Program (IODP) has completed a unique research expedition aimed at recovering samples of gas hydrate, an ice-like substance hidden beneath the seafloor off Canada's western coast. Gas hydrate, a mixture of water and mostly methane, is believed to occur under the world's oceans in great abundance, but it quickly "melts" once removed from the high pressure and cold temperatures of its natural environment, making it very challenging to recover and analyze.
When brought to the surface in a core, gas hydrate is no longer in its stable pressure and temperature field and decomposes (see fizzing and bubbling). (Image courtesy of Integrated Ocean Drilling Program Management International)
"We're interested in gas hydrate because we believe these deposits have played an important role in ancient global climate change," explains Michael Riedel of Natural Resources Canada's Geological Survey of Canada, IODP Expedition 311's co-chief scientist.
(7 November 2005)
What do you think? Leave a comment below.
Sign up for regular Resilience bulletins direct to your email.
This is a community site and the discussion is moderated. The rules in brief: no personal abuse and no climate denial. Complete Guidelines. | <urn:uuid:d1e271c8-783b-49e9-a970-1eedbf13352c> | CC-MAIN-2016-26 | http://www.resilience.org/stories/2005-11-07/environment-headlines-8-november-2005 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396949.33/warc/CC-MAIN-20160624154956-00184-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.957177 | 2,328 | 3.25 | 3 |
How do these trees and mosses differ?
The trees tower in the sky, while the mosses carpet the forest floor. Mosses, like the first plants, are restricted to life near the ground because they lack vascular system. Only with a vascular system can these trees transport sugars, nutrients, and water up and down their tall trunks. The evolution of the vascular system was a big step in the evolutionary history of plants.
Vascular Seedless Plants
For these plants, the name says it all. Vascular seedless plants have vascular tissue but do not have seeds. Remember that vascular tissue is specialized tissue that transports water and nutrients throughout the plant. The development of vascular tissue allowed these plants to grow much taller than nonvascular plants, forming ancient swamp forests. Most of these large vascular seedless plants are now extinct, but their smaller relatives still remain. Vascular tissue includes xylem, which transports water from the roots to the rest of the plant; and phloem, which transports sugars and nutrients from the leaves throughout the plant.
Seedless vascular plants include:
- Whisk ferns.
Clubmosses are so named because they can look similar to mosses (Figure below). Clubmosses are not true mosses, though, because they have vascular tissue. The “club” part of the name comes from club-like clusters of sporangia found on the plants. One type of clubmoss is called the "resurrection plant" because it shrivels and turns brown when it dries out but then quickly turns green when watered again.
Clubmosses can resemble mosses; however, clubmosses have vascular tissue, while mosses do not.
Ferns are the most common seedless vascular plants (Figure below). They usually have large divided leaves called fronds. In most ferns, fronds develop from a curled-up formation called a fiddlehead (Figure below). The fiddlehead looks like the curled decoration on the end of a stringed instrument, such as a fiddle. Leaves unroll as the fiddleheads grow and expand. Ferns grow in a variety of habitats, ranging in size from tiny aquatic species to giant tropical plants.
Ferns are common in the understory of the tropical rainforest.
The first leaves of most ferns appear curled up into fiddleheads.
Horsetails have hollow, ribbed stems and are often found in marshes (Figure below). Whorls of tiny leaves around the stem make the plant look like a horse's tail, but these soon fall off and leave a hollow stem that can perform photosynthesis. This is unusual since photosynthesis most often occurs in leaves. The stems are rigid and rough to the touch because they are coated with a scratchy mineral. Because of their scratchy texture, these plants were once used as scouring pads for cleaning dishes.
Horsetails are common in marshes.
Whisk ferns have green branching stems with no leaves, so they resemble a whisk broom (Figure below). Another striking feature of the whisk ferns is its spherical yellow sporangia.
Whisk ferns have yellow sporangia and no leaves.
- Vascular seedless plants have vascular tissue, a specialized tissue that transports water and nutrients throughout the plant.
- Vascular seedless plants include the club mosses, ferns, whisk ferns, and horsetails.
Use the resource below to answer the questions that follow.
- How many species of ferns and horsetails have scientists identified today?
- How do scientists feel the present day diversity of ferns and horsetails compares to the diversity of these plants before the appearance of plants with seeds?
- What sex are the spores of a fern?
- What happens to the fertilized embryo of a fern?
- Why are the vascular seedless plants different from the nonvascular plants?
- What are two examples of vascular seedless plants?
- What is the role of vascular tissue in plants?
- What was the primary result of the evolution of vascular tissue in plants?
- What is the most common seedless vascular plant? | <urn:uuid:5774bbf9-e876-4964-ae29-3a42dec1018b> | CC-MAIN-2016-26 | http://www.ck12.org/book/CK-12-Life-Science-Concepts-For-Middle-School/section/7.6/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395620.56/warc/CC-MAIN-20160624154955-00020-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.943502 | 876 | 4.15625 | 4 |
Green Roofs are Growing
Standards Support Sustainability
Standards from ASTM International Committee E60 on Sustainability guide work on vegetative green roofs.
Walking south along Michigan Ave. from the Chicago River, a first-time visitor might take in the green vistas of Millenium Park sprawling eastward toward the great lake with no hint that the park itself is a green roof. It covers two garages and a commuter rail line, occupying close to 100 square meters in Chicago's East Loop district and taking in a great lawn, a garden of native Illinois plans, a music pavilion and water features. It's one of the largest vegetative green roofs in the world.
Around the globe, vegetative green roofs are sprouting. The Expo Zaragoza Empresarial Business Park in Spain, built for a 2008 sustainability exposition, features more than 43,000 square meters planted with grasses, perennials and aromatic plants. Building rooftops in the Village on False Creek in Vancouver, British Columbia, Canada, a LEED1 Platinum neighborhood, are carpeted with sedum. At the Frankfurt International Airport in Germany, landscaped areas blanket several buildings and total some 80,000 square meters.
Vegetative green roof designs fall into two general categories: those with sedums or drought-tolerant plants for extensive vegetative green roofs and complete landscape gardens for intensive vegetative green roofs. In either approach, the final product increases energy efficiency, reduces stormwater runoff and urban heat island effects, and provides habitat for birds and insects, and even leisure space - as with Millenium Park - for people. No matter the type of roof, the system comprises plants, growing media and layers for waterproofing, drainage and water retention. And that's where ASTM International standards come in.
E60 and VGR Standards
ASTM International members began to develop vegetative green roof standards in the early 2000s in Subcommittee E06.71 on Sustainability (now reorganized as Committee E60 on Sustainability) with the creation of the green roof task group.
"There was a strong market need for substantive guidance. Also, there was a pretty good range of VGR technologies," says Dru Meadows, principal at theGreenTeam Inc., Tulsa, Okla., and E60 chairman. "It was a classic example of market need for performance standards and an excellent example of ASTM bringing together stakeholders to develop consensus documents."
Meadows says that the responsible task group looked to work on a comprehensive document, a "granddaddy" standard that would address the breadth of vegetative green roof considerations. The proposed guide, WK25385, Guide for Vegetative (Green) Roof Systems, now being balloted, has facilitated the task group's work on related standards that have been approved.
Completed standards include:
- E2396, Test Method for Saturated Water Permeability of Granular Drainage Media [Falling-Head Method] for Vegetative (Green) Roof Systems, to compare one type of media to another;
- E2397, Practice for Determination of Dead Loads and Live Loads Associated with Vegetative (Green) Roof Systems, to help assess the building for such considerations as structural design given the weight of the system without and with rain or irrigation;
- E2398, Test Method for Water Capture and Media Retention of Geocomposite Drain Layers for Vegetative (Green) Roof Systems, to help assess one system's performance relative to another as well as assess irrigation requirements for system designs;
- E2399, Test Method for Maximum Media Density for Dead Load Analysis of Vegetative (Green) Roof Systems, which provides an objective measure of media density for estimating structural loads;
- E2400, Guide for Selection, Installation and Maintenance of Plants for Green Roof Systems, includes recommendations regarding choosing, planting and irrigating plants grown on vegetative roofs; and most recently,
- E2788, Specification for Use of Expanded Shale, Clay and Slate (ESCS) as a Mineral Component in the Growing Media and the Drainage Layer for Vegetative (Green) Roof Systems, details quality and gradation requirements.
These standards, according to Meadows, have helped bring down early adopter costs and are referenced in the Whole Building Design Guide from the National Institute of Building Sciences. A vegetative green roof still often costs at least two times that of another commercial roof, and up to four times as much if paths or paved areas are added or if shrubs and trees are part of the plan, adding materials, installation and maintenance to the project. But, according to Michael Gibbons, chairman of the vegetative green roof task group and owner/president of Architectural Systems Inc., Dallas, Texas, the cost for a simple vegetative green roof might be recouped in energy savings in five years or fewer.
The Grandaddy Standard
The granddaddy standard, WK25385, when approved, will fill the need of the practitioner wanting a complete approach to a vegetative green roof, or to answer the question as Gibbons puts it, "If I say I want a green roof, what's next?" WK25385 identifies the terminology, principles and concepts of a vegetative green roof consistent with E2432, Guide for General Principles of Sustainability Relative to Building, an E60 standard that covers concepts and building characteristics for general sustainability purposes.
Once WK25385 is published as a standard - it has recently been balloted by Subcommittee E60.01 on Buildings and Construction - green architects and others will find information about both intensive and extensive roof systems: plants, media, wind scour resistance, soil reinforcement, separation or filter layers, drain layers, irrigation, water retention layers, insulation, waterproofing/roofing membranes, protection layers and root penetration barriers.
Gibbons says that the draft standard is something of a checklist, but its sections provide discussion, for example, about such project parameters as maintenance, performance and longevity. Sections about planting media detail the different requirements for intensive systems and extensive systems as well as functional properties of the media, including nutrients, density and depth, organic matter and more.
More to Come
The vegetative green roof task group has more standards development activities planned. Currently under way is a proposed standard on selecting waterproofing membranes for green roofs, which will list characteristics, materials and suggested performance requirements. The group will also be looking at possible vegetative green roof standards that address irrigation, fire, wind scour and roofs with steep slopes.
Where there are vegetative green roofs, right below the surface there may be an ASTM International standard.
1. LEED is Leadership in Energy and Environmental Design, a voluntary sustainable building program of the U.S. Green Building Council, Washington, D.C. | <urn:uuid:cb2143a8-95fa-4f56-90cd-442664a60fe4> | CC-MAIN-2016-26 | http://www.astm.org/standardization-news/features/green-roofs-are-growing-mj13.html?gateway=Building%20Construction | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398516.82/warc/CC-MAIN-20160624154958-00065-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.919363 | 1,401 | 2.65625 | 3 |
Going Green from the Get-Go
How Natural Product Selections Benefit Your Children - and the Planet
When it comes to raising an environmentally conscious child, eco-minded experts agree that the responsibility lies with parents. By setting a real-life example of how even one person - at any age - can play an active role in aiding the environment, you can help raise your children to be good stewards of the land.
One way to encourage children to follow in your eco-friendly footsteps - right from the start - is to purchase natural products such as organic cotton clothing and bedding, reusable diapers, recycled paper goods and organic foods. A commitment to the purchase of "green" products sends a strong message to your children about the limited availability of the earth's resources and the important role Mother Nature plays in our lives.
By choosing natural products, you show your children that you're concerned about where the product came from and where it's going - and want to be sure no harm is being done to the environment along the way.
Creating "Green" Habits
The habitual purchase of natural products demonstrates a clear message about the importance you place on aiding the environment - for the benefit of your children and your children's children. Of course, the importance of purchasing "green" goods isn't learned in one sitting. It takes time - especially with young children. It's up to parents to make each trip to the store, and every natural product purchase, a learning experience. Over time, your children will begin to understand - and even mimic - your eco-friendly behavior.
"Kids are creatures of habit," says Emily Main, associate editor of The Green Guide, a consumer resource for environmental education. "While younger kids don't understand the logic behind purchasing organic foods, they can learn about it later. It's still important to set a habit now by choosing to go to natural food stores."
Dan Chiras, the author of "Eco-Kids: Raising Children Who Care for the Earth," a guide for parents on instilling environmental values in their children, agrees that the use of natural products should start with your children even as babies - and continue as they grow older. In this case, the old adage, practice makes perfect, holds true. The routine purchase and use of "green" goods will only stand to ingrain the behavior into the minds of your children.
"While early product usage doesn't have an influence on kids, a parent's decision to act consistently does," says Chiras. "Kids pick up on inconsistency. Parents need to walk their talk and act on their ideals."
Do as I Say and As I Do
Another way you can harness eco-friendly behaviors to produce good stewards of the environment is by telling your children about the rationale behind your environmentally sound purchasing decisions. By explaining your behaviors, you marry your actions with the rationale, setting a strong example that can be easily emulated by your children.
