article
stringlengths 0
328k
| abstract
stringlengths 261
2.35k
|
|---|---|
the early brnemark protocol prescribed a healing period of 6 to 8 months between
tooth extraction and implant placement .
it
was believed that this was necessary to avoid infection and to allow for better
primary stability at implant placement .
continuing research lead to the introduction of immediate placement , where the
implant is installed in conjunction with tooth extraction .
the advantages of
immediate placement are the reduced number of surgical interventions and the
shortened overall treatment time [ 2 - 4 ] . additionally , some researchers believe that
immediate implant placement may improve the aesthetic outcome due to the reduced
risk of bone resorption and the maintenance of gingival and crestal bone
architecture .
a 50% reduction in horizontal bone width occurs during the first
year after tooth extraction . in the vertical dimension ,
this bone resorption is especially pronounced in the molar
region and when neighbouring teeth are absent [ 6 - 9 ] . in some cases , the reduction
in bone volume is so extensive that it might prevent the delayed placement ( 16
weeks ) of an implant . on the other hand ,
immediate placement has some disadvantages , such as the risk of
infection , unpredictable soft and hard tissue response(s ) , the difficulty to achieve
primary stability and the critical positioning of the implant . especially in
subjects with a thin biotype , immediate placement
is not recommended due to the risk
of recession over time . in
periodontally - susceptible patients ,
immediate implantation might also increase the
risk of implant failure . in
contradiction to what was initially believed , does immediate placement not prevent
the resorption of the buccal bone , which is part of the natural healing process
after tooth extraction [ 16 - 18 ] . according to a review by quirynen et al .
immediately placed implants
however , studies comparing the outcome between immediate and delayed
placement , found no significant difference in survival rate [ 19 - 22 ]
immediate
implantation into a molar socket raises an extra challenge for the clinician ,
because of the difficulty in positioning the implant , due to the residual
inter - radicular bone .
placing a regular diameter implant in one of the existing root sockets will result in
a compromised emergence profile , significant off - angle loading , and the creation of
a cantilever effect .
a wide diameter
implant will enhance bicortical primary stability , increase the surface for
osseointegration and will result in a more axial , prosthetically oriented
position .
early publications on wide diameter implants reported more than 20% implant failures
, however more recent studies using surface modified implants report
lower failure rates of less than 5% [ 28 - 31 ] .
a moderately rough surface and adapted
surgical protocol may promote the anchorage in the bone and decrease implant
failures . to achieve primary stability in molar extraction sockets more easily , a new wide
diameter , tapered implant was introduced .
the aim of this study was to evaluate
retrospectively the clinical outcome of this implant design when placed immediately
into maxillary and mandibulary molar extraction sockets .
the max implant ( southern implants , irene , south africa ) can be 7 to 10 mm
wide and 7 , 9 or 11 mm long .
it has a tapered design with a 0.8 mm thread pitch
( figure 1 ) .
they have an external hex and
a moderately rough surface created by sandblasting and chemically conditioned with
solvents of a grade 4 c.p .
, there is a platform switching of 0.25 mm in the horizontal plane and a
further 0.35 mm when the 45 degree bevel is included .
representation of the max implant . following comprehensive clinical and radiographic examination of the patient and the
associated molar tooth ,
the indication for tooth extraction and immediate implant placement was
extensive loss of coronal tooth material , preventing conventional prosthetic
treatment .
the immediate placement approach was only considered for patients with an
intact buccal socket wall and a medium or thick periodontal biotype , since it has
been shown that a thin biotype is more prone to recession and aesthetical
complications and is therefore less suited for immediate placement .
assessment of the biotype was based on the
transparency of the periodontal probe as described by de rouck et al . .
a signed consent was required from each
patient prior to treatment . on the day of surgery ,
local anaesthetic wasadministered , but no attempt was made to
remove the tooth with conventional extraction forceps .
as immediate implant
placement is critically dependant on the preservation of the perimeter bony walls of
the socket , the extractions were carried out by sectioning of the tooth to allow for
removal of the roots individually and to avoid potential fracture of any of the
associated bony elements , especially the buccal plate ( figure 2 ) .
clinical case representing the surgical procedure : a = caries and substantial loss of tooth material indicated extraction of
first molar .
c = the intact septum was used as a reference to position the first round
drill .
d = depending on the bone quality , the site was formed using a tapered drill ,
bone tap or osteotome .
e = when the implant bed was prepared , the implant was ready to be
installed .
f = if the residual space exceeded 2 mm , a bone graft was used to fill the
residual space .
h = a healing abutment was connected to the implant and the flap was
closed .
i = radiograph taken 13 months after surgery showing stable bone level around
the implant neck .
the roots were then carefully
separated and the inter - radicular bone within the socket was used to manipulate the
roots , which were then elevated without removal of any bone .
piezo surgery was often
utilized to assist with removal of the roots and if root removal proved to be
challenging , 4.3 times magnification surgical loupes with fibre optic illumination
were used to assist with the surgery .
once all the roots were removed successfully ,
the bony socket walls were inspected to confirm the presence of 4 intact outer walls
and the absence of any pathology or fenestrations .
the point at which the drill was placed was always
slightly off - centre towards the lingual in the case of a mandibular molar and often
slightly towards the mesial in the case of an maxillary molar .
this is to allow for
preparation of the implant placement site in a centrally located position , but away
from the buccal bone plate .
slight mesially positioned preparation in maxillary
molar sockets was only performed , if the available interdental bone between the
maxillary first molar and the maxillary second premolar was more than that available
between the first and second molar .
if this slight adjustment is overlooked , the
implant could end up being placed too close to the maxillary second molar .
preparation was then followed by a 1.2 mm , 2.00 mm , 2.85 mm and 3.07 mm diameter
twist drill .
this was followed by a 4 , 5 and 6 mm diameter tapered spade drills of
the correct length .
specially designed tapered wide diameter drills were then used
next , especially in the case of mandibular molars where denser bone was encountered .
in the case of a maxillary molar , further preparation of the site
these allow for slow and
careful preparation of the bone and enables lateral compaction of the prepared bone
as opposed to further bone removal which is commonly anticipated with drilling .
this
was especially useful in the maxillary molar sockets , where bone quality is usually
type iii - iv .
to clarify in more detail , three potential preparation methods were
employed after the 6 mm tapered spade drill .
these were carried out using one or a
combination of the following : 1 ) custom designed osteotomes whichcorrespond to the size of the available implants :
7 , 8 , 9 mm diameter and 7 , 9 , or 11 mm in length .
osteotomes wereusually used in a
very soft bone , where no drilling is required .
they were often useful in second
molar sockets with little or no inter - radicular bony anatomy .
2 ) custom designed 7 , 8 , or 9 mm diameter tapered drills with lengths of 7 , 9 , or 11
mm .
usually used in hard bone and when there is a very prominent inter - radicular
bony anatomy present .
3 ) custom designed surgical taps , which correspond to the size of the available
implants : 7 , 8 , 9 mm diameter and 7 , 9 , or 11 mm in length . usually used in soft
bone and when there is little need to remove more bone with further drilling .
also ,
used when the greater site preparation control was needed as the taps allow for slow
and careful preparation .
once preparation was complete , one of the custom designed osteotomes was used to
place in the osteotomy site and act as a profile gauge . a peri - apical radiograph
would then be taken to verify the position and depth of the osteotomy preparation.to
compensate for natural bone resorption after tooth extraction , the implant site must
allow the implant to be seated 2 mm below the margin of the intact buccal bony wall
and is therefore prepared 2 mm deeper , compared to delayed implantation .
after site preparation , the implant is installed at low speed using the implant
surgical unit . in all cases ,
the implant was primarily seated at 50 ncm with the
implant surgical unit and then finally seated by hand with an implant insertion
wrench until the implant platform ended 2 mm subcrestally .
the implant must also be
positioned well away from the buccal bony wall of the socket , to avoid damage and
recession .
ideally , one would like to
see the remaining buccal strut of the inter - radicular bony septum still intact and
butting up against the implant.if theresidual socket space was more than 2 mm wide ,
a bone graft was used , e.g. a bovine derived xenograft ( bio - oss , geistlich ,
wolhusen , switzerland ; nu - oss , ace surgical supply , brockton , ma , usa ) or
irradiated allogenic cancellous bone ( icb , rocky mountain tissue bank , aurora , co ,
usa ) .
soft tissue adaptation around
the healing abutment was assisted with vicryl 4.0 sutures and a post - operative
peri - apical radiograph was taken with a parallel - aiming device .
all patients
received a course of antibiotics ( 2 x amoxicillin 500 mg / day for 7 days ) and
analgesics ( 3 x ibuprofen 800 mg / day for 3 days , 2 x paracetamol 500 mg / day for
1 day ) as well as corsodyl mouthwash ( glaxosmithkline consumer healthcare ,
brentford , middlesex , uk ) after implant surgery .
all the cases were followed - up with
a postoperative evaluation within 10 - 14 days after surgery .
all patients , consecutively treated by one experienced periodontist ( ah ) with one or
multiple max implants , were personally invited by phone to attend a clinical
research examination . only implants placed in molar extraction sockets with at least
1 year follow - up post - surgery were included .
patients , who chose not to attend the examination were asked if the implant was still
in function and whether they had experienced any problems with the implant or
prosthetic restoration .
this method has been described before and was done to detect
possible failures or complications .
this study was approved by the ethical comit of the university hospital ghent ,
belgium and is in accordance with the helsinki declaration .
surgical
parameters were time of loading , 1 or 2 stage surgery , type of bone graft , implant
position and implant dimensions .
the implant prosthetics were categorized into 3 groups : single crowns , fixed partial
prosthesis and fixed full prosthesis .
the type of prosthetic retention
( cement - retained or screw - retained ) was also recorded .
if the neighbouring tooth , crown or pontic
was absent , no value was recorded .
radiographic analyses during examination , digital peri - apical radiographs ( vista scan , drr dental ag ,
bietigheim - bissingen , germany ) were taken using the long - cone paralleling technique
and to determine the peri - implant bone loss after comparison with a baseline
radiograph taken immediately after surgery .
an x - ray holder was used to orient the
x - ray beam perpendicular with the implant axis .
radiographic analyses were done by
the one independent examiner ( svdw ) not involved in the initial implant treatment
using dbswin software ( drr dental ag , bietigheim - bissingen , germany ) with an
accuracy of 0.1 mm .
bone level was determined from implant - abutment connection to the first
bone - to - implant contact mesial and distal .
the mean of both values was taken as the
implant bone level . the actual bone loss or bone gain
each individual implant was dichotomised as either a success ( value 1 ) or a survival
( value 0 ) , using a mathematical formula to link bone loss and time .
implants up to
one year in function were called " implant bone loss success " , when bone loss during
the first year was 1.5 mm ; implants longer than one year in function were
successful , when bone loss was 1.5 + ( 0.2 x [ time in months - 12]/12 ) mm ,
based on the internationally accepted criteria of albrektsson and isidor , allowing a maximum of 1.5 mm bone loss
during the first year and 0.2 mm yearly thereafter .
statistics were performed with pasw v18 for windows ( spss , chicago , illinois , usa ) .
mann whitney u - test and kruskal - wallis test were used for bone loss analyses .
chi - square was used for statistical comparison of implant failure and success rate .
in total , 98 implants installed in 89 patients answered to the selection criteria .
all patients could be reached by telephone and confirmed that their implant was
still present . only 1 implant failed prior to loading , resulting in an overall
98.98% implant survival rate .
38 patients ( 12 male , 26 female ) with 47 implants were available for clinical
examination ( table 1 ) .
the mean age was 60 years ( sd 11.64 , range 25 - 83 ) .
a detailed overview
of implant distribution according to implant position can be seen in figure 3 .
table 2 represents an overview of
implant length according to implant diameter . in the maxilla ,
69.2% of the implants
were 9 mm in diameter , while in the mandible , 76.2% of the implants were 8 mm in
diameter .
table representing frequency distribution , bone loss and implant success
for the different variables statistically significant difference in bone loss between
maxilla and mandible ( mann - whitney u test , p < 0.05 ) . statistically significant difference in bone loss between 8
and 9 mm diameter implants ( mann - whitney u test , p < 0.05 ) .
implant distribution according to implant diameter and length overview of implant distribution according to implant position .
the mean peri - implant bone
loss was 0.38 mm ( sd 0.48 ; range - 0.50 - 1.95 ) , after a mean follow - up period of 20
months ( sd 5.75 ; range 12 - 35 ) ( figure 4 ) .
there were no significant changes in the bone loss between the different 6 months
intervals ( p = 0.487 ) ( figure 5 ) .
peri - apical radiographs representing the bone levels around the max implant
over time : a = pre - operative radiograph . due to its poor prognosis ,
b = baseline radiograph , taken on the day of surgery . the implant is placed
slightly subcrestally .
box - plot representing the mean bone loss and range per 6 months ' time
interval .
univariate
analysis showed significantly more bone loss in the maxilla ( mean = 0.48 mm , sd
0.52 , range - 0.50 - 1.95 ) compared to the mandible ( mean = 0.27 mm , sd 0.42 , range
- 0.05 - 1.35 ) ( p = 0.050 ) .
furthermore , more bone loss was seen around the 9 mm
diameter implants ( mean = 0.55 mm , sd 0.50 , range 0.00 - 1.95 ) compared to the 8 mm
diameter implants ( mean = 0.23 mm , sd 0.42 , range - 0.50 - 1.35 ) ( p = 0.008 ) ( table
1 ) . at the mesial side
, the papilla filled the interproximal space completely at 76.1% of
the sites , more than half at 19.6% and less than half at 4.3% of the sites . at the
distal side
, the papilla filled the interproximal space completely at 62.1% , more
than half at 31% and less than half at 6.9% of the sites .
there was no significant
difference in bone loss between the different scores at the mesial side ( p = 0.236 )
or distal side ( p = 0.180 ) , or in success rate at mesial ( p = 0.852 ) or distal ( p
the 98.98% implant survival is in accordance with other studies on immediate
placement reporting survival rates over 92% after at least 1 year follow - up [ 24,43 - 53 ] .
although it was partially
based on telephonic contact , vercruyssen et al . demonstrated the reliability of this technique .
the survival rate
also corresponds to the outcome of an earlier multicenter study using this implant
design , reporting a 95.7% implant survival rate for the immediately placed max
implants .
however , some of the immediate
implants in that study were submerged during healing or immediately loaded , which
might explain the lower survival rate in that study and makes comparison not
completely valid .
the population in a private practice may differ from the one in clinical research
projects executed at academic centres .
although infection control measures were
taken before surgery and oral hygiene was adequate , patients were not excluded from
the study for certain risk factors as smoking or diabetes . despite this , these data
reflect reality and the outcome is comparable to highly - controlled studies . although some authors report more bone loss around wide diameter implants compared to
regular diameter implant , the amount of
bone loss was only 0.38 mm after at least 1 year follow - up .
this is in accordance
with other studies and far within the criteria for success [ 29 - 31,56,57 ] .
although one could argue that the clinical follow - up is too short , one has to keep
in mind that a marked stability of the bone level during the first six months after
surgery is normally an indication of a minimal risk for future implant failure or
further bone loss unless periimplantitis or traumatic overloading are involved .
this
being said , it remains of course necessary that the studied implant and presented
treatment protocol are scrutinized further after a longer follow - up time for further
validation .
today , very few studies reported on bone loss around implants immediately placed in
molar sockets . bianchi and
sanfilippo
reported a 0.75 mm bone loss after at least 72 months follow - up and penarrocha et
al . reported 0.83 mm bone loss after 1
year .
prosper et al . reported a bone
level of 0.17 mm after 1 year and 1.01 after 5 years .
these results indicate that
immediate placement generates limited bone loss , which is stable over time .
bone loss was significantly lower in the mandible compared to the maxilla , which is
in accordance with earlier studies .
jawbone quality and quantity are more
often compromised in maxillary than in mandibular sites and may therefore affect the
implant treatment outcome .
wide - diameter implants have reported an increased failure rate , mainly associated
with the operators ' learning curves , poor bone density , implant design and site
preparation , and its use when primary stability had not been achieved with a
standard - diameter implant .
innovations
in surgical protocol and implant design made their outcome comparable with standard
diameter implants . the increased bone loss around the 9 mm diameter implants can be
explained by the fact that 78.3% of these implants were placed in the maxilla , while
66.7% of the 8 mm implants were placed in the mandible . in 63.8% of the cases ,
an additional bone graft was used to fill the residual space
of the extraction socket . however , there is no consensus on the indication and the
optimal regenerative technique .
the
success for full bone healing depends on the stabilization of the coagulum , which
depends on the distance from the bone to the implant [ 63 - 66 ] . for this reason ,
some studies advise the use of a bone graft if the jumping distance is more than 2
mm .
papilla presence was
not correlated with bone loss , as confirmed by degidi et al . .
studies using the same index to evaluate the papilla fill
reported a full papilla at 35% to 78% of the sites [ 67 - 70 ] .
the disadvantage of the
papilla index of jemt is that scores are
based on the fill of the embrasure space and not on a comparison with the
pretreatment appearance of the papilla .
however , there is evidence that the final form of
the papilla is similar for immediate or delayed placement as well as immediate or
delayed restoration .
immediate molar replacement , using a wide body max implant , offers good primary
stability and limited bone loss over time .
however , careful surgery and case
selection is recommended to obtain a good result .
| abstractobjectivesimplant placement in molar extraction sockets can be difficult due to complex
multi - root anatomy and the lack of predictable primary stability .
the aim of
this study was to evaluate the outcome of an 8 - 9 mm diameter tapered
implant , designed to be placed in molar extraction sockets.material and methodspatients treated at least 1 year before with a max implant ( southern
implants , irene , south africa ) were invited for a clinical examination .
variables collected were surgical and prosthetic protocol , implant dimension
and smoking habits . peri - implant bone level was determined on peri - apical
radiographs and compared to baseline , being implant insertion.results98 implants had been placed in 89 patients .
one implant had failed .
thirty
eight patients representing 47 implants ( maxilla 26 , mandible 21 ) were
available for clinical examination .
mean bone loss was 0.38 mm ( sd 0.48 ;
range - 0.50 1.95 ) after a mean follow - up of 20 months ( range 12 - 35 ) .
implant success was 97.9% .
around 30 implants , a bone substitute was used to
fill the residual space , but this did not affect the bone loss outcome .
bone
loss was only significantly different between maxilla and mandible ( 0.48 mm
vs. 0.27 mm ) and between the 8 and 9 mm diameter implants ( 0.23 mm vs. 0.55
mm ) .
a full papilla was present at 71% of the interproximal sites and
irrespective of bone loss.conclusionsthe max implant demonstrated good primary stability , when placed in molar
extraction sockets , with limited bone loss over time . |
clinicians are often faced with the problem of bonding orthodontic brackets to teeth that already have undergone different types of restorations , especially in adult patients .
the prevalence of malocclusion in adults is equal to or greater than the prevalence in children and adolescents;1 therefore , the percentage of adult orthodontic patients is high.2 stress with a bonding procedure such as posterior tooth banding ( which is more prone to gingival inflammation and attachment loss3 ) has become a matter of concern to orthodontists .
metallic surfaces can be encountered on the labial surfaces of the molars and premolars and the lingual surfaces of the anterior or posterior teeth .
surface roughening before bracket bonding is therefore a prerequisite for sufficient bracket - to - alloy bonding.4,5 sandblasting , the most common method for surface preparation , creates scratch - like irregularities that increase the surface area , thereby enhancing mechanical bond strength.6 a recently introduced silica coating method facilitates mechanical retention by sandblasting and chemicophysical bonding between a composite resin and an alloy surface with a silane.6 by using an intraoral sandblaster , alloy surfaces are treated with aluminum oxide particles that are modified with silicic acid .
silane must thereafter be applied to allow chemical bonding with a resin - based system such as composite adhesives.7 silica coating has been used in many dental applications such as repairing intraoral fractured ceramic surfaces,8,9 treating ceramic bracket bases for rebonding , 10 and repairing resin - bonded prostheses.11 several studies were recently published in regard to bracket bonding on metal surfaces.12 - 14 in silicoating procedures , the ideal timing of silane application before bracket bonding remains equivocal .
manufacturer recommendations for silanation are typically 5 min for extraoral use ( 3 m espe sil ; 3 m espe dental products .
paul , mn , usa).15 however , 5 min is excessively long in clinical situations .
for that reason , manufacturers also recommend 30 s ( 3 m espe sil)15 or 1 min ( pore - etch and porcelain conditioner ; reliance orthodontic products inc . , itasca , il , usa ) in intraoral use.16 however , there has been no data concerning bond strength differences in regard to these time differences .
the objectives of this in vitro study were to measure the shear bond strength ( sbs ) of metal brackets on gold alloys ( treated by using a silica coating ) at different time intervals after applying silane and compare these sbs values with the sbs values on an enamel surface .
thirty - two 1.5-mm thick and 10-mm long gold alloy square plates ( type iii gold consisting of 50% gold , 5% palladium , 32.5% silver , and 11.45% copper ; argen co. , san diego , ca , usa ) and 36 human central incisors , which were extracted for periodontal purposes and stored in thymol solution ( 0.1% wt / vol ) , were used in this study .
the criterion for tooth selection was that a tooth had to be free of restoration , cracks , caries , attrition , or white spot lesion .
the upper central incisors were randomly divided into 2 groups : 1 h group and 24 h group .
institutional review board of the seoul national university dental hospital authorized the authors to proceed with this experimental study .
all plates and teeth were embedded in a cold - curing acrylic resin ( leocryl ; leone , sesto fiorentino , italy ) with acrylic rings ( taejin acrylic , seoul , korea ) .
each plate was oriented so that its surface was parallel to the force applied during the shear bond tests .
the silica coating process was performed on all alloy plates after embedding . a sandblasting device ( air - flow handy ii ; ems corp . , dallas , tx , usa ) was filled with 30-m aluminum oxide grain that was modified with silicic acid ( cojet - sand ; 3 m espe , seefeld , germany ) .
the grain was used for surface roughening . in accordance with the manufacturer 's instructions ,
the abrasive was applied perpendicularly to the metal surface at a distance of 10 mm under 2.5 bar pressure for 15 seconds .
excess particles were removed with gentle air after the silica coating procedure . a silane coupling agent ( espe - sil ; 3 m espe )
was then applied to the plate surface and air - dried with oil - free air . a power analysis ( alpha level , p < 0.05 ; beta level ,
< 0.20 ; 2-tailed ) was performed in this study by using the mean and standard deviation , on the basis of the results of a previously conducted pilot study . as a result of this analysis ,
18 samples were used for each group . because 2 factors ( i.e. , silanation time and test timing ) had to be evaluated , we assigned alloy plates to 8 groups . in the 1-s silanation time group , brackets were bonded immediately after the silane application .
we tried to immediately bond the brackets , but bracket positioning and removal of excessive adhesive takes time ; therefore , we named the group the " 1-s silanation time group , " for the sake of convenience . in the 30-s , 60-s , and 120-s silanation time groups ,
the specimens were air - dried for 30 s , 60 s , and 120 s , respectively , after the silane application to allow chemical adhesion between the silane and the silica - coated surface and to acquire a dry field before bracket bonding . to evaluate the effect of test timing
, specimens were stored in water in a thermostatic chamber at 37 for 1 h or for 24 h before sbs testing . immediately after surface conditioning and air drying , maxillary central - incisor metal brackets ( item number 017 - 875 ; 3 m unitek , monrovia , ca , usa ) were bonded to each conditioned alloy surface with a light - cured composite adhesive ( transbond xt ; 3 m unitek ) . to maximize the bond strength ,
a thin uniform coat of adhesive primer was applied to the bracket base and was light cured for 10 s with light emitting diode ( led ) curing lights ( ortholux led ; 3 m unitek ) , as demonstrated in previous research.12 resin adhesives were then applied to the bracket bases .
according to the manufacturer , the average surface area of each bracket base is 10.56 mm .
each bracket was positioned on the prepared alloy surface with sufficient pressure to expel excess adhesive , which was then carefully removed .
previous study suggests that 40 s of curing time is required to obtain proper bond strength of metal brackets on metal plates when using led curing lights.14 therefore , the brackets were light cured for 40 s. as the manufacturer recommends , the light source was held 1 - 2 mm above the bracket , and the mesial and distal edges were cured for an equal amount of time on each side . a minimum light intensity of at least 2,000 mw / cm was verified by using a handheld curing radiometer ( demetron 100 ; demetron research , danbury , ct , usa ) .
after photopolymerization , the plates were stored in water in a thermostatic chamber at 37 for 1 h or for 24 h. a universal testing device was used to determine the bracket sbs ( lf plus ; ametek , albany , ny , usa ) . for this test , acrylic rings were mounted in a jig with the brackets positioned vertically .
shear force at a cross - head speed of 1 mm / min was transmitted to the bracket by means of a square plate of the same size .
the force required to shear the bracket was recorded and converted into units of stress ( mpa ) , based on a known bracket area .
the tested alloy surfaces were polished with a shofu gold polishing kit ( hp 0303 ; shofu inc . ,
tokyo , japan ) and were cleaned for 10 min in an ultrasonic bath ( bransonic ; ultrasonic cleaner , shelton , ct , usa ) containing ethylacetate .
the plates were then air dried with oil - free air before reusing them for the next experiment .
these procedures followed the methods used in previous studies.13,14 the polished plates were randomly reassigned to a group for the next experiment .
this procedure was repeated for the alloy plates until the whole test was completed . to compare the sbs of the brackets on a gold surface and on an enamel surface ,
the brackets were bonded to the tooth surface of each group by using the same adhesive after 30 s of etching with 37% phosphoric acid ; the brackets were light cured for 40 s. after 1-h and 24-h storage in a thermostatic chamber , sbs testing was performed . after bond strength testing ,
the gold alloy plates were examined under 10 magnification to detect adhesive remnants on the alloy surfaces , on the basis of ari system.17 the ari scale ranges from 1 to 5 to define the sites of bond failure .
the ari assessment was performed with a zeiss opmi 111 microscope ( mednet locator inc . , memphis , tn , usa ) . after applying a cojet silica coating ( 3 m espe ) and silane , the specimens were sputter - coated with carbon evaporation ( scd-005 ; leica microsystems , wetzlar , germany ) and examined at 5,000 magnification with a scanning electron microscope ( sem ) ( jsm-6380 ; jeol , akishima , japan ) .
descriptive statistics ( i.e. , mean , standard deviation ) and inferential statistical analyses were performed .
after checking the normality assumption and the equality of variance , two - way analysis of variance ( anova ) was implemented to deduce the significant influential factors on the sbs of the alloy plates with regard to two variables : silanation time and testing timing .
differences between the groups were assessed by using the student - newman - keuls ( s - n - k ) multiple comparisons test with a level of significance at p less than 0.05 .
one - way anova and s - n - k test were used to compare the sbs of enamel and gold surfaces after 24 h. the kruskal - wallis test for the silanation time and the wilcoxon rank sum test for the test time were used to determine whether differences in aris existed between the groups . for the silanation time , a pairwise comparison test using the wilcoxon rank sum test with bonferoni correction was performed to determine whether there were differences between 1 s and 30 s , 30 s and 60 s , and 60 s and 120 s.
descriptive statistics ( i.e. , mean , standard deviation ) and inferential statistical analyses were performed . after checking the normality assumption and the equality of variance , two - way analysis of variance ( anova )
was implemented to deduce the significant influential factors on the sbs of the alloy plates with regard to two variables : silanation time and testing timing .
differences between the groups were assessed by using the student - newman - keuls ( s - n - k ) multiple comparisons test with a level of significance at p less than 0.05 .
one - way anova and s - n - k test were used to compare the sbs of enamel and gold surfaces after 24 h. the kruskal - wallis test for the silanation time and the wilcoxon rank sum test for the test time were used to determine whether differences in aris existed between the groups . for the silanation time , a pairwise comparison test using the wilcoxon rank sum test with bonferoni correction was performed to determine whether there were differences between 1 s and 30 s , 30 s and 60 s , and 60 s and 120 s.
table 1 shows the means , standard deviations , and range of sbs values , based on silanation time and test timing .
the results of the two - way anova test revealed significant differences between the groups ( p < 0.05 ) .
a significantly greater sbs was observed in samples subjected to 60 s and 120 s silanation time that were examined after 24 h , compared to the sbs of the other groups ( p < 0.05 ) .
figure 1 shows the distribution of the sbs values in relation to silanation time and test timing factor .
the results of the kruskal - wallis test revealed significant differences in the ari scores between the different silanation time groups ( = 44.0465 , degree of freedom = 3 , p < 0.001 ) .
the wilcoxon rank sum test showed no significant difference between the 1-h and the 24-h silanation time groups ( table 2 ) .
the pairwise comparison test revealed a difference in the ari score between 1 s and 30 s , but there was no significant difference between 30 s and 60 s or between 60 s and 120 s. the one - way anova and the s - n - k test showed that the sbs values of the 60 s and 120 s silanation time groups were not significantly different from sbs values of enamel after 1 h or 24 h ( tables 3 and 4 , respectively ) .
sem images were used to examine the characteristics of the gold alloy surfaces , after undergoing silicoating procedures .
after silica coating , bead - like structures were present on the irregular gold surfaces ( figure 1a ) .
after applying silane , the bead - like structures apparently became more complex ( figure 1b ) .
sandblasting can create surface irregularities that increase surface area , thereby enhancing mechanical bond strength .
previous studies have shown that a clinically acceptable bond strength can be achieved in bracket bonding procedures when sandblasting is combined with chemical bonding agents such as 4-meta resins or primers.5,18 however , many clinicians still use bands in gold crowns to safeguard against bond failure . usually gold surfaces are located in the posterior teeth , which receive a great amount of masticatory force , which can range above 30 kg.19 unlike enamel surfaces , strong bonds on alloy surfaces do not cause fractures or cracks on the surface of the substrate during debonding .
therefore , 6 - 8 mpa is usually the recommended minimum bond strength,20 although higher bond strengths are better for bracket bonding on alloy surfaces .
a previous study has shown that silica coating can produce a very high bond strength ( 19 mpa ) on a metal surface.13 other researchers have observed a higher bond strength in silicoated samples , compared to sandblasted and 4-meta - primed samples in bracket bonding on a gold alloy surface.14 the silica coating procedure may reduce the importance of the alloy composition and oxide formation on the bonding mechanism.9 in silicoating procedures , chemicophysical adhesion occurs between the resin monomer , silane , and silica particles .
the silane agent is a bifunctional molecule - one end is connected to the hydroxyl groups in the silica molecule and the other end creates double bonds with the monomer in the adhesive . as for many other chemical reactions ,
time for evaporation is also required for better bond since most of the silane uses alcohol as a solvent ( reliance porcelain conditioner , 3 m espe sil).15,16 the silanation reaction also produces alcohol as a by - product .
therefore , an appropriate time interval and air drying would be helpful in maximizing the success of the silicoating procedures .
manufacturer recommendations encourage 5 min of silanation before applying the adhesive extraorally ; therefore , most in vitro studies have incorporated silanation times of 5 min.11,13 however , 5 min of silanation is excessively long for clinical settings ; therefore , manufacturer recommendations for intraoral use is 30 s ( 3 m espe sil ; 3 m espe dental products ) or 1 min ( porcelain conditioner ; reliance orthodontic products inc . ) .
however , a previous study21 assessed the bond strength of porcelain surfaces exposed to 1 min of silanation .
it demonstrated lower bond strength than the bond strength observed in another study22 that used 2 min of silanation . on metal surfaces ,
a previous study that used 5 min of silanation time13 demonstrated higher bond strengths than studies that used 1 min12 or 2 min14 silanation time .
we tried to explore the most effective and efficient methods for bracket bonding on a gold alloy surface by using silicoating .
our results indicate that a silanation time of longer than 60 s is recommended , even though the manufacturer 's recommendation is 30 s. the samples subjected to short silanation times showed increased bond strength after 24 h , but the initial bond strength was significantly lower than the bond strength of samples subjected to a longer silanation time . restorations usually remain in the mouth after the brackets are debonded .
damage to the alloy resulting from extreme roughening of the surfaces during the pretreatment should be avoided .
silicoating with 30-m grains produces smoother alloy surfaces than does sandblasting with large grain aluminum oxide or high speed diamond bur roughening .
the ari scores of samples subjected to a silanation time of longer than 30 s were lower than samples subjected to a silanation time of 1 s. the lower ari score means that the adhesive resin had a stronger adhesion to the alloy surface than to the bracket base .
such ari scores are more favorable since the weakest bond between the bracket base and alloy surface is usually at the adhesive - alloy interface and there is no risk of cracking or fracture during debonding procedures
. a direct transfer of in vitro values to clinical situations is not usually accepted since differences would exist between the in vitro and the in vivo bond strengths .
the bond strength can be influenced by temperature , stress , humidity , and acidity and plaque - factors that can not be reproduced in the laboratory.5 however , in vitro studies are required for testing recently developed materials or methods to provide reference data and guidelines . despite the many limitations caused by being unable to make direct comparisons with other studies , silicoating with more than 60 s of silanation time showed similar sbs of a bracket to an enamel surface in this study .
light curing and a highly filled adhesive , which are commonly used , were chosen for this investigation .
thermocycling is a widely accepted method for bond strength testing , although there is no international standard of thermocycling for 1 h testing .
thermocycling was not applied in this experiment because we were trying to determine time - related differences in sbs .
the results of this study indicated that bond strength is greater at 24 h after bonding than it is at 1 h after bonding .
such differences can easily be explained by the higher conversion rate of the monomer to a polymer over time , and are in accordance with the results of previous reports.17,22
the silanation procedure requires time for the chemical reaction and for solvent evaporation to occur . therefore ,
more than 60 s of silanation time are required to initially achieve a sufficient bond strength when bonding brackets to gold alloy surfaces by using silicoating .
the sbs of a bracket to a gold alloy when using more than 60 s of silanation time was not significantly different from the shear bond strength of conventional enamel bonding . | objectivewe aimed to investigate the effects of silanation time on the shear bond strength ( sbs ) of metal brackets on gold alloy in a silicoating procedure and compare the sbs of metal brackets on gold alloy and enamel.methodstype iii gold alloy plates were sandblasted with 30-m silicon dioxide .
excess particles were removed with gentle air after silica coating , and silane was applied .
maxillary central - incisor metal brackets were bonded to each conditioned alloy surface with a light curing resin adhesive for 1 s , 30 s , 60 s , or 120 s after applying silane .
the brackets were also bonded to 36 upper central incisors with the same adhesive .
all samples were cured for 40 s with a light emitting diode curing light .
the sbs was tested after 1 h and after 24 h. the adhesive remnant index ( ari ) of the samples was also compared.resultsthe 60-s and 120-s silanation time groups showed a higher sbs than the other groups ( p < 0.05 ) .
samples tested after 24 h showed a significantly higher sbs than did the samples tested after 1 h ( p < 0.05 ) .
the 1-s group showed higher ari scores .
the one - way analysis of variance and student - newman - keuls test showed that the sbs values of the 60-s and 120-s silanation time groups were not significantly different from the sbs values of enamel.conclusionsadequate silanation time is required to produce sufficient bond strength during silicoating . |
laserassisted tattoo removal has wellknown limitations . often a lengthy regimen of many treatment sessions is required .
although a scale has been described that estimates the number of required sessions 2 , it is often difficult for the clinician to predict the number of treatment sessions required for satisfactory tattoo fading or clearance 3 .
it is not uncommon that 10 or more sessions at 4 to 6week intervals are required for a proper aesthetic result .
this poses significant challenges for subjects and clinicians alike , and is often an inhibiting factor for subjects desiring tattoo removal from actually obtaining it .
the r20 multipass technique initially showed promise by allowing several laser passes in a single session by permitting the laserinduced opaque whitening caused by the generation of microcavitation bubbles to naturally subside in approximately 20 minutes 4 .
this technique has not been widely adopted largely due to workflow limitations ; one patient could require an 80minute treatment session which is impractical in a busy clinical setting .
recently , it was demonstrated that perfluorodecalin ( pfd ) could rapidly dissipate the opaque , white microbubble layer formed after exposure of tattoos to qswitched lasers , allowing clinically efficient multipass treatment 1 . to this end
, the present qualitative pilot study was undertaken to determine if rapid multiple laser passes at highest tolerated fluence enabled by a transparent pfdinfused silicone patch might have a similar beneficial effect for laser tattoo removal .
perfluorodecalin is a stable , metabolically inert fluorocarbon liquid that has excellent optical transparency from the uv to the farir 5 .
it has the unusual properties of simultaneously being both lipophobic and hydrophobic , yet it is freely flowing with an extremely low surface energy that allows it to rapidly wick into porous materials . its intraocular use assists in the repair of detached retinas .
it enhances cosmetic preparations as a skin conditioner and hair detangler , but its high cost has limited more general use . a wellknown property of pfd and similar perfluorocarbons is their ability to dissolve gasses 6 .
pfd can absorb half its liquid volume of gaseous oxygen as well as other gases such as nitrogen and steam .
this led to its use in firstgeneration artificial blood substitutes as well as ongoing work in liquid ventilation and related medical applications 6 , 7 .
since the partial pressure of gas in laserinduced microcavitation bubbles is well above the partial pressure of atmospherically equilibrated pfd , the diffusion of gas from microbubbles into liquid pfd requires no special handling or degassing requirements . although it is a heavy molecule with approximately twice the density of water , pfd readily evaporates when exposed to room air , an effect exacerbated by warm skin . covering it with a transparent impermeable membrane
there are also optical indexmatching benefits to both the pfd and to the silicone material described below .
a solution to this problem was simply to perforate medicalgrade silicone gel with a multiplicity of fine holes , and allowing the pfd to mechanically reside in them .
pfd rapidly wicks into the perforations , and then readily wicks back out onto the surface of the skin .
the index of refraction of human epidermal tissue was measured by ding et al . to vary from 1.44 at 600 nm to 1.42 at 1064 nm 8 .
the indices of refraction of perfluorodecalin and the transparent silicone material are 1.31 and 1.40 , respectively .
this provides good optical index matching that allows efficient coupling of laser light into the skin despite the presence of the liquid pfd and the silicone patch itself .
littlejohn et al . have recently exploited this effect in a striking series of confocal microscopy studies of plant leaves 9 . when an opaque plant leaf plant leaf is briefly immersed in pfd , it becomes sufficiently transparent to read text through it .
the optical clearing effect of the pfd patch may have significance in laser tattoo removal for several reasons .
the reduction in optical scattering allows more photons to penetrate into the skin to interact with deeply residing ink particles , and reduces the local fluence near the skin surface compared to more highly scattering conventional treatment .
this effect would also reduce potentially damaging epidermal thermal effects by reducing heat generated superficially by the laser , as well as thermally coupling heat that is generated into the bulk material of the silicone .
perfluorodecalin is a stable , metabolically inert fluorocarbon liquid that has excellent optical transparency from the uv to the farir 5 .
it has the unusual properties of simultaneously being both lipophobic and hydrophobic , yet it is freely flowing with an extremely low surface energy that allows it to rapidly wick into porous materials . its intraocular use assists in the repair of detached retinas .
it enhances cosmetic preparations as a skin conditioner and hair detangler , but its high cost has limited more general use .
a wellknown property of pfd and similar perfluorocarbons is their ability to dissolve gasses 6 .
pfd can absorb half its liquid volume of gaseous oxygen as well as other gases such as nitrogen and steam .
this led to its use in firstgeneration artificial blood substitutes as well as ongoing work in liquid ventilation and related medical applications 6 , 7 .
since the partial pressure of gas in laserinduced microcavitation bubbles is well above the partial pressure of atmospherically equilibrated pfd , the diffusion of gas from microbubbles into liquid pfd requires no special handling or degassing requirements . although it is a heavy molecule with approximately twice the density of water , pfd readily evaporates when exposed to room air , an effect exacerbated by warm skin . covering it with a transparent impermeable membrane
there are also optical indexmatching benefits to both the pfd and to the silicone material described below .
a solution to this problem was simply to perforate medicalgrade silicone gel with a multiplicity of fine holes , and allowing the pfd to mechanically reside in them .
pfd rapidly wicks into the perforations , and then readily wicks back out onto the surface of the skin .
the index of refraction of human epidermal tissue was measured by ding et al . to vary from 1.44 at 600 nm to 1.42 at 1064 nm 8 .
the indices of refraction of perfluorodecalin and the transparent silicone material are 1.31 and 1.40 , respectively .
this provides good optical index matching that allows efficient coupling of laser light into the skin despite the presence of the liquid pfd and the silicone patch itself .
littlejohn et al . have recently exploited this effect in a striking series of confocal microscopy studies of plant leaves 9 . when an opaque plant leaf plant leaf is briefly immersed in pfd , it becomes sufficiently transparent to read text through it .
the optical clearing effect of the pfd patch may have significance in laser tattoo removal for several reasons .
the reduction in optical scattering allows more photons to penetrate into the skin to interact with deeply residing ink particles , and reduces the local fluence near the skin surface compared to more highly scattering conventional treatment .
this effect would also reduce potentially damaging epidermal thermal effects by reducing heat generated superficially by the laser , as well as thermally coupling heat that is generated into the bulk material of the silicone .
a conventional nanosecond pulse duration qswitched alexandrite 755nm laser ( candela alex trivantage , wayland , ma ) was selected for use in this study . while several laser wavelengths may be used to treat black and dark blue ink , 755 nm is well recognized as being clinically effective in achieving clearance of such tattoos 3 , 10 .
the selection of wavelength chosen for this particular study design was based simply on general availability and wellestablished clinical efficacy .
the pfd patch was designed to have no clinical effect on wavelength or spot size selection ; its optical clearing effect was however clinically observed to allow substantially higher maximum tolerated fluence .
this was an allendale irbapproved , singlesite , splitside , prospective pilot study to evaluate the efficacy and safety of a transparent pfd patch as an accessory to laser tattoo removal for accelerated clearing of blue or black tattoos .
twenty adult subjects , fitzpatrick skin types i iii , were enrolled in the study , with 15 remaining ( two subjects had two tattoos ) for five or more treatment sessions at approximately 4week intervals .
inclusion criteria included subjects 18 years of age with previously untreated tattoos less than 100 cm in size consisting of dark blue or black ink , fitzpatrick skin type i iii , no tan in the treatment area and no contraindications for participation in a clinical trial or treatment with a qswitched laser . subjects with a history of oral gold therapy , hypertrophic or keloidal scarring , use of oral retinoids within the previous 12 months , or who were pregnant , or breastfeeding
characteristics including age , gender , fitzpatrick skin type , tattoo site , and color(s ) present in the tattoo were documented during the enrollment session .
one half of the tattoo was randomly assigned laser treatment using the pfd patch ; the other half received conventional laser treatment through air without the patch and served as the control .
lidocaine hcl 1% with or without epinephrine 1:100,000 was injected at the treatment site on all subjects throughout the study .
pfd was applied to the skin and the patch was applied approximately 5 minutes prior to laser treatment .
standard unpolarized flash photographs were taken for all subjects at each visit before treatment , showing patch placement , and immediately posttreatment .
the pfd patch side received rapid multiple laser passes as clinically indicated , typically 3 or 4 , with an average of 3.6 .
the control half received a single laser pass due to the immediate development of persistently opaque epidermal whitening following exposure to laser energy rendering additional treatments impossible .
both sides of the tattoo were treated at the maximumtolerated fluence as determined by epidermal whitening without frank , clinically apparent blister formation .
treatment through the patch allowed higher treatment fluence in all subjects relative to control . the patch was lifted between passes and additional pfd was reapplied with a foamtipped swab ( mg chemicals , burlington , canada ) to replenish any liquid that may have been absorbed into the skin . in cases where some epidermal whitening developed despite treatment through the patch , with reapplication of liquid pfd this whitening typically resolved rapidly .
the patch was repositioned immediately after reapplication of liquid pfd to minimize evaporation and additional laser treatment was administered without further delay . upon completion of each treatment , subjects were given complete wound care instructions including clinic contact information .
aquaphor ( beiersdorf , wilton , ct ) was applied , and tegaderm framestyle film dressings were applied over the treated area ( 3 m , st .
the presence of side effects and adverse events was assessed and recorded for both patch and control sites immediately after treatment and at each visit .
repeat treatments were performed at 4 to 6week intervals until the tattoo was either fully resolved on the patch side or until no further clinical benefit was deemed likely . at that time , subjects continued to receive laser treatments to the control side until the tattoo reached the maximal perceived clinical benefit .
it is worth noting that although subjects were given the choice of continuing treatment with or without the patch on the control side after the patch side had cleared , all chose to continue with the patch .
a conventional nanosecond pulse duration qswitched alexandrite 755nm laser ( candela alex trivantage , wayland , ma ) was selected for use in this study . while several laser wavelengths may be used to treat black and dark blue ink , 755 nm is well recognized as being clinically effective in achieving clearance of such tattoos 3 , 10 .
the selection of wavelength chosen for this particular study design was based simply on general availability and wellestablished clinical efficacy .
the pfd patch was designed to have no clinical effect on wavelength or spot size selection ; its optical clearing effect was however clinically observed to allow substantially higher maximum tolerated fluence .
this was an allendale irbapproved , singlesite , splitside , prospective pilot study to evaluate the efficacy and safety of a transparent pfd patch as an accessory to laser tattoo removal for accelerated clearing of blue or black tattoos .
twenty adult subjects , fitzpatrick skin types i iii , were enrolled in the study , with 15 remaining ( two subjects had two tattoos ) for five or more treatment sessions at approximately 4week intervals .
inclusion criteria included subjects 18 years of age with previously untreated tattoos less than 100 cm in size consisting of dark blue or black ink , fitzpatrick skin type i iii , no tan in the treatment area and no contraindications for participation in a clinical trial or treatment with a qswitched laser .
subjects with a history of oral gold therapy , hypertrophic or keloidal scarring , use of oral retinoids within the previous 12 months , or who were pregnant , or breastfeeding were excluded .
informed consent was obtained as per standard protocol . characteristics including age , gender , fitzpatrick skin type , tattoo site , and
one half of the tattoo was randomly assigned laser treatment using the pfd patch ; the other half received conventional laser treatment through air without the patch and served as the control .
lidocaine hcl 1% with or without epinephrine 1:100,000 was injected at the treatment site on all subjects throughout the study .
pfd was applied to the skin and the patch was applied approximately 5 minutes prior to laser treatment .
standard unpolarized flash photographs were taken for all subjects at each visit before treatment , showing patch placement , and immediately posttreatment .
the pfd patch side received rapid multiple laser passes as clinically indicated , typically 3 or 4 , with an average of 3.6 .
the control half received a single laser pass due to the immediate development of persistently opaque epidermal whitening following exposure to laser energy rendering additional treatments impossible .
both sides of the tattoo were treated at the maximumtolerated fluence as determined by epidermal whitening without frank , clinically apparent blister formation .
the patch was lifted between passes and additional pfd was reapplied with a foamtipped swab ( mg chemicals , burlington , canada ) to replenish any liquid that may have been absorbed into the skin . in cases where some epidermal whitening developed despite treatment through the patch , with reapplication of liquid pfd this whitening typically resolved rapidly .
the patch was repositioned immediately after reapplication of liquid pfd to minimize evaporation and additional laser treatment was administered without further delay . upon completion of each treatment , subjects were given complete wound care instructions including clinic contact information .
aquaphor ( beiersdorf , wilton , ct ) was applied , and tegaderm framestyle film dressings were applied over the treated area ( 3 m , st .
the presence of side effects and adverse events was assessed and recorded for both patch and control sites immediately after treatment and at each visit .
repeat treatments were performed at 4 to 6week intervals until the tattoo was either fully resolved on the patch side or until no further clinical benefit was deemed likely . at that time , subjects continued to receive laser treatments to the control side until the tattoo reached the maximal perceived clinical benefit .
it is worth noting that although subjects were given the choice of continuing treatment with or without the patch on the control side after the patch side had cleared , all chose to continue with the patch .
in 11 out of 17 tattoos , those treated through the pfd patch showed more rapid clearance with higher subject satisfaction than standard throughair treatment ( table 1 ) .
the patch allowed three or four rapid multiple passes in all subjects as opposed to only a single pass on the control side .
the patch also allowed an increased fluence to be delivered relative to control by a factor of 1.5 to 1.8 , despite multiple laser passes , without an increase in adverse events .
these anticipated adverse events were mild to moderate in severity and included erythema , edema , pain , and crusting .
the incidence of anticipated adverse events was the same for both the patch and control sides of the tattoos .
blister formation was reported by 2 of the subjects , and transient hypopigmentation by 3 of the subjects , all of which resolved completely and without sequelae .
as one example , figure 1 shows subject 15 at : baseline , immediately after treatment 1 , and 4 weeks after treatment 5 .
summary of subject demographics and observations ( a ) tattoo from subject 15 at baseline .
( b ) the pfd patch on the left side of the tattoo reduces whitening allowing four laser passes in a few minutes .
there was a wide array of responses ranging from dramatic superiority after only two treatment sessions with over 90% clearance on the patch side compared to less than 20% on the control side , to marked superiority which became apparent after a few treatments , to cases in which superiority of the patch was not demonstrated .
typical positive results are shown in figure 2 . even in cases where superiority of clearance relative to control was not demonstrated ,
this proofofconcept pilot study was designed to qualitatively compare the effect of rapid , multiple qswitched laser passes performed at highest tolerated fluence in conjunction with an optical clearing and index matching pfd patch relative to standard qswitched laser treatment on the clearing of tattoos . quantifying the improvement in rate of clearance , and partitioning the benefit of multiple passes and/or higher fluence on outcomes were beyond the scope of the study design .
however , this study demonstrated that the pfd patch , when used in conjunction with a qswitched laser , produces a beneficial effect with respect to clearance of blue and black tattoo ink relative to standard treatment protocols .
some of the factors implicated in this phenomenon include the age of the tattoo , the composition and depth of the ink , location on the body , smoking status , and professional versus amateur application .
future studies that explore these parameters as they relate to pfd patch efficacy are clearly warranted , as are studies that evaluate the pfd patch in conjunction with qswitched lasers of other wavelengths and pulse durations in both the nanosecond and picosecond range .
just as there are many factors affecting the speed and efficacy of laser tattoo removal in general , there appear to be several mechanisms at play with the use of the pfd patch .
the first involves the unusual ability of pfd itself to absorb gas 6 , 7 .
when a tattoo is exposed to the high optical energy of a laser pulse , stress waves , and cavitation bubbles are formed 11 .
the apparent white layer is composed of microscopic bubbles formed nearly instantaneously as energy absorbed by the ink particles is transferred to surrounding tissue .
further laser passes are ineffective because light can no longer penetrate sufficiently to interact with the pigment . the first mechanism that the pfd patch facilitates is the direct absorption of the gas within the bubbles .
also , pfd contained in the most distal part of the perforations is at a lower partial pressure than that at the surface in direct contact with the cavitation bubbles , which drives the dissolution of gasses into the pfd .
pfd is a very mobile fluid that readily fills voids and wicks into porous materials 9 , 13 .
as the opaque bubble layer dissipates , optical clearing may become the dominant mechanism allowing photons to penetrate more deeply into the tissue 14 .
the laser may have improved efficacy if its light reaches deep ink particles due to a reduction in optical scattering ; this may lead to better treatment of recalcitrant tattoos .
but optical clearing also has a counterintuitive effect ; it reduces the local fluence in the upper layers of the skin precisely because it reduces scattering .
this allows more photons to penetrate more deeply where recalcitrant ink tends to reside , but also appears to require a higher incident fluence to compensate for the reduction in local fluence in the uppermost layers of the skin .
this is consistent with our clinical observation that the patch allows higher tolerated fluence when compared to throughair treatment of the same tattoo .
we note that even as the patch significantly increases the maximum tolerated fluence , this increase did not result in increased side effects .
the index of refraction of human epidermal tissue was measured by ding et al . to vary from 1.44 at 600 nm to 1.42 at 1064 nm 8 .
the index of refraction of perfluorodecalin and the transparent silicone material are 1.31 and 1.40 , respectively .
this provides optical index matching that allows efficient optical coupling of laser light into the skin despite the presence of the patch .
a fourth mechanism is thermal protection of the epidermis by the bulk transparent silicone material of the pfd patch itself as well as the high heat capacity of pfd relative to air .
as the patch is placed on the skin , air is excluded from the patchskin interface providing good thermal coupling from the epidermis through the pfd into the silicone .
this is extremely important from a perspective of both patients and staff as laserplume has been well documented to contain noxious materials 15 , 16 .
it is also important to note that , despite greater total energy application on the pfdtreated side on account of both multiple passes and increased fluence , there were no increases in adverse events or delay in recovery time associated with use of the pfd patch .
rapid multipass treatment of tattoos with highest tolerated fluence facilitated by a transparent pfdinfused patch clears tattoos more rapidly than conventional methods .
we observed that even with multiple laser passes , the highest tolerated fluence could be safely increased by a typical factor of 1.5 to as high as 1.8 with the pfd patch as compared to conventional treatment through an airskin interface on the control side of the same tattoo using a 755nm qswitched alexandrite laser .
no unanticipated adverse events were observed . although this study was limited by its modest sample size and by the use of only one laser wavelength and pulse duration , the potential benefit of the pfd patch with other wavelengths and pulse durations ( including picosecond lasers ) warrants further investigation .
costner had full access to all of the data in the study and take responsibility for the integrity of the data and the accuracy of the data analysis . | background and objectivesperfluorodecalin ( pfd ) has previously been shown to rapidly dissipate the opaque , white microbubble layer formed after exposure of tattoos to qswitched lasers [ 1 ] .
the current pilot study was conducted to qualitatively determine if the use of a transparent pfdinfused silicone patch would result in more rapid clearance of tattoos than conventional throughair techniques.materials and methodsblack or dark blue tattoos were divided into two halves in a singlesite irbapproved study with 17 subjects with fitzpatrick skin types i iii .
one half of each tattoo served as its own control and was treated with one pass of a standard qswitched alexandrite laser ( 755 nm ) .
the other half of the tattoo was treated directly through a transparent perfluorodecalin ( pfd ) infused patch ( on light sciences , dublin , ca ) .
the rapid whitening reduction effect of the patch routinely allowed three to four laser passes in a total of approximately 5 minutes .
both sides were treated at highest tolerated fluence , but the optical clearing , indexmatching , and epidermal protection properties of the pfd patch allowed significantly higher fluence compared to the control side .
standard photographs were taken at baseline , immediately prior to treatment with the pfd patch in place , and finally before and after each treatment session .
treatments were administered at 4 to 6week intervals.resultsin a majority of subjects ( 11 of 17 ) , tattoos treated through a transparent pfdinfused patch showed more rapid tattoo clearance with higher patient and clinician satisfaction than conventional treatment . in no case
did the control side fade faster than the pfd patch side .
no unanticipated adverse events were observed.conclusionsrapid multipass treatment of tattoos with highest tolerated fluence facilitated by a transparent pfdinfused patch clears tattoos more rapidly than conventional methods .
lasers surg .
med . 47:613618 , 2015 .
2015 the authors .
lasers in surgery and medicine published by wiley periodicals , inc . |
successful organ preservation is an important component of transplantationand ensures the maintenance of organ viability until implantationinto the recipient .
currently , heart preservation for transplantationis limited to 4 to 6 hours of cold ischemic storage , and longerperiods of ischemia are known to adversely affect survival .
this is in contrast to preservation of the liver , kidney , andpancreas , which have been successfully preserved for 24 to 36hours although graft function may be transiently compromised .
ischemia initiates a complex injury process that is characterized by the loss of high energy phosphates , the accumulation of intracellular inosine and hypoxanthine , cessation of the na - k pump , followed by cell swelling , cytosolic calcium increase , and enzymatic degradation . in general , lower organ temperatures ( 0c to 4c ) maintain high energy phosphates more effectively .
however , temperatures below 2c significantly increase the risk of cold injury with some proteins denaturing below 0c . at higher temperatures ( 8c to 12c ) , organ function is maintained to a greater extent [ 11 , 12 ] .
however , at temperatures above 12c the higher metabolic demand for oxygen leads to irreversible hypoxic injury and thus significantly impairs organ function .
ideally , there should be a temperature range at which these two tendencies can be balanced .
the instructions for use of organ preservation solutions state a temperature range between 2 - 8c or 4 - 8c .
hence , the balance seemingly forms the cornerstone of cold ischemic storage which is hypothermia at 4c to 8c with an appropriate cold storage solution .
hypothermiadecelerates metabolism and the ionic constituents of the storage solution facilitaterapid cessation of electrical activity .
the formulation of the preservation solution is based on three principles : ( a ) hypothermic arrest of metabolism ; ( b ) provision of a physical and biochemical environment that maintains viability of the structural components of the tissue during hypothermic metabolic arrest ; and ( c ) minimization of the effects of reperfusion injury .
hypothermia does not stop metabolism but it slows down biochemicalreaction rates and decreases the rate at which intracellularenzymes degrade essential cellular components necessary fororgan viability .
most enzymes of hypothermic animals showa 1.5 to 2.0-fold decrease in activity for every 10c decreasein temperature .
hypothermia also retards lysis of organelles like lysosomesthat , in turn , release autolytic enzymes that cause cell death .
the current gold standard for transporting a donor organ to a recipient for transplant involves storing the organ in organ preservation fluid within sequential plastic bags that are placed on ice and transported in a cooler .
some of the potential issues associated with this method of storage include ( a ) variability of packaging materials used ; ( b ) bioincompatibility of the material that touches the organ ; ( c ) tissue injury due to movement / vibration ; and ( d ) potential uneven cooling of the organ tissue . in a multicenter study of 186 organs , recommended packaging guidelines were tested for their ability to maintain organ temperatures at acceptable temperatures .
paragonix technologies , inc . has developed a series of medical devices intended for transport of donor hearts and kidneys to recipients for implant : the sherpa pak cardiac transport system ( cts ) and the sherpa pak kidney transport system ( kts ) .
the sherpa pak system ( figures 1 and 2 ) is intended to provide a safe , consistent method for cold ischemic storage and transport of donor organs .
a , b , c ) future product design of sherpa pak cts and kts .
the systems are designed to overcome many of the potential issues associated with the current systems used for transport .
the sherpa pak s cooling mechanism is based on phase - change material ( pcm ) , which is a substance with a high heat of fusion which is capable of storing and releasing large amounts of energy .
the sherpa pak s pcm panels are designed to hold 5c longer than conventional phase change material cold packs ( which undergo phase change at 0c , and have little heat capacity at 5c ) .
in addition , the pcm can be placed in direct contact with temperature sensitive products because there is no risk of freezing ( please note , however , that the cold panels do not come in direct contact with the donor organ ) .
management of preservation in the sherpa pak system is the same for both kidneys and hearts other than that the heart is connected to a connector in the inner hard shell assembly and the kidney is not .
we have performed multiple temperature profile studies for varying periods of time , from 4 hours up to 30 hours of storage ( tables 1 and 2 ) . preconditioning protocol for components of the sherpa pak systems .
performance data for static hypothermic storage between 4 and 8c for up to 30 hours using the sherpa pak technology at ambient temperature .
all protocols were in conformity with the guide for the care and use of laboratory animals published by the national institutes of health 86 - 23 , revised in 1985 .
anesthesia was induced with 4.4 mg / kg telazol , 2.2 mg / kg xylazine and 0.04 mg / kg atropine intramuscularly and maintained with isoflurane after endotracheal intubation .
median sternotomy was performed and heparin ( 300 units / kg ) was given intravenously .
an aortic root cannula was inserted and , after cross - clamping the ascending aorta , 1 l of celsior ( genzyme , cambridge , ma , usa ) cardioplegia was administered through the cannula .
the heart was vented through the left atrial appendage , and superior and inferior vena cava , and donor cardiectomy was performed .
complete sherpa pak cardiac transport systems ( cts ) and sherpa pak kidney transport systems ( kts ) were utilized for the thermal qualification test . prior to initiating the testing
, the components of the sherpa pak systems were preconditioned according to the instructions for use provided with the device ( table 1 ) .
the sherpa pak system consists of multiple components : 1 ) an outer transport shipper which contains various non - ice - based temperature controlled packaging elements ; 2 ) an inner and outer hard shell assembly ( i.e. sherpa pak/sherpa pak shell ) which provides a double , rigid barrier shipper in which the organ is immersed and suspended in a cold storage fluid cleared for use in storing and transporting donor organs ; 3 ) an off - the - shelf temperature data logger that monitors and displays the temperature of the organ during transport ; and 4 ) an off - the - shelf timer that displays elapsed time during transport .
once conditioned , the systems were assembled in accordance with the instructions for use with the exception that additional thermocouples were placed to monitor temperature at various locations within the system .
these thermocouples were connected to an external display ( the presence of the thermocouples did not alter the closure of the device ) .
temperature readings were monitored and recorded at regular intervals for the period of the experiment .
temperature measurements were taken every 5 min in studies i.a , i.b and iii.a , and every 10 s in studies ii and iii.b . when not otherwise indicated , the storage solution was saline or water . in order to capture any variations in temperature within the device , thermocouples were placed in various locations of the device .
thermocouple locations are designated as follows : center1 = one probe ( n=1 ) located in the center of the fluid filled sherpa pak. wetted probe = one probe ( n=1 ) located at the top of the fluid filled sherpa pak ( within fluid ) .
this assembly was then placed into a third solution - filled bag and placed onto crushed ice in an ice chest . when not otherwise indicated , the storage solution was saline or water . study design .
three different ex - vivo studies have been performed with the paragonix sherpa pak devices : study i : the temperature of the fluid filled device was measured for up to 30 h at an outside temperature set at 22c ( study i.a and study i.b , table 2).study ii : the temperature of the fluid filled device was measured for up to 30 h at extreme outside temperatures set at -8c and 31c ( study ii , table 3).study iii : the temperature of pig hearts attached to the device was measured for up to 12 h ( study iii.a and iii.b ; table 4 ) .
study i : the temperature of the fluid filled device was measured for up to 30 h at an outside temperature set at 22c ( study i.a and study i.b , table 2 ) .
study ii : the temperature of the fluid filled device was measured for up to 30 h at extreme outside temperatures set at -8c and 31c ( study ii , table 3 ) . study iii : the temperature of pig hearts attached to the device was measured for up to 12 h ( study iii.a and iii.b ; table 4 ) .
performance data for static hypothermic storage between 4 and 8c for up to 30 hours using the sherpa pak technology with two 1 hour excursions to extreme hot and cold temperatures .
summary of animal studies of static hypothermic storage between 4 and 8c using the sherpa pak technology .
sherpa pak can keep the temperature of the preservation solution between 4 - 8c for a period of up to 30 hours . the first part of study i ( table 2 ) demonstrated in three separate test runs that all temperatures recorded from the individually placed temperature probes remained below the 8c upper limit of the design specification through four hours .
moreover , all recorded temperatures from all individually placed temperature probes remained below the 8c upper limit through 12 hours of experimentation .
most importantly , the experiment verified that the fluid within the sherpa pak ( in which the donor heart is immersed ) was maintained between 4c and 6c ( as measured by the three probes placed within the fluid ; two at center of the container , one against the side wall ) which is within the accepted 4c - 8c .
the second part of study i ( table 2 ) demonstrated that all temperatures recorded from the individually placed temperature probes remained below the 8c upper limit through 30 hours .
most importantly , the experiment verified that the fluid within the sherpa pak ( in which the donor organ is immersed ) was maintained between 4c and 8c ( as measured by the temperature probes placed within the fluid ) .
sherpa pak consistently maintains fluid temperature at 4 - 8c despite extreme fluctuations in ambient temperature .
results of the four separate test runs ( two test runs each at cold or hot temperatures ) of the experiment ( study ii : table 3 ) demonstrated that the storage solution remained below the 8c upper limit of the design specification through 24 hours .
interestingly , in the second warm temperature test run , the cold storage solution was n't preconditioned according to its instructions for use and the starting temperature of the fluid was 7c ( versus 6c according to manufacturer ifus ) .
even with this slightly elevated temperature , the sherpa pak system was capable of maintaining temperature throughout the 24 hour period .
sherpa pak can maintain the temperature at 4 - 8c when the system is loaded with a pig heart .
both the sherpa pak cts as well as the conventional ice storage demonstrated their ability to cool and maintain temperature throughout the experimental period .
however , the ice system cooled the heart based on the two thermocouples to temperatures as low as 0c at the apex closest to the ice , and < 1c inside the left ventricle of the pig heart .
the experiment verified that the fluid within the sherpa pak ( in which the donor organ is immersed ) was maintained between 4c and 8c ( study iii , table 4 ) .
temperatures were recorded every 5 min , providing up to 145 readings in study iii.a , and every 10 s , providing up to 10801 readings in study iii.b results of 12 temperature test runs during pig heart storage demonstrated that the sherpa pak cts was able to maintain fluid temperatures within a range of 4 - 8c when fully loaded with a pig heart ( table 4 ) .
the purpose of this study was to verify whether the paragonix sherpa pak device was capable of maintaining the desired temperature for organ storage which lies between 4 and 8c .
several studies were performed during which all system components including the cold storage solution were preconditioned according to the instructions for use . in certain studies ,
exterior conditions remained constant as the system will always be under the direct supervision of medical personnel during transport and not anticipated to be exposed to uncontrolled temperatures or environmental conditions .
the purpose of study ii , in which exterior conditions were changed to either high temperatures ( 31c ) or low temperatures ( -8c ) for 1 hour twice during 30 hours of monitoring , was to challenge the system at two extreme temperatures .
the results of the testing verified that the design of the sherpa system was able to maintain the fluid in which the donor organ is contained within the clinically acceptable range of 4c - 8c through 24 hours , even when challenged to high and low temperatures . when ambient temperatures were kept constant ( at 22c ) the system was able to maintain temperatures within a range of 4c - 8c throughout 30 hours of monitoring .
based upon the results of the testing , we conclude that the sherpa pak devices are designed such that they can reliably maintain a clinically acceptable storage temperature for the donor organ .
it is commonly accepted that the 4c - 8c temperature range is the best balance for preservation of high energy phosphate stores , minimization of cold injury , and preservation of post - transplant function .
although temperatures below 4c offer superior maintenance of high energy phosphates , temperatures below 2c significantly increase the risk of cold injury and frostbite [ 8 , 9 ] .
the results of the studies demonstrated that the paragonix sherpa pak device was capable of maintaining a very consistent temperature within the 4c - 8c temperature range through twelve hours .
the conventional ice storage was also very effective at cooling and maintaining temperature of the heart through six hours ; however , the data show that temperatures encountered with this system approached 0c for the last few hours of the experiment , thus increasing the potential for issues with the donor heart .
these data compared well to a multicenter study on transport temperature of organs . studying 186 organs ,
the average organ temperature during transportation was below 2c , and after 6 hours below 0c .
based upon these test results , it appears that the paragonix sherpa pak transport system is effective at maintaining the temperature of the organ in the optimal temperature range . while the study investigated ambient temperatures that might be expected in a clinical situation and temperature excursion that may occur during organ transport
, a limitation of the study is that measurements were taken in a research setting , which may not entirely reflect the clinical setting .
the paragonix sherpa pak device may decrease cold injury of donor organs by maintaining the temperature consistently between 4c and 8c and therefore may decrease primary graft failure after organ transplantation . | introductioncurrently , the gold standard for donor organ preservation in clinical organ transplantation consists of 3 plastic bags and an ice box .
the first plastic bag includes the organ itself immersed in preservation solution ( e.g. celsior ) .
this bag is put in a second bag filled with saline , and then these two are put in a third bag filled with saline which is then put in the ice box .
the disadvantage of this method is that the organ usually gets too cold .
it has been shown that the theoretical perfect temperature for organ preservation is 4c - 8c .
while higher temperatures lead to hypoxic injury of the organ because the metabolism is not decreased efficiently , lower temperatures than 4c increase the risk of cold injury with protein denaturation . in the current study , we investigated a device that keeps the organ temperature consistently in the desired range of 4c - 8c and can potentially decrease cold injury to donor organs.methodsthree different ex vivo studies were performed with the paragonix sherpa pak devices : 1 ) the temperature of the fluid - filled device was measured for up to 30 hours at an outside temperature set at 22c , 2 ) the temperature of the fluid - filled device was measured for up to 30 hours at extreme outside temperatures set at -8c and 31c , 3 ) the temperature of a pig heart attached to the device was measured up to 12 hours.resultsall studies showed that the paragonix sherpa pak can keep the temperature of the heart consistently between 4 and 8c.conclusionsthe paragonix sherpa pak device may decrease cold injury of donor organs by maintaining the temperature consistently between 4c and 8c and therefore may decrease primary graft failure after organ transplantation . |
fusiform ruptured aneurysms of the vertebral artery involving posterior inferior cerebellar artery ( pica ) or the vertebro - pica ( va / pica ) origin are challenging aneurysms to treat.1 direct surgical clipping is usually not possible due to circumferential involvement of the vessel .
many surgical approaches have been described including clip / wrapping , segmental sacrifice , flow reversal with proximal occlusion , distal occlusion , and bypass with trapping .
of all these treatments , bypass with trapping likely offers the most durable option with less chance of infarction than trapping or sacrifice alone .
though endovascular techniques have been used,2 cases of vessel sacrifice result in a predictably high rate of infarction and newer techniques such as flow diversion are limited in cases of subarachnoid hemorrhage due to the need for dual antiplatelet agents .
because of the extremely variable anatomy of the vertebral and pica vasculature , the optimal treatment must be carefully determined with a full understanding of the specific angiographic anatomy and the impact of potential anatomic variations . in this report
, we describe two cases of aneurysms involving the origin of pica , both with very unusual anatomic features as well as the decision making involved in achieving a successful treatment for each .
this 52-year - old female patient presented with neck pain followed by severe headache and loss of consciousness .
she was found to have a fischer grade 4 , hunt and hess grade 3 subarachnoid hemorrhage .
1 ) showed a possible left pica origin saccular aneurysm , however , angiography revealed a small serpentine fusiform recanalization within the larger aneurysm dome .
the aneurysm was not large or giant as most serpentine aneurysms are , and if it had been mistaken for a saccular aneurysm and clipped , would have resulted in occlusion of pica at the origin and likely medullary and pica infarction . because of this very unusual anatomy , the decision was made to perform a bypass to the distal pica and trap the serpentine segment at the inflow and outflow .
the patient was taken for suboccipital craniotomy , partial left condylectomy , and midline pica
pica side - to - side anastomosis followed by trapping of the aneurysm at the origin of pica . at the time of surgical inspection , there was found to be a separate inflow and outflow vessel into a larger dome , which could have been mistaken for a saccular or fusiform sidewall type aneurysm .
postoperatively , the patient was found to have a small asymptomatic distal left pica stroke .
a 6-month follow - up angiogram showed patency of the bypass and the patient had returned to her neurologic baseline with no deficit .
case 1 : ( a ) reconstructed cta image showing the area suspicious for aneurysm ( black arrow ) .
( b ) lateral angiogram of the left vertebral artery , showing the serpentine recanalization within the aneurysm ( black arrow ) .
this is better visualized on the 3d rotational angiogram reconstruction ( c ) showing the clear serpentine nature of the aneurysm ( white arrow ) .
( d , e ) follow - up angiogram at 6 months , with ap ( d ) and lateral ( e ) views demonstrating the patent bypass ( white narrow arrow ) .
3d , three - dimensional ; ap , anteroposterior ; cta , computed tomographic angiography .
this 42-year - old female patient presented after sudden onset worst headache of her life ( fig .
she was intubated , weakly following commands in the upper extremities with no significant movement in the lower extremities .
angiogram showed a fusiform dissecting aneurysm of the left vertebral artery involving the origin of pica as well as the origin of the anterior spinal artery ( asa ) .
the pica was recognized to be a bihemispheric variant , crossing midline , and serving the contralateral pica territory with aplasia of the contralateral pica .
the patient was taken for suboccipital craniotomy , partial left condylectomy , and occipital artery to pica anastomosis ( due to the lack of contralateral pica ) .
no distal clip was applied to allow retrograde filling of the asa from the contralateral vertebral artery .
early follow - up angiography revealed patency of the bypass filling the bihemispheric pica , patency of the asa , and a small amount of slow filling of the aneurysm at the asa level .
she had a prolonged recovery with pneumonia and meningitis and required tracheostomy and percutaneous endoscopic gastrostomy tube . at 6-month follow - up ,
the aneurysm is angiographically cured with patency of the bypass ( feeding the bihemispheric pica ) as well as the asa ( from retrograde flow ) .
clinically she was awake and oriented , beginning to ambulate , and living at home .
case 2 : ( a ) left vertebral artery ap angiogram , showing the fusiform aneurysm ( black arrow ) and the filling of the anterior spinal artery from the dome of the aneurysm ( narrow white arrows ) .
the white arrow indicates the origin of the pica from the dome of the aneurysm .
c ) reconstruction of 3d rotational angiogram which shows bilateral filling of pica territories ( narrow white arrows ) from the left pica consistent with a bihemispheric variant .
( d ) postoperative lateral projection of the left common carotid injection , showing the patent anastomosis from the occipital artery to the pica ( narrow white arrow ) .
( e ) magnified ap projection of the postoperative injection of the right vertebral artery .
note that the distal left vertebral artery ( black arrow ) has remodeled to a very small channel that fills the anterior spinal artery ( white arrows ) .
3d , three - dimensional ; ap , anteroposterior ; pica , posterior inferior cerebellar artery .
this 52-year - old female patient presented with neck pain followed by severe headache and loss of consciousness .
she was found to have a fischer grade 4 , hunt and hess grade 3 subarachnoid hemorrhage .
1 ) showed a possible left pica origin saccular aneurysm , however , angiography revealed a small serpentine fusiform recanalization within the larger aneurysm dome .
the aneurysm was not large or giant as most serpentine aneurysms are , and if it had been mistaken for a saccular aneurysm and clipped , would have resulted in occlusion of pica at the origin and likely medullary and pica infarction . because of this very unusual anatomy , the decision was made to perform a bypass to the distal pica and trap the serpentine segment at the inflow and outflow .
the patient was taken for suboccipital craniotomy , partial left condylectomy , and midline pica
pica side - to - side anastomosis followed by trapping of the aneurysm at the origin of pica . at the time of surgical inspection , there was found to be a separate inflow and outflow vessel into a larger dome , which could have been mistaken for a saccular or fusiform sidewall type aneurysm .
postoperatively , the patient was found to have a small asymptomatic distal left pica stroke .
a 6-month follow - up angiogram showed patency of the bypass and the patient had returned to her neurologic baseline with no deficit .
case 1 : ( a ) reconstructed cta image showing the area suspicious for aneurysm ( black arrow ) .
( b ) lateral angiogram of the left vertebral artery , showing the serpentine recanalization within the aneurysm ( black arrow ) .
this is better visualized on the 3d rotational angiogram reconstruction ( c ) showing the clear serpentine nature of the aneurysm ( white arrow ) .
( d , e ) follow - up angiogram at 6 months , with ap ( d ) and lateral ( e ) views demonstrating the patent bypass ( white narrow arrow ) .
3d , three - dimensional ; ap , anteroposterior ; cta , computed tomographic angiography .
this 42-year - old female patient presented after sudden onset worst headache of her life ( fig .
she was intubated , weakly following commands in the upper extremities with no significant movement in the lower extremities .
angiogram showed a fusiform dissecting aneurysm of the left vertebral artery involving the origin of pica as well as the origin of the anterior spinal artery ( asa ) .
the pica was recognized to be a bihemispheric variant , crossing midline , and serving the contralateral pica territory with aplasia of the contralateral pica .
the patient was taken for suboccipital craniotomy , partial left condylectomy , and occipital artery to pica anastomosis ( due to the lack of contralateral pica ) .
no distal clip was applied to allow retrograde filling of the asa from the contralateral vertebral artery .
early follow - up angiography revealed patency of the bypass filling the bihemispheric pica , patency of the asa , and a small amount of slow filling of the aneurysm at the asa level .
she had a prolonged recovery with pneumonia and meningitis and required tracheostomy and percutaneous endoscopic gastrostomy tube . at 6-month follow - up ,
the aneurysm is angiographically cured with patency of the bypass ( feeding the bihemispheric pica ) as well as the asa ( from retrograde flow ) .
clinically she was awake and oriented , beginning to ambulate , and living at home .
case 2 : ( a ) left vertebral artery ap angiogram , showing the fusiform aneurysm ( black arrow ) and the filling of the anterior spinal artery from the dome of the aneurysm ( narrow white arrows ) .
the white arrow indicates the origin of the pica from the dome of the aneurysm .
c ) reconstruction of 3d rotational angiogram which shows bilateral filling of pica territories ( narrow white arrows ) from the left pica consistent with a bihemispheric variant .
( d ) postoperative lateral projection of the left common carotid injection , showing the patent anastomosis from the occipital artery to the pica ( narrow white arrow ) .
( e ) magnified ap projection of the postoperative injection of the right vertebral artery .
note that the distal left vertebral artery ( black arrow ) has remodeled to a very small channel that fills the anterior spinal artery ( white arrows ) .
3d , three - dimensional ; ap , anteroposterior ; pica , posterior inferior cerebellar artery .
these two cases of ruptured aneurysms represent very unusual anatomic variations involving the va / pica origin . each required tailored decision making and a detailed understanding of the involved anatomy as well as various bypass techniques to achieve angiographic cure . in case 1 ,
the cta revealed a small aneurysm at the origin of pica , which appeared to likely be a simple saccular aneurysm .
angiography revealed instead that this was a very unusual small serpentine aneurysm with a separate inflow and outflow vessel . to our knowledge , this type of aneurysm has not been reported .
serpentine aneurysms are typically large or giant and require trapping and ensuring distal vascular supply , either with surgical revascularization or by relying on internal collaterals.3
4 the same principle applies of trapping with restoration of distal flow was applied in this case .
the technique of pica pica side - to - side anastomosis was chosen due to the relative simplicity of the bypass and lack of extensive dissection time,5 though other options such as occipital to pica6 and pica reimplantation to the vertebral artery or interposition grafting could also be considered . in case 2 ,
the anatomic nuance was the recognition of the bihemispheric variant of the pica as well as the origin of the asa . though previously thought to be rare,7
we have recently observed a much higher incidence of bihemispheric pica in greater than 3% of cases.8 sacrificing the vertebral artery in this segment would have put a much larger territory at risk for stroke than usually considered in cases of pica sacrifice .
this observation also was critical in planning of the bypass procedure in that a side - to - side anastomosis would not have been effective since the contralateral tonsillar loop of pica was being fed by the ipsilateral pica origin .
for this reason , the occipital artery was required for revascularization of the pica territory before proximal occlusion of the vertebral artery .
the addition of distal occlusion for full trapping was considered as well and would have been a more definitive treatment , but would have sacrificed the fairly large asa . by occluding proximally ,
the asa was able to fill retrograde and the artery remodeled on follow - up angiography , excluding the aneurysm .
treatment of these aneurysms is complex due both to the rarity and variability in anatomic features1 and the available literature is largely limited to very small case series and case reports .
park et al6 recently reported a series of seven patients with va / pica aneurysms with occipital to pica bypass .
six of these bypasses remained patent and the remaining patient suffered multiple infarctions in the target territory , underscoring the risk of stroke with sacrifice of the entire pica .
wang et al9 also reported the use of the occipital to pica bypass in five patients with va / pica aneurysms with all remaining patent .
lemole et al10 reported a series of four patients with va / pica aneurysms treated with trapping and pica pica bypass , also showing good results in terms of patency and lack of infarction .
another report detailed the use of radial artery grafts from the v2v3 segment and included three patients with pica or pica origin aneurysms.11 czabanka et al12 also described two cases using a similar interposition graft technique in two cases of ruptured dissecting vertebral aneurysms .
the importance of multiple treatment options for these aneurysms has also been emphasized including a variety of bypass options13 and open and endovascular techniques.2
14
15
the described cases illustrate the importance of an understanding of potential anatomic variants and the need for technical proficiency with multiple treatment options depending on the specific anatomy of a specific aneurysm in this region .
these cases underscore the importance of understanding the highly variable anatomy in treatment decision making .
familiarity with a variety of surgical , endovascular , and bypass options is critical for vascular neurosurgeons treating these complex lesions . | ruptured fusiform aneurysms of the vertebral artery involving posterior inferior cerebellar artery ( pica ) origin are difficult to manage without sacrificing pica . in this report ,
two very unusual cases are described which highlight different revascularization strategies that may be required .
the first case initially appeared to be a small saccular pica origin aneurysm , but detailed angiography showed a serpentine recanalization of a fusiform aneurysm .
this was treated with pica
pica anastomosis and trapping of the aneurysm .
the second case is a dissecting vertebral aneurysm with both pica and the anterior spinal artery originating from the dome .
pica was found to be a bihemispheric variant , so no in situ bypass was available , and an occipital artery to pica bypass was performed .
the vertebral artery was occluded proximally only and follow - up angiography showed remodeling of the distal vertebral artery with the anterior spinal artery filling by retrograde flow from the distal vertebral artery .
these cases illustrate both the anatomic variability of this region as well as the need to be familiar with multiple treatment strategies including revascularization techniques to be able to successfully treat these aneurysms . |
obesity is associated with elevated free fatty acid levels , leading to the development of insulin resistance , diabetes , and cardiovascular disease ( cvd ) [ 13 ] .
the development of cvd is characterised by impaired nitric oxide ( no ) release from vascular endothelium and decreased blood flow to insulin target tissues resulting in insulin resistance , termed as endothelial dysfunction .
however , the mechanisms by which obesity causes both insulin resistance and vascular dysfunction are not fully understood . in this respect , increasing attention has been paid to the direct vascular effects of adipose tissue ( at ) derived factors termed
a few of these adipokines are characterised by their favourable effects to maintain the body 's energy and vascular homeostasis ; however , adipokines have also been implicated in the pathogenesis of obesity - related disorders , such as atherosclerosis , specifically , by increasing the expression of proangiogenic / proatherogenic factors like endothelial gelatinases ( matrix metalloproteinases 2 and 9 ) and vascular endothelial growth factor ( vegf ) .
leptin , adiponectin , monocyte chemoattractant protein- ( mcp- ) 1 , plasminogen activator inhibitor- ( pai- ) 1 , tumour necrosis factor ( tnf ) , interleukin- ( il- ) 6 , and resistin are a few of these adipokines implicated in endothelial dysfunction .
endothelial dysfunction in obesity is characterised by increased generation of oxygen - derived free radicals ( ros ) .
this is contributed by vascular cells and inflamed hypertrophied adipocytes as a result of endoplasmic reticulum ( er ) stress and mitochondrial dysfunction .
enzymes of mitochondrial electron transport chain , xanthine oxidase , cyclooxygenases , lipoxygenases , myeloperoxidases , cytochrome p450 monooxygenase , heme oxygenases , peroxidases , and nad(p)h oxidases contribute to endothelial dysfunction .
uncoupling of endothelial nitric oxide synthase ( enos ) is a major contributor to ros production .
this results in decreased no ( nitric oxide ) bioavailability , increased o2 production , and formation of peroxynitrite ( onoo ) , a key mediator of lipid peroxidation and foam cell formation in atherosclerotic lesions . additionally , ros accumulation results in activation of signalling cascades that regulate transcription factors , including nf- ( nuclear factor kappa beta ) adhesion molecules , chemotactic factors , antioxidant enzymes , and vasoactive substances promoting adhesion and migration of circulating monocytes initiating atherosclerotic lesions .
dysregulated adipokine production leading to increased ros generation forms a major feedback loop in initiation , maintenance , and progression of endothelial dysfunction .
adiponectin and leptin are the two widely studied most - abundant , circulating adipokines . in this review ,
we discuss the diverse roles of leptin and adiponectin in endothelial dysfunction with emphasis on proangiogenic / proatherogenic factors in the endothelial cells .
adiponectin , the most abundantly secreted adipokine ( 220 g / ml in circulating plasma ) , was first identified as acrp30adipose complement - related protein of 30 kda because of its high similarity to complement protein .
adiponectin exerts its insulin - sensitizing effects by increasing -oxidation of fatty acids , in the process reducing serum triglyceride and levels of free - fatty acids , and thus indirectly improving insulin sensitivity of the liver .
in addition to its metabolic actions , adiponectin is also reported to possess antiatherogenic and anti - inflammatory properties . circulating low adiponectin levels ( hypoadiponectinemia )
adiponectin is a 247-amino acid protein with four domains , an amino - terminal signal sequence , a variable region , a collagenous domain , and a carboxy - terminal globular domain [ 13 , 1719 ] , and undergoes posttranslational modifications within the adipocytes into multimeric forms including trimers , hexamers , and high - molecular - weight ( hmw ) oligomers .
more importantly , cleavage of globular domain of full - length adiponectin ( fad ) by activated monocytes has been reported to conversely affect the protective role of fad . both globular adiponectin ( gad ) and
fad exert their effects via transmembrane g - protein coupled receptors , adiponectin receptor 1 ( adipor1 ) , and adiponectin receptor 2 ( adipor2 ) .
these receptors have been described as structurally related integral plasma membrane proteins with seven transmembrane domains having their extracellular c terminus and intracellular n terminus regions [ depicted in figure 1 ] .
adipor1 is abundantly synthesised and expressed in skeletal muscle , whereas adipor2 is found predominantly in liver .
both receptors have also been described in pancreatic -cells , macrophages , endothelial cells , and smooth muscle cells within atherosclerotic plaques [ 23 , 24 ] .
c - terminus of adipor1 possesses high affinity for gad , whereas adipor2 exhibits intermediate affinity for both the gad and fad .
overexpression and gene knockout experiments in rodents have demonstrated the ability of these receptors to activate amp - activated protein kinase ( ampk ) , p38 mitogen activated protein kinase ( p38 mapk ) , and peroxisome - proliferator - activated receptor- ( ppar- ) and to stimulate fatty acid oxidation and glucose uptake in murine hepatocytes and c2c12 myocytes .
globular , trimeric , and high - molecular - weight ( hmw ) adiponectin forms activate different signal transduction pathways .
additionally , osmotin , a plant protein with structural similarities to mammalian globular adiponectin , binds to adiponectin receptors and activates ampk in c2c12 myocytes .
exercise training increases adipor1/r2 mrna expression in human skeletal muscle , whereas no significant change has been reported in human subcutaneous adipose tissue during calorie restriction .
the expression levels of adipor1 and adipor2 in skeletal muscle , as well as plasma adiponectin concentrations , have been described to be lower in individuals with a family history of type 2 diabetes mellitus ( t2 dm ) than in those with no family history . the expression level of both receptors correlated positively with insulin sensitivity . a study by zhang et al . , 2010 ,
had demonstrated significant reduction in expression of adipor2 in both coronary arterioles and aortas of diabetic mice , with no changes in adipor1 expression levels .
another adiponectin - binding protein with a preference for hmw adiponectin multimers and no affinity for the trimeric adiponectin has been identified as t - cadherin . since
this protein is a glycosylphosphatidylinositol - anchored extracellular protein devoid of any intracellular domain , the mechanism explaining its role in adiponectin intracellular signalling has not been fully clarified .
leptin , a 16 kda protein , is an adipose - tissue specific adipokine involved in regulation of food intake and energy haemostasis .
leptin also has multiple roles in carbohydrate and lipid metabolism , reproductive system , and inflammatory and immune reactions .
leptin has been shown to exert atherogenic , thrombotic , and angiogenic actions on the vasculature [ 4850 ] .
it has been linked extensively with obesity leading to cvds including atherosclerosis , myocardial infarction , and stroke [ 51 , 52 ] .
leptin acts on target cells through plasma membrane receptors ( figure 2 ) and exists in at least six isoforms , ob - ra through ob - rf , signalling predominantly via jak / stat ( janus kinases / signal transducers , and activators of transcription ) pathway .
functional leptin receptors ( both short and long forms of ob - r ) have been identified on endothelial cells [ 38 , 54 ] , and numerous studies link the possible mechanisms responsible for leptin - induced endothelial dysfunction .
jak-2/irs-2/pi3-k / akt pathways and nuclear translocation of stat ( signal transducer and activator of transcription ) proteins have been implicated to play a pivotal role in leptin - mediated effects in endothelial cells [ 53 , 55 ] .
interestingly , in states of obesity despite a paradoxical impairment of the satiety response , leptin resistance does not extend to leptin mediated endothelial dysfunction [ 5659 ] .
recent studies have demonstrated increased expression and modulation of astrocytic leptin receptor subtypes ( ob - r ) in adult - onset obesity facilitating increased leptin transport via the human brain endothelial cell barrier .
although this selective response of leptin has gained much attention , the molecular basis remains poorly understood . decreased production of no by the endothelial cells is considered as the hallmark of endothelial dysfunction .
adiponectin has been reported to increase no production in endothelial cells by the activation of phosphotidylinositol-3 ( pi-3 ) kinase / akt signalling pathway .
furthermore , the involvement of ampk and protein kinase a [ pka , or cyclic amp- ( camp- ) dependent protein kinase ] signalling have also been implicated to play a major role in both adiponectin induced no production and suppression of endothelial ros generation , inhibiting endothelial nf- ( nuclear factor kappa beta ) signalling [ 32 , 6265 ] .
animal studies conducted in adiponectin knockout ( ko ) mice have shown a significant reduction in endothelium - dependent vasodilatation .
adiponectin and lectin - like oxidized ldl ( ox - ldl ) receptor- ( lox- ) 1 have been demonstrated to exhibit a reciprocal pattern in states of endothelial dysfunction and inflammatory insults .
adiponectin administration in apolipoprotein e ( apoe ) knockout ( ko ) mice restored no - mediated endothelium - dependent vasorelaxation and decreased aortic lox-1 expression , implicating a key biological function of adiponectin in reducing systemic oxidative mediators and ox - ldl uptake .
more importantly , studies in t2 dm mice have elucidated a similar reciprocal regulation between adiponectin and tnf- affecting the regulation of both coronary and aortic endothelial function .
additionally , in vivo studies have indicated the critical role of adiponectin in alleviating sepsis - induced microvascular dysfunction leading to blood brain barrier ( bbb ) dysfunction in the mouse brain via modulation of e - selectin expression .
clinical studies have demonstrated impaired production of enos in the vasculature consequently leading to decreased endothelium - dependent vasorelaxation in subjects with decreased adiponectin levels .
furthermore , adiponectin drastically improves oxidized ldl induced decrease in enos activity [ 36 , 70 ] .
more importantly , to simulate pathological states of obesity and diabetes , the role of adiponectin in hyperglycaemic / hyperinsulinaemic environments has been studied .
xiao et al . have demonstrated a protective action of gad in alleviating endothelial dysfunction caused due to intermittent hyperglycaemia , implicating the involvement of akt , ampk , and enos signalling pathways .
the deleterious effects of hyperglycaemia in obese and diabetic subjects extend to a concomitant decrease in circulating endothelial progenitor cells ( epcs ) leading to impaired endothelial repair .
studies have indicated that gad promoted epc migration and tube formation and dose - dependently upregulated phosphorylation of enos , akt , and augmented no production . additionally , in vivo results have revealed that gad rescued high glucose induced impairment of epc functions by restoration of enos activity and vasculogenesis .
it is interesting to note that adiponectin induced activation of enos as well as increased production of no by the endothelial cells is crucial in mediating its anti - inflammatory effects . in this context , in vivo studies have demonstrated that pharmacological blockade of enos leads to decreased protective effect imparted by adiponectin , leading to increased leukocyte adhesion by tnf- .
endothelial dysfunction includes the activation of endothelial adhesion molecular cascade critical in facilitating the entry of macrophages into the vessel wall . circulating low adiponectin levels in metabolic diseases like obesity and diabetes
have been linked to the triggering of an inflammatory signalling cascade , leading to the early development of atherosclerosis .
the development of a similar scenario in adipoq/ ( adiponectin knock - out mice ) mice further strengthens the association between adiponectin and cvd .
furthermore , adiponectin has been shown to inhibit the vascular inflammatory response of endothelium to tnf- induced activation of nf- and increased expression of adhesion molecules vascular cell adhesion molecule ( vcam-1 ) , intercellular adhesion molecule ( icam-1 ) , and endothelial selectin ( e - selectin ) .
functional effects induced by mediators of systemic inflammation like tnf- and subsequent interactions with adipokines have a significant influence in either promoting or downregulating vascular insult .
adiponectin has been shown to induce in vitro angiogenesis in endothelial cells via ampk - enos pathway .
studies conducted in adiponectin - overexpressed mice brain ( following transfection with adenoassociated viral vector ( aav ) containing adiponectin gene ) have shown a significant benefit induced by adiponectin following ischemic insult .
this protective action was related to adiponectin induced focal angiogenesis involving vegf and ampk pathways . on the other hand ,
other groups have demonstrated the potent inhibition of endothelial angiogenic events like migration and proliferation by adiponectin , involving mapk and camp - pka pathways .
similar antiangiogenic effects of adiponectin have been studied in tumour growth suppression involving rho kinase / ifn - inducible protein 10 and matrix metalloproteinase 9 ( mmp-9 ) .
numerous studies have implicated the vasoprotective actions of fad by reducing the expression of endothelial adhesion molecules and inhibiting tnf- induced cytokine production from macrophages via nf-/camp - dependent pathway [ 32 , 7880 ] .
animal studies in ad ( mice completely lacking adiponectin ) and ad ( adiponectin - hemizygous mice ) mice showed an increased expression of e - selectins and vcams .
adiponectin has been demonstrated to suppress vegf - stimulated hcaec migration via camp / pka - dependent signalling .
clinical studies in patients with acute coronary syndromes have shown a negative correlation between circulating adiponectin levels and mmp-9/timp-1 ratio , an independent predictor of atherosclerotic plaque stability .
however , three independent studies have demonstrated that gad activates nf- leading to activation of the proinflammatory adhesion cascade , proliferation , and increased procoagulability in endothelial cells and cardiac fibroblasts [ 39 , 40 , 81 ] .
furthermore , studies by hattori et al . have indicated the suppression of cytokine induced inflammatory cascade via nf- by gad , albeit with a prolonged response time .
the authors attribute this to desensitisation of the receptor , seen in instances of cytokine overload .
more recently , colocalization studies conducted by xu et al . have demonstrated that adiponectin induces interaction between lymphotoxin- ( lt- ) b receptor ( ltbr ) and human adipor1 , subsequently resulting in inhibition of the nf- pathway .
studies have demonstrated the ability of leukocyte elastase secreted by activated monocytes and neutrophils to cleave the globular domain of adiponectin .
this local generation of gad at sites of inflammation , namely , in atherosclerotic lesions , could be having pathophysiological relevance given the differential actions of multimeric forms of adiponectin . in a study comparing the differential effects of fad and gad in human aortic endothelial cells ( haec ) , both peptides upregulated no production by ampk - dependent pathways .
however , in contrast to fad , gad activated nf- and p38 mapk signalling pathways , resulting in cyclooxygenase-2 ( cox-2 ) production and subsequently prostacyclin 2 [ pgi ] release .
this study further demonstrated that monocyte - endothelial adhesion enhanced by gad remained unaffected with either abrogation of adipor1 [ sirna ] signalling or cox-2 [ sirna ] downregulation , thereby suggesting independent mechanisms governing actions of fad and gad
. the obvious discrepancies between the experimental outcomes could be due to the differences in the forms of adiponectin used ( table 1 ) .
recently , we undertook a study to investigate the effect of gad and fad ( figure 3 ) on endothelial cell proliferation as well as in vitro migration and angiogenesis in relation to the induction of endothelial angiogenic factors , specifically , mmp-2 , mmp-9 , and vegf ; furthermore , we examined the involvement of the adiponectin receptors , that is , adiponectin receptor 1 ( adipor1 ) and adiponectin receptor 2 ( adipor2 ) , within this context .
more importantly , given the connection between the coexistence of hyperglycaemia and systemic inflammation with vascular disease in pathological states such as diabetes mellitus , we also studied the interaction between glucose and c - reactive protein ( crp ) [ a potent proinflammatory protein ] , respectively , with gad and fad . finally , since amp - activated protein kinase ( ampk ) , a stress - activated protein kinase , and akt have been implicated as critical mediators of adiponectin induced angiogenesis in both normoxic and ischemic tissues
we found that gad led to a significant increase in in vitro endothelial proliferation , migration , and angiogenesis with concomitant increase in mmp-2 , mmp-9 , and vegf gene and protein production , as well as mmp-2 and mmp-9 activation .
the effect of gad on vegf appears to be mediated by adipor1 whereas the effect of gad on mmp-2 and mmp-9 appears to be mediated by adipor1 and adipor2 . on the other hand ,
only endothelial cell proliferation was significantly increased by fad and appears to be mediated by adipor2 ; no significant effects on mmp-2 , mmp-9 , and vegf were observed .
2004 had reported that mouse fad stimulates in vitro migration and angiogenesis and suggested that this effect may be beneficial in line with the report by shibata et al .
, 2004 , who demonstrated that adiponectin promotes ischemia - mediated revascularization in adiponectin - knockout mice .
it is important to note that although in vitro angiogenic assays have been merited as useful reporters in deciphering specific steps , they however lack the complex interplay of multiple factors vital for in vivo processes [ 31 , 33 ] . taken together , it remains unclear as to whether our observations reflect on balance a beneficial or detrimental effect of adiponectin .
thus it seems imperative to study the local effects of various multimers of adiponectin in situ , for instance , in atherosclerotic plaques , to ascertain the potential pro / anti - inflammatory actions of this adipokine .
leptin has multiple proinflammatory and immune mediated effects on the vasculature . on engagement with leptin receptors expressed on vascular cell walls , leptin induces oxidative stress responses , increases mcp-1 , tnf- , il-6 , and endothelin-1 , and potentiates proliferation , along with the expression of other endothelial cell adhesion molecules , mmps , vegf , and impaired smooth - muscle cell function , resulting in impaired endothelium - dependent vasodilatation promoting hypertension and atherosclerosis .
clinical studies have reported a positive correlation between circulating leptin , plasma thrombomodulin , and vcam-1 levels .
endothelium dependent leptin induced vasorelaxation observed in rat arterial rings was promptly inhibited by increasing extracellular calcium and inhibition of no synthase .
intra - arterial administration of leptin showed a similar vasoactive response independent of no in humans .
additionally , a direct vasorelaxive effect of leptin on smooth muscle cells independent of endothelium was also observed in both rat and human arterial samples [ 88 , 89 ] .
acute hyperleptinemia induced vasodilatory effects and this seemingly contradicts the coexisting hypertension and increased leptin levels on obesity . a plausible explanation for this could be attributed to the acute and chronic effects of leptin on the vasculature .
recent in vivo studies have revealed additional induction of endothelial nnos ( neuronal nitric oxide synthase ) expression by leptin as a compensatory mechanism to induce endothelium - dependent relaxation in enos ( / ) mice .
more importantly , hyperleptinemia induced endothelial dysfunction may play a crucial role in the differential actions of leptin .
experiments by naseem have indicated that leptin initiated upregulation of inducible no synthase ( inos ) , which may or may not lead to net increased no production and paradoxically impairs endothelial function by inducing oxidative stress .
furthermore , a significant vasodilatory response induced by leptin in lean zucker rats failed to do so in obese hyperleptinemic zucker rats .
as mentioned , leptin has been shown to induce oxidative stress by increasing the formation of reactive oxygen species ( ros ) , a key mediator of endothelial dysfunction [ 42 , 93 ] .
this generated ros has potent peroxidant effects and thereby reduces the bioavailability of no in aortic endothelial cells , vascular smooth muscle cells , and macrophages .
additionally , ros further contributes to endothelial dysfunction by upregulating proinflammatory cascades including adhesion and chemotactic pathways in endothelial cells .
it is interesting to note that genetically modified ( ob / ob- leptin knock out ) mice maintain a relative hypotensive status in comparison with their wild types .
this could be attributed to the disturbance in the fine balance between the sympathetic nervous system and endothelial cell mediated regulation of vasomotor tone . with respect to the regulation of leptin receptors and endothelial dysfunction , a study by park et al .
2012 has revealed that leptin receptors in coronary arterioles are downregulated in high - fat fed sedentary mice leading to endothelial dysfunction . however , when subjected to exercise , the expression of leptin receptors in coronary arterioles was restored along with maintenance of enos phosphorylation , leptin sensitivity , and redox balance . as mentioned previously , leptin - mediated actions in endothelial cells , including angiogenesis ,
it is interesting to note the increased expressions of both ob - r and mmps in atherosclerotic plaques , particularly the endothelial lining of neointimal regions , suggesting the role of leptin in mediating aberrant angiogenesis . both in vivo and in vitro studies
have demonstrated the activation of endothelial ob - r by leptin , leading to capillary tube formation , a prerequisite for angiogenesis .
showed that leptin induced activation of mitogen - activated protein kinase family erk1/2 leads to an increase in endothelial cell viability in serum - free media .
leptin has been shown to upregulate key proangiogenic molecules like the gelatinases ( mmps , mmp-2/-9 ) and timps .
additionally , leptin has been shown to upregulate and act synergistically with the key angiogenic mediators like fgf-2 , vegf , and its receptor vegfr1 , stimulating vascular permeability , consequently resulting in functional angiogenesis .
it is important to note that wound healing disorder ( due to deficient angiogenesis ) in ob / ob mice is corrected by both topical and systemic leptin administration but not in fa / fa zucker rats ( rats with a recessive trait of the leptin receptor ) , due to the absence of functional leptin receptors . in a recent study involving an obese nzo ( mice with phosphatidylcholine transfer protein mutation leading to abnormal lipid homeostasis ) mice model ,
the angiogenic potential of leptin was found to be insignificant , perhaps due to the relative inactivity of its receptor in these mice .
studies in huvecs have implicated the involvement of a functional endothelial p38 ( mapk)/akt / cox-2 signalling axis for leptin 's proangiogenic effects and more importantly this signalling pathway is regulated upstream by obrb - dependent activation of vegfr2 receptor . in vivo findings
have implicated increased mobilisation of vascular progenitor cells mobilized from the bone marrow in response to leptin stimulation leading to angiogenesis .
these effects of leptin seem to be mediated via ob - r induced activation of nox2 and mmp9 .
additional studies have evidenced the importance of an obr - src kinase - alpha v beta 5 cross talk in leptin mediated functional effects in enhancing the angiogenic potential of circulating angiogenic cells ( cacs ) .
more importantly , cacs derived from obese , hyperleptinemic individuals were associated with relative insensitivity to the angiogenic effects of leptin .
leptin induced epcs and no production has been shown to play critical roles in melanoma tumour growth induction . extending these findings to tumour angiogenesis , recent studies have implicated intratumoral leptin to exert proangiogenic effects stimulating tube formation and proliferation of endothelial cells .
more importantly , the authors have also demonstrated the therapeutic potential of a peptide obr antagonist in inhibiting these proangiogenic effects of leptin via the vegf pathway .
interestingly , leptin induced proliferation / migration as well as expression of proangiogenic molecules in breast cancer has been recently demonstrated to involve extensive crosstalk between notch and interleukin-1 ( nilco ) pathways .
leptin has been shown to upregulate various mediators of vascular inflammation like tnf- , il-2 , il-6 , mcp-1 , ros , th1-type cytokines , and tgf- from endothelial cells and pbmcs [ 56 , 108110 ] . in vitro studies
have demonstrated leptin induced increases in tissue factor ( tf ) and cellular adhesion molecules ( cams ) expression in human coronary endothelial cells ( hcaecs ) via nf- leading to increased procoagulant activity and leukocyte adhesion .
additional molecules pivotal in vascular inflammation including pai-1 ( plasminogen activator inhibitor-1 ) and p - selectin have been documented to be induced upon leptin treatment [ 112 , 113 ] .
clinical studies have shown a positive correlation with pai-1 , vwf , tpa , and plasma fibrinogen levels and an inverse relationship with protein c and tissue factor pathway inhibitor .
these findings clearly demonstrate a strong link with circulating leptin and increased platelet activity observed in the metabolic syndrome [ 114117 ] .
it is therefore not surprising to note the decreased incidence of atherosclerosis in hyperlipidaemic mice ( ob / ob ; apoe ) . as discussed previously , converse actions of leptin and adiponectin in the vascular system
thereby , the leptin to adiponectin ratio ( l : a ) is higher in these subjects .
various clinical studies have been conducted to elucidate the relationship between l : a ratio and markers of atherosclerotic disease including carotid intima media thickness ( cimt ) and pulse wave velocity [ 119121 ] . in
yet another clinical study , l : a ratio has been demonstrated as a useful biomarker for the prevalence of metabolic syndrome , in comparison with either leptin or adiponectin levels on their own .
additionally , visceral fat mass and cardiorespiratory fitness levels have been documented to influence this ratio .
subjects with enos polymorphisms with or without hyperinsulinemia have a higher l : a ratio and are more prone for cardiovascular events , suggesting a genetic link in the associated risk factors .
have demonstrated that high serum l / a ratio is positively correlated with serum triglyceride levels , serving as surrogate markers of vascular inflammation in at - risk young severely obese individuals , which is independent of waist circumference ( wc ) and bmi .
additionally , l : a ratio represented a powerful independent predictor of intima media thickness ( imt ) , correlating with anthropometric , metabolic , and clinical parameters .
furthermore , components of the metabolic syndrome were correlated positively with leptin / hmw adiponectin ratio , independent of parameters including age , smoking status , exercise , low - density lipoprotein ( ldl ) cholesterol , and bmi . however , in contrary to the above mentioned findings , l : a ratio failed to establish any significant differences in disease parameters , in a study conducted in patients with severe coronary heart disease .
it is noteworthy to mention that these above mentioned studies do differ in patient characteristics and pathological parameters leading to opposing results .
adipose tissue secreted factors or adipokines have been implicated in facilitating communication between adipose tissue and vasculature comprising the adipovascular axis .
both proinflammatory and anti - inflammatory activities of these secreted adipokines seem to be crucial in creating a homeostatic response which remains disturbed in states of adipose tissue expansion .
in addition to alterations in the circulating levels , the local ( i.e. , tissue concentration ) availability of the activated forms of these adipokines has a significant bearing in influencing vascular function .
for example , it is important to consider the actions of locally available gad fragment of adiponectin , which could potentially drive leptin - induced effects . in - depth understanding of the mechanisms and properties of adipokine - receptor interactions and downstream signalling cascades
studies investigating the vascular effects of various multimeric / cleaved forms of adipokines will help in developing novel therapeutic strategies and targets in counteracting obesity - related metabolic and cvds .
additionally large multicentric clinical studies with strict inclusion - exclusion metabolic criteria need to be performed . | obesity is a major health burden with an increased risk of cardiovascular morbidity and mortality .
endothelial dysfunction is pivotal to the development of cardiovascular disease ( cvd ) . in relation to this , adipose tissue secreted factors termed
adipokines have been reported to modulate endothelial dysfunction . in this review
, we focus on two of the most abundant circulating adipokines , that is , leptin and adiponectin , in the development of endothelial dysfunction .
leptin has been documented to influence a multitude of organ systems , that is , central nervous system ( appetite regulation , satiety factor ) and cardiovascular system ( endothelial dysfunction leading to atherosclerosis ) .
adiponectin , circulating at a much higher concentration , exists in different molecular weight forms , essentially made up of the collagenous fraction and a globular domain , the latter being investigated minimally for its involvement in proinflammatory processes including activation of nf- and endothelial adhesion molecules .
the opposing actions of the two forms of adiponectin in endothelial cells have been recently demonstrated .
additionally , a local and systemic change to multimeric forms of adiponectin has gained importance .
thus detailed investigations on the potential interplay between these adipokines would likely result in better understanding of the missing links connecting cvd , adipokines , and obesity . |
onychomycosis is a fungal infection of nails caused by dermatophytes , yeasts , and non - dermatophytic molds where dermatophytes account for nearly 70% of the cases .
it accounts for upto 50% of nail disorders and 1.5 - 15% of patients presenting to the dermatologist .
several factors have been implicated in the increase in disease incidence such as reduced peripheral circulation , diabetes , nail trauma , and poor nail hygiene .
although not life - threatening , it may have significant clinical consequences such as secondary bacterial infections , chronicity , therapeutic difficulties , and disfigurement apart from serving as a reservoir of infection .
dermatophytes are the most frequently implicated causative agents in onychomycosis ( nearly 90% in toenail and at least 50% in fingernail infections ) . previously regarded as contaminants , yeasts are now increasingly recognized as pathogens in fingernail infections , as are some non - dermatophytic molds . here , we report a case of onychomycosis due to aspergillus niger . to the best of our knowledge ,
this is the first report of a non - dermatophytic mold infecting all 10 fingers of an immunocompetent male .
a 42-year - old male vegetable vendor by occupation , presented to the dermatology out - patient department of our hospital with brownish black discoloration and disfigurement of all the nails of 8 months duration .
the patient first noticed it on the nail of the right index and middle finger which gradually spread to the other fingers and all the fingers of the left hand . on examination ,
all fingernails were brownish black in color with loss of texture and there were dystrophic changes as well as onycholysis in most of the fingers [ figure 1 ] .
all 10 fingernails showing brownish black discoloration and dystrophic changes multiple specimens of nail scrapings and clippings from different parts of the affected nails were collected from all fingers after cleaning the area with 70% alcohol .
the samples were sent to the microbiology department where direct examination by 40% potassium hydroxide mount was done that showed branched septate hyphae .
the clippings were cultured on two sets of sabouraud 's dextrose agar with and without antibiotics and cycloheximide which were incubated at room temperature and 37c .
after 3 days , growth was seen in all the tubes in the form of cottony white mycelium growth , which was soon covered with abundant black spores [ figure 2 ] .
microscopic characterization of the fungal isolate was carried out by preparing a lactophenol cotton blue mount from the growth .
the secondary phialide bore chains of globose conidia were dark and covered the entire surface .
colonies of aspergillus niger growing on sabouraud 's dextrose agar with antibiotics at 25c complete blood count was normal except for a slight anemia with a hemoglobin of 11 g / dl .
the fasting and postprandial blood sugar levels were normal ; the tests for human immunodeficiency virus(hiv ) and hepatitis b surface antigen ( hbsag ) were negative .
the patient gave no history of alcohol consumption , smoking , or any drug addiction .
the patient was started on oral itraconazole 200 mg bd for 7 days for 2 consecutive months ( oral itraconazole pulse therapy ) .
after 2 months , his nails did not show much improvement in the appearance , though the microscopy and culture of the nail scrapings were negative for fungal elements .
so he was given pulse therapy of itraconazole for a further 2 months and was reassured that the nail color and texture will take some time to regain normalcy .
factors such as ageing , immunodeficiency , trauma , hyperhidrosis , socio - economic status , climatic conditions , and paronychia predispose to onychomycosis .
this is seen most frequently in elderly , in patients with skin diseases that affect the nails , and in the immunocompromised patients .
also , toenails are 25 times more likely to be infected than finger nails as the causative molds are ubiquitous fungi seen in soil , water , and decaying vegetations . however , in our case , though the patient was middle aged and immunocompetent , his occupation involved handling fruits without wearing gloves which could be the predisposing factor .
aspergillus onychomycosis is generally a distal subungual infection : it starts under the nail near the tip of the finger , where spores may have lodged or at the sides where the nail creases the skin .
it looks much the same as any fungal nail infection , discoloring the nail , causing it to become thick , distorted , and flaky .
the fungus will not , however , spread to the surrounding skin like some other fungal causes of nail infection .
aspergillus species growing in nature often produce colorful pigments ; therefore , an aspergillus nail infection may well appear greenish , black , brown , or various other shades .
it is not possible for a dermatologist to diagnose aspergillus onychomycosis just by looking at the affected nail .
the proof of the ability of the organism to produce the nail infection depends on the direct demonstration of the fungus in the infected nail and its culture on artificial media . the need for meticulous examination of these preparations should be emphasized since it is quite possible that they may be overlooked in too cursory an examination .
treatment of non - dermatophytic onychomycosis is not well standardized and can be difficult due to hardness of nail plate and location of infection between the nail bed and plate .
the duration of therapy depends on the nails that are affected and the extent of infection .
in our case , the patient was given itraconazole pulse therapy for 4 months because even though the microscopy and culture were negative after 2 months , the discoloration of the nails failed to improve indicating that there might be a persistent reservoir of infection .
onychomycosis is a condition which may create a number of clinical and occupational complications which can significantly impair the quality of life of a patient .
thus , isolation of the causative fungi is essential in all suspected cases of onychomycosis and the type and duration of treatment varies according to the pathogen isolated .
though aspergillus specieshave been implicated in causation of onychomycosis , to the best of our knowledge , this is the first case of aspergillus niger causing infection in all 10 fingernails in an immunocompetent patient . | onychomycosis , traditionally referred as a non - dermatophytic infection of the nail , is now used as a general term to denote any fungal nail infection .
it is an important public health problem due to its increasing incidence and has significant clinical consequences in addition to serving as a reservoir of infection .
we report a case of onychomycosis in all 10 fingers of an immunocompetent male with no co - morbid conditions caused by a non - dermatophytic fungus , aspergillus niger . to the best of our knowledge ,
this is the first case of its kind to be reported . |
a 45-year - old woman , five days after diagnosis by pharyngeal smear of influenza h1n1 , complained of an acute unilateral conjunctivitis condition of bleeding appearance .
her examination evidenced significant eyelid oedema , severe mixed conjunctival hyperaemia and moderate chemosis , and pseudomembrane formation .
a large number of subtarsal follicles and petechiae were seen ( figures 1 , 2 , 3 , and 4 ) .
a smear of conjunctival secretion from both eyes and study by pcr of h1n1 virus were performed detecting the presence of h1n1 virus rna only in the affected eye , being negative in the contralateral .
after 15 days of symptomatic treatment with topical nsaids and washes associated with topical ganciclovir , the condition subsided .
in april 2009 , the us cdc identified the organism responsible for the new worldwide influenza pandemic , the influenza a virus ( h1n1 ) , arising from the gene mutation of segments of two strains of an influenza virus present in swine .
the clinical symptoms caused by this new influenza virus are similar to those of seasonal human influenza , including high fever , cough , sore throat , generalised myalgia , headache , and asthenia , often associated with vomiting and diarrhoea .
nevertheless , no information about its presentation , course , and outcome and no microbiological prove are available .
the cdc has developed a specific panel of real - time reverse transcriptase polymerase chain reaction ( r - rt - pcr ) for the specific microbiological diagnosis of the new influenza virus strain .
although multiple complications have been described in association with infection by this virus , to date no microbiologically proven cases of conjunctivitis by h1n1 virus have been published .
viral conjunctivitis in adults is generally caused by an adenovirus , with over 50 serotypes and a high susceptibility to cause epidemics .
the presence of ipsilateral preauricular adenopathy , subtarsal follicles and subconjunctival bleeding , chemosis , and formation of pseudomembranes is characteristic in severe cases .
there are no specific authorised antivirals for the treatment of conjunctivitis . in the case of our patient
, it was shown how the onset of the conjunctival infection , its clinical outcome , its duration of three weeks , and the characteristics of the eye examination would be virtually identical to those of adenoviral conjunctivitis , except for the absence of preauricular node .
this should lead us to consider the differential diagnosis of conjunctivitis by the h1n1 virus in patients with consistent influenza conditions , all the more given the worldwide pandemic caused by this virus which now besets us .
in our case , the clinical outcome of the infection has been favourable , with no serious complications , and improving since the start of treatment , probably due to both the antiviral effect of topical ganciclovir and the natural course of the disease .
however , more cases should be described to evaluate the severity of the conjunctival infection by this new virus and the possible associated consequences . | influenza h1n1 or a virus is a new virus serotype capable of human - to - human transmission .
this infection causes a flu syndrome similar to that of seasonal influenza , with only one case of conjunctivitis described and no clinical details or microbiological confirmation .
its diagnosis is performed by pcr of pharyngeal smear of the patients affected .
we report the first well - documented case in the medical literature of conjunctivitis by h1n1 virus . |
condylar dislocations commonly occur in association with a mandibular fracture as a result of facial trauma , and its displacement is commonly anterior rather than posterior , lateral , or superior .
condylar dislocations with combined direction of displacement have often been misdiagnosed or entirely neglected due to their extremely rare occurrence .
according to yoshii et al.1 , clinicians should bear in mind the possibility of an unusual condylar dislocation whenever the signs , symptoms , and clinical courses are not typical of common mandibular fracture . in this paper , we present an unusual case of lateral dislocation of the intact mandibular condyle with symphysis fracture and describe a method of reduction using bone - traction hook .
this study was approved by the local ethics committee of the dental college hospital of yonsei university , seoul , korea , after obtaining written consent from the patient .
a 54-year - old man visited yonsei university health system with four - day history of maxillofacial trauma . during the injury ,
he was under the influence of alcohol ; he only recalled being hit with a falling luggage from a passing truck before landing on the ground .
he did not experience loss of consciousness or vomiting . before he was referred to the department of oral and maxillofacial surgery ,
the medical history revealed controlled diabetes mellitus and hypertension . during the physical examination , limitation of mandibular movement , unfavorable occlusion , tenderness to palpation of chin and bilateral temporomandibular joints ( tmj ) , and bony prominence in both preauricular regions
the panoramic radiograph and three - dimensional computed tomography ( 3d ct ) showed fracture of the symphyseal region and dislocation of both condyles .
the 3d ct clearly revealed the evident lateral displacement of the left condyle ; the right condyle was severely dislocated laterally from the glenoid fossa and engaged over the lateral surface of the zygomatic arch .
1 ) the patient was hospitalized and immediately transferred to the operating room . under general anesthesia via nasal intubation
bone traction hook was placed at the sigmoid notch through stab incision , and reduction was finally achieved after applying outward traction.(fig .
2 ) open reduction and internal fixation of the mandibular symphysis fracture were done with self - reinforced , biodegradable poly-70l/30dl - lactide plates and screws .
the mandible was placed into the intermaxillary fixation ( imf ) with imf screws and elastics for seven days .
we instructed the patient to open his mouth to the maximum extent possible and move anteriorly / laterally .
lateral and posterior - anterior cephalographic images were obtained during the first post - operative day and month .
all images verified the position of the bilateral dislocated condyles into the glenoid fossa and reduction of symphysis fracture . even though the right condyle seemed to be displaced slightly laterally ( fig .
3 ) , mouth opening was found to be within normal limits , and favorable occlusion was confirmed .
unfortunately , the patient was not cooperative , and long - term follow - up could not be performed .
although pubmed database listed 23 cases published between 1969 and 20111 - 17 , there were few reports of superior - lateral dislocation of intact mandibular condyle .
medial pulling of the pterygoid muscles during impact on the face may partly contribute to the rarity of condylar lateral displacement13 . according to amaral et al.17 ,
maxillofacial trauma associated with superior or lateral dislocation of the intact mandibular condyle is more predominant among young male adults who have figured in a road traffic accident .
allen and young2 classified the lateral dislocation of the mandibular condyle into two types : type i ( lateral subluxation ) , wherein the condyle is laterally displaced from the fossa ; and type ii ( complete dislocation ) , wherein the condyle has been dislocated both laterally and superiorly as it enters the temporal fossa .
satoh et al.8 further subdivided type ii dislocation into three subcategories : type iia , wherein the condyle is not hooked above the zygomatic arch ; type iib , wherein the condyle is hooked above the zygomatic arch ; and type iic , wherein the condyle is lodged into the zygomatic arch .
the present case fits the criteria of right - type iib and left - type i mandibular condyle dislocations .
amaral et al.17 pointed out that high energy of trauma could induce this type of dislocation and anterior mandibular fractures . according to allen and young2 , in such cases
, there was always a history of trauma to the chin usually associated with fracture in the symphyseal region .
the related mandibular fracture obviously promoted the rotation and movement of the ramus , which would facilitate the superior or lateral dislocation of the condyle as observed in the current case and previously reported cases2,6 - 9,11,13,17 .
as described by other authors , however , intact mandibular condyle dislocations may also occur occasionally without traumatic fractures5,12,14,16 . among the treatment options for intact condyle dislocations ,
nonsurgical methods such as traction wire placed at the angle of the mandible6,9 or mouth props -- functioning as fulcrum -- placed in the molar region12 have been previously used . according to the literature review ,
however , open reduction was selected for treating 52.2% of the cases , whereas closed reduction was carried out in the remaining 43.5%1 - 17 .
the higher rates of open reduction may be correlated to the waiting time for treatment17 .
delay in treatment may cause fibrosis of the glenoid fossa , resulting in incomplete reduction .
the formation of fibrous tissue can make manual reduction impossible12 . in the present case ,
the patient visited the emergency room four days after the trauma , and manual reduction under general anesthesia was unsuccessful .
to our knowledge , this is the first reported case of type iib dislocation reduced with the aid of bone traction hook . by modifying the approach of close reduction
, we were able to impose strong traction , disengage the condyle from above the zygomatic arch , and relocate both condyles to their normal positions .
despite the radiographic evidence of slight lateral displacement of the right condyle in the postoperative posterior - anterior cephalographic image ( fig .
3 ) , the patient did not manifest any discomfort or mouth opening limitation . in summary ,
superior or lateral dislocation of the intact condyle is often neglected yet requires thorough physical and radiographic examinations .
early diagnosis and management are strongly emphasized because prolonged dislocation can make reduction more difficult , leading to unsatisfactory results .
manual reduction is the first treatment option for superior - lateral condylar dislocations ; in delayed cases , however , open reduction or application of strong traction force by means of an extraoral route -- bone traction hook , for example -- is highly recommended in this case report due to its favorable outcome . | lateral and superior - lateral dislocations of the intact condyle are a rare complication , following traumatic insult to the mandible .
we report an unusual case of a 54-year - old male patient who experienced both types of dislocations of the intact condyles with symphysis fracture following a road - traffic accident . under general anesthesia ,
conventional manipulation was unsuccessful in relocating the condyles into the glenoid fossa .
after applying a percutaneous traction force , using a bone traction hook placed at the sigmoid notch , the displaced intact mandibular condyles were repositioned , and the symphyseal fracture was finally reduced and fixed .
the mouth opening was within normal limits , and favorable occlusion was confirmed one month postoperatively . to our knowledge
, this is the first case of dislocation of both intact condyles -- associated with symphysis fracture -- being reduced with bone traction hook . |
celiac disease ( cd ) is a chronic immune - mediated enteropathy with 1% worldwide prevalence .
cd is triggered by ingestion of a group of proteins , commonly known as gluten , from wheat , barley , and rye , in genetically susceptible individuals [ 1 , 2 ] .
cd is a polygenic disorder and certain hla alleles are the most important genetic factors involved .
almost all of the patients carry the hla variants hla - dq2 ( dqa105:01 , dqb102:01 ) , hla - dq8 ( dqa103 , dqb103:02 ) , and hla - dq2 ( dqa102:01 , dqb102:02 ) .
the role of hla molecules was clearly established when gluten - specific t cells were isolated from small intestine of cd patients at diagnosis .
these t cells are ifn producers and are restricted to hla - dq2 or hla - dq8 molecules [ 3 , 4 ] . though cd presents the highest association with particular hla alleles in comparison with other diseases
therefore , hla is considered a necessary , but not a sufficient , factor for cd development . in recent genetic studies ,
cd enteropathy is commonly limited to proximal small intestine where the characteristic histological findings are villous atrophy , crypt hyperplasia , and lymphocytic infiltration .
. mechanisms of both innate and adaptive immunity are involved in the damage to the small intestinal mucosa [ 1 , 2 ] .
currently , cd diagnosis is based on clinical evaluation , positive serology ( anti - transglutaminase 2 , anti - deamidated gluten peptides , and anti - endomysium antibodies ) , and the histological examination of a small intestine biopsy .
dietary exclusion of gluten proteins ( gluten - free diet , gfd ) restores the histology of the intestinal mucosa , reverts the symptoms , and is considered as complementary information in the diagnosis of cd . though serological tests present high analytical efficiency , cd diagnosis is still based on the assessment of the histology of intestinal biopsies .
new noninvasive tools for diagnosis and follow - up of cd patients are needed . intestinal and liver fatty acid binding protein ( ifabp and lfabp , resp . )
have been reported as markers of intestinal epithelial damage in mesenteric thrombosis , necrotizing colitis , and celiac disease [ 710 ] .
the fatty acid binding protein ( fabp ) family comprises 9 isoforms of small cytosolic proteins ( 14 - 15 kda ) expressed in different tissues , where more than one type of fabp can be found .
these proteins bind and transport long chain fatty acids ( among other hydrophobic ligands ) .
specifically , ifabp and lfabp have been suggested by in vitro studies to be involved in lipid uptake from the intestinal lumen into the enterocyte [ 12 , 13 ] .
ifabp and lfabp are highly expressed in the enterocyte , representing 1 - 2% of the total cytosolic proteins .
moreover , the mrnas of ifabp and lfabp are the most abundant translatable rna sequences in the gut epithelium .
several lines of evidence indirectly suggest they may perform different functions within the same cell type .
for example , although all the fabps have a highly conserved tertiary structure , containing a 10-strand beta - barrel where ligands are bound [ 11 , 16 ] , ifabp binds a single fatty acid per molecule whereas lfabp can bind up to two fatty acids and other hydrophobic ligands [ 17 , 18 ] . fatty acid binding specificity and mechanism of transfer to membranes
studies by immunofluorescence showed that ifabp and lfabp are expressed in the epithelium of normal small intestine .
differentiated enterocytes abundantly express ifabp and lfabp , and the latter is produced in 40 to 50 times higher concentration [ 8 , 22 ] . due to enterocyte damage occurring in cd enteropathy , lfabp and ifabp
were found significantly elevated in circulation in untreated cd patients compared to nonceliac controls [ 10 , 2325 ] .
the putative participation of intestinal fabps in cd deserves further exploration for at least two main reasons .
first , other fabps have been found to participate as mediators in inflammatory processes in the tissues where they are expressed [ 2628 ] .
second , the alteration of the enterocyte epithelia interferes with the absorption of nutrients and this could lead to modifications in intracellular lipid transport , proteins expression , and/or function . with the aim of exploring these possibilities , after determining the serum levels of ifabp in a local population of untreated cd patients compared to nonceliac controls , we analyzed the expression pattern of ifabp and lfabp at protein and mrna levels in human small intestine in normal and enteropathy tissues .
duodenal biopsies and blood samples were obtained from pediatric and adult patients during routine procedures to diagnose cd at the gastroenterology units of sor maria ludovica hospital and higa san martin from la plata , buenos aires , argentina , respectively .
the present study was approved by the ethical committees of the sor maria ludovica hospital and higa san martin from la plata , argentina .
cd diagnosis was achieved by evaluation of clinical presentation , histological examination , and serological analysis .
all pediatric and adult celiac patients had classical presentation , with signs and symptoms of malabsorption including chronic diarrhea , abdominal pain , distension , and failure to thrive or weight loss .
serological studies included determination of igg and iga anti - transglutaminase 2 antibodies , igg and iga anti - deamidated gluten peptides antibodies . in all the cases ,
positive serology was considered when antibody levels were , at least , twice the cut - off level . for diagnostic purposes
, three biopsy pieces were taken from the second portion of the duodenum and evaluated by an expert pathologist .
altogether , this study included cd patients with total or partial villus atrophy , classical clinical manifestations , and positive serology .
patients on gluten - free diet ( gfd ) presented histological recovery and negative serological markers for cd .
nonceliac individuals who suffered from other gastrointestinal conditions , primarily dyspepsia , and presented negative cd serology and normal duodenal histology were also included in this study .
the diagnosis of inflammatory bowel disease was confirmed by established clinical , endoscopic , and histological criteria . in this study , samples from a pediatric patient suffering from ulcerative colitis and six from adult patients ( 4 with ulcerative colitis and 2 with crohn 's disease ) were included .
all samples of ibd patients were taken at diagnosis and they did not receive any treatment at the time of sample collection .
serum samples were collected from 42 nonceliac controls ( 16 pediatric cases , 26 adults ) , 40 untreated cd patients ( 17 pediatric cases , 23 adults ) , 9 patients on gluten - free diet ( gfd ) ( 3 pediatric cases , 6 adults ) , and 7 intestinal bowel disease ( ibd ) patients ( 1 pediatric case , 6 adults ) .
duodenal samples were obtained from 27 pediatric patients ( 13 nonceliac controls , 14 cd patients ) and 15 adult individuals ( 9 nonceliac controls , 6 cd patients ) .
determination of ifabp serum levels was performed using an elisa kit ( hycult biotech , hk406 ) following the instructions provided by the manufacturer .
serum samples from nonceliac controls , treated and untreated celiac disease patients , and ibd patients were analyzed .
values are expressed as mean standard deviation ( s.d . ) of the mean .
we analyzed the expression of human fabps in duodenal samples using rabbit polyclonal antibodies raised against rat fabps .
the 132-residue rat and human ifabps have 82% amino acids ' sequence identity leading to a high degree of homology ( 83% ) and cross - reactivity between human and rat lfabp .
recombinant rat ifabp and lfabp were produced in e. coli bl21 ( de3 ) cells transformed pet11d - ifabp , pet11a - lfabp and purified as described elsewhere [ 20 , 31 ] , performing exclusion chromatography ( sephadex g-50 , pharmacia biotech inc . ) , followed by anion exchange chromatography ( de-52 , whatman ) and finally delipidation using a lipidex-1000 column .
sds - page electrophoresis followed by coomassie brilliant blue r250 ( thermo scientific ) staining was used to assess fabp purity .
reactivity of polyclonal antibodies from immunized rabbits was assessed by western blotting and elisa using the recombinant proteins .
sections of paraffin - embedded small intestine biopsies were obtained using a leica sm 2000r microtome ; subsequently they were rehydrated and citra solution ( biogenex , cat .
sections were stained with anti - ifabp or anti - lfabp rabbit polyclonal antibodies ( dilutions used : lfabp 1/2001/400 , ifabp 1/201/50 ) .
afterwards , they were incubated with anti - rabbit igg conjugated with alexa 488 ( life technologies , cat .
total rna was isolated from whole biopsy samples using an rna spin mini kit ( ge healthcare , cat .
reverse transcription was performed using 1 g of total rna . mml - v polymerase and random primers were obtained from molecular probes inc . , invitrogen ( carlsbad , ca , usa ) .
quantitative real time pcr was performed in an iq cycler from biorad using sybr green mix ( invitrogen , cat .
11761 - 100 ) and specific primers for the genes of interest : ifabp forward agcacttggaaggtagaccg , ifabp reverse cccctgagttcagttccgtc ; lfabp forward agctctattgccaccatgagtttct , lfabp reverse aactgaaccactgtcttgactttctc ; -actin forward atgggtcagaagtcctatgtg , -actin reverse cttcatgaggtagtcagtcaggtc ; villin forward ctacaccacacagatggatgacttc , villin reverse gacatctctacctctccagctacca . the comparative ct method was used to quantify ifabp and lfabp transcripts normalizing alternatively with -actin or villin .
values are expressed as mean standard deviation ( s.d . ) of the mean . both statistical evaluation of serum levels of ifabp by elisa and quantitative pcr analysis of ifabp and lfabp mrna levels
the concentration of ifabp in serum samples was determined by a commercial quantitative elisa kit .
untreated cd patients presented significant higher levels of ifabp in serum compared to treated cd patients , non - cd controls , or ibd patients .
because there was no difference between samples from pediatric and adult populations , the results obtained from both populations were depicted together .
no differences were found between non - cd controls , cd patients on gfd , and ibd patients ( figure 1 ) .
the assessment of ifabp concentration in serum samples showed statistical differences for samples from cd patients at diagnosis ( mean value 2898.89 pg / ml , range 616.837295.95 pg / ml ) , non - cd controls ( mean value 1356.49 pg / ml , range 256.513433.33 pg / ml ) , cd patients on gfd ( mean value 1766.84 pg / ml , range 391.423955.88 pg / ml ) , and ibd patients ( mean value 744.92 pg / ml , range 165.891558.2 pg / ml ) .
serum ifabp levels might serve to discriminate cd patients from non - cd controls as described by previous reports [ 10 , 2325 ] .
similar ifabp levels in serum from patients on gfd and controls were observed , suggesting that ifabp may also be a biomarker to follow up the response to treatment .
remarkably , ifabp concentration in serum samples from ibd patients was similar to the values observed in non - cd controls .
these results suggest that the increase of ifabp concentration in serum is a specific finding in cd enteropathy , which is limited to the proximal small intestine . in order to evaluate the expression pattern of lfabp and ifabp in human duodenum by immunofluorescence techniques ,
western blot analysis showed that each of the polyclonal antibodies produced in our laboratory specifically reacts with the protein used as antigen .
specific labeling was verified on duodenal sections from healthy control and enteropathy samples using serum from an unimmunized rabbit ( see supplementary figure 1 in the supplementary material available online at http://dx.doi.org/10.1155/2015/738563 ) .
the expression of lfabp was analyzed in sections of duodenal biopsies from healthy controls and cd patients at diagnosis .
conventional indirect immunofluorescence analysis showed that lfabp is abundantly expressed in enterocytes from the villi but not in the crypts in healthy tissue ( figures 3(a ) and 3(b ) ) . in duodenal samples from cd patients
lfabp was observed in enterocytes and remarkably in the crypts ( figure 3(c ) ) .
lfabp expression was more intense in the crypts closer to the epithelium fading away towards the muscularis mucosae .
similar findings were observed by fluorescence confocal microscopy ( figures 3(d ) and 3(e ) ) .
fully differentiated enterocytes showed homogeneous cytoplasmic staining for lfabp in the epithelium from tissues of both non - cd controls and cd patients .
crypts closer to the epithelium were also stained in severe enteropathy ( figures 3(c ) and 3(f ) ) .
the analysis of ifabp expression by conventional immunofluorescence microscopy showed bright staining in enterocytes but also very faint staining in some crypts of small intestine from nonceliac controls ( figures 4(a ) and 4(b ) ) .
enterocytes in the remaining epithelium and in the crypts were strongly stained in duodenal samples from cd patients at diagnosis ( figure 4(c ) ) .
confocal fluorescence microscopy analysis showed homogeneous staining for ifabp in the enterocytes in healthy small intestine ( figures 4(d ) and 4(e ) ) .
ifabp expression was observed in enterocytes in the damaged epithelium as well as the crypts in small intestine of untreated cd patients ( figure 4(f ) ) .
the expression of lfabp and ifabp mrna in duodenal tissue was assessed by quantitative pcr using -actin as housekeeping gene . in non - cd controls , higher mrna levels for both lfabp and ifabp were observed in adult than in pediatric small intestine ( figure 5 ) .
mrna levels of lfabp were higher than those of ifabp . strikingly , the expression of lfabp and ifabp was lower in untreated adult cd patients compared with non - cd controls .
fabps ' expression pattern , previously observed by immunofluorescence studies , suggests that an intense synthesis process occurs in fully differentiated enterocytes located in the villi . in severe enteropathy ,
however , a reduction in the mrna levels in tissues showing severe enteropathy was observed .
the small intestine in untreated cd patients shows relevant histological changes , particularly loss of epithelium and enlargement of lamina propria .
these changes can be described as a reduction in the ratio of number of cells from epithelium versus cells from lamina propria . to estimate this variation , we focused our attention on the expression of villin , which is limited to differentiated enterocytes
. thus , the use of villin as housekeeping gene allows a better evaluation of changes in mrna levels of proteins specifically expressed in the enterocytes .
as expected , the severe histological alterations observed in severe enteropathy were accompanied by changes at mrna levels of villin compared with -actin .
villin mrna levels were reduced in severe enteropathy compared with normal tissue ( figure 6(a ) ) .
therefore , we decided to use villin as housekeeping gene to reevaluate the changes in the expression of fabps in duodenal samples .
we found that mrna levels of both lfabp and ifabp were higher in samples with severe enteropathy compared with healthy tissue when villin was used as housekeeping gene , though a significant difference was only observed for ifabp .
lfabp mrna levels were higher than ifabp mrna levels as described above ( figure 6(b ) ) .
altogether , these results indicate that in cd fabps expression is actually increased inside enterocytes ( significantly for ifabp ) although their mrna levels are lower when evaluating the whole intestinal sample due to the reduction of enterocyte to lamina propria cells ratio .
cd is an immune - mediated enteropathy triggered by dietary gluten peptides in genetically susceptible individuals .
the histological findings range from increased number of intraepithelial lymphocytes and a minor reduction in the villus height / crypt depth ratio up to total villus atrophy .
the mechanism of mucosal damage is still not completely understood [ 2 , 3 ] .
however , diagnosis can not be established in some cases due to the lack of concordance between serology and histology [ 34 , 35 ] .
in addition , minor changes in the histology are frequently referred to as unspecific findings .
thus , a large number of cases may remain undiagnosed [ 36 , 37 ] .
hla typing by identifying the presence of the hla class ii susceptibility alleles ( hla - dq2/dq8 ) is a complementary test with high negative predictive value and is useful as exclusion criteria .
however , the high cost of this technique precludes its use in the routine clinical practice .
noninvasive tests using markers for intestinal permeability have been used to evaluate the integrity of the gut mucosa [ 38 , 39 ] . however , these tests are unspecific because many different conditions alter intestinal permeability .
there is a current need for new tests for the identification of absorption alterations in the intestinal mucosa .
thus , the search for noninvasive tests based on the evaluation of biomarkers that specifically detect cd or characterize its active stage is a promising tool for screening strategies , complementary information when diagnosis is controversial , or treatment follow - up .
we recently showed that the inflammatory chemokine cxcl10 is abundantly produced in duodenal mucosa in untreated celiac patients , and also significant higher levels of circulating cxcl10 were found in untreated cd patients .
concentration of cxcl10 in serum returns to basal levels in patients on gluten - free diet . though further studies evaluating large number of samples are required , these findings point to cxcl10 as a biomarker for the evaluation of cd . additionally , there are new proposed biomarkers of intestinal epithelial cell damage such as reg-3 .
enterocyte fabps are proposed for binding and trafficking long chain fatty acids absorbed from the dietary lipids to different cell fates ranging from mitochondrial beta oxidation , regulation of gene expression in the nuclei , and chylomicron synthesis , among others .
thus , it is possible to assume that in malabsorption syndromes , such as cd , these proteins may play a relevant role .
the measurement of cytosolic enterocyte proteins in peripheral blood has also been shown to be useful for estimating enterocyte damage .
ifabp has also been proposed as a differentiation marker to evaluate intestinal maturation in preterm neonates .
enterocytes on the top of the villi are the initial site of cell destruction in numerous intestinal diseases .
thus , high serum levels of fabps may correlate with a higher rate of enterocyte damage .
serum ifabp was used as a biomarker to detect active cd . since it is highly expressed in the villi tip , vreugdenhil et al .
in addition , as the expression of ifabp is limited to the intestinal epithelium , this protein is a better marker of intestinal damage than lfabp which is also expressed in other tissues .
the concentration of ifabp in serum samples also correlates with both anti - transglutaminase 2 iga antibody levels and the severity of villous atrophy in cd patients at the time of diagnosis [ 2325 ] .
in addition , ifabp determination may have an advantage over anti - tg2 given that ifabp 's half - life is shorter and could reflect rapid changes at mucosal level .
ifabp values diminished to normalization in cd patients after gfd for at least a year , independently of initial antibodies and ifabp levels . nevertheless , all the studies mentioned above reported the use of different cut - off values for ifabp levels in plasma . therefore , with the aim of using the determination of serum ifabp in clinical practice , studies involving a large number of samples and validated procedures are needed . similarly to reported studies , in this work we observed higher concentrations of ifabp in serum samples of cd patients at the time of diagnosis compared to samples from patients on gfd or controls .
thus , the analysis of a local population replicated previous reports [ 10 , 2325 ] and showed that determination of the concentration of ifabp in serum may be used as a noninvasive test in diagnosis and gfd follow - up .
in addition , our pilot study showed significantly higher ifabp levels in serum of cd patients compared to samples from ibd patients suggesting the potentiality of ifabp as a biomarker which may help in clinical practice to discriminate between samples from cd and ibd patients . to this end , further evaluation using a large number of cases is needed .
the use of circulating ifabp as a specific biomarker of small intestinal enterocytes damage was also suggested by wiercinska - drapalo et al . .
authors found high levels of ifabp in serum from a group of ulcerative colitis patients suffering from ileitis , an extended inflammatory process in the terminal small intestine .
this finding was associated with a diagnostic value of serum ifabp released from damaged enterocytes of the terminal small intestine .
in addition , analysis of ifabp urinary levels has been proposed as predictive biomarker of necrotising enterocolitis .
detection of ifabp in urine samples , as a consequence of its release from small intestine enterocytes , is useful for diagnosis since it may anticipate the rapid progression of this disease . in agreement with a previous report
, in this work we observed that lfabp and ifabp are highly expressed in the enterocytes of small intestine in healthy tissue .
however , some differences in the pattern of expression were evidenced . whereas levy et al .
described expression of lfabp and ifabp in the crypts , we observed no staining for lfabp and a very faint staining for ifabp in the crypts from proximal duodenum .
these differences are probably due to differences in the immunofluorescence techniques used , mainly the quality of the images obtained , and secondly the intestinal segments investigated in each study .
our work revealed an important change in the expression of both fabps when samples with severe enteropathy were analyzed .
the staining for lfabp was more intense in crypts located close to the epithelium whereas ifabp showed an intense staining in all crypts , close to and far away from the remaining epithelium .
this was a characteristic finding in tissues showing severe enteropathy from cd patients at the time of diagnosis .
to our knowledge , this is the first description of this change in fabps ' expression pattern .
the increased expression of fabps in the immature enterocytes in the crypts may reflect an accelerated developmental program of enterocytes .
highly differentiated enterocytes are unable to replace the lost epithelia as a consequence of the extended damage process .
therefore , lfabp and ifabp , which are normally expressed in fully differentiated enterocytes from the small intestine , may appear earlier in the crypt enterocytes due to a faster developmental program .
next , we evaluated the mrna expression of lfabp and ifabp in small intestine using -actin as housekeeping gene .
higher expression of both lfabp and ifabp was observed in control adult small intestine compared to control pediatric samples ( figure 5 ) . by western blot analysis , levy et al . did not observe changes in the expression of fabps at protein level in normal pediatric and adult jejunum .
strikingly , the analysis of samples from adult cd patients at the time of diagnosis showed a significant reduction in the mrna levels of lfabp and ifabp compared to healthy tissue . on the other hand
, pediatric samples showed no difference in mrna levels between cd patients and control for either protein ( figure 5 ) . since qpcr results are expressed as a ratio of the transcript of interest and the housekeeping gene on the whole piece of tissue , the reduction of lfabp and ifabp mrna levels observed in adult cd patients is likely due to histological changes .
healthy tissue contains a long layer of epithelial cells and a limited lamina propria , whereas in severe enteropathy it is just the opposite , a reduced epithelial layer and a larger lamina propria .
consequently , to evaluate whether the change in the histology may explain the results obtained , we used villin as housekeeping gene .
it is worth noting that villin specificity is such that its promoter has been used for transgenic expression of different proteins limited to the enterocyte .
the epithelium loss in duodenal samples from untreated cd patients was accompanied by a reduction in the relative expression of villin .
the analysis of lfabp and ifabp mrna expression using villin as housekeeping gene showed higher levels of lfabp and ifabp transcripts in cd samples compared to non - cd controls , reaching statistical significance for ifabp ( figure 6 ) .
this would be suggesting an upregulation in fabps expression within the enterocytes , as described in the renal ischemic injury for lfabp .
taken together , we observed that the expression of lfabp and ifabp is limited to fully differentiated enterocytes in healthy tissue whereas in active cd they are also expressed in immature enterocytes from the crypts . though the mrna analysis using villin as housekeeping gene showed that fabps expression is increased within enterocytes in cd enteropathy , the total expression in the tissue , referred to -actin , was diminished . in accordance with these findings , simula et al . , using quantitative proteomic analysis , found lower levels of lfabp ( fabp1 ) and ifabp ( fabp2 ) in duodenal samples from active cd patients compared to healthy small intestine , using vinculin as normalizing protein .
considering the multiple biological roles of fabps in the intestinal mucosa , the lower expression of fabps may have pathological effects .
ppar is a ligand - activated nuclear receptor which plays multiple roles in metabolism , cellular proliferation , differentiation , and immune response .
particularly , ppar performs relevant biological functions in the intestinal mucosa , where it also contributes to anti - inflammatory and regulatory effects .
the interaction of lfabp with ppar and ppar has already been described in hepatocytes , and lfabp 's function as a mediator in ppar activity in the nucleus has been shown . taking this into account
, we can hypothesize that lfabp and ifabp may modulate the function of ppar in enterocytes , and thus changes in fabps expression may affect ppar activation .
interestingly , downregulation of fabps and ppar was found in small intestine of cd patients , which may explain some of the alterations observed in signaling pathways in active cd .
lfabp and ifabp knock - out mice have shown alterations in mucosal lipid metabolism , with differential lipid assimilation in each knock - out type . in this context , it is possible to speculate that lipid metabolism may be altered in this pathology as well .
further studies will be carried out to asses this hypothesis . in this work , we showed changes in the pattern of expression of lfabp and ifabp in proximal small intestine in severe enteropathy .
these changes are likely associated with the histological changes observed in the intestinal mucosa in active cd and alterations in enterocyte differentiation . in conclusion
, these findings suggest that changes in fabps expression may have a relevant influence in the control of the immune response as well as other important functions in the intestinal mucosa , which altogether may contribute to the pathogenic mechanism of damage in active cd . | celiac disease ( cd ) is an immune - mediated enteropathy that develops in genetically susceptible individuals following exposure to dietary gluten .
severe changes at the intestinal mucosa observed in untreated cd patients are linked to changes in the level and in the pattern of expression of different genes .
fully differentiated epithelial cells express two isoforms of fatty acid binding proteins ( fabps ) : intestinal and liver , ifabp and lfabp , respectively .
these proteins bind and transport long chain fatty acids and also have other important biological roles in signaling pathways , particularly those related to ppar and inflammatory processes .
herein , we analyze the serum levels of ifabp and characterize the expression of both fabps at protein and mrna level in small intestinal mucosa in severe enteropathy and normal tissue . as a result
, we observed higher levels of circulating ifabp in untreated cd patients compared with controls and patients on gluten - free diet . in duodenal mucosa
a differential fabps expression pattern was observed with a reduction in mrna levels compared to controls explained by the epithelium loss in severe enteropathy . in conclusion , we report changes in fabps ' expression pattern in severe enteropathy .
consequently , there might be alterations in lipid metabolism and the inflammatory process in the small intestinal mucosa . |
in cases of low - grade prostate cancer with a gleason score ( gs ) of 6 , extraprostatic extension and metastasis have been shown to be less likely to occur , and such cases generally accompany a good prognosis . accordingly
, such cases have been known to be suitable for radical prostatectomy . in addition , since the application of prostate - specific antigen ( psa ) screening to prostate cancer , there have been increasing cases in which early - stage prostate cancer has been cured through surgeries . in prostate cancer , extraprostatic extension has been closely related to prostate biopsy , positive resection margin , and disease - free survival [ 3 - 8 ] .
cases of prostate cancer that turn out to be low grade on biopsy have shown a low incidence rate of extraprostatic extension and thus have usually been completely resected . moreover ,
such cases have been reported to have a lower mortality rate related to prostate cancer . in some studies ,
the probability of extraprostatic extension was analyzed with the use of standards and nomograms related to the clinical stage , psa level , and the prostate biopsy [ 3,6 - 8 ] .
one study dealt with a high - risk group of extraprostatic extension ; however , there have been very few studies focusing on the risk of extraprostatic extension in patients with gs6 prostate cancer . for gs6 prostate cancer ,
many surgeons have confidently performed nerve - sparing surgery along with radical prostatectomy . in many cases , however , such procedures cause positive resection margins and thus increase recurrence rates .
ordinarily , a positive resection margin is caused by ill - considered nerve - sparing surgeries , which have been known to affect progression - free survival . in many studies
, it has been reported that the results of preoperative biopsies were not consistent with those of postoperative specimen pathologies in relation to prostate cancer .
this study aimed to identify the predictive factors for extraprostatic extension of gs6 prostate cancer in addition to identifying cases suitable for nerve - sparing surgeries .
this study was conducted on 55 patients who had been diagnosed with prostate cancer through prostate biopsy and had undergone radical prostatectomy at our hospital between february 1996 and july 2010 .
their age was calculated on the basis of their hospital registration numbers , and biopsies were performed through transrectal ultrasonography ( trus ) after digital rectal examinations ( dres ) and psa tests .
the total prostate volume was calculated through the ellipsoid formula by using an ultrasonograph machine ( type 1202 and 2001 ; bk - medical aps , denmark ) . the psa density ( psad )
was calculated as the ratio of prostate volume to serum psa ( ng / ml / cc ) .
prostate biopsy - related factors included whether the prostate cancer was bilateral , whether the prostate cancer was detected in the basal core , the maximum length of the tumor , the cancer percentage of the cancer core , and the numbers of cores in which prostate cancer was detected .
clinical factors were limited to age , psa level measured before the biopsy , prostate volume , findings of the dre , and how univariate and multivariate analyses were conducted to investigate their influence on extraprostatic extension . the statistical analysis was conducted by using spss ver . 18.0 ( spss inc . ,
the median age of the 55 patients was 66 years ( range , 51 to 74 years ) , and their median psa was 6 ng / ml ( range , 3.2 to 46.9 ng / ml ) .
the psa levels of 4 patients ( 7.2% ) were less than 4 ng / ml , and those of 38 patients were between 4 and 10 ng / ml .
trus - weighted psad averaged 0.3 ng / ml / cc ( range , 0.07 to 1.27 ng / ml / cc ) . the mean prostate volume was 31.8 cc ( range , 20 to 65 cc ) , and the mean specimen weight was 33 g ( range , 15.9 to 72.1 g ) . according to the pathological analyses of the prostatectomy specimens , an adverse pathological outcome occurred in 26 patients ( 47.3% ) .
in the postoperative pathological examinations , the gs was worsened in 26 patients ( 47.3% ) .
the pathological stages of 38 patients ( 69.1% ) were rated pt2 , and those of 17 patients ( 30.9% ) were rated pt3 ( table 1 ) . in the univariate logistic regression model , a psa of 7.4 ng / ml or more , a trus - weighted psad of 0.2 ng / ml / cc or more , prostate cancer detected in the basal core , and prostate cancer detected in 2 or more cores out of 12 were the predictive factors for extraprostatic extension .
after factors unsuitable for the multivariate logistic regression model were excluded , the results indicated that the independent predictive factors for stage - pt3 were a psa of 7.4 ng / ml or more and prostate cancer detected in 2 or more cores out of 12 ( table 2 ) .
pathological upgrading was significantly correlated with the adverse outcome of seminal vesicle involvement , extraprostatic extension , and positive surgical margin .
these analyses were composed of cross - tabulations and chi - square ( table 3 ) . in cases
in which the gs was increased to 7 or more , extraprostatic extension comprised a high proportion ( 6.8% vs 57.6% ; p<0.001 ) , and a positive surgical margin comprised a higher proportion ( 20.6% vs 53.8% ; p=0.007 ) . when the cutoff value of trus - weighted psad was adjusted to 0.20 ng / ml / cc ,
it was possible to predict pt3 prostate cancer with a sensitivity of 92.3% and a specificity of 50% .
when the psa cutoff value was 7.4 ng / ml , sensitivity and specificity were 69.2% and 76.5% , respectively .
table 4 shows cases of upgrading or upstaging in relation to trus - weighted psad .
the gs of prostatectomy specimens has been known to be a predictive factor for survival .
clinically , the gs directly affects the decision of how to treat prostate cancer given that there is a general belief that biopsy findings correlate with prostatectomy specimens .
in previous studies , however , it was reported that 35% to 58.3% of cases showed inconsistency in the gs [ 13 - 15 ] .
also , in this study , 47.3% of cases showed inconsistency of biopsy - based gs with specimen - based scores . in overall cases from this hospital ,
cupp et al reported pathological factors as the cause of such wide variation , and allan et al and divrik et al reported that inexperienced clinicians , interobserver variability , needle size , and the frequency of biopsies might also be a cause .
further , cupp et al reported that there was a significant difference between the percentage of biopsy core involvement and the whole mount measured through the serial section performed on the radical prostatectomy specimen . according to the allan et al report , on a 12-core biopsy ,
10% of cases showed upgrading or upstaging of gs6 prostate cancer , and when the number of cores was less than 12 , 23% of cases showed this .
this finding demonstrates that biopsy pathology - prostatectomy pathology differences become more extensive in smaller amounts of prostate tissue .
allan et al reported that when gs6 prostate cancer was detected through needle biopsy , approximately 22% of prostatectomy specimens were stage - pt3 or gs7 and higher forms of prostate cancer . in our study , 26 of 55 patients ( 47.6% ) exhibited upgrading , and 17 ( 30.7% ) showed upstaging .
overall , 28 patients ( 50.9% ) showed upstaging or upgrading ( table 1 ) , and gs6 and stage t3 prostate cancer was reported in 2 ( 3.6% ) .
this implies that there is a limit as to what the biopsy can predict with respect to tumor grade .
these results were presumed to be caused by the heterogeneous and multifocal characteristics of prostate cancer , and pathological upgrading is known to be significantly correlated with adverse pathological outcomes and biochemical recurrence .
thus , from a clinical perspective , the accurate prediction of inconsistency carries important meaning .
prostate biopsy - related factors were limited to whether prostate cancer was bilateral , whether it was detected in the basal core , the maximum length of the tumor , the percentage of the cancer core , and the numbers of cores in which prostate cancer was detected .
clinical factors were limited to age , psa , trus - weighted psad , and findings of the dre . in many studies
, it has been reported that the incidence rate of prostate cancer aggressively increases as men age . in our studies , however , the risk of extraprostatic extension was not higher in older people .
the percentage of cores that turn out to be positive on prostate biopsy is known to be a predictive factor for extraprostatic extension and to significantly affect the prognosis [ 3,5 - 8,22,23 ] .
graefen et al reported that prostate cancer detected in two or more cores made it possible to predict extraprostatic extension , and teneja et al reported that the gs , the number of ipsilateral positive cores , and prostate cancer detected in the fundus were significant predictive factors for extraprostatic extension .
it was reported in another study that extraprostatic extension could be predicted through tumor volume . in our study , psa of over 7.4 ng / ml ( p=0.006 ) , prostate cancer detected in the basal core ( p=0.029 ) , prostate cancer detected in two or more cores out of 12 ( p=0.031 ) , and a psad of 0.20 ng
/ ml / cc or more ( p=0.042 ) were univariate predictive factors for extraprostatic extension . in the multivariate analysis , psa of
7.4 ng / ml or more and prostate cancer detected in two or more cores out of 12 were predictive factors for extraprostatic extension .
naya et al conducted a multivariate analysis on 430 subjects ( 720 lobes ) and reported that the risk of extraprostatic extension increased by 10% in cases in which prostate cancer was detected in the basal core and in which the cancer core was 7 mm long or longer . owing to the directivity of extraprostatic extension , prostate cancer detected in the basal core might be considered to be a significant univariate factor for predicting extraprostatic extension . in this study ,
the maximum length of the tumor turned out not to be a significant factor , unlike the study of naya et al . in our study , it was analyzed irrespective of direction , but in the case of naya et al , it was not certain whether the analyses were conducted with specimens extracted from lateral cores or irrespective of direction .
the inconsistency between the two studies is presumed to be related to different methods or different subjects ( this study was focused on patients with gs6 prostate cancer ) .
graefen et al and shah et al reported that psa was a predictive factor for extraprostatic extension of localized prostate cancer ; however , naya et al reported that psa was not significantly correlated with extraprostatic extension . in the case of psad , many studies have reported it to be a predictive factor for the extraprostatic extension of localized prostate cancer as well as a predictive factor for the aggressiveness of tumors . however , a few studies have reported that in comparison with psa , psad was not more advantageous in the prediction of extraprostatic extension . in our study , when the cutoff value of psad was adjusted to 0.20 ng / ml / cc , it made it possible to predict extraprostatic extension with a sensitivity of 92.3% and a specificity of 50% . with a psa cutoff value of 7.4 ng / ml ,
the weight of the pathologic specimen was reported to be significantly correlated with trus volume . in our study ,
a linear regression analysis showed that the two variables were correlated with each other ( p<0.001 ) .
in many studies , radical prostatectomy has been reported to make it possible to cure localized high - grade prostate cancer completely .
in contrast , manoharan et al reported that the biochemical failure rate reached 38% and that the 10-year disease - free survival rate reached 74% in radical prostatectomy for gs6 and less - localized prostate cancer .
in this regard , they reported that biochemical recurrence was closely related to the problem of whether nerve - sparing surgery was performed and whether the resection margin was positive . concerning the limitations of our study ,
the study was carried out retrospectively , and long - term data could not be gathered .
furthermore , an in - depth investigation was not made into whether prostate cancer was related to the death of patients and whether nerve - sparing surgeries were performed on patients with gs6 prostate cancer .
also , this study did not deal with adverse long - term outcomes or adverse long - term survival outcomes .
with respect to radical prostatectomy specimens rated pt3 , prostatectomy specimens need to be analyzed for prostate cancer detected in the basal core because extraprostatic extension progresses posterolaterally .
in addition , further investigation is needed to examine the influence of nerve - sparing surgery and a positive resection margin on adverse pathological and adverse long - term outcomes .
in relation to clinical factors , the risk of extraprostatic extension became higher with higher psa ( 7.4 ng / ml ) and when the trus - weighted psad was 0.2 ng / ml / cc or higher . in relation to biopsy - related factors , it was higher in prostate cancer detected in the basal cores and in prostate cancer detected in two or more cores out of 12 .
our results suggest that surgeons need to understand the uncertainty of gs in relation to biopsy . in patients with the previously mentioned risk factors ,
it is advisable that nerve - sparing surgery not be performed but rather that the patients prepare for the possibility of stage pt3 prostate cancer . | purposeoften , a diagnosis of pt3 is made on the basis of radical retropubic prostatectomy specimens , despite a gleason score of 6 on the preoperative prostate biopsy .
thus , we investigated the preoperative variables in patients displaying these characteristics.materials and methodsstudy subjects comprised patients at our institute from 1996 to july 2010 who had exhibited a gleason score of 6 on their prostate biopsies and had undergone a radical retropubic prostatectomy . through univariate and multivariate analysis , we investigated pt3 predictive factors including age , preoperative prostate - specific antigen ( psa ) levels , transrectal ultrasonography ( trus)-weighted prostate volume , digital rectal examination findings , bilaterality via prostate biopsy , prostatic cancer in prostate base cores via prostate biopsy , maximum length and percent of prostatic cancer , and number of cores detected in prostatic cancer via prostate biopsy.resultsin the univariate logistic regression mode , a psa value of 7.4 ng / ml or higher , trus - weighted psa density of 0.2 ng / ml / cc or higher , prostate cancer detected in the basal core , and prostate cancer detected in 2 or more cores out of 12 were predictive factors for extraprostatic extension .
independent predictive factors for stage pt3 were a psa of 7.4 ng / ml or higher and prostate cancer detected in 2 or more cores out of 12.conclusionsin the case of patients with the foregoing risk factors , it is advisable not to perform nerve - sparing surgery but to prepare for the possibility of a pt3 stage . |
classic cadherins are major mediators of homophilic cell cell adhesion during animal development ( tepass , 1999 ) . in many developmental processes ,
cell culture studies have shown that both clustering of cadherin molecules and linkage to the actin cytoskeleton dramatically affect the strength of adhesion .
the link between the intracellular domain of cadherin and the actin cytoskeleton is provided by proteins of the catenin family ; -catenin binds to the cooh - terminal part of the cadherin intracellular domain and to -catenin , which in turn links to the actin cytoskeleton by interacting with multiple proteins ( fig .
, members of the p120/-catenin family of proteins can bind to the juxtamembrane domain of cadherin . in vitro studies
have suggested that p120/-catenin proteins are regulators of cadherin - dependent adhesion , although there is some controversy on whether they are positive or negative regulators ( anastasiadis and reynolds , 2000 ) .
( a ) schematic representation of de - cadherin variants and catenins associated . ( b )
immunoprecipitation from schneider cells transfected with prm - ha - p120ctn and prm - de - cadherin - wt or puast - de - cadherin - aaa+prmgal4 .