Chiras encourages parents to always let their children know what they're doing. A parent should tell their child they chose to use cloth diapers because they're a reusable resource. They should know you wanted to use diapers that wouldn't end up in landfills or contaminate the ground. Doing so will help instill a deeper understanding of the importance of the environment to our lives, our economy, and our personal and collective future.
Tereson Thomas, founder and CEO of Mother of Eden and inventor of FuzziBunz® Pocket Diapers, is keenly aware of the need to share the mission behind her environmentally friendly behavior with her children. "We talk about why it is better to buy organic products when we go grocery shopping, and I go out of my way to point out the benefits to the special things we do such as buying organic milk, using cloth diapers and choosing reusable products instead of disposable. By making eco-friendly behaviors and choices a part of our lives, and reinforcing the benefit of doing so, our children adopt these things as part of themselves and will hopefully grow up to share this with their children."
Kellie Herring, a mom in Rockledge, Fla., has made it a priority to teach her three-year-old son to care for the earth. Even at a young age, the time she has spent educating her son about her natural product decisions has already started to pay off. "As a baby, I know my son had no idea that we recycled or used earth-friendly products. As he got older, I always told him his diapers were better than disposables and why. I know he understands that a little bit now because he told me that the "grass likes my diapers better."
An early effort to consistently and habitually teach your children to respect Mother Nature will, overtime, result in having them mimic your behavior - for the good of the land and their future.
Aimee Thompson is a freelance writer and mother to a 10-month-old son. She resides in Chicago, Illinois.
This article was commissioned by Mother of Eden. Sources are independent and are not-affiliated with Mother of Eden. No source was compensated for their comments in this article. | <urn:uuid:6aeb34b0-7925-40f2-84b7-efc39f1cbd0e> | CC-MAIN-2016-26 | http://www.kellyscloset.com/Going-Green_ep_69-1.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783399117.38/warc/CC-MAIN-20160624154959-00183-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.965911 | 1,053 | 2.984375 | 3 |
President Obama took a political swing through the Western United States in mid-February and was a guest of Intel and several other Big Tech corporations. On February 18, he went to an Intel facility and spoke with the employees about what his Administration is doing about "Winning the Future."
He could not have chosen a more fitting venue. Robert Noyce and Gordon Moore, two brilliant engineers, founded Intel in the summer of 1968. The third employee was Andrew Grove, who served as the corporate manager. Noyce and Moore created innovations in the semiconductor field that led to the creation of an entire industry.
Today, that little Silicon Valley start-up has grown into a company that does business in 50 nations and employs almost 80,000 people, half of whom work inside the United States. As President Obama noted, Intel is a dynamic corporate citizen in the communities where it operates, providing education to its workers and assisting in local projects.
As a start-up, Intel lacked the capital of competitors such as IBM, Motorola and Japanese manufacturers. What they did possess were unique inventions, patents and the protections provided by the U.S. Constitution - that is, their patent rights and the means to defend them in the federal courts.
Amazingly, Intel is among a handful of Big Tech corporations, including IBM and Cisco, which are lobbying the President and Congress to weaken patent laws in a way that will make infringement of the patents owned by others easier and deny to others the same opportunity that they had.
These companies use a business model termed "efficient infringement" by which they instruct their engineers to aggressively avoid doing a due diligence test as to whether the technology they are using is patented by others. The goal is to deniability in court whenever they are found to infringe and thus avoid paying the patent owner triple damages as current law provides.
The draft legislation that these Big Tech corporations drafted and persuaded the Senate Judiciary Committee to adopt in early February 2011 would make America's extraordinarily effective patent system more like that of Europe and Japan, which are structurally biased against small companies, entrepreneurs and inventors.
Their legislation would grant a patent not to the person who invented the creation but to the first-inventor-to-file the application at the Patent Office. The presumption is that an invention can simultaneously have multiple inventors and the winner is the one who beats the clock and gets the stamp first.
In practice, the existing U.S. patent system has no such problem determining who merits the patent. Of the more than 500,000 patent applications filed last year, there were only 47 contested patents as to who was the inventor. Moreover, the Patent Office has a well-oiled process to make that determination.
The real goal of this change is to take away what is known as the "grace period" - the one year prior to filing a patent application that inventors can use to reveal their secrets to potential investors and partners without worrying about their disclosures making their creation a "prior art" that is ineligible for a patent. This exists no where else and gives American inventors an advantage in their home country.
After stripping away this provision with a globalized patent award standard, the Big Tech companies will then ask that patents granted in China, India, Japan and elsewhere automatically be adopted in the U.S., allowing them to accelerate their movement of R&D offshore.
Indeed, this patent bill would do for the outsourcing of R&D jobs what NAFTA did for the outsourcing of manufacturing jobs.
The bill would also create a new European-style post-grant challenge process to invalidate a patent. In Europe, competitors use this process to tie up new technology in long, expensive administrative law reviews.
In effect, Intel and its corporate allies have climbed the economic ladder and reached success, but now it is trying to kick over the ladder for others.
Without question, the U.S. Patent Office is in trouble. A third of its 6,000 examiners must work at home because the Agency lacks enough office space. The computers are so antiquated that many parts must be found on eBay because they are no longer produced. The turnover rate of employees is more than 30 percent annually. The backlog of applications is more than 700,000 and the Agency will receive more than 500,000 new ones this year.
To make matters worse, the Agency relies on fees paid by patent owners for its revenues, but over the past decade Congress has diverted more than $800 million of those to the Treasury.
If President Obama and the Congress want to create more dynamic companies such as Intel, then they must recognize that Intel's advice on patents is short-sighted. The patent legislation that Intel, IBM and the other Big Tech corporations support will do nothing to cure the problems faced by the Patent Office.
The smartest move that the President and Congress can do now towards "Winning the Future" is to (1) enact legislation that will stop the diversion of patent funds to the Treasury, (2) return to the Patent Office the $810 million that has been taken away, (3) reject the bill that Big Tech supports (S. 23), and (4) have Congress hold hearings on what really needs to be done so that constructive legislation can be introduced in early 2012. | <urn:uuid:b917a487-7a2e-4afa-a321-f46e3618f7fd> | CC-MAIN-2016-26 | http://www.huffingtonpost.com/pat-choate/losing-americas-future_b_826137.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396147.66/warc/CC-MAIN-20160624154956-00067-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.969374 | 1,076 | 2.515625 | 3 |
Reporting on Sexual Violence
Quick tips on covering sexual violence, from preparation to writing the story.
Reporting on sexual violence demands special care and increased ethical sensitivity. It requires specialised interviewing skills, understanding of the law, and basic awareness about the psychological impact of trauma.
Sexual violence could be physical or psychological and perpetrated against men, women or children of any age. It includes rape, which is known to be one of the most deeply traumatic experiences any human being can undergo. Talking about such an event is usually associated with very high levels of distress – during re-telling survivors may even re-experience some of the same emotions they felt at the time of being attacked. Consequently, journalists need to take special care, if they are to avoid compounding their interviewees’ distress. Sexual violence has broader effects too: the impact can ripple out to those involved tangentially, such as family members and loved ones or even witnesses to the act. When used as a weapon of war, how a whole community relates to itself or neighbouring groups can be profoundly altered.
PREPARATION AND APPROACH
Brief yourself thoroughly on the likely impacts and causes of sexual violence. Research local conditions and circumstances. But once you have done your research, leave it at the door. It doesn’t matter how much knowledge you have on the topic, you can never predict how a particular individual experienced the events that happened to them.
Get the language right. Rape or assault is not “sex.” A pattern of abuse is not an “affair”. Rape or sexual assault is in no way associated with normal sexual activity; trafficking in women is not to be confused with prostitution. People who have suffered sexual violence may not wish to be described as a “victim” unless they choose the word themselves. Many prefer the word “survivor”.
Respect a potential interviewee’s right to say no. Nobody should ever be forced to talk in detail about an event as traumatic as rape. Not everybody is in the right place to speak.
- If there is a local expert or a support organisation involved in the case, consider asking them if speaking to the media is likely to make things worse.
- However sensitive a male interviewer is, in the majority of cases a female victim is likely to feel safer when interviewed by an other woman; if that is not possible, a female colleague should be on hand.
- Be fair and realistic. Don’t coerce, cajole, trick or offer remuneration, and don’t suggest that giving an interview will bring more aid / military intervention.
Ask yourself whether approaching someone risks compromising his or her safety and privacy. In some societies, just being suspected of having been raped, can lead to humiliation, being ostracised, and even to further violence. Tread carefully and think about how and where you meet a potential source.
- Identify yourself clearly and never pretend not to be a journalist. Explaining the type of story you’re planning to write is likely to help build trust between you and the interviewee and result in better work.
DURING THE INTERVIEW
Set good ground rules. Violent and abusive acts take control and power away from people, and so it is important to create a sense of safety during the interview. Try involving the interviewee in the decision-making: ask them if they can recommend a safe location and time.
- If you are using a translator, brief them on the fundamentals described here. Broadcast journalists should consider recording the interview in the interviewee’s own language and keeping the crew to a minimum.
- Let your interviewee know at the outset how much time it is likely to take. Cutting somebody short while they describing a traumatic experience without prior warning can cause deep hurt.
The secret to good interviewing is active, non-judgmental listening. That sounds simple, but it is a skill that requires time and effort to develop.
Don’t underestimate how your own reactions to traumatic detail can influence the conversation. If you are finding the material challenging, acknowledge that silently to yourself, and bring your focus back to what is being said. Usually just trying to listen a little harder, and observing the other’s facial expressions, body language, etc, helps. (The time to process the personal impact on the journalist is after the interview.)
Sexual violence is associated with high degrees of self-blame, guilt and shame. For this reason, avoid any language that might imply the interviewee is responsible in some way. Be careful of asking “why” questions - they are favoured by interrogators.
Don’t be surprised if accounts only make partial sense. Frequently survivors of sexual violence ‘shut down’ emotionally: their recall may become fragmentary, and in some cases they may even block out an event entirely. Incomplete and contradictory accounts are not prima facie evidence of deception, but rather of the struggle interviewees may experience in making sense of what happened to them.
Never say you know how they feel – you don’t. Instead, you could say, “I appreciate how difficult this is for you”.
End the interview well. After you have addressed the issues you need for your report, ask them if they would like to add anything else. And most importantly, make sure you bring the conversation back into the here and now and to the discussion of things that the interviewee finds safe.
Make yourself available for contact after your report is published or broadcast. If you say you’ll let them have a copy or a recording of what you write/broadcast, keep that promise.
WRITING IT UP
Again, think about the language. Sexual violence is both deeply personal and something that has wider public policy implications.
- When describing an assault, try to strike a balance when deciding how much graphic detail to include. Too much can be gratuitous; too little can weaken the survivor’s case.
- During conflict, rape by combatants is a war crime. Describing it as an unfortunate but predictable aspect of war is not acceptable.
Anticipate the impact of publication. Journalists have a responsibility to do everything they can to avoid exposing the interviewee to further abuse or undermining their standing in the community.
- Consider letting survivors read portions of your story before publication, as it can lesson the impact of public exposure and help catch factual errors. After reading - and seeing evidence of your intentions - they may decide to share more of their story with you.
- Tell the whole story. Sometimes media identify specific incidents and focus on the tragic aspects of it, but reporters do well to understand that abuse might be part of a long-standing social problem, armed conflict, or part of a community history. Finding out how individuals and communities have coped with the trauma of sexual violence in the longer term may add helpful insight.
- If appropriate, direct the interviewee, viewers or readers to relevant resources and information about sexual violence. Links to these can be found on the Dart Centre website.
Re-check whether you risk compromising a source’s anonymity. In the final report, have you left clues that might inadvertently identify the individual? Job, age and location may allow for jigsaw identification. Faces or clothes may need to be obscured in photographs or film. | <urn:uuid:2530b904-fed6-4f4a-9db4-86871834301d> | CC-MAIN-2016-26 | http://dartcenter.org/content/reporting-on-sexual-violence | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395166.84/warc/CC-MAIN-20160624154955-00101-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.949064 | 1,519 | 2.765625 | 3 |
Welcome to New Muslims eLearning site. It is for new Muslim converts who would like to learn their new religion in an easy and systematic way. Lessons here are organized under levels. So first you go to lesson 1 under level 1. Study it and then take its quiz. When you pass it move on to lesson 2 and so on. Best wishes.
It is highly recommended that you register so that your quiz grades and progress will be saved. So first register here, then start with lesson 1 under level 1 and from there move on to the next lesson. Study at your ease. Whenever you come back to this site, just click on the "Take me where I reached" button (available only for registered users).
Jump to article tools
Fate of Non-Muslims
Description: The Islamic stance on the fate of non-Muslims, who came before and after the advent of Islam.
Published on 02 Jan 2012 - Last modified on 02 Jan 2012Printed: 227 - Emailed: 2 - Viewed: 9099 (daily average: 6)
· Islam, Eeman, Kufr, and Ahl ul-Kitab
· Islam, Eeman, Kufr, and Ahl ul-Kitab
· To learn about the Jews and Christians promised Paradise in the Quran
· To learn the correct meaning of two frequently misunderstood verses of the Quran
· To learn about the Islamic stand on the fate of non-Muslims
· Islam, momin, kufr, kafir, kuffar, Ahl ul-Kitab
The Jews and Christians Promised Paradise in Quran
The Jews and Christians promised Paradise in the Quran were Muslims who were true monotheists, practiced tawhid, believed in their prophets, did not commit shirk with Allah, but died before the prophethood of Muhammad, may Allah praise him. A frequently misunderstood verse of the Quran refers to them:
“Indeed, those who believe and those who are Jews and Christians, and Sabians (before Prophet Muhammad) – those (among them) who believed in Allah and the Last Day and did righteousness will have their reward with their Lord, on them shall be no fear, nor shall they grieve.” (Quran 2:62)
The scholars of Islam agree this verse is not talking about those who believe Jesus is the son of God, or equate Jesus to God, or those who believe Allah is poor and they are rich, or who reject Prophet Muhammad, may Allah praise him. This verse is talking about the original followers of Moses and Jesus who believed in their prophet and worshipped Allah alone, but passed away before the coming of Prophet Muhammad. In fact, the Quran contains a whole chapter, Surah al-Buruj (Quran, 85), which speaks of the Christian martyrs before the advent of Prophet Muhammad in the story of ‘the People of the Ditch.’
As for the verse:
“You will surely find the strongest among people in animosity to the believers to be the Jews and idolaters, and you will find the nearest in affection to the believers those who say: ‘We are Christians.’”(Quran 5:82)
The rest of the verse explains the correct meaning. It is referring to Christians who entered Islam, believed in Prophet Muhammad, and were affected by the teachings of the Quran. Scholars of the Quran say this verse was revealed regarding Negus and his associates who entered Islam when a group of persecuted Muslims migrated to Ethiopia from Mecca. The Prophet offered the funeral prayer for Negus in absentia when he passed away. In the past and even today mostly Christians enter into Islam. That is why Christians are said to be closer in love to the Muslims.
“That is because among them are priests and monks, and they are not arrogant. And when they listen to what has been sent down to the Messenger, you see their eyes overflowing with tears, for they recognize the truth. They say: ‘Our Lord! We believe; so write us down among the witnesses. ‘And why should we not believe in Allah and what has come to us of the truth? And we aspire that our Lord will admit us along with the righteous people.’ Allah rewarded them for what they said with gardens under which rivers flow, they will abide therein forever. Such is the reward of good doers. But those who disbelieved and denied Our revelations they are the companions of Hellfire.” (Quran 5:82-86)
The End of Non-Muslims
The Islamic stand on Jews, Christians, and other non-Muslims to be kafir does not mean every non-Muslim is consigned to Hell. The Ahl ul-Kitab in our times can be divided in two categories:
(I) Those to whom the message of Islam has reached, who know Prophet Muhammad, on whom God’s proof has been established, yet they have chosen not to believe in him. According to Muslims scholars, they are kafir in this world and after they die, they will reside in Hell-Fire forever if they die on disbelief, on rejection. Apart from the verses of the Quran quoted previously, the Prophet Muhammad, may Allah praise him, said:
“By Him in Whose hand is the life of Muhammad, he who amongst the community of Jews or Christians hears about me, but does not affirm his belief in that with which I have been sent and dies in this state (of disbelief), he shall be but one of the denizens of Hell-Fire.”
“When the Day of Resurrection comes a proclaimer will summon: Let every people follow what they used to worship. Then all who worshipped idols and stones besides Allah would fall into the Fire, till only the righteous and the sinners from those who worshipped Allah and others of the people of the Book are left. Then the Jews would be summoned, and it would be said to them: What did you worship? They will say: We worshipped 'Uzair, son of Allah. It would be said to them: You tell a lie; Allah had never had a spouse or a son. What do you want now? They would say: We feel thirsty, O our Lord! Quench our thirst. They would be directed (to a certain direction) and asked: Why don't you go there to drink water? Then they would be pushed towards the Fire (and they would find to their great dismay that) it was but a mirage (and the raging flames of fire) would be consuming one another, and they would fall into the Fire. Then the Christians would be summoned and it would be said to them: What did you worship? They would say: We worshipped Jesus, son of God. It would be said to them: You tell a lie; Allah did not take for Himself either a spouse or a son. Then it would be said to them: What do you want? They would say: we are thirsty, O our Lord! Quench our thirst, and they will also suffer the same fate.”
(II) The second category: those for whom the message of Islam did not reach, or it may have reached them but was distorted, or they did not hear about Prophet Muhammad, may Allah praise him. They will be tested on the Day of Judgment. Those who obey will be saved, those who disobey will be doomed.
As can be seen, the fate of the two will be different in life after death, but in this world both are considered kafir by agreement of Muslim jurists. What does it mean? First, it is obligatory to deliver the message of Islam to them. Second, Islam is the only true religion of all prophets with a universal plan of salvation; all other religions are false and unacceptable in the sight of Allah. Third, the regulations for non-Muslims apply to them. For instance, regardless whether the message of Islam reached a non-Muslim or not, a Muslim woman cannot marry a Jewish or a Christian man. Furthermore, they may not be buried in a Muslim graveyard. Their funeral prayer can not be offered by Muslims.
In conclusion, Islam is a universal religion. Its inclusiveness extends to the true followers of all prophets, including Moses, Jesus, and Muhammad. Yet, it is exclusive of those who distorted the pure teachings of the prophets, and who still choose to follow falsehood even after truth reaches them.
Also you may ask thru the live chat available here.
- Beginners Guide to the Quran (part 1 of 3)
- Beginners Guide to the Quran (part 2 of 3)
- Beginners Guide to the Quran (part 3 of 3)
- Beginners Guide to Hadeeth & Sunnah
- The Importance of Prayer
- Pre-requisites of Prayer
- Hygiene in Islam
- Bathing (Ghusl)
- Ablution (Wudoo)
- Performing Two Units of Prayer
- Performing Three Units of Prayer
- Performing Four Units of Prayer
- General Points About Prayer
- A Day in the life of a Muslim (part 1 of 2): From Waking up till late Morning
- A day in the life of a Muslim (part 2 of 2): From Noon to Bed
- Fate of Non-Muslims
- Repentance (part 1 of 3): Door to Salvation
- Repentance (part 2 of 3): Conditions of Repentance
- Repentance (part 3 of 3): Prayers of Repentance
- Can We See Allah?
- Preservation of Sunnah (part 1 of 4)
- Preservation of Sunnah (part 2 of 4)
- Preservation of Sunnah (part 3 of 4)
- Preservation of Sunnah (part 4 of 4)
- Eating – The Islamic Way (part 1 of 2)
- Eating – The Islamic Way (part 2 of 2)
- Simple Explanation of Quran’s Greatest Verse: Aaya tul-Kursi
- Wiping Over Socks, Making Up Prayers, and Prayer of a Traveler
- Charms and Amulets
- Conditions of the First Testimony (part 1 of 3)
- Conditions of the First Testimony (part 2 of 3)
- Fiqh of Salah for Beginners | <urn:uuid:59b3f427-cc23-4dd4-83cb-7351e07850c7> | CC-MAIN-2016-26 | http://www.newmuslims.com/lessons/77/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394605.61/warc/CC-MAIN-20160624154954-00033-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.946086 | 2,135 | 2.828125 | 3 |
- Prolonged sitting in a right angle position (static sitting) is bad for your health--proven by researchers to cause these problems:
- Loss of electrical activity in muscles which leads to a cascade of metabolic problems.
- Slouching, fatigue, loss of circulation.
- Diminishes the natural curve of the spine which compresses vertebral disks in lumbar.
- Loss of muscle tone and weight gain.
- Inflammation, joint stress, and repetitive use injury.
- Loss of productivity.
- The Stand Up Sit Down Eco Desk™ is one of our FOUR ALTERNATIVES to sitting: For more see Laptop Ergonomics: Footloose and Chairfree
- Sit Down OR Stand Up, depending on your energy level/prefereces at the time. Easily transition to different positions.
- Some Health Effects of Prolonged Sitting: (Excerpt from New York Times article)
- This is your body on chairs:
- 1-- Electrical activity in the muscles drops and 'the muscles go as silent as those of a dead horse,'
- 2-- Leading to a cascade of harmful metabolic effects.
- 3-- Your calorie-burning rate immediately plunges to about one per minute, a third of what it would be if you got up and walked.
- 4-- Insulin effectiveness drops within a single day.
- 5-- The risk of developing Type 2 diabetes rises. So does the risk of being obese.
- 6-- The enzymes responsible for breaking down lipids and triglycerides responsible for vacuuming up fat out of the bloodstream plunge
- 7-- Which in turn causes the levels of good (HDL) cholesterol to fall.
* Standing up solves the ergonomic problems of desk work, stimulates creativity, takes up less space than a standard desk.
* Normally laptop computers are exceptionally hard on the back, neck, wrists, and eyes because the keyboard, mouse and screen are at the same level.
This means that normally when using a laptop, one has to either stoop to see the screen, or raise the hands to use keyboard and mouse.
The Eco-desk™ solves these age-old ergonomic problems, taking the ergonomic downfalls of the laptop, and turns the laptop computer into a viable alternative to all day use as one's sole computer. Whether using a laptop or a standard computer with CPU, this stand up work station has a separate shelf for the screen, mouse and keyboard. The shelf with the mouse also works as a nice writing surface as well.
Sitting down is no longer a requirement for computer use!
The Eco-desk™ makes these creative activities more enjoyable because the stress of chair sitting is alleviated. Inspiration comes easier when breathing is deeper and unrestricted. Also, if your job requires you get up and down a lot, there will be no more of the 'down' part.
This earth-friendly, compact shelf is the perfect addition to any non-toxic office or home.
Built from recycled wood (Medex) and finished with non-toxic finish, the sleek Eco-desk™ knocks down and assembles in 5 minutes without any tools. | <urn:uuid:4e6648d3-c929-4577-a93c-9d7baa724bd5> | CC-MAIN-2016-26 | http://zafu.net/ecoshelf.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395160.19/warc/CC-MAIN-20160624154955-00015-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.898382 | 663 | 2.875 | 3 |
Just as Estonians today talk with some familiarity of Russian occupation, Americans too withstood a British occupation of their soil during the American War of Independence. For me, growing up as a kid on Long Island in New York, I routinely passed a cemetery that my father told me had been used as a fort by the British during their occupation of New York which began in August 1776, after the colonies declared their independence.
From September 1, 1776 until March 1783, Huntington endured six and one-half years of occupation by British troops. Although this period was marked by many hardships and indignities suffered by the local population, the most notable is widely acknowledged to be the construction of Fort Golgotha literally on top of the Town’s Old Burying Ground using timbers taken from the Old First Presbyterian Church..
British Colonel Benjamin Thompson (1763-1814) (later known as Count Rumford) ordered the Church dismantled on November 26, 1782 and the timbers used to construct the new fort. The dual desecration of the Town’s place of worship and its ancestral cemetery was further compounded by Col. Thompson’s forced enlistment of Town residents to provide the required labor. Local carpenters were put to work tearing down the church and the sides of other buildings in the vicinity, while other inhabitants were ordered to bring their spades and axes to prepare the burial ground for the new construction. As a further insult, Col. Thompson ordered the local militia, who had been forced into British service, to deliver these orders to the local populace
Now here's that bit about the British respect for the dead:
Over 100 tombstones were removed and the burial ground was leveled in preparation for the new fort. The dug up tombstones were used in construction of fireplaces, ovens, and floors within the fort. Tradition tells us that people employed around the fort saw the loaves of bread baked in these ovens with the reverse inscription of the tombstones of their friends on the bottom crust. The bread became known as “tombstone bread.” Construction of Fort Golgotha was completed in fifteen days.
Rev. Ebenezer Prime, the Old First Church’s third minister from 1723 to 1779 and an enthusiastic supporter of the American Revolution, had been buried in the Old Burying Ground in 1779. It is reported that when building the fort, Col. Thompson made sure that its exit was placed in front of the Rev. Prime’s grave so that he might have the pleasure of “treading on the old Rebel” whenever he departed or entered the fort.