( c h ) schneider cells transfected with prm - ha - p120ctn ( c e , green , and c''e '' ) or prm--catenin ( f h , green , and f''h '' ) , and prm - de - cadherin - wt ( c and f ) , prm - de - cadherin - aaa ( d and g ) , or prm - de - cadherin- ( e and h , red , and c'h ' ) .
ha - p120ctn was often enriched at the cortex between two cadherin overexpressing cells , suggesting that recruitment to the membrane is affected by cadherin interactions .
drosophila is a useful model for studying the function and regulation of cadherin in the animal .
three classical cadherins have been identified in the drosophila genome ; drosophila epithelial cadherin ( de - cadherin ) * and two n - cadherins . de - cadherin , encoded by the shotgun ( shg ) locus , is associated with junctional complexes in epithelia ( oda et al . , 1994 ) .
genetic analyses have revealed a role for de - cadherin in different types of adhesion ( tepass , 1999 ) .
de - cadherin is required for epithelial integrity ; in particular , continued synthesis of de - cadherin is required in morphogenetically active epithelia of the embryo ( tepass et al . , 1996 ;
- cadherin also mediates differential cell affinities , including correct positioning of the oocyte in egg chambers ( godt and tepass , 1998 ; gonzlez - reyes and st .
finally , de - cadherin is absolutely required for the invasive migration of border cells during oogenesis ( niewiadomska et al . , 1999 ) .
it appears to be the key mediator of dynamic adhesion of migrating border cells to their substratum , the germ line cells .
the intracellular domain of de - cadherin is highly related to that of mammalian classical cadherins and is likely to mediate the same protein interactions ( tepass et al . , 2001 ) .
the importance of interaction with -catenin is supported by genetic analysis of mutations in armadillo ( arm ) , the single drosophila -catenin .
in addition to the established effects on wg / wnt signaling , arm mutants display phenotypes consistent with a requirement in cadherin - dependent adhesion ( peifer et al . , 1993 ) . a single member of the p120/-catenin family ( p120ctn ) is encoded in the drosophila genome , but no mutants are yet available .
the conserved interactions with the intracellular domain of de - cadherin have allowed us to investigate the requirements for catenin interactions in different cadherin - dependent processes in vivo .
to specifically disrupt the interaction between de - cadherin and p120ctn , we mutated a conserved triplet of glycine in the juxtamembrane region of de - cadherin to alanine ( fig .
the corresponding mutation in human e - cadherin disrupts the interaction with p120 without affecting the interaction with -catenin ( thoreson et al . , 2000 ) .
we also made a version of de - cadherin that should be unable to interact with -catenin by deleting the cooh - terminal -catenin interaction domain ( fig .
the mutant de - cadherin molecules were tested by transfection in schneider cells ( fig .
1 ) as well as by overexpression with the uas - gal4 system in the follicular epithelium of egg chambers ( fig .
2 ) . cortical recruitment of p120ctn and -catenin by de - cadherin variants in follicular cells .
localization of overexpressed ha - p120ctn ( a d , green , and a'd ' ) or endogenous -catenin ( e h , green , and e'h ' ) in follicular cells expressing only endogenous de - cadherin ( a and e ) , or overexpressing de - cadherin - wt ( b and f ) , de - cadherin - aaa ( c and g ) or de - cadherin- ( d and h ; red ) .
levels of endogenous de - cadherin are too low to recruit all overexpressed p120ctn to the cortex , except in cells where overexpression is milder ( arrow ) .
uas - ha - p120ctn and uas - de - cadherin transgenes were overexpressed with slbogal4 ( rrth et al . , 1998 ) .
wild - type ( de - cadherin - wt ) as well as mutant cadherin proteins were enriched at the cell cortex , presumably the plasma membrane , in schneider cells ( fig . 1 ,
d ) . as a measure of the ability of the different forms of de - cadherin to bind -catenin and p120ctn
schneider cells were cotransfected with tagged versions of p120ctn and -catenin . without coexpressed cadherin ,
ha - p120ctn and -catenin were cytoplasmic ( unpublished data ) ; -catenin was present only at a low level in the cytoplasm due to its instability .
coexpression of wild - type de - cadherin resulted in recruitment of ha - p120ctn ( fig .
1 c ) and in recruitment and/or stabilization of -catenin at the cortex ( fig . 1 f ) . in follicular cells
2 a , arrow ) and endogenous -catenin was present at the cell cortex ( fig .
overexpression of de - cadherin - wt resulted in efficient recruitment of ha - p120ctn ( fig .
2 g ) , but not ha - p120ctn ( fig . 1 d and fig .
1 e and fig . 2 d ) , but not -catenin ( fig . 1 h and fig
immunoprecipitation from schneider cell extracts confirmed an interaction between ha - p120ctn and de - cadherin - wt , but not de - cadherin - aaa ( fig .
thus , de - cadherin - aaa and de - cadherin- appear to be good tools to selectively affect de - cadherin interaction with p120ctn or with -catenin .
cell aggregation is commonly used to measure cadherin - dependent adhesion and importance of cytoplasmic interactions in mammalian cells ( thoreson et al . , 2000 ) . as a first functional analysis of the de - cadherin mutants
, we thus compared the ability of de - cadherin - wt , de - cadherin - aaa , and de - cadherin- to induce aggregation of schneider cells .
a form of de - cadherin lacking the full cytoplasmic tail ( de - cadherin-cyt ) was also tested .
all four constructs mediated de - cadherin dependent aggregation , and the degree of aggregation was indistinguishable .
thus , de - cadherin mediated aggregation of schneider cells is independent of its cytoplasmic tail .
this does not appear to be due to lack of p120ctn ; schneider cells express some p120ctn as detected by northern blot . also , co - overexpression of ha - p120ctn or -catenin had no effect .
we attempted to perform aggregation assays in cho cells , but did not obtain proper expression of de - cadherin in this heterologous system . to analyze the biological activity of the mutant de - cadherin proteins during development
, the following strategy was used to replace endogenous de - cadherin with mutant forms : we generated transgenic flies that express de - cadherin - wt , de - cadherin - aaa , or de - cadherin- ubiquitously , under the control of the tubulin-1 promoter .
endogenous de - cadherin was removed from specific cells by generating homozygous shg mutant clones or zygotic expression was removed by analyzing shg homozygous mutant embryos .
both shg alleles used in this study are strong alleles , one ( shg ) is a molecular null allele .
next , we determined whether the transgene - encoded de - cadherin could substitute for endogenous de - cadherin , that is , rescue the shg mutant phenotype .
membrane localization and expression levels were checked by immunostaining of egg chambers containing patches of shg mutant cells .
these cells expressed only the transgene - encoded de - cadherin , allowing comparison with endogenous levels ( fig .
3 ) . in follicle cells , de - cadherin - wt transgenes and one of the de - cadherin - aaa transgenes ( # 6 ) were expressed at somewhat higher levels than endogenous de - cadherin ( fig .
another de - cadherin - aaa transgene ( # 7 ) and de - cadherin- transgenes gave similar levels of expression , slightly lower than endogenous de - cadherin ( fig .
de - cadherin- transgenes gave expression levels similar to endogenous de - cadherin , whereas de - cadherin - wt and both de - cadherin - aaa transgenes were expressed at much higher levels ( fig .
( a d ) follicular epithelium from females carrying tubulin - de - cadherin - wt ( a ) , tubulin - de - cadherin - aaa-#6 ( b ) , tubulin - de - cadherin- ( c ) , or tubulin - de - cadherin - aaa-#7 ( d ) .
a''c '' show that de - cadherin - wt and de - cadherin - aaa recruit endogenous -catenin even in the absence of endogenous de - cadherin .
bars , 10 m . ( e f ) expression levels of de - cadherin - aaa-#6 ( e and e ' ) and # 7 ( f and f ' ) in border cells were estimated by comparison of de - cadherin levels at the inner membranes of border cells ( arrow ) in shg mutant cells ( e ' and f ' ) and non mutant cells ( e and f ) .
bars , 10 m . ( g j ) de - cadherin in nurse cells expressing only the indicated tubulin - de - cadherin transgene ( g i , germ line cells are shg mutant clones ) or only endogenous de - cadherin ( j ) .
we were particularly interested in how de - cadherin might be regulated during border cell migration , which occurs during stage 9 of oogenesis .
border cells are a group of 6 to 10 somatic follicle cells that delaminate from the anterior tip of the egg chamber , invade the germ line cluster , and migrate to the oocyte .
border cells migrate in between the nurse cells and apparently use these cells as substratum .
absence of de - cadherin from border cells or from nurse cells results in total lack of invasive migration , suggesting that border cells adhere to the nurse cell substratum through homophilic de - cadherin interaction ( fig .
adhesion to a substratum must in some way be dynamic for cells to move productively across it .
relative to the well - characterized function of cadherin in epithelial cell adhesion , de - cadherin function in border cell migration might therefore require additional regulatory mechanisms .
in addition , border cells normally express higher levels of de - cadherin than other follicle cells , and migration is quite sensitive to reduction of de - cadherin level ; even weak shg alleles cause detectable delays in migration ( niewiadomska et al . , 1999 ) . for these reasons
, it seemed likely that border cell migration would be sensitive to perturbations of cadherin catenin interactions . to test this , we analyzed the activity of mutant de - cadherin proteins in border cells as well as in the substratum , the nurse cells . in both border cells and nurse cells ,
expression of de - cadherin - wt as well as de - cadherin - aaa-#6 completely rescued the migration ( fig .
de - cadherin - aaa-#6 was expressed at levels similar to endogenous de - cadherin , whereas de - cadherin - aaa-#7 was expressed at lower levels ( fig .
3 , e and f ) . given that border cell migration is sensitive to cadherin expression level , this can explain the incomplete rescue by cadherin - aaa-#7 .
de - cadherin- expression in border cells did not rescue the shg phenotype at all , suggesting that de - cadherin must be anchored to the actin cytoskeleton via -catenin to function in the migrating cells .
de - cadherin- could partially compensate for endogenous de - cadherin in nurse cells ( fig .
4 b ) . strong linkage to the cytoskeleton via -catenin may be less critical for cadherin to function as substratum than in the actively migrating cell itself .
de - cadherin - wt and de - cadherin - aaa but not de - cadherin- transgenes can rescue shg phenotypes .
( a e ) phalloidin ( red ) stains the actin cytoskeleton of egg chambers and non - gfp ( non - green ) cells are wild type ( a e ) or shg mutant ( a'e ' ) clones . ( a and b ) border cell migration . in stage 10
wild type egg chambers , border cells ( arrow ) have reached the oocyte ( a and b ) .
lack of de - cadherin in border cells ( a ' ) or in nurse cells ( b ' ) prevent border cells from penetrating between the nurse cells .
( a '' and b '' ) migration defects in shg mutant border cells ( a '' ) and germ line ( b '' ) clones and in the presence of the indicated transgenes ( 15 n 73 ) .
the oocyte ( asterisk ) is located at the posterior of a wild type egg chamber ( c and d ) .
shg mutant clones often causes a mislocalization of the oocyte ( c ' and d ' , follicular cells and germ line clones , respectively ) .
( c '' and d '' ) oocyte mispositioning in shg mutant follicular cells ( c '' ) and germ line ( d '' ) clones and in the presence of the indicated transgenes ( 17 n 57 ) .
wild type follicular clones intermingle ( e ) , whereas shg mutant clones sort ( e ' ) .
( e '' ) sorting in shg mutant clones and in the presence of the indicated transgenes ( 27 n 68 ) .
f is a wild - type cuticle and f ' a cuticle of a homozygous shg mutant embryo .
( f '' ) cuticle defects in homozygous shg mutant embryos and in the presence of the indicated transgenes ( 32 n 232 ) .
( g ) hatching of homozygous shg mutant embryos and in the presence of the indicated transgenes ( n 278 ) .
early in oogenesis , de - cadherin mediated adhesion is necessary to correctly position the oocyte at the posterior pole of the egg chamber ( fig .
4 , c and d ; godt and tepass , 1998 ; gonzlez - reyes and st . johnston , 1998 ) . if either the germ line or the somatic cells are mutant for shg , the oocyte is often mispositioned . both de - cadherin - wt and de - cadherin - aaa-#6 rescued the shg defects in both germ line and follicular cell clones ( fig . 4 , c and d ) .
thus , adhesion between the oocyte and the follicular cells does not require the de - cadherin
de - cadherin - aaa-#7 failed to rescue the lack of endogenous de - cadherin in follicular cells , suggesting that levels of expression are important .
shg mutant cells sort away from wild - type cells generating a smooth boundary at the interface ( fig .
this is thought to reflect preferential adhesion between de - cadherin expressing cells . if de - cadherin
p120ctn interaction alters adhesion , cells expressing only de - cadherin - aaa might sort away from cells also expressing wild - type de - cadherin .
in contrast , cells expressing only de - cadherin- did sort from cells also expressing wild - type de - cadherin .
thus , the lack of interaction between de - cadherin and -catenin resulted in a decrease of adhesion strong enough to obtain sorting , whereas the lack of interaction between de - cadherin and p120ctn did not . at early to mid - oogenesis , shg mutant follicle cells maintained correct cell shape within the epithelium
. this may reflect functional overlap between de - cadherin and n - cadherin at these stages , as arm mutant clones have stronger defects ( tanentzapf et al . , 2000 ) . late in oogenesis ,
this defect was also rescued by de - cadherin - aaa , but not de - cadherin- ( unpublished data ) . to analyze additional types of de - cadherin mediated adhesion in other tissues
de - cadherin is maternally supplied , but zygotic expression is required for embryonic development , for example , in the embryonic epidermis .
homozygous shg mutant embryos lack the head and ventral epidermis , which results in the lack of head and ventral cuticle ( fig . 4 f ) . both de - cadherin - wt and de - cadherin - aaa
we also tested rescue of the shg zygotic lethality . despite the use of a heterologous promoter to express de - cadherin , 1025% of shg / shg embryos carrying a de - cadherin - wt or de - cadherin - aaa-#6 transgene hatched , and the resulting larvae looked normal ( fig .
the rescued females allowed us to test the ability of de - cadherin - aaa to substitute for maternally provided de - cadherin .
females expressing only de - cadherin - aaa-#6 gave rise to viable progeny also carrying only de - cadherin - aaa .
thus , de - cadherin - aaa rescued both maternal and zygotic de - cadherin functions .
p120ctn protein is present in the embryo ( magie et al . , 2002 ) and is expressed in the ovary , in a pattern identical to that of de - cadherin ( magie , c. , and s. parkhurst , personal communication ) .
however , our results indicate that the de - cadherin p120ctn interaction is not essential for any critical process during development . in an attempt to independently compromise p120ctn function , we used double - stranded rna - mediated interference ( rnai ) .
two p120ctn - rnai transgenes ( rnai-700 and rnai-2200 ) were able to severely reduce the levels of co - overexpressed ha - p120ctn ( fig . 5 , a
expression of p120-rnai in somatic cells did not cause any detectable phenotype in the ovary ( fig . 5 , d and e ) .
this is consistent with p120ctn not being important for de - cadherin function during oogenesis .
maternal and zygotic expression of p120ctn - rnai transgenes did not affect embryonic viability ( fig .
severe defects have been observed on injection of p120ctn double - stranded rna in embryos ( magie et al . , 2002 ) .
( a c ) levels of ha - p120ctn in border cells ( arrow ) and centripetal cells ( arrowheads ) overexpressing ha - p120ctn ( a ) and different rnai constructs ( b and c ) ; stage 10b egg chambers .
all constructs are expressed using slbogal4 , which starts expressing in border cells at stage 9 and in centripetal cells at stage 10 .
ha - p120ctn levels are severely reduced in border cells , estimated to have been expressing rnai constructs for 1224 h. bar , 10 m .
( d ) stage 9 egg chamber from a female of the genotype hsflp / actin - flipout - gal4 ; uas - rnai/+ ; uas - gfp/+ .
larval heat shock was used to initiate constitutive expression of the rnai in somatic cells ( marked by gfp ) one week before analysis .
( e ) quantification of phenotypes after expression of p120ctn - rnai transgenes in the ovary ( as in d ) and in embryos ( maternal [ mat ] and zygotic [ zyg ] expression ) .
the general inability of de - cadherin- to replace endogenous de - cadherin probably reflects that -catenin is an important , often essential , interaction partner for cadherin .
this supports the view that linkage to the actin cytoskeleton through -catenin and -catenin is critical for cadherin function .
we can not rule out that other proteins bind to the deleted cooh terminus of de - cadherin , but the requirement for -catenin interaction is supported by the cellular defects in arm ( -catenin ) mutants ( peifer et al . , 1993 ) .
in contrast to de - cadherin- , de - cadherin - aaa was able to replace wild - type de - cadherin in all assays . to investigate different modes of cadherin function
, different types of de - cadherin function were tested ; stable interactions within an epithelium and between cell layers , as well as dynamic adhesion required for migration .
given that the aaa mutation disrupts or strongly attenuates the interaction with p120ctn , our results indicate that interaction with p120ctn is not required for de - cadherin function .
it remains possible that the interaction has a subtle modulatory effect on de - cadherin function or a role in a nonessential process that we did not test directly . in chick embryos , experiments based on n - cadherin overexpression suggested a regulatory role of the juxtamembrane domain , but not the p120 binding site ( horikawa and takeichi , 2001 ) .
thus , a limited role of the p120ctn cadherin interaction may not be restricted to drosophila e - cadherin .
for de - cadherin - aaa , three glycines ( aa 13761378 ) were mutated to alanines by replacing ggtggcggc with gcggccgcc ( noti site ) . for de - cadherin- and de - cadherin-cyt
, de - cadherin cdna was truncated at bp 4954 and 4746 . de - cadherin - aaa and -
de - cadherin - wt , -aaa , and - were subcloned in pcasper - tubulin ( ecori / kpni fragment of tubulin-1 promoter in pcasper-4 ; asp718/xbai ) .
de - cadherin - wt and -aaa were cloned into prmha3 ( asp718/bamhi ; bunch et al . , 1988 ) and de - cadherin- and -cyt into prmha3b ( ecori / noti ) .
de - cadherin - wt , -aaa , - , and -cyt were cloned into pcdna-3 ( asp718/xbai ) .
p120ctn cdna ( obtained from est ld02621 ) was cloned in frame with the ha tag of prmha - nle - ha ( royet et al . , 1998 ) , in place of the nle insert ( asci / sali ) .
-catenin cdna was cloned from pmk33-myc ( yanagawa et al . , 1997 ) to prmha3b ( bamhi ) . for p120ctn - rnai , 1000 bp inverted repeats from the cdna
( bp 700 to1700 for rnai-700 or bp 12002200 for rnai-2200 ) were inserted with 500 bp spacers into puast .
schneider s2 and cho cells were transfected with cellfectin ( invitrogen ) , with prm and pcdna3 constructs , respectively .
prm plasmids were induced with 0.7 mm cuso4 for 24 h. immunoprecipitations were done in 1% np-40 lysis buffer with dcad2 antibody ( oda et al . , 1994 ) .
western blot was done with mouse anti - ha antibody ( 1:10,000 ; babco ) . for aggregation assays , s2 and
s2 cells were transferred in petri dishes and shaken at 50 rpm for 2 h before quantification .
percentage of gfp cells in aggregates and average size of aggregates were quantified in three independent experiments .
there were some variations from experiment to experiment , but in each experiment , all four de - cadherin constructs induced similar aggregation .
tubulin - de - cadherin - wt and aaa stocks were verified by pcr on genomic dna followed by a noti digest . for clonal analysis ,
flies of the genotype hsflp/+ ; frtg13shg / frtg13gfp ; tubulin - cadherin/+ were heat shocked as larvae or adults , at least 4 d before analysis .
for cuticles analysis and quantification of hatching , shg / shg ; tubulin - cadherin/+ embryos ( 1824 h ) were obtained by sorting non - gfp embryos from shg / cyo , krgfp ; tubulin - cadherin stocks ( copas select embryo sorter ; union biometrica , inc . ) .
rescue of lethality was tested using shg / cyo , krgfp ; tubulin - cadherin stocks . to test maternal rescue ,
shg / shg;tub - cad - aaa-#6/+ females were crossed to shg / cyo ; tubulin - cad - aaa-#6/+ males . for embryo
zygotic rnai , tubgal4/tm3ser females were crossed to uas - p120ctn - rnai / uas - p120ctn - rnai males . for maternal and zygotic rnai , uas - p120ctn - rnai/+ ; nosgal4 females were crossed to tubgal4/tm3ser .
primary antibodies were rat dcad2 ( 1:100 ) , mouse anti - ha ( 1:1,000 ) , mouse anti
fluorescent secondary antibodies ( jackson immunoresearch laboratories ) were used 1:200 and rhodamine - phalloidin ( molecular probes , inc . )
for de - cadherin - aaa , three glycines ( aa 13761378 ) were mutated to alanines by replacing ggtggcggc with gcggccgcc ( noti site ) . for de - cadherin- and de - cadherin-cyt
, de - cadherin cdna was truncated at bp 4954 and 4746 . de - cadherin - aaa and -
de - cadherin - wt , -aaa , and - were subcloned in pcasper - tubulin ( ecori / kpni fragment of tubulin-1 promoter in pcasper-4 ; asp718/xbai ) .
de - cadherin - wt and -aaa were cloned into prmha3 ( asp718/bamhi ; bunch et al . , 1988 ) and de - cadherin- and -cyt into prmha3b ( ecori / noti ) .
de - cadherin - wt , -aaa , - , and -cyt were cloned into pcdna-3 ( asp718/xbai ) .
p120ctn cdna ( obtained from est ld02621 ) was cloned in frame with the ha tag of prmha - nle - ha ( royet et al . , 1998 ) , in place of the nle insert ( asci / sali ) .
-catenin cdna was cloned from pmk33-myc ( yanagawa et al . , 1997 ) to prmha3b ( bamhi ) . for p120ctn - rnai , 1000 bp inverted repeats from the cdna
( bp 700 to1700 for rnai-700 or bp 12002200 for rnai-2200 ) were inserted with 500 bp spacers into puast .
schneider s2 and cho cells were transfected with cellfectin ( invitrogen ) , with prm and pcdna3 constructs , respectively .
prm plasmids were induced with 0.7 mm cuso4 for 24 h. immunoprecipitations were done in 1% np-40 lysis buffer with dcad2 antibody ( oda et al . , 1994 ) .
western blot was done with mouse anti - ha antibody ( 1:10,000 ; babco ) . for aggregation assays , s2 and
s2 cells were transferred in petri dishes and shaken at 50 rpm for 2 h before quantification .
percentage of gfp cells in aggregates and average size of aggregates were quantified in three independent experiments .
there were some variations from experiment to experiment , but in each experiment , all four de - cadherin constructs induced similar aggregation .
tubulin - de - cadherin - wt and aaa stocks were verified by pcr on genomic dna followed by a noti digest . for clonal analysis , flies of the genotype hsflp/+
; frtg13shg / frtg13gfp ; tubulin - cadherin/+ were heat shocked as larvae or adults , at least 4 d before analysis . for cuticles analysis and quantification of hatching ,
shg / shg ; tubulin - cadherin/+ embryos ( 1824 h ) were obtained by sorting non - gfp embryos from shg / cyo , krgfp ; tubulin - cadherin stocks ( copas select embryo sorter ; union biometrica , inc . ) .
rescue of lethality was tested using shg / cyo , krgfp ; tubulin - cadherin stocks . to test maternal rescue ,
shg / shg;tub - cad - aaa-#6/+ females were crossed to shg / cyo ; tubulin - cad - aaa-#6/+ males . for embryo
zygotic rnai , tubgal4/tm3ser females were crossed to uas - p120ctn - rnai / uas - p120ctn - rnai males . for maternal and zygotic rnai , uas - p120ctn - rnai/+ ; nosgal4 females were crossed to tubgal4/tm3ser .
primary antibodies were rat dcad2 ( 1:100 ) , mouse anti - ha ( 1:1,000 ) , mouse anti
fluorescent secondary antibodies ( jackson immunoresearch laboratories ) were used 1:200 and rhodamine - phalloidin ( molecular probes , inc . ) | homophilic cell adhesion mediated by classical cadherins is important for many developmental processes .
proteins that interact with the cytoplasmic domain of cadherin , in particular the catenins , are thought to regulate the strength and possibly the dynamics of adhesion .
-catenin links cadherin to the actin cytoskeleton via -catenin .
the role of p120/-catenin proteins in regulating cadherin function is less clear .
both -catenin and p120/-catenin are conserved in drosophila . here
, we address the importance of cadherin catenin interactions in vivo , using mutant variants of drosophila epithelial cadherin ( de - cadherin ) that are selectively defective in p120ctn ( de - cadherin - aaa ) or -catenin armadillo ( de - cadherin- ) interactions .
we have analyzed the ability of these proteins to substitute for endogenous de - cadherin activity in multiple cadherin - dependent processes during drosophila development and oogenesis ; epithelial integrity , follicle cell sorting , oocyte positioning , as well as the dynamic adhesion required for border cell migration .
as expected , de - cadherin- did not substitute for de - cadherin in these processes , although it retained some residual activity .
surprisingly , de - cadherin - aaa was able to substitute for the wild - type protein in all contexts with no detectable perturbations .
thus , interaction with p120/-catenin does not appear to be required for de - cadherin function in vivo . |
many asbestiform minerals exhibit temperature - dependent thermoluminescence . since thermoluminescence involves electronic transitions within crystalline materials , the effect of temperature on asbestos cytotoxicity was evaluated .
heat pretreatment of canadian chrysotile asbestos reduces its cytotoxicity towards cultured human fibroblasts and bovine alveolar macrophages . when monitored 44 hr after the addition of either 200 degrees c or 400 degrees c heat - pretreated asbestos , alveolar macrophage viability was approximately 40% higher than comparable amounts of unheated asbestos .
similarly , asbestos toxicity , expressed as fibroblast growth inhibition , was inversely related to the asbestos pretreatment temperature in the following manner , 70 degrees c greater than 200 degrees c greater than 400 degrees c = unexposed fibroblast controls .
pretreatment of chrysotile asbestos to 400 degrees c reduced its adsorptive capacity for bovine serum albumin by 25% .
furthermore , asbestos heated to 200 degrees c followed by irradiation with 4 mev x - rays ( 4500 rads ) resulted in reactivation of asbestos cytotoxicity .
scanning electron microscopy indicated that the ratios of free to fiber - associated alveolar macrophages and the fiber fragment size distributions were unaffected by either heat pretreatment or x - ray irradiation .
these observations strongly suggest that the surface charge characteristics and electronic state of asbestos fibers may be responsible for its biological activity.imagesfigure 4.figure 5 .
( a)figure 5 .
( b)figure 6 .
( a)figure 6 .
( b)figure 6 .
( c)figure 6 .
( d)figure 7 . |
|
hypocalcaemia can be an important cause for delayed recovery in the post - operative period and can significantly influence post - operative morbidity .
we report a case of laminectomy and decompression of the spine with increased morbidity because of undetected pre - existing hypoparathyroidism .
a 45-year - old male of 65 kg , presented with a history of low backache and weakness of both lower limbs for last 2 years , and urinary retention and constipation for the last 2 days .
he had full power in the upper limb and grade 3 power in the lower limbs .
a magnetic resonance image ( mri ) of the dorso - lumbar spine showed thickened ligamentum flavum indenting the thecal sac from d9 to d12 with cord oedema . pre
- anaesthetic examination was normal except for distended , but soft abdomen without clinical evidence of ascites or organomegaly .
standard monitoring , including invasive blood pressure and arterial blood gas ( abg ) was used intraoperatively .
anaesthesia was induced with propofol 140 mg , fentanyl citrate 150 g and rocuronium bromide 50 mg and trachea wase intubated .
anaesthesia was maintained with 2% sevoflurane in 50% o2 in air , propofol infusion at 25 g / kg / min and vecuronium bromide at 2 mg / h . the surgery lasted 5 h. intermittent fentanyl ( total 500 g ) was used for analgesia intraoperatively .
hydration was maintained with intravenous ( iv ) 3.5 l 0.9% saline , 0.5 l colloid ( tetra starch ) .
noradrenaline at 2 - 4 g / min was started in view of refractory hypotension .
methylprednisolone was started as 30 mg / kg bolus followed by infusion at 5.4 mg / kg / h . at the end of surgery ,
insulin infusion was started , and the patient was shifted to intensive care unit for elective ventilation .
a central venous line inserted showed a central venous pressure of 1 - 2 cm h2o . overnight
serum sodium , potassium , and thyroid status was found normal . at this time ,
his upper limb power was almost normal while power in both lower limbs was 1/5 requiring continuation of methylprednisolone .
due to inconclusive abdominal ultrasound report ( usg ) a computerized tomography of the abdomen was obtained which showed colonic gaseous distension without free fluid in the abdomen .
ryle 's tube was inserted and injection neostigmine started at 2.5 mg / h for 2 h. on post - operative day ( pod ) 2 the patient re - developed deranged kft along with high - grade fever .
blood , urine , and tracheal aspirate were sent for cultures and sensitivity and antibiotics upgraded as per culture reports .
sepsis and pancreatitis profile revealed serum procalcitonin 4.4 ng / ml , hypocalcaemia ( serum calcium 4.1 mg% ) , hypoalbuminemia ( 2 g% ) , but normal serum amylase and lipase .
, high doses of iv calcium ( 450 mg elemental calcium 4 h ) , was required along with oral calcitriol 0.5 g q8h . on pod 3 renal functions and
acidosis started to resolve . despite 2 days trial of neostigmine , prokinetics and laxatives , his abdominal symptoms persisted .
decompressive sigmoidoscopy was performed and total parenteral nutrition ( tpn ) was started . over next 2 days gastrointestinal ( gi ) symptoms , procalcitonin and total leucocyte count started to decrease .
eighteen hours later , he was reintubated and ventilated due to severe tachypnoea and decreased consciousness .
he was weaned off the ventilator fully conscious with good power in all limbs , normal calcium and albumin levels , and no gi symptoms .
he was later decannulated and discharged with on - going treatment and advice for follow - up .
the patient had been harbouring urinary tract infection ( uti ) which was missed in the absence of urine microscopic examination .
hyperglycaemia in our non - diabetic patient was because of steroids and sepsis due to uti .
the decreased urine output , and metabolic acidosis was the combined result of sepsis and intraoperative usage of noradrenaline .
spasticity is a known clinical manifestation of hypocalcaemia , which in our case manifested as a tense abdomen .
as calcium is an important mediator of excitation - contraction coupling , colonic distension and paralytic ileus is possible due to hypocalcaemia .
the best - studied treatment of acute colonic pseudo - obstruction is iv neostigmine , which leads to prompt colon decompression in the majority of patients after a single infusion .
however in our case , actual improvement started to occur only after normalisation of calcium levels .
alkalosis and hypokalaemia aggravate the clinical manifestations of hypocalcaemia . in this patient , pain and discomfort of tense abdominal distension
methylprednisolone , with predominantly glucocorticoid activity , decreases calcium absorption from the gut and increases its excretion in the urine .
it also causes hypokalaemia and alkalosis by excretion of potassium and hydrogen ions through renal tubules . increased serum free fatty acids due to tpn lower serum ionized calcium .
our patient was diagnosed as primary hypoparathyroidism , with severe hypocalcaemia , sepsis and acute renal failure .
pancreatitis profile in view of fever , abdominal symptoms , and acute kidney injury ( aki ) , which revealed hypocalcaemia .
a review into the literature of hypoparathyroidism revealed hyperostosis as a feature due to chronic hypocalcaemia .
to the best of our knowledge , this is the first report correlating hypoparathyroidism , paralytic ileus and aki .
hypocalcaemia though not an uncommon entity is frequently overlooked . its presence along with its etiological and aggravating factors should always be sought where recovery gets delayed . | routine investigation of serum calcium is not recommended in asa one and two patients unless abnormalities of calcium metabolism are clinically suspected .
the clinical features of hypocalcaemia can often be subtle and may manifest in the presence of associated factors .
hypoparathyroidism , an important cause of hypocalcaemia , often presents as soft tissue calcification ( ostosis ) .
ligamentum flavum ostosis can present with compressive myelopathy requiring laminectomy .
we report a case of ligamentum flavum ostosis and subclinical hypocalcaemia due to hypoparathyroidism , who went undetected pre - operatively resulting in significant post - operative morbidity . |
it is now well established that the adipose tissue , and more precisely the white adipose tissue , is not only a storage organ but plays an active role in that it can produce and release various mediators that might play a role in the physiological processes [ 1 , 2 ] .
indeed , adipocytes produce specific proteins or adipokines with a broad range of biological and physiological activities related to glucose homeostasis , lipid metabolism , appetite regulation , angiogenesis , hemostasis , and reproduction as well as immunity .
adipose tissue is composed of different cellular types , of which the adipocytes are the most abundant , but it also contains macrophages .
in obese patients , a low - grade systemic inflammation has been reported , as shown by increased crp and il-6 levels compared to those observed in lean subjects .
this relationship between fat tissue and systemic inflammation reflects the adipose tissue 's potential contribution with regard to the inflammatory response , which may be partly explained by the production of inflammatory cytokines .
in fact , macrophages from adipose tissue have been shown to contribute to up to 30% of circulating il-6 , indicating that adipose tissue is a significant production site of circulating proinflammatory cytokines [ 1 , 2 ] .
leptin 's role on appetite regulation is well documented , while adiponectin has been shown to be involved in insulin sensitivity [ 1 , 2 ] .
the influence of these adipokines on immunity and inflammation has been well documented . in most inflammatory diseases , it is generally accepted that leptin displays proinflammatory effects , while adiponectin is considered to primarily act as an anti - inflammatory molecule . as an example
, it has been reported that leptin receptors are expressed on b and t - cells , and that leptin may exert direct effects on lymphocytes .
leptin may stimulate t cell proliferation , promote a th1 response , influence t - cell activation , and activate macrophages and monocytes , thereby enhancing their phagocytic activities . in animal models ,
adiponectin exerts a variety of anti - inflammatory activities , interfering with macrophage function by inhibiting phagocytosis , il-6 or tnf production , reducing t - cell function , and promoting the release of il-10 and il-1 receptor antagonist [ 13 , 5 ] .
connective tissue diseases are systemic disorders which may have a potential impact on several organs , and result from the complex interaction between immunological , psychological , environmental , hormonal , and genetic predisposing factors .
systemic lupus erythematosus ( sle ) and sjgren 's syndrome ( ss ) are two prototypical autoimmune diseases .
this disease group also includes sarcoidosis , systemic sclerosis , dermato / polymyositis , and systemic vasculitis .
a common feature of all of these disorders is the contributive and interactive role of autoantibodies , immune complexes , and soluble mediators of cellular communication ( e.g. , interleukins , chemokines , and growth factors ) in tissue damage .
serum leptin and adiponectin have been previously assessed in patients with sle , giving conflicting results [ 611 ] .
this study aimed to assess circulating leptin and adiponectin in patients with various systemic autoimmune diseases in parallel with the evaluation of body composition , and more especially fat mass .
we also investigated serum levels of ghrelin , a gastric peptide involved in both appetite control and immunity regulation .
fifteen white consecutive outpatients with systemic autoimmune disease who were seen in our department were evaluated .
this patient series included only women , as it is well known that autoimmune diseases occur primarily in women .
the study group comprised patients with sle ( n = 3 ) , sjgren 's syndrome ( n = 7 ) , sarcoidosis ( n = 1 ) , polymyositis ( n = 1 ) , crest syndrome ( n = 1 ) , mixed connective tissue disease ( n = 1 ) , or undifferentiated vasculitis ( n = 1 ) .
clinical assessment included demographic data such as age , body mass index ( bmi ) , disease duration , and laboratory parameters of inflammation ( erythrocyte sedimentation rate [ esr ] , and crp and il-6 levels ) . to be included in the study , no elevated acute phase reactants were required .
excluded from the study were patients with diabetes mellitus and other endocrine disorders ( cushing syndrome or thyroid disease).the treatments administered included nonsteroidal anti - inflammatory drugs and second - line treatments ( hydroxychloroquine , methotrexate ) .
corticosteroid dosage was required to be below or equal to 10 mg prednisone per day ; cumulative and mean corticosteroid dosages were also calculated . among the patient group ,
as the patients suffered from various autoimmune diseases , no specific scoring system for clinical disease activity was used .
the control group included 15 healthy white women with no history of inflammatory condition , metabolic / endocrine disorders , or drug treatment ( hospital staff ) .
the exclusion criteria were the same as those for the patient group . among the control group , 10 women were postmenopausal .
the study protocol was approved by our institutional ethics committee ( comit d'thique clinique du chu de besanon ) .
a total body scan was performed using a lunar idxa densitometer ( lunar , madison , wi , usa ) .
measurements for body composition were taken from the total body scan including fat mass and lean mass .
adiposity ( % fat ) was defined as the ratio between total fat tissue and total lean mass + total fat tissue .
fat distribution was evaluated as the relative proportion of fat tissue in the android ( central ) and the gynoid ( hip and thigh ) regions . in our hands , the coefficients of variation for values for adiposity , fat mass , and lean mass were 0.63% , 0.59% , and 0.45% , respectively , .
after overnight fasting , venous blood samples were taken at 8.00 a.m. from each patient and control subject .
radioimmunoassay was used for measurements of leptin ( mediagnost gmbh , reutlingen , germany ) as well as for total adiponectin ( including high - molecular and low - molecular weight complexes ) and total ghrelin ( linco research , st charles , mo , usa ) .
interassay coefficients of variation were 5.7% for leptin , 6.2% for adiponectin , and 7.9% for ghelin .
the lowest level that could be detected by each assay ( sensitivity ) was 0.5 ng / ml for leptin , 1 g / ml for adiponectin , and 93 pg / ml for ghrelin .
in addition , fasting glycemia and insulin levels were determined ( enzyme immunoassay , st aia - pack iri , tosoh corporation , tokyo , japan ) .
the homeostasis model assessment index for insulin resistance ( homa - ir ) , used as a marker of insulin resistance , was calculated as previously described : fasting insulin ( u / ml ) fasting glucose ( mmol / l)/22.5 .
detection of il-6 in the patients ' sera was performed by elisa using il-6 elisa kit ii bd opteia ( bd biosciences , le pont de claix , france ) . fasting serum total cholesterol as well as low - density lipoprotein ( ldl ) cholesterol and high - density lipoprotein ( hdl ) cholesterol were also evaluated .
the data was analyzed using a computed package for statistical analysis ( alsyd , sas , meylan , france ) .
all the measured variables were compared between study patients and controls using the nonparametric mann - whitney u - test .
the relationship between the different variables ( fat measurements , laboratory parameters of disease activity , and serum adipokines and ghrelin levels ) were analyzed using the spearman 's r test .
the results were expressed as mean sem , as shown in table 1 . in the whole series , five patients and three healthy controls were considered obese ( bmi 30
overall , 11 patients were receiving prednisone at a mean dosage of 6.6 1.3 mg /day , while six were taking hydroxychloroquine and seven methotrexate at study initiation .
the cumulative corticosteroid dosage for these patients was 11018 4481 mg prednisone equivalent .
there were no significant between - group differences in erythrocyte sedimentation rate and crp levels , while il-6 serum levels were markedly elevated in the patient group ( 9.02 3.7 pg / ml versus 0.02 0.02 pg / ml ; p = .025 ) . between both groups
, we found no significant differences regarding fat mass and lean mass as well as adiposity and fat distribution in the android and gynoid regions ( all p > .05 ) .
adiponectin levels were higher in patients with systemic autoimmune disease than in control subjects ( 16.3 1.6 g / ml versus 9.7 0.6 g / ml ; p = .01 ) ( figure 1 ) .
conversely , no statistically significant differences between patients and controls were observed for fasting glycemia , insulin levels , homa - ir , total serum cholesterol , ldl and hdl cholesterol , ghrelin , leptin , and leptin corrected by fat mass ( all p > .05 ) . the relationships between fat mass , bmi , ghrelin , adipokines , and disease activity parameters were then examined .
as expected , we found a strong correlation between circulating leptin levels and bmi , fat mass , or adiposity in both patients ( r = 0.92 , r = 0.91 , and r = 0.88 , resp . ;
p < .001 for all tests ) and control subjects ( r = 0.93 , r = 0.91 and r = .95 , resp . ; p < .001 for all tests ) .
by contrast , and as previously described [ 1 , 2 ] , there was no direct correlation between adiponectin or ghrelin and fat mass measurements .
body mass index , fat mass , and adiposity were slightly correlated with crp levels ( r = 0.41 , r = 0.49 , and r = 0.45 , resp . ;
p .05 for all tests ) but not with esr or il-6 . additionally , the relationships between disease activity markers and serum adiponectin levels were examined , and esr and adiponectin were found to be markedly and negatively correlated ( r = 0.8 , p = .003 ) , whereas no relationship was observed between adiponectin and crp or il-6 levels .
the serum levels of certain adipokines may be influenced by some treatments including corticosteroids and methotrexate .
for this reason , adiponectin serum levels in the patient group were examined in relation with corticosteroid or methotrexate use . although adiponectin serum levels were found to be higher in patients with or without corticosteroids as compared to healthy controls , the difference reached statistical significance only for patients who were not taking corticosteroids ( healthy subjects ( n = 15 ) versus autoimmune disease patients without corticosteroids ( n = 4 ) : 10.64 0.8 g / ml versus 19.9 3.3 g / ml ; p = .02 ) , whereas only a trend towards a higher adiponectinemia was observed for patients who were actually taking corticosteroids ( healthy subjects ( n = 15 ) versus autoimmune disease patients with corticosteroids ( n = 11 ) : 10.64 0.8 g / ml versus 15.1 1.7 g / ml ; p = .07 ) .
similar results were found for adiponectin when examining the use of methotrexate ( healthy subjects ( n = 15 ) versus patients without methotrexate ( n = 8) : 10.64 0.8 g / ml versus 17.2 2.4 g / ml ; p = .04 ; healthy subjects ( n = 15 ) versus patients with methotexate ( n = 7 ) : 10.64 0.8 g / ml versus 15.2 2.1 g / ml ; p = .07 ) . as our series included mainly subjects with sjgren 's syndrome ( n = 7 ) , results from this subgroup were analyzed separately and compared to those obtained in healthy subjects ( table 1 ) .
similarly to the entire patient group , higher il-6 and adiponectin serum levels were noted in patients with sjgren 's syndrome as compared to healthy controls ( p = .05 and p = .04 , resp . ) .
in this study , we assessed the serum levels of adipokines such leptin , adiponectin , and ghrelin , in association with body composition measurements , in women with various systemic autoimmune diseases .
the main outcome of our study was that patients with systemic autoimmune disease presented higher adiponectin levels than control subjects , in contrast with the absence of differences observed in serum leptin and ghrelin levels .
although patients with various autoimmune diseases were included in our study , they were carefully matched for age , sex , and bmi with the control subjects in order to obtain a homogeneous comparison group .
in addition , all systemic autoimmune diseases included in the study were characterized by common pathophysiological processes induced by inflammatory mediators , that is , cytokines such as tnf or il-6 , and adipokines as well . as our patient population
was mainly comprised of patients with primary sjgren 's syndrome ( n = 7 ) , this prompted us to analyze , separately , the results for this patient subgroup . in accordance with the data gathered in the entire patient group , high adiponectinemiae ( and il-6 as well ) was observed in this subgroup . to our knowledge ,
our patients were receiving corticosteroid treatments at a mean daily dose of 6.6 1.3 mg prednisone equivalent .
corticosteroid treatment has been associated with the development of adiposity involving predominantly the body 's central or visceral regions , and contributing to increased cardiovascular risk . however , there was no difference in android or visceral fat mass between the patients and controls participating in our study .
this may be explained by the fact that our patients had received low - dose corticosteroid therapy .
an interesting observation of our study was that there was a significant relationship between fat mass measurements ( total fat mass , adiposity ) and laboratory inflammation parameters such as crp , reflecting the potential contribution of the adipose tissue to the inflammatory response .
our patients exhibited a significant elevation in serum adiponectin levels in line with previous works on sle patients [ 7 , 8 , 11 ] , but no data was available so far on adiponectin levels in patients suffering from other systemic autoimmune diseases , notably primary sjgren 's syndrome .
the high adiponectinemia found in our patient series can not be explained by changes in fat mass or fat distribution .
our patients were taking corticosteroids and/or methotrexate , and these treatments have been associated with changes in circulating adiponectin levels .
however , high adiponectinemia was observed in both patients receiving or not receiving corticosteroids or methotrexate , with statistically significant results observed only in the subgroup that was receiving these drugs .
while the effects of corticosteroids on serum adiponectin levels are controversial , [ 15 , 16 ] adiponectin has been shown to increase modestly ( 13% ) during methotrexate treatment in rheumatoid arthritis ( ra ) .
previous studies have already reported high adiponectin levels in systemic autoimmune diseases , even in patients with a marked inflammatory response .
as proinflammatory factors such as cytokines are known to suppress adiponectin production by adipocytes , this high adiponectinemia in patients with inflammatory conditions such systemic autoimmune diseases is paradoxical .
taking into account adiponectin 's anti - inflammatory properties , the results of our study can be interpreted as a dampening effect of adiponectin on inflammation .
the negative correlation that we noted between adiponectin and esr supports this hypothesis , suggesting that a rise in adiponectin levels could be a mechanism involved in the control of inflammatory or immunological processes occurring in these disease states .
alternatively , adiponectin has been described as a potent proinflammatory mediator , as it has been shown to stimulate the production of il-6 and prostaglandin e2 by synovial fibroblasts in rheumatoid arthritis patients , with serum adiponectin levels correlating to the severity of rheumatoid arthritis evaluated by the extent of joint destruction [ 1820 ] .
thus , depending on the model , adiponectin has been reported to display anti- or proinflammatory activities .
however , based on literature data , adiponectin appears to display a predominantly anti - inflammatory activity . in addition to its pro / anti - inflammatory properties ,
adiponectin has emerged as a key determinant of the metabolic syndrome and may be considered as a protective agent against cardiovascular risk . indeed , adiponectin levels have been reported to be reduced in patients presenting type 2 diabetes or metabolic syndrome , and low plasma adiponectin concentrations closely correlate with obesity - related diseases such as atherosclerotic cardiovascular diseases [ 3 , 21 ] .
sle has been shown to be associated with insulin resistance , metabolic syndrome , and high cardiovascular risk [ 79 ] .
unexpectedly , however , adiponectinemia was found to be elevated in patients with sle and insulin resistance . in our patients
, we did not specifically evaluate all of the components of the metabolic syndrome , but high adiponectinemia did not influence insulin levels , insulin resistance , or changes in lipid profile . whether high adiponectinemia could have clinical consequences in these patients , especially with regard to cardiovascular disease risk ,
leptin serum levels have been evaluated in various inflammatory conditions . in ra , circulating and synovial leptin levels were reported to be elevated compared to those observed in healthy controls or osteoarthritis patients . in sle ,
elevated serum leptin levels were observed in most studies [ 69 ] , while some authors reported normal or decreased serum levels [ 10 , 11 ] . on the basis of the results observed in sle patients , the authors speculated on the possible influence of leptin on inflammation , certain clinical manifestations , or weight changes during the course of the disease .
however , no correlation was found between leptin levels and clinical or biological disease activity indices .
our series included only three patients with sle , and these patients did not exhibit changes in circulating leptin .
this gastric peptide has several physiologic functions involving gh secretion , gastric function , control of blood pressure , and adiposity as well as appetite stimulation and decreased fat utilization .
in addition to its role in the energetic balance , ghrelin exhibits anti - inflammatory properties and therefore , its determination is relevant in studies investigating adipokine levels in inflammatory disease states .
ghrelin has been shown to modulate phagocytosis , while downregulating innate immunity [ 22 , 23 ] .
ghrelin receptors are expressed on human monocytes , and the binding of ghrelin to these receptors inhibits the production of proinflammatory cytokines such as il-1 , il-6 , or tnf .
were reported in ra patients , circulating ghrelin was increased in patients suffering from ankylosing spondylitis , another inflammatory condition .
however , our case series did not exhibit significant changes in serum ghrelin levels . in conclusion
, our study did not reveal any significant differences in serum leptin and ghrelin levels as well as in body composition and distribution between systemic autoimmune disease patients and healthy controls .
contrarily , patients with systemic autoimmune disease , particularly sjgren 's syndrome , exhibited a marked increase in circulating adiponectin .
as adiponectin is thought to mainly exert anti - inflammatory activities , high adiponectin levels could influence or mitigate the inflammatory response or immunopathological mechanisms involved in these disease states .
however , the precise consequences of this high adiponectinemia on the metabolic syndrome development and atherosclerotic cardiovascular risk in this patient population still need to be determined . | adipose tissue produces a wide range of proteins that may influence the immune system . in this study , we assessed the serum levels of leptin , adiponectin , and ghrelin , in association with the measurements of body composition , in 15 female patients with various autoimmune diseases ( systemic lupus erythematosus , primary sjgren 's syndrome , sarcoidosis , mixed connective tissue disease , vasculitis , crest syndrome , and polymyositis ) and in 15 healthy female controls .
there were no statistically significant differences between the patients and controls with regard to serum leptin , serum ghrelin , global fat mass , adiposity , and fat mass in the android or gynoid regions , whereas serum adiponectin levels were higher in patients than controls ( 16.3 1.6 g / ml versus 9.7 0.6 g / ml ; p = .01 ) .
as adiponectin is known to exhibit potent anti - inflammatory properties , a high adiponectinemia in patients with systemic autoimmune disease may mitigate the inflammatory response .
however , the precise consequences of these elevated serum adiponectin levels on the metabolic syndrome development and atherosclerotic cardiovascular risk in this patient population still needs to be determined . |
china is undergoing a recent outbreak of human nh7n9 infection that has involved 132 patients , including 37 deaths , as of 31st may 2013 .
the median age of these patients was 61 years with a male to female ratio of approximately 2:1 .
two - thirds of the patients had adult respiratory distress syndrome secondary to viral pneumonia , 24% had septic shock and 15% had acute renal failure .
although most nh7n9 viruses are sensitive to oseltamivir , a mutation in the neuraminidase ( na ) gene that conferred resistant to both oseltamivir and zanamivir was detected in two patients who received steroid therapy .
it has been reported that oseltamivir initiated at symptom onset to control disease progress was ineffective in a family cluster .
the hemagglutinin ( ha ) gene of this virus might have originated from h7n3 avian influenza viruses of duck origin . the na gene of this virus might have been transferred from an h7n9 avian influenza virus of migratory birds . the six internal genes ( non - structural ( ns ) , nucleoprotein , polymerase acidic ( pa ) , polymerase basic 1 ( pb1 ) , pb2 and matrix ) most likely originated from h9n2 avian influenza viruses endemic in brambling birds or chickens in china .
nh7n9 viruses isolated from humans contain features related to human adaptation , such as a q226l mutation in the ha and e627k and d701n mutations in the pb2 protein .
nh7n9 can be transmitted efficiently via direct contact among ferrets and can replicate in both the upper and lower respiratory tracts of these infected animals .
the absence of multiple basic amino acids at the ha cleavage site of these low pathogenic nh7n9 viruses probably led to subclinical infections among poultry and favored the silent spread of nh7n9 in the live poultry market .
nh7n9 viruses encode a deletion at position 6973 of the na stalk region , a characteristic related to adaptation of an avian influenza virus from aquatic birds to terrestrial domestic poultry , particularly chickens .
hence , nh7n9 may have been circulating among poultry for some time before the current outbreak .
twenty percent of human nh7n9 infections were associated with farm exposure , especially in rural china .
the effectiveness of culling infected poultry and closing the live poultry markets in preventing human outbreaks of nh7n9 was demonstrated in hangzhou , shanghai and zhejiang .
the suspension of transport and trading of live birds carrying the virus may limit further geographical spread of nh7n9 to other uninvolved provinces .
the mixing of multiple species of poultry along with mammals in live poultry markets provides an ideal environment that favors reassortment among avian influenza viruses of different subtypes and interspecies viral transmission , including transmission from avian species to humans .
quail may serve as the intermediate host for the adaptation of novel reassortant avian influenza viruses from domestic waterfowl to gallinaceous poultry and humans .
chickens , common quail , red - legged partridges , and turkeys have both human - like sialic acid alpha-2,6-galactose - linked receptors and avian - like sialic acid alpha-2,3-galactose - linked receptors in their trachea and intestine .
the ability of some low pathogenic h9 and h7 avian influenza viruses to bind to both avian and human receptors has conferred a survival advantage to these subtypes over other avian influenza viruses in these poultry species , which may explain why endemic h9n2 , h7n2 and h7n7 viruses in poultry have been shown to acquire human receptor specificity and have caused outbreaks in humans .
the asymptomatic infection of poultry with these pathogenic influenza viruses that have acquired human receptor specificity in live poultry markets facilitates the transmission of these pathogenic reassortant influenza viruses to humans .
there is a link between human highly pathogenic h5n1 avian influenza virus ( hph5n1 ) infection and live poultry markets in china .
influenza infection of ostrich and emu can lead to the selection of pb2-e627k and pb2-d701n mutants , and ratite - origin isolates of low pathogenicity can easily be converted to highly pathogenic avian influenza viruses in chickens .
the mixing of new birds with unsold birds in live poultry markets sustains the circulation of these reassortant viruses .
hence , the live poultry market is important in the emergence , spread and maintenance of these pathogenic reassortant influenza viruses .
the interferon - mediated antiviral response and the species specificity of the ns segment are important in determining tissue tropism and virulence of influenza viruses .
interferon - beta ( ifn- ) plays a critical role in the defense against an influenza virus that can not be compensated by ifn-. the ns of hph5n1 is able to inhibit constitutive ifn- release and inducible ifn- production at the pre - transcriptional and post - transcriptional levels and to induce cytokine dysregulation .
the intense innate immune suppression enhances tropism of hph5n1 for human tissues and allows hph5n1 to invade and replicate in human tissues without the need for the avian sialic acid alpha-2,6-galactose receptor .
introduction of the hph5n1 ns into the low pathogenic h7n1 avian influenza virus enabled h7n1 to replicate efficiently in different human cell lines without prior adaptation due to potent suppression of ifn- production .
this observation shows that the ns of hph5n1 is able to increase the virulence and enhance the adaptation of avian influenza viruses to human hosts .
the viral polymerase protein pa and the nucleocapsid protein are important for the stabilization of the cpsf30ns1 complex .
the three influenza virus polymerases ( pa , pb1 and pb2 ) and the pb1-f2 protein enhance ns - mediated interferon antagonism .
the interaction between matrix and ns leads to down - regulation of the inflammasome and produces a delayed apoptosis of respiratory epithelial cells .
this delayed apoptosis and potent suppression of the innate immune response allows hph5n1 to proliferate rapidly during the stealth phase of influenza infection and results in a high viral load , cytokine dysregulation and high mortality .
the ns of hph5n1 comes from an ancestor h7n7 avian influenza virus , which has become incorporated into the h9n2 of the quail population in china .
the introduction of ns and the other five internal genes ( nucleoprotein , pa , pb1 , pb2 and matrix ) from the h9n2 of the quail population into hph5n1 was responsible for the outbreak of the hph5n1 infection in 1997 in chickens and humans in hong kong .
this ns - associated gene constellation that led to the outbreak of hph5n1 in 1997 is also present in some of the h9n2 avian influenza viruses endemic in china .
the outbreak of human nh7n9 infection after reassortment of the six internal genes from h9n2 into nh7n9 has been corroborated by the outbreak of the human hph5n1 infection in 1997 following the reassortment of these six internal genes from h9n2 that are capable of suppressing the innate immune response into hph5n1 in hong kong .
the potent ifn - suppressing capability of this ns - associated gene constellation may have contributed to the virulence of nh7n9 in humans . because low pathogenic h7 avian influenza virus can cause asymptomatic infections in poultry and has an increased ability to acquire human receptor specificity by selective pressure in poultry species that contain both human and avian binding sites in their trachea and intestine , the reassortment of this ns - associated gene constellation of h9n2 into nh7n9 may be more disastrous than the outbreak of hph5n1 in 1997 in terms of pandemic risk .
furthermore , the virulence of the ns of an influenza virus in host cells is species specific .
the species specificity of ns was first discovered during testing of the individual gene segments of the 1918 h1n1 spanish influenza pandemic virus in mice .
the ns that is virulent to human cells is less virulent than the corresponding wild - type control virus in mice .
the 2009 novel h1n1 influenza virus ( 2009pv ) , which induced a potent cytokine dysregulation of the human host and produced an enhanced mortality among young adult humans , caused only modest disease in ferrets and asymptomatic infection in pathogen - free miniature swine .
the asymptomatic infection of 2009pv in pathogen - free miniature swine explains the absence of a detectable outbreak of 2009pv infection in the swine population before the virus surfaced in humans .
hph5n1 is highly pathogenic to humans but has heterogeneous virulence in mice and ferrets . despite the outbreak of an hph5n1 infection that had a mortality rate of 80% in indonesia ,
therefore , tests assessing the pathogenicity of nh7n9 in humans should be conducted in human cell lines .
live poultry markets provide an ideal environment for viral reassortment and interspecies transmission of avian influenza viruses .
ducks and quail can act as mixing vessels to facilitate reassortment of influenza viruses of different subtypes , which may result in the generation of novel reassortant avian influenza viruses and the selection of mutants that may expand their host range to mammals .
nh7n9 has a five - amino - acid deletion in the na stalk that may be associated with increased virulence .
sustained circulation of subtype h5 and h7 influenza viruses in terrestrial poultry often selects for viruses with a shorter neuraminidase stalk .
those hph5n1 viruses with a short na stalk have increased virulence in mice and humans . among the 162 hph5n1 viruses isolated from humans , only two viruses
serial passage of a duck - origin avian influenza virus in quail led to the acquisition of mutations in ha commonly found in human seasonal influenza viruses and stepwise stalk deletions in na .
these quail - adapted duck - origin influenza viruses were able to replicate in human bronchial epithelial cells .
serial passage of h9n2 viruses into quails and chickens can lead to the production of mutants with short na stalks that can infect mice without prior adaptation and result in the selection of pb2-e627k mutants .
these quail- and chicken - adapted mutants with short na stalks can efficiently replicate in the respiratory tract of chickens and be transmitted via respiratory contact .
the susceptibility of quails to multiple subtypes of influenza viruses facilitates reassortment among these viruses .
the role of quail as an intermediate host in the adaptation of avian influenza viruses from domestic waterfowl , such as ducks and geese , to gallinaceous poultry , such as chickens and related terrestrial - based species , and the ability of quail to shed these novel reassortant viruses via respiratory aerosols led to their removal from live poultry markets in hong kong in 2002 .
nh7n9 isolated from humans contains features related to human adaptation , such as a q226l mutation in the ha cleavage site and e627k and d701n mutations in the pb2 protein , that facilitate nh7n9 binding to and replication in the human upper respiratory tract .
the q226l mutation in ha facilitated the adhesion of nh7n9 to the human upper respiratory tract , a property that enhanced the ability of this avian influenza virus to transmit via aerosols .
the pb2-e627k mutation increased the viral polymerase activity , replication efficiency and pathogenicity of this avian influenza virus in the mammalian host .
the pb2-e627k mutation also allowed efficient replication of the avian influenza virus at both 33 c and 37 c .
the ability to replicate at 33 c facilitates avian influenza virus proliferation in the upper respiratory tract of humans , a property that may allow the virus to be readily spread by sneezing and coughing .
efficient replication at 37 c allows this avian influenza virus to replicate in human lungs and to induce acute pulmonary complications .
the only reported fatal case of a low pathogenic h7n7 avian influenza virus was with a virus containing a pb2-e627k mutation , which is absent in those patients presenting with mild conjunctivitis .
the pb2-d701n mutation allows the avian influenza virus to cross the host species barrier and to infect mammalian cells .
the asymptomatic spread of nh7n9 among poultry and the rapid selection of nh7n9 mutants capable of human invasion indicates that the pandemic threat of nh7n9 may surpass that of hph5n1 .
the live poultry market plays a key role in the recent outbreak of poultry and human infections with nh7n9 by providing an environment for amplification , maintenance and interspecies transmission of the nh7n9 virus .
closing of the live poultry markets and culling of poultry in infected live poultry markets are important events in the prevention of further dissemination of nh7n9 infection . a ban on keeping live poultry
massive poultry vaccination and central poultry slaughtering should be considered if nh7n9 becomes an endemic disease among poultry .
however , such a vaccination program may lead to the development of multilineage antigenic drift in these low pathogenic avian influenza viruses .
the control of a human nh7n9 outbreak may prevent further adaptation of nh7n9 in humans because pb2-e267k and pb2-d701n mutants can be selected during replication in humans .
proper disposal of infected poultry and animal carcasses is important in preventing the spread of nh7n9 via predatory or scavenger birds . because influenza infection of ostrich and emu can lead to the selection of pb2-e267k and pb2-d701n mutants and because ratite - origin influenza isolates of low pathogenicity can easily be converted to a highly pathogenic avian influenza virus in chickens
, meticulous care must be taken to prevent the spread of nh7n9 to ostrich and other members of the ratitae family .
china has undergone a boom in ostrich and emu farming due to the market demand for their high - quality feathers , leather , healthy low - cholesterol red meat , eggs , eggshells and oil .
, producers are experimenting with the rearing of emus to replace sheep and goats in grasslands to alleviate the problem of overgrazing and desertification in china .
outbreaks of avian influenza virus infections have been reported in ostrich and emu farms in china .
direct contact between ostrich flocks and migratory birds via the free - range production systems in ostrich farms may play an important role in the mutual dissemination of mutant avian influenza viruses between ostriches and migrating birds .
biosecurity measures should be implemented to minimize possible contact between ostriches or emus and migrating birds on these farms .
regular surveillance programs on ostrich and emu farms are important for the detection and early control of the asymptomatic spread of nh7n9 among these species .
the acquisition of the pb2-e627k mutation has been reported in a hph5n1 virus at qinghai lake in 2005 .
descendants of the ratitae family around qinghai lake have been implicated in the emergence of such mutant viruses as fossils of struthio asiaticus and ornithomimosaurs ( ostrich - mimic dinosaurs ) have been detected in the gansu province of china .
hence , nh7n9 may undergo further reassortment or mutation at qinghai lake before spreading to the southern part of china and to the rest of the world during the coming winter season via migrating birds .
current epidemiological data suggest that an immediate human nh7n9 pandemic is unlikely , although it is impossible to predict whether nh7n9 will become endemic among poultry in china . the world should be vigilant against nh7n9 . continued monitoring and surveillance to obtain additional epidemiological data of nh7n9 is important for the early detection of a potential human nh7n9 pandemic .
seroprevalence studies may delineate the magnitude of asymptomatic or mild nh7n9 cases in the community . unless long - term measures are taken , such as the enhancement of live poultry market hygiene and poultry farm biosecurity to eliminate the emergence , spread and maintenance of reassortant avian influenza viruses and the selection of mutants capable of human invasion , live poultry markets and poultry farms
may serve as incubators for the emergence of highly lethal reassortant avian influenza viruses with pandemic potential . | china is undergoing a recent outbreak of a novel h7n9 avian influenza virus ( nh7n9 ) infection that has thus far involved 132 human patients , including 37 deaths .
the nh7n9 virus is a reassortant virus originating from the h7n3 , h7n9 and h9n2 avian influenza viruses .
nh7n9 isolated from humans contains features related to adaptation to humans , including a q226l mutation in the hemagglutinin cleavage site and e627k and d701n mutations in the pb2 protein .
live poultry markets provide an environment for the emergence , spread and maintenance of nh7n9 as well as for the selection of mutants that facilitate nh7n9 binding to and replication in the human upper respiratory tract . innate immune suppression conferred by the internal genes of h9n2 may contribute to the virulence of nh7n9 .
the quail may serve as the intermediate host during the adaptation of avian influenza viruses from domestic waterfowl to gallinaceous poultry , such as chickens and related terrestrial - based species , due to the selection of viral mutants with a short neuraminidase stalk .
infections in chickens , common quails , red - legged partridges and turkeys may select for mutants with human receptor specificity .
infection in ratitae species may lead to the selection of pb2-e627k and pb2-d701n mutants and the conversion of nh7n9 to a highly pathogenic avian influenza virus . |
the prisma-7 tool has been introduced in two emergency rooms ( ers ) in sherbrooke to identify older people with significant disabilities .
the seven yes / no questions had been included in the triage instrument for people aged 75 years and over .
the positive cases were directed to the single entry point of the local health and social services centre , which then conducted assessment and eventually provided home care .
the study 's objective was to monitor the rate of prisma-7 use in ers since its implementation ( 4 years ago ) .
during the first year of implementation , the rate of prisma-7 use gradually increased up to 5060% , then remained stable during the second and third years .
this plateau can be accounted for , in part , by the scarcity of resources for assessing and delivering home - care services .
the rate of prisma-7 use fell to 40% during the fourth year , which coincided with renovation of an er . a 50% objective is in place .
the rate of case - finding appears logical with the services actually available for assessing functional autonomy and the corresponding home services required . in terms of the population - health approach for supporting functional autonomy , it highlights the challenges in reaching the population level .
as suggested by young and turnock , some managers consider publishing community - care waiting lists to increase attention and , consequently , priority in the health system . | introductionthe prisma-7 tool [ 1 ] has been introduced in two emergency rooms ( ers ) in sherbrooke to identify older people with significant disabilities .
the seven yes / no questions had been included in the triage instrument for people aged 75 years and over .
the positive cases were directed to the single entry point of the local health and social services centre , which then conducted assessment and eventually provided home care .
the study 's objective was to monitor the rate of prisma-7 use in ers since its implementation ( 4 years ago).resultsduring the first year of implementation , the rate of prisma-7 use gradually increased up to 5060% , then remained stable during the second and third years .
this plateau can be accounted for , in part , by the scarcity of resources for assessing and delivering home - care services .
the rate of prisma-7 use fell to 40% during the fourth year , which coincided with renovation of an er . a 50% objective is in place.discussionthe rate of case - finding appears logical with the services actually available for assessing functional autonomy and the corresponding home services required . in terms of the population - health approach for supporting functional autonomy , it highlights the challenges in reaching the population level . as suggested by young and turnock
[ 2 ] , some managers consider publishing community - care waiting lists to increase attention and , consequently , priority in the health system . |
serum bilirubin may protect against inflammation , cardiovascular disease ( cvd ) , and all - cause mortality in adults [ 1 , 2 ] .
moreover , current evidences demonstrate that mildly elevated serum bilirubin may confer potent antioxidant properties , as indicated by its ability to scavenge peroxyl radicals and to inhibit oxidation of low - density lipoprotein ( ldl ) derived lipids [ 3 , 4 ] .
lots of studies have shown a positive relationship between serum bilirubin and estimated glomerular filtration rate ( egfr ) [ 59 ] , showing that serum bilirubin has a potential renoprotective effect .
we also demonstrated an independent positive association between serum bilirubin and egfr in both genders among elderly persons .
therefore , it is reasonable to speculate that serum bilirubin levels may be negatively correlated with diabetic nephropathy and renal function among diabetic patients .
several cross - sectional studies have shown that low serum bilirubin levels were significantly associated with decreased egfr , and negatively associated with diabetic nephropathy in a hospital - based sample of diabetic patients [ 6 , 7 ] . in a cohort of japanese type 2 diabetic patients , mashitani et al . [ 9 , 11 ] demonstrated that serum bilirubin levels were prospectively associated with diabetic nephropathy progression , independent of possible confounders .
in contrast , targher et al . found that serum bilirubin was negatively associated with egfr , considering serum bilirubin as a renal risk factor .
we evaluated the relationship of serum bilirubin with confounding risk factors such as renal function , as well as hypertension , hyperglycemia , and lipids , using cross - sectional data from the nomura study .
patients for this investigation were recruited among consecutive diabetic patients aged 50 years that visited the medical department of seiyo municipal nomura hospital .
patients with serum bilirubin > 2.0 mg / dl and severe cardiorenal ( e.g. , gilbert 's syndrome ) or nutritional disorders that would affect blood pressure , lipid , and glucose metabolism were excluded .
all procedures were approved by the ethics committee of seiyo municipal nomura hospital , and written informed consent was obtained from each patient .
information on demographic characteristics and confounding factors was collected using clinical files in all cases .
body mass index ( bmi ) was calculated by dividing weight ( in kilograms ) by the square of the height ( in meters ) .
we measured systolic blood pressure ( sbp ) and diastolic blood pressure ( dbp ) in the right upper arm of patients while in a sedentary position using a standard sphygmomanometer or an automatic oscillometric blood pressure recorder .
smoking status was quantified based on daily consumption and duration of smoking ( packyear ) irrespective of the difference between current and past smoking status : never , light ( < 20 packyear ) , moderate ( 2039 packyear ) , and heavy ( 40 packyear ) .
total cholesterol ( t - c ) , triglycerides ( tg ) , high - density lipoprotein cholesterol ( hdl - c ) , fasting plasma glucose ( fpg ) , creatinine ( enzymatic method ) , uric acid , and serum bilirubin were measured during a fasting condition within 24 hours after admission .
low - density lipoprotein cholesterol ( ldl - c ) level was calculated by the friedewald formula , and those patients with tg levels 400 mg / dl were excluded .
egfr was calculated using ckd - epi equations modified by a japanese coefficient ( egfrckdepi ) : male , cr 0.9 mg / dl , 141 ( cr/0.9 ) 0.993 0.813 ; cr > 0.9 mg / dl , 141 ( cr/0.9 ) 0.993 0.813 ; female , cr 0.7 mg / dl , 144 ( cr/0.7 ) 0.993 0.813 ; cr > 0.7 mg / dl , 144 ( cr/0.7 ) 0.993 0.813 .
moreover , ischemic stroke , ischemic heart disease , and peripheral vascular disease were defined as cvd .
all values are expressed as the mean standard deviation ( sd ) , unless otherwise specified , and in the cases of parameters with nonnormal distribution ( such as tg , fpg , and serum bilirubin ) , the data are shown as median ( interquartile range ) values . in all the analyses , parameters with nonnormal distributions were used after log - transformation .
statistical analysis was performed using ibm spss statistics version 21 ( statistical package for social science japan , inc . ,
pearson 's correlations were calculated in order to characterize the associations between various characteristics and egfr .
a multiple regression model was employed to evaluate the contribution of each confounding factor to egfr .
subjects were divided into four groups based on the stage of egfr ( stage 1 , egfr 90 ; stages 2 , 89.9 to 60 ; stage 3a , 59.9 to 45.0 ; stage 3b , 44.9 to 30.0 ; stage 4 , < 30 ml / min/1.73 m ) and quartile of serum bilirubin ( q-1 , 0.130.50 ; q-2 , 0.510.70 ; q-3 , 0.711.00 ; q-4 , 1.011.97 mg / dl ) , and logistic regression analyses were used to test significant determinants of ckd serving as the dichotomous outcome variable . to examine the consistency of the observed association between serum bilirubin levels and egfr , we performed subgroup analyses by age ( < 80 , 80 years ) , medication ( such as antihypertensive , antidyslipidemic , and antidiabetic agents ) ( absence , presence ) , serum uric acid ( first - second tertiles , third tertile ) , and cvd ( absence , presence ) , and interaction between serum bilirubin and the subgroups was analyzed by a general linear model . a value of p < 0.05 was considered significant .
the subjects comprised 230 men aged 77 10 ( range , 50100 ) years and 279 women aged 81 10 ( range , 50101 ) years .
mean uric acid , cr , and egfr in the study sample were 5.5 2.1 ( sd ) mg / dl , 1.1 0.9 mg / dl , and 56.0 20.2 ml / min/1.73 m with 1.0% stage 1 , 51.5% stage 2 , 21.2% stage 3a , 14.5% stage 3b , and 12.8% stage 4 , respectively .
median serum bilirubin level was 0.7 ( interquartile range , 0.51.0 ) mg / dl .
prevalence of antihypertensive , antidyslipidemic , antidiabetic medication , and cvd was 56.2% , 8.4% , 43.6% , and 40.1% , respectively .
serum bilirubin ( r = 0.22 , p < 0.001 ) along with age , dbp , prevalence of antihypertensive medication , tg , hdl - c , ldl - c , and serum uric acid correlated significantly with egfr ( figure 1 ) .
stepwise multiple regression analysis using egfr as an objective variable , adjusted for risk factors as explanatory variables , showed that serum bilirubin ( = 0.13 , p < 0.001 ) was significantly and independently associated with egfr , in addition to gender , age , prevalence of antihypertensive medication , hdl - c , and serum uric acid .
table 3 shows the odds ratio of renal dysfunction for each quartile increase in serum bilirubin .
the prevalence of egfr < 60 ml / min/1.73 m ( stages 3 + 4 ) for each quartile in serum bilirubin was 40.8% q-4 , 43.2% q-3 , 51.1% q-2 , and 58.9% q-1 , respectively . compared with q-4 in serum bilirubin , nonadjusted , age and gender - adjusted , and multivariate - adjusted odds ratios { 95% confidence interval ( ci ) } of stages 3 + 4 for q-1 in serum bilirubin were 2.08 ( 1.253.44 ) , 1.82 ( 1.073.09 ) , and 1.53 ( 0.832.81 ) , respectively .
moreover , the prevalence of egfr < 45 ml / min/1.73 m ( stages 3b + 4 ) for each quartile in serum bilirubin was 17.6% q-4 , 21.6% q-3 , 27.4% q-2 , and 42.7% q-1 , respectively . compared with q-4 ,
nonadjusted , age and gender - adjusted , and multivariate - adjusted odds ratios ( 95% ci ) of stages 3b + 4 for q-1 were 3.50 ( 1.956.23 ) , 3.12 ( 1.725.65 ) , and 3.53 ( 1.717.26 ) , respectively .
next , to control potential confounding factors , the data were further stratified by gender , age , medication ( antihypertensive , antidyslipidemic , and antidiabetic agents ) , serum uric acid ( first - second tertiles , third tertile ) , and prevalence of cvd ( table 4 ) .
the standardized coefficients for egfr were significant in all subgroups other than the prevalence of cvd , and there were significant interactions only between the two groups regarding cvd .
to examine the possible contribution of decreased serum bilirubin to renal dysfunction among diabetic persons , we studied the relationship between potential confounding risk factors including serum bilirubin and egfr .
individuals with hypobilirubinemia ( first quartile of serum bilirubin , < 0.50 mg / dl ) showed increased risk for stage 3b ckd ( egfr < 45 ml / min/1.73 m ) .
moreover , the strength of serum bilirubin level as an independent determinant of egfr was similar to those of known factors such as gender , age , prevalence of antihypertensive medication , hdl - c , and serum uric acid . to our knowledge , few epidemiologic studies have quantified the link between decreased serum bilirubin and renal dysfunction in diabetic patients .
thus , we think that serum bilirubin levels may be utilized as a provisional new confounding factor of diabetic nephropathy that can be measured easily and applied in medical practice .
several studies have shown that decreased serum bilirubin is a risk factor for the development of ckd among type 2 diabetic individuals .
inoguchi et al . showed a lower prevalence of vascular complications as well as reduced markers of oxidative stress and inflammation in patients with gilbert 's syndrome , which is a congenital hyperbilirubinemia , and diabetes .
a community - based cross - sectional study in korea found that total serum bilirubin levels were negatively correlated with 24-hour proteinuria and positively associated with egfr after adjusting for potential confounding factors in 612 diabetic patients .
. found that serum bilirubin level was independently and negatively associated with albuminuria in a hospital - based cross - sectional study in 633 japanese type 2 diabetic patients .
in addition , it was shown that serum bilirubin levels were higher in patients without diabetic nephropathy than in those with diabetic nephropathy . in a longitudinal cohort study of 12,823 korean male workers without ckd or proteinuria at baseline , higher serum direct bilirubin levels
were significantly associated with a lower risk of developing ckd ( egfr , < 60 ml / min/1.73 m ) , even after adjusting for potential confounding factors . in the single - center longitudinal observational cohort study of type 2 diabetic patients , toya et al
. found that higher serum bilirubin levels , within the normal range , were associated with a lower risk of progression from microalbuminuria to macroalbuminuria . in a hospital - based study of 2,678 us
longitudinal data from 2,511 type 2 diabetic japanese patients showed that multivariable - adjusted odds ratios for progression from microalbuminuria to macroalbuminuria for the second , third , and fourth quartiles of serum bilirubin levels were 0.89 ( 95% ci 0.491.58 ) , 0.93 ( 0.471.83 ) , and 0.33 ( 0.130.84 ) , respectively .
however , this trend disappeared after adjustment for hemoglobin level . in our hospital - based sample of 509 individuals , we found that decreased serum bilirubin levels were significantly associated with decreased egfr , and multivariate adjusted - odds ratio of hypobilirubinemia ( 0.130.50 mg / dl ) for stage 3b ( egfr < 45 ml / min/1.73 m ) was 3.53 ( 1.717.26 ) .
the mechanism by which serum bilirubin level is associated with a lower risk of ckd is not completely understood .
bilirubin has been described as the most powerful endogenous antioxidant substance in vitro when acting alone and complexed with serum albumin to serve as a superoxide scavenger and peroxyl radical trapping antioxidant .
a recent study in a rodent model discovered a protective effect of bilirubin against diabetic nephropathy through inhibition of renal nicotinamide adenine dinucleotide phosphate- ( nadph- ) dependent superoxide production and both hyperglycemia and angiotensin - ii - induced production of reactive oxygen species . taken together , the present results suggest that bilirubin might have a protective role in the progression of diabetic nephropathy , particularly in diabetic patients with greater oxidative stress such as cvd . in our study , the standardized coefficient for egfr was significant in the subgroup with prevalence of cvd , and there were significant interactions between the two groups regarding cvd .
first , due to the cross - sectional study design , the present results are inherently limited in the ability to eliminate causal relationships between serum bilirubin and egfr among diabetic patients .
second , our definition of egfr is based on a single assessment of serum creatinine , which may introduce a misclassification bias .
third , estimating gfr listed as the ckd - epi equation tends to be less accurate in subjects with normal renal function and ckd than gfr when inulin clearance is used , but is more accurate than serum creatinine or egfr using the modification of diet in renal disease ( mdrd ) formula .
fourth , in this study , ckd may have been misclassified with egfr > 60 ml / min/1.73 m and proteinuria as mildly reduced renal function because renal dysfunction was defined as reduced egfr irrespective of the presence or absence of proteinuria .
the present study showed that decreased serum bilirubin levels are strongly associated with decreased egfr among diabetic patients .
the underlying mechanism behind this relationship is unclear , but seems to be independent of traditional confounding risk factors such as age , hypertension , and dyslipidemia . for community - dwelling diabetic patients , | the subjects comprised 230 men aged 77 10 ( range : 50100 ) years and 279 women aged 81 10 ( 50101 ) years that visited the medical department .
we examined the relationship between increased serum bilirubin and renal function evaluated by estimated glomerular filtration rate ( egfr ) using ckd - epi equations modified by a japanese coefficient . compared with the fourth quartile in serum bilirubin ( 1.011.97 mg / dl ) , the nonadjusted , age and gender - adjusted , and multivariate - adjusted odds ratios { 95% confidence interval ( ci ) } of egfr < 60 ml / min/1.73 m2 for the first quartile in serum bilirubin ( 0.130.50 mg / dl ) were 2.08 ( 1.253.44 ) , 1.82 ( 1.073.09 ) , and 1.53 ( 0.832.81 ) , respectively .
moreover , compared with the fourth quartile , nonadjusted , age and gender - adjusted , and multivariate - adjusted odds ratios ( 95% ci ) of egfr < 45 ml / min/1.73 m2 for the first quartile were 3.50 ( 1.956.23 ) , 3.12 ( 1.725.65 ) , and 3.53 ( 1.717.26 ) , respectively .
the data were further stratified by gender , age , medication ( antihypertensive , antidyslipidemic , and antidiabetic agents ) , and prevalence of cardiovascular disease ( cvd ) .
the standardized coefficients for egfr were significant in all the subgroups other than the prevalence of cvd , and there were significant interactions between the two groups regarding cvd .
our data demonstrated an independent positive association between serum bilirubin and egfr among diabetic patients . |
metastatic dissemination is a major problem in all types of tumors , in which cells colonize distant organs . in breast tumors , in order to leave the primary niche , the metastatic breast carcinomas form a membrane degrading protrusion named invadopodia ( fig . 1 ) .
invadopodia , also called invasive protrusion to distinguish from locomotory protrusions ( involved in bulk cell movement ) , allow the cells to degrade the basement membrane underneath the tissue and penetrate into the tumor stroma .
once in the stroma , tumor cells will migrate within the three - dimensional extracellular matrix . in order to propel themselves in such an environment , tumor cells form actin - rich locomotory protrusions ,
also named pseudopodia / lamellipodia ( pseudopodia in 3d and lamellipodia in 2d ) . once the tumor cells reach the blood vessels , invadopodia facilitate penetration of the tumor cells into the blood stream for tumor cell dissemination .
tumor cells in the primary tumor form an invadopodium to degrade the basement membrane and penetrate into the tumor stroma .
migration in the three - dimension extracellular matrix is facilitated by locomotory protrusions , such as pseudopodium .
when close to the blood vessel , tumor cells form invadopodia in order to penetrate into the blood stream .
how does the tumor microenvironment regulate their formation ? in order to understand the molecular mechanisms that drive the formation of the different protrusions , researchers have used many experimental approaches , such as two - dimensional gelatin matrices . in this context , these two types of protrusions can be spatially separated , facilitating at a molecular level the individual analysis of each of them .
different studies have described that microenviromental factors such as egf secreted by macrophages , hypoxia conditions , or matrix rigidity , can trigger the formation of invasive protrusions . among them , egf secreted by macrophages can trigger the formation not only of invasive protrusions but also locomotory protrusions , facilitating migration and invasion .
stimulation of tumor cells with egf ligand trigger the formation of invasive protrusions . from various studies
we have learned that the formation of an invadopodium is a multistep process composed of a number of well - defined stages : ( 1 ) formation of an invadopodium precursor , ( 2 ) tks5-dependent anchoring , and ( 3 ) maturation into a degradative structure .
surprisingly , while studying invasive structures , we have found that some of the key regulatory molecules affecting actin cytoskeleton dynamics such as cofilin or cortactin are shared between those compartments .
thus , the question becomes : are locomotory and invasive protrusions similar structures but located at different subcellular locations ?
recent work has shown that the spatiotemporal dynamics of activation of rhoc gtpase plays an important role in confining the actin polymerization in these protrusions facilitating tumor cell migration and invasion .
the use of high - resolution fret imaging has revealed that the dynamics of rhoc activity is a common regulator within both compartments ; acting in such a way as to geometrically confine and define the location of actin polymerization to affect an efficient locomotory and invasive protrusion .
what are the signaling pathways controlled by rhoc that are shared in both of these compartments ?
cofilin is an actin - binding protein that can regulate actin dynamics in a number of ways . in highly invasive tumor cells
it has been shown that cofilin can sever actin filaments to generate new barbed ends that are accessible to monomers of g - actin promoting actin polymerization at invasive and locomotory protrusions .
this step is dependent on the phosphorylation on a serine residue of cofilin , targeted by the rock / limk pathway .
this phosphorylation step takes place after cofilin is released from its inhibitory partner , cortactin , through cortactin phosphorylation by arg and nhe1 activation .
these pathways need to be carefully regulated in order to regulate the steps of invadopodium assembly and maturation .
rock is a well - known effector of rho gtpases regulating many pathways related to motility , having greater affinity for rhoc than for rhoa .
but which rho isoform is triggering the cofilin phosphorylation in highly invasive tumor cells ? this signaling pathway is under the specific control of rhoc but not rhoa in these metastatic cells . depletion of rhoc impacts cofilin phosphorylation but on the contrary , rhoa depletion has no effect .
these results point to the high degree of specialization of function of gtpase isoforms in tumor cells .
we found that rhoc is essential to control cofilin - dependent barbed ends through the activation of rock / limk at those specific subcellular locations but not rhoa .
this cofilin inactivation step triggered by rhoc is crucial for the geometric confinement of active cofilin either at the tip of the leading edge or within the core of the invadopodium , localizing barbed - ends , and therefore , the geometry of actin polymerization in those structures .
how is rhoc regulating invasion at the cellular level ? by looking at the ultrastructure of invadopodia we found a striking result when depleting rhoc . while control cells form invadopodia that are capable of penetration into the extracellular matrix , cells depleted for rhoc form abnormal invadopodia structures with multiple branches that can not efficiently penetrate into the extracellular matrix .
based on this result , we proposed that the defect in confining actin polymerization within invadopodia protrusions might account for the impaired tumor cell invasion after rhoc depletion
. moreover , rhoc also plays an important role in facilitating tumor cell migration as shown in other studies . in the case of invasive breast tumor cells ,
the presence of a local egf source induces the formation of an actin - rich directional protrusion toward the source of egf .
depletion of rhoc abolishes the formation of this directional protrusion , and as a result , chemotaxis is impaired .
other studies have indentified rhoc as an effector of integrin signaling and have shown that it is involved in regulation of integrin trafficking in pancreatic tumor cells . in other cancer models , and also in cancer stem cells , rhoc has been identified as an important regulator of metastasis .
rhoc , through controlling one molecular mechanism ( the cofilin pathway ) at two specific protrusive compartments , regulates migration and invasion of breast tumor cells .
the spatially and temporally specific activation dynamics of rhoc is thus necessary to properly localize and to control these protrusions during invasion and metastasis .
thus , these results could potentially explain why rhoc knockout mice in a mmtv tumor model while forming primary tumors , metastasizes less , and may explain the importance of rhoc in other tumor models .
rhoc is also expressed in human macrophages , so it is possible that rhoc may play a role in the regulation of podosome formation , structures also involved in matrix degradation .
the signaling pathways that regulate invasive and locomotory protrusions must be well - regulated in space and precisely timed .
we have observed that during invadopodium formation , molecules regulating different stages of invadopodium assembly are recruited and activated with a detailed precision during the invadopodium lifetime .
so , in this highly regulated series of events : when and where is rhoc activated during their formation ?
when studying rhogtpase signaling , we must take into account that the activity cycling of the rho gtpases require finely tuned spatiotemporal coordination occurring at seconds resolution and in spatial resolution of sub - microns .
fret - based fluorescent biosensor technology is the ideal technique in order to decipher such rapid dynamics . to answer the question of where and when rhoc is activated , we used a recently developed rhoc biosensor that allows the study of the activation of rhoc during tumor cell protrusion formation .
the results obtained with this technology allowed us to better understand the functional data obtained using rhoc depletion and other traditional biochemical means .
rhoc activity spatially and temporally surrounds the invadopodium core and localizes behind the lamellipodium at the leading edge of migrating tumor cells .
the activation of rhoc at those areas triggers the rock / limk pathway phosphorylating cofilin and geometrically confining cofiln activity , barbed end formation , and actin polymerization at the core of the invadopodium and at the tip of the leading edge of the lamellipodium ( fig . 2 ) .
p190rhogef activates rhoc outside of the invadopodia or behind the cell edge ( red areas ) .
rhoc activates the rock / limk pathway that inactivates cofilin , through phosphorylation ( pathway detailed in red box ) . p190rhogap
localized at the tip of the lamellipodium or the core of the invadopodium inactivates rhoc ( green areas ) confining cofilin activity , barbed end formation , and actin polymerization for efficient protrusions ( pathway detailed on green box ) .
while only three close isoforms for rho , rhoa , b , and c are known , over 70 gefs and 70 gaps are known to regulate rhogtpases .
this molecular organization of the rhogtpase signaling suggests that what could determine where and when gtpases are activated / inactivated , must be the spatial and temporal regulation of the upstream molecules .
we have shown that at invasive and locomotory protrusions , rhoc is regulated by p190rhogef / p190rhogap .
these two molecules display very specific localization patterns that contribute to confine the activation of rhoc at specific areas to control the cofilin pathway and confine actin polymerization ( fig . 2 ) . in our studies we found that , during lamellipodium protrusions , other gefs including larg , p115rhogef , or the gap dlc-1 , do not show the same localization pattern as p190rhogef / p190rhogap and do not affect cofilin phsophorylation .
how are these gefs and gaps placed at specific locations and activate / deactivate rho gtpases only under specific conditions ?
we can hypothesize that factors including the membrane contour , specific scaffolding protein organization at the plasma membrane , assembly of focal adhesion components , and activation of upstream kinase pathways , could be responsible for the recruitment of these molecules that can be activated prior to the gtpases being delivered to these particular locations . by interfering with p190rhogef and p190rhogap ,
the amount of barbed ends during lamellipodium protrusion can be modulated through cofilin phosphorylation triggered by rhoc .
but interestingly , the signaling module composed of p190rhogef / p190rhogap / rhoc must be present at all times in order to form efficient protrusions . by interfering with the components
while they both regulate the actin cytoskeleton , their roles in invasion seems to be quite different .
strikingly , when looking at the activation of rhoa in relation to rhoc , we found that at invasive protrusions , rhoa does not seem to display any specific activation patterns , while at locomotory protrusions , rhoa is activated in a narrow band at the edge of cell protrusions .
these different spatial localization patterns of rhoa in comparison to rhoc suggest different roles each isoform of rho gtpases may play during these physiological processes .
these different subcellular localizations , specifically at the leading edge , seem to be a conserved feature since in fibroblasts the analysis of rhoa and rhoc activities revealed similar findings .
recently , machacek et al . has shown that rhoa , rac1 , and cdc42 display highly characteristic and specific activation patterns during leading edge protrusions in fibroblasts .
the coordinated dynamics of the rho gtpase activations at the protrusions may likely require and affect potential feedback / forward mechanisms activating / repressing certain gtpases , as has been shown for rhoa / rac .
while rhoa plays an important role in delivering mt1mmp to invadopodia , rhoc is involved in regulating the actin cytoskeleton through the cofilin pathway . by contrast , at locomotory protrusions , while rhoc is important for the directional polarization and formation of protrusions , rhoa does not seem to be necessary .
mdia1-dependent pathway is activated , and in that situation we were able to localize high levels of activation of rhoa reveling the role of rhoa in regulating these mdia1-dependent filaments at locomotory protrusions .
these studies show the importance of observing signaling pathways and gtpase activations at subcellular spatial resolutions and in time scales of seconds , thus the use of fret - biosensors is the ideal approach for these studies .
we are only starting to understand how rhogtpases are regulated at locomotory and invasive protrusions and the relationship between these two actin - rich protrusions at a molecular scale . by identifying the molecules and the signaling pathways that commonly regulate these different protrusions
, we will be able to define critical pathways that could be targeted for possible intervention to halt metastasis .
important questions remain : ( 1 ) what recruits gefs and gaps to their specific locations ; ( 2 ) how are gef / gap activities regulated ; and ( 3 ) what regulates the specificity of each gefs and gaps ? clearly , far more work is needed to address these critical issues in order to better understand the mechanisms by which isoform - specific roles of gtpases are regulated , both within specific tumor microenvironments and from the metastatic context in vivo .
the development of new imaging technologies , including fret - based biosensors to monitor the activation of the upstream molecules , will certainly shed light onto these aspects , as well as development of approaches to directly visualize protein activation dynamics in live animals in vivo will clear the way to understanding how protein - activation level events regulate the dynamics of tumor dissemination .
we are in a very exciting time when the technology is moving fast enough to potentially address all these questions and better our understanding of tumor metastasis . | systemic metastasis is the dissemination of cancer cells from the primary tumor to distant organs and is the primary cause of death in cancer patients .
how do cancer cells leave the primary tumor mass ?
the ability of the tumor cells to form different types of actin - rich protrusions including invasive protrusions ( invadopodia ) and locomotory protrusions ( lamellipodia [ 2d ] or pseudopodia [ 3d ] ) , facilitate the invasion and dissemination of the tumor cells .
rho - family of p21 small gtpases plays a direct role in regulating the actin dynamics in these intracellular compartments .
recent studies have shown that the signaling molecules including rhoc / p190rhogef / p190rhogap acts as a molecular compass in order to direct the spatial and temporal dynamics of the formation of these invasive and locomotory protrusions leading to efficient invasion . |
idiopathic giant cell myocarditis is a rapid progressive disease with an enormously high mortality because of pump failure or arrhythmias.1 in many cases , clinical course is acute to fulminant , and time span between clinical presentation and start of treatment should be as short as possible .
the diagnostic tool of choice is endomyocardial biopsy ( emb ) showing typical granulomas of giant cells in histology .
however , repeat embs are frequently necessary delaying initiation of treatment.2 treatment consists of immunosuppression including cortisone and cyclosporine . here , we present a case of a young woman with fulminant myocarditis in whom gene expression profiling of giant cells was helpful in diagnosing the disease . a previously healthy woman ( 26 years )
was admitted via helicopter because of sudden onset of massive dyspnoea , nausea , and vomiting following a respiratory infection 2 weeks ago .
because of the acute beginning of dyspnoea , pulmonary embolism was excluded by computed tomography .
she was intubated and mechanically ventilated with initially high positive end expiratory pressure that led to respiratory stabilization .
echocardiography revealed a massive depression of left ventricular function with an ejection fraction ( lvef ) of 25% , while right ventricular function was normal .
inotropic therapy including levosimendan ( 0.05 g / kg / min ) and norepinephrine ( 0.2 g / kg / min ) was started .
laboratory values out of range at admission ck , creatinkinase ; hs troponin , highsensitivity troponin ; fio2 , fraction of inspiratory oxygen ; pao2 , arterial pressure of oxygen ; paco2 , arterial pressure of carbon dioxide .
invasive cardiologic workup including coronary angiography and emb was performed the following day under the suspicion of fulminant myocarditis to differentiate between lymphocytic , eosinophilic , or giant cell myocarditis .
after emb , echo showed an even more depressed lvef ( 15% ) , and the dose of norepinephrine necessary to stabilize circulation increased further ( up to 0.5 g / kg / min ) . overall , cardiogenic shock progressively deteriorated ( intermacs1 ) .
this prompted the implantation of an extracorporeal membrane oxygenation ( ecmo ) in a venoarterial manner .
after 5 days on ecmo and inotropes , the patient was stable , but lvef still was poor ( 15% ) .
preliminary results of emb showed no viral genome and no giant cells in histology ( three embs , although lymphocytes and macrophages were present ; figure
1(a ) ) .
( a ) histology with atrophic myocytes ( mean diameter : 14 m ) in regular arrangement .
( b)(e ) immunohistochemical examination including digital imaging analysis in other biopsies displays increase of tlymphocytes ( cd3 32 cells / mm , b ) , lfa1 positive cells ( lfa1 187 cells / mm , c ) , and macrophages ( mac1 468 cells / mm , d ) , but no multinuclear giant cells and no cytotoxic perforinpositive cells ( e ) .
quantification of immunohistochemical stainings by digital image analysis in two additional embs yielded the following values : cd3 + : 32 per mm ( normal values ( nv ) < 7 per mm ) , cd11a / lfa1 + : 187 per mm ( nv < 14.0 per mm ) , cd11b / mac1 + : 487 per mm ( nv < 35 per mm ) , area fraction of human leucocyte antigen class i : 14.8% ( nv < 5.5% ) , and cd54/icam1af : 7.56% ( nv < 1.2% ) , demonstrating a massive elevation of lymphocytes and macrophages ( figure
1(b)(d ) ) and expression of adhesion molecules ( no perforinpositive cytotoxic cells have been present ) .
immunohistochemical composition of cellular infiltrates corresponded to fulminant lymphocytic myocarditis , although active myocarditis ( i.e. myocytolysis ) was excluded .
however , as histological proof of multinuclear giant cells or eosinophilic cells was not successful , a myocardial gene expression profiling using a set of 16 altered genes was performed .
the results suggested the presence of multinucleated giant cells in the myocardium as key feature for giant cell myocarditis.3 this diagnostic approach was suitable to differentiate this disease from active lymphocytic myocarditis ( figure
2 ) .
expression profiles of highly upregulated ( a ) or downregulated ( b ) myocardial genes of our patient ( grey bar ) compared with inflammationfree controls ( black bar ) and to idiopathic giant cell myocarditis ( light bar ) suggested the presence of multinuclear giant cells in myocardium .
all expression values of controls free of inflammation are given as 100% and the others in relation to it .
with this information , the recommended therapy for giant cell myocarditis was started with a high cortisonedose ( 10 mg / kg body weight for 3 days followed by 4 weeks at 1 mg / kg body weight ) in combination with cyclosporine .
after 3 days of highdose cortisone and cyclosporine , lvef increased from 15% to 55% , and ecmo was explanted .
the patient was extubated and transferred to the normal ward after another 4 days .
overall , the patient left the hospital after 4 weeks to start cardiac rehabilitation .
treatment at discharge consisted of methylprednisolone ( 1 mg / kg for 4 weeks , followed by a decline of 10 mg every 2 weeks until 10 mg will be reached ) , cyclosporine ( trough level 100150 ) , pantoprazole 40 mg , calcium plus vitamin d , ramipril , eplerenone , and bisoprolol .
this treatment was continued for 12 months with repeated visits at our outpatient clinic .
all echocardiographic parameters stayed within normal ranges , throughout this time , and the patient returned to work after 10 months .
a previously healthy woman ( 26 years ) was admitted via helicopter because of sudden onset of massive dyspnoea , nausea , and vomiting following a respiratory infection 2 weeks ago .
because of the acute beginning of dyspnoea , pulmonary embolism was excluded by computed tomography .
she was intubated and mechanically ventilated with initially high positive end expiratory pressure that led to respiratory stabilization .
echocardiography revealed a massive depression of left ventricular function with an ejection fraction ( lvef ) of 25% , while right ventricular function was normal .
inotropic therapy including levosimendan ( 0.05 g / kg / min ) and norepinephrine ( 0.2 g / kg / min ) was started .
laboratory values out of range at admission ck , creatinkinase ; hs troponin , highsensitivity troponin ; fio2 , fraction of inspiratory oxygen ; pao2 , arterial pressure of oxygen ; paco2 , arterial pressure of carbon dioxide .
invasive cardiologic workup including coronary angiography and emb was performed the following day under the suspicion of fulminant myocarditis to differentiate between lymphocytic , eosinophilic , or giant cell myocarditis .
after emb , echo showed an even more depressed lvef ( 15% ) , and the dose of norepinephrine necessary to stabilize circulation increased further ( up to 0.5 g / kg / min ) .
this prompted the implantation of an extracorporeal membrane oxygenation ( ecmo ) in a venoarterial manner .
after 5 days on ecmo and inotropes , the patient was stable , but lvef still was poor ( 15% ) .
preliminary results of emb showed no viral genome and no giant cells in histology ( three embs , although lymphocytes and macrophages were present ; figure
1(a ) ) .
( a ) histology with atrophic myocytes ( mean diameter : 14 m ) in regular arrangement .
( b)(e ) immunohistochemical examination including digital imaging analysis in other biopsies displays increase of tlymphocytes ( cd3 32 cells / mm , b ) , lfa1 positive cells ( lfa1 187 cells / mm , c ) , and macrophages ( mac1 468 cells / mm , d ) , but no multinuclear giant cells and no cytotoxic perforinpositive cells ( e ) .
quantification of immunohistochemical stainings by digital image analysis in two additional embs yielded the following values : cd3 + : 32 per mm ( normal values ( nv ) < 7 per mm ) , cd11a / lfa1 + : 187 per mm ( nv < 14.0 per mm ) , cd11b / mac1 + : 487 per mm ( nv < 35 per mm ) , area fraction of human leucocyte antigen class i : 14.8% ( nv < 5.5% ) , and cd54/icam1af : 7.56% ( nv < 1.2% ) , demonstrating a massive elevation of lymphocytes and macrophages ( figure
1(b)(d ) ) and expression of adhesion molecules ( no perforinpositive cytotoxic cells have been present ) .
immunohistochemical composition of cellular infiltrates corresponded to fulminant lymphocytic myocarditis , although active myocarditis ( i.e. myocytolysis ) was excluded .
however , as histological proof of multinuclear giant cells or eosinophilic cells was not successful , a myocardial gene expression profiling using a set of 16 altered genes was performed .
the results suggested the presence of multinucleated giant cells in the myocardium as key feature for giant cell myocarditis.3 this diagnostic approach was suitable to differentiate this disease from active lymphocytic myocarditis ( figure
2 ) .
expression profiles of highly upregulated ( a ) or downregulated ( b ) myocardial genes of our patient ( grey bar ) compared with inflammationfree controls ( black bar ) and to idiopathic giant cell myocarditis ( light bar ) suggested the presence of multinuclear giant cells in myocardium .
all expression values of controls free of inflammation are given as 100% and the others in relation to it .
with this information , the recommended therapy for giant cell myocarditis was started with a high cortisonedose ( 10 mg / kg body weight for 3 days followed by 4 weeks at 1 mg / kg body weight ) in combination with cyclosporine .
after 3 days of highdose cortisone and cyclosporine , lvef increased from 15% to 55% , and ecmo was explanted .
the patient was extubated and transferred to the normal ward after another 4 days .
overall , the patient left the hospital after 4 weeks to start cardiac rehabilitation .
treatment at discharge consisted of methylprednisolone ( 1 mg / kg for 4 weeks , followed by a decline of 10 mg every 2 weeks until 10 mg will be reached ) , cyclosporine ( trough level 100150 ) , pantoprazole 40 mg , calcium plus vitamin d , ramipril , eplerenone , and bisoprolol .
this treatment was continued for 12 months with repeated visits at our outpatient clinic .
all echocardiographic parameters stayed within normal ranges , throughout this time , and the patient returned to work after 10 months .
histological proof of multinucleated giant cells is the gold standard , but a recent publication showed that only 68% of first embs are diagnostic and repeat embs are necessary to confirm diagnosis.2 in our case , repeat emb has been discussed but gene expression profiling , a method previously published by lassner and coworkers , proved beneficial and a repeat biopsy could be avoided.3 , 4 however , the complete lack of myocytolysis ( i.e. histological confirmation of myocarditis ) in our patient was surprising . nevertheless , lymphocytic myocarditis could be diagnosed with immunohistochemical tools . we can not completely rule out that lvef may have recovered by prolongation of ecmo and inotropic therapy .
however , the finding of gene profiles of giant cells in biopsy specimen prompted the initiation of treatment for giant cell myocarditis and lvef recovered within 48 h. we think that a full recovery without immunosuppression is highly unlikely .
as shown here , the new technique of gene expression profiling may be helpful in patients with fulminant myocarditis to confirm the presence of giant cells in specimen without histological evidence of the disease , laying path to early initiation of immunosuppression and avoidance of repeat embs as shown in our case report .
therefore , we conclude that gene expression profiling of giant cell myocarditis in patients with fulminant myocarditis and negative histological findings may be helpful laying path to tailored immunosuppressive treatment for this disease .
drs lassner and schultheiss report a patent pending named verwendung von micrornas oder genen als marker zur identifizierung , diagnose und therapie einzelner nichtischmischer kardiomyopathien oder speichererkrankungen in germany . | abstracta healthy woman with acute onset of pulmonary oedema and severely depressed left ventricular function underwent endomyocardial biopsy under the clinical suspicion of fulminant myocarditis . while awaiting the results of biopsy , the situation deteriorated to interagency registry for mechanically assisted circulatory support ( intermacs ) and extracorporeal membrane oxygenation was implanted .
finally , immunohistochemistry in biopsy specimen corresponded to fulminant lymphocytic myocarditis , although active myocarditis was excluded .
furthermore , gene expression profiling identified giant cell myocarditis although multinuclear cells were absent .
this prompted the start of immunosuppression with cortisone and cyclosporine .
the patient fully recovered . |
the presence of an idic(ph ) chromosome(s ) represents a mechanism for genomic bcrabl1 amplification and may contribute to resistance against targeted therapies based on imatinib or dasatinib . a 52yearold , previously healthy man presented to his local ed with worsening right groin pain of 2months duration , which began after a traumatic fall with direct trauma to that site . at that time
, he was discharged home from the ed with a diagnosis of rectus sheath hematoma .
his pain continued to progress , and he returned to the ed where repeat ct demonstrated worsening hematoma size and a cbc showed significant leukocytosis .
the patient was transferred to our hospital with a concern for leukemia . at our institution ,
the admission white blood cell count ( wbc ) was 116.4 10/l with a differential consisting of 70% neutrophils , 3% metamyelocytes , 6% myelocytes , 2% promyelocytes , 7% lymphocytes , 5% eosinophils , 4% basophils , and 3% blasts ( fig .
the platelet count was 506 10/l and the hemoglobin level was 10.5 g / dl .
( a ) the peripheral blood smear shows a leukocytosis with neutrophils at various stages of maturation , a basophilia ( < 20% ) , and 3% blasts ; ( b ) the marrow is hypercellular with diffuse granulocytic proliferation and numerous dwarf megakaryocytes ; ( c ) bcrabl1 fish showed a variant fusion pattern ( 3 fusions ; 1 orange ; 1 green ) ; ( d ) chromosome analysis revealed an abnormal male karyotype with an isodicentric philadelphia chromosome ; ( e ) metaphase fish studies show the presence of two bcr / abl1 fusion signals on the idic(ph ) chromosome .
peripheral blood flow cytometry showed an increased granulocyte population with leftshifted maturation and myeloblasts accounting for about 2.5% of the total events .
a bone marrow biopsy showed findings consistent with cml including marked marrow hypercellularity with leftshifted granulocytic preponderance , numerous dwarf megakaryocytes , and 3% blasts ( fig . 1b ) .
fluorescence hybridization ( fish ) analysis on the bone marrow with bcrabl1 dualcolor , dualfusion probes revealed three distinct bcr / abl1 fusion patterns .
the typical bcr / abl1 fusion pattern was observed in 31% of interphase nuclei analyzed . a variant bcr / abl1 fusion pattern ( 3 fusions ; 1 orange ; 1 green )
1c ) and 2.5% of nuclei showed 4 fusions ; 1 orange ; and 1 green pattern .
karyotyping studies revealed the presence of an isodicentric philadelphia chromosome , 46,xy , der(9)t(9;22)(q34;q11.2),22,+ider(22)(q10)t(9;22)(q34;q11.2 ) , in all 20 analyzed metaphases ( fig .
additional metaphase fish studies with bcr / abl1 probes showed the localization of two fusion signals on the isodicentric philadelphia chromosome and another fusion signal on the derivative chromosome 9 ( fig .
bcrabl1 fusion transcripts were at the level of 100% on the international scale ( is ) .
two weeks later , the wbc trended down to 40 10/l and ldh level was 299
the 3month followup visit showed complete hematological response , with the bone marrow showing morphologic remission and a normal karyotype ( 46,xy ) by unstimulated bone marrow culture .
however , pcr studies for the mutant transcript showed that there was lack of a major molecular response ( mmr , defined as < 0.1% on the is ) with bcrabl1 transcripts at 6.12% on the is .
the patient is clinically well and continues to be followed closely in the clinic at this time
. chronic myeloid leukemia ( cml ) is linked to the philadelphia chromosome t(9;22)(q34;q11.2 ) , which results in the formation of a chimeric bcrabl1 gene fusion . by binding to the kinase domain of abl1
, imatinib mesylate inhibits the function of the fusion gene and is a highly effective therapy .
. mechanisms of resistance against imatinib treatment may include mutations within the abl1 kinase domain , genomic bcrabl1 amplification and clonal evolution 1 .
very few cases of cml with the presence of idic(ph ) chromosome(s ) have been reported in the literature .
the idic(ph ) chromosome has generally been observed in accelerated phase or in blast phase of cml 2 , 3 .
in other cases , idic(ph ) chromosome(s ) were observed as a secondary chromosomal abnormality in patients resistant to imatinib mesylate or dasatinib 1 , 4 , 5 , 6 . in our patient ,
the idic(ph ) chromosome was observed at diagnosis with 3% blasts , suggesting the presence of idic(ph ) in chronic phase .
additional studies will help in clarifying the prognostic significance of the presence of idic(ph ) chromosome during the chronic phase of cml .
to date , only one other study reported the occurrence of idic(ph ) chromosome during chronic phase cml , and this case was associated with lack of hematological and cytogenetic response despite administering higher doses of imatinib 7 .
| key clinical messagean isodicentric philadelphia chromosome is an uncommon finding previously described as a secondary chromosomal abnormality in accelerated or blastphase of chronic myeloid leukemia ( cml ) with resistance to imatinib mesylate or dasatinib . here ,
we present a case with idic(ph ) chromosome identified at initial diagnosis in a patient with chronicphase cml . |
parkinson 's disease ( pd ) has traditionally been defined by cardinal motor features of tremor , rigidity , bradykinesia , and postural instability in the later stages , and has been attributed to dopamine deficiency reflective of degeneration in the nigrostriatal system .
there is increased emphasis on identifying premotor symptoms of pd when nonmotor features such as mild cognitive changes might characterize the earliest phases of the disease , prior to the stage of extensive neurodegeneration resulting in motor impairment .
although cognitive impairment in pd has been well accepted and a high incidence of dementia in the later stages has been demonstrated , the characteristic profiles suggestive of the underlying pathophysiological mechanisms remain unclear .
therefore , the extent to which dopamine depletion can explain mild cognitive deficits during the early stage of pd is of critical importance to elucidate neural mechanisms mediating the preclinical phase of pd and the pathophysiology of nonmotor features of the disease .
although neuropsychological deficits in pd have been clearly documented , the characteristic profiles based on disease duration and the underlying neuropathology implicated remain controversial .
this is especially the case when reviewing the literature on dopamine replacement therapy in cognition .
study findings have been inconsistent across cognitive task demands and may be partly related to failure to control for disease severity and daily levodopa doses .
nonetheless , mild cognitive impairment in pd is well accepted , and early cognitive impairment has demonstrated predictive validity for a later conversion to dementia as well as reductions in quality of life .
clinically , the expected cognitive profile of patients with pd has been described as a
subcortical syndrome with greater impairment in executive and attentional functions and less impairment in memory , language , and visuospatial functions , presumably related to the involvement of the frontostriatal system
. however , cognitive deficits in pd are heterogeneous , with some patients displaying memory deficits that may place them at greater risk for the development of dementia in the later stages of the disease , raising the question of whether extranigral pathology is implicated in early cognitive decline .
therefore , clear characterization of neuropsychological profiles early in the disease process is critical to elucidate the neuropathological basis of pd .
moreover , this will facilitate the identification of new therapeutic targets focused on treating the entire constellation of motor and nonmotor pd symptoms that are more likely to affect both the onset and progression of symptoms , resulting in disease - related disability .
evidence supporting the hypothesis that structural changes are present in the earliest stages of the disease is emerging , but the relationship between neuroimaging changes and neuropsychological deficits has not been studied extensively .
while neocortical atrophy has been described in pd patients with dementia , there may also be structural changes in cortical and subcortical regions in pd patients without dementia underlying mild cognitive deficits traditionally attributed primarily to frontostriatal dysfunction assumed to result from dopamine deficiency .
cortical thinning has been identified as being particularly pronounced in frontotemporal regions in early stages of pd , while regional cerebral glucose metabolism has implicated extensive hypometabolism in temporoparietal regions in pd patients with mild cognitive impairment .
consequently , there is growing evidence of the presence of extranigral pathology that likely occurs well before dopamine depletion , although it remains unclear which cognitive deficits can be attributed to dopaminergic loss as opposed to structural degeneration . to further elucidate the role of dopamine in cognitive deficits in pd , we evaluated the neuropsychological profile of nondemented early - stage pd patients compared to that of normal healthy controls and investigated the degree of dopaminergic modulation by evaluating patients both on and off dopaminergic medications .
in addition to investigating the role of dopamine in cognition , we also evaluated other disease - related predictors ( quality of life , levodopa daily dosage , motor impairment , age , etc . ) of mild cognitive deficits in early - stage pd .
the study population ( n = 82 ) consisted of 40 nondemented early - stage pd patients and 42 age- and education - matched normal controls .
healthy controls were recruited from the landon center on aging database and patients from the parkinson 's disease and movement disorder center at the kansas university medical center .
general enrollment criteria for healthy controls were as follows : ( i ) age 50 - 75 years ; ( ii ) right - handed defined as a score of > 60 on the edinburgh handedness inventory ( edin ) ; ( iii ) a minimum score of 26 out of 30 on the mini - mental state examination ( mmse ) , and ( iv ) no dementia as determined by the repeatable battery for the assessment of neuropsychological status ( rbans ; table 1 ) .
general exclusion criteria included a history of neurologic disorder other than pd , dementia , major psychiatric disorder ( including alcohol or substance abuse ) , concurrent , unstable , or serious medical condition , major head trauma , chronic use of psychoactive medications , and the presence of dyskinesia based on neurological examination .
the study was conducted in accordance with the declaration of helsinki and was approved by the institutional review boards of the kansas university medical center and the emory university school of medicine .
selection criteria for pd subjects included a diagnosis of idiopathic pd based on the united kingdom parkinson 's disease society brain bank criteria as well as on the criteria proposed by hughes et al . .
subjects selected had mild disease severity based on a hoehn and yahr rating of 2.5 , a unified parkinson 's disease rating scale ( updrs ) motor score of 20 or a updrs total score of 30 in the on medication state ( see table 2 for on and off medication values ) , and a mean disease duration of 5.7 years ( sd = 2.7 years ) .
all patients were prescribed levodopa with an average daily dosage of 597.5 mg ( sd = 288.7 ) as well as one of two dopamine agonists ( pramipexole = 47.5% ; ropinirole = 52.5% of the pd group ) .
all subjects were screened prior to enrollment to determine study eligibility ( see table 1 for screening measures ) .
a repeated - measures model was utilized for the study , with levodopa medication state ( on vs. off ) as the within - subjects factor and group ( control vs. pd ) as the between - subjects factor .
all subjects received two alternative forms of neuropsychological assessments on two visits , with an 8-week interval between visits to minimize practice effects .
the medication state was counterbalanced across visits 1 and 2 ( i.e. , one half of the subjects were in the on state for visit 1 , while the other half of the subjects were in the off medication state for visit 1 and vice versa ) .
the neuropsychological assessment included the rbans form a or alternate form b that provides subtest scores for immediate memory ( list learning , story memory ) , visuospatial / constructional ( figure copy , line orientation ) , language ( picture naming , semantic fluency ) , attention ( digit span , coding ) , and delayed memory ( list learning free recall and recognition , and story memory free recall , figure free recall ) domains ( see table 3 for specific measures included in the comprehensive neuropsychological battery ) .
additional measures of attention and inhibition were provided by subtests from the wechsler intelligence scale - fourth edition [ wais - iv digit span and letter - number sequencing ( lns ) ] and the stroop color and word test . several subtests measuring visuomotor integration , motor speed and cognitive flexibility ( trails 1 - 5 ) , fluency and switching , and planning functions ( tower test ) from the delis - kaplan executive function system ( d - kefs ) were also administered .
raw scores from neuropsychological tests were converted into z - scores based on the mean and sd of normal controls for each neuropsychological measure to allow for normalization across tests for comparison .
individual repeated - measures manovas were conducted for the attention / executive , language , memory , and visuospatial / visuomotor function domains , with group ( pd vs. controls ) as the between - subjects factor and medication state ( on vs. off ) as the within - subjects factor .
differences in the dependent measures were initially evaluated by multivariate measures of significance and followed with univariate analyses for main effects and interactions as appropriate .
the study population ( n = 82 ) consisted of 40 nondemented early - stage pd patients and 42 age- and education - matched normal controls .
healthy controls were recruited from the landon center on aging database and patients from the parkinson 's disease and movement disorder center at the kansas university medical center .
general enrollment criteria for healthy controls were as follows : ( i ) age 50 - 75 years ; ( ii ) right - handed defined as a score of > 60 on the edinburgh handedness inventory ( edin ) ; ( iii ) a minimum score of 26 out of 30 on the mini - mental state examination ( mmse ) , and ( iv ) no dementia as determined by the repeatable battery for the assessment of neuropsychological status ( rbans ; table 1 ) .
general exclusion criteria included a history of neurologic disorder other than pd , dementia , major psychiatric disorder ( including alcohol or substance abuse ) , concurrent , unstable , or serious medical condition , major head trauma , chronic use of psychoactive medications , and the presence of dyskinesia based on neurological examination .
the study was conducted in accordance with the declaration of helsinki and was approved by the institutional review boards of the kansas university medical center and the emory university school of medicine .
selection criteria for pd subjects included a diagnosis of idiopathic pd based on the united kingdom parkinson 's disease society brain bank criteria as well as on the criteria proposed by hughes et al . .
subjects selected had mild disease severity based on a hoehn and yahr rating of 2.5 , a unified parkinson 's disease rating scale ( updrs ) motor score of 20 or a updrs total score of 30 in the on medication state ( see table 2 for on and off medication values ) , and a mean disease duration of 5.7 years ( sd = 2.7 years ) .
all patients were prescribed levodopa with an average daily dosage of 597.5 mg ( sd = 288.7 ) as well as one of two dopamine agonists ( pramipexole = 47.5% ; ropinirole = 52.5% of the pd group ) .
all subjects were screened prior to enrollment to determine study eligibility ( see table 1 for screening measures ) .
a repeated - measures model was utilized for the study , with levodopa medication state ( on vs. off ) as the within - subjects factor and group ( control vs. pd ) as the between - subjects factor .
all subjects received two alternative forms of neuropsychological assessments on two visits , with an 8-week interval between visits to minimize practice effects .
the medication state was counterbalanced across visits 1 and 2 ( i.e. , one half of the subjects were in the on state for visit 1 , while the other half of the subjects were in the off medication state for visit 1 and vice versa ) .
the neuropsychological assessment included the rbans form a or alternate form b that provides subtest scores for immediate memory ( list learning , story memory ) , visuospatial / constructional ( figure copy , line orientation ) , language ( picture naming , semantic fluency ) , attention ( digit span , coding ) , and delayed memory ( list learning free recall and recognition , and story memory free recall , figure free recall ) domains ( see table 3 for specific measures included in the comprehensive neuropsychological battery ) .
additional measures of attention and inhibition were provided by subtests from the wechsler intelligence scale - fourth edition [ wais - iv digit span and letter - number sequencing ( lns ) ] and the stroop color and word test . several subtests measuring visuomotor integration , motor speed and cognitive flexibility ( trails 1 - 5 ) , fluency and switching , and planning functions ( tower test ) from the delis - kaplan executive function system ( d - kefs ) were also administered .
raw scores from neuropsychological tests were converted into z - scores based on the mean and sd of normal controls for each neuropsychological measure to allow for normalization across tests for comparison .
individual repeated - measures manovas were conducted for the attention / executive , language , memory , and visuospatial / visuomotor function domains , with group ( pd vs. controls ) as the between - subjects factor and medication state ( on vs. off ) as the within - subjects factor .
differences in the dependent measures were initially evaluated by multivariate measures of significance and followed with univariate analyses for main effects and interactions as appropriate .
healthy controls and pd subjects did not significantly differ in terms of age or strength of right handedness ; nevertheless , controls displayed slightly higher educational levels [ f(1 , 80 ) = 5.03 , p < 0.05 ; table 1 ] .
pd patients were nondemented based on their mmse scores and did not display clinically significant symptoms of anxiety or depression .
however , as expected , pd patients scored lower on the mmse than controls [ f(1 , 80 ) = 11.69 , p < 0.001 ] and endorsed more symptoms of anxiety [ f(1 , 80 ) = 42.34 , p < 0.001 ] and depression [ f(1 , 80 ) = 30.97 , p < 0.001 ; see table 1 for means and sd ] .
pd patients displayed higher updrs total scores ( t = 11.12 , p < 0.001 ) and updrs motor scores ( t = 10.66 , p <
0.001 ) in the off state compared to the on state , verifying adequate medication washout .
however , they did not differ in sleep or self - reported measures of anxiety or depression between medication states ( see table 2 for means and sd ) .
since education differences were identified between the pd and healthy control groups , education was investigated as a covariate in all models below .
the multivariate model for attention / executive subtests was significant for between - groups differences [ f(10 , 71 ) = 2.97 , p < 0.005 ] ; however , education did not significantly adjust the variance in dependent measures and thus was not utilized as a covariate .
all attention / executive subtests were statistically significant between the groups , demonstrating lower z - scores for pd subjects compared to controls , with the exception of the wais - iv digit span forward ( dsf ) and the stroop color and color - word tests ( see table 3 for univariate values ) .
a comparison of the effect sizes revealed the greatest significance for the d - kefs tower total completion time , followed by the wais - iv lns and stroop word scores .
however , an evaluation of the z - scores revealed a very subtle decline in the attention / executive measures for early - stage pd patients of less than 1 sd below the mean of healthy controls .
a medication effect was only evident for the digit span total [ dst ; f(1 , 80 ) = 5.01 , p = 0.012 , = 0.10 ] and the dsf [ f(1 , 80 ) = 6.56 , p = 0.028 , = 0.08 ] .
pd patients displayed significantly greater impairment on the dst ( dstoff = 0.588 ; dston = 0.356 ) and the dsf ( dsfoff = 0.322 ; dsfon = 0.101 ) in the off medication state , although they did not differ from controls on the dsf and barely reached significance for the dst .
the multivariate model for language subtests was significant for between - groups differences [ f(6 , 75 ) = 2.94 , p = 0.012 ] but not for within - subjects medication effects .
all language subtests were significant between - groups , with the exception of d - kefs letter fluency ( table 3 ) .
pd patients displayed lower scores on all language subtests ; however , the rbans picture naming subtest displayed the greatest level of impairment and the largest effect size , with pd patients falling 1.45 sd below the means of normal controls ( table 3 ) .
conversely , across fluency measures , pd patients were only 0.27 to 0.55 sd below normal controls . when education was utilized as a covariate , as it significantly adjusted for language functions at the multivariate level [ f(6 , 74 ) = 3.26 , p = 0.007 ] , the d - kefs fluency measures were no longer significant .
the rbans picture naming scores remained highly significant ( p < 0.001 ) , while the rbans semantic fluency scores only approached significance ( p = 0.057 ) .
the multivariate model revealed a between - groups significance across memory subtests [ f(6 , 75 ) = 4.52 , p < 0.001 ] , but within - subjects effects for medication as well as education as a covariate were not significant .
pd subjects scored lower than normal controls in all learning and memory measures on the rbans , although effect sizes were the largest for story delayed recall , list recognition , and list recall ( table 3 ) .
impairment indices based on z - scores revealed that early - stage pd patients scored from 0.76 to 1.41 sd below the mean of normal controls .
the multivariate model revealed between - groups significance across visuomotor / visuospatial subtests [ f(8 , 73 ) = 2.89 , p = 0.007 ] , but there was no within - subjects significance for medication .
pd patients scored significantly below normal controls on all subtests , with the exception of rbans line orientation .
effect sizes were greatest for d - kefs trails 5 ( motor ) , d - kefs trails 2 ( number ) , and rbans coding . however , impairment indices were greatest for d - kefs trails 3 and 4 ( letter and number - letter alternation ) , displaying the most significant deviation relative to controls ( 1.79 and 1.8 ) across the entire neuropsychological battery .
although education significantly adjusted for the variance in the model when utilized as a covariate [ f(8 , 72 ) = 2.63 , p = 0.014 ] , the significance of the subtests remained unchanged . based on effect sizes and impairment indices , the following neuropsychological measures from each cognitive domain were selected as stepwise predictors for a multiple regression model to identify the best predictors of cognitive impairment in early - stage pd patients relative to normal controls : lns , d - kefs tower completion time , stroop word , rbans naming , rbans memory ( list learning , list recall , story recall , and figure recall ) , d - kefs trails 2 , 4 , and 5 , and rbans coding . after controlling for age and education [ accounting for only 6.9% of the variance ; f(2 , 79 ) = 2.91 , p = 0.061 ] , trails 5 [ motor ; f(3 , 78 ) = 9.31 , p < 0.0001 ] and rbans list recall [ f(3 , 78 ) = 10.06 , p < 0.0001 ] were the best predictors of early - stage pd cognitive impairment , accounting for an additional 19.5 and 7.9% of the variance , respectively . in a second regression model that eliminated visuomotor tasks ( i.e. , trails ) ,
f(3 , 78 ) = 8.89 , p < 0.0001 ] , lns [ an additional 8.5% ; f(4 , 77 ) = 9.86 , p < 0.0001 ] , and figure recall [ an additional 3.9% ; f(5 , 76 ) = 9.24 ,
p < 0.0001 ] were the best predictors and explained a combined 37.8% of the variance in terms of cognitive impairment in early - stage pd ( table 4 ) . to expand on the above regression analyses ,
the performance of each significant predictor was utilized in separate regression models to determine disease - related predictors of cognitive performance in early - stage pd .
the predictors entered into the equation for each model ( after forcing age and education into the first step of the regression ) included daily levodopa dosage , disease duration , and either on or off scores for the updrs motor , parkinson 's disease questionnaire 39 ( pdq-39 ) , epworth sleepiness scale ( ep ) , parkinson 's disease sleep scale ( pdss ) , beck anxiety inventory ( bai ) , and beck depression inventory ii ( bdi - ii ) .
cognitive performance was modeled both for on and off medication states , with the corresponding appropriate variables in either the on or off medication state utilized as predictors .
the first set of regression analyses for the off medication state is presented in table 4 .
age and education significantly accounted for 27.1% of the variance [ f(2 , 37 ) = 8.06 , p < 0.001 ] for rbans list recall in the off state , while the pdq-39 in the off medication state explained an additional 12% of the variance [ f(3 , 36 ) = 8.76 , p < 0.001 ] .
following age and education [ accounting for 24.4% of the variance ; f(2 , 37 ) = 5.79 , p = 0.007 ] , rbans figure recall in the off state was best predicted by disease duration , explaining an additional 11.5% of the variance [ f(3 , 36 ) = 6.52 , p = 0.001 ] .
wais - iv lns performance in the off state was predicted by age and education [ 25.3% of the variance ; f(2 , 37 ) = 6.08 , p = 0.005 ] , followed by the pdq-39 in the off state , explaining an additional 8.5% of the variance [ f(3 , 36 ) = 5.95 , p = 0.002 ] .
finally , 30.2% of the variance in the d - kefs trails 5 performance in the off state was explained by age and education [ f(2 , 37 ) = 7.79 , p = 0.002 ] , with the bai explaining an additional 9.8% of the variance [ f(3 , 36 ) = 7.76 , p = 0.001 ] .
the same dependent cognitive measures were evaluated in the on medication state , but the disease predictors were not significant with the exception of d - kefs trails 5 , which measures motor speed .
after accounting for the variance from age and education [ 32% of the variance ; f(2 , 37 ) = 8.69 , p = 0.001 ] , the updrs motor score in the on state accounted for an additional 9.6% of the variance in the d - kefs trails 5 performance in the on state [ f(3 , 36 ) = 8.56 , p = 0.001 ] .
healthy controls and pd subjects did not significantly differ in terms of age or strength of right handedness ; nevertheless , controls displayed slightly higher educational levels [ f(1 , 80 ) = 5.03 , p < 0.05 ; table 1 ] .
pd patients were nondemented based on their mmse scores and did not display clinically significant symptoms of anxiety or depression .
however , as expected , pd patients scored lower on the mmse than controls [ f(1 , 80 ) = 11.69 , p < 0.001 ] and endorsed more symptoms of anxiety [ f(1 , 80 ) = 42.34 , p < 0.001 ] and depression [ f(1 , 80 ) = 30.97 , p < 0.001 ; see table 1 for means and sd ] .
pd patients displayed higher updrs total scores ( t = 11.12 , p < 0.001 ) and updrs motor scores ( t = 10.66 , p <
0.001 ) in the off state compared to the on state , verifying adequate medication washout .
however , they did not differ in sleep or self - reported measures of anxiety or depression between medication states ( see table 2 for means and sd ) .
since education differences were identified between the pd and healthy control groups , education was investigated as a covariate in all models below .
the multivariate model for attention / executive subtests was significant for between - groups differences [ f(10 , 71 ) = 2.97 , p < 0.005 ] ; however , education did not significantly adjust the variance in dependent measures and thus was not utilized as a covariate .
all attention / executive subtests were statistically significant between the groups , demonstrating lower z - scores for pd subjects compared to controls , with the exception of the wais - iv digit span forward ( dsf ) and the stroop color and color - word tests ( see table 3 for univariate values ) .
a comparison of the effect sizes revealed the greatest significance for the d - kefs tower total completion time , followed by the wais - iv lns and stroop word scores .
however , an evaluation of the z - scores revealed a very subtle decline in the attention / executive measures for early - stage pd patients of less than 1 sd below the mean of healthy controls .
a medication effect was only evident for the digit span total [ dst ; f(1 , 80 ) = 5.01 , p = 0.012 , = 0.10 ] and the dsf [ f(1 , 80 ) = 6.56 , p = 0.028 , = 0.08 ] .
pd patients displayed significantly greater impairment on the dst ( dstoff = 0.588 ; dston = 0.356 ) and the dsf ( dsfoff = 0.322 ; dsfon = 0.101 ) in the off medication state , although they did not differ from controls on the dsf and barely reached significance for the dst .
the multivariate model for language subtests was significant for between - groups differences [ f(6 , 75 ) = 2.94 , p = 0.012 ] but not for within - subjects medication effects .
all language subtests were significant between - groups , with the exception of d - kefs letter fluency ( table 3 ) .
pd patients displayed lower scores on all language subtests ; however , the rbans picture naming subtest displayed the greatest level of impairment and the largest effect size , with pd patients falling 1.45 sd below the means of normal controls ( table 3 ) .
conversely , across fluency measures , pd patients were only 0.27 to 0.55 sd below normal controls . when education was utilized as a covariate ,
as it significantly adjusted for language functions at the multivariate level [ f(6 , 74 ) = 3.26 , p = 0.007 ] , the d - kefs fluency measures were no longer significant .
the rbans picture naming scores remained highly significant ( p < 0.001 ) , while the rbans semantic fluency scores only approached significance ( p = 0.057 ) .
the multivariate model revealed a between - groups significance across memory subtests [ f(6 , 75 ) = 4.52 , p < 0.001 ] , but within - subjects effects for medication as well as education as a covariate were not significant .
pd subjects scored lower than normal controls in all learning and memory measures on the rbans , although effect sizes were the largest for story delayed recall , list recognition , and list recall ( table 3 ) .
impairment indices based on z - scores revealed that early - stage pd patients scored from 0.76 to 1.41 sd below the mean of normal controls .
the multivariate model revealed between - groups significance across visuomotor / visuospatial subtests [ f(8 , 73 ) = 2.89 , p = 0.007 ] , but there was no within - subjects significance for medication .
pd patients scored significantly below normal controls on all subtests , with the exception of rbans line orientation .
effect sizes were greatest for d - kefs trails 5 ( motor ) , d - kefs trails 2 ( number ) , and rbans coding
. however , impairment indices were greatest for d - kefs trails 3 and 4 ( letter and number - letter alternation ) , displaying the most significant deviation relative to controls ( 1.79 and 1.8 ) across the entire neuropsychological battery . although education significantly adjusted for the variance in the model when utilized as a covariate [ f(8 , 72 ) = 2.63 , p = 0.014 ] , the significance of the subtests remained unchanged .
based on effect sizes and impairment indices , the following neuropsychological measures from each cognitive domain were selected as stepwise predictors for a multiple regression model to identify the best predictors of cognitive impairment in early - stage pd patients relative to normal controls : lns , d - kefs tower completion time , stroop word , rbans naming , rbans memory ( list learning , list recall , story recall , and figure recall ) , d - kefs trails 2 , 4 , and 5 , and rbans coding . after controlling for age and education [ accounting for only 6.9% of the variance ; f(2 , 79 ) = 2.91 , p = 0.061 ] , trails 5 [ motor ; f(3 , 78 ) = 9.31 , p < 0.0001 ] and rbans list recall [ f(3 , 78 ) = 10.06 ,
p < 0.0001 ] were the best predictors of early - stage pd cognitive impairment , accounting for an additional 19.5 and 7.9% of the variance , respectively . in a second regression model that eliminated visuomotor tasks ( i.e. , trails ) ,
rbans list recall [ 18.6% of the variance ; f(3 , 78 ) = 8.89 , p < 0.0001 ] , lns [ an additional 8.5% ; f(4 , 77 ) = 9.86 , p < 0.0001 ] , and figure recall [ an additional 3.9% ; f(5 , 76 ) = 9.24 , p < 0.0001 ] were the best predictors and explained a combined 37.8% of the variance in terms of cognitive impairment in early - stage pd ( table 4 ) . to expand on the above regression analyses ,
the performance of each significant predictor was utilized in separate regression models to determine disease - related predictors of cognitive performance in early - stage pd .
the predictors entered into the equation for each model ( after forcing age and education into the first step of the regression ) included daily levodopa dosage , disease duration , and either on or off scores for the updrs motor , parkinson 's disease questionnaire 39 ( pdq-39 ) , epworth sleepiness scale ( ep ) , parkinson 's disease sleep scale ( pdss ) , beck anxiety inventory ( bai ) , and beck depression inventory ii ( bdi - ii ) .
cognitive performance was modeled both for on and off medication states , with the corresponding appropriate variables in either the on or off medication state utilized as predictors .
the first set of regression analyses for the off medication state is presented in table 4 .
age and education significantly accounted for 27.1% of the variance [ f(2 , 37 ) = 8.06 , p < 0.001 ] for rbans list recall in the off state , while the pdq-39 in the off medication state explained an additional 12% of the variance [ f(3 , 36 ) = 8.76 , p < 0.001 ] .
following age and education [ accounting for 24.4% of the variance ; f(2 , 37 ) = 5.79 , p = 0.007 ] , rbans figure recall in the off state was best predicted by disease duration , explaining an additional 11.5% of the variance [ f(3 , 36 ) = 6.52 , p = 0.001 ] .
wais - iv lns performance in the off state was predicted by age and education [ 25.3% of the variance ; f(2 , 37 ) = 6.08 , p = 0.005 ] , followed by the pdq-39 in the off state , explaining an additional 8.5% of the variance [ f(3 , 36 ) = 5.95 , p = 0.002 ] .
finally , 30.2% of the variance in the d - kefs trails 5 performance in the off state was explained by age and education [ f(2 , 37 ) = 7.79 , p = 0.002 ] , with the bai explaining an additional 9.8% of the variance [ f(3 , 36 ) = 7.76 , p = 0.001 ] .
the same dependent cognitive measures were evaluated in the on medication state , but the disease predictors were not significant with the exception of d - kefs trails 5 , which measures motor speed .
after accounting for the variance from age and education [ 32% of the variance ; f(2 , 37 ) = 8.69 , p = 0.001 ] , the updrs motor score in the on state accounted for an additional 9.6% of the variance in the d - kefs trails 5 performance in the on state [ f(3 , 36 ) = 8.56 , p = 0.001 ] .
our study results reveal clear statistical differences between healthy controls and early - stage pd patients across all cognitive domains . based on impairment indices and effect sizes , the most pronounced differences emerged for visuomotor and verbal memory functions . while impairment was also evident for working memory and planning functions ,
which is consistent with the expected frontostriatal cognitive dysfunction in pd , the impairment indices and effect sizes for these measures were not as impressive .
similarly , simple attentional and visuospatial functions were unimpaired , and our findings reveal that visuomotor and visuospatial functions previously attributed to cognitive decline are likely the result of motor impairment . while between - groups differences in fluency were present , these were accounted for based on educational differences . furthermore , dopaminergic modulation as measured by differences between on and off medication states was only significant for simple attentional measures that displayed the least deviation from normal controls
. therefore , our results support the early presence of cognitive deficits across most cognitive domains ; however , dopaminergic depletion was not capable of accounting for the mild cognitive deficits present at this early stage of the neurodegenerative process . a clear segregation of cognitive deficits identified early in the course of pd , attributable to extranigral sources , and dopamine - dependent attentional and motor functions is supported by our study findings .
the results indicate that cognitive deficits are present in the earliest stages of the disease prior to dopamine - mediated cognitive dysfunction and implicate an early involvement of nondopaminergic systems previously considered ( e.g. , noradrenergic locus coeruleus , serotonergic raphe nuclei , or early involvement of cholinergic structures in the forebrain ) or alternatively structural changes in frontal and temporoparietal association cortices involved in mild cognitive deficits .
impairment on tests of visuomotor integration , planning , and working memory functions replicate previously documented frontostriatal deficits in pd , although , apart from motor task demands , they were not the most pronounced and did not respond to dopaminergic medications .
these findings are not congruent with previous descriptions of cognition in nondemented pd patients but may be partly related to differences in disease severity . in summary ,
our findings raise the question of whether extranigral pathology is present before dopamine depletion given the presence of extensive cognitive deficits that did not differ between medication states .
however , evidence of prominent memory impairment is consistent with previously identified extensive hypometabolism in temporoparietal regions in pd patients with cognitive impairment . disease - related predictors in the regression model were not capable of explaining the cognitive impairment in the on medication state but conversely explained the cognitive variance while off medication .
while these findings are suggestive of differences based on dopamine mediation , most of the variance for cognitive performance in the off medication state was explained by age and the pdq-39 , as opposed to other , more pertinent , disease predictors or levodopa dosage .
a positive correlation between increasing age and cognitive dysfunction has been previously documented as being predictive of a more rapid disease progression in pd .
overall , the results of the regression reflect increased health - related concerns for pd patients in the off medication state and are congruent with other reports in the literature regarding the predictive relationship between cognitive impairment in pd and quality of life .
however , in our study , subjects were evaluated after 8 weeks between visits , and patients only discontinued medications the night before the evaluation .
thus , the relationship between the pdq-39 and the off medication state is more likely related to a transient increase in health - related concerns rather than being indicative of the impact of cognitive deficits on sustained quality of life , as has been previously suggested .
alternatively , it is conceivable that transient changes in mood related to increased symptoms in the off medication state could explain our findings ( this is also supported by the significant prediction of anxiety symptoms by the trails 5 performance ) as well as a relationship between pdq-39 and mood measures which has been previously established .
a strong predictor of cognitive deficits in pd relative to controls was nonverbal memory recall , and this in turn was predicted by disease duration in the off medication state .
these findings suggest that memory impairments in pd are progressive throughout the course of the disease , which is consistent with the amyloid burden in pd that predicts cognitive decline over time
. however , progressive decline in nonverbal memory following dopamine replacement therapy has been reported in de novo patients and could conceivably be an alternate explanation . in summary , our investigation does not support a dopaminergic basis for early cognitive deficits in pd , and the least impaired cognitive functions were attentional tasks associated with the dorsal frontostriatal circuitry implicated in early - stage pd and dopamine depletion .
our findings are in line with investigations of mild cognitive impairment identifying greater memory than executive deficits in the early stages of pd , although there were differences in complex attentional and executive subtests with emphasis on planning and working memory functions , displaying some sensitivity to cognitive deficits related to the frontostriatal circuitry .
these frontostriatal deficits have traditionally been assumed to be secondary to dopamine deficiency , but based on our results , cortical thinning identified as being particularly pronounced for frontotemporal regions in early stages of pd is a more plausible explanation .
overall , these findings challenge previously described stages of pathological progression and raise the question of the neuropathological basis for pd - associated cognitive deficits present in the earliest stages of the disease process that do not appear to be associated with significant dopamine depletion .
future longitudinal studies evaluating cognitive deficits in pd with a clear identification of the relationship with both structural and functional neuroimaging findings based on disease stage or disease duration will help elucidate the extranigral basis of cognitive deficits in pd . | aimthe aim of this study was to identify mild cognitive deficits in parkinson 's disease ( pd ) prior to extensive neurodegeneration and to evaluate the extent to which dopamine depletion and other disease - related predictors can explain cognitive profiles.methodsneuropsychological performances of 40 nondemented early - stage pd patients and 42 healthy controls were compared across on or off dopaminergic medications .
stepwise regression evaluated cognitive predictors of early - stage pd and disease - related predictors of pd cognition ( levodopa dose , disease duration , unified parkinson 's disease rating scale score , sleep , quality of life , and mood ) across on and off states.resultsneuropsychological performance was lower in pd patients across cognitive domains with significant memory , naming , visuomotor , and complex attention / executive deficits , but with intact visuospatial , simple attention , and phonemic fluency functions .
however , medication effects were absent except for simple attention .
regression analyses revealed age , working memory , and memory recall to be the best cognitive predictors of pd , while age , quality of life , disease duration , and anxiety predicted pd cognition in the off state.conclusionnondemented early - stage pd patients presented with extensive mild cognitive deficits including prominent memory impairment .
the profile was inconsistent with expected isolated frontostriatal dysfunction previously attributed to dopamine depletion and this highlights the need to further characterize extranigral sources of mild cognitive impairment in pd . |
ginger , the rhizome of zingiber
officinale , has
been cultivated as both a ubiquitous spice and a traditional medicinal
food for thousands of years .
its many
curative properties include treatment of nausea and dyspepsia , ameliorating
symptoms of arthritis via anti - inflammation , and therapeutic activity
against asthma , respiratory disorders , and rheumatic ailments .
most recently , pharmacologically active components of ginger have
been implicated in chemoprevention via numerous mechanisms .
gingerols
and shogaols have been identified as the most active ingredients in
ginger .
shogaols , the products of ginger thermal processing , consistently
show greater anticarcinogenic activity than gingerols , with -shogaol
( 6s ) being the most abundant one followed by - and -shogaol
( 10s and 8s ) ( figure 1a ) .
in particular , 6s has repeatedly shown strong chemopreventive
activity against colorectal cancer , the third most common cancer diagnosed
in the united states . m2
and m2 serve as a carrier to their parent compounds
- and -shogaol ( 8s and 10s ) , respectively
. chemical structures
of shogaols ( a ) and their cysteine - conjugated metabolites ( b ) ; hplc - ecd
chromatograms representing the metabolic profiles of 8s , m2 ,
10s , and m2 in human colon normal cells , ccd-18co ( c , f ) ,
and human colon cancer cells , hct-116 ( d , g ) and ht-29 ( e , h ) . therapeutics with high anticancer
potency often come under scrutiny
for their accompanying toxicity against noncancerous cells in the
viable organism .
consequently , there is escalating interest in employing
dietary components and their metabolic constituents as less noxious
treatments toward chemoprevention .
our group has recently
established that the reactive ginger component 6s is extensively metabolized
in mice and in cancer cells and that redox transformation
and a phase ii mercapturic acid pathway ( map ) are its major metabolic
routes .
as previously reported , an initial reaction
between the ,-unsaturated ketone functional group of
6s and the cysteine sulfhydryl component of gsh takes place in the
map , giving rise to the corresponding conjugates .
the conjugates then
undergo series of enzymatic modifications on the gsh moiety , forming
cysteinylglycine , cysteine , and finally n - acetylcysteine
conjugates .
additional studies show that both 8s and 10s are also
metabolized in humans through the map and the cysteine - conjugated
metabolites , m2 and m2 , respectively ( figure 1b ) , were identified as their major metabolites in
human urine . phase ii metabolism products
such as thiol conjugates are more water - soluble and often less toxic
and pungent than their parent compounds , making them preferable for
chemoprevention trials .
our group recently
investigated the bioactivity of the cysteine - conjugated metabolite
of -shogaol ( m2 ) and its putative mode of action as a hydrophilic
carrier of the parent molecule to its site of efficacy .
we established
that cysteine - conjugation reduced the toxicity of 6s against normal
human colon and lung fibroblast cells while still retaining efficacy
against human colon and lung cancer cells . through a series of chemical stability and biological assays
, we
demonstrated the function of m2 as a carrier of 6s to its active site ,
wherein the parent compound is rendered less toxic but regains potency
and similar bioactivity upon deconjugation .
it is still unknown whether m2 and m2 behave in
a similar manner to m2 , in both efficacy as anticancer agents and
metabolically . as an expansion of our proposed chemical mechanism
for cysteine conjugates as carriers of their parent molecule shogaols
,
we investigated whether m2 and m2 are the respective
carriers of 8s and 10s in cancer cells and can induce apoptosis through
a mechanism similar to m2 .
although we have established the
functionality and importance of
m2 , its mechanism of action against colon cancer cells has not been
completely elucidated .
there have been studies implicating 6s as a
pro - apoptotic agent , via reactive oxygen species ( ros ) production
and subsequent growth arrest and dna damage ( gadd)-inducible transcription
factor 153 ( gadd153 ) expression in colo 205 cells , an inducer of g2/m arrest and aberrant mitotic
cell death associated with tubulin aggregation in hct-116 colon carcinoma
cells , and an inhibitor of colon cancer
cell proliferation through activation of peroxisomal proliferator
activated receptor ( ppar ) .
given the significance of m2 as a potential therapeutic with selective
toxicity toward cancerous cells , the impetus of this study is also
to determine the mechanistic role m2 plays in promoting apoptosis
in human colon cancer cells hct-116 and ht-29 . in particular , examining
the impact of m2 in colon cancer cells containing wild - type p53 ( hct-116 ) and mutant p53 ( ht-29 ) will
be emphasized . the progressive loss or inactivation of p53 is well associated with the corresponding advancement of cancer
to more aggressive stages , and is one of the most prevalent genetic
defects in human malignancies that often correlates to chemotherapeutic
resistance .
thus , determining whether the bioactivity of m2 ,
m2 , or m2 is dependent upon p53 status
is of critical concern in terms of cancer prevention , since usable
compounds must be able to exert their activity through the early mutations
stages of cancer .
hct-116 and ht-29 human colon cancer cells ,
ccd-18co human fibroblast cells derived from colon , and eagle s
minimum essential media ( emem ) were obtained from american type tissue
culture ( manassas , va ) .
supplements of fetal bovine
serum ( fbs ) and penicillin / streptomycin were purchased from gemini
bio - products ( west sacramento , ca ) .
6s , 8s ,
and 10s were purified from ginger
extract in our laboratory .
hplc - grade solvents and other reagents were obtained from vwr international
( south plainfield , nj ) .
lc / ms grade solvents and other reagents were
obtained from thermo fisher scientific ( rockford , il ) .
glutathione
was obtained from sigma - aldrich ( st . louis , mn ) .
crystal violet , glutaraldehyde ,
mtt [ 3-(4,5-dimethylthiaxol-2-yl)-2,5-diphenyltetrazolium bromide ] ,
and propidium iodide were procured from thermo fisher scientific ( waltham ,
ma ) . primary antibodies against -actin , b - cell lymphoma 2 ( bcl-2 ) ,
caspase 9 , caspase 3 , cytochrome c , puma ( p53 up - regulated
modulator of apoptosis ) , p53 , xiap ( x - linked inhibitor of apoptosis
protein ) , as well as secondary antibodies conjugated to hrp ( horseradish
peroxidase ) against mouse and rabbit were purchased from cell signaling
technology ( beverly , ma ) . a high - performance
liquid chromatrography / esa
electrochemical detector ( hplc - ecd ) ( esa , chelmsford , ma ) consisting
of an esa model 584 hplc pump , an esa model 542 autosampler , an esa
organizer , and an esa electrochemical detector ( ecd ) coupled with
two esa model 6210 four sensor cells was used .
a gemini c18 column
( 150 mm 4.6 mm , 5 m ; phenomenex , torrance , ca ) was used
for chromatographic analysis at a flow rate of 1.0 ml / min .
the mobile
phases consisted of solvent a ( 30 mm sodium phosphate buffer containing
1.75% acn and 0.125% thf , ph 3.35 ) and solvent b ( 15 mm sodium phosphate
buffer containing 58.5% acn and 12.5% thf , ph 3.45 ) . the gradient
elution had the following profile : 20% b from 0 to 3 min ; 2055%
b from 3 to 11 min ; 5560% b from 11 to 12 min ; 6065%
b from 12 to 13 min ; 65100% b from 13 to 40 min ; 100% b from
40 to 45 min ; then 20% b from 45.1 to 50 min .
the cells were then
cleaned at a potential of 1000 mv for 1 min .
the eluent was monitored by the coulochem
electrode array system ( ceas ) with potential settings at 200 , 250 ,
300 , 350 , 400 , 450 , and 500 mv .
data for figure 1 were from the channel set at 350 mv of the ceas .
lc / ms analysis was carried out with
a thermo - finnigan spectra system , which consisted of an accela high - speed
ms pump , an accela refrigerated autosampler , and an ltq velos ion
trap mass detector ( thermo electron , san jose , ca ) incorporated with
heated electrospray ionization ( h - esi ) interfaces . a gemini c18 column ( 50 mm 2.0 mm i.d .
, 3 m ; phenomenex ,
torrance , ca ) was used for separation at a flow rate of 0.2 ml / min .
the column was eluted from 100% solvent a ( 5% aqueous methanol with
0.2% acetic acid ) for 3 min , followed by linear increases in b ( 95%
aqueous methanol with 0.2% acetic acid ) to 40% from 3 to 15 min , to
91% from 15 to 49 min , and to 100% from 49 to 50 min , and then with
100% b from 50 to 55 min .
the positive ion polarity mode was set for the h - esi source with the
voltage on the h - esi interface maintained at approximately 4.5 kv .
optimized
source parameters , including esi capillary temperature ( 300 c ) ,
capillary voltage ( 50 v ) , ion spray voltage ( 3.6 kv ) , sheath gas flow
rate ( 30 units ) , auxiliary gas flow rate ( 5 units ) , and tube lens
( 120 v ) , were tuned using authentic 6s .
the collision - induced dissociation
( cid ) was conducted with an isolation width of 2 da and normalized
collision energy of 35 for ms and ms .
default
automated gain control target ion values were used for ms ms analyses .
data acquisition was performed with
xcalibur 2.0 version ( thermo electron , san jose , ca ) .
the
experimental procedure to synthesize m2 and m2 was
similar to that of m2 . in brief , a catalytic
amount of nahco3 ( 1.3 mg , 0.015 mmol ) was added to a mixture
of 8s ( 91.2 mg , 0.3 mmol ) and cysteine ( 54 mg , 0.45 mmol ) in methanol / water
( 6 ml , 1:1 , v / v ) .
the mixture was stirred at room temperature for
24 h , and adjusted to ph 6 with a diluted acetic acid solution ( 0.1
m ) .
the mixture was then purified by preparative hplc to give m2
as a white solid ( 70 mg , yield 55% ) .
shogaol 10s ( 100 mg , 0.3 mmol )
instead of 8s was used in the above reaction to give m2 ( 73
mg , yield 54% ) .
waters preparative hplc systems with
2545 binary gradient module ,
waters 2767 sample manager , waters 2487 autopurification flow cell ,
waters fraction collector iii , dual injector module , and 2489 uv / visible
detector were used to separate m2 or m2 from the reaction
mixture .
a phenomenex gemini - nx c18 column ( 250 mm
30.0 mm i.d . , 5 m ) was used with a flow rate of 20.0 ml / min .
the mobile phase consisted of solvent
a ( h2o + 0.1% formic acid ) and solvent b ( meoh + 0.1% formic
acid ) .
the reaction mixture of m2 was injected to the preparative
column and eluted with a gradient solvent system ( 75% to 87% b from
0 to 12 min ; to 75% b from 12 to 12.5 min ; then 75% b from 12.5 to
15 min ) .
a total of six runs resulted in 70 mg of m2 ( tr 9.45 min ) . similarly
, reaction mixture of
m2 was injected to the preparative column and eluted with
a gradient solvent system ( 85% to 100% b from 0 to 15 min ; then 100%
b from 15 to 16 min ; to 85% b from 16 to 16.5 min ; then 85% b from
16.5 to 20 min ) .
a total of seven runs resulted in 73 mg of m2
( tr 8.13 min ) .
h ( 600
mhz ) , and c ( 150 mhz ) nmr spectra of m2 and m2
in cd3od were acquired on a bruker avance 600 mhz nmr spectrometer
( bruker , inc . ,
the h and c nmr data of m2 and m2 are listed
in table 1 .
assignments interchangeable . cells ( 1.0 10 ) were plated
in six - well culture plates and were allowed to attach for 24 h at
37 c in 5% co2 incubator .
shogaol 8s or 10s in dmso
or the corresponding cysteine - conjugated metabolites m2 and
m2 were diluted in mccoy s 5a medium ( containing 10%
fetal bovine serum , 1% penicillin / streptomycin , and 1% glutamine )
to reach a final concentration of 10 m and were incubated with
different colon cancer cell lines ( hct-116 or ht-29 ) . at different
time points ( 0 , 2 , 4 , 8 , 24 , and 48 h ) ,
190 l samples of supernatant
were taken and transferred to vials containing 10 l of 2% acetic
acid to stabilize these compounds and their respective metabolites .
the supernatant was harvested , and the samples were then analyzed
by hplc - ecd .
briefly ,
human colon fibroblast cells , ccd-18co , or human colon cancer cells ,
hct-116 or ht-29 , were plated in 96-well microtiter plates with 3000
cells / well and allowed to attach for 24 h at 37 c and 5% co2 .
the test compounds ( in dmso ) were added to cell culture
medium to desired final concentrations ( final dmso concentrations
for control and treatments were 0.1% ) .
after the cells were cultured
for 24 h , the medium was aspirated , and cells were treated with 200
l of fresh medium containing 2.41 mmol / l mtt .
after incubation
for 3 h at 37 c , the medium containing mtt was aspirated , 100
l of dmso was added to solubilize the formazan precipitate ,
and the plates were shaken gently for an hour at room temperature .
absorbance values were derived from the plate reading at 550 nm on
a biotek ( winooski , vt ) microtiter plate reader .
the reading reflected
the number of viable cells and was expressed as a percentage of viable
cells in the control .
ccd-18co cells were grown in emem . both hct-116
and ht-29 cells were cultured in mccoy s 5a medium .
all of
the above media were supplemented with 10% fetal bovine serum , 1%
penicillin / streptomycin , and 1% glutamine , and the cells were kept
in a 37 c incubator with 95% humidity and 5% co2 .
apoptosis was determined by facs
analysis of propidium iodide ( pi)-stained cells . in brief ,
cells were
trypsinized , washed with cold phosphate - buffered saline ( pbs ) , fixed
in ice - cold 70% ethanol for 1 h , and then resuspended in 2 ml of pbs
supplemented with 10 l of rnase ( 100 mg / ml ) and incubated at
37 c for 30 min .
after incubation , dna was stained with 1 mg / ml
pi in pbs .
cell staining was analyzed using a cell lab quantatm sc
flow cytometer ( beckman coulter , danvers , ma ) , and data were processed
using fcs express software ( denovo software , los angeles , ca ) .
the
percentage of apoptotic cells in each sample was determined based
on the sub - g0 peaks detected in monoparametric
histograms .
this assay employed
the cell - permeable fluorogenic probe 2,7-dichlorodihydrofluorescein
diacetate [ dcfh - da ] ( sigma - aldrich , st .
louis , mo ) to measure the
relative changes in o2 and h2o2 levels
in hct-116 or ht-29 cells after treatment with 5 , 10 , and 20 m
6s or m2 ( or dmso ) over 0 , 2 , 4 , 8 , and 24 h. in brief , dcfh - da is
diffused into cells and is deacetylated by cellular esterases to nonfluorescent
2,7-dichlorodihydrofluorescein ( dcfh ) , which is rapidly
oxidized to highly fluorescent 2,7-dichlorofluorescein
( dcf ) by intracellular hydrogen peroxide or other low molecular weight
peroxides .
measured fluorescence intensity
is thus proportional to the amount of such peroxides in the cell at
a given time .
human colon cancer cells hct-116 or ht-29 were seeded
in 96-well black - sided , clear - bottomed culture plates , with 5000 cells / well
and were allowed to adhere for 24 h in a 37 c incubator with
5% co2 .
media was aspirated , and 5 , 10 , or 20 m
m2 , 6s , or dmso diluted in media was added to designated wells , which
were run in triplicate .
after desired incubation times of 0 , 2 , 4 ,
8 , or 24 h , media and test compounds were aspirated .
cells were washed
three times with 200 l of pbs before addition of 100 l
of 1 mm dcfh - da .
the fluorogenic probe permeated cell membranes and
was processed to dcf for 1 h at 37 c .
after incubation , plates
were immediately placed in a biotek microplate reader to measure fluorescence
at wavelengths of 485 ( excitation ) and 528 ( emission ) .
raw values
were normalized to dmso control for each time point and are presented
as fold induction versus 0 h time point ( n = 3 ) .
cell lysates were prepared in
ice - cold ripa lysis buffer [ 25 mm tris - hcl ( ph 7.6 ) , 150 mm nacl ,
1% np-40 , 1% sodium deoxycholate , 0.1% sds , thermo fisher scientific ]
supplemented with a protease inhibitor cocktail ( aebsf , aprotinin ,
bestatin , e-64 , leupeptin , and pepstatin a in dmso with edta , thermo
fisher scientific ) .
protein content was measured by a pierce bca assay
kit ( thermo fisher scientific ) .
protein contents of cell lysates ( 30
g of protein / lane ) were resolved by sds - page .
proteins were
then electro - transferred onto pvdf membranes , and blots were blocked
for 1 h at room temperature in 1 tbs with 1% casein ( bio - rad
laboratories , berkeley , ca ) .
blots were then incubated overnight at
4 c with the desired primary antibody diluted in tbs with 0.5%
tween-20 .
blots were then washed with tbs - tween 20 and probed for
1 h with the appropriate secondary antibody ( 1:1000 ) .
protein bands
were visualized with chemiluminescence using west femto maximum detection
substrate ( thermo fisher scientific ) . to confirm equal protein loading
in each lane ,
protein fold - induction was calculated by normalizing the intensity
of the band of interest to -actin first and then to dmso control
lanes .
human colon cancer cells hct-116
or ht-29 ( 1000 cells per well ) were seeded in 6-well culture plates
for 24 h and then incubated with m2 ( 0 , 1 , 5 , 10 , 20 , or 40 m )
in dmso in a 37 c incubator with 5% co2 .
after 2
weeks , colonies were washed with phosphate - buffered saline ( pbs ) ,
then stained with a mixture of 6.0% glutaradehyde and 0.5% crystal
violet for 30 min at room temperature , rinsed in water , air - dried ,
and then photographed .
student s t - test or two - way analysis of variance ( anova ) with the
bonferroni
post - test were used to determine the statistical significance of data ,
which was performed on graphpad prism version 5.00 for windows ( graphpad
software , san diego , ca ) .
a similar
experimental procedure was used for the syntheses of
m2 and m2 as the previous protocol used for m2 .
m2 showed the molecular formula c22h35no5s on the basis of positive esi - ms
at m / z 426 [ m + h ] and
its h and c nmr data . the molecular weight
of m2 was 121 mass units more than that of 8s ( mw 304 ) , indicating
that m2 was the cysteine - conjugated 8s , which is an expected
result from the reaction between 8s and l - cysteine .
this
was also supported by the observation of the absence of a double bond
in the h and c nmr spectra of m2.
therefore , m2 was confirmed to be 5-cysteinyl-8s . in the same
way ,
m2 was identified as 5-cysteinyl-10s , based on its positive
esi - ms at m / z 454 [ m + h ] and its h and c nmr data ( table 1 ) .
recent work in our group
has focused on the biotransformation of the cysteine - conjugated metabolite
of 6s , m2 .
the metabolic profiles of m2 in cancer cells hct-116 and
h-1299 resembled those of 6s , indicating that its biotransformation
route was initiated by deconjugation .
evidence supporting the identification of m2 and m2
as carriers of their respective shogaols is presented in figure 1 , in which the metabolic profiles of 8s and 10s
in human colon fibroblast cells ccd18co ( figure 1c , f ) or human colon cancer cells hct-116 ( figure 1d , g ) and ht-29 ( figure 1e , h ) are compared
with the profiles of m2 and m2 in the same respective
cell lines . upon removal of the cysteine residue , which occurs after
less than 2 h of treatment , m2 and m2 are metabolized
in an almost identical fashion as their parent shogaols .
we have reported
that m9 and m11 are the major metabolites of 6s in cancer cells ; m11
is the double bond reduced metabolite of 6s , and m9 is the ketone
group reduced metabolite of m11 . in the
present study , reduced products
were also identified as the major
metabolites of 8s and 10s in human colon fibroblast cells and cancer
cells , m9 and m11 for 8s and m9 and m11
for 10s .
their structures were confirmed by comparing their ms / ms
spectra with those of m9 and m11 ( figure 2 ) .
chemical
structures and ms / ms spectra of m9 , m9 , and m9
( a ) and m11 , m11 , and m11 ( b ) .
we have reported that m2 has
low toxicity in normal human fibroblast colon and lung cells while
still remaining toxic against colon cancer and lung cancer cells . as the structure of the cysteine - conjugated
metabolites of 8s and
10s only differ from 6s by their respective
increases in side chain length , we hypothesized that m2 and
m2 should have similar activities compared with their parent
molecules as m2 has compared with 6s .
our results from measurement
of cell viability by mtt assay show that 8s and 10s and their respective
cysteine - conjugated metabolites m2 and m2 have low
toxicity in normal colon cells ccd-18co ( figure 3a ) , with ic50 values of 104.66 and 135.53 m for
8s and 10s , respectively , and ic50 values greater than
200 m for m2 and m2. all compounds were highly
potent against human colon cancer cells hct-116 ( figure 3b ) and ht-29 ( figure 3c ) , with slightly
different efficacy profiles between the two types of cells .
m2
and m2 show higher activity against hct-116 than their parent
molecules , with ic50 values of 15.21 and 13.28 m ,
respectively , versus values of 22.8 and 25.09 m for 8s and
10s , respectively .
similar results were observed in the p53 mutant ht-29 cell line , albeit slightly more resistant to treatment
from all compounds .
the ic50 values for 8s and 10s , 27.88
and 23.92 m , were about 1016% lower than those for
m2 and m2 , at 31.15 and 28.75 m , respectively .
m2
and m2 remain bioactive to human colon cancer
cells but less toxic to human normal colon cells than 8s and 10s and
m2 induces apoptosis on hct-116 and ht-29 human colon cancer cells .
growth inhibitory effects of 8s , m2 , 10s , and m2 against
human normal colon cells ccd-18co ( a ) and human colon cancer cells
hct-116 ( b ) and ht-29 ( c ) treated with 8s , m2 , 10s , or m2
for 24 h at different doses
( d ) effect of m2 on apoptosis in human colon cancer cells
hct-116 and ht-29 treated with m2 ( 0 , 10 , 20 , and 40 m ) for
24 h measured by pi staining ; data represent mean sd .