In March 1783, just four months after disassembly of the Old First Church and construction of Fort Golgotha, the British troops evacuated Huntington. As his last act to aggravate Huntington’s townspeople, Col. Thompson burned all the wood in the area so that the inhabitants would have less to heat their homes during the remaining months of winter. The hated Fort Golgotha was subsequently torn down and the Old First Church reconstructed (in 1784) on the site where it still stands today.
Growing up, I may have been one of the few kids to know that the burial ground in town had once been torn apart to build a fort. Instead, I think most children knew the UK as the land of Mary Poppins and James Bond. It just goes to show you that even the most bitter of rivals are capable of putting things back together again. | <urn:uuid:c8186e19-084c-44e9-89cd-435e30097ad0> | CC-MAIN-2016-26 | http://palun.blogspot.com/2007/01/there-is-hope-for-estonian-russian.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783391634.7/warc/CC-MAIN-20160624154951-00114-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.980278 | 721 | 3.40625 | 3 |
LIMA, PERU (AP).- Tourists love the enigmatic Inca citadel of Machu Picchu high in Peru's Andes. They may love it too much.
As the country prepares to celebrate the 100th anniversary of the rediscovery of the "Lost City of the Incas" on Thursday, archaeologists are warning that a heavy flow of visitors and poor administration are threatening one of the wonders of the world.
The Incas built Machu Picchu atop an Andean peak 7,970 feet (2,430 meters) high, with a breathtaking view across the inhospitable abysses that surround it. Some experts believe it was a refuge for one or more Inca rulers, others that it was a religious sanctuary.
The site receives an average of 1,800 visitors a day and the maximum allowed by authorities is 2,500. Already, the former farming village of Aguas Calientes that is used as a jumping-off point for tourists has grown into a town of 4,000 inhabitants with five-star hotels and restaurants.
In some places, authorities have noticed soil erosion and damage to vegetation, Juan Julio Garcia, regional director of Peru's culture ministry, told The Associated Press.
Tourism companies and some local officials constantly pressure authorities to allow even more tourists, arguing it would benefit local communities.
Cultural guardians fear irreparable damages if the tourist flow surges, and they are especially concerned by official plans to build a highway to the remote 15th-century ruin.
Tourists now must reach Machu Picchu by foot or by a scenic, zigzagging narrow-gauge train ride.
"In one way or another, the train controls the flow (of tourists). There is a maximum capacity on the train and this maximum capacity determines how many people can reach the monument. In contrast, with a road, any person or tourism company can reach the site and try to enter the sanctuary," Garcia said.
But rains washed out the rail route in January 2010, trapping 4,000 tourists in the towns of Machu Picchu and Aguas Calientes for five days. Without road access to the area, the government had to airlift tourists out by helicopter. In Aguas Calientes, which serves as a tourist base for Machu Picchu, there were shortages of food.
In September, Peru's Congress approved construction of an access road to Machu Picchu.
That raised a red flag at UNESCO, which inscribed the Inca stronghold on its World Heritage list in 1983, boosting the site's fame and making it eligible for international technical support. The U.N. agency had already expressed concern about management of the site. It said in 2008 that there were "urgent problems with deforestation, the risk of landslides, uncontrolled urban development and illegal access to the sanctuary."
The U.N. agency threatened to put it on its list of endangered sites if the road project is not canceled, a move that would be a blow to Peru's prestige.
Peruvian tourism authorities insist they are protecting the monument. Carlos Zuniga, head of the Foreign Trade and Tourism office for the Cuzco region, said that officials have given UNESCO proof of concern for Machu Picchu by completing a plan for use of the sanctuary and by issuing a decree that funds generated by tourism to Machu Picchu be used in maintaining the site. Previously, earnings were sent to the central government in the capital, Lima.
Garcia, of the culture ministry, said local authorities support the highway project because they want to break the monopoly of PeruRail, the train company owned by Chilean and British interests. Aguas Calientes Gov. Antonio Sinchi Roca said the monopoly hurts the local economy. "Many entrepreneurs who could reach the zone don't because the cost of transportation is so high."
Machu Picchu was largely unknown to the outside world, abandoned and covered in highland jungle, until July 7, 1911, when Yale University historian and explorer Hiram Bingham reached Machu Picchu and later announced its existence. He became famous as the site's modern discoverer, though Peruvian Agustin Lizarraga had been there first. He wrote on one of the citadel's stones with a piece of charcoal: "Lizarraga, July 14, 1902, for posterity."
For decades, the site's remoteness, as well as the cost of reaching it, kept foreign tourists at bay. In the 1980s, visitors shunned Peru because of a raging guerrilla conflict that ended in 1999.
In 1991, about 77,000 tourists visited. That number has risen about tenfold over the past decade, reaching more than 800,000 in 2009, the year before the rail line washed away.
The director of Machu Picchu Archaeological Park, Fernando Astete, said the main problem facing the site today is that the area is controlled by rival municipal authorities contending for tourism dollars.
"Local authorities in and around the zone don't know what UNESCO is, they know nothing about it. They don't know they are in a protected area," Astete told The AP.
Many authorities view the citadel as "a marketing issue" and don't make decisions based on technical criteria about conservation of the site, Garcia said.
An example occurred in 2000, when a beer company was allowed to film a television commercial in Machu Picchu. The heavy arm of a crane used in the filming fell onto and damaged the emblematic Intihuatana Stone, which many believe to be sacred.
This didn't stop authorities from recently permitting the filming of dance scenes for the Bollywood movie "Endhiran" ("The Robot"), starring former Miss World Aishwarya Rai.
Peru's government had planned a big celebration in the ruins themselves for Thursday's anniversary, but called that off when UNESCO objected.
Copyright 2011 The Associated Press. | <urn:uuid:0beca89c-96e3-4a25-8e95-7e93a87ddfe2> | CC-MAIN-2016-26 | http://artdaily.com/news/48894/Peru-Celebrates-Inca-Citadel-of-Machu-Picchu-s-100th-Rediscovery-Anniversary-Amid-Tourism-Worries- | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395613.65/warc/CC-MAIN-20160624154955-00173-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.955727 | 1,216 | 2.703125 | 3 |
As a parent, you want what is best for your child. Every parent does.
Unfortunately, according to the American Heart Association, about one in three American kids is overweight or obese and experiencing weight-related diseases including Type 2 diabetes, elevated cholesterol and high blood pressure.
This statistic scares me, really scares me. It means that we're potentially setting children up for poor confidence and depression related to their weight, and potentially an earlier death.
The other difficulty is the lack of conclusive recommendations on how to treat high cholesterol in children. The American Academy of Pediatrics recommends treating high cholesterol in children with prescription drugs, such as statins, for children age 8 and older if a child has a high level of low-density lipoprotein (LDL, or "bad") cholesterol. Unfortunately, according to the Mayo Clinic, many doctors disagree that cholesterol-lowering drugs are an appropriate treatment, since little research has been done on the safety and effectiveness of these drugs in children.
Again, as a parent, you always want what's best for your child, and with the crazy schedules of school and extracurricular activities that kids have, some nights it's a major feat just getting dinner to the table. You can take it up a notch in simple ways, even on the craziest nights, to work on preventive care for your kids' heart health.
Heart healthy food kids will eat
Kids hear "no" from us all the time. It makes me think of the silly kids book, "No, David!" that I read to my 3-year-old about 20 times on Sunday. Encouraging heart healthy eating with your kids doesn't need to always be about saying "no" to greasy unhealthier foods. Instead, you can start with focusing on how they can include foods that will promote a stronger heart.
First and foremost, when you think of heart health, think whole foods. Fresh fruits and vegetables help protect blood vessels by wiping out free radicals. Think about stepping away from dependence on granola bar type foods as snacks and instead encourage your kids to grab produce/protein snacks.
Here are some examples of easy snacks to have ready for kids to grab:
• 15 grapes OR tennis-ball sized piece of fruit plus 12 almonds OR 25 pistachios
• 1 cup mixed fresh berries or ½ cup canned fruit packed in its own juice plus 1 string cheese
• 1 mini box raisins with 12 almonds
• Fruit parfait: ½ cup plain Greek yogurt, ½ cup berries, ¼ cup granola cereal
• Half banana with 2 teaspoons peanut butter
• 1¼ cup whole strawberries and 1½ ounces reduced fat hard cheese
In addition to encouraging whole food snacks, here are three additional foods that, with a little preplanning in your grocery shopping, you can begin immediately adding to your kids' diet.
• Ground flaxseed. Flaxseed is naturally high in omega-3 fatty acids, fiber, and phytoestrogens which all protect the heart -- to get these benefits, the flaxseed must be ground. The best part of ground flaxseed is that it's easy to hide in a multitude of foods. Consider sprinkling it in yogurt in the morning, stir it into cottage cheese with fruit, or even bake it into muffins and cookies.
• Almonds. If you asked me for one food to add for heart health, I'd immediately respond almonds because they are overflowing with heart-protective components: omega-3 fatty acids, vitamin E, fiber, phytoesterols and mono- and polyunsaturated fats. Easy ways to add these to the diet is to mix them into trail mix, stir into yogurt with berries for a parfait, or pair it with a fresh fruit for snack.
• Dark chocolate. Yep, you read it correctly. Offer your kids a little chocolate. And you thought heart healthy couldn't be fun! But, make sure that it is dark chocolate and has a 70 percent or higher cocoa content. This chocolate gives you the benefit of reservatrol and cocoa phenols, which are heart protective.
Enjoy your month and love your heart!
Contact me: If you have any feedback, comments or questions on this topic or others, I would love to hear from you! Email [email protected] with all your thoughts.
• Christina Fitzgerald, a registered dietitian and licensed dietitian nutritionist, is the owner of Nourished, Nutrition and Wellness, nourishedliving.com. She lives with her husband and three young sons in the Northwest suburbs.n | <urn:uuid:a94812e1-317e-4acb-87a3-6b600bc88f2d> | CC-MAIN-2016-26 | http://www.dailyherald.com/article/20140220/entlife/140229982/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783403508.34/warc/CC-MAIN-20160624155003-00054-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.940036 | 947 | 2.65625 | 3 |
|Almanac of Policy
Home : Policy Archive : Search
Questia: Search over 400,000 books and journals at Questia online.
FastWeb Free Scholarship Search: Find free money for college or an advanced degree.
U.S. Congressional Budget Office
The Pros and Cons of Pursuing Free-Trade Agreements
The Recent Increased Emphasis on Free-Trade Agreements
The first U.S. free-trade agreement, which was with Israel, went into effect on September 1, 1985; the second, with Canada, took effect on January 1, 1989. Exactly five years later, NAFTA went into effect, creating a free-trade area encompassing the United States, Canada, and Mexico.
More recently, the United States' pursuit of FTAs has intensified. A free-trade agreement with Jordan went into effect on December 17, 2001. Negotiations for free-trade areas with Singapore and Chile, begun in December 2000, have been completed, and the resulting agreements are awaiting final approval and implementation by the respective governments. Negotiations were recently launched for a free-trade area encompassing the United States and five Central American countries--Costa Rica, El Salvador, Guatemala, Honduras, and Nicaragua--with the goal of completing the talks by December 2003. Negotiations for a Free Trade Area of the Americas--comprising 34 countries of the Western Hemisphere (including Chile and the Central American countries listed above)--are also ongoing, with the aim of completion in 2005.
On October 26, 2002, the Administration announced the Enterprise for ASEAN Initiative, the goal of which is to negotiate a number of bilateral FTAs with other members of the Association of Southeast Asian Nations (ASEAN) patterned after the agreement with Singapore. No negotiations have been announced, but likely initial candidates for agreements include the Philippines, Thailand, Indonesia, and Malaysia.
On November 5, 2002, the Office of the U.S. Trade Representative notified the Congress of the Administration's intent to negotiate a free-trade agreement with the members of the Southern African Customs Union: Botswana, Lesotho, Namibia, South Africa, and Swaziland. Eight days later, the office notified the Congress of its intent to negotiate an agreement with Australia. On January 21, 2003, the United States and Morocco announced their intention to negotiate a free-trade agreement, and on May 21, 2003, the United States and Bahrain announced such an intention. U.S. Trade Representative Robert Zoellick said: "A U.S.-Bahrain FTA could serve as a regional anchor for the Gulf, facilitating economic integration and reforms, and leading toward the eventual goal of a Middle East Free Trade Area."(1)
In 2002, the countries with which the United States had free-trade agreements--Israel, Canada, Mexico, and Jordan--received 37.2 percent of U.S. exports and provided 31.0 percent of U.S. imports. Adding in all of the countries covered by FTAs that have been negotiated but not yet approved, for which negotiations are under way, or for which the intent to negotiate has been formally announced would raise those numbers to almost 50 percent of U.S. exports and nearly 40 percent of U.S. imports in 2002 (see Table 1).
The Benefits of Multilateral Trade Liberalization
The long-standing U.S. policy of supporting multilateral trade liberalization is consistent with well-established conclusions from economic reasoning and empirical evidence about the benefits of trade to all participating countries.
Benefits from Increased Exports and
Irrelevance of the Balance of Trade
Whatever concern that trade balances merit (which normally is very little) relates to a country's balance with the world as a whole--not its balance with any one country--and trade agreements usually do not have much effect on the U.S. balance of trade with the world. By an accounting identity, the trade balance with the world as a whole (specifically, the current-account balance) is equal to the difference between aggregate saving and gross domestic investment. Hence, for a trade agreement to have much effect on the trade balance, it would have to significantly alter either aggregate saving or gross domestic investment. Only substantial changes to barriers that affect large amounts of U.S. trade and investment (relative to the size of the U.S. economy) might do that.
Even if an agreement were to significantly
worsen the U.S. balance of trade with the world, that would not undermine
the benefits of the agreement. Trade deficits with the world are not
generally harmful, and trade surpluses are not generally beneficial. CBO
examined the U.S. trade deficit with the world in a March 2000 report and
concluded that such deficits normally have a small positive effect on
gross domestic product (GDP) and little if any effect on aggregate
employment (although some redistribution of employment among industries
may occur, and some individual workers may be made better or worse off).(3)
The Benefits of Free-Trade Agreements
The analysis of FTAs is a little more complicated than that of multilateral trade liberalization. The rules of the WTO (and before that of the GATT) stipulate that, except in relation to free-trade areas, countries may not impose a higher tariff against one member country than against another, and any reduction in a country's trade barriers must apply equally to imports from all other member countries.(4) Accordingly, any reduction in a country's trade barriers will benefit the competitiveness of all imports equally, and any resulting growth in imports from a given foreign country will displace domestic production and not displace imports from other countries.
In the case of an FTA, however, the reductions in trade barriers increase the competitiveness of imports from the other parties to the agreement not only relative to domestic production but also relative to imports from other countries. Consequently, any resulting rise in imports from parties to the agreement may displace either domestic production or imports from other countries. Economists refer to the displacement of domestic production as trade creation because it results in a net increase in trade. They call the displacement of imports from other countries trade diversion since it does not increase trade overall but rather amounts to a diversion of existing trade.
The distinction between trade creation and trade diversion is important because the former is more likely than the latter to produce a net economic benefit. Although trade creation may hurt some sectors, it is almost always economically beneficial overall because it occurs only when the price of the import in question is lower than the domestic cost of producing the same good. Trade creation therefore allows the domestic economy to obtain the good at a lower cost than would be possible without trade.
Trade diversion is less likely to be beneficial to the importing country (in this case, the United States) in the aggregate, although some sectors are still likely to gain from it, because it results in the import's being obtained at a higher cost to the economy. The reason is that an import's cost to the economy is different from its cost to a domestic purchaser: the cost to the domestic purchaser equals the foreign country's selling price plus any tariff imposed on the import, whereas the cost to the economy equals the foreign country's selling price only. The tariff paid by the purchaser constitutes U.S. government revenue and therefore remains with the U.S. economy rather than going to the foreign economy.
As an illustration, suppose that before NAFTA went into effect, a particular product was imported from Chile and not Mexico, but that after NAFTA, because of the elimination of tariffs on Mexican goods, the same product was imported from Mexico and not Chile. The fact that the good was imported from Chile before NAFTA means that the price to U.S. purchasers was lower for the Chilean good than for the Mexican good. Since U.S. tariffs on the product were the same for both countries, the foreign country's selling price--the cost to the U.S. economy--must have been lower for the Chilean good than for the Mexican good. The implementation of NAFTA did not change that fact; the cost of the Chilean good to the U.S. economy remained lower than the cost of the Mexican good. However, the elimination of the tariff on the Mexican good meant that U.S. purchasers faced a lower price for that product than for the Chilean one, which was still subject to the tariff, so they bought the Mexican good even though its cost to the economy was higher.
In general, one would expect an FTA to
result in some amount of both trade creation and trade diversion. If the
trade diversion was sufficiently large relative to the trade creation, the
agreement could conceivably end up being slightly harmful to the United
States rather than beneficial (although, interestingly enough, the harm
would come from imports that did not cause the pain of dislocating
production by domestic industries). However, as more and more FTAs are
negotiated, the later agreements become less and less likely to divert
trade and more and more likely to reverse the trade diversion that
resulted from earlier agreements. Returning to the example above, if NAFTA
caused a rise in imports from Mexico at the expense of imports from Chile,
the subsequent free-trade agreement with Chile would reverse that
diversion of trade and eliminate the resulting harm. Ultimately,
negotiating individual FTAs with all countries would eliminate all trade
diversion and leave only trade creation--just as would happen if free
trade with all countries was negotiated multilaterally in the WTO--and the
United States and all other countries would benefit.(5)
Likely Effects of Future Agreements
The effects of current FTAs shed some light on the likely effects of the proposed new agreements. The Congressional Budget Office recently analyzed the effects of NAFTA over its first eight years using a statistical model of U.S.-Mexican trade.(6) That model indicated that by 2001 (eight years into the agreement), NAFTA had increased U.S. exports to Mexico by only 11.3 percent ($10.3 billion, or 0.12 percent of U.S. GDP) and had increased U.S. imports from Mexico by only 7.7 percent ($9.4 billion, or 0.11 percent of U.S. GDP). According to the model, the agreement had almost no effect on the U.S. trade balance with Mexico, and what little effect it did have was positive in most years--a $0.9 billion increase (or 0.01 percent of GDP) in 2001. On the basis of those estimates and the results of other studies in the economics literature, CBO estimated that the expanded U.S.-Mexican trade resulting from NAFTA increased annual U.S. GDP by a small amount-- probably a few billion dollars or less.
The countries with which the United States is negotiating or considering FTAs have much smaller trade with the United States than Mexico does (see Table 1). Further, unlike Mexico, those countries do not share a border with the United States. Consequently, transportation costs for trade with those countries are higher, and it is unlikely that production-sharing arrangements with those countries will develop to the extent that they have across the U.S.-Mexican border. Therefore, given the results of NAFTA, one would expect the net effects on the United States of the proposed free-trade agreements to be positive but extremely small. Even the temporary disruptions to employment that would result from increases in imports that compete with domestic production should be very small.
The effects of the FTAs on the economies of
the partner countries are likely to be much larger, however, because those
countries have much smaller economies than the United States does. The
NAFTA-induced increase in U.S. exports to Mexico by 2001 indicated by the
CBO model, although trivial in comparison to the U.S. economy, equaled 1.9
percent of Mexican GDP. Likewise, the NAFTA-induced increase in U.S.
imports from Mexico by that year equaled 1.7 percent of Mexican GDP. The
disparity in size between the U.S. economy and the economies of many of
the countries for which free-trade agreements have been proposed is even
larger than that between the U.S. and Mexican economies. Thus, the
benefits to those economies relative to the benefits to the U.S. economy
are likely to be even larger than was the case for Mexico with NAFTA.
Moreover, the economies of many small developing countries are less
diversified than the U.S. economy, producing one or two main products for
export. An agreement allowing those products into the United States would
be of tremendous benefit to such a country's economy.(7)
Reasons for and Against the Pursuit of Free-Trade Agreements
One reason for the recent U.S. pursuit of FTAs is that progress in multilateral trade negotiations has become more difficult. The increasingly large membership of the GATT/ WTO over time means that more countries must reach agreement in each subsequent round of negotiations. The newer members are generally developing countries that see their interests as being different from those of the United States and other industrialized countries that were more dominant in the earlier rounds. In addition, one might expect countries to agree first (that is, in early negotiating rounds) to eliminate their least politically sensitive trade barriers, leaving the more sensitive ones for later rounds and consequently making those later rounds more difficult. The current Doha Round of WTO negotiations had an original goal of completion by January 1, 2005. However, the EU's resistance to compromise on the politically difficult issue of its agricultural policy and the United States' resistance to compromise on its antidumping policy have dimmed prospects for timely completion of those talks. Free-trade agreements allow progress in trade liberalization to continue with countries for which those issues are not important stumbling blocks.
The negotiation of FTAs by the United States could also help to stimulate progress in the WTO talks. Over the years, the U.S. economy has grown substantially faster than the Japanese and European economies have, and countries resisting compromise in the Doha Round will not want to have their exports to the United States diverted by exports from countries with which the United States negotiates free-trade agreements. The prospect of such diversion could put pressure on countries to make concessions to achieve an agreement in the Doha Round or to negotiate their own FTAs with the United States.
Foreign policy constitutes a second reason for the United States to seek FTAs. Because the proposed free-trade agreements would be of substantial benefit to the economies of small developing countries while having little effect on the U.S. economy (and a beneficial effect at that), they provide a relatively easy way for the United States to help such countries.
The 1985 free-trade agreement with Israel was of value to the United States almost entirely for reasons of foreign policy. FTAs (or the prospect of them) with other Middle Eastern countries also have value for the United States as a tool for stabilization and development and as a carrot in foreign-policy negotiations. An FTA with the members of the Southern African Customs Union would aid the development and stability of a number of extremely poor countries.
Foreign policy was also part of the motivation for NAFTA. Although Mexico was a relatively large U.S. trading partner, a number of people argued that the agreement would have only a small effect on the U.S. economy but would help secure the large amount of trade and other economic liberalization that Mexico had enacted over the previous decade.
Opinion in favor of pursuing free-trade agreements is by no means unanimous. Some critics worry that FTAs might divert the world away from multilateral trade liberalization and lead to the development of large, competing trading blocs--the United States and the Western Hemisphere, the EU and nearby countries, and Japan and its trading partners in Asia and the Pacific Rim--a result that would be inferior to multilateral free trade. Critics also note that the large size of the U.S. economy and its consequent desirability as a market give the United States a great advantage in negotiations with individual countries, especially small developing ones. The same is true for FTAs negotiated by the EU or Japan. The result of such unequal bargaining power can be that significant trade restrictions by the large countries remain in place that would more likely be eliminated under circumstances of more-equal negotiating power.
Further, if small countries individually negotiate disproportionate concessions in FTAs, it may be difficult to rectify the situation multilaterally in WTO talks because the small countries will no longer have anything of substantial interest to trade away to the large countries in exchange for the latter eliminating their remaining significant barriers. Critics argue that if negotiations were instead to remain in the WTO with no free-trade agreements, the small countries could band together to increase their bargaining power. The result would be a more equal--and quite likely closer to total--elimination of trade barriers, which would benefit all countries. That argument assumes that progress in multilateral trade talks will eventually occur.
Supporters of pursuing FTAs could argue that the EU has already negotiated a number of such agreements with various trading partners and that, consequently, refusal by the United States to negotiate such agreements would not stop any tendency that might exist toward the development of trading blocs. Instead, it only leaves the United States out of the opportunity to have more trade in its own bloc.
In summary, economic reasoning alone cannot determine whether FTAs are an advisable path to take to an eventual goal of multilateral free trade. Foreign policy and tactical considerations are also important. Multilateral free trade is the most desirable trade policy from the standpoint of overall U.S. economic productivity and efficiency. FTAs are similarly beneficial, but to a lesser degree, provided that they do not result in too much trade diversion (and, as noted earlier, trade diversion disappears as more countries are covered by such agreements).
This document is not necessarily endorsed by the Almanac of Policy Issues. It is being preserved in the Policy Archive for historic reasons.
|U.S. Trade in 2002 with Countries of Current and Proposed Free-Trade Agreements|
to Country as
of Total U.S.
from Country as
of Total U.S.
|Agreements Already Implemented|
|U.S.-Israeli Free Trade Agreement||5.3||12.4||0.8||1.1|
|U.S.-Canadian Free Trade Agreement||142.5||210.5||22.6||18.2|
|North American Free Trade Agreement (Mexico only, excluding Canada)||86.1||134.1||13.7||11.6|
|U.S.-Jordanian Free Trade Agreement||0.4||0.4||*||*|
|Agreements Negotiated but Not Yet Ratified|
|U.S.-Singaporean Free Trade Agreement||14.7||14.1||2.3||1.2|
|U.S.-Chilean Free Trade Agreement||2.3||3.6||0.4||0.3|
|Agreements Under Negotiation or for Which Intention to Negotiate Has Been Announced|
|U.S.-Central American Free Trade Agreement|
|Free Trade Area of the Americas (Excluding Canada, Mexico, Chile, and Central America)|
|Antigua and Barbuda||*||*||*||*|
|St Vincent and Grenadines||*||*||*||*|
|Trinidad and Tobago||1.0||2.4||0.2||0.2|
|U.S.-Southern African Customs Union Free Trade Agreement|
|U.S.-Australian Free Trade Agreement||12.3||6.4||2.0||0.6|
|U.S.-Moroccan Free Trade Agreement||0.6||0.4||*||*|
|U.S.-Bahraini Free Trade Agreement||0.4||0.4||*||*|
|All Current and Proposed Free-Trade Agreements|
|Total Trade for All of the Above||310.7||450.4||49.4||39.0|
|Source: Congressional Budget Office based on trade data from the U.S. Bureau of the Census.|
|Notes: The numbers for exports are free-alongside-ship values, and the numbers for imports are customs values. Numbers may not add up to totals because of rounding.|
|* = less than $0.1 billion or 0.1 percent.| | <urn:uuid:16741368-d841-44cd-9ca6-8b9641330b08> | CC-MAIN-2016-26 | http://www.policyalmanac.org/economic/archive/free_trade_agreements.shtml | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396887.54/warc/CC-MAIN-20160624154956-00070-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.946116 | 4,259 | 2.609375 | 3 |
Definition of 'Housing Starts'
At the peak of the housing bubble in January 2007 housing starts were around 1.5 million units. Two years later they were down to a third of that at around 500 thousand.