( e ) western
blot analysis of hct-116 and ht-29 cell extracts treated with dmso ,
10 , 20 , and 40 m of m2 for 24 h. fold induction for each marker
compared with dmso is indicated under the corresponding line . in order to compare the biological similarities of
m2 , m2 , and m2
, we first needed to acquire a more
accurate view of the mechanisms of action of m2 . to study the impact
of m2 on induction of apoptosis in both hct-116 and ht-29 colon cancer
cells , the percent of apoptotic cells were quantified after 24 h treatment
of increasing doses of m2 ( figure 3d )
. a dose - dependent
effect of m2 was observed with hct-116 cells being notably more sensitive
to m2 treatment than ht-29 cells .
treatment with 40 m m2 gave
the greatest induction of apoptosis in hct-116 and ht-29 cells , with
26.34% or 14.38% apoptotic cells , respectively .
the 10 and 20 m
treatments also yielded twice as many apoptotic hct-116 cells compared
with ht-29 cells ( figure 3d ) .
induction
of apoptosis was further confirmed by western blot analysis of markers
of the intrinsic mitochondrial apoptosis pathway ( figure 3e ) .
increasing doses of m2 led to puma induction
( up to 17-fold increase in both cell lines when treated with
40 m m2 ) and progressive reduction of bcl-2 levels ( undetectable
in hct-116 and 0.1-fold in ht-29 cells when treated with 40
m m2 ) .
we detected a progressive increase in cytochrome c release with increasing doses of m2 ( up to 2.2-fold
increase in both cell lines when treated with 40 m m2 ) .
we
also observed a clear , progressive reduction in xiap expression with
increasing doses of m2 ( undetectable in hct-116 and 0.3-fold
in ht-29 cells when treated with 40 m m2 ) .
finally , increasing
concentration of the cleaved forms of caspase 9 ( up to 4.6-fold
increase in both cell lines when treated with 40 m m2 ) and
caspase 3 ( 34-fold increase in both cell lines when
treated with 40 m m2 ) were detected with increasing doses of
m2 .
overall , these results show that markers of the mitochondrial
pathway ( puma , bcl-2 ) of apoptosis were activated upon exposure to
m2 and ultimately led to the release of the corresponding apoptosis
markers ( cytochrome c , cleaved caspases 3 and 9 ) .
our
results on m2 and m2 are consistent with our
previous observation that m2 has low toxicity in normal colon cells
while still retaining strikingly similar potency to 6s in cancer cell
growth inhibition .
thus , we could tentatively
propose that m2 and m2 have similar biological roles
as the function we previously proposed for m2 , as low toxicity carriers
of parent molecular 8s and 10s to active sites , where function is
restored upon removal of the cysteine group . to verify this hypothesis
, we studied the apoptotic markers modulated
by m2 ( described figure 3e ) in hct-116 and
ht-29 cells treated with 8s , m2 , 10s , or m2 for 24
h. we chose a dose of 20 m since it is close to the ic50 values of all compounds .
screening of the markers
modulated by the pro - apoptotic activity of m2 gave similar results
for 8s and 10s and their respective cysteine - conjugated metabolites
m2 and m2(figure 4a ) .
in other
words , puma and cleaved caspase-3 were up - regulated , with concomitant
down - regulation of bcl-2 .
the changes in marker expression was observed
in both cell lines in a nearly identical amplitude between the parent
compound and its corresponding metabolite .
western blot analysis of hct-116 or ht-29 cell extracts
treated with dmso or 20 m of 8s , m2 , 10s , or m2
for 24 h on apoptosis - related protein ( a ) or with 0 , 10 , 20 , and 40
m of m2 or 6s on p53 expression with or without the presence
of gsh ( 5 mm ) ( b and c ) .
protein levels were relatively quantitated
by densitometric analysis using -actin as a loading control .
fold induction for each marker compared with dmso is indicated under
the corresponding line .
hct-116
and ht-29 cells were treated with indicated concentrations of 6s or
m2 for different time periods , and the intracellular ros levels were
determined as described under materials and methods .
( * p < 0.05 , * * p < 0.01 ,
* * * p < 0.001 , and * * * * p <
0.0001 ) . since we established that the cysteine - conjugated
shogaols could activate apoptosis through the same pathway , we wanted
to further study their mechanisms of action using 6s and its metabolite
m2 as a model .
we established that puma , a transcriptional target
of p53 , accumulated almost identically in p53 wild - type
hct-116 and p53 mutant ht-29 cell lines , with both
showing greater than 17-fold induction of puma after 24 h treatment
with 40 m m2 ( figure 3e ) .
to study the
impact of m2 on p53 regulation in human colon cancer cells and its
dependency on p53 integrity , p53 wild - type hct-116
or p53 mutant ht-29 cells were cultured with m2 or
6s for 24 h at concentrations of 10 , 20 , or 40 m .
the p53 response
in colon cancer cells to 6s treatment ( 10 , 20 , or 40 m for
24 h ) was observed in hct-116 and ht-29 . after m2 or 6s treatment ,
a dose - dependent up - regulation of p53
is noted in both wild - type and
mutant cancer cell lines ( figure 4b , c ) , indicating
that m2 or 6s regulation of p53 does not require a wild - type gene ,
although induction of p53 expression by m2 or 6s is dramatic in hct-116
cells and slightly less striking ( but still significant ) in ht-29
cells ( figure 4b , c ) .
consistent with our premise ,
we then studied p53 expression in hct-116 and ht-29 cells after exposure
to 20 m of 8s , m2 , 10s , or m2. we observed
an increase in p53 accumulation for all compounds ( figure 4a ) .
the cysteine - conjugated metabolites were able
to increase p53 accumulation in a similar manner to their parent compound .
our observations up to this point indicated that m2
induces apoptosis in colon cancer cells through modulation of p53
expression and subsequent activation of the mitochondrial apoptotic
pathway through puma and bcl-2 .
however , the mechanism triggering
the p53 accumulation was still unclear . because overabundance of reactive
oxygen species has been implicated as a genotoxic stressor and trigger
for p53 activation , we observed the production of ros by m2 ( compared with parent compound
6s for reference ) in hct-116 and ht-29 cells .
as shown in figure 4d , e , the trends of ros induction by both m2 and
6s are strikingly similar , with the greatest peak at 2 h after treatment
and a steady decline thereafter , which is consistent with the changes
of glutathione levels in cancer cells that we reported previously . in this case ,
treatment of hct-116 cells with
40 m m2 produced the greatest ros activity after 2 h , with
greater than 2-fold induction ( with statistical significance , p < 0.0001 ) .
the scales of induction of ros by m2 or
6s are parallel to the p53 induction response in the two respective
cell lines .
that is , in hct-116 cells , ros activity is induced 2-fold
or greater by m2 or 6s treatment , while in ht-29 cells , ros activity
is induced less than 1.5-fold . to demonstrate that ros induction
was indeed the trigger to p53 accumulation , we treated hct-116 and
ht-29 cells for 24 h with m2 or 6s ( 10 , 20 , or 40 m ) and supplemented
with 5 mm gsh in order to suppress ros accumulation in the cells .
as shown on figure 4b , c , addition of gsh suppressed
p53 induction in both cell lines for all concentrations of m2 or 6s ,
establishing that p53 does not accumulate if there is no ros generation .
while we established that the cysteine conjugate
of 6s can activate apoptosis , it is possible that other mechanisms
leading to cancer cell death are triggered , especially in light of
the specific activation of the multiacting p53 .
since p53 is one of
the major regulators of the cell cycle , we further investigated the
potential of our cysteine conjugated metabolites to inhibit cancer
cell proliferation , using a colony assay and m2 as a model .
human
colon cancer cells hct-116 ( figure 5a ) and
ht-29 ( figure 5b ) were treated with m2 with
doses ranging from 0 to 40 m for 2 weeks .
inhibition of colony
formation was observed in a dose - dependent manner in both cell lines ,
with 50% inhibition between 5 and 10 m treatments .
following
a trend underlined previously , hct-116 cells are slightly more sensitive
to m2 than ht-29 cells .
dose dependent inhibition of human colon cancer
cell colony formation
by m2 in hct-116 ( a ) and ht-29 ( b ) cells .
ht-29 ( b )
cells were treated with m2 ( 0 , 1 , 5 , 10 , 20 , and 40 m ) and
incubated in 6-well plates for 2 weeks , and the cells were then stained
with crystal violet and counted for colony formation .
each column
represents a mean sd ( n = 3 ; * p < 0.05 ; * * p < 0.01 ; * * * p < 0.001 ) .
there
is currently considerable interest in developing cancer therapeutics
and preventive agents from dietary sources , with extensive research
over the past few decades focusing on plant derivatives .
ginger has been comprehensively studied in recent years for its
chemopreventive properties , particularly against colorectal cancer .
our group and others have identified active constituents of ginger ,
with our most recent focus on shogaols , especially 6s . the metabolism and
biotransformation of 6s
was investigated thoroughly , providing further
insight into its means of exerting bioactivity . upon testing the efficacy of the major metabolites of 6s
,
we found that 5-cysteinyl - conjugated 6s ( m2 ) exerted strong antiproliferative
activity against human colon cancer cells , while having significantly
lessened toxicity in normal human colon cells .
further , m2 was shown to act as a carrier of parent molecule
6s .
the discovery of m2 was via correlation
of 6s metabolism as a highly electrophilic xenobiotic through the
detoxifying mercapturic acid pathway ( map ) .
we also found that increased
chain length of shogaols does not cause a departure from the map .
m2 and m2 were identified as the major metabolites
of 8s and 10s , respectively , from humans upon consumption of ginger
tea .
the current study shows that m2
and m2 are the carriers of 8s and 10s , respectively , and have
similar antiproliferative activity against human colon cancer cells
and less toxicity in normal human colon cells to their respective
parent compounds .
our results clearly indicate that this portion of
phase ii metabolism transforms electrophiles to less reactive and
more water - soluble intermediates , thus aiding in their mobility and
decreasing their toxicity en route .
it has already been established through many studies that 6s induces
apoptosis in cancer cells via several pathways , and thus our focus was to identify
the pathway that encompasses the mode of activity of m2 .
we demonstrated
that m2 treatment could induce ros generation , which in turn up - regulated
p53 expression and induced apoptosis through the mitochondrial pathway .
this proposed mechanism is summarized in figure 6 . since tumor suppressor gene p53 is one of the
most frequent mutations in cancers , leading to resistance to pharmacological
interventions and more aggressive progression , we were interested in testing
the efficacy of m2 in wild - type p53 hct-116 human
colon cancer cells as well as mutant p53 ht-29 human
colon cancer cells . in what could be a fortunate outcome for the putative
roles of ginger constituents and metabolites toward chemoprevention ,
it is notable that although
the p53 pro - apoptotic pathway was exploited for at least some of m2 s
bioactivity and that we observed a general trend of superior bioactivity
in hct-116 cells , the metabolite s efficacy was ultimately
not compromised by p53 mutation .
this is particularly
attractive in terms of cancer chemoprevention , since it suggests that
the cysteine - conjugated metabolite of 6s would still be able to activate
a p53 apoptotic response even in cancer cells containing mutations
of the p53 gene .
schematic representation of the mechanisms
of action of shogaols
and their cysteine - conjugated metabolites in regulating apoptosis
by p53 induction , activation of puma via p53 translocation to the
mitochrondrial surface , bcl-2 down - regulation , cytochrome c release , xiap inhibition , and finally caspases 9 and 3
activation and cleavage .
a commonly proposed p53-induced apoptosis mechanism involves
direct
interaction with bcl-2 family members and down - regulation of antiapoptotic
genes , such as bcl-2 , which was also noted in the current study .
both hct-116 and ht-29 human colon cancer cells experienced
a dramatic down - regulation of bcl-2 after m2 treatment .
interestingly ,
puma , a transcriptional target of p53 , was also up - regulated in both colon cancer cell lines after treatment
with m2 . upon a transcriptionally induced signal from p53 , puma assists
in promoting apoptosis by disrupting the association restraints bcl - xl
exerts on p53 , thus liberating the molecule to exert pro - apoptotic
activity , but binding to bcl - xl in the process .
this evidence supports the strong role of m2 as a chemopreventive
agent against colon cancer cells that induces p53 expression and downstream
regulation .
treatment of colon cancer cells hct-116 and ht-29
with m2 in this
study lead to apoptosis , through early production of reactive oxygen
species .
overabundance of ros combined with a cancer cell s
reduced detoxification ability can often lead to oxidative stress
sufficient to induce programmed cell death .
apoptosis induced by p53 is at least partially dependent upon accumulation
of ros , and we demonstrated this to be
also true in our model .
therefore , we can conclude that m2 causes
p53 induction of apoptosis via ros production in both hct-116 and
ht-29 human colon cancer cells . since we demonstrated that the other
metabolites m2 and m2 activate similar markers of
apoptosis ( figure 4a ) and contain the same
chemical reactivity as m2
, it is reasonable to conclude that these
metabolites would behave in a similar way and could also activate
cancer cell apoptosis through ros induction and the subsequent p53
accumulation .
in addition , we also demonstrated that m2 does not exclusively
induce cancer cell death through apoptosis and can also influence
other major mechanisms such as cell proliferation ( figure 5 ) ; it follows that other cysteine conjugated metabolites
originating from the same map have that potential as well .
these compounds
are worthy of further investigation , and further studies could examine
commonly consumed ginger mixtures containing these compounds for more
direct translation of these data to in vivo dietary
models .
because shogaols have been proven as highly effective
anticancer agents , the continued study of their mechanisms of activity
can allow us to discover novel anticancer targets .
further , investigation
of the metabolic products of shogaols can provide new therapeutic
routes that are less toxic , while retaining high efficacy .
this study
has shown that cysteine - conjugated shogaols are novel compounds with
a putative role as natural pharmaceuticals with low - toxicity , high - potency ,
and at least partial indifference to p53 integrity
in colon cancer cells . | shogaols ,
the major constituents of thermally processed ginger ,
have been proven to be highly effective anticancer agents .
our group
has identified cysteine - conjugated shogaols ( m2 , m2 , and m2 )
as the major metabolites of [ 6]- , [ 8]- , and [ 10]-shogaol in human
and found that m2 is a carrier of its parent molecule [ 6]-shogaol
in cancer cells and in mice , while being less toxic to normal colon
fibroblast cells . the objectives of this study are to determine whether
m2 and m2 behave in a similar manner to m2 , in both
metabolism and efficacy as anticancer agents , and to further explore
the biological pro - apoptotic mechanisms of the cysteine - conjugated
shogaols against human colon cancer cells hct-116 and ht-29 .
our results
show that [ 8]- and [ 10]-shogaol have similar metabolic profiles to
[ 6]-shogaol and exhibit similar toxicity toward human colon cancer
cells .
m2 and m2 both show low toxicity against normal
colon cells but retain potency against colon cancer cells , suggesting
that they have similar activity to m2 .
we further demonstrate that
the cysteine - conjugated shogaols can cause cancer cell death through
the activation of the mitochondrial apoptotic pathway .
our results
show that oxidative stress activates a p53 pathway that ultimately
leads to p53 up - regulated modulator of apoptosis ( puma ) induction
and down - regulation of b - cell lymphoma 2 ( bcl-2 ) , followed by cytochrome c release , perturbation of inhibitory interactions of x - linked
inhibitor of apoptosis protein ( xiap ) with caspases , and finally caspase
9 and 3 activation and cleavage .
a brief screen of the markers attenuated
by the proapoptotic activity of m2 revealed similar results for [ 8]-
and [ 10]-shogaol and their respective cysteine - conjugated metabolites
m2 and m2. this study highlights the cysteine - conjugated
metabolites of shogaols as novel dietary colon cancer preventive agents . |
ala - al - din abu al - hassan ali ibn abi - hazm al - qarshi al - dimashqi , known as ibn al - nafis ( 1210 - 1288 ad ) , was a muslim syrian physician primarily famous for being the first to describe the pulmonary circulation of the blood .
the most voluminous of his books is alshamel fi sanaat tebbiat , which is a comprehensive medical encyclopedia .
the aim of this review article , as a tribute to ibn al - nafis , was to introduce his valuable but neglected encyclopedia of materia medica .
ibn al - nafis traditional approach in his alshamel fi sanaat tebbiat book is studied in the present article .
alshamel fi sanaat tebbiat covers three branches of knowledge . the first category is devoted to theoretical traditional medicine .
the third category is on materia medica covering the aspect of unani medicine , from which only 28 volumes of the comprehensive book on the traditional medicine have been found so far .
the latter , introduces mono - ingredient medications in alphabetical order . each chapter , in several parts ,
is dedicated to the botanical characteristics and nature of each mono - ingredient medication . in addition
, this book explains traditional pharmacokinetic of every single medication for each human body organs .
based on pharmaco - mechanistic perspective on alshamel fi sanaat tebbiat , it could be considered as the main reference book on traditional medicine and pharmacy , worthy of revival . | background : ala - al - din abu al - hassan ali ibn abi - hazm al - qarshi al - dimashqi , known as ibn al - nafis ( 1210 - 1288 ad ) , was a muslim syrian physician primarily famous for being the first to describe the pulmonary circulation of the blood .
the most voluminous of his books is alshamel fi sanaat tebbiat , which is a comprehensive medical encyclopedia .
it comprised 300 volumes of notes , from which only 80 volumes are published .
his writings are cataloged in many libraries around the world .
the aim of this review article , as a tribute to ibn al - nafis , was to introduce his valuable but neglected encyclopedia of materia medica.methods:ibn al - nafis traditional approach in his alshamel fi sanaat tebbiat book is studied in the present article.results:alshamel
fi sanaat tebbiat covers three branches of knowledge .
the first category is devoted to theoretical traditional medicine .
the second is in four sections where much of it is not available yet .
the third category is on materia medica covering the aspect of unani medicine , from which only 28 volumes of the comprehensive book on the traditional medicine have been found so far .
the latter , introduces mono - ingredient medications in alphabetical order . each chapter , in several parts ,
is dedicated to the botanical characteristics and nature of each mono - ingredient medication .
in addition , this book explains traditional pharmacokinetic of every single medication for each human body organs.conclusion:based on pharmaco - mechanistic perspective on alshamel fi sanaat tebbiat , it could be considered as the main reference book on traditional medicine and pharmacy , worthy of revival . |
the latest study on the therapeutic value of statins in pneumonia adds further support to the association between statin use and improved patient outcomes .
the role of statins in the management of sepsis has been increasingly studied but remains contentious .
animal studies of statin use in sepsis have shown a significant benefit with respect to mortality but a plethora of observational studies have come to conflicting conclusions .
many mechanisms have been postulated to explain why statins may influence sepsis , and it is possible some of these may be of particular benefit in pneumonia [ 6 - 8 ] .
statins are taken by millions of people around the world and pneumonia represents one of the most common infections seen in clinical practice .
this provides an opportunity to review a large number of cases of pneumonia that involve coincidental statin use .
as would be expected for a drug targeting vascular disease and hypercholesterolaemia , statin users have different comorbidities and risk profiles to those patients that do not take statins .
therefore , observational and retrospective studies are potentially confounded by both an unhealthy user effect ( a cohort often older with more coexisting cardiovascular disease ) and the ' healthy user ' effect .
the recent study by nielsen and colleagues is a well conducted , large , observational study .
the authors provide extensive detail on coexisting diseases in each of the cohorts in an effort to reveal hidden confounders that plague database interrogation .
this paper adds another observational study to a large bank that already exists addressing the outcome from pneumonia in statin users [ 10 - 13 ] .
it serves to remind us that while again suggesting a possible therapeutic role for these agents in pneumonia , it does not prove a clear cause and effect relationship .
firstly , it defined ' current use ' as one prescription filled in the past 125 days . while the results suggest the improvement in pneumonia outcome was associated with current and not former statin users , a huge variation in timing of statin administration in relation to onset of infection is possible within these definitions .
in addition to the timing of administration , the impact of one statin over another or drug dosage remains unclear .
finally , large registry databases pose other challenges . as was highlighted recently , both the consistent use of a diagnostic category over time and the motivations for recording specific diagnosis can further confound the validity of results from large national or administrative databases .
it is fortuitous that prevalence has provided the opportunity to observe statin use in pneumonia patients .
these observations have provided the impetus to investigate statins as a potential adjuvant therapy for severe lung injury .
two randomised controlled trials are currently underway : statins for acutely injured lungs from sepsis ( sails ) and hydroxymethylglutaryl - coa reductase inhibition with simvastatin in acute lung injury to reduce pulmonary dysfunction ( harp 2 ) .
in contrast , harp-2 will compare 80 mg simvastatin to placebo . whilst these may be equipotent doses in the management of hypercholesterolaemia
, it remains unknown what effects these agents at these doses will have in acute lung injury .
these two drugs have pharmacokinetic differences , including lipid solubility , volume of distribution , metabolism and potency . without an explanation of how statins may benefit patients with lung injury , predicting
compared to the general population , the pharmacokinetics of atorvastatin differs in critical illness , and perhaps with sepsis in particular .
exploring commonly used statin pharmacology in critically ill patients with pneumonia would better define dose - response relationships on varied biological endpoints and this may provide some valuable insights into mechanisms that could explain an association with improved patient outcomes .
in addition to statin use possibly being associated with a reduction in the severity of infection , a second intriguing possibility is that statins may reduce the risk of infection .
a post hoc analysis of the jupiter trial suggested a modest reduction in the incidence of pneumonia in patients randomised to receive 20 mg of rosuvastatin . a nested case control study has also suggested a reduced incidence of pneumonia in statin users .
the recent study by nielsen and colleagues again suggests a decrease in the risk of hospitalization for pneumonia with statin use , but only after adjustment for potential confounding variables .
pneumonia represents an illness with known risk factors and the administration of statins as preventative therapy could be prospectively explored in this patient population in an effort to avoid confusion from uncontrolled or unknown factors .
rather than question what can be learned from observational data while the results of randomised trials are awaited , perhaps we can use all these research methods to better inform our clinical practice .
whilst observational studies to date are far from conclusive , it is hard to see how randomised controlled trials will resolve a complex debate that is still in its infancy .
it is more likely that a multipronged approach with retrospective large databases , smaller biological studies and randomised trials will help complete the biological puzzle of statin use and its role in patients with pneumonia .
harp 2 : hydroxymethylglutaryl - coa reductase inhibition with simvastatin in acute lung injury to reduce pulmonary dysfunction ; sails : statins for acutely injured lungs from sepsis .
| several studies have investigated the use of statins as an adjunct in the treatment of pneumonia , some with conflicting conclusions .
the most recent of these large observational studies again suggests statin use is associated with an improved outcome for patients with pneumonia .
how best to incorporate these findings into current practice is of great interest .
hidden confounders plague database interrogation and so cast doubt on the real or causal nature of observed associations .
data from large , observational studies must be complemented by smaller biological studies and randomised controlled trials in an effort to complete missing pieces in the biological puzzle of the use of statins in patients with pneumonia . |
non - hodgkin lymphoma ( nhl ) is a heterogeneous group of lymphoid malignancies which can occur at any age .
most often it is marked by enlarged lymph nodes associated to symptoms such as fever and weight loss .
although nhl frequently involves extranodal organs or arises outside the lymphatic system , primary pancreatic lymphoma ( ppl ) , a lymphoma localized to the pancreas with or without peripancreatic nodal involvement , is an exceedingly rare entity .
ppl accounts for only 1% of extranodal lymphomas and for 0.5% of all pancreatic masses .
compared to ppl , nhl with secondary involvement of the pancreas is more common and can occur in 3040% of nhl cases with extranodal disease .
behrns diagnostic criteria are well accepted to define and distinguish ppl from secondary involvement of the pancreas by nhl and include : ( 1 ) a mass predominantly located in the pancreas ; ( 2 ) involved lymph nodes confined to the peripancreatic region , no palpable superficial lymphadenopathy , no mediastinal nodal enlargement on chest radiograph ; ( 3 ) no hepatic or splenic involvement ; ( 4 ) normal white cell count .
ppl shows a slight male predominance ( 58% ) and is usually seen in the 5th or 6th decade of life .
the most common histological subtype of ppl is diffuse large b cell lymphoma , accounting for 80% of all patients . in rare cases ,
ppl can also present as follicular lymphoma , small lymphocytic lymphoma and t cell lymphoma either of nhl or of hodgkin lymphoma .
interestedly , ppl rarely presents with the typical b symptoms seen in lymphoma , i.e. fever , weight loss or night sweats .
the common presentations of ppl are vague abdominal complaints such as dyspepsia , pain , nausea , vomiting , flatulence , an abdominal mass and weight loss .
ct scans usually demonstrate a circumscribed , solitary tumor that most commonly involves the pancreatic head .
it appears hypoechoic and hypodense on endoscopic ultrasound ( eus ) and ct , respectively .
it is crucial to differentiate ppl from pancreatic adenocarcinoma since ppl is potentially treatable and its prognosis is better even if it is found at a late stage .
however , due to its rarity and nonspecific clinical presentations and radiographic findings , differentiating ppl from the more common pancreatic adenocarcinoma is often a very difficult task without the aid of a cytopathological diagnosis .
tissue sampling can be obtained by us / ct - guided fine needle aspiration ( fna ) , eus - guided fna or surgical means .
diagnosis by imaging - guided or eus - guided fna is preferred since it will avoid surgery and its associated complications . the treatment of choice for ppl is chemotherapy . especially with the aggressive combination chemotherapeutic regimens including rituximab ,
even though there are significant overlaps of clinical features of ppl with those of carcinoma , literature reviews have found some clinical , laboratory as well as imaging features favoring a diagnosis of ppl .
here we present a case of ppl which presented with several clinical , laboratory and imaging findings that supported ppl over adenocarcinoma .
the patient was successfully diagnosed with ppl using eus - guided fna and responded well to r - chop ( rituximab , cyclophosphamide , hydroxydaunorubicin , oncovin and prednisone ) .
this case demonstrated that even though the clinical , laboratory and radiologic features of ppl overlap with those of pancreatic adenocarcinoma , high clinical suspicion and tumor sampling , especially by eus - guided fna , to achieve clinicopathologic diagnosis and classification of ppl is essential to proper patient management .
a 43-year - old man presented to the outpatient practice with a 1-week history of right upper quadrant abdominal pain , nausea , weight loss and an epigastric mass .
the patient had been seen 6 months earlier for evaluation of a 2-year history of recurrent abdominal discomfort .
he had described intermittent left upper quadrant abdominal distress associated to complaints of reflux and constipation .
he underwent both upper endoscopy and colonoscopy , the results of which were unremarkable except for the finding of mild gastritis .
physical examination at the time of his recurrent complaints revealed a well - nourished male complaining of epigastric tenderness and a 6 3 cm epigastric mass .
laboratory data revealed a normal complete blood count , serum transaminase as well as carbohydrate antigen 19 - 9 ( ca19 - 9 ) level .
he did however have an elevated amylase of 297 ( reference range 20104 ) , lipase of 264 ( reference range 5.651.3 ) and ldh of 24 ( reference range 820 ) .
ct scan of the abdomen performed under pancreatic protocol revealed a 14.3 cm right upper quadrant mass ( fig .
1 ) with obliteration of the fat planes between the stomach , duodenum , colon and pancreas .
there was also a mass effect evident on the inferior vena cava , and there was no indication of pancreatic ductal dilatation ; other findings noted consisted of scattered enlarged mesenteric and retroperitoneal lymph nodes .
he subsequently underwent eus which revealed a pancreatic mass within the pancreatic head ( fig .
eus - guided fna of the pancreas was performed along with biopsies of the duodenal mucosa .
3 ) which stained positive for pan b cell markers : cd20 and pax5 with co - expression of cd10 , bcl-2 and bcl-6 on immunohistochemistry staining ( fig .
flow cytometry analysis was performed which also demonstrated a monoclonal kappa cd10 positive large b cell population ( fig .
further workup consisting of pet scan did not reveal any other pathological site apart from the pancreatic mass .
the above findings are indicative of ppl by behrns diagnostic criteria . a repeated pet scan 1 month after r - chop chemotherapy showed resolution of the mass , although some hazy residual infiltration of the fat in the region anterior to the pancreatic head did persist .
adenocarcinoma of the pancreas ranks as the fourth leading cause of cancer death in the united states and is the second leading cause of death with respect to gastrointestinal carcinomas .
most patients with pancreatic cancer typically present late in their course and have either locally extensive or metastatic disease .
overall , only up to 20% of these patients end up being candidates for resection and have a potential for curative surgery .
this late presentation is therefore the result of a combination of delays related to patient presentation , misdiagnoses , and lack of sufficiently sensitive screening and diagnostic techniques that would help identify truly localized disease .
an additional contributing factor is the rather unfavorable natural history of these tumors in which widespread dissemination of malignant cells exists that typically occurs early and usually during the preclinical phase of the disease .
being able to differentiate the possible etiology of the pancreatic mass is paramount , as this would lead to less morbidity and mortality .
it is important therefore to differentiate them , given the fact that the treatment and prognosis will differ considerably .
although the final diagnosis is based on cytohistological evidence , literature reviews so far have described several clinical , laboratory as well as imaging features that can help substantiate the possible diagnosis of ppl .
they demonstrated that ppl typically has a less frequent presentation of painless obstructive jaundice or abdominal pain even though it is commonly located in the pancreatic head .
elevated levels of both ldh and 2-microglobulin have been noted and these may actually help in diagnosing ppl , but remain controversial as these are rather nonspecific .
today there exists consensus that the ca19 - 9 levels will remain normal unless biliary involvement is present . ca19
- 9 is the most useful marker in patients with suspected pancreatic tumors as its level correlates with both tumor burden and the level of cancer expression .
a level > 200 u / ml is strongly suggestive of pancreatic adenocarcinoma as this carries a positive predictive value of 100% .
unfortunately , only half of patient with tumors < 2 cm in size have elevated levels .
also normal values may occur in some pancreatic tumors that do not express ca19 - 9 .
approximately 50% of individuals can not synthesize this antigen and are therefore regarded as lewis a b negative .
these are the combination of a bulky localized tumor in the pancreatic head without significant dilatation of the main pancreatic duct or enlarged lymph nodes below the level of the renal veins .
other less specific findings would be the lack of invasion into vascularity surrounding the pancreas as well as the presence of calcifications or necrosis within the tumor , which seem to suggest a possible diagnosis of ppl [ 4 , 6 ] .
the patient presented with a large bulky pancreatic mass that did not demonstrate any significant dilatation of the main pancreatic duct or invasion of the large vessels .
furthermore he lacked any vascular , hepatic or splenic involvement as well as obstructive jaundice and presented with a normal ca19 - 9 .
eus combined with guided fna can be used to establish a tissue diagnosis in patients who are suspected of having pancreatic lymphoma or are nonoperative candidates .
fna of the pancreas has an established sensitivity of > 80% and a specificity of 95% .
however it does carry a false - negative rate of 20% . submitting the specimen to flow
cytometry is a valuable and cost - effective method for the diagnosis of a pancreatic mass as demonstrated in this case , since the goal is to individualize the appropriate therapy leading to minimal risks and to be able to differentiate those patients who have potentially resectable disease from those who have unresectable or metastatic disease .
every effort should be made to have an accurate cytologic and histologic diagnosis by fna technique , especially when clinical , laboratory and imaging findings support ppl . | primary pancreatic lymphoma ( ppl ) , a localized lymphoma in the pancreas , accounts for < 0.5% of all pancreatic masses and presents with symptoms favoring the more common adenocarcinoma .
it is important to differentiate ppl from adenocarcinoma since treatment and prognosis differ considerably .
ppl is potentially curable with chemotherapy , especially if it is diagnosed at early stages .
a definitive diagnosis can only be based on histopathological findings .
endoscopic ultrasound - guided fine needle aspiration ( eus - guided fna ) is a reliable , minimally invasive and cost - effective method for this purpose . even though there are neither typical clinical features nor specific biomarker for the diagnosis of ppl , certain common presentations
have been observed which may indicate ppl .
we herein present the case of a 43-year - old man who was successfully diagnosed with ppl by eus - guided fna .
his clinical , laboratory and radiographic findings supported ppl over adenocarcinoma as well .
this case demonstrates that high clinical suspicion based on clinical , laboratory and imaging features is critical in ppl diagnosis and management . |
to study the prevalence of diabetes mellitus amongst urban older adults and to study the relationship between diabetes mellitus and cognitive impairment .
study sample consisted of 900 subjects fulfilling the inclusion / exclusion criteria , recruited out of 1067 elderlies aged 55 years and above residing permanently in a randomly selected ward of urban lucknow .
out of total 1067 subjects 167 ( 15.65% ) subjects refused to participate in the study because their family members refused to give blood of the subjects for pathological investigations such as blood sugar ( fasting and pp ) , hemoglobin % , total leucocyte count ( tlc ) , differential leucocyte count ( dlc ) , liver function test ( lft ) , serum urea / createnin and lipid profile . mean age of the study sample was found to be 67.17 years .
pathological investigation was done on all 900 study subjects to see the status of diabetes mellitus . out of 900 subjects 145
these subjects were further divided into two groups : ( i ) with and ( ii ) without cognitive impairment based on detailed assessment of mini mental state examination ( mmse ) positive subjects by cambridge examination for mental disorders of the elderly - revised ( camdex - r ) .
age and education specific cut off criteria was used to determine the mmse positive and negative subjects to control education bias .
international classification of diseases-10 revision ( icd-10 ) criteria were used to make diagnosis of cognitive ( organic ) disorders .
subjects with a definite diagnosis of dementia or subjects having objective cognitive impairment but no dementia ( other than dementia ) as per icd-10 criteria ( f00-f09 only ) were called as cognitively impaired group .
the table 1 shows the breakup of elderlies with and without diabetes mellitus by age and status of cognitive functioning .
status of diabetes mellitus and cognitive impairment by age table 1 shows that 13.7% pre - elderly ( 55 - 59 years ) and 16.9% elderly ( 60 years and above ) were found to be suffering from diabetes mellitus amongst urban older adults .
the prevalence of cognitive impairment amongst the non - diabetic urban pre - elderlies aged 55 - 59 years was found to be 1.5% . in pre - elderly group , none of the subjects with diabetes mellitus were found to be having cognitive impairment .
the prevalence of cognitive impairment amongst the diabetic urban elderlies aged 60 years and above was found to be 9.6% .
however , the prevalence of cognitive impairment amongst the urban elderlies aged 60 years and above without diabetes mellitus was found to be 7.5% which is slightly lower against the prevalence rate of cognitive impairment amongst urban elderlies with diabetes mellitus ( 9.6% ) .
odds ratio was calculated between the two groups i.e. , urban elderlies aged 55 - 59 years and 60 years and above with and without diabetes mellitus with regard to evidence of cognitive impairment in them and it was found to be statistically significant [ table 2 ] . more than 1 with 95% confidence interval ( ci ) for both the age
ranges indicate that subjects with diabetes mellitus is 1.3 times at more risk to develop cognitive impairment amongst urban older adults than non - cognitively impaired subjects .
status of cognitive impairment and diabetes mellitus amongst older adults aged 55 - 59 years and 60 years and above however , on chi square test the differences between cognitively impaired and non - cognitively impaired group on diabetes mellitus among pre - elderly and elderly age group was not found .
in the study the prevalence of diabetes mellitus was 16.9% amongst older adults aged 60 years and above .
this is quite high in comparison to other studies which have recorded a prevalence of 12.1% and 9% , 10.3 - 12.4% in indian adults .
however , the present prevalence of diabetes may turn out to be similar to this study as in recent years the prevalence of diabetes in on rapid rise in the country .
but in the light of escalating population , increase of prevalence rate of diabetes is justified .
it may be more than reported in this study because in the study sample only those elderlies were included who were found diabetic on blood sugar estimation without consideration to whether they were currently on anti - diabetic medication or not .
many known diabetic elderlies whose blood sugar level may have been within normal range due to intake of anti - diabetic drugs may have been missed inclusion in the study sample .
highest prevalence of cognitive impairment in the age group 70 - 79 ( 138 out of 186 ) suggests that 8 decade in life is probably the most susceptible period for becoming the victim of cognitive impairment , and probably those in this age suffering from diabetes mellitus are maximally prone [ table 1 ] .
the statistical analysis of odds ratio in the study has revealed that diabetes mellitus is risk factor for cognitive impairment in urban older adults irrespective of the cut off age of either 55 years or 60 years [ table 2 ] .
although , the odds ratio was found to be significant on 95% ci but chi square is not .
the range on odds ratio is also more wide ( 0.6532 - 2.5684 ) to predict diabetes mellitus is a risk factor for cognitive impairment .
hence , the finding of the study is not in strong support of the alternative hypothesis that diabetes mellitus is a risk factor of cognitive impairment
. it might be due to a small sample size of cognitive impairment based on and cross sectional epidemiological study .
separate study with large sample size of cognitive impairment would be more appropriate to establish the relation of cognitive impairment with diabetes mellitus .
this is an important finding from a preliminary report of a large epidemiological study employing stringent research criteria .
the final report of the study will generate large sample size to recheck the findings of the study .
diabetes mellitus was found to be prevalent is 13.7% and 16.9% in urban older adults amongst older adults aged 55 - 59 years and 60 years and above respectively .
diabetes mellitus has been found to be a risk factor for cognitive impairment but , with weak significance level amongst urban older adults .
interventions aimed at diabetes that begins before age 60 might lessen the burden of cognitive impairment in later life .
it is a community based epidemiological study on large sample size using stringent research methodology .
detailed psychological assessments of the subjects by trained clinical psychologists , reliability exercises amongst research team for data collection , and pathological investigations on all the study subjects are the major strengths of the study .
an issue that emerges for more detailed investigations is whether the elderlies whose diabetes is under control with drugs are more skip to non - diabetes or to diabetes in respect of their vulnerability for cognitive impairment .
it was also noticed that the sample of cognitive impairment subjects is small to predict strong association .
urban population of north india is different for their dietary habits from the other parts of the country hence ; the findings can not be generalized .
it is a community based epidemiological study on large sample size using stringent research methodology .
detailed psychological assessments of the subjects by trained clinical psychologists , reliability exercises amongst research team for data collection , and pathological investigations on all the study subjects are the major strengths of the study .
an issue that emerges for more detailed investigations is whether the elderlies whose diabetes is under control with drugs are more skip to non - diabetes or to diabetes in respect of their vulnerability for cognitive impairment .
it was also noticed that the sample of cognitive impairment subjects is small to predict strong association .
urban population of north india is different for their dietary habits from the other parts of the country hence ; the findings can not be generalized . | background : studies reported in relation to diabetes mellitus and cognitive impairment are inconclusive .
diabetes mellitus is a wide spread physical illness amongst older adults .
the study explores whether , it leads to cognitive impairment amongst older adults in comparison to those without diabetes mellitus.materials and methods : study sample consisted of 900 subjects fulfilling the inclusion / exclusion criteria out of 1067 elderlies aged 55 years and above residing in a randomly selected ward of urban lucknow .
pathological investigation was done on all elderlies to rule out diabetes mellitus . out of 900 subjects 145
were found to have diabetes mellitus and rests 755 were without diabetes mellitus .
these subjects were further divided into two groups : ( i ) with and ( ii ) without cognitive impairment based on detailed assessment of mini mental state examination positive subjects by cambridge examination for mental disorders of the elderly- revised ( camdex - r ) .
international classification of diseases-10th revision criteria were used to make diagnosis .
data analysis was done calculating odds ratio , chi square , and percentages.results:diabetes mellitus was found to be prevalent is 13.7% and 16.9% amongst older adults aged 55 - 59 years and 60 years and above respectively .
odds ratio 1.3 with ci 95% indicates that subjects with diabetes mellitus is 1.3 times at more risk to develop cognitive impairment amongst urban older adults than non - cognitively impaired subjects .
but differences on chi square test were found to be insignificant.conclusion:there is a weak association between diabetes mellitus and cognitive impairment amongst urban older adults . |
light with wavelength in the near - infrared range can
propagate a few centimeters through the tissue because of low tissue absorption
in the spectral of near - infrared window .
this finding has encouraged the
development of fluorescence techniques to visualize specific biochemical events
inside living subjects [ 1 , 2 ] . in recent years
, a great development has happened to
the fluorescence molecular tomography ( fmt ) , a technique that resolves
molecular signatures in deep tissue using fluorescent probes or markers
[ 1 , 36 ] .
tissue is illuminated by a series of excitation light
in fmt ; multiple measurements for the fluorescent emission light are collected
from the tissue surface to resolve and quantify fluorochromes deep inside the
tissue . with great potential
, fmt has become a promising imaging modality for
in vivo small animal imaging [ 1 , 2 ] .
the model can be solved by
methods such as finite difference method , finite element method , adaptive finite element
method , and
statistical method .
a weighting matrix can be obtained from the forward
model , which describes the influence of each volume element on the detector
readings . generally , the inverse reconstruction problem of fmt is to find the
fluorescent source distribution in the target tissue based on the precalculated
weighting matrix and the measured data .
since the data measured from the tissue
surface is far less than the number of unknown points inside the tissue , the
reconstruction problem is illposed , and the solution is sensitive to noise as
well as measurement error .
several algorithms have been reported , such as the
modified newton method - based optimization scheme and the born - type
approximation techniques .
the conjugate gradient ( cg ) methods , which need less
storage and computation , are favorable for the problems with large - dimension
data .
they have been reported to be adopted successfully in the reconstruction
algorithms for imaging modalities such as the positron emission tomography
( pet ) [ 1517 ] and diffusion optical tomography
( dot ) .
normally ,
two different kinds of cg with different properties are being used under
different conditions .
they are the linear cg method ( l - cg ) and the nonlinear cg
method ( n - cg ) .
there is a remarkable point that l - cg and n - cg have reciprocal properties .
combining them together may generate an improved algorithm , which has the
advantages of both of them.in this paper , a penalized linear and nonlinear
combined conjugate gradient method ( pln - cg ) for the reconstruction of fmt is
presented .
the l - cg method and the n - cg method are employed separately at
different period based on a restart strategy , in order to exert their
advantages while compensating for their disadvantages . besides , a quadratic
penalty method is adopted to give the result a nonnegative constraint , as well
as reduce the uncertainty and illposedness of the problem .
simulation studies
show that the pln - cg algorithm can give a more accurate and more stable result
for the reconstruction in fmt with less computation .
detailed description of the
pln - cg algorithm can be found in section 3 .
section 2
gives a general review of
the forward and inverse problems in fmt , including the conventional cg - based
reconstruction method .
simulation experiments are presented in section 4 to
demonstrate the validity and efficiency of the proposed algorithm .
when an external excitation light source works at
continuous wave mode ( cw mode ) , the following diffusion equation can be
employed to model the propagation of the excitation light and the fluorescent
emission light [ 610 ] :
( 1 )
[ dx(r)x(r ) ] [ ax(r ) + af(r)]x
( r ) = s ( r
rsk ) ,
[ dm(r)m(r ) ] am(r ) m(r ) = x(r )
af(r ) ,
where r is the position
vector belonging to the image region . x , m(r ) represents the
photon density at r for the
excitation light ( subscript x ) or the
fluorescent emission light ( subscript m ) .
dx , m(r ) is defined as
the diffusion coefficient
( 2)dx , m(r ) = ( 3 ( ax , m(r ) + ( 1 g)sx , m(r ) ) ) ,
where ax , m(r ) and sx , m(r ) are the
absorption and scattering coefficients , respectively .
the absorption of the excitation light due to
fluorophores is described as af(r ) and the
fluorescent yield af(r ) is required for
fluorescence parameter . in this work ,
detailed description of the finite element method for
the fmt forward problem can be found in [ 6 , 11 ] .
based on the finite element solution of the forward
problem , ( 1 )
is transformed into a linear matrix equation as follows :
( 3)wx = i ,
where x , an n 1 vector , denotes
the real fluorescent source distribution to be reconstructed .
i , a m 1 vector , is the
emission data computed from the measurement at the surface of the tissue . and
w , a m n matrix , is the
weighting matrix generated from the forward model .
generally , the inverse
problem for fmt is to find the fluorescent source distribution x in the target
tissue from the measured data i and the
precalculated matrix w. as mentioned before , the problem in ( 3 ) is quite illposed
and undetermined .
cg is one of the most useful methods for solving
large linear systems of equations with symmetric and positive definite
parameters , as it is called l - cg .
l - cg can be employed in fmt reconstruction by
transforming equation ( 1 )
into a standard linear system .
since all parameters of each step in l - cg can be
obtained from the value of the last step by iterative functions , the
computation and storage of the algorithm are reduced .
besides , with pertinence ,
l - cg converges fast and has a good orientating ability .
the requirement of the standard form of the problem in
l - cg limits the implementation of the regularization and penalty methods , which
are quite important for the illposed problem in fmt reconstruction .
thus , the
cg method for nonlinear optimization problems , namely n - cg , which is more
flexible to work along with the regularization and penalty methods and has a
better capability to work under noise , is used widely for image reconstruction
[ 15 , 17 ] . according to the
least - squares ( ls ) rule , problem ( 3 ) can be changed into a nonlinear optimization problem
as follows :
( 4)min(x)=12iwx2+(x ) ,
where (x ) is the
regularization or penalty term chosen on various purposes .
then the n - cg method
can be adopted to find the optimal solution of ( 4 ) .
this method is more computationally expensive than l - cg ,
resulting in more time consuming for each iteration .
nevertheless , it is noticed that the properties of n - cg and l - cg are
reciprocal .
thus , combining n - cg and l - cg together may generate an improved
algorithm , which can get a higher speed and accuracy from l - cg as well as a
good antinoise capability and the flexibility from n - cg .
therefore , an improved
cg - based algorithm for fmt reconstruction , penalized linear and nonlinear
combined conjugate gradient method ( pln - cg ) , was developed according to this
consideration .
the searching process for the optimal solution x * in pln - cg
begins with an initial guess x0 , and takes a steepest descent first step .
, the search is general and the effect of
noise is low , so l - cg is employed to find the rough region of the optimal
solution x * , that is , 2 . because l - cg has a better orientating ability , and
needs less computation , it can find 2 faster and more
accurately , while it does not have to expose its fragility under noise .
transformation has to be made to ( 3 ) to make it a standard linear system with symmetric
positive definite coefficient matrix .
the optimal solution of the ls problem
described in ( 4 )
satisfies the normal equation as follows :
( 5)wwx = wi ,
where w is the
transpose of w. thus
( 6)w*x = i * ,
where w * = ww , is an n n symmetric
matrix . the reconstruction problem has become a standard linear one , as is
required by l - cg . starting from an initial guess x0
, the solution can be updated iteratively
by
( 7)xk+1 = xk + kpk ,
where k is the step
size
( 8)k = rktrkpktwpk ,
and rk is the gradient
of each step .
it is defined in l - cg as the residue of the linear system , which
is obtained iteratively by
( 9)rk+1 = rk + kw*pk ,
where pk is the
searching direction and
( 10)pk+1=rk+1+k+1pk,k+1=rk+1trk+1rktrk .
the l - cg searching iteration process will cease when xk enters the
region 2 .
the definition of the region 2 is determined
by a restarting parameter , which is described in the following section .
the restart strategy is a modification that is often
used in nonlinear conjugate gradient procedures [ 19 , 21 ] .
the general scheme is to
restart the iteration and take a steepest descent step according to some predetermined
conditions .
restarting serves to periodically refresh the algorithm , erase old
information that may not be beneficial or even harmful , and renew the initial
guess x0 at every restarting
time for the new iteration process .
we adopt a restart strategy in the pln - cg scheme
described as follows :
( 11 )
|rk| = |rk 1 + k 1w*pk1 | ,
where rk represents the
gradient of (xk ) .
when |rk| satisfies
( 11 ) , it
means that the xk obtained at current
iteration has entered the small region 2 around x*. then , a steepest descent step is taken , using the
gradient direction at current point as the searching direction .
at the same
time , a new iteration process with the n - cg method begins , using xk as the initial
guess x0 .
the searching result is getting quite closer to the
optimal solution , so the effect of noise has to be taken into consideration .
besides , the uncertainty of the searching has increased .
thus , the method has
been shifted to n - cg , which can work better with noisy data . besides
, n - cg can
introduce the penalty or regularization method to gain a constraint as well as
to reduce the illposedness .
now , problem ( 3 ) is transformed into
a nonlinear optimization problem :
( 12)min (x)=12iwx2+(x ) ,
where (x ) is a penalty
term which will be discussed in section 3.4 .
the n - cg method differs from l - cg mainly in two ways .
firstly , rather than using a standard iterative function to find the step
length k , a line search method is used to identify an
approximate minimum of the nonlinear function (x ) along the
searching direction pk [ 15 , 17 , 19 ] .
secondly , the gradient of (x ) in l - cg is
simply the residue of the linear system that can be obtained iteratively . while
for n - cg
, it must be replaced by the gradient of the nonlinear objective (x ) , that is , (x ) .
thus , using the xk obtained from
l - cg as the initial guess x0 for n - cg , the
solution is updated iteratively :
( 13)xk+1 = xk + kpk ,
where k is the step
size that is computed by a line search method ,
( 14 )
min f ( xk + pk ) s.t .
0 ,
where pk is the
searching direction and
( 15)pk+1=rk+1+k+1pk,k+1=rk+1t(rk+1rk)rktrk ,
where rk is the gradient
of the objective function (x ) at current
point , that is ,
( 16)rk = ( xk ) .
it is known that a major problem of the conventional
gradient - based methods is that they are mainly designed for unconstrained
problems , but the fluorescent source distribution in the biological tissue has
to be constrained to a nonnegative region [ 16 , 22 ] .
here
, a quadratic penalty method [ 15 , 19 ] is adopted to give the problem a nonnegative
constraint .
consider the penalty function described
below
( 17)=ixi2u(xi ) ,
where xi is the ith element of x , u(x ) is the unit
step function . during the searching procedure ,
when the searched result x at current
iteration has negative values , the penalty term will be increased . in this way
is a penalty
weighting parameter , which will gradually become zero as the iteration number
increases .
thus , the solution of the new unconstrained problem in ( 12 ) with the penalty
term ( 17 )
will approach the solution of the original problem in ( 3 ) .
the value of will be
discussed experimentally in section 4.1.3
thus , a penalized linear and nonlinear combined
conjugate gradient method is generated according to the scheme described above .
a numerical model was set up to
test the validity of the pln - cg algorithm .
a circular object was simulated with
an outer diameter of 25 mm , which had a fluorophore with a diameter of 4 mm
embedded in it .
we supposed the optical property to be homogeneous , with a= 0.005 mm and s= 1 mm . in order to show the
efficiency of pln - cg better
they were placed around the inner surface of the circular object ( as shown in
figure 2(a ) ) , and were turned on in turn . for each source ,
32 detector readings
were available through the detector fibers , which were distributed uniformly on
the surface of the circular object .
the forward data were simulated by finite element
method [ 6 , 10 ] , using a fem light
transport model in cw mode .
the object was divided into 518 small triangular elements
and the mesh is shown in figure 2(b ) .
a computer with cpu amd athlon 23600 + and 512 m ddrii memory was used .
images reconstructed by n - cg , l - cg , and pln - cg are
shown in figures 3(a ) , 3(b ) , and 3(c ) .
all images were obtained with one
hundred iterations , as the objective function would descend very slowly
thereafter .
it can be seen that images reconstructed by n - cg and
l - cg are noisy .
while for pln - cg , the values are all nonnegative , and the image is
cleaner and more accurate .
the computing time was about 5.02 seconds for n - cg ,
0.22 second for l - cg , and 1.45 seconds for pln - cg .
so helping n - cg with l - cg has tremendously reduced the
computing time , as in the pln - cg method .
being sensitive to the initial guess is a big disadvantage
for most of the iterative approach based algorithms .
figure 4 shows the results reconstructed with
different initial values , using n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg
( column 3 ) , respectively .
since most elements of the original solution are zero
and the quantity of the fluorochrome intensity in fmt is relatively small , a
zero vector is closer to the solution of the problem and is a better choice to
be the initial value ( figure 3 ) . when the initial value is increased to 0.005
and 0.01 ,
the reconstructed images of n - cg ( figures 4(a ) and 4(d ) ) and l - cg
( figures 4(b ) and 4(e ) ) become perturbed , with artifacts distributed in the
background . whereas the pln - cg ( figures 4(c ) and 4(f ) ) is still giving a clear
result , with only a slight blur on the edge . to test the stability of the algorithm ,
figure 5 shows the images
reconstructed by n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg ( column 3 ) .
the image is perturbed when the
noise level is 5% ( figure 5(e ) ) .
when the noise level is 10% , the image is
totally blurred , as is shown in figure 5(h ) .
the n - cg method has a better
performance compared with l - cg ( figures figure 5(i ) and figure 5(g ) ) .
however , many artifacts
exist in the images and affect the quantification of the fluorophore . whereas ,
images reconstructed with pln - cg approach are clear when the noise levels are
1% ( figure 5(c ) ) and 5% ( figure 5(f ) ) .
when the noise level is 10% , the
fluorescent source distribution is still relatively clear , with a little
artifacts appearing on the edge .
when using the pln - cg method , is the
weighting parameter that controls the effect of the penalty term .
figure 6
shows the images reconstructed with different . it can be seen that when is 10 , the effect of the penalty term is not enough .
negative values exist and the background is not clean . increasing to 1 does
produce better results ( figure 6(b ) ) , and a further increase to 10 enhances the
improvement ( figure 6(c ) ) .
when increases to 10 , the quality of the image begins to get worse ( figure 6(d ) ) .
the results show that the penalty term can work well for a large
variation of . a typical value for is 10 to 10 . besides , should be
increased when the total iteration number increases .
in addition , rather than keeping fixed , one can
use different according to the
experiential equation
( 18) = an ,
where n is the
iteration number .
a is a fixed
weighting parameter , which can be set to a value between 10 and 1 .
the iteration
number was one hundred and a was chosen to
be 0.005 .
simulation studies above were based on two excitation
sources , in order to demonstrate the qualities of the pln - cg approach better .
when the number of sources is increased , a larger dataset can be obtained .
it
will improve the information content of the measurements and reduce the
illposedness of the inverse problem .
thus , in practice , fmt equipments normally use more
excitation sources [ 3 , 4 ] . here , simulation experiments were designed using 4
sources ( figure 7(a ) ) , 8 sources ( figure 7(b ) ) , and 16 sources ( figure 7(c ) ) ,
respectively . in each experiment , sources were turned on in turn and
32 detector readings were available for each source .
results with clean data
were obtained with a hundred iterations for about 2.99 seconds in the 4 sources
case ( figure 8(a ) ) . while the computing time was about 4.9220 seconds and
9.1560 seconds for 150 iterations in the 8 sources case ( figure 8(b ) ) and 16
sources case ( figure 8(c ) ) , as they have a larger dataset .
was simply set
to 50 for all cases because the difference among the iteration numbers was
small .
it is shown that as the source number increases , the qualities of the
reconstructed images are in progress .
the reconstructed fluorochrome region
marked with the small black circle is more even and closer to the original
value .
after the experiments using clean data described
above , white gaussian noise with a constant variance was added to the detector
readings .
it is shown that the reconstructed results
become clearer and better when the sources number increases from 2 ( figure 5(i ) ) to 4 ( figure 8(d ) ) and 8 ( figure 8(e ) ) . however , when using 16 sources
( figure 8(f ) ) , the image is not improved compared with the 8 sources case , or
even worse , which defies the common sense .
the reason may be that , when using
clean and accurate data for the reconstruction , more datasets mean more
information , whereas for the cases using noisy data , too many data may
interfere with each other and counteract the effect .
nevertheless , the results
of this experiment further demonstrate the capability of the pln - cg method to
work under noise .
in this experiment , a numerical model was set up to
test the validity of the pln - cg algorithm .
a circular object was simulated with
an outer diameter of 25 mm , which had a fluorophore with a diameter of 4 mm
embedded in it .
we supposed the optical property to be homogeneous , with a= 0.005 mm and s= 1 mm . in order to show the
efficiency of pln - cg better
they were placed around the inner surface of the circular object ( as shown in
figure 2(a ) ) , and were turned on in turn . for each source ,
32 detector readings
were available through the detector fibers , which were distributed uniformly on
the surface of the circular object .
the forward data were simulated by finite element
method [ 6 , 10 ] , using a fem light
transport model in cw mode .
the object was divided into 518 small triangular elements
and the mesh is shown in figure 2(b ) .
the reconstruction algorithm was programed
in matlab 6.5 . a computer with cpu amd athlon 23600 + and 512 m ddrii memory was used .
images reconstructed by n - cg , l - cg , and pln - cg are
shown in figures 3(a ) , 3(b ) , and 3(c ) .
all images were obtained with one
hundred iterations , as the objective function would descend very slowly
thereafter .
it can be seen that images reconstructed by n - cg and
l - cg are noisy .
while for pln - cg , the values are all nonnegative , and the image is
cleaner and more accurate .
the computing time was about 5.02 seconds for n - cg ,
0.22 second for l - cg , and 1.45 seconds for pln - cg .
so helping n - cg with l - cg has tremendously reduced the
computing time , as in the pln - cg method .
being sensitive to the initial guess is a big disadvantage
for most of the iterative approach based algorithms .
figure 4 shows the results reconstructed with
different initial values , using n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg
( column 3 ) , respectively .
since most elements of the original solution are zero
and the quantity of the fluorochrome intensity in fmt is relatively small , a
zero vector is closer to the solution of the problem and is a better choice to
be the initial value ( figure 3 ) .
when the initial value is increased to 0.005
and 0.01 , the reconstructed images of n - cg ( figures 4(a ) and 4(d ) ) and l - cg
( figures 4(b ) and 4(e ) ) become perturbed , with artifacts distributed in the
background . whereas the pln - cg ( figures 4(c ) and 4(f ) ) is still giving a clear
result , with only a slight blur on the edge . to test the stability of the algorithm ,
figure 5 shows the images
reconstructed by n - cg ( column 1 ) , l - cg ( column 2 ) , and pln - cg ( column 3 ) .
the image is perturbed when the
noise level is 5% ( figure 5(e ) ) .
when the noise level is 10% , the image is
totally blurred , as is shown in figure 5(h ) .
the n - cg method has a better
performance compared with l - cg ( figures figure 5(i ) and figure 5(g ) ) .
however , many artifacts
exist in the images and affect the quantification of the fluorophore . whereas ,
images reconstructed with pln - cg approach are clear when the noise levels are
1% ( figure 5(c ) ) and 5% ( figure 5(f ) ) .
when the noise level is 10% , the
fluorescent source distribution is still relatively clear , with a little
artifacts appearing on the edge . when using the pln - cg method , is the
weighting parameter that controls the effect of the penalty term .
figure 6
shows the images reconstructed with different . it can be seen that when is 10 , the effect of the penalty term is not enough .
negative values exist and the background is not clean . increasing to 1 does
produce better results ( figure 6(b ) ) , and a further increase to 10 enhances the
improvement ( figure 6(c ) ) .
when increases to 10 , the quality of the image begins to get worse ( figure 6(d ) ) .
the results show that the penalty term can work well for a large
variation of . a typical value for is 10 to 10 . besides , should be
increased when the total iteration number increases .
in addition , rather than keeping fixed , one can
use different according to the
experiential equation
( 18) = an ,
where n is the
iteration number .
a is a fixed
weighting parameter , which can be set to a value between 10 and 1 .
the iteration
number was one hundred and a was chosen to
be 0.005 .
the goal of this work was to establish a fast and
accurate algorithm for fmt reconstruction , which is illposed . in order to
achieve this goal ,
simulation studies have indicated that this pln - cg
method can exhibit very favorable performance and produce relatively stable
behavior .
further studies show that , when using sixteen sources , the reconstruction
algorithm can work under 15% noise , which is sufficient for practical use .
the
better performance is partly achieved by the combination of l - cg and n - cg .
l - cg
makes the algorithm faster and more accurate . while at the same time , n - cg
gives the whole algorithm a better capacity to deal with noise .
it introduces
the penalty method to get a nonnegative constraint and reduce the uncertainty
of the problem .
the restart strategy also improves the efficiency of the
algorithm by refreshing the algorithm periodically .
some kind of regularization techniques can be employed to
regularize the results and smoothen the images .
the prior knowledge about
the intensity of the fluorochrome can be used to utilize a general threshold of
the reconstructed fluorescent source density to decrease the permissible region
.
in addition ,
doing more restarting procedures appropriately may also upgrade the
reconstruction images .
currently , we are involved in the practical use of the
pln - cg reconstruction algorithm for the ongoing fmt experiment in our
laboratory . | conjugate gradient method is verified to be efficient for nonlinear optimization problems of large - dimension data . in this paper , a penalized linear and nonlinear combined conjugate gradient method for the reconstruction of fluorescence molecular tomography ( fmt ) is presented .
the algorithm combines the linear conjugate gradient method and the nonlinear conjugate gradient method together based on a restart strategy , in order to take advantage of the two kinds of conjugate gradient methods and compensate for the disadvantages .
a quadratic penalty method is adopted to gain a nonnegative constraint and reduce the illposedness of the problem .
simulation studies show that the presented algorithm is accurate , stable , and fast .
it has a better performance than the conventional conjugate gradient - based reconstruction algorithms .
it offers an effective approach to reconstruct fluorochrome information for fmt . |
merkel cell carcinoma ( mcc ) of the skin , formerly called trabecular carcinoma , is a rare , highly malignant neuroendocrine tumor .
clinical features that may serve as clues in the diagnosis of mcc are summarized in the acronym aeiou : asymptomatic / lack of tenderness , expanding rapidly , immune suppression , older than age 50 , and uv - exposed site on a person with fair skin .
the definitive diagnosis is made by histology and immunohistopathology depicting intermediate filaments and neuroendocrine markers .
the incidence of mcc has been rising in recent years [ 3 , 4 ] .
5 years after diagnosis , overall survival was 40% and the age - adjusted and sex - adjusted survival was 54% .
infection with the merkel cell virus ( mcv ) and immunosuppression are the key factors in the development of mcc .
the relative risk for mcc is about 13-fold higher in hiv and about 5-fold higher in solid organ transplantation recipients than in the general population . on the one hand
on the other hand , they might be key factors for the successful treatment of mcc .
the stage of patients with mcc has prognostic impact and influences the therapy offered . over the years
, different staging systems of mcc have been applied making it difficult to compare clinical data . in 2010 ,
the american joint committee on cancer ( ajcc ) staging system first included the staging for mcc .
summarized ajcc staging system and five - year survival data from lemos et al . in a table .
clinicians and researchers should be cautious when comparing clinical studies which applied older systems and with those which applied the recent ajcc staging system .
mcc mostly appears as a hemispherical , firm - elastic , and reddish - livid tumor with a smooth surface .
it is typically located on sun exposed areas like head , neck , extremities , and upper body .
because of its harmless appearance , this rare neuroendocrine tumor , first described by toker in 1972 , is often misdiagnosed , for example , as a cyst .
interestingly , the clinically suspected diagnosis has only been made correctly for one percent of the cases [ 1 , 12 ] .
the mcc grows rapidly , is highly aggressive , and metastasizes early locoregionally as well as distantly [ 1 , 13 ] illustrating the importance of comprehensive strategies to control disseminated diseases .
the rareness of the disease and , possibly also the comorbidities have contributed to the lack of prospective clinical studies evaluating the efficacy of therapeutic options . up to now
the only randomized controlled clinical study published in the field of mcc compared regional adjuvant radiotherapy with observation . while adjuvant radiotherapy significantly reduced the probability of regional recurrence , it had no effect on the overall survival .
the authors wrote that the introduction of sentinel node dissection decreased the recruitment rate for this study .
surgery is considered the mainstay of treatment for mcc . however , there is no evidence basis for this treatment option .
a prospective evaluation of sentinel node dissection in mcc was described only in 9 patients .
basically mcc is assumed to be a chemosensitive tumor [ 12 , 36 , 37 ] but to date no broadly accepted treatment algorithm exists .
supportively to primary excision , chemotherapy is used on mcc stages iii ( lymph node metastasis ) and iv ( distant metastases ) after the ajcc staging system .
furthermore , chemotherapeutics are used in locally advanced disease , as palliative measure or in case of recurrences .
the following data refers to retrospective case series or single case reports , except [ 14 , 15 ] and ( table 1 ) , which are prospective case series .
several groups tried to treat mcc with chemotherapeutic regimens commonly used for small cell lung cancer ( sclc ) because of histopathological and cytochemical similarities besides both of them are considered as neuroendocrine tumors [ 16 , 3842 ] .
these regimens combined carboplatin , cisplatin , and etoposide , cyclophosphamide with vincristine , doxorubicin , prednisone , bleomycin , or 5-fluorouracil ( table 1 ) .
they were reported to provide a good initial regression of the lesion , but recurrences occurred mainly within 4 to 15 months .
these potential benefits should be weighed against the possible adverse reactions of these therapeutic attempts .
some of these rather old patients died from sepsis caused by chemotherapy - induced leukopenia , progressive renal failure , or impaired hepatic function . in a retrospective analysis of a series of 251 patients from a single centre treated between 1970 and 2002 ( table 1 )
28 of 237 patients presenting with locally advanced disease or locoregional metastases received adjuvant chemotherapy and showed a 5-year disease - specific survival rate of 28% compared to 73% of 209 patients without receiving chemotherapy .
furthermore , 67 node - positive patients receiving chemotherapy were associated with a lower survival rate compared to not - receiving chemotherapy . beside polychemotherapy with burdensome toxicity ,
there are better tolerated monotherapeutic options like etoposide and anthracyclines [ 10 , 25 , 37 ] .
liposomal doxorubicin together with radiotherapy ( n = 5 ) yielded rapid response , but showed less adverse reactions , for example , gastrointestinal disorders .
orally administered etoposide achieved complete responses in 3 out of 4 patients ( 75% ) and two of them were comparatively long lasting ( 16 and 36 months ) ( table 1 ) .
the most common regimens used were cyclophosphamide , doxorubicin ( or epirubicin ) , vincristine plus / or minus prednisone , and etoposide combined with cisplatin ( or carboplatin ) .
a relevant difference in the response rate could not be described ( table 1 ) . although high remission rates were reported after chemotherapy ( up to 7075% [ 25 , 37 ] ) , but no such prolongation of survival .
main therapy still is wide excision of the tumor with or without node dissection , often in combination with radiotherapy . in comparison
, the literature does not provide adequate , sufficient data to support the use of chemotherapy .
davids et al . ( table 2 ) treated a patient who suffered from metastatic pulmonary lesions with pazopanib , which is a small - molecule tyrosine kinase inhibitor acting against vascular - endothelial - growth - factor - receptors- ( vegfr- ) 1 , 2 , and 3 and against platelet - derived - growth - factor - receptor- ( pdgfr- ) and . the rationale was that mccs have been shown having upregulated vegfr [ 46 , 47 ] and pdgfr [ 48 , 49 ] .
it was well tolerated and provided partial response of the pulmonary lesions as well as complete response of the primary lesion , but disease recurred or rather progressed 4 months later . in this case , every other therapy that had been tried before ( surgery , radiotherapy , etoposide and carboplatin , paclitaxel , tegafur , and 5-chloro-2,4-dihydroxypyridine and oxonic acid ) also led to partial or complete response and lesions recurred 48 and once 24 months later . in this paper , the authors conclude that pazopanib appears to have a promising antitumor and antiangiogenic function and a good oral bioavailability ; as per them , this has been demonstrated in preclinical studies . in this patient ,
single nucleotide polymorphism ( snp ) in pdgfr- gene was found , namely , 1432t > c mutation in codon 478 .
the same mutation was shown in two other samples of mccs that were examined by this group and in three other patients with mcc from another study .
it is not clear whether this mutation leads to an activation of pdgfr- and consequently to a better response to tyrosine kinase inhibitors , for example , pazopanib or not .
similarly well tolerated is another tyrosine kinase inhibitor called imatinib mesylate ( gleevec ) ( table 2 ) .
kit ( cd117 ) , a tyrosine kinase receptor which belongs to the same family of tyrosine kinase receptors like pdgfr- , is reported to be highly expressed ( 8495% ) in mccs [ 5052 ] . activating mutations of kit
were found in 88,2% ( n = 127 ) of gastrointestinal stromal tumors ( gists ) and showed a significantly higher partial response rate to imatinib for exon 11 kit mutation ( 83.5% ) compared to exon 9 kit mutation ( 47.8% ) or no found mutation ( 0.0% ) .
because of the successful treatment of kit expressing gists [ 53 , 54 ] and because of the recent insight that kit receptor activation through its ligand stem cell factor ( scf ) stimulates growing of mcc cells in vitro , imatinib was assumed to be a promising therapeutic option for mcc .
in fact , there were only few adverse events but imatinib appeared to provide insufficient effects on progression - free and overall survival .
just one out of 23 patients with kit expressing mccs responded partially and the progression happened rapidly after 1 or 2 months in most of the patients .
kartha and sundram examined primary and metastatic mccs ( n = 32 ) to evaluate the expression and mutations of kit and pdgfr in mccs .
coexpression of kit and scf was shown in 16% only , whereas coexpression of pdgfr- and its ligand pdgf - a was found in 81% of the cases . in this study , no activating mutations could be found ( kit exons 9 , 11 , 13 , and 17 and pdgfr- exons 10 , 12 , and 18 were analyzed ) . therefore , efficacy of imatinib is questionable , also considering results of samlowski et al . .
somatostatin analogue octreotide showed unfruitful results concerning tumor regression with a partial response rate of 3% ( n = 58 ) ( table 2 ) .
radiopeptide therapy is used to treat neuroendocrine tumors by binding of edotreotide ( dotatoc , which contains the active peptide of somatostatin , namely , octreotid ) to somatostatin receptors . in one case ,
the radiolabeled somatostatin analog 90y - dotatoc led to complete remissions after a few days , but relapse and progression occurred within weeks .
it has to be pointed out that the tolerability was very good ( table 2 ) .
lanreotide , a nonradiolabeled somatostatin analog , was intramuscularly administered in one patient every two weeks and showed a complete response of the lesion .
oblimersen sodium ( genasense ) , which inhibits the production of bcl-2 ( which is a protein acting against apoptosis in cancer cells ) , was applied intravenously to 12 patients and showed no responses ( table 2 ) .
mcc is associated with immunosuppression [ 1 , 4 ] . cases of spontaneous regressions of mccs were reported that were deemed to be caused by the regained activity of the immune system [ 56 , 57 ] .
mccs that showed a high infiltration with cd8 + lymphocytes were attributed to a better prognosis ( 100% mcc - specific survival , n = 26 ) compared to mccs with lower infiltration ( 60% survival , n = 120 ) .
some patients developed mcc during treatment with tumor necrosis factor ( tnf ) alpha inhibitors , which usually promotes inflammatory response .
therefore , tnf - alpha inhibitors are assumed to increase the risk of occurring of mcc [ 59 , 60 ] .
the detection of the merkel cell polyomavirus ( mcv ) and its genetic material , found in mcc tumor cells of about 80% of the concerned patients , provided new opportunities and possibilities regarding therapy strategies [ 61 , 62 ] .
for instance , interferons ( and ) have been suggested to be a possible therapeutic option . however , there are only few reports on the use of immunomodulating substances in mcc . in two case reports ,
interferon--2b caused severe asthenia and depression , leading to discontinuation of the therapy , considering that no tumor regression was observed .
recently , it has been shown that viral t - antigens represent an important signal for mcv - infected mcc cells concerning survival and growth .
imiquimod , which induces immune response by binding to tlr7 ( toll like receptor-7 , located on the surface of immune cells , e.g. , macrophages ) , was topically applied to mcc ( n = 1 ) and combined with radiotherapy .
another new therapeutic approach is based on cytokine inducted inflammatory response . to avoid systemic reactions ,
fusion proteins were developed consisting of antibodies and cytokines , which bind to their corresponding antigens located on the tumor cell surface . in general , combined therapy of cytokine - based antibodies and regular chemotherapy seems to be well tolerated .
there is a considerable lack of prospective clinical studies and in particular randomized controlled studies that evaluated the therapeutic options for mcc . for the time being , nearly all conclusions are based on case series or even isolated cases and theoretic considerations , rather than evidence - based medicine . with respect to chemotherapeutics or molecular - targeted agents , no convincing responses were reported ; at best the responses lasted a few months or just several weeks .
thus , the question arises whether there truly is a benefit of chemotherapy for mcc ; if any , the benefit is unlikely to be relevant .
because of frequent comorbidities of the older patient collective , it is necessary to develop therapy modalities that are effective and more likely to be tolerated .
the recent insight of an association of mcc to mcv infection and immunosuppression enables new therapeutic options , for example , the inhibition of viral t - antigens , that requests further investigations .
currently , there is an ongoing phase ii trial study with the purpose of placing the gene for interleukin-12 into mcc cells by intratumoral injection so that humans build up an immune defense and may kill tumor cells .
more important , however , would be randomized controlled studies in this field , which are urgently needed .
the often rapid deterioration of this cancer and the frequent comorbidities might require rather simple protocols .
the rareness of the disease calls for the implementation of an mcc network to collect sufficient numbers of patients in an mcc registry and multicenter clinical trials . | merkel cell carcinoma ( mcc ) is a rare neuroendocrine skin tumor that typically occurs in elderly , immunosuppressed patients .
infection with merkel cell virus ( mcv ) and immunosuppression play an important role in the development of mcc .
different staging systems make it difficult to compare the existing clinical data .
furthermore , there predominantly exist single case reports and case series , but no randomized controlled trials .
however , it is necessary to develop further therapy options because mcc tends to grow rapidly and metastasizes early . in the metastatic disease ,
therapeutic attempts were made with various chemotherapeutic combination regimens . because of the high toxicity of these combinations , especially those established in sclc , and regarding the unsatisfying results , the challenge is to balance the pros and cons of chemotherapy individually and carefully . up to now , emerging new therapy options as molecular - targeted agents , for example , pazopanib , imatinib , or somatostatin analogues as well as immunologicals , for example , imiquimod and interferons , also showed less success concerning the disease - free response rates . according to the literature , neither chemotherapy nor molecular - targeted agents or immunotherapeutic strategies have shown promising effects in the therapy of the metastatic disease of mcc so far . there is a great demand for randomized controlled studies and a need for an mcc registry and multicenter clinical trials due to the tumors curiosity . |
variations in human growth patterns arise from complex genetic and environmental interactions . variability is expressed clinically as differences in the timing and intensity of growth events , so that children vary in the ages at which they reach stages of physical development .
well - defined indicators of physiological maturity provide a more reliable basis than chronological age for the assessment of growth potential , especially during the puberty growth spurt . in dentistry ,
the knowledge of physiological maturation is particularly useful as a diagnostic tool to determine the most appropriate time and method for orthodontic treatment , as well as to determine the need and the best time for surgery procedures23 .
the development of each individual can be affected by genetic , racial , nutritional , climate , hormonal and environmental factors12,14,18 . in view of this , some authors14,19 have recommended the acceptance of the normal parameters between different regions .
the development of secondary sexual features , mental age , tooth mineralization and eruption , height - weight relationship and bone development are some of the adjunctive methods used to determine the developmental stage . for some authors , bone development is the most reliable method23 . on the other hand ,
others emphasize the superiority of the degree of dental mineralization , which is less affected by external factors7,18 .
some authors have advocated the applicability of the bone age determination method8,10 , while others endorsed the applicability of the dental age determination method1,3,4,9,22,26,27 . yet , others13 have applied a combination of both in different populations .
, emphasis is placed on studies that describe a chronological table of permanent tooth mineralization in the brazilian population15,17,20 .
the methods used to determine dental age have been developed according to different individual features of tooth growth and development in the populations of northeastern brazil .
based on the differences in these populations , the goal of this study was to determine the dental age of children in northeastern brazil and compare the results with those of established methods .
in addition , the use of correction factors will assessed for allowing the clinical application of the study results .
the study population consisted of 360 healthy patients of both genders aged 7 to 15 years from the city of fortaleza ( ce , brazil ) , who were assisted at the radiology clinic of the university of fortaleza .
the research protocol was approved by the ethics in research committee of the university of fortaleza .
the children were assigned to 18 groups ( n=20 , being 10 male and 10 female ) according to the chronological age . at the time of radiographic examination , the chronological age of each child was calculated on the basis of the child 's reported date of birth .
the final statistical analysis was applied when the result of the intraexaminer test was considered as adequate .
dental age was assessed by panoramic radiographs according to the methods proposed by nolla22 ( 1960 ) and nicodemo , et al.21 ( 1974 ) . in the nolla method ,
the stage of development of the mandibular left teeth of each child was analyzed and then compared to a series of standardized drawings depicting 10 stages of tooth calcification for each gender .
a similar procedure was used for the method proposed by nicodemo , et al.21(1974 ) . however
data were tabulated and submitted to statistical analysis using the bioestat 2.0 ( 2000 ) software .
student - neuman- keuls test was performed and pearson 's correlation coefficients were calculated at 5% significance level .
the relationship between chronological and estimated dental age was evaluated by each method , gender and age groups , as well as in the total population by analysis of means and standard deviation .
table 1 shows that the mean chronological age for boys was 135.94 months ( 30.40 , range 85.30 - 186.30 ) and for girls was 135.97 months ( 30.93 , range 83.80 - 186.40 ) . in boys ,
the mean dental ages were underestimated in both methods , and the differences were quite marked for the older groups .
, the mean dental age was underestimated for almost all groups using the nolla22 ( 1960 ) method . on the other hand
, the use of the method proposed by nicodemo , et al.21(1974 ) showed that , although the tendencies for chronological age were greater than those for dental age , the ages in both genders were essentially the same ( figure 1 ) .
table 2 shows the difference between chronological age and dental age for both methods and for male and female subgroups using the student - neuman - keuls test and the pearson correlation coefficient , which revealed high and statistically significant ( p<0.05 ) values .
different letters indicate statistically significant difference by student - newman - keuls test at 5% significance level .
figures 2 and 3 show the scatter plots and the straight line and curves adjusted for regression equations between estimated dental age ( x ) and chronological age ( y ) , for each method and gender studied .
additionally , the respective determination coefficients ( r ) were obtained , which present the amount of total variation expected for each method , and the regression equations that should be used to make the method applicable to the studied population .
children with the same chronological age may show differences in the developmental stages of different biologic systems .
these differences have led to the concept of physiological age as a means to define progress toward completeness of child 's development or maturity .
thus , physiological age , or its frequently used synonyms , biological and developmental age , are measures for describing the status of an individual child , whereas chronological ages convey only a rough approximation of this status because of the range in development observed for any given age .
physiological age is estimated by the maturation of one or more tissue systems , and dentition is one of the systems used11,16 .
studies have shown that dental development relates more closely to chronological age than skeletal , somatic or sexual maturity indicators12 .
tooth formation has been more widely used than tooth eruption for assessing dental maturation because it is a continuous and progressive process that can be followed radiographically , and most teeth can be evaluated at each examination . when information about the formation stages of several teeth is combined , the dental age of an individual can be estimated22 .
there are several methods for estimating dental age , among them , the method proposed by nolla21 ( 1960 ) , which has been the method of choice over the years7,9,24 , and the method proposed by nicodemo , et al.20 ( 1974 ) , which has been developed taking into consideration the brazilian population1 .
there is extensive documentation on the differences between different populations relative to the age for determining dental maturation markers , mostly tooth eruption , which makes ethnicity a quite attractive factor .
other less tangible factors , such as climate , nutrition , socioeconomic levels and urbanization , may also influence maturation rates13 .
therefore , considering the regional differences in a country like brazil , establishing specific parameters for each region would be extremely valuable . in the present study ,
the applicability of two dental age determination methods was assessed for the brazilian northeast population .
the 82 - 189-month age range was chosen because most maturity changes occur during this period .
different types of radiographs , like oblique cephalogram and intraoral radiographs , have been used to investigate dental development , but the panoramic radiographs used in the present study have been adopted by most authors due to their accessibility and the possibility to visualize all teeth2,6,17,24,26 .
the mandibular teeth were chosen because they can be easily visualized on the panoramic radiograph .
several authors13,17,19,21 have shown that there are no significant differences between the right and left sides and that the rate of growth was approximately the same on both sides .
however , further comparison of the various studies is virtually impossible because of the many differences in methodology , age groups and sample sizes .
the relationship between chronological and estimated dental ages was evaluated for each studied method , gender and age range , as well as , for the total sample , by analysis of means and standard deviation . in boys ,
the mean dental ages were underestimated in both methods , and the differences were quite marked for the older groups .
the mean dental age was also underestimated in almost all groups using the nolla method .
on the other hand , when the method proposed by nicodemo and colleagues were used , it was observed that , although the tendencies for the chronological age were greater than those for the dental age , the ages were essentially the same when compared to the male population data .
this difference probably occurred because this method uses the same parameter for both genders , not taking into account the female precociousness .
similar results have been reported by other authors , such as nolla21 ( 1960 ) , daito , et al.3 ( 1989 ) , carvalho , et al.2 ( 1990 ) and ferreira jnior , et al.6 ( 1993 ) .
only moraes17 ( 1974 ) and arajo1 ( 2000 ) found no significant difference between genders .
nstron , et al.22 ( 1988 ) reported that differences in overall dental maturity exist not only among nations but also among groups of children in a nation with a relatively homogenous population .
the underestimated dental age found in the population of the present study was not observed by souza freitas , et al.25 ( 1970 ) , who reported an overestimation in younger children and an underestimation in older - age children of southeast brazil using nolla method .
another study4 ( 1994 ) showed that dental age was significantly higher than chronological age among chinese children , whereas moraes17 ( 1974 ) found a delay in the first and later stages , the dental age being greater than the chronological age .
finally , holtgrave , et al.9 ( 1997 ) reported no difference in girls using the nolla method ; in boys , however , dental development was accelerated , being most apparent in very young males . only arajo1 ( 2000 ) , using the method proposed by nicodemo , et al.21(1974 ) to study a sample of children from the state of maranho , in northeastern brazil , showed that dental development was delayed when compared to chronological age . a possible explanation for this could be the similarity between our sample and the sample from arajo 's study1 , with respect to nutritional , environmental and socioeconomic conditions .
according to tompkins27 ( 1996 ) and stefanac - papic , et al.26 ( 1998 ) , differences in dental development could exist between different ethnic groups .
furthermore , moorrees16 ( 1963 ) , nanda and chawla19 ( 1966 ) , moraes17 ( 1974 ) and nystrn , et al.22 ( 1988 ) emphasized that the methods of conversion to dental ages depend on the population at issue .
, correction factors must be established to make the methods proposed by nolla22 ( 1960 ) and by nicodemo , et al.21 ( 1974 ) applicable to each studied population .
there was no significant difference between both methods , however , significant difference was observed between the estimated dental age and the chronological age .
there was significant difference between both methods and between the chronological and the estimated dental age .
for each studied method , the values of correction factors ( regression equations ) were established and might be used to improve the applicability to the studied population . | objective : the purpose of this investigation was to evaluate the applicability of the methods proposed by nolla and by nicodemo and colleagues for assessing dental age and its correlation to chronological age.methods:panoramic radiographs of 360 patients from the city of fortaleza ( ce , brazil ) aged 7 - 15 years were used to assess the associations between dental and chronological age .
data were submitted to statistical analysis using the bioestat 2.0 ( 2000 ) software . student - neuman - keuls test was performed and pearson 's correlation coefficients were calculated at 5% significance level.results:when the nolla method was applied , the mean difference between true and estimated age for males and females was underestimated .
the use of the method proposed by nicodemo and colleagues also resulted in underestimation , although it was more evident in male subjects .
the correlation coefficients between chronological age and estimated dental age were high , with mean values ranging between 0.87 and 0.91 for males and between 0.84 and 0.93 for females.conclusion:although both methods proved to be reliable in estimating age , the use of correction factors is recommended . |
approximately 1% of people worldwide are affected by rheumatoid arthritis ( ra ) that is a systemic autoimmune disease .
this is a form of arthropathy characterized by a chronic inflammation that leads to progressive cartilage and bone destruction .
the immunopathogenetic pathways implicated in ra are not fully elucidated ; however , it is known that they involve the recruitment of several cell types from both innate and adaptive immunity .
cytokines are viewed as the main players in arthritic lesions , maintaining chronic inflammation and promoting autoimmunity .
tnf- greatly contributes to joint inflammation by stimulating cell proliferation , metalloproteinases and adhesion - molecules expression , secretion of other cytokines , and prostaglandin production by the synovial tissue .
il-6 is another mediator that is found in elevated levels in synovial fluid and serum from ra patients .
this cytokine contributes to both local and systemic ra histopathological alterations and clinical manifestations , such as pannus , cartilage degradation , fever , fatigue , and weight loss .
some of the autoantigens involved in the pathogenesis of ra include igg , collagen , proteoglycan , citrullinated proteins , fibrin , fibrinogen , and the shared human leukocyte antigen ( hla ) dr epitope [ 6 , 7 ] .
experimental models induced with some of these antigens , specially collagen and proteoglycan , are being widely employed due to their similarities with the corresponding human disease [ 8 , 9 ] .
we recently demonstrated that bovine pg can also induce typical arthritis when associated with dimethyldioctadecylammonium bromide .
it is well known that several autoantigens able to induce autoimmunity have also the potential to induce antigen - specific tolerance depending upon the route , the dose , and the physical form of the antigen .
systemic administration of soluble antigens is a well - accepted approach to induce immunological tolerance .
anergy and clonal deletion of effector cells , induction of regulatory t cells ( tregs ) , and immune response deviation have been postulated as mechanisms underlying systemic tolerance . to date
, ra is not a curable disease and most of the treatments consist in general suppression of the immune response to control synovitis and prevent joint injury worsening .
therefore , there is an increasing interest in alternative immunomodulatory strategies , particularly the ones that induce antigen - specific tolerance .
these procedures could be , theoretically , the safest measures to avoid or treat autoimmune diseases . in this context
, we expected that the systemic administration of proteoglycan ( pg ) that is a cartilage compound would induce antigen - specific tolerance and therefore restrain arthritis development .
female balb / c retired breeder mice aged 8 to 11 months were purchased from cemib ( campinas , so paulo , brazil ) .
they were maintained in the animal facility of the department of microbiology and immunology under controlled conditions of luminosity ( 12 h light/12 h dark ) and temperature ( 22 2c ) .
mice were allocated in ventilated cages with sterile pine shavings and received sterile food and filtered water ad libitum .
the manipulation of the animals was in compliance with the local ethics committee ( protocol number 257-ceea ) .
doses of proteoglycan ( pg ) ( 50 g or 100 g ) every three days .
injections of bovine pg associated with dimethyldioctadecylammonium bromide ( dda ) adjuvant at intervals of 21 days . after the third injection , arthritis score was daily evaluated until euthanasia ( 70 days after the beginning of arthritis induction ) .
arthritis severity was determined using a standard visual scoring system based on the degree of edema and erytema ranging from 0 to 4 for each paw .
the following system was used : 0 = normal ; 1 = mild edema in one joint in the paw ; 2 = moderate edema and erytema in one or more joints in the paw ; 3 = pronounced edema and erytema in all joints in the paw and ankle ; 4 = severe edema and erytema of the entire paw and ankle and movement impairment .
this classification resulted in a total score that ranged from 0 to 16 for each animal .
mice paws were collected after euthanasia and fixed in 10% formalin phosphate buffer for at least 48 hours at room temperature .
the samples were demineralized in 10% titriplex edta disodium salt ( merck millipore , darmstadt , germany ) for three months .
the decalcified tissues were embedded in paraffin and 5 m sections were mounted on glass slides and stained with hematoxylin and eosin ( he ) .
the images were acquired by a digital camera attached to the optical microscope ( nikon , kurobanemuko , otawara , japan ) .
spleens were collected after euthanasia , ressuspended in rpmi medium containing gentamicin and fetal calf serum ( 5.0 10 cells / ml ) , and stimulated with pg ( 50 g / ml ) .
after 48 hours of incubation at 37c/5% co2 , culture supernatants were collected for tnf- , il-6 , il-17 , ifn- , il-5 , and il-10 quantification .
these cytokines were assessed by using enzyme linked immunosorbent assay ( elisa ) , according to manufacturer 's instructions ( bd biosciences , san jose , ca , usa , and rd systems , minneapolis , mn , usa ) .
sensitivity of elisa kits for these cytokines was 31.25 , 19.5 , 15.6 , 31.25 , 7.8 , and 15.6 pg / ml , respectively .
flow cytometry analysis was performed according to manufacturer 's instructions ( ebiosciences , san diego , ca , usa ) .
briefly , for dendritic cells ( dcs ) immunophenotyping , splenic cells were incubated with fitc - conjugated anti - mouse cd11c ( clone n418 ) , apc - conjugated anti - mouse mhcii ( clone m5/114.15.2 ) , and pe - conjugated anti - mouse cd80 ( clone 16 - 10a1 ) antibodies .
the cells were washed and ressuspended in flow cytometry buffer containing paraformaldehyde solution . for tregs , splenic cells were first incubated with fitc - conjugated anti - mouse cd4 ( clone gk1.5 ) and apc - conjugated anti - mouse cd25 ( clone pc61.5 ) antibodies .
intracellular foxp3 transcription factor was detected using foxp3 pe staining set ( ebiosciences , san diego , ca , usa ) according to manufacturer 's instructions .
mrna was extracted using trizol ( life technologies ) and rneasy mini kit ( qiagen , valencia , ca , usa ) .
dnase treatment followed manufacturer 's instructions and purity of the samples was assessed by 260/280 ratio .
single - strand cdna synthesis was performed from 100 ng/l of extracted rna , using the high capacity cdna reverse transcription kit ( applied biosystems , carlsbad , ca , usa ) .
aliquots of cdna ( 3 l ) were subjected to real time pcr reaction using taqman system .
each reaction contained 15 l of taqman gene expression master mix ( life technologies , carlsbad , ca , usa ) , 0.25 l of the reference gene , and 1.0 to 1.5 l of the target genes .
the following inventoried primes / probes tested by life technologies were used : -actin ( mm00607939_s1 ) , t - bet ( mm00450960_m1 ) , gata-3 ( mm00484683_m1 ) , ror- ( mm01261022_m1 ) , and foxp3 ( mm00475162_m1 ) . the reactions were performed in abi 7300 equipment ( applied biosystems , carlsbad , ca , usa ) using standard parameters .
data were analyzed in sds software system 7300 and relative quantification was determined based on fold difference ( 2 ) using ct value of the target gene normalized to the reference gene and the control ( ) group as the calibrator .
proteins from paws were extracted by homogenization in ripa ( radioimmunoprecipitation assay ) buffer with an automatic homogenizer ( ultra turrax werke , ika , staufen , germany ) .
homogenates were centrifuged , the supernatants were filtered through a 22 m filter , and protein concentration was determined by pierce method ( thermo scientific , waltham , ma , usa ) .
the samples were stored at 80 until cytokines were quantified by cytometric bead array ( cba ) .
mouse th1/th2/th17 cytokine kit ( bd biosciences , san jose , ca , usa ) was used to quantify these cytokines in all samples .
briefly , 25 l of supernatants was incubated with beads of different sizes conjugated with fluorochromes .
the acquisition of the beads was performed in facs canto ii flow cytometer ( bd biosciences , san jose , ca , usa ) with facs diva software and the analysis was done using fcap 3.0 software ( soft flow inc . , st .
doses of 50 g of pg or chicken ovalbumin ( ova ) ( sigma aldrich , st .
one week after the last dose , the animals were immunized with a single i.p .
dth was performed one week later by pg inoculation ( 10 g ) in the hind paw .
paw thickness was measured before and 24 hours after pg inoculation using a caliper ( starrett , athol , ma , usa ) .
results were presented as mean standard deviation for parametric variables and the comparison among the groups was performed by anova followed by tukey 's test . for nonparametric variables ,
the results were presented as median and the comparison among the groups was performed by kruskal - wallis followed by dunn 's test . disease prevalence and severity were compared using chi - square test .
, san jose , ca , usa ) and p < 0.05 was considered significant .
disease prevalence in 2xpg50 and 2xpg100 groups was similar to those in the control ( + ) group . however , a significant decrease in prevalence was observed in the group previously injected with 3xpg50 as presented in table 1 .
although clinical disease appeared around days 43 or 44 after arthritis induction in all experimental groups , the maximum clinical scores reached in 2xpg50 and 3xpg50 groups were significantly reduced in comparison to control ( + ) group . moreover
, these two groups presented a much less severe disease , with a significant smaller number of animals with clinical score above 8 .
protection in the 3xpg50 group was also confirmed by histopathological analyses that indicated a clear reduction in inflammation .
figure 1(c ) shows representative micrographs of mice hind paws in score 0 from control ( ) , score 3 from control ( + ) , and score 1 from 3xpg50 group , respectively .
70 days after arthritis induction , there were a massive inflammation and pannus formation only in the control ( + ) group .
the 3xpg50 group presented well preserved joint structures similar to the control ( ) group
. cytokine profile , which is illustrated in figure 2 , was assessed in both unstimulated and pg stimulated spleen cell cultures .
spontaneous production of ifn- , il-6 , il-5 , and il-10 was observed in all arthritic groups . however , except il-6 , all other cytokines were produced in much higher levels after pg stimulation .
reduction in ifn- and il-17 levels was more accentuated in the 3xpg50 whereas il-5 and il-10 levels were comparable in the three groups inoculated with pg before disease induction .
as dc immaturity has been associated with tolerance induction in rheumatoid arthritis , we evaluated the frequency of mature dcs in the spleen of healthy , arthritic , and 3xpg50 experimental groups .
the frequency of splenic cd11c+ mhcii+ cd80 + dcs , which is illustrated in figure 3(c ) , is significantly higher in the control ( + ) group whereas the 3xpg50 group presented levels comparable to the control ( ) group .
considering that immaturity of dcs is frequently associated with the development of cd4 + cd25 + foxp3 + t cells and that this is an important mechanism to keep peripheral tolerance , the amount of splenic cd4 + cd25 + foxp3 + tregs was also evaluated .
however , the frequency of this t cell subset was similar in the three experimental groups ( figure 3(f ) ) .
the knowledge of the interplay among t cell subsets has been pivotal to understand arthritis immunopathogenesis and also to suggest new therapeutic modalities . to evaluate if the prophylactic efficacy of pg administration would affect the proportion of these subsets , the local mrna expression of their respective putative transcription factors was determined .
relative quantification of t - bet , gata-3 , ror- , and foxp3 expression , which are related to th1 , th2 , th17 , and treg subsets , respectively , was determined . as illustrated in figure 4
, there was a significant increase in gata-3 and ror- expression in animals from the 3xpg50 group compared with the control ( + ) one .
furthermore , foxp3 expression was significantly decreased in this previously immunized group when compared with the control ( + ) group .
il-2 , il-4 , il-10 , il-17 , and ifn- production was not detected in the arthritic joints .
previous pg immunization determined a significant reduction in the local ( paws ) production of these cytokines .
a delayed - type hypersensitivity ( dth ) reaction was used to confirm that pg was able to induce tolerance and that this tolerance was specific for pg .
as expected , there was no increase in the paw thickness of animals from the control ( ) group ( not immunized with pg+dda but challenged with pg ) .
however , all other experimental groups presented elevated paw thickness 24 hours after pg challenge in comparison to the control ( ) group .
inoculation of ova ( an irrelevant antigen ) before immunization with pg+dda did not trigger a tolerogenic effect .
animals from this group presented paw thickness similar to the control ( + ) group when challenged with pg .
previous inoculation of the specific antigen ( pg ) determined a tolerogenic effect demonstrated by a significant decrease in dth response in comparison to the control ( + ) group ( figure 5 ) .
autoimmune diseases such as rheumatoid arthritis , multiple sclerosis , and type 1 diabetes are on the list of the most relevant causes of female death . in this context , much effort has been expended to induce tolerance to autoantigens as an alternative to current and usually global immunosuppressive treatments .
antigen administration by oral route , for example , has been promising by showing a protective effect in experimental diabetes and encephalomyelitis .
intravenous administration of soluble antigen in the absence of adjuvants is another well documented procedure to induce tolerance [ 21 , 22 ] .
the present study was undertaken to evaluate if proteoglycan ( pg ) injected by intraperitoneal ( i.p . )
pg administration , before arthritis induction by this same antigen , was able to decrease disease prevalence , clinical score , and also the histopathological features .
the most effective protocol was the inoculation of three doses of 50 g of pg .
two doses of 50 g of pg triggered a similar but less accentuated protective effect .
the prophylactic effect observed in this work is consistent with the literature . already in 1997 , liblau et al . suggested that systemic inoculation of soluble proteins , synthetic peptides , or peptide analogues could become an acceptable approach to prevent or to treat human autoimmune diseases as multiple sclerosis and type 1 diabetes .
the prophylactic effect of a cartilage specific antigen was described , for the first time , by gumanovskaya et al . , 1999 .
at first sight , it could appear too complex to translate our findings to human arthritis because , differently from multiple sclerosis and type 1 diabetes , whose involved autoantigens are better established , arthritis targeted autoantigens are still not so well characterized . however , it was recently reported that oral administration of shark type ii collagen suppressed arthritis induced in rats by inoculation of complete freund 's adjuvant .
it is possible , therefore , that a specific joint antigen , as is the case of pg , can trigger a similar protective effect in human arthritis when administered by a systemic route .
this possibility still needs a profound preclinical investigation . to elucidate the possible protective mechanism triggered by pg
all experimental groups produced detectable levels of ifn- and il-17 but not tnf-. these findings are in accordance with several studies that reveal the proarthritogenic effect of ifn- and il-17 .
previous pg administration prevented the development of a more severe disease and concomitantly reduced the production of ifn- and il-17 .
analysis of cytokine production by spleen cells stimulated with pg also suggests that the protective effect is mediated by an increased production of il-5 and il-10 anti - inflammatory cytokines .
as il-5 is described as a typical th2 cytokine [ 26 , 27 ] , it is possible that i.p .
administration of pg has polarized the immune response towards th2 . the higher expression of gata-3 in the paws from previously pg injected mice reinforces this possibility .
moreover , il-10 has been described by some authors as being comparable to il-4 and il-5 concerning the th2 pattern .
il-10 is endowed with a strong anti - inflammatory potential and its contribution to tolerance induction to both self - antigens and foreign antigens has also been described .
a similar anti - inflammatory role has been attributed to these cytokines in experimental diabetes and encephalomyelitis .
the higher percentage of mature dcs in the positive control group shows that the arthritogenic process is associated with an increased maturation of dcs .
otherwise , the smaller amount of mature dcs in pg inoculated mice suggests that pg effect over dcs could be involved in this protective effect .
demonstration that skewing dcs differentiation towards a tolerogenic state is efficient as an ra treatment supports this possibility .
intraperitoneal delivered substances are primarily absorbed by mesenteric vessels which drain into the portal vein and pass to the liver .
it is well known that this organ also uses other pathways to establish a state of immunological tolerance .
route did not observe alterations in tregs frequency and function in rats with adjuvant arthritis after treatment with the 65 kda heat shock protein .
they also demonstrated that this tolerogenic effect was not mediated by indoleamine 2,3-dioxygenase expressing dcs .
otherwise , the increased expression of gata-3 mrna levels suggests higher accumulation of th2 polarized cells in the joints of pg protected mice .
this is consistent with the literature since th2 polarization has been associated with tolerance induction by systemic immunization .
the increased expression of ror- and the decreased expression of foxp3 in the tolerized experimental group were unexpected since th17 and treg subsets are usually associated with antagonistic roles in the course of autoimmune inflammatory pathologies .
the extreme complexity of tregs plasticity is being acknowledged and includes an unpredictable correlation between foxp3 expression and suppressive ability and also the potential of this subset to acquire the features of effector t cells .
thus , additional subsets as th17/th1 , th17/th2 , and th17/treg have been recently described .
the concomitant elevated expression of gata-3 and ror- could therefore represent the local presence of a th17/th2 subset .
alternatively , the elevated amount of th cells expressing ror- ( th17 ) could be linked to tregs plasticity . in this scenario ,
this possibility is partially supported by a recent report by wang et al . 2015 .
they also observed that il-17 producing t cells retained suppressive function and were associated with milder inflammatory conditions .
a possible correlation between t cell subsets and their signature cytokines was not found in mice paws , but the prophylactic pg effect clearly downmodulated the local production of tnf- and il-6 .
the relevance of these findings resides in the pivotal role of these two mediators on joint destruction . this knowledge upgraded disease treatment with the adoption of various strategies based , initially , on tnf- inhibition .
more recently , mainly because some ra patients are nonresponsive to anti - tnf therapy , agents targeting il-6 are viewed as promising biologicals in ra treatment . to determine if the prophylactic activity elicited by pg administration was specific , we compared the effects of previous injection of pg and ova on the intensity of a dth reaction .
previous administration of three doses of the specific antigen ( pg ) determined a tolerogenic effect characterized by a significant decrease in the dth reaction in comparison to the control ( + ) group .
this effect was not observed in animals previously inoculated with the nonrelated cartilage antigen ( ova ) , indicating , therefore , that the tolerogenic effect was specific for pg .
the possible prophylactic use of bovine pg to prevent human arthritis , based on the presence of shared epitopes between human and bovine pg , certainly needs further investigation .
further investigation is also necessary to disclose if this procedure can be translated to ra patients who already present with disease symptoms . considering that these patients have a compromised self - tolerance , ra putative target autoantigens as pg , collagen , or citrullinated molecules
could be associated with tolerogenic adjuvants or with the standard ra therapies to optimize disease treatment .
the possible therapeutic use of pg alone or combined with vitamin d3 is being investigated by our research group .
we also recently demonstrated that treatment with myelin peptide combined with vitamin d3 controlled experimental encephalomyelitis development in both therapeutic and prophylactic approaches .
combined therapies would also allow decreasing immunosuppressive drugs dosage and , therefore , avoiding a generalized immunosuppression .
in addition , these antigen - specific strategies could be efficacious during the preclinical disease phase when immunological abnormalities are already happening without clinical manifestation .
together , these results indicate that previous pg inoculation determines a specific tolerogenic effect strong enough to reduce the severity of subsequently induced arthritis . | this study was undertaken to evaluate the prophylactic potential of proteoglycan ( pg ) administration in experimental arthritis .
female balb / c retired breeder mice received two ( 2xpg50 and 2xpg100 groups ) or three ( 3xpg50 group ) intraperitoneal doses of bovine pg ( 50 g or 100 g ) every three days .
a week later the animals were submitted to arthritis induction by immunization with three i.p .
doses of bovine pg associated with dimethyldioctadecylammonium bromide adjuvant at intervals of 21 days . disease severity was daily assessed after the third dose by score evaluation .
the 3xpg50 group showed significant reduction in prevalence and clinical scores .
this protective effect was associated with lower production of ifn- and il-17 and increased production of il-5 and il-10 by spleen cells restimulated in vitro with pg .
even though previous pg administration restrained dendritic cells maturation this procedure did not alter the frequency of regulatory foxp3 + t cells .
lower tnf- and il-6 levels and higher expression of ror- and gata-3 were detected in the paws of protected animals .
a delayed - type hypersensitivity reaction confirmed specific tolerance induction .
taken together , these results indicate that previous pg inoculation determines a specific tolerogenic effect that is able to decrease severity of subsequently induced arthritis . |
in late june 2012 , an increase in cases of prolonged fever for 3 days was reported from the vanimo general hospital in vanimo , sandaun province .
the illness was characterized by high fever ( temperature > 40c ) , arthralgia , emesis , and severe nausea . in most patients ,
fever subsided within 2472 hours and patients were discharged after abatement of initial signs and symptoms .
however , many patients returned within a few days reporting lingering arthralgia and severe pruritus . on the basis of clinical characteristics
serum samples were collected from 86 patients with acute fever during september october 2012 .
samples were screened for chikv by using a reported real - time reverse transcription pcr ( 4 ) , and 31 ( 36% ) were positive for chikv .
partial e1 genes for 3 chikv strains from papua new guinea ( vn033kc524770 , vn064kc524771 , and vn083kc524772 ) were sequenced ( 4 ) .
the papua new guinea strains had high levels of nucleotide ( 99.9% ) and amino acid ( 100% ) identity ; only 2 synonymous sequence polymorphisms were observed between the 3 strains .
sequence alignment and phylogenetic analysis of e1 sequences showed that the papua new guinea outbreak was caused by chikv from the ecsa genotype ( figure 1 ) .
phylogenetic analysis of a 924-nt fragment of partial envelope 1 glycoprotein gene sequences of chikungunya virus strains isolated in vanino , papua new guinea ( png ) and global strains .
the tree was constructed by using bootstrap analysis ( 1,000 replicates ) and the neighbor - joining method with the kimura 2-parameter method for nucleotide data analysis .
a total of 1,590 suspected cases of chikungunya were recorded at vanimo general hospital ( figure 2 ) .
detailed data were collected for 98 patients ( 54 female patients ; p = 0.31 ) .
the age range of the patients was 260 years ( median age 24 years ) .
the most common signs and symptoms were fever and arthralgia ( 100% ; these symptoms constituted the case definition ) , headache ( 83% ) , cough ( 31% ) , and nausea ( 26% ) .
syndromic cases ( n = 1,565 ) reported from vanimo general hospital , papua new guinea , july
it is not known why no cases were recorded during the week of october 1 . in november 2012 ,
all potential indoor and outdoor breeding containers were recorded and container , household , and breteau indices were calculated ( table ) on the basis of the presence of aedine larvae . a portion of larvae from each collection was reared to adults for morphologic identification , and 100% ( n = 137 ) were identified as ae .
adult mosquitoes were collected over 10 days by using the biogents - sentinel odor - baited trap ( biogents ag , regensberg , germany ) .
all 155 mosquitoes collected were identified morphologically to species ; 154 were identified as ae .
mosquitoes were separated by sex and location and combined in pools of 10 for detection of chikv by use of real - time reverse transcription pcr .
there are grave concerns that the outbreak will spread throughout the country ; as of this writing , confirmed or suspected cases have been reported in 8 other provinces ( madang , west new britain , east new britain , new ireland , eastern highlands , oro , chimbu , and morobe ) in papua new guinea . although no previous outbreaks of chikungunya in papua new guinea have been documented , a study conducted in the mid-1970s reported that the seroprevalence of chikv was 30% in some regions of the country ( 5 ) .
a similar study at that time also reported a high seroprevalence of chikv throughout indonesia and southeast asia ( 6 ) .
these studies suggest that there may have been a widespread outbreak of chikungunya in the region during preceding years .
however , the antigenic cross - reactivity of arboviruses is widely recognized and can not be ruled out as a cause of the high seropositivity to chikv .
the broad age distribution of persons in the outbreak reported here suggests a lack of neutralizing antibodies against chikv , at least in the vanimo area .
the recent evolution of ecsa strains with the e1:a226v mutation has resulted in several outbreaks of chikungunya in widely distributed geographic regions .
the emergence of these strains seems to be a case of convergent evolution with adaption to ae .
albopictus mosquitoes occurring during outbreaks in india and the indian ocean region ( 7 ) .
analysis of e1 genes in this study suggests that virus strains in papua new guinea are closely clustered with mutant strains that evolved in india and subsequently spread to other countries , such as malaysia , singapore , sri lanka , thailand , and italy .
however , full - genome analysis is required to establish the relationship between strains from papua new guinea and other regions .
neighborhoods in vanimo had a high breteau index of 324 , which indicated high transmission potential for chikv ( 8) and dengue virus ( 9 ) .
albopictus mosquitoes were found breeding in many types of containers found outdoors and in vases found indoors .
most infested containers were water storage vessels , such as old metal drums and buckets without proper coverings ; in some instances , covered vessels were also infested .
old tires were a highly used breeding site , and gutters were observed to be densely populated . because of the absence of a reticulated water system in vanimo and the general ubiquity of artificial containers ( water storage and refuse )
these breeding opportunities existed despite the fact that sandaun provincial health authorities initiated multiple cleanup campaigns before our survey ( although no other vector control measures were implemented ) .
because of logistic constraints , the entomologic survey was conducted during the decrease in the outbreak and was designed to identify the dominant vector and opportunities for control .
. however , the predominance of this mosquito throughout the outbreak region ( 10,11 ) and its role in chikv transmission in other regions ( 1214 ) highlights the need for targeted vector control to curtail the spread of disease . | in june 2012 , health authorities in papua new guinea detected an increase in febrile illnesses in vanimo .
chikungunya virus of the eastern / central / southern african genotype harboring the e1:a226v mutation was identified .
this ongoing outbreak has spread to 8 other provinces and has had a harmful effect on public health . |
a 36-year - old healthy woman with reddish , painless local swellings over the dorsal aspect of the proximal interphalangeal ( pip ) joints of both hands presented at our rheumatologic outpatient clinic to exclude an inflammatory joint disease .
she noticed the swellings over a period of one year without any trigger or prior injury .
the patient 's medical history was unremarkable and did not suggest a predisposition to a specific musculoskeletal disorder .
the systematic general enquiry and patient 's medical history were unremarkable and did not suggest a predisposition to a specific musculoskeletal disorder .
she denied any symptoms or local changes of the metacarpophalangeal ( mcp ) , distal interphalangeal or wrist joints .
she had no morning stiffness , no paraesthesia and no pain during the night or other signs for inflammatory or mechanical pain .
clinical examination showed several soft subcutaneous nodules located at the dorsal aspect of the pip joints of the third and fourth fingers ( fig .
1 ) . there was no local tenderness and the overlying skin showed a normal temperature .
knuckle pads ( arrows ) over the pip joints there was no signs of synovitis or tenosynovitis , thickening of the palmar fascia or muscle atrophy .
ultrasound ( us ) ( philips hd15 , broadband linear array transducer l12 - 5 12 mhz operating frequency ) of the nodules revealed several subcutaneous hypoechoic masses with irregular borders ( fig .
b - mode image of the dorsal pip joint of the ring finger showing a hypoechoic mass ( * ) , line border between dermis and subcutis power doppler - mode image of the dorsal pip joint showing absence of internal flow signals ( * ) a biopsy was performed because the patients fear of neoplastic lesions .
histology showed focal proliferation of myofibroblasts with a decrease of elastic filaments in the deep thicker reticular dermis ( fig .
histology : normal epidermis and corium ( + ) , proliferation of myofibroblasts ( arrow ) with a decrease of elastic filaments in the deep dermis layer on the basis of family history , clinical data , us appearance and histologic findings a diagnosis of knuckle pads ( kp ) was retained .
knuckle pads , also known as garrod 's nodes , are benign fibrofatty subcutaneous pads located over the pip joints that can be mistaken for arthritis .
kp can be associated with camptodactyly ( fixed flexion deformity of the interphalangeal joints of the little finger ) as overlapping symptoms and are associated with many genetic factors .
although they can be associated to repetitive local trauma ( for example repetitive batting of the knuckles , e.g. by boxers or suction the fingers by children ) , coexist with palmar ( dupuytren 's disease ) or plantar fibromatosis ( ledderhose 's disease ) or peyronie 's disease , most kp are idiopathic .
some authors tried to distinguish them ( dorsal cutaneous pads ) from dorsal dupuytren 's nodules , what usually is not possible clinically and not necessary assuming being similar findings .
palmar dupuytren 's contracture consists of fibrous thickening of the palmar fascia with a palpable hard and tense band .
in contrast to dupuytren 's disease , where the affected fingers ( often the ring finger ) can not be extended completely and can be fixed in a flexion deformity , the affected fingers with kp generally are not restricted in motion . as in our patient , us shows kp as diffuse or focal hypoechoic subcutaneous thickening located at the dorsal aspect of affected pip joints .
the nodes are generally non - compressible masses with irregular margins and generally do n't show internal color or power doppler flow signals .
the differential diagnosis of kp includes other subcutaneous nodules like rheumatoid nodules , gouty tophi , bouchard 's and heberden 's nodes , synovial cysts , tumors ( e.g. giant cell tumor of the tendons sheats , neurofibromas ) or retained foreign bodies within the soft tissues and should not be misunderstood as a joint disease . in this context
it 's indispensable to perform a careful clinical and ultrasound examination of the affected region .
rheumatoid nodules ( rn ) are also painless and firm and can be found over the extension surface of the joints .
can further detect as a specific and very sensitive tool different pathologic changes including synovitis ( fig .
6 ) , tenosynovitis , bursitis , tendon tears , secondary nerve entrapment , and cartilage and bone changes .
other us features of gout are isoechoic mass with hyperechoic spots inside synovium , erosions and the presence of a double contour sign .
b - mode image of the dorsal pip joint showing a subcutaneous inhomogenic hypoechoic mass ( * ) , arrow head epidermis and dermis rheumatoid arthritis .
color doppler image of the dorsal mcp joint showing synovial fluid ( * ) , synovial thickening ( + ) and pathologic venous and arterial capillary hypervascularization ( arrow ) gout .
b - mode image of the dorsal pip joint showing subcutaneous inhomogenic tophus ( * ) , arrow head epidermis and dermis a key finding in osteoarthritis ( oa ) of the fingers are osteophytes ( fig . 8) and synovitis . furthermore us can detect bone cortex defects in erosive hand osteoarthritis .
b - mode image of the dorsal dip joint showing an osteophyte of the head of the distal phalanx ( arrow ) and a synovitis ( * ) in giant cell tumor of the tendons sheats us shows a hetero- or homogeneous mass that can be even hypoechoic or hyperechoic , and typically originating from the tendon sheats of the fingers flexor tendons .
typically there is an increased central or peripherally hypervascularization in color or power doppler mode ( fig .
power doppler image of the wrist showing a homogenic mass with pathological power doppler signal ( arrows ) , arrow head
subcutis on the dorsal aspect of the hand , above the interphalangeal joints , ganglion cysts can be also encountered .
small foreign bodies can be detected and appear for example hypoechoic if wooden or hyperechoic with comet - tail reverberation if metallic ( fig .
a hypoechoic halo with possible hypervascularization can be present if the foreign body lies for example in the skin .
b - mode image of the dorsal pip joint showing a synovitis ( * ) caused by a metallic foreign body ( arrow )
authors do not report any financial or personal links with other persons or organizations , which might affect negatively the content of this publication and/or claim authorship rights to this publication . | knuckle pads are rare harmless subcutaneous nodules that must be differentiated from joint disease of the proximal interphalangeal or rarely of the metacarpophalangeal joints as well as from other masses of the paraarticular tissues .
we present a case of an otherwise healthy 36-year - old woman presenting with bilateral knuckle pads located at the dorsal aspect of the proximal interphalangeal joints .
no predisposition to a specific musculoskeletal disorder was noted .
ultrasound revealed well - delimited subcutaneous hypoechoic masses without internal flow signals at color doppler .
histology showed proliferation of myofibroblasts with a decrease of elastic filaments in the deep dermis .
the clinical picture , the family history in addition to the histology allowed us to make the diagnosis of knuckle pads .
we present the ultrasound findings of knuckle pads and discuss the differential diagnosis of a swelling in the dorsal region of proximal interphalangeal joints and metacarpophalangeal joints . |
the identification of replication origins will be helpful to reveal the regulatory mechanisms of the initiation step in dna replication ( 1,2 ) and discover new broad - spectrum antibacterial drugs ( 3 ) . based on the z - curve theory ( 4 ) ,
we have developed a web - based system ori - finder for finding orics in bacterial genomes with high accuracy and reliability ( 5 ) , and the predicted oric regions in bacterial genomes have been organized into an online database doric ( 6 ) .
based on the database , putative origins of replication in sorangium cellulosum , microcystis aeruginosa ( 7 ) and cyanothece 51142 ( 8) , which could not be determined by using standard gc skew , have been identified by taking advantage of comparative genomics .
the application of the proposed oric selection criteria and the comparison of different cyanobacterial strains may also gain insight into the replication origins in other cyanobacteria ( 9 ) .
as the database was constructed in 2007 , we noticed that the replication origins of anabaena sp .
pcc 7120 ( 10 ) , cytophaga hutchinsonii atcc 33406 ( 11 ) and synechococcus elongatus pcc 7942 ( 12 ) have been confirmed by experiments , which are all consistent with our predictions in doric .
because of continuous updates , our database has been widely used in the comparative genomics analysis .
for example , as a source of data , doric has been used in the study of the relationship between the functionality of essential genes and gene strand bias in bacterial genomes ( 13 ) , in the analysis of nucleotide compositional asymmetry between the leading and lagging strands of bacterial genomes ( 14 ) , in the investigation of the association between growth - related traits and minimal generation times ( 15 ) , in an algorithm for prediction of putative essential and core - essential genes in mycoplasma genomes ( 16 ) , in the research on coordination of spatiotemporal gene expression during the bacterial growth cycle ( 17 ) and in the study of the variation in terms of the percentage of leading strand genes across different bacteria ( 18 ) , etc .
it is expected that the new release of the database , doric 5.0 , will promote the study of orics in both bacteria and archaea .
in the current release , the database has been significantly improved compared with the initial release , and the main advances include ( i ) inclusion of orics in more bacterial genomes that increased from 435 to 1528 ; ( ii ) inclusion of orics in 81 archaeal genomes ; ( iii ) inclusion of detailed information about repeats in orics identified by reputer program ( 19 ) ; and ( iv ) addition of urls that link to ncbi map viewer ( 20 ) or ucsc archaeal genome browser ( 21 ) , which are useful to explore and discover the conserved features around the oric region .
consequently , the latest release of doric contains orics for > 1500 bacterial genomes and 81 archaeal genomes , which can be accessed from http://tubic.tju.edu.cn / doric/.
to identify oric regions of unannotated bacterial genomes , we have developed a web - based system , ori - finder , based on an integrated method comprising gene identification , analysis of base composition asymmetry using the z - curve method , distribution of dnaa boxes , occurrence of genes frequently close to orics and phylogenetic relationships .
consequently , the predicted oric regions have been organized into an online database , doric .
based on doric , the relationships between the conserved features associated with the oric regions , such as adjacent genes , dnaa boxes , etc . , and
for example , detailed analyses have shown that the consensus sequence of the dnaa boxes in oric regions and the distribution of genes around orics are strongly conserved among the bacteria in the phylum cyanobacteria ( 7,8 ) .
the feature that the oric is adjacent to dnan gene , which encodes the beta clamp processivity factor , has been found to be universal among the bacteria within the phylum cyanobacteria , and the species - specific dnaa box motif for the phylum cyanobacteria is
these strongly conserved features indicate that the in silico identified orics are reliable , as they have been confirmed by comparative genomics approaches .
this observation also shows that if the oric for one of the bacteria in the phylum cyanobacteria is confirmed experimentally , the orics for the other bacterial genomes in this phylum may be confirmed simultaneously . as we expected , the experimentally confirmed replication origins of anabaena sp .
pcc 7120 ( 10 ) and s. elongatus pcc 7942 ( 12 ) in the phylum cyanobacteria are all adjacent to the dnan gene , which encodes the beta clamp processivity factor .
therefore , the proposed rules may be helpful to predict the oric regions for some bacteria without complete genomes in the phylum cyanobacteria .
in addition , the application of the proposed rules derived from doric would speedup the experimental confirmation and functional analysis of orics in bacterial genomes .
because of the rapid growth in the number of sequenced bacterial genomes , the replication origins for those unsubmitted to genbank or not deposited in doric temporarily can be predicted by ori - finder firstly , which now has been used to analyze 30 newly sequenced bacterial genomes
. the z - curve analysis has been used to identify one replication origin in the genomes of methanocaldococcus jannaschii ( 22 ) and methanosarcina mazei ( 23 ) , two replication origins in the halobacterium species nrc-1 genome ( 24 ) , which have been confirmed by in vivo experiments ( 25,26 ) and three replication origins in the sulfolobus solfataricus p2 genome ( 24 ) , which have been later confirmed experimentally ( 27,28 ) . here , we collected the information of orics provided in the literature , such as the oric sequences , origin recognition boxes ( orb ) motifs , uncharacterized motif sequences , etc . , which were identified by in vivo experiments ( 2534 ) , as well as in silico analysis ( 4,2224,35 ) .
in addition , we also predicted some new replication origins by z - curve method , with the aid of homologous sequence search against the known replication origins , analysis of orb motifs and repeats , cdc6 gene location , etc .
consequently , oric regions in 81 archaeal genomes identified by in vivo experiments , as well as in silico analyses , have been added to our database .
the number of orics in archaea is correlated with the phylogeny , which has been summarized in detail in the
, it shows that there is one replication origin in the genomes within the order methanococcales ( 11 genomes ) and within the class thermococci ( 12 genomes ) , and three replication origins in sulfolobus species ( 13 genomes ) .
our results and the z - curves also show that the archaea within the crenarchaeota phylum contain multiple origins , although some origins could not be determined at the sequence level currently .
for example , pyrobaculum calidifontis has been experimentally characterized to contain four replication origins , which is the highest number detected in a prokaryotic organism ( 34 ) . however , only one origin can be determined at the sequence level ( 34 ) . during the course of the prediction
, we found that the location of some putative replication initiator gene besides cdc6 gene can be helpful to the oric prediction in some cases .
for example , in the genome of m. jannaschii , an orf ( mj0774 ) , annotated as a hypothetical protein , is a distant homolog of the cdc6 protein in fact ( 22 ) .
the name mc - prip for the putative replication initiator protein in methanococcales has been used here for mj0774 and related proteins to distinguish it from bona fide orthologous cdc6 .
we also found the genes , which encode mc - prip in other 10 genomes within the order methanococcales ( methanococcus aeolicus nankai-3 , methanocaldococcus fervens ag86 , methanococcus maripaludis c5 , m. maripaludis c6 , m. maripaludis c7 , m. maripaludis s2 , m. maripaludis x1 , methanococcus vannielii sb , methanococcus voltae a3 and methanocaldococcus vulcanius m7 ) , were annotated as
marr family transcriptional regulator , etc . based on the locations of these genes , the orics in the aforementioned genomes
were predicted reliably , which contains almost all the features of known replication origins in archaeal genomes .
urls that link to ncbi map viewer or ucsc archaeal genome browser ( if available ) are also provided , which will be useful to explore and discover the conserved features around the oric region . with the availability of an increasing number of archaeal genomes ,
the prediction will be more accurate and reliable , as the orb elements or genes frequently close to orics can also be analyzed by comparative genomics , and new rules for replication origins in archaeal genomes will also be extracted in the future with the continuous update of doric . here ,
motif - based sequence analysis tools , the multiple em for motif elicitation ( meme ) suite ( 36 ) , have been used to discover motifs in the replication origins of closely related species , e.g. the archaea from the order thermococcales .
consequently , orb motifs and some new uncharacterized motif sequences have been found by the meme suite and are also included in the database .
to identify oric regions of unannotated bacterial genomes , we have developed a web - based system , ori - finder , based on an integrated method comprising gene identification , analysis of base composition asymmetry using the z - curve method , distribution of dnaa boxes , occurrence of genes frequently close to orics and phylogenetic relationships .
consequently , the predicted oric regions have been organized into an online database , doric .
based on doric , the relationships between the conserved features associated with the oric regions , such as adjacent genes , dnaa boxes , etc . , and
for example , detailed analyses have shown that the consensus sequence of the dnaa boxes in oric regions and the distribution of genes around orics are strongly conserved among the bacteria in the phylum cyanobacteria ( 7,8 ) .
the feature that the oric is adjacent to dnan gene , which encodes the beta clamp processivity factor , has been found to be universal among the bacteria within the phylum cyanobacteria , and the species - specific dnaa box motif for the phylum cyanobacteria is
these strongly conserved features indicate that the in silico identified orics are reliable , as they have been confirmed by comparative genomics approaches .
this observation also shows that if the oric for one of the bacteria in the phylum cyanobacteria is confirmed experimentally , the orics for the other bacterial genomes in this phylum may be confirmed simultaneously . as we expected , the experimentally confirmed replication origins of anabaena sp .
pcc 7120 ( 10 ) and s. elongatus pcc 7942 ( 12 ) in the phylum cyanobacteria are all adjacent to the dnan gene , which encodes the beta clamp processivity factor .
therefore , the proposed rules may be helpful to predict the oric regions for some bacteria without complete genomes in the phylum cyanobacteria .
in addition , the application of the proposed rules derived from doric would speedup the experimental confirmation and functional analysis of orics in bacterial genomes .
because of the rapid growth in the number of sequenced bacterial genomes , the replication origins for those unsubmitted to genbank or not deposited in doric temporarily can be predicted by ori - finder firstly , which now has been used to analyze 30 newly sequenced bacterial genomes .
the z - curve analysis has been used to identify one replication origin in the genomes of methanocaldococcus jannaschii ( 22 ) and methanosarcina mazei ( 23 ) , two replication origins in the halobacterium species nrc-1 genome ( 24 ) , which have been confirmed by in vivo experiments ( 25,26 ) and three replication origins in the sulfolobus solfataricus p2 genome ( 24 ) , which have been later confirmed experimentally ( 27,28 ) . here , we collected the information of orics provided in the literature , such as the oric sequences , origin recognition boxes ( orb ) motifs , uncharacterized motif sequences , etc . , which were identified by in vivo experiments ( 2534 ) , as well as in silico analysis ( 4,2224,35 ) .
in addition , we also predicted some new replication origins by z - curve method , with the aid of homologous sequence search against the known replication origins , analysis of orb motifs and repeats , cdc6 gene location , etc .
consequently , oric regions in 81 archaeal genomes identified by in vivo experiments , as well as in silico analyses , have been added to our database .
the number of orics in archaea is correlated with the phylogeny , which has been summarized in detail in the
, it shows that there is one replication origin in the genomes within the order methanococcales ( 11 genomes ) and within the class thermococci ( 12 genomes ) , and three replication origins in sulfolobus species ( 13 genomes ) .
our results and the z - curves also show that the archaea within the crenarchaeota phylum contain multiple origins , although some origins could not be determined at the sequence level currently .
for example , pyrobaculum calidifontis has been experimentally characterized to contain four replication origins , which is the highest number detected in a prokaryotic organism ( 34 ) .
however , only one origin can be determined at the sequence level ( 34 ) . during the course of the prediction
, we found that the location of some putative replication initiator gene besides cdc6 gene can be helpful to the oric prediction in some cases .
for example , in the genome of m. jannaschii , an orf ( mj0774 ) , annotated as a hypothetical protein , is a distant homolog of the cdc6 protein in fact ( 22 ) .
the name mc - prip for the putative replication initiator protein in methanococcales has been used here for mj0774 and related proteins to distinguish it from bona fide orthologous cdc6 .
we also found the genes , which encode mc - prip in other 10 genomes within the order methanococcales ( methanococcus aeolicus nankai-3 , methanocaldococcus fervens ag86 , methanococcus maripaludis c5 , m. maripaludis c6 , m. maripaludis c7 , m. maripaludis s2 , m. maripaludis x1 , methanococcus vannielii sb , methanococcus voltae a3 and methanocaldococcus vulcanius m7 ) , were annotated as
marr family transcriptional regulator , etc . based on the locations of these genes , the orics in the aforementioned genomes
were predicted reliably , which contains almost all the features of known replication origins in archaeal genomes .
urls that link to ncbi map viewer or ucsc archaeal genome browser ( if available ) are also provided , which will be useful to explore and discover the conserved features around the oric region . with the availability of an increasing number of archaeal genomes ,
the prediction will be more accurate and reliable , as the orb elements or genes frequently close to orics can also be analyzed by comparative genomics , and new rules for replication origins in archaeal genomes will also be extracted in the future with the continuous update of doric . here ,
motif - based sequence analysis tools , the multiple em for motif elicitation ( meme ) suite ( 36 ) , have been used to discover motifs in the replication origins of closely related species , e.g. the archaea from the order thermococcales .
consequently , orb motifs and some new uncharacterized motif sequences have been found by the meme suite and are also included in the database .
with the increased availability of completely sequenced bacterial and archaeal genomes and experimental evidence , the database will become more useful because of including more information .
the application of the rules from the database will be helpful to develop new prediction algorithms of replication origins and speedup the experimental confirmation and functional analysis of orics in bacterial or archaeal genomes .
systematic and functional analysis of oric regions in bacteria and archaeal genomes will also be useful for the construction of the minimum genome and regulation of growth rate and generation time of bacteria and archaea , which play a key role in the emerging field of synthetic biology .
doric will be updated periodically to include more entries , and to integrate more information for each entry .
the national natural science foundation of china [ 31171238 , 30800642 and 10747150 ] . funding for open access charge : the national natural science foundation of china . | replication of chromosomes is one of the central events in the cell cycle .
chromosome replication begins at specific sites , called origins of replication ( orics ) , for all three domains of life .
however , the origins of replication still remain unknown in a considerably large number of bacterial and archaeal genomes completely sequenced so far .
the availability of increasing complete bacterial and archaeal genomes has created challenges and opportunities for identification of their orics in silico , as well as in vivo .
based on the z - curve theory , we have developed a web - based system ori - finder to predict orics in bacterial genomes with high accuracy and reliability by taking advantage of comparative genomics , and the predicted oric regions have been organized into an online database doric , which is publicly available at http://tubic.tju.edu.cn/doric/ since 2007 .
five years after we constructed doric , the database has significant advances over the number of bacterial genomes , increasing about 4-fold .
additionally , oric regions in archaeal genomes identified by in vivo experiments , as well as in silico analyses , have also been added to the database .
consequently , the latest release of doric contains orics for > 1500 bacterial genomes and 81 archaeal genomes , respectively . |
jp-8 jet fuel ( similar to commercial / international jet a-1 fuel ) is the standard military fuel for all types of vehicles , including the u.s . air force aircraft inventory . as such
, jp-8 presents the most common chemical exposure in the air force , particularly for flight and ground crew personnel during preflight operations and for maintenance personnel performing routine tasks .
personal exposure at an air force base occurs through occupational exposure for personnel involved with fuel and aircraft handling and/or through incidental exposure , primarily through inhalation of ambient fuel vapors .
because jp-8 is less volatile than its predecessor fuel ( jp-4 ) , contact with liquid fuel on skin and clothing may result in prolonged exposure .
the slowly evaporating jp-8 fuel tends to linger on exposed personnel during their interaction with their previously unexposed colleagues . to begin to assess the relative exposures
, we made ambient air measurements and used recently developed methods for collecting exhaled breath in special containers .
we then analyzed for certain volatile marker compounds for jp-8 , as well as for some aromatic hydrocarbons ( especially benzene ) that are related to long - term health risks .
ambient samples were collected by using compact , battery - operated , personal whole - air samplers that have recently been developed as commercial products ; breath samples were collected using our single - breath canister method that uses 1-l canisters fitted with valves and small disposable breathing tubes .
we collected breath samples from various groups of air force personnel and found a demonstrable jp-8 exposure for all subjects , ranging from slight elevations as compared to a control cohort to > 100 [ mutilpe ] the control values .
this work suggests that further studies should be performed on specific issues to obtain pertinent exposure data .
the data can be applied to assessments of health outcomes and to recommendations for changes in the use of personal protective equipment that optimize risk reduction without undue impact on a mission.imagesfigure 1figure 2figure 3figure 4figure 5figure 6 |
|
macular amyloidosis commonly presents as localized hyper pigmented patches but very rarely can present as generalized dyschromic diffuse patches with poikiloderma - like picture .
familial poikiloderma like cutaneous amyloidosis ( plca ) is a rare generalized but genetic dyschromic skin disorder characterized by amyloid deposits in dermis due to defective dna repair secondary to sunlight damage .
clinically , it presents with diffuse brownish pigmentation with hypopigmented macules and many brownish scattered lichenoid papules with normal developmental milestones .
amyloidosis cutis dyschromica is probably a congenital disorder with hypersensitivity to ultraviolet b and dna repair defects due to repeated uvb damage as possible etiological factors .
the awareness of this rare entity among dermatologist and histopathologist is important , especially in the ethnic region where it is not commonly seen .
we are reporting a rare familial case of plca with the review of the literature .
a 15-year - old boy presented with asymptomatic diffuse mottled pigmentation involving the entire , sparing the face , since childhood . on close examination , there was diffuse brownish pigmentation with hypo pigmented macules and many brownish scattered lichenoid papules [ figure 1 ] . but oral mucosa , palms , soles , nails , and genitals were normal without any color changes . there were neither changes like atrophy , telangectesia , sclerotic changes nor malar erythema noted .
but since past 3 - 4 years , patient was getting recurrent attacks of blisters with crusting and itching particularly over exposed areas . however , systemic examinations were unremarkable .
his 33-year - old father also has similar type of skin lesions since his childhood [ figure 2 ] .
there was a history of consanguineous marriage , indicating a role of autosomal dominant with incomplete penetrance .
close view showing poikiloderma changes over abdomen skin generalized poikiloderma like cutenous changes in a father and son after biopsy from both hyper and hypopigmentation lesions from both father and son , which showed typical changes of amyloid deposits in papillary dermis on h and e stains as amorphous , hazy deposits , it is confirmed by special stain like congo red [ figure 3 ] . his routine blood ,
papillary dermis showing purple red deposits ( congo red stain ; 40 ) a clinical diagnosis of familial poikiloderma like cutaneous amyloidosis ( fplca ) was made after going through literature and classification of primary cutaneous amyloidosis .
primary cutaneous amyloidosis ( pca ) is an uncommon dermatosis which usually presents with macular or lichenoid types .
but fplca is a rare clinical type of primary cutaneous amyloidosis , described by morishma from japan in 1970 .
his patient had similar clinical features as in our patients : prepubertal onset , rippled hyperpigmentation with interspersed hypopigmented macules without atrophy , mild to absence of pruritus , and amyloid deposits in papillary dermis .
amyloidosis cutis dyschromica is mostly a congenital disorder with hypersensitivity to uvb and dna repair defects due to repeated uvb damage as possible etiological factors . due to this repeated damage to keratinocytes
there is production of amyloid materials in the skin leading to hyperpigmented and hypopigmented xerotic lesions in sun - exposed areas .
the condition usually presents in early life and persists for many years or for lifetime .
amyloid is usually detected as homogenous eosinophilic material in the papillary dermis on h and e stain .
however , to confirm diagnosis , special stains like congo red or crystal violet are used .
the clinical differential diagnosis are xeroderma pigmentosum , dyschromatosis universalis hereditaria , and other rare types of amyliodosis cutis dyschromica .
although pca is a common acquired skin condition but rarely it can present as generalized presentation with a familial occurrence .
hence , observation made by us will be the first reported case of familial plca from india , which may help in the awareness of this rare entity among dermatologists , especially in the ethnic regions where it is not commonly seen .
the treatment of this rare genetic disease is not well documented , but photo protection , antioxidants , and acitretin are tried with variable results .
in this report , we are reporting a rare case of fplca ; only few cases are reported worldwide so far , most are from japan and china . to the best of our knowledge ,
we strongly advise clinicians who come across a case of generalized mottled pigmentation , consisting of asymptomatic hyper pigmented and hypopigmented macules , that amyloidosis cutis dyschromica must be considered in the differential diagnosis and histopathological confirmation should be made to reach a diagnosis . a detail family and genetic history should be evaluated in such cases . | familial poikiloderma - like cutaneous amyloidosis(fplca ) is a rare , generalized but genetic dyschromic skin disorder characterized by amyloid deposits in dermis due to defective dna repair secondary to sunlight damage .
clinically , it presents with diffuse brownish pigmentation with hypo - pigmented macules and many brownish scattered lichenoid papules with normal developmental milestones .
the condition is autosomal dominant with incomplete penetrance .
we are here reporting a rare familial case of fplca with a review of the literature |
despite recent advances in therapeutics and diagnostics , morbidity and mortality after myocardial infarction ( mi ) remains a great socio - economic burden in western societies .
early identification of patients with sub - optimal cardiac recovery is of great importance to improve clinical management .
for this reason , both functional and structural characterization of the infarcted myocardium is important for risk stratification of patients after mi .
technological advances in cardiovascular magnetic resonance ( cmr ) have demonstrated different ways to track and characterize mi at different time points [ 16 ] .
cmr has been applied to analyze inflammation , edema , necrosis , fibrosis , left - ventricular ( lv ) remodeling and metabolism in mi [ 715 ] .
pathological changes in the injured myocardium , such as the presence of fibrosis , hemorrhage and edema , influence the signal intensity on t1-and t2-weighted imaging [ 7 , 1618 ] .
cmr is thus considered as one of the most important imaging tools in the assessment of the heart after mi .
typically , t1-weighted imaging is performed some time after injecting a gadolinium - based contrast agent to delineate injured myocardium in a late gadolinium enhancement ( lge ) scan .
the enhancement mechanism of infarcted tissue is related to the extent of the extracellular volume , which is associated with the delayed washout relative to the healthy myocardium .
lge is widely used and , without competition , considered the gold standard to assess infarct size .
nevertheless , there are certain limitations of lge related to pathological processes after the onset of infarction . in the acute and sub - acute phase after successful reperfusion of the ischemic myocardium
, the transmural infarct extent is not stable and an overestimation of infarct size has been reported . in the chronic phase ,
in view of the above limitations , several alternative contrast mechanisms are explored to study the pathophysiological changes in the injured myocardium .
the sensitivity of the t2 relaxation time to myocardial water content has led to the application of t2-weighted cmr protocols to image myocardial edema as an indicator of inflammation and necrosis in acute mi [ 13 , 15 , 2124 ] . t2 * contrast has been explored as a tool to diagnose the presence of hemorrhage and myocardial iron [ 15 , 2528 ] .
recently , it was demonstrated that t2 * has the potential to image fibrosis in the infarct zone using an ultra - short echo time ( ute ) technique . in this paper
, we hypothesize that the structural and pathological changes in acute and chronic mi , such as the presence and development of myocardial hemorrhage and fibrotic tissue progressively influence t2 * values in the infarcted myocardium . to investigate this , we quantified t2 * using a t2 * -mapping protocol longitudinally in acute and chronic ischemia / reperfusion ( i / r ) infarcts in mice .
we explored the utility of t2 * mapping as a complementary tool to lge to characterize the infarcted myocardium .
c57bl6/j mice ( n = 23 , body weight = 2025 g ) were used in this study .
cmr measurements were performed at baseline ( bl ) , 1 day ( acute infarct ) , 7 and 28 days ( chronic infarct ) after induction of mi by 30 min transient ligation of the left coronary artery ( lca ) ( n = 9 ) . a sham - operated group ( n = 8) served as control .
the cmr protocol for the infarct group consisted of a multi - gradient - echo quantitative t2 * -mapping sequence , traditional lge to assess the location and size of the infarct , and gradient - echo cine imaging to determine cardiac function .
the sham - operated ( control ) group underwent gradient - echo cine imaging only to evaluate cardiac function . in the first group of nine mice with mi , one mouse died at day 28 during the cmr scan .
another three mice of this group presented a small infarct on lge images at day 1 , but no chronic myocardial infarct at day 7 and 28 ( as exemplified in fig . 3 ) .
a separate set of mice with mi ( n = 6 ) were killed either at day 1 ( n = 2 ) , 7 ( n = 2 ) , or 28 ( n = 2 ) for the histopathological characterization of myocardial tissues . all animal experiments were performed in accordance with the national guidelines on animal care and with prior approval by the animal experimentation committee of utrecht university .
briefly , mice were anesthetized with a mixture of fentanyl ( jansen - cilag ) 0.05 mg / kg , dormicum ( roche ) 5 mg / kg , and medetomidine 0.5 mg / kg through an intraperitoneal injection . a core body temperature of about 37c was maintained during surgery by continuous monitoring with a rectal thermometer and an automatic heating blanket .
mice were intubated and ventilated ( harvard apparatus inc , holliston , ma ) with 100% oxygen .
the lca was ligated for 30 min with an 8 - 0 ethilon ( ethicon ) suture with a section of polyethylene-10 tubing placed over the lca .
reperfusion was initiated by release of the ligature and removal of the polyethylene-10 tubing . in sham - operated animals ,
reperfusion of the endangered myocardium was characterized by typical hyperemia in the first few minutes .
the chest wall was closed , and the animals subcutaneously received antisedan ( pfizer ) 2.5 mg / kg , anexate ( roche ) 0.5 mg / kg , and temgesic ( schering - plough ) 0.1 mg / kg .
a vertical 9.4 t and 89-mm - diameter bore scanner was used , equipped with 1,500 mt / m gradients ( bruker biospin gmbh , ettlingen , germany ) .
mice were anesthetized with 1.53 vol% isoflurane in a 2:1 mixture of air ( 0.3 l / min ) and oxygen ( 0.15 l / min ) .
the mice were put on a custom - built cradle and positioned inside a 3-cm - diameter quadrature volume coil . during the cmr examination anesthesia was maintained at 1.52.5 vol% isoflurane to keep the respiratory rate at 5060 bpm .
we did not use ecg leads for cardiac triggering but derived both cardiac and respiratory motion signals from a pressure pad placed under the chest of the mouse . the cmr protocol consisted of the following steps .
after global shimming and rf pulse calibration , 2- and 4-chamber view scout scans were made to plan a single mid - cavity short - axis slice .
cine imaging was performed with a retrospectively - triggered ( self - gated ) gradient - echo sequence , with the following parameters : tr = 6.8 ms , te = 1.9 ms , number of movie frames = 15 , slice thickness = 1 mm , matrix = 256 256 , field - of - view = 3 3 cm . because of the slight difference of hearts size between mice and the dilation of each heart after infarction ,
seven to nine short - axis slices with inter - slice distance of 1 mm and no slice gap were measured to cover the heart from apex to base .
based on the cine short - axis images , a mid axial slice was selected that included an area of remote viable tissue as well as a substantial infarct area . t2 * mapping was performed in this slice using a cardiac - triggered multi - gradient - echo sequence with the following parameters : tr = r r interval , te = 1.22 , 3.45 , 5.68 , 7.91 , 10.14 , and 12.37 ms , slice thickness = 1 mm , matrix = 128 128 , field - of - view = 3 3 cm .
the trigger delay was chosen in the mid - diastolic rest period of the heart cycle observed in the cine series .
the acquisition window of less than 13 ms resulted in images , which were sufficiently co - registered for the different echo times to allow for a pixel - wise t2 * determination ( fig . 1 ) .
lge scans were performed in the same slice with a cardiac - triggered inversion - recovery segmented gradient - echo sequence , with the following parameters : tr = 5.8 ms , te = 2.2 ms , number of segments = 16 , slice thickness = 1 mm , matrix = 256 256 , field - of - view = 3 3 cm .
the inversion time ( ti ) was optimized to null the signal from remote myocardium [ 33 , 34 ] .
gadobutrol ( gadovist , bayer schering pharma ag , berlin , germany ) dose of 1 mmol / ml was used . to reduce volume related variability ,
this dilution resulted in administered weight - adapted volume of 2 l / g body weight , resulting in an equivalent dose of 0.5 mmol / kg body weight .
the contrast agent was injected intravenously through the tail vein , using a 24-gauge catheter.fig .
a gradient - echo cmr with varying te for a mid - ventricle short - axis slice of a representative mouse at baseline .
bottomt2 * map . t2 * in the lv myocardium at end - diastole is color - coded between 0 and 20 ms according to the pseudo color scale on the right .
the background image is a regular gradient echo image with te = 1.22 ms representative series of cardiac images with varying te and corresponding t2 * map .
a gradient - echo cmr with varying te for a mid - ventricle short - axis slice of a representative mouse at baseline .
* in the lv myocardium at end - diastole is color - coded between 0 and 20 ms according to the pseudo color scale on the right .
the background image is a regular gradient echo image with te = 1.22 ms t2 * maps were generated in mathematica 7 ( wolfram research , champaign , il , usa ) by pixel - wise fittings of the multi - gradient - echo signal intensities to the equation \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ s = s_{0 } { \text{e}}^ { { - { \text{te}}/t_{2}^ { * } } } $ $ \end{document}. the lv myocardium was manually segmented by drawing epicardial and endocardial contours , excluding the papillary muscles .
lge - based single - slice infarct size is reported as percentage of the lv myocardial cross - sectional area .
a region of interest in the infarct in the myocardial free wall ( infarct roi ) was drawn based on gadolinium enhancement and presence of akinetic myocardium .
a second roi was drawn in the non - enhancing remote tissue in the septum ( remote roi ) .
for the control mice , rois were drawn in the septum and the free wall .
these rois were drawn within the zone free from susceptibility artifacts induced by lungs . t2
* values are reported as group average and standard deviation of the mean t2 * in the rois .
cine images were analyzed with qmass digital imaging software ( medis , leiden , the netherlands ) .
semi - automatic segmentation was used to determine end - diastolic volume ( edv ) , end - systolic volume ( esv ) , wall thickness ( wt ) and systolic wall thickening ( swt ) .
ejection fraction ( ef ) was calculated as 100%(edv esv)/edv . for histological evaluation a 1.5-mm - thick slice containing infarcted myocardium
, 5-m - thick sections were mounted on glass slides and stained with picrosirius red staining for collagen , prussian blue staining for iron , and hematoxylin - eosin ( he ) for cellular structures .
the stained sections were photographed with a digital image microscopy using white or polarized light .
results were expressed as mean standard deviation for each group of animals . an independent two - tailed sample t test and the mann
whitney exact two - tailed u test were performed to compare mean values in subjects for each time point post mi versus baseline .
c57bl6/j mice ( n = 23 , body weight = 2025 g ) were used in this study .
cmr measurements were performed at baseline ( bl ) , 1 day ( acute infarct ) , 7 and 28 days ( chronic infarct ) after induction of mi by 30 min transient ligation of the left coronary artery ( lca ) ( n = 9 ) . a sham - operated group ( n = 8) served as control .
the cmr protocol for the infarct group consisted of a multi - gradient - echo quantitative t2 * -mapping sequence , traditional lge to assess the location and size of the infarct , and gradient - echo cine imaging to determine cardiac function .
the sham - operated ( control ) group underwent gradient - echo cine imaging only to evaluate cardiac function . in the first group of nine mice with mi , one mouse died at day 28 during the cmr scan .
another three mice of this group presented a small infarct on lge images at day 1 , but no chronic myocardial infarct at day 7 and 28 ( as exemplified in fig . 3 ) .
a separate set of mice with mi ( n = 6 ) were killed either at day 1 ( n = 2 ) , 7 ( n = 2 ) , or 28 ( n = 2 ) for the histopathological characterization of myocardial tissues . all animal experiments were performed in accordance with the national guidelines on animal care and with prior approval by the animal experimentation committee of utrecht university .
mice underwent myocardial i / r surgery as previously described . briefly , mice were anesthetized with a mixture of fentanyl ( jansen - cilag ) 0.05 mg / kg , dormicum ( roche ) 5 mg / kg , and medetomidine 0.5 mg / kg through an intraperitoneal injection . a core body temperature of about 37c was maintained during surgery by continuous monitoring with a rectal thermometer and an automatic heating blanket .
mice were intubated and ventilated ( harvard apparatus inc , holliston , ma ) with 100% oxygen .
the lca was ligated for 30 min with an 8 - 0 ethilon ( ethicon ) suture with a section of polyethylene-10 tubing placed over the lca .
reperfusion was initiated by release of the ligature and removal of the polyethylene-10 tubing . in sham - operated animals ,
reperfusion of the endangered myocardium was characterized by typical hyperemia in the first few minutes .
the chest wall was closed , and the animals subcutaneously received antisedan ( pfizer ) 2.5 mg / kg , anexate ( roche ) 0.5 mg / kg , and temgesic ( schering - plough ) 0.1 mg / kg .
a vertical 9.4 t and 89-mm - diameter bore scanner was used , equipped with 1,500 mt / m gradients ( bruker biospin gmbh , ettlingen , germany ) .
mice were anesthetized with 1.53 vol% isoflurane in a 2:1 mixture of air ( 0.3 l / min ) and oxygen ( 0.15 l / min ) . the mice were put on a custom - built cradle and positioned inside a 3-cm - diameter quadrature volume coil . during the cmr examination anesthesia was maintained at 1.52.5 vol% isoflurane to keep the respiratory rate at 5060 bpm .
we did not use ecg leads for cardiac triggering but derived both cardiac and respiratory motion signals from a pressure pad placed under the chest of the mouse . the cmr protocol consisted of the following steps .
after global shimming and rf pulse calibration , 2- and 4-chamber view scout scans were made to plan a single mid - cavity short - axis slice .
cine imaging was performed with a retrospectively - triggered ( self - gated ) gradient - echo sequence , with the following parameters : tr = 6.8 ms , te = 1.9 ms , number of movie frames = 15 , slice thickness = 1 mm , matrix = 256 256 , field - of - view = 3 3 cm .
because of the slight difference of hearts size between mice and the dilation of each heart after infarction , seven to nine short - axis slices with inter - slice distance of 1 mm and no slice gap were measured to cover the heart from apex to base . based on the cine short - axis images ,
a mid axial slice was selected that included an area of remote viable tissue as well as a substantial infarct area . t2
* mapping was performed in this slice using a cardiac - triggered multi - gradient - echo sequence with the following parameters : tr = r r interval , te = 1.22 , 3.45 , 5.68 , 7.91 , 10.14 , and 12.37 ms , slice thickness = 1 mm , matrix = 128 128 , field - of - view = 3 3 cm .
the trigger delay was chosen in the mid - diastolic rest period of the heart cycle observed in the cine series .
the acquisition window of less than 13 ms resulted in images , which were sufficiently co - registered for the different echo times to allow for a pixel - wise t2 * determination ( fig . 1 ) .
lge scans were performed in the same slice with a cardiac - triggered inversion - recovery segmented gradient - echo sequence , with the following parameters : tr = 5.8 ms , te = 2.2 ms , number of segments = 16 , slice thickness = 1 mm , matrix = 256 256 , field - of - view = 3 3 cm .
the inversion time ( ti ) was optimized to null the signal from remote myocardium [ 33 , 34 ] .
gadobutrol ( gadovist , bayer schering pharma ag , berlin , germany ) dose of 1 mmol / ml was used . to reduce volume related variability ,
this dilution resulted in administered weight - adapted volume of 2 l / g body weight , resulting in an equivalent dose of 0.5 mmol / kg body weight .
the contrast agent was injected intravenously through the tail vein , using a 24-gauge catheter.fig .
1representative series of cardiac images with varying te and corresponding t2 * map . a gradient - echo cmr with varying te for a mid - ventricle short - axis slice of a representative mouse at baseline .
bottomt2 * map . t2 * in the lv myocardium at end - diastole is color - coded between 0 and 20 ms according to the pseudo color scale on the right .
the background image is a regular gradient echo image with te = 1.22 ms representative series of cardiac images with varying te and corresponding t2 * map . a gradient - echo cmr with varying te for a mid - ventricle short - axis slice of a representative mouse at baseline .
bottomt2 * map . t2 * in the lv myocardium at end - diastole is color - coded between 0 and 20 ms according to the pseudo color scale on the right .
the background image is a regular gradient echo image with te = 1.22 ms
t2 * maps were generated in mathematica 7 ( wolfram research , champaign , il , usa ) by pixel - wise fittings of the multi - gradient - echo signal intensities to the equation \documentclass[12pt]{minimal }
\usepackage{amsmath }
\usepackage{wasysym }
\usepackage{amsfonts }
\usepackage{amssymb }
\usepackage{amsbsy }
\usepackage{mathrsfs }
\usepackage{upgreek }
\setlength{\oddsidemargin}{-69pt }
\begin{document}$$ s = s_{0 } { \text{e}}^ { { - { \text{te}}/t_{2}^ { * } } } $ $ \end{document}. the lv myocardium was manually segmented by drawing epicardial and endocardial contours , excluding the papillary muscles .
lge - based single - slice infarct size is reported as percentage of the lv myocardial cross - sectional area .
a region of interest in the infarct in the myocardial free wall ( infarct roi ) was drawn based on gadolinium enhancement and presence of akinetic myocardium .
a second roi was drawn in the non - enhancing remote tissue in the septum ( remote roi ) .
for the control mice , rois were drawn in the septum and the free wall .
these rois were drawn within the zone free from susceptibility artifacts induced by lungs . t2
* values are reported as group average and standard deviation of the mean t2 * in the rois .
cine images were analyzed with qmass digital imaging software ( medis , leiden , the netherlands ) .
semi - automatic segmentation was used to determine end - diastolic volume ( edv ) , end - systolic volume ( esv ) , wall thickness ( wt ) and systolic wall thickening ( swt ) .
for histological evaluation a 1.5-mm - thick slice containing infarcted myocardium was fixed in 4% formalin and paraffin - embedded . hereafter
, 5-m - thick sections were mounted on glass slides and stained with picrosirius red staining for collagen , prussian blue staining for iron , and hematoxylin - eosin ( he ) for cellular structures .
the stained sections were photographed with a digital image microscopy using white or polarized light .
results were expressed as mean standard deviation for each group of animals . an independent two - tailed sample t test and the mann
whitney exact two - tailed u test were performed to compare mean values in subjects for each time point post mi versus baseline .
an image series of a mid - axial slice with varying te for a representative mouse at baseline is shown in fig . 1a .
signal loss due to susceptibility differences was occasionally observed for the images with the longest te .
pixel - wise fitting of the signal intensities in the lv myocardium as function of te resulted in a t2 * map as shown in fig .
* values were homogeneous throughout the lv myocardial wall and consistent between mice , with a mean t2 * value of 17.1 2.0 ms in the free wall .
figure 2 displays a collection of images , consisting of lge , t2 * maps , and cine images at diastole , for a representative mouse at day 1 , 7 and 28 after induction of the mi . on day 1
, lge resulted in a homogeneous enhancement of the infarct in the mid - anterior and mid - anterolateral wall , whereas on days 7 and 28 enhanced area was smaller , heterogeneous , and difficult to detect . corresponding t2 * maps revealed a different picture . at day 1 , a significant change in t2 * could be detected in the lge - based infarct area .
further , at days 7 and 28 , t2 * dramatically decreased , particularly in the mid - anterolateral region indicating the existence of a significant infarct .
the presence of an infarct was further corroborated by the cine images , which showed increased wt in the mid - anterior and mid - anterolateral wall at day 1 , followed by progressive thinning below baseline levels at days 7 and 28 , respectively.fig .
2mid - ventricle short - axis slice of a mouse heart at 1 , 7 , and 28 days after i / r myocardial infarction . left cine images at end - diastole . at day 1 wall thickness in the free wall
is increased , whereas at days 7 and 28 the free wall decreased in thickness .
middle corresponding t2 * maps color - coded from 0 to 20 ms . t2
* is decreased in the infarct in the free wall at day 7 and 28 ( red arrows ) .
infarct location was confirmed by the presence of an akinetic area and locally reduced wall thickening in cine imaging mid - ventricle short - axis slice of a mouse heart at 1 , 7 , and 28 days after i / r myocardial infarction . left cine images at end - diastole . at day 1 wall thickness in the free wall
is increased , whereas at days 7 and 28 the free wall decreased in thickness .
middle corresponding t2 * maps color - coded from 0 to 20 ms . t2 * is decreased in the infarct in the free wall at day 7 and 28 ( red arrows ) .
infarct location was confirmed by the presence of an akinetic area and locally reduced wall thickening in cine imaging figure 3 shows lge and t2 * maps of one of three mice with a small infarct in the mid - anterolateral wall , as indicated by a small area of lge at day 1 .
gadolinium enhancement could not be detected anymore at days 7 and 28 . in the first group of n = 9 mice with mi , n = 3 mice displayed this atypical behavior .
presumably , lge at day 1 revealed a small area at risk that could not be detected in the chronic phase .
importantly , t2 * values in the mid - anterolateral wall also remained unaffected throughout infarct healing and did not deviate from baseline values.fig .
3t2 * maps and lge of a mouse with a small lge positive area at day 1 but no detectable infarct at later days .
lge showed enhancement in the mid - anterior wall at day 1 ( yellow arrow ) .
enhancement , however , was absent at 7 and 28 days . in parallel ,
t2 * values in the infarct area were maintained at baseline levels . t2 * maps displayed spurious lowering in areas with no infarct related to susceptibility artifacts ( red arrows ) t2 * maps and lge of a mouse with a small lge positive area at day 1 but no detectable infarct at later days .
lge showed enhancement in the mid - anterior wall at day 1 ( yellow arrow ) .
enhancement , however , was absent at 7 and 28 days . in parallel , t2 * values in the infarct area were maintained at baseline levels . t2
* maps displayed spurious lowering in areas with no infarct related to susceptibility artifacts ( red arrows ) quantitative t2 * values ( n = 5 mice , fig .
* values decreased significantly ( p < 0.05 ) from baseline ( 17.1 2.0 ms ) to day 1 ( 12.0 1.1 ms ) followed by a further decrease ( p <
0.005 ) both at day 7 ( 7.9 1.0 ms ) and day 28 ( 6.4 0.7 ms ) .
in addition , the mid - septal ( remote ) area showed a significant ( p < 0.05 ) decrease of t2 * values from baseline ( 18.2 2.0 ms ) to day 1 ( 13.9 0.8 ms ) , then slightly recovered at day 7 ( 14.2 1.1 ms ) and day 28 ( 15.6 1.0 ms).fig .
4quantitative t2 * values in the infarct and remote myocardium at baseline ( bl ) and up to 28 days after surgery .
n = 5 mice , * significantly different from baseline ( p < 0.05 ) , and * * significantly different from baseline ( p <
0.005 ) quantitative t2 * values in the infarct and remote myocardium at baseline ( bl ) and up to 28 days after surgery .
n = 5 mice , * significantly different from baseline ( p < 0.05 ) , and * * significantly different from baseline ( p <
0.005 ) global cardiac function of both infarct and sham - operated groups was assessed by cine imaging ( fig .
the infarct group displayed a progressive and significant increase in edv and esv , indicative for a considerable dilation of the heart due to the infarct .
for the sham - operated group no significant changes in edv and esv upon time after surgery were observed .
the infarct group presented a decline in ef from 54 3% at baseline to 39 2% , 28 days after surgery ( fig .
for the sham - operated group , ef was slightly elevated at day 1 ; however , it normalized at day 7 and 28 after surgery .
group - averaged ( n = 5 ) infarct sizes from lge analysis of a mid - ventricular slice as function of days after surgery are presented in fig . 5d .
at day 1 , lge revealed an average infarct size of 41 6% , dropping to 26 3 and 22 4 % ( p < 0.05 , compared to day 1 ) of the lv area at days 7 and 28 , respectively , which could be related to infarct resorption over time .fig .