Housing starts are defined as residential building projects where the excavation of the foundations for the building has begun.
The figures posted for the housing starts will have an inverse effect on bond prices which will rise when housing starts fall and fall when housing starts rise.
Due to the number of industries that the house building sector touches, this indicator is closely watched as a leading indicator for sales in other sectors such as DIY and appliance stores. Index futures traders will also pay careful attention to this figure as it will impact the stock market as a whole.
Do you have a trading or investing definition for our dictionary? Click the Create Definition link to add your own definition. You will earn 150 bonus reputation points for each definition that is accepted.
Is this definition wrong? Let us know by posting to the forum and we will correct it. | <urn:uuid:d37f60f9-fd58-42d6-8f11-0d69bbfdcbd5> | CC-MAIN-2016-26 | http://www.mypivots.com/dictionary/definition/276/housing-starts | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783397749.89/warc/CC-MAIN-20160624154957-00147-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.97032 | 211 | 3.03125 | 3 |
On a recent game drive in northern Tanzania, in eastern Africa, our driver pulled to a stop next to a group of acacias decked out like Christmas trees. Hundreds of five-inch grass spheres decorated the branches.
Along with students from a Hope College biology class, I gazed in wonder at the nests of the Red-billed Quelea, a sparrow-sized weaver that breeds in colonies. As many as 400-500 of its nests can hang in a single tree. Colonies can contain millions of nests and cover several hundred hectares — almost unbelievable! (A hectare is equivalent to 2.5 acres.)
The male is quite handsome. During the breeding season, he wears red, sometimes yellowish, feathers on his crown, neck, and breast and sports a black mask around a thick red bill. Non-breeding males and females have a cryptic tan plumage. The species is widely distributed in sub-Saharan Africa but absent from west-central rainforests.
The onset of prolonged rains at the beginning of the wet season, usually in November, stimulates breeding. Because colonies are so densely packed, the birds begin nesting at the same time, and all stages are virtually synchronous.
Each male starts building his hanging nest but doesn’t complete it. Instead, when construction is about half-finished, he sings and displays to attract a female. If one comes and accepts him, they pair, and she helps complete the nest.
The colony we were observing was in the late stages of feeding nestlings and at the beginning of fledging. The scene was chaotic: Adults flew in with food while nestlings gaped and older nestlings stood on nests. Some young queleas even made their first short flights.
Besides stimulating breeding, the rains also cause important food sources to become available at the right time. Caterpillars, grasshoppers, and other insects — main food items for young queleas during the first few days after hatching — continue their development and emerge from the soil. Then the adults bring milky seeds from developing grass plants that germinated with the early rains. After fledging, the youngsters leave their parents early and become independent, feeding on grass seeds.
Red-billed Quelea is an opportunistic species that relies on rainfall for its breeding season, rather than temperature or photoperiod. And when the rains continue, so do the nesting queleas, sometimes bringing off four broods. The rains also affect the juveniles. While they typically become reproductively active at the age of one year, if the rains continue long enough, the youngsters may breed as early as nine months. All of this adds to the great reproductive potential of the species.
Queleas form dense, highly synchronized flocks that, from a distance, look like clouds of smoke. As a flock flies closer, the birds’ wing-beats sound like high wind. It is common for people who observe a large flock rise from the ground to insist that a grass fire is developing. Flocks have been reported in the tens of millions. It is believed that quelea populations grew 10- to 100-fold beginning in the 1970s, when farmers started devoting more and more acres to millet and other cereal crops.
Queleas have many natural enemies, including herons, storks, hawks, owls, hornbills, rollers, kingfishers, shrikes, and corvids as well as snakes, lizards, and several small mammals, but predation hasn’t put a dent in the population.
Red-billed Quelea has been an agricultural pest for centuries. In fact, paintings in the tombs of pharaohs show farmers cracking whips to scare off queleas.
“Its main characteristic is that it occurs in extremely big numbers,” says retired biologist Clive Elliott, who worked with the species during most of his 31 years with the United Nations Food and Agriculture Organization. “Nomadic super colonies can grow to millions of birds, making queleas not only the most abundant bird in the world but the most destructive.”
Two million birds can eat 20 tons of grain a day, Elliott says. Since the adult population is estimated to be 1.5 billion (2009), FAO estimates annual agricul- tural losses of $50 billion.
Planters of small farms are especially vulnerable because a large quelea flock can wipe out their fields quickly. Growers commonly respond by becoming human scarecrows. They walk through their fields banging pots and hollering. It’s effective, but they have to do this all day for a month.
Government agencies spend millions trying to control the queleas. A common method is to spray night roosts with fenthion, a controversial organophosphate insecticide that it is highly toxic to birds. (It was removed from the market in the United States in 2004.) A second method is to detonate a mixture of dynamite and diesel fuel under a roost. The huge blast rises up, killing most birds instantly. Both techniques dispatch non-target species along with millions of queleas each year but do not appear to reduce the overall population significantly.
Red-billed Quelea’s preference for grass seeds, including domestic cereal crops, makes it a nemesis to farmers throughout sub-Saharan Africa. But its sheer numbers — whether at water holes, in trees, in the air, or in nesting colonies — will overwhelm and amaze you. — Eldon Greij
Eldon Greij’s column “Amazing Birds” appears in every issue of BirdWatching magazine. Subscribe. This article appeared in the October 2014 issue. Eldon is professor emeritus of biology at Hope College, located in Holland, Michigan, and the founding editor of Birder’s World magazine.
Read additional columns by Eldon Greij
What every birder should know about bird poop.
Bird’s varied and surprising mating strategies.
The amazing way birds breathe.
The muscles and bones that enable flight.
CHISELS AND TONGUES
Why woodpeckers can hammer without getting headaches.
THE MYSTERY OF ANTING
The behavior is common and fascinating but not often seen.
Why birds-of-paradise have gaudy plumage and extravagant displays. | <urn:uuid:d994045f-be7d-4876-972e-6afd8bfd8baa> | CC-MAIN-2016-26 | http://www.birdwatchingdaily.com/blog/2014/08/21/eldon-greij-describes-the-most-abundant-bird-in-the-world/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783395992.75/warc/CC-MAIN-20160624154955-00138-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.945887 | 1,322 | 3.6875 | 4 |
Defense contractor SPAWAR System Center Pacific has developed a system that turns a stream of seawater shot into the air into a functional antenna:
As the pillar of water is squirted through the current probe, a magnetic field is created and signal comes through to a hooked-up communication device.
Plus, depending on the height of the stream of water, you can get UHF, VHF and HF broadcasts, all from the same jet of H2O. You can even set up multiple jets of water, at different heights, to broadcast on different bands simultaneously. Handy.
The idea could prove particularly useful for ships, which struggle to find room for all the antennas on board. US Navy ships already have upwards of 80 antennas on deck, meaning real estate for extra towers is hugely limited. Instead, the sea water device can be placed anywhere on the deck.
Link via Ace of Spades HQ | <urn:uuid:2fb22e94-15e8-44e3-b169-61a95fd660ca> | CC-MAIN-2016-26 | http://www.neatorama.com/2010/11/11/antenna-made-of-seawater/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398516.82/warc/CC-MAIN-20160624154958-00083-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.943228 | 184 | 2.8125 | 3 |
question markITU-T: question mark; ques. Rare: whatmark; INTERCAL: what; wildchar; huh; hook; buttonhook; hunchback. Question mark is used, along with colon for C's lazy triadic "if" operator (similar to the IIF function in Visual Basic). The expression x?y:z evaluates x, then if x is true it returns y else it returns z. In Unix shell file name patterns, question mark matches any single character.
Last updated: 2003-06-17 | <urn:uuid:48ad791e-57aa-47c2-8592-d87960ea2501> | CC-MAIN-2016-26 | http://foldoc.org/ques | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783404405.88/warc/CC-MAIN-20160624155004-00121-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.711696 | 113 | 2.75 | 3 |
My daughter is almost three years old, and she currently has a fascination with dirt—the dirtier, the better.
She can literally spend hours playing in the dirt, moving it around, making dirt cakes and mud pies, and covering herself in earthy brown goodness. I suspect she is not alone in her fascination; it seems that both boys and girls are drawn to play with dirt from the youngest of ages.
At our home, there have been a few observers who objected.
“Yucky! Don’t play in the dirt!”
I simply smile and say, “That’s what childhood is for—getting dirty. It’s good for her.”
And believe it or not, it is good for her—body and soul.
Dirt: It does a body (and soul) good
Here are just five ways (of many) that dirt can benefit your children.
1. Did you know that studies have shown dirt is good for your brain? There are types of bacteria naturally found in soil that activate the neurons that produce serotonin, a key chemical in many bodily functions, as well as a natural anti-depressant.
In other words, dirt can actually help make you feel happy. (And I’m not just talking about the mud wraps at the day spa.)
2. Dirt is also great for the immune system, especially in children. Research has shown that early exposure to naturally occurring microbes in soil will help build stronger, more disease-resistant kiddos.
In our germaphobic culture where we have entire aisles of cleaning products at the grocery store, some children are being raised in overhygienic conditions. Without enough exposure to different bacteria and microbes, the immune system doesn’t learn to recognize its own cells, and this could be a reason for higher rates of asthma, eczema, and other diseases.
3. If you’ve read The Last Child in the Woods, you’re familiar with the term “nature-deficit disorder.” In our technologically savvy generation, kids just aren’t getting enough time to play outside, and that has now been linked to attention disorders, depression (yes, in children), and obesity.
4. Children who play outside laugh more, which means they’re happy! It also means their blood pressure and stress levels are lower.
5. Kids who play outside grow in their character development: they become more adventurous, more self-motivated, and they are better able to understand and assess risk.
How to get dirty
Grown-up or child, playing in the dirt is good for the soul as well as the body.
Here are some ideas for your children:
• Give your younger child a bucket and a shovel and set them in the dirt. See what happens. They’ll probably be in heaven.
• Garden with your kids! We’ve got lots of gardening tips, and Tsh has three suggestions for gardening with kids. You can create a separate little garden for your children, too (if your child is really young, you don’t even need to plant anything in it; they’ll just love a dirt plot of their own).
• Explore nature with your children: study insects, leaves, wildflowers, rocks. Start a nature collection. Take hikes. Wade in creeks. Go on picnics. DON’T clean their hands with antibacterial wipes before you eat. A little water and soap will do.
Considering all the benefits of playing in the dirt, it sounds like a great idea for us grown-ups to get outside and join our children. | <urn:uuid:f585356c-9f6b-43b1-af75-dfd5dd426788> | CC-MAIN-2016-26 | http://theartofsimple.net/let-your-kids-get-dirty/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396222.11/warc/CC-MAIN-20160624154956-00130-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.959221 | 769 | 2.890625 | 3 |
THE universe is expanding at a rate comparable to a rollercoaster, according to scientists who have mapped the galaxies for the first time as they were 11 billion years ago.
Astronomers at the University of Portsmouth have been involved in a project examining how the universe has evolved since the big bang occurred 13.75 billion years ago.
The study has now mapped the universe as it was in its youth, three billion years after it was formed.
Dr Mat Pieri, Marie Curie research fellow at the university and co-author of the study, said the universe’s growth when it was young was slowed by the effects of gravity but in the past five billion years it has begun to rapidly expand because of a mysterious force, which scientists call dark energy.
Dr Pieri likened this slow rise then rapid expansion to a rollercoaster.
He said: ‘If we think of the universe as a rollercoaster, then today we are rushing downhill, gaining speed as we go.