5left ventricle functional parameters and infarct size for infarct ( n = 5 ) and sham - operated ( n = 8) groups at baseline ( bl ) and up to 28 days after surgery . a end diastolic volume .
d single - slice infarct size . * significantly different from baseline ( p < 0.05 ) , and * * significantly different from baseline ( p <
0.005 ) left ventricle functional parameters and infarct size for infarct ( n = 5 ) and sham - operated ( n = 8) groups at baseline ( bl ) and up to 28 days after surgery . a end diastolic volume .
* significantly different from baseline ( p < 0.05 ) , and * * significantly different from baseline ( p <
0.005 ) in the infarct group , wt in the free wall ( infarct area ) showed a significant ( p <
0.005 ) transient increase day 1 after mi , followed by progressive thinning ( fig .
decreased wt in the infarct paralleled a decrease of the quantitative t2 * values ( fig .
the mid - septal ( remote ) area in the infarct group showed no significant changes in wt . in line with the increased wt of the free wall at day 1 ,
the swt , as a measure of local systolic function , also displayed a transient depression 1 day after surgery , only partially recovering at days 7 and 28 ( fig .
also , swt of the remote area was slightly depressed at all time points compared to baseline .
the sham - operated group revealed no significant changes in both wt and swt as function of days after surgery ( fig .
thus , the chronic mi is characterized by a lower t2 * value compared to the acute mi.fig .
6regional wall thickness ( wt ) and systolic wall thickening ( swt ) for infarct ( n = 5 ) and sham - operated ( n = 8) groups .
* significantly different from baseline ( p < 0.05 ) , and * * significantly different from baseline ( p < 0.005)fig . 7correlation between infarct wall thickness ( wt ) and t2 * regional wall thickness ( wt ) and systolic wall thickening ( swt ) for infarct ( n = 5 ) and sham - operated ( n = 8) groups .
d swt for sham - operated group in septal and free wall . * significantly different from baseline ( p < 0.05 ) , and * * significantly different from baseline ( p <
0.005 ) correlation between infarct wall thickness ( wt ) and t2 * since t2 * changes are related to the structural and compositional changes in the infarct myocardial tissue , we performed histology at each time point after i / r injury
. figure 8 shows images of three representative mice at day 1 , 7 and 28 after mi .
8a ) revealed no collagen deposits in the infarct area at day 1 . at day
7 substantial collagen deposition was observed , followed by a significant increase at day 28 .
sections stained with prussian blue showed scattered spots of iron as early as 1 day after mi ( fig .
8c ) the infarct area on day 1 was characterized by infiltration of inflammatory cells.fig .
8representative histological images of infarct myocardial tissue at day 1 , 7 and 28 post mi . a picrosirius red .
scale bar equals 200 m representative histological images of infarct myocardial tissue at day 1 , 7 and 28 post mi .
in this study we aimed to systematically study quantitative changes in t2 * of the mouse myocardium up to 28 days post i / r injury and to evaluate its added value in characterizing chronic infarcts in comparison to commonly applied lge and cine imaging . combining different cmr techniques , if interpreted carefully , are a potential advantage in the evaluation of the pathophysiological changes in the injured myocardium .
baseline t2 * values were comparable to t2 values found at 9.4 t and 11.75 t , which suggests that decay due to static magnetic field inhomogeneities is largely absent in the healthy myocardium .
we found that quantitative t2 * values decreased progressively during infarct development . throughout the observation period ,
the local decrease of t2 * in the infarct was accompanied by globally and locally reduced ventricular function ( figs . 4 , 5 , 6 , 7 ) .
the reduction in t2 * with infarct age could be explained by the presence of iron ( fig .
8a ) [ 3 , 38 ] . additionally , the formation of significant amounts of collagen ( fig .
nevertheless , in certain cases when lge imaging is inconclusive , additional characterization of the infarct by t2 * imaging could provide complementary information . in the acute phase after i
/ r injury lge - based infarct size may be inaccurate , when there is loss of cell membrane integrity , an inflammatory response [ 40 , 41 ] , necrosis , hemorrhage , micro - vascular obstruction ( mvo ) and edema .
indeed , for the acute infarcts at day 1 we found a large lge - based infarct size accompanied by increased wall - thickness , suggesting the presence of edema .
we did not observe a transient increase in t2 * at day 1 by the presence of this edema , as previously observed with t2-weighted imaging .
the effect of edema on t2 * is apparently lower than the decrease of t2 * induced by iron or collagen ( fig .
this observation is critical in the clinical setting where early assessment of viability is significantly hampered by the presence of infarct - induced edema . t2
* -imaging may be a tool to circumvent this inevitable problem after acute mi . in the chronic infarct
, the formation of scar tissue could be responsible for a reduced distribution volume for the extracellular contrast agent . in turn , reduced distribution volume leads to an apparent reduction in infarct size and inhomogeneous enhancement ( figs . 2 , 5 ) .
2 ) , which locally decreased down to a few milliseconds , could effectively null the signal of the inversion recovery gradient - echo sequence with an echo time of 2.2 ms , obscuring the lge . at day 1 , a significant decrease of t2 * ( fig . 4 ) and a transient depression of systolic performance ( swt ; fig . 6 ) were found not only in the infarct , but also to a lesser extent in the remote myocardium .
this could be a secondary response in parallel to the structural changes in the infarct region .
these findings are in agreement with those of bogaert et al . who observed a dysfunction in the remote area at 5 2 days after reperfusion in patients with transmural anterior mi .
others have also shown that remodeling is initiated in the remote myocardium as early as 1 day after i / r injury [ 4447 ] . comparing figs .
figure 2 presented an example of a mouse with a considerable infarct at day 1 , based on a large lge positive area .
however , at days 7 and 28 , the infarct was difficult to detect on lge , from which one could jump to the conclusion that a considerable part of the area at risk at day 1 recovered at later time points .
however , the t2 * maps at day 7 and 28 revealed low t2 * values in the infarct area , indicating that the infarct was not recovered .
the presence of non - viable myocardium ( not detected by lge ) was confirmed by akinesia of that area and locally suppressed systolic thickening ( swt ) in cine imaging .
figure 3 , conversely , showed one of three mice that presented a small infarct by lge at day 1 , but displayed no positive enhancement at day 7 and 28 .
for this mouse t2 * in the infarct region was preserved during follow - up , indicating that for this mouse the initial area at risk recovered at later time points , as confirmed by healthy lv function .
thus , t2 * is able to provide additional information , complementary to lge , about the myocardial viability after infarction . taken together , these findings suggest that t2 * can be used as a surrogate marker for myocardial recovery during follow - up after mi .
a limitation to the use of t2 * as a diagnostic marker for myocardial injury is contamination of intrinsic t2 * values by the presence of macroscopic susceptibility differences , mainly present at the air - lung interfaces [ 26 , 27 ] .
occasionally , we observed lowered t2 * values at the lung - heart interface ( see for example fig .
also the orientation of the heart with respect to the magnetic field could alter absolute t2 * values .
still , use of t2 * mapping as a stand - alone technique without the complementary information from lge is undesired .
imaging of the myocardium with a t2 * -mapping technique in a mouse model of myocardial i / r injury provides useful and complementary information to lge and cine imaging .
the changes of the t2 * were associated with the infarct age , reversibility of the injury , and gave an indication of the structural variation in the myocardium throughout infarct maturation . t2 * decrease in the infarcts was associated with iron and collagen depositions . in cases where lge was inconclusive , t2
* mapping was able to confirm the presence of a chronic myocardial scar in mice . taken together , t2 * mapping may provide important additional information on myocardial viability in the acute and chronic phase and scar maturation after acute mi .
this article is distributed under the terms of the creative commons attribution license which permits any use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited . | objectimaging of myocardial infarct composition is essential to assess efficacy of emerging therapeutics . t2
* mapping has the potential to image myocardial hemorrhage and fibrosis by virtue of its short t2*. we aimed to quantify t2 * in acute and chronic myocardial ischemia / reperfusion ( i / r ) injury in mice.materials and methodsi / r - injury was induced in c57bl/6 mice ( n = 9 ) .
sham - operated mice ( n = 8) served as controls .
mri was performed at baseline , and 1 , 7 and 28 days after surgery .
mri at 9.4 t consisted of cine , t2 * mapping and late - gadolinium - enhancement ( lge ) .
mice ( n = 6 ) were histologically assessed for hemorrhage and collagen in the fibrotic scar.resultsbaseline t2 * values were 17.1 2.0 ms . at day 1 , lge displayed a homogeneous infarct enhancement . t2 * in infarct ( 12.0 1.1 ms ) and remote myocardium ( 13.9 0.8 ms ) was lower than at baseline . on days 7 and 28 ,
lge was heterogeneous . t2 * in the infarct decreased to 7.9 0.7 and 6.4 0.7 ms , whereas t2 * values in the remote myocardium were 14.2 1.1 and 15.6 1.0 ms .
histology revealed deposition of iron and collagen in parallel with decreased t2*.conclusiont2 * values are dynamic during infarct development and decrease significantly during scar maturation . in the acute phase , t2 * values in infarcted myocardium differ significantly from those in the chronic phase . t2
* mapping was able to confirm the presence of a chronic infarction in cases where lge was inconclusive .
hence , t2 * may be used to discriminate between acute and chronic infarctions . |
rinosinusites ( rs ) is a pathology that reflects a contiguously inflammatory or infectious process of the nasal region and to the sinus .
it is a clutter that annually affects more than 31 million americans of all the ages and sorts1 .
the rs can be divided in acute ( when it lasts up to 12 weeks ) or chronicle ( lasting 12 weeks more than ) , a time that does not have histopathological substratum that it differentiates the acute form of the sub - acute .
the frequency of fungal rinosinusites ( rsf ) , although to be uncommon , it has increased in last the two decades3 . in patients with chronic rs
, 6% to 12% will go to present fungus in the culture or in histopathological study4 .
has little time also was observed that its classification is of utmost importance to predict of accurate form the prognostic and to optimize of form accomplishes its therapy .
it has two basic types of rsf : the invasive form and the not - invasive one .
moreover , it still has 5 distinct subtypes depending on the immunological system of patient5 : in immunosuppressed sudden the acute / invasive form and invasive indolent / chronic ( that it can also be disclosed in immunocompetent , in the granulomatosis or not - granulomatosis form ) ; in immunocompetent , the saprophytic settling and the fungal ball ; e in atopics , the allergic fungal sinusitis .
the present series of cases will approach two cases of not invasive rsf in a private clinic of caxias do sul , with its diagnostic evolutions and its treatments , beyond one brief revision of literature on the pathology .
case 1 ) patient of the feminine sex , pensioner , 78 years , presented itself in a particular doctor 's office complaint with cheek pain with irradiation for superior dental arches to the left has about six months .
it carried through evaluation with dentist and , although to have endodontically treatment in the # 26 in the past , was set free .
it told that after exposition the climatic alterations had a compatible picture with infection of superior aerial ways and received a treatment with antibiotic that alleviated the symptoms temporarily .
its only factor of relief was the anti - inflammatory frequent use of not steroidal ( aine ) . the x - ray brought for the patient presented complete veiling of left maxillary sinus .
to the physical examination and nasal endoscopy , a shunting line of septum was evidenced and the purulent secretion presence in left average meatus . computed tomography ( tc ) of face
a sinusotomy was indicated to maxillary endoscopy to the left with anattomicopathological and specific culture for fungus ( figure 1 ) .
case 2 ) patient of the feminine sex , pensioner , 70 years , that if presented in a particular doctor 's office directed which had to a description of sinusitis of repetition and allergic rhinitis . was in use of nasal furoate of fluticasone spray and it did not present complaints .
it brought a tc of face that presented thickening of the mucous covering of the left maxillary sinus with hydro - aereal level associate , identifying itself mass with density of soft parts next to the medial wall and to its den , with small calcifications of permeate ( figure 2 ) .
was requested that if presented with hypointense , attacking the socket to left maxillary , which showed fast parietal thickening , with presence of hydro - aereal level and , also , structure with dense standard , showing calcification component associated ( figure 3 ) .
this hypointense to the rm with hyper attenuation of tc is typical signals of fungal ball .
it was carried through the same sequence of surgical treatment and examinations of etiological diagnosis .
tc of face presenting thickening of the mucous covering of the maxillary sinus left and mass of density of soft parts with calcifications .
rm of face with hydro - aereal level and presence of hypointense of maxillary sinus left . ] both the cases had presented aspergillus spp as etiological agent .
fugal ball is described as a not invasive accumulation of a dense conglomeration of fungal hyphae in a paranasal sinus .
it is characterized by a mass of fungal hardened remaining portions and mucus , with gradual growth in the sinusal socket , without involvement of the underlying mucous membrane3 .
fungal balls had been classified erroneously as maduromycosis or aspergilloma in the past . during the last decades
fungal balls had been found in 3,7% of the patients operated in the mayo clinic for chronic inflammatory conditions of the paranasal sinus6 .
the incidence can be artificially increased of innumerable forms , including the best detention through radiological evaluations and greater expectation of life7 .
the average age of attacking is 64 years , having the feminine sex 64% predominance , befitting with the characteristics of the told cases .
the place more frequent involved is the maxillary sinus , followed for the sphenoid sinus8 .
the case 1 presented a description of previous dental treatment , being this present characteristic in about 84% of the diagnosised patients with fungal ball6 . in a case - control study , the risk to develop the illness in submitted patients the endodontic treatment was 14 times bigger that of the patients without treatment9 .
the pathophysiology of the fungal ball is not totally understood , existing some theories to try to explain its appearance .
the aerogenic theory claims that the inhaled spores of fungus if would deposit in the paranasal sinuses , becoming pathogenic when the conditions in the interior of the sinuses if became relatively anaerobic .
another theory suggests that the functional blockage of the sinusal ostium could act as an inductive factor , and that the fungal growth could be favored by the hypoxic and anaerobic conditions .
moreover , the reduction of the ventilation would diminish ph , favoring the growth of hifas10 .
one another considered mechanism conjectured that the growth of hyphae can be extended for a long period of time , with proliferation episodes alternating with longer periods of inactivity .
super infections could take the episodes of acute sinusitis , and the resultant purulent secretion would consist of an ideal nutritional way to boosting the fungal growth . finally , the hypothesis of the ticket of dental sealant exists contends zinc oxide to the maxillary sinus could be an important inductive factor of necrotic alterations and inflammatory in the mucous , what would favor the fungal growth11 .
this last hypothesis , however , it does not explain the appearance of fungal balls in other paranasal sinus .
the fungal ball can be asymptomatic , as it occurred in the first case , or can simulate chronic rhinosinusitis pictures7 .
frequent symptoms include nasal blockage , purulent nasal secretion , sensation of unpleasant smell and face pain .
less common symptoms include convulsions , epistaxis , proptosis , fever , cough and blurred vision .
the symptoms generally last a long period of time and can be gifts for months or until years8 . the diagnosis of fungal ball must be considered in the cases of recurrent sinusitis or refractory to the treatments with antibiotics previously used ( case 2 ) and especially when they will be unilateral6
8 .
radiological evidences , through x - rays and , mainly , tc suggest this strong diagnostic11 . however , the definitive diagnosis is based on the macroscopic characteristics and histopathological of the surgery part6
8 . frequently , the cultures present resulted negative , being that in only 23 - 50% of the cases the cultures helping8 . of these , the aspergillus fumigatus species grows more than in 90% of the cases12 . in the told cases ,
after to consider some criteria diagnostic and to compare them with the finding in 20 cases published in medical literature , deshazo
et al arrived the five criteria for the diagnosis of maduromycosis of the paranasal sinus13 .
the finding most common in this examination is the complete or partial opacification of the attacked sinus .
microcalcifications or spots with metallic density also is found in about a third of the cases of opacification of one sinus6 .
the best form of treatment of maduromycosis of paranasal sinus is the surgery , since the anti - fungal , topic or systemic drugs , are not indicated14 , except in the immunodepression cases , where some authors recommend adjuvant treatment with the use of antifungal systemic , as itraconazole8 .
two forms of surgical procedures for removal of the fungal ball in the maxillary sinus are described in medical literature : the historical procedure of caldwell - luc , who consists of the opening of canine pit for attainment of access to the maxillary sinus ; beyond the surgery for it saw endoscopy , standard - gold actually14 .
the two cases told in this work had been dealt with sinusotomy for endoscopy via .
the boarding of the paranasal sinus saw endoscopy aims at to the natural opening of the ostium of the attacked sinus , in intention to recoup its draining and ventilation . in case that it has mucous polypoid next to the average meatus
, a wide antrostomy can be created removing great part of posterior fontanelle and connecting a possible secondary ostium to the area of the ostium to natural maxillary .
this procedure cause little damages to the patient , as well as reestablishes the ventilation and the draining of the sinus to its natural ostium14 . on the other hand
, this surgery presents a problem technician : it is not possible to visualize the angle formed for the bone of lachrymal ducts and the previous wall of the maxillary sinus . in this point
, it can remain a fungal particle concentrate after the surgery , what it can generate relapses15 .
when the fungal ball attacks the sphenoid sinus or the ethmoidal , the choice boarding is , respectively , endonasal sphenoid or complete ethmoidectomy .
already in the rare cases where the engaged sinus is the frontal a endonasal access generally is possible14 .
although the advance of the diagnostic methods and the examinations of image , the diagnosis of fungal sinusitis still remains a challenge .
the fungal infection must be considered in all the patients with chronic sinusitis , when it does not have adjusted therapeutically reply or in recurrent unilateral sinusitis , being more gifts in those submitted previous the endodontic treatments . considered an exclusion diagnosis , many times the attacked patients arrive at the doctor 's office already had passed a health professional for more than , as the told cases . in these cases , a tc of paranasal sinus must be considered , but its definitive diagnosis is based on macroscopic and histopathological analyses of the surgical part . | summary
introduction : fungal ball of the sinuses is a not invasive infection that if characterizes for its chronicity , being the majority related with previous endodontic treatment .
affect mainly the breasts to maxillary ; even so all the breasts can be involved .
the main etiological agent is the aspergillus spp .
the computed tomography , had to characteristic the radiological presentations , suggests the diagnosis that is carried through definitively through histopathological analyses .
the treatment standard - gold is the sinus surgery with average meatal antrostomy .
objective : reporting two cases of fungal ball of the sinuses and to stand out important aspects of this pathology .
story of the cases : case 1 ) patient of the feminine sex , 78 years old , presented itself with complaints of face pain has 6 months and previous history of endodontic treatment .
to the physical examination it was evidenced purulent secretion presence in left average meatus .
ray x presented complete veiling of the breasts to maxillary left , while the computed tomography showed injury calcified in this place .
sinusotomy was become fulfilled that evolved well .
case 2 ) patient of the feminine sex , 70 years old , looked attendance for history of sinusitis of repetition . to the physical examination no particularity
was not perceived .
the computed tomography , as well as the magnetic resonance , detected thickening of the mucous wall of the breasts to maxillary left , beyond a calcified mass .
it was become fulfilled same sequence of treatment and the patient also evolved well .
final considerations : the fungal infection must be considered in the patients who if present with chronic sinusitis , that they do not answer to the antibiotic use and that they possess history of endodontic manipulation . |
pulmonary alveolar proteinosis ( pap ) is a rare disease characterized by the excessive accumulation of lipoproteins containing periodic acid / schiff reagent ( pas)-positive surfactant in the lower respiratory tracts .
it can be classified as autoimmune , secondary , or genetic . regarding the secondary type ,
secondary pap is believed to be caused by a relative deficiency of granulocyte macrophage colony - stimulating factor ( gm - csf ) and related macrophage dysfunction .
in contrast , autoimmune pap is thought to be primarily caused by anti - gm - csf autoantibodies ( 1 - 3 ) . in the present report , we describe a patient with pap who was positive for gm - csf autoantibodies and simultaneously exhibited a myeloproliferative neoplasm .
he underwent an examination at a local clinic after becoming aware of swelling of the dorsum of the right foot for 2 weeks .
regarding his lifestyle , he had smoked 30 cigarettes per day for 50 years and was never exposed to a dust explosion . on a physical examination ,
a fine crackle was audible on both sides of the back , and edema of the right dorsum of the foot was evident .
the blood test results were as follows : white blood cells ( wbcs ) : 30,402 /l ( differential count = myeloblasts : 2% , promyelocytes : 1% , myelocytes : 3% , metamyelocytes : 2% , band cells : 9% , granulocytes : 68% , lymphocytes : 7% , basophils : 1% , and monocytes : 7% ) , hb : 15.6 g / dl , reticulocytes ( ret ) : 2.2% , platelets ( plt ) : 195,000 /l , total protein : 7.4 g / dl , albumin ( alb ) : 4.1 g / dl , blood urea nitrogen : 18.2 mg / dl , creatinine ( cr ) : 1.18 mg / dl , aspartate amino transferase : 22 iu / l , alanine amino transferase : 19 u / l , lactate dehydrogenase ( ldh ) : 430 iu / l , total bilirubin : 0.5 mg / dl , uric acid : 6.6 mg / dl , sodium : 138 meq / l , potassium : 4.0 meq / l , chloride : 105 meq / l , calcium : 9.3 mg / dl , c - reactive protein : 0.71 mg / dl , antinuclear antibody : ( - ) , cytoplasmic antineutrophil cytoplasmic antibodies : ( - ) , perinuclear antineutrophil cytoplasmic antibodies : ( - ) , cardioembryonic antigen ( cea ) : 15.8 ng / ml , krebs von den lungen-6 ( kl-6 ) : 38,090 u / ml , surfactant protein d : 185.9 ng / ml , and -d - glucan : 9.5 pg / ml . plain chest x - ray and computed tomography ( ct ) showed ground glass opacity ( ggo ) accompanied by significant , diffuse hypertrophy of the interlobular septa of both lungs ( fig .
1 ) . no lymph node enlargement was noted , but the spleen was mildly enlarged .
( a , b ) on plain chest radiography , bilateral alveolar opacities located centrally in mid and lower lung zones are found .
( c , d ) on high resolution ct reveals ground glass opacity accompanied by significant , diffuse hypertrophy of the interlobular septa of both lungs referred to as
respiratory function testing indicated that , on room air , the blood oxygen saturation level ( spo2 ) was 93% , blood gas was ph 7.437 , partial pressure of carbon dioxide was 33.6 mmhg , partial pressure of oxygen was 72.2 mmhg , base excess was -0.7
mmol / l , bicarbonate was 22.3 meq / l , vital capacity was 94.1% , forced expiratory volume in 1 second ( fev1% ) was 80.2% , and diffusing capacity for carbon monoxide was 11.39 ml / min / mmhg ( 80.8% ) . regarding leukocytosis , bone marrow testing indicated that the numbers of all types of granulocytes were elevated in the hyperplasic bone marrow without any abnormalities in differentiation of any lineages or dysplastic features .
a small increase in the numbers of reticular fibers was detected using the silver impregnation method .
chronic myelogenous leukemia ( cml ) was excluded because the g - banding chromosome analysis was 46,xy [ 20/20 ] and a fluorescence in situ hybridization analysis of the bcr - abl fusion gene was 0% .
it was difficult to make an accurate diagnosis according to the who classification 2008 because mutations in genes such as jak2 , v617f , and csf3r were not evaluated . on clinical presentation , there was no splenomegaly . on a peripheral blood analysis
these findings excluded primary myelofibrosis , polycythemia vera , essential thrombocythemia , and chronic eosinophilic leukemia .
there was no bone marrow dysplasia , so we excluded myelodysplastic syndrome ( mds ) and atypical cml .
chronic neutrophilic leukemia was also excluded because a peripheral blood analysis revealed that the band cell and granulocyte levels were less than 80% and myeloblast levels over 1% .
therefore , we diagnosed the patient with myeloproliferative neoplasm , unclassifiable ( mpn u ) by exclusion diagnosis .
lung shadows on x - ray imaging suggested pap ; therefore , bronchoscopy was performed .
iu / l , leukocytes were 1.110/ml , quantitative method for alb was 246.8 mg / cr , quantitative method for urinary protein was 70 mg / dl , and cea was 18.4 mg / ml . on transbronchial lung biopsy ,
the alveolar space was filled with pas - positive eosinophilic granule - like substances , consistent with pap ( fig .
we noted substances that tended to stain light green in the bal fluid and suctioned the sputum .
macrophages were also present in the bal and sputum ( fig . 2c and d ) .
taken together , these findings were consistent with pap , and a diagnosis of pap was made .
( a , b ) on trans bronchial lung biopsy , the terminal bronchioles and alveoli are filled with a pas - positive eosinophilic material with a granular pattern .
( c , d ) on bronchoalveolar lavage fluid and suctioned sputum , we can find granule - like substances that tended to be stained light green and the presence of macrophages .
our treatment strategy involved a conservative approach with regular follow - up observations for mpn .
regarding pap , following discussion with respiratory specialists , given that the dyspnea on exertion was mild and did not interfere with the patient 's daily activities , we decided not to perform alveolar lavage or gm - csf inhalation therapy until more severe symptoms manifested .
two years after the diagnosis , the wbc count reached over 70,000 /l , and we began treatment with hydroxyurea ( 500 mg / day ) . at that time
, the respiratory symptoms and chest x - ray showed no signs of progression of pap .
three years after the diagnosis , the levels of blast cells in the peripheral blood increased suddenly to 18% . at that time
the spo2 was 94% on room air , and plain chest x - ray and ct showed no marked changes from the initial diagnosis of pap .
the blood test results were as follows : wbcs : 13,710 /l ( differential count = myeloblasts : 18% , myelocytes : 1% , band cells : 2% , granulocytes : 42% , lymphocytes : 19% , basophils : 1% , eosinophils : 1% , and monocytes : 16% ) , hb : 11.5 g / dl , ret : 1.5% , and plt : 43,000 /l .
bone marrow testing showed that the blast cell levels were at 37% , and peroxidase staining results were positive .
blast cells were positive for cd13 , cd33 , and hla - dr and negative for cd34 and cd117 .
the levels of monocytes also reached 10% , and a diagnosis of acute myeloid leukemia ( aml ) was made .
the g - banding chromosome analysis was 46,xy[7/20 ] , 46,xy , idic(17)[11/20 ] , 47,xy,+21[2/20 ] .
soon after admission , remission induction therapy ( 30 mg / m daunorubicin for 3 days and 200 mg / m enocitabine for 8 days ) was introduced in accordance with the japan adult leukemia study group gml200 protocol ( 4 ) .
no severe adverse events occurred during the course , although on day 27 of the recovery phase of remission induction therapy , bone marrow aspirate showed residual myeloid blast cells ( about 5 - 10% ) , and the patient failed to achieve remission .
a large volume of hemoptysis began to continuously appear , and his oxygenation simultaneously worsened rapidly .
plain chest x - ray and ct showed progression of bilateral ggo and pleural effusion .
a respiratory specialist determined the patient to have alveolar bleeding due to thrombocytopenia and infection . despite intensive care ,
the patient died on day 16 of the second induction . throughout the course from diagnosis to death , we deemed the state of pap to be unchanged , despite the progression to leukemia .
this meant that we did not provide therapy for pap , such as alveolar lavage .
the gm - csf autoantibody levels could not be evaluated periodically because this was not covered by his medical insurance .
the abnormal gm - csf function caused by autoimmune mechanisms is the main cause of adult pap ( 5 - 7 ) . of the 248 reported cases of pap in japan , 223 ( 89.9% )
twenty - four patients ( 9.7% ) were diagnosed with secondary pap that was negative for gm - csf autoantibodies or an underlying illness . the remaining patient ( 0.4% ) had disease of unknown cause ( 7 ) .
this report shows that autoimmune pap is the most common form . in the present case ,
tests for gm - csf autoantibodies were positive , and the disease was thus considered to be autoimmune pap . the causes of secondary pap are likely related to relative decreases in the levels of gm - csf and corresponding macrophage dysfunction .
only one case of secondary pap related to indium - tin oxide exposure with gm - csf autoantibodies was observed ( 8) . other reports on secondary pap have shown that most cases were negative for gm - csf autoantibodies and did not involve autoimmune mechanisms ( 1,3,9,10 ) .
one report showed that 40 cases of pap secondary to hematologic malignancy were negative for gm - csf autoantibodies ( 3 ) .
in contrast , the present case of pap was positive for gm - csf autoantibodies and had mpn .
although the median antibody titer for autoimmune pap was reported to be 15.29 g / ml ( 7 ) , the antibody titer in our case was 56.45 g / ml , which was relatively high .
we can not exclude the possibility that the onset of pap was a result of mpn , but we regarded this case as one of autoimmune pap with independent mpn .
secondary pap with hematological disease and without autoimmune mechanisms is common , but autoimmune pap with hematological disease , as in the present case , has rarely been reported .
previous case reports of pap with mpn are listed in table ( 11 - 14 ) .
as noted in other reports ( 9 ) , cml and mds are the most common cause of pap , and there are no reports of pap with mpn u such as ours . in one case of pap , gm - csf autoantibodies were detected , and it was speculated that abl tyrosine kinase inhibitor - induced mechanisms were involved ( 14 ) .
interestingly , three out of four cases listed in table were diagnosed with pap when mpn progressed or disseminated infection occurred . in the remaining case ,
however , in our case , the relationship between the clinical course of mpn and pap was not apparent .
one report compared the ct findings between autoimmune pap and secondary pap and showed that the typical high - resolution ct ( hrct ) findings for autoimmune pap were ggo with a patchy geographic pattern , subpleural sparing , crazy - paving appearance , and predominance in the lower lung field .
these findings are uncommon for secondary pap ( 15 ) . in the present case ,
additionally , subpleural sparing and the crazy - paving appearance were seen , patterns which are more similar to autoimmune pap . however , ggo was not predominant in the lower lung field , and we could not confirm the typical appearance of an autoimmune pap pattern . when reviewing the therapeutic strategies for pap ,
it is important to note that the various forms of pap may require different treatments , even though whole - lung lavage is the current therapeutic standard ( 16,17 ) .
gm - csf inhalation therapy ( 18 ) and rituximab ( 19 ) may also be effective treatments for autoimmune pap .
several reports have shown that alveolar lavage and serial measurements of serum gm - csf autoantibodies may prove useful for monitoring disease activity and response to treatment ( 20 ) .
however , it has been reported that pap may also improve if hematological malignancy can be controlled ( 2 ) .
pap did not progress after mpn transformed to aml in our case , and this observation was consistent with autoimmune pap .
this report shows that evaluating the levels of gm - csf autoantibodies is critical for distinguishing secondary and autoimmune pap , even if the patient has pap with hematological disease .
| pulmonary alveolar proteinosis ( pap ) is classified as autoimmune , secondary , or genetic .
we herein describe a 69-year - old man with autoimmune pap , simultaneously diagnosed with myeloproliferative neoplasm ( mpn ) .
two years after the diagnosis , the mpn progressed to acute myeloid leukemia , and the patient died from an alveolar hemorrhage during remission induction chemotherapy . throughout the clinical course ,
no progression of pap was observed , despite the progression to leukemia .
there are few reports of autoimmune pap with hematological malignancy , and this case demonstrated that an evaluation for gm - csf autoantibodies is important for distinguishing the autoimmune and secondary forms of pap , even if the patient has hematological malignancy . |
the field of drug delivery system ( dds ) utilizing polymeric carrier , which covalently conjugates molecule of interest , plays an important role in modern therapeutics [ 1 , 2 ] .
such polymer - based drug entities are now termed as polymer therapeutics and include nanomedicine class that has become immensely critical in recent years [ 35 ] .
the objectives for designing a polymer therapeutics are primarily to improve the potential of the respective drug by ( i ) enhancing water solubility , particularly relevant for some drugs with low aqueous solubility , ( ii ) stability against degrading enzymes or reduced uptake by reticulo - endothelial system ( res ) , and ( iii ) targeted delivery of drugs to specific sites of action in the body [ 1 , 6 ] .
poly(ethyleneglycol ) ( peg ) is the most commonly used nonionic polymer in the field of polymer - based drug delivery . due to high aqueous solubility ,
ringdorf was the first to propose the rational model for pharmacologically active polymers in 1975 .
an ideal prodrug model typically consists of multiple components ( figure 1 ) : polymer as a carrier ; drug , peptide , or protein as a biological active component ; spacer molecule or targeting moiety .
pegylation , the covalent attachment of peg to molecules of interest , has become a well - established prodrug delivery system [ 8 , 9 ] .
pegylation was first reported by davies and abuchowski in the 1970s for albumin and catalase modification . since
then the procedure of pegylation has been broadened and developed thereafter tremendously [ 1016 ] .
the remarkable properties of the biologically inert ( biocompatible ) peg polymer derive from its hydrophilicity and flexibility .
peg is also considered to be somewhat hydrophobic due to its solubility in many organic solvents .
most used pegs for prodrug modification are either monomethoxy peg or dihydroxyl peg ( figure 2 ) .
typically , most of the peg - based prodrugs have been developed for the delivery of anticancer agents such as paclitaxel , methotrexate , and cisplatin .
high - molecular - weight prodrugs containing cytotoxic components have been developed to decrease peripheral side effects and to obtain a more specific administration of the drugs to the cancerous tissues .
favorably , a macromolecular antitumor prodrug is expected to be stable in circulation and should degrade only after reaching the targeted cells or tissues .
peg - drug conjugates can therefore be tailored for activation by extra- or intracellular enzymes releasing the parent drug in situ ( figure 3 ) . in this paper
, we represent an overview on the advances of peg prodrug conjugates which are being currently used as therapeutics . a short discussion with particular emphasis on the derivatives in clinical practice or still under clinical trials is also provided .
peg in its most common form is a linear or branched polyether terminated with hydroxyl groups .
peg is synthesized by anionic polymerization of ethylene oxide initiated by nucleophilic attack of a hydroxide ion on the epoxide ring .
most useful for polypeptide modification is monomethoxy peg ( mpeg ) . on the other hand ,
successful conjugation of peg with biomolecule depends upon the chemical structure , molecular weight , steric hindrance , and the reactivity of the biomolecule as well as the polymer . in order to synthesize a bioconjugate , both chemical entities ( i.e. , the bioactive as well as the polymer ) need to possess a reactive or functional group such as cooh , oh , sh , or nh2
therefore , the synthetic methodology to form a conjugate involves either protection or deprotection of the groups .
most commonly used strategies for conjugation involve use of both coupling agents such as dicyclohexyl carbodiimide ( dcc ) and 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide ( edc ) or use of n - hydroxysuccinimide ( nhs ) esters .
chemical conjugation of drugs or other biomolecules to polymers and its modifications can form stable bonds such as ester , amide , and disulphide .
the resulting bond linkage should be relatively stable to prevent drug release during its transport until it reaches the target .
covalent bonds ( e.g. , ester or amide ) are comparatively stable bonds and could deliver the drug at the targeted site . however , in some instances such bonds may not easily release targeting agents and peptides under the influence of acceptable environmental changes . in the past ,
peg prodrugs have been designed mostly for the delivery of anticancer agents due to its overall implications in the treatment .
however it should be noted that peg - antitumor prodrug is expected to be stable during circulation and degrade / hydrolyze only on reaching the targeted site .
peg - drug conjugates can therefore be tailored to release the parent drug in situ on activation by extra- or intracellular enzymes or ph change .
peg has limited conjugation capacity since it possesses only one ( two in case of modified pegs ) terminal functional group at the end of the polymer chain . to overcome this limitation of peg , coupling
amino acids , such as bicarboxylic amino acid and aspartic acid , to the peg has been proposed [ 20 , 21 ] .
such derivatization increases the number of active groups of the original peg molecule . using the same method with recursive derivatization ,
dendrimeric structures have also been achieved at each pegs extremity . however , in the study the authors encountered low reactivity of the bicarboxylic acids groups towards arabinofuranosylcytosine ( ara - c ) binding due to steric hindrance between two ara - c molecules on conjugation with neighboring carboxylic moieties .
it was suggested that this effect might be overcome by incorporating the dendrimer arms with an amino alcohol ( h2n[ch2ch2o]2h ) .
peg polymers with hydroxyl terminals can be easily modified by aliphatic chains molecules or small amino acids .
for example , antitumor agent 1--d - ara - c was covalently linked to varying molecular weight oh terminal pegs through an amino acid spacer in order to improve the in vivo stability and blood residence time .
conjugation was carried out with one or two available hydroxyl groups at the polymer 's terminals .
furthermore , to increase the drug loading of the polymer , the hydroxyl groups of peg were functionalized with a bicarboxylic amino acid to form a tetrafunctional derivative . finally , the conjugates with four or eight ara - c molecules for each peg chain were prepared ( figure 4 ) .
the authors investigated steric hindrance in peg - ara - c conjugates using molecular modeling to investigate the most suitable bicarboxylic amino acid with the least steric hindrance .
typically , hydroxyl groups of peg are activated by p - nitrophenyl chloroformate to form a stable carbamate linkage between peg and amino acid .
the degree of peg hydroxyl group activation with p - nitrophenyl chloroformate was determined by uv analysis of the p - nitrophenol released from peg - p - nitrophenyl carbonate after alkaline hydrolysis .
activated peg was further coupled with amino acid and the intermediate peg - amino acid was linked to ara - c by edc / nhs activation .
peg - nhs esters are readily available which are reactive with nucleophiles to release the nhs leaving group and forms an acylated product ( figure 5(a ) ) .
nhs is a choice for amine coupling because of its higher reactivity at physiological ph reactions in bioconjugation synthesis . in particular , carboxyl groups activated with nhs esters are highly reactive with amine nucleophiles and are very common entity in peptides and proteins .
polymers containing reactive hydroxyl groups ( e.g. , peg ) can be modified to obtain anhydride compounds . on the other hand
, mpeg can be acetylated with anhydrides to form an ester terminating to free carboxylate groups ( figure 6 ) .
the reactive peg and its derivatives succinimidyl succinate and succinimidyl glutamate are used for conjugation with drugs or proteins .
the coupling reactions involving amine groups are usually of two types : ( a ) acylation , ( b ) alkylation .
carbodiimide coupling reactions or zero lengths crosslinkers are widely used for coupling or condensation reactions .
most of the coupling methodologies involve use of heterobifunctional reagent to couple via modified lysine residues on one protein to sulphydryl groups on the second protein , while modification of lysine residues involves the use of a heterobifunctional reagent comprising an nhs functional group , together with a maleimide or protected sulphydryl group .
the linkage formed is either a disulphide bridge or as a thioether bond , depending if the introduced group is either a sulphydryl or maleimide , respectively .
the thiol group on the second protein may be an endogenous free sulphydryl , or chemically introduced by modification of lysine residues .
in general , low - molecular - weight compounds diffuse into normal and tumor tissue through endothelia cell layer of blood capillaries .
conjugation of low - molecular - weight drugs with high - molecular - weight polymeric carriers results in high - molecular weight prodrugs ( figure 1 ) .
high - molecular - weight drugs are internalized mainly by endocytosis , which is a much slower internalization process over to simple diffusion . hence in case of endocytosis higher drug concentration outside the cell is required to produce the same cellular effect as corresponding low - molecular - weight drug . therefore , higher - molecular - weight prodrugs displays lower specific activity compared to its free form of drugs .
for example , polymeric anticancer prodrugs are generally less toxic when compared with its free form , yet require substantially higher concentrations inside the tumor to be cytotoxic .
compensation for this decrease in drug efficacy can be achieved by targeting a polymeric drug to the specific organ , tissue , and/or cell . following two approaches
is generally used to target polymeric anticancer drugs to the tumor or cancer cells [ 25 , 26 ] : passive targeting is a drug delivery approach in which drugs are delivered to the targeted site by conjugating with polymer which releases the drug outside the targeted site due to altered environmental conditions ( figure 6(a ) ) .
tumors and many inflamed areas of body have hyperpermeable vasculature and poor lymphatic drainage which passively provides increased retention of macromolecules into tumor and inflamed area of body [ 2730 ] .
epr effect is primarily utilized for passive targeting due to accumulation of prodrug into tumor or inflamed area .
low molecular drugs covalently coupled with high - molecular - weight carriers are inefficiently eliminated due to hampered lymphatic drainage and therefore accumulate in tumors . while epr effect enhances the passive targeting ability due to higher accumulation rate of drug in tumor and subsequently due to accumulation , prodrug slowly releases drug molecules which provide high bioavailability and low systemic toxicity .
passive accumulation of macromolecules such as peg and other nanoparticles in solid tumors is a phenomenon which was probably overlooked for several years as a potential biological target for tumor - selective drug delivery .
, for macromolecular anticancer drug delivery systems . furthermore , passive targeting increases the concentration of the conjugate in the tumor environment and therefore
passively forces the polymeric drug to enter the cells by means of the concentration gradient between the intracellular and extracellular spaces and therefore is not very efficient .
active targeting approach is based on interaction between specific biological pairs ( e.g. , ligand receptor , antigen antibody , enzyme substrate ) ( figure 6(a ) ) .
active targeting is achieved by attaching targeting agents that bind to specific receptors on the cell surface to the prodrug by a variety of conjugation chemistries .
most widely used targeting moieties are peptide ligands , sugar residues , antibodies , and aptamers specific to particular receptors , selectins , antigens , and mrnas expressed in targeted cells or organs .
the targeted anticancer lhrh - peg - cpt conjugate is an example of such targeted anticancer drug delivery system . in this system ,
lhrh peptide is used as a targeting moiety to the corresponding receptors overexpressed in several cancer cells , peg polymer as a carrier and cpt as an anticancer drug .
interaction of these targeting moieties to their target molecule results in uptake of the drug by two main approaches : ( i ) internalization of the whole prodrug or ( ii ) internalization of the drug into targeted cells by various endocytosis and phagocytosis pathways .
( i ) internalization of the prodrugin this system , the drug is cleaved intracellularly after endocytosis .
the internalized prodrug exhibits pharmacological activity on reaching the cytosol or the nucleus , which are the sites of action of intracellularly active drugs .
this process can be divided into several distinct steps as schematically presented in figure 6(b ) .
interaction of a targeted prodrug with a corresponding receptor initiates receptor - mediated endocytosis by formation of an endocytic vesicle and endosomes - membrane - limited transport vesicles with a polymeric delivery system inside .
the activity of the drug is preserved during the intracellular transport as the membrane - coated endosome prevents drugs from degradation by cellular detoxification enzymes .
if the drug - polymer conjugate is designed by incorporating an enzymatically cleavable bond then the drug is released from the polymer - drug conjugate by the lysosomal enzymes and might exit a lysosome by diffusion .
the advantage of this approach is a high local drug concentration with a potential increase in efficacy .
in this system ,
the internalized prodrug exhibits pharmacological activity on reaching the cytosol or the nucleus , which are the sites of action of intracellularly active drugs .
this process can be divided into several distinct steps as schematically presented in figure 6(b ) .
interaction of a targeted prodrug with a corresponding receptor initiates receptor - mediated endocytosis by formation of an endocytic vesicle and endosomes - membrane - limited transport vesicles with a polymeric delivery system inside .
the activity of the drug is preserved during the intracellular transport as the membrane - coated endosome prevents drugs from degradation by cellular detoxification enzymes .
if the drug - polymer conjugate is designed by incorporating an enzymatically cleavable bond then the drug is released from the polymer - drug conjugate by the lysosomal enzymes and might exit a lysosome by diffusion .
the advantage of this approach is a high local drug concentration with a potential increase in efficacy .
( ii ) internalization of the drugin this system , the drug conjugate is cleaved extracellularly .
in this system , the drug conjugate is cleaved extracellularly .
the microenvironment of tumors has been reported to be slightly acidic in animal models and human patients and the ph value in tumor tissue is often 0.51.0 units lower than in normal tissue .
the potential value of proteins such as antibodies , cytokines , growth factors , and enzymes as therapeutics has been recognized for years .
however , successful development and application of therapeutic proteins are often impeded by several difficulties , for example , short circulating t1/2 , low stability , costly production , poor bioavailability , and immunogenic and allergic potential . an elegant method to overcome most of these difficulties
pegylation of the native protein generally masks the protein 's surface , inhibits antibodies or antigen processing cells , and reduces degradation by proteolytic enzymes .
in addition , pegylation of the native protein increases its molecular size and as a result prolongs the half - life in vivo , which in turn allows less frequent administration of the therapeutic protein .
the most common chemical approach for preparing peg - protein conjugates has been by coupling nh2 groups of proteins and mpeg with an electrophilic functional group .
such conjugate reactions usually result in formation of polymer chains , covalently linked to a globular protein in the core .
figures 7(a ) and 7(b ) illustrate the commonly used methods of mpeg - based protein modifying reagents .
derivatives 1 and 2 contain a reactive aryl chloride residue , which is displaced by a nucleophilic amino group by a reaction with peptides or proteins , as shown in figure 7(b ) .
derivatives 1 and 2 are acylating reagents , whereas derivatives 311 contain reactive acyl groups referenced as acylating agents .
protein modification with all of these agents results in acylated amine - containing linkages : amides derived from active esters 36 and 11 or carbamates derived from 710 .
alkylating reagents 12 and 13 react with proteins forming secondary amine conjugation with amino - containing residues . as represented in figure 7(a ) , tresylate 12 alkylates directly , while acetaldehyde 13 is used in reductive alkylation reactions .
numbers 113 represent the order in which these activated polymers were introduced [ 6 , 36 ] .
adagen ( pegademase bovine ) , used for the treatment of severe combined immunodeficiency disease ( scid ) , is developed using peg polymer .
peg chemistry may results in side reaction or weak linkages upon conjugation with polypeptides and low - molecular - weight linear pegs ( 12 kda ) .
it is prepared by first reacting mpeg ( mw 5000 da ) with succinic anhydride spacer .
the resulting carboxylic group of peg succinic acid is activated with n - hydroxysuccinimide ( nhs ) by using carbodiimide coupling agents .
another peg prodrug of enzon ( oncaspar ) is also synthesized by the use of peg succinimidyl succinate .
the peg ester and thioesters are highly susceptible to hydrolysis and thus modification occurs primarily at the amines forming amides .
the pegylated cera protein conjugate , a product of hoffmann - laroche ( mircera ) is synthesized by attachment of an nhs - activated monomethoxy peg butanoic acid to lysine 46 and 52 on erythropoietin ( epo ) [ 38 , 39 ] . also , hoffman - la roche , inc .
's peginterferon 2a ( pegasys ) is prepared by conjugating peg with the side chain and n - terminal amine groups of lysine spacer , forming a biscarbamate .
then on activation of the carboxylic acid with nhs , it helps the branched peg chain linker form stable amide bonds with 11 possible lysine residues .
monosubstituted conjugate can also be synthesized by the same reaction process by limiting the amount of peg chain linker used in the conjugation step . while , peg - intron by schering - plough ( peginterferon 2b ) is a covalent conjugate of interferon alfa-2b linked to a single unit of mw 12000 peg is a covalent conjugate of interferon alfa-2b linked to a single unit of mw 12000 peg .
the interferon conjugates are synthesized by condensing activated peg , wherein a terminal hydroxy or amino group can be replaced by an activated linker , and reacting with one or more of the free amino groups in the interferon ( figure 8) .
condensation with only one amino group to form a monopegylated conjugate is a prime feature of this synthesis process .
in other instance , pegvisomant ( somavert ) prodrug conjugate is synthesized by covalent attachment of four to six mw 5000 da peg units via nhs displacement to several lysine residues available on hgh antagonist b2036 , as well as the n - terminal phenylalanine residue is used for acromegaly treatment [ 4143 ] .
similarly , amgen 's pegfilgrastim ( neulasta ) is used to decrease febrile neutropenia manifested infection and this prodrug is a covalent conjugation of mw 20000 da monomethoxy peg aldehyde by reductive amination with the n - terminal methionine residue of the filgrastim protein . on the other hand , krystexxa ( pegloticase ) by savient , used for the treatment of chronic gout ,
the primary amine lysine side chain is replaced by p - nitrophenol to form carbamates , which are further subjected to decrease hydrolysis under mild basic conditions . from the total of 28 - 29 lysines , approximately 12 lysines on each subunit of urate oxidase are surface accessible in the native tetrameric form of the complete enzyme .
in fact , due to the close proximity of some of the lysine residues , pegylation of one lysine may sterically hinder the addition of another peg chain [ 45 , 46 ] .
pegylation of drugs does influence the pharmacokinetic properties of drugs and drug carriers and therefore is emerging as an important area in pharmaceutics .
peg has been successful for protein modification but in the case of low - molecular - weight drugs it presents a crucial limit , the low drug payload accompanying the available methoxy or diol forms of this polymer .
this intrinsic limitation had for many years prevented the development of a small drug - peg conjugate , and also because the conjugates extravasation into tumors by epr effect is directly proportional to the conjugate 's molecular weight .
unfortunately , in case of peg the use of larger polymer does not correlate well with an increase in the amount of drug selectively delivered into the tumor . in case of peg ,
the number of available groups for drug coupling does not change with the length of polymeric chain , as happens instead with other polymers ( e.g. , polyglutamic acid , and dextran ) or copolymers ( e.g. , hpma ) .
the latter can have several functional groups along the polymeric backbone : longer polymer chains correspond to an increased number of functional groups [ 22 , 4749 ] .
a few studies have been conducted recently to overcome the low peg loading by using multiarm pegs either branched at the end chain groups or coupling on them small dendron structures ( figure 9 ) [ 47 , 4951 ] .
this compound was obtained by coupling a 4-arm peg of 40 kda with the camptothecin derivative sn38 , through a spacer glycine ( figure 10 ) .
the coupling strategy was developed to link selectively the 20-oh group of sn38 , thus preserving the e ring of sn38 in the active lactone form while leaving the drug 10-oh - free .
design and synthesis of nontargeted or antibody targeted biodegradable peg multiblock coupled with n2,n5-diglutamyllysine tripeptide with doxorubicin ( dox ) attached through acid - sensitive hydrazone bond has also been reported [ 5457 ] .
peg activated with phosgene and nhs was reacted with nh2 groups of triethyl ester of tripeptide n2,n6-diglutamyllysine to obtain a degradable multi - block polymer .
the polymer was converted to the corresponding polyhydrazide by hydrazinolysis of the ethyl ester with hydrazine hydrate . on the other hand ,
the nontargeted conjugate was prepared by direct coupling of dox with the hydrazide peg multi - block polymer . whereas the antibody - targeted conjugates , a part of the polymer - bound hydrazide group , was modified with succinimidyl 3-(2-pyridyldisulfanyl ) propanoate to introduce a pyridyldisulfanyl group for subsequent conjugation with a modified antibody .
dox was coupled to the remaining hydrazide groups using acid - labile hydrazone bonds to obtain a polymer precursor .
in addition , human immunoglobulin igg modified with 2-iminothiolane was conjugated to the polymer by substitution of the 2-pyridylsulfanyl groups of the polymer with sh groups of the antibody .
it was demonstrated that dox was rapidly released from the conjugates when incubated in phosphate buffer at lysosomal ph 5 and 7.4 ( blood ) . to construct a prodrug
, various spacers have been incorporated along with the polymers and copolymers to decrease the crowding effect , to increase the reactivity , and reduce steric hindrance [ 6 , 58 ] .
the application of a spacer arm can enhance ligand - protein binding and also provide multiple binding sites .
ideal spacer molecules possess the following characteristics : stable during conjugate transport , adequate drug conjugation ability and , being able to release the bioactive agent at an appropriate site of action .
amino acid spacers such as alanine , glycine , and small peptides are most commonly used due to their chemical versatility for covalent conjugation and biodegradability .
polymer spacers are used to enhance the conjugation ratio of an antibody with a drug by introducing them between the targeting antibody and the drug . the use of an intermediate polymer with drug molecules carried in its side chains increases the potential number of drug molecules able to attach to that antibody by modification of only a minimum amount of existing amino acid residues ( figures 7(a ) and 7(b ) ) .
peg - based therapeutics were initially dismissed as interesting , but impractical to be translated in clinical setups . however , a growing number of products have shown that they can satisfy the stringent requirements of regulatory authority approvals ( table 1 ) .
enzon 's adagen was among the first few peg - protein conjugates to enter the clinic with fda approval in 1990 .
it is used as a placement therapy to treat severe combined immunodeficiency ( scid ) disease .
it is usually fatal in children unless the patient is kept in protective isolation or undergoes a bone marrow transplant . as an alternative
it is a replacement therapy and is repeated for the rest of the life by the patients following the dosing schedule : 10 u kg , 15 u kg , and 20 u kg for the first three doses , and the weekly maintenance dose of 20 u kg .
however , immune related problems have been reported for pegademase and its long - term treatment benefits are yet to be elucidated .
also , the high cost of treatment ( $ 200,000$300,000 per annum per patient ) is an obvious disadvantage [ 6062 ] .
oncaspar is a peg - modified entity of the enzyme l - asparaginase and is used for the treatment of acute lymphoblastic leukaemia .
pegylation was attempted to overcome several factors limiting the utility of asparaginase as therapeutic agent such as high clearance , immunologic factors such as antibodies to asparaginase owing to bacterial protein and also inactivation due to conversion to asparagine via asparagine synthetase . also , the immunological side effects such as hypersensitivity reactions ( up to 73% ) were major factors that limited clinical utility of l - asparaginase .
pegaspargase was developed in the 19701980 while it was translated in the clinical trials in the 1980 . taking clues from the preclinical studies , a series of systematic clinical studies revealed the effectiveness of the pegaspargase as compared to its non - peg - grafted parent drug [ 65 , 66 ] .
clinical trials demonstrated safety in terms of fewer incidence of hypersensitivity reactions and prolonged duration of action .
the trials defined different protocols ( weekly or every two weeks ) and recipes of multidrug regime to treat different malignancies . the clinical observations from clinical studies for pegaspargase conjugate are summarized in table 2 [ 67 , 68 ] .
mircera is a pegylated continuous erythropoietin ( epo ) receptor activator ( cera ) introduced by hoffmann - la roche .
it got approved by fda in 2007 and is currently used to treat renal anemia in patients with chronic kidney disease ( ckd ) .
pegylation of erythropoietin helps to prolong the half - life to approximately 130 h .
darbepoetin alfa ( aranesp , amgen ) , a second - generation epo , due to the inclusion of an amino acid mutation has a higher glycosylation rate , and hence requires only weekly or biweekly injections . on the other hand , third - generation epo ( cera ) requires only monthly administration and thus helps in significantly improving the quality of life .
however , it has been reported to have negligible effects on morbidity or mortality like other esas .
pegasys ( peginterferon alfa-2a ) ( hoffmann - la roche ) drug is used to treat chronic hepatitis c ( hcv ) either alone or in combination with antimicrobial ribavirin .
pegylated interferon demonstrated higher efficacy by increasing the clearance time of the protein , thus maintaining interferon concentration levels in the blood to control hcv .
the clinical study of peginterferon revealed that 180 g of peginterferon alfa-2a , administered once a week in patients with hepatitis c - related cirrhosis or bridging fibrosis was significantly more effective than 3 million units of standard interferon alfa-2a [ 7173 ] .
peg - intron marketed by schering - plough is used to eradicate hepatic and extrahepatic hepatitis c virus infection .
peg conjugated with -interferon ( ifn ) was approved by fda for use in 2001 .
monomethoxy - peg - linked interferon has a sustained serum for 4872 h compared to the native protein half - life of 79 h. the recommended dosage for standalone peg - intron therapy is 1 mg kg per week for 52 weeks on the same day of the week subcutaneously [ 74 , 75 ] .
interestingly , peginterferon -2a has a higher market share because peginterferon -2b is dosed on a body weight basis , whereas peginterferon -2a is not . as a result ,
nevertheless , some reports have suggested that peginterferon -ribavirin combination therapy has higher risks of neutropenia and thrombocytopenia than interferon -ribavirin combination therapy [ 87 , 88 ] , although both therapies have been reported to have similar side effect profiles .
pegvisomant ( somavert ) conjugate ( pfizer ) is used to treat acromegaly by preventing human growth hormone ( hgh ) binding to its receptor , because this binding activates the signal pathways that lead to igf-1 generation .
it is a genetically engineered analogue of hgh conjugated with peg which was approved for use in 2003 .
acromegaly is a chronic metabolic disorder caused when the pituitary gland generates excess hgh after epiphyseal plate closure .
gh receptor has two binding sites : ( i ) binds to site 1 and ( ii ) then to site 2 , inducing the functional dimerization of the hgh receptor .
pegvisomant inhibits the dimerization of the hgh receptor due to its increased affinity for site 1 of the hgh receptor . with eight amino acid mutations at the site , and by the substitution of position 120 glycine to arginine ,
overall , pegylation reduces the activity of the gh receptor antagonist . however , the 46 peg-5000 moieties added to pegvisomant prolongs its half - life and allow once - daily administration immunogenicity as the rate of clearance from the body are greatly reduced , making it an effective drug against acromegaly .
the patient can self - administer 10 mg of somavert daily with adjustments to the dosage of somavert in 5 mg increments depending on the elevation or decline of insulin growth factor-1 ( igf - i ) levels [ 91 , 92 ] .
however , because pegvisomant can increase glucose tolerance , care is embarked for the diabetes mellitus patients .
amgen 's pegfilgrastim ( neulasta ) is developed using filgrastim ( neupogen , amgen ) from nektar ( formerly shearwater ) pegylation technology .
the conjugate is formed by conjugating a 20 kda linear monomethoxy - peg aldehyde with granulocyte - colony stimulating factor g - csf .
neulasta is used to decrease febrile neutropenia manifested infection and was approved for use in 2002 .
the pegylation increases the protein serum half - life to 42 h compared to the serum half - life of 3.53.8 h for the unmodified g - csf .
therefore , the overall dose is reduced to a single cycle dose that is as effective as daily doses of native g - csf [ 9496 ] .
the recommended dose of neulasta is a single administration of 6 mg subcutaneously once - per - chemotherapy cycle and advised of not delivering it within 14 days before and 24 days after administration of chemotherapeutics .
krystexxa ( pegloticase ) by savient , a pegylated mammalian urate oxidase ( uricase ) was fda approved in 2010 .
the advantage of pegloticase over other standard treatments is the higher effectiveness in reducing gout tophi .
subcutaneous and intravenous injections of pegloticase in clinical trials showed production of antibodies [ 100102 ] .
however , it was found out that the antibodies produced were due to peg and not because of uricase .
furthermore , as hydrogen peroxide may be produced during the conversion of uric acid to allantoin by uricase , the long - term safety profile of pegloticase needs to be established . moreover , the transient local pain , slow absorption , and allergic reactions induced by subcutaneous injections of pegloticase were not observed after intravenous injections . however , intravenous injections are administratively inconvenient because self - administration is difficult and may have caused infusion reactions in multidose trials [ 103105 ] .
peg low - molecular - weight drug conjugates that entered the clinical trials are mostly from the camptothecin ( cpt ) family , namely , camptothecin itself , sn38 , and irinotecan ( table 1 ) .
although the first peg based products were anticancer agents , subsequently other peg therapeutics were developed and introduced for the treatment , for example , infectious diseases ( e.g. , peg - interferons ) , and age - related diseases including macular degeneration and arthritis .
moreover , building of these first generation compounds , the pipeline of polymer therapeutics in clinical development continues to grow .
pegamotecan is a product of enzon pharmaceuticals , inc . which is peg prodrug of the dna damaging agent .
the prodrug conjugate was conceived by coupling two molecules of cpt to a glycine - bifunctionalised 40 kda peg , yielding a drug loading of only approximately 1.7% ( w / w ) ( figure 11 ) .
the cpt prodrug was designed with the aim of doubling the loading capacity to increase the drug half - life in blood by pegylation and to stabilize cpt by acylation of the active lactone configuration of cpt .
the maximum tolerated dose of the conjugate in phase i trials was determined at 7000 mg m when administered for 1 h i.v .
phase i clinical studies underlined partial response in some cases and indicated that the conjugation to peg notably improved the pharmacokinetics of the compound .
the multiarm peg design was employed for the synthesis of nktr-102 by nektar therapeutics in which the drug was conjugated to a four - arm peg for the treatment of solid tumors . the plasma half - life
evaluated for nktr-102 in a mouse model taking into consideration the active metabolite sn-38 , released from irinotecan demonstrated prolonged pharmacokinetic profile with a half - life of 15 days compared to 4 h with free irinotecan . while in phase i clinical trial the safety , pharmacokinetic and antitumour activity of nktr-102 were evaluated on patients with advanced solid tumors , ( e.g. , breast , ovarian , cervical , and non - small - cell lung cancer ) .
interestingly , 13 patients showed significant antitumor activity and reduction of tumor size ranging from a 40% to 58% , while 6 patients showed minor response only . the cumulative sn38 exposure in patients treated with
the maximum tolerated dose ( mtd ) of the conjugate was to be 115 mg m and the toxicity was manageable ( diarrhea and not neutropenia is dose limiting ) . noteworthy , that the patients enrolled in this study had failed the prior anticancer treatments or have tumors with no standard treatments available .
multiple phase ii studies are ongoing with nktr-102 alone or in combination with cetuximab for the treatment of ovarian , breast , colorectal , and cervical cancer .
the multiarm peg - sn38 conjugate which recently entered phase i clinical trials ( year ) showed an increased drug loading of 3.7 wt.% with respect to pegamotecan .
sn38 is an active metabolite of irinotecan and has 100- to 1000-fold more cytotoxic activity in tissue cell cultures than irinotecan .
however , sn38 is practically insoluble in water and hence can not be administered intravenously .
the conjugate acts as a prodrug system with a half - life of 12.3 min of sn38 release in human plasma .
even though the drug release is quite rapid , the peg conjugate accumulates in tumor mass by epr effect .
in fact , ezn-2208 showed a 207-fold higher exposure to sn38 compared to irinotecan in treated mice , with a tumor to plasma drug concentration ratio increased over the time during the four - day - long pharmacokinetic and biodistribution studies .
especially , in mouse xenograft models of mx-1 breast , miapaca-2 pancreatic , or ht-29 colon carcinoma , treatment with the conjugate administered either as a single dose or multiple injections exhibited better results than irinotecan . however , recently enzon pharmaceuticals , inc . announced the discontinuance of its ezn-2208 clinical program , following conclusion of its phase ii study .
the decision was taken in light of evolving standards of care for the treatment of metastatic colorectal cancer ( mcrc ) .
the company planned to continue to enroll studies for the other peg - sn38 programs , which included a soon - to - be fully enrolled phase ii study in metastatic breast cancer , a phase i study in pediatric cancer , and a phase i study in combination with avastin ( bevacizumab injection ) in solid tumors .
early polymer therapeutics were developed as treatments for life - threatening diseases ( cancer and infectious diseases ) , the emerging products , and clinical development candidates are designed for a much broader range of diseases .
nktr194 , an opioid drug , being developed by nektar using their advanced polymer conjugate technology platform is presently in the preclinical stage . it has been designed to act peripherally without entering the cns so that the gastrointestinal bleeding , cns side effects , and cardiovascular risks associate with nsaids and cox-2 inhibitors used for treating moderate pains .
nktr-171 is another drug being designed by nektar to treat neuropathic pain without cns side effects is in the early research stage .
nktr-125 also in the research stage combines nektar 's pegylation technology with potent antihistamine to enhance its anti - inflammatory properties and minimize the side effects .
bax 855 , baxter 's most advanced longer - acting candidate , is schedule to move into phase i clinical trial in 2011 .
it is a pegylated fviii molecule , which utilizes nektar 's pegylation and baxter 's proprietary plasma and albumin - free platform .
preclinical animal studies have revealed that 1 injection of bax 855 per week imparted similar fviii levels as that of 3 injections of advate given approximately every alternate day .
in addition , nektar and baxter have collaborated to design long - acting clotting protein for hemophilia using nektar 's innovative pegylation and releasable linker conjugate technology .
convincingly , there are pioneering new approaches in research , for example , peg - recombinant human ha - degrading enzyme , ( rhuph20 ) developed to degrade ha ( it often accumulates in the tumor interstitium ) with the aim of decreasing interstitial tumor pressure and to enhance penetration of both low - molecular - weight and nanosized anticancer agents [ 111 , 112 ] .
peg is currently the only water soluble polymer , widely accepted in therapeutics with market approval for different drugs .
the reason for the wide utility of peg is because its decreased interaction with blood components ( low plasma protein binding ) and high biocompatibility .
pegylated drugs such as peginterferon and pegfilgrastim have proven their cost - effectiveness in the market , and products like pegvisomant and certolizumab pegol demonstrate that pegylated forms will be marketed regardless of the prior commercialization of their non - pegylated counterparts .
this trend indicates that the long - term prospects for the biopharmaceutical pegylated protein market are high . due to significant clinical advantages ,
. the therapeutic advantages of g - csf , ifn , and epo have been acknowledged , and pegylation offers an attractive means of replacing the original market , given the assumption that biosimilars will appear soon after patents expire .
the critical perspective of pegylation is now envisioned to achieve cellular targetability and therefore suitable chemistry is being explored .
advanced forms of pegs and their various architectures are designed and being introduced ( e.g. , hyper branched polyglycerols ) .
therefore , the importance of conducting comprehensive investigations on recently introduced potent peptides , proteins , oligonucleotides , and antibody fragments for pegylation can not be overemphasized . | poly(ethylene glycol ) ( peg ) is the most widely used polymer in delivering anticancer drugs clinically .
pegylation ( i.e. , the covalent attachment of peg ) of peptides proteins , drugs , and bioactives is known to enhance the aqueous solubility of hydrophobic drugs , prolong circulation time , minimize nonspecific uptake , and achieve specific tumor targetability through the enhanced permeability and retention effect .
numerous peg - based therapeutics have been developed , and several have received market approval .
a vast amount of clinical experience has been gained which has helped to design peg prodrug conjugates with improved therapeutic efficacy and reduced systemic toxicity .
however , more efforts in designing peg - based prodrug conjugates are anticipated . in light of this
, the current paper highlights the synthetic advances in peg prodrug conjugation methodologies with varied bioactive components of clinical relevance .
in addition , this paper discusses fda - approved pegylated delivery systems , their intended clinical applications , and formulations under clinical trials . |
post - traumatic diaphragmatic rupture ( ptdr ) has been well described after blunt ( 25% ) or penetrating ( 75% ) thoracoabdominal injuries .
traffic accidents that lead to non - penetrating traumas in lower chest or upper abdomen represent the main cause of diaphragmatic blunt injuries while injuries from knives , firearm or fractured ribs are mainly responsible for penetrating traumas .
it has been reported that 17% of patients after major blunt thoracoabdominal trauma and 1015% of patients with penetrating trauma will sustain diaphragmatic rupture .
approximately 4062% of the traumatic patients arrive delayed to the emergency department suffering from chronic diaphragmatic hernia .
laparoscopy has been proposed as a rational alternative to open surgery for chronic ptdr . regarding its role in the acute setting of blunt trauma
. herein , we present three patients who underwent laparoscopic treatment of ptdr , one of which was conducted early after the injury . a 42 year old man presented to the er with multiple injuries due to a car accident .
he complained of chest pain , dyspnea and he was tachypnoic ( 35 breaths per minute ) and febrile ( 38 c ) .
bilateral chest tubes were inserted . due to worsening respiratory distress the patient was intubated .
fast ( focused abdominal sonography for trauma ) was negative and the patient underwent whole body ct scan which revealed extensive injuries of the spinal cord and persistent right pneumothorax along with atelectasis of the ipsilateral lung , subtle left pneumothorax , bilateral lung contusions and subtle bilateral pleural effusion .
ct scan of the abdomen showed intrathoracic herniation of the gastric fundus the gastric body and the splenic flexure , spleen and part of the pancreatic tail through a 10 cm long discontinuity ( fig .
1 ) of the left hemidiaphragm displaced fracture of the manubrium of the sternum followed by rear displacement , cracked fractures of t1 , t2 , t3 vertebral bodies , fractures of the 1st , 2nd , 3rd and 4th thoracic rib ambilaterally and of the 5th , 6th and 7th rib on the left side and parenchymal contusion of about 3 cm diameter in vii liver segment .
cervical brace and he was transferred to the intensive care unit ( icu ) . due to severe bilateral lung injury the operation to treat the diaphragmatic rupture was initially postponed in order to obtain adequate and stable ventilation . his respiratory function was improved during the next 5 days and for its further improvement treatment of diaphragmatic rupture was considered necessary .
the patient was guided to the operating theater the 6th day after the injury . during laparoscopy , a sizeable rupture of the left hemidiaphragm with prolapse of the gastric body , fundus , part of the spleen , the left colonic flexure and part of the pancreatic tail
the prolapsed organs were reduced to the abdominal cavity and the diaphragmatic lesion was repaired with the use of non - absorbable sutures ( fig .
the respiratory function of the patient was significantly improved during the following days and the patient underwent an open reduction and posterior fixation of the c5c7 as well as osteosynthesis of the right knee fracture , the 14th day after the injury .
the patient had a long postoperative recovery due to the orthopedic condition and was discharged 30 days after the injury .
eight months after the operation the patient is asymptomatic without clinical evidence of recurrence . a 66 year old male presented with continuous epigastric pain after a 2-month hospitalization following a serious injury in a traffic accident . immediately after the injury
the patient had been diagnosed with right acetabular fracture , subluxation of the hip joint and a ct scan of thorax had revealed fracture of the 8th10th rib with limited ambilateral pleural effusion without evidence of diaphragmatic rupture . at physical examination
a new ct scan of the chest and the abdomen revealed the presence of small intestine 's loups inside the right hemithorax .
the patient was guided to the operating room and he underwent laparoscopy during which a sizeable rupture of the right hemidiaphragm was evident with prolapse of the small intestine .
the prolapsed intestine was reduced to the peritoneal cavity , pleural effusion was aspirated and the diaphragmatic lesion was repaired with clips and inabsorbable sutures .
the patient had a normal postoperative course and he was discharged the 5th postoperative day .
a 53 year old female with a history of car accident 4 years ago , presented with a diaphragmatic rupture .
the clinical imaging results revealed rupture of the left hemidiaphragm with prolapse of the omentum and part of the large intestine .
the patient underwent a laparoscopic repair of the diaphragmatic rupture during which prolapse of the omentum and part of the transverse colon through a 5 cm 5 cm lesion of the right diaphragm was evident .
abdominal organs where reduced to the peritoneal cavity after lysis of the adhesions with the diaphragm and pleura .
bleeding from the spleen was caused which was controlled with hemostatic pad ( surgicell ) .
the patient had an uneventful recovery and discharged from the hospital on the 6th postoperative day .
a 42 year old man presented to the er with multiple injuries due to a car accident .
he complained of chest pain , dyspnea and he was tachypnoic ( 35 breaths per minute ) and febrile ( 38 c ) .
bilateral chest tubes were inserted . due to worsening respiratory distress the patient was intubated . fast ( focused abdominal sonography for trauma ) was negative and the patient underwent whole body ct scan which revealed extensive injuries of the spinal cord and persistent right pneumothorax along with atelectasis of the ipsilateral lung , subtle left pneumothorax , bilateral lung contusions and subtle bilateral pleural effusion .
ct scan of the abdomen showed intrathoracic herniation of the gastric fundus the gastric body and the splenic flexure , spleen and part of the pancreatic tail through a 10 cm long discontinuity ( fig .
1 ) of the left hemidiaphragm displaced fracture of the manubrium of the sternum followed by rear displacement , cracked fractures of t1 , t2 , t3 vertebral bodies , fractures of the 1st , 2nd , 3rd and 4th thoracic rib ambilaterally and of the 5th , 6th and 7th rib on the left side and parenchymal contusion of about 3 cm diameter in vii liver segment .
cervical brace and he was transferred to the intensive care unit ( icu ) . due to severe bilateral lung injury the operation to treat the diaphragmatic rupture was initially postponed in order to obtain adequate and stable ventilation . his respiratory function was improved during the next 5 days and for its further improvement treatment of diaphragmatic rupture was considered necessary .
the patient was guided to the operating theater the 6th day after the injury . during laparoscopy , a sizeable rupture of the left hemidiaphragm with prolapse of the gastric body , fundus , part of the spleen , the left colonic flexure and part of the pancreatic tail
the prolapsed organs were reduced to the abdominal cavity and the diaphragmatic lesion was repaired with the use of non - absorbable sutures ( fig .
the respiratory function of the patient was significantly improved during the following days and the patient underwent an open reduction and posterior fixation of the c5c7 as well as osteosynthesis of the right knee fracture , the 14th day after the injury .
the patient had a long postoperative recovery due to the orthopedic condition and was discharged 30 days after the injury .
a 66 year old male presented with continuous epigastric pain after a 2-month hospitalization following a serious injury in a traffic accident . immediately after the injury
the patient had been diagnosed with right acetabular fracture , subluxation of the hip joint and a ct scan of thorax had revealed fracture of the 8th10th rib with limited ambilateral pleural effusion without evidence of diaphragmatic rupture . at physical examination
intestinal sounds were noticeable upon auscultation of the right lower hemithorax . a new ct scan of the chest and the abdomen revealed the presence of small intestine 's loups inside the right hemithorax .
the patient was guided to the operating room and he underwent laparoscopy during which a sizeable rupture of the right hemidiaphragm was evident with prolapse of the small intestine .
the prolapsed intestine was reduced to the peritoneal cavity , pleural effusion was aspirated and the diaphragmatic lesion was repaired with clips and inabsorbable sutures .
the patient had a normal postoperative course and he was discharged the 5th postoperative day .
a 53 year old female with a history of car accident 4 years ago , presented with a diaphragmatic rupture .
the clinical imaging results revealed rupture of the left hemidiaphragm with prolapse of the omentum and part of the large intestine .
the patient underwent a laparoscopic repair of the diaphragmatic rupture during which prolapse of the omentum and part of the transverse colon through a 5 cm 5 cm lesion of the right diaphragm was evident .
abdominal organs where reduced to the peritoneal cavity after lysis of the adhesions with the diaphragm and pleura .
bleeding from the spleen was caused which was controlled with hemostatic pad ( surgicell ) .
the patient had an uneventful recovery and discharged from the hospital on the 6th postoperative day .
it is estimated that trauma is the major cause of acquired diaphragmatic hernias ( dh ) .
the rupture is mostly left - sided ( 80% ) vs right - sided ( 15% ) vs bilateral ( 5% ) .
the major challenge for successful management of a ptdr is the early diagnosis which can often be excessively delayed , in cases where the existence of diaphragm damage has not been established in the acute period of a trauma .
it is quite common for the missed dh to present months or even years after the injury with a high risk of life - threatening complications such as visceral perforation or strangulation as well as cardiovascular and respiratory compromise . for the timely diagnosis of ptdr high index of suspicion
is needed along with deliberate use of computerized tomography in patients with moderated to severe thoracoabdominal trauma . despite the technological evolution and the great advances in imaging ,
ct scan may miss 3050% of the diaphragmatic rupture during the initial assessment . on the contrary ,
both thoracoscopic and laparoscopic approaches have been found to have both excellent diagnostic and promising therapeutic benefits .
the sensitivity and the specificity almost climb up to 100% and they offer the benefit of simultaneous treatment if a diaphragmatic rupture is diagnosed . whether laparoscopy or thoracoscopy is more appropriate in the acute phase of ptdr is a matter of debate and could be also influence by the expertise of the treating surgeon .
a significant limitation of thoracoscopy in the acute trauma is that it can not exclude intraperitoneal injury which is a significant concern in these patients .
laparoscopy gives the opportunity for an integrated exploration of the whole diaphragm and the peritoneal cavity .
the left hemidiaphragm can be completely evaluated by positioning the patient in a steep reverse trendelenburg position while using a 45-degree laparoscope with a right lateral tilt .
the right hemidiaphragm is slightly more difficult to visualize completely , thus an additional port may be required to retract the right lobe of the liver . in case of ptdr with laparoscopy
it is possible to check the viability of the prolapsed organs and control directly any bleeding .
we generally perform primary repair of diaphragmatic hernias without the use of mesh unless the risk of subsequent recurrence is high i.e. in large defects where the diaphragmatic parts can not be approximated , when there is significant tension after primary closure or when the approximated tissue appears weak . in these patients the use of a prosthetic mesh the benefit of the mesh outweighs the risk of infection and erosion or adjacent organs .
the indications of laparoscopy in acute blunt abdominal trauma have been controversial in the literature .
laparoscopy may play a role in patients with blunt abdominal trauma , who are not bleeding , but have unclear findings on ct and the patient 's clinical status is only suspicious or not assessable ( comatose patients ) because these patients may have unrecognized injuries that prompt surgical intervention . on the other hand , the society of american gastrointestinal and endoscopic surgeons , states that diagnostic laparoscopy is contraindicated when there is obvious intra - abdominal injury .
this has been challenged by many authors that described successful laparoscopical repairs of injuries to virtually every organ ; however everyone agrees that if laparoscopy is to be employed in the acutely injured patient , high degree of expertise and skills are necessary along with careful patient selection .
the reported benefits of laparoscopy in trauma is avoiding unnecessary ( non - therapeutic ) laparotomy , improve operative visualization of diaphragm , reduced the incidence of systemic inflammatory response syndrome often seen in multiple injured patients , decrease postoperative pain , respiratory complications and rates of incisional hernia or postoperative ileus and allow faster recovery . in our first case
, the multidisciplinary team of the surgeon , thoracic surgeon , anesthetist , intensive care physician and radiologist decided that the patient was at higher risk due to his respiratory instability than due to a potential organ ischemia .
therefore surgery was postponed until the 6th day after the injury and by that time his respiratory function was significantly improved and pneumothoraces had been resolved
. if there was continuing air leak from lung parenchyma the patient would be at risk for tension pneumothorax with the clamping of the chest tube but this was not the case in our patient . if there was difficulty to ventilate the patient hemodynamic instability indicating tension pneumothorax we would unclamp the chest tube and convert the operation immediately .
we believe that the effective communication between surgeons , the intensive care unit physicians and the anesthetist was critical in order to select the optimal time point for surgical intervention , involve the surgeons with the necessary laparoscopic expertise to the management of the patient and offer him the benefits of minimally invasive surgery .
moreover , it may offer the benefits of minimally invasive surgery during the acute phase of injury in highly selected patients .
for this study we have received no reimbursements , fees , funding , or salary from an organization that may in any way gain or lose financially from the publication of this manuscript , either now or in the future .
we hold no stocks or shares in an organization that may in any way gain or lose financially from the publication of this manuscript , either now or in the future .
there any no non - financial competing interests ( political , personal , religious , ideological , academic , intellectual , commercial or any other ) to declare in relation to this manuscript .
written informed consent was obtained from the patients for publication of these case reports and any accompanying images / videos .
a copy of the written consents is available for review by the editor of this journal .
s.x . contributed in the design of the manuscript , k.l . contributed in the collection of the data , creation and narration of the videos and design of the manuscript , a.a
participated in the design and coordination and helped to draft the manuscript , g.c . reviewed the manuscript and was the operating surgeon
all authors read and approved the final manuscript.key learning pointslaparoscopy can be successfully used in the treatment of chronic post - traumatic diaphragmatic hernia.laparoscopy can be used in the acute or subacute phase of diaphragmatic injury in carefully selected patients by experienced surgeons .
laparoscopy can be successfully used in the treatment of chronic post - traumatic diaphragmatic hernia.laparoscopy can be used in the acute or subacute phase of diaphragmatic injury in carefully selected patients by experienced surgeons .
laparoscopy can be successfully used in the treatment of chronic post - traumatic diaphragmatic hernia .
laparoscopy can be used in the acute or subacute phase of diaphragmatic injury in carefully selected patients by experienced surgeons .
laparoscopy can be successfully used in the treatment of chronic post - traumatic diaphragmatic hernia.laparoscopy can be used in the acute or subacute phase of diaphragmatic injury in carefully selected patients by experienced surgeons .
laparoscopy can be successfully used in the treatment of chronic post - traumatic diaphragmatic hernia .
laparoscopy can be used in the acute or subacute phase of diaphragmatic injury in carefully selected patients by experienced surgeons .
| introductionposttraumatic diaphragmatic rupture ( ptdr ) is a rare complication of thoracoabdominal injuries . in the emergency phase
, it is generally treated via wide laparotomy .
the laparoscopic approach is controversial and it is reserved for the chronic type of ptdr .
herein we present three cases of laparoscopic treatment of ptdr , one of which was conducted early after the injury.presentation of casethe patients age was 42 , 66 and 53 years and the time from the injury until the operation 1 week , 2 months and 4 years , respectively .
hernia involved the left hemidiaphragm in two patients and the right hemidiaphragm in the second patient .
prolapsing viscera were the omentum / stomach / spleen , the small intestine and the omentum / large bowel , respectively .
the ptdr was diagnosed right after the injury of the first patient but its treatment was postponed until the fourth day of hospitalization because of severe respiratory distress due to bilateral pneumothorax , flail chest and extended bilateral lung contusions .
all patients underwent laparoscopic operation and correction of the hernia with the use of non - absorbable sutures or endoclips in two patients .
there were no serious intra- or postoperative complications and the patients were discharged 30 , 5 , 6 days after the operation . after a period of 1 , 8 and 9 years , respectively the patients remain without clinical evidence of recurrence.discussiontrauma is the major cause of acquired diaphragmatic hernias.conclusionlaparoscopy is an attractive approach for the management of chronic ptdr .
moreover , it may offer the benefits of minimally invasive surgery during the acute phase of injury in highly selected patients . |
in 2013 , serum from domestic animals was collected from 12 different regions of kosovo .
samples were collected from 933 cattle and 153 sheep from 9 and 5 different regions , respectively , in kosovo ; the information ( location , specimen , date ) were recorded .
ten milliliters of blood was taken from jugular venipuncture , and serum was separated by centrifugation .
we tested cattle and sheep serum for neutralizing antibodies using the virus microneutralization assay , described for phleboviruses ( 7 ) in parallel with tosv strain mrs2010 - 4319501 and sfsv strain sabin .
serum samples were diluted from 1:10 to 1:80 into 96-well plates with a volume of 50 l . except for controls
, we added a 1,000 50% tissue culture infective dose in a 50-l volume . for controls
, we added 50 l of eagle 's minimum essential medium enriched with 5% fetal bovine serum , 1% penicillin
the plates were incubated at 37c . after 1 h , a 100 l suspension of 2 10 vero cells / ml was added and incubated at 37c in the presence of 5% co2 .
the microplates were read under an inverted microscope after 5 days for tosv and 6 days for sfsv , and the presence ( neutralization titer at 10 , 20 , 40 , and 80 ) or absence ( no neutralization ) of cytopathic effect was noted .
cutoff value for positivity was set at titer > 20 ( 8) . in 2014 , a total of 267 sand flies were trapped and identified .
global rates of tosv neutralizing antibodies were in the same magnitude in cattle ( 5.14% ) and sheep ( 1.96% ) in kosovo ( table ; figure ) .
results observed in pej were congruent with recent findings obtained with human serum ; in both cases , tosv circulation appears limited ( 6 ) .
although sfnv and tosv belong to the same serocomplex , they can be distinguished by using neutralization ; therefore , the high rate ( 27.9% ) of sfnv neutralizing antibodies in humans reported in the 1970s ( 5 ) most likely reflects circulation of sfnv rather than tosv , a finding that did not differ from our results and recent results reported by others ( 6 )
. rates of tosv neutralizing antibodies were highest in southwestern regions of kosovo , whereas negative results were obtained in the pej area ( pej , dean , junik ) .
although we did not detect viral rna in the 267 tested sand flies , tosv was reported in croatia and greece ( 10 , ) , and a new phlebovirus was described in albania , croatia , and bosnia - herzegovina ( 9 ; n. ayhan et al .
geographic distribution of rates of neutralizing antibodies against sfsv and tosv in cattle and sheep , kosovo , 2013 .
results for cattle ranged from 24.0% to 78.2% ( mean 58.5% ) ; results for sheep were lower , ranging from 2.7% to 56.7% ( mean 22.2% ) . for sheep , 4 of the 5 regions
had rates of 14.0%56.7% ; the rate was much lower ( 2.7% ) in gjakov .
few data are available for comparison ; 9.6% of tested human serum contained sfsv neutralizing antibodies in the 1970s ( 5 ) .
although no direct evidence ( molecular detection of viral rna or virus isolation ) exists of sfsv or another sfsv - like virus in kosovo or neighboring countries , our results imply the presence of either sfsv or an sfsv - related virus in kosovo .
we consider it valid to use sfsv as a surrogate for all sfsv - related viruses ( sandfly fever turkey virus , sandfly fever cyprus virus ) because amino acid distances observed between the proteins that elicit neutralizing antibodies ( gn and gc ) are well within the acceptable range , ( i.e. , < 5% different for sfsv and sfsv - related viruses ) ( 7 ) .
recent seroprevalence studies showed high seroprevalence rates for sfsv neutralizing antibodies in dogs in portugal ( 50.8% ) ( 7 ) , tunisia ( 38.1%59.2% depending on the region ) ( 8) , and greece ( 71.9% ) and cyprus ( 60.2% ) ( 11 ) .
our results are congruent with data from continental greece , with rates in the same order of magnitude ( 12 ) .
all these findings verify the high prevalence of sfsv in the mediterranean basin . because of the nature of this study , the serum was collected and stored under conditions that prevented attempts to detect viral rna and isolate viral strains .
sfsv remains an important human pathogen , as recently highlighted in africa and turkey ( 12,13 ) .
published data about the distribution of sand flies and species identification are old and scarce ; phlebotomus papatasi , p. perfiliewi , p. neglectus , and p. tobbi sand flies have been documented in kosovo and neighboring countries with similar environmental and climatic conditions ( 14,15 ) . in our study , p. major sand flies dominated ( 81% ) , followed by p. tobbi ( 11.2% ) , p. simici ( 3.7% ) , p. papatasi ( 1% ) , and other species ( 3.1% ) .
the regional prevalence differences might have resulted from geographic and climatic characteristics of the region that could affect the vector sand fly species distribution and population size .
our results confirm that tosv and sfsv , or an sfsv - like virus , are circulating in several regions of kosovo , which indicates that humans are exposed to these viruses .
this finding merits confirmation through seroprevalence studies and initiation of systematic testing for tosv and sfsv real - time reverse transcription pcr for febrile illness and central nervous system infections during the warm season . | toscana and sandfly fever sicilian viruses ( tosv and sfsv , respectively ) , both transmitted by sand flies , are prominent human pathogens in the old world . of 1,086 serum samples collected from cattle and sheep during 2013 in various regions of kosovo ( balkan peninsula ) , 4.7% and 53.4% had neutralizing antibodies against tosv and sfsv , respectively . |
reconstruction of composite oromandibular defects ( comd ) is a challenging task as it involves different tissues , needs large size flap for both lining and cover , and requires tridimensional inset of flap to maintain contour and function .
the extensive composite or en bloc defects as described by daniel et al .
the bone and the mucosal lining are reconstructed with free fibula osteocutaneous flap ( ffocf ) in all these patients and the second free flap is used for the external lining .
we present two cases in which the external skin defect was managed with a free flap based on a perforator from the proximal part of the ffocf .
both the patients were cases of cancer lower alveolus with t4 stage and involvement of skin .
the intraoperative details regarding the bone defect , external skin requirement and their locations are shown in table 1 .
details of patient , bone defect and skin defect dimensions the resection was done by the head and neck oncosurgery team .
both cases were planned for middle one - third segmental mandibulectomy and bilateral modified neck dissection .
the skin excision was done based on clinical examination , intra - op findings and frozen section reports . the ffocf is harvested under tourniquet control by the anterolateral approach .
we do preoperative hand - held doppler examination for locating the perforators . for composite defects
, we design ffocf with a larger skin paddle with more width on the proximal aspect as this skin flap usually will come for the external cover .
we start harvest simultaneously with the resection team , and do the anterior part of the dissection .
once the final excision markings are done by the resection team , we modify the skin paddle and make the posterior incision accordingly .
if the tentative excision plan shows that the combined internal and external defect is larger than the fibula skin paddle , then we plan for a second free / pedicled flap .
time and details of anastomosis this patient was a case of cancer lower alveolus crossing midline .
the patient had a contour deformity on the right side face post chemotherapy [ figure 1a and b ] .
the resection included the mandible excision from right ramus to left body , b / l type iii mnd and the involved skin [ figure 2 ] . during flap harvest ,
it had an additional perforator in the proximal part ( upper one - third of leg ) , 10 cm from the head of fibula , which was dissected separately for about 6 cm in length .
the perforator was harvested with a cuff of soleus muscle and the additional time required was 20 min .
this pedicle could not be dissected up to the origin since it was deep in the region of the popliteal / tibio - peroneal trunk .
after the bone fixation [ figure 3 ] and intraoral inset , we attempted dedeepithelisation for the external cover .
hence , the paddle was divided , insetted in appropriate position [ figure 4b ] and a separate set of anastomosis done based on the perforator [ figure 5 ] .
pre - op ( a ) frontal view , ( b ) worm 's eye view intra - op : ( a ) attempted deepithelisation , intra - op ; ( b ) external skin paddle with the pedicle intra - op picture showing anastomosis : a1 v1 , bone and intraoral paddle ; a2 v2 , external paddle this patient had the disease predominant on the left side but crossing the midline [ figure 6a and b ] .
this patient had an external skin defect in the anterior and submental region and the bone defect from left ramus to right body [ figure 7a and b ] .
since the defect was in different planes , we expected a difficult inset with the same flap , and hence dissected the perforator of the proximal skin paddle . in this case
but a soleal perforator was identified 8 cm from the head of fibula and dissected up to its origin from the posterior tibial artery .
after the bone fixation and the intraoral inset , the remaining skin paddle along with this perforator was divided [ figures 8 and 9 ] .
this was later anastomosed on the same side of the primary anastomosis [ figure 10 ] .
pre - op : ( a ) ap view , pre - op ; ( b ) mouth open view showing the lesion intra - op : ( a ) external skin defect , ( b ) bone defect intra - op neomandible fixed and intraoral inset divided proximal skin paddle with the pedicle intra - op anastomosis : a1 v1a v1b , bone and intraoral paddle ; a2 v2 , external paddle all the four free flaps survived completely .
the contour deformity in patient 1 had also been corrected by the skin paddle used for external cover [ figure 11a ] .
donor site graft take was 100% and the patients were mobilised on pod-5 with support .
the flaps settled well [ figures 11b d , 12a and b ] and both patients were discharged on day 10 .
patient 1 received adjuvant post - op radiotherapy ( rt ) as per the schedule and there was minimal reduction in flap volume [ figure 11e ] .
the absence of facial muscles which maintain the skin turgor , the effect of post - op rt and reconstruction of the various aesthetic subunits of face with a single paddle are the reasons for the contour deformity in the late post - op . but as far such large defects are concerned , these results are definitely considered to be acceptable .
post - op : ( a ) immediate , post - op ; ( b ) ap view , post - op ; ( c ) mouth open showing intraoral and external paddle , post - op ; ( d ) worm 's eye view ; ( e ) post rt post - op : ( a ) ap view showing intraoral paddle ; ( b ) post - op showing outer paddle
both cases were planned for middle one - third segmental mandibulectomy and bilateral modified neck dissection .
the skin excision was done based on clinical examination , intra - op findings and frozen section reports . the ffocf is harvested under tourniquet control by the anterolateral approach .
we do preoperative hand - held doppler examination for locating the perforators . for composite defects
, we design ffocf with a larger skin paddle with more width on the proximal aspect as this skin flap usually will come for the external cover .
we start harvest simultaneously with the resection team , and do the anterior part of the dissection .
once the final excision markings are done by the resection team , we modify the skin paddle and make the posterior incision accordingly . if the tentative excision plan shows that the combined internal and external defect is larger than the fibula skin paddle , then we plan for a second free / pedicled flap .
the patient had a contour deformity on the right side face post chemotherapy [ figure 1a and b ] .
the resection included the mandible excision from right ramus to left body , b / l type iii mnd and the involved skin [ figure 2 ] .
it had an additional perforator in the proximal part ( upper one - third of leg ) , 10 cm from the head of fibula , which was dissected separately for about 6 cm in length .
the perforator was harvested with a cuff of soleus muscle and the additional time required was 20 min .
this pedicle could not be dissected up to the origin since it was deep in the region of the popliteal / tibio - peroneal trunk .
after the bone fixation [ figure 3 ] and intraoral inset , we attempted dedeepithelisation for the external cover .
hence , the paddle was divided , insetted in appropriate position [ figure 4b ] and a separate set of anastomosis done based on the perforator [ figure 5 ] .
pre - op ( a ) frontal view , ( b ) worm 's eye view intra - op : ( a ) attempted deepithelisation , intra - op ; ( b ) external skin paddle with the pedicle intra - op picture showing anastomosis : a1 v1 , bone and intraoral paddle ; a2 v2 , external paddle
this patient had the disease predominant on the left side but crossing the midline [ figure 6a and b ] .
this patient had an external skin defect in the anterior and submental region and the bone defect from left ramus to right body [ figure 7a and b ] .
since the defect was in different planes , we expected a difficult inset with the same flap , and hence dissected the perforator of the proximal skin paddle . in this case
but a soleal perforator was identified 8 cm from the head of fibula and dissected up to its origin from the posterior tibial artery .
after the bone fixation and the intraoral inset , the remaining skin paddle along with this perforator was divided [ figures 8 and 9 ] .
this was later anastomosed on the same side of the primary anastomosis [ figure 10 ] .
pre - op : ( a ) ap view , pre - op ; ( b ) mouth open view showing the lesion intra - op : ( a ) external skin defect , ( b ) bone defect intra - op
neomandible fixed and intraoral inset divided proximal skin paddle with the pedicle intra - op anastomosis : a1 v1a v1b , bone and intraoral paddle ; a2 v2 , external paddle
the contour deformity in patient 1 had also been corrected by the skin paddle used for external cover [ figure 11a ] .
donor site graft take was 100% and the patients were mobilised on pod-5 with support .
the flaps settled well [ figures 11b d , 12a and b ] and both patients were discharged on day 10 .
patient 1 received adjuvant post - op radiotherapy ( rt ) as per the schedule and there was minimal reduction in flap volume [ figure 11e ] .
the absence of facial muscles which maintain the skin turgor , the effect of post - op rt and reconstruction of the various aesthetic subunits of face with a single paddle are the reasons for the contour deformity in the late post - op .
but as far such large defects are concerned , these results are definitely considered to be acceptable .
post - op : ( a ) immediate , post - op ; ( b ) ap view , post - op ; ( c ) mouth open showing intraoral and external paddle , post - op ; ( d ) worm 's eye view ; ( e ) post rt post - op : ( a ) ap view showing intraoral paddle ; ( b ) post - op showing outer paddle
reconstruction of the oromandibular defects by free flaps has superior results both functionally and aesthetically compared to pedicle flaps .
though most of the defects can be covered with a single free flap , multiple free flaps in head and neck reconstruction have been described for indications such as increased soft tissue requirement , need for inset in different planes and requirement of tissues of different texture and thickness to optimally replace missing tissues.[68 ] in these cases of multiple free flaps , the ffocf is used for the bone defect and the inner lining . for the external cover , the flaps that are described are alt , free radial forearm , rectus abdominus flap and lateral arm flap .
advocate alt compared to others because of the ease of simultaneous harvest , low donor site morbidity , possibility of primary closure and the advantage of primary thinning .
there are many reports regarding the reliability of the skin paddle of the fibula free flap .
but now it has been established anatomically and clinically that the skin paddle of the free fibula osteocutaneous is reliable .
the skin component of the flap is supplied predominantly by septocutaneous perforators in the lower two - thirds of leg . according to wei et al .
most of these perforators are concentrated between the mid one - third and lower one - third junction .
the study by yu et al . has also shown that these distal perforators are mostly septocutaneous and are consistently present in the third quarter of the fibula . in the proximal one - third of the leg , the skin is usually supplied by musculocutaneous perforators .
the incidence of these musculocutaneous perforators is variable . in the anatomical study by jones et al .
the incidence of the musculocutaneous perforators was 67% , and the clinical analysis of the perforators by yu et al .
has shown the incidence of these musculocutaneous perforators to be as high as 84% . but none of these studies has mentioned the exact location or reference points for these perforators as these are not commonly used in free fibula flap.the origin of the musculocutaneous perforators can be from peroneal artery , popliteal artery or posterior tibial artery .
separate anastomosis of these perforators to salvage the flap has been reported in the literature .
but complete harvest of the skin paddle as a free flap and using for comd has not been mentioned .
the other methods for using the same ffocf for lining and cover are deepithelisation and division of skin paddle based on perforators .
the disadvantages of deepithelisation are part of the flap is wasted while turning out the skin paddle , extra time and altered contour at the suture line . moreover ,
the survival of the distal part is dependent on the quality of the proximal perforator , the depth of deepithelisation and the thickness of the dermis . in cases where the flap has two or more perforators ,
the skin paddle can be divided based on separate perforators for lining and cover . in such cases , preserving this proximal perforator may limit the actual pedicle length and there is a possibility of traction on the pedicle . in our experience of more than 200 free fibula flaps for composite defects ,
we have found in few cases that location of these perforators may not be suitable for a divided paddle providing inner lining and outer cover .
hence , in cases where a large comd is expected , during harvest of the fibula , the perforator in the proximal part of the ffocf is dissected till its origin or the maximum possible length .
we harvest with a cuff of muscle to safeguard the perforator . after bone fixation and intraoral inset ,
the options for the external cover using the same fibula osteocutaneous flap are : ( i ) deepithelisation , ( ii ) dividing the skin paddle based on different perforators for lining and cover and ( iii ) complete division and thus converting into a free flap .
deepithelisation is done when there is ( i ) a single good perforator , ( ii ) adequate length of flap for deepithelisation and external cover , and ( iii ) pliable skin quality for turning the flap without compression of the perfortor .
the criteria for division of the skin paddle based on the perforators are the presence of two or more perforators and the location of the perforator should be appropriate for division . if the lie of the perforators is not appropriate and the flap not suitable for deepithelisation , then the remaining flap could be divided and converted into a free flap based on the perforator . the flap based on the perforator
should be divided once the intraoral inset is completed or the lining defect is appropriately calculated .
this skin paddle is insetted for the outer cover and a separate set of anastomosis is performed .
the technique of converting the attached skin paddle into a perforator - based free flap gives more leverage for placing the pedicle , allows better lie of the flap and a smooth contour at the flap native skin junction . in both our cases ,
hence , the inner lining required is also more . at the same time , the external defect was in a different plane , hence becomes difficult to turn the flap and cover .
moreover , there was no possibility of dividing based on perforators as there was only one distal perforator from the peroneal artery .
in patient 1 , the proximal perforator was dissected , assuming it was from the peroneal artery .
then finally , an intraoperative decision was made to convert it into a free flap .
the experience from the first case made us to cautiously dissect the proximal musculocutaneous perforator in patient 2 .
both the perforator 's pedicles had one artery and two veins of size 1.5 mm and 2 mm , respectively , and were suitable for anastomosis .
the vascular status of the lower limb is assessed by clinical examination , and the status of the dorsalis pedis and posterior tibial artery pulsations in both limbs are documented .
the perforators over the lateral aspect of the leg should be marked with doppler preoperatively .
but until the time of the flap elevation , it will not be possible to differentiate whether these are musculocutaneous or septocutaneous perforators .
but doppler examination gives an idea and confidence to the surgeon so that extra care can be taken during the dissection of the corresponding regions .
angiography or 3d ct for assessing vascularity localisation of perforators is not done routinely . however , in future , these modalities could be used for planning such cases preoperatively .
this method of reconstruction using two free flaps from the fibula osteocutaneous unit has the advantage of having the same donor site and reduction in overall operative time , compared to a double free flap from two different sites .
basically it is two free flaps : o0ne from the peroneal artery and the other based on the perforator , but are harvested together and can be utilised as needed [ figure 13 ] .
the contour and the tissue utilisation are better when compared to the technique of deepithelisation .
the reported incidence of these proximal musculocutaneous perforators can be as high as 84% and furthers favours the plan of identification and dissection of these perforators .
the perforators are also of adequate size suitable for anastomosis . these types of cases with such large defects are infrequently met with . in such instances ,
dissection of the proximal perforator and the idea of double free flap from a single free fibula osteocutaneous unit will provide an additional tool in the reconstructive armamentarium of the surgeon .
diagrammatic representation of the two free flaps from single ffocf the disadvantage of this technique is that it can not be applied to all cases where a double free flap is required because we might not have a proximal perforator in all patients .
moreover , the size , length and the exact location of these perforators have not been reported in the literature . in cases where a large comd is anticipated
, the surgeon should harvest a larger proximal skin paddle and take care to dissect the proximal perforator , whenever present , up to an adequate length to be used if needed . if the expected intraoral mucosal defect and the external skin defect are larger than the designed fibula skin paddle , then a second free / pedicled flap should be planned .
this novel method of doing a double free flap from a single free ffocf unit should be considered in patients where double free flaps from different sites are planned .
this reduces the overall operating time and saves another donor site , in case that may be required in the future . | in the past two decades , the advancement in the microsurgical techniques has revolutionised the reconstruction of post - oncological head and neck defects .
free fibula osteocutaneous flap ( ffocf ) has been considered as the treatment of choice by many for mandible reconstruction .
the improvement in the surgical resection and adjuvant treatment has improved the survival rates even in patients with advanced cancer . simultaneously the reconstruction is addressed towards more functional and aesthetic aspects to improve the quality of life in these patients . in this respect ,
a double free flap is advocated in certain cases of extensive composite oromandibular defects ( comds ) .
but in our institute , we have managed two such cases of extensive comd with a single ffocf unit fibula bone with a skin paddle for inner lining and a perforator - based skin paddle from the proximal part of the ffocf unit , anastomosed separately for outer cover .
compared to two separate free flaps , this method has the advantage of single donor site and reduction in reconstruction time . though the technique of divided paddle , deepithelisation and supercharging has been mentioned for ffocf , no such clinical cases of two free flaps from a single ffocf unit have been mentioned in the literature . |
pompe disease is characterized by a deficiency of the glycogen - degrading lysosomal enzyme , acid alpha - glucosidase ( gaa ) , . in classic infantile - onset pompe disease ( iopd ) ,
glycogen deposition in cardiac , skeletal , and respiratory muscles causes severe cardiomyopathy , hypotonia , and respiratory failure , leading to death by 1 year of age if not treated . in those with onset during childhood or adulthood ( late - onset pompe disease [ lopd ] ) ,
glycogen deposition is mainly in skeletal and respiratory muscles , causing progressive limb - girdle myopathy and respiratory insufficiency , .
enzyme replacement therapy ( ert ) with recombinant human gaa ( alglucosidase alfa ) has been shown to improve walking distance and stabilize pulmonary function in lopd patients , , and to improve survival and motor outcomes in classic iopd patients .
studies have examined the effect of individual mutations in the gaa gene and other genetic factors , with one gene of interest encoding angiotensin converting enzyme ( ace ) .
ace catalyzes the conversion of angiotensin i to the active form , angiotensin ii ( a potent vasoconstrictor ) , and degrades bradykinin ( a potent vasodilator ) .
half of the variation in human ace activity is attributable to an insertion / deletion ( i / d ) marker allele in intron 16 of the ace gene , , , .
an insertion ( i allele ) of an alu repeat results in lower ace activity , whereas the absence of the insertion ( or deletion , d allele ) results in higher activity .
the ace i / d polymorphism has been linked to physical performance and exercise duration , and it has been reported that the i allele is associated with a predominance of slow - twitch muscle fibers ( type i ) and the d allele with fast - twitch muscle fibers ( type ii ) , . taken together , it has been hypothesized that differences in muscle - fiber type and vasodynamics may impact the skeletal muscle response to ert .
the d / d genotype in 14 lopd patients was found to be associated with higher serum creatine kinase levels at diagnosis , earlier onset of disease , and the presence of muscle pain . in a larger cohort of pompe patients ( n = 85 ) , individuals with the d / d ace genotype presented with an earlier onset of disease and muscle pain , confirming the previous observation .
the relationship between ace genotype and clinical parameters in a cohort of lopd patients who received biweekly infusions of alglucosidase alfa for > 2 years also was reported .
notably , i / i genotype patients had significantly greater muscle mass measured by quantitative magnetic resonance imaging ( mri ) .
muscle strength and endurance variations demonstrated a similar trend , with the i / d genotype resulting in intermediate outcomes between i / i and d / d ; however , these differences were not statistically significant .
we tested the hypothesis that ace genotype was a contributing factor to disease progression and clinical response to ert in the pompe disease late - onset treatment study ( lots ) .
lots , a randomized , double - blind , placebo - controlled trial involving 90 lopd patients , evaluated the safety and efficacy of biweekly infusions ( 20 mg / kg ) of alglucosidase alfa compared to placebo for 78 weeks in juvenile and adult lopd patients .
only patients who completed 26 weeks of the study were included in this analysis ( n = 58 alglucosidase alfa - treated ; n = 30 placebo - treated )
. the i / d allele status of a 287 base - pair alu repeat in intron 16 of the ace gene was determined by polymerase chain reaction ( pcr ) analysis using methods described previously with slight modifications ( 2 u platinum taq polymerase , 1 platinum taq pcr buffer - mg , 3 mm mgcl2 , 0.25 mm dntp mix , and 0.5 mm of the forward and reverse primers ) .
one - way anova analysis was used to evaluate correlations between ace genotype ( i / i , i / d , and d / d ) and baseline pompe disease characteristics .
student 's t - test was conducted to compare alglucosidase alfa treatment and placebo within each ace genotype .
at baseline , patients with the d / d genotype did not present with earlier onset of disease ( mean age at first symptoms : 27.4 12.7 years vs. 28.5 11.5 [ i / d ] and 28.6 14.4 [ i / i ] ) , longer duration of disease at trial entry ( mean duration since symptom onset : 18.3 10.2 years vs. 17.6 11.6 [ i / d ] and 20.4 9.9 [ i / i ] ) , or more severe disease as measured by 6-minute walk test ( 6mwt ) ( mean : 343.0 144.4 m vs. 339.2 125.6 [ i / d ] and 293.1 147.4 [ i / i ] ) , or percent predicted forced vital capacity ( fvc ) ( mean : 53.3 15.4% vs. 56.2 15.6 [ i / d ] and 52.4 12.5 [ i / i ] ) .
, lots patients with the d / d genotype appeared less responsive to alglucosidase alfa treatment than patients with the i / i or i / d genotypes ( fig .
patients with the i / d and i / i genotype who received ert showed significantly greater improvements in fvc ( mean change : 1.516 [ p = 0.028 ] and 4.8 [ p = 0.007 ] , respectively ) compared to d / d patients ( mean change : 1.412 ) receiving treatment ( fig .
similarly , the mean increase in the 6mwt was significantly higher in i / d patients on ert ( mean change : 40.16 [ p = 0.022 ] ) compared to the d / d group ( mean change : 1.412 ) , with a trend for an improved response in patients with the i / i genotype ( mean change : 32 ) ( fig .
1c presents the change from baseline in patients treated with alglucosidase alfa and also illustrates a trend toward lower responsiveness to alglucosidase alfa in d / d genotype patients .
importantly , while the mean changes in fvc and 6mwt do not appear to indicate an overall response to alglucosidase alfa within the d / d genotype group , it is important to note that a variable response to ert was observed , and several patients demonstrated gains in the 6mwt and fvc with this genotype ( fig .
the d / d genotype was not associated with increases in peak igg titers , sustained antibody titers , or inhibitory antibodies ( data not shown ) , indicating that the correlation between ace genotype and response to ert is not associated with an immune response to alglucosidase alfa .
our finding that lopd patients with the ace d / d genotype demonstrate a reduced response to alglucosidase alfa relative to those with i / i or i / d genotypes is consistent with earlier findings .
we also demonstrated the presence of this association regardless of baseline disease severity and anti - gaa igg antibody levels .
however , unlike patients in earlier studies , , lots patients with the d / d genotype did not present with an earlier onset of disease or a longer duration of disease at study entry .
our results suggest that the ace i / d polymorphism may influence the response to alglucosidase alfa treatment independent of the patient 's disease severity at treatment initiation .
these findings raise pertinent questions about the mechanisms by which the ace genotype influences the muscle response to alglucosidase alfa treatment .
does the d / d genotype result in increased vasoconstriction , and therefore less enzyme delivery to skeletal muscle ?
do patients with the d / d genotype have an increase in type ii muscles fibers ( fast - twitch , anaerobic , glycogen - rich ) that decreases their response to treatment ?
type i muscles fibers ( slow - twitch , aerobic , mitochondria - rich ) have an increased capillary density , which has been correlated with increased glycogen clearance after ert in a mouse model of pompe disease . on the other hand ,
type ii muscle fibers exhibit increased autophagic pathology in pompe mice , which may be responsible for the mis - targeting of ert within the muscle fiber .
finally , it is important to note that individual patient responses to alglucosidase alfa were variable across the three ace genotypes , and many patients with the d / d genotype demonstrated improvements in the functional assessments evaluated .
this supports the concept that an individualized treatment approach and careful follow - up are warranted for pompe disease patients receiving ert . in conclusion ,
pompe disease patients with the ace d / d genotype appeared to show a decreased response to alglucosidase alfa , although the mechanism underlying this observation is not yet known .
continued genotyping of pompe disease patients for the ace polymorphism and further investigation of therapeutic response are warranted .
all authors are employees of sanofi , and the study was funded by sanofi genzyme . | correlations between angiotensin - converting enzyme ( ace ) genotype ( i / i , i / d , d / d ) , disease severity at baseline and response to enzyme replacement therapy ( ert ) were assessed in the pompe disease late - onset treatment study ( lots ) .
no correlations were observed between ace genotype and disease severity at baseline .
however , d / d patients appeared to have a reduced response to alglucosidase alfa treatment than i / i or i / d patients , suggesting that ace polymorphisms may influence the response to alglucosidase alfa treatment and warrants further investigation . |
bipolar ii disorder ( bdii ) is a common mood disorder with a prevalence of approximately 3% to 11% .
however , it is believed that bdii is greatly underdiagnosed and frequently misdiagnosed , because patients usually seek treatment during depressive episodes but perceive hypomanic episodes as positive experiences .
more comprehensive research is needed on the clinical presentation of , pathophysiology of , and treatment for bdii .
patients with bipolar disorder ( bd ) have a higher prevalence rate of metabolic disturbance and obesity than does the general population .
it used to be conventional wisdom that people with a pyknic broad - built body were more likely to develop bd . with improving economic and living conditions , and with obesity at historically high levels and becoming a major public health problem ,
the association between body build and bd is no longer seriously considered . nevertheless , the prevalence rates of metabolic disturbance and obesity are still higher in patients with bd than in the international general population .
vancampfort et al , for example , reported that 37.3% of unselected patients with bd have metabolic syndrome ( mets ) , almost twice the prevalence rate of controls . in taiwan
, 33.9% of patients with bd meet the criteria for mets , especially those taking second - generation antipsychotics ( sgas ) .
mets is a cluster of cardiovascular disease and adverse risk factors for type ii diabetes , for example , central obesity , impaired glucose metabolism , dyslipidemia , and hypertension ( htn ) .
in addition , in patients with bd , the prevalence of mets is as high as is the prevalence of obesity , and it is higher than in the general population .
moreover , patients with both mets and obesity are more likely to have a lifetime history of suicide attempts .
the striatal dopaminergic system , which is implicated in the pathogenesis of bd , is correlated with body mass index ( bmi ) .
in contrast , dopamine agonists have been hypothesized to reverse the metabolic change caused by hyperprolactinemia .
in addition to the known etiologies of mets , such as insulin resistance and central obesity , whether the candidate genetic variant of bd involved with the dopaminergic system affects body weight and metabolic profiles warrants additional study .
one of them , the dopamine receptor d3 ( drd3 ) gene , is associated with in treatment response to atypical antipsychotics such as clozapine , which frequently caused drug - associated mets .
the drd3 gene , on chromosome 3q13.3 , is expressed at a relatively high level in the mesolimbic brain regions associated with emotions and behavior , novelty seeking , the reward system , and cognition .
therefore , the drd3 gene might be important for susceptibility to bd and metabolic change , because mood swings , neurocognitive impairments , and the reward system are all important aspects of bd and are related to appetite change , which affects metabolic parameters .
chiaroni et al suggested that the drd3 locus might be involved in a specific endophenotype of bd that consists of clinical characteristics of mania , a low age at onset , and initiation by an acute delusional episode .
our research also suggests an association between the drd3 serine-9-glycine ( ser9gly ) polymorphism and bdii comorbid with anxiety disorder .
moreover , the receptor protein encoded by the drd3 gene is a target site for antipsychotic agents and is efficient for treating bd .
the drd3 ser9gly polymorphism ( rs6280 ) is the most frequently studied variant of the drd3 gene that causes a ser - to - gly substitution and leads to a significant increase in dopamine - binding affinity .
the gly9 allele of the ser9gly polymorphism is associated with significantly greater odds for a treatment response to antipsychotics .
it seems that the potential effect of the drd3 ser9gly polymorphism on the metabolic profile in bdii has never been studied .
we hypothesized that the drd3 ser9gly polymorphism affects metabolic profile changes in patients with bdii after 12 weeks of standard treatment .
the drd3 gly / gly and ser / gly genotypes have a significantly higher binding affinity for d3-selective ligand than does the ser / ser genotype . these genotypes with a higher binding affinity for clozapine also yield better treatment responses .
therefore , in the current study , we grouped the ser / gly and gly / gly genotypes together to evaluate changes in metabolic parameters in these 2 groups of genotypes with different binding affinities . in the present study , to determine whether the drd3 ser9gly polymorphism predicts posttreatment changes in bmi and metabolic indices , we recruited patients who had been diagnosed with bdii for the first time , and we measured their metabolic parameters changes after they received a standard 12-week pharmacological intervention for bdii .
the institutional review board for the protection of human subjects at tri - service general hospital and at national cheng kung university hospital approved the research protocol .
after each participant signed written informed consent , blood samples were collected . this study is a secondary and subgroup analysis of a clinical trial ( trial registration : nct01188148 at https://register.clinicaltrials.gov/ ) .
the original study was a 12-week trial using randomized , double - blind , controlled design to investigate the add - on effect of memantine on bdii treated using valproate ( vpa ) . as the aim of this study was to explore the association between the drd3 gene and changes in metabolic parameters , we chose to analyze only patients who received placebo to stay away from the influence of not routinely used treatment for bdii , add - on memantine . in this way , the present subgroup analysis may make our results more generalizable to daily clinical practice .
the study population was recruited from outpatients and inpatients at tri - service general hospital in taipei , and at national cheng kung university hospital in tainan , taiwan .
the inclusion criteria were having a diagnosis of bdii when first evaluated by an attending psychiatrist , then confirmed by a clinical psychologist to verify that the diagnosis met the criteria of the diagnostic and statistical manual of mental disorders ( dsm - iv ) , using a structural interview with good inter - rater reliability , the chinese version of the modified schedule of affective disorder and schizophrenia - life time ( sads - l ) ; whose ethnics are han chinese ; and aged 18 to 65 years .
patients having psychiatric illness including substance dependence , borderline personality disorder , or dementia were excluded .
patients who were previously medicated with any psychotropic agent or having a history of metabolic diseases were also excluded . although the diagnostic and statistical manual of mental disorders - fourth edition criteria imposed a 4-day duration criterion for hypomanic episode , a 2-day duration of hypomania was supported by current epidemiologic data samples as being more prevalent in the community .
therefore , in the current study , we implemented the 2-day minimum for hypomania when diagnosing bdii . after enlisting in this study ,
the patients were administered with open - label use of valproic acid [ 500 and 1000 mg daily ( 50100 g / ml in plasma ) ] .
accompanying medication was narrowed to benzodiazepines ( lorazepam ; up to 8 mg / day ) for insomnia , agitation , or irritability and fluoxetine ( up to 20 mg / day ) for depression .
the doses were adjusted according to each patient 's clinical manifestations and tolerance . in the event of side effect intolerance or worsening of clinical symptoms ,
after the introduction of pharmacological treatment , the patients metabolic profiles , including bmi , lipid profile [ cholesterol , triglycerides , high - density lipoprotein ( hdl ) , low - density lipoprotein ( ldl ) ] , waist circumference , blood pressure , and fasting serum glucose levels , were measured at baseline and at 2 , 8 , and 12 weeks .
the young mania rating scale ( ymrs ) and the hamilton depression rating scale ( hdrs ) were used to assess severity of mood symptoms . trained and experienced
research psychiatrists assessed the clinical ratings of ymrs and hdrs at baseline and at each visit when metabolic profiles were assessed .
the diagnosis of mets was defined according to the national cholesterol education program ( ncep ) adult treatment panel iii ( atpiii ) guidelines and the asian criteria for abdominal obesity : plasma triglycerides ( after 8-hour fasting ) 150 mg / dl ) ; low hdl cholesterol with fasting hdl cholesterol 40 mg / dl in men and 50 mg / dl in women ; previously diagnosed htn or htn defined as systolic blood pressure ( sbp ) 130 or diastolic blood pressure ( dbp ) 85 mm hg ; or hyperglycemia , defined as fasting plasma glucose 100 mg / dl or previously diagnosed type 2 diabetes ; and abdominal obesity , defined as a waist circumference 90 cm in men or 80 cm in women .
the genotyping of the drd3 ser9gly polymorphism was done at baseline using a modified protocol described elsewhere .
the laboratory analyst who performed and recorded the genotyping was blinded to the patients diagnoses .
spss 18 for windows , chicago : spss inc . was used for all statistical analyses .
significance was set at p < 0.05 . the demographic and clinical characteristics of the patients were compared between different genotype groups at baseline and endpoint using independent t tests for continuous variables and tests for categorical variables . when the sample size in each cell was less than 5 , fisher exact probability tests were used instead of tests .
we performed quality control on all the metabolic parameters ( bmi , lipid profile , fasting serum glucose level , blood pressure , and waist circumference ) to check for outliers using box plot and q - q plot .
we found outliers in the variables of fasting plasma glucose and triglyceride , presenting positive skew .
we therefore transformed these variables to normal distribution by taking log ( x + 1 ) of these variables , and then performed further statistical analysis .
the metabolic parameters before and after pharmacological treatment were repeatedly measured . to evaluate the possible association of the drd3 ser9gly polymorphism with changes in metabolic parameters and symptom severity
the generalized estimating equation ( gee ) is a statistical method using multiple linear regression for repeated - measures studies , which is able accommodate randomly missing data .
we used gee analysis to investigate whether the drd3 ser9gly polymorphism predicts changes in the metabolic profiles controlling for concomitant medication ( fluoxetine use and plasma valproic acid levels ) , time effects ( treatment period from baseline to week 12 ) , gender , and age .
all the variables , after transformation by taking log ( x + 1 ) , fit the normality assumption for gee .
seven models ran with each outcome ( metabolic parameters : bmi , triglycerides , hdl - c , etc . ) as a dependent variable . to check the validity of gee model
, we used the quasi - akaike information criterion ( qic ) method . in each model , the interaction of the drd3 ser9gly ser / ser genotype and the treatment course , main effects of the drd3 ser9gly genotypes , treatment course , gender , age , valproic acid level , and fluoxetine were included as independent variables ; patients with the drd3 ser9gly ser / gly + gly / gly genotypes were the reference group .
the interactive variable ( genotype treatment duration ) reflects the effect of the genotype on the dependent variable ( e.g. , bmi , triglyceride ) after the entire treatment course in the assessed gee model without considering the time effect ( the treatment course ) . in the gee model ,
the moderators included age and gender , and the mediators included the drug used valproic acid or fluoxetine . to adjust for multiple comparisons ,
the power analysis was done using g - power 3 , and the effect - size conventions were determined on the basis of buchner et al .
the institutional review board for the protection of human subjects at tri - service general hospital and at national cheng kung university hospital approved the research protocol .
this study is a secondary and subgroup analysis of a clinical trial ( trial registration : nct01188148 at https://register.clinicaltrials.gov/ ) .
the original study was a 12-week trial using randomized , double - blind , controlled design to investigate the add - on effect of memantine on bdii treated using valproate ( vpa ) . as the aim of this study was to explore the association between the drd3 gene and changes in metabolic parameters , we chose to analyze only patients who received placebo to stay away from the influence of not routinely used treatment for bdii , add - on memantine . in this way , the present subgroup analysis may make our results more generalizable to daily clinical practice .
the study population was recruited from outpatients and inpatients at tri - service general hospital in taipei , and at national cheng kung university hospital in tainan , taiwan .
the inclusion criteria were having a diagnosis of bdii when first evaluated by an attending psychiatrist , then confirmed by a clinical psychologist to verify that the diagnosis met the criteria of the diagnostic and statistical manual of mental disorders ( dsm - iv ) , using a structural interview with good inter - rater reliability , the chinese version of the modified schedule of affective disorder and schizophrenia - life time ( sads - l ) ; whose ethnics are han chinese ; and aged 18 to 65 years .
patients having psychiatric illness including substance dependence , borderline personality disorder , or dementia were excluded .
patients who were previously medicated with any psychotropic agent or having a history of metabolic diseases were also excluded . although the diagnostic and statistical manual of mental disorders - fourth edition criteria imposed a 4-day duration criterion for hypomanic episode , a 2-day duration of hypomania was supported by current epidemiologic data samples as being more prevalent in the community .
therefore , in the current study , we implemented the 2-day minimum for hypomania when diagnosing bdii .
after enlisting in this study , the patients were administered with open - label use of valproic acid [ 500 and 1000 mg daily ( 50100 g / ml in plasma ) ] .
accompanying medication was narrowed to benzodiazepines ( lorazepam ; up to 8 mg / day ) for insomnia , agitation , or irritability and fluoxetine ( up to 20 mg / day ) for depression .
the doses were adjusted according to each patient 's clinical manifestations and tolerance . in the event of side effect intolerance or worsening of clinical symptoms ,
after the introduction of pharmacological treatment , the patients metabolic profiles , including bmi , lipid profile [ cholesterol , triglycerides , high - density lipoprotein ( hdl ) , low - density lipoprotein ( ldl ) ] , waist circumference , blood pressure , and fasting serum glucose levels , were measured at baseline and at 2 , 8 , and 12 weeks .
the young mania rating scale ( ymrs ) and the hamilton depression rating scale ( hdrs ) were used to assess severity of mood symptoms . trained and experienced research psychiatrists assessed the clinical ratings of ymrs and hdrs at baseline and at each visit when metabolic profiles were assessed .
the diagnosis of mets was defined according to the national cholesterol education program ( ncep ) adult treatment panel iii ( atpiii ) guidelines and the asian criteria for abdominal obesity : plasma triglycerides ( after 8-hour fasting ) 150 mg / dl ) ; low hdl cholesterol with fasting hdl cholesterol 40 mg / dl in men and 50 mg / dl in women ; previously diagnosed htn or htn defined as systolic blood pressure ( sbp ) 130 or diastolic blood pressure ( dbp ) 85 mm hg ; or hyperglycemia , defined as fasting plasma glucose 100 mg / dl or previously diagnosed type 2 diabetes ; and abdominal obesity , defined as a waist circumference 90 cm in men or 80 cm in women .
the genotyping of the drd3 ser9gly polymorphism was done at baseline using a modified protocol described elsewhere .
the laboratory analyst who performed and recorded the genotyping was blinded to the patients diagnoses .
spss 18 for windows , chicago : spss inc . was used for all statistical analyses .
significance was set at p < 0.05 . the demographic and clinical characteristics of the patients were compared between different genotype groups at baseline and endpoint using independent t tests for continuous variables and tests for categorical variables .
when the sample size in each cell was less than 5 , fisher exact probability tests were used instead of tests .
we performed quality control on all the metabolic parameters ( bmi , lipid profile , fasting serum glucose level , blood pressure , and waist circumference ) to check for outliers using box plot and q - q plot .
we found outliers in the variables of fasting plasma glucose and triglyceride , presenting positive skew .
we therefore transformed these variables to normal distribution by taking log ( x + 1 ) of these variables , and then performed further statistical analysis .
the metabolic parameters before and after pharmacological treatment were repeatedly measured . to evaluate the possible association of the drd3 ser9gly polymorphism with changes in metabolic parameters and symptom severity
, we implemented a multiple linear regression model . the generalized estimating equation ( gee )
is a statistical method using multiple linear regression for repeated - measures studies , which is able accommodate randomly missing data .
we used gee analysis to investigate whether the drd3 ser9gly polymorphism predicts changes in the metabolic profiles controlling for concomitant medication ( fluoxetine use and plasma valproic acid levels ) , time effects ( treatment period from baseline to week 12 ) , gender , and age .
all the variables , after transformation by taking log ( x + 1 ) , fit the normality assumption for gee .
seven models ran with each outcome ( metabolic parameters : bmi , triglycerides , hdl - c , etc . ) as a dependent variable . to check the validity of gee model
, we used the quasi - akaike information criterion ( qic ) method . in each model , the interaction of the drd3 ser9gly ser / ser genotype and the treatment course , main effects of the drd3 ser9gly genotypes , treatment course , gender , age , valproic acid level , and fluoxetine were included as independent variables ; patients with the drd3 ser9gly ser / gly + gly / gly genotypes were the reference group .
the interactive variable ( genotype treatment duration ) reflects the effect of the genotype on the dependent variable ( e.g. , bmi , triglyceride ) after the entire treatment course in the assessed gee model without considering the time effect ( the treatment course ) . in the gee model ,
the moderators included age and gender , and the mediators included the drug used valproic acid or fluoxetine . to adjust for multiple comparisons ,
the power analysis was done using g - power 3 , and the effect - size conventions were determined on the basis of buchner et al .
the first patient was recruited on august 25 , 2009 , and the last enrolled patient finished on may 30 , 2012 .
all the recruited patients were first diagnosed bdii , never administered with mood stabilizers or antipsychotics in the past . at baseline ,
finally , 76 ( 65.0% ) patients completed the 12-week pharmacological treatment and metabolic profile follow - up ; the other 41 patients dropped out .
the genotype and allele distributions of the drd3 ser9gly polymorphism of patients at baseline were ser / ser , ser / gly , gly / gly : 56.4% versus 35.0% versus 8.5% and ser / gly : 74% versus 26% .
the genotype distributions of the drd3 ser9gly polymorphisms at baseline were in hardy weinberg equilibrium ( chi = 0.966 , p = 0.325 ) .
we divided the study population into 2 genotype subgroups : the ser / ser and the ser / gly + gly / gly of the drd3 ser9gly polymorphism .
the demographic and clinical characteristics , and the metabolic parameters between the 2 subgroups , were similar in all patient groups at baseline . at the endpoint ,
patients with the ser / gly + gly / gly genotype had a higher level of triglycerides ( table 1 ) .
mean hdrs score , ymrs score , and cytokine and metabolic profiles before and after pharmacological treatment in addition , the frequency of mets at the endpoint was significantly ( p = 0.03 ) higher in the ser / gly + gly / gly group ( 11.4% ) than in the ser / ser group ( 0% ) .
three of the 10 patients with mets at baseline dropped out at the end and were lost to follow - up .
four of the 5 patients with the ser / ser genotype and mets at baseline did not have mets at the endpoint , and 1 patient was lost to follow - up .
two of the 5 patients with the ser / gly + gly / gly genotypes and mets at baseline still had mets at the endpoint , 2 patients were lost to follow - up , and only 1 patient did not have mets at the endpoint .
in addition , 2 patients with the ser / gly + gly / gly genotypes who did not have mets at baseline developed mets at the endpoint . therefore , at the endpoint ,
4 patients with the ser / gly + gly / gly genotypes had mets . by excluding patients who dropped out before the endpoint , we found that there was still no significant difference in the prevalence of mets at baseline , but that the significant difference ( p = 0.036 ) at the endpoint remained .
therefore , although the dropout rate was high , the change in the incidence of mets in patients with different genotypes of the drd3 ser9gly polymorphism was still significant . a multiple linear regression analysis of the association between the drd3 ser9gly polymorphism and changes in the metabolic parameter scores before and after the 12 weeks of treatment showed that the drd3 ser9gly polymorphism was significantly ( p = 0.03 ) associated with the changes in triglyceride levels ( table 2 ; figure 1 ) .
patients with the ser / ser genotype had a significantly smaller increase in triglycerides than did patients with the ser / gly + gly / gly genotype . however , the drd3 ser9gly polymorphism was not associated with changes in other metabolic parameters ( table 2 ) . after correcting for multiple comparisons , the associations between the drd3 ser9gly polymorphism with changes in triglyceride levels become nonsignificant .
association of the drd3 ser9gly polymorphism with changes in metabolic profiles from baseline after 12 wks of follow - up in patients with bp - ii changes in the triglyceride level of patients with different genotypes of the drd3 ser9gly polymorphism after 12 weeks of standard treatment for bipolar ii disorder .
( the error bars represent the standard error of the mean ) . for multiple regression analysis in a sample of 117 patients in the present study ,
the power was 0.33 to detect a small effect ; to detect medium and large effects , the power was 0.99 .
the effect - size for the multiple regression model ( = 0.05 ) was set at 0.02 for small effect , 0.15 for medium effect , and 0.35 for large effect , determined according to buchner et al .
in the association analysis of the drd3 ser9gly polymorphisms and changes of metabolic parameters , we found preliminary evidence that , in patients with bdii , the drd3 gene influences changes in triglyceride levels , one of the key criteria of mets .
the genotype distribution of the drd3 ser9gly polymorphism in the current study is comparable to patients with schizophrenia and healthy individuals in other studies from the han chinese population .
patients with the ser / ser genotype had a significantly smaller increase in triglyceride level than did those with the ser / gly + gly / gly genotype . furthermore , after 12 weeks of follow - up , significantly fewer patients with the ser / ser genotype than with the ser / gly + gly / gly genotype had mets .
however , the drd3 ser9gly polymorphism was not related to changes in other metabolic parameters .
we therefore hypothesize that , after 12 weeks of standard bdii treatment , patients with the drd3 ser9gly ser / gly + gly / gly genotype are at a higher risk for higher triglyceride levels and for mets than are those with the ser / ser genotype .
the current study showed that the drd3 ser9gly polymorphism , the candidate genetic variant of bd involved in the dopaminergic system , might affect changes in metabolic profiles .
such an association between the drd3 ser9gly polymorphism and metabolic profiles in bdii or other disorders has never been studied in the past . the relationship between the dopamine system and mets , however , has been reported : the striatal dopaminergic system is apparently involved in regulating bmi .
dopamine is a mediator of feeding behavior : an increase in dopamine signaling promotes feeding behavior , but a decrease represses it .
in addition , dopamine neurons are frequently targets of hormones such as leptin and insulin , both of which regulate the homeostatic system .
global dopamine d2 receptor knockout female mice are reported to eat more and have more adipose tissue than mice with the normal density of dopamine d2 receptors . in the current study ,
patients with the gly allele , which increases dopamine binding affinity , had a greater risk for mets and an increase in triglycerides after 12 weeks of standard bdii therapy .
it is possible that the increased dopamine - binding affinity of those patients might also have caused them to increase their food intake .
however , because we did not record the dietary habits of each patient , this hypothesis requires additional investigation .
nevertheless , we found no significant association between the drd3 ser9gly polymorphism and other metabolic parameters .
this agrees with the study by soma et al , who reported no association between the drd3 ser9gly polymorphism and essential htn .
in addition , unlike other studies , we analyzed this association between the drd3 ser9gly polymorphism and changes in metabolic profiles in a longitudinal rather than a cross - sectional study .
moreover , we focused on drug - naive patients with bdii undergoing initial short - term pharmacological intervention .
additional evaluations of the association between the drd3 ser9gly polymorphism and longer - term metabolic changes are warranted .
significant correlations have been reported between obesity and comorbid binge - eating disorder and health habits in bd .
therefore , it is important to regularly monitor a patient 's mets status and provide prompt lifestyle interventions that encourage greater physical activity and less overeating . whether these lifestyle behaviors are associated with genetics or the underlying psychology of bd requires additional study .
we would need about 395 participants ( more than 3 times the current sample size ) for sufficient power ( 0.8 ) detect a small effect ( 0.02 ) .
in addition , the associations between the drd3 ser9gly polymorphism with changes in triglyceride level become nonsignificant after correcting for multiple comparisons .
second , the correlation between the gene and metabolic indices might be obscured by the medication permitted in the study . although we tried to limit concomitant treatment medication to only 3 drugs ( lorazepam , fluoxetine , and valproic acid ) and adjust for its use in our linear regression analysis , our results should still be taken with caution .
in addition , other possible confounders such as socioeconomic class , education level , dietary habits , drug adherence , and daily activities and the energy they required were not adjusted for .
third , the 2-day hypomania criteria used in the present study is not widely agreed .
our positive finding might not be generalizable to patients with bdii diagnosed using the dsm - iv - tr criterion of a 4-day duration for hypomania .
finally , the current study only followed the metabolic change after 12-week of pharmacological intervention .
a longer - term follow - up of metabolic changes in our patients is needed in future investigation . in conclusion , the present study results support that the drd3 gene affects changes in triglyceride levels and in the frequency of mets after 12-week of standard treatment in drug - naive bipolar ii patients .
those with the gly allele might be vulnerable to an increased risk for a high level of triglyceride and for mets .
however , the exact mechanism of the drd3 gene 's effects on metabolic parameters warrants additional analysis .
we hypothesize that knowledge of how the drd3 ser9gly polymorphism affects changes in triglyceride levels will be clinically useful for reminding clinicians to more closely monitor and control metabolic parameters in patients being treated for bdii . | abstractpatients with bipolar ii disorder ( bdii ) have a higher prevalence rate of metabolic disturbance . whether bdii itself , in addition to its current standard treatment ,
is a risk factor for metabolic syndrome warrants additional study .
the dopamine receptor d3 ( drd3 ) gene , one of the candidate genes for bdii , is also involved in the dopaminergic system .
we investigated whether it is related to changes in the metabolic indices of patients with bdii given 12 weeks of standard treatment.patients with a first diagnosis of bdii ( n = 117 ) were recruited .
metabolic profiles ( cholesterol , triglycerides , fasting serum glucose , body mass index ) were measured at baseline and at 2 , 8 , and 12 weeks .
the genotype of the drd3 ser9gly polymorphism ( rs6280 ) was determined .
multiple linear regressions with generalized estimating equation methods were used.seventy-six ( 65.0% ) patients completed the 12-week intervention .
significant differences in triglyceride change were associated with the drd3 ser9gly genotype ( p = 0.03 ) .
patients with the ser / ser genotype had significantly smaller triglyceride increases and a lower risk of developing metabolic syndrome than did those with the ser / gly+gly / gly genotype .
however , the associations between the drd3 ser9gly polymorphism with changes in triglyceride level become nonsignificant after correcting for multiple comparisons.we conclude that the drd3 ser9gly polymorphism is nominally associated with changes in triglycerides and metabolic syndrome after 12 weeks of standard bdii treatment . |
the patient , a 54-year - old caucasian male , had been diagnosed with nsclc in 2006 . at the time of primary diagnosis , he had been suffering from increasing shortness of breath due to malignant pericardial effusion that contained carcinoembryonic antigen ( cea)-positive cancer cells . apart from smoking (
50 pack - years ) , his past medical history had been unremarkable . after diagnosis of inoperable nsclc stage iiib ( bilateral malignant pleural and pericardial effusion , bilateral lymph node involvement , uicc ct4n3m0 ;
iaslc proposed staging system ct4n3m1a ) , the patient was started on first - line chemotherapy with gemcitabine ( 1,000 mg / m ) and cisplatin ( 70 mg / m ) .
because of hearing changes , therapy was continued with gemcitabine ( 1,000 mg / m ) and carboplatin ( auc5 ) for 5 additional cycles .
in the course of treatment , the patient developed raynaud 's syndrome which was treated with calcium channel antagonists . because of increasing cea , therapy with erlotinib ( 150 mg / d )
was initiated in december 2006 . unfortunately , this led to an exacerbation of raynaud 's syndrome . in february 2007 , systemic therapy with pemetrexed ( 500 mg / m d1 q 3 weeks ) was initiated and given for a total of 3 cycles , when the patient refused further treatment because of polyneuropathic symptoms .
ct scan and fdg - pet in july 2007 revealed increasing pet - positive mediastinal and supraclavicular lymph nodes corresponding to a further increase of serum cea levels .
in august 2007 , the patient consulted the emergency room with tachycardia and increased shortness of breath .
1 ) . after stabilization , systemic chemotherapy with docetaxel ( 75 mg / m d1 q21d ) was started and continued for 2 cycles . during this time , regular heart ultrasound showed stable , non - haemodynamically relevant pericardial effusion .
serum cea levels showed a rapid decline , suggesting good antitumour effect of docetaxel ( fig .
1 ) . nevertheless , the patient suffered from increasing dyspnoea and orthopnoea that required hospitalization .
staging ct showed predominantly hyperdense interstitial thickening with sporadic alveolar infiltrates most prominent in the dorsobasal parts of the lung ( fig .
2b ) and had not been detectable in the initial chest ct 2 months before ( fig .
since ground glass opacifications or patchy attenuation patterns were not seen , the findings were summarized as a subpleural fibrosis . since organizing pneumonia was not a differential diagnosis at the time of the examination and no ground glass infiltrates were seen , a combination of in- and expiratory multislice ct scans was not performed . apart from progressive pericardial effusion , there was no pleural effusion , or enlarged lymph nodes .
pathological analysis showed unspecific chronic inflammation reaction with granulation tissue in the small bronchi and alveoli similar to op ( fig .
3 ) . therapy with prednisone ( 1 mg / kg ) was initiated and resulted in a rapid improvement of respiratory symptoms .
of note was the overt reduction of subpleural interstitial thickening and the sporadic alveolar infiltrates ( see fig . 2c ) .
after 1 cycle of vinorelbine ( 25 mg / m weekly q 6 weeks ) , staging ct showed stable disease and markedly improved pulmonary changes ( fig .
therapy was halted . during further follow - up by repeated cts , progressive disease and increasing pericardial effusion
2d ) , so that in february 2008 the pericardium was fenestrated to allow drainage into the left pleural space . in april 2008
it is characterized by inflammation and destruction ( obliteration ) of the bronchioles and surrounding tissue in the lungs .
typically , infiltrates are not resolved , but form fibrous tissue in the alveoli . the clinical features and
however , diagnosis is suspected when there is no response to multiple antibiotics , and blood and sputum cultures are negative for organisms .
approximately 50% of op cases are idiopathic , but multiple op - inducing factors , such as drugs , infection , radiation therapy , aerosols and chronic inflammatory diseases , have been described .
op often develops on grounds of pre - existing chronic inflammatory diseases or as adverse effect to certain drugs ( for an excellent review , see ) .
patients may present with flu - like complaints , low - grade fever , non - productive cough and ( increasing ) shortness of breath . often , these symptoms are interpreted as infection and treated with broad - spectrum antibiotics without clinical improvement . on clinical examination ,
laboratory tests are unspecific and may show signs of infection . pulmonary function is often compromised
. plain chest radiography may show characteristic patchy unilateral or bilateral consolidation areas and/or small nodular opacities , but may show unspecific findings as well .
typically , op is characterized by multiple , predominantly bilateral patchy air space opacities disseminated throughout both lungs .
other patterns include interstitial ( reticular , nodular or reticulonodular ) opacities , focal consolidations or nodules or masses .
pleural effusions may be present , but are not typical [ 3 , 7 ] .
nevertheless , the diagnosis of op can not reliably be made solely on radiologic grounds , as findings are unspecific .
acute fibrosis as possibly detectable in idiopathic interstitial fibrosis includes a variety of possible findings .
the lower and subpleural parts of the lung are affected predominantly or exclusively . with respect to the severity of the disease , the findings change and
cytological findings in bronchoalveolar lavage samples are characteristic , but unspecific ( increases in the percentages of neutrophils and lymphocytes , decreased cd4+/cd8 + ratio , and activation of t cells ) .
most patients with op respond to treatment with steroids , and symptoms resolve within days or weeks .
radiographic findings reportedly demonstrate improvement in 50 - 86% of patients ; however , in a minority of patients , the disease may persist .
a standardized approach to dosing starting at 0.75 mg / kg and weaning over 24 weeks has been shown to reduce total corticosteroid exposure without affecting outcome .
we here report a case of op ( formerly known as boop ) that developed after treatment with docetaxel for advanced nsclc in a fourth - line chemotherapy setting . to our knowledge , this is the second report of op or pulmonary fibrosis that can be directly attributed to docetaxel therapy .
one prior case reported op secondary to combination chemotherapy with docetaxel and gemcitabine for bronchoalveolar carcinoma , although others have reported pulmonary fibrosis and interstitial pneumonitis [ 9 , 10 ] .
although other chemotherapeutic agents have been reported to induce op , docetaxel has been regarded to have mainly non - pulmonary toxicities , mainly cytopenia and polyneuropathy .
although it is a potent drug for treatment of various solid tumour entities , docetaxel might cause serious pulmonary side effects . in a poster presented by ahn et al . at the 2008 joint iaslc and esmo conference ,
the authors report a high incidence of docetaxel - related pneumonitis of 17% in patients receiving treatment for lung cancer . given our findings that ct - morphological changes interpreted as pulmonary fibrosis turned out to be bronchiolitis obliterans pneumonia , one has to worry about the true incidence of op .
so , if a patient receiving docetaxel develops respiratory distress and radiographic changes suggestive of alveolar consolidation , op must be differentiated from infectious pneumonia , as treatment and prognosis are different . | organizing pneumonia ( formerly known as bronchiolitis obliterans organizing pneumonia , boop ) is an inflammatory process of the bronchioles that can lead to the destruction of small airways and surrounding lung tissue .
although the majority of cases are idiopathic , certain chemicals and drugs can induce op . here , we report a 54-year - old male patient with advanced non - small cell lung cancer ( nsclc ) who developed therapy - associated op .
he had undergone several other chemotherapies before being switched to docetaxel as monotherapy ( 75 mg / m2 ) .
treatment was initially well tolerated , but after the second cycle the patient developed increasing shortness of breath . computed tomography ( ct ) for staging after the second cycle showed bilateral predominantly interstitial infiltration highly suggestive of acute lung fibrosis .
bronchoscopy revealed signs of chronic bronchitis and watery discharge from both lungs .
bronchoalveolar lavage and transbronchial needle biopsy was performed .
based on histopathologic examination , diagnosis of op was made .
after cessation of docetaxel and initial high dose steroids , the infiltration ameliorated rapidly .
this is the second case in the literature that associates docetaxel with rapid onset of bronchiolitis obliterans .
therefore , patients with lung cancer receiving docetaxel who develop respiratory symptoms should be suspected to develop op . |
first - cleavage mouse embryos , fertilized in vitro and in vivo , provide ideal material for chromosomal analysis . with the appropriate incubation in a mitotic inhibitor
, syngamy is prevented and the sperm- and egg - derived chromosomes remain as separate clusters . because the latter chromosomes undergo condensation sooner than those from the spermatozoon , the parental source of chromosome sets can be identified even without a marker chromosome . thus these embryos can be analyzed both for the primary incidence and the parental source of a number of chromosomal anomalies , including aneuploidy . by using fertilization in vitro to obtain the embryos ,
the synchrony of fertilization and nuclear development is such that 80% or more of the chromosomal preparations are suitable for analysis , compared with about 50% for embryos fertilized in vivo.imagesfigure 1.figure 2.figure 3.figure 4 . |
|
a 47-year - old african - american woman with a history of minimal change disease and steroid - induced cardiomyopathy presented to the emergency department with an acute episode of dyspnea .
after intubation , she was admitted to the intensive care unit ( icu ) . on the fifth day in the icu , she was found to have an edematous left eyelid , chemosis , and a purulent discharge . on ophthalmic examination ,
visual acuity was 20/100 in the right eye and light perception in the left eye .
the anterior segment exam in the left eye was remarkable for corneal clouding , and a 3-mm inferonasal ulcer and an inferior infiltrate ( fig .
however , a view of the left fundus was not possible on the initial evaluation due to corneal opacification .
the patient was empirically started on parenteral vancomycin , topical moxifloxacin eye drops , and erythromycin ointment .
multiple blood and sputum cultures were negative , so parenteral antibiotics were stopped . however , the ocular cultures grew mrsa , and based on sensitivity testing , the patient was treated with fortified gentamycin and vancomycin eye drops . by the third day of treatment , there was clearing of the infiltrate and a decrease in the size of the ulcer .
visualization of the fundus of the left eye was now possible , the vitreous was quiet , and it was concluded that the bacterial infection was localized to the anterior segment as a keratitis . over the course of her 9-day icu
once she was able to converse , we learned she had a history of congenital ptosis of the left upper eyelid with lagophthalmos and amblyopia .
her vision was poor in the left eye due to her amblyopia but otherwise , she rarely complained of ocular symptoms .
we contacted the patient 's primary care physician who urged us to keep the patient admitted at the hospital to complete the ophthalmic therapy because she has been known to be non - compliant for dozens of prior medical therapies . fearing the complications of further ocular infection ( 5 ) , and consequences from medical non - compliance ( 6 , 7 ) ( e.g. , greater morbidity , cost , and resources ) , we kept the patient admitted until the frequency of dosing could be cut down from every hour to every 45 hours ( 3 days ) . on a follow - up visit , visual acuity in the left eye recovered to her baseline of 20/200 .
bacterial keratitis is very uncommon in a healthy eye and usually develops when ocular defenses have been compromised .
keen attention needs to be paid to the following four broad risk factors : contact lens weartrauma such as accidental injury and surgical injury ( refractive surgery or loose sutures)ocular surface diseases such as dry eye and exposuresystemic immunosuppression
trauma such as accidental injury and surgical injury ( refractive surgery or loose sutures ) ocular surface diseases such as dry eye and exposure systemic immunosuppression the mechanism of infection in our patient started from exposure keratopathy due to lagophthalmos .
the patient may have acquired this infection at the hospital where mrsa is more common and has a commensal relationship with the conjunctiva and nares ( 8) .
exposure keratitis may be caused by : neuroparalytic conditions , especially facial nerve palsyreduced muscle tone , such as coma , parkinson 's , or strokemechanical conditions , such as scarring and tight skinglobe protrusion
neuroparalytic conditions , especially facial nerve palsy reduced muscle tone , such as coma , parkinson 's , or stroke mechanical conditions , such as scarring and tight skin staining is typically seen in the inferior third of the cornea with subsequent epithelial breakdown .
there have been several reports of mrsa keratitis occurring in hospitalized patients who were in comas ( 9 ) , suffered a cva ( 10 ) , or had other neurological impairments allowing improper eyelid closure , resulting in exposure keratitis and infection with ha - mrsa .
simple precautions , which are not yet the standard of care in all icus and operating rooms , may help prevent nosocomial ocular infections .
reversible causes may be treated with artificial tears ( non - preservative ) during waking hours and with an ointment at night .
lid taping works well for patients undergoing non - ocular surgery and those who are in a coma or deeply sedated on intubation .
permanent corneal exposure may be treated with tarsorrhaphy or insertion of gold weights in the upper eyelid in cases of facial nerve palsy .
mrsa infections are becoming more frequent including ocular manifestations , prompting health care workers to vigilantly monitor their patients for signs of mrsa infections involving the eye ( 10 ) .
hospitals and nursing homes will face rising rates of morbidity and cost if appropriate means of controlling ocular mrsa are not met .
these simple and cost - effective techniques , which are already implemented by many large institutions , could benefit patients if incorporated into the standard of care .
the authors declare that there is no conflict of interest regarding the publication of this paper .
informed consent : the patient gave their express consent via writing to use their images for the purpose of publication . | a 47-year - old african - american woman was admitted to the intensive care unit of our community hospital for respiratory failure secondary to severe decompensated heart failure , requiring intubation . in the ensuing days , she developed a methicillin - resistant staphylococcus aureus ( mrsa ) infection of the cornea , despite no growth of mrsa in multiple blood , sputum , and urine cultures .
this unexpected corneal infection complicated her hospital stay , and increased morbidity and disease - related cost .
risk factors , warning signs , and preventative measures for mrsa keratitis secondary to lagophthalmos ( inability to completely close one 's eyelids ) are outlined in this case report .
implementing simple precautions such as taping eyelids shut or using artificial lubrication may reduce patient morbidity and disease - related costs .
these recommendations are directed to non - ophthalmic clinicians who provide care to patients in settings where mrsa colonization is widespread . |
it is well recognized that aging plays a fundamental role in the development of cancer in the human adult population . to describe the relationship between cancer incidence rates and the age of cancer presentation several mathematical models
have been proposed ( see , for example,15 and references therein ) . in these models ,
the distribution of incidence rates are presented as a set of numbers , ii , j(ti ) , of new cases of a particular type of cancer that have been diagnosed during a given time period , j , per 100,000 population at each of the considered age intervals , ti . often , five - year - long age intervals are considered .
for instance , 100 years of human life span can be divided on 20 five - year intervals : 04 , 59 , 1014 , , 9599 .
the values ii , j(ti ) , representing cancer incidence in each of these age intervals , are called the age - specific cancer incidence rates ( or simply cancer rates ) .
these rates can be collected during one or several calendar years . in the mathematical modeling of the age distribution of cancer rates ,
for instance , ii , j(ti ) may represent numbers of new cancer cases in each of the aforementioned age intervals diagnosed in the j - th time period that correspond to , for example , 20002004 .
analyses of this type of data are called cross - sectional studies , because these studies aim to analyze data on people at different ages at the same time period .
the cross - sectional studies of the cancer incidence rate distributions in aging are different from the longitudinal studies of the analogous distributions . in the cross - sectional studies ,
the number of new cancer diagnoses can be counted simultaneously for different cohorts of people at a given time period , while in the longitudinal studies this data must be obtained for the same cohort of people but in different time periods .
each of these types of studies , cross - sectional vs. longitudinal , has their own advantages and disadvantages .
for instance , it is clear that data for cross - sectional studies can be obtained much faster than for the longitudinal studies .
in fact , to perform the aforementioned cross - sectional study , one has to collect data over a time period of five years ( 20002004 ) , while for the analogous longitudinal studies , using a cohort of people born , say , in 19051909 , to get data for all of the considered age intervals one must collect the corresponding incidence rates over 100 years .
in addition , studies of cross - sectional data can provide clues to possible time period effects during which data was collected . for instance , implementation of new diagnostic techniques in a particular time period could influence the detection of a given cancer type at earlier ages ( age - period effect ) . on the other hand , longitudinal studies ( in contrast to cross - sectional data ) can determine the influence of cohort effects on the age distribution of cancer rates ( age - cohort effect ) .
for example , dietary and life - style habits characteristic for a given generation of people can affect the cancer incidence rates . in this connection
, it must be emphasized that cross - sectional and longitudinal studies of cancer incidence rates performed independently can provide inconsistent or even confusing results .
for instance , recently , using the seer ( surveillance epidemiology and end results ) database,6 harding and colleagues4 analyzed the distribution of age - specific cancer incidence rates .
for the vast majority of the examined cancers they found that the rates collected during three time periods , 197983 , 198993 and 19992003 ( cross - sectional data ) increase up to the age of about 80 years and then fall at the oldest ages .
however , the longitudinal data for lung cancer ( lc ) presented by holford7 showed that the lc cohort risk increases with age , while the lc time period risk falls at old age .
moreover , it was suggested that there was no turnover , if both time period and cohort effects on cancer rates were considered.8 accounting for time period and cohort effects ( age - period - cohort model ) represents a main challenge for mathematical modeling of relationship between cancer incidence rates and age of cancer presentation .
this is because mathematically this problem falls into a category of so called identifiability problems with multiple estimators.9 in general , parameters to be determined ( i.e. estimates for time period and cohort effects ) as a solution of the considered problem , can not be unambiguously identified . in other words ,
multiple estimators can provide equally good solutions for the problem and true age - period - cohort effects are difficult ( if not impossible ) to estimate simultaneously.915 the only hope for solving this problem ( obtain consistent estimation for period and cohort effects ) is to utilize an additional assumption on the data that is used . until recently ,
mathematical modeling of the relationship between cancer incidence rates and the age of cancer presentation has been performed exclusively using cross - sectional data.14 to address this short - coming , we are proposing a simple , computationally efficient procedure for analyses of time period and birth cohort effects on the distribution of the age - specific incidence rates of cancers . assuming that cohort effects for neighboring cohorts are almost equal and using the log - linear age - period - cohort ( llapc ) model , this procedure allows one to evaluate temporal trends and birth cohort variations of any type of cancer without prior knowledge of the hazard function .
the proposed approach was used to analyze the influence of the time period and birth cohort effects on the lc incidence rate distributions . only first primary , microscopically confirmed cases from the seer9 database6 over the period of 19752004 were considered . using a novel approach , which is valid for any hazard function
, we demonstrated that the time period trends in men and women are different in lc , while the cohort trends are similar .
we also demonstrated that the distribution of these incidence rates falls at old ages , even after accounting for time period and birth cohort effects .
we describe a novel , computationally efficient procedure for the analysis of the time period and birth cohort effects in the frame of the llapc model .
this procedure is tested on the example of lc . in our study , we used data from only the seer registries6 that correspond to the following nine ( seer9 ) areas : atlanta , connecticut , detroit , hawaii , iowa , new mexico , san francisco - oakland , seattle - puget sound , and utah .
we used these nine registries , rather than the current set of seventeen , because the longitudinal nature of our study requires us to use data dating back two decades when there were only nine registries .
first primary , microscopically confirmed lc cases from the seer9 database for patients with known gender and race were considered to be filtered data , whereas the cases where such filtering was not performed were considered to be raw data .
we used only filtered data that are more reliable and homogeneous than raw data.5,16 the incidence rates , i(t ) , expressed per 100,000 persons and age - adjusted by the direct method to the 2000 united states standard population,17 and their standard errors , se , were utilized .
the data were combined in six five - year cross - sectional time periods : 197579 , , 20002004 .
the gender - specific incidence rates were grouped into 18 five - year age groups : 17 groups , ranging from 0 to 84 years , and the 18th group that included all cases for ages 85 + .
table 1 presents approximations of the observed incidence rates , ii , j(ti ) , as the product of a hazard function , h(ti ) ( which is a function of age t ) , the time period effect coefficient , vj , and the birth cohort effect coefficient , ul :
( 1)ii , j(ti)=vjulh(ti ) i=1 , ,
n ; j=1 , , m ; l=1 ,
, k;where i , j , and l denote the given age interval , time period , and cohort , correspondingly ; n , m , and k are numbers of the age intervals , time periods , and cohorts , correspondingly . in this table , the approximations of the cross - sectional data for six time periods 197579 , , 20002004 ( index j = 1 ,
, 6 ) are shown in columns , while the approximations of the incidence rates for the same cohort groups ( longitudinal data ) are located along diagonals .
we used only the data for the groups over age 30 ( i = 7 , , 18 ) , because the incidence rates for these groups were significant ( according to seer practice , the number of cases should exceed 15 to be statistically significant ) .
we consider 17 birth cohorts ( l = 1 , , 17 ) , corresponding to birth year ranges of 189094 , , 197074 . from this table
one can see that l can be presented as l = j i + 18 . assuming that the numbers of cases have a poisson distribution and the mathematical form of the hazard function
is known a priori and the llapc model is used , one can make adjustments by using the maximum likelihood method for assessing the birth cohort and time period effect coefficients as well as parameters of the hazard function .
these coefficients can be estimated by anchoring one time period coefficient ( v = 1 ) and one birth cohort effect coefficient ( u = 1).8,18,19 note : the results of this procedure depend on the hazard function , and also the time period and cohort , to which the coefficients are anchored .
the hazard function values , presented in table 1 , can be canceled out by dividing the corresponding elements of the neighboring columns with indices j and j + 1 or j + 1 and j. then from ( 1 ) , one can obtain a pair of systems :
( 2)ii , j(ti)ii , j+1(ti)=vjvj+1ulul+1i=7 , , 18 ; j=1 , , 5 ; l = ji+18
( 3)ii , j+1(ti)ii , j(ti)=vj+1vjul+1uli=7 , , 18 ; j=1 , , 5 ; l = ji+18 in ( 2 ) and ( 3 ) , ii , j(ti ) can be considered as the observed values of the normally distributed variables with known standard errors , sei , j .
( because we are using only the incidence rates with numbers of cases larger than 15 , the normal distribution can be used instead of the poisson distribution ) .
coefficients of variation for these rates can be estimated as :
( 4)cvi , j = sei , jii , j(ti),i=7 , , 18 ; j=1 , , 6 ; l = ji+18 note : ( 2 ) provides 12 5 conditional equations for assessing five ratios of the time period coefficients ( vj / vj+1 , j = 1 , , 5 ) , and 16 ratios of the cohort effect coefficients ( ul / ul+1 , l = 1 , , 16 ) .
analogously , ( 3 ) provides 12 5 conditional equations for assessing five ratios of the time period coefficients ( vj+1/vj , j = 1 , , 5 ) , and 16 ratios of the cohort effect coefficients ( ul+1/ul , l = 1 , , 16 ) . here , a problem of parameter identifiability arises.7,916 in particular , these systems do not have a single set of best estimates of vj+1/vj and ul+1/ul or vj / vj+1 and ul / ul+1 .
now , if we multiply the estimates of vj+1/vj by a constant and divide the estimates of ul+1/ul on this constant , the derived set of new estimates will also be as good as the initially assumed best estimates . in order to solve this identifiability problem , additional assumptions are required.915 assuming that any pair of the neighboring cohorts has the cohort effect coefficient ratio close to 1 , these ratios can be set equal to 1 in ( 2 ) and ( 3 ) .
the rationale behind this assumption is that the adjacent cohorts usually overlap in time intervals and thus values of their cohort effect coefficient should be close .
now for estimating five ratios , vj / vj+1 and five ratios vj+1/vj , one has a pair of systems :
( 5)ii , j(ti)ii , j+1(ti)=vjvj+1 i=7 , , 18 ; j=1 , , 5 .