‘Our new measurement tells us about the time when the universe was climbing the hill, still being slowed by gravity. It looks like the rollercoaster crested the hill just about seven billion years ago, and we’re still going.’ | <urn:uuid:30591f47-6ed4-4bae-ad76-67c82f75a00b> | CC-MAIN-2016-26 | http://www.portsmouth.co.uk/news/education/universe-expands-at-rate-of-a-rollercoaster-1-4470548 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783393518.22/warc/CC-MAIN-20160624154953-00158-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.974546 | 256 | 3.796875 | 4 |
Caucasians: The indigenous population of the Caucasus region in southeastern European Russia , including Armenians, and Georgians amongst others.
Chahar Mahal & Bakhtiyari: A province in Iran in the central Zagros area. It borders Isfahan, Boir Ahmadi & Kuhgiluya and Luristan provinces. It is inhabited by many Bakhtyari, but has a mixed population including, Kurds and Turkish speaking groups and Persians.
Chahar Shanbeh Suri ( Jumping Over the Fire): This festival originally has been a purification rite and part of an ancient ancestor cult. It is one of the most popular national festivals in Iran. It is celebrated on the last Tuesday of the year. At sunset, all Iranians will jump over bon fires and continue festivities with music, feasts and celebrations.
Chaldiran Battle: In 1514, the Ottoman ruler Sultan Selim I, launched a battle against Shah Ismail I. He won in a decisive victory and Iran lost control of eastern Anatolia. Chaldiran is located in northeast of Lake Van in eastern Anatolia (the Asian part of Turkey).
Chamishkazaklu: A Kurdish group from Anatolia and Caucasia. They were resettled by Shah Abbas the Great in northern Khurasan in the early 1600s.
Chorasmia (Khwarazm): An ancient Persian province, the area is located in present day Uzbekistan, and has been on and off part of the Iranian territories. In the Avestan Gathas it is the country where its’ king protects Prophet Zoroaster.
Dailamite: An Iranian group occupying the Dailam region in Caspian area. They resisted both Arabs and Turks for centuries.
Drangiana (Sakastana, > Sistan): Home to the ancient Iranian tribes Sarangians or Drangians, it occupied modern Sistan in eastern Iran. Under the Greek occupation, the Sacae nomadic tribes of Central Asia invaded it constantly, and eventually gave their name Sacastane (Sistan) to the region.
Dravidian languages: A family of around 23 languages that is unrelated to any other known language family. Presently the Dravidian languages are spoken in India and Sri Lanka. The name also applies to the peoples of south and central India, and north Sri Lanka.
Elam: The coastal regions along the northern shore of the Persian Gulf, from what is now Kuwait to the Straits of Hurmuz. The ancient kingdom of Elam with Susa as its capital was the earliest urbanized center in Iran, and has been inhabited extensively from 3300 BC.
Farah Diba (Pahlavi): Muhammad Reza Shah’s third wife. She played a major role in
the cultural and political life of Iran. She was the first queen in Middle East to participate extensively in public affairs and became a role model for other First Ladies in the area. She was publicaly crowned and appointed regent by the parliament. This was the first time a woman was officially granted such a position.
Fars (Parsua): The ancient province inhabited by Persians who gave their name to the area that comprises present day Fars. The geographical boundary contains a series of steps leading from the Persian Gulf to the central deserts of Iran.
Feast of Sacrifice (Id-e Qorban): It is one of the most important Muslim festivals. It concludes the end of the pilgrimage to Mecca. It lasts for three days and Arabs call it Id al-Adha. The festival involves slaughtering animals such as ram or cow commemorating Ibraham's (Abraham) willingness to obey God by sacrificing his son. The story is very similar to the same story in Bible with Ishmael being sacrificed instead of Isaac.
Fedai- Khalq (the Organization of the Iranian People's Feda’i Guerillas): The independent underground militant group was an amalgamation of two leftist groups in 1971 in Iran. They expressed no loyalty to the Soviet Union. After the Islamic Revolution they split into two groups. Most of their leaders and many activists were executed and many more went into exile. They emerged outside Iran in 1983 and formed the Iranian People's Democratic Party in exile.
Gilaki: A northwestern Iranian dialect, Gilaki is spoken in the Caspian area, particularly Gilan. It is related to other dialects in the Caspian mainly, Mazandarani, Gorgani, and Taleshi. None is written and all are widespread in the region. .
Gillites: An Iranian group inhabiting modern province of Gilan. Like other groups in the Caspian region, they resisted Arabs and Turks for a long time. They are the ancestors of modern Gillaki people.
Georgia: It is located between the Black and Caspian Seas and borders Russia, Azerbaijan, Armenia and Turkey. It declared independence in 1991 from the Soviet Union.
Ghilzai Afghans: A major tribe in Afghanistan. Their leader Mahmud Ghilzai attacked Iran in 1722 and ended the Safavid rule.
Guklan: A Turkmen tribe, originally from central Asia. They are Sunni and their language closely resembles other Oghuz related groups and is related to Azerbaijani, Crimean Tartar and Turkish. They live close to the border with Russian Turkmenistan.
Guardian Council: Composed of clergy, the group has the power to veto all legislation passed by the parliament. The council has 12 members, six are appointed by the supreme leader, and the rest is elected by the parliament, but they are nominated by the Supreme Judicial Council (clergy).
Gulistan treaty: The treaty was signed between Russia and Iran in 1813. It ended the war of 1804. According to the treaty, Iranians lost many territories west of Caspian, including Georgia and parts of Azerbaijan in southern Russia.
Gurani: A Kurdish group who live in both Iraq and Iran. The name applies to both a group and a language related to Kurmanji. They are mentioned as the fourth largest Kurdish group in the 16th century. Gurani is closely related to Zaza, both languages are Northwestern Iranian in origin and both groups do not consider themselves to be Kurds. They are mainly Ahl i Haqqi.
Gypsies: The Iranian Gypsies are known as Koli and Luli. They originally migrated towards Europe from a region between India and Iran in the fourteenth and fifteenth centuries. They have been nomadic for centuries and were involved in making handicrafts such as baskets and sieve-making and some iron work. There are very few Gypsies in Iran and they are not recognized as a special group.
Hanafi Sunni: One of the four schools of law in Islam. It is named after its 8th century founder Abu Hannifa. It is considered one of the more liberal schools of law and traditionally it is non-hierarchical and decentralized. It is the official sect in Turkey.
Hawraman: A Kurdish group speaking Zaza/Gurani language. They live both in Iran (West Kurdistan) and Iraq. They are mostly Ahl-i Haqqi and some are Sunni. In 1996, their population is reported to be close to 80,000. Half live in Iran.
Hazara: The group is mainly concentrated in Afghanistan, but a small group lives in Iran as well. They are assumed to be from Mongolia. Most moved from Tansoxiana in the thirteenth and fourteenth centuries. They are pastoral nomads, mainly Shiites and speak a dialect of Persian.
Hijrat: The term applies to Prophet Muhammad’s departure into exile, from Mecca to Medina. The date this departure took place (622 AD), became the beginning of the Muslim lunar calendar.
Hurrians: Arriving from the highlands of Anatolia with their own language, they
established themselves at the foothills of the Zagros region by 2400 BC. They created the kingdom of Mitanni.
Hyrcania (Hyrcana, Gorgan): Meaning the country of the wolves, present day Gorgan is located on the southern shores of the Caspian Sea. With other Caspian kingdoms it became an Iranian stronghold during the Islamic period with many pro-Iranian dynasties resisting the Arab conquest for centuries.
Imam jom'eh: A title assigned to the senior clergyman in charge of the Friday Prayers at the main mosque in each county. Formally appointed by the Qajar and Pahlavi kings, at times, they were too powerful and their appointment was only a formality and a sign of recognizing their prominence. They still exist and have become very involved in the politics of the country.
Imam Zaman: The twelfth Shi’i imam, who is assumed to be hidden, and will appear towards the end of the time to save the world. The idea is very similar to the concept of the last Zoroastrian savior Saoshyant. Imam Zaman (the Time Lord), has the title Mahdi meaning, “divinely guided one” and is expected to appear when the world is in its most corrupt state.
Irani Zoroastrians of India: Zoroastrians who immigrated to India in the eighteenth century from Iran. They have maintained their contact with the Iranian Zoroastrians.
Ismaili: Supporters of Ismail the 7th Shi’i Imam. After the death of the sixth Imam, a division occurred amongst the followers. Ismaili supported the eldest son of the deceased Imam. Currently, most are followers of Agha Khan, and are scattered around the world.
Jamshidis: A small minority Sunni tribe in north-eastern Iran. They are primarily concentrated in Khurasan. They speak mainly Persian with some Turkic (Aimaq) vocabulary. The Aimaqs are originally from Mongolia and many Jamshidis still have the same Mongolian features.
Jizya; A capitation tax prescribed in Quran, and applied to non-Muslims only. Applicable in accordance with the subjects’ capacity, the tax became a major reason why many non-Muslims adopted the new fate.
Kalhur Kurds: A major Kurdish tribe in Iran. They are mentioned as a major group from sixteenth century. They acquired dominance in the nineteenth century Iran.
Khamseh confederation: Khamseh means five in Arabic and was a powerful confederation of Arab, Iranian and Turkish tribes in Iran in the nineteenth century. | <urn:uuid:7a601f85-2bb0-445e-b424-dd04078f1202> | CC-MAIN-2016-26 | http://www.cultureofiran.com/a-z_iranian_culture_01.html | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783394987.40/warc/CC-MAIN-20160624154954-00060-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.964472 | 2,194 | 2.859375 | 3 |
Pregnancy is the period where a fetus grows inside the uterus of the mother. Pregnancy starts with conception, and ends with delivery of the baby, or premature termination of the pregnancy.
Childbirth usually occurs about 38 weeks from fertilization, i.e. approximately 40 weeks from the start of the last menstruation. Thus, pregnancy lasts about nine months, although the exact definition of the English word “pregnancy” is a subject of controversy. The term embryo is used to describe the developing human during the initial weeks, and the term fetus is used from about two months of development until birth.
In many societies' medical and legal definitions, human pregnancy is somewhat arbitrarily divided into three trimester periods, as a means to simplify reference to the different stages of fetal development. The first trimester period carries the highest risk of miscarriage (natural death of embryo or fetus). During the second trimester the development of the fetus can start to be monitored and diagnosed. The third trimester often marks the beginning of viability, or the ability of the fetus to survive, with or without medical help, outside of the mother's womb.
Conception happens when the sperm combine with the egg. This usually normally occurs if a heterosexual couple has vaginal intercourse without contraception, especially if performed in the several days before the woman ovulates. To prevent conception, birth control methods should be used, such as condoms and hormonal contraceptives such as The Pill. Even if a man does not ejaculate inside the vaginal canal, semen released near the vulva can still enter the vagina and fertilize an egg. For this reason, it is possible (although unlikely) for a heterosexual couple to conceive without actually having any vaginal intercourse. Further, it is important to know that contraception may not be completely effective, and conception can still occur, although this is rare if the manufacturers' recommendations are strictly followed.
If a heterosexual couple wants to conceive, they should have natural vaginal intercourse, and neither partner should be taking hormonal contraceptives. Fertility changes over a woman's ovulation period, so it may be helpful to study a fertility awareness method, or use devices called Ovulation Predictor Kits (OPKs). This may help couples know to have intercourse on the woman's most and least fertile days. The Rhythm Method of birth control is not however very effective. If you and your partner want to conceive a baby, it is important to talk about the various factors involved in pregnancy with a trained professional. Neonatal death (death of either mother or baby about the time of birth) was once very common and can still occasionally occur, even when advanced medical attention is available.
About the time that sexual intercourse becomes routine the adult human body prepares itself for pregnancy and parenting regardless of the use of contraceptives. Typically a man may sprout additional body hair and a woman may develop more prominent breasts. These quite severe hormonal changes are likely to have emotional effects, so that the man may become excessively protective and the woman excessively insular (broody) In extreme cases this can lead to post natal depression. Pre-natal classes usually address these psychological changes, and are therefore recommended for both expectant mothers and fathers, especially during the gestation of the first baby.
Having a baby is an important, life-changing moment, and couples should not attempt to conceive without talking about the consequences. A baby requires a lot of effort and patience, and it is a big responsibility to take care of a child for 15 or 20 years until it is entirely self-sufficient.
Having a baby before academic education is complete increases a person's risk of dropping out of school, having a lower-than-average income, and needing government assistance or charity services. Young men who are not mature may not accept the long term responsibilities of fatherhood and become untraceable, and in consequence children born to teenage parents or single mothers tend to be less socialized than regularly parented children and so (statistically at least) at higher risk of committing crimes and going to jail.
It is important for people expecting their first child to have family and friends to support them during this emotionally tumultuous time, when emotions are experienced with extreme force. Arguments and rows are common between couples about this time, and a wide range of mature mediators (parents, older relations, more experienced friends) can greatly reduce fear and confusion that is natural in such an important life-changing period. The desire to run away and abandon one's parental obligation to the new child is common, often severe but always transitory. Both abortion and separation have long term psychological consequences that may be worse than the short-term panic that often provokes such extreme acts.