( 6)ii , j+1(ti)ii , j(ti)=vj+1vj i=7 , , 18 ; j=1 , , 5 .
when coefficients of variation ( 4 ) are small , the standard errors of the ratios , ii , j(ti)/ii , j+1(ti ) , ii , j+1(ti)/ii , j(ti ) can be calculated by the standard rules of error propagation.20
( 7)se2(ii , j(ti)ii , j+1(ti ) ) = ( ii , j(ti)ii , j+1(ti))2(sei , j2(ti)ii , j2(ti)+sei , j+12(ti)ii , j+12(ti ) )
( 8)se2(ii , j+1(ti)ii , j(ti ) ) = ( ii , j+1(ti)ii , j(ti))2(sei , j+12(ti)ii , j+12(ti)+sei , j2(ti)ii , j2(ti ) ) it can be shown that when the numerators and denominators in ( 5 ) and ( 6 ) are normally distributed and their coefficients of variation are small , then the ratios presented in ( 5 ) and ( 6 ) will be also normally distributed .
in fact , let us assume that we have random variables a1 = a1 + 1 and a2 = a2 + 2 , where a1 0 and a2 0 are constants and 1 and 2 are normally distributed random variables with zero means and standard deviations 1 and 2 , correspondingly .
when coefficients of variation are small ( i.e. 1/a1 1 and 2/a2 1 ) , then one can express the a1/a2 and a2/a1 ratios in the bivariate taylor series around a1/a2 and a1/a2 , and consider their linear approximations :
a1a2=a1+1a2+2=a1a2 + 1a21a1a222a2a1=a2+2a1+1=a2a1 + 1a12a2a121 because 1 and 2 are normally distributed variables , these linear combinations will be also normally distributed . in the considered incidence rate data , coefficients of variation are less than 0.1 , therefore the errors of the observed incidence rate ratios of the systems ( 5 ) and ( 6 ) can be considered as normally distributed . for estimation of vj / vj+1 and vj+1/vj , a least squares method can be applied and the most efficient estimates for these ratios are the weighted means of the observed values ii , j(ti)/ii , j+1(ti ) and ii , j+1(ti)/ii , j(ti ) averaged through index i correspondingly ( weights are given as reciprocals of the square of their standard errors ) .
the se of the estimates ( vj / vj+1 ) and ( vj+1/vj ) can also be calculated in a standard way ( here and below asterisks ( * ) designate the corresponding estimates ) : after anchoring any time period coefficient ( for example , assuming that v6 = 1 and se(v6 ) = 0 ) , one can obtain step by step the following estimates of vj derived by the estimated ratios ( vj+1/vj ) :
( 9)v5*=(v5v6 ) * ; v4*=(v4v5 ) * v5 * ; v3*=(v3v4 ) * v4*;v2*=(v2v3 ) * v3 * ; v1*=(v1v2)*v2 * for the other anchored time period coefficients , the estimates of vj can be derived analogously by means of the estimates ( vj / vj+1 ) and ( vj+1/vj ) .
the se of vj can also be calculated by the standard rules of error propagation . after estimating the time period coefficients ,
the incidence rates can be corrected for the time effects and the following system can be obtained from ( 2 ) and ( 3 ) :
( 10)ii , jt(ti)ii , j+1t(ti)=ulul+1l=1 , , 17 ; j=1 , , 5 ; i = jl+18
( 11)ii , j+1tii , jt = ul+1ull=1 , , 17 ; j=1 , , 5 ; i = jl+18 here
ii , jt(ti ) denotes incidence rates corrected for the time effects . by the standard rules of error propagation
, one can calculate the se of the incidence rates ratios presented on the left side of ( 10 ) and ( 11 ) .
now , there are 12 5 conditional equations for assessing 16 ratios of the cohort effect coefficients ul / ul+1 and the same number of equations for assessing ul+1/ul .
similarly , as for ratios of time period coefficients , the ratios ul / ul+1 and ul+1/ul can be estimated by the weighted means of the incidence rate ratios of the left side of system ( 10 ) and ( 11 ) .
weights should be given according to the se of the incidence rate ratios ( reciprocal of squares of the se ) .
then , by choosing an anchored cohort coefficient , say u9 = 1 , ( se(u9 ) = 0 ) , all cohort coefficients and their se can be estimated step - by - step by a procedure analogous to one used for the time period coefficients :
( 12)u10*=(u10u9 ) * , u11*=(u11u10 ) * u10 * , , u17*=(u17u16)*u16*and
( 13)u8*=(u8u9 ) * , u7*=(u7u8)*u8 * , , u1*=(u1u2)*u2 * after evaluating time period and cohort effect coefficients , one can divide the initial incidence rates , ii , j(ti ) , with the product of vj and ul , to obtain the incidence rates corrected for time period and cohort effects :
( 14)ii , j*(ti)=ii , j(ti)vj*ul*,i=7 , , 18 ; j=1 , , 6 ; l = ji+18 the aforementioned approach looks similar to one used in.18 however , the approach used in18 is based on the assumption that the birth cohort effects are absent .
then , using the obtained time period effects , they correct the observed incidence rates and after that , estimate the ul coefficients .
in contrast to,18 our approach uses the assumption that cohort effects for any two neighboring cohorts are almost equal . as can be seen
, this assumption is not as strong as one used in.18 in addition , our procedure can assess time period and cohort coefficients without knowing the mathematical form of the hazard function , while the procedure described in18 requires prior knowledge of this function .
in our study , we used data from only the seer registries6 that correspond to the following nine ( seer9 ) areas : atlanta , connecticut , detroit , hawaii , iowa , new mexico , san francisco - oakland , seattle - puget sound , and utah .
we used these nine registries , rather than the current set of seventeen , because the longitudinal nature of our study requires us to use data dating back two decades when there were only nine registries .
first primary , microscopically confirmed lc cases from the seer9 database for patients with known gender and race were considered to be filtered data , whereas the cases where such filtering was not performed were considered to be
we used only filtered data that are more reliable and homogeneous than raw data.5,16 the incidence rates , i(t ) , expressed per 100,000 persons and age - adjusted by the direct method to the 2000 united states standard population,17 and their standard errors , se , were utilized .
the data were combined in six five - year cross - sectional time periods : 197579 ,
the gender - specific incidence rates were grouped into 18 five - year age groups : 17 groups , ranging from 0 to 84 years , and the 18th group that included all cases for ages 85 + .
table 1 presents approximations of the observed incidence rates , ii , j(ti ) , as the product of a hazard function , h(ti ) ( which is a function of age t ) , the time period effect coefficient , vj , and the birth cohort effect coefficient , ul :
( 1)ii , j(ti)=vjulh(ti ) i=1 , ,
n ; j=1 , , m ; l=1 , ,
k;where i , j , and l denote the given age interval , time period , and cohort , correspondingly ; n , m , and k are numbers of the age intervals , time periods , and cohorts , correspondingly . in this table , the approximations of the cross - sectional data for six time periods 197579 , , 20002004 ( index j = 1 ,
, 6 ) are shown in columns , while the approximations of the incidence rates for the same cohort groups ( longitudinal data ) are located along diagonals .
we used only the data for the groups over age 30 ( i = 7 , , 18 ) , because the incidence rates for these groups were significant ( according to seer practice , the number of cases should exceed 15 to be statistically significant ) .
we consider 17 birth cohorts ( l = 1 , , 17 ) , corresponding to birth year ranges of 189094 , , 197074 .
from this table one can see that l can be presented as l = j i + 18 .
assuming that the numbers of cases have a poisson distribution and the mathematical form of the hazard function is known a priori and the llapc model is used , one can make adjustments by using the maximum likelihood method for assessing the birth cohort and time period effect coefficients as well as parameters of the hazard function . these coefficients can be estimated by anchoring one time period coefficient ( v = 1 ) and one birth cohort effect coefficient ( u = 1).8,18,19 note : the results of this procedure depend on the hazard function , and also the time period and cohort , to which the coefficients are anchored . below we describe a procedure that provides results independent of the hazard function .
the hazard function values , presented in table 1 , can be canceled out by dividing the corresponding elements of the neighboring columns with indices j and j + 1 or j + 1 and j. then from ( 1 ) , one can obtain a pair of systems :
( 2)ii , j(ti)ii , j+1(ti)=vjvj+1ulul+1i=7 , , 18 ; j=1 , , 5 ; l = ji+18
( 3)ii , j+1(ti)ii , j(ti)=vj+1vjul+1uli=7 , , 18 ; j=1 , , 5 ; l = ji+18 in ( 2 ) and ( 3 ) , ii , j(ti ) can be considered as the observed values of the normally distributed variables with known standard errors , sei , j .
( because we are using only the incidence rates with numbers of cases larger than 15 , the normal distribution can be used instead of the poisson distribution ) .
coefficients of variation for these rates can be estimated as :
( 4)cvi , j = sei , jii , j(ti),i=7 , , 18 ; j=1 ,
, 6 ; l = ji+18 note : ( 2 ) provides 12 5 conditional equations for assessing five ratios of the time period coefficients ( vj / vj+1 , j = 1 , , 5 ) , and 16 ratios of the cohort effect coefficients ( ul / ul+1 , l = 1 , , 16 ) .
analogously , ( 3 ) provides 12 5 conditional equations for assessing five ratios of the time period coefficients ( vj+1/vj , j = 1 , , 5 ) , and 16 ratios of the cohort effect coefficients ( ul+1/ul , l = 1 , , 16 ) . here
, a problem of parameter identifiability arises.7,916 in particular , these systems do not have a single set of best estimates of vj+1/vj and ul+1/ul or vj / vj+1 and ul / ul+1 .
now , if we multiply the estimates of vj+1/vj by a constant and divide the estimates of ul+1/ul on this constant , the derived set of new estimates will also be as good as the initially assumed best estimates . in order to solve this identifiability problem , additional assumptions are required.915 assuming that any pair of the neighboring cohorts has the cohort effect coefficient ratio close to 1 , these ratios can be set equal to 1 in ( 2 ) and ( 3 ) .
the rationale behind this assumption is that the adjacent cohorts usually overlap in time intervals and thus values of their cohort effect coefficient should be close .
now for estimating five ratios , vj / vj+1 and five ratios vj+1/vj , one has a pair of systems :
( 5)ii , j(ti)ii , j+1(ti)=vjvj+1 i=7 , , 18 ; j=1 , , 5 .
( 6)ii , j+1(ti)ii , j(ti)=vj+1vj i=7 , , 18 ; j=1 , , 5 .
when coefficients of variation ( 4 ) are small , the standard errors of the ratios , ii , j(ti)/ii , j+1(ti ) , ii , j+1(ti)/ii ,
j(ti ) can be calculated by the standard rules of error propagation.20
( 7)se2(ii , j(ti)ii , j+1(ti ) ) = ( ii , j(ti)ii , j+1(ti))2(sei , j2(ti)ii , j2(ti)+sei , j+12(ti)ii , j+12(ti ) )
( 8)se2(ii , j+1(ti)ii , j(ti ) ) = ( ii , j+1(ti)ii , j(ti))2(sei , j+12(ti)ii , j+12(ti)+sei , j2(ti)ii , j2(ti ) ) it can be shown that when the numerators and denominators in ( 5 ) and ( 6 ) are normally distributed and their coefficients of variation are small , then the ratios presented in ( 5 ) and ( 6 ) will be also normally distributed .
in fact , let us assume that we have random variables a1 = a1 + 1 and a2 = a2 + 2 , where a1 0 and a2 0 are constants and 1 and 2 are normally distributed random variables with zero means and standard deviations 1 and 2 , correspondingly . when coefficients of variation are small ( i.e. 1/a1 1 and 2/a2 1 ) , then one can express the a1/a2 and a2/a1 ratios in the bivariate taylor series around a1/a2 and a1/a2 , and consider their linear approximations :
a1a2=a1+1a2+2=a1a2 + 1a21a1a222a2a1=a2+2a1+1=a2a1 + 1a12a2a121 because 1 and 2 are normally distributed variables
, these linear combinations will be also normally distributed . in the considered incidence rate data , coefficients of variation
are less than 0.1 , therefore the errors of the observed incidence rate ratios of the systems ( 5 ) and ( 6 ) can be considered as normally distributed . for estimation of vj / vj+1 and vj+1/vj ,
a least squares method can be applied and the most efficient estimates for these ratios are the weighted means of the observed values ii , j(ti)/ii , j+1(ti ) and ii , j+1(ti)/ii , j(ti ) averaged through index i correspondingly ( weights are given as reciprocals of the square of their standard errors ) . the se of the estimates ( vj / vj+1 ) and ( vj+1/vj ) can also be calculated in a standard way ( here and below asterisks ( * ) designate the corresponding estimates ) :
after anchoring any time period coefficient ( for example , assuming that v6 = 1 and se(v6 ) = 0 ) , one can obtain step by step the following estimates of vj derived by the estimated ratios ( vj+1/vj ) :
( 9)v5*=(v5v6 ) * ; v4*=(v4v5 ) * v5 * ; v3*=(v3v4 ) * v4*;v2*=(v2v3 ) * v3 * ; v1*=(v1v2)*v2 * for the other anchored time period coefficients , the estimates of vj can be derived analogously by means of the estimates ( vj / vj+1 ) and ( vj+1/vj ) .
the se of vj can also be calculated by the standard rules of error propagation . after estimating the time period coefficients , the incidence rates can be corrected for the time effects and the following system can be obtained from ( 2 ) and ( 3 ) :
( 10)ii , jt(ti)ii , j+1t(ti)=ulul+1l=1 , , 17 ; j=1 , , 5 ; i = jl+18
( 11)ii , j+1tii , jt = ul+1ull=1 , , 17 ; j=1 , , 5 ; i = jl+18 here
ii , jt(ti ) denotes incidence rates corrected for the time effects . by the standard rules of error propagation
, one can calculate the se of the incidence rates ratios presented on the left side of ( 10 ) and ( 11 ) .
now , there are 12 5 conditional equations for assessing 16 ratios of the cohort effect coefficients ul / ul+1 and the same number of equations for assessing ul+1/ul .
similarly , as for ratios of time period coefficients , the ratios ul / ul+1 and ul+1/ul can be estimated by the weighted means of the incidence rate ratios of the left side of system ( 10 ) and ( 11 ) .
weights should be given according to the se of the incidence rate ratios ( reciprocal of squares of the se ) .
then , by choosing an anchored cohort coefficient , say u9 = 1 , ( se(u9 ) = 0 ) , all cohort coefficients and their se can be estimated step - by - step by a procedure analogous to one used for the time period coefficients :
( 12)u10*=(u10u9 ) * , u11*=(u11u10 ) * u10 * ,
, u17*=(u17u16)*u16*and
( 13)u8*=(u8u9 ) * , u7*=(u7u8)*u8 * , , u1*=(u1u2)*u2 * after evaluating time period and cohort effect coefficients , one can divide the initial incidence rates , ii , j(ti ) , with the product of vj and ul , to obtain the incidence rates corrected for time period and cohort effects :
( 14)ii , j*(ti)=ii , j(ti)vj*ul*,i=7 ,
; l = ji+18 the aforementioned approach looks similar to one used in.18 however , the approach used in18 is based on the assumption that the birth cohort effects are absent .
then , using the obtained time period effects , they correct the observed incidence rates and after that , estimate the ul coefficients . in contrast
to,18 our approach uses the assumption that cohort effects for any two neighboring cohorts are almost equal .
as can be seen , this assumption is not as strong as one used in.18 in addition , our procedure can assess time period and cohort coefficients without knowing the mathematical form of the hazard function , while the procedure described in18 requires prior knowledge of this function .
table 2 shows the time period distributions ( presented in columns ) of the first primary , microscopically confirmed incidence lc rates for women .
the observed patterns of the cross - sectional data are shown along columns and longitudinal data along diagonals .
the cross - sectional and longitudinal data for the three consecutive cohorts that contain observations for the elderly exhibit turnovers at old age .
the longitudinal patterns shown in table 2 are different from those presented in.7 in,7 using the raw lc incidence rates for women collected in connecticut during the years of 19401984 , it was shown that the longitudinal risks always increased with age ( see table 1 in7 ) .
this discrepancy can be explained by the fact that in contrast to,7 where raw data was used , we analyzed filtered seer9 data collected during 19752004 .
figures 1a and 2a show the distributions of the filtered incidence rates for men and women , correspondingly . after estimating the time period and birth cohort effects , the incidence rates were adjusted to the 20002004 time period and to the 19451949 birth cohort .
the adjusted rates are shown in figures 1b and 2b . as can be seen , the adjusted lc incidence rate distributions for both men and women have turnovers at old ages .
the adjusted rates for men and women increase ( starting from the age of 30 ) , reach the maximum and then fall at old ages .
the differences are only in the age at which the distributions reach the maximum , and in the maximum values of the corresponding incidence rates . for men ,
this maximum is near the age of 7778 , while for women , it is near the age of 7273 .
these patterns are different from the linear patterns ( up to the age of 85 ) obtained in8 by accounting for time period and cohort effects on cancer .
again , this discrepancy can be explained by the use of raw data and an a priori assumed form of the hazard function for the time period and birth cohort adjustments used in,8 whereas we utilized only filtered data and our approach is independent of the hazard function .
panels c and d of figures 1 and 2 show the changes of the time period and cohort effect coefficients for men and women , correspondingly .
the time period effect coefficients for men increase from the year 1975 to 1980 and then decrease until 2004 . for women , these effects increase from 1975 to 1990 and then remain nearly constant .
the birth cohort effect coefficients for men and women are similar ; they increase from the cohort of 189094 until the cohort of 192529 , then decrease until the cohort of 195054 and after that remain almost unchanged .
it is possible that the observed temporal differences of the lc rates in men and women can be explained by the gender - specific smoking habits as it was suggested in21 ( see also references in that paper ) .
for analyses of the time period and birth cohort effects on the distribution of the age - specific incidence rates of cancers , a simple , computationally efficient procedure , which does not require any prior knowledge of the hazard function , was proposed .
our approach uses the llapc model and assumes that cohort effects for neighboring cohorts are almost equal .
the proposed procedure was used for analyzing the influence of the time period and birth cohort effects on the lc incidence rate distributions . however
, this procedure can be applied for different types of cancers as well as for epidemiological studies of chronic diseases .
we found that the incidence rates of first primary , microscopically confirmed lc cases from the seer9 database , adjusted by period and cohort effects , increase for both women and men , then turn over ( at ages of about 7273 and 7778 for women and men ,
thus , by utilizing the longitudinal and cross - sectional data and by accounting for time period and cohort effects , we have demonstrated that the lc incidence rates have a turnover at old ages , and the age at which this turnover takes place , is gender - specific . | a simple , computationally efficient procedure for analyses of the time period and birth cohort effects on the distribution of the age - specific incidence rates of cancers is proposed .
assuming that cohort effects for neighboring cohorts are almost equal and using the log - linear age - period - cohort model , this procedure allows one to evaluate temporal trends and birth cohort variations of any type of cancer without prior knowledge of the hazard function .
this procedure was used to estimate the influence of time period and birth cohort effects on the distribution of the age - specific incidence rates of first primary , microscopically confirmed lung cancer ( lc ) cases from the seer9 database .
it was shown that since 1975 , the time period effect coefficients for men increase up to 1980 and then decrease until 2004 . for women , these coefficients increase from 1975 up to 1990 and then remain nearly constant .
the lc birth cohort effect coefficients for men and women increase from the cohort of 189094 until the cohort of 192529 , then decrease until the cohort of 195054 and then remain almost unchanged .
overall , lc incidence rates , adjusted by period and cohort effects , increase up to the age of about 7275 , turn over , and then fall after the age of 7578 .
the peak of the adjusted rates in men is around the age of 7778 , while in women , it is around the age of 7273 .
therefore , these results suggest that the age distribution of the incidence rates in men and women fall at old ages . |
presence of endometrial glandular and stromal cells outside the uterine cavity is called endometriosis which can be diagnosed by visual inspection of the pelvis during laparoscopy .
the most common manifestations of endometriosis are dyspareunia , dysmenorrhea , pelvic pain and infertility that can have important effects on the quality of life ( 1,2 ) .
endometriosis is an estrogen dependent disease ( 3,4 ) and estradiol supports growth and inflammation process in endometriotic lesions ( 2,5 ) .
almost all treatments for endometriosis ( gnrh agonists , progestins , danazol , ocp ) have an effect on endometriosis by decreasing ovarian estrogen levels or antagonize estrogen .
in women ,
another estrogen source is androgen change into estrogen in peripheral tissues by aromatase p 450 enzyme ( 1,6 ) .
perhaps inhibition of aromatase enzyme and decreasing the peripheral conversion of androgens to estrogen could have a therapeutic effect as inhibition of endometriotic foci .
letrozoleis a drug that can inhibit aromatase enzyme and in some studies on animal models ( rats , mice and baboons ) it has led to the reduction in the size of endometriotic implants ( 7 - 10 ) .
letrozole is a drug that inhibits the aromatase enzyme by competitively binding to the cytochrome p 450 subunit of the enzyme , resulting in a reduction of estrogen biosynthesis in all tissues .
this study was conducted as a randomized controlled trial to assess the effect of letrozole on pain due endometriosis .
as letrozole can activate ovulation and is also a teratogen ( 12 ) , during its use the patient must take contraception .
we prescribed letrozole in combination with ocp in one group and in the control group we prescribed ocp only .
our sample was composed of the patients with at least one kind of endometriotic pain ( dyspareunia , dysmenorrhea , pelvic pain ) who were diagnosed as endometriotic by laparoscopy .
on laparoscopy , the surgeon tried to excise or ablate all the endometriotic implants and adhesiolysis was also performed . the day before laparoscopy
the severity of dyspareunia , dysmenorrhea and pelvic pain was estimated by visual analogue scale test ( vas test ) .
those patients who had the score of 5 or more before the operation for one of their painful symptoms ( dyspareunia , dysmenorrhea , pelvic pain ) were included in our study .
after operation , the severity of endometriosis was written in the data collection form as revised american society for reproductive medicine classification ( asrm ) scores for endometriosis ( 1,13 ) .
with the acceptance of ethic committee of tehran university of medical sciences and obtaining informed consent in cases of letrozole prescription , we prescribed ocp ( levonorgestrel 0.15 mg plus ethinyl estradiol 0.03 mg , iran hormon , tehran , iran ) daily for 4 months continuously in control group and ocp in combination with oral letrozole ( femara , 2.5 mg - novartis - switzerland ) daily for 4 months continuously in another group .
both groups took vitamin d 400iu plus calcium 1 gram ( schiff , usa ) daily for 4 months .
all of the samples were the patients who had not planned to become pregnant after discharge .
we randomized the patients by assigning to the case and control groups alternately in the order of their admission .
patients were evaluated at one and four months after operation and after starting medical treatment by office visits and telephone inquiry for severity of their endometriotic pain and drug compliance .
the patients did not have any other medical or systemic diseases . before initiation of treatment , liver function tests , serum urea , creatinin , lipids and plasma glucose were checked .
we analyzed the data by spss 13 , using the ks test ( one - sample kolmogorov - smirnov test ) for normality of data distribution , levene 's test for equality of variances and independent samples t - test for equality of means for comparing quantitative normal data between two groups , paired sample t - tests for comparing quantitative normal data between before and after treatment in each group and pearson chi - square test for matching and comparing categorical variables between two groups . according to the ks test
, we compared the non - normal quantitative data by mann - whitney u nonparametric test between two groups and wilcoxon signed ranks test for comparing before and after treatment data in each group.the categorical variables , before and after medical treatment were analyzed by mcnemar test .
in this study we had 25 patients in letrozole plus ocp group ( l group ) and 26 patients in ocp group ( o group ) .
10 patients from l group and 12 patients from o group were single and had not sexual contact .
the patients in the l group were matched with o group for marital status , severity of endometriosis and severity of pelvic pain so that there had been no significant differences ( table 1 ) .
all the patients reported improvement in the pain score within one month and four months of initiation of medical treatment .
all of the patients developed amenorrhea after initiation of therapy and none of them had bone pain .
there was no significant difference in severity of dyspareunia , dysmenorrhea and pelvic pain between the two groups before and after treatment , but after treatment the severity of the 3 mentioned symptoms was significantly reduced in both groups in comparison with their pretreatment status ( table 1,5 ) .
treatment group = letrozole
none of the patients developed any side - effects of letrozole or ocp and all continued the prescribed medication for 4 months .
the major finding of this prospective , randomized trial of letrozole plus ocp versus ocp in the treatment of endometriotic pelvic pain after ablative surgery was that there was no significant difference in outcome between the two groups and the results of both treatment modalities were similar .
there are observations of increased expression of aromatase p 450 in endometriotic tissues ( 11,14 - 16 ) and aromatase inhibitors had been successful in regressing endometriotic tissue ( 17 ) and decreasing pelvic pain ( 17 - 22 ) .
severity of dyspareunia in two groups before treatment
paired samples test(pain scores before treatment and 4 months after start of treatment in letrozole group ) table 5 .
paired samples test ( pain scores before treatment and 4 months after start of treatment in ocp group ) table 6 .
treatment group = ocp
in a retrospective study by abushahin et al . on 16 patients with endometriosis and chronic pelvic pain letrozole 2.5 mg plus norethindrone acetate 2.5 mg daily for 6 months improved pain symptoms , however pain recurred after treatment was completed ( 19 ) . in another study by verma et al .
on 4 premenopausal women with endometriosis prescription of 2.5 mg letrozole plus 2.5 mg norethisterone daily for 6 months , the mean pain score fell from 9 prior to the treatment to 4.5 at the end of treatment ( 4 ) . in a prospective study by ailawadi et al . on 10 patients with endometriosis and chronic pelvic pain , they prescribed 2.5 mg per day letrozole plus norethinderone for 6 months and after that they did a second - look laparoscopy .
on laparoscopy , there was no histologic evidence of endometriosis and pelvic pain score decreased significantly in response to treatment ( 17 ) . in a study by amesterdam et al . ,
anastrozole and ocp continuously for 6 months made reduction of pain in 93% of cases ( 23 ) . in a study by seal et al . , 5 patients with ovarian endometrioma used letrozole , 2.5 mg per day plus ocp for 6 months and they found disappearance of ovarian endometrioma and reduction of pain scores ( 24 ) .
we did not use letrozole with progestins because of break through bleeding and that they could not make adequate contraceptive effect ( because letrozole is teratogen and during its use , the patient must have effective contraception . in our study , the results of ocp prescription for endometriotic pain in comparison with letrozole plus ocp were similar .
1.we prescribed letrozole in combination with ocp and the pain reduced significantly , but it is not known that the reduction in pain severity is due to ocp as a standard regimen for endometriosis or due to letrozole itself or synergistic effect of the two .
therefore , we suggest another study to be conducted using larger sample sizes on single sexually inactive women to know the isolated effect of lerozole on pelvic pain and dysmenorrhea secondary to endometriosis .
2.we did not perform a second - look laparoscopy to determine the effect of treatment on the size of endometriotic lesions .
of course it is possible that letrozole has a reductive effect on the size of the endometriotic lesion without significant reduction in severity of subjective pain experience in patients , because the severity of symptoms is not directly related to the severity of endometriosis ( 1 ) .
the outcomes of 2 groups were similar so we may can conclude that letrozole had not any positive effect on decreasing endometriotic pain . | background : to determine the role of letrozole , an aromatase inhibitor , in the treatment of endometriotic pain .
methods : in this prospective , randomized , controlled clinical trial in minimally invasive surgery research center , 51 women with pelvic endometriosis and endometriotic pain ( dyspareunia , dysmenorrhea , pelvic pain ) score of 5 or more ( for at least one of these endometriotic pain ) , after laparoscopic diagnosis and conservative laparoscopic surgery were treated with either letrozole plus ocp ( n=25 ) or only ocp ( n=26 ) for 4 months continuously .
results : using vas test , the score of dyspareunia , dysmenorrhea and pelvic pain 4 months after the laparoscopic surgery declined significantly in both groups but the difference between results of the two groups was not significant .
conclusion : both treatment modalities showed comparable effectiveness in the treatment of pains related to endometriosis and in comparison with ocp , letrozole did not affect the outcome . |
the animal study was conducted beginning in february 2009 , and the human study was conducted beginning in june 2009 .
r. conorii , r. akari , r. rhipicephali , r. africae , r. parkeri , and o. tsutsugamushi were grown in l929 cell monolayers , purified , and titrated as reported ( 12 ) .
a suspension of each rickettsial species ( 200 l containing 1 10 rickettsia ) was injected intradermally into 8 shaved areas on the backs of 6 hartley guinea pigs ( 1 species / guinea pig ) by using aseptic procedures ( 12 ) . a negative control guinea pig was infected with 200 l ( 1 10 cells / ml ) of an l929 cell suspension .
887848 du 10/19/1987 , paris . the experimental protocol was reviewed and approved by the institutional animal care committee , universit de la mditerrane , marseille .
infection with each rickettsial species caused an eschar at the infection site ( 12 ) .
a sterile cotton swab ( copan italia s. p. a. , brescia , italy ) was rotated against the eschar ( 3 circular motions ) and stored at 4c for 24 h. swabs were then placed in 400 l of phosphate - buffered saline , and dna was extracted by using the qiaamp dna mini kit ( qiagen , hilden , germany ) .
lesions were swabbed daily until the animal showed clinical recovery ( day 20 postinfection for those infected with r. akari , r. conorii , and r. rhipicephali and day 13 postinfection for those infected with r. africae , r. parkeri , and o. tsutsugamushi )
. maximum number of dna copies for r. rhipicephali , r. akari , and r. conorii was detected on day 4 postinfection ( 2.27 10 , 2.96 10 , and 9.28 10copies/5 l of swab dna extracts , respectively ( figure 1 , panel a ) .
maximum number of dna copies for r. parkeri was detected on day 3 postinfection ( 2.66 10 copies/5 l ) , for r. africae on day 6 postinfection ( 6.73 10 copies/5 l ) , and for o. tsutsugamushi on day 10 postinfection ( 2.7 10 copies/5 l ) ( figure 1 , panel b ) .
molecular detection of rickettsia spp . in swabs of skin lesions , marseille , france .
guinea pigs were infected intradermally with different rickettsia spp . , and skin eschar swab specimens were obtained when lesions appeared . samples ( 2 1 mg ) were tested , and dna was extracted in a final volume of 100 l .
number of rickettsial dna copies was determined by quantitative pcr until day 20 postinfection for r. akari ( black line ) , r. conorii ( red line ) , and r. rhipicephali ( blue line ) ( a ) and until day 13 postinfection for r. africae ( black line ) , orientia tsutsugamushi ( red line ) , and r. parkeri ( blue line ) ( b ) .
effects of temperature and storage time of cotton swabs on bacterial dna were evaluated in 3 guinea pigs infected with r. conorii .
twelve swabs per animal were obtained daily for 5 days and stored in groups of 3 at 22c , 4c , 20c , or 80c .
storage at 4c was the optimal temperature condition for isolation of dna ( 7.53 10 copies/5 l vs. 1.03 10 , 3.77 10 , or 4.49 10 copies/5 l for swab storage at 22c , 20c , or 80c respectively ; p = 0.0001 ) ( figure 2 , panel a ) .
storage time ( 24 h , 48 h , and 72 h ) had no effect on dna yield ( figure 2 , panel b ) . temperature had a significant effect ( p<0.05 ) on dna yield and for the same extraction ( figure 2 , panels c e ) .
effect of temperature ( a ) , storage time ( b ) , and temperature and storage times ( c e ) on yield of rickettsial dna , marseille , france .
guinea pigs ( n = 3 ) were infected with rickettsia conorii and inspected daily for skin lesions .
after lesions appeared , 12 swab specimens / animal were obtained daily for 5 days and stored in groups of 3 at 22c , 4c , 20c , or 80c .
dna was extracted after storage for 24 h , 48 h , or 72 h at each temperature in a final volume of 100 l , and numbers of bacterial dna copies were quantified in 5 l of swab dna extracts by using quantitative pcr .
box plots indicate 25th and 75th percentiles , horizontal lines indicate medians , and error bars indicate minimum and maximum values .
to demonstrate the usefulness of skin lesion swabs for detection of rickettsial infection , we used this technique with eschars from patients with suspected rickettsioses .
this experiment was reviewed and approved by the local ethics committee ( reference 09016 ) .
dna was extracted from swabs or skin biopsy specimens and tested by quantitative pcrs ( qpcrs ) ( 13 ) specific for a fragment of the citrate synthase a gene , which is conserved among spotted fever group rickettsiae , or the gene coding periplasmic serine protease of o. tsutsugamushi ; -actin gene was used as a control ( 14 ) . when rickettsial dna was amplified in samples ,
specific qpcr was performed by using specific primers and probes and on the basis of clinical and epidemiologic data ( technical appendix table 1 ) ( 4 ) .
if specific rickettsial dna was not detected , pcr amplification and sequencing were performed to identify the causative agent ( 4,15 ) .
r. montanensis dna was used as a positive control , and dna from sterile biopsy samples and sterile water were used as a negative control .
the qpcr for the -actin gene showed cycle threshold ( ct ) values of 1923 for skin biopsy samples and 2237 for swab samples ( table ) . spotted fever group
rickettsial dna was detected in biopsy samples from 5/5 patients and swab samples from 8/9 patients ( technical appendix table 2 ) .
specific qpcr showed a diagnostic result in 3/7 swabs samples and 4/5 skin biopsy samples .
* ct , cycle threshold ; neg , negative ; , not applicable ; nd , not done ; pos , positive .
rickettsial dna was identified by using a fragment of the citrate synthase a gene that is conserved among all spotted fever group rickettsiae .
specific quantitative pcr was performed on the basis of epidemiologic data and tick bite history of each patient .
results for patient 9 correspond to results of re - amplification of products of the first pcrs .
we amplified r. conorii dna from patients 1 and 2 , r. africae dna from patients 4 and 5 , and r. australis dna from patient 9 .
rickettsial dna from patients 3 and 7 showed 100% homology with the r. sibirica mongolitimonae citrate synthase a gene ( genbank accession nos .
patient 9 was a technician who was accidentally infected by the aerosol route when handling r. australis .
only 2/11 swabs obtained from vesicular lesions of patient 9 were positive for rickettsial dna and r. australis dna after reamplification of primary pcr products .
these samples showed 98% homology with r. australis 23s rrna gene ( genbank accession no .
our study showed the efficacy and reliability of skin lesion swabs for molecular detection of 6 rickettsia species ( figure 1 ) .
rickettsial dnas were detected by using this technique as long as eschars persisted ( < 19 days ) . for short - term storage of swabs ,
for patients 6 , 7 , and 8 , for whom biopsy samples were not available , we confirmed the diagnosis by using swab samples .
we also showed that for patient 9 , who had a rickettsiosis but no eschar , swabbing of vesicular lesions may be useful for diagnosis , although these lesions were less sensitive than eschars .
our results indicate that swabs of eschars can be used for molecular detection of rickettsial infections when biopsy samples are not available or biopsies are difficult to perform .
we recommend that swabs be used for dna extraction immediately after sampling or stored at 4c until needed .
| to determine the usefulness of noninvasive cutaneous swab specimens for detecting rickettsiae , we tested skin eschars from 6 guinea pigs and from 9 humans . specimens from eschars in guinea pigs were positive for rickettsiae as long as lesions were present .
optimal storage temperature for specimens was 4c for 3 days . |
other than trauma , the most common cause of intracranial subarachnoid hemorrhage ( sah ) is rupture of a cerebral aneurysm .
there have been very few case reports worldwide on isolated spinal artery aneurysm rupture . although histologically similar to intracranial aneurysms , they are uncommon .
we report a case of sah due to anterior spinal artery aneurysm rupture in a renal transplant patient at our institution .
a 47-year - old hispanic male with end - stage renal disease secondary to autosomal dominant polycystic kidney disease was admitted for renal allograft transplantation . past medical history was significant for intracranial aneurysms in the left middle cerebral artery ( mca ) and in the right posterior communicating artery ( pca ) , originally diagnosed 30 months ago on magnetic resonance angiography ( mra ) of the head done for history of headaches and family history of intracranial bleeds .
he underwent stent - assisted coiling of the left mca aneurysm in september 2008 and also had a two - stage endovascular repair of the right pca aneurysm in january 2009 .
repeat mra of the head in june 2009 did not show any evidence of recurrent or residual aneurysm .
he was hospitalized in january 2010 for subacute subdural hematomas involving bilateral frontal lobes , right parietal and temporal lobes requiring burr hole evacuation . a computed tomographic ( ct ) scan of the head without contrast during that hospitalization
did not reveal sah to suggest aneurysm rupture . a repeat ct of the head 2 months later showed stable previously stented aneurysms of left mca and right pca .
he was ambulating well with the aid of physical therapy and started to complain of muscle spasm in his neck muscles and also back pain , predominantly on the left . on postoperative day five , he developed urinary retention following removal of the foley catheter .
he was seen by urology and started on tamsulosin with subsequent reinsertion of the foley catheter .
he also had severe constipation and progressive abdominal distention , which was concerning for an internal hernia .
he underwent exploratory laparotomy and was found to have ogilvie 's syndrome and a herniation of the small bowel without incarceration or obstruction .
while he was recovering from this procedure he complained of bilateral leg numbness and weakness which was initially intermittent , but progressed to persistent motor weakness of the left leg .
physical examination revealed his blood pressure to be 190/90 mm / hg , pulse 80 per minute and regular , with respirations 16 per minute .
examination was significant for a distended abdomen . on neurological examination , the patient was alert , oriented and able to follow all commands .
motor strength was zero in the left lower extremity associated with decrease in all sensory modalities with a sensory level of t12 .
neurology consult was obtained to evaluate for acute abrupt weakness of the left leg . a magnetic resonance image ( mri ) of the thoracic and lumbar spine
was ordered which showed diffuse sah throughout the spinal cord with effaced spinal cord from t7 to t12 .
the brain mri showed sah in the cerebral sulci , prepontine , premedullary and superior cerebellar cisterns ( fig . 1 , fig .
the patient was taken to the operating room with evacuation of the intradural clots with t7 to t10 thoracic laminectomies .
follow - up intracranial arterial ultrasound showed normal pulsatility indices with vasospasm of basilar artery .
he received several sessions of physical therapy with minimal recovery of left leg weakness and was subsequently discharged to a skilled nursing facility for rehabilitation .
the syndrome of sah due to lesions within the spinal canal is a known entity , but is seen infrequently in clinical practice .
aneurysm of the spinal artery is an exceptionally rare entity that can give rise to sah with an incidence of less than 1% .
henson and croft stated that though sah is an uncommon mode of presentation with spinal angiomas , such angiomas are the commonest cause of spinal sah .
however , in contrast , sah seems to be common when spinal arteriovenous malformations ( avm ) are associated with aneurysms and when spinal aneurysms occur in isolation .
spinal vascular malformations can be categorized into spinal dural arteriovenous fistulae ( avfs ) , spinal cord avms and spinal cord avfs .
patients with polycystic kidney disease have a high incidence of aneurysms , as do patients with family members who have had aneurysms .
the nidus of spinal cord avms may be intramedullary , pial or partly intra- and partly extramedullary .
spinal cord avfs are rare and have direct fistulous connection between medullary artery , usually anterior spinal artery and coronal venous plexus .
spinal artery aneurysms are usually found with other avms or entities that increase hemodynamic stress like aortic coarctation or vasculitides .
this theory also explains the formation of aneurysm in the region of the anterior communicating artery to collateral cerebral circulation .
spinal sah poses diagnostic problems in contrast to intracranial sah , especially when the lesions are located low in the lumbar region .
lesions of the thoracic region cause intense back pain , paraspinal muscle spasm , headache , photophobia and stiff neck .
the sequence of back pain followed by headache is the hallmark of sah in the thoracic region .
sah due to spinal vascular malformations may cause pain , paresis , bowel and bladder disturbances and sensory abnormalities .
minor sah can present predominantly as radicular pain that is often mistaken for a musculoskeletal problem .
presence of headache , nausea and vomiting may be the only clue to spinal sah .
patients with dural avfs present with gradual progression of sensory and motor deficits in the lower extremities with symptoms increased by physical activity .
however , dural avms often present with spontaneous hemorrhage and neurological deficits that involve both upper and lower extremities .
spinal cord avfs present with recurrent episodes of transient lower extremity weakness and symptoms of cord infarction .
current knowledge on the incidence and natural history of spinal artery aneurysms is limited to a number of case reports .
in contrast to intracranial aneurysms , the location of spinal artery aneurysms is often unrelated to arterial branching sites .
there does not seem to be any predilection for spinal aneurysms to occur at any specific segment of the spinal artery .
diagnostic imaging of patients who experience sudden onset of back pain , lower extremity radiculopathy , or both , should be evaluated for a potential source of hemorrhage from an aneurysm , when imaging findings indicate the presence of spinal sah .
selective spinal angiography seems to be the only way by which these aneurysms can be diagnosed . in many instances ,
the assumption is that the patient may have had a small aneurysm that ruptured and because of vasospasm , the aneurysm is no longer visible . in a small subset of patients , no intracranial vascular lesions
are noted on the angiography and it is conceivable that a fraction of these patients may have a high spinal vascular lesion .
surgical treatment of any spinal aneurysm should be performed only if the various types of inflammatory and noninflammatory vasculopathies are excluded as underlying etiology .
only a very few cases of sah due to isolated anterior spinal artery aneurysms have been reported in the literature .
our patient had abrupt onset of left lower extremity weakness with bowel and bladder disturbances which prompted emergent surgical evacuation of the clot and hence immediate diagnostic angiography was not performed .
whether early diagnosis of a spinal artery aneurysm with imaging studies at the first sign of neurologic manifestation would have had beneficial effects in this patient is a matter of speculation .
as many of the reported spinal aneurysms are small and have a fusiform rather than saccular shape , standard surgical treatment ( clip placement ) is not possible .
however , follow - up serial intracranial arterial ultrasound studies showed only vasospasm of the basilar artery . repeat mri of the thoracic spine showed persistence of subarachnoid blood products , but no larger foci compared to previous imaging . in conclusion ,
when spinal sah is present in the appropriate clinical setting , isolated anterior spinal artery aneurysm should be considered as a possible , treatable cause . | only a very few cases of subarachnoid hemorrhage due to isolated anterior spinal artery aneurysms have been reported in the literature .
we report a case of subarachnoid hemorrhage due to anterior spinal artery aneurysm rupture in a renal transplant patient at our institution .
a 47-year - old male had abrupt onset of left lower extremity weakness with bowel and bladder disturbances which prompted emergent surgical evacuation of the clot and hence immediate diagnostic angiography was not performed . however , follow - up serial intracranial arterial ultrasound studies showed only vasospasm of the basilar artery . repeat mri of the thoracic spine showed persistence of subarachnoid blood products , but no larger foci compared to previous imaging .
when spinal subarachnoid hemorrhage is present in the appropriate clinical setting , isolated anterior spinal artery aneurysm should be considered as a possible , treatable cause . |
mitochondria are key organelles in intermediate cellular metabolism , energy conversion , and calcium homeostasis ( dimmer and scorrano , 2006 )
. they also integrate and amplify apoptosis induced by intrinsic stimuli , releasing cytochrome c and other proapoptotic factors required for the activation of caspases ( green and kroemer , 2004 ) .
cytochrome c release is regulated by proteins of the bcl-2 family that control the permeabilization of the outer membrane ( omm ) ( danial and korsmeyer , 2004 ) .
energy conversion occurs at the inner mitochondrial membrane ( imm ) that can be further divided into two subcompartments : the so - called boundary membrane and the cristae , separated from the former by narrow tubular junctions ( frey and mannella , 2000 ) .
mitochondria become condensed , with an expanded cristae space ( hackenbrock , 1966 ) . during apoptosis , the curvature of the cristae membrane is inverted in a remodeling process required for the complete release of cytochrome c , normally confined in the cristae ( scorrano et al . , 2002 ; frezza et al . , 2006 ; yamaguchi et al . ,
cristae remodeling occurs in response to proapoptotic bh3-only bcl-2 family members , such as bid , bim - s , and bnip3 , and independently of the outer membrane multidomain bcl-2 family members bax and bak ( scorrano et al . , 2002 ; cipolat et al . , 2006 ;
whether changes in morphology of the cristae , where respiratory chain complexes ( rccs ) mainly localize ( vogel et al . , 2006 ) , affect oxidative phosphorylation efficiency , as originally predicted ( hackenbrock , 1966 ) , is unclear .
this issue is further complicated by the assembly of rcc in supercomplexes ( rcs ) ( schgger , 1995 ; acn - prez et al . , 2008 ) , quaternary supramolecular structures that , by channeling electrons among individual rccs , allow the selective use of rcc subsets for nicotine adenine dinucleotide ( nadh)- or flavin adenine dinucleotide - derived electrons ( lapuente - brun et al . , 2013 ) .
such a supramolecular organization is common in cristae : also , the mitochondrial atp synthase is assembled into dimers with greater adenosine triphosphatase ( atpase ) activity ( campanella et al .
interestingly , cristae shape and atpase dimers are linked : in yeast mutants where the atpase can not dimerize , cristae are disorganized ( paumard et al . , 2002 ;
, 2005 ; strauss et al . , 2008 ) , whereas in mammalian cells , increased cristae density favors atpase dimerization during autophagy ( gomes et al . , 2011 ) .
on the contrary , despite their importance in mitochondrial bioenergetics , the relationship between rcs and cristae shape remains unclear .
mitochondrial morphology and ultrastructure depends on mitochondria - shaping proteins that regulate organellar fusion and fission ( griparic and van der bliek , 2001 ) .
mitofusins ( mfn ) 1 and 2 , highly homologous dynamin - related proteins of the omm , orchestrate fusion ( santel and fuller , 2001 ; legros et al .
, 2002 ; chen et al . , 2003 ; santel et al . ,
mfn1 primarily participates in fusion , cooperating with the imm dynamin - related protein optic atrophy 1 ( opa1 ) ( cipolat et al . , 2004 ) , whereas mfn2 also tethers mitochondria to the endoplasmic reticulum ( de brito and scorrano , 2008 ) .
mitochondrial fission is regulated by the cytoplasmic dynamin - related protein 1 that , upon calcineurin - dependent dephosphorylation , translocates to mitochondria ( yoon et al . , 2001 ;
genetic depletion of opa1 leads to disorganization of the cristae ( frezza et al . ,
2006 ) , and oligomers that contain a soluble and a membrane - bound form of opa1 keep the cristae junctions tight , independently from opa1 role in fusion ( frezza et al . , 2006 ;
during apoptosis , these oligomers are early targets of bid , bim - s , and bnip3 , as well as of intrinsic death stimuli ( frezza et al . , 2006 ;
whereas our knowledge of the molecular determinants of cristae shape and their role in apoptosis is increasing , the relationship between cristae morphology and mitochondrial function remains unexplored .
we therefore set out to genetically dissect whether and how cristae shape regulates mitochondrial respiration .
we show that cristae morphology determines assembly and stability of rcs and hence optimal mitochondrial respiratory function during life and death of the cell .
whether apoptotic cristae remodeling that maximizes cytochrome c release from mitochondria affects mitochondrial function is unclear , mainly because it occurs around the same time as outer membrane permeabilization ( scorrano et al . , 2002 ) .
in order to genetically dissociate the two processes , we inspected the primary structure of the prototypical cristae remodeling inducer bcl-2 family member bid for homology with peptides known to perturb the mitochondrial inner membrane , like mastoparan , a 14 amino acid wasp venom component ( pfeiffer et al . , 1995 ) .
interestingly , bid membrane inserting 6 helix as well as the transmembrane domains of bnip3 and bims that also remodel cristae ( yamaguchi et al .
2010 ) displayed homology to mastoparan ( figures s1a and s1b available online ) . to exploit the role of this homologous sequence in cristae remodeling , we mutagenized the two highly conserved 157 and 158 lys h. sapiens bid residues to ala ( bid ) ( figure s1c ) . because this mutation did not impair caspase-8 cleaved recombinant bid ( cbid ) integration in purified mouse liver mitochondria ( mlm ) ( wei et al .
, 2000 ; figure s1d ) , we could measure its biological activity using an established quantitative , specific cytochrome c release elisa ( scorrano et al . , 2002 ) .
cbid efficiently released cytochrome c from purified mitochondria , whereas a bh3 domain g94e mutant was , as expected , inactive ( wei et al . , 2000 ) and the cbid mutant released 25%30% more cytochrome c than the baseline ( figure 1a ) , a figure close to the amount of free intermembrane space cytochrome c ( scorrano et al . , 2002 ) .
bak oligomerization was superimposable in cbid or cbid - treated mitochondria ( figure 1b ) ; conversely , two established assays of intramitochondrial cytochrome c redistribution , the cytochrome b5-dependent extramitochondrial nadh oxidation and the ratio of ascorbate - driven over tetramethyl - p - phenylenediamine ( tmpd)-driven respiration ( scorrano et al . , 2002 ) , indicated that cbid mobilized the cristae cytochrome c pool less efficiently than cbid ( figures 1c and 1d ) .
indeed , cbid was unable to remodel mitochondrial cristae , as indicated by morphometric analysis of electron micrographs of mitochondria treated with the bid mutants ( figures 1e and 1f ) ( scorrano et al . , 2002 ) .
cristae remodeling is associated with the disruption of high molecular weight ( hmw ) opa1 oligomers ( frezza et al . , 2006 ) .
western blots of blue native gel electrophoresis ( bnge ) of mitochondrial proteins revealed four major opa1-containing complexes . upon treatment with cbid , opa1 rapidly disappeared from 720 kda hmw complexes ( figures 1 g , s1e , and s1f ) .
these hmw forms of opa1 were similarly targeted by cbid but significantly less by cbid , as determined by bnge ( figure 1h , quantification in [ i ] ) .
chemical crosslinking experiments ( frezza et al . , 2006 ) further confirmed that the opa1-containing oligomer is disrupted by the mutants of cbid able to induce cristae remodeling ( figures s1 g and s1h ) .
finally , we measured the killing efficiency of these truncated bid ( tbid ) mutants expressed in mouse embryonic fibroblasts ( mefs ) .
only tbid efficiently killed mefs : tbid and tbid elicited comparable low levels of cell death , whereas the double tbid mutant appeared completely ineffective ( figure 1j ) , suggesting that both outer membrane permeabilization and mitochondrial cristae remodeling are required for bid - induced apoptosis . in conclusion , bid is deficient in cristae remodeling , cytochrome c release , and induction of apoptosis .
the bid mutant dissociates outer membrane permeabilization from cristae remodeling and can be used to investigate the relationship between the latter and mitochondrial function .
we therefore measured the effect of the bid mutants on the respiratory control ratio ( rcr ) , an index of respiratory efficiency , of mitochondria incubated with excess exogenous cytochrome c and nadh ( to compensate for the potential effects of inner membrane or outer membrane [ om ] permeabilization ) .
cbid reduced rcr only when mitochondria were energized with substrates for complex i ( glutamate / malate ) but not when they were fed with substrates entering the electron transport chain at complex ii ( succinate ) or complex iv ( ascorbate + tmpd ) ( figure 2a ; data not shown ) .
interestingly , these changes were recapitulated by the bh3 domain mutant cbid that does not permeabilize the om but not by the cristae remodeling - deficient mutants cbid and cbid ( figure 2b ) .
maximal ( uncoupled ) respiration was similarly affected by the cbid mutants tested , ruling out that bid alters rcr , because it affects atpase or activity or atp / adp exchange ( figure s2a ) .
these experiments suggest that cristae remodeling causes complex i - dependent changes in mitochondrial bioenergetics .
complex i is further assembled in quaternary functional rcs with complexes iii and iv ( i + iii and i + iii + iv ) , whereas most complex ii is not found in rcs ( acn - prez et al . , 2008 ) .
thus , the reduction in complex i - supported respiration could be a consequence of specific inhibition of complex i or of issues in rcs function . even after 30 min of acute bid treatment ,
the specific complex i nadh - ubiquinone reductase activity of purified mitochondria was unaltered ( data not shown ) , prompting us to investigate rcs assembly and stability in situ .
we therefore took advantage of bax , bak ( dko ) mefs , resistant to mitochondrial permeabilization , cytochrome c release , and apoptosis triggered by expression of tbid ( wei et al . , 2001 ) .
upon transduction of metabolically labeled dko mefs with tbid but not with tbid that does not cause cristae remodeling ( figure s2b ) , the rcs radioactivity signal as well as the rcs / complex v radioactivity ratio were reduced ( figures 2c and 2d ) , and we observed a reduction in the autoradiographic signal of cytochrome b retrieved in rcs compared to that in free complex iii ( figures 2e and 2f ) . whereas this result could suggest that complex iii was incorporated less efficiently into rcs , immunoblotting for the complex i subunit ndufa9 revealed that rcss were also destabilized in dko cells ( figure 2 g ) .
functionally , only cbid and cbid that cause cristae remodeling but not cbid reduced glutamate - supported rcr in dko mitochondria ( figure 2h ) .
whether rcs disorganization was a general consequence of altered cristae shape , we turned to cells lacking opa1 , a key regulator of cristae morphology ( frezza et al . ,
however , chronic opa1 depletion impaired mitochondrial dna ( mtdna ) levels and translation ( figures s3a and s3b ) , complicating the analysis of the relationship between opa1 and rcs and calling for a model of conditional opa1 ablation .
we produced , by homologous recombination , c57bl6/j embryonic stem cells with loxp sites inserted in the opa1 gene ( opa1 ) , which were then microinjected in c57bl6/j blastocysts to generate opa1 mice .
following cre - mediated recombination , the deletion of exons 2 and 3 resulted in an aberrant exon1exon4 transcript with a stop codon immediately after exon 1 , producing a predicted 10 amino acid ( aa ) residual protein ( figures 3a and 3b ) .
chimerism and germ - line transmission of the offspring was tested by pcr , and germ - line transmittants were bred to homozygosity ( figure 3c ) .
fibroblasts isolated from the diaphragm of homozygous opa1 7-week - old male mice ( mafs ) were immortalized and used for subsequent analysis .
opa1 was completely ablated 24 hr after adenoviral delivery of cre recombinase ( figure 4a ) and , as expected , mitochondria were fragmented ( figures 4b and 4c ) with defects in cristae shape ( figures 4d and 4e ) .
four days after cre - mediated opa1 ablation , mtdna copy number ( figure 4f ) and translation ( figures 4 g and 4h ) were unaffected , allowing us to specifically address the role of opa1 and cristae shape in rcs assembly using an assay based on the incorporation of radiolabeled mtdna - encoded proteins into rcc and rcs ( acn - prez et al . , 2008 ) .
upon acute opa1 ablation , the assembly of mtdna - encoded subunits into rcc was not affected ( data not shown ) .
we therefore followed the rcs assembly rate ( measured as the ratio between rcs and complex v radioactivity throughout the chase period ) that resulted 8-fold slower when opa1 was ablated from opa1 mafs ( figures 4i and 4j ) .
a similar reduction in the rcs assembly rate was observed in opa1 mefs ( figure s3c ) , suggesting that , in absence of opa1 , rcc are less superassembled , irrespective of their initial levels . to test if acute opa1 ablation altered rcs in vivo , we tail vein - injected cre - expressing adenoviruses in opa1 animals . after 72 hr ,
s4a ) , cristae morphology was abnormal ( figure s4b ) , rcs were reduced ( figure s4c ) , and glutamate / malate rcr was impaired ( figure 4k ) .
these experiments of conditional ablation of opa1 identify a role for cristae shape in rcs assembly in vitro and in vivo .
the model linking cristae shape to rcs predicts that higher opa1 levels should favor rcs assembly . to verify this hypothesis , we wanted to generate a mouse model of opa1 overexpression .
very high opa1 levels are , however , toxic , causing paradoxical mitochondrial fragmentation ( cipolat et al . , 2004 ) : we therefore targeted , by homologous recombination in the murine x chromosome hprt region , a transgene - carrying mouse variant 1 opa1 under the human -actin promoter ( opa1 ) ( figure 3d ) .
the integration into microinjected bpes embryonic stem cells was verified by pcr ( figure 3e ) , and the cells were microinjected into c57bl6/j blastocysts .
six generated agouti chimeras with a chimerism exceeding 90% were bred with c57bl6/j mates and tested for germline transmission by fur color and transgene pcr analysis ( figure 3f ) .
mice were viable , fertile , grew normally , and resisted to different forms of tissue damage ( t.v .
r. menab , m. sandri , f. di lisa , and l.s . , unpublished data ) . immortalized
mafs prepared from the diaphragm of hemizygous opa1 7-week - old c57bl6/j male mice displayed an 1.5 increase in opa1 levels compared to age- and sex - matched littermate controls mafs ( wild - type [ wt ] ; figure 5a ) .
mitochondria were slightly elongated ( figures 5b and 5c ) and cristae tighter ( figures 5d and 5e ) , without any difference in mtdna levels ( figure 5f ) and translation ( figures 5 g and 5h ) .
importantly , in opa1 mafs , rcs assembly ( figures 5i and 5j ) and glutamate - supported rcr ( figure
an 50% increase in liver mitochondria opa1 levels ( figure s5a ) was similarly associated to tighter cristae ( figure s5b ) and increased rcs levels ( figure s5c ) . taken together , these results indicate that rcs assembly is facilitated by increased opa1 levels and tighter cristae .
we therefore measured the growth of dko cells ( resistant to bid - induced outer membrane permeabilization , caspase - dependent mitochondrial damage , and apoptosis ) in galactose media , where most of cellular atp comes from the respiratory chain ( acn - prez et al . , 2004 ) .
wt and g94e tbid impaired growth in galactose , whereas cells transduced with tbid that does not cause cristae remodeling did not display any defect ( figure 6a ) .
growth in galactose - containing media was impaired upon acute ablation of opa1 in mafs , whereas it was normal for fusion - deficient mfn1 , mfn2 mefs ( figures 6b and 6c ) , where mitochondrial fusion is also inhibited . in mfn1 , mfn2 mefs ,
mtdna copy number was reduced ( figure s6a ) , but cristae shape ( figures s6b and s6c ) , mtdna translation ( figure s6d ) , rcs stability ( figure s6e ) , and assembly ( figure s6f ) were not affected .
thus , the galactose growth defect is not the consequence of impaired fusion but correlates with altered cristae shape and rcs . finally , opa1 mafs grew faster than their wt counterparts in galactose media ( figure 6d ) , further confirming the link between cristae shape , rcs levels , and mitochondria - dependent cellular growth . in conclusion ,
respiratory chain supercomplexes have been considered bnge artifacts until direct respirometric experiments on purified rcs identified them as the functional mitochondrial respiratory units ( acn - prez et al . , 2008 ) . since then
, rcs have been directly visualized in intact cristae by electron tomography ( davies et al . ,
2011 ) , complex iv assembly factors that favor rcs formation have been identified ( chen et al . , 2012 ;
2013 ) , and the role of rcs in mitochondrial utilization of reducing equivalents has been demonstrated ( lapuente - brun et al . , 2013 ) .
however , the relationship between cristae shape and rcs , as well as between rcs and mitochondrial function , remained obscure .
our results demonstrate that cristae shape regulates respiratory chain supercomplexes stability and assembly , impacting on respiratory efficiency and respiratory cell growth . to dissect the role of cristae shape in rcs structure and function , we genetically ablated the master cristae shape regulator opa1 .
individual respiratory chain units associate with opa1 ( zanna et al . , 2008 ) , and mitochondrial metabolism is deranged in dominant optic atrophy caused by opa1 mutations ( lodi et al . , 2004 ) .
however , the defect in atp production in opa1 haploinsufficient cells was unexplained : opa1 is not essential for assembly of respiratory chain complexes and mtdna levels as well as activities of individual respiratory chain complexes are normal in dominant optic atrophy ( zanna et al . , 2008 ) .
conversely , the reduction in mtdna copy number has been invoked to explain the mitochondrial dysfunction of fusion - deficient cells from mfn1 , mfn2-deficient mice ( chen et al . , 2010 ) .
our results challenge this hypothesis : upon acute opa1 ablation , mtdna levels are normal , whereas cristae shape , rcs , complex - i - dependent respiration , and respiratory growth are impaired .
conversely , in mfn1 , mfn2 cells , mtdna copy number is reduced , but cristae shape , rcs , and respiratory growth are normal .
thus , rcs disorganization shall be regarded as a key mechanism of mitochondrial dysfunction accompanying altered organelle morphology .
the role of opa1 and cristae shape in rcs organization is further supported by mouse models of opa1 conditional ablation and mild overexpression .
the first tool allowed us to dissociate cristae biogenesis from mtdna maintenance : whereas chronic opa1 depletion reduces mtdna copy number and translation , upon acute opa1 ablation , mtdna levels are normal , but cristae are disorganized , impacting on rcs assembly and respiratory function and growth .
thus , mtdna reduction appears to be a consequence of chronic fusion inhibition in opa1 ( and double mfn ) cells .
we can therefore predict that the opa1 cells will be useful to elucidate how prolonged inhibition of mitochondrial fusion results in mtdna levels reduction .
opa1 mild overexpression lends further support to the model linking rcs organization to cristae shape : rcs assembly and respiratory function and growth are increased in opa1 cells without any measurable change in mtdna levels and translation .
the opa1 mouse will be instrumental to investigate the role of opa1 and cristae shape in vivo .
the role and mechanisms of cristae remodeling in apoptosis are controversial ( scorrano et al . , 2002 ; germain et al . , 2005 ; frezza et al . , 2006 ; yamaguchi et al . , 2008 ;
2010 ) , cristae remodeling has been reckoned as a mere feedback mechanism in situ , occurring after caspase activation ( sun et al . , 2007 ) .
our results suggest that , in addition to its role in cytochrome c release , cristae remodeling also impairs mitochondrial function to precipitate apoptosis .
the bid 6 mutant generated here , which does not induce cristae changes and cytochrome c mobilization but permeabilizes the outer membrane , can be a useful tool to dissect in vivo the involvement of cristae remodeling in developmental and homeostatic apoptosis .
we think that cristae remodeling influences rcs by targeting opa1 ( frezza et al . , 2006 ) , not by altering membrane potential that is normal during cristae remodeling ( scorrano et al . , 2002 ) or by inhibiting mtdna translation and insertion of mtdna - encoded subunits that similarly appear normal in dko cell - expressing bid ( data not shown ) .
our work unravels a role for cristae shape in rcs assembly and stability , mitochondrial respiratory efficiency , and respiratory growth , suggesting that shape of biological membranes can influence membrane protein complexes .
moreover , our data highlight the importance of rcs in respiration by complex i - feeding substrates .
the pathogenesis of dominant optic atrophy where opa1 is mutated ( alexander et al . ,
2000 ) or of other mitochondrial diseases where opa1 is degraded ( duvezin - caubet et al . ,
2006 ) could also depend on this unexpected opa1 function . in these latter settings , stabilization of opa1 could correct rcs and therefore mitochondrial dysfunction , opening novel therapeutic perspectives for currently intractable diseases .
to generate opa1 mice , a mouse bac clone containing the opa1 gene was isolated from the c57bl/6j es bac clone library . an 11 kb hpai dna restriction fragment containing
the opa1 fragment was excised with ecorv and xmal to generate blunt ends and inserted into a pko4.4a - loxp cut with xhoi and sali .
a loxp site was introduced between intron1 and exon2 of opa1 and a phosphoglycerate kinase ( pgk ) promoter - driven neomycin resistance gene , flanked by two frt sequences and with one loxp sequence downstream , was inserted in intron3 .
the targeting vector was linearized and electroporated into c57bl6 embryonic stem cells ( escs ) .
three mutated esc lines were microinjected into c57bl6 blastocytes and implanted in host mice to obtain chimeric mice , which were then bred with c57bl6 mates and their offspring tested by pcr for germline transmission .
the human -actin promoter was extracted from pdrive - h-actin ( invivogen ) using spei and ncoi and cloned in pentry . the complementary dna of mouse isoform 1 opa1 and polya extracted from pcdna3.1-opa1 ( cipolat et al . ,
2004 ) using nhe1 and ecii was ligated into pentry using quick ligase ( ozyme ) .
the transgene was then inserted by homologous recombination in a pdest vector containing part of the human hypoxanthine phosphoribosyltransferase locus .
the resulting vector was linearized using pvui and electroporated into c57bl6 bpes cells by nucleis ( france ) .
three positive esc recombinant clones were microinjected into c57bl6 blastocysts and implanted into host pseudopregnant female c57bl6 to obtain chimeric mice .
six chimeras ( identified by fur agouti color ) were bred with c57bl6 mates , and germline transmission was verified by fur color and pcr .
mitochondria ( 10 mg / ml ) were suspended in buffer d ( 1 m 6-aminohexanoic acid , 1.25% v / v digitonin , 50 mm bis - tris - hcl , ph 7 ) and centrifuged .
the supernatant was collected , and 5% serva blue g dye in 1 m 6-aminohexanoic acid was added to 1/3 of the final sample volume .
equal amounts ( 100 g ) of mitochondrial proteins were separated by 3%13% gradient bnge ( schgger , 1995 ) . for rcs detection ,
the concentration of digitonin in buffer d was 4% ( v / v ) . for two - dimensional ( 2d ) blue native ( bn)/bnge ,
the lane cut from the first - dimension bnge was casted on top of a native 3%14% gradient gel in 1% ( v / v ) dodecyl maltoside . for 2d bn / sds page ,
the lane cut from the first - dimension bnge was incubated for 1 hr at 25c in 1% sds and 1% -mercaptoethanol and then casted on top of an 8% or a 16.5% denaturing gel .
after electrophoresis , the complexes were electroblotted on a polyvinylidene fluoride ( pvdf ) membrane and probed with the indicated antibodies . to detect rcs from radiolabelled cells ,
samples were treated as described above , and after electrophoresis , the gels were dried and the signal was detected following exposure for 36 days .
labeling of mtdna - encoded proteins was performed with [ s]-methionine and cysteine ( express protein labeling mix , perkin elmer life sciences ) .
cells were preincubated for 12 hr in the presence of 40 g / ml chloramphenicol in uridine - supplemented medium and then exposed for 2 hr to the [ s ] protein labeling mix ( pulse ) in the presence of 50 g / ml cycloheximide .
cells were washed for four times with pbs and cold dulbecco s modified eagle s medium ( dmem ) and then cultured for the indicated time ( chase ) prior to lysis and protein separation by bnge .
to assay basal mtdna translation , equal protein amounts ( 40 g ) from cells metabolically labeled as described above treated for 30 min with 50 g / ml emetine were separated by sds - page .
mitochondria from liver of mice and from the indicated cell lines were isolated as in frezza et al .
cytochrome c release , ascorbate / tmpd - driven respiration and cytochrome b5-dependent nadh oxidation were determined as described ( scorrano et al . ,
crosslinking , mitochondria treated as indicated were incubated with 1 mm 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride ( edc ) or 1 mm bismaleimidohexane ( bmh ) , as previously described ( frezza et al . , 2006 ) .
carbonate extraction was performed as previously described ( dimmer et al . , 2008 ) .
details and procedures for sds - page and immunoblotting can be found in the extended experimental procedures .
the retroviral vector pmig - tbid was described previously ( cheng et al . , 2001 ) .
kkaa , g94e , and g94ekkaa mutants were generated by site - direct mutagenesis using kod polymerase ( biolabs ) .
to measure mtdna copy number , total cellular dna was amplified using specific oligodeoxynucleotides for mt - co2 and sdha by real - time pcr .
mefs and human embryonic kidney 293 cells ( hek293 ) cells were cultured as described ( gomes et al . , 2011 ) .
when indicated , in dmem , glucose was substituted with 0.9 mg / ml galactose .
ecotropic viruses were generated as described ( cheng et al . , 2001 ) .
wt , opa1 , opa1 , and mafs sv40 transformed cell lines were generated from the diaphragm of the respective 7-week - old mouse killed by cervical dislocation .
acute opa1 ablation in opa1 mafs was obtained by infection with adenoviruses expressing cytomegalovirus ( cmv)-cre - gfp ( ad - cre ; 300 pfu / cell ; vector biolabs ) .
opa1 mafs were infected and dko mefs were transduced 24 or 16 hr before the growth was assessed .
apoptosis was measured by flow cytometric detection ( facscalibur ) of the annexin - v - pe positive events in the gfp - positive population .
details can be found in the extended experimental procedures . for mitochondrial imaging , cells stained with a rabbit polyclonal anti - tom20 ( santa cruz ; 1:200 ) , as previously described ( frezza et al . , 2006 )
electron microscopy ( em ) was performed as described ( scorrano et al . , 2002 ) .
details can be found in the extended experimental procedures . extended experimental proceduresmouse handlingfor genotyping of the opa1 mice ,
the following primers were used : primer ck1 5-cag tgt tga tga cag ctc ag-3 ; primer ck2 5-cat cac aca cta gct tac att tgc-3. for genotyping of the opa1 mice , the following primers were used : primer tgf 5-gca atg acg tgg tcc tgt tttg-3 ; primer tgr 5-gat agg tca ggt aag caa gca ac-3 ; primer wtr 5-gag gga gaa aaa tgc gga gtg-3 ; primer wtf 5-ctc cgg aaa gca gtg agg taa g-3.all mice procedures were performed according to protocols approved by the local ethic committees ( protocol 32/2011 ceasa university of padova , venetian institute of molecular medicine ; license 1034/3703/02 cantonal veterinarian authority , university of geneva ) .
opa1 mice were tail injected with adenoviruses ( 2x10 pfu ) ( vector biolabs ) .
after 3 days , they were killed by cervical dislocation and the liver was extracted.mitochondrial assaysmitochondria from mouse liver and from the indicated cell lines were isolated as described ( frezza et al . , 2007 ) .
mitochondria were isolated from opa1 mice 3 days after the tail - vein injection of the indicated adenoviruses .
cytochrome c release , ascorbate / tmpd - driven respiration and cytochrome b5-dependent nadh oxidation were determined as described ( scorrano et al . , 2002 ) . to measure respiration , mitochondria ( 1
mg / ml ) were incubated in experimental buffer ( eb : 150 mm kcl , 10 mm tris mops , 10 m egta - tris , 10m atp ) . to determine bid effect of rcr
, eb was supplemented with 5 m cytochrome c , 2 mm nadh and 3.2 pmol mg cbid . when indicated , mitochondria were transferred into a clark s type oxygen electrode chamber and 5 mm glutamate /2.5 mm malate or 2 m rotenone/10 mm succinate were added .
basal o2 consumption was recorded ( state 2 ) and after 2 min 100 m adp was added ( state 3 ) , followed by 2.5 g / ml oligomycin ( state 4 ) and 200 m fccp ( state 3u ) . for complex iv dependent - o2 consumption , mitochondria ( 1 mg / ml ) were incubated for the indicated time in eb supplemented with 5 m cytochrome c. mitochondria were treated with 1 nmol / mg antimycin a and 2 nm rotenone and they were transferred into a clark s type oxygen electrode chamber . after 2 min 6 mm ascorbate and 300 m tmpd were added and the complex iv - dependent o2 consumption rate was measured.the enzymatic activity of complex i and citrate synthase was determined as described ( spinazzi et al . , 2012).transmission electron microscopyem of cells and isolated mitochondria were performed as described ( scorrano et al . , 2002 ) and
thin sections were imaged on a tecnai-20 electron microscope ( philips - fei ) . for morphometric analysis of mitochondrial
cristae , cristae width was measured using the image j multimeasure plug-in.measurement of mitochondrial dna copy numbertotal cellular dna was isolated using phenol / chlorophorm 24:25 ( v / v ) and was amplified using specific oligodeoxynucleotides for mt - co2 and sdha by real - time pcr using platinum sybr green qpcr supermix ( invitrogen ) following manufacturer s indications .
the mtdna copy number per cell was calculated using sdha amplification as a reference for nuclear dna content.imaging4x10 cells seeded on 13 mm round glass coverslips were fixed , permeabilized and blocked as previously described ( frezza et al . , 2006 ) and then stained with a rabbit polyclonal anti - tom20 ( santa cruz , 1:200 ) overnight at 4c . after washing with pbs
, cells were incubated with texasred conjugated goat anti - rabbit ( 1:500 , invitrogen ) for 1 hr at room temperature and coverslips were mounted on slides using prolong gold antifade reagent ( invitrogen ) and analyzed by confocal microscopy .
adenovirus infected cells were identified by expression of gfp.confocal images were acquired using a nikon eclipse te300 inverted microscope equipped with a spinning - disk perkinelmer ultraview lci confocal system , a piezoelectric z axis motorized stage ( pifoc , physik instrumente ) , and an orca er 12-bit ccd camera ( hamamatsu photonics ) . for detection of gfp or texasred fluorescence
, samples were excited using the 488 nm or the 543 nm lines of a he ne laser ( perkinelmer , waltham , ma , usa ) with exposure times of 100 - 200 ms using a 60x , 1.4 na plan apo objective ( nikon ) .
measurement of mitochondrial major axis length was performed in at least five mitochondria per cell , in a minimum of 50 cells / experiment ( 250 mitochondria / experiment ) .
mitochondrial length was then quantified using the roi manager plug - in of imagej software.biochemistryfor protein crosslinking , mitochondria treated as indicated were incubated with 1 mm edc or 1 mm bmh as previously described ( frezza et al . , 2006 ) .
for sds - page , mitochondrial proteins ( 20 g ) were separated on 3%8% tris - acetate or 4%12% tris - glycine ( nupage , invitrogen ) polyacrilamide gels , transferred onto pvdf membranes ( biorad ) and probed using the indicated primary antibodies and isotype matched secondary antibodies conjugated to horseradish peroxidase whose signal was detected with ecl ( amersham ) .
the following primary antibodies were employed : monoclonal anti - opa1 ( 1:1000 bd pharmingen ) , rabbit polyclonal anti - bak - nt ( 1:1000 upstate ) , mouse monoclonal anti - fp subunit ( 1:5000 ) , mouse monoclonal anti - ndufa9 subunit ( 1:1000 ) , mouse monoclonal anti - core2 subunit ( 1:1000 ) , mouse monoclonal anti - co1subunit ( 1:1000 ) ( mitoscience ) , mouse monoclonal anti - vdac1 ( 1:1000 abcam ) , rabbit polyclonal anti - tom20 ( 1:1000 santa cruz ) , mouse monoclonal anti - tim23 ( 1:1000 bd pharmingen ) , rabbit polyclonal anti - bid ( 1:1,000 , a kind gift of a. gross , weizmann institute , rehovot ) .
densitometry was performed by analyzing optical density using gel pro analyzer.carbonate extraction was performed as previously described ( dimmer et al . ,
2008).molecular biologythe retroviral vector pmig - tbid was described previously ( cheng et al . , 2001 ) .
kkaa , g94e and g94ekkaa mutants were generated by site - direct mutagenesis using kod polymerase ( biolabs ) and the following primers : for bid forward 5-aca atg ctg ttg gcc gcc gcc gtg gcc agt cac-3 and reverse 5-gtg act ggc cac ggc ggc ggc caa cag cat tgt-3 ; for bid forward 5-ctc gcc caa ata gaa gat gag atg gac cac aac-3 and reverse 5-gtt gtg gtc cat ctc atc ttc tat ttg ggc gag-3.recombinant protein expressionp7/p15 recombinant bid was produced , purified and cleaved with caspase-8 as described ( frezza et al .
, 2006).assays of cell growth and deaththe growth of wt , opa1 mafs was determined by counting viable cells ( as determined by trypan blue exclusion ) daily for 5 days .
1.5x10
opa1 mafs were infected with the indicated adenoviruses and after 24 hr the growth was determined by counting viable cells ( as determined by trypan blue exclusion ) daily for 4 days .
1.5x10 dko mefs were transduced with the indicated retroviruses and after 16 hr the growth was determined by counting viable gfp positive cells by flow cytometry.for measurements of apoptosis , 1.5x10 cells of the indicated genotype grown in 6 well - plates were transfected with the indicated vector .
after 48 hr apoptosis was measured by flow cytometric detection ( facscalibur ) of the annexin - v - pe positive events in the gfp - positive population.cell culture , transfection , virus production , and transductiondko mefs and hek293 cells were cultured as previously described ( gomes et al . , 2011 ) . when indicated , glucose in dmem was substituted with 0.9 mg / ml galactose .
cells were transfected using transfectin ( biorad ) following manufacturer s instruction.ecotropic viruses were generated by cotransfecting the hek293 packaging cell lines with the packaging vector pik and the appropriate pmig as previously described ( cheng et al . , 2001 ) .
viral supernatant were retrieved and used to transduce dko mefs in the presence of 4 g / ml of hexadimethrine bromide ( sigma ) .
following an over - night transduction , the rate of gfp expression was typically around 70% as determined by flow cytometry.wt , opa1 , opa1 , mafs sv40 transformed cell lines were generated respectively from wt , opa1 , opa1 mice .
male 7 weeks old mice were killed by cervical dislocation and their diaphragm were carefully dissected , washed in dmem , minced and then enzymatically digested with a collagenase 0.5% ( sigma ) solution for 10 min at 37c .
cell were spun at 200 g for 3 min , resuspended in dmem containing 4.5 mg / ml glucose , 10% fetal bovine serum ( fbs ) , 50 u / ml penicillin , 50 g / ml streptomycin , 100 m nonessential aminoacids ( gibco ) , 50 g / ml uridine , 25 mm hepes ( gibco ) , 2.5 g / ml fungizone ( gibco ) and seeded on a 0.1% gelatin ( sigma ) precoated plate .
after 15 min the supernatant was removed and the adherent fibroblasts were left growing in complete dmem .
mafs were transformed using an sv40 large t antigen expressing plasmid as previously described ( cipolat et al . , 2006 ) and
for genotyping of the opa1 mice , the following primers were used : primer ck1 5-cag tgt tga tga cag ctc ag-3 ; primer ck2 5-cat cac aca cta gct tac att tgc-3. for genotyping of the opa1 mice , the following primers were used : primer tgf 5-gca atg acg tgg tcc tgt tttg-3 ; primer tgr 5-gat agg tca ggt aag caa gca ac-3 ; primer wtr 5-gag gga gaa aaa tgc gga gtg-3 ; primer wtf 5-ctc cgg aaa gca gtg agg taa g-3. all mice procedures were performed according to protocols approved by the local ethic committees ( protocol 32/2011 ceasa university of padova , venetian institute of molecular medicine ; license 1034/3703/02 cantonal veterinarian authority , university of geneva ) .
opa1 mice were tail injected with adenoviruses ( 2x10 pfu ) ( vector biolabs ) .
after 3 days , they were killed by cervical dislocation and the liver was extracted .
mitochondria from mouse liver and from the indicated cell lines were isolated as described ( frezza et al . , 2007 ) .
mitochondria were isolated from opa1 mice 3 days after the tail - vein injection of the indicated adenoviruses .
cytochrome c release , ascorbate / tmpd - driven respiration and cytochrome b5-dependent nadh oxidation were determined as described ( scorrano et al . ,
2002 ) . to measure respiration , mitochondria ( 1 mg / ml ) were incubated in experimental buffer ( eb : 150 mm kcl , 10 mm tris mops , 10 m egta - tris , 10m atp ) . to determine bid effect of rcr ,
eb was supplemented with 5 m cytochrome c , 2 mm nadh and 3.2 pmol mg cbid . when indicated , mitochondria were transferred into a clark s type oxygen electrode chamber and 5 mm glutamate /2.5 mm malate or 2 m rotenone/10 mm succinate were added .
basal o2 consumption was recorded ( state 2 ) and after 2 min 100 m adp was added ( state 3 ) , followed by 2.5 g / ml oligomycin ( state 4 ) and 200 m fccp ( state 3u ) . for complex iv dependent - o2 consumption , mitochondria ( 1 mg / ml ) were incubated for the indicated time in eb supplemented with 5 m cytochrome c. mitochondria were treated with 1 nmol / mg antimycin a and 2 nm rotenone and they were transferred into a clark s type oxygen electrode chamber .
after 2 min 6 mm ascorbate and 300 m tmpd were added and the complex iv - dependent o2 consumption rate was measured . the enzymatic activity of complex i and citrate synthase was determined as described ( spinazzi et al .
em of cells and isolated mitochondria were performed as described ( scorrano et al . , 2002 ) and thin sections were imaged on a tecnai-20 electron microscope ( philips - fei ) . for morphometric analysis of mitochondrial cristae , cristae width was measured using the image j multimeasure plug - in .
total cellular dna was isolated using phenol / chlorophorm 24:25 ( v / v ) and was amplified using specific oligodeoxynucleotides for mt - co2 and sdha by real - time pcr using platinum sybr green qpcr supermix ( invitrogen ) following manufacturer s indications .
the mtdna copy number per cell was calculated using sdha amplification as a reference for nuclear dna content .
4x10 cells seeded on 13 mm round glass coverslips were fixed , permeabilized and blocked as previously described ( frezza et al . , 2006 ) and then stained with a rabbit polyclonal anti - tom20 ( santa cruz , 1:200 ) overnight at 4c . after washing with pbs
, cells were incubated with texasred conjugated goat anti - rabbit ( 1:500 , invitrogen ) for 1 hr at room temperature and coverslips were mounted on slides using prolong gold antifade reagent ( invitrogen ) and analyzed by confocal microscopy .
confocal images were acquired using a nikon eclipse te300 inverted microscope equipped with a spinning - disk perkinelmer ultraview lci confocal system , a piezoelectric z axis motorized stage ( pifoc , physik instrumente ) , and an orca er 12-bit ccd camera ( hamamatsu photonics ) . for detection of gfp or texasred fluorescence
, samples were excited using the 488 nm or the 543 nm lines of a he ne laser ( perkinelmer , waltham , ma , usa ) with exposure times of 100 - 200 ms using a 60x , 1.4 na plan apo objective ( nikon ) .
measurement of mitochondrial major axis length was performed in at least five mitochondria per cell , in a minimum of 50 cells / experiment ( 250 mitochondria / experiment ) .
mitochondrial length was then quantified using the roi manager plug - in of imagej software . for protein
crosslinking , mitochondria treated as indicated were incubated with 1 mm edc or 1 mm bmh as previously described ( frezza et al . , 2006 ) .
for sds - page , mitochondrial proteins ( 20 g ) were separated on 3%8% tris - acetate or 4%12% tris - glycine ( nupage , invitrogen ) polyacrilamide gels , transferred onto pvdf membranes ( biorad ) and probed using the indicated primary antibodies and isotype matched secondary antibodies conjugated to horseradish peroxidase whose signal was detected with ecl ( amersham ) .
the following primary antibodies were employed : monoclonal anti - opa1 ( 1:1000 bd pharmingen ) , rabbit polyclonal anti - bak - nt ( 1:1000 upstate ) , mouse monoclonal anti - fp subunit ( 1:5000 ) , mouse monoclonal anti - ndufa9 subunit ( 1:1000 ) , mouse monoclonal anti - core2 subunit ( 1:1000 ) , mouse monoclonal anti - co1subunit ( 1:1000 ) ( mitoscience ) , mouse monoclonal anti - vdac1 ( 1:1000 abcam ) , rabbit polyclonal anti - tom20 ( 1:1000 santa cruz ) , mouse monoclonal anti - tim23 ( 1:1000 bd pharmingen ) , rabbit polyclonal anti - bid ( 1:1,000 , a kind gift of a. gross , weizmann institute , rehovot ) .
carbonate extraction was performed as previously described ( dimmer et al . , 2008 ) .
the retroviral vector pmig - tbid was described previously ( cheng et al . , 2001 ) .
kkaa , g94e and g94ekkaa mutants were generated by site - direct mutagenesis using kod polymerase ( biolabs ) and the following primers : for bid forward 5-aca atg ctg ttg gcc gcc gcc gtg gcc agt cac-3 and reverse 5-gtg act ggc cac ggc ggc ggc caa cag cat tgt-3 ; for bid forward 5-ctc gcc caa ata gaa gat gag atg gac cac aac-3 and reverse 5-gtt gtg gtc cat ctc atc ttc tat ttg ggc gag-3. p7/p15 recombinant bid was produced , purified and cleaved with caspase-8 as described ( frezza et al . , 2006 ) .
the growth of wt , opa1 mafs was determined by counting viable cells ( as determined by trypan blue exclusion ) daily for 5 days .
1.5x10
opa1 mafs were infected with the indicated adenoviruses and after 24 hr the growth was determined by counting viable cells ( as determined by trypan blue exclusion ) daily for 4 days .
1.5x10 dko mefs were transduced with the indicated retroviruses and after 16 hr the growth was determined by counting viable gfp positive cells by flow cytometry . for measurements of apoptosis , 1.5x10 cells of
the indicated genotype grown in 6 well - plates were transfected with the indicated vector .
after 48 hr apoptosis was measured by flow cytometric detection ( facscalibur ) of the annexin - v - pe positive events in the gfp - positive population .
dko mefs and hek293 cells were cultured as previously described ( gomes et al . , 2011 ) . when indicated , glucose in dmem was substituted with 0.9 mg / ml galactose .
ecotropic viruses were generated by cotransfecting the hek293 packaging cell lines with the packaging vector pik and the appropriate pmig as previously described ( cheng et al . , 2001 ) .
viral supernatant were retrieved and used to transduce dko mefs in the presence of 4 g / ml of hexadimethrine bromide ( sigma ) . following an over - night transduction ,
wt , opa1 , opa1 , mafs sv40 transformed cell lines were generated respectively from wt , opa1 , opa1 mice .
male 7 weeks old mice were killed by cervical dislocation and their diaphragm were carefully dissected , washed in dmem , minced and then enzymatically digested with a collagenase 0.5% ( sigma ) solution for 10 min at 37c .
cell were spun at 200 g for 3 min , resuspended in dmem containing 4.5 mg / ml glucose , 10% fetal bovine serum ( fbs ) , 50 u / ml penicillin , 50 g / ml streptomycin , 100 m nonessential aminoacids ( gibco ) , 50 g / ml uridine , 25 mm hepes ( gibco ) , 2.5 g / ml fungizone ( gibco ) and seeded on a 0.1% gelatin ( sigma ) precoated plate .
after 15 min the supernatant was removed and the adherent fibroblasts were left growing in complete dmem .
mafs were transformed using an sv40 large t antigen expressing plasmid as previously described ( cipolat et al . , 2006 ) and | summaryrespiratory chain complexes assemble into functional quaternary structures called supercomplexes ( rcs ) within the folds of the inner mitochondrial membrane , or cristae . here
, we investigate the relationship between respiratory function and mitochondrial ultrastructure and provide evidence that cristae shape determines the assembly and stability of rcs and hence mitochondrial respiratory efficiency .
genetic and apoptotic manipulations of cristae structure affect assembly and activity of rcs in vitro and in vivo , independently of changes to mitochondrial protein synthesis or apoptotic outer mitochondrial membrane permeabilization . we demonstrate that , accordingly , the efficiency of mitochondria - dependent cell growth depends on cristae shape .
thus , rcs assembly emerges as a link between membrane morphology and function . |
long - term intubation is the cause of the majority of acquired , nonmalignant tracheoesophageal fistulae ( tef ) .
post - intubation tef could present as chronic aspiration after intubation , and could therefore be mistaken as unilateral or bilateral vocal fold palsy , especially when there was combined posterior glottic synechia
due to the variety of surgical options to repair a tef , including direct closure of the tracheal and esophageal defects with or without pedicled muscle flaps , tracheal closure with an esophageal patch , segmental tracheal resection , and anastomosis with esophageal closure and esophageal diversion , the timing and type of repair are still being debated .
we present a case of post - intubation tef which was successfully treated with tracheal resection and anastomosis , using primary esophageal closure and endoscopic lysis for the accompanying posterior glottic web .
approval for this case report was granted by the institutional review board of the author 's hospital ( no . 20090428/06 - 2009 - 54/83 ) .
a forty four - year - old woman was referred from a local general hospital for dyspnea and aspiration on eating .
she had history of drug intoxication from a suicidal attempt 2 months prior . at that time
she had been intubated and had a gastric lavage , after which she had a nasogastric feeding tube .
a tracheotomy was necessary because of prolonged intubation ( longer than 20 days ) . during the hospital
stay her t - cannula was recurrently obstructed by crust and secretion and her symptoms seemed to be relieved after t - cannula change . on endoscopic examination , performed by an ent resident , it was apparent that the right side of her vocal fold seemed to be paralyzed , and injection laryngoplasty was initially planned to solve her aspiration problem . on detailed examination of her airway , however , a glottic scar band was found at the posterior glottis , which seemed to be the cause of the limited mobility of her right vocal fold ( fig .
moreover , there was a tef on the left posterior wall of the trachea , 1 cm above the level of tracheostoma ( fig .
we confirmed that it was a tef by verifying leakage through the fistula on oral intake of water .
the skin , subcutaneous fat , and platysma were elevated as one layer and the flap was raised to the level of the suprahyoid region .
the sternohyoid muscles were divided in the midline and the thyroid isthmus was divided and ligated to expose the anterior surface of the trachea .
the trachea was freed circumferentially only above and below the site of the fistula , and care was taken to maintain the dissection as close as possible to the outer tracheal surface , thereby avoiding injury to the recurrent laryngeal nerves and to preserve the lateral blood supply to the unresected trachea .
the tracheal resection was done from the 2nd to the 4th tracheal rings ( 2.5 cm in length ) , and the esophageal fistula was found to be a slit - like shape , 1 cm in length ( fig .
it is of paramount importance to assure that the tracheal cut end has a normal diameter and mucosal appearance .
the edges of the esophageal defect were debrided and a two - layer closure was was made over a nasogastric tube .
after closure of the esophageal defect , the trachea was reconstructed via interrupted 4 - 0 vicryl sutures with 4 mm interval between stitches . before completion of the anastomosis , the distal ventilation system was removed and a new endotracheal tube advanced beyond the anastomosis line .
the cervical incision was closed by covering the anastomotic line with the thyroid isthmus and by approaching the linea alba cervicalis .
two soft multi - holed drain catheters were placed . soon after , the larynx was evaluated with suspension laryngoscopy . under microscopic magnification
topical 0.04% mitomycin c solution was applied with 3 mm - sized cotton balls around the interarytenoid area , to prevent synechia or scarring .
the patient was moved to ward via recovery room with her intubation tube in situ .
follow - up visit , she had no dyspnea or aspiration and both vocal folds were freely mobile ( fig .
surgical repair for tef can be accomplished by simple division and closure of the fistula ( 1 ) .
the lateral approach used for the simple division and repair is limited in that it gives a limited and unilateral exposure of the fistulous tract , and requires identification of the recurrent laryngeal nerve ( 1 , 2 ) .
identification of the fistulous tract may not be simple and usually requires a more extensive dissection than expected .
moreover , the separation of the tracheal and esophageal lines requires esophageal rotation and thus esophageal devascularization , which can result in late tracheal stenosis at the level of the repair or muscle interposition .
in addition , there could be a combined tracheostoma , which should be closed by secondary healing , if it were not resected with tef closure simultaneously ( 1 ) .
therefore , tracheal resection and anastomosis with primary esophageal closure has some advantages over simple division and closure of the fistula : 1 ) it is a one - stage procedure , 2 ) easy visualization and division of the esophageal fistula site , 3 ) reliable result despite the risk of anastomosis site problems ( 1 - 3 ) . in this case
, we could manage the patient successfully by tracheal resection and end - to - end anastomosis with primary esophageal closure 1 ) in one stage , 2 ) without identification of recurrent laryngeal nerve , and 3 ) with early rehabilitation . except for the possible morbidity related to tracheal resection and anastomosis , including disruption of anastomosis , emphysema or pneumomediastinum caused by air leakage
, this procedure could be one of the best options for acquired tef after prolonged intubation ( 1 ) .
prolonged intubation caused various problems such as glottic or subglottic stenosis , tef , vocal fold paralysis , hypertrophic scar , and so on ( 4 - 6 ) . because these complications could be brought - on at the same time , clinicians should be alert to find all the problems in the aerodigestive tract comprehensively ( 4 ) .
therefore , thorough endoscopic and imaging work - up should precede the initial surgical intervention . in this case , initial the misdiagnosis was idiopathic unilateral vocal fold paralysis , which was based on vocal fold immobility on endoscopic examination and chronic aspiration on medical history .
posterior glottic stenosis is , for clinicians , a troublesome and hard to solve complication after prolonged intubation ( 6 - 8 ) .
nd - yag laser and mitomycin c shows good result for posterior glottic stenosis after prolonged intubation ( 9 , 10 ) . the posterior glottic scar band in this case was easily resolved by endoscopic resection and topical mitomycin c application .
tracheal resection and anastomosis with primary esophageal closure was successfully used to treate tef occurring after prolonged intubation , with , and endoscopic technique of web lysis for the accompanying posterior glottic web .
careful evaluation for combined complications from prolonged intubation is mandatory and should be settled simultaneously . | tracheoesophageal fistula ( tef ) after prolonged intubation could present as chronic aspiration and could be mistaken as unilateral or bilateral vocal fold palsy , especially when there was combined posterior glottic synechia .
we present a case of post - intubation tef which was successfully treated with tracheal resection and anastomosis with primary esophageal closure .
the accompanying posterior glottic web was treated by endoscopic technique of web lysis , with topical application of mitomycin c solution . |
fibromyalgia is one of the most common disorders seen by primary care physicians , with a prevalence of 2% in the us population .
the incidence of fibromyalgia rises with aging , with a maximum at the age above 60 years , and is typically 7 times more prevalent in women than in men .
after several unsuccessful efforts aimed at proving the existence of muscle and connective inflammation , in the 1980s , the term fibromyalgia definitely replaced the older term
currently fibromyalgia is seen as one of several disorders referred to as central sensitivity syndrome ( css ) , which are all characterized by an abnormal pain regulation ( table 1 ) .
the overlapping of 2 such disorders supports the contention that central sensitization is the unifying mechanism of such array of diseases .
conditions associated with central sensitivity syndrome widespread pain , fatigue , and sleep disturbance are the characterizing core symptoms of fibromyalgia .
when unusual symptoms for fibromyalgia are overbearingly predominant at clinical presentation , the diagnosis becomes challenging .
an 80-year - old caucasian woman presented at the emergency department because of diffuse pain at the anterior chest and epigastric region , dysphagia , odynophagia , vomiting , and fever .
her blood pressure on presentation was 145/80 mmhg , with a heart rate of 90 beats / min .
blood tests showed mild increase of white blood cells ( 12.42 10 cells / l ) and c - reactive protein ( 7.2 mg
/ l ) . an ekg documented subtle st - segment depression in v3 to v6 with normal troponin i ( tni ) levels .
an abdomen x - ray failed to show signs of bowel obstruction or free intra - abdominal gas .
because of her history of coronary artery bypass grafting , and the persistence of pain and dysphagia , she was referred to our internal medicine unit .
the patient was a housewife , and her medical history included high blood pressure for 25 years , type 2 diabetes mellitus , chronic kidney disease ( ckd ) , osteoporosis , arthrosis , and cholecystectomy .
she was assuming pantoprazole , ticlopidine , atenolol , nitroglycerin , doxazosin , simvastatin , metformin , alendronate , and non - steroidal anti - inflammatory drugs . at admission , she complained dysphagia and oral burning ( glossodynia ) .
the patient reported that the difficulty in swallowing started 1 month prior hospitalization , and progressively increased so that nourishment and fluid intake were impeded .
her face showed paucity of expression suggesting scleroderma , but raynaud 's phenomenon , skin induration , or teleangiectasia was not detected .
serial tni tests were normal , and a transthoracic echocardiogram showed normal ejection fraction with no regional wall motion abnormalities .
serum urea ( 14.30 mmol / l ) and creatinine ( 172 mol / l ) levels ( egfr 24 ml / min/1.73 m calculated with ckd - epi formula ) after an early worsening , improved with intravenous hydration . because of bacteriuria and fever , antibiotic treatment was started , with remission of fever in 2 days . since the epigastric pain was associated with low levels of hemoglobin ( 110
g / l ; red blood cells 3.63 10 cells / l ) and iron ( 8.5 mol / l ) , an esophagogastroduodenoscopy was performed , which disclosed only few microerosions of the antral mucosa that could not explain dysphagia and glossodynia . to investigate whether oral symptoms were caused by micronutrient deficiency , we measured plasma levels of zinc ( 13.0 mol / l ) and vitamin b12 ( 481 ng / l ) , but they both were normal . because ace - inhibitors are a well - known cause of dysgeusia , we also investigated whether the patient assumed such drugs in last years , but she denied .
odynophagia and glossodynia persisted , and became the predominant symptoms . because the patient rejected water and food for days , parenteral nutrition was started . in the next days , she also complained dysgeusia and abnormal sensitivity to some odors with nausea .
poor short - term memory was noticed , and the patient often complained to be confused as being in the clouds . after exclusion of cardiac disease and upper digestive tract lesions , the diagnosis of fibromyalgia was put forward .
we therefore calculated the widespread pain index ( wpi ) as recommended by the american college of rheumatology ( acr ) .
wpi of 7 plus symptom severity ( ss ) scale score of 5 , or alternatively , wpi of 3 to 6 and ss scale score of 9 are the 2 criteria required for diagnosis of fibromyalgia .
wpi , calculated by summing up patient 's reports of pain in 19 separate regions of the body as recommended by acr guidelines , was 6 in our patient , and ss scale score , calculated by grading pain , fatigue , and
awaking unrefreshed on a severity scale from 0 ( no problem ) to 3 ( severe , pervasive , continuous , life - disturbing problems ) , was 9 ( figure 1 ) .
the american college of rheumatology recommends to assess pain and severity of symptoms using the widespread pain index ( wpi ) and symptom severity ( ss ) scale , which both exploit a self - report questionnaire .
wpi requires that the patient localizes the sites of pain or tenderness during the past 7 days , and then the physician assigns 1 point to each site .
the red boxes correspond to painful sites , whereas the blue to painless areas , with a score of 6 .
the ss scale consists of 2 sections . in the first , that is , section a
, the severity during the past 7 days is indicated for each symptom by the following scale : no problem ( point 0 ) ; slight problem : generally mild or intermittent ( point 1 ) ; moderate problem : considerable problems , often present and/or at a moderate level ( points 2 ) ; severe problem : continuous , life - disturbing problems ( points 3 ) . in the second section the symptoms listed in section
b , if present during the past 6 months , are indicated by yes ( corresponding to point 1 ) . in our patient
the total score , which is calculated as the sum of wpi and ss , and ranges from 0 to 31 points , when 13 points is consistent with diagnosis of fibromyalgia .
additional informations are included in the survey ( bottom ) because they can be helpful for diagnosis , but no points are assigned to them .
the total score of self - report survey was 15 in our patient , thereby supporting fibromyalgia ( modified from clauw d.j .
the american college of rheumatology recommends to assess pain and severity of symptoms using the widespread pain index ( wpi ) and symptom severity ( ss ) scale , which both exploit a self - report questionnaire .
wpi requires that the patient localizes the sites of pain or tenderness during the past 7 days , and then the physician assigns 1 point to each site .
the red boxes correspond to painful sites , whereas the blue to painless areas , with a score of 6 .
the ss scale consists of 2 sections . in the first , that is , section a
, the severity during the past 7 days is indicated for each symptom by the following scale : no problem ( point 0 ) ; slight problem : generally mild or intermittent ( point 1 ) ; moderate problem : considerable problems , often present and/or at a moderate level ( points 2 ) ; severe problem : continuous , life - disturbing problems ( points 3 ) . in the second section the symptoms listed in section
b , if present during the past 6 months , are indicated by yes ( corresponding to point 1 ) . in our patient
the total score , which is calculated as the sum of wpi and ss , and ranges from 0 to 31 points , when 13 points is consistent with diagnosis of fibromyalgia .
additional informations are included in the survey ( bottom ) because they can be helpful for diagnosis , but no points are assigned to them .
the total score of self - report survey was 15 in our patient , thereby supporting fibromyalgia ( modified from clauw d.j .
the final diagnosis was fibromyalgia , and treatment with amitriptyline 10 mg bid was started .
both odynophagia and glossodynia improved within some days , and diffuse pain , dysgeusia , and fibro - fog ( ie , feeling of being in the clouds ) gradually weakened in 2 weeks . at that time , the levels of hemoglobin ( 114
g / l ) and iron ( 9.5 mol / l ) persisted low and , therefore , we could exclude that oral symptoms were caused by anemia .
the patient gave her informed consent to diagnostic procedures , therapy , and data collection at the admission to our unit .
she was not explicitly asked for the consent to the present case report because no element allows her identification .
the patient was a housewife , and her medical history included high blood pressure for 25 years , type 2 diabetes mellitus , chronic kidney disease ( ckd ) , osteoporosis , arthrosis , and cholecystectomy .
she was assuming pantoprazole , ticlopidine , atenolol , nitroglycerin , doxazosin , simvastatin , metformin , alendronate , and non - steroidal anti - inflammatory drugs . at admission , she complained dysphagia and oral burning ( glossodynia ) .
the patient reported that the difficulty in swallowing started 1 month prior hospitalization , and progressively increased so that nourishment and fluid intake were impeded .
her face showed paucity of expression suggesting scleroderma , but raynaud 's phenomenon , skin induration , or teleangiectasia was not detected .
serial tni tests were normal , and a transthoracic echocardiogram showed normal ejection fraction with no regional wall motion abnormalities .
serum urea ( 14.30 mmol / l ) and creatinine ( 172 mol / l ) levels ( egfr 24 ml / min/1.73 m calculated with ckd - epi formula ) after an early worsening , improved with intravenous hydration . because of bacteriuria and fever , antibiotic treatment was started , with remission of fever in 2 days . since the epigastric pain was associated with low levels of hemoglobin ( 110
10 cells / l ) and iron ( 8.5 mol / l ) , an esophagogastroduodenoscopy was performed , which disclosed only few microerosions of the antral mucosa that could not explain dysphagia and glossodynia . to investigate whether oral symptoms were caused by micronutrient deficiency , we measured plasma levels of zinc ( 13.0 mol / l ) and vitamin b12 ( 481 ng / l ) , but they both were normal . because ace - inhibitors are a well - known cause of dysgeusia , we also investigated whether the patient assumed such drugs in last years , but she denied .
odynophagia and glossodynia persisted , and became the predominant symptoms . because the patient rejected water and food for days ,
poor short - term memory was noticed , and the patient often complained to be confused as being in the clouds . after exclusion of cardiac disease and upper digestive tract lesions , the diagnosis of fibromyalgia was put forward .
we therefore calculated the widespread pain index ( wpi ) as recommended by the american college of rheumatology ( acr ) .
wpi of 7 plus symptom severity ( ss ) scale score of 5 , or alternatively , wpi of 3 to 6 and ss scale score of 9 are the 2 criteria required for diagnosis of fibromyalgia .
wpi , calculated by summing up patient 's reports of pain in 19 separate regions of the body as recommended by acr guidelines , was 6 in our patient , and ss scale score , calculated by grading pain , fatigue , and
awaking unrefreshed on a severity scale from 0 ( no problem ) to 3 ( severe , pervasive , continuous , life - disturbing problems ) , was 9 ( figure 1 ) .
figure 1self - report survey for the assessment of fibromyalgia in our patient . the american college of rheumatology recommends to assess pain and severity of symptoms using the widespread pain index ( wpi ) and symptom severity ( ss ) scale , which both exploit a self - report questionnaire .
wpi requires that the patient localizes the sites of pain or tenderness during the past 7 days , and then the physician assigns 1 point to each site .
, the red boxes correspond to painful sites , whereas the blue to painless areas , with a score of 6 .
the ss scale consists of 2 sections . in the first , that is , section a
, the severity during the past 7 days is indicated for each symptom by the following scale : no problem ( point 0 ) ; slight problem : generally mild or intermittent ( point 1 ) ; moderate problem : considerable problems , often present and/or at a moderate level ( points 2 ) ; severe problem : continuous , life - disturbing problems ( points 3 ) . in the second section the symptoms listed in section
b , if present during the past 6 months , are indicated by yes ( corresponding to point 1 ) . in our patient
the total score , which is calculated as the sum of wpi and ss , and ranges from 0 to 31 points , when 13 points is consistent with diagnosis of fibromyalgia .
additional informations are included in the survey ( bottom ) because they can be helpful for diagnosis , but no points are assigned to them .
the total score of self - report survey was 15 in our patient , thereby supporting fibromyalgia ( modified from clauw d.j .
the american college of rheumatology recommends to assess pain and severity of symptoms using the widespread pain index ( wpi ) and symptom severity ( ss ) scale , which both exploit a self - report questionnaire .
wpi requires that the patient localizes the sites of pain or tenderness during the past 7 days , and then the physician assigns 1 point to each site .
the red boxes correspond to painful sites , whereas the blue to painless areas , with a score of 6 .
the ss scale consists of 2 sections . in the first , that is , section a
, the severity during the past 7 days is indicated for each symptom by the following scale : no problem ( point 0 ) ; slight problem : generally mild or intermittent ( point 1 ) ; moderate problem : considerable problems , often present and/or at a moderate level ( points 2 ) ; severe problem : continuous , life - disturbing problems ( points 3 ) . in the second section the symptoms listed in section
b , if present during the past 6 months , are indicated by yes ( corresponding to point 1 ) . in our patient
the total score , which is calculated as the sum of wpi and ss , and ranges from 0 to 31 points , when 13 points is consistent with diagnosis of fibromyalgia .
additional informations are included in the survey ( bottom ) because they can be helpful for diagnosis , but no points are assigned to them .
the total score of self - report survey was 15 in our patient , thereby supporting fibromyalgia ( modified from clauw d.j .
the final diagnosis was fibromyalgia , and treatment with amitriptyline 10 mg bid was started .
both odynophagia and glossodynia improved within some days , and diffuse pain , dysgeusia , and fibro - fog ( ie , feeling of being in the clouds ) gradually weakened in 2 weeks . at that time , the levels of hemoglobin ( 114
g / l ) and iron ( 9.5 mol / l ) persisted low and , therefore , we could exclude that oral symptoms were caused by anemia .
the patient gave her informed consent to diagnostic procedures , therapy , and data collection at the admission to our unit .
she was not explicitly asked for the consent to the present case report because no element allows her identification .
clinical presentation of fibromyalgia includes pain associated with an array of other symptoms , for example , fatigue , sleep disturbance , headache , or morning stiffness .
the paucity of objective findings in contrast to the abundance of subjective ailments makes the diagnosis difficult .
however , when an unusual symptom dominates the picture , the diagnosis becomes even more challenging .
pain in fibromyalgia is widespread , entailing jaws , shoulders , arms , buttocks , legs , back , chest and abdomen , and usually is protean , being described as throbbing , stabbing , burning , cramping , or gnawing .
acr criteria require that pain is present at a similar level for at least 3 months , and that no disorder would otherwise explain it . in our 80-year - old patient presenting with chest pain ,
ischemic disease was excluded , and pain at pelvis and bilaterally at the inferior limbs was at a first glance referred to osteoarthrosis .
the association of glossodynia and odynophagia with dysgeusia , sensitivity to odors , and fibro - fog finally unveiled fibromyalgia
. a search of the literature revealed that patients with fibromyalgia occasionally complain oral - esophageal pain and hypersensitivity .
orofacial symptoms include xerostomia , ulcerations , orofacial pain , temporomandibular joint dysfunction , glossodynia , dysphagia , and dysgeusia .
such symptoms have been seldom investigated in fibromyalgia patients , and therefore rarely reported : in a small study of 67 fibromyalgia patients who were systematically examined for orofacial symptoms , dysphagia was present in 37.3% , glossodynia in 32.8% , and dysgeusia in 34.2% .
fibromyalgia was also found to be commonly associated with esophageal motility disorders , nausea , and/or dyspepsia .
hence , orofacial symptoms are more common than believed in fibromyalgia . of interest , in our patient ,
odynophagia and glossodynia were the major symptoms , and their severity impeded oral nutrition , thus requiring parenteral nutrition .
we decided to use amitriptyline in our patient because depression and anxiety involve about half of the patients with fibromyalgia , and use of antidepressants is strongly advised .
gabapentinoids , serotonin norepinephrine reuptake inhibitors , and -hydroxybutyrate were also found to be effective in patients with fibromyalgia .
in contrast , because of the hyperactivity of the endogenous opioid system in such patients , opioids may lead to paroxysmal hyperalgesia .
after 7-month follow - up , the patient is in good health with no major illness development . in conclusion ,
odynophagia , dysphagia , and glossodynia can be the prevalent symptoms at presentation of fibromyalgia patients although often overlooked .
the recognition of these symptoms could be determinant for a physician to pursue the diagnosis of fibromyalgia with this presentation , helpful to offer relieve of pain and avoid unnecessary tests for patients affected . | abstractfibromyalgia is a disorder characterized by an abnormal pain regulation
. widespread pain , fatigue , and sleep disturbance are the prevalent symptoms .
when unusual symptoms are overbearingly predominant at clinical presentation , the diagnosis becomes challenging.we report on the case of a patient with fibromyalgia , who presented with dysphagia , odynophagia , and glossodynia as prevalent symptoms .
difficulty in swallowing gradually developed over a month prior hospitalization , and worsened progressively so that nourishment and fluid intake were impeded.because anemia with mild iron deficiency was found , esophagogastroduodenoscopy was performed , but no lesions were seen in the upper digestive tract .
levels of zinc and vitamin b12 were normal .
intense pain at pelvis and the inferior limbs , which was at a first glance referred to as osteoarthrosis , associated with oral symptoms and feeling of being in the clouds allowed us to diagnose fibromyalgia .
amitriptyline was used , with relief of symptoms.although oropharyngeal symptoms were occasionally reported in fibromyalgia , they are often overlooked .
the present case , therefore , testifies the need to consider the diagnosis of fibromyalgia when the patient presents with such symptoms that can not be readily explained on other grounds . |
as a service to our authors and readers , this journal provides supporting information supplied by the authors .
such materials are peer reviewed and may be re - organized for online delivery , but are not copy - edited or typeset . technical support issues arising from supporting information ( other than missing files ) should be addressed to the authors . | spiroketals organize small molecule structures into well - defined , three - dimensional configurations that make them good ligands of proteins . we recently discovered a tandem cycloisomerization
dimerization reaction of alkynyl hemiketals that delivered polycyclic , enol - ether - containing spiroketals . here
we describe rearrangements of those compounds , triggered by epoxidation of their enol ethers that completely remodel their structures , essentially turning them
inside out . due to the high level of substitution on the carbon skeletons of the substrates and products , characterization resorted to x - ray crystallography and advanced computation and nmr techniques to solve the structures of representative compounds .
in particular , a new proton - detected adequate nmr experiment ( 1,1-hd - adequate ) enabled the unequivocal assignment of the carbon skeleton of one of the new compounds .
solution of the structures of the representative compounds allowed for the assignment of product structures for the other compounds in two separate series . both the rearrangement and the methods used for structural determination of the products are valuable tools for the preparation of characterization of new small molecule compounds . |
however , the mortality rate of patients exposed to these complications is extremely high ( 11%-59% ) . in this case report
, the patient happened to have intra- and post - operative iatrogenic liver injuries by chest tubes , associated with intra - abdominal hemorrhage after cabg .
various causes of post operative hemodynamic instability were investigated promptly , managed aggressively , and led to successful outcome .
a fifty - seven - year - old man with history of smoking , coronary artery disease ( cad ) , diabetes , hypertension , and hyperlipedemia , was admitted with inferior st segment elevation myocardial infarction ( stemi ) .
he had history of previous anterior myocardial infarction ( mi ) and percutaneous coronary intervention ( pci ) to the left anterior descending ( lad ) coronary artery .
echocardiography showed hyopkinetic posterior segment , with left ventricular ejection fraction ( ef ) of 55% and right ventricular systolic pressure ( rvsp ) of 32 mmhg .
coronary angiography showed in - stent occlusion of the lad , 90% stenosis of ramus marginalis and 90% lesion of the right coronary artery ( rca ) .
ten days after thrombolytic therapy , and 3 days after stopping clopidogrel , the patient underwent urgent cabg operation using the left internal mammary artery ( lima ) to lad and vein grafts to rca and ramus marginalis .
the aortic cross - clamp time was 61 minutes , and total cardiopulmonary bypass ( cpb ) time was 108 minutes .
two anterior chest tubes were placed ; one in the anterior mediastinum and the second in the basal area of the left pleural cavity .
intra - operative blood products were administered ( 6 units of platelets , 4 units fresh frozen plasma ( ffp ) and 4 units of cryoprecipitate ) . at the end of the procedure ,
the immediate post - operative period was characterized by bleeding , with a total blood loss of 1,400 ml in 16 hours .
sedation was discontinued on the following day , and the patient was extubated . the early morning routine chest x - ray showed right pleural effusion , and left and mediastinal chest drains in good position [ figure 1 ] .
chest x - ray on the first postoperative day showing right pleural effusion with mediastinal and left drains in place . by the early afternoon of the first post - operative day
a repeat chest x - ray showed increased haziness on the right side of the chest , distended stomach , and colonic loops with elevated right hemi - diaphragm [ figure 2 ] .
chest x - ray on in the afternoon of the first postoperative day showing increase in the amount of effusion with gastric distension .
a right intercostal drain was inserted in the 8 intercostal space without difficulty , and drained a total of 800 ml of dark blood .
chest x - ray showed very low position of the new right intercostal drain , with resolution of the pleural effusion and clinical improvement of the spo
2 to 98% [ figure 3 ] .
two hours later , the patient became distressed , hypoxemic , and hypotensive with signs of hypovolemic shock , severe metabolic acidosis and drop of hemoglobin from 9.5 to 5.6 gm / dl .
aggressive fluid resuscitation by colloids infusion and blood products was administered , and inotropic support was re - started .
echocardiography showed normal ef , no evidence of tamponade , no segmental cardiac wall motion abnormalities and under - filling of the cardiac chambers .
abdominal ultrasonography showed a large supra - hepatic fluid collection and free intra - abdominal fluid . computed tomography ( ct ) scan of the abdomen showed a large anterior hepatic subcapsular hematoma with active arterial and venous bleeding , a significant right subphrenic hematoma and free abdominal fluid [ figure 4 ] .
ct scan of the abdomen showing large anterior hepatic subcapsular hematoma , right subphrenic hematoma and some free abdominal fluid .
emergency exploratory laparotomy revealed 2,500 ml of free blood with clots , and two liver tears with active bleeding ; one at the superior aspect of the right lobe of the liver , and the second at the anterior surface of the left hepatic lobe , with a small superficial serosal tear of the transverse colon .
the anterior hepatic laceration corresponded with the intra - operative anterior chest tube placement , while the superior laceration was related with the post - operative right intercostal chest tube insertion .
the bleeding points were controlled by gauze packing , the abdomen was closed , and the patient was transferred back to the sicu . upon re - exploration after 48 hrs , the packs were removed .
a small 3 cm superficial tear on the anterior surface of the left hepatic lobe , and a second puncture deep but small tear on the right lateral superior surface of the liver were identified along with a small superficial serosal tear of the transverse colon .
parenteral nutrition was started as the patient developed ileus . however , enteral feeding was given later on , and the patient was extubated on the 10 post operative day .
the j - vac drain output contained bile drainage that gradually decreased , eventually stopped , and the drain was removed .
the patient made a full recovery and was discharged home after 23 days of hospital stay .
although gastrointestinal and intra - abdominal complications are rare after open - heart surgery , they significantly increase the mortality rate .
the most common gastrointestinal complications in published large series were abdominal abscess , ileus , gastrointestinal ulcer ( perforation / bleeding ) , enteric ischemia , and bleeding diverticulitis in the colon.[49 ] erkan and colleagues reported one case of aortic valve replacement complicated with hepatic and splenic injuries .
the patient expired after 28 days postoperatively due to abdominal bleeding that may have resulted from either the effect of low molecular weight heparin ( lmwh ) , or due to blunt - trauma of the drainage tubes on intra - abdominal organs .
the most common risk factors for gi complications after cardiac surgery include : age greater than 70 years , low cardiac output , peripheral vascular disease , redo operations , chronic renal insufficiency , increased number of blood transfusions , prolonged cardiopulmonary bypass time , arrhythmias , and the use of iabp .
. however , these factors may predispose patients to enteric ischemia or ulceration , but not to injury of the liver .
there are reports of spontaneous hemorrhage , such as retroperitoneal and intra - abdominal hemorrhage , related to lmwh used in prosthetic valve operations , or for deep vein thrombosis prophylaxis after cardiac surgery . in our case report
, the cause of bleeding was inadvertently caused by the insertion of the chest tubes . the first , intra - operatively through the anterior abdominal wall that resulted in the anterior left lobe injury of the liver and probably the serosal tear of the transverse colon , and the second by too low insertion of the intercostal chest tube , that was done in sicu for drainage of the right pleural effusion , which inadvertently caused the puncture injury of the superior aspect of the right lobe of the liver . in conclusion ,
intra - abdominal hemorrhage of the liver is a possible complication of open - heart surgery .
although rare , hepatic lacerations may occur spontaneously , or due to iatrogenic causes , and may contribute to postoperative hemodynamic instability after open - heart surgery .
when bleeding occurs , the cardiac surgeon should consider causes other than the usual postoperative complications , and the cause should be promptly investigated , since delay in management carries very high mortality . to the best of our knowledge ,
this is probably the first case report of iatrogenic liver injury after open - heart operation . | gastrointestinal complications after open - heart surgery are rare but may increase mortality rate significantly .
we are presenting a rare complication of liver laceration after coronary bypass operation .
the patient is a 57-year - old man who underwent urgent coronary artery bypass grafting operation ( cabg ) .
liver laceration and free intra - peritoneal hemorrhage was discovered to be the result of chest tubes insertion , and resulted in drop of hemoglobin and hemodynamic instability .
the hemorrhage was surgically controlled , and the patient made full recovery and was sent home .
this case report emphasizes that when bleeding of unknown origin occurs after cardiac surgery , intra - abdominal bleeding should be considered . |
the cytosolic free ca concentration ( [ ca]i ) in eukaryotic cells is in the low nanomolar range ( ~100 nm ) , and transient modifications of this concentration serve as an intracellular mechanism for cell signaling because of the existence of a variety of effectors that are sensitive to such transient increases .
for instance , in many cases the binding of extracellular ligands to their receptors , including g protein - coupled receptors ( gcprs ) located at the plasma membrane , triggers the phosphoinositide pathway by means of the activation of phospholipase c. this activation is responsible for the hydrolysis of phosphatidylinositol 4,5-bisphosphate and the subsequent generation of inositol 1,4,5-trisphosphate ( ins(1,4,5)p3 ) and 1,2-diacylglycerol ( dag ) .
soluble ins(1,4,5)p3 binds to its receptor ( ins(1,4,5)p3r ) in the endoplasmic reticulum ( er ) , whereas the more lipophilic dag accumulates in the plasma membrane .
ins(1,4,5)p3r is a receptor - operated ca channel that activates by binding to its endogenous ligand ins(1,4,5)p3 , leading to transient ca release from the er and thereby transiently increasing [ ca]i .
many ca - sensitive effectors are found in the cytosol , which contribute to the diversity of the intracellular signaling initiated by the ca release from the er . alternatively , other ca channels located in the plasma membrane such as the ligand - gated plasma membrane p2x receptor and the voltage - operated ca channels families regulate the influx of extracellular ca to the cytosol upon biding to ligands or upon plasma membrane depolarization conditions , respectively .
we highlight these examples to draw attention to the fact that there are two major sources of ca that may increase [ ca]i , - the extracellular milieu , and the intracellular compartments including the most important intracellular ca store , the er and the specialized sarcoplasmic reticulum ( sr ) in muscle cells . in all cases the increase of [ ca]i is transient , and the high cytosolic ca levels are rapidly cut down by the activation of ca pumps in the plasma membrane and the er . whereas the plasma membrane ca - atpase ( pmca ) extrudes ca into the extracellular milieu , the sarco(endo)plasmic ca - atpase ( serca ) pumps ca into the lumen of the er . other active ca transport systems are also involved in the restoration of cytosolic ca basal levels , such as the na / ca exchanger with a lower affinity for ca compared with ca pumps , and the mitochondrial ca uniporter ( mcu ) which transport ca into the mitochondria matrix .
the combination of the activities of all ca transport systems defines specific ca transients in terms of amplitude , intensity , and duration which vary according to the initial stimulus and the cell type .
thus , the number , type and molar ratios of the molecules involved in the origin and maintenance of the ca mobilization define the spatio - temporal pattern of ca signaling .
for instance , ca signaling during fertilization of mammalian oocytes is initiated by the sperm - specific phospholipase c zeta ( plc ) that triggers the phosphoinositide pathway once plc has been released into the oocyte after the fusion with the sperm .
this pathway induces an initial increase of [ ca]i in the oocyte which last for 12 min , which is followed by repetitive and transient increases of [ ca]i , required for the exit from cell cycle arrest of oocytes in the metaphase of the second meiotic division .
another classical example of ca mobilization required to trigger downstream effects is found in skeletal muscle cells .
depolarization of plasma membrane induces a conformational change in dihydropyridine receptors ( dhprs , voltage - dependent , l - type , plasma membrane ca channels ) which activate ryanodine receptors located in the sr , enabling the ca release from this intracellular store .
these are just two classical examples of how ca fluxes regulate cell physiology , which also indicate the importance of intracellular ca stores for this signaling . to ensure the durability and maintenance of the signaling , a plasma membrane ca transport systems regulates intracellular ca stores refilling .
this ca entry pathway is called store - operated ca entry ( soce ) , a ubiquitous mechanism and one of the most important pathways for ca entry in non - excitable cells .
consistent with its descriptive name , soce is regulated by the ca concentration within the er .
the mechanism that links luminal ca levels with plasma membrane ca entry is mediated by stim1 ( stromal interaction molecule 1 ) , a type i transmembrane protein that senses ca within the luminal space of the er , and activates plasma membrane ca channels ( socs ) upon ca depletion conditions in the intracellular stores .
human stim1 protein consists of 685 aminoacids , with an sam domain ( sterile motif ) and an ef - hand domain that acts as a ca sensor within the luminal space of the er . upon depletion of ca within the er , the sam - ef domain mediates the oligomerization of stim1 , triggering this oligomerization in clusters of ~1 m diameter .
the clustering favors the relocalization of stim1 in er - plasma membrane ( pm ) junctions , required for the activation of soce .
stim1 directly binds to store - operated calcium channels ( socs ) , activating a highly ca - selective , non - voltage - gated , inwardly rectifying current known as the ca release activated ca current ( icrac ) .
this current is reconstituted by both stim1 and orai1 ( also known as cracm1 ) , a plasma membrane protein that constitutes a major ca channel regulated by stim1 .
in addition to orai1 , some of the transient receptor potential canonical ( trpc ) channels can function in a stim1-dependent mode .
stim1 directly binds and activates trpc1 , trpc4 and trpc5 channels that can therefore act as socs .
however , the stim1/trpc molar ratio determines the stim1-dependent or stim1-independent mode of action of the channels .
in addition , trpc1 also associates with orai1 to produce trpc1-orai1-stim1 ternary complexes that act as socs .
it was early found that the c - terminal portion of stim1 is sufficient for the activation of orai1 , and that both proteins physically interact through a coiled - coil domain in the c - terminus of orai1 .
the minimal domain of stim1 that activates orai1 is a conserved crac activation domain ( cad ) of stim1 of ~100 amino acids that binds directly to orai1 .
the cytosolic domain ( residues 234685 ) contains three coiled - coil domains , cc1 , cc2 , and cc3 .
cc2 and cc3 overlap with the soar / cad region required to activate ca channels ( aminoacids 334442 ) . because cc1 interacts with cc2/cc3 at resting state , keeping stim1 in a closed conformation , the activation of stim1 by store depletion and the binding of stim1 with orai1 requires an intramolecular transition of stim1 into an open conformation , in order to expose cc2 and cc3 so they are able to activate orai1 by a physical interaction of coiled - coil domains .
investigation of the mechanism of trpc1 gating led to the proposal that it involves an electrostatic mechanism through the interaction of two negative charged aspartates in trpc1 and the conserved polybasic domain , enriched in lysine residues , at the c - terminus of stim1 .
an additional ca channel that is regulated by stim1 belongs to the voltage - operated ca channels family .
stim1 binding to cav1.2 channels suppresses the activation of these channels , an action that is mediated also by the soar / cad domain of stim1 , causing long - term internalization of the channel from the membrane .
thus , multiple actions are triggered by the cytosolic domain of stim1 , including the activation and inactivation of diverse channels in response to different stimuli .
it is plausible that the cytosolic domain encompasses additional domains that modulate the ca channel - regulation activity of stim1 , by controlling stim1 subcellular localization and/or the selectivity of the ca channel to be activated or inhibited . in this
regard , stim1 has a serine / proline - rich domain ( or s / p)-rich domain which could be acting as a modulator of the stim1 activity .
stim1 is a phosphoprotein in which large - scale mass spectrometry studies have revealed potential phosphorylation sites .
subsequent initial reports of detailed analyses of phosphoresidues from immunoprecipitated stim1 differed in their findings , mainly because the studies had focused on different cell cycle stages . during the m - phase ,
although yu et al . reported that stim1 is phosphorylated during meiosis of xenopus oocytes , substitution mutations of target residues to mimic constitutive phosphorylation or dephosphorylation do not modulate the clustering of stim1 in response to store depletion , an observation that supports the lack of any physiological function for stim1 phosphorylation during meiosis in xenopus oocytes .
smyth et al . found that stim1 clustering is also inactivated during mitosis of mammalian cells , and they identified specific residues , such as ser602 and ser608 , that become dephosphorylated during that process .
other sites were initially found to be constitutively phosphorylated ( ser575 , ser620 , and ser621 ) .
ser668 belongs to a consensus sequence for cyclin - dependent kinase 1 ( cdk1 ) , and is phosphorylated by cdk1 in vitro .
also , the expression of single alanine substitution mutations ( s668a or s486a ) does not rescue soce in mitotic cells .
however , expression of a double mutant s486a / s668a does show soce responses in mitosis , confirming the role of stim1 phosphorylation at ser486 and ser668 in soce inactivation during mitosis .
further evidence was that extracellular signal - regulated kinases 1/2 ( erk1/2 ) phosphorylate stim1 in vitro at ser575 , ser608 , and ser621 and that stim1 phosphorylation at erk1/2 target sites regulates soce in hek293 cells .
the phosphorylation of stim1 at ser575 , ser608 , and ser621 was revealed by mass spectrometry using immunoprecipitated stim1 from asynchronous hek293 cells , and later with phospho - specific antibodies against phosphorylated residues .
this latter strategy demonstrated that stim1 phosphorylation at erk1/2 target sites increases during soce activation , and consequently the alanine substitution mutation of these sites nullifies soce , whereas ser - to - glu mutation enhances ca entry .
in contrast to the results reported in , phospho - specific antibodies against phosphoser575 , phosphoser608 , and phosphoser621 revealed a dynamic phosphorylation of stim1 that was strongly dependent on the ca store filling state . thus , ca store depletion is accompanied by an increase of stim1 phosphorylation at erk1/2 target sites , whereas ca store refilling triggers stim1 dephosphorylation at these sites .
many aspects of the molecular mechanism by which the phosphorylation of stim1 regulates soce remain unclear , but the inhibition of stim1 phosphorylation decreases stim1 clustering in response to store depletion and impairs stim1-orai1 binding , as monitored by fluorescence resonance energy transfer ( fret ) and by co - immunoprecipitation . in an attempt to resolve the open question of the requirement of stim1 phosphorylation at ser575 , ser608 , and ser621 to activate soce in hek293 cells during interphase , we recently found that phosphorylation of stim1 at erk1/2 target sites regulates the association of stim1 with eb1 ( end - binding protein 1 ) , a regulator of growing microtubule ends .
the role of the cytoskeleton in soce regulation has been studied in depth , and it was early established that stim1 colocalizes with tubulin and that the treatment of hek293 cells with nocodazole , which triggers microtubule depolymerization , severly reduces soce .
later , sampieri et al . reported that stim1 travels through the er in association with eb1 under resting conditions , confirming the connection between stim1 and microtubules , and that the association ceases upon depletion of the er , facilitating the aggregation of stim1 into large clusters .
those authors also observed that stim1 re - associates with eb1 when intracellular calcium stores are replenished , i.e. , stim1-eb1 dissociation is fully reversible . because stim1 binds to eb1 in the resting state , stim1 can be considered a microtubule plus - end - tracking protein ( + tip ) .
there are two modes of direct interaction between eb1 and + tips - either through a cytoskeleton - associated protein glycine - rich ( cap - gly ) domain or by binding to a ser / thr - x - ile - pro ( s / txip ) consensus sequence . as a + tip ,
stim1 localization is dependent on microtubule formation , and a stim1 sequence encompassing residues 642645 ( thr - arg - ile - pro ) has been found to be essential for the binding to eb1 . for those + tips with an s / txip motif , examples of regulation by phosphorylation in the vicinity of this domain , but not within this sequence , have been reported .
these examples include apc , mcak , and clasp2 , all of which are phosphorylated in the vicinity of the s / txip sequence , regulating their interaction with microtubules . in all cases , as with stim1
, sequences flanking the s / txip motif contain a high number of proline , serine , and basic residues , leading to a net positive charge in the surroundings of this eb1 binding domain .
this observation might explain why phosphorylation in the vicinity of this sequence blocks the localization of + tips to microtubule ends .
in this regard , the phosphorylation of stim1 at residues ser575 , ser608 , and ser621 triggers the dissociation of stim1 from eb1 . because refilling of ca stores is accompanied by dephosphorylation of these residues ,
this reversible phosphorylation constitutes a mechanism that fully explains the reversible interaction of stim1 and eb1 ( see figure 1 ) . indeed ,
ser - to - ala substitution mutants of stim1 do not dissociate from eb1 under store depletion conditons , and ser - to - glu mutants remain dissociated from eb1 even under resting conditions . in accordance with the proposed model described in figure 1 , those stimuli that induce store depletion and erk1/2 activation lead to phosphorylation of stim1 at ser575 , ser608 , and ser621 .
this specific phosphorylation triggers the dissociation of stim1 from eb1 , which in turn facilitates stim1 clustering and the binding to socs to activate ca entry .
replenisment of ca stores induces stim1 dephosphorylation by as yet to be described phosphatases , leading to the reassociation of stim1 with eb1 , and the microtubule localization pattern of stim1 ( fig . 1 ) .
as has been reported for other + tips , the phosphor - regulation of stim1-eb1 interaction could be more complex , and other phosphoresidues might trigger a diversity of actions .
for instance , the ser - to - ala substitution mutation of 10 residues in stim1 leads to er mislocalization by pulling er tubules into the mitotic spindle .
because in wild - type stim1-expressing cells er tubules are excluded from this mitotic spindle , those results suggest that hyperphosphorylation of stim1 is required to maintain er normal structure in mitosis
. however , it would be necessary to monitor the phosphorylation state of individual residues to discover which , if not all , of the residues are involved in this specific control of localization . finally , other phosphorylation sites at tyr residues could be important for the initial steps of soce activation , because an increase of total phosphorylated tyr has been detected in stim1 from platelets under store depletion conditions , and the inhibition of this phosphorylation decreases the binding of stim1 to orai1 and therefore soce .
however , the identification of the specific modified residues and the molecular mechanism underlying this regulation remains to be clarified .
with the recent studies of the role of stim1 phosphorylation on cell physiology , one has just started to understand the physiological relevance of this modulation .
in addition to hek293 cells , stim1 phosphorylation , enhanced by thapsigargin , has been reported in neonatal rat ventricular myocytes .
also , it is known that phosphorylation of stim1 at ser575 , one of the target sites of the erk1/2 activity , promotes the differentiation of cultured mouse c2c12 myoblasts to myocytes . in parallel
, it has been shown that stim1 is necessary and sufficient for cardiomyocyte hypertrophy in vitro and in the adult heart in vivo .
taken togeteher , these recent results indicate that the activity of stim1 as a ca channels regulator is important for skeletal and cardiac muscle cells development , and that stim1 phosphorylation constitutes a potential pharmacological target for the treatment of muscle hypertrophy .
the mek - erk pathway was early suggested as being involved in the activation of soce in human platelets , probably as a downstream effector of ras proteins , and it has recently been demonstrated that constitutive dephosphorylation of stim1 at erk1/2 target sites impairs platelet adhesion to fibrinogen , supporting a physiological role for stim1 phosphorylation by this signaling pathway . in conclusion , phosphorylation regulates the activation of stim1 .
however , the phosphorylation of different target residues has diverse effects . because a differential phosphorylation profile can trigger opposing actions , the phosphorylation state of target residues needs to be defined under different stimuli so that one can establish molecular models capable of predicting stim1 activities , particularly under pathophysiological conditions . in this scenario ,
phosphorylation target residues could be investigated as potential pharmacological targets for the treatment of diseases , since this would not alter upstream signaling cascades , and would therefore limit the intensity of side effects . | calcium ion ( ca2 + ) concentration plays a key role in cell signaling in eukaryotic cells . at the cellular level ,
ca2 + directly participates in such diverse cellular events as adhesion and migration , differentiation , contraction , secretion , synaptic transmission , fertilization , and cell death . as a consequence of these diverse actions ,
the cytosolic concentration of free ca2 + is tightly regulated by the coordinated activity of ca2 + channels , ca2 + pumps , and ca2 + -binding proteins .
although many of these regulators have been studied in depth , other proteins have been described recently , and naturally far less is known about their contribution to cell physiology . within this last group of proteins ,
stim1 has emerged as a major contributor to ca2 + signaling by means of its activity as ca2 + channel regulator .
stim1 is a protein resident mainly , but not exclusively , in the endoplasmic reticulum ( er ) , and activates a set of plasma membrane ca2 + channels termed store - operated calcium channels ( socs ) when the concentration of free ca2 + within the er drops transiently as a result of ca2 + release from this compartment .
knowledge regarding the molecular architecture of stim1 has grown considerably during the last years , and several structural domains within stim1 have been reported to be required for the specific molecular interactions with other important players in ca2 + signaling , such as ca2 + channels and microtubules . within the modulators of stim1 , phosphorylation has been shown to both activate and inactivate stim1-dependent ca2 + entry depending on the cell type , cell cycle phase , and the specific residue that becomes modified . here
we shall review current knowledge regarding the modulation of stim1 by phosphorylation . |
heart failure ( hf ) is a major and growing public health and clinical problem in the united states and other industrialized nations.1,2 despite advances in the medical and nonpharmacologic management of patients with acute and chronic manifestations of hf , the prognosis of patients with hf remains poor.38 given the aging of the american population , the improved treatment of coronary heart disease and hf , as well as the ongoing epidemics of obesity and diabetes , there is a myriad of reasons to believe that the characteristics and prognosis of persons with hf may have changed over time . despite the magnitude and impact of this clinical syndrome , however , few contemporary data exist , particularly from the more generalizable perspective of a population - based study , describing the long - term prognosis of patients hospitalized with decompensated hf , changes over time therein , or the independent predictors of death among representative populations with acute hf . in
a prior study carried out in the metropolitan worcester population , the long - term prognosis of patients discharged from all greater worcester medical centers after being hospitalized for acute hf in 2000 and factors associated with an increased risk of dying were examined.8 the objectives of the present community - wide observational study were to describe the overall prognosis of patients discharged from the hospital after acute hf , changing trends in the post - discharge survival of these patients , and to identify demographic and clinical factors associated with a poor long - term prognosis .
residents of the worcester ( ma ) metropolitan area discharged from all greater worcester medical centers after an episode of documented acute hf in 1995 and 2000 as part of the worcester heart failure study comprised the population of this report.9,10
adult male and female residents of all ages from the worcester ( ma ) metropolitan area ( 2000 census estimate = 478,000 ) hospitalized for possible acute hf at all eleven greater worcester medical centers during 1995 and 2000 comprised the study population . for purposes of identifying the study population ,
the medical records of patients with primary or secondary international classification of diseases , ninth revision ( icd-9 ) codes consistent with the possible presence of hf were reviewed in a standardized manner.9,10 patients with a discharge diagnosis of hf ( icd-9 code 428 ) comprised the primary diagnostic rubric reviewed for the identification of cases of possible hf .
in addition , the medical records of patients with discharge diagnoses of rheumatic hf ( icd-9 code 398.9 ) , hypertensive heart and renal disease ( icd-9 codes 402 and 404 , respectively ) , acute cor pulmonale ( icd-9 code 415 ) , other diseases of the endocardium ( icd-9 code 424 ) , cardiomyopathy ( icd-9 code 425.4 ) , pulmonary heart disease and congestion ( icd-9 codes 416.9 and 514 , respectively ) , acute lung edema ( icd-9 code 518.4 ) , edema ( icd-9 code 782.3 ) , and dyspnea and respiratory abnormalities ( icd-9 code 786 ) were reviewed by trained study physicians and nurses to identify patients who may have had newly diagnosed acute hf . the diagnosis of acute hf in greater worcester residents presenting to area hospitals with signs and symptoms of hf was defined as the presence of decompensated hf based on use of the framingham study criteria.11 these criteria included the presence of two major criteria ( eg , rales and distended neck veins ) or one major and two minor ( eg , night cough and dyspnea on ordinary exertion ) criteria .
an incident ( first ) event of acute hf was defined as the absence of a prior hospitalization for hf , physician diagnosis of hf , or past treatment for hf based on the review of data contained in hospital medical records .
patients who developed hf secondary to admission for another acute illness ( eg , acute myocardial infarction ) or after a procedure or surgery ( eg , percutaneous coronary intervention ) were not included .
patients who died during the index hospitalization were excluded from the final analytic sample , since the aim was to describe the long - term prognosis of discharged hospital patients .
information was collected about patient s demographic , medical history , and clinical characteristics , as well as laboratory test results , through the review of information contained in hospital medical records .
this included information about a patient s age , sex , race / ethnicity , body mass index ( bmi ) , initial symptoms of hf , physical examination findings , clinical characteristics , prior comorbidities ( eg , stroke , hypertension , diabetes mellitus ) , and laboratory findings ( eg , serum levels of glucose , hematocrit , estimated glomerular filtration rate [ egfr]).12 since ejection fraction findings during the index hospitalization were available for only one - third of hospital survivors of decompensated hf in the present study , this variable was not used in the analysis of factors associated with long - term prognosis after acute hf .
physicians progress notes and daily medication logs were reviewed for the prescribing of selected medications .
the use of cardiac medications that have been shown to be of benefit in improving the prognosis of patients with hf ( -blockers , angiotensin receptor blockers , and angiotensin- converting enzyme inhibitors ) , as well as the use of medications shown to be effective in relieving the symptoms of patients with acute hf ( digoxin and diuretics ) were examined.13 information about patients long - term survival status was obtained through the review of hospital medical records at all participating medical centers for subsequent hospitalizations or medical care contacts , as well as through the review of the social security death index and statewide death certificates .
a life - table approach was used to examine long - term mortality patterns after greater worcester residents were discharged from all metropolitan worcester medical centers after a first episode of acute hf or a new exacerbation of previously diagnosed hf in 1995 and 2000 through the end of 2008 , including patients with varying lengths of long - term follow - up .
long - term all - cause post - hospital - discharge death rates were calculated in a standard manner with accompanying 95% confidence intervals ( cis ) .
differences in the distribution of selected demographic and clinical characteristics between post - discharge decedents and survivors were examined using chi - square tests and t - tests for discrete and continuous variables , respectively .
differences in the long - term prognosis of patients discharged from all greater worcester hospitals after acute hf at selected post - discharge time points were examined through the use of chi - square tests and the log - rank test for statistical significance . a logistic regression approach was used to identify demographic , medical history , laboratory , and clinical factors associated with a poor prognosis after hf at 3 and 12 months after hospital discharge , given the high risk of dying at these time points .
multivariable adjusted odds ratios ( ors ) and accompanying 95% cis of factors associated with a poor prognosis at 3 months and at 1 year after hospital discharge were calculated in a standard manner .
these periods were chosen for analysis due to the high death rates experienced by patients with acute hf during the first several months to 1 year after hospital discharge for hf .
since further information was not available about changes in patients clinical or treatment statuses after being discharged from greater worcester medical centers during the years under study , the identification of factors associated with a poor prognosis was focused on those that could be identified at the time of hospital discharge for hf and that may be amenable to change .
the use of various hospital therapies were not controlled for in these multivariable adjusted regression analyses , due to the nonrandomized observational nature of the present noncurrent prospective study and potential for confounding by treatment indication .
further , treatment variables were not included in the multivariable adjusted regression models due to the difficulty in interpretation of any resultant findings .
after an extensive review of hospital medical records and various disease diagnostic rubrics in which cases of possible hf might be found , a total of 1949 greater worcester residents were hospitalized for acute hf in the year 1995 and 2587 in the year 2000 ; of these , there were a total of 508 incident ( initial episode ) events of acute hf in 1995 and 645 cases of newly diagnosed acute hf in 2000 . in 1995 , 8.5% of all cases of acute hf died during their index hospitalization compared with 5.5% of all patients with acute hf in 2000 ; among incident cases of acute hf , 7.9% died in 1995 , whereas 5.7% died in 2000 . after excluding patients who died during their index hospitalization , in order to systematically characterize the post - discharge prognosis of patients with acute hf , the final analytic sample consisted of 1783 hospital survivors in 1995 and 2445 patients in 2000 ; of these ,
the average age of the study population was 76 years , 57% were women , and approximately three - quarters had been previously diagnosed with hf based on a review of the information contained in hospital medical records .
there were no appreciable differences in the average age ( 75 years versus 76 years ) , proportion of women ( 58% versus 57% ) , or percentage of patients presenting with a first episode of hf ( 26% versus 25% ) between hospital survivors of hf in 1995 as compared with those discharged in 2000 , respectively . in examining the long - term prognosis for all patients discharged after a confirmed episode of acute hf , the 3-month , 1-year , and 5-year death rates were 18.8% ( 95% ci 17.6%20.0% ) , 39.7% ( 95% ci 38.2%41.2% ) , and 82.9% ( 95% ci 81.7%84.0% ) , respectively .
patients discharged from all greater worcester medical centers in 2000 after hospitalization for decompensated hf experienced slightly lower all - cause death rates than patients discharged in 1995 at each of the time points examined , namely 3 months , 1 year , and 5 years ( table 1 ) .
when post - discharge death rates in persons with an incident ( first ) documented episode of acute hf were examined , patients discharged from all greater worcester hospitals in 2000 also experienced slightly lower post - discharge death rates at 3 months , 1 year , and at 5 years compared with patients discharged in 1995 ( table 1 ) .
a series of multiple regression analyses were carried out for purposes of determining whether the long - term prognosis after hf has changed during the years under study after controlling for a number of factors of prognostic importance . after controlling for age , sex , medical history of several comorbid conditions , acute symptoms , and laboratory findings in these regression analyses ,
patients discharged from all greater worcester hospitals in 2000 , as compared with those discharged in 1995 , were at considerably lower risk of dying at 3 months ( or = 0.85 , 95% ci 0.731.00 ) and at 1 year ( or = 0.81 , 95% ci = 0.710.92 ) . given the high death rates experienced by hospital survivors of acute hf during the first year after being discharged from the hospital after acute decompensated hf , the demographic and clinical characteristics of post - discharge decedents were compared with survivors at 3 months and at 1 year ( table 2 ) .
overall , patients who died during the first 3 months after hospital discharge were generally older , had a lower bmi , and were more likely to have been previously diagnosed with anemia , chronic kidney disease , stroke , and hf than survivors of this high - risk period ( table 2 ) .
patients who died during the first 3 months following hospital discharge were more likely to present with weakness at the time of their index hospitalization than post - discharge survivors .
patients dying during the first 3 months after hospital discharge had markedly lower blood pressure findings than patients who survived this period .
post - discharge decedents were less likely to have been prescribed angiotensin converting enzyme ( ace ) inhibitors / angiotensin receptor blockers , aspirin , beta blockers , and digoxin than patients who survived the initial 3 months or 1 year after hospital discharge .
relatively similar characteristics were associated with an adverse prognosis during the first 3 months and 1 year after hospital discharge for hf when the characteristics of post - discharge decedents were examined , comparing survivors hospitalized in 1995 with those hospitalized in 2000 ( data not shown ) .
similarly , when the characteristics of individuals hospitalized with acute hf who died during the first year after hospital discharge were compared with those who did not die over this period , post - discharge decedents were older , had a lower bmi , and were more likely to have had anemia , chronic obstructive pulmonary disease ( copd ) , or hf previously diagnosed ( table 2 ) .
persons who died during the first year after hospital discharge had a different symptom profile at the time of hospital admission than persons who survived this period .
decedents in the first year after hospital discharge were also less likely than survivors to have been treated with effective cardiac therapies .
a relatively similar profile of demographic , clinical , and treatment characteristics was observed in 1-year post - discharge decedents as compared with post - discharge survivors during each of the 2 years under study ( data not shown ) .
a series of multivariable adjusted regression analyses were carried out for purposes of identifying factors independently associated with post - discharge death rates at 3 months and 1 year , overall and separately , in the two patient cohorts ( table 3 ) .
advanced age , a history of copd or stroke , generalized weakness at the time of hospital presentation , and lower egfr and systolic blood pressure findings were associated with an increased odds of dying during the first 3 months after hospital discharge for decompensated hf . on the other hand ,
a higher bmi and a history of hypertension were associated with a lower odds of dying within 3 months after hospital discharge .
relatively similar prognostic factors were associated with an adverse prognosis in each of the two study cohorts ( 1995 and 2000 ) , though their predictive importance varied slightly .
similar factors to those identified as being of prognostic importance during the first 3 months after hospital discharge were associated with an increased risk for dying during the first year after hospital discharge ( table 3 ) .
in addition , a history of previously diagnosed anemia , chronic kidney disease , and hf were associated with a greater likelihood of dying at 1 year ; the presence of orthopnea at the time of hospital admission was associated with a lower odds of dying at 1 year after hospital discharge for hf .
relatively similar factors were associated with an increased risk of dying during the first year after hospital discharge in patients hospitalized in 1995 and in those hospitalized during 2000 .
after an extensive review of hospital medical records and various disease diagnostic rubrics in which cases of possible hf might be found , a total of 1949 greater worcester residents were hospitalized for acute hf in the year 1995 and 2587 in the year 2000 ; of these , there were a total of 508 incident ( initial episode ) events of acute hf in 1995 and 645 cases of newly diagnosed acute hf in 2000 . in 1995 , 8.5% of all cases of acute hf died during their index hospitalization compared with 5.5% of all patients with acute hf in 2000 ; among incident cases of acute hf , 7.9% died in 1995 , whereas 5.7% died in 2000 . after excluding patients who died during their index hospitalization , in order to systematically characterize the post - discharge prognosis of patients with acute hf , the final analytic sample consisted of 1783 hospital survivors in 1995 and 2445 patients in 2000 ; of these ,
the average age of the study population was 76 years , 57% were women , and approximately three - quarters had been previously diagnosed with hf based on a review of the information contained in hospital medical records .
there were no appreciable differences in the average age ( 75 years versus 76 years ) , proportion of women ( 58% versus 57% ) , or percentage of patients presenting with a first episode of hf ( 26% versus 25% ) between hospital survivors of hf in 1995 as compared with those discharged in 2000 , respectively .
in examining the long - term prognosis for all patients discharged after a confirmed episode of acute hf , the 3-month , 1-year , and 5-year death rates were 18.8% ( 95% ci 17.6%20.0% ) , 39.7% ( 95% ci 38.2%41.2% ) , and 82.9% ( 95% ci 81.7%84.0% ) , respectively .
patients discharged from all greater worcester medical centers in 2000 after hospitalization for decompensated hf experienced slightly lower all - cause death rates than patients discharged in 1995 at each of the time points examined , namely 3 months , 1 year , and 5 years ( table 1 ) .
when post - discharge death rates in persons with an incident ( first ) documented episode of acute hf were examined , patients discharged from all greater worcester hospitals in 2000 also experienced slightly lower post - discharge death rates at 3 months , 1 year , and at 5 years compared with patients discharged in 1995 ( table 1 ) .
a series of multiple regression analyses were carried out for purposes of determining whether the long - term prognosis after hf has changed during the years under study after controlling for a number of factors of prognostic importance .
after controlling for age , sex , medical history of several comorbid conditions , acute symptoms , and laboratory findings in these regression analyses , patients discharged from all greater worcester hospitals in 2000 , as compared with those discharged in 1995 , were at considerably lower risk of dying at 3 months ( or = 0.85 , 95% ci 0.731.00 ) and at 1 year ( or = 0.81 , 95% ci = 0.710.92 ) .
given the high death rates experienced by hospital survivors of acute hf during the first year after being discharged from the hospital after acute decompensated hf , the demographic and clinical characteristics of post - discharge decedents were compared with survivors at 3 months and at 1 year ( table 2 ) .
overall , patients who died during the first 3 months after hospital discharge were generally older , had a lower bmi , and were more likely to have been previously diagnosed with anemia , chronic kidney disease , stroke , and hf than survivors of this high - risk period ( table 2 ) .
patients who died during the first 3 months following hospital discharge were more likely to present with weakness at the time of their index hospitalization than post - discharge survivors .
patients dying during the first 3 months after hospital discharge had markedly lower blood pressure findings than patients who survived this period .
post - discharge decedents were less likely to have been prescribed angiotensin converting enzyme ( ace ) inhibitors / angiotensin receptor blockers , aspirin , beta blockers , and digoxin than patients who survived the initial 3 months or 1 year after hospital discharge .
relatively similar characteristics were associated with an adverse prognosis during the first 3 months and 1 year after hospital discharge for hf when the characteristics of post - discharge decedents were examined , comparing survivors hospitalized in 1995 with those hospitalized in 2000 ( data not shown ) .
similarly , when the characteristics of individuals hospitalized with acute hf who died during the first year after hospital discharge were compared with those who did not die over this period , post - discharge decedents were older , had a lower bmi , and were more likely to have had anemia , chronic obstructive pulmonary disease ( copd ) , or hf previously diagnosed ( table 2 ) .
persons who died during the first year after hospital discharge had a different symptom profile at the time of hospital admission than persons who survived this period .
decedents in the first year after hospital discharge were also less likely than survivors to have been treated with effective cardiac therapies .
a relatively similar profile of demographic , clinical , and treatment characteristics was observed in 1-year post - discharge decedents as compared with post - discharge survivors during each of the 2 years under study ( data not shown ) .
a series of multivariable adjusted regression analyses were carried out for purposes of identifying factors independently associated with post - discharge death rates at 3 months and 1 year , overall and separately , in the two patient cohorts ( table 3 ) .
advanced age , a history of copd or stroke , generalized weakness at the time of hospital presentation , and lower egfr and systolic blood pressure findings were associated with an increased odds of dying during the first 3 months after hospital discharge for decompensated hf . on the other hand ,
a higher bmi and a history of hypertension were associated with a lower odds of dying within 3 months after hospital discharge .
relatively similar prognostic factors were associated with an adverse prognosis in each of the two study cohorts ( 1995 and 2000 ) , though their predictive importance varied slightly .
similar factors to those identified as being of prognostic importance during the first 3 months after hospital discharge were associated with an increased risk for dying during the first year after hospital discharge ( table 3 ) .
in addition , a history of previously diagnosed anemia , chronic kidney disease , and hf were associated with a greater likelihood of dying at 1 year ; the presence of orthopnea at the time of hospital admission was associated with a lower odds of dying at 1 year after hospital discharge for hf .
relatively similar factors were associated with an increased risk of dying during the first year after hospital discharge in patients hospitalized in 1995 and in those hospitalized during 2000 .
the results of this large observational study in residents of metropolitan worcester hospitalized at all greater worcester medical centers with acute hf demonstrate that patients with this clinical syndrome experience high death rates after hospital discharge . despite the overall poor prognosis of this condition , however , there were slight improvements in the crude 3-month and 1-year survival rates noted between 1995 and 2000 .
these findings were further magnified after controlling for a number of demographic and clinical factors of long - term prognostic importance .
a number of demographic and clinical characteristics were able to be identifed that were associated with an increased risk for dying during the first year after hospital discharge for acute hf .
residents of greater worcester with acute hf in 1995 and 2000 experienced high death rates after hospital discharge . indeed ,
hospitalization for acute hf has been shown to be one of the strongest risk factors for dying in patients with a history of hf.14 on the other hand , the results of the present study showed encouraging improvements in the likelihood of surviving at both 3 months and 1 year in patients discharged from all metropolitan worcester hospitals after acute hf in 2000 as compared with 1995 . although the observational nature of the investigation does not allow for proof of causality , the observed improvements in long - term prognosis may be due to the improved hospital treatment of acute hf , increased use and effectiveness of outpatient clinics for patients with hf , greater use of effective medical and nonpharmacologic regimens for hospital survivors of hf and greater adherence to these treatment modalities , and/or increased provider attention to the use of guidelines for the more effective management of patients with hf .
few studies have described the long - term prognosis associated with acute hf from a more generalizable community - based perspective or determined whether or not the long - term prognosis of patients with hf has changed over time . in a large population - based study of olmsted county , minnesota , residents ,
the 5-year age - adjusted survival rates associated with hf improved significantly between 1991 and 1996.15 in an investigation of more than 1000 framingham heart study enrollees who had developed new - onset hf between 1950 and 1999 , improvements in survival after new - onset hf were estimated to be approximately 12% per decade for men and women enrolled in this seminal longitudinal study.16 improving trends in the 3-year survival rates after new - onset hf have also been demonstrated in a national study of older and younger patients from scotland with hf over the period 19861995.17 in a prior analysis of data collected in the worcester heart failure study , the authors of the present study described the long - term death rates associated with acute hf in residents of the worcester metropolitan area discharged after acute hf in 2000.8 the present study extends the findings of these community - based studies to a relatively contemporary and high - risk cohort of predominantly elderly patients hospitalized for acute hf .
the data suggest that hf remains a highly serious and lethal condition for most hospitalized patients but that patients long - term prognosis has been improving .
the authors hypothesize that increases in the percentage of patients receiving cardiac medications shown to be of benefit in improving the long - term prognosis of patients with hf over the years under study may have contributed to the improvements in long - term prognosis noted between 1995 and 2000 , though this hypothesis was unable to be directly tested due to the nonrandomized observational nature of the present investigation .
to better understand the factors affecting prognosis after hf , particularly for patients encountered in the broader community setting , the independent prognostic significance of several demographic and clinical factors on long - term survival at different time points was evaluated . at 3 months after hospital discharge , older age ,
a lower blood pressure and bmi , and the presence of previously diagnosed copd , chronic kidney disease , stroke , and prior hf were associated with an increased risk of dying .
similar prognostic variables have been identified in other studies evaluating short - term mortality among patients with hf.18,19 the association between copd and hf is well known , as between 10% and 50% of all hf patients also have coexisting copd.20 in a similar fashion to hf , copd is characterized by both recurrent acute exacerbations as well as by a general progression of disease over time.21 in addition , the stress on the cardiovascular system from complications of copd , including hypoxia , cor pulmonale , and polycythemia , could theoretically exacerbate hf over time , and the presence of copd may make it more difficult to diagnose hf.20 furthermore , beta blockers may not be tolerated by patients with both copd and hf , and beta agonist treatment of copd has been associated with increased mortality in these individuals.22 previous studies have found that approximately one - third of patients with hf will also have concomitant renal dysfunction,23 and as with copd , the relationship between chronic and acute renal disease and adverse prognosis has been well documented.24 renal dysfunction complicates acute and chronic treatment decisions in volume - overloaded patients , and renal function may be worsened by concomitant diuretic administration.25 the data of this present study suggest that early mortality after hospitalization for hf is strongly associated with advanced age , a previous history of hf , and the presence of other serious comorbid conditions , several of which appear to be secondary to chronic hf such as cardiorenal syndrome .
relatively similar factors were associated with an increased risk of dying during the first year after discharge .
as has been noted in prior studies involving patients with acute hf , bmi was inversely related to mortality in the present study s hospitalized cohort.26,27 it has been hypothesized that cardiac cachexia may contribute to the obesity paradox in hf , although the causes of cachexia among patients with severe hf are complex and incompletely understood.28 it also remains unclear whether patients who are obese are more likely to develop or be diagnosed with acute hf earlier and the extent to which obesity affects prognosis once hf is manifest .
factors associated with a poor prognosis after hospital discharge for acute hf , including those associated with preserved versus systolic hf , merit further study , particularly with regards to better understanding the possible mechanisms involved so that appropriate advice and treatment regimens may be prescribed for patients with acute hf and its major subtypes .
although considerable advances have been made and will continue to be made in the management of patients with acute hf , it is important that clinicians have a realistic understanding of the long - term prognosis associated with this clinical syndrome , including the extremely high death rates observed in the present study . clinicians also need to be aware of factors that adversely affect patients long - term survival , which may facilitate targeted treatment toward specific high - risk groups or help inform decisions about making realistic expectations about prognosis .
decisions about the use of more aggressive interventions for patients with hf must also take into account the presence and effect of various comorbidities on the patient s long - term survival outlook . in the present study ,
post - discharge decedents were less likely to be discharged on effective cardiac medications , perhaps due to the fact that these patients were elderly , more likely to be hypotensive , and had worse renal function at the time of hospitalization compared with those who survived . in light of the fact that elderly patients tend to have more comorbid conditions ,
many of which also preclude the use of medications known to improve long - term survival , and since they may be less likely to be prescribed these medications due to their advanced age , it is not surprising that their prognosis is worse . a recent meta - analysis examining the efficacy of ace inhibitors in patients with chronic hf with preserved ejection fraction found that ace inhibitors reduced hf - related hospitalizations in elderly patients.29 another meta - analysis of more than 12,000 patients with systolic hf found that -blockers improved mortality in elderly patients , with a similar relative risk reduction in mortality between elderly and nonelderly patients.30 the aldosterone antagonists are another important class of medications shown to have benefit in patients with systolic hf.31 despite the known benefits associated with the use of these medications , they remain underprescribed in patients discharged from the hospital after decompensated hf , particularly in elderly patients.32 treating these high - risk patients with evidence - based therapies to optimize their long - term survival , while balancing risk , remains a clinical challenge and an area in need of further investigation .
residents of greater worcester with acute hf in 1995 and 2000 experienced high death rates after hospital discharge . indeed ,
hospitalization for acute hf has been shown to be one of the strongest risk factors for dying in patients with a history of hf.14 on the other hand , the results of the present study showed encouraging improvements in the likelihood of surviving at both 3 months and 1 year in patients discharged from all metropolitan worcester hospitals after acute hf in 2000 as compared with 1995 . although the observational nature of the investigation does not allow for proof of causality , the observed improvements in long - term prognosis may be due to the improved hospital treatment of acute hf , increased use and effectiveness of outpatient clinics for patients with hf , greater use of effective medical and nonpharmacologic regimens for hospital survivors of hf and greater adherence to these treatment modalities , and/or increased provider attention to the use of guidelines for the more effective management of patients with hf .
few studies have described the long - term prognosis associated with acute hf from a more generalizable community - based perspective or determined whether or not the long - term prognosis of patients with hf has changed over time . in a large population - based study of olmsted county , minnesota ,
residents , the 5-year age - adjusted survival rates associated with hf improved significantly between 1991 and 1996.15 in an investigation of more than 1000 framingham heart study enrollees who had developed new - onset hf between 1950 and 1999 , improvements in survival after new - onset hf were estimated to be approximately 12% per decade for men and women enrolled in this seminal longitudinal study.16 improving trends in the 3-year survival rates after new - onset hf have also been demonstrated in a national study of older and younger patients from scotland with hf over the period 19861995.17 in a prior analysis of data collected in the worcester heart failure study , the authors of the present study described the long - term death rates associated with acute hf in residents of the worcester metropolitan area discharged after acute hf in 2000.8 the present study extends the findings of these community - based studies to a relatively contemporary and high - risk cohort of predominantly elderly patients hospitalized for acute hf .
the data suggest that hf remains a highly serious and lethal condition for most hospitalized patients but that patients long - term prognosis has been improving .
the authors hypothesize that increases in the percentage of patients receiving cardiac medications shown to be of benefit in improving the long - term prognosis of patients with hf over the years under study may have contributed to the improvements in long - term prognosis noted between 1995 and 2000 , though this hypothesis was unable to be directly tested due to the nonrandomized observational nature of the present investigation .
to better understand the factors affecting prognosis after hf , particularly for patients encountered in the broader community setting , the independent prognostic significance of several demographic and clinical factors on long - term survival at different time points was evaluated . at 3 months after hospital discharge , older age ,
a lower blood pressure and bmi , and the presence of previously diagnosed copd , chronic kidney disease , stroke , and prior hf were associated with an increased risk of dying .
similar prognostic variables have been identified in other studies evaluating short - term mortality among patients with hf.18,19 the association between copd and hf is well known , as between 10% and 50% of all hf patients also have coexisting copd.20 in a similar fashion to hf , copd is characterized by both recurrent acute exacerbations as well as by a general progression of disease over time.21 in addition , the stress on the cardiovascular system from complications of copd , including hypoxia , cor pulmonale , and polycythemia , could theoretically exacerbate hf over time , and the presence of copd may make it more difficult to diagnose hf.20 furthermore , beta blockers may not be tolerated by patients with both copd and hf , and beta agonist treatment of copd has been associated with increased mortality in these individuals.22 previous studies have found that approximately one - third of patients with hf will also have concomitant renal dysfunction,23 and as with copd , the relationship between chronic and acute renal disease and adverse prognosis has been well documented.24 renal dysfunction complicates acute and chronic treatment decisions in volume - overloaded patients , and renal function may be worsened by concomitant diuretic administration.25 the data of this present study suggest that early mortality after hospitalization for hf is strongly associated with advanced age , a previous history of hf , and the presence of other serious comorbid conditions , several of which appear to be secondary to chronic hf such as cardiorenal syndrome .
relatively similar factors were associated with an increased risk of dying during the first year after discharge .
as has been noted in prior studies involving patients with acute hf , bmi was inversely related to mortality in the present study s hospitalized cohort.26,27 it has been hypothesized that cardiac cachexia may contribute to the obesity paradox in hf , although the causes of cachexia among patients with severe hf are complex and incompletely understood.28 it also remains unclear whether patients who are obese are more likely to develop or be diagnosed with acute hf earlier and the extent to which obesity affects prognosis once hf is manifest .
factors associated with a poor prognosis after hospital discharge for acute hf , including those associated with preserved versus systolic hf , merit further study , particularly with regards to better understanding the possible mechanisms involved so that appropriate advice and treatment regimens may be prescribed for patients with acute hf and its major subtypes . although considerable advances have been made and will continue to be made in the management of patients with acute hf , it is important that clinicians have a realistic understanding of the long - term prognosis associated with this clinical syndrome , including the extremely high death rates observed in the present study .
clinicians also need to be aware of factors that adversely affect patients long - term survival , which may facilitate targeted treatment toward specific high - risk groups or help inform decisions about making realistic expectations about prognosis .
decisions about the use of more aggressive interventions for patients with hf must also take into account the presence and effect of various comorbidities on the patient s long - term survival outlook . in the present study ,
post - discharge decedents were less likely to be discharged on effective cardiac medications , perhaps due to the fact that these patients were elderly , more likely to be hypotensive , and had worse renal function at the time of hospitalization compared with those who survived . in light of the fact that elderly patients tend to have more comorbid conditions ,
many of which also preclude the use of medications known to improve long - term survival , and since they may be less likely to be prescribed these medications due to their advanced age , it is not surprising that their prognosis is worse .
a recent meta - analysis examining the efficacy of ace inhibitors in patients with chronic hf with preserved ejection fraction found that ace inhibitors reduced hf - related hospitalizations in elderly patients.29 another meta - analysis of more than 12,000 patients with systolic hf found that -blockers improved mortality in elderly patients , with a similar relative risk reduction in mortality between elderly and nonelderly patients.30 the aldosterone antagonists are another important class of medications shown to have benefit in patients with systolic hf.31 despite the known benefits associated with the use of these medications , they remain underprescribed in patients discharged from the hospital after decompensated hf , particularly in elderly patients.32 treating these high - risk patients with evidence - based therapies to optimize their long - term survival , while balancing risk , remains a clinical challenge and an area in need of further investigation .
the primary strength of this study is the inclusion of a large sample of patients hospitalized with independently validated hf from a well characterized new england metropolitan area . in addition , information was collected about a number of different factors that could affect the long - term prognosis after hf , and the rates of patient follow - up were excellent .
the limitations of the study include the inability to systematically examine the long - term prognosis of patients with acute hf according to type of left ventricular dysfunction ( systolic versus diastolic ) given the extent of missing data with regard to ejection fraction findings .
in addition , it was not possible to assess the prognostic value of brain natriuretic peptide and troponin laboratory values as these factors were not routinely measured at the greater worcester medical centers studied in 1995 and 2000 .
the results of the present study suggest that the long - term survival outlook for patients discharged from the hospital after acute hf remains poor but is improving .
a number of characteristics associated with a poor long - term prognosis were identified , several of which might be effectively intervened upon .
the present results provide further impetus for current efforts to improve the management of patients with acute hf and for the further development and increased use of long - term strategies to enhance patients adherence to effective medical and nonpharmacologic treatment regimens . | backgrounddespite the magnitude and impact of heart failure ( hf ) in the united states , relatively little data are available that describe the prognosis associated with acute hf , especially from the perspective of a population - based investigation .
the purpose of this nonconcurrent prospective study was to describe the overall , and changing trends therein , prognosis of 4228 patients discharged from all eleven greater worcester ( ma ) medical centers after a documented episode of acute hf and factors associated with an increased risk of dying after hospital discharge.methodsthe study population consisted of residents of the worcester metropolitan area discharged after being hospitalized for acute hf at all greater worcester medical centers during 1995 ( n = 1783 ) and 2000 ( n = 2445).resultsthe 3-month ( 20% versus 18% ) , 1-year ( 41% versus 38% ) , and 5-year ( 84% versus 82% ) death rates were lower in patients discharged from all metropolitan worcester hospitals in 2000 versus 1995 , respectively . improving long - term survival rates for patients discharged in 2000 as compared with 1995 were magnified after controlling for several confounding demographic and clinical factors of prognostic importance .
a number of potentially modifiable demographic , medical history , and clinical factors were associated with an increased risk of dying during the first year after hospital discharge for acute hf.conclusionthe results of this community - wide observational study suggest improving trends in the long - term prognosis after acute hf . despite these encouraging trends ,
the long - term prognosis for patients with acute hf remains poor , and several at - risk groups can be identified for early intervention and increased monitoring efforts . |
hirayama disease ( hd ) , also known as monomelic amyotrophy ( ma ) , is a rare motor neuron disorder that involves a single upper extremity.1 in 1959 , hirayama et al first described this disease , which reportedly lacks clinical signs compatible with any of the previously recognized degenerative disorders or disorders causing progressive muscular dystrophy.2 the age of onset of the disease ranges between 20 and 35 years , and it is more common in men .
it is clinically characterized by weakness and atrophy of the muscles of hand and forearm.3 the disease is limited to motor neuron involvement affecting upper extremity , and lower extremity , bulbar , and sensory involvement are absent.4,5 in some cases , muscle weakness becomes prominent in cold weather ( cold paresis ) .
affected persons complain about their weakness being exaggerated in cold weather and resolved in warm weather .
hence , they typically notice their disease in winter months . rarely , the disease may be accompanied by hyperhidrosis and abnormal sympathetic skin response .
although its etiology is unknown , theories have been put forth that it occurs secondary to chronic compression of spinal cord or atopy.6 this report presents a 19-year - old woman who visited the orthopedics outpatient clinic with weakness and atrophy in her right hand and was clinically diagnosed with advanced stage carpal tunnel syndrome and scheduled for surgical intervention ; she was later diagnosed with hd by an electrophysiological study . before attempting to prepare the paper , a written informed consent to have the case details and any accompanying images published was obtained from the patient .
a 19-year - old woman who presented to the orthopedics outpatient clinic with weakness and atrophy in her right hand was diagnosed with advanced stage carpal tunnel syndrome and recommended surgery .
she was then referred to the electrophysiology laboratory of the hospital s neurology department for electroneuromyography ( enmg ) .
she stated that her symptoms had begun 2 years ago ; she occasionally had numbness and chilling sensation in her right arm ; and she had long been unable to carry anything in her right hand .
her physical examination was also normal except for neurological examination which revealed atrophic appearance of the right hand ( figures 1 and 2 ) and a muscle strength of 4/5 in the distal part of the right arm .
it was also noted that the distal interphalangeal joint of the first finger of the right hand had a muscle strength of 1/5 and the proximal one had a muscle strength of 4/5 .
muscle strength was 2/5 in the distal and proximal interphalangeal joints of the second finger .
the wrist circumference measured 5 cm proximal to the wrist was 15 cm on the right side and 16 cm on the left side .
the arm circumference measured 10 cm proximal to the elbow was 26 cm on the right side and 26.5 cm on the left side .
cranial and cervical vertebral magnetic resonance imaging ( mri ) studies performed at an outside center were normal .
an enmg was performed , which demonstrated an absent right median and ulnar nerve compound muscular action potential ( cmap ) at the motor conduction study .
the sensory conduction study revealed normal sensory action potential ( sap ) conduction velocities and amplitudes in the right median nerve , right ulnar nerve , right radial nerve , right lateral antebrachial cutaneous nerve ( right median nerve second finger sap amplitude 56.6 v , conduction velocity 63.8 m / s ; right median nerve third finger sap amplitude 34.7 v , conduction velocity 59.3 m / s ; right ulnar nerve fifth finger amplitude 12.1 v , conduction velocity 56.3 m / s ; right radial nerve amplitude 31.2 v , conduction velocity 59 m / s ; right lateral antebrachial cutaneous nerve amplitude 11.1 v , conduction velocity 66.7 m / s ) .
a needle enmg recorded very large amplitude single oscillation pattern and diffuse spontaneous denervation potentials ( positive sharp waves and fibrillation potentials ) in the right first dorsal interosseous muscle , right abductor digiti minimi muscle , and right abductor pollicis brevis muscle .
hd affects men more commonly than women , and the first symptoms appear in the 20s .
hd is limited to a single extremity such as an arm or hand rather than legs.7 the age of the patient of the present study was consistent with the literature reports although her gender was female , being in a less affected group .
nalini et al , in a 190-patient study , reported only one case of familial hd.8 no family member of the patient had this disease , and thus he was considered a sporadic case .
the common clinical symptoms of the disease which are present in > 80% of the affected persons include cold paresis and irregular tremor in finger extension ( minipolymyoclonus).9,10 the patient had cold paresis but lacked irregular tremor or involuntary movements .
hd is a condition with insidious onset and limits itself with atrophy and weakness in hand and forearm.11 the patient in the present study had no prominent atrophy and weakness in her right upper extremity and forearm but had prominent thenar atrophy and weakness in hand muscles , making the orthopedic surgeon consider advanced stage carpal tunnel syndrome . in the latter , the addition of worsened localized demyelination and axonal degeneration leads to muscle paresis and atrophy as well as skin hypoesthesia and anesthesia .
it is common that as the intensity of neurological signs increase , pain and paresthesia are gradually alleviated but thenar atrophy becomes more prominent . in this patient ,
a more prominent atrophy in the thenar region compared to the hypothenar region and the absence of pain , which were coupled with the absence of electrophysiological tests , led the orthopedic surgeon to diagnose advanced stage carpal tunnel syndrome , a condition which is common .
although hyperhidrosis and abnormal sympathetic skin responses have been reported in some studies , this patient lacked excess perspiration , and sympathetic skin responses were not studied .
nerve conduction tests have been found normal in most patients with hd.12 nevertheless , atypical cases have also been reported , which were characterized by slowed conduction and reduced cmap amplitudes .
hamano et al reported reduced conduction velocity and reduced cmap amplitudes in the affected extremity.13 cmap could not be obtained from the motor fibers of the right median and ulnar nerves in the nerve conduction study .
enmg yields a typical neurogenic response in atrophic muscles , suggesting anterior horn involvement . in this patient , very large amplitude single oscillation pattern and diffuse spontaneous denervation potentials ( positive sharp waves and fibrillation potentials ) were detected , suggesting anterior horn cellular involvement in the right hand where atrophy was observed ( in right first dorsal interosseal muscle , right abductor digiti minimi muscle , and right abductor pollicis brevis muscle ) .
a report in the literature has identified intrinsic spinal cord pathologies in cervical mri in some cases.14 this patient had normal cervical mri examination .
although similar distal atrophy of forearm and hand can be observed in the early stages of amyotrophic lateral sclerosis , there are typical fasciculations in the upper aspect of the arm during rest.15 the patient did not have similar fasciculations . in conclusion ,
hd should be definitely considered in the differential diagnosis of advanced stage carpal tunnel syndrome in a young person presenting with weakness in hand muscles and a predominant thenar atrophy in a single upper extremity .
a careful electrophysiological study and neurological examination can make the diagnosis of hd . in this way
, advanced stage carpal tunnel syndrome will be ruled out and patients will be spared from an unnecessary surgical operation . | hirayama disease ( hd ) is a rare motor neuron disorder that involves a single upper extremity .
it is clinically characterized by weakness and atrophy of the muscles of the hand and forearm .
this article presents a 19-year - old woman who visited the orthopedics outpatient clinic with weakness and atrophy in her right hand and was clinically diagnosed with advanced stage carpal tunnel syndrome and scheduled for surgical intervention ; she was later diagnosed with hd by an electrophysiological study . as a result , it has been found that a careful electrophysiological study and neurological examination can be used to diagnose hd . in this way
, advanced stage carpal tunnel syndrome will be ruled out and patients will be spared from an unnecessary surgical operation . |
phosphorus is necessary for several , various biological roles in the signal transduction of cells and energy exchange of human body . about 80%90% of phosphorus
mineral balance is regulated by a complex interaction between gastrointestinal absorption , renal excretion and translocation between parts of the human body .
impaired intestinal phosphate absorption , renal phosphate reabsorption , and phosphate metabolism can elevate serum phosphorus level .
elevated serum phosphorus is suspected to elevate the risk of cardiovascular disease ( cvd ) through vascular calcification , myocardial fibrosis , and development of left ventricular hypertrophy .
erectile dysfunction ( ed ) is a frequent problem that affects about 15% of men 40 to 50 years of age , 45% of men in their 60s , and 70% of men older than 70 .
in addition to being a distressing condition itself , ed is thought to be a harbinger of cvd and mortality .
organic ed and coronary artery disease ( cad ) are closely related , as endothelial dysfunction leads to a restriction of blood flow .
ed and cvd share many common risk factors , such as age , hypertension , insulin resistance , increased body mass index ( bmi ) , cholesterol , lower levels of high - density lipoprotein , and smoking .
overall atherosclerotic processes affect arterial blood flow and lead to major pathophysiologic changes that contribute to both cardiovascular and peripheral vascular diseases , including ed .
there is a growing body of evidence that ed is a sentinel marker of subclinical cvd and likely precedes symptomatic cad . in light of these observations
, we assessed whether serum phosphorus is associated with erectile function in middle - aged korean men .
the proposal of our research was approved by the institutional review board of national police hospital ( no .
it is a cross - sectional study including 1,899 male police officers ranging from 40 to 59 years who entered in a prostate health screening between march and september 2013 at national police hospital .
people who were taking drugs affecting prostate physiology , such as antiandrogens and 5--reductase inhibitors , who used phosphodiesterase-5 inhibitors daily or nutrients that might adjust mineral or bone metabolism , who had palpable nodules on the digital rectal examination , or who showed a high prostate - specific antigen ( psa ) level ( > 4.0 ng / ml ) were not included in our study . additionally , patients diagnosed with chronic kidney disease were excluded .
blood samples were obtained to measure serum psa , testosterone , and phosphorus between 7:00 am and 9:00 am after eight hours fasting .
total psa was measured by an abbott architect i2000 analyzer using the abbott architect total psa assay ( abbott laboratories , slingo , ireland ) .
serum testosterone was calculated by ria ( parc marcel boiteux , codolet , cisbio bioassays inc . ,
serum inorganic phosphorus was determined with a hitachi 7600 - 020 ( hitachi co. , tokyo , japan ) autoanalyzer using hrii series p - hrii reagent ( wako pure cemical industries ltd , osaka , japan ) . certified version of the ipss was served to participants to evaluate voiding symptoms .
prostate volume ( pv ) was measured by transrectal ultrasound ( ultraview , bk medical , copenhagen , denmark ) , and digital rectal examination of prostate was also carried out .
blood pressure was measured over twice ( 5 minutes apart ) in the right arm using a digital blood pressure monitors , were averaged .
waist circumference was measured at the level of uppermost border of hipbones ( iliac crest ) .
blood was sampled at the same time of day ( 7:009:00 am ) in the 8 hours fasting state .
chemistry tests included measurements of serum glucose , total cholesterol , high - density lipoprotein cholesterol , low - density lipoprotein cholesterol , and triglycerides .
metabolic syndrome ( mets ) was diagnosed in case of three or more of the national cholesterol education program adult treatment panel iii for asians criteria were confirmed .
first , one - way analysis of variance tests were assessed to compare the differences in iief-5 scores according to other factors , such as age , bmi , testosterone level , psa , phosphorus , and pv .
chi - square or fisher exact test were performed to compare the differences in iief-5 scores according to the mets .
second , all subjects were analyzed the simple relationships between iief-5 and age , phosphorus , bmi , testosterone , psa , and pv by the spearman correlation test .
third , we tested the relationship between iief and phosphorus , pv after adjusting for age , testosterone , and mets using multiple linear regression .
finally , univariate and multivariate logistic regression analyses were underwent to confirm the significance of age , psa , testosterone , phosphorus , bmi , pv , and mets as predictors of significant ed ( iief-5 score 11 ) .
12.0 ( spss inc . , chicago , il , usa ) for statistical analyses .
the proposal of our research was approved by the institutional review board of national police hospital ( no .
it is a cross - sectional study including 1,899 male police officers ranging from 40 to 59 years who entered in a prostate health screening between march and september 2013 at national police hospital .
people who were taking drugs affecting prostate physiology , such as antiandrogens and 5--reductase inhibitors , who used phosphodiesterase-5 inhibitors daily or nutrients that might adjust mineral or bone metabolism , who had palpable nodules on the digital rectal examination , or who showed a high prostate - specific antigen ( psa ) level ( > 4.0 ng / ml ) were not included in our study . additionally , patients diagnosed with chronic kidney disease were excluded .
blood samples were obtained to measure serum psa , testosterone , and phosphorus between 7:00 am and 9:00 am after eight hours fasting .
total psa was measured by an abbott architect i2000 analyzer using the abbott architect total psa assay ( abbott laboratories , slingo , ireland ) .
serum testosterone was calculated by ria ( parc marcel boiteux , codolet , cisbio bioassays inc . ,
serum inorganic phosphorus was determined with a hitachi 7600 - 020 ( hitachi co. , tokyo , japan ) autoanalyzer using hrii series p - hrii reagent ( wako pure cemical industries ltd , osaka , japan ) .
certified version of the ipss was served to participants to evaluate voiding symptoms . prostate volume ( pv ) was measured by transrectal ultrasound ( ultraview , bk medical , copenhagen , denmark ) , and digital rectal examination of prostate was also carried out .
blood pressure was measured over twice ( 5 minutes apart ) in the right arm using a digital blood pressure monitors , were averaged .
waist circumference was measured at the level of uppermost border of hipbones ( iliac crest ) .
blood was sampled at the same time of day ( 7:009:00 am ) in the 8 hours fasting state .
chemistry tests included measurements of serum glucose , total cholesterol , high - density lipoprotein cholesterol , low - density lipoprotein cholesterol , and triglycerides .
metabolic syndrome ( mets ) was diagnosed in case of three or more of the national cholesterol education program adult treatment panel iii for asians criteria were confirmed .
first , one - way analysis of variance tests were assessed to compare the differences in iief-5 scores according to other factors , such as age , bmi , testosterone level , psa , phosphorus , and pv .
chi - square or fisher exact test were performed to compare the differences in iief-5 scores according to the mets .
second , all subjects were analyzed the simple relationships between iief-5 and age , phosphorus , bmi , testosterone , psa , and pv by the spearman correlation test .
third , we tested the relationship between iief and phosphorus , pv after adjusting for age , testosterone , and mets using multiple linear regression .
finally , univariate and multivariate logistic regression analyses were underwent to confirm the significance of age , psa , testosterone , phosphorus , bmi , pv , and mets as predictors of significant ed ( iief-5 score 11 ) .
the median value of age , testosterone , and phosphorus were 53.0 years , 4.58 ng / ml , and 3.50 mg / dl , respectively .
the median bmi was 24.8 kg / m , and 33.5% of all patients had mets .
the median iief-5 score was 18 . to analyze differences in erectile function according to many clinical factors
, we divided questionnaire groups into 3 subgroups by the degree of severity ( table 1 ) . in the results , patients with moderate to severe ed had relatively older age , higher phosphorus level , and larger pvs than other two groups ( p<0.001 , p=0.004 , p=0.002 , respectively ) .
other continuous variables were insignificantly different between the three groups . and , moderate to severe ed patients had a higher prevalence of mets ( p=0.021 ) than other groups .
significant correlation was not found between iief-5 and bmi ( r=0.031 , p=0.189 ) , testosterone ( r=0.033 , p=0.148 ) , or psa ( r=0.007 , p=0.769 ) .
iief-5 was revealed to have a positive correlation with pv ( r=0.065 , p=0.004 ) .
in addition , age ( r=0.238 , p<0.001 ) and phosphorus level ( r=0.108 , p<0.001 ) were significantly related to iief .
serum phosphorus level had the highest correlation with iief-5 except age , followed by pv . however , as shown in table 3 , phosphorus and pv were not significantly correlated with iief after adjusting for age .
the relationship of iief-5 with phosphorus and pv remained insignificant after adjusting for other confounding factors ( testosterone and mets ) .
phosphorus , age , and mets were found to be predictors for moderate to severe ed in the univariate analysis ( p=0.007 ; or , 1.108 ; 95% ci , 1.1801.137 ; p<0.001 ; or , 1.125 ; 95% ci , 1.0931.159 ; and p=0.010 ; or , 1.372 ; 95% ci , 1.0781.745 , respectively ) . and ,
phosphorus , age , and mets were independent predictive factors for moderate to severe ed ( p=0.048 ; or , 1.101 ; 95% ci , 1.0761.131 ; p<0.001 ; or , 1.119 ; 95% ci , 1.0861.153 ; and p=0.048 ; or , 1.283 ; 95% ci , 1.0031.641 , respectively ) in the multivariate analysis ( table 4 ) .
the median value of age , testosterone , and phosphorus were 53.0 years , 4.58 ng / ml , and 3.50 mg / dl , respectively .
the median bmi was 24.8 kg / m , and 33.5% of all patients had mets .
the median iief-5 score was 18 . to analyze differences in erectile function according to many clinical factors
, we divided questionnaire groups into 3 subgroups by the degree of severity ( table 1 ) . in the results , patients with moderate to severe ed had relatively older age , higher phosphorus level , and larger pvs than other two groups ( p<0.001 , p=0.004 , p=0.002 , respectively ) .
other continuous variables were insignificantly different between the three groups . and , moderate to severe ed patients had a higher prevalence of mets ( p=0.021 ) than other groups .
significant correlation was not found between iief-5 and bmi ( r=0.031 , p=0.189 ) , testosterone ( r=0.033 , p=0.148 ) , or psa ( r=0.007 , p=0.769 ) .
iief-5 was revealed to have a positive correlation with pv ( r=0.065 , p=0.004 ) .
in addition , age ( r=0.238 , p<0.001 ) and phosphorus level ( r=0.108 , p<0.001 ) were significantly related to iief .
serum phosphorus level had the highest correlation with iief-5 except age , followed by pv . however , as shown in table 3 , phosphorus and pv were not significantly correlated with iief after adjusting for age .
the relationship of iief-5 with phosphorus and pv remained insignificant after adjusting for other confounding factors ( testosterone and mets ) .
phosphorus , age , and mets were found to be predictors for moderate to severe ed in the univariate analysis ( p=0.007 ; or , 1.108 ; 95% ci , 1.1801.137 ; p<0.001 ; or , 1.125 ; 95% ci , 1.0931.159 ; and p=0.010 ; or , 1.372 ; 95% ci , 1.0781.745 , respectively ) . and ,
phosphorus , age , and mets were independent predictive factors for moderate to severe ed ( p=0.048 ; or , 1.101 ; 95% ci , 1.0761.131 ; p<0.001 ; or , 1.119 ; 95% ci , 1.0861.153 ; and p=0.048 ; or , 1.283 ; 95% ci , 1.0031.641 , respectively ) in the multivariate analysis ( table 4 ) .
serum phosphorus level had the highest correlation coefficient with iief-5 , and the severity of ed was greater in patients with elevated phosphorus levels . in the multivariate analysis , we also found that age , mets , and phosphorus are independent predictive factors of moderate to severe ed .
the iief is , today , one of the most commonly used forms for men presenting with sexual complaints . on the iief ,
ed is classified from mild to severe . to date , this is the first research to study the association between phosphorus and ed .
it is also the first study to evaluate that association using iief score and a detailed prostate work - up . even after multivariate logistic regression analysis
including traditional ed confounding factors , we revealed that phosphorus is a meaningful predictive factor of severe ed . in previous in vitro studies , hyperphosphatemia leads a phenotypic converting vascular smooth muscle cells to osteoblast - like cells that generate biochemical markers of bone lineage , for example , runx2 , creating calcification .
furthermore , excessive phosphorus diet has been appeared to induce endothelial dysfunction in young age , and a phosphorus - enriched medium induces bovine aortic endothelial cells to generate greater amounts of reactive oxygen species .
one nephrology study group revealed that higher serum phosphorus level , even in the normal range , had independent association with the occurrence of coronary vessel calcification fifteen years later in young adults with normal renal function .
recently , in korea , one study group demonstrated that a higher phosphorus concentration , even within a normal value , may be related with higher coronary vessel calcification in healthy adults , and the effects did not change given racial or regional difference . except in cases with cad , yao et al .
said that high phosphorus level causes calcification in great vessel through the influence of -catenin in subjects with chronic kidney disease .
recent evidence has proposed that the serum phosphorus is associated with clinical and subclinical cvd in the normal population and it may differ by gender .
in addition , high serum phosphorus levels had an association between carotid intima - media thickness and cvd risks in males , but not in females .
this relationship may be related to declines in endogenous estradiol that occur during the menopausal transition in women . in a large cohort of community - living italians ,
cirillo et al . demonstrated that at the age 4550 years , there was a significant increase in serum phosphorus and a comparable decrease in urinary phosphorus excretion in females , but not males . and , in a large population of older men , serum estradiol levels and phosphorus levels
were inversely correlated , independent of kidney function , vitamin d levels , parathyroid hormone concentration , and bone density .
vascular calcification and endothelial dysfunction are both related to the atherosclerotic process , and obstruction of atherosclerotic sites are closely associated with calcifications of vascular endothelium .
there are several hypotheses on the pathophysiology of ed as a sentinel marker of vascular dysfunction .
the artery size hypothesis stipulates that ed is an early symptom of systemic atherosclerosis . assuming that atherosclerosis progresses in all major vascular beds at a relatively similar pace
, those authors argued that symptoms will manifest earlier in the smaller arterial branches such as the penile artery rather than in the larger vessels of the heart and limbs , which are able to better tolerate the same degree of atherosclerosis or obstruction . in accordance with this hypothesis , rogers et al .
found that the degree of stenosis in the internal pudendal arteries was similar to that found in the coronary artery ( 52% to 65% ) and that the average diameter of the internal pudendal artery was just slightly smaller than the average diameter of the coronary artery .
this also implies that the increased atherosclerotic plaque burden in patients with stable cad is systemic and may be associated with endothelial dysfunction , especially when the fact that patients with severe ed and stable cad may have high syntax scores is taken into account .
in clinical practice , phosphorus levels in men are not routinely measured prior to a health work - up and treatment . in view of this point
, our study underlines the usefulness of serum phosphorus measurement in the health screening process as a predictor of ed .
therefore , this study was not including the various factors affecting erectile function in men such as insulin - like growth factor-1 , several cytokines , and c - reactive protein .
second , the cross - sectional design rules out the evaluation of causality and may have temporality among the variables .
third , our study can not rule out the possibility that outcomes were affected by phosphorus intake and , consequently , that personal dietary habits might disrupt the relation between phosphorus levels and morbidity rates .
finally , in this study , we did not observe the vitamin d and parathyroid related parameters .
we also excluded subjects who were taking drugs affecting prostate physiology , who used phosphodiesterase-5 inhibitors daily or nutrients that might adjust mineral or bone metabolism .
there have been no reported cross - sectional studies evaluating the role of phosphorus as a predictive factor of ed .
we suggest that serum phosphorus level is a nontraditional potential risk factor of ed in the healthy men . in modern society , we tend to intake less of natural meal and more of processed it . processed foods usually have high - phosphate additives and may affect phosphate intake more than recommended amounts .
known harmful effects of a high - phosphate diet on the body is not enough to be well understood . given the increasing evidence of relationship between phosphorus and several metabolic diseases , prospective well - designed studies are required . in that study ,
interventions reducing phosphate intake , such as restriction of dietary phosphorus and adjustment of food additives , have to be included .
they can reduce the rates of metabolic diseases including ed in high - risk patients or in the healthy population in the future . nowadays ,
managing the causes of increased serum phosphorus and thereby correcting elevated serum phosphorus levels in individuals may be a relevant therapeutic target in preventing the excess risk of ed .
future studies , however , should confirm the causality of the relationship between the simultaneous existence of serum phosphorus and the risk of ed .
in addition , basic research into all types of minerals and ed merits further investigation .
we found that , in clinically stable middle - aged men , serum phosphorus was strongly associated with ed . and , recommended serum phosphorus levels could be different for males than for females . given this finding , handling of phosphorus in men may have a particular meaning of reducing the risk of ed . | purposehigh serum inorganic phosphorus level is related with atherosclerosis and an elevated risk of cardiovascular disease . at the same time , the association of phosphorus with erectile dysfunction ( ed ) is not well reported .
we studied the effect of serum phosphorus on ed and the relationship with other clinical variables.materials and methodsfrom march to september 2013 , 1,899 police men aged 40 to 59 years who entered in a prostate health screening were targeted .
all subjects underwent a clinical checking using the international index of erectile function-5 ( iief-5 ) questionnaire translated into korean .
serum prostate - specific antigen ( psa ) , testosterone , inorganic phosphorus , body mass index , metabolic syndrome ( mets ) , and prostate ultrasound were also examined.resultsserum inorganic phosphorus ( r=0.108 , p<0.001 ) had the highest correlation coefficient with iief-5 score other than age , followed by prostate volume ( pv ) ( r=0.065 , p<0.001 ) . using logistic regression analysis , age , phosphorus , and
mets were predictive factors for moderate to severe ed in univariate analysis .
psa , testosterone , body mass index , and pv could not predict ed .
age , mets , and phosphorus were independent predictive factors of moderate to severe ed ( p<0.001 ; odds ratio [ or ] , 1.119 ; 95% confidence interval [ ci ] 1.0861.153 ; p=0.048 ; or , 1.283 ; 95% ci , 1.0031.641 ; and p=0.048 ; or , 1.101 ; 95% ci , 1.0761.131 ) in the multivariate analysis.conclusionsin our study , phosphorus level is related with ed .
phosphorus is a significant predictor of ed and a strong factor that can be modified in the middle - age .
controlling phosphorus in men may have a particular meaning of preventing the occurrence of ed . |
diverse pathogens have evolved virulence factors that mimic host cell functions ( elde and malik , 2009 ) .
this molecular mimicry , presumably acquired through either divergent or convergent evolution , is indispensible for pathogens to exploit or subvert the host cellular processes for efficient infection .
a fascinating example of the molecular mimicry is pathogen - encoded f - box proteins . as a component of the scf ( skp1-cul1-f - box protein ) ubiquitin ligase complex ,
f - box proteins mediate polyubiquitination of target proteins and the subsequent proteasome - dependent protein degradation in eukaryotic cells ( petroski and deshaies , 2005 ; lechner et al . , 2006 ; vierstra , 2009 ; hua and vierstra , 2011 ) .
surprisingly , an f - box - coding gene was also found in agrobacterium tumefaciens , a bacterial pathogen that causes neoplastic growths and crown gall disease in plants ( schrammeijer et al . , 2001 ) . considering that prokaryotes possess neither the ubiquitin/26s proteasome system ( ups ) nor the functional scf ubiquitin ligase complex , the agrobacterium - encoded f - box protein presumably does not function in the bacterial cell .
rather , agrobacterium translocates this f - box effector into plant cell ( vergunst et al .
, 2000 , 2005 ) and hijacks the host scf complex to facilitate bacterial infection ( tzfira et al . ,
2004 ) . since this discovery , similar f - box - like effector proteins have been described in many other viral and bacterial pathogens , including a human pathogen legionella pneumophila ( price et al . , 2009 ; lomma et al . ,
furthermore , a recent bioinformatic analysis identified at least 74 putative f - box proteins encoded by 22 different bacterial species , most of which are known pathogens ( price and kwaik , 2010 ) .
this finding further suggests the importance and widespread utilization of pathogen - derived f - box proteins for the infection strategy . like animals ,
plants face a challenge to adapt their development and growth to a rapidly changing environment .
in particular , preparing for a potential threat from a wide array of pathogens is crucial for survival of plants .
increasing evidence suggests that plants utilize the ups to recognize and combat pathogen invasion ( zeng et al . , 2006 ; citovsky et al . ,
, plants often exploit the scf ubiquitin ligase complexes , thereby targeting negative regulators of their own defense response and/or pathogen - derived proteins for degradation ( zeng et al . , 2006 ; citovsky et al . ,
notably , plants encode an unusually large number of f - box proteins , the substrate specificity module of the scf complex ( gagne et al . , 2002 ; hua and vierstra , 2011 ) .
for example , the model plant arabidopsis thaliana possesses almost 700 f - box genes , which represent almost 2.3% of the protein - coding genes ( gagne et al . , 2002 ; hua and vierstra , 2011 ) .
by comparison , fruit flies and humans encode only 27 and 69 f - box proteins , respectively ( hua and vierstra , 2011 ) . furthermore , a maximum - likelihood analysis of codon evolution predicted that most of plant f - box genes are likely subject to positive selection specifically in the c - terminal substrate - binding domains ( thomas , 2006 ) . such site - specific positive selection in plant f - box genes as well as their high degree of diversity are reminiscent of the major histocompatibility complex ( mhc ) molecules ( hughes and nei , 1988 , 1989a , b ) , the membrane - associated proteins that activate immune responses in vertebrates by binding fragments of foreign proteins ( i.e. , antigens ) . based on these evolutionary features shared by plant f - box genes and mhc molecules ,
it is tempting to speculate that plants may have evolved a diverse array of f - box proteins ( hence , a wide variety of different scf complexes ) to enable broad protection against innumerable invading pathogens . if this is the case , it is not surprising that plant pathogens , in turn , have evolved a counter - defense strategy using a molecular mimic of f - box proteins to disrupt or co - opt the defense - associated scf machinery of the host plants .
although only a few phytopathogen - encoded f - box proteins have been intensively studied thus far , understanding the role of such an f - box effector during the corresponding pathogen infection process is highly informative to illustrate the molecular arms race between host plants and pathogens . here , we summarize the basic concepts of the ups as well as the scf ubiquitin ligase complex , and provide several case studies on plant pathogen - derived f - box proteins , including virf of a. tumefaciens , galas of ralstonia solanacearum , and p0 of poleroviruses .
post - translational modifications regulate the molecular function of target proteins by modulating their activity , stability , localization , and affinity to other molecules . among
many known post - translational modifications , addition of ubiquitin moieties ( i.e. , ubiquitination ) is known to be a highly complex process regulated by numerous cellular factors , and plays an essential role in diverse biological processes .
ubiquitin is a 76-amino acid polypeptide that is highly conserved among eukaryotes . as its name suggests ,
covalent attachment of ubiquitin to its target protein is mediated by a reaction cascade involving three classes of enzymes : ubiquitin - activating enzymes ( e1 ) , ubiquitin - conjugating enzymes ( e2 ) , and ubiquitin ligases ( e3 ) ( petroski and deshaies , 2005 ; vierstra , 2009 ; hua and vierstra , 2011 ; figure 1 ) .
the sequential reactions start with atp - dependent activation of ubiquitin by an e1 enzyme , resulting in formation of a high energy thioester linkage between a cysteine residue present in e1 and the c - terminal glycine residue of ubiquitin .
this activated ubiquitin is then transferred to another cysteine residue in an e2 enzyme , and subsequently conjugated to a lysine residue in the target protein with the help of a substrate - specific e3 ligase .
e3 ligases are the largest and most diverse class of ubiquitinating enzymes , which is prominent especially in plants . for example , a. thaliana possesses more than 1,500 different e3 enzymes ( hua and vierstra , 2011 ) , suggesting that e3 ligases have evolved to regulate a wide spectrum of endogenous and foreign proteins through ubiquitination .
e3 ligases are classified into two major types : the hect - type and the ring finger - type ubiquitin ligases ( figure 1 ) .
the hect - type ligases accomplish ubiquitin ligation by two steps , where the activated ubiquitin first becomes covalently attached to a cysteine residue in the hect domain of the e3 ligase and then transferred to the final substrate . on the other hand , the ring finger - type ligases , which include the scf complex , transfer the activated ubiquitin directly from the e2 enzyme to the target protein .
ubiquitination is accomplished by sequential reactions involving three classes of enzymes ( e1 , e2 , and e3 ) .
first , a ubiquitin - activating enzyme ( e1 ) activates a ubiquitin molecule in an atp - dependent manner , resulting in formation of a high energy thioester linkage between e1 and the c - terminal glycine residue of ubiquitin .
the activated ubiquitin is then transferred to a ubiquitin - conjugating enzyme ( e2 ) , and subsequently conjugated to a lysine residue in the target protein with the help of a substrate - specific ubiquitin ligase ( e3 ) .
ring finger - type e3 ligases transfer a ubiquitin moiety directly from e2 to a lysine residue of the target protein .
hect - type e3 ligases conjugate ubiquitin in two steps : first , a ubiquitin moiety is transferred from e2 to the hect domain of a hect - type e3 ligase and , then , to a lysine residue of the target protein .
lys11- or lys48-linked polyubiquitination targets the substrate for 26s proteasome - dependent protein degradation . in many cases ,
ubiquitin polymers are assembled by reiterative rounds of ubiquitination , where the first ubiquitin monomer is conjugated to a lysine residue of the target protein , followed by attachment of additional ubiquitin monomers to any of 7 lysine residues available in the previously attached ubiquitin molecule ( figure 1 ) .
the type of linkage in a polyubiquitin chain determines the fate of the substrate protein .
substrates with these polyubiquitin chains are directly recognized and degraded by the 26s proteasome , a very large protein complex of 2.5 mda that catalyzes proteolysis ( figure 1 ) .
this ups not only facilitates removal of misfolded proteins , but also regulates a plethora of cellular processes by targeting regulatory proteins for selective degradation .
furthermore , the ups is also known to play a key role in host immune responses against invading pathogens ( zeng et al .
for instance , some plant virus - encoded movement proteins ( mps ) , the essential factors for the cell - to - cell spread of viral infection , are targeted for degradation by the ups ( reichel and beachy , 2000 ; drugeon and jupin , 2002 ) .
similarly , the viral rna - dependent rna polymerase ( rdrp ) , which is required for genome replication of positive - strand rna viruses , is also degraded by the ups in plant cells ( camborde et al . , 2010 ) .
these examples illustrate the importance of the defensive role of the ups in host pathogen interactions and imply that the host ups represents a challenge that pathogens need to overcome for successful infection .
the role of e3 ubiquitin ligases in the ups is substantial as these enzymes determine substrate specificity by selectively recruiting target proteins to the ubiquitination machinery . among the e3 families ,
the scf complex is by far the largest and best characterized class of e3 ligases .
the scf complex is comprised of cullin 1 ( cul1 ) , s - phase kinase - associated protein 1 ( skp1 ) , ring - box 1 ( rbx1 ) , and an f - box protein ( petroski and deshaies , 2005 ; lechner et al .
, 2006 ; vierstra , 2009 ; hua and vierstra , 2011 ; figure 2 ) . in this multi - protein complex
, cul1 serves as a scaffold that tethers skp1 and rbx1 to its n - terminal and c - terminal domains , respectively .
an f - box protein , which confers substrate specificity to the scf complex , directly interacts with skp1 via its f - box domain whereas rbx1 functions as the docking site for e2 ubiquitin - conjugating enzymes .
most , but not all , f - box proteins harbor an additional interaction domain that brings specific target proteins in close proximity to the catalytic core of the scf complex ( gagne et al . ,
2005 ; assembled from protein data bank files 1ldk and 2ass ) and a simplified cartoon of the scf complex ( bottom ) .
the n - terminal half and the c - terminal half of cul1 interact with skp1 and rbx1 , respectively .
an f - box protein interacts with skp1 via its f - box domain and recruits the target protein to the ubiquitin ligase complex . in plants ,
the scf complex has been shown to regulate a multitude of developmental processes ( lechner et al .
indeed , different scf complexes are involved in signaling pathways of almost all plant hormones , including auxin , gibberellins , jasmonic acid , etc .
in addition , the scf complex plays a critical role in plant pathogen interactions ( zeng et al . , 2006 ; citovsky et al . ,
one such example is the involvement of the acif1 ( avr9/cf-9-induced f - box1)-containing scf complex ( scf ) in disease resistance in tomato and tobacco ( van den burg et al . , 2008 ) .
silencing of the acif1 gene in tobacco compromises the host defense responses to tobacco mosaic virus ( tmv ) as well as to the bacterial pathogen pseudomonas syringae ( van den burg et al . , 2008 ) . in tomato ,
knockdown of acif1 attenuates resistance against the pathogenic fungus cladosporium fulvum ( van den burg et al . ,
the arabidopsis homologs of acif1 are also implicated for defense responses as simultaneous knockdown of three acif1 homologs alters expression of defense - responsive genes , including those coding for pathogenesis - related ( pr ) proteins ( van den burg et al . ,
thus , the f - box protein acif1 and the scf complex may serve as a conserved , integral part of plant defense against various pathogens , from viruses to bacteria to fungi .
the role of the scf complex in plant pathogen interactions is also exemplified by the rice defense - related f - box ( osdrf1 ) protein ( cao et al . , 2008 ) .
expression of the osdrf1 transcripts is induced by infection of the rice blast fungus magnaporthe grisea , as well as by treatment of benzothiadiazole ( bth ) , a chemical inducer of plant defense responses ( cao et al . , 2008 ) .
interestingly , overexpression of osdrf1 in tobacco transgenic plants leads to enhanced disease resistance to tomato mosaic virus ( tomv ) and p. syringae ( cao et al .
these results suggest that the potential osdrf1-containing scf complex ( scf ) may positively regulate plant defense responses against diverse pathogens .
the scf complex functions not only as a positive regulator but also as a negative regulator of plant defense responses . for instance , the arabidopsis f - box protein cpr1 ( constitutive expresser of pr genes 1 , also known as cpr30 ) is involved in negative regulation of plant immunity via the ups ( gou et al .
the cpr1-containing scf complex ( scf ) mediates degradation of at least two resistance ( r ) proteins , snc1 ( suppressor of npr1 - 1 constitutive 1 ) and rps2 ( resistance to p. syringae 2 ) , both of which are critical immune receptors that recognize pathogen invasion ( cheng et al . , 2011 ; gou et al . ,
consistent with this negative role of scf , loss - of - function mutations in cpr1 lead to enhanced resistance to p. syringae ( gou et al .
, 2009 , 2011 ) as well as the oomycete pathogen hyaloperonospora arabidopsidis ( cheng et al . , 2011 ) .
utilization of the scf complex in plant defense responses should exert selective pressure on pathogens toward evolution of counter - defense strategies by which they can subvert or co - opt the host scf machinery .
indeed , increasing evidence suggests that several plant pathogens , such as a. tumefaciens , r. solanacearum , and poleroviruses , hijack the host scf complex for their own benefits by translocating or expressing their own f - box effectors in the host cell ( tzfira et al .
moreover , recent bioinformatic analyses revealed that many other plant pathogens also encode f - box - like proteins
table 1 ) , suggesting that hijacking of the host scf machinery through this molecular mimicry may be a widespread infection strategy . to better understand the plant pathogen molecular arms race revolving around the scf complex , we summarize recent advances in the studies of phytopathogen - encoded f - box effectors .
agrobacterium tumefaciens - encoded virf is the first f - box protein that was identified in prokaryotes and proved functional in eukaryotic host cells ( schrammeijer et al . , 2001 ; tzfira et al . ,
agrobacterium is a phytopathogenic soil bacterium that causes neoplastic growths ( crown gall tumors ) on various plant species by transferring and integrating its own genetic materials into the host genomes .
this agrobacterium - mediated genetic transformation has been considered to represent the only known natural example of trans - kingdom gene transfer until a recent study using cultured human cells showed that the zoonotic pathogen bartonella henselae is also capable of mobilizing its dna into the eukaryotic host ( schrder et al . , 2011 ) .
furthermore , under laboratory conditions , agrobacterium can genetically transform virtually any eukaryotic species , from fungi to human cells ( bundock et al .
, 1995 ; piers et al . , 1996 ; kunik et al . , 2001
the infection process of agrobacterium is regulated by many bacterial factors as well as the host cellular components ( tzfira and citovsky , 2006 ; gelvin , 2010 ; pitzschke and hirt , 2010 ; figure 3 ) .
first , agrobacterium activates expression of virulence ( vir ) proteins in response to phenolic compounds exuded from wounded plant tissues . among the induced vir proteins , vird1 and vird2
mediate generation of a single - stranded copy of transferred dna ( t - dna ) , a specific dna segment of the bacterial tumor - inducing ( ti ) plasmid .
the resulting mobilized single - stranded ( ss ) dna molecule , termed t - strand , is then delivered into the host cell via the type iv secretion system composed of the virb and vird4 proteins . within the plant cell , the t - strand
is thought to exist as a nucleoprotein complex called t - complex , in which its 5 end is covalently attached to one vird2 molecule and the entire length of the t - strand is coated with numerous molecules of the ssdna binding protein vire2 , another bacterial effector exported into the host cell ( sheng and citovsky , 1996 ; gelvin , 2000 ; tzfira and citovsky , 2000 , 2002 ; zupan et al . , 2000 ) .
furthermore , the host vire2-interacting protein 1 ( vip1 ) directly binds to vire2 and facilitates the nuclear import of t - dna as well as its subsequent targeting to the host genome ( tzfira et al . , 2001 ; li et al .
agrobacterium exports a single - stranded copy of t - dna ( t - strand ) as well as virulence ( vir ) effector proteins into plant cell .
within plant cell , t - strand is assembled into a nucleoprotein complex ( t - complex ) in which one vird2 molecule is attached to the 5 end of the t - strand and multiple vire2 molecules coat the entire length of the t - strand .
in addition , the plant factor vip1 directly interacts with vire2 and guides the t - complex into the host cell nucleus .
once the t - complex enters the nucleus , it is presumably disassembled by an scf complex containing virf as an f - box component .
the scf complex mediates polyubiquitination of vip1 , thereby targeting vip1 as well as its associated vire2 for 26s proteasome - dependent degradation . in plant species that do not require virf for full virulence , agrobacterium most likely also utilizes the host f - box protein vbf for the t - complex uncoating . as a defense strategy ,
the host plants destabilize virf via the ubiquitin/26s proteasome system ( ups ) , presumably using an as yet unidentified plant scf complex .
another exported effector , vird5 , counteracts this host - induced degradation of virf by directly binding to and stabilizing virf .
once the t - complex reaches the host chromatin , the coating vire2 and vip1 proteins are most likely removed from the t - strand , resulting in release of the naked dna molecule as a substrate for integration .
presumably , this uncoating process is mediated by virf ( tzfira et al . , 2004 ) , another bacterial effector that is translocated into the host cell independently of the t - strand ( vergunst et al . , 2000 , 2005 ) and localizes to the host cell nucleus by as yet unknown mechanism ( tzfira et al . , 2004
the agrobacterium f - box effector virf has been shown to interact with the plant skp1 through the f - box domain ( schrammeijer et al . , 2001 ) , suggesting that virf functions as a component of the scf complex in plant cell ( schrammeijer et al . , 2001 ;
although virf does not possess any additional protein interaction domains , which are usually found in many f - box proteins , it directly binds vip1 and targets it for 26s proteasome - dependent degradation in plant and yeast cells ( tzfira et al . , 2004 ) .
in addition , vire2 , which is associated with vip1 , is indirectly destabilized by virf at least in a heterologous yeast system ( tzfira et al . , 2004 ) .
the degradation of vip1 and vire2 is indeed mediated by the virf - containing scf complex ( scf ) because this degradation does not occur in yeast mutant cells that do not express functional skp1 ( tzfira et al . ,
together , these observations suggest that agrobacterium hijacks the host scf machinery for efficient infection with the help of the bacterial f - box effector .
it remains unknown how agrobacterium controls the timing of the scf - mediated t - complex uncoating , but the proposed role of virf during agrobacterium infection illustrates the strategic importance of molecular mimicry by pathogen - encoded f - box effectors .
the paradox of the infection strategy using virf is , however , that f - box proteins are inherently unstable due to their own degradation mediated by the autocatalytic mechanism ( zhou and howley , 1998 ; galan and peter , 1999 ) or other e3 ligases ( ayad et al .
, 2003 ; guardavaccaro et al . , 2003 ; margottin - goguet et al . ,
thus , agrobacterium , which delivers only the virf protein molecules but not the virf gene into the host cell , faces a challenge to protect virf against detrimental degradation .
most likely , this is achieved by another translocated effector of agrobacterium , vird5 , that directly binds to and stabilizes virf , which otherwise undergoes rapid degradation via the host ups ( magori and citovsky , 2011 ; figure 3 ) .
this degradation of virf is likely mediated by an unknown plant e3 ligase , but not the autocatalytic mechanism because mutations in the f - box , a domain required for autoubiquitination , do not stabilize the virf protein ( magori and citovsky , 2011 ) .
although it remains elusive whether the host - induced degradation of virf is actually associated with bona fide plant defense responses , these observations illustrate a novel type of host pathogen molecular arms race , in which both sides compete for the control of the stability of pathogen - encoded f - box effectors .
it should be noted that virf was originally identified as a bacterial host range factor , the function of which is required for agrobacterium infection in some , but not all , plant species ( hooykaas et al . , 1984 ; melchers et al . , 1990 ;
jarchow et al . , 1991 ; regensburg - tuink and hooykaas , 1993 ) .
for example , agrobacterium strains lacking the virf gene exhibit substantially attenuated infectivity on tomato and tree tobacco ( nicotiana glauca ; hooykaas et al . , 1984 ; melchers et al . , 1990 ) , while such strains still exhibit wild - type virulence on arabidopsis ( zaltsman et al . , 2010 ) .
thus , in plant species that are susceptible to the virf - lacking strains , agrobacterium may utilize a host f - box protein as an alternative to virf .
consistent with this notion , an arabidopsis f - box protein , vip1-binding f - box protein ( vbf ) , was shown to substitute for the virf function during agrobacterium infection ( zaltsman et al .
, 2010 ; figure 3 ) . similarly to virf , vbf interacts with the plant skp1 , and promotes proteasomal degradation of vip1 as well as vire2 ( zaltsman et al . , 2010 ) .
interestingly , the vbf transcripts are upregulated in arabidopsis upon inoculation with agrobacterium ( ditt et al . , 2006 ) and fungal pathogens ( li et al . ,
this , in turn , suggests that agrobacterium may co - opt the plant defense responses to facilitate the t - complex uncoating and , hence , successful infection .
another phytopathogenic bacterium r. solanacearum causes a lethal wilting disease on more than 200 plant species , which belong to as many as 50 families ( schell , 2000 ) .
this unusually wide host range may be related to a diverse array of effector proteins that ralstonia potentially uses during the infection process .
indeed , genomic and gene expression studies have predicted that ralstonia injects over 70 different effectors into the eukaryotic host cell via the type iii secretion system ( salanoubat et al . , 2002 ; cunnac et al . ,
, the gala family plays an essential role in ralstonia pathogenicity ( angot et al . , 2006 ) .
this protein family is a group of seven members ( gala1 to 7 ) , each of which contains an f - box domain as well as a c - terminal leucine - rich repeat ( lrr ) domain ( cunnac et al . , 2004 ) .
gala derives from a conserved gaxala amino acid sequence in the lrr domain of these effectors ( cunnac et al . ,
the evolutionary origin of the gala family is unknown , but a phylogenetic analysis of various f - box domains suggested that the ralstonia gala genes may have been acquired from plants via horizontal gene transfer ( kajava et al . , 2008 ) .
like virf of agrobacterium , at least four gala proteins ( gala1 , 5 , 6 , and 7 ) have been shown to interact with the arabidopsis skp1 ( angot et al . ,
2006 ) , suggesting that translocated galas may be incorporated into the host scf complex .
although mutating any single gala gene does not alter ralstonia infection of arabidopsis or tomato ( cunnac et al . , 2004 ) , a strain harboring simultaneous mutations of all of the seven gala genes shows almost no virulence in arabidopsis and exhibits significantly attenuated infectivity in tomato ( angot et al . , 2006 ) .
these observations suggest that the gala family members have partially overlapping functions during ralstonia infection of its plant hosts . however , among seven gala proteins , at least gala7 appears to possess a distinct host - specific function as its mutation alone does not affect the bacterial virulence in arabidopsis or tomato , but leads to reduced disease symptoms in medicago truncatula ( angot et al . , 2006 ) .
it is tempting to speculate that the specific role of gala7 in medicago may be conferred by its c - terminal lrr domain , which potentially recruits medicago - specific factors to the scf ubiquitin ligase complex .
similarly , the other gala members may also target different and specific host factors in different plant species .
nevertheless , this bacterial f - box protein family can be a good model to understand not only how ralstonia exploits the host scf machinery for infection of specific hosts , but also how this plant pathogen has used this machinery to expand its host range .
rna silencing , also known as post - transcriptional gene silencing ( ptgs ) , plays a central role in plant defense responses against viral pathogens ( vance and vaucheret , 2001 ; baulcombe , 2004 ; voinnet , 2005 ; diaz - pendon and ding , 2008 ) . in this defense system ,
double - stranded rna molecules derived from viral genomes or transcripts are processed into 2125 nt small interfering rna ( sirna ) duplexes by the rnaseiii enzyme dicer .
subsequently , a single - stranded sirna is incorporated into the rna - induced silencing complex ( risc ) , which then degrades viral rnas that are complementary to the bound sirna .
interestingly , many plant and animal viruses are known to encode suppressor proteins that suppress this host rna silencing machinery ( vance and vaucheret , 2001 ; baulcombe , 2004 ; voinnet , 2005 ; diaz - pendon and ding , 2008 ) . among such viral suppressors ,
the polerovirus p0 protein harbors an f - box motif that is required for the interaction of p0 with the plant skp1 ( pazhouhandeh et al . , 2006 ) .
mutations in the f - box domain of p0 not only abolish the interaction between p0 and skp1 , but also significantly reduce accumulation of the viral rnas in the host plants ( pazhouhandeh et al . , 2006 ) , indicating that p0 is a bona fide f - box protein essential for viral infectivity .
the potential targets of the scf complex include argonaute1 ( ago1 ) , the catalytic component of the risc complex ( baumberger et al . , 2007 ; bortolamiol et al . , 2007 ) .
p0 directly interacts with ago1 and targets it for degradation in the host cell ( baumberger et al .
indeed , transient expression of p0 in nicotiana benthamiana or arabidopsis leads to substantial reduction in the ago1 protein levels ( baumberger et al .
consistent with this result , ectopic expression of p0 in transgenic arabidopsis plants elicits pleiotropic developmental abnormalities that are reminiscent of ago1 mutants ( bortolamiol et al . , 2007 ) .
together , these observations reveal a novel counter - defense strategy , in which viral pathogens disrupt the host rna silencing through targeted degradation of ago1 .
the p0 protein of poleroviruses is the first evidence that not only bacterial pathogens but also viral pathogens have evolved to encode their own f - box proteins and hijack the host scf machinery to enhance infection efficiency .
host pathogen interactions represent a never - ending arms race between host organisms defending against unwanted invaders , and pathogens counteracting the host defense system . due to their short generation times and large population sizes , bacterial , and viral pathogens
are thought to evolve much faster than multicellular , eukaryotic hosts ( arber , 2000 ) .
in addition , horizontal gene transfer , a process in which different prokaryotic species exchange their genetic materials , further speeds up evolution of pathogens ( arber , 2000 ) .
thus , it is not surprising that pathogens , rather than hosts , seem to dominate the battle by constantly updating their infection strategies .
in particular , use of f - box effectors within host cells illustrates how elaborate pathogens are when infecting their hosts .
hijacking the host scf machinery by pathogens makes biological sense because the scf complex plays a key role in host defense responses in many cases .
furthermore , due to the essential function of the scf complexes in diverse cellular processes , hosts can not modify this ubiquitin ligase system just to evade pathogen attack , further allowing for evolution of pathogen - encoded f - box proteins .
ever since the discovery of the agrobacterium virf protein , many additional pathogen - encoded f - box effectors have been identified , and at least several of them have been demonstrated to play an indispensible role in pathogenicity .
how widespread is this infection strategy ? how have pathogens evolved such eukaryotic f - box effectors
? how have the f - box effectors affected evolution of host defense systems ? with the advent of the discovery and studies of pathogen - encoded f - box proteins , we are beginning to understand the true complexity of host pathogen interactions .
the authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest . | the scf ( skp1-cul1-f - box protein ) ubiquitin ligase complex mediates polyubiquitination of proteins targeted for degradation , thereby controlling a plethora of biological processes in eukaryotic cells .
although this ubiquitination machinery is found and functional only in eukaryotes , many non - eukaryotic pathogens also encode f - box proteins , the critical subunits of the scf complex .
increasing evidence indicates that such non - eukaryotic f - box proteins play an essential role in subverting or exploiting the host ubiquitin / proteasome system for efficient pathogen infection .
a recent bioinformatic analysis has identified more than 70 f - box proteins in 22 different bacterial species , suggesting that use of pathogen - encoded f - box effectors in the host cell may be a widespread infection strategy . in this review ,
we focus on plant pathogen - encoded f - box effectors , such as virf of agrobacterium tumefaciens , galas of ralstonia solanacearum , and p0 of poleroviruses , and discuss the molecular mechanism by which plant pathogens use these factors to manipulate the host cell for their own benefit . |
there is a chance of indirect pulpal injury during restorative procedures47 . in cavities prepared to receive restorative materials , factors such as margin location , cavity depth and remaining sound tooth structure are important for a good prognosis . to avoid thermomechanical shortcomings ,
it has been recommended to seal dentinal tubules soon after tooth preparation30 with varnishes , bactericidal solutions , silver and/or potassium nitrate34 .
however , understanding the interactions between contemporary adhesive strategies ( etch - and - rinse , self - etching , one - step protocols)14 and sealing agents is a key factor to improve bond durability17,25,30,35,40,47,58 .
dentin hypersensitivity is characterized by a short , sharp pain arising from exposed dentin in response to tactile , evaporative , chemical or thermal stimuli and which can not be ascribed to any other dental defect or pathology5,34 .
the prevalence of dentinal hypersensitivity has been reported over the years in a variety of ways : greater than 40 million people in the u.s .
annually26 , 14.3% of all dental patients16 , between 8% and 57% of adult dentate population24 , and up to 30% of adults at some time during their lifetime1 .
one of the proposed treatments for dentin hypersensitivity is the use of potassium oxalate - based desensitizing agents on etched dentin before placing the adhesive36,50 .
the lack of calcium ions on dentin surface , due to demineralization after acid etching , allows oxalate ions to spread within dentinal tubules in order to bind to calcium ions in the demineralized area .
efforts on adequate tubule occlusion have led to the development of bioactive glasses . developed in 1969 by larry hench , who defined this type of product as " a bioactive material that produces a specific biological response on the interface that results on the formation of a bonding between tissue and material"39 ,
the bioactive glasses have the capacity of chemically bonding to bone and dental tissue through the formation of a carbonate hydroxyapatite layer that presents structure and chemical composition identical to that of the mineral phase of the bone and dental tissue20 .
the mechanism of action of bioactive glasses is based both on occlusion of dentinal tubules by particles with diameters close to that of the tubules and on desensitization by interruption of neural activation and painful stimuli22 .
bioactive glasses are able to eliminate dentinal sensitivity for a much longer period than that offered by current treatments39,41 . in addition , the particles previously bonded to the dental tissue undergo dissolution within the oral environment and constantly release calcium and phosphate ions ( two components of bioactive glass ) to the oral environment , which elevates the local ph and favors the process of tooth remineralization37,41 . in brazil , a crystalline bioglass for dentin desensitization ( called biosilicato ) has been recently developed and patented41,60 .
this material is very similar to bioglass 45s5 , which contains , among other components , na2o , cao , sio2 and p2o5 .
the aim of this study was to assess the bond strength of indirect composite restorations cemented with a resin - based cement associated with etch - and - rinse and self - etching primer adhesive systems to dentin treated or not with a bioactive material .
the null hypothesis was that the use of a bioactive material as a desensitizing agent would decrease the bond strength of indirect resin - cemented restorations .
twenty bovine incisors had had their roots removed and the crowns were embedded with autopolymerizing acrylic resin in pvc rings with their surface parallel to the horizontal plane .
next , the enamel of the buccal surface was removed and the dentin was wet - ground flat with 400 and 800-grit sic papers and stored in the refrigerator .
penta : dipentaerythritol penta acrylate monophosphate ; udma , urethane dimethacrylate ; mma , methyl methacrylate ; hema , 2-hydroxylethyl methacrylate ; mac-10 , methacryloxyundecane dicarboxylic acid ; fasg : fluoroaluminosilicate glass ; tegdma : triethylene glycol dimethacrylate ; edab : ethyl-4-dimethylaminobenzoate ; bht : 2,6-di - tert - butyl - p - cresol ; dhept : n , n ,- dihydroxyethyl - p - toluidine ; bis - gma , bisphenol a diglycidyl ether dimethacrylate the teeth were assigned to 4 groups ( n=5 ) with different treatment protocols , as show on table 1 .
groups ii and iv were treated with biosilicato ( 0.5 g / teeth ) , which was applied / rubbed on the dentin surface for 10 seconds after mixing the powder to distilled water at a ratio of 3:1 .
twenty 6-mm - diameter composite resin ( artglass , heraus kulzer , germany , lot # 010113 ) cylinders were obtained using a split 10-mm brass matrix ( figure 1 ) .
the resin was inserted in increments into the matrix with the aid of a stainless steel spatula and light cured in 180-second cycles in a unixs unit ( hareaus kulzer , germany ) . before placing the last increment ,
the composite resin cylinders were cemented to dentin with a dual - cure resin - based cement ( enforce , dentsply , petroplis , rj , brazil ) . for this , equal amounts of base and catalyzing pastes were mixed for 20 seconds and the material was applied to dentin and to the composite surface .
excess material was removed using an explorer and the material was light cured for 20 seconds ( ultralux ; dabi atlante , ribeiro preto , sp , brazil ) .
all specimens were stored for 30 days in artificial saliva at 37c , despite knowing the effect of humidity in the degrading process of adhesive systems8,9,11 .
after this period , the specimens were removed from saliva and , 24 h later11 , tensile bond strength was tested in a universal testing machine ( emic , so jos dos pinhais , pr , brazil ) ( figure 2 ) at a crosshead speed of 1 mm / min and the highest value of load required to dislodge each specimen was divided by the bonding area ( 0.2826 cm ) .
after debonding , the specimens were mounted on aluminum stubs , sputter - coated with gold and the fractured surfaces were analyzed with a scanning electronic microscope ( jeol jsm7500 , tokyo , japan ) at 150x to 2000x magnification to assess the failure mode ( adhesive , cohesive or mixed ) .
kolmogorov - smirnov test determined a normal data distribution and 2-way anova ( adhesive , bioactive glass ) was performed to assess significant differences among groups at 5% significance level .
statistical analysis showed that there was no significant interaction between adhesive and bioactive material ( p>0.05 ) .
no statistically significant differences ( p>0.05 ) were observed between the etch - and - rinse ( group i ) and the self - etching ( group iii ) adhesive systems without surface treatment .
no statistically significant differences ( p>0.05 ) were found between groups i ( one - step ) and ii ( one - step after application of bioglass ) . however , statistically significant differences ( p<0.001 ) were found between groups iii ( self - etching ) and iv ( self - etching after application of bioglass ) ( table 2 ) .
different letters indicate statistically significant difference at 5% significance level ( anova , tukey 's test ) .
cohesive , adhesive and mixed failures were observed in the four groups . in groups i and
most fractures were adhesive , while in group iv , mixed and cohesive failures were present in a similar number ( figures 3 to 6 ) .
the methodology used in this study is similar to that found in the literature13,31,42 . yet ,
bond strength tests are the most frequently used to screen adhesives14 . despite the fact that bond strength results are inconclusive regarding the properties of adhesive systems , they may , however , be valuable for comparing different materials14 .
the loop test was chosen for this study because indirect composite resin restoration cemented on dentin tends to become a single body , which has the capacity of withstanding or dispersing the tensions suffered on all its extension31 .
in addition , it would make the debonded surface more appropriate for sem analysis , thus allowing identifying the most common fracture patterns according to the type of dentin adhesive used42 .
the substrate used in this study was bovine dentin , similar to that of other studies6,12,13,31,32,48 .
no significant differences being observed between bovine and human dentin43 . currently , the most appropriate method for in vitro bond strength testing , which provides closer values to those of the clinical condition ( in vivo ) , must involve aging of specimens bonded to substrate14 .
most studies report a significant decrease in bond strengths , even after relatively short storage periods caused by degradation of interface components by hydrolysis ( mainly resin and/or collagen)3,4,15,19 . nevertheless , water can also infiltrate and affect negatively the mechanical properties of the polymer matrix , by swelling and reducing the frictional forces between the polymer chains , a process known as ' plasticization'28,45 .
artificial saliva solutions can also be used , but the decrease of bond strength has been shown to be similar to that obtained with pure water degradation27 .
thus , the present study assessed the bond strength of indirect restorations with longer clinical cementation time , which had previously suffered degradation to its adhesive interface .
the quality of bonding of restorative material to tooth substrate depends on several factors , such as the adhesive system , handling characteristics and the substrate itself . applying desensitizing products on dentin
may promote alterations to its structure and influence the adhesion process59 . in the present study , the desensitizing agent evaluated was biosilicato37,41,60 , a recently developed bioglass that has shown excellent clinical results in in vitro tests29,53 .
prime & bond nt ( etch - and - prime ) and one - up bond f ( self - etching primer ) were the adhesive systems of choice .
it has been suggested that they are less technique sensitivity and improve clinical efficiency by reducing chair - side time54 .
however , this may make bonding more susceptible to the effects of post - polymerization water , which may compromise the bonding quality18 . after performing the loop tests in groups i and
iii , it was observed that there were no statistically significant differences between the bond strengths of the etch - and - rinse and the self - etching primer adhesive systems .
these results confirm those previously reported by giannini , et al.19 ( 2003 ) , who compared materials with the same characteristics and found similar results .
it is known that the efficiency of a dentin adhesive depends , among other factors , on the organic solvent in its composition28 . according to tay , et al.51 ( 2002 ) ,
self - etching primer adhesive systems are permeable membranes , and the action of water on the cured adhesive layer is associated with its hydrophilicity .
water is easily absorbed and accumulates in areas with internal porosity and where hydrophilic molecules are located52 .
prime bond nt uses acetone in its composition , while one - up bond has alcohol / water as solvent .
hence , it was expected that the acetone - based material would have higher bond strengths compared to alcohol / water - based system because it is more hydrophilic .
in addition , most of the currently available self - etching primer adhesives are methacrylate - based with a ph - value from 1.52.5 . under these strong acidic conditions , esters such as 2-hydroxyethyl methacrylate ( hema ) , triethyleneglycol dimethacrylate ( tegdma ) , methacryloyloxydecyl dihydrogen phosphate ( mdp ) or hema - phosphate , are hydrolytically degraded33,44 .
however , acetone - based adhesives are more sensitive to the adhesive technique55,56 , which is a possible explanation for the lower bond strength . comparing the groups in which the etch - and - rinse adhesive system was used , group i ( adhesive ) had higher bond strength means than group ii ( adhesive after application of biosilicato ) .
for this type of adhesive , which requires previous acid etching , the obliteration of the dentinal tubules with biosilicato ( group ii ) did not reduce bond strength .
this is a favorable condition because the use of a desensitizing agent prior to cementation of indirect restorations may reduce postoperative sensitivity30 and improve clinical success .
the fact that bioglass has p2o5 in its composition may result in stronger affinity with calcium in dentin .
this is due to the fact that , as observed with organic phosphates added to dentifrices , these components act as calcium sequestrants7 , forming compounds that accumulate in the internal portion of the dentinal tubule .
. the results of the present study disagree with those of a recent study59 , which indicated that the carbonate hydroxyapatite crystal has higher stability than calcium oxalate for prime bond nt . comparing the groups
in which the self - etching primer adhesive system was used , group iv ( adhesive after application of biosilicato ) had statistically significant higher bond strength means than group iii ( adhesive ) ( p<0.001 ) . the use of the desensitizing agent ( group iv ) enhanced the adhesion , with a possible favorable interaction between the carbonate hydroxyapatite layer , formed after applying biosilicato20,39 and the respective adhesive system . a possible explanation for this would be the presence of methacrylate phosphates , which are used in self - etching adhesive systems to make them more hydrolytically stable28 .
thus , the 30-day aging did not interfere with the self - etching adhesive system in the same way as it did with the etch - and - rinse adhesive .
differences in concentration of fluoride , ph values and availability of calcium ions on dentin surface2 also contributed for this variation .
these outcomes show that treating the substrate with bioactive glass improved the bonding of the tested materials . differently from what was expected , the tested bioglass did not narrow or occlude the dentinal tubules , which would hinder the penetration of the adhesive systems . a possible reason for this could be the small size of the bioglass particles ( 0.5 m on average ) . in addition , since the material was mixed with distilled water , it is possible that it did not effectively penetrate the tubulii , which may have led to false results ( figure 3 ) .
another factor that diverges from which was reported in previous studies refers to the cement used for restoration retention . according to suh , et al.46 ( 2003 )
, there is an incompatibility between single - step , self - etching adhesive and chemically cured or dual - cured composites due to decoupling of the tertiary amine used in chemically cured resins .
nonetheless , we agree with yiu , et al.59 ( 2005 ) , who stated that effective bonding to the desensitizer - treated acidetched dentin is adhesive - specific , an additional reason that reinforces the hypothesis that material penetration was not effective .
sem results after applying bioglass ( groups ii and iv ) showed that dentin surface was characterized by the presence of small granules with irregular shapes randomly spread on dentinal tubules ( figure 4 ) .
an interaction was observed between dentin and resin material ( mixed failure ) despite being evident that some tubules remained without material ( figure 6 ) .
the knowledge of this structure is of foremost , importance , especially its interaction with the adhesive systems , due to the previously addressed reasons .
further studies should be performed to better understand this structure and its possible interactions with restorative materials .
based on the outcomes of the present study , it may be concluded that the bioactive glass produced higher bond strength for the self - etching primer adhesive .
the use of adesensitizing agent did not affect negatively the bonding of the indirect composite restorations to dentin , independently of the tested adhesive systems . | objective : the aim of this study was to assess the bond strength of indirect composite restorations cemented with a resin - based cement associated with etch - and - rinse and self - etching primer adhesive systems to dentin treated or not with a bioactive material.materials and method : twenty bovine incisor crowns had the buccal enamel removed and the dentin ground flat .
the teeth were assigned to 4 groups ( n=5 ) : group i : acid etching + prime & bond nt ( dentsply ) ; group ii : application of a bioactive glass ( biosilicato)+ acid etching + prime & bond nt ; group iii : one - up bond f ( j morita ) ; group iv : biosilicato + one - up bond f. indirect composite resin ( artglass , kulzer ) cylinders ( 6x10 mm ) were fabricated and cemented to the teeth with a dualcure resin - based cement ( enforce , dentsply ) .
after cementation , the specimens were stored in artificial saliva at 37oc for 30 days and thereafter tested in tensile strength in a universal testing machine ( emic ) with 50 kgf load cell at a crosshead speed of 1 mm / min .
failure modes were assessed under scanning electron microscopy .
data were analyzed statistically by anova and tukey 's test ( 95% level of confidence).results : groups i , ii and iii had statistically similar results ( p>0.05 ) .
group iv had statistically significant higher bond strength means ( p<0.05 ) than the other groups .
the analysis of the debonded surfaces showed a predominance of adhesive failure mode for group iii and mixed failure mode for the other groups.conclusion:the use of desensitizing agent did not affect negatively the bonding of the indirect composite restorations to dentin , independently of the tested adhesive systems . |
chronic diseases are considered as the major public health problems of today s world ( or within contemporary societies ) .
diabetes is one of the most important metabolic dysfunctions which is often asymptomatic in the early stages that manifests as chronic hypoglycemia which causes damage to body organs while increasing blood sugar levels ( 15 ) .
one of the main forms of diabetes is gestational diabetes mellitus ( gdm ) defined as glucose intolerance that occurs for the first time or is first identified during pregnancy ( 610 ) .
women with gestational diabetes who have elevated fasting blood glucose levels appear to be exposed to an increased risk for fetal macrosomia and perinatal complications if no treatments are provided ( 11 ) .
the assessment of the disease prevalence depends on area of study , population , differences in data collection methods , using random selection method for choosing potential participants for research and diagnostic criteria used ( 12 , 13 ) .
the main method of gdm is using a 50-g nonfasting one - hour glucose challenge test between 24 and 28 weeks gestation . for women with a positive screening test ,
the 100-g three - hour oral glucose tolerance test is executed to diagnose gestational diabetes ( 14 , 15 ) .
a number of worldwide studies have reported different prevalence rate of gestational diabetes prevalence varying from 1% to 14% ( 1621 ) .
the differences are more evident in studies conducted in iran where the reported prevalence of the disease differed greatly from 1/3 to 18/8 ( 12 , 22 ) .
the cumulative incidence of diabetes ranges from 2.6% to over 70% in studies that examined women 6 weeks postpartum to 28 years postpartum ( 23 ) . due to the high heterogeneity among the study results and the importance of prevention and treating gestational diabetes , which constitutes a major burden for health care service systems ,
the accurate determination of gdm prevalence is necessary using appropriate research methodology and summarizing the influencing factors for better monitoring and better planning . given the importance of the subject , it was decided to perform a systematic review and meta- analysis of all relevant studies conducted in iran on the prevalence and risk factors for gdm .
in this systematic review and meta- analysis in which we used the databases of science direct , pubmed , scopus , magiran , iranmedex and sid , google search engine , gray literature , reference lists check and manual journal searching ( such as : j obstet gynaecol can , arch gynecol obstet , diabet med , world j diabetes , and etc . )
gdm , risk factor * , postpartum diabetes , and
these databases were searched in both english and persian papers published between 1985 and 2012 .
the inclusion criteria of the articles were the studies that were conducted to determine the prevalence of gdm , investigated the various aspects of the epidemiology of gdm , and conducted in iran .
excluded studies were those that were presented in conferences , case reports , and intervention studies .
first , the titles of all articles were reviewed to screen for eligibility and those found to be inconsistent with the objectives of the study were excluded from the survey . in the later stages , the abstracts and full text articles were examined to identify and exclude those that did not satisfy the inclusion , or had a weak correlation with the objectives of the study .
the initial search resulted in 1011 articles . after excluding irrelevant ones and those that were alike in various databases or had poor correlation with the objectives of the review , 24 articles were enrolled in this study .
the selected papers were fully reviewed and the required information for the systematic review was extracted and summarized using extraction table in microsoft office excel software .
comprehensive meta - analysis ( cma ) version 2.0 ( englewood , nj , usa ) software was used to estimate and conduct a meta - analysis to determine the prevalence of the disorder .
forest plot diagrams were used to illustrate the study findings in which the area of each square was proportionally sized to signify the sample size and the lines drawn in each square represented 95% confidence interval for the prevalence rate of gestational diabetes in each of the studies .
overall , 24 out of 1011 papers were quite relevant to the objectives of the review so they were included ( table 1 ) . in iran ,
tehran province had the highest frequency of conducted studies ( 10 out of the 24 studies ) .
mass screening was used in 14 of 24 reviewed papers . the screening test in 3 articles was 75 g over 1- hour while it was 50 g over 1-hour at the others .
characteristics of selected and studied articles in the study the highest and lowest prevalence reported were 18.6% and 1.3% in , respectively , karaj and ardebil . among the influential factors mentioned in the literature , potential causes of gdm are gestational age , history of gestational diabetes , family history of diabetes , body mass index , abortions and parity , history of macrosomia . out of 24 papers , two articles were excluded due to methodological and statistical problems and 22 were entered in meta - analysis using cmasoftware .
2 shows the gdm incidence , confidence interval 95% and weight coefficient of each of these 22 studies .
the prevalence of gestational diabetes mellitus in iran with ci 95% ( fixed model of meta - analysis ) fixed model of meta - analysis showed that the prevalence of postpartum diabetes was 0.034 with a standard error of 0.001 ( q - value= 180.795 , i - squared=88.385 ) . in this stage ,
the studies by kashi and manafi were excluded from the meta - analysis as were considered outliers and it was repeated without these two surveys .
the prevalence of gestational diabetes mellitus in iran with ci 95% ( fixed model of meta - analysis after excluded two heterogenic studies ) after excluding two studies with outliers , results showed that prevalence of diabetes after pregnancy is 0.034 with standard deviation of 0.001 .
funnel plot was used to evaluate the publication bias , which is shown in fig .
gestational diabetes can cause side effects for both pregnant mother and her fetus but proper management of it can prevent complications ( 24 ) .
the prevalence of gdm is growing in all developed and developing countries ( 16 ) and it is estimated that its increase will continue in coming years due to increasing mean age of population , urban sedentary lifestyle and increasing the number of obese women ( 25 ) .
effective planning , firstly , requires accurate knowledge of the disease prevalence and associated factors .
the results of the present study , showed the prevalence of gdm to be 3.4% ( the highest and lowest incidence rate were 18/6% and 1/3% , respectively ) .
the researchers rated the following to be the most important risk factors in gestational diabetes : history of gestational diabetes , family history of diabetes , body mass index , abortions and parity , and history of macrosomia .
this rate is lower compared to 3.9% reported by janghorbani and anjazad ( 12 ) .
this difference could be due to the adopted method of calculating and estimating the prevalence in these two studies . in the aforesaid study
, the incidence was calculated using arithmetic means but in the present survey , it has been calculated through meta- analysis of the results using the software and considering the impact of the number of samples which can be more accurate and reliable in our method . during 1992 and 2007 ,
nikoo khoshniyyat and colleagues ( 26 ) performed another review study on 18 articles and only noted gdm prevalence range ( 1.3% to 10% ) but without any estimation of it .
their estimated incidence range ( 1.3 to 18 ) was lower than the range recommended in the present study representing increase in gdm prevalence .
gdm varies in prevalence in different parts of the world that shows great heterogeneity so that ranged between less than 1 percent to about 14 percent in different areas ( lowest was less than 1% in a study conducted in singapore and tanzania ( 27 , 28 ) and highest was 14% in india ( 18 ) .
incidence rates of this disease in canada , turkey , japan and china were reported to be 12.8% ( 29 ) , 1.23% ( 30 ) , 2.9% ( 31 ) , and 2.31% respectively ( 32 ) .
significant differences in different countries and even within each of them can be due to differentiation in races and cultures .
so it has been reported to be more prevalent among black race as well as asian , arab and chinese women than caucasian is and european women . the preferred screening and diagnostic methods and their accuracy and even cut off points for gestational diabetes can play a significant role in this regard ( 3336 ) . despite the rich diversity of cultures and races in iran in the present survey ,
therefore , it can not be firmly concluded that the differences in various regions are due to the diversity in ethnicities and cultures .
the factors such as age over 30 years , previous history of gdm , family history of diabetes , high body mass index , history of abortion and genetic disorders , are widely recognized as the effective risk factors on the prevalence of gdm ( 3742 ) which is consistent with the results of our reviewed literatures . yet across the studies , there is more consistency among the results related to gdm risk factors than the prevalence rate differences . therefore we can rely on the findings of the conducted studies then more effective gdm prevention and reduction programs can be implemented , including the programs for improving the culture and planning for reducing childbirth age ( considering the high prevalence of gdm in older women ) , planning further care of the women with history of diabetes , family history of diabetes , abortion and genetic disorders as well as weight loss planning during and even before pregnancy for the overweight women .
our study showed the prevalence of gdm data in 14 provinces of iran ( tehran , ardebil , west azerbaijan , semnan , isfahan , ilam , south khorasan , bandarabbas , mazandaran , gilan , khuzestan , karaj , yazd and kermanshah ) .
furthermore , the results of some of the studies conducted in these provinces are not valid and reliable due to the low number of samples and methodological problems that indicates the information gap in this area .
since decision - making in macro - level necessarily requires information from all regions of a country so it is recommended to perform more studies with larger sample sizes along with sound methodological principles to allow estimating the prevalence of gdm in iran s provinces .
one of the main limitations of this study was the missing of complications assessment , as far as the complications of gdm is the most prominent result of this condition .
one of the other limitations of this study was limitations of research databases , because many of the epidemiological researches in field of gdm are conducted as theses of students in different ranks , which are not published as valid articles and are just reported to research councils of universities .
gdm is usually associated with an increased risk for a number of complications during pregnancy and postnatal period for the mother and her off - spring . according to present study prevalence of gdm
these with other problems such as emotional - psychological disorders and care spending lead us to consider gestational diabetes as one of the major health problems in the world requiring effective prevention and control strategies . in this regard having accurate and reliable information on the prevalence and influential causes for planning and decision making and intervening seem essential for this group of patients , thus the results of the present study can be used in these areas .
ethical issues ( including plagiarism , informed consent , misconduct , data fabrication and/or falsification , double publication and/or submission , redundancy , etc . ) have been completely observed by the authors . | background : gestational diabetes ( gd ) is one of the major public health issues . the purpose of the present study was to perform a systematic review and meta - analysis to assess the risk factors and prevalence rate of this disorder in iran.methods:this systematic review and meta- analysis article was prepared using the databases of science direct , pub - med , scopus , magiran , iranmedex and sid , google search engine , gray literature , reference lists check and hand searching using keywords such as prevalence , gestational diabetes mellitus ,
gdm , risk factor * , iran and postpartum diabetes .
the selected papers were fully reviewed and the required information for the systematic review was extracted and summarized using extraction table in microsoft office excel software.results:twenty-four of 1011 papers were quite relevant to the objectives of the review so they were included .
the mean age of the participants was 29.434.97 yr and the prevalence of gdm was 3.41% ( the highest and the lowest prevalence rates were 18.6% and 1.3% respectively ) . among the influential factors mentioned in the literature , potential causes of gdm are gestational age , history of gestational diabetes , family history of diabetes , body mass index , abortions and parity , and history of macrosomia.conclusion:considering the high prevalence of postpartum diabetes and its related factors in iran , strategic planning for disease prevention and reduction
is inevitable . |
recombinant atxa , atnl and its quadruple h28y / l31v / n33g / s49d mutant lw were prepared by in vitro refolding following expression in e. coli as described . all other chemicals were from sigma aldrich or gibco life technologies .
adult male balb / c mice ( 2025 g ) were maintained and humanely killed according to the guiding principles in the use of animals in toxicology ( society of toxicology , 1999 , guidelines are available at www.toxicology.org ) and the animals ( scientific procedures ) act 1986 .
hemidiaphragms and accompanying phrenic nerves were dissected and placed into 10 ml tissue baths containing krebs solution ( 118.4 mm nacl , 4.7 mm kcl , 25 mm nahco3 , 1.2 mm kh2po4 , 1.4 mm mgso4 and 2.5 mm cacl2 ) , maintained at 37c and oxygenated with a mixture 95% o2 and 5% co2 .
muscle contractions were evoked indirectly or directly . in the case of indirect neurally - evoked twitches ,
the attached phrenic nerve was stimulated at a frequency of 0.2 hz with rectangular pulses of 0.2 ms duration and a supramaximal voltage ( < 15 v ) from a grass force displacement transducer .
muscle twitches were recorded on a grass polygraph model 79 ( grass instruments ) . in order to reveal the triphasic effect of recombinant proteins on nm transmission ,
in some experiments the preparation was partially paralyzed ( to 1520% of control ) by reducing the concentration of ca to 0.380.50 mm and allowing the tissues to equilibrate for 3045 min . in these experiments
recombinant proteins were added to the tissue bath and changes in the amplitude of twitch tension responses were followed continuously .
the functionality of the muscle in the preparation at the end of the recordings was checked directly by acetylcholine stimulation or indirectly by 2.5 mm ca stimulation . in experiments with directly - evoked twitches the preparation was set up as described for the phrenic nerve - hemidiaphragm for recording neurally - evoked twitches .
in addition , one end of a bipolar stimulating electrode was sutured into the diaphragm muscle near the costal margin and the other one was attached to the base of the hemidiaphragm .
the directly - evoked twitches were recorded by supramaximal voltage stimulation ( 50 v ) at a frequency of 0.2 hz and 2 ms duration . to eliminate nm transmission in the preparation , d - tubocurarine ( 10 m ) , an antagonist of the nicotinic acetylcholine receptors ,
was added into the organ bath 5 min prior to the beginning of direct stimulation .
positive controls for the neurotoxic triphasic effect were performed by adding taipoxin ( 0.51 g / ml ) after reducing the concentration of ca in order to partially paralyze the nm preparation as described above .
recombinant atxa , atnl and its quadruple h28y / l31v / n33g / s49d mutant lw were prepared by in vitro refolding following expression in e. coli as described . all other chemicals were from sigma aldrich or gibco life technologies .
adult male balb / c mice ( 2025 g ) were maintained and humanely killed according to the guiding principles in the use of animals in toxicology ( society of toxicology , 1999 , guidelines are available at www.toxicology.org ) and the animals ( scientific procedures ) act 1986 .
hemidiaphragms and accompanying phrenic nerves were dissected and placed into 10 ml tissue baths containing krebs solution ( 118.4 mm nacl , 4.7 mm kcl , 25 mm nahco3 , 1.2 mm kh2po4 , 1.4 mm mgso4 and 2.5 mm cacl2 ) , maintained at 37c and oxygenated with a mixture 95% o2 and 5% co2 .
muscle contractions were evoked indirectly or directly . in the case of indirect neurally - evoked twitches ,
the attached phrenic nerve was stimulated at a frequency of 0.2 hz with rectangular pulses of 0.2 ms duration and a supramaximal voltage ( < 15 v ) from a grass force displacement transducer .
muscle twitches were recorded on a grass polygraph model 79 ( grass instruments ) . in order to reveal the triphasic effect of recombinant proteins on nm transmission ,
in some experiments the preparation was partially paralyzed ( to 1520% of control ) by reducing the concentration of ca to 0.380.50 mm and allowing the tissues to equilibrate for 3045 min . in these experiments
recombinant proteins were added to the tissue bath and changes in the amplitude of twitch tension responses were followed continuously .
the functionality of the muscle in the preparation at the end of the recordings was checked directly by acetylcholine stimulation or indirectly by 2.5 mm ca stimulation . in experiments with directly - evoked twitches the preparation was set up as described for the phrenic nerve - hemidiaphragm for recording neurally - evoked twitches . in addition
, one end of a bipolar stimulating electrode was sutured into the diaphragm muscle near the costal margin and the other one was attached to the base of the hemidiaphragm .
the directly - evoked twitches were recorded by supramaximal voltage stimulation ( 50 v ) at a frequency of 0.2 hz and 2 ms duration . to eliminate nm transmission in the preparation , d - tubocurarine ( 10 m ) , an antagonist of the nicotinic acetylcholine receptors ,
was added into the organ bath 5 min prior to the beginning of direct stimulation .
positive controls for the neurotoxic triphasic effect were performed by adding taipoxin ( 0.51 g / ml ) after reducing the concentration of ca in order to partially paralyze the nm preparation as described above . | the molecular mechanism of action of presynaptically neurotoxic secreted phospholipases a2 ( spla2s ) has not been fully elucidated .
we have recently proposed a model to explain one of the hallmarks of their action the reduction in endocytosis leading to synaptic vesicle depletion in nerve terminals .
our results speak strongly in favor of a mechanism in which both specific protein - protein interactions and enzymatic activity of the neurotoxic spla2 ammodytoxin a ( atxa ) are necessary for impairment of clathrin - dependent endocytosis in yeast cells .
the reduction of endocytosis was strictly dependent on the enzymatic activity of spla2s expressed ectopically in our yeast model cells and was not observed with the catalytically inactive , non - neurotoxic atxa - homolog , ammodytin l ( atnl ) .
here we confirm the validity of the model in mammalian cells also , by demonstrating that the enzymatically active mutant of atnl , shown to inhibit endocytosis in yeast , acts as a presynaptically neurotoxic spla2 at the mammalian neuromuscular junction . |
hyperglycemia has a wide variety of neurological manifestations including visual hallucinations , seizures , choreoathetosis , hemiballismus , dysphagia , somatosensory symptoms or headache associated with nausea and vomiting , and severe cases of coma . while seizures associated with hypoglycemia are mainly generalized , seizures associated with hyperglycemia are usually focal in nature .
previous reports have described occipital seizures associated with hyperglycemia , although the descriptions are rare , and few of them have showed electroencephalographic ( eeg ) findings .
we report the clinical presentation of a 15-year - old child with hyperglycemia who presented with focal occipital seizures which was confirmed by eeg .
a 15-year - old boy with 2 weeks duration of osmotic symptoms ( polyuria , polydipsia , and weight loss ) was diagnosed to have diabetic ketoacidosis and was on insulin infusion .
( random blood sugar - 474 mg / dl , urine ketones positive , arterial blood gas metabolic acidosis ) .
he experienced flashes of lights ( photopsia ) , well - formed visual hallucinations , fearfulness , and headache .
his hba1c was 9.4% and glutamic acid decarboxylase-65 ( gad-65 ) igg serum enzyme immunoassay was > 2000 iu / ml ( normal value - < 10 iu / ml ) .
his eeg showed spike and waves arising from the right occipital region suggestive of occipital lobe seizures [ figure 1 ] .
electroencephalographic showing spike and waves arising from the right occipital region suggestive of occipital lobe seizures
this includes epilepsia partialis continua , which is the most frequent type and simple or complex partial seizures .
the less common recognized types are apnea , somatosensory symptoms , aphasia , and visual disturbance . of the two distinct patterns of hyperglycemia ( ketotic and nonketotic ) ,
a potential explanation is that ketoacidosis decreases neuronal excitability by increasing the levels of gamma - amino - butyric - acid ( gaba ) via activation of gad , increased cellular concentration of glutamic acid , and decreased gaba shunt .
other than changes in gaba , atp sensitive potassium channels ( katp ) have been recently shown to be important in hyperglycemia - induced seizures .
katp channels are well - known for their action in pancreatic cells , where an increase in intracellular atp / adp ratio leads to closure of the channels preventing potassium efflux leading to cell membrane depolarization and insulin secretion .
recent evidence indicates that neurons ( e.g. , hippocampal and neocortical ) also have katp channels , and these channels are responsible for increasing neuronal excitability in hyperglycemic environment .
our patient had a variety of transient neurological symptoms including occipital seizures in the form of a headache , well - formed visual hallucinations , and memory impairment .
well - formed visual hallucinations in this patient could be an equivalent of todd 's phenomena following occipital seizures .
wang et al . discussed a patient with flickering red objects in the right visual field associated with complex visual hallucinations .
occipital seizures are a unique presentation of hyperglycemia with eeg showing sequential spikes , slowing , and attenuation .
the focal character of the seizures described during hyperglycemia has been reported consistently over the years .
| a 15-year - old boy presented with osmotic symptoms and photopsia .
he had short - term memory impairment , visual hallucinations , and headache .
his random blood sugar was 474 mg / dl , hba1c 9.4% , and glutamic acid decarboxylase 65 > 2000 iu / ml . magnetic resonance imaging brain and cerebrospinal fluid study were normal .
digital electroencephalography was suggestive of bilateral hemispheric occipital lobe seizures .
he responded well to insulin and antiepileptic medications . |
chronic intestinal pseudo - obstruction ( cipo ) is a rare , debilitating disorder characterized by obstructive symptoms mimicking mechanical obstruction without any lesion occluding the gut.1 pseudo - obstruction could occur either with acute or chronic onset .
acute intestinal pseudo - obstruction , so called ogilvie 's syndrome , is the most common form .
acute intestinal pseudo - obstruction often occurs in critically ill patients or during the postoperative period.2,3 however , cipo patients typically passes unrecognized for long periods of time before the definitive diagnosis is established , so affected individuals are often unable to maintain normal body weight and/or become malnourished.4 furthermore , patients sometimes receive inadequate treatments or needless abdominal surgeries due to the delay in confirming the diagnosis.5 therefore , it is very important for physicians to understand the pathophysiology , clinical features and treatment of this rare but debilitating disorder .
we experienced a case of chronic pseudo - obstruction in the initial phase , which mimicked an acute pseudo - obstruction , and treated through medical approach .
he was compared to another recurrent and intractable case successfully treated with surgery and diagnosed as hypoganglionosis .
38-year - old male patient visited emergency room for abdominal pain and distension which were aggravated two days ago .
abdominal distension was developed 2 months ago but he did not visit any hospital since defecations with loose stools and gas passages were possible .
he had no known history of any metabolic , neurological , cardiovascular or pulmonary diseases , previous abdominal or pelvic surgeries , and no history of abdominal cancer , inflammatory processes or trauma .
physical examination revealed marked abdominal distension with hyperactive bowel sound , and he complained of mild tenderness on the entire abdomen without any rebound tenderness .
the laboratory findings showed a hemoglobin of 14.7 g / dl , white blood cells 5,310/mm and platelets 265,000/mm .
the blood chemistry showed : a sodium of 142 mmol / l , potassium 3.6 mmol / l , chloride 105 mmol / l , calcium 8.6 mg / dl and albumin 4.4 g / dl .
thyroid function test was normal ; t3 , free t4 , and tsh were 0.7 ng / ml , 1.31 ng / dl , and 2.86 iu / ml , respectively ( all within normal range ) .
however , we did not perform tests for sle or scleroderma because there were no clinical symptoms or physical signs of these diseases .
marked gaseous dilatation above the pelvic cavity was shown in the simple abdominal x - ray image ( fig . 1a ) .
abdominal computed tomography revealed a marked distension from the ascending colon to the sigmoid colon whereas the entire colon was well traced without a definite obstructive lesion .
there was a narrowed segment in the sigmoid colon which was suggestive of transitional zone . no fluid collection or free air was shown in the abdominal cavity ( fig .
randomized , multiple mucosal biopsies showed normal findings except mild ischemic changes due to the over - distension .
initially he was diagnosed as acute intestinal pseudo - obstruction , so called ogilvie 's syndrome , and intravenous neostigmine was tried with ekg monitoring .
after intravenous administration of neostigmine ( 2.5 mg ) for 1 hour , side effects such as bradycardia , hypotension , atrial fibrillation developed and continuous infusion was stopped . simultaneously , there was a dramatic evacuation of flatus and loose stools ( fig .
3a ) . however , abdominal distension developed again in the following day , and neostigmine ( i.v . 2.0 mg for 4 hours ) was retried cautiously .
again there were evacuations of gases and loose stools without any side effects occurring abdominal distension developed in the next following day similar to the first trial of neostigmine .
the symptom was endurable and ordinary activity was possible and the patient began to take 500 mg of erythromycin three times per day .
3b ) , gas passages and defecations were possible every day and the degree of distension was rather mild .
she suffered from constipation for 10 years which repeatedly aggravated and improved . from two months ago , it became worse and did n't improve .
the laboratory findings showed a hemoglobin of 12.6 g / dl , platelets and white blood cells were 229 10/l and 16.19 10/l , respectively .
the blood chemistry showed : a sodium of 136 mmol / l , potassium 4.1 mmol / l , chloride 100 mmol / l , calcium 8.7 mg / dl and albumin 4.4 g / dl .
there was no history of any metabolic , neurological , cardiovascular or pulmonary diseases , previous abdominal or pelvic surgeries , and no history of abdominal cancer , inflammatory processes or trauma .
after the admission , detailed medical tests were performed to find out the causes of abdominal pain and distention .
there was no evidence of metabolic diseases such as diabetes , porphyria , or amyloidosis .
marked gaseous distension in the colon , especially in the descending colon was seen in the simple abdominal x - ray image .
abdominal computed tomography scan showed marked distension in the left colon and the sigmoid colon , but there was no specific lesion to induce mechanical obstruction or no fluid collection or free air in the peritoneal cavity ( fig .
these radiologic and functional test suggested colonic pseudo - obstruction at the sigmoid colon level .
colonoscopy showed marked dilatation of the left and sigmoid colon , with non - specific ulcers in the transverse colon and rectum .
biopsies on ulcer lesions and random colonic areas showed non - specific changes . under the impression of ciipo surgical approach
dilated segment was 28 cm long and 4.3 cm length of narrowed segment was observed distal to the dilated segment ( fig .
markedly decreased number of mature myenteric ganglion cells , immature ganglion cells and decreased size of gangions in the myenteric plexus were observed in the narrowed segment ( fig .
5c ) , and bcl-2 were markedly decreased in the myenteric plexus of the narrowed segment ( fig .
5d ) , in which the pathologic findings confirmed hypoganglionosis as the cause of pseudo - obstruction .
she is under a good nutritional status and symptoms have not recurred for 2 years after the surgery .
38-year - old male patient visited emergency room for abdominal pain and distension which were aggravated two days ago .
abdominal distension was developed 2 months ago but he did not visit any hospital since defecations with loose stools and gas passages were possible .
he had no known history of any metabolic , neurological , cardiovascular or pulmonary diseases , previous abdominal or pelvic surgeries , and no history of abdominal cancer , inflammatory processes or trauma .
physical examination revealed marked abdominal distension with hyperactive bowel sound , and he complained of mild tenderness on the entire abdomen without any rebound tenderness .
the laboratory findings showed a hemoglobin of 14.7 g / dl , white blood cells 5,310/mm and platelets 265,000/mm .
the blood chemistry showed : a sodium of 142 mmol / l , potassium 3.6 mmol / l , chloride 105 mmol / l , calcium 8.6 mg / dl and albumin 4.4 g / dl .
thyroid function test was normal ; t3 , free t4 , and tsh were 0.7 ng / ml , 1.31 ng / dl , and 2.86 iu / ml , respectively ( all within normal range ) .
however , we did not perform tests for sle or scleroderma because there were no clinical symptoms or physical signs of these diseases .
marked gaseous dilatation above the pelvic cavity was shown in the simple abdominal x - ray image ( fig . 1a ) .
abdominal computed tomography revealed a marked distension from the ascending colon to the sigmoid colon whereas the entire colon was well traced without a definite obstructive lesion .
there was a narrowed segment in the sigmoid colon which was suggestive of transitional zone . no fluid collection or free air was shown in the abdominal cavity ( fig .
randomized , multiple mucosal biopsies showed normal findings except mild ischemic changes due to the over - distension .
initially he was diagnosed as acute intestinal pseudo - obstruction , so called ogilvie 's syndrome , and intravenous neostigmine was tried with ekg monitoring .
after intravenous administration of neostigmine ( 2.5 mg ) for 1 hour , side effects such as bradycardia , hypotension , atrial fibrillation developed and continuous infusion was stopped . simultaneously , there was a dramatic evacuation of flatus and loose stools ( fig .
3a ) . however , abdominal distension developed again in the following day , and neostigmine ( i.v . 2.0 mg for 4 hours ) was retried cautiously .
again there were evacuations of gases and loose stools without any side effects occurring abdominal distension developed in the next following day similar to the first trial of neostigmine .
the symptom was endurable and ordinary activity was possible and the patient began to take 500 mg of erythromycin three times per day .
3b ) , gas passages and defecations were possible every day and the degree of distension was rather mild .
she suffered from constipation for 10 years which repeatedly aggravated and improved . from two months ago , it became worse and did n't improve .
the laboratory findings showed a hemoglobin of 12.6 g / dl , platelets and white blood cells were 229 10/l and 16.19 10/l , respectively .
the blood chemistry showed : a sodium of 136 mmol / l , potassium 4.1 mmol / l , chloride 100 mmol / l , calcium 8.7 mg / dl and albumin 4.4 g / dl .
there was no history of any metabolic , neurological , cardiovascular or pulmonary diseases , previous abdominal or pelvic surgeries , and no history of abdominal cancer , inflammatory processes or trauma .
after the admission , detailed medical tests were performed to find out the causes of abdominal pain and distention .
there was no evidence of metabolic diseases such as diabetes , porphyria , or amyloidosis .
marked gaseous distension in the colon , especially in the descending colon was seen in the simple abdominal x - ray image .
abdominal computed tomography scan showed marked distension in the left colon and the sigmoid colon , but there was no specific lesion to induce mechanical obstruction or no fluid collection or free air in the peritoneal cavity ( fig .
these radiologic and functional test suggested colonic pseudo - obstruction at the sigmoid colon level .
colonoscopy showed marked dilatation of the left and sigmoid colon , with non - specific ulcers in the transverse colon and rectum .
biopsies on ulcer lesions and random colonic areas showed non - specific changes . under the impression of ciipo surgical approach
dilated segment was 28 cm long and 4.3 cm length of narrowed segment was observed distal to the dilated segment ( fig .
markedly decreased number of mature myenteric ganglion cells , immature ganglion cells and decreased size of gangions in the myenteric plexus were observed in the narrowed segment ( fig .
5c ) , and bcl-2 were markedly decreased in the myenteric plexus of the narrowed segment ( fig .
5d ) , in which the pathologic findings confirmed hypoganglionosis as the cause of pseudo - obstruction .
she is under a good nutritional status and symptoms have not recurred for 2 years after the surgery .
intestinal pseudo - obstruction is a disease characterized by failure of intestinal propulsion without a definite cause for mechanical obstruction .
this disorder presents with a wide spectrum of clinical manifestations in respect to onset time of either acute or chronic and to the etiology as idiopathic or secondary .
acute intestinal pseudo - obstruction , also known as ogilvie 's syndrome , often occurs in hospitalized patients and is associated with a wide variety of medical and surgical conditions.2,3 most of acute intestinal pseudo - obstruction occur in the colon and respond to conservative medical treatment , although perforation develops in a small number of patients with high mortality rate.6 treatment modality such as medical therapy , colonoscopic decompression , or surgery should be individualized based on the severity of the patient 's clinical status.3 in the first case , acute and first onset of pseudo - obstruction was developed and the patient was initially diagnosed as ogilvie 's syndrome . at first , the patient was evaluated for the possible causes of acute pseudo - obstruction and colonoscopic decompression was applied to the patient .
no specific cause for acute pseudo - obstruction was found in spite of the comprehensive tests .
medical therapies such as neostigmine and erythromycin were only partially effective to the patient . currently , the patient has been relatively doing well but mild sub - occlusive symptoms and signs were sustained during 5 months of follow - up period . as a result , the patient was considered to have undergone the first episode of cipo . in the adult population , the first attack of pseudo - obstruction is often accompanied by a long history of non - specific , progressive symptoms like severe constipation .
but an acute onset of the disease mimicking ogilvie 's syndrome also occurs in one - fourth of the cases as the first case patient.7 cipo develops in either idiopathic or secondary form and the former comprises the majority of cases . in one study ,
systemic or metabolic causes of the disease were identified in only 4 of 77 cipo patients.7 nevertheless , investigation of any secondary causes is necessary since correction of the secondary causes might be the only chance for cure of the cipo .
many different diseases affect the control mechanisms of intestinal function , including intrinsic and extrinsic neural system as well as muscular system.4 the secondary causes that impair extrinsic nervous system can occur centrally or peripherally .
the diseases affecting central nervous system are parkinson syndrome , shy - drager syndrome , stroke , encephalitis , and neoplasm , whereas peripheral nervous system involves diabetes neuropathy , other neuropathies such as hirschsprung , chagas , and von reckling - hausen , as well as paraneoplastic syndromes , autoimmune diseases , or viral infections.4 systemic muscular disorders like myotonic dystrophy and progressive systemic sclerosis could provoke damage to the intestinal smooth muscle cells and can also be the secondary causes of cipo.4 collagen vascular disease , ehlers - danlos syndrome , jejunal diverticulosis and radiation enteritis can be responsible for both neuronal and myogenic impairment.4 furthermore , hypothyroidism , hypoparathyroidism , and celiac disease were reported to be the secondary causes of cipo , even if the underlying mechanism remains undetermined.4 chronic idiopathic intestinal pseudo - obstruction ( ciipo ) is diagnosed when no underlying cause is found in spite of the detailed and thorough medical examination .
most cases of ciipo in adults occur as sporadic forms , but some familial clusters were also reported as autosomal dominant , autosomal recessive or x - linked transmission.8 in the present report , both patients were diagnosed as ciipo without known causes for the secondary form of cipo after the full examinations .
usually ciipo is classified as neuropathic , mesenchymopathic and myopathic based on the pathogenesis affecting the enteric nervous system or smooth muscle cells,4,5 so the full - thickness biopsies of intestinal wall are mandatory to define the underlying mechanisms of ciipo .
furthermore , neuropathic form of ciipo is classified as degenerative or inflammatory based on the mechanism of damage to the enteric nervous system .
inflammatory neuropathies are diagnosed by infiltrations of dense inflammatory cells and damages to the myenteric plexus .
inflammatory cells in the myenteric plexus could be observed as lymphocyte predominant ( lymphocytic myenteric ganglionitis ) or eosinophil predominant ( eosinophilic ganglionitis).9,10 autoimmune mechanism is considered to involve in lymphocytic myenteric ganglionitis with several cases reported with positivity for anti - hud anti - neuronal antibodies.11 degenerative neuropathies are characterized by degeneration and loss of intrinsic neurons of the myenteric plexus.4 typical pathologic findings reported in neurodegenerative ciipo include various qualitative ( neuronal swelling , intranuclear inclusions , axonal degeneration and others ) and quantitative lesions ( especially hypoganglionosis).4 bcl-2 protein is widely expressed in the peripheral nervous system and is considered to play a major role in neuronal survival . in severe form of degenerative ciipo , bcl-2 protein is markedly reduced in the myenteric plexus as the second case patient .
this pathologic finding suggests apoptosis in association with loss of ganglion cells in the myenteric plexus.9 in the second case patient , total colectomy was performed because of the recurrent , sub - occlusive events and ongoing severe constipation .
the histological exam revealed marked decrease of ganglion cells in the myenteric plexus and decreased immunoreactivity for c - kit , synaptophysin , and bcl-2 confirming the diagnosis of hypoganglionosis .
in the first case , mild sub - occlusions were sustained in the radiologic exams with mild abdominal distension .
we assume this patient could follow the clinical course of the second case which had shown the typical course of ciipo . in the acute , sub - occlusive episodes of ciipo ,
treatment should be the same as the mechanical obstruction with proper decompression , correction of fluid and electrolytes imbalance and appropriate nutritional support .
furthermore , erythromycin , somatostatin and neostigmine could aid the gastrointestinal motility , control visceral sensitivity and decrease the duration of sub - occlusive episodes.4,12,13 erythromycin enhances upper gastrointestinal motility with a specific agonist action on the motilin receptors.12 octerotide increases intestinal motility and decreases bacterial overgrowth.13 combination of erythromycin and octreotide could be useful in controlling both the gastric emptying and the intestinal motility.14 neostigmine is effective in ogilvie 's syndrome15 and also in acute symptomatic relief of sub - occlusive episodes in ciipo as in our case .
other medical options considered in the treatment of ciipo are prokinetics , antibiotics , steroid and immunosuppressive agents.4 the effect of surgery is limited since ciipo often involves the entire gastrointestinal tract with a progressive nature.16 as surgical approach can aggravate the underlying condition , it should be reserved for only carefully selected patients .
however , surgical resection such as colectomy should be considered , especially in hypoganglionosis,17,18 as in the second case patient . in our hospital , five patients among 7 ciipo were confirmed as hypoganglionosis during the last 6 years and all of them are doing well after the colectomy .
although the cases are few in numbers , these results suggest that hypoganglionosis is a frequent cause of ciipo in korea and colectomy offers a curable opportunity before bowel transplantation or death in the intractable cases , which is somewhat different from western society . in conclusion , we experienced two cases of ciipo with different clinical features and treatment approaches . in the first case ,
the clinical feature was regarded as the first episode of cipo mimicking ogilvie 's syndrome .
this patient could experience the recurrent and progressive nature of ciipo . in the second case patient
, typical clinical feature with recurrent episodes of ciipo was shown , and she was successfully treated by total colectomy and was confirmed as hypoganglionosis , suggesting colectomy as a considerable and effective therapeutic option in the intractable and debilitating cases of hypoganglionosis . | chronic intestinal pseudo - obstruction ( cipo ) is a rare disorder characterized by a severe impairment of gastrointestinal propulsion in the absence of mechanical obstruction .
we experienced a case of chronic pseudo - obstruction in the initial phase mimicking acute pseudo - obstruction , which was treated medically .
this ongoing case was compared to another recurrent and intractable case successfully treated with surgery and diagnosed as hypoganglionosis .
these two cases showed different clinical features and therapeutic approaches for cipo ; one with the first episode of cipo mimicking ogilvie 's syndrome ; the other with recurrent episodes of cipo with typical features . in conclusion , cipo is a difficult disorder with various clinical manifestations and different treatment modalities , therefore individualized diagnostic and therapeutic approaches are needed . |
for decades , joint replacement has been a procedure with major impact on the quality of life in elderly patients with joint degenerative diseases or traumatic injuries .
unfortunately , some patients develop symptoms after surgical intervention . in the majority of patients , aseptic loosening due to biochemical reaction of the bone
both entities have a very similar clinical appearance , but require different therapeutic approaches due to different pathophysiological substrates ( 1 ) .
lack of a single imaging modality that could clearly differentiate between infections and loosening makes this problem a challenge in the routine workup of these patients .
laboratory analysis , including white blood cell count , erythrocyte sedimentation rate ( esr ) and c - reactive protein ( crp ) are not specific enough .
canner et al . found that out of fifty - two patients who had an infection following joint arthroplasty , only eight ( 15% ) had leukocytosis ( 2 ) .
the esr may remain elevated for months after an uncomplicated total hip replacement ( 3 ) .
crp levels increase in a non - specific manner as a result of infectious , inflammatory or neoplastic disorders .
conventional imaging methods are helpful in some situations when complications arise ( 4 , 5 ) , but their diagnostic potential in distinguishing loosening and inflammation are limited .
ct is superior to radiography in imaging soft tissue abscesses ( 6 ) ; however , not a recommended diagnostic tool due to significant artifacts on the images at the location of the prosthesis that hamper the optimal interpretation of the results .
thus , non - attenuation - corrected images must be interpreted to avoid false - positive results if pet / ct is used for the evaluation of painful prosthesis ( 7 ) .
aspiration biopsy of the joint was regarded as a gold standard , but it is not convenient for the patient and may not always be helpful in distinguishing the two above - mentioned pathological entities . a positive result can confirm infection , but a negative result can not exclude it ( 8) .
nuclear medicine modalities offer several diagnostic methods that are dedicated to the diagnosis of infection and are not affected by orthopedic implants .
three - phase bone scintigraphy ( tpbs ) is widely accepted for the diagnosis of different pathological processes of the musculoskeletal system including detection of infection with a high sensitivity and limited specificity in the diagnosis of infected joint prostheses ( 9 ) .
it is noticeable that reported results of different studies dealing with the problem of painful joint prosthesis show variation , which is mostly due to different interpretation criteria applied ( 10 , 11 ) .
tpbs , with an accuracy of about 50 - 70% can be performed as the modality of primary choice in these patients , but it should be combined with other diagnostic modalities ( 12 ) .
white blood cell ( wbc ) scintigraphy labeled with 99mtc hmpao or 111in - oxine or anti - granulocyte scintigraphy using 99mtc - labeled monoclonal antibodies ( moab ) or their fragments are frequently used nuclear medicine imaging modalities in the detection of infection and inflammation , but it is important to emphasize that neither of these imaging methods can reliably differentiate sterile inflammation from infection ( 13 ) .
significant decrease in the accuracy of wbc imaging is caused by the fact that labeled leukocytes are accumulating both in infected tissue and in bone marrow ( 10 ) . a combined study consisting of wbc imaging and complementary bone marrow ( bm ) imaging performed with radiolabeled sulphur colloid
is based on the fact that both radiopharmaceuticals accumulate in marrow ; whereas , wbcs accumulate in infection , but sulfur colloid does not .
although the combination of these two modalities increases the accuracy in the diagnosis of osteomyelitis up to 90% , pitfalls that could affect the results are not negligible ( 14 ) .
18f - fdg - pet is a promising imaging modality for the evaluation of a variety of infectious and inflammatory processes ( 15 ) .
in addition , there are reports indicating that in the evaluation of inflammation or infection , 18f - fdg - pet is even more accurate than conventional nuclear medicine procedures ( 16 ) . these features of 18f - fdg - pet diagnostic modalities encouraged many professionals to perform research on its applicability in patients with painful prostheses .
however , the results of the studies dealing with the role of 18f - fdg - pet are so far rather inconclusive and need to be more clearly defined ( 12 ) . according to chacko et al . , the intensity of uptake is not useful for separating the infected from the aseptically loosened device ( 17 ) .
the periprosthetic glucose metabolism could also be enhanced to certain degrees in normal cases , which have been addressed in another study ( 18 ) , and could hamper the interpretation of the examination .
the reason for this shortcoming is to our opinion the unawareness of physiological remodelling processes that could be seen in asymptomatic patients .
the aim of this study was to demonstrate this physiological pattern and discuss the findings in the literature .
in the present study , we aim to delineate different metabolic patterns in asymptomatic patients with hip prostheses and to improve the specificity of 18f - fdg - pet in patients with suspected septic loosening of hip prosthesis .
twelve patients , ( 6 males , 6 females ) ; mean age , 73 7 ( range , 58 - 91 ) years were enrolled prospectively into the study .
none of the patients expressed any symptoms in regard to their implanted prosthesis and none of them had hematological malignancies or any metabolic bone manifestation of the primary tumor .
the pet studies were performed on a full ring pet - scanner ( siemens exact , knoxville , usa ) as described in earlier studies ( 19 ) .
the results are summarized in table 1 . with findings related to periprosthetic enhanced uptake ,
figure 1 demonstrates a case of a patient with asymptomatic hip prosthesis on both sides with enhanced uptake in the left neck region .
t = trochanter , n = neck , m = male , f = female , l = left , r = right
one of the largest samples of patients with hip prosthesis examined with 18f - fdg - pet was reported by reinartz and colleagues who compared pet with tpbs .
the authors concluded that 18f - fdg - pet is a highly accurate diagnostic procedure to differentiate reliably between aseptic loosening and periprosthetic infection ( 18 ) .
they described , by a qualitative analysis , the different patterns of periprosthetic 18f - fdg uptake in different conditions , from normal to septic loosening 6 months after arthroplasty .
18f - fdg - pet has great potential in detecting the infection , but in cases of increased aseptic loosening , periprosthetic uptake of 18f - fdg could be caused by wear - induced polyethylene particles and the subsequent growth of aggressive granulomatous tissue ( 16 ) .
non - infectious inflammatory reactions around the neck of the prosthesis are common findings months or even years after surgery and they should not be interpreted as a finding suggestive of infection ( 21 ) .
application of suv ( standard uptake value ) as a semiquantitative parameter is usually a very important tool in the interpretation of oncological pet images , but it can not be applied as a reliable criterion in inflammatory pathology due to low specificity , particularly not as a single criterion ( 10 ) . knowing the limitations of 18f - fdg - pet alone and taking into account the mechanism of its uptake in malignant tissues , leukocytes were labeled with 18f - fdg in order to increase its affinity to the inflamed tissue .
although the first results were promising , it was found that 18f - fdg was rapidly released from the leukocytes .
it has been suggested that the amount of increased 18f - fdg uptake is less important than the location of increased 18f - fdg uptake when this technique is used to diagnose periprosthetic infection in patients who had undergone prior hip arthroplasty ( 16 ) .
uptake pattern seems to be of essential importance in the diagnosis of infection and is defined as very suggestive of infection if the 18f - fdg uptake between the bone and prosthesis at the level of the midshaft portion of the prosthesis is present ( 23 , 24 ) .
this suggests that more standardized criteria for the interpretation of the 18f - fdg scan for the diagnosis of infection on the prosthesis placement should be defined and applied in practice .
depending on the type of prosthesis and on other factors , hip prosthesis can show different metabolic patterns . keeping in mind different metabolic patterns of periprosthetic 18f - fdg uptake in different conditions and the reliability of periprosthetic suv - measurement with the new pet / ct devices
, it seems to be of the utmost importance to find visual criteria that could be applied in these cases ( 18 ) . in this study
, we could demonstrate ( table 1 ) this pattern of hypermetabolic areas that could be defined more likely as normal and not caused by septic or aseptic loosening only on the neck and/or trochanteric area .
two patients who showed enhanced periprosthetic uptake in two regions , had a history of re - implantation in one case and a period longer than 10 years after the surgery in the second case .
interestingly , we could not observe focal enhanced glucose metabolism in the stem or tip region in any patient .
these findings are also of importance to rule out a suspected infection , as it was shown in a recent study where fdg - pet had a sensitivity of 100% and a negative predictive value of 100% ( 25 ) .
the study is limited by the fact that the patients could not provide information regarding the type of prosthesis , particularly whether they were cemented or not .
no patient had a leukocytosis , but 8/12 patients -- with or without periprosthetic - enhanced uptake -- had an elevated crp . since they were all referred for oncological reasons , data was not taken into consideration .
the results of this study demonstrate a non - specific pattern of enhanced 18f - fdg - uptake in asymptomatic patients in the neck or trochanteric region after arthroplasty , which should be taken into consideration for correct interpretation of metabolic studies in patients with suspected septic loosening of the hip prosthesis . | background : joint replacement is a procedure with a major impact on the quality of life of patients with joint degenerative disease or traumatic injuries .
however , some patients develop symptoms after the intervention caused by mechanical loosening or infection .
metabolic imaging by 18f - fdg - pet investigated in these patients isoften hampered by low specificity for diagnosis of possible septic vs. mechanical loosening .
the reason for this shortcoming is to our opinion the unawareness of physiological remodeling processes that could be seen in asymptomatic patients.objectives:in order to overcome this drawback , we aimed to find out the physiological metabolic functional pattern in asymptomatic patients with implanted hip prosthesispatients and methods : twelve patients ( 6 males , 6 females ) ; mean age 73 7 ( range 58 - 91 ) years were prospectively enrolled in the study .
the patients were admitted to our department for oncological referral with implanted hip prostheses .
all patients explained no symptoms with regard to their implanted prosthesis .
the attenuation corrected images were used for analysis.results:fourteen hip prostheses in 12 patients were visually analyzed .
seven out of 14 prostheses among 12 patients showed focal periprosthetic enhanced metabolism , two of which showed two sites of enhanced uptake ; whereas , the remaining five prostheses showed singular hypermetabolic areas within the periprosthetic site .
the remaining seven prostheses in the other five patients showed no periprosthetic - enhanced uptake.conclusion:of the asymptomatic patients investigated , 58% showed focal enhanced periprosthetic glucose metabolism .
this finding should be taken into consideration as a more probable unspecific metabolic pattern for correct interpretation of 18f - fdg - pet studies in patients with suspected septic loosening of the hip prosthesis . |
studies have suggested that posterior tibial slope ( pts ) is associated with biomechanics of the knee joint and posterior cruciate ligament ( pcl ) tension and stability , and facilitates femoral rollback .
thus , it has a profound influence on the clinical outcomes of total knee arthroplasty ( tka)1 - 3 ) .
several biomechanical studies have shown that pts is positively correlated with the range of flexion and inhibits excessive tension in the pcl during knee flexion , resulting in fewer instances of tibial component loosening4 ) .
however , excessive pts can lead to anterior dislocation of the tibia and biomechanical changes of the knee , compromising the longevity of tka5 ) . on the other hand
, the type of knee prosthesis ( pcl - retaining vs. pcl - sacrificing ) is an important factor that should be considered in evaluating the relationship between pts and tka outcomes .
a majority of studies have reported that the influence of pts on the range of motion ( rom ) was notable in pcl - retaining tka , whereas insignificant in pcl - sacrificing tka6,7 ) .
the normal pts was reported as 7 by hofmann et al.8 ) , 8-10 by laskin and reiger9 ) , and 14.8 by chiu et al.10 ) . however , there is no consensus on the proper pts for normal biomechanics of the knee joint in the absence of clinical studies .
patellar fracture , wear or loosening , and anterior knee pain develop in approximately 50% of tka patients11,12 ) .
these complications are associated with patellofemoral contact forces that are affected by the device design12 ) , patellar thickness13 ) , and femoral rollback in flexion .
the purpose of this study is to assess the influence of intraoperative changes in pts on clinical results under the hypotheses that 1 ) compared to excessive postoperative pts , insufficient pts after pcl - retaining tka relatively increases anterior dislocation of the femur , which results in a higher femorotibial contact pressure and development of patellofemoral pain , and 2 ) pts is positively correlated with stress on the posterior compartment of the tibia in flexion , which results in component loosening . in the absence of established intraoperative measurement methods , pts measured from the preoperative and postoperative radiographs were used to assess the relationship between pts change and clinical outcome and rom .
a total of 1,028 tkas were performed at our institution between july 2003 and july 2009 . of those ,
801 cases with a minimum follow - up of 12 months were enrolled in this retrospective study .
the exclusion criteria were < 90 preoperative rom , rheumatoid arthritis , traumatic or infectious arthritis , patellar resurfacing , and outerbridge grade iii lesion in more than 50% of the patellofemoral joint .
the surgery was performed on the right knee in 436 cases and on the left knee in 465 cases .
surgery was performed using the e - motion ( aesculap , b - braun , tuttlingen , germany ) pcl - retaining prosthesis in all cases .
proximal tibial osteotomy was performed with care to maintain the original slope of the articular surface by taking 3 of posterior slope of the tibial implant into consideration .
rotation of the femoral component was determined as 3-5 of external rotation with respect to the posterior condylar axis based on the preoperative computed tomography ( ct ) scan .
taking care to avoid more than one size smaller or larger prosthesis , a femoral component that was identical as much as possible to the anteroposterior diameter of the femoral condyle was chosen using a posterior reference method .
if severe flexion contracture and soft tissue contracture were present , posterior osteophyte removal and partial pcl release were done to achieve flexion - extension gap balance .
the mean values of pts measured by two observers using a picture archiving and communicating system ( maroview 5.4 , marotech , seoul , korea ) were used for analysis .
the anatomical axis and mechanical axis were measured on the weight - bearing radiographs preoperatively and at the last follow - up .
pts was defined as the angle between a line perpendicular to the proximal tibial anterior cortex and a line parallel to the tibial medial plateau on the 30 flexion lateral view ( fig .
patients were divided into 5 groups , according to the change in pts that was calculated by subtracting the preoperative value from the postoperative value .
if the postoperative value was greater than the preoperative value , a plus sign ( + ) was placed in front of a numeric value , whereas a minus sign ( - ) was used in the opposite case : group 1 , > 3 ( 129 patients ) ; group 2 , 3 to 1 ( 113 patients ) ; group 3 , 1 to -1 ( 312 patients ) , group 4 , -1 to -3 ( 163 patients ) ; and group 5 , < -3 ( 84 patients ) .
knee function was assessed using the visual analog scale ( vas ) score , feller patella score15 ) , kujala score16 ) , functional score , and knee society knee score ( kss)17 ) preoperatively and at the last follow - up .
intergroup differences in knee function score changes between the preoperative and last follow - up examinations were analyzed using the spss ver .
was performed to compare the differences in parameters among the groups and scheffe test was conducted additionally to confirm statistical significance of the differences .
the pre- and postoperative parameters in each group were assessed using paired t - tests with a 95% confidence interval .
a total of 1,028 tkas were performed at our institution between july 2003 and july 2009 . of those ,
801 cases with a minimum follow - up of 12 months were enrolled in this retrospective study .
the exclusion criteria were < 90 preoperative rom , rheumatoid arthritis , traumatic or infectious arthritis , patellar resurfacing , and outerbridge grade iii lesion in more than 50% of the patellofemoral joint .
the surgery was performed on the right knee in 436 cases and on the left knee in 465 cases .
surgery was performed using the e - motion ( aesculap , b - braun , tuttlingen , germany ) pcl - retaining prosthesis in all cases .
proximal tibial osteotomy was performed with care to maintain the original slope of the articular surface by taking 3 of posterior slope of the tibial implant into consideration .
rotation of the femoral component was determined as 3-5 of external rotation with respect to the posterior condylar axis based on the preoperative computed tomography ( ct ) scan . taking care to avoid more than one size smaller or larger prosthesis , a femoral component that was identical as much as possible to the anteroposterior diameter of the femoral condyle
if severe flexion contracture and soft tissue contracture were present , posterior osteophyte removal and partial pcl release were done to achieve flexion - extension gap balance .
the mean values of pts measured by two observers using a picture archiving and communicating system ( maroview 5.4 , marotech , seoul , korea ) were used for analysis .
the anatomical axis and mechanical axis were measured on the weight - bearing radiographs preoperatively and at the last follow - up .
pts was defined as the angle between a line perpendicular to the proximal tibial anterior cortex and a line parallel to the tibial medial plateau on the 30 flexion lateral view ( fig .
1 ) . patients were divided into 5 groups , according to the change in pts that was calculated by subtracting the preoperative value from the postoperative value .
if the postoperative value was greater than the preoperative value , a plus sign ( + ) was placed in front of a numeric value , whereas a minus sign ( - ) was used in the opposite case : group 1 , > 3 ( 129 patients ) ; group 2 , 3 to 1 ( 113 patients ) ; group 3 , 1 to -1 ( 312 patients ) , group 4 , -1 to -3 ( 163 patients ) ; and group 5 , < -3 ( 84 patients ) .
knee function was assessed using the visual analog scale ( vas ) score , feller patella score15 ) , kujala score16 ) , functional score , and knee society knee score ( kss)17 ) preoperatively and at the last follow - up .
intergroup differences in knee function score changes between the preoperative and last follow - up examinations were analyzed using the spss ver .
the anova test was performed to compare the differences in parameters among the groups and scheffe test was conducted additionally to confirm statistical significance of the differences .
the pre- and postoperative parameters in each group were assessed using paired t - tests with a 95% confidence interval .
there was no statistically significant intergroup difference in the parameters that can affect the postoperative rom and knee function including the preoperative body mass index ( bmi ) and rom , vas score , functional score , kss , feller patella score , and kujala score ( table 1 ) .
the mean preoperative anatomical axis and mechanical axis of the lower limb measured by two observers was 3.64.2 of varus and 7.85.3 of varus , respectively .
the interobserver reliability of the measurements assessed with intraclass correlation coefficient ( icc ) proposed by shrout and fleiss18 ) was high with an icc of 0.813 and 0.799 , respectively .
the mean anatomical axis and mechanical axis at the last follow - up was 8.73.3 of valgus and 2.42.2 of valgus , respectively , indicating a correction of varus deformity .
there was no significant difference among the groups in the last follow - up measurements and the amount of increase ( p=0.143 ) .
the mean preoperative pts was 7.15.4 with an icc of 0.823 and no notable difference was found among the groups ( p=0.211 ) .
the mean pts at the last follow - up was 7.22.8 with an icc of 0.812 .
the vas score , functional score , and kss were improved postoperatively in all groups and the level of improvement was not significantly different among the groups .
the feller patella score was improved postoperatively in all the groups ; however , especially significant improvement was observed in group 2 ( 26.3 , p=0.022 ) and group 3 ( 27.8 , p=0.034 ) .
the kujala score was increased postoperatively in all groups , and especially significantly in group 2 ( 76.5 , p=0.041 ) and group 3 ( 77.4 , p=0.029 ) ( table 2 ) .
the rom was improved postoperatively in all groups , but the level of improvement was not significantly different among the groups ( p=0.241 ) .
there were no clinically significant complications during the follow - up , such as aseptic loosening , increased radiolucency , and fracture of the polyethylene insert .
there was no statistically significant difference in the pre- and postoperative changes in the vas score , functional score , and kss among the 5 groups that were divided according to the changes in the pre- and postoperative pts .
we attributed this to the fact that most of the patients had degenerative arthritis and pts is not the only factor that influences postoperative pain , rom limitation , and knee function .
however , feller patella score and kujala score appeared correlated with pts as in groups 2 and 3 .
it is our understanding that pts is negatively correlated with anterior dislocation of the tibia , which results in reduced patellofemoral contact surface and stress , and eventually improvement in the feller patella score and kujala score .
however , significant improvement was not observed in group 1 with > 3 increase in pts .
we thought that the poor clinical results in this group were attributable to posterior translation of the femur , relative to the tibia , resulting in excessive traction forces on the quadriceps femoris tendon or patellar tendon or impingement of the patellar tendon during joint movement .
further , contrary to our hypothesis that pts is correlated with the incidence of tibial component loosening due to increased pressure on the posterior compartment during flexion , there was no case of loosening in this study .
the latter corrects anteroposterior tightness , whereas the former enhances varus and valgus , anteroposterior , and rotational laxity in knees that are too tight in flexion .
therefore , pts increase can be more effective than pcl release in the knees with abnormal collateral ligament tightness and flexion tightness19 ) .
walker and garg20 ) reported that 30 increase in flexion was observed in the knees with 10 pts compared to those with 0 pts after pcl - retaining tka . in a cadaver study by bellemans et al.21 ) , flexion improved by 1.7 for every 1 extra pts .
however , we could not find a correlation between pts and rom in this study .
one of the limitations of our study is that factors , such as posterior condylar offset , that can affect the postoperative rom were not taken into consideration in patient selection .
therefore , we think that our study results should be confirmed by future clinical and biomechanical studies with prospective design and tighter control on possible confounding variables .
the improvement was especially notable in groups 2 and 3 with 3 to -1 increase in pts compared to the other groups . | purposethe purpose of this retrospective study is to investigate the effect of posterior tibial slope ( pts ) on clinical results in total knee replacement arthroplasty ( tka).materials and methodswe analyzed 801 knees in 768 patients who underwent tka using a cruciate - retaining prosthesis for osteoarthritis from july 2003 to july 2009 .
pts was measured on simple x - ray films and patients were divided into 5 groups , according to the change in pts that was calculated by subtracting the preoperative from the postoperative pts : group 1 , > 3 ; group 2 , 3 to 1 ; group 3 , 1 to -1 ; group 4 , -1 to -3 ; and group 5 ,
< -3. we analyzed the correlations between the change in pts and clinical results , such as knee society knee score , knee society functional score , feller patella score , kujala score , visual analog scale score , range of motion , and complications.resultsthere was no statistically significant intergroup difference ; however , feller patella score and kujala score were significantly different in groups 2 and 3 .
there were no complications , such as progressive loosening of implants , fractures of polyethylene inserts and wears.conclusionsclinically meaningful improvement was observed in all patients after tka .
groups 2 and 3 ( 3 to -1 ) showed significant improvement compared to the other groups . |
along with the obesity epidemic , the prevalence of metabolic syndrome ( mets ) has increased among children and adolescents [ 1 , 2 ] .
a recent review concluded that the worldwide prevalence of mets among children and adolescents varies between 1.2 and 22.6% .
the highest rates of mets among overweight and obese children were observed in turkey and the us ( around 40% ) and the lowest rates in china , france and italy ( around 11.5% ) . in europe ,
the prevalence of mets vary from 0.2% among 10 year olds in estonia , portugal , and denmark to 21% among 416 year olds in germany .
apart from differences in obesity prevalence , another explanation to the great variation is the many definitions of mets for children and adolescents .
the international diabetes federation recently defined mets in children and adolescents as abdominal obesity and the presence of 2 or more other clinical features ( i.e. , elevated triglycerides , low hdl - cholesterol , high blood pressure , or increased plasma glucose ) .
the most important risk factor for developing mets is obesity and the risk increases with increased levels of obesity .
unhealthy dietary habits and low levels of physical activity are other important risk factors [ 1 , 3 ] .
overweight and obesity as well as mets in childhood and adolescence predict future mortality and diseases such as type 2 diabetes and atherosclerotic cardiovascular disease [ 1 , 7 , 9 ] .
since obese children are at high risk of becoming obese adults and components of mets track into adulthood early intervention is of great importance [ 1 , 10 , 11 ] .
there is some evidence that early interventions aiming at managing obesity could reduce the risk of developing mets and improve metabolic health .
the initial treatment of mets in obese children and adolescents is the reduction of body mass index ( bmi ) , that is , the same as for managing childhood overweight and obesity .
a recent cochrane review stated that family - based , lifestyle interventions with behavioural programs aiming at improving physical activity and food habits appear to be the most effective treatment for childhood overweight and obesity .
however , many studies aiming at preventing further development of overweight and obesity have limited results [ 15 , 16 ] and there is a need of studies trying new methods , for example , the use of internet as a way of communicating with children and parents .
the aim of the present study was to evaluate the effect of a family - based intervention program on anthropometric and metabolic markers in 812-year - old overweight and obese children .
this study was a parallel group , randomized controlled trial where children were randomized into either an intervention or control group .
however , the research nurses performing anthropometric and biochemical measurements were not informed about the children 's group allocation .
the anthropometric and biochemical measurements were done at the pediatric clinical research unit , department of pediatrics , ume university , and the intervention sessions were conducted at the department of food and nutrition , ume university .
children allocated to the control group participated in one information session . apart from that , they only participated in the same measurements as the intervention group .
all families , regardless if they were normal weight or overweight , with children born between 1995 and 1998 living in or near the northern swedish city ume ( n = 6290 ) were informed about the study by a letter from the researchers . to participate in the study ,
the children had to have an age and gender adjusted bmi 25 kg / m , be born 19951998 , and live in or nearby the city of ume . excluded were children who had chronic diseases that could influence metabolic parameters , attention deficit disorders , or lack of access to internet . to obtain a study power of 80% with = 0.05 and to detect a difference in bmi of 1.6
kg / m between intervention and control children , 84 participants were needed . however , to allow for a dropout , we aimed to recruit 120 children .
recruitment and randomization occurred at four different time points , october 2006 and in january , march , and may 2007 . in total , 112 families showed interest to participate and were contacted by phone to ascertain eligibility .
seven children did not meet inclusion criteria and were excluded . as a result , 105 children ( 53 girls and 52 boys ) were included in the study ( figure 1 ) .
the children were consecutively randomised ( 1 : 1 ) and stratified by gender into either an intervention group or a control group by the researchers . after inclusion ,
12 of the 105 randomized children changed their mind regarding participation ( before having done baseline measurements ) which resulted in 93 children who participated in baseline measurements ( figure 1 ) . during the time period from inclusion to the baseline measurements , ranging from 3 days to 2 months , the bmi classification of 3 children , 2 allocated to the intervention group and 1 to the control group , changed from overweight to normal weight .
these 3 children remained in the group , they were randomized to and continued to participate in the study .
of the recruited children , 1015 were allocated to each of 4 subintervention groups and 4 subcontrol groups , starting on 4 different occasions in time .
eleven more children were randomized to the last intervention group than to the last control group , to compensate for dropouts that had occurred in previously three intervention groups .
written informed consent was obtained from the children 's parent and verbal consent was ascertained from each child through their parents .
the study was approved by the regional research ethics review board ( ref number : 05088 m ) and all applicable institutional and governmental regulations concerning the ethical use of human volunteers were followed during the study .
the family - based intervention was based on principles of behavioural [ 19 , 20 ] and solution - oriented group work , where both children and parents participated .
focus was on improving present behaviours related to food and physical activities in a group setting .
the aim of the intervention was to improve food and physical activity habits , and the intervention has been described in more details previously [ 22 , 23 ] . in summary , the first year of the intervention program consisted of 14 sessions 1 - 2 times per month .
five sessions concerned food habits , 4 physical activities , and the remaining 5 sessions focused on behavioural change as well as working towards personal goals and motivation . between sessions
, participants were given home assignments that were related to the theme of the upcoming session and contact was held through a web platform where the participants could report home assignments or communicate with other participants or leaders between the sessions .
the recommended dietary intake and physical activity level were in line with national recommendations given to swedish children .
the mean attendance rate at the 5 sessions regarding food among intervention children who participated during the first year ( a mean of 7 children participated per group ) was 3.4 ( range 15 ) children per session .
the corresponding rate for the 4 sessions regarding physical activity in groups was 4.1 ( range 27 ) children per session and for the remaining 5 sessions regarding behavioural change and self - esteem the attendance rate was 5.3 ( range 38 ) children per session .
all group sessions were led by the authors m. waling ( with a food and nutrition degree ) and c. bcklund ( registered physiotherapist ) , and at some of the sessions other health professionals were invited to colead the sessions . at 3 sessions , a registered dietician was invited , at 1 session a paediatric physician was invited , and at 3 sessions a child psychologist was invited .
all sessions were planned before the intervention started and each session had a manual which was followed by the leaders .
outcome measures were obtained at baseline and 1 year into the study in both intervention and control groups .
height was measured to the nearest 0.1 cm with a wall stadiometer ( hyssna measuring equipment ab , sweden ) , and weight was measured to the nearest 0.1 kg with an electronic scale ( aj medical , sweden ) .
the main outcome of the study , bmi , was calculated as weight ( kg)/height ( m ) and converted to bmi z - scores by using both us reference data and a swedish reference dataset .
children were classified as normal weight , overweight , or obese using the international obesity task force ( iotf ) definitions , and parents ' weight status was classified using the world health organization 's definitions .
waist circumference measurements were recorded to the nearest 0.1 cm midway between the tenth rib and the iliac crest with children in a standing position using a nonelastic flexible tape .
sagittal abdominal diameter was measured to the nearest 0.1 cm using a ruler with the child in a supine position from the bed to the top of the abdomen .
puberty stage was estimated according to tanner [ 28 , 29 ] and puberty was categorized into 2 groups : pre - pubertal ( tanner stage 1 ) and pubertal ( tanner stage 24 ) , no child had reached tanner stage 5 .
body composition analysis was performed using dual energy x - ray absorptiometry ( dexa ) ( lunar prodigy whole - body scanner ge medical systems , madison , wis , usa ) , with the child in a supine position .
body fat content is expressed as absolute values ( kilograms ) and as percent fat ( fat mass % ) , and truncal fat expressed as percent fat ( truncal fat mass % ) in the soft tissue of the trunk .
fat mass index ( fmi , kg / m ) was calculated as fat mass ( kg)/height ( m ) .
blood pressure was measured on the right arm using an electronic blood pressure device ( welch allyn spot vital signs , welch allyn ab , sweden ) after supine rest for 5 minutes .
venous blood samples were collected after overnight fasting and analysed for plasma glucose , serum lipids [ total cholesterol ( tc ) , high - density lipoprotein cholesterol ( hdl - c ) , low - density lipoprotein cholesterol ( ldl - c ) , triglycerides ( tg ) , apo lipoprotein a1 ( apo a1 ) and apo lipoprotein b ( apo b ) ] , insulin , and hba1c .
homeostatic model assessment index ( homa - index ) was calculated as ( insulin glucose/22.5 ) .
the children were classified as having mets using the definitions of the international diabetes federation ; waist circumference 90th percentile and the presence of 2 or more other clinical features ( i.e. , elevated tc , low hdl - c , high blood pressure , or increased glucose ) . reference data collected in a cohort of 10-year - old children from ume was used when defining the 90th percentile of waist circumference .
statistical analyses were performed using spss version 17.0 ( spss inc . , chicago , ill , usa ) and the significance level was set at p < 0.05 .
independent t - test and one - way analysis of covariance ( ancova ) with adjustment for baseline data were used to analyze differences between intervention and control groups . paired samples t - test
were performed to determine differences within intervention and control groups , respectively , between baseline and 1-year measurement .
relationship between bmi and truncal fat was investigated using pearson product - moment correlation coefficient .
results were analysed both per protocol and on an intention - to - treat analysis basis , that is , all children were analyzed in the group they originally were randomized to . in the intention - to treat - analysis the principle of carrying the last observation ( in this study baseline measurements were used ) forward was used in children who dropped out before the 1 year measurement .
from baseline to the 1-year measurement , 42% of the children in the intervention group and 33% of the children in the control group dropped out ( figure 1 ) , which left 58 children who had completed the 1-year measurement . the proportion of dropouts did not differ between the groups ( p = 0.407 ) . in the intention - to - treat analysis where the principle of the last value carry forward
was used , the 35 children who had dropped used baseline measurements as a proxy for the 1-year measurement .
forty - eight children ( 44% girls ) in the intervention group completed baseline measurement of which 38% were classified as obese and 45% had at least one parent classified as being obese . in the control group ,
45 children ( 58% girls ) completed the baseline measurements , 24% were classified as being obese and 36% had at least one parent classified as being obese .
no differences were seen between the groups regarding gender distribution ( p = 0.176 ) , prevalence of overweight and obesity ( p = 0.109 ) , or prevalence of having at least one parent classified as being obese ( p = 0.372 ) .
the only difference noted at baseline was a 2.2% higher fat mass in the intervention group compared to the control group ( table 1 ) .
after 1-year participation , there was no difference in bmi , bmi z - score , or proportions of children classified as being normal weight , overweight , or obese between the intervention and control group ( table 2 ) .
however , in contrast to the intervention group , the proportion of children changing weight status within the control group was statistically significant ( p < 0.001 ) after 1-year participation , with 2 less children classified as obese and 6 more children being classified as normal weight . in the intervention group , 4 less children were classified as obese and 2 more children were classified as normal weight after 1-year participation but the change was not statistically significant ( p = 0.182 ) .
there were children in both groups who decreased bmi during the study period without a change in classification ( e.g. , if classified as overweight at baseline still classified as overweight at 1-year measurement ) ; in the intervention group , there were 4 children with a bmi decrease ranging from 0.282.20 kg / m , and in the control group there were 2 children with a bmi decrease of 0.410.72 kg / m .
both the intervention and control group decreased bmi z - scores from baseline to 1-year measurement , regardless of reference population ( swedish or the us ) ( table 3 ) .
there was no statistically significant change in the proportion of children having a bmi z - score above + 2 sd during first year of the study within the intervention or control group ( p = 0.141 or p = 0.258 , resp . )
after 1-year of intervention , there was a statistically significant difference between intervention and control group in waist circumference , waist / hip ratio , and apob / a1 when baseline measurements had been carried forward ( table 3 ) .
the waist / hip ratio did not change significantly in the intervention group but it increased by 0.02 ( p = 0.042 ) in the control group when analysing according to the last observation carried forward and similar results were seen when analysing per protocol .
the apob / a1 quotient did not change significantly in the intervention group but it increased by 0.03 ( p = 0.032 ) in the control group when using the last observation carried forward and similar results was seen when analysing per protocol , resulting in a significant difference between the two groups after 1 year of participation ( p = 0.041 ) .
the relationship between bmi and truncal fat ( expressed as % truncal fat mass ) was strong at baseline in both the intervention group , r = 0.75 ( p 0.001 ) , and the control group , r = 0.62 ( p 0.001 ) .
after 1 year , when analysing , according to the last observation carried forward the relationship was 0.76 ( p 0.001 ) in the intervention group and 0.73 ( p 0.001 ) in the control group .
3 children in the study were defined as having mets , 1 participant in the intervention group , and 2 participants in the control group . at 1 year measurement 3
children in the intervention group and 2 in the control group fulfilled the mets definition .
the nonstatistically significant increase in mets prevalence in the intervention group was explained by increased tg levels in 2 children .
after 1-year participation in the present study , bmi z - scores decreased in both groups and there were no differences in bmi or bmi z - score between the groups .
the family - based intervention program designed to improve health of overweight and obese children through lifestyle changes resulted in limited effects on anthropometric and metabolic measurements . in accordance with the present study ,
many similar intervention studies with the same aim as ours show no difference in bmi between intervention and control group 1.52 years into the intervention .
one study performed in finland that included 79-year - old obese children in a family group treatment showed no intervention effect on bmi 2 and 3 years after baseline .
further , williamson et al . showed no intervention effect on bmi after a 2-year web - based intervention on 1115-year - old overweight and obese girls .
similar results with no intervention effect on bmi were seen among 812-year - old extremely obese children at 1.5 year follow - up . on the other hand , one study performed in the us on 816-year - old obese children
did show a 2.8 kg / m lower bmi in the intervention group compared to control group at a 2-year followup . even though the intervention did not succeed in decreasing the intervention groups ' bmi in relation to the control group after 1 year of participation , the stagnated bmi ( which naturally increases as children grow ) and
the decreased bmi z - score in both groups indicate that both groups have been affected .
one reason for this could be that merely the participation in a study with focus on a healthy lifestyle could be an incitement for lifestyle change .
another reason could be the focus on the increased prevalence of overweight in media the past years .
the possible effect of society on bmi and bmi z - score in the present study is supported by studies that show stagnation and in some cases a decrease in prevalence of childhood overweight and obesity in sweden [ 2931 ] . in the present study ,
the prevalence of mets ( 3% at baseline and 5% at 1-year measurement ) was low compared to the reported prevalence of 1132% , among overweight and obese children in europe . despite the decreased bmi z - score , we saw no effect on biochemical parameters or blood pressure .
this may be explained by the fact that a majority of the children were within the normal range at baseline and consequently major improvements could not be expected .
some studies suggest that a reduction of 0.25 in bmi z - score is needed for a minor improvement in metabolic markers among obese adolescent and that a decrease of 0.5 units is needed for a major improvement [ 4 , 36 ] .
it is possible that we would have seen different results if we had included children that had abnormal metabolic values to begin with . in the present study
, we had mainly families representing those living in the town of ume , a town with a high educational level .
it is most likely that families that agree to participate in a study like the present one are more motivated than those who decline participation .
these characteristics of the study population are a limiting factor when it comes to the generalization of the results .
a strength of the present study is the randomized controlled trial design but the sample size is small and the study had a high dropout rate . even though several recruitment efforts were made , including expanding the inclusion criteria to a larger age and bmi span , expanding the geographical catchment area and even though all families in the area with children in the specific age group were sent an invitation , we were not able to recruit a larger number of participants .
we also had a higher dropout than expected even though high dropout rates are quite common in intervention studies aiming at treating childhood overweight and obesity and may vary between 12 and 52% .
the most common reason of intervention families for leaving the present study was that the child was not interested in participating , while most of the control families left the study without explanation .
the large dropout rate and consequently low study power makes it difficult to detect small differences between intervention and control group as well as to generalize the results .
this is a major limitation of the study and to increase the study power a last observation carried forward strategy was used to replace dropouts .
the last observation carried forward principle is one of the most commonly used strategies to deal with drop outs , even though it has some disadvantages .
a disadvantage to be considered is dilution of the intervention effect , and in the present study 42% and 33% of the baseline data of the intervention , respectively , control group was used as proxy for the 1-year measurements . to control for this all analyses
were also made per protocol showing similar results , however then there might not be enough power in the study to be able to detect a small intervention effect .
another limitation of the present study is the relatively many hypotheses that were tested which increases the risk of chance findings . in conclusion ,
the family - based lifestyle programme had limited effects on anthropometric and metabolic outcomes of the overweight and obese children .
this strongly supports the idea that efforts should primarily be aimed at primary prevention of overweight and obesity . | objective . to evaluate the effect of a family - based intervention on anthropometric and
metabolic markers in overweight and obese children
.
methods .
overweight or obese 812 years olds ( n = 93 ) were randomized into intervention or
control groups .
the intervention group participated in a program aiming for lifestyle changes
regarding food habits and physical activity .
anthropometric measures and venous blood
samples were collected from all children at baseline and after 1 year .
results .
bmi z - scores decreased in both groups , 0.22 ( p = 0.002 ) and 0.23 ( p = 0.003 ) in intervention and control group , respectively , during the 1-year study , but there was no difference in bmi between the groups at 1-year measurement ( p = 0.338 ) .
after 1 year , there was a significant difference in waist circumference , waist / hip ratio , and apolipoprotein b / a1 ratio between intervention and control group .
conclusions .
the intervention had limited effects on anthropometrics and metabolic markers , which emphasizes the need of preventing childhood overweight and obesity . |
over the past 30 years , the prevalence of adult obesity in the united states has doubled while that of adolescent obesity has tripled .
current estimates classify 15.5% of us children and adolescents as overweight ( body mass index ( bmi ) between 85th and 95th percentile for age ) , 4% as obese ( bmi between 95th and 99th percentile for age ) , and 4% as morbidly obese ( bmi 99th percentile for age ) .
these children are at risk of developing serious obesity - related comorbidities such as type 2 diabetes , dyslipidemia , hypertension , and metabolic syndrome ( mes ) .
the necessity for early , aggressive treatment of obesity stems from the need to not only alleviate the medical and psychosocial comorbidities experienced in adolescence but also to decrease the risk of premature mortality in adulthood .
mes affects an estimated 1/3 to 1/2 of morbidly obese adolescents and likely contributes to the increased morbidity and mortality seen in adulthood .
pediatric mes , just as adult mes , is associated with a significantly elevated risk of cardiovascular disease and type 2 diabetes .
additionally , risk of mes in adulthood is associated with its presence in childhood and adolescence [ 3 , 4 ] .
adolescent obesity has significant long - term consequences , as there is a dose - dependent relationship between bmi in adolescence and risk of morbidity and mortality in adulthood .
alarmingly , studies show that childhood obesity , particularly adolescent obesity , is a key predictor of adult obesity , and up to 77% of children will carry their obesity into adulthood .
the dangers of adult obesity include a reduction of median survival by 810 years in adults with bmis between 40 and 45 kg / m .
increasing evidence suggests that traditional nonsurgical weight loss methods are ineffective and that bariatric surgery is the most sustainable and effective treatment for weight loss in the morbidly obese [ 811 ] . presently , the most common surgical options for adolescents are roux - en - y gastric bypass and laparoscopic adjustable gastric banding ( lagb ) , with gastric bypass comprising more than 90% of us adolescent cases in 2003 .
lagb is associated with a five- to ten - fold lower mortality rate and three - fold lower complication rate than gastric bypass , has the advantages of adjustability and reversibility , and has been associated with sustained weight loss and improved comorbidities in adults .
there is little long - term data on lagb in adolescents however , since the procedure is not fda approved for use in individuals under the age of 18 yrs .
while a handful of promising national and international studies demonstrating the safety and efficacy of lagb in morbidly obese adolescents have been published [ 811 , 1319 ] , few report on the effects of lagb - induced weight loss on mes .
the aim of this study was to evaluate the effects of lagb on weight , inflammatory markers , and components of mes in morbidly obese adolescents and to determine if those with mes lose less weight post - lagb than those without as a consequence of their preoperative metabolic derangements .
we hypothesize that lagb will result in a significant amount of excess weight loss , which will be accompanied by improvements in markers of inflammation as well as in measures diagnostic of mes .
we further postulate that mes may represent a more advanced state of metabolic derangement , in which the patient is more resistant to weight loss .
therefore , those who carry a diagnosis of mes will lose less weight compared to those who do not .
this is an irb - approved , prospective , nonrandomized single center study conducted under an fda - approved investigational device exemption .
an initial feasibility trial of 15 adolescents with followup was performed with interim safety and effectiveness data submitted to the fda .
the fda subsequently granted approval to implant up to 125 additional patients with evaluation and followup identical to the initial 15 .
all adolescents who underwent lagb were entered into a database and included in the data analysis .
subjects with 6-month ( 6 m ) and/or 12-month ( 12 m ) post - lagb anthropometric and/or metabolic data were included in this report , which assessed weight , bmi , waist circumference ( wc ) , systolic and diastolic blood pressure ( bp ) percentiles , triglycerides ( tg ) , high - density lipoprotein ( hdl ) , fasting blood sugar ( fbs ) , c - reactive protein ( crp ) , % weight loss ( % wl ) , and % excess weight loss ( % ewl ) .
the bmi guidelines used were consistent with nih criteria for bariatric surgery in adults .
subjects were recruited from among those enrolled in weight management programs at columbia university medical center ( cumc ) or referred by private pediatricians to the center for adolescent bariatric surgery .
both adolescents and their parents or caregivers were actively involved in the screening process , during which medical , social , psychiatric , and weight histories were obtained . as part of the protocol ,
subjects who met criteria for entry were enrolled at cumc in either a 6 m lifestyle modification program if they had no prior programmatic weight loss experience or a 3 m program if they had documentation of participation in prior programs . during this time , subjects met monthly with a nurse practitioner / exercise specialist and a registered dietician , one to three times with an endocrinologist , and twice with a psychiatrist or psychologist and the pediatric surgeon . at the end of the lifestyle modification program ,
those subjects who demonstrated active participation and willingness to make changes were offered lagb , while those having difficulty with program compliance were encouraged to continue with medical weight management . prior to undergoing lagb ,
baseline evaluations including anthropometric measurements , fasting blood studies ( comprehensive metabolic panel , lipids , and nutrition panel ) , and an oral glucose tolerance test were performed .
in addition , an electrocardiogram , chest x - ray , sleep study , and abdominal ultrasound with attention to the liver and gallbladder were completed for preoperative clearance .
a bone age was performed to document skeletal maturity , and a serum hcg was carried out in females to ensure negative pregnancy .
diagnosis of mes was made using the 2003 cook criteria for adolescents with modification of the fbs criterion to the november 2003 ada criterion of > 100 mg / dl as abnormal .
thus , we used the presence of any 3 of the following : tg 110 mg / dl , hdl 40 mg / dl , fbs 100 mg / dl , wc ( cm ) 90th percentile for ethnicity , age and sex , and bp ( mmhg ) 90th percentile for age , height , and sex .
hypertension was defined as systolic and/or diastolic bp greater than the 95th percentile for age , sex , and height .
dyslipidemia was defined by the presence of fasting hdl 40 mg / dl , ldl 110 mg / dl , tg 110 mg /dl , and/or total cholesterol 200 mg / dl .
height was measured using a stadiometer to the nearest 0.1 cm ; weight was measured using a digital readout scale to the nearest 0.1 kg .
wc was measured at the anterior superior iliac spine to the nearest 0.5 cm .
three readings for each of systolic and diastolic bps were obtained , and the average of the measurements was used .
serum glucose , hdl , and tg were run on an olympus a42700 analyzer ( olympus america inc , melville ny ) .
crp was measured by nephelometry using a bn2 immunoassay ( siemens industry , usa ) .
lap - band ( lap - band system ; allergan corp , santa barbara , ca ) is a silicone ring with an adjustable inner diameter that is positioned around the proximal stomach just distal to the gastroesophageal junction , creating a small proximal gastric pouch .
saline can be injected into or withdrawn from the port to adjust the diameter of the band .
lap - band controls the outlet diameter of the upper stomach pouch , limiting emptying rate and causing a feeling of early satiety and subsequent weight loss .
all surgical procedures were performed at the morgan stanley children 's hospital of new york by a pediatric surgeon ( jz ) .
placement of the lap - band was performed laparoscopically with the patient under general anesthesia .
the lap - band was placed using 5 trocar sites according to the pars flaccida technique , which has been described in detail elsewhere .
the lap - band was left empty at the end of placement to allow for postoperative swelling .
patients were observed in the hospital overnight , and a contrast esophagram was performed to confirm band position and assess pouch emptying prior to discharge .
patients were instructed to return for followup visits for assessment of weight changes , for nutritional advice , and for postsurgical monitoring and adjustments at weeks 2 , 4 , 6 , and 8 , then monthly for the initial 12 m , with plans for followup at 15 , 18 , and 24 m , and semiannually thereafter for a total of 5 years .
fasting laboratory evaluations ( including comprehensive metabolic panel , nutritional panel , lipids , and oral glucose tolerance test ) were performed at postoperative months 6 and 12 with biannual assessments intended for the next 5 yrs .
subsequent band adjustments were tailored to the individual 's needs , including feelings of hunger and satiety , as well as pain with or without vomiting .
the overall goal for weight loss was 11.5 lbs per week , which is consistent with other studies [ 16 , 24 ] .
patients were instructed to follow a pureed diet in the first postoperative week , a blended diet for postoperative weeks 23 , a soft diet for postoperative weeks 46 , and a well - balanced low - fat diet for postoperative week 7 and beyond .
in addition , patients were instructed to continue physical activity , to eat 3 small meals per day , to avoid liquids 30 minutes before and 30 minutes after eating , and to stop eating when full .
ideal body weight was derived by multiplying the square of each subject 's baseline height by the bmi at the 85th percentile for each subject 's sex and age using the cdc growth charts ( 2000 ) .
there is no consensus with respect to the optimal bmi to use when determining ideal body weight for children and adolescents .
our goal was to have subjects achieve a weight and bmi within normal range for their age . while a bmi at the 85th percentile is at the uppermost limit of normal , it is within the normal range and a realistic goal for our study subjects .
excess weight ( ew ) was calculated by subtracting ideal body weight from actual baseline weight .
% ewl was calculated by dividing the amount of weight lost at 6 m or 12 m post - lagb by the ew and multiplying by 100 .
% wl was calculated by dividing the amount of weight lost at 6 m or 12 m post - lagb by baseline weight and multiplying by 100 .
pearson correlation was used to identify associations among changes in weight and indices of the mes at both 6 m and 12 m. fisher 's exact test was used to assess the change in the proportion of subjects meeting mes criterion at 6 m and 12 m. logistic regression with dichotomously coded mes status ( improved versus unimproved ) was used to assess which weight change measure was most highly associated with change in mes status .
linear mixed models for repeated measures were used to check whether average within - subject changes over time represented statistically reliable changes from baseline .
a p - value less than.05 was considered statistically significant , and data are expressed as counts and percentages or means and standard error of the mean ( sem ) .
early complications included 1 exploration for bleeding , 1 repositioning of a misplaced band , and 1 exploration for presumed bowel obstruction which proved to be prolonged ileus .
no patient required band removal . from march 2006 through june 2010 , 108 adolescents ( 31 males , 77 females ) underwent lagb . at the time of this report , all subjects were at least 6 m post - lagb and 88 ( 81.5% ) presented for followup .
these 88 adolescents ( 36 hispanic , 13 african - american , 33 caucasian , and 6 mixed ethnicity ) had baseline age 16.8 0.1 yrs , bmi 45.9 1.0 kg / m , and ew 66.9 3.0 kg .
mean % wl at 6 m post - lagb was 7.5 0.9% , ranging from a loss of 24.8% to a gain of 12.7% .
the mean % ewl equaled 17.1 2.2% , ranging from 86.8% of excess weight lost to 27.3% of excess weight gained .
fifteen patients gained weight at the 6 m time point with mean weight gain of 6.1 1.1 kg .
baseline and 6 m post - lagb anthropometric data of subjects who had blood work assessed were not significantly different from that of subjects who did not ( data not shown ) .
there were significant improvements in bmi , weight , wc , systolic and diastolic bp% iles , and crp ( table 2 ) .
mes resolved in 21 of the adolescents diagnosed at baseline ( 56.8% ; p < .0004 ) .
no significant differences were observed in % ewl , % wl , or change in bmi between those with mes at baseline and those without ( data not shown ) .
resolution of mes did not significantly correlate with change in bmi , % wl , or % ewl ( p = ns ) . at the time of this report , 84 adolescents were at least 12 m post - lagb .
forty - five adolescents ( 50.6% ; 17 male , 28 female ) attended 12 m followup visits .
these 45 adolescents ( 19 hispanic , 6 african - american , 17 caucasian , and 3 mixed ethnicity ) had baseline age 17.2 0.2 yrs , bmi 45.8 1.5 kg / m , and ew 69.4 4.3 kg .
the % wl for this group was 10.9 1.2% , ranging from a 43.0% loss to a gain of 9.1% .
mean % ewl was 25.9 3.6% ranging from an excess weight loss of 76.4% to an excess weight gain of 21.6% ( figure 1 ) .
four adolescents had net weight gains , the mean of which was 6.1 2.8 kg ( range 0.613.5 kg ) .
there were no differences in the anthropometric data between those who came for bloodwork and those who did not ( data not shown ) .
significant improvements in bmi , weight , wc , systolic bp % ile , crp , and hdl one year after lagb were observed ( table 3 ) .
mes resolved in 16 of the adolescents diagnosed at baseline ( 69.6% ; p = .0003 ) .
there were no significant differences in % ewl , % wl , or change in bmi between those who had mes at baseline and those who did not ( data not shown ) .
resolution of mes correlated to % ewl , nearing statistical significance ( p = .06 ) but did not correlate to % wl or bmi ( p = ns ) .
tables 4 and 5 demonstrate correlations of components of mes with parameters of weight change in those with and without mes at 6 m and 12 m post - lagb . at 6 m post - lagb ,
% wl , bmi , and % ewl ( table 4 ) correlated significantly with wc in those who did not have mes at baseline .
bmi and % wl also correlated significantly with change in tg and fbs in this cohort . in those with mes at baseline ,
bmi , % ewl , and % wl only correlated with change in wc ( table 4 ) .
one year post - lagb , % ewl , bmi , and % wl correlated significantly with wc in those who did not have mes at baseline ( table 5 ) .