Know if you are pregnant
It is important to know if you are pregnant or not. Women commonly suspect they are pregnant if they do not get an expected period. During pregnancy, the normal menstrual cycle ceases, and women will not menstruate again until after the pregnancy is over.
Modern over-the-counter pregnancy tests are just as accurate as tests at a doctor's office. Pregnancy tests become accurate between one and three weeks after the last act of intercourse (or other sexual contact in which semen came near the woman's vagina). There are two reasons for this delay. First, sperm can live for up to five days before fertilizing an egg. Thus, a woman may have sex on Monday and not become pregnant until Friday. Second, a newly created embryo does not implant in the woman's uterus until six to twelve days after fertilization. Before implantation, there is no method available to detect pregnancy.
Many women occasionally have longer menstrual cycles ("late periods") without being pregnant. Stress will delay ovulation, and menstruation does not happen until about two weeks after ovulation. Women who frequently have longer menstrual cycles may worry needlessly about being pregnant. These women may benefit from fertility awareness, which allows them to predict the length of even irregular cycles.
If you are pregnant, it is important that you see a doctor. Pregnant women should receive prenatal care, to protect their own health, and the health of their unborn babies. Pregnant women have different nutritional needs from non-pregnant women.
Women who take folic acid supplements before becoming pregnant significantly lower the risk of certain birth defects. As half of pregnancies in the United States are unplanned, all sexually active women should take folic acid supplements.
Stages of Pregnancy
Pregnancy begins with fertilization, when the sperm from the man join with the egg from a woman. Fertilization, also called conception, occurs in the fallopian tubes, and the newly created embryo will continue to develop in the fallopian tubes for several days. Six to twelve days after fertilization, the embryo will embed itself into the uterine wall, where it will begin secreting hormones that can be detected by pregnancy tests. Because pregnancy cannot be detected before implantation, some groups define conception, the beginning of pregnancy, as the time of implantation.
Doctors count the beginning of pregnancy as the first day of the woman's last menstrual period (LMP). Because ovulation happen on average two weeks after menstruation, a newly created embryo is already two weeks old! It is normal and common for ovulation to happen earlier or later in the menstrual cycle, however, so often age estimates based on LMP will be wrong. Sometimes doctors will do an ultrasound of an early pregnancy to estimate its age (based on size of the embryo). This measurement is more accurate than calculation from a woman's LMP.
Development of all major proto-organs is complete seven weeks after fertilization, about nine weeks LMP. At this point, the embryo is called a fetus. The fetus continues to develop until the end of pregnancy.
The average pregnancy lasts 40 weeks from a woman's last menstrual period (this would be 38 weeks from fertilization). Pregnancy lengths of between 38 and 42 weeks are considered normal. Any baby born before 38 weeks is considered premature, and is at increased risk for health problems. Pregnant women should ask their doctor to describe the symptoms of premature labor, and should call their doctor or go to the hospital if they are worried they might be in premature labor.
Over 25% of pregnancies end in miscarriage, almost all in the first trimester. Some of these miscarriages may occur without a woman ever knowing she is pregnant. While there are medical treatments for later-term pregnancies that threaten to miscarry, there are no known treatments for early miscarriages. It is believed that most early miscarriages are caused by chromosomal defects in the embryo or fetus.
Sometimes a miscarriage is 'incomplete', meaning some embryonic or fetal tissue is left inside the woman. This tissue can become infected, which is a serious health concern for the woman. Women who know they have miscarried should be monitored by a doctor to verify that the miscarriage was complete. The doctor might make sure the levels of pregnancy hormone (hCG) in the woman's blood have dropped. An ultrasound could also be performed to see that the woman's uterus was empty. Even if the doctor is not concerned about infection, the woman may want to finish the process of miscarriage without waiting the weeks it sometimes takes to occur naturally. A procedure called Dilation and Curettage(D&C) may be used to remove the contents of the uterus.
There are two ways to give birth to a baby: vaginally and by C-section (the "C" stands for "caesarian," because people used to think this was how Julius Caesar was born.) Vaginal birth is where the baby is pushed out the woman's vagina. C-section is where an incision is made in the woman's abdomen, and surgeons pull the baby out.
The average woman will recover from a vaginal birth about three times faster than from a C-section. A C-section is major abdominal surgery, and like all surgeries, it carries risks such as infection and blood loss.
In case of birth complications, however, C-sections can be lifesaving to both mother and baby.
Most women give birth to their babies in a hospital. Hospitals have the most up-to-date technology and have surgical teams available to deliver babies by C-section if necessary.
Women may also birth in a birth center. These centers tend to provide more support for women seeking to avoid medical interventions (such as drugs for pain control), and are almost always run by midwives. Many birth centers are attached to hospitals, so the resources of the hospital are readily available in case of complications. Some birth centers have a "Know Your Midwife" scheme, where during their pregnancy women get to meet the midwives that will be with them for their birth.
Depending on where they live, women may also be able to find a midwife that will attend a birth at their home. In this way women get to know really well the person who will help them at the birth of their baby. Some women who plan to birth at home will transfer to a hospital to receive pain medicines or for other medical assistance. Most midwives who offer home births will provide follow-up care for up to 6 weeks after the baby is born. Studies of planned home births in low-risk pregnancies have shown that they are just as safe as planned hospital births.
Not every pregnancy is straight-forward, and this is why it is important that pregnant women receive pre-natal care. These days many women are offered tests during their pregnancy to determine how things are going, and whether they need help keeping themselves and their babies healthy. Women may be offered blood or urine tests to check for gestational diabetes, and ultrasounds to check on the growth of the baby - different places test for different things and it is always good to ask questions before consenting to any procedure.
People today know that drug, alcohol and tobacco use during pregnancy can create problems for the mother and the baby, and most health care providers will have strategies to help pregnant women where this is an issue.
During pregnancy, especially in the first trimester, women are often nauseous and may throw up. While this condition is called 'morning' sickness, it may occur at any time of day.
Eating frequent small meals and snacks may help reduce the severity of morning sickness. In extreme cases, IV fluids and anti-nausea drugs may be needed to protect the woman's health.
Several natural and mild drug remedies exist to treat morning sickness. Natural remedies include an increase in vitamin B12 intake and using ginger. Vitamin B12 can be increased by drinking red raspberry leaf tea or through an oral vitamin.
An ectopic pregnancy occurs when an embryo implants in a location other than the uterus. Most commonly, this is in a fallopian tube (a "tubal pregnancy"), but embryos may also implant in the abdominal cavity or an ovary. Tubal pregnancies, if allowed to continue, will burst and threaten the woman's life due to internal bleeding.
Sometimes a woman can be pregnant with more then one child at a time. 2 fetuses are called "twins", 3 are called "triplets", and 4 are called "quadruplets". If the fetuses are identical, it means that they are split from a single fertilized egg, and therefore have the same DNA. Fetuses that are fraternal are the result of multiple eggs that were released simultaneously, and each fertilized by different sperm.
Couples who are having difficulty conceiving a child may resort to fertility treatments. Fertility treatments known as injectables can cause many eggs to be released, and therefore create the potential for multiple births. If in vitro fertilization is used, the woman and her doctor might choose to place many embryos into the woman's uterus. It is not unheard of for a couple on such treatments to have groups of 5 babies or more simultaneously, although couples are offered selective reduction (abortion of one or more fetuses to decrease health risks to the remaining fetuses) for any pregnancy higher than twin.
A couple may decide it is not in their best interest, or in the interest of their child, to raise a baby. These couples may choose to make an adoption plan for their baby. In an adoption, the birth parents terminate their parental rights so that another couple may parent the child. Adoption is considered one of the three options (in addition to abortion or raising a child) available to women and couples who experience unplanned or unwanted pregnancy.
Couples who cannot have children themselves often consider adopting a child or children. Also, couples who have a child or children of their own may want to help other children through adoption. Single people may also choose to grow their family through adoption.
Adoption may be done through a government agency, a private agency, or through a "private adoption." Government and private agencies require single people or couples considering adoption to go through a home study, where a caseworker evaluates their ability to parent a child. Government agencies typically handle adoption cases where the child was abandoned or removed from the parents due to abuse or neglect. Private agencies typically handle adoption cases where the birth parents choose to make an adoption plan. In countries where private adoption is legal, the birth parents choose a couple to adopt their child without any formal evaluation process.
Women may decide it is not in their best interest to continue the pregnancy. Abortion means a doctor helps a woman end the pregnancy, which kills the developing embryo or fetus. Abortion may not be legal in all jurisdictions, and aborting a pregnancy at certain times in the pregnancy might be illegal as well. | <urn:uuid:709e9142-d3a0-4ab6-8028-2a7b1e008869> | CC-MAIN-2016-26 | https://en.wikibooks.org/wiki/Sexual_Health/Pregnancy | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783398873.39/warc/CC-MAIN-20160624154958-00150-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.952116 | 3,170 | 3.921875 | 4 |
Chronic inflammation can cause severe pain for the cat. The cat may exhibit unusual behavior such as irritability, aggressiveness, depression, or hiding. Eating behaviors may also change, manifested in excessive drooling, difficulty in eating or not eating. A typical sign of stomatitis is the cat going up to the dish as though very hungry, and then running from the dish because eating is so painful.
Bacteria play a major role in the formation of plaque and if a cat's teeth are not cared for, plaque leads to sticky tartar and to more bacteria. Good nutrition and keeping teeth plaque-free through daily dental care is essential for cats that are prone to stomatitis. This would include brushing and applying a chlorhexidine solution such as Dental Cleanser or Dental Clens Pads.
Even if your cat is not prone to dental disease, regular dental care is important. It can keep bad breath at bay and make your cat's life much more comfortable.
Dental care is a frequently overlooked aspect in cat healthcare. In fact, dental diseases are the most common disorder affecting cats. Among dental diseases, Dental Resorption Lesions or Cervical Line Lesions (CLL) is the most common. Various studies have shown CLL in up to 66% of all cats. By providing proper dental care, you can help prevent many dental diseases while keeping your cat happy and pain-free.
What are Cervical Line Lesions?
Prevent CLL with regular dental care
Provide regular at-home cleanings to monitor dental health and prevent conditions such as CLL from going unnoticed. Aggressive treatments may be avoided if lesions are detected early. Use Dental Cleanser or Dental Clens Pads to make dental care easier. Cats with a history of CLL should have their teeth professionally cleaned every six months. Due to the potential difficulty involved in properly detecting CLL, consult your veterinarian to schedule a thorough oral examination.
Remember... an ounce of prevention is worth a pound of cure. | <urn:uuid:0c9ab44e-a50b-4489-808e-876468f13d07> | CC-MAIN-2016-26 | http://www.drsfostersmith.com/pic/article_print.cfm?aid=903 | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783402746.23/warc/CC-MAIN-20160624155002-00194-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.945551 | 420 | 2.8125 | 3 |
By Alison Hawkes
It’s easy to get depressed about the loss of biodiversity when every day, it seems, some new species pops up on a watch list like a death toll.
But there are success stories that offer rays of hope in a world beset by climate change and habitat destruction.
In 2008, retired psychotherapist Robbie Brandwynne was perusing the San Francisco Chronicle when she came across a story about brown pelicans being taken off the threatened and endangered species list.
“I thought about it and realized that’s not the kind of news people get in front of their faces very often,” she said. “Everyone needs that kind of message, particularly young people who feel they are inheriting a world that is pretty damaged.”
So Brandwynne sprang into action. Her outlet? Art. Over the course of more than two years, the hobby watercolorist and quilter gathered contributions from fellow artists depicting species saved from the brink of extinction through conservation and restoration efforts.
The culmination of her work opened on May 1 at the Tilden Nature Area Environmental Education Center in Berkeley. “Celebration: Illustrating the Success of Conservation through Art” includes 55 artists who each chose a species to portray. The vast majority of artists are from the Bay Area, and a heavy focus is on California and Bay Area species…
… Continue reading on Bay Nature, where this article first appeared, on April 27, 2012.
To find out about more events in Berkeley and nearby, check out Berkeleyside’s Events Calendar. We also encourage you to submit your own events. | <urn:uuid:93355547-649d-4f3f-8b2f-57594a1f2fcf> | CC-MAIN-2016-26 | http://www.berkeleyside.com/2012/05/14/berkeley-art-show-depicts-conservation-success-stories/ | s3://commoncrawl/crawl-data/CC-MAIN-2016-26/segments/1466783396027.60/warc/CC-MAIN-20160624154956-00079-ip-10-164-35-72.ec2.internal.warc.gz | en | 0.943792 | 339 | 2.671875 | 3 |
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.