% wl and bmi , correlated significantly with change in fbs as well . in those with mes at baseline ,
% ewl , bmi and % wl correlated with wc and hdl ( table 5 ) .
this study examined the effects of lagb on a diverse population of morbidly obese adolescents with respect to changes in weight and resolution of mes .
our results indicate that lagb is effective in most morbidly obese adolescents for achieving weight loss and decreasing the frequency of mes . similar to other adolescent lagb series
, there were no intraoperative or postoperative deaths , and the complication rate was comparable to what has previously been reported [ 810 , 1419 ] .
our study showed weight loss at 6 m and 12 m post - lagb , which is consistent with results of other studies , but of smaller magnitude .
post - lagb weight gain was observed in 15 of 88 adolescents at 6 m post - lagb and in 4 of 45 adolescents at 12 m post - lagb . while widhalm et al .
also reported weight gain in 4 of 7 adolescents post - lagb , they began gaining at 44 m after surgery . although they did not report adolescents who gained weight postoperatively , silberhumer et al . and angrisani et al .
did describe failure rates of 3 out of 50 at 1-year followup and 5 out of 25 at 5-year followup , respectively , defining failure as % ewl < 25% [ 13 , 14 ] .
possible explanations for the insufficient weight loss and weight gain in our subjects include lack of social support , failure to change eating habits , and failure to incorporate recommended exercise .
possible reasons for lack of followup may include difficulty in attending appointments due to school , work , or other obligations ; inability to finance appointments due to loss of health insurance ; satisfaction with weight loss such that no need was felt to see the medical team ; embarrassment at the lack of weight loss or presence of weight gain ; lack of desire to undergo blood testing and/or consume glucola for the 2-hour oral glucose tolerance test .
we were unable to provide monetary or other incentives for attending followup visits and complying with lifestyle modifications .
such enticements may have increased our compliance rate and resulted in even better weight loss results .
information regarding changes in body composition , including percent fat mass , was not obtained during the study .
it is possible that for some adolescents muscle accrual is occurring but not being accounted for when they step on the scale .
we plan to assess body fat percentage of our study subjects in future visits in order to better understand body compositional changes that are occurring with weight changes .
we are also investigating factors relating to subject compliance in order to understand which adolescents will succeed post - lagb , thus enabling us to better screen future candidates .
there is increasing evidence that resolution of obesity - related comorbidities such as mes with weight loss can be seen in adolescents as it has been in adults [ 16 , 19 , 25 ] .
using the international diabetes federation guidelines , reported a 34% reduction of mes in 10 adolescent girls at 6 m and a 68% reduction at 9 m post - lagb .
our data show comparable post - lagb improvement with a 56.8% resolution of mes 6 m post - lagb and a 69.6% resolution of mes 12 m post - lagb .
both series noted near statistically significant improvement in tg 6 m post - lagb , but this was not sustained at the 12 m time point in our subjects .
this is likely a reflection of dietary changes , which incorporated more carbohydrate - rich foods and fewer fatty foods .
, who saw improvements in systolic bp following lagb , we saw significant improvement in systolic bp 6 m and 12 m post - lagb .
in addition , we saw significant improvement in diastolic bp at the 6 m time point that was not sustained 12 m after surgery .
change in hdl approached statistical significance 6 m post - lagb and was significant one year following surgery , probably a reflection of the increase in physical activity in our subjects over time .
studies indicate that 10% wl can lead to resolution of a number of adiposity - related comorbidities . in our study , subjects lost only 7.5% wl 6 m following surgery , but this gave them a % ewl of 17.1% .
this degree of ewl was accompanied by a significant resolution of mes in these subjects , manifested by significant improvement in a number of components that define the disease .
one year following surgery , with % wl of 10.9% and % ewl of 25.9% , an even greater percentage of subjects had resolution of mes .
it is possible therefore that lesser degrees of wl than the generally recommended 10% in the morbidly obese population will result in significant health - related improvement and that the utilization of % ewl to assess co - morbidity risk reduction may be of benefit in the morbidly obese population .
, we also observed improvements in crp , an inflammatory biomarker that independently predicts future vascular events .
decreased crp has been associated with reductions in the occurrence of adverse cardiovascular outcomes .
in our adolescents , crp decreased significantly at 6 m post - lagb and continued to decrease at 12 m post - lagb .
this improvement is important since 20.5% of our subjects had at least three risk factors for cardiovascular disease at baseline , which included obesity , sedentary lifestyle , dyslipidemia , elevated bp , impaired glucose tolerance , and impaired fbs .
lagb - induced weight loss appears to eliminate some of these risk factors , in addition to reducing crp levels , all of which may lead to improved cardiovascular health in this group of adolescents .
this is one of the first studies to date to examine correlations of mes components to changes in weight in adolescents following bariatric surgery . at both 6 m and 12 m post - lagb , change in wc
was correlated with % ewl , % wl , and change in bmi , irrespective of mes status .
this is similar to findings by coppen et al . , who observed significant correlation between weight change and wc following a 75.5% decrease in mes following 10 weeks of diet - induced weight loss in a group of 619 year old .
our results showed that in those without mes at baseline , % wl and change in bmi correlated with change in fbs and tg 6 m post - lagb , findings that were not observed in those who had mes prior to surgery . despite weight loss and improvements in individual components of mes , no significant relationship existed between these components and weight loss in those with mes prior to surgery .
this suggests that another factor may serve as a link between weight change and mes components and is relevant only in those who have the syndrome .
12 m following lagb , % wl and change in bmi continued to correlate with fbs but not with tg in those who did not have mes at baseline .
the fact that there was no significant improvement in tg levels 12 m post - lagb could explain this finding .
interestingly , in those who did have mes at baseline , change in hdl correlated significantly with % ewl and % wl .
further studies examining the relationship between mes components and weight change will help shed more light into this matter .
this study is limited by the lack of a control group undergoing conventional diet and exercise , as was present in a study by o'brien et al . .
the short - term nature of our study precludes an assessment of the long - term impact of lagb on comorbidities ; however , long - term followup is ongoing with a goal of a total of 5 years of postsurgical followup .
the number of subjects who presented for followup metabolic evaluation was less than the total number of subjects who presented for followup anthropometric assessment .
there were no significant differences in weight change between those who had laboratory data for evaluation and those who did not , suggesting that our conclusions from the laboratory assessments may be extended to the entire group at each time point .
our study adds to the limited literature documenting the effectiveness of lagb in achieving not only weight loss with limited adverse effects , but also resolution of comorbidities , particularly mes in morbidly obese adolescents .
we found that mes does not hinder weight loss in our study subjects and that a number of components of mes improve with less than the % wl currently recommended for improvement .
the option of using % ewl as a goal for improvement of comorbidities in the morbidly obese and obese population is introduced ; further studies into this matter are warranted .
we show that correlations between parameters of weight change and components of mes indeed are different between those with and without mes prior to undergoing surgical weight loss .
long - term followup can clarify the role of lagb amongst the various weight loss treatments available and whether the diagnosis of mes alters the response of the individual components of mes to weight loss . | we examined the effect of laparoscopic adjustable gastric banding ( lagb ) on weight loss , inflammatory markers , and components of the metabolic syndrome ( mes ) in morbidly obese adolescents and determined if those with mes lose less weight post - lagb than those without .
data from 1418 yr adolescents were obtained at baseline , 6 and 12 months following lagb .
significant weight loss and improvements in mes components were observed 6 months and one year following lagb .
the incidence of mes declined 56.8% after 6 months and 69.6% after 12 months .
there was no significant difference in amount of weight lost post - lagb between those with and without mes at either timepoint .
correlations between change in weight parameters and components of mes in those with and without mes at baseline were examined and found to vary by diagnostic category .
lagb is effective for short - term improvement in weight , inflammatory markers , and components of mes in morbidly obese adolescents . |
pharmacotherapy in patients with peripheral arterial disease ( pad ) aims to prevent progression of atherosclerotic disease , to reduce risk of global cardiovascular events and to improve walking capacity . since pad is a manifestation of systemic atherosclerosis in the lower extremities , its pharmacotherapeutic goals are nearly identical to those of the cerebrovascular disease and cardiovascular disease ( cvd ) .
smoking cessation , exercise , and an aggressive pharmacological risk factor modification , including diabetes , hypertension , lipid abnormalities , and life - long antiplatelet therapy , represent the cornerstones of treatment .
the therapeutical recommendations based on solid research are included in current national and international pad guidelines . despite strict guideline directives ,
the pad is still considered today as undertreated in many countries [ 14 ] . in particular ,
an underuse of pad treatment has been documented compared to treatment of cvd patients [ 58 ] .
in germany , high prescription rates for secondary preventive medication in pad patients primarily treated by vascular specialists were recently reported .
the objectives of the study were to examine whether an accordingly intensive pharmacological pad patient treatment is also realized in primary care , particularly when compared with those of cvd patients .
the content ( continuous morbidity registration epidemiologic network ) database is a national primary care research project which is created and maintained by the department of general practice and health services research of the university hospital heidelberg .
the structure and core elements of this datapool have been described elsewhere . in brief ,
based on the international classification of primary care ( icpc-2 ) , all electronic , routinely documented elements of doctor - patient encounters in 34 primary care settings in southwest germany are registered continuously and are available for analysis of specific problem areas . the study protocol was approved by the ethics committee of the university of heidelberg ( registration number 442/2005 ) .
the electronic patient records of 105,026 primary care patients across a three - year period ( april 1 , 2007march 31 , 2010 ) were screened in an anonymous manner .
patients with pad were identified using the international classification of disease ( icd-10 ) code i73.9 .
this method allows extraction of all pad / cvd patients who exhibit ensured and coded diagnoses in their electronic patients record .
thus not only patients who had become conspicuous through their symptoms and were definitively diagnostically clarified were detected , but also those who have become asymptomatic subsequent to pta / ptca treatment .
however , we were not able to extract , for example , information about the number of therapeutic interventional or surgical procedures and their possible medical success or consequences .
asymptomatic patients , and thus the majority of pad patients , could not be identified because abi measurement was not available as a pad selection criterion .
furthermore , patients presenting with atypical claudication symptoms , for example , patients with superimposing coincident neuropathy or osteoarthrosis , could not be identified .
this is traced to a nonexistent icpc code or icd-10 code for the doppler sonographic abi measurement .
subjects presented coincidentally with pad code and cvd code were excluded from the analysis . moreover , only patients with continuous contact to their family practitioner and properly documented prescriptions were included . in order to obtain comparable cohorts , we identified determinants for pad on the basis of binary logistic regression .
based on these variables , matching was performed with the propensity score ( ps ) method proposed by rosenbaum and rubin . the package matching of r
( version 2.12.0 ) was used for the matching procedure . for evaluation of the matching
results the matchbalance function of this package was applied , since this function not only examines differences of means , but also accounts for potential differences across the entire distribution .
sociodemographic variables ( e.g. , education or profession ) were not available for the analysis .
the chronic conditions were defined on the basis of icpc codes according to the concept of o'halloran et al .
all prescriptions corresponding to the pad code and the cvd code were analysed by means of the anatomical therapeutic chemical classification ( atc ) .
the atc system divides the drugs into different groups according to the organ or system on which they act and according to their chemical , pharmacological , and therapeutic properties .
drugs are classified in 14 main groups ( first level ) and spread out into therapeutic / pharmacological subgroups down to the plain chemical substances ( fifth level ) . in order to assess potential differences in pharmacotherapy between pad and cvd patients in matters of well - defined atc subgroups
the matched - pair procedure resulted in 958 corresponding cvd patients , that is , a pad / cvd patient ratio of 1 : 2 . binary logistic regression defined patients ' age , gender , practice setting , and type of health insurance ( statutory versus private ) as significant determinants for the analysis ( table 1 ) .
the matching procedure resulted in an exact match for patients ' gender and practice setting for the entire pad group .
the percentage of patients with private health insurance was slightly but not significantly lower in the pad cohort ( 7.1% pad versus 9.0% cvd ) .
there was no significant difference in average age at the end of the observation period for pad patients and cvd patients .
the matchbalance function indicated that patients ' age in both cohorts was distributed very similarly .
there was no difference between pad and cvd patients concerning the number of chronic conditions .
as was expected , the studied patient cohorts were of markedly older age compared to the total register sample ( table 2 ) .
table 3 shows that the total number of prescribed drugs did not differ between the pad and cvd cohorts .
however , compared to the pad patients , the cvd patients received significantly more drugs of the atc level 1 group c cardiovascular system .
the more detailed atc level 2 subgroup analysis suggested that this distinction is primarily based on higher prescription rates for cardiac therapy agents , -blockers , and lipid - lowering agents .
in contrast , pad patients presented significantly more frequent prescriptions for antidiabetic agents than cvd patients , particularly more insulin and analogues and more calcium channel blockers .
the analysis of atc drug levels 4 and 5 showed that the difference between prescriptions of lipid - lowering agents is mainly caused by higher hmg - coa reductase inhibitor nominations among cvd patients , in particular simvastatin prescriptions .
the atc groups level 5 of antithrombotic agents suggested equal prescription rates for aspirin and clopidogrel between the cvd and pad cohorts .
in the present study , we attempt to depict the secondary medical prevention among symptomatic patients with pad compared to cvd patients in german primary care . the analysis of the gp 's prescription dataset suggested no substantial difference in the total number of prescribed drugs between pad and cvd patients .
this concerned all medications except cardiovascular drugs , which more frequently emerged in the prescriptions for cardiac patients than in those of patients with peripheral vascular disorder .
this distinction is based on significantly more dispensations of specific cardiac agents for cvd patients , for example , glycosides , antiarrhythmics , or nitrates , and particularly on more prescribed -blockers .
europe , which reported marked differences for treatment with -blockers between the two studied populations [ 1 , 6 , 17 ] .
this may not only be related to the fact that cvd management is mainly influenced by specialists , whereas pad is largely managed in primary care .
there is also an incomprehensible restraint of some physicians to administer -blockers among pad patients , although -blocker therapy was proven as being nondetrimental to walking capacity and is even related to a significant independent decrease in new coronary events .
little is known about the secondary preventive effects of other classes of antihypertensive drugs in the presence of pad . in our study , 67% of both the pad and cvd patients obtained ace inhibitors / at - ii receptor antagonists .
our data are consistent with results of other inpatient and outpatient studies [ 6 , 7 , 9 , 17 ] .
notably , pad patients received significantly more calcium channel blockers than patients with cvd , perhaps as a consequence of gps ' contemplating the peripheral vasodilatation effect of these agents .
the data of the german reach study demonstrated a similar but not significantly higher administration of calcium - antagonists in pad patients than in patients with cvd ( 31% versus 27% ) . as an effective secondary - preventive measure ,
the 4s study of 4,444 patients with known cardiovascular disease revealed that use of simvastatin reduced episodes of new or worsening intermittent claudication .
moreover , the heart protection study demonstrated that statins reduced coronary death in pad patients irrespective of their initial cholesterol value . in our study , only half of the pad patients received an appropriate lipid - lowering therapy . in accordance with the literature
this confirms an undertreatment of pad patients with lipid - lowering agents in primary care , in particular , in view of the advanced stage of the disease [ 7 , 9 , 24 ] . despite pad guideline recommendations for secondary prevention ,
a meta - analysis of eighteen prospective randomized trials involving 5269 participants resulted in a demand for additional randomized controlled trials of aspirin therapy to establish the real benefit and bleeding risks in pad .
nevertheless , in numerous more recent studies , patients with atherothrombotic diseases are univocally considered as aspirin underused [ 1 , 7 , 17 , 26 ] .
however , the findings of our study can not contribute a substantial result to this issue .
the comparably low aspirin prescription rates of 43% in both pad and cvd cohorts do not reflect the real intake of low - dose aspirin by these patients , because in german pharmacies aspirin compounds are obtainable as over - the - counter medication being even cheaper than prescribed aspirin copayment .
the findings of our study suggest an inadequate preventive medical therapy in patients with pad in german family practice settings as had already been demonstrated in other studies [ 17 , 17 , 24 , 25 ] . taking into account that the study sample consists of pad patients suffering from an advanced stage of the disease , an overestimation of the general treatment prevalence in pad / cvd patients can be assumed .
the real cardiovascular drug supply of patients with pad would probably be less intensive if asymptomatic pad patients were additionally included in the statistical analysis .
the reason for the underuse of preventive cardiovascular medication in patients with atherosclerotic disease remains speculative .
besides a deficient realization of guideline recommendations , a general lacking awareness among physicians of the pad patients cardiovascular hazard could be supposed , tending to result in neglect of appropriate medication [ 27 , 28 ] .
we are aware of the limitations inherent to any study extracting data from electronic patient records .
the main weakness of our study is the data collection by means of icd / icdc coded diagnoses which disregards asymptomatic patients with pad / cvd and is more selective with regard to the advanced stages of the atherosclerotic disease .
furthermore , a potential selection bias must be admitted because a gp 's participation in the content registry is voluntary and not by random selection . in view of the considerable number of participating practices and analyzed patients
, it can nevertheless be assumed that our study findings give at least a realistic insight into the drug treatment of pad patients in primary care .
we should also underline that with the atc classification we only analysed plain chemical substances and not compound medicines , and for this reason a slight underestimation of true agent use can not be ruled out .
altogether , we believe the key information of our study findings is not substantially affected by these limitations , especially as a possible bias involves a systematic error for both the pad and cvd cohorts .
the findings of the present study reflect an overall picture of secondary prevention drug management in patients with pad in german primary care . in accordance with the international literature ,
the analysed pad patient sample was less intensively treated with -blockers , ace inhibitors , and lipid - lowering agents than comparable cvd patients . as a consequence
, serious considerations should be taken to implement the pad therapy guidelines recommendations more effectively in practice . | background .
the aim of the study was to determine the secondary preventive medical supply of patients with peripheral arterial disease ( pad ) in german primary care .
methods and results .
a population - based case control study was conducted using electronic medical records of patients extracted from the content primary care database of heidelberg , germany , between april 2007 and march 2010 .
the prescription rates of cardiovascular medication among symptomatic pad patients were analysed by means of the atc classification and compared with those of patients with cardiovascular disease ( cvd ) .
479 cases with pad and 958 sex- and age - matched control cvd patients were identified .
pad patients showed significantly lower prescription rates for cardiac agents ( 21.7% versus 37% ) , -blockers ( 50.1% versus .
66.2% ) , and lipid - lowering agents ( 50.3% versus 55.9% ) compared to cvd patients .
in contrast , significantly more prescriptions of antidiabetic agents ( 28.2% versus 20.3% ) , particularly insulin and analogues ( 12.5% versus 8% ) , and calcium channel blockers ( 29.2% versus 24.3% ) were found in pad patients .
low - dose aspirin use among both pad and cvd patients was underestimated , as it is available without a prescription .
conclusions .
optimal pharmacotherapeutical care of patients with pad requires more intensive cardioprotective medication in primary care settings . |
diabetes has become a global epidemic affecting an estimated 371 million people ( in 2012 ) , a number that is expected to reach 552 million by 2030 . with healthcare costs approaching $ 490 billion for the treatment of diabetes , alternative ( patient - centered )
lifestyle management approaches and cost - effective dietary interventions such as plant - based diets are a focus of increasing attention .
recent research has revealed that 58% of type 2 diabetes ( t2 dm ) cases can be prevented or delayed through lifestyle changes such as increased physical activity , healthy eating , and weight loss .
other large cohort studies have shown that the prevalence of t2 dm is significantly lower amongst people following a range of plant - based diets [ 46 ] and that those with greater adherence to plant - based foods , such as a low - fat vegan diet , experience the greatest benefit .
( 2013 ) define a plant - based diet as a regimen that encourages whole , plant - based foods and discourages meats , dairy products , and eggs as well as all refined and processed foods .
( the definition of other variants of plant - based diets is included in the questionnaire . )
various studies suggest that plant - based diets can be an effective medical nutrition therapy ( mnt ) for the treatment and management of t2 dm , specifically by improving body weight , cardiovascular risk factors , and insulin sensitivity [ 911 ] and reducing the need for diabetic medications [ 1214 ] .
providing mnt to people with diabetes demonstrates effectiveness in reducing hospitalization and physician services by 9.5% and 23.5% , respectively , which , in turn , reduces healthcare costs in the long - term .
studies show that a plant - based diet is as effective , if not more effective than an ada - recommended diabetes diet at reducing certain clinical markers such as hba1c levels . with the growing body of evidence , the new 2013 canadian diabetes association clinical practice guidelines ( cdacpg 2013 ) recommend the use of plant - based diets for management of t2 dm .
however , this dietary pattern is often perceived to be extreme and difficult to follow , and this perception may be influenced by the healthcare providers that diabetic patients encounter . despite a strong understanding of the health benefits of a plant - based diet , healthcare providers commonly cite low patient interest and difficulties in facilitating patient adoption as reasons for not promoting plant - based diets . in order to provide insight into the justification for ( and development of ) an effective and patient - focused education program
, a survey of patients and clinicians was undertaken to assess the awareness , confidence , perceived barriers and promoters , and educational needs for using a plant - based diet in the prevention and management of t2 dm .
the diabetes education centre ( dec ) at southlake regional health centre ( srhc ) provides assessment and therapeutic and self - management education for adults with type 1 , type 2 , gestational diabetes , and prediabetes in york region , on , canada . with the mission of providing a broad - based education on the prevention and management of diabetes
this pilot study was approved by the research ethics board prior to patient enrolment and study commencement .
participants from the dec community were subsequently recruited for one of two surveys : a patient survey or a health professional survey .
all patients visiting the clinic for an appointment during the survey period were approached in the waiting room and given the option to complete the patient survey .
the patient survey ran from april 22 , 2013 , to june 5 , 2013 , and 100 individuals agreed to participate .
inclusion criteria for patient participation included being a patient of the dec diagnosed with prediabetes , type 1 diabetes , or type 2 diabetes .
patients with gestational diabetes and type 1 diabetes on insulin pump therapy and nonpatients were excluded from the study .
the final analytic sample included 98 individuals ( prediabetes : n = 14 ; type 1 diabetes : n = 17 ; and t2 dm : n = 62 ) .
survey data was derived from dichotomous ( yes / no ) and likert - type scale closed - ended questions .
additional open - ended questions were used to acquire more specific demographics , health history , and behavioural information ( e.g. , height , weight , and opinions about diabetes education needs ) .
since a validated questionnaire in this particular topic was not available , questions were carefully designed to address the following areas : ( 1 ) present knowledge , ( 2 ) confidence level , ( 3 ) potential barriers / promoters , and ( 4 ) interests and needs for establishing a future education program .
staff members of the diabetes team were also asked to provide responses to a brief questionnaire on their attitudes and practices regarding plant - based diets .
the health professional survey was offered to all staff members working at the dec and included registered nurses ( rn ) , endocrinologists , and registered dietitians ( rd ) .
the survey ran from march 25 , 2013 , to april 12 , 2013 , and was completed by 25 staff members : 11 rn , 1 endocrinologist , and 13 rd .
mean values ( ) and frequency counts ( n , % ) were used to describe the demographics , health history , and dietary practices and perceptions of participants for continuous and categorical variables , respectively . after developing a character profile of participants ( e.g. , body mass index ( bmi ) , diabetes type , duration of diabetes , new versus continuing patient , weight management strategies , etc . ) ,
logistic regression was used to explore the relationship between clinical and education - related factors on the willingness of patients to change to a vegetarian diet .
all analyses were conducted using spss ( v 19 ) , with significance set at alpha = 0.05 .
in general , study participants tended to be male ( 55% ) , over age 50 ( 71% ) , be overweight or obese ( 73% ) , have t2 dm ( 68% ) , be diagnosed in the last 10 years ( 65% ) , and be returning patients ( 55% ) ( table 1 ) .
the majority of patients ( 89% ) had not heard of using a plant - based diet to treat or manage t2 dm .
furthermore , only 8 ( 9% ) participants reported adherence to a plant - based diet of any type , 3 of whom had followed the diet for less than 1 year . given the appropriate support , 66% of nonvegetarians were willing to follow a trial plant - based diet for 3 weeks .
( 48% ) , a lack of meal planning skills ( 45% ) , and a preference to eat meat
other factors such as food cost ( 22% ) , ease of cooking ( 19% ) , time constraints ( 19% ) , and other factors ( 6% ) were also common ( results not shown ) .
few respondents were confident in their ability to follow a vegetarian ( vegan , pesco- , or lacto - ovo ) diet , with 1728% of participants indicating that they were not confident at all ( results not shown ) .
overall , less than half of all participants were aware of the benefits of a plant - based diet to improve diabetes , weight , heart disease , high blood pressure , or high cholesterol .
awareness also varied according to dec attendance ( figure 1(a ) ) and willingness to try a plant - based diet ( figure 1(b ) ) while there was a trend for higher awareness within those who were willing to try plant - based diets and those who were returning patients in the dec , these differences did not reach statistical significance ( figure 2 ) .
when asked what supports would benefit dietary change , 22% of participants indicated that they did not intend on making a change .
stratified by time since diagnosis , more longer - term than newly diagnosed diabetics ( 30% versus 10% , p < 0.05 ) were unwilling to consider a plant - based diet , despite greater awareness of alternative dietary treatments to diabetes . at the bivariate level , patients interested in educational resources ( or = 42.9 , 95% ci : 12.9142.4 ) and those who were motivated by potential health ( 13.0 , 4.934.2 ) or weight loss ( 4.0 , 1.69.6 ) benefits of a plant - based diet had higher odds of being willing to make the necessary change ( table 2 ) .
further adjustment for age and sex only served to strengthen the association between motivation and willingness to change [ health : 17.0 ( 5.948.8 ) ; weight loss : 4.8 ( 1.912.0 ) ] .
a majority of staff ( 72% ) were aware of the use of plant - based diets for treatment of t2 dm , but only 32% are currently recommending this dietary pattern to patients ( table 3 ) . while the reasons are likely to vary by clinician and individual patient risk profile , the three most commonly cited reasons were as follows : ( 1 ) this eating pattern is not realistic and too difficult to adhere to ( and could lead to meal imbalance ) ; ( 2 ) there is low perceived acceptance by patients ; ( 3 ) there are lack of clear clinical practice guidelines and diet - specific educational support .
study results reflect that approximately 89% of patients were not aware of using an alternate diet such as a plant - based diet for the prevention and management of t2 dm and many of them cited low confidence in adopting this eating pattern . however , two - thirds of the patients showed willingness to follow a plant - based diet for the short - term and expressed interest in attending a vegetarian education program .
patients ' low awareness and confidence level on the use of plant - based diets for managing t2 dm can be partially attributed to the fact that , despite the growing interest in the health benefits of a plant - based diet , the vegetarian population remains relatively small in canada ( 4% ) .
another plausible reason is that the patients were not well informed about this eating pattern , as less than half of the diabetes team recommended this dietary pattern to patients , potentially influencing their awareness and confidence level .
the top three barriers for making dietary changes towards a plant - based diet included family 's influence , preference of eating meat , and meal planning skills . to promote this change ,
patients cited their top educational needs to be a vegetarian education program consisting of individual or group counselling and cooking instructions components .
this result suggests that the traditional theory - based nutrition education at the dec setting may be insufficient to address patients ' barriers ; a bigger focus should be placed on the practical aspects , such as teaching patients and family members how to prepare appetizing plant - based meals , in order to change their perception towards this new eating pattern .
one of the common reasons for diabetes educators not to be recommending this diet to patients was that this dietary approach is too difficult to follow with low perceived approval ( i.e. , patients are unlikely to accept it ) .
this notion is contrary to the patient survey results that almost two - thirds of patients were willing to follow this dietary pattern at least for short - term when educational support is provided .
( 2010 ) also indicate in a workplace study that a vegan diet is well accepted with over 95% adherence rate , and subjects report increased energy level , better digestion , better sleep , and increased satisfaction when compared with the control group .
study that had a bmi 25 and/or previous diagnosis with type 2 diabetes were randomized into a low fat vegan diet group or a placebo group for 22 weeks .
previous studies also demonstrate that the adherence and acceptability of a vegetarian diet are comparable to those of other therapeutic diets [ 1921 ] .
a number of staff members also expressed their second reason for not recommending this diet as the clinical practice guidelines and scientific evidence regarding this dietary pattern are not clear .
although randomized controlled intervention studies regarding the use of plant - based diets for the treatment of diabetes have been rather limited until recently , a number of high profile studies show that this diet is not only nutritionally adequate for long - term use [ 14 , 22 ] but also effective in promoting weight loss , reducing insulin resistance , reducing diabetes medications ( 43% versus 5% ) , and improving plasma lipids levels and overall glycemic control [ 12 , 13 ] .
studies show that a plant - based vegan diet may be as effective as an ada - recommended diet at causing weight loss [ 12 , 13 ] and decreasing fat intake
. it may be more effective than an ada - recommended diet at reducing the use of diabetes medication , hba1c levels , and plasma lipids .
it is therefore possible that our survey simply captured a lag - time in dissemination of this new information from current research findings to clinician to patient . alternatively , because there are a number of vegetarian food guides and practical guidelines that can be used by nutritional professionals [ 14 , 23 , 24 ] , the disparity in recommendations and the varying effect of plant - based diets may in themselves be a challenge for nutrition counselling . as with any study
first , the small sample size ( n = 98 ) and selective nature of participant recruitment limit the applicability of the results to a larger and more general population .
second , the patients who completed the surveys may be individuals who were already more interested in vegetarian diets and have a healthier risk profile overall .
it is also possible that not all patients understood the terminology being used . when designing the patient and staff questionnaires , it was intended to compare the acceptance and confidence levels of using different types of vegetarian diets such as lacto - ovo vegetarian , pesco - vegetarian , semivegetarian , and vegan diets .
however , as many patients had limited exposure to these diets , many of these questions were left unanswered or a single response was selected as an overall rating for all diet types .
the questions used in both surveys were not validated due to the preliminary nature of the study as well as a lack of validated questionnaires available for use in this particular subject area .
although more than half ( 66% ) of patients expressed an interest in following a plant - based diet , this interest was expressed only for the three - week period ; therefore it does not guarantee long - term interest in or attendance in education programs or the longer - term change in eating habits that would be required for effective diabetes management .
finally , the heterogeneity of the surveyed clinicians limits the ability of the current study to ascertain a certain opinion of a given professional group .
patient awareness of ( and interest in ) the benefits of a plant - based diet for the management of diabetes remains suboptimal and may be influenced by the perception of diabetes educators and clinicians . to provide assurance of the acceptability and efficacy of plant - based diets to patients , offering diet - specific education programs by nutrition professionals in community - based diabetes centres is warranted .
developing these programs in partnership with local nutrition service providers such as community kitchens , grocery stores , and local food network could foster exchange of teaching experience and new perspectives amongst educators and enable sharing of important teaching resources such as a demonstration kitchen .
as such , additional training on plant - based diets may require the development of a more standardized and user - friendly practice guideline on plant - based diets to facilitate patient education . with its proven multiple health benefits ,
a plant - based diet has clearly shown to be beneficial in improving clinical outcomes , and also it has great potential to alleviate healthcare cost in the prevention and management of diabetes as well as other chronic diseases .
the current study provides support for the need to further investigate the cost - effectiveness of this dietary pattern in a clinical setting .
there is now considerable evidence to support the use of plant - based diets as an effective medical nutrition therapy for chronic diseases such as t2 dm [ 8 , 10 , 1214 ] .
nonetheless , results from this pilot study suggest low awareness and confidence , but a willingness to try a plant - based eating pattern , which supports the need for a patient - focused vegetarian education program . for diabetes educators and
registered dietitians , developing diet - specific education programs ( such as the mediterranean and vegetarian diets ) are now supported within best practice guidelines such as cdacpg 2013 . depending on available resources ,
the nutrition program should consist of one - on - one or group counseling sessions and cooking instructions components , and educators should address the patient 's barriers to change ( e.g. , family 's eating preference and meal planning skills ) to increase a patient 's likelihood of making long - term lifestyle changes . | objective . to assess awareness , barriers , and promoters of plant - based diet use for management of type 2 diabetes ( t2d ) for the development of an appropriate educational program
. design .
cross - sectional study of patients and healthcare providers . setting .
regional diabetes education centre in on , canada . participants .
n = 98 patients attending the diabetes education centre and n = 25 healthcare providers .
variables measures .
patient questionnaires addressed demographics , health history , and eating patterns , as well as current knowledge , confidence levels , barriers to , promoters of , and interests in plant - based diets .
staff questionnaires addressed attitudes and current practice with respect to plant - based diets . analysis .
mean values , frequency counts , and logistic regression ( alpha = 0.05 ) .
results .
few respondents ( 9% ) currently followed a plant - based diet , but 66% indicated willingness to follow one for 3 weeks .
family eating preferences and meal planning skills were common barriers to diet change .
72% of healthcare providers reported knowledge of plant - based diets for diabetes management but low levels of practice .
conclusions and implications .
patient awareness of the benefits of a plant - based diet for the management of diabetes remains suboptimal and may be influenced by perception of diabetes educators and clinicians .
given the reported willingness to try ( but low current use of ) plant - based diets , educational interventions targeting patient and provider level knowledge are warranted . |
patients with advanced cirrhosis can suffer from hepatorenal syndrome ( hrs ) , a unique form of kidney injury that results from renal vasoconstriction in the setting of systemic and splanchnic arterial vasodilatation , in the absence of intrinsic renal pathological changes . in a small fraction of patients , renal function
however , the prognosis of patients with cirrhosis who develop hrs remains poor because of the limited therapies we can provide for end - stage liver disease and because very few patients can get liver transplants .
it was found that mice with cirrhosis can be converted to have hrs when injected intraperitoneally with albumin . the urea transporter protein ( ut ) in the kidneys
therefore , we injected succinylated gelatin into the abdominal cavity of cirrhotic rats to produce an hrs model , then explored the changes of ut expression in this model .
the protocol was authorized by the animal experimental ethics committee of tongji hospital , tongji university .
male sd rats , weighing 20020 g ( n=100 ) were bred under standard conditions at constant humidity , room temperature , and regular 12 h/12 h light / dark cycles .
fifty male sd rats were randomly divided into 2 groups : model group rats were subcutaneously injected with a mixture of carbon tetrachloride ( 30% ) and plant oil ( 70% ) according to its weight ( initial dosage was 0.5 ml/100 g. maintenance dose was 0.3 ml/100 g twice a week ) in the model group and the control group rats were injected with plant oil ( 0.3 ml/100 g twice a week ) .
a subset of rats in the model group was sacrificed after 12 weeks and the liver histopathology was examined to ensure the successful establishment of a cirrhotic model .
twelve rats in the control groups were randomly divided into 2 subgroups : group a was the new control group and group b was the abdominal compartment syndrome ( acs ) group .
twelve cirrhotic rats were also divided into 2 groups : group c was the new cirrhotic group and group d was the hrs group .
the rats in group b and d were anesthetized subcutaneously with 0.03% na - pentobarbital ( 0.1 ml/100 g ) and fixed on experimental tables .
a pressure gauge with a t - shaped 3-way pipe , graduated l - shaped glass tube , and infusion tube was punctured into the lumbar region of midaxillary line on umbilicus level of rats to detect the abdominal pressure .
when fluid levels of the l - shaped glass tube raised to 26.7 cm of water column ( equivalent to 20 mmhg ) , abdominal pressure had been maintained at this level for 3 h by adjusting the dripping speed . except for dripping of succinylated gelatin ,
the remaining methods were the same as above for the rats in group a and group c. then , serum bun and cr were determined from blood samples obtained from rat aortas . in addition , left kidneys were cryopreserved in liquid nitrogen and right kidneys were fixed in neutral buffered formalin . the later was then sectioned in coronal plane ( 5-m slice thickness ) and prepared with h and e staining for routine light microscopy .
total rna was extracted from150 mg of renal medulla into trizol reagent ( kusatsu , japan ) according to manufacturer s instructions . for cdna synthesis ,
rt reactions were performed with total rna ( 2 ug ) according to the directions of the takara rt reagent kit ( kusatsu , japan ) .
the product was amplified in a reaction volume of 10 ul including 1 ul rt product , 5 ul sybr premix ex taq ii ( 5 ) , 0.2 ul 50rox reference dye ii ( 50 ) , and 20 pmol of each primer .
pcrs were performed for 40 cycles at 94c for 45 s , 60c for 30 s , and 72c for 30 s in a 7900ht fast rt - pcr system ( abi , palo alto , ca , usa ) .
threshold cycle values of each sample were normalized to b - actin mrna expression , and the fold change for each mrna was calculated using the 2 method .
ut - a1 ( genetex , usa ) and b - actin ( santa cruz , usa ) were used and visualized using the detection system ( odyssey li - cor 9120 , usa ) following the procedure provided by the manufacturer .
the protocol was authorized by the animal experimental ethics committee of tongji hospital , tongji university .
male sd rats , weighing 20020 g ( n=100 ) were bred under standard conditions at constant humidity , room temperature , and regular 12 h/12 h light / dark cycles .
fifty male sd rats were randomly divided into 2 groups : model group rats were subcutaneously injected with a mixture of carbon tetrachloride ( 30% ) and plant oil ( 70% ) according to its weight ( initial dosage was 0.5 ml/100 g. maintenance dose was 0.3 ml/100 g twice a week ) in the model group and the control group rats were injected with plant oil ( 0.3 ml/100 g twice a week ) .
a subset of rats in the model group was sacrificed after 12 weeks and the liver histopathology was examined to ensure the successful establishment of a cirrhotic model .
twelve rats in the control groups were randomly divided into 2 subgroups : group a was the new control group and group b was the abdominal compartment syndrome ( acs ) group .
twelve cirrhotic rats were also divided into 2 groups : group c was the new cirrhotic group and group d was the hrs group .
the rats in group b and d were anesthetized subcutaneously with 0.03% na - pentobarbital ( 0.1 ml/100 g ) and fixed on experimental tables . succinylated gelatin was dripped into the abdominal cavity of rats via an infusion tube .
a pressure gauge with a t - shaped 3-way pipe , graduated l - shaped glass tube , and infusion tube was punctured into the lumbar region of midaxillary line on umbilicus level of rats to detect the abdominal pressure .
when fluid levels of the l - shaped glass tube raised to 26.7 cm of water column ( equivalent to 20 mmhg ) , abdominal pressure had been maintained at this level for 3 h by adjusting the dripping speed . except for dripping of succinylated gelatin ,
the remaining methods were the same as above for the rats in group a and group c. then , serum bun and cr were determined from blood samples obtained from rat aortas .
in addition , left kidneys were cryopreserved in liquid nitrogen and right kidneys were fixed in neutral buffered formalin . the later was then sectioned in coronal plane ( 5-m slice thickness ) and prepared with h and e staining for routine light microscopy .
total rna was extracted from150 mg of renal medulla into trizol reagent ( kusatsu , japan ) according to manufacturer s instructions . for cdna synthesis ,
rt reactions were performed with total rna ( 2 ug ) according to the directions of the takara rt reagent kit ( kusatsu , japan ) .
the product was amplified in a reaction volume of 10 ul including 1 ul rt product , 5 ul sybr premix ex taq ii ( 5 ) , 0.2 ul 50rox reference dye ii ( 50 ) , and 20 pmol of each primer .
pcrs were performed for 40 cycles at 94c for 45 s , 60c for 30 s , and 72c for 30 s in a 7900ht fast rt - pcr system ( abi , palo alto , ca , usa ) .
threshold cycle values of each sample were normalized to b - actin mrna expression , and the fold change for each mrna was calculated using the 2 method .
ut - a1 ( genetex , usa ) and b - actin ( santa cruz , usa ) were used and visualized using the detection system ( odyssey li - cor 9120 , usa ) following the procedure provided by the manufacturer .
compared with the control group ( figure 1a ) , the surfaces of gross liver specimens of the cirrhotic group became coarser .
the normal structures of the hepatic lobules ( figure 1c ) were destroyed with hyperplasia of fibrous tissue with formation of pseudo - lobes ( figure 1d ) . during the experiment , the respiratory rate of rats increased with increased intra - abdominal pressure and abdominal distension .
bun and cr levels of group b were significantly higher than those of group a , respectively ( 10.982.14 mmol / l vs. 4.541.05 mmol / l , 369.64 umol / l vs. 25.43.29 umol / l , p<0.05 ) .
in addition , bun and cr levels of group d were also higher than those of group c ( 8.70.96 mmol
/ l vs. 4.840.93 mmol / l , 30.37.81 umol / l vs. 17.82.68 umol / l , p<0.05 ) ( figure 2 ) .
there were no significant morphological differences among the 4 groups of rat kidneys in pathological sections .
endothelial cells , mesangial cells , and renal tubules were also normal ( figure 3 )
. the mrna expression of ut - a2 and ut - a3 in group d decreased markedly compared with that of group c ( p<0.05 ) ( figure 4 ) .
moreover , there was also no significant difference in ut - a2 , ut - a3 , and ut - b between group a and group b ( p<0.05 ) ( figure 4 ) . in terms of protein expression ,
no significant difference in ut - a1was detected among the 4 groups by western blotting ( figure 5 ) .
compared with the control group ( figure 1a ) , the surfaces of gross liver specimens of the cirrhotic group became coarser .
the normal structures of the hepatic lobules ( figure 1c ) were destroyed with hyperplasia of fibrous tissue with formation of pseudo - lobes ( figure 1d ) .
during the experiment , the respiratory rate of rats increased with increased intra - abdominal pressure and abdominal distension .
bun and cr levels of group b were significantly higher than those of group a , respectively ( 10.982.14 mmol / l vs. 4.541.05
mmol / l , 369.64 umol / l vs. 25.43.29 umol / l , p<0.05 ) .
in addition , bun and cr levels of group d were also higher than those of group c ( 8.70.96 mmol / l vs. 4.840.93
mmol / l , 30.37.81 umol / l vs. 17.82.68 umol / l , p<0.05 ) ( figure 2 ) .
there were no significant morphological differences among the 4 groups of rat kidneys in pathological sections .
endothelial cells , mesangial cells , and renal tubules were also normal ( figure 3 ) .
the mrna expression of ut - a2 and ut - a3 in group d decreased markedly compared with that of group c ( p<0.05 ) ( figure 4 ) .
moreover , there was also no significant difference in ut - a2 , ut - a3 , and ut - b between group a and group b ( p<0.05 ) ( figure 4 ) . in terms of protein expression ,
no significant difference in ut - a1was detected among the 4 groups by western blotting ( figure 5 ) .
some commonly used animal models of cirrhosis are induced by ccl4 , dimethylnitrosamine , thioacetamide , and bile duct ligation [ 912 ] . the model induced by ccl4
was used in the present study . according to the changes in gross liver specimen morphology and histopathology , the rat model of cirrhosis
then , we established the rat model of acs . in the clinic , the definition of acs is an intra - abdominal pressure 20 mmhg with abdominal organ dysfunction .
it can occur in conditions such as abdominal surgery , mechanical ventilation , ileus , and acute pancreatitis [ 1316 ] .
for further study of the pathogenesis , prevention , and therapy of this disease , several animal models of acs have been reported . in these studies , gas , liquid , or solid
however , metabolic changes and inflammatory response were found in peritoneal cells exposed to high co2 concentrations .
therefore , the impact of co2 for the model was not restricted to increasing intra - abdominal pressure .
benninger et al . used a crystal solution that was easily absorbed by the peritoneum .
however , intra - abdominal pressure was not optimally controlled and the tamponade was tedious and inaccurate .
the ascites that results in intra - abdominal hypertension is a colloid suspension that contains albumin . however , the cost of injecting albumin intraperitoneally is too high .
in the present study , succinylated gelatin was used to establish a model of asc and hrs .
because of leakage from the junction of the hose and abdominal cavity , succinylated gelatin needs to be replenished .
cyanoacrylate glue was used to adhere to the junction between tubes and the skin of the rat to prevent leakage of succinylated gelatin . in our study , rats survived for 3 h when intra - abdominal pressure reached 20 mmhg .
however , we admit that 3 h may not ne enough time to cause the change of urea transporter protein by western blot .
we successfully established the acs model and confirmed that bun and cr levels in group b increased . to the best of our knowledge ,
the present study is the first to show that the model can be used in cirrhotic animal to mimic hrs .
in addition , the 20 mmhg level in the acs definition pertains to humans , not rats .
this acs model in rats can be further improved through studying changes of renal function at different intra - abdominal pressures . as a result
, the pressure of acs in rats could be obtained and the prolonged survival will be beneficial to detect the changes of urea transporter protein . moreover , the phosphorylation of urea transporter protein could be also examined , although there is no change in total protein .
renal insufficiency has been induced by arterial blood supply deficiency rather than renal organic injury . because it usually occurs at the last stage of cirrhosis ,
pereira et al . used bile duct ligation , but found it was complex and had an unpredictable success rate .
chang et al . dripped albumin into rat abdominal cavities to model acs ; however , they used the method of measuring body weight instead of measuring pressure directly , which fails to ascertain the pressure .
the rat model of hrs in this study accorded with the cirrhosis with ascites and increased level of cr without renal organic injury .
taken together , these results indicate that dripping succinylated gelatin into the abdominal cavities of cirrhotic rats is a feasible method to produce a hrs model .
a theory of passive urine concentration in the renal medulla was proposed in 1972 by koko et al . .
in the process of renal water metabolism , the gradient osmotic pressure constituted by a great quantity of bun in renal medulla facilitates reabsorption of initial urine and excretion of bun without loss of much water .
studies showed that accumulation of bun and concentration of urine was regulated by ut - a1 and ut - a3 in the inner medullary collecting duct .
in addition , ut - a2 distributed in descending thin limb of helen s loop was found to be involved in countercurrent exchange located in the ascending limb and thick descending limb , which likewise enhances the effect of gradient osmotic pressure in the renal papilla .
ut - b protein supplies the lost urea in the inner medulla by enhancing the countercurrent exchange in the vasa recta . through researching ut expression in the renal medulla in a rat model of acs and hrs
, we found that compared with the normal group ( group a ) , there was no significant difference in expression of ut - a2 , ut - a3 , and ut - b mrna in the acs group ( group b ) , and that compared with the cirrhotic group ( group c ) , the level of ut - a2 and ut - a3 mrna was significantly decreased in the hrs group ( group d ) .
in addition , there was no significant difference in ut - a1among the 4 groups .
although ascites can induce both acs and hrs , the expression of uts in the 2 formations was different .
it is feasible create a model of acs in rats by injecting succinylated gelatin into the abdominal cavity .
increasing the intra - abdominal pressure by succinylated gelatin is also a novel approach for modeling hrs in cirrhotic rats .
compared with control rats , there is an abnormal mrna expression of ut in acs rats and hrs rats . | backgroundhepatorenal syndrome ( hrs ) is a serious complication of advanced chronic liver disease .
abdominal compartment syndrome ( acs ) occurs with dysfunction of multiple organs when abdominal pressure increases . here
, we report on a novel model of acs with ascites and a model of hrs in rats to observe the urea transporter protein ( ut ) expression in the 2 models.material/methodsa liver cirrhosis model was induced by ccl4 .
after changes of liver histopathology were observed , rats were injected intraperitoneally with succinylated gelatin to establish a model of acs and hrs .
then , changes in bun , cr , and renal histopathology were detected .
moreover , the ut in acs and hrs were also quantified.resultsthe surfaces of liver in the cirrhotic group became coarse , with visible small nodules and became yellow and greasy .
the normal structure of the hepatic lobules were destroyed , and hyperplasia of fibrotic tissue and pseudo - lobe was observed .
the levels of bun and cr were significantly increased in rats suffering from acs and hrs , respectively , compared to their control groups .
in addition , the mrna levels of ut - a2 and ut - a3 decreased in rats with hrs compared to cirrhotic rats .
however , there was no significant difference between the mrna levels of ut - a2 , ut - a3 , and ut - b in rats with acs vs. normal rats.conclusionsit is feasible to model acs in rats by injecting succinylated gelatin into the abdominal cavity .
increasing the intra - abdominal pressure by succinylated gelatin is also a novel approach for modeling hrs in cirrhotic rats .
compared with control rats , there is an abnormal mrna expression of ut in acs rats and hrs rats . |
in recent years , a
large variety of porphyrin - fullerene dyads has
been studied in the search for efficient charge- and energy - transfer
processes of interest in the area of artificial photosynthesis and
organic photovoltaics . although greater
efforts have been devoted to the study of covalent hybrids , supramolecular
approaches have also been developed .
thus , supramolecular porphyrin - fullerene
associates have been built up by interactions , in particular with porphyrin tweezers and cages , metal
ligand bonds , hydrogen bonds , electrostatic
interactions , mechanical bonds , or a combination of several of these interactions .
supramolecular arrays involving conjugated multiporphyrin
systems are , however , scarce in the literature . some of us have studied
different conjugated polytopic porphyrin receptors with two up to
10 porphyrin subunits . in those systems ,
a positive cooperative supramolecular effect was encountered and rationalized
by the existence of favorable interactions
between the different fullerene moieties interacting with the porphyrin
rings . however , in such systems the porphyrin subunits behaved independently ,
as demonstrated by comparison of the absorption and emission spectra
of the polytopic receptors with those of the corresponding monotopic
porphyrin system . on the other hand ,
tashiro and aida studied the
supramolecular interaction of a cyclic receptor formed by two fused
porphyrin dimers and c60 .
this
receptor was able to complex one unit of c60 , while the
introduction of a second fullerene moiety was hindered by a strong
negative cooperative effect . in this case
, the electronic communication
between the two fused porphyrins causes a decrease of the affinity
of the receptor toward the second c60 unit .
herein
we report the synthesis of two new ditopic porphyrin receptors
for c60 ( 3 and 4 ) , appended with
crown ether moieties , to study their complexation with the ammonium
salt c60 derivative 1(11 ) ( figure 1 ) .
the ammonium - crown
ether interaction provides a recognition motif for the supramolecular
complexation of two fullerene moieties . while in system 3 the two porphyrins
are almost orthogonal , they are fully conjugated
in the planar fused compound 4 .
theoretical calculations
were carried out to understand the nature of the interactions controlling
the association processes with special attention to the cooperative
effects experimentally evidenced for these systems .
for both porphyrinic
receptors , the combination of ammonium - crown ether interactions with
fullerene - porphyrin interactions provided very stable supramolecular
ensembles and negative cooperative effects have been evidenced for
the binding of the second fullerene - ammonium salt 1 .
actually , the intramolecular c60-porphyrin interactions
of the first guest molecule substantially reduce the electron density
in the porphyrin dimers 3 and 4 and thus
intramolecular interactions of the second fullerene guest with its
porphyrinic receptor are less favorable .
interestingly , this effect
is however stronger for compound 3 , despite the reduced
electronic communication between the two porphyrinic moieties when
compared to porphyrin tape 4 .
the negative cooperativity
resulting from the fullerene - porphyrin interactions may be partially
compensated by additional stabilizing interactions between the guest
c60 units in the complex formed with 4 .
monoporphyrin 2 was used to obtain host molecules 3 and 4 , which were then complexed with guest
molecule 1 .
porphyrin dimer 3 was obtained
by ag(i)-promoted oxidative meso meso coupling
of monoporphyrin 2(8a ) in chcl3 .
the proposed mechanism for this reaction is based on the
initial one - electron oxidation of a porphyrin unit by agpf6 , followed by the nucleophilic attack of another neutral porphyrin
molecule and its subsequent dehydrogenation.h nmr analysis of the crude reaction mixture after the
reaction evidenced the appearance of a signal at 2.92 ppm ,
corresponding to the partial demetalation of the porphyrin subunits .
therefore , the mixture was treated with a zn(ii ) salt to ensure full
metalation .
purification of the product was easily achieved by gravity - fed
chromatography and gel permeation chromatography due to the good solubility
of this derivative , with an orthogonal conformation hampering aggregation
by stacking between molecules .
triply
fused porphyrin tape 4 was obtained in an efficient manner
using more oxidative conditions , i.e. , sc(iii)-catalyzed oxidation
of porphyrin 2 with 2,3-dichloro-5,6-dicyanobenzoquinone .
as in the previous case
, the reaction was followed by treatment with
a zn(ii ) salt to ensure full metalation of the product ( scheme s1
in the supporting information ) .
h nmr spectroscopic
analysis of the aromatic region of dimer 3 provided valuable
information on its structure . to start with ,
the characteristic meso proton signal of porphyrin 2 at 10.3
ppm , strongly deshielded by the aromatic ring current , was no longer
present ( figures 2a , b ) .
also , inner pyrrolic protons were shifted upfield by 0.85 ppm , in
good agreement with an approximate perpendicular arrangement of both
subunits , where the ring current of one porphyrin moiety affects the
protons of the other moiety . additional
through - space correlation noesy experiments enabled full assignment
of all the protons in the aromatic region ( figure s1 , supporting information ) .
h
nmr ( cdcl3 , 400 mhz , 298 k ) of monoporphyrin 2 ( a ) versus meso
meso dimer 3 ( b ) and ( c ) h nmr variable temperature experiments
( clcd2cd2cl , 400 mhz , 30100 c ) .
variable temperature h nmr studies of 3 ( figure 2c ) evidenced
the presence of a chiral axis across the porphyrin - benzocrown ether
bond .
heating the system led to an increase in its kinetic energy
and , thus , the benzocrown ether moieties started to rotate around
the porphyrin - phenyl bonds , overcoming their steric hindrance .
17 kcalmol ( figure s2 ) in line with other experimental
measurements on phenyl porphyrins .
as
a result of the heating , all pyrrolic protons in the porphyrin were
then equally affected by the crown ether , changing the apparent symmetry
of the system and reducing the complexity of the spectra .
this is
evidenced by the appearance of two clear ab systems in the pyrrolic
region .
a similar effect was observed in the signals corresponding
to the crown ether moiety ( figure s3 ) .
rotation around the porphyrin - porphyrin bond is not possible at the
measurement conditions due to the higher steric hindrance as will
be further demonstrated with uv vis spectra .
nmr characterization
was not possible for molecule 4 due to the appearance
of very broad signals , probably as a result
of the formation of aggregates .
however , its characteristic absorption
spectrum , together with its ms spectrum , allowed us to unambiguously
characterize the product .
the
uv vis absorption
spectrum of molecule 3 corresponds to that of a typical meso
meso dimer , with a large splitting of the soret band due to exciton coupling
and a q - band modestly shifted toward the red in comparison with 2 , suggesting that each of the porphyrin subunits retains
its monomeric electronic character . in
contrast , dimer 4 exhibits the characteristic absorption
spectrum of a triply fused porphyrin tape , with no splitting of the
soret band and the appearance of a low - lying broad band reaching the
1000 nm region ( figure 3 ) .
vis spectra of 2 ( 1.9 10 m , red ) , 3 ( 4.7 10 m , blue ) ,
and 4 ( 1.1 10 m , green ) in
ch2cl2 .
variable temperature absorption measurements ( 2595 c in phcl ) on porphyrin dimer 3 did not show any clear evidence of rotation around the porphyrin
in order to rationalize the changes observed in the uv vis
spectra in passing from 2 to 3 and 4 , singlet excited states ( sn )
were computed at the b3lyp/(6 - 31g**+lanl2dz ) level using time - dependent density functional theory ( td - dft ) ( see the supporting information for full computational details ) . table s1 summarizes the most relevant electronic transitions that give shape
to the absorption spectra of 24 .
for 2 , the electronic transitions to the two low - lying
singlet excited states ( s1 and s2 ) are computed
about 550 nm .
these transitions are weak , with oscillator strengths
( f ) of 0.045 and 0.025 , respectively , correspond
to electronic excitations locally centered on the porphyrin core ,
and give rise to the q - band observed experimentally at 548 nm . in
addition , states s5 and s6 computed around 380
nm are responsible for the soret band observed at 400 nm . the electronic
transitions to s5 and s6
possess high oscillator
strengths of 1.565 and 0.831 , respectively , and also imply electronic
excitations mainly located on the porphyrin core ( table s1 and figure s8 ) .
meso dimer 3 ,
the electronic transitions to the s1 and s2 states
associated with the q - band are computed
at slightly higher wavelengths ( in the 570 nm region ) due to the small
electronic interaction between the two porphyrin moieties that causes
a narrowing of the homo
lumo energy gap from 2.71 ev in 2 to 2.55 ev in 3 ( figure s8 and s10 ) . the soret band , originating now in the s17 state ( f = 1.577 ) , is also red - shifted in comparison
with 2 .
interestingly , td - dft calculations predict an
intense s11 excited state ( f = 1.022 )
lower in energy than s17 and computed at 475 nm , which
reproduces the splitting of the soret band and the peak experimentally
observed at 460 nm .
this state originates in an electronic excitation
of the porphyrin moieties with no implication of the peripheral benzene
rings or the crown ether groups . for porphyrin tape dimer 4 ,
the two lowest - lying electronic
transitions associated with the s1 and s2 states
are computed in the 960970 nm range ( table s1 ) .
these two moderately intense transitions
( f = 0.312 and 0.089 , respectively ) originate in
porphyrin - centered excitations and give rise to the new broad band
observed for 4 in the 8001100
nm range .
their low energy is due to the complementarity of the two
fused porphyrin moieties with an efficient -conjugation between
them , which results in a destabilization / stabilization of the homos / lumos
and , therefore , in a drastic decrease of the homo
states
s7 and s10 computed in the 520560 nm range give rise to the typical q - band , which is notoriously
more intense than in 2 and 3 as predicted
by the oscillator strengths obtained for s7 ( 1.150 ) and
s10 ( 0.874 ) .
the peripheral benzene rings participate in
these states that mainly correspond to the excitation of the porphyrin
cores ( table s1 and figure s9 ) .
finally ,
several intense transitions are computed in the 385395 nm region , which give rise to the broad peak observed at 400
nm for the soret band ( figure 3 ) .
supramolecular
ensembles were
built up by adding increasing quantities of fullerene derivative 1 over the corresponding porphyrin dimers 3 and 4 in ch2cl2 at room temperature ( schemes 1 and 2 ) .
complexation was followed by monitoring the induced uv visible
spectroscopic changes . in the case of dimer 3
, it resulted
in a red shift of the soret bands ( 1,max = 422
427 nm ; 2,max = 458 463 nm ) , evidencing
the presence of intermolecular
interactions between the host and the guest ( figure 4 ) .
a similar
behavior was found for the soret band ( 1,max = 416
426 nm ) , the q - band ( 2,max = 578 nm
581 nm ) , and also the red - shifted absorption bands ( 3,max = 917 941 nm ; 4,max = 1042 1063
nm ) of porphyrin tape 4 ( figure 5 ) . uv
vis spectral changes observed during the complexation
of porphyrin dimer 3 ( 4.72 10 m ) by addition of 1 ( 03.4 equiv ) in ch2cl2 at room temperature .
vis spectral changes observed during the complexation
of porphyrin tape 4 ( 1.18 10 m ) by addition of 1 ( 010.5 equiv by 0.7 equiv
steps ) in ch2cl2 at room temperature .
a 1:2 stoichiometry was foreseen for both 3 and 4 based on the design of the host molecules
and the results
previously obtained for the analogous monoporphyrin system [ 21 ] .
this was further corroborated
by esi ms for a 1:2 mixture of porphyrin dimer 3 and
methanofullerene 1 in ch2cl2 , which
exhibited a double charged ion peak at m / z 2461.0 , ascribed to the 1:2 complex after loss of the
trifluoroacetate ( tfa ) counteranions ( figure s5 ) .
a similar result was obtained in the esi - ms analysis of a 1:2
mixture of porphyrin tape 4 and 1 ( figure s6 ) .
the peak corresponding to the 1:1
complex was not detected under these conditions in any case , suggesting
that 1:2 complexes are the most abundant species in the analyzed solutions .
it is important to note that , in spite of being formed by a myriad
of internal micro equilibria leading to semicomplexed species ( scheme s2 ) , the complexation of 3 and 4 by 1 can be simplified in the two - steps
processes sketched in schemes 1 and 2 ( see also scheme s2b ) .
this is possible due to the high effective molarity
found for the analogous [ 21 ] system ( 3.16 m ) evidencing its tendency toward ring - closing under
the conditions employed .
nonlinear curve
fitting to a 1:2 model yields the association constants ( ka ) summarized in table 1 . in the case of the complexes formed with porphyrin
tape 4 , curve fitting was better when performed over
the region around 7501100 nm than over the soret bands region .
first evidence of cooperative
behavior in the supramolecular complexes formed by 34 and 1 arise from the shape of the binding isotherms
found for both systems , which are not the rectangular hyperbola expected
for a noncooperative system ( insets in figures 4 and 5 ) .
further quantitative
analysis can be made if we consider that , even if each of the porphyrin
subunits exhibits chelate cooperativity , interactions between subunits
can be considered as allosteric ( scheme s2 ) .
therefore , an approximation to the allosteric cooperative factor
can be calculated for these systems . for [ 312 ] ,
the value obtained ( 0.0005 )
was much lower than unity , thus clearly pointing to a negative cooperativity ,
i.e. , the complexation of the first molecule of 1 leads
to a complex where it is more difficult to complex a second equivalent
of 1 .
this result can be in principle explained by invoking
the electronic communication between porphyrin moieties , according
to which complexation of a first fullerene molecule by a porphyrin
subunit would deplete the electronic density of that porphyrin and
its neighbor s , thus decreasing the affinity of the latter
toward fullerenes .
however , the electronic communication between the
porphyrin moieties in 3 is low due to their orthogonal
disposition as evidenced above by the uv vis spectra and the
theoretical calculations.1 the allosteric cooperativity factor
obtained for [ 412 ] ( eq 2 ) also
evidences a negative cooperativity
in the system . in this case ,
a very efficient electronic communication
exists between the porphyrin moieties , and a significant electronic
depletion can be expected for the empty porphyrin unit upon complexation
of one fullerene guest.2 interestingly , the cooperativity factor obtained for [ 412 ] is 80 times larger than that
found for [ 312 ] , suggesting the existence of other interactions that overcome the
electronic depletion of the porphyrin tape upon complexation of the
first equivalent of 1 .
as depicted in scheme 2 , complex [ 412 ] can yield two different complexes , [ 412]-syn and [ 412]-anti .
although
it is not possible to ascertain which disposition is preferred in
solution by spectroscopic measurements , and steric hindrance could
be expected to be larger for the syn configuration ,
the possibility of having additional interactions
between fullerene moieties in [ 412]-syn , not existent
in [ 412]-anti , could explain the larger value
obtained , thus pointing to the syn disposition as
the one preferred in solution .
the relative stability of [ 412]-syn and [ 412]-anti associates is discussed below
on the basis of theoretical calculations .
the redox potentials of compounds 24 and their supramolecular complexes
with 1 have been studied by cyclic voltammetry ( cv ) and
osteryoung square wave voltammetry ( oswv ) measurements in ch2cl2 at room temperature .
two quasireversible one - electron oxidation processes lead
to the formation of the corresponding radical - cation , in which an
electron is delocalized over the porphyrin , and also to the corresponding
dication .
dimer 3 seems to display a behavior close
to that of the corresponding monomer 2 ( table s2 and figures s11 and s14 ) .
indeed , the two porphyrin
rings are poorly conjugated and , as a result , the dimer nearly behaves
as the juxtaposition of two monomers .
notwithstanding , some electronic
communication exists between the two porphyrin moieties because the
first two oxidation waves split in two peaks in passing from 2 to 3 .
in contrast , the conjugation of
the two porphyrin units has a huge
effect on the redox potentials of tape 4 ( table s2 and figure s14 ) .
conjugation induces
an important lowering of the first oxidation ( eox = 0.55 v ) and first reduction ( ered = 0.58 v ) potentials as compared
to monomer 2 ( eox = 0.87 v and ered = 1.31
v ) and to porphyrin dimer 3 ( eox = 0.83 v and ered = 1.28 v ) .
this trend is supported by theoretical calculations
which predict that the homo / lumo increases / decreases drastically in
energy in passing from 2 ( 4.73/2.02 ev )
and 3 ( 4.63/2.07 ev ) to 4 ( 4.31/2.77 ev ) .
since the porphyrin rings are efficiently
conjugated in tape dimer 4 , the resulting unpaired electron
is delocalized over the two rings , giving rise to a completely delocalized
radical cation or anion .
lumo energy gap can be
associated with the difference between the first oxidation and first
reduction processes : e = eox ered .
thus , dimer 4 provides a significant decrease in the
homo lumo energy gap as compared to that of
monomer 2 ( e(monomer 2 )
e(tape 4 ) = 1.05 v ) , due to the lowering of the first oxidation potential
by 320 mv and of the first reduction potential by 730 mv .
the low
electrochemical gap is a direct result of the more extended -conjugation
in the planar triply fused system than in the simply fused 3 or monomer 2 .
lumo energy gap in passing
from 2 to 4 , in good accord with the value
obtained from electrochemical data and literature . in oswv ,
complexation - induced changes are observed
in the porphyrin
host molecules 24 upon complexation
with guest molecule 1 ( see figures s14s16 ) .
specifically , a significant decrease of the
intensity of the oxidation waves below 1.5 v is detected .
it
has been previously observed that porphyrins may influence c60 reduction potentials , especially its first wave , upon complexation . in the particular case of [ 412 ]
, the c60 moiety becomes less favorable
to reduction upon complexation , as evidenced by a cathodic shift of
60 mv in the first fullerene - centered reduction ( table s2 and figure s16 ) , thus suggesting an intramolecular
fullerene - porphyrin interaction in [ 412 ] . even though the first apparent reduction
potential of 4 is close to that of the c60 ,
the change observed in figure s16 after
addition of 2 equiv of c60 clearly evidences this interaction :
two different peaks at 0.56 v and 0.62 v are clearly
distinguishable .
the magnitude of the potential shift observed for 4 after guest complexation ( 60 mv ) is similar to that found
in other supramolecular complexes such as the zn - porphyrin sandwich
designed by aida and saigo .
, redox potentials
of fullerene donor conjugates are generally very weakly affected
by intramolecular interactions , even in cyclic
systems in which the two components are forced to be at the van der
waals contact . in our systems , no significant
electrochemical changes are detected for 1 upon complexation
with 2 and 3 ( table s2 ) . the different electrochemical behavior can be explained
on the
basis of tape 4 being a better donor molecule than 2 and 3 , with an eox 300 mv lower .
this is most likely due to the electronic
conjugation across the whole molecule , which may render the donor
acceptor
electron transfer to the c60 easier , something in full
agreement with the calculation of the net electronic charges of the
[ 31 ] and [ 41 ] species ( vide
infra ) .
moreover , the analysis of the cooperativity , which emphasizes
the role of other interactions , indicates a much higher cooperativity
factor for [ 412 ] than for
[ 312 ] .
theoretical calculations performed
at the dft b97-d3/(6 - 31g**+lanl2dz ) level of theory were used to provide deeper understanding
of the origin and nature of the intermolecular forces driving the
supramolecular assembly of dimers 3 and 4 with the fullerene - based compound 1 ( see the si for computational details ) . in [ 31 ] , compound 1 interacts with the crown
ether through the positively charged ammonium group forming three
n
ho(ether ) hydrogen - bond
interactions in the 1.832.00 range
( figure 6a ) .
this interaction
has been recently demonstrated to be the promoting force in the supramolecular
assembly between guest 1 and related metalloporphyrin - based
hosts with a net stabilizing energy that amounts to 64.9 kcal / mol .
the fullerene ball of 1 favorably interacts with the porphyrin core of 3 with short metalc(c60 ) contacts of
3.14 .
this interaction originates not only from dispersion
forces arising from long - range electron correlation effects but also
from strong electrostatic effects when considering metal - substituted
porphyrins .
furthermore , short hc
contacts between the peripheral tert - butyl - substituted
phenyl rings and c60 are computed in the range of 2.53.2 , which add approximately 1 kcal / mol per
each interaction to the final stabilization energy of the complex .
more importantly , the vicinal porphyrin , linked to the porphyrin that
interacts with 1 , approaches the fullerene fragment and
gives rise to additional interactions : short hc
contacts in the 2.73.2 range and a
weak interaction between the
peripheral benzene ring and the fullerene .
in fact , the empty porphyrin
core is distorted from linearity with respect to the occupied porphyrin
core by approximately 8 to maximize the interaction with c60 ( figure 6a ) .
these additional interactions , which are not present in [ 21 ] , can be a plausible explanation for the higher
experimental association constant found for porphyrin dimer 3 ( log k1 = 8.7 1.4 ) in
comparison with monoporphyrin 2 ( log ka = 6.9 0.2 ) .
minimum - energy
geometry computed for supramolecular complexes [ 31 ] ( a ) and [ 312 ] ( b ) at the b97-d3/(6 - 31g**+lanl2dz ) level of
theory . selected intermolecular distances are given in .
, the second molecule of 1 enters the
empty
porphyrin core and defines similar interactions to those described
for [ 31 ] .
the minimum - energy geometry shows that
the two fullerenes tend to approximate each other in order to stabilize
the resulting complex ( figure 6b ) .
again , the peripheral di - tert - butylphenyl groups placed on the vicinal porphyrin
moieties play an active role in the stabilization of the complex with
short hc(c60 ) contacts around 2.8
and interactions at 4.4 .
the association between porphyrin tape 4 and 1 ( figure 7a ) follows the same pattern as previously described for [ 31 ] .
the fullerene
interacts with the porphyrin core and with the di - tert - butylphenyl groups through metalc60 contacts of 2.87 and hc60 distances
in the range of 2.73.1 , respectively .
oddly , the dimer porphyrin tape becomes curved to better embrace the
fullerene ball and further stabilize the complex .
in contrast to that
previously described in [ 31 ] , the di - tert - butylphenyl groups of the vicinal porphyrin core are not close enough
to interact with c60 ( closest hc(c60 ) contact calculated at 3.80 ) and , therefore , they
do not contribute in the stabilization of the [ 41 ] complex ( figure 7a ) .
minimum - energy geometry computed for [ 41 ] ( a ) [ 412]-syn ( b ) and [ 412]-trans ( c ) at the b97-d3/(6 - 31g**+lanl2dz ) level
of theory . selected intermolecular distances are given in .
the introduction of the second fullerene - based guest 1 into the [ 41 ] complex can be achieved
in two
different ways : the two fullerene balls standing in the same side
in a syn disposition ( [ 412]-syn ) , or the two balls located in opposite sides with respect to the
plane generated by the porphyrin tape dimer in an anti disposition ( [ 412]-anti ) ( figure 7b and c ) . in both cases ,
all the previous
intermolecular interactions described for [ 41 ] exist
in the stoichiometric complex 1:2 with short metalc60 contacts in the range of 2.822.99
and di - tert - butylphenyl
however , by comparing the anti with
the syn complex , an important stabilizing interaction arises for the latter due to the
fullerene fullerene proximity ( ring - to - ring distance calculated
at 3.46 ) .
a recent study on related fullerene - based adducts
showed the key importance of the stabilizing c60c60 interactions , resulting in an energy
differentiation between the syn and anti dispositions of more than 5 kcal / mol in favor of syn .
single - point energy b97-d3 calculations
were performed on the b97-d3/(6 - 31g**+lanl2dz)-optimized
geometries by using the more extended cc - pvtz+lanl2dz basis set to
estimate the binding energy ( ebind ) for
all the supramolecular complexes ( table 2 ) .
meso porphyrin dimer 3 leads to a large net stabilization of 108.19 kcal / mol rising especially from the n
ho(ether ) contacts and the porphyrin core c60 interaction . additionally , the di - tert - butylphenyl groups contribute to the final stabilization
of the complex by approximately 1 kcal / mol per hc60 contact ( total number of contacts = 6 ) . upon the inclusion
of the second molecule of 1 ,
ebind is approximately doubled , reaching a value of 211.05 kcal / mol for [ 312 ] .
the additional fullerene fullerene stabilizing
interactions in [ 312 ] with respect to [ 31 ] are counteracted
by the poorer disposition of the balls to interact with the di - tert - butylphenyl groups of the vicinal porphyrin moiety
that contribute to the stabilization of [ 31 ] . for [ 41 ] , the
binding energy is computed to
be 98.40 kcal / mol .
this value is 10 kcal / mol
lower than in [ 31 ] due to the less - efficient interaction
with the vicinal empty porphyrin ( compare figures 6a and 7a ) .
upon addition
of the second molecule of 1 in an anti disposition ( [ 412]-anti ) , ebind is computed at 195.46 kcal / mol ,
almost twice the binding energy of [ 41 ] ( table 2 ) .
finally , a slightly
larger stabilization of 200.20 kcal / mol is
obtained for the [ 412-syn ] complex .
as suggested above
, the additional c60c60 interaction with a short contact calculated at 3.46 overcomes the steric hindrance
between the two balls and makes the syn complex 5
kcal / mol more stable than the anti .
this value is
in good accord with the energy difference of 6.36 kcal / mol recently
reported in favor of the cis configuration in a related
pentacene - c60 derivative .
the theoretical values predicted for ebind ( table 2 ) therefore
indicate that the incorporation of the first guest molecule leads
to a more stable complex for 3 than for 4 , and suggest that the entrance of the second molecule of 1 is more favored for 4 than for 3 .
these
trends are in accord with the higher association constant k1 obtained for 3 compared to 4 , and with the smaller decrease it experiences for 4 in passing from the 1:1 to the 1:2 stoichiometry ( table 1 ) .
a direct correlation
between the theoretical values predicted for ebind and the experimental values of ka is however not straightforward because calculations do not
take into account the desolvation energy needed to form the complexes
in solution . to help in the rationalization of the experimental
values of the
association constants for both the 1:1 and 1:2 complexes ( table 1 ) ,
net electronic
charges were calculated at the b97-d3/(6 - 31g**+lanl2dz ) level for [ 31 ] and [ 41 ] using the natural population
analysis ( npa ) approach . upon inclusion
of the first 1 molecule , the electron - donor porphyrin
dimer 3 transfers 0.19e to the fullerene - based acceptor .
the porphyrin moiety interacting with the c60 ball accumulates
a positive charge of + 0.16e , whereas the vicinal empty porphyrin bears
a residual positive charge of only + 0.03e . moving to [ 41 ]
in contrast to [ 31 ] , the c60-interacting porphyrin moiety bears a smaller positive charge
of + 0.11e compared to the empty porphyrin fragment ( + 0.15e ) .
the efficient
-conjugation between the two porphyrin moieties in porphyrin
type 4 explains the charge transfer from one fragment
to the other .
theoretical calculations therefore predict a notable
decrease in the electron density for both meso and
tape porphyrin dimers in the ground state upon complexation of the
first 1 acceptor molecule .
the decrease of electronic
density disfavors the entrance of the second guest molecule and contributes
to the remarkable change of the association constant ( log ka ) , from 8.7 to 5.4 in [ 312 ] and from 6.8 to 5.4 in [ 412 ] , when the
second 1 molecule is included to form the stoichiometric
1:2 complex .
for complex [ 412 ] , the stabilizing interactions between the c60 units found for the more stable cis disposition
partially compensate for the negative effect provoked by the lowered
electronic density .
however , other factors such as the steric hindrance
provoked by the long alkyl chains born by the guest molecules should
be considered to fully justify these trends and the higher negative
cooperativity shown by 3 compared to 4 .
in conclusion , we have studied the supramolecular
interaction of
porphyrin dimer 3 and porphyrin tape 4 ,
endowed with crown ether rings , with c60 derivative 1 .
the formation of the complexes is driven by the complementary
ammonium - crown ether h - bonding interactions and the
interactions between the porphyrin rings and the c60 moieties .
both porphyrin systems form complexes with 1:1 and 1:2 stoichiometries ,
and present a negative cooperativity , showing a decrease of the binding
constants for the complexation of the second fullerene unit .
this
fact is justified by the decrease of the donating ability of the second
porphyrin moiety once the first fullerene unit has been added . in
the case of compound 4 , the two porphyrins moieties present
a very effective -conjugation that allows for a larger charge
transfer between them upon the inclusion of the first guest molecule .
however , this negative effect is partially compensated by the favorable
interaction between the two fullerene guests
in the more stable syn disposition of [ 412 ] and , therefore , the decrease
of the binding constant for the addition of the second fullerene unit
in [ 412 ] is
not as large as observed for [ 312 ] .
the supramolecular arrays studied in this work constitute
singular examples that will help one to better understand the supramolecular
recognition of fullerenes by porphyrin - based hosts , in the quest for
efficient charge- and energy - transfer architectures potentially useful
in artificial photosynthesis and organic photovoltaics . | two new conjugated porphyrin - based
systems ( dimers 3 and 4 ) endowed with suitable
crown ethers have been
synthesized as receptors for a fullerene - ammonium salt derivative
( 1 ) .
association constants in solution have been determined
by uv vis titration experiments in ch2cl2 at room temperature .
the designed hosts are able to associate up
to two fullerene - based guest molecules and present association constants
as high as 5 108 m1 .
calculation of the allosteric cooperative factor for supramolecular
complexes [ 312 ] and [ 412 ] showed a negative cooperative effect in both cases .
the interactions
accounting for the formation of the associates are based , first , on
the complementary ammonium - crown ether interaction and , second , on
the interactions between the porphyrin rings
and the c60 moieties .
theoretical calculations have evidenced
a significant decrease of the electron density in the porphyrin dimers 3 and 4 upon complexation of the first c60 molecule , in good agreement with the negative cooperativity
found in these systems .
this negative effect is partially compensated
by the stabilizing c60c60 interactions
that take place in the more stable syn - disposition
of [ 412 ] . |
we used single - neuron spike train data , recorded in macaque monkeys , from the foreperiod of various cognitive tasks . for the romo dataset ,
the foreperiod entailed holding a lever by the free hand ; for all other datasets , the foreperiod entailed fixation of eye position to a central target .
datasets were selected as they comprised multiple cortical areas , and the task foreperiod had durations of at least 500 ms with minimal task - related stimulus during the foreperiod ( for visual tasks , only a fixation point on the screen ) . only completed trials were analyzed .
cells and trials were filtered for further analysis by two criteria . to allow computation of spike - count autocorrelation , we required that each time bin have a non - zero mean firing rate . to minimize spurious autocorrelation due to very slow drift of firing rates across the recording session , we selected the longest block of trials in which the total foreperiod spike count was statistically stationary across trials .
for single neurons recorded over multiple tasks , each task - neuron pair was treated as a separate single neuron to control for task - dependent changes in foreperiod firing .
single - neuron counts were 485 from mt ( 2 monkeys ) and 427 from lpfc ( 4 monkeys ) .
single - neuron counts were 59 from mt ( 2 monkeys ) , 222 from lip ( 4 monkeys ) , and 458 from lpfc ( 2 monkeys ) .
single - neuron counts were 192 from lip ( 3 monkeys ) , 293 from lpfc ( 5 monkeys ) , and 146 from acc ( 2 monkeys ) .
single - neuron counts were 946 from lpfc ( 6 monkeys ) , 481 from ofc ( 7 monkeys ) , and 841 from acc ( 6 monkeys ) .
single - neuron counts were 1,024 from lpfc ( 2 monkeys ) , 1,768 from ofc ( 2 monkeys ) , and 987 from acc ( 2 monkeys ) .
single - neuron counts were 711 from s1 ( 2 monkeys ) and 928 from s2 ( 2 monkeys ) .
our primary analysis was the temporal autocorrelation of spike counts , which we computed in the following way for single neurons .
we divided the foreperiod into separate , successive time bins of duration . we set = 50 ms ; results were similar for changes of 20% . for two time bins , indexed by their onset times i and
j , we computed the across - trial correlation between spike counts n in those time bins using the pearson 's correlation coefficient r : ( 1)r = cov(n(i),n(j))var(n(i))var(n(i))=(n(i)n(i))(n(j)n(j))var(n(i))var(n(j ) ) where covariance ( cov ) and variance ( var ) are computed across trials for those time bins , and is the mean spike count for a particular bin . importantly , spike - count autocorrelation corrects for nonstationarity in the mean firing rate during the foreperiod ( e.g. , ramping ) , because covariance and varience subtract the mean spike count for each time bin . based on our theoretical calculations for doubly stochastic processes ( supplementary mathematical note ) , the decay of autocorrelation was fit to the population of neurons within an area by an exponential decay with an offset as a function of the time lag k between time bins ( k = |i j| ) : ( 2)r(k)=a[exp(k)+b ] where is the intrinsic timescale and b is the offset that reflects the contribution of timescales much longer than our observation window .
some areas in the datasets showed sign of refractoriness or negative adaptation at short time lags ( fig .
1c ) , which would not be captured by equation ( 2 ) . to accommodate this feature of the autocorrelation data , fitting started at the time lag with maximum decrease of the mean autocorrelation .
we fit equation 3 to the full autocorrelation data for all neurons and times ; fits were therefore performed at the population level rather than single - neuron level , yielding a set of fit parameters for an area in a dataset . for the visual presentation in fig .
1 , and autocorrelation averaged across time but not neurons is presented in supplementary fig .
equation 2 was fit to the autocorrelation data using nonlinear least - squares fitting via the levenberg - marquardt algorithm ( through the scipy function optimize.curve fit ) .
the parameter covariance matrix generated by the levenberg - marquardt fitting procedure describes the dependence between parameters in fitting an individual area in a dataset .
a positive ( negative ) off - diagonal term for two parameters indicates that increasing one parameter will increase ( decrease ) the other to optimize the fit . for most areas
( 11 of 16 ) , this term had negative sign , indicating that the positive correlation in between and b shown in fig .
to test for hypothesized relationships between two measures we used a linear regression model : yd = mx+k{datasets}bkd , k where d , k is a dummy variable , which is 1 for a particular dataset k and 0 otherwise .
this model assumes that all datasets have a linear dependence of y on x across all datasets ( m ) , and allows datasets to have different constant terms ( bk ) . the statistical significance of a regressor , in particular the dependence term m , was assessed by a t - test .
this regression analysis was applied to test three dependences : ( 1 ) x is intrinsic timescale , y is autocorrelation offset ( fig .
2b ) ; ( 2 ) x is mean firing rate , y is intrinsic timescale ( supplementary fig .
3 ) ; and ( 3 ) x is trial - to - trial correlation , y is autocorrelation offset ( supplementary fig .
4 ) . we assessed normality of residuals for the regression analyses ; in all cases , the magnitude of skew was < 0.4 .
statistical significance ( defined by p < 0.05 ) , or lack thereof , for each test was preserved if a single constant term bk = b was used for all datasets . to test for correlation between the timescale hierarchy and anatomical hierarchy , we calculated the spearman rank correlation between the ordering of areas by mean timescale and the discrete anatomical ordering shown in fig .
the rank correlation coefficient was the same for the visual prefrontal system ( mt , lip , lpfc , ofc , acc ) and for the somatosensory
prefrontal hierarchy ( s1 , s2 , lpfc , ofc , acc ) . unless otherwise stated , reported p - values are one - sided , as we tested a priori hypotheses of positive correlations between variables .
custom python code was used for all analyses ; analysis code is available from the authors upon request .
we used single - neuron spike train data , recorded in macaque monkeys , from the foreperiod of various cognitive tasks . for the romo dataset ,
the foreperiod entailed holding a lever by the free hand ; for all other datasets , the foreperiod entailed fixation of eye position to a central target .
datasets were selected as they comprised multiple cortical areas , and the task foreperiod had durations of at least 500 ms with minimal task - related stimulus during the foreperiod ( for visual tasks , only a fixation point on the screen ) . only completed trials were analyzed .
cells and trials were filtered for further analysis by two criteria . to allow computation of spike - count autocorrelation , we required that each time bin have a non - zero mean firing rate . to minimize spurious autocorrelation due to very slow drift of firing rates across the recording session , we selected the longest block of trials in which the total foreperiod spike count was statistically stationary across trials .
for single neurons recorded over multiple tasks , each task - neuron pair was treated as a separate single neuron to control for task - dependent changes in foreperiod firing .
single - neuron counts were 485 from mt ( 2 monkeys ) and 427 from lpfc ( 4 monkeys ) .
single - neuron counts were 59 from mt ( 2 monkeys ) , 222 from lip ( 4 monkeys ) , and 458 from lpfc ( 2 monkeys ) .
single - neuron counts were 192 from lip ( 3 monkeys ) , 293 from lpfc ( 5 monkeys ) , and 146 from acc ( 2 monkeys ) .
single - neuron counts were 946 from lpfc ( 6 monkeys ) , 481 from ofc ( 7 monkeys ) , and 841 from acc ( 6 monkeys ) .
single - neuron counts were 1,024 from lpfc ( 2 monkeys ) , 1,768 from ofc ( 2 monkeys ) , and 987 from acc ( 2 monkeys ) .
single - neuron counts were 711 from s1 ( 2 monkeys ) and 928 from s2 ( 2 monkeys ) .
our primary analysis was the temporal autocorrelation of spike counts , which we computed in the following way for single neurons .
we divided the foreperiod into separate , successive time bins of duration . we set = 50 ms ; results were similar for changes of 20% . for two time bins , indexed by their onset times i and
j , we computed the across - trial correlation between spike counts n in those time bins using the pearson 's correlation coefficient r : ( 1)r = cov(n(i),n(j))var(n(i))var(n(i))=(n(i)n(i))(n(j)n(j))var(n(i))var(n(j ) ) where covariance ( cov ) and variance ( var ) are computed across trials for those time bins , and is the mean spike count for a particular bin .
importantly , spike - count autocorrelation corrects for nonstationarity in the mean firing rate during the foreperiod ( e.g. , ramping ) , because covariance and varience subtract the mean spike count for each time bin . based on our theoretical calculations for doubly stochastic processes ( supplementary mathematical note ) , the decay of autocorrelation was fit to the population of neurons within an area by an exponential decay with an offset as a function of the time lag k between time bins ( k = |i j| ) : ( 2)r(k)=a[exp(k)+b ] where is the intrinsic timescale and b is the offset that reflects the contribution of timescales much longer than our observation window .
some areas in the datasets showed sign of refractoriness or negative adaptation at short time lags ( fig .
1c ) , which would not be captured by equation ( 2 ) . to accommodate this feature of the autocorrelation data , fitting started at the time lag with maximum decrease of the mean autocorrelation .
we fit equation 3 to the full autocorrelation data for all neurons and times ; fits were therefore performed at the population level rather than single - neuron level , yielding a set of fit parameters for an area in a dataset . for the visual presentation in fig . 1c , autocorrelation was averaged across neurons and times .
autocorrelation averaged across neurons but not time is presented in supplementary fig . 1 , and autocorrelation averaged across time but
equation 2 was fit to the autocorrelation data using nonlinear least - squares fitting via the levenberg - marquardt algorithm ( through the scipy function optimize.curve fit ) .
the parameter covariance matrix generated by the levenberg - marquardt fitting procedure describes the dependence between parameters in fitting an individual area in a dataset .
a positive ( negative ) off - diagonal term for two parameters indicates that increasing one parameter will increase ( decrease ) the other to optimize the fit . for most areas ( 11 of 16 ) , this term had negative sign , indicating that the positive correlation in between and b shown in fig .
standard error for fit parameters was computed by the delete - one jackknife procedure . to test for hypothesized relationships between two measures we used a linear regression model :
yd = mx+k{datasets}bkd , k where d , k is a dummy variable , which is 1 for a particular dataset k and 0 otherwise .
this model assumes that all datasets have a linear dependence of y on x across all datasets ( m ) , and allows datasets to have different constant terms ( bk ) .
the statistical significance of a regressor , in particular the dependence term m , was assessed by a t - test .
this regression analysis was applied to test three dependences : ( 1 ) x is intrinsic timescale , y is autocorrelation offset ( fig .
2b ) ; ( 2 ) x is mean firing rate , y is intrinsic timescale ( supplementary fig .
3 ) ; and ( 3 ) x is trial - to - trial correlation , y is autocorrelation offset ( supplementary fig .
we assessed normality of residuals for the regression analyses ; in all cases , the magnitude of skew was < 0.4
. statistical significance ( defined by p < 0.05 ) , or lack thereof , for each test was preserved if a single constant term bk = b was used for all datasets . to test for correlation between the timescale hierarchy and anatomical hierarchy , we calculated the spearman rank correlation between the ordering of areas by mean timescale and the discrete anatomical ordering shown in fig .
the rank correlation coefficient was the same for the visual prefrontal system ( mt , lip , lpfc , ofc , acc ) and for the somatosensory
prefrontal hierarchy ( s1 , s2 , lpfc , ofc , acc ) . unless otherwise stated , reported p - values are one - sided , as we tested a priori hypotheses of positive correlations between variables .
custom python code was used for all analyses ; analysis code is available from the authors upon request .
| specialization and hierarchy are organizing principles for primate cortex , yet there is little direct evidence for how cortical areas are specialized in the temporal domain .
we measured timescales of intrinsic fluctuations in spiking activity across areas , and found a hierarchical ordering , with sensory and prefrontal areas exhibiting shorter and longer timescales , respectively . based on our findings
, we suggest that intrinsic timescales reflect areal specialization for task - relevant computations over multiple temporal ranges . |
gestational diabetes mellitus ( gdm ) , defined as carbohydrate intolerance first recognized during pregnancy , affects up to 14% of pregnancies and appears to be increasing in frequency in concert with the rising prevalence of adult obesity ( 1 ) .
childhood obesity has also become a major public health problem as evidenced by a nearly fourfold increase over a 30-year period ending in 2000 ( 2 ) .
freinkel ( 3 ) first suggested that even the mildest forms of diabetes complicating pregnancy could have long - range effects on offspring by affecting behavioral , anthropometric , and metabolic functions .
emerging evidence suggests that the intrauterine environment of maternal diabetes can have significant influence on health in later life .
longitudinal studies of the offspring of women with diabetes during pregnancy demonstrate a link between maternal hyperglycemia and the development of obesity and altered carbohydrate metabolism during childhood and adolescence that is independent of both maternal obesity and birth weight ( 4,5 ) . in utero exposure to hyperglycemia as measured by amniotic fluid insulin levels has been found to be a strong predictor of insulin resistance during childhood ( 6 ) , and these effects of maternal diabetes on offspring appear to extend into adult life ( 7 ) .
thus , fetal programming in the setting of maternal diabetes affecting fetal islet function can lead to the development of subsequent obesity , diabetes , and insulin resistance , which may create an intergenerational cycle of diabetes ( 8) .
after decades of uncertainty , results from randomized treatment trials now confirm that treatment of mild gdm is associated with immediate benefits , including reductions in birth weight , macrosomia , and neonatal fat mass , among other outcomes ( 9,10 ) .
there is , however , insufficient evidence regarding whether treatment confers long - term metabolic benefit in offspring .
the results of an observational study and limited follow - up from one treatment trial remain inconsistent about whether treatment of gdm is a modifiable risk factor for childhood obesity ( 11,12 ) . because of concerns about potential long - term effects of maternal diabetes on the developing fetus
, we conducted a follow - up study of the offspring from a randomized treatment trial for mild gdm to determine whether treatment influences child health outcomes .
between february 2012 and september 2013 , we conducted an unplanned follow - up study of the offspring of women who participated in a eunice kennedy shriver national institute of child health and human development maternal - fetal medicine units ( mfmu ) network randomized clinical trial ( rct ) for mild gdm ( 10 ) .
mild gdm was defined as a fasting glucose < 95 mg / dl and two of three timed measurements that exceeded established thresholds ( 1 h , 180 mg / dl ; 2 h , 155 mg / dl ; 3 h , 140 mg / dl ) .
eligibility for the follow - up study included enrollment in the rct at a center still participating in the mfmu network at the time of the follow - up study ( 12 of 16 centers ; 94% of the original rct patients ) .
following mother informed consent and child assent , when appropriate , children ages 510 years of the index pregnancy were enrolled in the follow - up study . at the study visit ,
trained nursing personnel obtained height and weight measurements using a calibrated scale and stationary stadiometer .
in addition , waist circumference measurements were obtained at the position horizontal to the uppermost lateral border of the right ilium of the pelvis per the national health and nutrition examination survey anthropometry procedures manual ( 13 ) .
the study visit took place after an overnight fast , and blood samples were collected and sent to the northwest lipid metabolism and diabetes research laboratories for fasting glucose , insulin , hdl cholesterol , and triglyceride levels .
the mothers were administered a questionnaire concerning demographic information , breast - feeding history , child health , diet , and physical activity .
mothers were asked whether their child showed any signs of pubertal changes using drawings and descriptions of the five tanner stages ( 14 ) , and their responses were coded as no ( tanner = 1 ) or yes for any ( tanner > 1 ) without requiring the mothers to specify the stage .
the primary outcome of the study was defined as a bmi 95th percentile for child age and sex per 2000 centers for disease control and prevention growth charts ( 15 ) .
secondary outcomes were waist circumference 90th percentile for age , sex , and race / ethnicity ( 16 ) ; bmi 85th percentile for child age and sex ; diabetes defined as fasting glucose 126 mg / dl or impaired fasting glucose of 100125 mg / dl ( 17 ) ; elevated triglyceride levels 100 mg / dl in the children aged 59 years and 130 mg / dl in the children aged 10 years ( 18 ) ; low hdl cholesterol < 40 mg / dl ( 18 ) ; and hypertension 95th percentile for child age , sex , and height ( 19 ) .
these outcomes were also assessed as continuous outcomes , as was homa - estimated insulin resistance ( homa - ir ) calculated as ( fasting glucose [ mmol / l ] fasting insulin [ u / ml ] ) / 22.5 ( 20 ) .
continuous variables were assessed to determine whether they were normally distributed and log - transformed when appropriate ; bmi percentile for child age and sex was converted to a z score .
estimation of the required sample size for the follow - up study was based on a two - sided type i error of 5% .
given the race / ethnicity distribution of the children eligible for this study and the reported prevalence of bmi 95th percentile ( 21 ) , we estimated that 20% of the treated offspring would be obese .
assuming a one - third reduction in obesity ( 30% untreated vs. 20% treated ) , a sample size of 600 was required for 80% power .
if the children of the mild gdm - treated group were one - half as likely to be obese ( e.g. , 20% in the untreated and 10% in the treated ) , a sample size of 550 would provide 90% power . because we previously reported sex differences in neonatal outcomes from the original trial ( 22 )
the and wilcoxon rank sum tests were used to assess differences between treatment groups and baseline characteristics and birth outcomes as well as to assess differences in baseline characteristics and birth outcomes between those eligible who did and did not participate in the follow - up study . when examining the primary and secondary binomial outcomes , we used multivariable log - binomial regression to estimate relative risks and 95% cis , adjusting for race / ethnicity and log maternal baseline bmi . for continuous outcomes , we used multivariable generalized least squares to estimate adjusted means and 95% cis .
tests for interaction between treatment group and age ( 56 years , 710 years ) and between treatment group and sex were determined a priori and assessed by including an interaction term in the multivariable model .
post hoc analyses also assessed the association between treatment group and child bmi by neonatal adiposity .
sas statistical software ( sas institute , cary , nc ) was used for the analyses .
all tests were two - tailed , and p < 0.05 was used to define statistical significance without adjustment for multiple comparisons .
a total of 666 of 905 eligible women ( 74% ) from the rct were successfully contacted , and 500 ( 55% ) consented to have their children enrolled in the follow - up study ; 390 children provided fasting blood samples for glucose , insulin , and lipid measurements . a comparison of maternal baseline characteristics between treated and untreated groups revealed no difference in 50-g glucose screening value , diagnostic oral glucose tolerance test results , bmi , or gestational age at entry into the trial ( table 1 ) .
treatment was associated with lower birth weight , fat mass > 90th percentile , frequency of large - for - gestational age ( lga ) , and birth weight > 4,000 g. however , these associations were observed only in male offspring ( table 2 ) .
the maternal baseline characteristics and birth outcomes were generally similar in eligible children who did and did not participate in the follow - up study , although some differences were observed ( supplementary tables 1 and 2 ) .
for example , a higher percentage of the children of non - hispanic white women participated in the follow - up study . among those who participated in the follow - up study , and
similar to the full trial cohort , the maternal glucose values during the intervention in the treated group indicated that target glycemic thresholds were achieved ( supplementary table 3 ) .
maternal baseline characteristics by mild gdm treatment group data are mean sd and n ( % ) .
ogtt , oral glucose tolerance test . based on the test for categorical variables and wilcoxon rank sum test for continuous variables .
birth outcomes by mild gdm treatment group , overall and by sex data are mean sd and n ( % ) .
based on the or fisher exact test for categorical variables and wilcoxon rank sum test for continuous variables . in the cohort of enrolled children
overall , no significant difference was found between treated and untreated groups in terms of sex ( 53.0% vs. 51.3% males , p = 0.69 ) , frequency of breast - feeding > 1 month ( 72.4% vs. 72.5% , p = 0.98 ) , tanner stage > 1 ( 20.5% vs. 26.3% , p = 0.12 ) , or age at follow - up ( 7.0 1.3 vs. 7.2 1.4 years , p = 0.40 ) .
additionally , no differences were noted among offspring of treated versus untreated women with respect to reported diet or physical activity levels ( data not shown ) .
overall , 21.8% of the children were obese , and 6.4% had impaired fasting glucose ; none had diabetes .
we found no difference in the primary outcome , as 20.8% vs. 22.9% ( p = 0.69 ) of offspring of treated compared with untreated mothers were found to have a bmi 95th percentile at follow - up ( table 3 ) .
additionally , no significant differences existed with respect to any secondary measures of obesity or metabolic dysfunction between the treatment groups ( tables 3 and 4 ) .
follow - up outcomes ( binomial ) by mild gdm treatment group , overall and by sex data are n ( % ) unless otherwise indicated .
all models adjusted for race / ethnicity and log maternal baseline bmi , except waist circumference > 90th percentile for age , sex , and race / ethnicity was adjusted only for log maternal baseline bmi .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
follow - up outcomes ( continuous ) by mild gdm treatment group , overall and by sex all models adjusted for race / ethnicity and log maternal baseline bmi ; log waist circumference also adjusted for child s sex ( overall model ) and child s age in months ; log triglycerides also adjusted for child s age in months ; and systolic and diastolic bps also adjusted for child s sex ( overall model ) , child s age in months , and child s height .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
calculated as ( fasting glucose [ mmol / l ] fasting insulin [ u / ml ] ) / 22.5 ( 20 ) .
significant interaction was observed between treatment group and sex for fasting glucose and log homa - ir ( p for interaction 0.007 for impaired fasting glucose , 0.002 for fasting glucose , and 0.02 for log homa - ir ) .
no treatment group - by - sex interaction was observed for measures of obesity ( tables 3 and 4 ) .
female offspring of treated women had a decreased frequency of impaired fasting glucose , lower fasting glucose , lower log homa - ir , but higher diastolic blood pressure than female offspring of untreated women .
however , lipid levels were similar between treatment groups ( tables 3 and 4 ) .
in male offspring , mean fasting glucose and log homa - ir were not significantly affected by treatment .
1 shows the relationship between treatment group and childhood bmi z score stratified by neonatal adiposity . in the high neonatal adiposity stratum , treatment was associated with a significantly lower childhood bmi z score in female offspring ( supplementary fig .
a total of 666 of 905 eligible women ( 74% ) from the rct were successfully contacted , and 500 ( 55% ) consented to have their children enrolled in the follow - up study ; 390 children provided fasting blood samples for glucose , insulin , and lipid measurements . a comparison of maternal baseline characteristics between treated and untreated groups revealed no difference in 50-g glucose screening value , diagnostic oral glucose tolerance test results , bmi , or gestational age at entry into the trial ( table 1 ) .
treatment was associated with lower birth weight , fat mass > 90th percentile , frequency of large - for - gestational age ( lga ) , and birth weight > 4,000 g. however , these associations were observed only in male offspring ( table 2 ) .
the maternal baseline characteristics and birth outcomes were generally similar in eligible children who did and did not participate in the follow - up study , although some differences were observed ( supplementary tables 1 and 2 ) .
for example , a higher percentage of the children of non - hispanic white women participated in the follow - up study . among those who participated in the follow - up study , and
similar to the full trial cohort , the maternal glucose values during the intervention in the treated group indicated that target glycemic thresholds were achieved ( supplementary table 3 ) .
maternal baseline characteristics by mild gdm treatment group data are mean sd and n ( % ) .
ogtt , oral glucose tolerance test . based on the test for categorical variables and wilcoxon rank sum test for continuous variables .
birth outcomes by mild gdm treatment group , overall and by sex data are mean sd and n ( % ) .
based on the or fisher exact test for categorical variables and wilcoxon rank sum test for continuous variables .
in the cohort of enrolled children overall , no significant difference was found between treated and untreated groups in terms of sex ( 53.0% vs. 51.3% males , p = 0.69 ) , frequency of breast - feeding > 1 month ( 72.4% vs. 72.5% , p = 0.98 ) , tanner stage > 1 ( 20.5% vs. 26.3% , p = 0.12 ) , or age at follow - up ( 7.0 1.3 vs. 7.2 1.4 years , p = 0.40 ) .
additionally , no differences were noted among offspring of treated versus untreated women with respect to reported diet or physical activity levels ( data not shown ) .
overall , 21.8% of the children were obese , and 6.4% had impaired fasting glucose ; none had diabetes .
we found no difference in the primary outcome , as 20.8% vs. 22.9% ( p = 0.69 ) of offspring of treated compared with untreated mothers were found to have a bmi 95th percentile at follow - up ( table 3 ) . additionally , no significant differences existed with respect to any secondary measures of obesity or metabolic dysfunction between the treatment groups ( tables 3 and 4 ) .
follow - up outcomes ( binomial ) by mild gdm treatment group , overall and by sex data are n ( % ) unless otherwise indicated .
all models adjusted for race / ethnicity and log maternal baseline bmi , except waist circumference > 90th percentile for age , sex , and race / ethnicity was adjusted only for log maternal baseline bmi .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
follow - up outcomes ( continuous ) by mild gdm treatment group , overall and by sex all models adjusted for race / ethnicity and log maternal baseline bmi ; log waist circumference also adjusted for child s sex ( overall model ) and child s age in months ; log triglycerides also adjusted for child s age in months ; and systolic and diastolic bps also adjusted for child s sex ( overall model ) , child s age in months , and child s height .
the data presented by child sex are based on multivariable adjusted models that included treatment group , sex , and a treatment group - by - sex interaction term .
calculated as ( fasting glucose [ mmol / l ] fasting insulin [ u / ml ] ) / 22.5 ( 20 ) .
significant interaction was observed between treatment group and sex for fasting glucose and log homa - ir ( p for interaction 0.007 for impaired fasting glucose , 0.002 for fasting glucose , and 0.02 for log homa - ir ) .
no treatment group - by - sex interaction was observed for measures of obesity ( tables 3 and 4 ) .
female offspring of treated women had a decreased frequency of impaired fasting glucose , lower fasting glucose , lower log homa - ir , but higher diastolic blood pressure than female offspring of untreated women .
however , lipid levels were similar between treatment groups ( tables 3 and 4 ) .
in male offspring , mean fasting glucose and log homa - ir were not significantly affected by treatment .
1 shows the relationship between treatment group and childhood bmi z score stratified by neonatal adiposity . in the high neonatal adiposity stratum
, treatment was associated with a significantly lower childhood bmi z score in female offspring ( supplementary fig .
in this follow - up study of the offspring of women participating in an rct for the treatment of mild gdm , we observed no difference in the overall frequency of obesity or metabolic dysfunction at ages 510 years according to whether treatment was undertaken .
we did , however , observe sex - specific differences according to treatment with respect to childhood blood glucose levels .
mild gdm treatment was associated with a decreased frequency of impaired fasting glucose , lower fasting glucose , and lower log homa - ir in female offspring at ages 510 years but not in male offspring .
this follow - up study represents the largest of its kind in offspring from a randomized treatment trial for mild gdm .
the follow - up rate of 55% in those eligible from the original rct was accomplished despite this being an unplanned study at the time we conducted the rct .
however , enrollment of 500 children fell short of our goal of 600 needed to observe at least a one - third reduction in childhood obesity with treatment with 80% power , which means that we were underpowered to observe a more modest treatment effect .
although the study also included assessment of several metabolic outcomes in addition to measures of childhood obesity , a limitation of this study was the use of bmi as the primary measure of obesity . furthermore , although we collected anthropometric data , more - precise measures of body composition , such as dexa or air densitometry , may have more accurately assessed relative obesity
. we also limited glucose measurements to the fasting state such that the full spectrum of carbohydrate intolerance in the offspring could not be assessed .
thus , a greater number of children with carbohydrate intolerance might have been identified if a glucose tolerance test had been performed .
a large prospective analysis of mother - infant pairs enrolled in the national collaborative perinatal project revealed that infants of gdm mothers were more likely to have a higher bmi z score at 7 years of age ( 23 ) .
in contrast , a retrospective cohort study of 2,093 women - and - toddler pairs demonstrated that the risk for childhood obesity was not associated with gdm but was associated with higher maternal prepregnancy bmi and lga birth weight status ( 24 ) .
these authors suggested that because their gdm population was well controlled , gdm management could be a modifiable risk factor for childhood obesity .
whether treatment of gdm is a determinant of offspring outcomes can only be assessed from follow - up studies of treatment trials .
both the mfmu network gdm and the australian carbohydrate intolerance study in pregnant women ( achois ) trials demonstrated a reduction in birth weight and macrosomia with treatment of mild gdm ( 9,10 ) .
preventive services task force to acknowledge for the first time that treatment of gdm is beneficial ( 25 ) . to date
, however , there has been a paucity of information regarding whether treatment of gdm conveys long - term benefits to offspring ( 12,26 ) .
gillman et al . ( 12 ) reported follow - up data on 199 ( or 20% ) 45-year - olds who participated in the achois trial . unlike the present study in which specific study follow - up visits occurred ,
the achois follow - up was limited to preschool height - and - weight measurements obtained through data linkage analysis .
these investigators found no difference in the bmi z score or frequency of bmi > 85th percentile in the intervention group compared with the control group ( 12 ) . a smaller and underpowered follow - up study of 89 children aged 9 years from an unblinded rct for the treatment of gdm revealed an overall greater - than - expected rate of impaired glucose tolerance with no difference in treated versus control subjects ( 26 ) .
there were fewer children with bmi > 85th percentile in the group treated for gdm ; however , this difference was not significant . notwithstanding the concern that some researchers have raised regarding the inconsistent evidence of an association of gdm and childhood obesity due to failure to consider important factors such as maternal and paternal obesity , there may be several explanations for the results of the present study ( 27 ) . of note ,
the present study included women with mild gdm ( fasting glucose < 95 mg / dl ) of whom only 7% required insulin therapy .
inclusion of women with more - pronounced hyperglycemia during pregnancy might have demonstrated a long - term treatment effect on obesity in their offspring .
alternatively , although treated women met conventional glucose targets for control , these maternal glucose levels may actually exceed those required to affect later outcomes , such as childhood obesity .
the appropriate offspring follow - up period for assessing the effects of maternal diabetes is debatable .
an analysis of the hypoglycemia and adverse pregnancy outcomes study in offspring 2 years of age found no relationship between maternal glucose levels and child obesity ( 28 ) .
we followed children ages 510 years , yet the emergence of both obesity and metabolic dysfunction in the offspring of diabetic women may not occur until adolescence or early adulthood ( 6,29 ) .
overweight infants of diabetic mothers may have normalization of their weight in the first few years of life and then develop obesity later in childhood .
crume et al . ( 29 ) reported that the effects of maternal diabetes on offspring bmi may not be apparent until age 9 or until puberty . because most of the children in the present study were prepubertal ( average age 7 years )
, we acknowledge that the development of obesity and any potential treatment benefit may not yet be apparent in this cohort .
a follow - up study of indian children born to gdm mothers also revealed that differences in adiposity compared with control subjects diminished during infancy and then increased through childhood ( 30 ) .
social and environmental factors could also be significant confounders affecting the results of a childhood follow - up study for which obesity is an outcome .
breast - feeding , for example , may be associated with a reduction in childhood obesity in offspring of diabetic women ( 29 ) .
we collected data on physical activity and nutrition , including breast - feeding practices , and did not observe significant differences between groups .
because metabolic differences exist between male and female neonates , differing sensitivities to hyperglycemia in utero may also result in long - term sex - specific programming ( 31 ) .
we previously reported that male offspring of treated women from this rct had lower birth weight and neonatal fat mass , which was not apparent in female offspring ( 22 ) . in agreement with these findings ,
lingwood et al . ( 31 ) also reported that males appear more immediately sensitive to maternal glycemia as it relates to the development of neonatal adiposity .
in contrast , female offspring may be more likely to exhibit the effects of in utero exposure to maternal diabetes later in childhood . at 5 years of age ,
female offspring of diabetic mothers exhibited increased skinfold thicknesses and higher insulin concentrations and were more likely to develop impaired glucose tolerance than control subjects ( 30 ) .
the present follow - up metabolic data further support the concept of sex - specific programming because we found higher glucose levels and a trend toward increased insulin resistance in untreated female offspring .
females have been shown to have similar cord glucose to males yet increased insulin levels at birth . together with lower birth weight and increased neonatal adiposity compared with males , in females , this might suggest increased insulin resistance ( 32 ) . in female offspring , the present results indicate that the development of such insulin resistance might be modifiable with treatment of mild gdm .
we found no evidence of such an effect in males . because neonatal adiposity has been determined to be predictive of subsequent childhood obesity , we stratified subjects according to neonatal fat mass percentile in our analysis and found a relationship with subsequent bmi . in female offspring exhibiting the highest neonatal fat mass , treatment of mild gdm was associated with a lower childhood bmi z score .
infants with the greatest degree of fat accumulation in utero in the untreated arm might represent those most susceptible to the effects of maternal hyperglycemia , which might be particularly true in the setting of mild maternal hyperglycemia found in subjects participating in the present rct .
the long - term offspring effects of maternal diabetes may be partly mediated by neonatal body composition . whereas the development of childhood obesity has been reported to be increased across the spectrum of birth weight in offspring of gdm women , boney et al .
( 33 ) reported that only lga offspring of diabetic mothers are at significant risk for the development of childhood metabolic syndrome .
in conclusion , although this study did not demonstrate an overall effect on childhood obesity with treatment of mild gdm , our observations with respect to the metabolic differences according to sex among the offspring remain intriguing .
the association between neonatal adiposity and childhood obesity in this study is also apparent , and a potential treatment effect was suggested in female offspring with the highest neonatal fat mass .
thus , the possibility that fetal programming of metabolic function in gdm can have an intergenerational effect that may in turn be modified by treatment remains open to question .
larger follow - up studies of pregnancy randomized trials are necessary to provide evidence that the vicious cycle of intergenerational diabetes and obesity can in fact be interrupted . | objectiveto evaluate whether treatment of mild gestational diabetes mellitus ( gdm ) confers sustained offspring health benefits , including a lower frequency of obesity.research design and methodsfollow - up study of children ( ages 510 ) of women enrolled in a multicenter trial of treatment versus no treatment of mild gdm .
height , weight , blood pressure , waist circumference , fasting glucose , fasting insulin , triglycerides , and hdl cholesterol were measured.resultsfive hundred of 905 eligible offspring ( 55% ) were enrolled .
maternal baseline characteristics were similar between the follow - up treated and untreated groups .
the frequencies of bmi 95th ( 20.8% and 22.9% ) and 85th ( 32.6% and 38.6% ) percentiles were not significantly different in treated versus untreated offspring ( p = 0.69 and p = 0.26 ) .
no associations were observed for bmi z score , log waist circumference , log triglycerides , hdl cholesterol , blood pressure , or log homa - estimated insulin resistance ( homa - ir ) .
the effect of treatment was different by sex for fasting glucose and log homa - ir ( p for interaction = 0.002 and 0.02 , respectively ) but not by age - group ( 56 and 710 years ) for any outcomes .
female offspring of treated women had significantly lower fasting glucose levels.conclusionsalthough treatment for mild gdm has been associated with neonatal benefits , no reduction in childhood obesity or metabolic dysfunction in the offspring of treated women was found . however , only female offspring of women treated for mild gdm had lower fasting glucose . |
water is a large component of the human body and plays a key role in normal physiological balance .
this general concept has been widely explored by the food / beverage market to cultivate the idea that an increase of water intake in our diet might act as a health ( and antiage ) promotor . regarding skin health ,
this association between water and better ( skin ) performance has been widely accepted , although not clearly demonstrated.13 water is the main component of cells and tissues , a major element of body fluid compartments,4 and represents 75% and 60% ( from birth and in adults , respectively ) of body s composition .
it is an essential nutrient with unique properties as a solvent for ionic compounds and solutes5 and acts as a carrier with a central role in cell homeostasis.6,7 water is the environment in which all transport systems work.8 it helps in maintaining body volume ( intracellular and extracellular),9,10 which is essential to prevent dehydration , a potentially life - threatening condition.11 the water in the body also plays an important role in thermoregulation10 and acts as a lubricant and shock absorbent.10 several studies have suggested that the amount of water supplied by regular food and beverages , including the water produced by the cellular metabolism , is not sufficient to meet the body s daily water requirements,10,1214 even considering the very effective neuroendocrine osmoreflexes regulating thirst and voluntary water ingestion.1315 unlike other essential nutrients , daily recommendations for water consumption are often disregarded , and a clear definition of the daily water requirement needs does not exist . however , there are some indicative recommendations .
the dietary guidelines for americans 2010 report15 establishes as adequate water intake 3.7 and 2.7 l / day for men and women , respectively , between 19 and 30 years old , while the european food safety authority ( efsa ) indicates dietary reference values of 2.0 and 2.5
l of water per day for women and men , respectively.16 regarding human skin s physiology , cutaneous water content is known to play an important role in different skin functions , such as the water barrier
function or the envelope function , and water deficiency is associated with several dermatological dysfunctions.1719 nevertheless , a direct relationship between these properties and regular dietary water consumption have not been clearly demonstrated , and only very few publications have addressed this theme.20,21 in this study , a validated food frequency questionnaire ( ffq ) was used to measure the total water intake in a population , ie , the water they drink , the water content of the dietary nutrients , and the water produced by regular metabolism.22 in this way , a relationship between some cutaneous functions and water ingestion could be measured in order to look deeper into the impact of dietary water on normal skin physiology .
a convenience sample of 49 healthy female volunteers , aged between 22 and 34 ( 24.54.3 ) years was selected .
the effects of gender on normal physiology , including the skin are known.2226 so , this research compromise was intended to reduce the gender - related variability .
the selection of volunteers took place after informed written consent was obtained , in accordance with previously established inclusion criteria .
the methodologies used fully complied with all ethical standards set by the declaration of helsinki and its amendments,27 and were previously approved by the institution s ethical commission .
the population s water consumption pattern involved all contributions accounting for the total amount of water consumed .
the measurement instrument was an ffq , which was previously validated to the portuguese population.22 volunteers were grouped according to their total water consumption , which corresponded to the sum of drinking water ( drw ) , water from the dietary nutrients ( diw ) , and water produced by metabolism ( mew).22 two groups with different total daily water consumptions were identified by cluster analysis ( see the following section ) as group 1 , corresponding to a total water consumption lower than 3,200 ml / day ( n=38 ) , and group 2 , corresponding to a water total consumption higher than 3,200 ml / day ( n=11 ) .
the groups were stratified by the total water consumption over the preceding 4 weeks , with ratings on day 0 ( t0 ) , on day 15 ( t1 ) , and on day 30 ( t2 ) .
volunteers were then asked to supplement their normal diet with a fixed daily amount of water for 4 weeks in order to establish the impact of this surplus on their normal skin physiology .
a mean value of 2,000 ml water / day was adopted as the reference surplus , based on the dietary reference values for women from efsa.16 to quantify skin functions , measurements took place after full acclimation to room conditions by volunteers ( temperature and humidity 21c1c , 45%5% , respectively ) for a period of approximately 20 minutes .
all evaluations were conducted in the absence of heat sources and forced convection , according to previously published recommendations.23 five anatomical sites were measured face ( zygomatic and forehead ) , arm ( ventral forearm and hand ) , and leg ( external face ) .
bmi ( body mass index ) and blood pressure were controlled throughout the study in order to identify potential changes in weight and hemodynamics .
the bmi was measured by the quetelet s formula , while hemodynamics were monitored by blood pressure and heart rate measurements .
function was assessed by the transepidermal water loss ( tewl ) measurement , obtained with the tewameter tm 300 ( ck electronics , cologne , germany ) , expressed in g / m / h , and by the epidermal hydration measured by the moisturemeter sc and moisturemeter d ( delphin technology d , bergisch gladbach , germany ) system , expressed in au ( arbitrary units ) .
function was assessed by the cutometer cm 575 system ( in mm ) from ck technologies .
the utility descriptors chosen were extensibility ( uf ) , the ability of the skin to return to its original state ( uf ua ) , total elasticity ( ua / uf , including pulse stretching and recovery ) , elastic function ( ur / ue ) , and viscoelasticity ( uv / ue).24,28,29 statistical analysis ( descriptive and comparative ) was performed using the spss version 20.0 ( spss inc . , chicago , il , usa ) software
. the cluster s analysis , which is based on a hierarchic model that groups similar objects , allowed to identify a group of individuals consuming less than 3,200 ml / day ( n=38 ) as group 1 , and another group of individuals consuming more than 3,200 ml / day ( n=11 ) , as group 2 .
the analysis of variance generalized linear model , the sphericity test of mauchly , and the levene test were applied to both groups . the goal was to test the homogeneity of these populations .
so , we confirmed that variance of endpoint variables for these two groups were similar and that the data distribution was narrow , tending to normal .
post hoc multiple comparisons were performed using the bonferroni test , a suitably robust method to control errors in handling.30 variables were also compared by the spearman correlation coefficient . a confidence level of 95% was adopted . due to the population homogeneity of age ,
a convenience sample of 49 healthy female volunteers , aged between 22 and 34 ( 24.54.3 ) years was selected .
the effects of gender on normal physiology , including the skin are known.2226 so , this research compromise was intended to reduce the gender - related variability .
the selection of volunteers took place after informed written consent was obtained , in accordance with previously established inclusion criteria .
the methodologies used fully complied with all ethical standards set by the declaration of helsinki and its amendments,27 and were previously approved by the institution s ethical commission .
the population s water consumption pattern involved all contributions accounting for the total amount of water consumed .
the measurement instrument was an ffq , which was previously validated to the portuguese population.22 volunteers were grouped according to their total water consumption , which corresponded to the sum of drinking water ( drw ) , water from the dietary nutrients ( diw ) , and water produced by metabolism ( mew).22 two groups with different total daily water consumptions were identified by cluster analysis ( see the following section ) as group 1 , corresponding to a total water consumption lower than 3,200 ml / day ( n=38 ) , and group 2 , corresponding to a water total consumption higher than 3,200 ml / day ( n=11 ) .
the groups were stratified by the total water consumption over the preceding 4 weeks , with ratings on day 0 ( t0 ) , on day 15 ( t1 ) , and on day 30 ( t2 ) .
volunteers were then asked to supplement their normal diet with a fixed daily amount of water for 4 weeks in order to establish the impact of this surplus on their normal skin physiology .
a mean value of 2,000 ml water / day was adopted as the reference surplus , based on the dietary reference values for women from efsa.16 to quantify skin functions , measurements took place after full acclimation to room conditions by volunteers ( temperature and humidity 21c1c , 45%5% , respectively ) for a period of approximately 20 minutes .
all evaluations were conducted in the absence of heat sources and forced convection , according to previously published recommendations.23 five anatomical sites were measured face ( zygomatic and forehead ) , arm ( ventral forearm and hand ) , and leg ( external face ) .
bmi ( body mass index ) and blood pressure were controlled throughout the study in order to identify potential changes in weight and hemodynamics .
the bmi was measured by the quetelet s formula , while hemodynamics were monitored by blood pressure and heart rate measurements .
the epidermal barrier function was assessed by the transepidermal water loss ( tewl ) measurement , obtained with the tewameter tm 300 ( ck electronics , cologne , germany ) , expressed in g / m / h , and by the epidermal hydration measured by the moisturemeter sc and moisturemeter d ( delphin technology d , bergisch gladbach , germany ) system , expressed in au ( arbitrary units ) .
function was assessed by the cutometer cm 575 system ( in mm ) from ck technologies .
the utility descriptors chosen were extensibility ( uf ) , the ability of the skin to return to its original state ( uf ua ) , total elasticity ( ua / uf , including pulse stretching and recovery ) , elastic function ( ur / ue ) , and viscoelasticity ( uv / ue).24,28,29
statistical analysis ( descriptive and comparative ) was performed using the spss version 20.0 ( spss inc . , chicago , il , usa ) software .
the cluster s analysis , which is based on a hierarchic model that groups similar objects , allowed to identify a group of individuals consuming less than 3,200 ml / day ( n=38 ) as group 1 , and another group of individuals consuming more than 3,200 ml / day ( n=11 ) , as group 2 .
the analysis of variance generalized linear model , the sphericity test of mauchly , and the levene test were applied to both groups . the goal was to test the homogeneity of these populations .
so , we confirmed that variance of endpoint variables for these two groups were similar and that the data distribution was narrow , tending to normal .
post hoc multiple comparisons were performed using the bonferroni test , a suitably robust method to control errors in handling.30 variables were also compared by the spearman correlation coefficient . a confidence level of 95% was adopted . due to the population homogeneity of age ,
the water consumption pattern was crucial to assess the impact of dietary water on the cutaneous physiology within this population .
previous results have drawn attention to the importance of diw in quantitative terms , representing more than 50% of the total water related to diet.1,21,31 diw includes water from food , juices and soup , and in accordance with those results , our ffq detected that diw contributed 57.2% of the total water accounted within these patients diets , stressing the need to consider all sources of water input to calculate the total water consumption ( figure 1 ) .
results obtained from both groups having different daily water consumptions revealed no relevant changes regarding epidermal barrier and tewl .
as shown in table 1 , we found a progressive decreasing gradient from the face , the highest ( forehead and zygomatic area ) , to the forearm and leg , where the lowest values were recorded in both groups .
this is in accord with the known expected anatomical and functional variation.3235 thus , our methodology did not significantly change the epidermal barrier in both groups .
regarding epidermal hydration , however , a dramatically different reality was registered , with a consistent improvement of superficial and deep hydration in both groups , although with different magnitudes ( table 2 ) .
in fact , changes observed in the group with lower initial water consumption ( group 1 ) were significantly greater and present in all anatomical areas , relative to the ( reduced ) impact observed in group 2 .
similar results were previously reported in individuals with dry skin , leading the authors to suggest that increasing the dietary water intake would affect the skin the same way as a topical moisturizer.2 in our current study , impact on epidermal hydration was consistently noticed in both surface and deep hydration variables , which may signify that more water is available for the normal physiological processes ( table 2 ) .
these effects are especially detectable in group 1 , from t1 forward . in order to look further into the impact of this dietary water overload on the skin s physiology
skin hydration has been related to skin mechanics to justify preservation of a younger , healthier looking skin .
dermal water was reported to decrease the friction between fibers , acting as a lubricant , including in the upper layers , thus facilitating the dynamics of the overall structure.26,36 however , a direct relationship between skin hydration and biomechanics has not been clearly demonstrated.3739 biomechanical descriptors such as maximum extensibility ( uf ) , the ability to return to the original state ( uf ua ) , total elasticity ( ua / uf ) , elastic function ( ur / ue ) , and the viscoelastic ratio ( uv / ue ) were chosen as the most relevant , in accordance to several authors40,41 and because they have been referred as the most useful to detect improvements in the plasticity of skin4145 ( table 3 ) .
as mentioned previously , our experimental methodology did impact skin biomechanics in both groups with different magnitudes , and statistically significant evidence of biomechanical changes could be found in group 1 ( table 3 ) .
total extensibility ( uf ) significantly improved in all body areas except the face after the 2 weeks of the test . by the end of the study , these improvements were still present in all the tested regions , with significant differences present in the leg , forearm , hand , and in the forehead ( table 3 ) .
similar impact was registered for the ability of the skin to return to its original state ( uf ua ) , which significantly increased after the 2 weeks ( t1 ) and 4 weeks ( t2 ) of the water surplus in all the tested areas , except the zygomatic region in the face .
this consistent increase of uf and uf ua throughout the study seems to be related with the highest amount of water available in the epidermis of these volunteers , facilitating deformation and recovery after stress , as has been previously suggested.25,46 the evolution of the other ratios are more difficult to follow .
total elasticity ( ua / uf ) was significantly reduced in all tested areas except the zygomatic , especially in t2 , and this reflects a higher impact of the water surplus on skin extensibility ( table 3 ) rather than in the elastic recovery ( ua ) .
the elastic function ur / ue and viscoelasticity ( uv / ue ) do not follow this pattern .
however , these descriptors are closely age - related , thus they depend primarily on the dermal components whose contribution(s ) can not be specifically quantified with these methods.28,40,47,48 a decrease in the viscoelasticity index has been reported after regular long - term use of topical moisturizers.26,43 we have finally analyzed a potential relationship between the most relevant descriptors representing epidermal hydration and biomechanics .
in fact , many of the factors that modify skin mechanical properties have been identified , but relationships between epidermal structure and these characteristics are still insufficiently documented . although suggested for many years,49 experimental evidence is still recent ( although rare ) , and are frequently obtained from other perspectives.5052 moreover , the in vivo approach is particularly difficult , considering the close relationship between cutaneous tissues and the poor discriminative capacity of currently available technology .
recent results from a three - layer computational skin model53 and from a new dynamic mechanical device,54 both assessing mechanical properties of skin under different conditions , suggested that the epidermis , the statum corneum in particular , and different factors such as hydration , do influence skin mechanical properties in vivo as well . after calculating a confidence range for each anatomical area
, our data was tested by the spearman correlation coefficient , a well - known determinant for these properties.41,45 in this way , an estimated interval allowed a mean value calculation for each variable in the face , upper limb ( forearm and hand ) , and leg in both groups .
as shown in table 4 , clear , consistent relationships between epidermal hydration and biomechanical descriptors could not be found under the present experimental conditions .
the water stress test seems to contribute to the significant relationships found , especially at t2 and in particular within group 1 .
the progressive reduction of these relationships from the face to the leg areas should also be mentioned ( table 4 ) .
more sensitive , discriminative technology may be a key aspect behind this apparent absence of differential data .
the clinical relevance of this approach should be strongly emphasized in specific conditions where the correction of skin water balance by strategies other than pharmacological might dramatically improve the patient s quality of life .
this particularly may be the case for the elderly or obese , for whom dry skin is a consistent compliant .
the present methodology allowed , for the first time , an objective clinical approach to study the effects of dietary water on normal skin physiology .
these results seem to confirm that higher water inputs in one s regular diet might positively impact normal skin physiology , as expressed by its hydration and biomechanical behavior , and in particular in those individuals with lower daily water consumptions . | it is generally assumed that dietary water might be beneficial for the health , especially in dermatological ( age preventing ) terms .
the present study was designed to quantify the impact of dietary water on major indicators of skin physiology .
a total of 49 healthy females ( mean 24.54.3 years ) were selected and characterized in terms of their dietary daily habits , especially focused in water consumption , by a food frequency questionnaire .
this allowed two groups to be set
group 1 consuming less than 3,200 ml / day ( n=38 ) , and group 2 consuming more than 3,200 ml / day ( n=11 ) .
approximately 2 l of water were added to the daily diet of group 2 individuals for 1 month to quantify the impact of this surplus in their skin physiology .
measurements involving epidermal superficial and deep hydration , transepidermal water loss , and several biomechanical descriptors were taken at day 0 ( t0 ) , 15 ( t1 ) , and 30 ( t2 ) in several anatomical sites ( face , upper limb , and leg ) . this stress test ( 2 l / day for 30 days ) significantly modified superficial and deep skin hydration , especially in group 1 .
the same impact was registered with the most relevant biomechanical descriptors .
thus , in this study , it is clear that higher water inputs in regular diet might positively impact normal skin physiology , in particular in those individuals with lower daily water consumptions . |
cochrane overviews of reviews ( cochrane overviews ) compile evidence from multiple systematic reviews of interventions into one accessible document .
an essential part of an overview is the assessment of the quality of evidence arising from the included reviews , and the grading of recommendations assessment , development and evaluation ( grade ) approach , is the framework recommended by the cochrane handbook to facilitate transparent rating of quality of evidence .
although principally developed for grading recommendations during guideline development , the grade system for assessing the quality of a body of evidence has gained widespread use within systematic reviews .
journal of clinical epidemiology has previously invited researchers to share their experiences of using grade .
we have recently published a cochrane overview of reviews relating to interventions to improve upper limb ( arm ) function after stroke . within this we identified , from 40 included systematic reviews , 127 comparisons with relevant outcomes .
we planned to grade the evidence for each relevant comparison using the grade definitions of high , moderate , low , or very low quality of evidence , , , , using definitions of these criteria from published literature on grade .
have previously found poor agreement on grading strength of evidence within systematic reviews using grade , even among experienced systematic reviewers .
concluded that more specific guidance was required to assist reviewers in judging grade of evidence .
in contrast to balshem et al . , who warned that a mechanistic approach
proposed exploring the advantages and disadvantages of concrete rules for reaching strength of evidence grades . in this brief report , we share our experience of developing and applying concrete rules to grading quality of evidence of the 127 comparisons included in our overview and discuss whether this was an advantageous approach .
the methods we used were exploratory , developed iteratively and pragmatically , to first explore the challenges of applying grade levels of evidence , and second , develop a systematic , consistent , and transparent approach to applying grade to efficiently grade the quality of evidence within these 127 comparisons .
we explored the process of applying grade levels of evidence to a sample of four purposively selected reviews , chosen to reflect a range of different types , format , and quality of reviews .
for the comparisons within these four reviews , two independent , experienced , reviewers with clinical knowledge relating to the topic assessed risk of bias , publication bias , indirectness , imprecision , and inconsistency and applied the grade levels of evidence based on their considered judgment .
the reviewers first familiarized themselves with published materials relating to best practices in using the grade framework , in particular the 2011 journal of clinical epidemiology 20-part series .
no statistical assessment of agreement between reviewers was carried out , as the aim of this exercise was simply to explore the application of grade to inform subsequent decisions regarding the methods we would adopt for the overview .
we used an expert panel approach ; the overview author team and professor wiffen , who was invited to share his methodological expertise and experience relating to cochrane overviews , attended an all - day meeting .
we had substantive discussions over the application of grade criteria , and the reviewers ' perceived challenges associated with the process .
we agreed to develop a set of objective criteria for determining whether the evidence relating to each comparison was of high , moderate , low , or very low quality .
the team discussed in depth which objective criteria were perceived to be most relevant to a judgment of quality of the particular evidence synthesized within this overview , and specific objective criteria perceived to support a judgment of high , moderate , or
an initial algorithm for assigning downgrades to the level of evidence was drafted based on these criteria .
the initial developed algorithm was applied to a convenience sample ( alphabetical selection ) of five reviews ( containing 43 comparisons ) identified for inclusion in the overview .
the assigned level of evidence based on this initial algorithm was explored and compared to previous , independently applied , subjective judgments of all overview authors . an iterative process , involving discussion between all overview authors , was then carried out , exploring the impact of the weighting assigned to each of the criteria included in the algorithm .
discussion and further refinement continued until all authors agreed on a revised algorithm , judged to assign an appropriate number of downgrades in response to different objective data .
we created and applied four different versions of a formula to assign levels of evidence based on numbers of downgrades to each of the 43 sample comparisons , and the resulting levels of evidence were explored and discussed by the overview authors .
discussion continued until all authors reached consensus on the number of downgrades which should equate to the grade levels of evidence of high , moderate , low , and very low .
we explored the process of applying grade levels of evidence to a sample of four purposively selected reviews , chosen to reflect a range of different types , format , and quality of reviews .
for the comparisons within these four reviews , two independent , experienced , reviewers with clinical knowledge relating to the topic assessed risk of bias , publication bias , indirectness , imprecision , and inconsistency and applied the grade levels of evidence based on their considered judgment .
the reviewers first familiarized themselves with published materials relating to best practices in using the grade framework , in particular the 2011 journal of clinical epidemiology 20-part series .
no statistical assessment of agreement between reviewers was carried out , as the aim of this exercise was simply to explore the application of grade to inform subsequent decisions regarding the methods we would adopt for the overview .
we used an expert panel approach ; the overview author team and professor wiffen , who was invited to share his methodological expertise and experience relating to cochrane overviews , attended an all - day meeting .
we had substantive discussions over the application of grade criteria , and the reviewers ' perceived challenges associated with the process .
we agreed to develop a set of objective criteria for determining whether the evidence relating to each comparison was of high , moderate , low , or very low quality .
the team discussed in depth which objective criteria were perceived to be most relevant to a judgment of quality of the particular evidence synthesized within this overview , and specific objective criteria perceived to support a judgment of high , moderate , or
an initial algorithm for assigning downgrades to the level of evidence was drafted based on these criteria .
the initial developed algorithm was applied to a convenience sample ( alphabetical selection ) of five reviews ( containing 43 comparisons ) identified for inclusion in the overview .
the assigned level of evidence based on this initial algorithm was explored and compared to previous , independently applied , subjective judgments of all overview authors .
an iterative process , involving discussion between all overview authors , was then carried out , exploring the impact of the weighting assigned to each of the criteria included in the algorithm .
discussion and further refinement continued until all authors agreed on a revised algorithm , judged to assign an appropriate number of downgrades in response to different objective data .
we created and applied four different versions of a formula to assign levels of evidence based on numbers of downgrades to each of the 43 sample comparisons , and the resulting levels of evidence were explored and discussed by the overview authors .
discussion continued until all authors reached consensus on the number of downgrades which should equate to the grade levels of evidence of high , moderate , low , and very low .
during the exploration of applying grade to a sample of reviews , both reviewers communicated that they felt there was a great deal of subjectivity involved in the assessment of grade levels of evidence and that the grade criteria were poorly defined and difficult to apply .
the reviewers both recounted that they lacked sufficient guidance to make judgments confidently , and agreement between reviewers on grade levels of evidence was inconsistent .
furthermore , both reviewers independently commented that their decisions to downgrade the level of evidence were largely being influenced by objective data that had been extracted for each comparison .
these data commonly included the results of the assessment of risk of bias ( on the cochrane risk of bias tool ) , measures of heterogeneity ( e.g. , i ) , and the volume of evidence ( number of trials and included participants ) . to develop the initial algorithm ,
it was agreed that the key criteria which were of most importance to our overview and which should be used to make objective decisions relating to the grade level of evidence were number of participants ; risk of bias of trials , specifically in relation to randomization and blinded outcome assessment ; heterogeneity ; and methodological quality of the review . the rationale and supporting evidence for agreement over these four criteria
table 2 illustrates the final algorithm which was agreed to be most appropriate for determining the number of downgrades to levels of evidence in reviews .
this algorithm results in a maximum of six downgrades for each assessed comparison ; table 3 illustrates the agreed formula for applying grade level of evidence from the number of assigned downgrades .
we developed an algorithm which provided a set of concrete rules for grading quality of evidence .
this algorithm was developed specifically for our cochrane overview and with careful consideration of the type of evidence included with this overview . with limited published guidance to aid decisions , the objective criteria , and the cutoffs within these criteria ,
were agreed by the overview team , using an iterative process of exploration and discussion .
undoubtedly , the selection of different methodological criteria , and cutoffs within these criteria , will have impacted on the grade levels allocated to evidence within this overview .
however , the weightings that our methods gave to different methodological criteria were considered in detail by the overview team , and care was taken to ensure that the resultant objectively determined grade levels reflected overview authors ' more subjective views of the quality of the evidence .
application of this algorithm to all 127 comparisons within our overview enabled us to efficiently compute the grade level of evidence based on objective data extracted from the included reviews .
the algorithm afforded a transparent and reproducible system , which avoided the need for subjective decision making , and we believe this is a key strength of our overview .
however , we are not advocating that our specific algorithm is directly applied to the assessment of quality of evidence within other overviews or in the assessment of other bodies of evidence .
rather we argue that this approach may have direct relevance and implications to authors of other overviews or those involved in assessing other bodies of evidence .
our algorithm was developed specifically to reflect what we judged to be important to the quality of this particular body of evidence .
both the criteria we included and the cutoffs we applied were specifically one might even argue
subjectivelyselected to reflect our expert opinions and considerations relating to what we perceived to be high- , moderate- , or low - quality evidence relating to interventions to improve upper limb function after stroke .
thus , although we have been mechanistic in our application of our algorithm , we were not mechanistic in its development .
the algorithm was developed based on detailed subjective judgment , informed by in - depth understanding of the topic area , of what was most important to the quality of this specific body of evidence .
we developed an algorithm , which assigned grade levels of evidence using a set of concrete rules , and successfully applied this within our cochrane overview .
our algorithm was developed to assess the specific body of evidence synthesized within our overview ; however , we believe that our approach to the application of grade levels of evidence may have widespread applicability .
we propose that this methodological approach has implications for assessment of quality of evidence within future evidence syntheses , which will be able to build on our work in this area .
| objectivesone recommended use of the grading of recommendations assessment , development and evaluation ( grade ) approach is supporting quality assessment of evidence of comparisons included within a cochrane overview of reviews . within our overview
, reviewers found that current grade guidance was insufficient to make reliable and consistent judgments . to support our ratings , we developed an algorithm to grade quality of evidence using concrete rules.methodsusing a pragmatic , exploratory approach , we explored the challenges of applying grade levels of evidence and developed an algorithm to applying grade levels of evidence in a consistent and transparent approach .
our methods involved application of algorithms and formulas to samples of reviews , expert panel discussion , and iterative refinement and revision.resultsthe developed algorithm incorporated four key criteria : number of participants , risk of bias of trials , heterogeneity , and methodological quality of the review .
a formula for applying grade level of evidence from the number of downgrades assigned by the algorithm was agreed.conclusionour algorithm which assigns grade levels of evidence using a set of concrete rules was successfully applied within our cochrane overview .
we propose that this methodological approach has implications for assessment of quality of evidence within future evidence syntheses . |
public health relies on comprehensive analyses of quality data to improve the health outcomes of people within a particular socio - political geographical boundary[13 ] .
this assumes that public health officials can achieve their goals simply by selecting , implementing , and evaluating cost - effective intervention for preventing and controlling disease and injury among people , without the willingness of the people to change their lifestyle practices .
people are not machines , which denote that they will not simply do what they are told or what an external agent states is best for them .
this is among the challenges faced by public health practitioners including medical practitioners in their attempt to effectively attain the stated aims of achieving particular health outcomes .
empirical evidence shows that even when people are experiencing ill - health , some of them do not seek medical care , and that social determinants such as income , poverty , health insurance , severity of illness and others are among the reasons for people 's unwillingness to seek health care[411 ] . for decades ( since 1988 ) ,
the planning institute of jamaica and the statistical institute of jamaica have been collecting data on jamaicans living conditions including their health conditions , health care - seeking behavior , and consumption patterns among other things , and the statistics showed that less than 20% of people have been ill in any given year and that their health care - seeking behavior has never surpassed 70% . in 1990 ,
the health care - seeking behavior of jamaicans was 38% and in 2007 , it reached a height of 70% .
health care - seeking denotes the percentage points of jamaicans who were ill that sought medical care , suggesting that despite all the investment in health by governments over the years , and the efforts of public health practitioners , there are in excess of 780,000 people who did not seek care although they indicated that they were experiencing ill - health in 2007 .
the unresponsiveness of jamaicans to seek medical care is even wider between the sexes . in 2007 , statistics revealed that 5.3% more females sought health care compared to males , and that this disparity was as much as 6.9% in 1999 .
a qualitative study by ali and de muynck in rawalpindi and islamabad , pakistan , revealed that street children were more willing to seek medical help based on ( 1 ) severity of illness , and ( 2 ) if the illness interfaced with their economic livelihood .
statistics for jamaica showed that males on average spent 11 days being treated for illness compared to 9 days for females , which not only concurs with the thinking of males in pakistan but goes to the culture of males unwillingness to seek medical care and higher mortality among them . using life expectancy to substantiate the effective of males unwillingness to seek medical care and its influence on mortality , and to establish that this not atypical to jamaica or pakistan , life expectancy for females in the world is 4.2 years more than that of males and 5.81 years in jamaica .
this is made even worse by poverty , as a study by bourne revealed that health care - seeking behavior is even lower among the poorest 20% in jamaica , suggesting that premature deaths are highly likely among this group .
a publication by the who opined that 80% of chronic illnesses were in low and middle income countries , and that 60% of global mortality is caused by chronic illness , suggesting that illness interfaces with poverty and vice versa , along with other socio - economic conditions[1820 ] . owing to their greater probability of unwillingness to seek medical care and a willingness to seek care based on severity of illness ,
a study of mortality in english and dutch - speaking caribbean nations from 1985 2000 , by ivory et al . found that males accounted for 54% of all deaths .
cancer of the prostate is the leading cause of mortality from malignant neoplasm of males in the english and dutch - speaking caribbean[2123 ] , yet still many men are unwilling to seek medical care or even to inquire about it , or have themselves examined by medical practitioners for the likelihood of having prostate cancer .
there is a question , is this any different among male health workers ? since the decentralization of the health care system in the 1990s ( with the passage of the national health services act of 1997 ) , the jamaican health care sector is now divided into four semi - autonomous regional bodies : south - east ; north - east , western and southern .
much of the analyses on health care have focused on the south - east region ( including the university of the west indies hospital the only training hospital in the country ) . despite the needed information on the south east , given that it is the largest region in the nation , the western region is the third largest in terms of population coverage , service utilization and health expenditure allocations . the western region of jamaica is the second largest utilization of pharmaceutical services from public hospitals , and represents 17% of the total population ( in 2002 ) , which suggests that this group warrants scientific examination , in particular the male health workers . for effective public health intervention
, an examination of rural western males is needed to provide an understanding of these men and how their health can be better planned for without using them to provide a benchmark for this cohort .
the current study aims to fill this void in the literature by examining the perception of rural male health workers ( from the western region ) about prostate examination , and why they are reluctant to inquire about the probability of having , or the likelihood of having prostate cancer .
the survey was submitted and approved by the university of the west indies medical faculty 's ethics committee .
all participants gave written informed consent to actively participate in the study , and they also were informed that they could discontinue the process at any time convenient to them .
the survey was submitted and approved by the university of the west indies medical faculty 's ethics committee .
all participants gave written informed consent to actively participate in the study , and they also were informed that they could discontinue the process at any time convenient to them .
the survey was submitted and approved by the university of the west indies medical faculty 's ethics committee .
all participants gave written informed consent to actively participate in the study , and they also were informed that they could discontinue the process at any time convenient to them .
the study utilized primary cross - sectional data that was collected during february and march 2008 from 170 males ( ages 29 years and older ) , health - care workers who were employed in particular rural health institutions in jamaica ( i.e. western regional health authority ) .
a listing of all male health workers in the western regional health authority ( i.e. wrha ) was obtained from the institution .
the sample was stratified by area of work , area of residence , and a table of random numbers was used to select the actual respondents , thereby facilitating independence of response . on occasions when an individual was selected and he could not participate , no other person was used to replace the individual . in cases where the selected person was not available , a minimum of three call - back visits would be made to that person 's place of work . a 26-item questionnaire was used to collect the data .
the instrument was sub - divided into general demographic profiles of the sample ; family history ; health - seeking behavior ; perception of prostate examination and choice of method in prostate examination .
test - retest reliability of the questionnaire was conducted about a month prior to the main study .
the instrument was vetted by academics from the university of the west indies , mona , jamaica . then
30 respondents who were non - participants in the main study were interviewed on two separate occasions about 7 days apart .
modifications were made to the final instrument based on the recommendations , queries and issues raised by the participants in order to attain clarity and conciseness of questions .
all field workers were trained in interviewing techniques , customer service and data collection over a four week period .
the criteria for exclusion and inclusion were based on being : ( 1 ) male , ( 2 ) 29 years and older , and ( 3 ) employed to the western regional health authority .
the age of 29 + was chosen because the literature stated that this is the age at highest risk of prostate cancer .
the response rate was 76.8% , and 2% of the data was lost during cleaning .
data were stored , retrieved and analyzed , using spss for windows ( 16.0 ) ( spss inc ; chicago , il , usa ) .
percentages were used to provide background information on the demographic characteristics of the sample , knowledge of prostate and self - reported information on prostate .
chi - square tests were utilized to examine whether statistical associations existed between non - metric dependent and independent variables . a p - value of 5% ( i.e. 95% confidence interval ) will be used to determine statistical associations between the variables .
decentralization shifted the central government ( i.e. ministry of health ) into four semi - autonomous regional bodies : south - east , north - east , western , and southern .
the south - east region consists of three parishes : kingston and saint andrew , saint catherine and saint thomas , which represents 47% of the population ( in 2002 ) .
the north - east region comprises the parishes of saint ann , saint mary and portland , which is 14% of the population ( in 2002 ) .
the western region constitutes trelawny , saint james , hanover , and westmoreland , which represents 17% of the population ( in 2002 ) .
digital rectal examination : this is a procedure in which an examiner inserts a gloved , lubricated finger into the rectum to determine the size , shape and texture of the prostate .
prostate cancer screening : this is an attempt to determine undetected cancer of the prostate .
western health region authority : professionals include doctors , administrators , nurses and public health inspectors .
skilled people mean those who are classified in any groups such as medical technologists or medical records clerks .
test - retest reliability of the questionnaire was conducted about a month prior to the main study .
the instrument was vetted by academics from the university of the west indies , mona , jamaica . then
30 respondents who were non - participants in the main study were interviewed on two separate occasions about 7 days apart .
modifications were made to the final instrument based on the recommendations , queries and issues raised by the participants in order to attain clarity and conciseness of questions .
all field workers were trained in interviewing techniques , customer service and data collection over a four week period .
the criteria for exclusion and inclusion were based on being : ( 1 ) male , ( 2 ) 29 years and older , and ( 3 ) employed to the western regional health authority .
the age of 29 + was chosen because the literature stated that this is the age at highest risk of prostate cancer .
the response rate was 76.8% , and 2% of the data was lost during cleaning .
data were stored , retrieved and analyzed , using spss for windows ( 16.0 ) ( spss inc ; chicago , il , usa ) .
percentages were used to provide background information on the demographic characteristics of the sample , knowledge of prostate and self - reported information on prostate .
chi - square tests were utilized to examine whether statistical associations existed between non - metric dependent and independent variables .
a p - value of 5% ( i.e. 95% confidence interval ) will be used to determine statistical associations between the variables .
decentralization shifted the central government ( i.e. ministry of health ) into four semi - autonomous regional bodies : south - east , north - east , western , and southern .
the south - east region consists of three parishes : kingston and saint andrew , saint catherine and saint thomas , which represents 47% of the population ( in 2002 ) .
the north - east region comprises the parishes of saint ann , saint mary and portland , which is 14% of the population ( in 2002 ) .
the western region constitutes trelawny , saint james , hanover , and westmoreland , which represents 17% of the population ( in 2002 ) .
the southern region comprises clarendon , manchester and saint elizabeth . , which represents 22% of the population ( in 2002 ) .
digital rectal examination : this is a procedure in which an examiner inserts a gloved , lubricated finger into the rectum to determine the size , shape and texture of the prostate .
prostate cancer screening : this is an attempt to determine undetected cancer of the prostate .
western health region authority : professionals include doctors , administrators , nurses and public health inspectors .
skilled people mean those who are classified in any groups such as medical technologists or medical records clerks .
test - retest reliability of the questionnaire was conducted about a month prior to the main study .
the instrument was vetted by academics from the university of the west indies , mona , jamaica . then
30 respondents who were non - participants in the main study were interviewed on two separate occasions about 7 days apart .
modifications were made to the final instrument based on the recommendations , queries and issues raised by the participants in order to attain clarity and conciseness of questions .
all field workers were trained in interviewing techniques , customer service and data collection over a four week period .
the criteria for exclusion and inclusion were based on being : ( 1 ) male , ( 2 ) 29 years and older , and ( 3 ) employed to the western regional health authority .
the age of 29 + was chosen because the literature stated that this is the age at highest risk of prostate cancer .
the response rate was 76.8% , and 2% of the data was lost during cleaning .
data were stored , retrieved and analyzed , using spss for windows ( 16.0 ) ( spss inc ; chicago , il , usa ) .
percentages were used to provide background information on the demographic characteristics of the sample , knowledge of prostate and self - reported information on prostate .
chi - square tests were utilized to examine whether statistical associations existed between non - metric dependent and independent variables .
a p - value of 5% ( i.e. 95% confidence interval ) will be used to determine statistical associations between the variables .
regional health authorities . decentralization shifted the central government ( i.e. ministry of health ) into four semi - autonomous regional bodies : south - east , north - east , western , and southern .
the south - east region consists of three parishes : kingston and saint andrew , saint catherine and saint thomas , which represents 47% of the population ( in 2002 ) .
the north - east region comprises the parishes of saint ann , saint mary and portland , which is 14% of the population ( in 2002 ) .
the western region constitutes trelawny , saint james , hanover , and westmoreland , which represents 17% of the population ( in 2002 ) .
the southern region comprises clarendon , manchester and saint elizabeth . , which represents 22% of the population ( in 2002 ) .
digital rectal examination : this is a procedure in which an examiner inserts a gloved , lubricated finger into the rectum to determine the size , shape and texture of the prostate .
prostate cancer screening : this is an attempt to determine undetected cancer of the prostate .
western health region authority : professionals include doctors , administrators , nurses and public health inspectors .
skilled people mean those who are classified in any groups such as medical technologists or medical records clerks .
demographic characteristic of sample table 1 presents information on the demographic characteristics of the sample .
the sample was 170 respondents : 74.8% of 40 49 years old ; 54.2% with secondary level education ; and 44.2% professionals .
three out of every 4 respondents indicated that they became aware of the prostate cancer screening through the media , as compared to 3% who indicated medical practitioners .
demographic characteristic of sample when respondents were asked to state what influenced their choice not to have a prostate examination done on them , most of them stated cost ( 31.6% ) ; availability of lab service , 6.5% ; fear of results , 25.8% ; other , 6.5% ; non - response , 9.7% . concurrently , when respondents were asked to state what influenced their choice of not doing a digital rectal examination , 20.6% indicated comfort level ; 9.4% stated the gender of the health practitioner , 5.3% mentioned fear and others did not respond .
table 2 highlights the information on self - reported knowledge of the place in the body where the prostate gland is located by either education or occupation .
a statistical relationship was found between knowing the location of the prostate gland and education ( 2 ( df = 6 ) = 13.907 , p = 0.031 ) and knowing the location of the prostate gland and occupation ( 2 ( df = 6 ) = 25.338 , p < 0.0001 ) .
respondents who had tertiary level education were most likely to be correct in stating the location of the prostate gland ( 84.2% ) compared to the other educational cohorts . on the other hand ,
professionals ( 85.7% ) were most likely to correctly state the place in the body in which the prostrate gland is located , compared to unskilled ( 30.8% ) , skilled ( 63.2% ) or casual workers ( 66.7% ) .
self - reported knowledge of prostate gland by education and occupation table 3 displays percentage points of respondents answers to particular questions on screening practices . of the valid sample ( n=169 )
, 93.5% responded to the question have you ever heard about the screening procedure for prostate ? of those who responded , 71.2% indicated yes .
although 71% were informed about the procedure of prostate screening , only 27.1% had got their prostate checked by a health practitioner .
table 4 presents information on the last time that an individual had , or had not done , a prostate examination . of the sample , 15% ( n=26 )
had done a prostrate examination and/or digital examination of the prostate gland 2 years ago . of those who had the examination 2 years ago
last prostate examination and by type of examination the study is not a representation of rural males , and so can not be generalizable as such .
the study is not a representation of rural males , and so can not be generalizable as such .
the study is not a representation of rural males , and so can not be generalizable as such .
the current research had 35.5% of the sample with tertiary level education ; 44.2% were professionals ( including doctors , nurses and hospital administrators ) ; 95.3% indicated that they had knowledge of prostate screening ; 71.8% correctly stated where the prostate gland is located in the human body ; and 27.1% had done a prostate examination . of those who had done the examination , 56.5% did so at least 2 years ago and 15.2% less than 6 months ago . while only 30.8% of unskilled males in the western regional health authority were able to correctly classify the location of the prostate gland in the human body , this figure increased to 85.7% among professionals and 84.2% among tertiary males .
this begs the question why are men like this ? the issue of males reluctance to seek medical care is embedded in cultural explanations . a caribbean anthropologist provided some justification of the caribbean male 's attitude using social learning theory to examine the lifestyle practices of boys .
he cited that young males who are culturalized to imitate the roles of society members do so by modeling their behavior on that of older males .
there is a cosmology that illness is an indicator of weakness , and males are socialized to be strong , which suggests that they are not to display weakness .
embedded in the anthropological explanation of males unhealthy life style behavior is the culture , which also extends across many other cultures[510 ] .
this denotes that the gender roles of the sexes account for many of the health disparities and outcomes between the sexes in the world .
ali and de muynck found that street children in pakistan had a similar gender stereotype about health , health care and medical care seeking - behavior based on the severity of the illness and whether the illness interfaces with their economic livelihood .
males perception of illness is such that a mild ailment is not severe enough to bar them from physical functioning , and it does not warrant health care - seeking behavior , as this is an indicator of weakness and not merely a question of being ill .
chevannes anthropological explanation is embodied in socialization , but a study by bourne found there was no statistical association between health care - seeking behavior and children and their sex .
it follows therefore that parents are not responsible for the males unwillingness to seek medical care , as both sexes utilize medical care equally , and this disparity begins after 15 years , when males will seek to establish their identity .
if chevannes explanation is justifiable , religion or spirituality plays a critical role in rural males low probability for prostate screening .
although 9 out of every 100 rural males of the sample knew of prostate cancer , the knowledge of where the prostate gland is and the technique associated with it upon examination violate cultural practices and ideology .
the inserting of the finger in the rectum is a fundamental rationale which deters many males from seeking to carry out this exercise .
jamaicans are highly homophobic , and this aids in the explanation of males unwillingness to have someone , in particular another male , examine or insert a finger in his anus .
this is considered to be a violation of his manhood , and clearly education does not remove this cultural barrier .
the current study interviewed 36% of tertiary graduates , or 44% of professionals , yet the rate of visits for prostate screening was 27% . when the respondents were asked to state the reason for their unwillingness to have prostate screening , 21% stated the discomfort and 9.4% claimed the sex of the medical practitioner , while over 30% did not respond to the question , which could indicate their strong objection to rectal examination .
the present study revealed that 38% of the sample indicated that they had discussed prostate screening with their medical care provider , but only 70.9% had done the examination .
the culture is deterring rural health care workers in the western regional health authority from seeking prostate screening , suggesting the power of early socialization agents such as peer groups and religion in forming people 's perception , practices and choice , and the difficulty of changing this culturalization through education .
a study by bourne found that health care - seeking behavior did not differ significantly between the sexes in jamaica , which concurs with a study by williams et al .. with there being no difference between the percentage of males and females seeking health care in jamaica , it can be extrapolated from the current study that the strength of culture in jamaica is rooted in the explanation for males unwillingness to seek medical care ; that this is across the sexes , and that it strengthens with rectal issues .
there are health behavior theories which have explained the difficulty of changing people 's health behavior .
these include health belief model ; theory of reasoned actions ; theory of planned behavior ; trans theoretical model and stages of change ; and precaution adoption process model .
although these were developed outside of the caribbean , they provide some explanation for people 's unwillingness to seek medical care and are also applicable to jamaica . according to glanz et al . , while it is reasonable to assume that a theory such as the health belief model is applicable to different cultures , it is also important to realize that constructs may have to be adapted to make them more relevant to the target culture .
those modifications may be applicable , with some generalizability , to developing nations , but this does not suggest a comprehensive understanding of caribbean peoples or of jamaicans .
although the health belief model did not emerge from data in jamaica or the wider caribbean , it has some merits which we examine in this study .
the health belief model ( hbm ) was developed in the 1950s by some social psychologists in the united states public health service .
it was designed to account for the failure of people to become involved in preventative and detection disease programmes ; and then it evolved to people 's response to symptoms with a later expansion that entails individuals behavior in response diagnosed dysfunctions .
hence , embedded in the hbm are preventative actions , illness behavior , and sick - role behavior , suggesting that dysfunction is the primary focus of this model .
based on the literature and the current findings , males perception of health risk and illness is not marginally influencing their health care seeking behavior , suggesting that hbm is not a good fit for the rural males who are employed to the western health authority .
there are many theories ( i.e. reasoned action and behavioral intentions ) that are applied to individual health behavior - change , and these , king and colleagues argued , are less relevant for populations in traditional communal cultures. in addition to the limitations identified , king and colleagues opined that hbm and other theories are dominated by western psychological theories of developed countries , and that they are based on an understanding of the individual 's cognitive process , which omits peoples of developing nations and their cultures .
cohen , scribner and farley , on the other hand , developed a model for behavior change using structural modeling , which addresses physical structures , social structures , cultural and media messages .
though cohen and colleagues work had broad parameters for public health behavior - change interventions , it has two critical limitations .
these models were established for developed nations , and despite modifications for developing countries , they are not developed specifically from data on developing nations or the caribbean and in particular jamaica .
second , the model omits to emphasize personality and cognition in public health behavior - change intervention .
elder noted that health communication and learning theories are culturally specific , and are relevant for developing countries .
irrespective of the health behavior theories that have been used by public health practitioners in jamaica , even among knowledgeable males in rural areas , prostate examination is a difficult decision for male workers of the western regional health authority .
the culture dominates behavior , even among those who are aware of the health choices , which suggests that merely being knowledgeable , rational and well - educated does not indicate high responsiveness to making better health choices when this is affected by fundamental cultural practices , ideology and norms .
the price of males reluctance to seek care and treat cancers is seen in malignant neoplasm of the prostate accounting for 7.6% of total deaths of males , which is the 5 leading cause of mortality for males 5 years and older .
hence , rural workers of the western regional health authority are obviously fearful of the probability of hearing that they have prostate cancer , and they would rather not know that this is the case .
prostate cancer awareness is clearly not the issue here , as the knowledge level was relatively adequate among the sample , which was the case in another study , and cost , fear of results and perception of prostate cancer are among the barriers , as much for rural health workers of the western regional health authority as for african american men .
there is a public health challenge for health practitioners in jamaica , especially in western areas , to have men do prostate cancer screening .
a recent survey conducted on health and lifestyle behavior found that 20.8% of jamaicans had done cancer screening compared to 1.3 times more in western areas ( 27.1% ) , indicating the dominance of the culture in deterring men from rectal examination .
's research , examines rural men in the western health authority region as well as providing information on knowledge and barriers to screening .
this study is on prostate screening among men in the afore - mentioned geographical areas , but it is not an indicator of men 's health .
men 's health is far wider than a single medical issue , but it provides an insight into men 's perception , attitude , knowledge and practices with regard to rectal examination , and by extension highlights the cultural challenges for public health policy makers to increase the low level of practice among jamaican men .
the current study is limited in terms of its generalizability to rural males or rural males in western jamaica , but it does provide an insight into the difficulty men have in breaking from culture .
this speaks to the challenges faced by public health workers to effectively manage human behaviors , and the difficulty of erasing the culture from the sample 's psyche which will have them take reasoned actions .
one of the recommendations of this study is a similar study on jamaicans in order to establish some of the issues that emerged from these findings , and secondly , research on the belief system of jamaican in order to better guide intervention strategy in the future . | background : statistics have shown that since 1988 , a significant percentage of males are unwilling to seek medical care .
the question is if they had the knowledge , worked in the health system and were educated , would this be any different?aim : the current study aims to fill this void in the literature by examining the perception of rural male health workers ( from the western region ) about prostate examination , and why they are reluctant to inquire about the probability of having , or the likelihood of not having prostate cancer.materials and methods : the study utilized primary cross - sectional data that was collected during february and march 2008 from 170 males ( ages 29 years and older ) , health - care workers who were employed in particular rural health institutions in jamaica ( i.e. western regional health authority ) .
spss was used to analyze the data.results:when the respondents were asked have you ever heard about the screening procedure for prostate ?
71.2% indicated yes , but only 27.1% had got their prostate checked by a health practitioner . when respondents were asked to state what influenced their choice of not doing a digital rectal examination , 20.6% indicated comfort level ; 9.4% stated the gender of the health practitioner , 5.3% mentioned fear and others did not respond . of those who had the examination 2 years ago ,
96.5% did not state the choice of method.conclusion:the current study is limited in terms of its generalizability to rural males or rural males in western jamaica , but it does provide an insight into the difficulty of men in breaking away from culture . |
a previously healthy 53-year - old asian man presented to the emergency department with a 1-day history of severe bilateral testicular pain and swelling .
he reported feeling generally unwell for 3 weeks with fatigue , myalgias , and intermittent fevers .
he had no history of dysuria , hematuria , urethral discharge , prostatism , scrotal trauma , or surgery . on examination , he was febrile ( 37.9 ) , his right eye was noted to be inflamed , and there was mild swelling of both ankles .
g / l ( normal range : 135 - 180 ) , white cell count of 14.510/l ( normal range : 4 - 11 ) , neutrophils of 12.910/l ( normal range : 2 - 8 ) , and c - reactive protein of 94 mg / l ( normal range : < 5 ) . his bilirubin was 43
mol / l ( normal range : 3 - 18 ) , ggt was 149 /l ( normal range : 5 - 65 ) , and albumin was 23
creatinine , anca , ana , ebv serology , urinalysis , and testicular tumor markers were normal .
scrotal ultrasound revealed two avascular , intratesticular lesions of 2.3 cm and 2.1 cm in diameter on the left and a similar 2 cm lesion on the right ( fig .
a diagnosis of severe bilateral orchitis was made and the patient was treated with intravenous ampicillin and gentamicin but failed to improve . on the fourth day of the hospital admission , the patient developed left facial weakness and the crp level increased further to 190 mg / l .
intraoperatively , more than one third of the testicle was necrotic with coagulated blood ( fig .
2 ) . histopathology demonstrated features of transmural inflammation and fibrinoid necrosis of medium - sized vessel walls , consistent with pan ( fig .
only one testis was explored and minimal debridement was done to conserve as much testicular tissue as possible .
postoperatively , treatment consisted of intravenous methylprednisolone and cyclophosphamide 500 mg weekly for 6 weeks followed by oral prednisone and cyclophosphamide maintenance .
the testicular pain was resolved after 5 days and the left seventh nerve palsy was resolved after 3 months .
five months after disease onset he was asymptomatic and his crp was 0.5 mg / l with prednisone 5 mg / day and cyclophosphamide 500 mg / wk .
after 6 months of follow - up , no relapse had occurred and his testosterone level was in the low normal range .
pan is a multisystem necrotizing vasculitis that is characterized by segmental transmural inflammation of small or medium - sized arteries with resultant tissue necrosis .
pan may present as either a limited or systemic disease and may be either primary or secondary when associated with hepatitis b virus infection , a connective tissue disease , or leukemia .
testicular involvement is one of the acr diagnostic criteria for pan ( table 1 ) .
although isolated vasculitis of the testis is uncommon , involvement of the testis is reported in up to 86% of systemic pan in autopsy studies .
uncommonly , testicular involvement is the initial manifestation of systemic disease and the clinical presentation may include pain , swelling , atrophy , or a palpable mass .
pan is often diagnosed late and may be mistaken for acute infection , torsion , or tumor .
systemic manifestations such as fever , fatigue , and weight loss further confound the diagnosis .
both conditions may present as a mass lesion and reveal multiple hypoechoic areas on scrotal ultrasound .
mononeuritis multiplex is the most common manifestation , with cranial nerve palsies present in less than 2% of cases .
the oculomotor ( iii ) , trochlear ( iv ) , abducens ( vi ) , facial ( vii ) , and acoustic ( viii ) nerves are affected most often . with the introduction of corticosteroids and immunosuppressants such as cyclophosphamide
, the 5-year survival rate has increased from 13% to 80% . with evidence of neurological involvement ,
our patient was started on high - dose intravenous methylprednisone and cyclophosphamide with good effect . in this case
, we also report successful conservative management with normal endocrine testicular function ( table 2 ) [ 6 - 9 ]
. the facial weakness resolved after 3 months . to our knowledge , this is the first reported case of pan presenting with bilateral testicular swelling with the subsequent development of a facial nerve palsy .
this case highlights that the diagnosis of pan needs a high index of suspicion in presentations of testicular swelling accompanied by systemic symptoms .
an expedited diagnosis will permit early instigation of treatment and could prevent the extent and distribution of other end - organ damage . | polyarteritis nodosa ( pan ) is a systemic necrotizing vasculitis that is generally restricted to medium - sized vessels . here
we describe the first case of a patient in which a bilateral testicular mass was a presenting symptom and the diagnosis was made on the basis of testicular histopathology . a 53-year - old asian man presented with a history of constitutional symptoms and testicular swelling .
scrotal ultrasound revealed two avascular , bilateral , intratesticular lesions .
the bilateral testicular abscess was treated without improvement .
the patient developed left seventh cranial nerve palsy during his admission .
the clinical changes made vasculitis or a related disorder more likely and the patient underwent a right testicular biopsy .
histopathology demonstrated features of transmural inflammation and fibrinoid necrosis of medium - sized vessel walls , consistent with pan .
this case illustrates the difficulty in diagnosing polyarteritis nodosa with isolated bilateral testicular swelling and the delay in the diagnosis .
after 9 months of follow - up , no relapse had occurred and the patient 's testosterone level was on the lower side of normal . |
the diagnosis of hepatic masses is important for clinical decision - making and it is typically achieved by percutaneous or transjugular biopsy .
small liver masses ( < 2 cm ) and those that are difficult to differentiate from the background parenchyma are not easily accessible by ultrasound ( us)- or computed tomography ( ct)-guided percutaneous biopsy .
recently , endoscopic ultrasound ( eus ) has been widely used for the diagnosis and management of gastrointestinal and pancreatobiliary diseases .
however , the role of eus - guided fine - needle aspiration ( eus - fna ) in the diagnosis of liver lesions has not been well described . to date , few studies have demonstrated the feasibility and safety of eus - guided liver biopsy ; the results indicated that the specimen adequacy with eus - fna was variable ( 19%100% ) .
furthermore , there was no study to investigate the role of eus - fna in the right hepatic lobe .
the aim of this study is to evaluate the feasibility and safety of eus - fna in patients with liver masses including the right lobe .
forty - seven consecutive patients who underwent eus - fna for liver lesions between september 2010 and february 2016 at asan medical center were included in this single - arm observational study .
all patients were aged > 20 years and had hepatic masses detected by us or ct .
the indications of eus - fna included a pancreatic lesion with liver mass , failure of percutaneous liver biopsy , contraindication of percutaneous liver biopsy , and liver mass to assess primary lesion and establish tissue diagnosis .
no patient used antiplatelet agents within the last 5 days before the procedure . written informed consent
this study was approved by the institutional review board ( irb ) of asan medical center ( irb number : 2016 - 0417 ) .
all procedures were performed under conscious sedation with intravenous midazolam and meperidine using a linear array echoendoscope ( gf - uct 240 ; olympus optical , tokyo , japan ) .
tissue acquisition was performed with a 22-gauge or a 25-gauge needle ( expect , boston scientific , natick , mass ) .
after careful evaluation of the target lesion and regional vasculature with eus , including real - time doppler , fna was performed either from the stomach or duodenum . the needle was advanced into the target lesion under eus guidance .
specimen was obtained by moving the needle to - and - fro within the lesion while applying negative pressure by using a 10 ml syringe .
suction was released by closing the syringe lock , and the needle was finally removed .
the aspiration was repeated until enough specimen was obtained , as determined by gross inspection .
the material on the slide was carefully inspected by the endosonographer after each pass to determine successful acquisition of specimen , as is done for percutaneous liver biopsy , with additional passes performed if necessary .
if a specimen obtained by the first needle pass was bloody , eus - fna was performed without applying negative pressure .
the specimen samples were smeared on glass slides for cytological examination , fixed in 95% ethanol , and stained with hematoxylin and eosin stain .
patients were observed for immediate complications in the recovery room for 1 h and were followed up for 1 month to monitor for potential late adverse events .
patients with hepatic masses for whom eus - fna was not diagnostic were clinically followed up for a minimum of 6 months .
cytological diagnoses were classified as positive for malignancy , suspicious for malignancy , atypical , negative , and inadequate .
cytological examination that was diagnostic for malignancy was considered the definitive diagnosis . for patients in whom eus - fna was not diagnostic for liver masses ,
the definite diagnosis was made on the basis of additional tissue specimens obtained by other methods such as surgical resection and us - guided liver biopsy or on clinical follow - up with imaging studies > 6 months .
sample size calculation was not planned because of the nature of the feasibility trial in the first pilot study .
whitney u - test and fisher 's exact test were used to test for differences in comparisons between continuous and dichotomous variables , respectively .
forty - seven consecutive patients who underwent eus - fna for liver lesions between september 2010 and february 2016 at asan medical center were included in this single - arm observational study .
all patients were aged > 20 years and had hepatic masses detected by us or ct .
the indications of eus - fna included a pancreatic lesion with liver mass , failure of percutaneous liver biopsy , contraindication of percutaneous liver biopsy , and liver mass to assess primary lesion and establish tissue diagnosis .
no patient used antiplatelet agents within the last 5 days before the procedure . written informed consent
this study was approved by the institutional review board ( irb ) of asan medical center ( irb number : 2016 - 0417 ) .
all procedures were performed under conscious sedation with intravenous midazolam and meperidine using a linear array echoendoscope ( gf - uct 240 ; olympus optical , tokyo , japan ) .
tissue acquisition was performed with a 22-gauge or a 25-gauge needle ( expect , boston scientific , natick , mass ) .
after careful evaluation of the target lesion and regional vasculature with eus , including real - time doppler , fna was performed either from the stomach or duodenum . the needle was advanced into the target lesion under eus guidance .
specimen was obtained by moving the needle to - and - fro within the lesion while applying negative pressure by using a 10 ml syringe .
suction was released by closing the syringe lock , and the needle was finally removed .
the aspiration was repeated until enough specimen was obtained , as determined by gross inspection .
the material on the slide was carefully inspected by the endosonographer after each pass to determine successful acquisition of specimen , as is done for percutaneous liver biopsy , with additional passes performed if necessary .
if a specimen obtained by the first needle pass was bloody , eus - fna was performed without applying negative pressure .
the specimen samples were smeared on glass slides for cytological examination , fixed in 95% ethanol , and stained with hematoxylin and eosin stain .
patients were observed for immediate complications in the recovery room for 1 h and were followed up for 1 month to monitor for potential late adverse events .
patients with hepatic masses for whom eus - fna was not diagnostic were clinically followed up for a minimum of 6 months .
cytological diagnoses were classified as positive for malignancy , suspicious for malignancy , atypical , negative , and inadequate .
cytological examination that was diagnostic for malignancy was considered the definitive diagnosis . for patients in whom eus - fna was not diagnostic for liver masses ,
the definite diagnosis was made on the basis of additional tissue specimens obtained by other methods such as surgical resection and us - guided liver biopsy or on clinical follow - up with imaging studies > 6 months .
sample size calculation was not planned because of the nature of the feasibility trial in the first pilot study .
whitney u - test and fisher 's exact test were used to test for differences in comparisons between continuous and dichotomous variables , respectively .
forty - seven consecutive patients who underwent eus - fna for liver lesions between september 2010 and february 2016 at asan medical center were included in this single - arm observational study .
all patients were aged > 20 years and had hepatic masses detected by us or ct .
the indications of eus - fna included a pancreatic lesion with liver mass , failure of percutaneous liver biopsy , contraindication of percutaneous liver biopsy , and liver mass to assess primary lesion and establish tissue diagnosis .
no patient used antiplatelet agents within the last 5 days before the procedure . written informed consent
this study was approved by the institutional review board ( irb ) of asan medical center ( irb number : 2016 - 0417 ) .
all procedures were performed under conscious sedation with intravenous midazolam and meperidine using a linear array echoendoscope ( gf - uct 240 ; olympus optical , tokyo , japan ) .
tissue acquisition was performed with a 22-gauge or a 25-gauge needle ( expect , boston scientific , natick , mass ) . after careful evaluation of the target lesion and regional vasculature with eus , including real - time doppler , fna was performed either from the stomach or duodenum .
specimen was obtained by moving the needle to - and - fro within the lesion while applying negative pressure by using a 10 ml syringe .
suction was released by closing the syringe lock , and the needle was finally removed .
the aspiration was repeated until enough specimen was obtained , as determined by gross inspection .
the material on the slide was carefully inspected by the endosonographer after each pass to determine successful acquisition of specimen , as is done for percutaneous liver biopsy , with additional passes performed if necessary .
if a specimen obtained by the first needle pass was bloody , eus - fna was performed without applying negative pressure .
the specimen samples were smeared on glass slides for cytological examination , fixed in 95% ethanol , and stained with hematoxylin and eosin stain .
patients were observed for immediate complications in the recovery room for 1 h and were followed up for 1 month to monitor for potential late adverse events .
patients with hepatic masses for whom eus - fna was not diagnostic were clinically followed up for a minimum of 6 months .
cytological diagnoses were classified as positive for malignancy , suspicious for malignancy , atypical , negative , and inadequate .
cytological examination that was diagnostic for malignancy was considered the definitive diagnosis . for patients in whom eus - fna was not diagnostic for liver masses ,
the definite diagnosis was made on the basis of additional tissue specimens obtained by other methods such as surgical resection and us - guided liver biopsy or on clinical follow - up with imaging studies > 6 months .
sample size calculation was not planned because of the nature of the feasibility trial in the first pilot study .
whitney u - test and fisher 's exact test were used to test for differences in comparisons between continuous and dichotomous variables , respectively .
the median patient age was 63 years ( iqr : 5973 ) , and 27 patients ( 57.4% ) were male .
the indications for eus - fna are shown in table 2 . the most common indication was a pancreatic lesion with liver mass and concurrent eus - fna of pancreatic and liver masses underwent in 16 of 47 patients ( 34% ) figure 1 .
the baseline characteristics of patients who underwent endoscopic ultrasound - guided fine - needle aspiration clinical characteristics and cytological results of endoscopic ultrasound - guided fine - needle aspiration final diagnosis achieved with endoscopic ultrasound - guided fine needle aspiration ( a ) computed tomography showing a pancreatic mass accompanied with a liver mass at segment 4 .
( b ) positron emission tomography original magnification 40 showing hypermetabolic lesions in the pancreas and liver .
( c ) endoscopic ultrasound - guided fine - needle aspiration concurrently performed in pancreas and liver .
surgical specimen of liver acquired during pancreaticoduodenectomy shows no malignant cells in liver tissue acquisition was successful in 46 of 47 ( 97.9% ) patients .
eus - fna failed in one patient because the liver lesion was not detected on eus .
specimens were acquired from the left lobe in 30 patients ( 63.8% ) and the right lobe in 17 patients ( 36.2% ) .
the median distance of the liver mass from the transducer was 1.9 cm ( iqr : 1.52.7 ) . on microscopic examination ,
tissue specimens obtained by eus - fna were determined as adequate in 42 of 46 patients ( 91.3% ) .
the pathological diagnosis was malignancy in 23 of 46 patients ( 50% ) , suspicious for malignancy in 6 patients ( 13% ) , atypical in 4 patients ( 8.7% ) , and negative for malignancy in 9 patients ( 19.6% ) .
the final diagnosis was based on cytological / histological findings in 42 patients ( 89.4% ) and clinical follow - up with imaging studies in five patients ( 10.6% ) . among patients who were diagnosed by cytology ,
two patients ( 4.3% ) were diagnosed by us - guided liver biopsy , and the surgical specimens in the remaining two patients showed inconclusive histological findings on eus - fna .
we compared the outcomes of eus - fna between the right lobe and left lobe mass .
median size of lesions on eus and median number of needle passes did not differ significantly between the left and right lobes [ table 4 ] .
the median distance of the liver mass from the transducer in the right lobe and in the left lobe was 2.3 cm ( iqr : 1.92.9 ) and 1.6 cm ( iqr : 1.42.3 ) , respectively .
the distance of the liver mass from the transducer was significantly longer in the right lobe ( p = 0.01 ) .
technical success rate was also similar in both lobes ( 30/30 , 100% vs. 16/17 , 94.1% , p = 0.2 ) . however , adequate specimen obtained was significantly higher in the left lobe ( 28/30 , 93.3% vs. 14/17 , 82.4% , p = 0.04 ) . diagnostic accuracy for liver masses was not statistically different ( 25/28 , 89.3% vs. 13/14 , 92.9% , p = 0.86 ) . none of the patients experienced procedure - related adverse events .
comparison of characteristics and outcomes of endoscopic ultrasound - guided fine needle aspiration between left and right lobes
our study demonstrated that eus - fna is a technically feasible and safe procedure , even the mass located in the right lobe .
it can provide a cytopathological diagnosis of liver masses , and the study further showed that eus could identify liver lesions that could not be visualized by us or ct .
in addition , our results suggested that eus - fna might be utilized as a rescue procedure in cases of failure to obtain specimen by a percutaneous approach .
eus - fna for liver lesions could be performed concurrently in the setting of intra - abdominal tumor metastases , where confirmation of malignancy and staging could be accomplished in the same session .
finally , eus - fna for evaluation of liver lesions showed excellent safety in this study .
liver metastasis can significantly affect the management and prognosis of patients ; thus , liver biopsy is critical for diagnosis , staging , and clinical management of patients with liver lesions .
although trans - abdominal us and contrast - enhanced ct are the most commonly used imaging studies to evaluate liver masses , detection rates of these modalities for small lesions are relatively low .
us- or ct - guided percutaneous liver biopsy has technical limitations in the assessment of small focal lesions whereas eus and eus - fna can detect small liver lesions .
furthermore , eus provides an excellent resolution of liver lesions without interference of the rib cage or pleural deflection . in the current study ,
eus - fna was performed for lesions that were located in the right lobe in 17 patients ( 36.2% ) . to the best of our knowledge ,
this is the largest study of its kind assessing the diagnostic accuracy of eus - fna for right hepatic lesions .
diagnostic yield for liver lesions is similar in both lobes ( 25/28 , 89.3% vs. 13/14 , 92.9% , p = 0.86 ) . in one patient ,
the liver lesion that was located in the right posterior segment was not well visualized ; therefore , eus - fna was not possible .
although the diagnostic accuracy of lesions in the right lobe is generally limited , our results demonstrated that eus - fna is possible for the acquisition of specimens from the right lobe .
evaluation of lesions in the right lobe is usually difficult because endosonographic examination is performed from the duodenum , which has a small endosonographic window . in the setting of higher frequencies ,
the depth of examination is limited to 56 cm ; hence , lesions in the right anteriosuperior and right posterior segments may not be visualized well .
however , the inherent disadvantage with decreased depth of penetration may be partially overcome by reducing the frequency of echoendoscope down to 5 mhz .
therefore , the development of wide frequency of echoendoscope to assess the right lobe lesions by eus - fna may be warranted .
in the current study , 12 patients ( 25.5% ) underwent eus - fna after failure with the percutaneous approach .
eus - fna was diagnostically helpful in 9 of 12 patients ( 75% ) , in agreement with a study by tenberge et al . who also reported that eus - fna was able to diagnose malignancy in 23 of 26 patients following a nondiagnostic fna under transabdominal us guidance .
the higher success rate achieved with eus - fna than with trans - abdominal us approach appears to be because of the higher resolution of images which improved access to lesions .
eus - fna led to a diagnosis of malignancy in cases where percutaneous liver fna failed to obtain specimen for cytological diagnosis .
the utility of eus - fna as a complementary method will be more significant although it can not completely replace percutaneous biopsy .
as one of its major advantages , eus - fna can be performed simultaneously for lesions of the pancreas and liver . in patients with pancreatic cancer ,
the probability that small liver lesions are metastatic is higher ; thus , their evaluation is critical for clinical management .
the presence of liver metastasis is generally an indication of an inoperable and incurable malignancy .
eus has been used to evaluate pancreatic cancer with high sensitivity , ranging from 88% to 99% .
chang et al . reported that eus could detect small , focal liver lesions that were missed by ct scan in 11 of 574 patients ( 2.4% ) . in our study , 16 of 47 patients ( 34% ) underwent eus - fna for pancreatic and liver lesions in the same session .
cytopathological diagnosis was confirmed by eus - fna in 14 of 16 patients ( 87.5% ) .
thirteen of these 14 patients were diagnosed with metastases and avoided unnecessary surgery . in our experience , eus - fna
might be considered for the evaluation of liver metastases in the setting of intra - abdominal tumors .
tenberge et al . reported that 4% of the patients developed eus - fna - related adverse events and that eus - fna was more sensitive than percutaneous biopsy in the diagnosis of liver masses in the same patient cohort . in our study , there were no procedure - related adverse events among a total of 47 patients who underwent eus - fna .
our results provide further evidence that eus - fna for liver lesions is a safe procedure .
in contrast , percutaneous liver biopsy may cause significant pain that is not relieved by preprocedural local anesthesia in most patients and may further cause serious adverse events such as severe bleeding and bile peritonitis . under eus
guidance , fna can be safely performed as intervening blood vessels can be avoided by the simultaneous use of color flow and doppler , thus minimizing the risk of bleeding in the setting of advanced liver cirrhosis and coagulopathy .
in addition , albeit rare , percutaneous fna for malignancy was associated with tumor implantation . to date , no occurrences of tumor seeding after eus - fna for liver metastases were reported .
moreover , eus - fna can assess caudate lobe mass which is challenging by percutaneous biopsy due to its anatomic location .
therefore , eus - fna may be an alternative , safe , and reproducible method of liver biopsy that can yield satisfactory specimens .
optimal diagnostic results may be achieved by combining cytological and histological analyses , especially when assessment of architectural features is essential ( e.g. , malignant lymphomas or well - differentiated tumors ) or when a large number of cells are required to determine the malignancy potential ( e.g. , gastrointestinal stromal tumors ) .
in addition , on - site evaluation of cytological specimens for adequacy can improve diagnostic accuracy .
second , this study was a single - arm observational study and did not compare the outcomes of eus - fna with those of percutaneous biopsy
. therefore , further comparative studies with a large number of patients are necessary to confirm the efficacy and safety of eus - fna for liver lesions .
eus - fna for liver masses was helpful and safe for the diagnosis of malignant liver masses , especially in cases where the percutaneous approach failed .
eus - fna may be considered as the next step in patients for whom the percutaneous approach fails .
furthermore , cytological diagnosis of liver metastases in the setting of intra - abdominal tumors , which may change the clinical management of patients , is possible within the same session by eus - fna .
finally , the right lobe lesions can be assessed and targeted by eus - fna although there is a limitation of penetration depth .
| background and objectives : endoscopic ultrasound - guided fine - needle aspiration ( eus - fna ) has been established as a safe and accurate method for diagnosing and staging intra - abdominal mass .
however , few studies investigated its feasibility , efficacy , and safety for targeting liver mass .
we evaluated the efficacy and safety of eus - fna in patients with liver masses including the right lobe.patients and methods : the technical feasibility , safety , and diagnostic yield were determined in 47 patients ( 30 in the left lobe and 17 in the right lobe ) presenting with liver masses between september 2010 and february 2016.results:thirty-eight patients ( 80.9% ) had malignancies whereas nine patients ( 19.1% ) had benign liver masses .
technical success rate was 97.9% ( 46/47 ) .
eus - fna was diagnostic in 38 of 42 patients ( 90.5% ) .
when the outcomes of eus - fna between right liver mass and left mass were accessed , the technical success rates were similar in both lobes ( 100% vs. 94.1% , p = 0.2 ) .
the median tumor size on eus ( 25.5 mm , interquartile range [ iqr ] 13.830.3 vs. 28 mm , iqr 18.543.5 , p = 0.24 ) and number of needle passes ( 3 , iqr 34 vs. 3 , iqr 33 , p = 0.24 ) were not significantly different .
adequate specimen obtained was statistically higher in the left lobe ( 28/30 , 93.3% vs. 14/17 , 82.4% , p = 0.04 ) . however , diagnostic accuracy for liver masses was not different ( 25/28 , 89.3% vs. 13/14 , 92.9% , p = 0.86 ) .
no complications developed after procedure.conclusions:eus-fna can be a safe and efficient method for the diagnosis of liver mass and it is technically feasible even for those in the right lobe . |
mortality registration is the oldest form of disease surveillance , and its importance for epidemiology and public health planning is perhaps obvious .
two of the millennium development goals and one out of three essential elements of the human development index are specific mortality measures ( 1 , 2 ) , enhancing the need for valid and representative data on mortality and its risk factors to track progress , evaluate disease - control programmes and monitor major global health initiatives . consistent and reliable cause - specific mortality data therefore constitute a crucial and major resource for health planning and prioritisation ( 3 ) . however , the chance of a death being registered and the cause of death documented strongly depends on the socioeconomic status of the community and nation in which it occurs ( 3 ) . with little or no progress in civil registration systems in the last 50 years ,
between two - thirds and three - quarters of the world 's population remain outside any kind of systematic health surveillance ( 48 ) . as of 2003 , 60% of united nations
however , regional coverage of death registration is less than 10% in the africa region and is considered to be complete in only one - third of the 115 reporting countries those providing data of high quality representing only 12% of the world 's population ( 6 , 9 ) .
this ongoing lack of knowledge on who lives and dies where and from what has been described as the single most critical failure of development over the past 30 years and the lack of any record of the lives of billions living in poorer countries as a scandal of invisibility ( 10 ) .
tracing the imprint of a person 's existence , including their birth and death , not only confirms ideals of citizenship , but also represents the first step in securing population rights to life , freedom and protection ( 11 ) . a popular application of finagel 's law to health measurement states that the data we have are not the data we need ; the data we need are not the data we want ; the data we want are unobtainable ( 12 ) . underlying this saying are the methodological realities of data capture as well as the conceptual aspects of the intended users and use of data ( fig .
mortality measurement is based on highly interconnected relationships between the actual situation one wants to measure , the methods available for measurement and data needs , which should be informed by the intended use of the data . in practice ,
methodological approaches to measuring mortality and assigning causes of death do not always appear to be directly informed by the intended use of the data , but rather by an underlying presumption of a
appreciation of differing needs and uses of mortality data should inform the methods used so that the data we have are reconciled with the data we need .
in practical public health terms , there are different levels at which cause - specific mortality data are needed , ranging from the local to the global .
health managers require cause - specific mortality data to effectively plan health services based on local patterns of disease . at this level , it is essential to be able to monitor major causes of death simply and cheaply . the breakdown of cause - of - death categories based on a few hundred cases is needed and very detailed causes of death would be superfluous .
epidemiologists , health service researchers and assessors of specific health interventions , such as safe motherhood interventions , need a consistent assessment of cause - specific mortality to determine trends in causes of death that enable evaluations of the effectiveness of interventions across time and regions .
for such users , a reduction in rates of a specific cause of death is usually an important endpoint for example , detailed sub - causes of maternal mortality .
national and global authorities concerned with building respective pictures of health patterns require consistent and reliable cause - specific mortality data from a wide range of settings ( 3 ) .
for all users in low- and some middle - income settings , however , mortality registration processes and methods often have to be implemented from first principles .
this has resulted in a variety of different approaches to population health surveillance , ranging from one - off cross - sectional surveys to longitudinal monitoring of population cohorts . as a result
, mortality surveillance methodologies vary widely between settings and seemingly ad hoc approaches that are not always explicit about the gap in health information that they are attempting to fill or do not seem to be directly related to the intended use of the data are apparent .
furthermore , lack of standardisation and rigorous validations hinder meaningful comparisons of data between settings and over time , and may diminish the use of surveillance data for public health action . a common ,
if perhaps simplistic , understanding of the purpose of population surveillance is to gain an overall impression of population composition and distribution of risk factors to inform public health action
. if this is the case , then when are surrogate methods for more widespread health surveillance in resource - poor settings and the data derived from these methods
good enough for this purpose ? understanding the particular strengths and limitations of existing methods , the data that they generate and how such data can be used to meet specific needs is essential to reconcile the data we want with the data we actually need and the data that we can get . with a particular focus on health and demographic surveillance systems ( hdsss )
, this paper summarises recent research and conceptual development on some methodological aspects of mortality surveillance that stem from a series of empirical investigations ( 13 ) .
for the majority of the world 's population , for whom vital events of births and deaths are not counted , hdsss have emerged as a useful surrogate .
notwithstanding local and contextual variations , hdsss maintain regular surveillance of births , deaths and migrations and , frequently , social and economic correlates of population and health dynamics , in an open cohort population within a clearly circumscribed geographic area ( 14 ) .
this is achieved through selecting a population , conducting an initial census and following up by periodic household surveys .
such approaches are unique in that they are able to generate data in settings with no other comparable source of information on births , deaths and causes of death , and vast amounts of high quality research , training and service provision are generated from such sites , much of which would be difficult to do without such infrastructures ( 15 ) .
nevertheless , methodological variation between sites and the fact that hdsss are localised systems that cover only a small proportion of total national populations has somewhat limited the wider utility of hdss data by national and international researchers and practitioners . in the context of hdsss
, it has been suggested that the resource - intensive active follow - up of individuals can only be justified if the results can be extrapolated meaningfully into the surrounding 100-fold population ( 5 , 16 ) . in focus here
representativity refers to the context of a site and the extent to which physical , cultural , religious and social characteristics approximate to other areas .
generalisability relates to the extent to which findings from an investigation using particular methods in a particular setting ( i.e. an hdss ) can plausibly be applied more widely ( 17 ) .
however , there remain no best - practice guidelines for enhancing representativity or generalisability and the size and selection of hdss populations are seemingly influenced more by economic restraints than sound sampling theory .
such determining factors have been criticised for failing to take into account the number of deaths needed to yield sufficiently robust information on cause - specific mortality ( 8) . while mathematical formulae are available to calculate necessary sample sizes for acceptable degrees of precision ( 1820 ) , including methods for determining efficient sizes for sample - based mortality surveillance systems in situations where prior information on the cause composition of mortality is lacking ( 8 , 21 ) , there is no evidence that these are used in existing hdsss .
given that budgets , geography and national contexts vary widely , there is unlikely to be a simple , one - size - fits - all solution to determining the ideal population surveillance size , but choice should be related to specific goals and intended use of the data , with appreciation for the impact on representativity and generalisability .
thorough understanding of causal pathways and potential intervention strategies in relation to mortality requires the reliable measurement of basic population parameters such as age , gender and socioeconomic distributions , which are likely to have a wide distribution among any population .
the distributions of such parameters should have important implications on the choice of sampling method , yet this is not apparent in current hdss methods and a wide variety of sampling procedures are utilised , not least with regards to their complexity ( 19 , 2224 ) .
given the reality of variation in sampling approaches between sites , it is prudent to know a priori whether and to what extent this might hinder cross - site comparisons of data .
such questions are not only important for the establishment of the hdsss themselves , but also for one - off surveys in resource - poor settings and nested surveys within hdss settings . empirical investigations into sampling approaches for population surveillance
emphasises the need to consider general population distributions and uniformity of certain parameters within localities when selecting sampling methods ( 16 , 25 ) .
while 1% samples drawn from reference datasets using different sampling approaches can represent the reference data well , distribution of parameters has been shown to be an important consideration .
for example , consistent and approximately normal distribution of gender means that the proportion of males in a population can be well represented irrespective of the sampling approach .
in contrast , parameters with more skewed and inconsistent distributions , such as education , are more difficult to capture .
modelling of multistage hdss - style sampling approaches appear to perform inconsistently with regard to reliability and representativity of various demographic and health parameters , emphasising the need to consider general population distributions and uniformity of certain parameters within localities when selecting methods . as with sample size
one - size - fits - all sampling technique that can satisfy all needs of survey design , therefore compromises , which are informed by empirical evidence , are necessary . in terms of the generalisability of hdss data to wider national populations , empirical comparisons with demographic and health survey
( dhs ) data have shown that population composition and certain mortality risk factors identified in hdsss are broadly applicable to regional and national populations ( 2628 ) .
it appears from these investigations that hdsss have more scope to detect the extent of local variations in population composition and health status than dhs methods , which average out local variations across regions or nations . as was the case for the sampling technique , general population distributions and uniformity of certain parameters within localities
are important determinants of whether locally derived estimates can be applied nationally , and vice versa .
the differing yet complementary characteristics of dhs and hdss mean that , when combined , these two data sources have the potential to characterise national population composition and health status as well as the extent of local variation both of which are important for health monitoring and planning . moving on from discontinuous thinking about data sources and continually drawing comparisons , there is room for further investigations into how data from different sources , such as hdsss and dhss , could be combined to provide more complete pictures of population health and maximise the potential utility of existing data in supporting developing - country health systems ( 2629 ) .
regardless of specific methods used , a certain amount of error is to be expected in population surveillance ( 30 , 31 ) , and the extent to which imprecision should affect the use of mortality surveillance data is an important concept with practical implications .
a significant proportion of population surveillance operations and resources are dedicated to data quality - assurance mechanisms ( 32 ) .
the majority of member sites of the indepth
network , for example , describe scheduled random re - visits of primary sampling units as a method of data quality control , with the percentage of households re - visited ranging from 2% ( agincourt hdss , south africa ) to between 5 and 10% ( nouna hdss , burkina faso ) ( 14 , 33 ) .
recent developments in direct data capture using handheld computers or personal digital assistants ( pdas ) and global positioning systems ( gps ) present innovative approaches that may simplify data capture and enhance the quality of household and individual identification data , and several studies have demonstrated their usefulness for data capture , even in rural african settings with limited electricity supply and harsh environmental conditions ( 3438 ) .
nevertheless , error is unlikely to ever be completely eliminated from the data that we have , therefore drawing correct quantitative conclusions that can form the basis for public health intervention necessitates that the effects of measurement error in the data that we have are appreciated and accounted for ( 31 ) .
recent work suggests that high levels of purely random errors may not be hugely detrimental to the utility of population surveillance data based on large samples ( 39 ) .
the expense and practical difficulty of detecting and correcting random errors must be considered in relation to the benefits of such efforts .
efforts will have a diminishing return as the 100% accurate dataset is approached , and so further consideration should be given to redirecting the costs of such efforts towards increasing the size or geographic spread of surveillance operations in order to increase representativity , or indeed towards analysing the data and disseminating findings . simply counting the number of deaths
is not enough to develop an understanding of population - level disease profiles and important health transitions .
therefore , cause - specific mortality measurement is vital and , for the time being at least , verbal autopsy ( va ) methods are the only feasible way of obtaining such data for the majority of the world 's population .
va methods gather information from a close caregiver about the signs and symptoms of the deceased 's terminal illness , as well as lifestyle behaviours and other characteristics .
this information is then used to derive probable causes of death , most commonly through independent review of the data by local physicians who try to reach consensus on a single cause ( 40 ) .
longstanding concerns over inter - observer agreement and lack of standardisation of physician review methods preclude meaningful comparisons of cause - specific mortality between regions and over time , where physicians and their methods of interpreting evidence may differ ( 41 ) .
this lack of standardisation has been tackled with efforts culminating in the development of various algorithmic approaches based on the concept of distilling the process of physician review into standardised rules ( 42 ) .
diagnostic algorithm - based cause - of - death determination may be less accurate than physician review , but has the advantage of being transparent and repeatable . nevertheless , algorithmic procedures make it impossible to consider parallel possibilities of causes of death along the lines of classic clinical differential diagnoses , and their consistency depends on the consistency of diagnostic criteria .
. limitations of physician review and traditional algorithmic approaches have led to the development of more innovative approaches to cause - of - death determination based on vas .
application of bayes theorem for va interpretation has been developed and evaluated using va data from vietnam , ethiopia and burkina faso ( 4345 ) .
known as interva ( for all age mortality ) and interva - m ( for deaths in reproductive - aged women ) , the approach derives up to three probable causes of death from va data and has been shown to produce comparable va - derived cause - specific mortality fractions ( csmfs ) to physician review with the advantage of being completely reliable the same set of indicators , signs and symptoms will always lead to the same probable cause of death ( 4347 ) . an alternative method developed by king and lu ( 48 ) , directly estimates csmfs without individual cause - of - death attribution .
their method resolves the problem of generalising va analysis to the population based on test properties quantified in health facility validation studies . combining king and lu 's approach with the interva method , murray et al .
( 42 ) propose and have attempted to validate a new approach called the symptom pattern method .
such developments are welcome attempts to overcome limitations of current va methods and the fact that these innovative methods are addressing differing data needs should be emphasised
failure to emphasise the differing data needs that va methods are attempting to address can result in a narrow assumption that va is a direct surrogate for western - style cause - of - death determination .
rather than targeting specific gaps in the understanding of mortality in less - developed countries and considering whether the method is now more or less fit for purpose , therefore , va developments tend to be discussed in terms of whether they meet medical ideals .
one - size - fits - all solution to long - standing information gaps , and limiting vas to a medical model undermines their full potential as epidemiological tools , which can be adapted to any specific point along this chain of economic , social , operational , biomedical and physical events leading to death .
va may be designed to address specific public health or mortality questions in a way that western , medical - based models can not
. explicit targeting of a specific point along the chain of events leading to death is useful in terms of data collection and analysis and may allow more useful discussions of new methods in terms of adequacy for purpose rather than absolute validity in relation to dubious gold standards ( 40 , 49 ) .
such conceptual developments , however , will need to overcome a default assumption of general medical audiences that cause - of - death determination is solely for the purposes of individual - level cause - of - death certification .
filling gaps in population - level information is arguably more important for health planning and monitoring purposes than filling gaps in individual - level data .
nevertheless , the largely individually derived and clinically oriented international classification of disease ( icd ) coding , remains the mandatory level of coding for international reporting to the who mortality database ( 50 ) .
the purpose of such standardised disease reporting rules is to ensure comparability , however the assumption that individual deaths will be coded consistently and reliably between regions and over time and can be aggregated to identify population - level disease burdens in different regions is flawed .
the use of an individual - focussed approach to address a population - level need seems inappropriate . while individually va - determined causes may be methodologically easier to compare with individually certified causes of death from other settings
rather , it emphasises the need for reliable methods of interpreting csmfs for known populations . furthermore
, determining multiple , rather than single causes of death for any particular case is more likely to accurately reflect the interaction of different diseases that lead to death and give a more complete representation of broad , population - level cause categories for which the public health response implications are essentially similar .
this may be less precise in terms of icd coding , but could be more suitable for guiding public health prioritisation on a more local level ( 8) .
regardless of specific methods used , a certain amount of error is to be expected in population surveillance ( 30 , 31 ) , and the extent to which imprecision should affect the use of mortality surveillance data is an important concept with practical implications .
a significant proportion of population surveillance operations and resources are dedicated to data quality - assurance mechanisms ( 32 ) .
the majority of member sites of the indepth
network , for example , describe scheduled random re - visits of primary sampling units as a method of data quality control , with the percentage of households re - visited ranging from 2% ( agincourt hdss , south africa ) to between 5 and 10% ( nouna hdss , burkina faso ) ( 14 , 33 ) .
recent developments in direct data capture using handheld computers or personal digital assistants ( pdas ) and global positioning systems ( gps ) present innovative approaches that may simplify data capture and enhance the quality of household and individual identification data , and several studies have demonstrated their usefulness for data capture , even in rural african settings with limited electricity supply and harsh environmental conditions ( 3438 ) .
nevertheless , error is unlikely to ever be completely eliminated from the data that we have , therefore drawing correct quantitative conclusions that can form the basis for public health intervention necessitates that the effects of measurement error in the data that we have are appreciated and accounted for ( 31 ) .
recent work suggests that high levels of purely random errors may not be hugely detrimental to the utility of population surveillance data based on large samples ( 39 ) .
the expense and practical difficulty of detecting and correcting random errors must be considered in relation to the benefits of such efforts .
efforts will have a diminishing return as the 100% accurate dataset is approached , and so further consideration should be given to redirecting the costs of such efforts towards increasing the size or geographic spread of surveillance operations in order to increase representativity , or indeed towards analysing the data and disseminating findings .
simply counting the number of deaths is not enough to develop an understanding of population - level disease profiles and important health transitions . therefore , cause - specific mortality measurement is vital and , for the time being at least , verbal autopsy ( va ) methods are the only feasible way of obtaining such data for the majority of the world 's population .
va methods gather information from a close caregiver about the signs and symptoms of the deceased 's terminal illness , as well as lifestyle behaviours and other characteristics .
this information is then used to derive probable causes of death , most commonly through independent review of the data by local physicians who try to reach consensus on a single cause ( 40 ) .
longstanding concerns over inter - observer agreement and lack of standardisation of physician review methods preclude meaningful comparisons of cause - specific mortality between regions and over time , where physicians and their methods of interpreting evidence may differ ( 41 ) .
this lack of standardisation has been tackled with efforts culminating in the development of various algorithmic approaches based on the concept of distilling the process of physician review into standardised rules ( 42 ) .
diagnostic algorithm - based cause - of - death determination may be less accurate than physician review , but has the advantage of being transparent and repeatable .
nevertheless , algorithmic procedures make it impossible to consider parallel possibilities of causes of death along the lines of classic clinical differential diagnoses , and their consistency depends on the consistency of diagnostic criteria .
. limitations of physician review and traditional algorithmic approaches have led to the development of more innovative approaches to cause - of - death determination based on vas .
application of bayes theorem for va interpretation has been developed and evaluated using va data from vietnam , ethiopia and burkina faso ( 4345 ) .
known as interva ( for all age mortality ) and interva - m ( for deaths in reproductive - aged women ) , the approach derives up to three probable causes of death from va data and has been shown to produce comparable va - derived cause - specific mortality fractions ( csmfs ) to physician review with the advantage of being completely reliable the same set of indicators , signs and symptoms will always lead to the same probable cause of death ( 4347 ) . an alternative method developed by king and lu ( 48 ) , directly estimates csmfs without individual cause - of - death attribution .
their method resolves the problem of generalising va analysis to the population based on test properties quantified in health facility validation studies . combining king and lu 's approach with the interva method , murray et al .
( 42 ) propose and have attempted to validate a new approach called the symptom pattern method .
such developments are welcome attempts to overcome limitations of current va methods and the fact that these innovative methods are addressing differing data needs should be emphasised
failure to emphasise the differing data needs that va methods are attempting to address can result in a narrow assumption that va is a direct surrogate for western - style cause - of - death determination . rather than targeting specific gaps in the understanding of mortality in less - developed countries and considering whether the method is now more or less fit for purpose , therefore ,
one - size - fits - all solution to long - standing information gaps , and limiting vas to a medical model undermines their full potential as epidemiological tools , which can be adapted to any specific point along this chain of economic , social , operational , biomedical and physical events leading to death .
va may be designed to address specific public health or mortality questions in a way that western , medical - based models can not
. explicit targeting of a specific point along the chain of events leading to death is useful in terms of data collection and analysis and may allow more useful discussions of new methods in terms of adequacy for purpose rather than absolute validity in relation to dubious gold standards ( 40 , 49 ) . such conceptual developments
, however , will need to overcome a default assumption of general medical audiences that cause - of - death determination is solely for the purposes of individual - level cause - of - death certification .
filling gaps in population - level information is arguably more important for health planning and monitoring purposes than filling gaps in individual - level data .
nevertheless , the largely individually derived and clinically oriented international classification of disease ( icd ) coding , remains the mandatory level of coding for international reporting to the who mortality database ( 50 ) .
the purpose of such standardised disease reporting rules is to ensure comparability , however the assumption that individual deaths will be coded consistently and reliably between regions and over time and can be aggregated to identify population - level disease burdens in different regions is flawed .
the use of an individual - focussed approach to address a population - level need seems inappropriate . while individually va - determined causes may be methodologically easier to compare with individually certified causes of death from other settings
rather , it emphasises the need for reliable methods of interpreting csmfs for known populations . furthermore
, determining multiple , rather than single causes of death for any particular case is more likely to accurately reflect the interaction of different diseases that lead to death and give a more complete representation of broad , population - level cause categories for which the public health response implications are essentially similar .
this may be less precise in terms of icd coding , but could be more suitable for guiding public health prioritisation on a more local level ( 8) .
that the value of data lies in their use and not in their collection does not always seem to be appreciated by surveillance systems , often burdened with tight budgets that hinder rapid local analyses ( 6 , 51 ) .
a major challenge facing population surveillance activities in general , and hdsss in particular , is the accumulation of unanalysed data .
all too often the period from data capture in the field to analysis , publication and use for informing public health action is very long . even when data are processed efficiently , they are rarely made widely available or communicated effectively enough to have an immediate effect on the lives of the surveillance population .
it is debatable whether sentinel surveillance and hdss operations in developing countries are directly responsible for practical public health action , but to justify the risks and intrusion of surveillance , the collected information must have a demonstrated utility . within the context of humanitarian disasters , for example , important fluctuations in surveillance population mortality should be detectable and trigger action ( 29 ) .
ill - defined responsibilities , complex operational procedures and long time lags between data capture and analysis are unacceptable excuses for not using the data generated from population surveillance activities for the timely detection of entirely preventable morbidity and loss of life in the surveillance population . while the standardisation , quality control and validation of surveillance methods is important , efforts are also needed to stimulate the debate and development of simple procedures for using data and clearly defined surveillance responsibilities . that population surveillance activities in developing countries typically operate in cooperation with local health authorities , universities and local and foreign government ministries
means that key actors in health , development and relief are likely to be receptive to efforts to enhance communication with population surveillance organisations . in combination with data that may be collected by other parties , such as environmental and meteorological data
, mortality information could enhance understanding of environmental and population inter - relationships and provide a more complete incentive for public health action . that the data must be used to justify the effort and intrusion on individual privacy is one principle that fits all surveillance activities .
establishment of registration systems for entire populations is unlikely to occur in the short to medium term ; the data we want will remain unobtainable . in the meantime , sample - based and sentinel population and mortality surveillance can yield sufficiently reliable and relevant information for programme action , and are well within the means of many developing countries . indeed , such systems represent the only useful alternative to establish the evidence base for health policy and programme delivery for the foreseeable future in much of the developing world . that the data we have may not be exactly the data we want does not make evidence - based decision making impossible the data and evidence that we do have should be used while efforts continue to be made to improve the evidence base ( 52 ) .
understanding the potential advantages and limitations of methods in particular contexts is important for informing appropriate population survey design within the boundaries of financial and logistical constraints .
however , as this paper repeatedly emphasises , there is no single methodology that can fully satisfy all data needs .
methodological decisions about surveillance should therefore be a synthesis of all available and relevant knowledge relating to clearly defined concepts of why data are being collected , how they can be used and when they are of good enough quality .
significant statistically , but no comparable principles have been established to indicate what is significant operationally in relation to public health action .
ultimately , explicit discussion of such issues internationally as well as with surveillance communities is not only vital to improving the state of knowledge on the world 's health , but also to maintaining public trust in , and understanding of , health and demographic surveillance efforts .
this , in turn , may be a significant step towards more widespread , routine , vital - event surveillance and the crucial goal of not just counting deaths , but also making all deaths count . | reliable cause - specific mortality data constitute a crucial resource for health monitoring , service planning and prioritisation .
however , in the majority of the world 's poorest settings , systematic health and vital event surveillance systems are weak or non - existent . as such ,
deaths are not counted and causes of death remain unregistered for more than two - thirds of the world 's population.for researchers , health workers and policy makers in resource - poor settings , therefore , attempts to measure mortality have to be implemented from first principles . as a result , there is wide variation in mortality surveillance methodologies in different settings , and lack of standardisation and rigorous validation of these methods hinder meaningful comparison of mortality data between settings and over time.with a particular focus on health and demographic surveillance systems ( hdsss ) , this paper summarises recent research and conceptual development of certain methodological aspects of mortality surveillance stemming from a series of empirical investigations .
the paper describes the advantages and limitations of various methods in particular contexts , and argues that there is no single methodology to satisfy all data needs .
rather , methodological decisions about mortality measurement should be a synthesis of all available knowledge relating to clearly defined concepts of why data are being collected , how they can be used and when they are of good enough quality to inform public health action . |
generation of waste in per capita of langkawi island is more than in compare with malaysia ( according to our research and project ) .
the natural characteristics of langkawi local ecosystems with coral reefs , sand beaches , and mangroves in geopark are affected under threat by poorly waste management and cause other environmental problems .
knowledge about solid waste sources and types as well as information on its composition and rates of production and disposal is essential for the design and operational facets of the functional elements concomitant to solid waste management . on the other side ,
source - based classification of solid wastes classifies the wastes on the basis of their origins .
thus , this classification perspective is vital for the waste management process as it provides information related to the origin of the waste which will eventually help in managing the waste at its source of release .
the classification types of categorized wastes by consideration to their nature and produced source are wide - ranging and significant in fact .
knowledge of the nature of the wastes is crucial for the waste management process since it can help waste managers deal with the different types of wastes in appropriate ways as well as reduce the potential negative impacts attendant to its waste handling and handlers . worldwide ,
one of the most dynamic economic activities is tourism . over the last few decades tourism
year after year , further attractions have evolved on the grounds of the potential and facilities of trips to adventurous areas , diving , boat - trips , and observation of wildlife ( e.g. , birds , dolphins , and corals ) in the island and these possibilities have made coastal destinations far more attractive [ 4 , 5 ] .
yet , it results in creation of additional wastes which have indirect and direct impacts on the somewhat unique and quite vulnerable environmental resources . in light of this , an identification of the negative and positive effects of the growing tourism industry in langkawi island as well as evaluation of the net balance between these is an objective that is necessary for development of a sustainable tourism industry in the area .
it is well established that development of the global tourism industry in islands in the recent years has led to increased production of wastes and to altering the composition of these wastes as well .
securing sustainable tourism industry in islands should set reducing resource consumption and waste generation as a basic principle and priority . reducing overconsumption and
the amounts of waste produced has two dimensions : conserving the resources utilized by the tourists to be employed in production of different goods and releasing pressure on environmental resources that result from treatment and disposal of wastes .
as far as waste production and management are concerned , what is really important is confirming dominance of sustainable waste management patterns rather than the amounts of waste which are produced .
malaysia is spending 75 percent of municipality budget for waste collection . according to the available statistics ,
the biggest challenges are related to the municipalities for services of sustain waste management in a sound and effective manner .
it has been estimated that tourists generate double solid waste per capita compared to local residents in langkawi island .
these problems have been exacerbated by the small size , remoteness , and rapid urbanisation of langkawi islands .
unfortunately , amount of recyclable material is few and no real and good market for recyclable material .
waste also is generally burned or dumped in some areas near roads and waste pollutants are increasing .
waste pollution and illegal dumping will have impact on people health , potential of tourism , geopark characteristic , and sustainable development in the island .
the tourism industry can have both positive and negative impacts on tourist destinations , such as bali , indonesia , and thailand .
negative impacts of tourist industry in langkawi geopark include natural resources deterioration and problems of increasing solid waste quantities .
the negative impacts of tourism in the area include natural resources consumption , consumerism , and generation of waste . hotels often generate large quantities of solid waste because tourists use the materials in the small packaging forms .
improper management of waste causes environmental degradation and aesthetic appeal losing , in shape of litter on beaches and streets , illegal dumping , and garbage burning .
sustainable swm principles include equity ( for all citizens that are entitled to an appropriate waste management system due to environmental health reasons , promote the health issues for resident and tourist , and minimise the waste production for resident in island ) , effectiveness ( related to safe removal of waste management , protection of environmental quality and sustainability , and maximing 3r ) , and efficiency and sustainability of solid waste management related to increasing benefits and decreasing of costs .
the planning program of solid waste management optimization will have an important impact when the government plays the role of the facilitator and catalyser to implement partnerships between stakeholders .
the municipality should encourage the waste management development with utilising waste separation at source , waste reduction , reuse , recycling , and composting . as the facilitator
( using concepts such as the polluter pays principle and cleaner production for development of waste management program ) , the government should protect the langkawi geopark and support the society , funding , training , technical assistance , information exchange , and monitoring .
the key elements for a successful iswm implementation program in hotels are management 's initiative and training of personnel . for successful iswm program ,
it is necessary for hotel management to be convinced of improved waste management importance . with the top management support
improve environmental quality ( with the long - term profit to preserve the attractive region ) or even generate additional income through the recyclables selling or compost industry due to using enrich soil .
staff contacts with waste are in the lower organization parts mostly . rates of rotation and attrition at this special step are high extremely .
improper swm can lead to contaminant and deterioration of the aesthetic appeal of tourist destinations .
integrated solid waste management ( iswm ) may be defined as selection and implementation of appropriate techniques , technologies , and management programs to realize certain waste management goals and objectives .
the hierarchy of integrated solid waste management of the united states environmental protection agency ( usepa ) follows the priority order : source reduction , recycling , waste combustion or waste transformation and land filling .
langkawi island comprises archipelago of 99 islands located in the andaman sea , around 30 km off the mainland coast of northwestern malaysia .
the total land area of the islands is 47,848 hectares while langkawi , which is the main island , has an area of 32,000 hectares . from north to south , langkawi is nearly 25 km long and from east to west it is almost as wide .
two - thirds , approximately , of the island are predominated by natural vegetation , hills , and forest - covered mountains .
the average annual temperature is about 32c ( 3324c ) , and the average yearly rainfall is around 2500 mm .
the landfill site in langkawi island is known as tapak pelupusan sisa pepejal kampung belanga pecah .
it has been in service since 1985 with daily solid waste input of 80 tons on the average .
only 10 years of the lifespan of this land - filling site are yet left .
landfill in the area is not sanitary and leachate with run - off near landfill is valid specially in high raining season .
separation of waste has not been at source ; it is one of the waste issues need to discuss and educate the people ( table 1 ) .
in this study we used american society for testing materials ( astm ) that field sampling was implemented during one week , whereby a total of 35 samples were taken ( five samples per days ) .
hitherto , there are no standard procedures adopted by the government of malaysia ( gom ) for msw characterization study . as such
, procedures outlined in astm will be used as a guide in carrying out all the sampling and laboratory works . in the study area
was gathered randomly from a list of 35 ward names written on pieces of folded paper and placed in a container . picking
was done through a non - replacing method to prevent picking the same ward more than once .
subsequently , this was followed by sampling a number of households following the systematic random sampling approach .
additionally , a questionnaire prepared and provided to the residents of langkawi island as it was deemed that feedback from which will ( i ) elucidate the local 's level of awareness of issues related to solid waste and solid waste management and ( ii ) contribute to an understanding of issues related to solid waste management such as the approaches employed , the limitations to sustainable waste management , management needs , amongst others .
waste management systems in langkawi island are under pressure because of increasing population and urbanization , changing patterns of consumption , tourism industry .
economic costs of solid waste will be very large in langkawi island if all significant variables and also optimization of the collection and transportation not be considered ( figure 1 ) .
the results of this study indicated that raw material has the highest percentage of the solid waste generated in the island .
paper and then plastic bag wastes ranked the second and third highest group ( 18.15% and 17.04% ) ( figure 2 ) .
feedback on the questionnaire showed that the municipality of langkawi has been facing numerous obstacles and challenges associated with solid waste management that prevented it from addressing the challenges of solid waste management in the island in a proper and efficient manner .
the problems attendant to poor management of solid wastes in relation to tourists , besides other related issues that were highlighted by the respondents , call for urgent attention of the municipal authority in langkawi .
around 34.8% of the respondents indicated that improper management of the solid waste will contribute to increased environmental problems and may lead to closing the kilim river branch of the geopark , while 23.2% , 12.4% , 16.4% , and 13.2% of the total respondents expressed that poor solid waste management will lead to limited tourist visits , high levels of soil and water pollution , degraded aesthetic value of the environment , and steady objectionable odor release , respectively .
potential efficiency between sustainable development of tourist and solid waste management in island is including cooperation between sustainable tourist development in langkawi island and integrated solid waste management , both of them affect on policy alternatives , in addition to role of stakeholders in economic condition , social and environmental impacts on solid waste management .
part of the questionnaire aimed at drawing possible suggestions on how waste - related laws and regulations can be enacted .
almost 55.3% of the respondents supported that waste - related laws can be made more effective through public sensitization of the existing laws while 32.9% argued that these laws may be made effective via proper enforcement by the related law enforcement agencies .
in addition , 14.5% of the respondents suggested that the waste legislation can be made more effective by means of instant fine posed on the offenders while only few respondents ( 2.9% ) supported that such legislation may be made more effective by proper , regular monitoring .
improvements in the solid waste collection services will to some degree contribute positively to reducing the amounts of waste in and around the municipality area . as the questionnaire showed ,
about 35% of the respondents claimed that public awareness on solid waste collection issues is vital for the municipality to manage the solid waste . on the other hand
, nearly 37 % of the respondents highlighted that there is a need to engage the public in managing the solid waste .
moreover , almost 20.2% of the respondents supported that enforcing the waste and waste management legislations is important for dealing with the wastes in the municipality while 7.8% suggested that charging some fee , or pay as you pollute , that is , implementation of the polluters pay principle , may play a positive role in controlling the generation of waste by the public and subsequently minimize the costs of management , particularly the costs of waste collection .
groundwater pollution because of high level , surface water pollution from land based sources such as domestic sewage should be mentioned .
they cause to carry risks for human health and can degrade habitats such as coral reefs , and tourist attractions such as beaches
. the management of tourist should be attention to left of eagle feed at geopark that oily waste cause to produce problem for mangrove trees in area . in island
the facilities are inadequate either because a trained manpower shortage ; consequently , poorly - treated effluent of waste leachate is often discharged into the branches of geopark that is near the landfill site environment .
the problem in regulations of langkawi island has not been very effective according to questionnaire because inadequate institutional and human resource capacities to enforce them .
insufficient facilities to storage and disposal of hazardous wastes is the problem too in langkawi island .
the present system of solid waste management can not meet growing volumes of solid wastes that are produced daily .
the central government should find legal and institutional framework for municipal solid waste management ( mswm ) and guarantee that local governments have the authorities , powers , and capacities necessary for effective management of the solid waste . enhancing the solid waste management practices in langkawi island
, the municipality needs to establish waste management strategies and employ the technological innovations due for securing improved waste separation at the source , resource recovery or recycling , and sanitary disposal of the solid wastes .
while examining the local level of awareness on the benefits of appropriate solid waste management system to the local community , the researcher noticed that the residents of langkawi island were quite aware of the value of a clean and waste - free environment in terms of environmental health and safety , aesthetic value of the island , encouraged tourism , and reduction in spread of vector diseases .
inadequate and/or inappropriate management of the solid waste will enhance survival , growth , and spread of vectors which will hence endanger the people and environment besides polluting the water , soil , and air with organic and inorganic materials .
it is much likely that varying proportions of the waste could be washed to the surface water bodies and consequently aggravate the environmental pollution problems .
new strategies can improve tourism industry in the area without serious environmental problems and minimum dangerous effect on the natural geopark .
we recommend establish the working relationships among hotels , resorts , and companies of waste collection .
we also suggest good practices of environment , the most significant of them is developing integrated solid waste management ( iswm ) approach at the hotel level .
successful programs of iswm at the hotel level need necessary elements such as initiative of management , adequate space for the separation of the waste , and activities of treatment related to capacity building plan for hotel personnel .
usually tourist visits only short periods of time -one to two weeks- in the langkawi island which poses a challenge for awareness raising purposes between tourists and residents ; as a result expanding separation at source will be useful at hotel level in island and education to public participation for separation at source . achieving a better services provision to improve infrastructure | the population growth , changing consumption patterns , and rapid
urbanization contribute significantly to the growing volumes of solid
waste that are generated in urban settings . as the rate of
urbanization increases , demand on the services of solid waste
management increases .
the rapid urban growth in langkawi island ,
malaysia , combined with the increasing rates of solid waste production
has provided evidence that the traditional solid waste management
practices , particularly the methods of waste collection and disposal ,
are inefficient and quite nonsustainable .
accordingly , municipal
managers and planners in langkawi need to look for and adopt a model
for solid waste management that emphasizes an efficient and
sustainable management of solid wastes in langkawi island .
this study
presents the current practices of solid waste management in langkawi
island , describes the composition of the solid waste generated in that
area , and presents views of local residents and tourist on issues
related to solid waste management like the aesthetic value of the
island environment .
the most important issue of this paper is that it
is the first time that integrated solid waste management is
investigated in the langkawi island . |
shoulder pain is common in society , with 7%27% of the adult population experiencing shoulder pain at any one time , and 7%67% of people experiencing shoulder pain in their lifetime . of first episode shoulder
pain clients , 50% will continue to have symptoms 18 months later , making shoulder pain the third most common reason for primary care consultation , after back and neck complaints .
accurate and effective assessment and treatment of shoulder conditions is therefore important to health care practitioners .
physiotherapists often assess and treat clients with shoulder pain , and there exists considerable evidence of effective physiotherapy treatments for many shoulder disorders [ 38 ] , with conservative physiotherapy management shown to provide up to an 88% improvement in shoulder function in the long term .
unfortunately , people living in rural and remote areas of australia have limited access to physiotherapy services , a phenomenon observed also in the usa [ 1012 ] .
telerehabilitation , the provision of rehabilitation services via the internet , is one potential service delivery model which may improve access to physiotherapy services in rural and remote areas .
however , relatively little research has been conducted into the validity and reliability of telerehabilitation for the assessment and treatment of musculoskeletal disorders [ 13 , 14 ] . to establish the concurrent validity of such services
, research must prove that measurements taken using telerehabilitation are the same or similar as those that are made in the traditional face - to - face manner .
the reliability of such assessments should also be established prior to the wide scale adoption of telerehabilitation into the community .
research has established the validity and reliability of telerehabilitation to assess joint range of motion ( rom ) at the knee , wrist , elbow , forearm supination , and pronation as well as all movements at the shoulder [ 1517 ] .
studies have also proven the validity of remote assessment of quadriceps muscle strength and limb girth and functional analysis of gait [ 15 , 18 ] . however , to perform a comprehensive musculoskeletal assessment for a complex joint such as the shoulder , further research should be performed into the other tests commonly required for a shoulder examination , such as special orthopaedic and neural system tests . to date , only two studies have used physical outcome measurements from a telerehabilitation consultation to establish the validity and reliability of telerehabilitation for remote diagnosis [ 19 , 20 ] . both studies focused on lower limb disorders , the first on the ankle and the second on nonarticular disorders of the lower limb .
the two studies reported 80% and 79% exact agreement for diagnosis respectively , with the percentage agreement for their physical examination findings ranging from 76.4% to 99.9% .
the authors of the studies concluded that the telerehabilitation assessments appeared to be accurate and valid and demonstrated high intra- and interrater reliability .
this claim is made in the context of research that shows that the agreement between two face - to - face examinations was similar in magnitude .
indeed , it should be noted that in the shoulder , research has demonstrated that the inter - rater reliability of face - to - face examinations of this complex joint may be as low as 46% bamji et al . .
relative poor agreement between face - to - face examinations must therefore be considered when investigating the use of telerehabilitation for assessment and diagnosis for the upper limb .
this study has three aims : ( 1 ) to evaluate the use of a telerehabilitation system to formulate valid and reliable diagnoses of shoulder disorders ; ( 2 ) to establish the validity and reliability of the individual physical examination findings via the telerehabilitation system ; ( 3 ) to examine the satisfaction of the participants with the use of the system for their physiotherapy examination .
we hypothesised that telerehabilitation will be valid and reliable in generating physical examination findings and can be used by examiners to create valid and reliable diagnoses for musculoskeletal problems of the shoulder .
a total of 22 participants with 28 reports of shoulder pain ( some had both left and right sided problems , which were considered independently ) were recruited over a one - month period for this study .
participants were recruited from within the community of a large tertiary university in brisbane , queensland ( students and staff ) , and the university 's musculoskeletal and sports injury physiotherapy clinic .
participants were included if they were over 18 years old , english speaking , and possessed an adequate level of cognition and communication to complete a full physiotherapy assessment .
the exclusion criteria included poor vision or hearing and concomitant medical conditions such as severe respiratory or cardiac conditions that would prevent participants from safely completing the examinations .
all participants volunteered for the study and provided signed informed consent after receiving written and verbal explanations on how the session would progress .
approval was gained from the relevant medical research ethics committee before commencement of the project . a convenience sample of three final year physiotherapy
they had all completed the musculoskeletal training components of their degree prior to the project . during the study , the students each had access to separate independent , experienced clinical educators for the purposes of clinical reasoning assistance .
for example , the students were able to ask questions about and discuss the interpretation of assessment findings .
the students were blinded to each other 's assessments and results to avoid bias .
remote patient interviews and physical examinations were performed using the ehab telerehabilitation system ( neorehab , brisbane , qld , australia ) .
this system uses a wireless 3 g internet connection ( telstra next g ) and allows videoconferencing as well as a battery of physical measurement tools , as described elsewhere in the literature .
participants attended a single 1.5 hour session at the university of queensland , during which a patient interview , a face - to - face physical examination and a remote physical examination were undertaken .
the order of examinations was randomly determined upon the participant 's arrival for the session , using a balanced block design of size four .
the randomisation code was determined prior to the commencement of the study and was administered by an author ( t. g. russell ) who was not involved in performing the participant assessments .
the balanced block design ensured that for every four participants recruited , two were examined via telerehabilitation first and these were performed by different examiners .
the examiners that were randomly assigned to the first physical examination also conducted the patient interview in the same mode as they were to perform the physical examination .
this patient interview was simultaneously observed passively by the alternative examiner in the mode of assessment they were assigned to use for their physical examination . using this method ,
all patient interviews and remote physical examinations were recorded at the time of assessment using the ehab telerehabilitation system , to be used later for reliability analysis .
the face - to - face physical examination was conducted in the conventional manner with the physiotherapist in the room with the participant and utilising tests they felt appropriate according to their clinical reasoning .
tests included postural analysis , joint palpation , range of motion ( rom ) testing at the shoulder and adjacent joints , static muscle tests ( smt 's ) , special orthopaedic tests and neural testing .
neural testing involves assessing the response of the neural system to movement at the joints that the nerve crosses .
the remote examination was conducted with the examiner in another room , communicating with the participant via the ehab telerehabilitation system .
similarly to the face - to - face examination , the remote examiners lead the participant through tests they felt appropriate for their particular presentation , according to their clinical reasoning . as the examiner had no physical contact with the participant ,
the examiners verbally lead the participant through the tests , demonstrating on themselves for the participants to copy .
many of the tests used the participants other arm and objects that can be found in the home ; for example ; when conducting speeds test , a test designed to assess for pathology of the long head of biceps , the participants held their arm out straight in front of them and used their other arm to apply pressure in a downward force ( figure 1(a ) ) , or when conducting the hawkins - kennedy impingement test , participants used a nearby surface at the level of the shoulder ( figure 1(b ) ) . to determine the validity and reliability of the pathoanatomical diagnosis ,
the diagnoses were compared by two blinded , independent , experienced clinicians and recorded as the same , similar , or different ( table 2 ) . to allow statistical analysis ,
the physical examination findings were recorded and coded according to a system developed by the examiners for this study ( see example in table 1 ) .
some outcome measures were recorded in a binary format ; for example , strength was recorded as full or reduced ; orthopaedic tests were recorded negative or positive .
others were recorded on a categorical scale ; for example , pain on palpation of the shoulder joint ( joint assessment ) was given a value from zero to ten , while bruising , muscle wasting , and postural deviation were recorded on a severity scale from nil to severe . upon completion of the two physical examinations , participants filled out a satisfaction survey .
the videorecordings of the patient interview and physical examinations captured from the original telerehabilitation examination were used to evaluate the reliability of the telerehabilitation assessments .
inter - rater reliability was established by a third examiner independently analysing the videorecordings and formulating a diagnosis .
intra - rater reliability was established by the original remote examiner reanalysing the videos after a 6-week waiting period .
all examiners recorded a primary diagnosis of the participants presenting condition in the form of a patho - anatomical structure ( e.g. , supraspinatus tear ) , condition ( e.g. , adhesive capsulitis ) , or in descriptive terms of a movement dysfunction ( e.g. , scapular dyskinesia ) .
a system diagnosis was also nominated , referring to the anatomical system ( muscle , bone , articular , neural , and other ) responsible for the primary condition .
in addition to these , the physical examination findings , which were coded into either binary or categorical data , were recorded to enable the statistical comparison of the individual examination procedures .
the questionnaire that was completed by participants at the conclusion of the study used a 10 cm visual analogue scale ( vas ) to get their opinion on ( 1 ) how beneficial participants rated the internet examination , ( 2 ) recommend to a friend who was unable to travel , ( 3 ) as good as the face - to - face examination , ( 4 ) visual clarity , ( 5 ) audio clarity , and ( 6 ) overall satisfaction with the internet examination .
data was analysed using medcalc , version 10.4.8.0 ( medcalc software , ghent , belgium ) and spss , version 19 ( ibm , armonk , ny , usa )
the validity was established by comparing the face - to - face examiners ' findings to telerehabilitation examiners ' findings for each participant .
similarly , inter - rater reliability was assessed by comparing the original telerehabilitation examiners ' findings to second telerehabilitation examiners ' findings , and intra - rater reliability was assessed by comparing the first and second findings of the original telerehabilitation examiner .
the validity and reliability of the pathoanatomical diagnoses , as mentioned above , were recorded by two - blinded , independent , experienced clinicians as the same , similar , or different . if the independent clinicians differed in their opinion , a third experienced clinician arbitrated until consensus was obtained .
similarly , the validity and reliability of the systems ' diagnosis were analysed using percent agreement and statistics .
assessments which produced binary data ( full / reduced , negative / positive ) were analysed using percentage agreement and statistics .
the assessments which produced an outcome on a scale ( categorical data ) were analysed using percentage agreement ( exact and close , with close determined as one rating above or below compared rating ) and quadratically weighted kappa ( ) .
the strength of agreement was appraised according to the guidelines stipulated by landis and koch .
the questionnaire data was measured in millimetres on the 10 cm scale by the same person , using the same ruler , and was analysed using descriptive statistics .
this study included 16 males and 6 females who presented to the clinic reporting a problem with their shoulder .
the participants ' ages ranged from 18 to 60 years old , with an average of 30.7 years , and a standard deviation of 14.2 years .
as previously described , a number of participants had both left and right sided problems which were considered independent in the study , producing a total number of 28 assessments .
the order of assessment ( face - to - face or telerehabilitation ) first did not appear to be a factor in the results ( wilcoxon signed rank test ; z = 0.91 , p = 0.37 ) results for the analysis of the pathoanatomical diagnoses are presented in table 3 .
moderate agreements were demonstrated for the combined same and similar results for validity ( 59.72% agreement ) .
reliability achieved stronger results with substantial agreements that achieved for inter - rater reliability ( 73.08% ) and almost perfect agreements for intra - rater reliability ( 100% ) that combined same and similar results .
the results for the primary systems ' diagnosis analysis are presented in table 4 and demonstrate substantial validity ( 78.6% agreement ; = 35.70 ; p < 0.001 ) , with even stronger results for intra - rater ( 82.1% agreement ; = 38.05 ; p < 0.001 ) and inter - rater ( 82.1% agreement , = 41.60 ; p <
validity analysis of physical examination findings produced strong agreements for most outcome measures , with the highest agreement for rom ( 87.4% agreement ; = 30.782 ; p < 0.001 ) , and the lowest significant agreement for nerve testing ( 56.1% agreement ; = 6.291 ; p = 0.012 ) .
joint assessment findings were found to have poor agreement and failed to reach statistical significance ( 64.4% agreement , = 0.762 , p = 0.383 ) .
reliability analysis of physical examination parameters was found to be very high across all binary measures , ranging from 66.9% to 98.3% agreement ( 7.204 < < 1795.945 , all p < 0.05 ) .
analysis of the assessment items which produced categorical data is presented in table 5 , demonstrating fair agreement for pain ratings ( 67.7% exact agreement and 76.8% exact and close agreement , = 0.50 ) , and substantial agreement for the severity rating scale ( 80.8% exact agreement , 96.0% exact and close agreement , = 0.66 ) .
intra - rater ( 94.1% exact , 97.2% exact and close , = 0.95 ) , and inter - rater ( 93.6%-exact , 97.2% exact and close , = 0.95 ) , reliability analysis for pain ratings demonstrated almost perfect agreement , with similar agreements for severity scale ratings ( 88.5% exact agreement , 97.7% exact and close agreement , = 0.83 ; 85% exact agreement , 99.2% exact and close agreement , = 0.83 ) , respectively .
results for patient satisfaction are presented in figure 2 , demonstrating that the participants were very satisfied with the telerehabilitation mode of assessment , with average ratings of 6.8/10 . the use of telerehabilitation to diagnose clients with shoulder disorders appears to be both valid and reliable as well as acceptable to participants .
this study represents an important first step in obtaining evidence for the use of telerehabilitation for clients that otherwise would find access to physiotherapy services difficult .
systematic reviews investigating the physical examination tests used when assessing the shoulder in the face - to - face method have found that they do not demonstrate high levels of validity or reliability [ 2427 ] and are affected by information gathered during the patient interview .
a meta - analysis by hegedus et al . concluded that many of the shoulder tests have limited diagnostic accuracy ; however , it has been suggested that some ( many of those employed in the present study ) can be used as a screen for certain shoulder pathologies .
poor reliability findings have been reported for tests used in physical examinations in general , with similar results in many other areas of the body . in light of the poor reliability of shoulder examination tests , it has been suggested that expert clinicians consider their results within the context of the patient interview and patterns of physical examination findings , rather than relying on one key finding or outcome measure [ 24 , 28 , 29 ] .
considering the difficult nature of physical examinations of the shoulder and the limited reliability seen in face - to - face studies , the strong agreement found in this study between face - to - face and telerehabilitation assessment is convincing evidence for the validity of online physical assessments of the shoulder .
the percentage agreement for diagnoses obtained for validity in the study is fair . although exact diagnoses agreement was low (
18.5% ) , the combined same and similar results demonstrate moderate agreement ( 59.7% ) .
stronger agreements were achieved for inter - rater reliability ( 73.1% ) and intra - rater reliability ( 100% ) combining same and similar agreements .
previous research on the reliability of face - to - face examinations of the shoulder reveals conflicting results [ 21 , 2931 ] .
, 90.5% agreement , = 0.875 ; carter et al . , 80% agreement , = 0.664 ) , whereas others report poorer agreement rates ( de winter et al .
; 60% agreement , = 0.45 , bamji et al . ; 46% agreement , no kappa recorded ) .
poor diagnostic agreements for the shoulder are not particularly surprising , as there exists no generally accepted explanation for the aetiology and pathogenesis of many shoulder disorders [ 24 , 30 , 32 ] .
the disagreements typically arise when patients have increased pain severity , more than one problem , have bilateral involvement , and when examiners vary on their interpretation of physical examination signs [ 21 , 2931 ] .
our study asked examiners to write a free text diagnosis , while the previous studies all required examiners to assign participant diagnoses according to distinct groups . within this context , and in light of our fair diagnostic agreement results
, it appears that the introduction of a telerehabilitation system does not compound the difficulties already faced for diagnosis of the shoulder in the clinical setting . despite the current evidence which indicates that reliability is poor for the physical examination tests of the shoulder , high inter - rater and intra - rater reliability rates were recorded for the tests in the current study .
it could be said that any differences in diagnoses could potentially be explained by differing clinical reasoning processes between examiners rather than a factor of the mode of assessment .
this has been reported in previous diagnostic accuracy literature , with studies finding inherent differences between clinicians when faced with the same clinical information [ 33 , 34 ] .
found that even when examiners discussed and agreed on all the clinical signs for the participants , they still reached a different diagnosis in 22% of cases .
the findings of this study are similar to previous telerehabilitation diagnostic accuracy studies [ 19 , 20 ] .
two prior studies reported high levels of validity and reliability for the use of a telerehabilitation system in the diagnosis of ankle disorders and nonarticular disorders of the lower limb .
the percentage agreement findings in these studies for the validity of systems diagnosis ( at 80% and 79% resp . ) were comparable to this study ( at 78.1% ) .
the present study recorded much higher chi - squared values for systems diagnosis ( validity and reliability ) , with the previous studies ranging from 4.27 < < 13.46 , compared to the current studies results ranging from 35.70 < < 41.6 .
this may be explained by the fact that the previous two studies grouped the binary and categorical examination findings for statistical analyses , while the current study kept them separate in order to obtain validity and reliability information on each specific test .
the previous studies report categorical data exact agreement results ranging from 76.4% to 94.5% , and binary data agreement ranging from 82.9% to 99.9% .
these findings are comparable to the present study 's findings , with our physical examination analysis recording agreements from 56.1% to 94.1% . on closer examination of the poor results of the joint assessment findings in this study ( 64.4% agreement , = 0.762 , p = 0.383 )
, it was noted that there were considerable differences between the examiners in their method of recording results .
one examiner did not use this section at all , and the others did so sporadically and without a systematic approach .
additionally , we obtained relatively poor agreement results for the assessment of the neural system .
firstly , the neurodynamic tests involved very complex movements at many joints within a number of planes , making it difficult to verbally describe .
secondly , neural testing was always performed last during the examination , after a battery of previous tests , and the participants were often fatigued by this point .
these difficulties could potentially be avoided in the future by performing the tests earlier in the session and by creating a premade instruction video to send to the participants that is clear and easy to follow .
one aspect of telerehabilitation which has been widely discussed and investigated in the literature is its acceptability to clients and health care professionals .
. found promising evidence of high client and health professional satisfaction ratings for telerehabilitation .
it has been proposed that its utilisation can empower clients , giving them higher confidence levels and a deeper understanding of their condition , leading to improved health outcomes [ 3537 ] .
analysis of the participants comments in the present study revealed that the face - to - face assessment was preferable to the remote assessment , however , that participants would recommend the internet examination to a friend who was unable to travel for treatment . as telerehabilitation aims to provide an alternative when physical distance or disability makes travel difficult , this is an encouraging result . there were a number of limitations in this study . the inexperience of the examiners and their lack of real world
, good results were still obtained , which is promising as it is reasonable to anticipate that these results may be improved when repeated with experienced physiotherapists .
secondly , the demographic of the participants , although spanning across a wide range of ages , was restricted to the university community , and thus the results of this study can only be generalised to other populations with caution .
these limitations should be addressed in future research using experienced examiners with larger sample sizes and using people from a varied demographic background .
additionally , future research should investigate the ability of the system to clinically monitor the progress of a client through the course of their rehabilitation .
the use of telerehabilitation to gather information and diagnose clients with shoulder disorders appears to be both valid and reliable.this is an important first step in obtaining evidence for the use of telerehabilitation for clients that otherwise would find access to physiotherapy services difficult .
the use of telerehabilitation to gather information and diagnose clients with shoulder disorders appears to be both valid and reliable .
this is an important first step in obtaining evidence for the use of telerehabilitation for clients that otherwise would find access to physiotherapy services difficult . | shoulder disorders are common , debilitating , and represent a considerable burden on society . as primary contact practitioners ,
physiotherapists play a large role in the management and rehabilitation of people with these conditions . for those living outside of urban areas , however ,
access to physiotherapy can be limited .
the aim of this study was to evaluate the validity and reliability of using a telerehabilitation system to collect physical examination findings and correctly identify disorders of the shoulder .
twenty - two participants with 28 shoulder disorders were recruited and underwent a face - to - face physical examination and a remote telerehabilitation examination .
examination findings and diagnoses from the two modes of assessment were used to determine validity and reliability of the new method . diagnostic agreement and agreement on individual findings between the two methods
were found to be consistent with the reliability of conventional assessment methods .
this study provides important preliminary findings on the validity and reliability of musculoskeletal examinations conducted via telerehabilitation . |
human t - cell leukemia virus type 1 ( htlv-1 ) infection is of particular interest to the field of immunology as well as microbiology because htlv-1 is never eliminated from the host in spite of vigorous cellular and humoral immune responses against the virus but causes no disease in vast majority of infected subjects ( asymptomatic carriers : acs ) .
although only approximately 2%-3% develop adult t cell leukemia ( atl ) [ 1 , 2 ] and another 0.25%3.8% develop chronic inflammatory diseases involving the central nervous system ( htlv-1-associated myelopathy / tropical spastic paraparesis : ham / tsp ) [ 3 , 4 ] , evaluation of the individual risk for developing diseases in each acs would certainly be of considerable importance especially in htlv-1 endemic area such as southern japan , the caribbean , central and south america , the middle east , melanesia , and equatorial regions of africa .
first , how does htlv-1 persist in the individual host in spite of strong host immune response ?
second , why do some htlv-1-infected people develop consequent diseases such as atl or ham / tsp , whereas the majority remains asymptomatic carriers of the virus ?
third , how is the inflammatory lesion in ham / tsp initiated and maintained , and why is the inflammation specifically in thoracic spinal cord ?
this review summarizes the past and recent works for ham / tsp attempting to resolve each of these questions .
htlv-1 is classified as a complex retrovirus in the genus deltaretrovirus of the subfamily orthoretrovirinae and infects 1020 million people worldwide [ 68 ] .
htlv-1 can be transmitted through sexual contact , injection drug use , and breastfeeding from mother to child [ 10 , 11 ] .
although htlv-1 infection is associated with a range of nonmalignant chronic inflammatory diseases in the eyes , the lungs , or the skeletal muscles , ham / tsp is the bestrecognized with chronic progressive myelopathy characterized by spastic paraparesis , sphincter dysfunction , and mild sensory disturbance in the lower extremities . to date , more than 3,000 cases of ham / tsp patients have been reported in htlv-1 endemic areas .
sporadic cases have also been described in nonendemic areas such as the united states and europe , mainly in immigrants from an htlv-1 endemic area . among acs ,
the lifetime risk of developing ham / tsp , which is different among different ethnic groups , ranges between 0.25% and 4% .
it has been reported that the annual incidence of ham / tsp is higher among jamaican subjects than among japanese subjects ( 20 versus 3 cases/100,000 population ) , with a two to three times higher risk for women in both populations [ 1316 ] .
pathological analysis of ham / tsp autopsy materials indicates that the disease affects the spinal cord , predominantly at the thoracic level [ 1719 ] .
loss of myelin and axons in the lateral , anterior , and posterior columns is associated with perivascular and parenchymal lymphocytic infiltration with the presence of foamy macrophages , proliferation of astrocytes , and fibrillary gliosis .
the presence of atypical lymphocytes ( so - called flower cells ) in peripheral blood and cerebrospinal fluid ( csf ) , a moderate pleocytosis , and raised protein content in csf are typically found in ham / tsp patients .
oligoclonal bands , raised concentrations of inflammatory markers such as neopterin , tumor necrosis factor ( tnf)- , interleukin ( il)-6 and interferon ( ifn)- , and an increased intrathecal antibody synthesis specific for htlv-1 antigens have also been described .
clinical progression of ham / tsp is associated with increased proviral load in individual patients , and the ratio of proviral loads in csf cells / in peripheral blood mononuclear cells ( pbmcs ) is significantly associated with clinically progressive disease . the major histocompatibility complex ( mhc ) class i tetramer analysis of lymphocytes isolated from the csf of ham / tsp patients showed even higher frequencies of htlv-1 tax11 - 19-specific , hla - a*02-restricted cd8 lymphocytes compared to those of pbmcs .
therefore , an increased proliferation or migration of htlv-1-infected and/or htlv-1-specific lymphocytes to the central nervous system ( cns ) might be closely associated with ham / tsp pathogenesis .
previous population association study of 202 cases of ham / tsp and 243 acs in kagoshima , htlv-1 endemic southern japan , revealed that one of the major risk factors is the htlv-1 proviral load .
the median proviral load was more than ten times higher in ham / tsp patients than in acs , and a high proviral load was also associated with an increased risk of progression to disease .
higher proviral load in ham / tsp patients than in acs was observed in other endemic area , such as the caribbean , south america , and the middle east .
it was suggested that genetic factors such as human leukocyte antigen ( hla ) are related to the high proviral load in ham / tsp patients and genetic relatives . in southern
japan , possession of the hla - class i genes hla - a*02 and cw*08 was associated with a statistically significant reduction in both htlv-1 proviral load and the risk of ham / tsp , whereas possession of hla - class i hla - b*5401 and class ii hla - drb1 * 0101 predisposes to ham / tsp in the same population [ 28 , 29 ] . since the function of class i hla proteins is to present antigenic peptides to cytotoxic t lymphocytes ( ctl ) , these results imply that individuals with hla - a*02 or hla - cw*08 mount a particularly efficient ctl response against htlv-1 , which may be an important determinant of htlv-1 proviral load and the risk of ham / tsp . further analysis to look at nonhla host genetic factors revealed that nonhla gene polymorphism also affects the risk for developing ham / tsp .
for example , the tnf- promoter 863 a allele , and the longer ca repeat alleles of matrix metalloproteinase ( mmp)-9 promoter predisposed to ham / tsp , whereas il-10 -592 a , stromal derived factor ( sdf)-1 + 801a and il-15 + 191 c alleles conferred protection against ham / tsp .
the polymorphisms of mmp-9 and il-10 promoter each linked to the htlv-1-encoded transactivator tax - mediated transcriptional activity of each gene [ 31 , 32 ] .
although most studies of htlv-1 genotype have reported no association between variants of htlv-1 and the risk of ham / tsp , furukawa et al . reported the association between htlv-1 tax gene variation and the risk of ham / tsp .
the tax subgroup a that belongs to cosmopolitan subtype a was more frequently observed in ham / tsp patients and this effect was independent of protective allele hla - a*02 .
hla - a*02 appeared to give protection against only one of the two prevalent sequence variants of htlv-1 , tax subgroup b that belongs to cosmopolitan subtype b but not against tax subgroup a in japanese population .
interestingly , hla - a*02 appears not to give protection against infection with cosmopolitan subtype a in a population in iran .
these findings suggest that both host genetic factors and htlv-1 subgroup play a part in determining the risk of ham / tsp .
in htlv-1 infection , anti - htlv-1 antibody that often includes igm is detected in all infected individuals , either acs or patients with ham / tsp .
it has been reported that ham / tsp patients generally had higher anti - htlv-1 antibody titer than acs with the similar htlv-1 proviral load [ 3436 ] .
these data suggest that there was persistent expression of htlv-1 proteins in vivo and the existence of an augmented humoral immune response to htlv-1 in ham / tsp patients .
interestingly , although antibody responses to the immunodominant epitopes of the htlv-1 envelope ( env ) proteins were similar in all of three clinical groups ( ham / tsp , atl , and acs ) , reactivity to four tax immunodominant epitopes was highest in ham / tsp ( 71%93% ) than atl patients ( 4%31% ) or acs ( 27%37% ) . in 2002 , levin et al . reported that antibodies that recognize htlv-1 tax protein can cross - react with a heterogenous nuclear riboprotein ( hnrnp)-a1 , suggesting intriguing evidence for antigen mimicry in htlv-1 infection .
however , since the host protein hnrnp - a1 is not confined to the central nervous system but is widely expressed and is not normally accessible to antibody attack , it is unlikely that anti - tax antibody explains the onset or initial tissue damage of ham / tsp .
rather , anti - tax antibody might be associated with subsequent inflammation following initial tissue damage and disruption of blood brain barrier , which is probably caused by the antiviral immune responses to htlv-1 and induces the release of autoantigens .
previous reports indicated that patients with ham / tsp had both a lower frequency and a lower activity of nk cells ( especially the cd3cd16 subset ) than acs , although the results were not normalized with respect to the proviral load .
since an important mechanism of induction of nk cell - mediated killing is recognition by the nk cell of a complex of the nonpolymorphic mhc molecule hla - e bound to a peptide derived from the signal sequence of some other mhc class i molecules , the synthetic tetramers of hla - e with the hla - g signal sequence peptide were used to identify nk cells in ham / tsp patients .
the results clearly showed a lower frequency of hla - e tetramer - binding cells in ham / tsp patients than acs , and as in the earlier studies , this reduction in frequency was particularly notable in the cd3 cells whereas there was no significant difference in the frequency of hla - e tetramer - binding cd3 cells between patients with ham / tsp and acs .
recent data also suggest that the frequency of invariant nkt cells in the peripheral blood of ham / tsp patients is significantly decreased when compared with healthy subjects and/or acs [ 42 , 43 ] .
these findings indicated that the activity of the nk or nkt cell response was associated with the presence or absence of ham / tsp .
interestingly , previous uncontrolled preliminary trial of viable lactobacillus casei strain shirota containing fermented milk for ham / tsp patients resulted in significant increase of nk cell activity with improvements in clinical symptoms .
thus , circulating nk and nkt cells might also play an important role in the disease progression and the pathogenesis of ham / tsp .
it has been reported that htlv-1 preferentially and persistently infects cd4cd25 lymphocytes in vivo , which contains the majority of the foxp3 tregs . in ham / tsp patients ,
the percentage of foxp3 tregs in cd4cd25 cells is lower than that in acs and uninfected healthy controls [ 45 , 47 ] whereas the percentage of foxp3 cells in the cd4 population tended to be higher in the ham / tsp patients than in the acs [ 4850 ] .
as cd25 is induced by htlv-1 tax oncoprotein , it is most likely that the proportion of foxp3 cells falls in the cd4cd25 population , which contain both tregs and activated nontregs , in htlv-1-infected individuals especially ham / tsp patients .
interestingly , the frequency of htlv-1 negative foxp3cd4 cells positively correlated with the htlv-1 proviral load [ 23 , 49 ] and the ctl activity negatively correlated with the frequency of htlv-1 negative foxp3cd4 cells .
these data suggest that an increase in htlv-1 negative foxp3cd4 tregs is one of the chief determinants of the efficiency of t cell mediated immune control of htlv-1 .
if such tregs reduce ctl activity , which in turn increases the htlv-1 proviral load , this activity increases the risk for developing ham / tsp . it is well known that antiviral cd4 t cell responses are of central importance in driving b - cell and cd8 t - cell responses in vivo .
the htlv-1 antigen most commonly recognized by cd4 t cells is the env protein [ 52 , 53 ] , in contrast with the immunodominance of tax in the cd8 t cell response [ 5456 ] . at a similar proviral load ,
patients with ham / tsp had significantly increased frequency of virus - specific cd4 t - cells compared to that of acs [ 53 , 57 ] .
the antiviral t helper ( th)1 phenotype is also dominant among htlv-1-specific cd4 t cells in both acs and patients with ham / tsp , and there is a higher frequency of ifn- , tnf- , and il-2 production by cd4 t cells in patients with ham / tsp compared to acs of a similar proviral load [ 58 , 59 ] .
a role for cd4 + t cells in initiating and causing ham / tsp is also consistent with the immunogenetic observations that the possession of hla - drb1 * 0101 , which restricts immunodominant epitope of htlv-1 env gp21 , was associated with susceptibility to ham / tsp in independent htlv-1-infected populations in southern japan [ 28 , 29 ] and northeastern iran . accordingly , a synthetic tetramer of drb1 * 0101 and the immunodominant htlv-1 env380394 peptide was used to analyze env - specific cd4 t cells directly ex vivo .
the results showed that the frequency of tetramercd4 t cells was significantly higher in ham / tsp patients than in acs with similar proviral load .
moreover , direct ex vivo analysis of tetramercd4 t cells from two unrelated drb1 * 0101 positive ham / tsp patients indicated that certain t cell receptor ( tcr ) vs were utilized and antigen - specific amino acid motifs were identified in complementarity determining region ( cdr ) 3 from both patients .
these data suggest that the observed increase in virus - specific cd4 t cells in ham / tsp patients , which may contribute to cd4 t cell - mediated antiviral immune responses and to an increased risk of ham / tsp , was not simply due to the rapidly growing htlv-1-infected cd4 t cells but was the result of in vivo selection by specific mhc - peptide complexes , as observed in freshly isolated hla - a*0201/tax11 - 19 tetramer cd8 t cells and muscle infiltrating cells from ham / tsp patients and htlv-1-infected polymyositis patients .
previous reports indicated that the htlv-1-specific cd8 ctl is typically abundant , chronically activated , and mainly targeted to the viral transactivator protein tax .
also , as already mentioned , the median proviral load in pbmcs of ham / tsp patients was more than ten times higher than that in acs , and a high proviral load was also associated with an increased risk of progression to disease .
furthermore , hla - a*02 and hla - cw*08 genes were independently and significantly associated with a lower proviral load and a lower risk of ham / tsp [ 28 , 29 ] , and cd8 t cells efficiently kill autologous tax - expressing lymphocytes in fresh pbmcs in htlv-1-infected individuals .
these data have raised the hypothesis that the class i - restricted cd8 ctl response plays a critical part in limiting htlv-1 replication in vivo and that genetically determined differences in the efficiency of the ctl response to htlv-1 account for the risk for developing ham / tsp .
however , since the frequency of htlv-1-specific cd8 t cells was significantly elevated in ham / tsp patients than in acs [ 64 , 65 ] and these cells have the potential to produce proinflammatory cytokines , there is a debate on the role of htlv-1-specific - cd8 t cells , that is , whether these cells contribute to the inflammatory and demyelinating processes of ham / tsp or whether the dominant effect of such cells in vivo is protective against disease , although these two mechanisms are not mutually exclusive .
recently , sabouri et al . reported that a frequency of cd8 t cells that were negative for costimulatory molecules such as cd27 , cd28 , cd80 , cd86 , and cd152 was significantly higher in patients with ham / tsp than in age - matched uninfected controls , but there was no such difference between acs and uninfected controls .
they also found a significantly lower frequency of perforin cells and granzyme b cells in the cd8 t cells in htlv-1-infected subjects than in uninfected controls , although there was no significant difference between patients with ham / tsp and acs .
furthermore , the lytic capacity of htlv-1-specific ctl between ham / tsp and acs estimated by cd107a mobilization assay showed the significantly lower cd107a staining in htlv-1-specific ctl in ham / tsp than acs .
these findings suggest that patients with ham / tsp have a high frequency of htlv-1-specific cd8 t cells with poor lytic capacity , whereas acs has a lower frequency of cells with high lytic capacity .
dendritic cells are antigen - presenting cells which play a critical role in the regulation of the adaptive immune response . in htlv-1 infection
, it has been shown that the dcs from ham / tsp patients were infected with htlv-1 , and the development of ham / tsp is associated with rapid maturation of dcs .
one of the hallmarks of htlv-1 infection is the in vitro proliferation of pbmcs when cultured in the absence of exogenous antigen or mitogen , referred to as spontaneous lymphocyte proliferation ( slp ) , and in ham / tsp patients , the levels of slp reflect the severity of the disease [ 70 , 71 ] .
interestingly , depletion of dcs from the ham / tsp patient 's pbmcs abolishes spl while supplementing dcs , but not b cells nor macrophages restore proliferation . dc dependent mechanism of slp was further supported by data showing that antibodies to mhc class ii , cd86 , and cd58 can block spl .
recently , jones et al . had demonstrated that human - derived both myeloid and plasmacytoid dcs are susceptible to infection with cell - free htlv-1 , and htlv-1-infected dcs can rapidly transfer virus to autologous primary cd4 t cells .
furthermore , in contrast to the previous report that cd4cd25 t cells are responsible for the stimulation of tax - specific cd8 t cells , it was recently demonstrated that , compared to the cd4cd25 t cells , the dcs are the major cell type responsible for the generation and maintenance of the tax - specific cd8 t cells both in vitro and in vivo .
these findings suggest that the interaction of dcs with htlv-1 is also crucial for the pathogenesis of ham / tsp .
previous studies have indicated that only a small proportion of the monocyte - macrophage lineage cells are infected with htlv-1 in peripheral blood and that there has been no direct evidence indicating that htlv-1-infected cells of the monocyte - macrophage lineage cells are present in the cns .
however , monocyte - macrophage lineage cells may also play important roles in the pathogenesis of ham / tsp , since it has been shown that the activation of macrophage and microglial cells within the cns closely correlated with the proviral load within the cns of ham / tsp patients .
meanwhile , it was also shown that a vast majority of bone marrow cells from ham / tsp patients are positive for htlv-1 proviral dna but negative for viral rna expression , whereas no htlv-1 proviral dna positive cd34 hematopoietic progenitor cells were detected in atl patients .
these results suggest that htlv-1-infected cells within the bone marrow may be a reservoir of htlv-1 in ham / tsp patients and play an important role in the etiology of neuroinflammation observed in ham / tsp .
as shown in figure 1 , accumulating evidence suggests that the virus - host immunologic interactions play a pivotal role in ham / tsp pathogenesis .
genetically determined less efficient ctl response against htlv-1 may cause higher proviral load and antigen expression in infected individuals , which lead to activation and expansion of antigen - specific t cell responses , subsequent induction of large amounts of proinflammatory cytokines and chemokines , and progression of ham / tsp development . | human t - cell leukemia virus type 1 ( htlv-1 ) is a replication - competent human retrovirus associated with two distinct types of disease only in a minority of infected individuals : the malignancy known as adult t - cell leukemia ( atl ) and a chronic inflammatory central nervous system disease htlv-1-associated myelopathy / tropical spastic paraparesis ( ham / tsp ) .
although the factors that cause these different manifestations of htlv-1 infection are not fully understood , accumulating evidence suggests that complex virus - host interactions play an important role in determining the risk of ham / tsp .
this review focuses on the role of the immune response in controlling or limiting viral persistence in ham / tsp patients , and the reason why some htlv-1-infected people develop ham / tsp whereas the majority remains asymptomatic carriers of the virus . |
the giant cell fibroma is an interesting non - neoplastic lesion of the oral mucosa .
the gcf was first described as a separate entity among fibrous hyperplastic soft tissue lesions by weathers and callihan in 1974 .
it was named for its characteristically large , stellate - shaped , mononuclear and multinucleated giant cells .
they examined more than 2,000 specimens in a group of fibrous hyperplasias , and 108 met their criteria for this new lesion which they called gcf . before weathers and callihans distinction of gcf , eversole and rovin
compared and contrasted 279 fibrous hyperplastic gingival lesions , which fell into four categories : pyogenic granuloma , peripheral gingival fibroma , peripheral giant cell granuloma , and peripheral ossifying fibroma .
speculations from the study were that all four types of lesions are merely varied histologic responses to common etiologic factors , but similar to one another and to other fibrous hyperplasias .
gcfs are often mistaken for papilloma or fibroma because of their papillary surface and fibrous or elastic nature , respectively.[610 ] very few case reports are seen regarding this tumor and controversy regarding the origin of this lesion continues .
this retrospective study was aimed to evaluate the clinicopathological features of gcfs in the sub continent population .
the study group consisted of 21cases of gcf from 609 fibrous lesions , retrieved from the files of the department of oral pathology microbiology , meenakshi ammal dental college , chennai , from 1995 to 2010 .
the tissues were processed for routine h and e stain and examined under light microscope .
the demographic and clinical data of 21 cases of gcf are presented in table 1 .
the mean age of patients at the time of diagnosis was 39 years ( 6 - 67 years ) .
the lesion occurred more frequently on the mandibular gingiva ( 9 cases ) , maxillary gingiva ( 5 cases ) [ figure 1 ] , tongue ( 3 cases ) , and two cases each on the buccal mucosa [ figure 2 ] and the hard palate .
table exhibiting location and age lobulated growth in the maxillary gingiva pedunculated growth in left buccal mucosa microscopically , all the cases revealed dense collagenous fibrous tissue made of haphazardly arranged dense fiber bundles [ figure 3 ] .
stellate shaped giant cells were seen in the connective tissue immediately below the epithelium [ figure 4 ] with short dendritic processes and large hyperchromatic nuclei .
overlying epithelium was keratinized stratified squamous showing mild hyperplasia , with elongated and thick rete ridges .
based on the microscopic findings , all the cases were diagnosed as giant cell fibroma .
haphazardly arranged dense fiber bundles exhibiting slightly stellate fibroblasts scattered throughout in moderate numbers ( h and e stain , 20 ) artifactual spacing was observed surrounding the giant cells ( h and e stain , 20 )
gcf is a fibrous hyperplastic lesions of the oral cavity with distinctive clinicopathology unlike traumatic fibroma .
giant cell fibroma is a relatively rare fibrous hyperplasic lesion that could be diagnosed only on histopathological examination .
it is a reactive lesion that was considered to occur due to chronic irritation and is characterized by functional changes in the fibroblastic cells .
though gcf can occur at any age , the mean age reported was approximately 29 years in previous studies .
the mean age of occurrence in the present study is 39 years [ table 1 ] .
this discrepancy may be attributed to its asymptomatic nature or patients delayed reporting or due to genetic and racial differences .
clinically gcf is asymptomatic and appears as pedunculated [ figure 2 ] or sessile fibrous lesion with the color of normal mucosa , measuring 0.5 - 1 cm with a pebbly surface [ figure 5 ] .
it is found more frequently on the gingiva , followed by the tongue and the buccal mucosa . in the present study also , gingiva is the most common site in the oral cavity [ table 2 ] .
pebbly appearance in right retromolar region table exhibits the lesion distribution sites four studies have shown a slight female preponderance for the occurrence of gcf whereas another study has demonstrated no significant sex predilection .
we found slight male predominance ( m : f=12:9 ) . clinically suggesting , majority of oral giant cell fibromas are unrelated to the histologically similar fibrous papule of the nose or facial angiofibroma .
none of the 21 lesions were diagnosed correctly as gcf at the time of initial clinical presentation .
although it remains controversial whether to distinguish gcf from other forms of fibrous hyperplasia , most authorities have listed it as a separate entity because of its distinctive histopathologic characteristics and ultra structure .
histologically the lesions are characterized by a diffuse , somewhat immature , rather avascular collagenic stroma with small bipolar and slightly stellate fibroblasts scattered throughout in moderate numbers .
occasional fibroblasts will be quite large and angular , and may have more than one nucleus .
gcf is characterized by the presence of numerous large stellate and multinucleated giant cells in a loose collagenous stroma [ figures 3 and 4 ] .
these pathognomonic cells are never hyperchromatic , as they would be if they were truly dysplastic fibroblasts , and they often have a smudged appearance . mechanisms of fusion of macrophages to form giant cells are extensively studied .
large amounts of lymphokines are produced that causes fusion of macrophages which results in the formation of multinucleated giant cells ( galndo et al .
, 1974).fusion occurs between young and older cells , the stimulus being the recognition of alterations in cell surface by young macrophages ( mariano et al .
, 1974).simultaneous attempted phagocytosis , where in 2 or more macrophages try to ingest same particle at the same time results in the fusion of endosomal margins and form multinucleated giant cells ( chambers et al . , 1978 ) .
in immune
mediated phenomenon , large amounts of lymphokines are produced that causes fusion of macrophages which results in the formation of multinucleated giant cells ( galndo et al . , 1974 ) .
fusion occurs between young and older cells , the stimulus being the recognition of alterations in cell surface by young macrophages ( mariano et al . , 1974 ) .
simultaneous attempted phagocytosis , where in 2 or more macrophages try to ingest same particle at the same time results in the fusion of endosomal margins and form multinucleated giant cells ( chambers et al . , 1978 ) .
gcf has abundance of dense collagen fibres which is responsible for the clinical appearance of firm fibroma like mass .
gcf and other common fibrous hyperplasias like fibromas , fibroepithelial polyps show similar histopathologic features , but presence of numerous stellate giant cells differentiates gcf from other similar lesions .
histopathologic examination of the lesions in this study also correlates with the findings in earlier studies .
electron microscopic and immunohistochemical study revealed that this giant fibroblast are identified as atypical fibroblasts and formed by fusion of mononuclear cells .
giant fibroblasts showed negative reactivity for cytokeratin , neurofilament , hhf , cd 68 , hla dr , tryptase and s 100 protein .
the results showed positive staining only for vimentin and prolyl-4 - hydrolase.[78142022 ] this suggests that the stellate and multinucleate cells of gcf have a fibroblast phenotype .
histochemical and immunohistochemical studies have also revealed that fibroepithelial polyps contain elastin but gcf does not .
further minor subsets of giant cells in few cases showed positivity for factor xiiia indicating that stellate cells may be of fibroblastic lineage with variable mixture of cells from mucosal dendrocytes .
the choice of treatment for gcf is surgical excision in adults whereas in children electrosurgery or laser excision is preferred .
though there is distinct histopathologic features for gcf , its clinical presentation and prognosis are similar to the conventional fibroma / fibroepithelial polyp .
a high index of suspicion and appropriate investigative work up is necessary for separate lesions in order to arrive at a suitable diagnosis and offer appropriate therapy . | objective : giant cell fibromas ( gcf ) of the oral cavity are found predominantly in caucasians and rarely in other races .
this retrospective study was done to evaluate the clinicopathological features of gcfs in a sample of indian population.materials and methods:21 oral gcf cases were investigated from the year 1995 to 2010 .
clinical data and microscopic features were reviewed and analyzed.results:the mean age of patients at the time of diagnosis was 39years .
oral gcf occurred in patients between 6 and 67 years of age .
the lesions were 4 - 17 mm in greatest dimension .
gcf frequently has the provisional diagnosis of fibroma or papilloma .
all tumors were treated by total surgical excision and no recurrence was reported .
the consistent and diagnostic feature was the presence of large stellate giant cells , usually with one or two nuclei .
multinucleated giant cells were seen occasionally .
these giant cells were most numerous in the connective tissue beneath the epithelium.conclusion:though there are distinct histopathologic features for gcf , its clinical presentation and prognosis are similar to the conventional fibroma / fibroepithelial polyp . |
replantations for major amputations of the upper limb have been widely reported and performed at many centres around the world .
we report a case of successful replantation of complete avulsion amputation of the right upper limb at scapulothoracic level in a 3-year - old boy . in our literature search
a 3-year - old boy was brought to the emergency room around 3 h after sustaining an injury while playing in the fields .
his right upper limb accidentally got caught in the belt of a thresher machine and was avulsed from the chest wall .
the child was taken to a nearby hospital with the amputated part [ figures 1 and 2 ] from where he was referred to our hospital .
amputated limb ( dorsal aspect ) amputated limb ( ventralaspect ) on arrival , the child was stable and the amputated limb was well preserved . the patient was evaluated to rule out other injuries and prepared for surgery while an x - ray was done for the amputated part [ figures 3 and 4 ] .
x - ray of the amputated part on examination , the skin disruption was found to be at axillary level while the upper limb had avulsed from the chest wall along with the scapula and its attached muscles ( scapulothoracic dissociation ) .
the deltoid muscle was disrupted from its origin and found in the amputated stump with the skin retracted distally over it .
the cut ends of brachial artery and its accompanying vein were found retracted under the biceps muscle .
the brachial plexus was disrupted at cord level with distal cut ends of medial , lateral and posterior cords found alongside the transected vessels .
the posterior cord was found to be of longest length suggesting higher level of avulsion .
after thorough cleaning of the amputated limb , the brachial artery and its accompanying vein were dissected out and tagged .
the brachial artery was cannulated , and infusion of cold heparinised saline ( 5000 units in 500 ml ) started .
meanwhile , the patient was shifted to the operating room and anaesthetised . on exploration of the amputation stump ,
the axillary artery was found to be transected after the branch to the latissimus dorsi muscle .
the posterior cord was not found in the wound , and an incision was given in the supraclavicular region for exploration of the brachial plexus .
however , the proximal end of the posterior cord could not be found . since the level of transection of the axillary artery was after the take - off of the thoracodorsal and circumflex scapular arteries , the anticipated blood supply to the scapular muscles after replantation would have been doubtful .
furthermore , the approach to debride the subscapularis muscle in the event of necrosis following replantation would have been cumbersome and dangerous .
the supraspinatus and infraspinatus muscles were left attached to the scapula as even in the scenario of necrosis of these muscles following replantation , they would potentially be easily approached from the dorsal side . the amputated limb was then brought into the operative field [ figure 5 ] .
the dislocation of shoulder joint was reduced and fixed with a 1.5 mm k - wire . the fracture of glenoid neck was reduced and stabilised with two 1.5 mm k - wires .
acromioclavicular joint was fixed by a k - wire , and acromioclavicular joint capsular repair was performed by figure of 8 non - absorbable sutures .
the associated elbow dislocation was managed with closed reduction , and the fracture of ulna was managed by splinting .
amputated limb following fasciotomy and prepared amputation stump axillary vessels were dissected to the healthy end . since no bone shortening was feasible in this case , an end - to - end vascular anastomosis was not possible .
an 18 cm long saphenous vein graft was harvested from the left lower leg to reconstruct the segmental defects of the axillary artery and vein ( 8 cm each ) .
the total ischaemia time was nearly 8 h ( 1 h warm/7 h cold ) .
the distal end of the posterior cord was anastomosed end to side with the proximal medial cord .
there was persistent ooze from the scapular side , which was packed with laparotomy sponges .
intraoperatively , the patient was given unfractionated heparin and 3 paediatric units of blood were transfused .
after 48 h , the sponge packs were removed from scapular site in the operating room and no further oozing was encountered .
post - fasciotomy raw area was covered with split - thickness skin graft on day 20 .
the k - wires were removed on day 90 in the outpatient department , and the arm supported in a sling , and physiotherapy started [ figures 6 and 7 ] .
the last follow - up at 18 months post - operative showed evidence of recovery of crude touch sensations up to the digits .
one year post - operative ( frontal view ) one year post - operative ( oblique view )
nonetheless , they are worthwhile as reported in a large series by sabapathy et al . in 2007 as patients with successful replants put the hand to greater use . furthermore , as reported by otto et al . in 2015
, replantation of a traumatically amputated arm leads to good function and higher satisfaction rates than a prosthesis .
although few reports are available of successful shoulder level replantation , there is none for scapulothoracic level .
although venkatarama et al . in 2015 have reported a case of scapulothoracic avulsion amputation in a 18-year - old male , the replanted limb had to be amputated due to ensuing sepsis .
hence , to our knowledge , this is the first reported case of a successful replantation of a limb separated at scapulothoracic level .
literature is rife with reports of cases with scapulothoracic dissociation which is a closed avulsion injury caused by a severe traction injury and associated with massive soft tissue swelling of the shoulder , lateral displacement of the scapula and severe neurovascular injury .
scapulothoracic muscles are devascularised and have to be debrided . with no muscles being available for scapulothoracic fixation
bone shortening is not possible , and therefore , vascular reconstruction would always involve vein grafts .
however , with the patient being a child , a reasonable degree of neural recovery is expected .
furthermore , the replanted upper limb at this level would be better than any available prosthesis .
the child and family have been saved the stigma of an amputation which can have serious psychosocial issues .
although the child is doing fine at present , there is still a long road ahead for a reasonable functional recovery , and the secondary reconstructive procedures may be required .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
the authors certify that they have obtained all appropriate patient consent forms . in the form the patient(s )
has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal .
the patients understand that their names and initials will not be published and due efforts will be made to conceal their identity , but anonymity can not be guaranteed .
| replantations for major amputations of upper extremity have been widely performed .
we report a unique case of successful replantation of scapulothoracic avulsion amputation in a child . in this manuscript
, we discuss the various challenges faced during the procedure and chances of neural recovery . |
a 42-year - old man was admitted with a recurring vesicocutaneous fistula on the lateral surface of the left hip after two surgical repairs .
three years previously he had experienced a major pelvic trauma ( closed left acetabular and left hip fracture ) in a motor vehicle accident with immobilization being the only treatment applied .
three months after the accident , the patient denoted urine leakage from a small orifice on the left hip .
he used two to three incontinence pads per day for the leakage . during the following 2 years the patient twice underwent surgical treatment ( extraperitoneal fistula excision and bladder wall suturing ) in a small rural hospital
admission radiograms disclosed ankylosis of the left hip joint , avascular necrosis of the femoral head , and central hip dislocation through the perforated acetabulum ( fig .
1 ) . on the lateral surface of the left hip in the projection of the greater trochanter
, there was a 2 mm fistula orifice with hyperemic rims and discharge confirmed biochemically to be urine .
the median micturition volume was 210 ml with a maximum flow speed of 18 ml / s according to the uroflowmetry .
otherwise , the patient was healthy and all laboratory parameters were within the normal ranges .
the cystography combined with the fistulography showed contrast extravasation through the left bladder wall but could not elucidate any relevant information about the fistula tract 's course or its relation to the pelvic bones and the hip joint ( fig .
2 ) . to obtain this information , we performed multispiral computed tomography ( ct ) combined with ct - fistulography .
the nonenhanced ct images showed a drastic disfigurement of the left hip joint with some dense structures up to 5 cm in size lying in the joint cavity ( fig .
a fistulography showed contrast extension to the bladder with excellent visualization of the fistula tract within the left hip joint ( fig .
the patient underwent a retroperitoneal fistula excision and a double - layer closure of the bladder wall .
the patient was discharged on the 14th postoperative day , and cystography showed no contrast extravasation .
the fistula and urinary leakage recurred within 2 months . a decrease in mean bladder volume to 130 ml
was found according to the bladder diary and during the bladder filling through the urethral catheter .
wide dissection of the left bladder wall was performed with a complete excision of scar tissue .
to 10 urinary stones 0.3 to 4 cm in size were extracted from the joint cavity ( which were previously seen on ct ) . also , ileocystoplasty was performed to augment the bladder , and the left rectus abdominis muscle flap was interposed between the bladder and the acetabulum .
the bladder capacity during filling was 150 ml with a postvoid residual volume of 20 to 30 ml .
after analyzing the previous failures , we decided to make a urinary diversion as a salvage procedure for this patient .
the bricker procedure was chosen by the patient after explanation of all possible variants ( the patient refused to catheterize himself because of living in rural conditions very far from any medical help ) .
cystectomy was not performed because the access to the bladder was virtually impossible as the result of the previous procedures . after the operation , discharge from the fistula continued with significant decrease of the amount and change in appearance to a whitish cloudy liquid .
the patient was referred to the orthopaedic center for further treatment . during the next 2 months , the patient two joint revisions with the removal of the nonviable bone tissue and open reduction internal fixation ( orif ) to stabilize the pelvic bones .
according to current guidelines , acetabular fractures with articular displacement of more than 2 mm , as observed in our patient , should be treated by the orif procedure .
left without fixation , the bony fragments in this weight - bearing area could lead to bladder wall entrapment by the mechanism demonstrated in fig .
together with the central dislocation of the hip , this leads to bladder wall jamming between the bony fragments . a failure to reduce the bladder impingement leads to local ischemic and mechanical damage causing a connection between the bladder lumen and the joint cavity to ensue . regularly rising pressure within the bladder can press the bladder wall against the sharp bony fragments ( if present ) , which could also contribute to the relapse of the fistula , even with soft tissue interposition , as long as the fracture is left without orif and special care is taken to remove all sharp bony prominences in the bladder vicinity .
delayed presentation of the bladder entrapment secondary to the nonoperative treatment of the lateral compression pelvic fracture has been reported in the literature , with authors particularly recommending the use of ct with bladder contrast or magnetic resonance tomography if an injury is treated nonoperatively because of the high probability of occult bladder entrapment and the unreliability of cystography for visualization [ 4 - 8 ] . in our experience ,
also , previously , an acetabular wall defect in an intimate relation to the truncated bladder extension was cited as a pathognomonic finding of acetabular bladder entrapment on the ct images , which we also observed in our patient .
these two signs ( fistula tract visualization during ct - fistulography and bladder wall extension towards the acetabular perforation ) are the tips for the correct diagnosis of bladder wall entrapment .
concerning the orthopedic treatment options for this patient , restoration of the hip joint is feasible only after bladder integrity has been restored and pelvic ring stability is established . in cases of untreated acetabular fractures with a central hip dislocation , acetabular augmentation with meshes , bone grafting , and
one more point that should be taken into consideration is that our patient had the hip joint ankylosis for several years .
tha of the ankylosed joint with the restoration of range of motion is possible as has been reported in the literature .
however , the clinical outcomes of this procedure are compromised by the long - term muscle disuse , resulting in atrophy and soft tissue contracture .
first , after the resection of all nonviable bone tissue and closure , a continuous irrigation system is established .
when the perfusate is clean and cultures are negative , the cement / antibiotic molds in the form of hip prosthesis ( spacer ) should be placed into the bone canal and the joint cavity to maintain the joint space for several months with rehabilitation to prevent immobilization morbidity .
if there is no infection recurrence , tha can be performed after several months of observation . in our case ,
the treatment strategy was suboptimal because the fistula excision and the bladder wall repair and prolonged bladder drainage had to be combined with the joint revision and orif .
it was initially unclear that the patient , who was ambulating freely without assistance 3 years after the trauma , had an unstable pelvic fracture .
nevertheless , leaving the pelvis without fixation enables the bladder entrapment mechanism to work even after a successful reconstructive operation and creates conditions for fistula recurrence .
failure to eliminate the entrapment mechanism could lead to multiple operations up to salvage procedures with heterotopic urinary diversion .
this case of a vesico - acetabular fistula is an illustrative example of how a hidden cause for a pathology can lead to mistreatment .
the bladder entrapment mechanism , encountered during the acute period of pelvic fractures , persisted in this patient for 3 years after the trauma , even when he regained the ability to walk without assistance , because of the malunion of the fractured bones , which led to the initial mistake in the clinical assessment .
this issue should be considered by urologists when managing patients with urological problems related to pelvic trauma , especially in countries with high rates of trauma and difficulties for patients in reaching specialized medical help , as in our case . | we report a rare case of vesico - acetabular fistula due to an improperly treated pelvic fracture with urinary stone formation in the joint cavity .
this complication was related to an unrecognized mechanism of bladder wall entrapment in the acetabular floor defect during weight bearing .
this situation led to several mistreatment decisions in our case and should be always considered by urologists dealing with patients after major pelvic trauma . in this case report , we analyze the publications related to this problem , discuss the main mechanisms of bladder wall damage after acetabular fracture , and propose tips for diagnosis and treatment . |
it is at present known and accepted that immunoglobulin g4 ( igg4)-associated cholangitis ( iac ) is one of several diseases associated with autoimmune pancreatitis ( aip ) [ 1 , 2 , 3 ] .
however , iac may occur in 2090% of cases of aip whereas a study of the mayo clinic recently revealed that 92.5% of patients with iac suffer from aip [ 4 , 5 , 6 ] .
a possible involvement of helicobacter pylori in the initiation of the autoimmune process is speculated [ 7 , 8 , 9 ] .
typical results concerning blood values are high igg4 concentrations , which can be seen as a useful indicator to differentiate between other pancreatic or bile duct diseases [ 1 , 2 , 3 , 4 , 10 ] .
igg4-related diseases such as aip and iac have typical histopathological features in common showing a diffuse infiltration with lymphocytes and igg4-positive plasma cells [ 1 , 2 , 4 , 7 , 10 ] .
the acute syndrome appears with obstructive jaundice ( 30100% ) , diabetes mellitus ( 4070% ) , abdominal pain ( 35% ) , and weight loss ( 30% ) [ 1 , 3 , 4 , 7 , 10 , 11 ] .
typical changes in pancreatic tissue are diffuse pancreatic swelling ( diffuse type ) or a focal pancreatic mass ( focal type ) with local lymphadenopathy and peri - pancreatic capsule - like rim [ 7 , 11 , 12 , 13 ] .
iac is characterized by bile duct wall thickening and biliary strictures , which are , in contrast to primary sclerosing cholangitis , predominantly located in the lower bile ducts [ 1 , 7 , 11 , 14 , 15 , 16 ] .
both aip and iac respond well to steroid therapy [ 3 , 11 , 14 , 17 , 18 ] .
although there is no accepted consensus concerning the dose of steroid therapy , an initiation of prednisolone with 0.6 mg / kg / day followed by steroid dose tapering has been demonstrated to be effective [ 1 , 7 , 11 , 19 , 20 ] . the need for maintaining immunosuppression ( e.g. with azathioprine ) after resolution has been documented [ 4 , 7 , 19 ] . based on clinical and radiological similarities to primary sclerosing cholangitis ,
cholangiocarcinoma or pancreatic neoplasm but with completely different prognosis and therapeutic strategies , it is of major importance for the physician to differentiate between these entities and aip / iac .
a 68-year - old male caucasian patient was referred to our institution in may 2011 for a suspected tumor in the pancreatic head with consecutive stenosis of the hepatico - choledochic duct .
anamnestically , the patient complained of progressive fatigue and slight weight loss of 4 kg in the past 3 months accompanied by a painless jaundice .
laboratory studies were significant for total bilirubin of 5.5 mg / dl ( normal 0.31.2 mg / dl ) , alkaline phosphatase ( ap ) of 294 u / l ( normal 25124 ) and -glutamyltransferase ( -gt ) of 359 u / l ( normal < 55
advanced diagnostic examinations revealed a hypergammaglobulinemia of 19.3% ( normal 8.015.8% ) with a significant elevation of the igg4 subtype to 2,350 mg / l ( normal 521,250 mg / l ) , while titers for anti - nuclear , anti - mitochondrial and anti - neutrophilic cytoplasmic antibodies were all negative .
furthermore , the tumor marker ca 19 - 9 was elevated to 532 u / ml ( normal < 37 u / ml ) .
presented a swelling of the processus uncinatus , conspicuous cholestasis , and a ductus wirsungianus with many cystic lesions .
differentiation between a chronic process of inflammation or a malignant process was not possible with certainty ( fig .
consecutive endoscopic retrograde cholangiopancreatography ( ercp ) showed a stenosis of the distal ductus hepaticus communis ( dhc ) caused by pancreatic head swelling and also a bihilar stenosis of the main hepatic bile ducts ( fig .
cytology of the bile duct stenosis revealed inflammatory cells without evidence of malignancy . under suspicion of aip with iac , immunosuppressive therapy with an initial steroid dose of 50 mg prednisolone
steroids were tapered down slowly by scheme to 5 mg / day prednisolone conservation dose in combination with azathioprine 1 mg / kg / day . at follow - up 3 months later , the patient was in excellent general condition , had no complaints , had gained weight , and jaundice was no longer detectable .
ercp revealed a significant regression of the stenosis of the dhc and the main right and left bile ducts ( fig .
total serum bilirubin ( 0.2 mg / dl ) , -gt ( 107 u / l ) , ap ( 48 u / l ) , igg4 ( 1,110 mg / l ) , and finally ca 19 - 9 ( 9 u / ml ) were within normal ranges ( fig .
mri control examination 3 months after initiation of immunosuppressive therapy demonstrated regressive largeness of the bile ducts and pancreatic head .
we herein describe a patient who was referred to our institution with the suspicion of a carcinoma of the pancreatic head with consecutive cholestasis . clinical signs which encouraged the diagnosis were weight loss , progressive fatigue and painless jaundice .
moreover , the tumor marker ca 19 - 9 was significantly elevated , while pancreatic enzymes were within normal ranges . according to the literature , elevated levels of ca 19 - 9
are not common in patients with aip , while levels > 100 u / ml are often associated with pancreatic cancer .
the most common clinical features of aip are weight loss and painless jaundice , the last being reported to occur in up to 100% of patients [ 1 , 3 , 4 , 7 , 10 , 11 , 22 , 23 ] .
aip is frequently associated with extrapancreatic organ involvement , especially of the biliary tract , so - called iac .
elevated levels of serum igg4 are a characteristic feature of aip with a sensitivity of 76% and a specificity of 93% [ 21 , 22 ] .
recently described a specificity of 97% for a > 2-fold increase in serum igg4 , while the specificity for a > 4-fold increase was even 100% . in our case ,
serum igg4 was significantly elevated to 2,350 mg / l ( normal 521,250 mg / l ) .
ercp displayed a stenosis of the distal dhc caused by pancreatic head swelling without evidence of malignant cells in cytology .
due to clinical and radiological similarities but a completely different prognosis and therapy , it is of major importance to differentiate between pancreatic cancer and aip .
especially , determination of serum igg4 levels with associated inflammatory bile duct changes should clarify the diagnosis of aip and legitimate initiation of immunosuppressive therapy .
this case report highlights the features of an emerging disease which is diagnostically challenging for the physician . to date
| a 68-year - old male patient was referred to our institution in may 2011 for a suspected tumor in the pancreatic head with consecutive jaundice . using magnetic resonance imaging ,
further differentiation between chronic inflammation and a malignant process was not possible with certainty .
apart from cholestasis , laboratory studies showed increased values for ca 19 - 9 to 532 u / ml ( normal < 37 u / ml ) and hypergammaglobulinemia ( immunoglobulin g , igg ) of 19.3% ( normal 8.015.8% ) with an elevation of the igg4 subtype to 2,350 mg / l ( normal 521,250 mg / l ) .
endoscopic retrograde cholangiopancreatography revealed a prominent stenosis of the distal ductus hepaticus communis caused by pancreatic head swelling and also a bihilar stenosis of the main hepatic bile ducts .
cytology demonstrated inflammatory cells without evidence of malignancy . under suspicion of autoimmune pancreatitis with igg4-associated cholangitis , immunosuppressive therapy with steroids and
azathioprine was started .
follow - up endoscopic retrograde cholangiopancreatography after 3 months displayed regressive development of the diverse stenoses .
jaundice had disappeared and blood values had returned to normal ranges . moreover , no tumor of the pancreatic head was present in the magnetic resonance control images . due to clinical and radiological similarities but a consecutive completely different prognosis and therapy , it is of fundamental importance to differentiate between pancreatic cancer and autoimmune pancreatitis .
especially , determination of serum igg4 levels and associated bile duct lesions induced by inflammation should clarify the diagnosis of autoimmune pancreatitis and legitimate immunosuppressive therapy . |
a 2-year - old , previously healthy indonesian boy presented with decreased consciousness and inadequate breathing , followingdrowning .
sputum culture resulted in pseudomonas aeruginosa and cerebrospinal fluid was supportive for acanthamoeba with 13 trophozoites and cyst .
no treatment so far has given a succesful outcome for acanthamoeba . in this case ,
management with metronidazole , rifampicin and fluconazole showed regain of consciousness resulting in altered mental status .
a free - living protozoan , first established as a cause of human disease in the 1970s and isolated from soil , water , air , and dust , can be contracted through swimming or drowning ( 1,2 ) .
a case of acanthamoeba infection was reported in surabaya ( 2008 ) , and two previous cases in 2002 were infected with acanthamoebaspp from stagnant water ( 3 ) .
acanthamoeba infection is known to cause three clinical syndromes : disseminated granulomatous amebic disease , central nervous system ( cns ) manifestation of granulomatous amoebic encephalitis ( gae ) and amoebic keratitis ( 1,2 ) .
the management of drowning - associated acanthamoeba infection remains controversial and there have been no recommended guidelines ( 4 ) .
antimicrobial therapy for the drowning associated pneumonia can be treated with an extended - spectrum penicillin -lactamase inhibitor .
there are four outcomes in drowning : full recovery ( neurologically intact ) , neurological impairment , persistent vegetative state and death .
while survival reports have been on case reports only ( 5 ) , the purpose of this paper is to report a rare case of acanthamoeba infection related to drowning event in a child .
a 2-year - old , previously healthy indonesian boy drowned in a river and was exposed to decreased consciousness , inadequate breathing and received immediate resuscitation in soetomo hospital , surabaya , indonesia in the year 2014 .
sputum specimen collected from the endotracheal tube showed alive acanthamoeba in movements with pseudopods ( figure 2 ) with some transformed into cysts .
complete blood count showed white blood cell count of 21,190 cells / mcl , ( eosinophil 0.05% , basophil 0,55% , neutrophil 87.63% , lymphocyte 7.98% , monocyte 3.79% ) , hemoglobin of 9 g / dl , hematocrite of 27% , and platelet count of 136,500/mcl .
head ct scan showing cerebral edema and encephalitis sputum specimen collected from the endotracheal tube showing alive acanthamoeba fresh specimen obtained from the cerebrospinal fluid was supportive for acanthamoeba with 13 trophozoites and one cyst was seen in field view ( figure 3 ) .
intravenous ceftazidime , metronidazole , fluconazole and oral rifampicin were given for three weeks , the fever subsided , without any episodes of seizure .
the who definition of near drowning has been replaced by drowning with either mortality , morbidity or no morbidity ( 6 ) .
freshwater drowning causeshemodilution , hemolysis , hyperkalemia , hyponatremia and an elevated circulating volume , whereas seawater drowning producesheme concentration , hypernatremia and lower circulating blood volume .
important concern in aspiration of fresh and saltwater are in regards to the impurities and bacteria contained ( 79 ) .
pneumonia occurs in drowning event that happen within 24 hours until first weeks usually caused by aerobic gram bacteria organism ( 9 ) .
p. aeruginosa is commonly isolated from both fresh - and seawater . despite this water tropism ,
fresh sputum specimen collected from the endotracheal tube resulted in a living acanthamoeba and a cyst .
when acanthamoebais found on the fresh specimen , the patient had a high - grade fever with productive coughing .
patients who are awake and oriented upon arrival to the emergency department survive without neurologic sequelae once pulmonary problem is resolved ( 8) .
the cerebrospinal fluid obtained from lumbar puncture was supportive for acanthamoeba with 13 trophozoites and one cyst in field view .
most patients present focal neurological deficit occurring few days to few weeks or even months after swimming , diving or drowning in stagnant fresh water .
invasive fungal disease or acanthamoeba should be aggressively pursued , when patient show a slow response to antibacterial therapy , brain abscess , or meningitis .
there are two possible routes of entry to the cns : through the nasal passage or via the blood .
acanthamoeba enters the lungs via the nasal route , traverses the lungs into the bloodstream , followed by hematogenous spread , and crosses the blood - brain barrier to enter the cns .
acanthamoeba may bypass the lower respiratory tract and directly enter the bloodstream via skin lesions .
the olfactory neuroepithelium provides an alternative route of entry into the cns and has been used in experimental models ( 1,2,4 ) .
cases of cns involvement results in death due to inavailabilityof effective / recommended drugs and the drug 's inability to traverse the blood - brain barrier .
current treatment involves various drugs such as fluconazole , ketoconazole , sulfadiazine , azithromycin , rifampicin and amphotericin b or itraconazole which rarely leads to a successful outcome , and depends on early diagnosis and aggressive treatment .
delivery system for the cns drugs may include some routes.first route is trans - cranial drug delivery to the brain .
third route is transient blood - brain barrier disruption with possible complications due to side effect ( 1,2,9 ) .
the ultimate prognosis in individuals with acanthamoeba infection is abysmal , even with timely therapy .
the disseminated disease involving cns has a mortality rate of nearly 100% ; most cases are fatal in 7120 days ( mean 39 days ) .
patients who remain profoundly comatose for 26 hours after drowning will have brain death or moderate / severe neurological impairment ( 5 ) . in children who were comatose on arrival ,
survival with normal brain function approximated 44% ; 39% deceased , and 17% survived with brain damage . in conclusion , early presentation of acanthamoeba infection may involve encephalitis with significant deterioration of consciousness .
the mortality rate is high because of the unknown incubation period and treatment difficulties . in this case ,
management with metronidazole , rifampicin and fluconazole showed regain of consciousness resulted in altered mental status .
the limitations of this report include inadequate drug availability and long term monitoring following therapy . | backgroundacanthamoeba infection is a potential life - threatening complication of drowning .
the management of drowning - associated acanthamoeba infection remains controversial .
survival reports on acanthamoeba infection have been on case reports only.case detailsa 2-year - old , previously healthy indonesian boy presented with decreased consciousness and inadequate breathing , followingdrowning .
the event was unsupervised with unknown estimated time of submersion .
resuscitation was commenced and mechanical ventilated was applied .
sputum specimen revealed alive acanthamoeba with pseudopods and cysts .
sputum culture resulted in pseudomonas aeruginosa and cerebrospinal fluid was supportive for acanthamoeba with 13 trophozoites and cyst .
imaging of the head showed cerebral edema and encephalitis .
the patient received intravenous ceftazidime , metronidazole , fluconazole and rifampicin .
the patient 's consciousness was unsatisfactory regained resulting in an altered mental status.conclusionno treatment so far has given a succesful outcome for acanthamoeba .
in this case , management with metronidazole , rifampicin and fluconazole showed regain of consciousness resulting in altered mental status . |
immediate endosseous implantation into fresh extraction sockets was not well accepted until 15 years of research and clinical practice were published .
schwartz - arad and chaushu stated in their review article that today , the dilemma is no longer when , but which protocol to follow for immediate placement of dental implants . another significant exploration in the history of implant dentistry is the attempt to immediately load dental implants and the success of all - on-4 technique by paulo malo has been widely employed today for proven patient satisfaction and function .
however , several problems exist for immediate loading the dental implants . in order to immediately load the implants ,
therefore , impression copings need to be attached onto implants shortly after implant placement in order to take the impressions .
factors such as bleeding during surgery and the difficulty to seat the coping completely with soft tissue and/or bone interference can significantly reduce the accuracy of impression taking .
extra chair time for taking radiographs to confirm the complete seating of impression copings is also required , which may further exhausts the patient and cause more discomfort .
therefore , there is a need to modify the implant fixture mount design so it can be used as an impression coping and also a temporary abutment .
a modified preassembled fixture mount / impression coping / temporary abutment , which has been readily attached to the implant before packaging or before implant placement , therefore , can greatly reduce the chair time and guarantee the precision of the interface .
in addition , there is no need to purchase a separate impression coping or a temporary abutment and the cost of restorations can be reduced , which also benefits the patients .
the first report of using an implant fixture mount as an impression coping was described by mccarthy and morgan in 1995 .
the unmodified fixture mount was used as a transfer coping or prepared on a lathe to mimic the elastomeric impression coping , after shortening and slotting the retention screw . with further modification ,
papazian and morgano employed a disposable implant mount for use as positional index for an immediate provisional restoration , temporary implant abutment , verification jig , and implant - supported record base .
later listed seven uses for an implant carrier / fixture mount : as ( 1 ) a surgical guide , ( 2 ) a positional index at stage i surgery , ( 3 ) an impression coping for the open or closed tray technique , ( 4 ) a verification device to verify the position of multiple implants after the definitive cast is fabricated , ( 5 ) a provisional abutment , ( 6 ) an aid for an implant - supported record base and ( 7 ) an occlusal registration stop .
the implant / fixture mount abutment system specifically designed for the purpose of immediate implant placement and immediate impression taking was proposed by hung and kim in 2009 . the new design employs several modern concepts in order not only to enhance the primary stability but also to provide multiple applications of an implant fixture mount . with the new designed fixture mount / impression coping / temporary abutment
a cast can then be immediately poured for wax - up and a screw - retained / cement retained provisional prosthesis is fabricated and delivered within the same day or in couple of days . alternatively , an acrylic shell can be fabricated before the surgery and a provisional prosthesis fabricated and placed on the modified temporary abutment at chair side right after implant placement .
this case report describes a clinical case utilizing the newly designed fixture mount abutment as well as discusses the advantages and disadvantages of this system .
the implant system described in this report is a new implant / fixture mount abutment assembly ( aidi biomedical ) , which is designed to facilitate immediate implant loading by : ( 1 ) supporting immediate impression taking , especially with multiple implants , ( 2 ) providing precise fitting between the impression coping and the implant with the coping preassembled with the implant or attached to the implant before implant placement and ( 3 ) providing a provisional abutment ( three - in - one design ) .
description of the modified fixture mount / impression coping / temporary abutment assembly ( three - in - one design )
dental implant fixture mount abutment ( difma , aidi biomedical):the difma comprises [ figure 1 ] ( 1 ) a male connector for endomaxim connection to the implant , ( 2 ) a temporary abutment portion at the bottom with two flat facets , ( 3 ) a 2-mm coronal extension / metal collar delineated from the abutment portion by a circumferential groove , ( 4 ) and an internal hex ( pentagonal , square , or triangular ) slot which receives an implant driver.abutment screw : connects the difma to the implant [ figure 2].ball impression screw [ figure 3 ] : is used to attach the difma to the implant , also provides additional retentive features for the difma to serve as an impression coping.the retentive features on the assembly to serve as an impression coping come from the two flat facets , the circumferential groove between the abutment portion and the 2-mm extension , a circumferential notch formed at the junction of the ball impression screw and the difma , and a circumferential groove on the head of the ball impression screw [ figure 4].implant - difma package [ figure 5 ] : the idi implant is prepackaged as an implant - difma assembly .
the implant - difma is carried and placed into the osteotomy site with a hex implant driver .
the hex implant driver bears an o - ring on its head , which is inserted into the hex slot of difma .
dental implant fixture mount abutment ( difma , aidi biomedical ) : the difma comprises [ figure 1 ] ( 1 ) a male connector for endomaxim connection to the implant , ( 2 ) a temporary abutment portion at the bottom with two flat facets , ( 3 ) a 2-mm coronal extension / metal collar delineated from the abutment portion by a circumferential groove , ( 4 ) and an internal hex ( pentagonal , square , or triangular ) slot which receives an implant driver .
ball impression screw [ figure 3 ] : is used to attach the difma to the implant , also provides additional retentive features for the difma to serve as an impression coping .
the retentive features on the assembly to serve as an impression coping come from the two flat facets , the circumferential groove between the abutment portion and the 2-mm extension , a circumferential notch formed at the junction of the ball impression screw and the difma , and a circumferential groove on the head of the ball impression screw [ figure 4 ] .
implant - difma package [ figure 5 ] : the idi implant is prepackaged as an implant - difma assembly .
the implant - difma is carried and placed into the osteotomy site with a hex implant driver .
the hex implant driver bears an o - ring on its head , which is inserted into the hex slot of difma .
abutment screw connecting difma to implant ball impression screw retentive features of difma as an impression coping implant - difma assembly the newly developed dental implant fixture mount abutment can be used as an impression coping when coupled with a ball impression screw , which is designed for closed tray technique .
the lower portion of the difma can also serve as a temporary abutment after the upper portion of the difma is removed by a lab disk .
the intended implant sites or a fresh extraction socket is prepared with twist drills [ figure 6 ] .
implant - difma is carried with a hex implant driver attached to the fixture mount [ figure 6 ] and inserted into the prepared alveolar bone or extraction socket .
it is recommended to torque the implant to 45 - 70 ncm to ensure good primary stability .
after insertion of the implant , the abutment screw is replaced with the ball impression screw and the immediate impression is taken using closed tray technique [ figure 7 ] .
the difma and ball impression screw are then removed from the implant , attached to an implant analog , and inserted into the impression before a cast is poured . surgical protocol for placing aidi implant impression taking with closed tray technique
if a cement - retained immediate provisional prosthesis is planned , the top 2-mm portion of the difma , delineated from the bottom abutment portion with a circumferential groove , can be removed by a lab disk .
the remaining abutment portion of the difma provides a finishing margin ready for chair - side fabrication of a provisional prosthesis with an acrylic shell .
a male patient , age 56 , was admitted with bouncing pain at # 13 and pupitis of # 17 due to a recurrent decay [ figures 8 and 9 ] .
# 17 was an abutment for fixed partial denture from # 17 to # 20 .
after consultation and treatment option given , patient elected to have # 13 and # 17 to be extracted and three implants were immediately placed at # s 13 , 17 and 18 positions ( 4.310.5 mm , 5.08.8 mm , 4.310.5 mm , respectively ) ( aidi biomedicals ) .
the final torque for implant # 13 was 70 ncm , for # 17 was 70 ncm , and for # 18 was 70 ncm .
immediately after implant placement , final impressions were taken using the implant fixture mounts as impression copings [ figures 10 and 11 ] .
a single screw - retained restoration for # 13 was delivered 1 week later and a splinted screw - retained restoration for # 17 and # 18 was fabricated and delivered in 3 weeks [ figures 1214 ] .
one - week postdelivery check revealed good stability of all three dental implants and restorations .
preoperatory radiograph for # 13 preoperatory radiograph for # 17 and # 18 an aidi implant was placed with fixture mount for # 13 implants were placed with fixture mounts for # 17 and # 18 check for framework fit for # 17 and # 18 final restoration for # 13 final restoration for # 17 and # 18 a 66-year - old male patient presented with a missing tooth of # 31 with healed socket .
ball screws were used o secure the fixture mount abutment [ figure 15 ] and a pvs impression was made immediately after implant placement [ figure 16 ] .
impression taking with ball screws attached to difmas difmas were inserted into pvs impression before being sent to laboratory final restoration for # 31
the newly developed dental implant fixture mount abutment can be used as an impression coping when coupled with a ball impression screw , which is designed for closed tray technique .
the lower portion of the difma can also serve as a temporary abutment after the upper portion of the difma is removed by a lab disk .
the intended implant sites or a fresh extraction socket is prepared with twist drills [ figure 6 ] . implant - difma is carried with a hex implant driver attached to the fixture mount [ figure 6 ] and inserted into the prepared alveolar bone or extraction socket . it is recommended to torque the implant to 45 - 70 ncm to ensure good primary stability .
after insertion of the implant , the abutment screw is replaced with the ball impression screw and the immediate impression is taken using closed tray technique [ figure 7 ] .
the difma and ball impression screw are then removed from the implant , attached to an implant analog , and inserted into the impression before a cast is poured . surgical protocol for placing aidi implant impression taking with closed tray technique
if a cement - retained immediate provisional prosthesis is planned , the top 2-mm portion of the difma , delineated from the bottom abutment portion with a circumferential groove , can be removed by a lab disk .
the remaining abutment portion of the difma provides a finishing margin ready for chair - side fabrication of a provisional prosthesis with an acrylic shell .
a male patient , age 56 , was admitted with bouncing pain at # 13 and pupitis of # 17 due to a recurrent decay [ figures 8 and 9 ] .
# 17 was an abutment for fixed partial denture from # 17 to # 20 .
after consultation and treatment option given , patient elected to have # 13 and # 17 to be extracted and three implants were immediately placed at # s 13 , 17 and 18 positions ( 4.310.5 mm , 5.08.8 mm , 4.310.5 mm , respectively ) ( aidi biomedicals ) .
the final torque for implant # 13 was 70 ncm , for # 17 was 70 ncm , and for # 18 was 70 ncm .
immediately after implant placement , final impressions were taken using the implant fixture mounts as impression copings [ figures 10 and 11 ] .
a single screw - retained restoration for # 13 was delivered 1 week later and a splinted screw - retained restoration for # 17 and # 18 was fabricated and delivered in 3 weeks [ figures 1214 ] .
one - week postdelivery check revealed good stability of all three dental implants and restorations .
preoperatory radiograph for # 13 preoperatory radiograph for # 17 and # 18 an aidi implant was placed with fixture mount for # 13 implants were placed with fixture mounts for # 17 and # 18 check for framework fit for # 17 and # 18 final restoration for # 13 final restoration for # 17 and # 18 a 66-year - old male patient presented with a missing tooth of # 31 with healed socket .
ball screws were used o secure the fixture mount abutment [ figure 15 ] and a pvs impression was made immediately after implant placement [ figure 16 ] .
impression taking with ball screws attached to difmas difmas were inserted into pvs impression before being sent to laboratory final restoration for # 31
a male patient , age 56 , was admitted with bouncing pain at # 13 and pupitis of # 17 due to a recurrent decay [ figures 8 and 9 ] .
# 17 was an abutment for fixed partial denture from # 17 to # 20 .
after consultation and treatment option given , patient elected to have # 13 and # 17 to be extracted and three implants were immediately placed at # s 13 , 17 and 18 positions ( 4.310.5 mm , 5.08.8 mm , 4.310.5 mm , respectively ) ( aidi biomedicals ) .
the final torque for implant # 13 was 70 ncm , for # 17 was 70 ncm , and for # 18 was 70 ncm .
immediately after implant placement , final impressions were taken using the implant fixture mounts as impression copings [ figures 10 and 11 ] .
a single screw - retained restoration for # 13 was delivered 1 week later and a splinted screw - retained restoration for # 17 and # 18 was fabricated and delivered in 3 weeks [ figures 1214 ] .
one - week postdelivery check revealed good stability of all three dental implants and restorations .
preoperatory radiograph for # 13 preoperatory radiograph for # 17 and # 18 an aidi implant was placed with fixture mount for # 13 implants were placed with fixture mounts for # 17 and # 18 check for framework fit for # 17 and # 18 final restoration for # 13 final restoration for # 17 and # 18
a 66-year - old male patient presented with a missing tooth of # 31 with healed socket .
ball screws were used o secure the fixture mount abutment [ figure 15 ] and a pvs impression was made immediately after implant placement [ figure 16 ] .
impression taking with ball screws attached to difmas difmas were inserted into pvs impression before being sent to laboratory final restoration for # 31
the development of immediate load of dental implants is derived from the need of early satisfactory aesthetics and function for the patients , which can not be delivered by the use of removable dentures or with no restorations during the healing period of postimplantation .
the predictable success of immediate load of all - on-4 prosthesis has been demonstrated by paulo malo .
observation on immediately loaded implant revealed faster increase of implant stability and less marginal bone loss ( ostman et al . ) studies compared early or immediately loaded implants and traditional submerged implants placed in complete edentulous mandible and maxilla , partially edentulous mandible and maxilla , and as single implants have shown comparative or better results with immediately loaded implants . for complete edentulous mandible and maxilla , when implants were rigidly splinted together to afford an early / immediately loaded fixed or removable provisional restoration ( chow et al .
ibanez et al . , degidi et al . ) , implant success rates were found to be comparable to those of implants placed submerged ( 85.7 - 100% ) .
implants loaded early or immediately in partial edentulous mandible and maxilla also showed encouraging results with implant survival rate ranging from 90% to 100% with 1 - 4 years of follow - up ( machtei et al . , roccuzzo et al . ) . in order to immediately load dental implants , an immediate impression is required to fabricate a provisional prosthesis shortly after implant placement . traditionally , impression copings need to be inserted onto implants at the time of placement surgery before taking the immediate impression .
problems exist when access to the implant shoulder is obscured by bloody surgical field or obstructed by collapsed gingiva or alveolar bone on top of the implant .
in addition , the complete seating of each impression coping on top of the implant needs to be confirmed by radiograph before impression taking .
therefore , a proposed modification of an implant fixture mount , which is attached to the implant before placement , to be used as an impression coping and even a temporary abutment is appealing .
early attempts of modification of an implant fixture mount provided the convenience and function of a completely seated impression coping , however , did present some problems or disadvantages .
the unmodified fixture mount reported by mccarthy and morgan did not provide sufficient retentive features as an impression coping . on the other hand , the modified version of the same fixture mount had to be prepared on a lathe and the retention screw needed to be shortened and slotted , in which the fixture mount had to be removed from the implant and therefore did not provide the advantage of an readily seated impression coping .
the first unmodified fixture mount which was suitable to be used as an impression coping was reported by ganddini and schejtman et al .
difma , when unmodified and with the exchange of an abutment screw with a ball screw while leaving the fixture mount still seating on the implant , provides sufficient retentive features as an impression coping .
this seemingly simple concept provides a predictable fit between the impression coping and the implant , excluding the troubles of finding the implant in a bloody surgical field , taking verification radiographs , as well as the need of using a scalpel or a chisel to remove collapsed gingival tissue or alveolar bone onto the implant shoulder .
furthermore , with a very simple modification by separating the top 2-mm collar from the bottom portion with a lab disk , the difma can be used as a provisional abutment with a readily incorporated finishing margin and eliminates the need to purchase a separate provisional abutment .
therefore , difma provides several advantages over a regular fixture mount and an impression coping , which include less office visits , simpler procedure , less chair time , convenience and comfort , and cost reduction .
the three - in - one design of difma is a novel concept of reducing the cost of implant restoration as well as providing support for immediate loading of dental implants . in conclusion , with a specially designed fixture mount , more patient satisfaction can be delivered by employing the fixture mount in the process of immediate impression taking and/or as an immediate provisional abutment . | purpose : an integrated fixture mount / impression coping/ temporary abutment can provide many advantages for immediate loading of dental implants , such as simpler procedure , less chair time , cost reduction , and comfort for the patients.materials and methods : a newly designed dental implant fixture mount ( difma ) can be used as an impression coping for taking an immediate impression . an immediate load provisional prosthesis
can then be fabricated shortly after implant placement to immediately load the implants .
this fixture mount can also serve as a temporary abutment for immediate chair - side fabrication of provisional prosthesis .
two clinical cases are presented.results:a clinical case utilizing the fixture mount abutment ( difma)/implant assembly is presented .
the precision of fitting between the impression copings and implants is secured with this system .
the chair time for taking an immediate impression is greatly reduced . less cost for the restoration
is provided and patient comfort is delivered.conclusions:more patient satisfaction can be conferred by employing the fixture mount in the process of immediate impression taking and as an immediate provisional abutment . |
during 2012 , we collected fecal specimens from sheltered dogs in northern hungary to detect enteric viruses . of 63 samples obtained from 50 animals , 37 randomly selected samples ( from 33 animals ) were subjected to random primed reverse transcription pcr and semiconductor sequencing by using the ion torrent pgm platform ( new england biolabs , ipswich , ma , usa ) ( technical appendix ) .
bioinformatics analysis consisted of the mapping of reads > 40 bases against 1.7 million viral sequences downloaded from genbank by applying moderately rigorous mapping parameters ( length fraction 0.6 ; similarity fraction 0.8 ) within the clc genomics workbench ( http://www.clcbio.com/ ) .
one sample ( ke135/2012 ) obtained from a suckling dog in may 2012 was positive for several enteric viruses .
when analyzing the initially obtained 60.5-k sequence reads , in addition to canine rotavirus a ( 141 reads ) , astrovirus ( 2,399 reads ) , and parvovirus ( 3,623 reads ) , we identified a single 53-nt sequence read that mapped to the vp1 gene of rotavirus b. another sample , ke528/2012 , collected during august 2012 from an adult dog with diarrhea , was positive for coronavirus ( 30 reads ) , vesivirus ( 17 reads ) , picodicistrovirus ( 3 reads ) , and astrovirus ( 1 read ) ; in addition , 7 and 5 sequence reads , respectively , mapped to the vp1 and vp3 genes of rotavirus h and/or b. subsequently , we enriched genomic dsrna of ke135/2012 by differential licl precipitation ; however , the enriched dsrna remained invisible by polyacrylamide gel electrophoresis and silver staining . because of the apparent low titer of the novel rotavirus , we tried to obtain more sequence data by drastically increasing the output in parallel sequencing runs .
de novo assembly of the resulting 1.59 million sequence reads readily identified homologs of the structural and some nonstructural genes , which were divergent from rotavirus a
determination of the coding regions in most cases was successful by extension of the termini of consensus sequences using the ion torrent sequence reads .
however , we found no evidence for nsp3 and nsp4 with this approach , probably because of the great sequence divergence of these genes across members of the genus ( 6,7 ) . because the genomic rna of each rotavirus species is characterized by low gc ( guanine : cytosine ) content ( 29%40% )
, we expected that contigs with low gc content and with no genbank homologs might be good candidates for detecting the missing genes . indeed , further assembly and subsequent analysis of selected sequence stretches helped to identify the nsp3 by similarity search through the blastx engine ( http://blast.ncbi.nlm.nih.gov/blast.cgi ) after an 800-bp long fragment was obtained , and analysis of the structural features of the deduced protein sequence supported detection of the putative nsp4 .
the obtained consensus sequence was used as reference to map other viral metagenomics data generated from the sheltered dog population ; however , except for the aforementioned sample , ke528/2012 , we found no additional specimens by this method to contain homologous viruses .
the 2 related unusual rotaviruses , ke135/2012 and ke528/2012 , had conserved genome segment termini ( 5 end , ggc / ta ; 3 end , aaccc ) and shared high sequence identities in most genes ( e.g. , vp2 : 88% nt , 95% aa ; nsp4 : 99% nt , 99% aa ) and very low sequence similarity in the vp7 gene ( 53% nt , 38% aa ) ( genbank accession nos . km369887km369908 ; technical appendix ) .
* total sequence reads to obtain genomic rna sequence for ke135/2012 and ke 528/2012 were 1,591,803 , and 144,747 , respectively . the minimum overlap with the consensus sequences ( i.e. , the de novo assembled rotavirus i
specific consensus sequences ) was 20 nt , the minimum identity was 80% . to improve the mapping results ,
the following gap penalties were applied for the dataset : mismatch cost = 2 , insertion cost = 3 , deletion cost = 3 .
after visual inspection of the sequence alignments and remapping onto the obtained gene sequence , a single consensus sequence was finalized for each genome segment .
the deduced vp6 amino acid sequences served as the basis to classify these 2 unusual rotavirus strains ( 2 ) .
the greatest amino acid sequence identity of the vp6 proteins was found when compared to the novel rotavirus h strains ( < 46% ) ; lower sequence similarities were found in comparison to randomly selected representatives of other rotvirus species ( e.g. , rotavirus g and b , < 37% ; rotavirus a , c , d , and f , < 18% ) . to extend the analysis and
assess whether the obtained vp6 gene might be functionally integral , we conducted molecular modeling of the amino acid sequence . in brief ,
amino acid sequence similarity values created a reliable protein model ( 8,9 ) showing similar protein folding of the vp6 monomer and comparable electrostatic charge pattern around the 3-fold axis of the vp6 homotrimer to that experimentally determined for rotavirus a ( figure 1 ) .
subsequent phylogenetic analysis of the vp6 protein identified 2 major clades of rotaviruses ( 6 ) .
the novel rotavirus strains clustered with species h , g , and b within clade 2 , whereas clade 1 included representative strains of species a , c , d , and f ( figure 2 ) .
collectively , sequence and phylogenetic analysis demonstrated moderate genetic relatedness of the unusual canine rotaviruses to representative strains of species a h , suggesting that they belong to a novel species , tentatively called rotavirus i. the prototype strains were named rvi / dog - wt / hun / ke135/2012/g1p1 and rvi / dog - wt / hun / ke528/2012/g2p1 according to recent guidelines ( 10 ) ( online technical appendix ) .
a ) structure - based amino acid sequence alignment of the novel canine rotavirus vp6 protein and the template bovine rotavirus a vp6 protein .
the background of the sequence alignments reflects the homology levels of the 2 vp6 sequences .
red , identical amino acid ; orange , similar amino acid ; pink , different amino acid ) .
the main structural differences are indicated by dark red and menthol green on the sequence alignment and on the superimposed vp6 structures ( b ) .
cartoon presentation of the homologous vp6 proteins : pink , rotavirus a ; green , rotavirus i. further information is available in the technical appendix .
protein sequence based phylogenetic tree of the rotavirus viral protein 6 gene obtained by the neighbor - joining algorithm .
asterisks indicate > 90% bootstrap values . the 2 canine rotavirus strains from hungary that belong to the proposed novel rotavirus i cluster with rotavirus h , g , and b within a major clade referred to as clade 2 .
rotavirus a , c , d , and f strains belong to clade 1 ( 6 ) .
short rotavirus sequences detected recently in the fecal viral flora of cats and california sea lions ( 4,5 ) showed closer relatedness to our strains in the amplified vp6- and vp2-specific stretches , respectively , than to the corresponding genomic regions of reference rotavirus species ( vp6 , 70 aa , 67% vs. < 55% ; vp2 , 160 aa , 78%86% vs. < 44% ) ( technical appendix ) . these published data ( 4,5 ) together with our results suggest that genetically related non rotavirus a h strains occur in various carnivore host species and geographic settings .
we identified 2 representative strains of a novel rotavirus species , rotavirus i. many questions remain , including those related to the epidemiology , host range , and evolution of this species .
one intriguing finding was the distantly related vp7 genes expressed on a fairly conserved genetic backbone .
typically , very low sequence identity values within the vp7 gene ( e.g. , rotavirus a , as low as 60% nt and 55% aa ; rotavirus b , 54% nt , 46% aa ; rotavirus h , 63% nt , 56% aa ) can be seen when strains from different host species are compared ( 1113 ) . whether the vp7 gene(s ) of rotavirus i strains could have been acquired in the past from another rotavirus species by reassortment
remains uncertain , given that reassortment among various rotavirus species is thought to occur only rarely ( 7,14 ) .
comparison of the genome size and the coding potential of different rotavirus species ; laboratory methods ; percentile nucleotide and amino acid sequence - based identities between the novel canine rotavirus strain and reference rotavirus a d and f h strains ; 5 and 3 termini confirmed by sanger sequencing ; additional insight into the structure of viral protein ( vp ) 6 and its homotrimer form ; phylogenetic trees obtained for vp1vp4 , vp7 , nonstructural protein ( nsp ) 1 to nsp5 proteins with representative strains of rotavirus a h ; and phylogenetic trees obtained for the partial sequences using unusual feline and otarine rotavirus gene sequences . | we identified unusual rotavirus strains in fecal specimens from sheltered dogs in hungary by viral metagenomics .
the novel rotavirus species displayed limited genome sequence homology to representatives of the 8 rotavirus species , a
h , and qualifies as a candidate new rotavirus species that we tentatively named rotavirus i. |
metabolic degradation of heme by heme oxygenase ( ho ) yields three products ; biliverdin , ferrous iron , and carbon monoxide ( co ) .
currently , two major isoforms of the ho enzyme have been recognized , the inducible ho-1 and the constitutive ho-2 .
several biological stressors , such as oxidative stress , ischemia , and hypertension , are known to increase ho-1 levels [ 46 ] .
in contrast , the ho-2 isoform is constitutively expressed and is present in high concentrations in the kidney , as well as in other vascular beds and tissues .
alterations in ho levels have been demonstrated to alter co concentration , in addition to having profound effects on vascular tone [ 8 , 9 ] .
current literature supports both an endothelial - dependent vasoconstrictor effect of co and an endothelial - independent vasorelaxation [ 10 , 11 ] .
co - mediated vasoconstriction is via inhibition of nitric oxide synthase ( nos ) [ 11 , 12 ] .
co also promotes endothelium - independent vasodilation through the activation of soluble guanylyl cyclase , stimulation of k channels , and inhibition of the cytochrome - p450-dependent monooxygenase system in vascular smooth muscle cells [ 10 , 13 ] .
increases in endogenous co levels produce a decrease in blood pressure in several forms of hypertension , while ho inhibition increases arterial blood pressure [ 4 , 1417 ] .
regional differences in renal blood flow ( rbf ) have been demonstrated with increases in the medulla without significant increases in cortical blood flow during heme - induced increases in co .
other studies have not shown significant alterations in renal vascular resistance during alterations in co levels , thus controversy does exist in the literature as it relates to the ability of co to regulate renal vascular resistance .
increases in ho activity via heme administration promote vasorelaxation and produce diuresis and natriuresis . in addition , several studies have identified an antioxidant role for bilirubin and biliverdin during stress [ 20 , 21 ] . however , the mechanisms of ho - mediated effects on renal function have yet to be elucidated .
because the ho - mediated diuretic and natriuretic effects were observed concomitantly with an increase in rbf , it is possible that alterations in renal hemodynamics mediate the increase in uf and sodium excretion .
it has also been reported that renal medullary ho plays a key role in the regulation of pressure natriuresis and , thus , the control of arterial blood pressure .
macula densa cells have been reported to express ho-1 and ho-2 , and stannous mesoporphyrin , an inhibitor of ho , was shown to augment tubuloglomerular feedback in both in vitro and in vivo studies .
in addition , we recently reported that co inhibition promotes antidiuresis and antinatriuresis independent of vascular or systemic changes .
therefore , we hypothesized that increased levels of endogenous co promote natriuresis and diuresis independent of inhibition of nitric oxide synthase ( nos ) and alterations in rbf . to examine this hypothesis ,
the potential direct tubular effects of a heme precursor , delta - aminolevulinic acid ( dala ) , which drives ho activity , were studied using a dose of dala that does not elicit changes in renal hemodynamic function in control and l - name treated rats .
inactin ( thiobutabarbital sodium ) , n - nitro - l - arginine methyl ester ( l - name ) , bilirubin , and para - aminohippuric acid ( pah ) were obtained from sigma - aldrich ( st . louis , mo , usa ) .
biliverdin was purchased from mp biochemicals , llc ( solon , oh , usa ) . all other chemicals were purchased from fisher scientific ( houston , tx , usa ) .
dala stock solution ( 800 mmol / l ) was prepared in saline on the day of the experiments . l - name ( 50 mmol / l ) was dissolved in saline immediately before intraperitoneal injection .
male sprague - dawley rats ( 250350 g ; n = 146 , harlan , indianapolis , in , usa ) were used ( n = 32 ) .
this protocol was approved by the tulane school of medicine and university of louisiana at monroe institutional animal care and use committee .
prior to experiments , rats were housed in a controlled environment and had free access to commercial rat chow and tap water .
subsets of animals were chronically treated every 12 hours for four days with an inhibitor of nos , l - name ( 50 mg / kg , ip ) . to minimize postprandial sodium excretion variability , animals were deprived of food for 12 hours before experiments .
subsets of animals were chronically treated with l - name every 12 hours for four days .
after anesthetization with inactin and surgical preparation , rats were allowed to stabilize for 45 min . after this initial stabilization period ,
l - name - treated and -untreated animals were then acutely administered dala ( 80 mol / kg , iv ) , biliverdin ( 20 mg / kg , iv ) , bilirubin ( 30 mg / kg , iv ) , or vehicle ( 1 ml saline , iv ) , and an additional 30-minute treatment period was performed .
the doses of biliverdin and bilirubin were chosen from previous studies where an antioxidant effect was observed [ 20 , 21 ] .
mean arterial pressures ( map ) , heart rates ( hr ) , and rbf were measured during both the 30-minute control and treatment periods .
after the experimental protocols were completed , renal vascular resistance ( rvr ) was calculated as the pressure to flow ratio and expressed as
rats were anesthetized with a single injection of thiobutabarbital sodium ( 120 mg / kg ; ip ) , and a tracheal tube was inserted to maintain an open airway .
fluid filled catheters ( pe-50 tubing filled with heparinized saline ) were inserted into a carotid artery and a jugular vein to allow for continuous monitoring of map and hr , and for intravenous administration of drugs , respectively .
the arterial catheter was connected to a pressure transducer ( model tsd104a , biopac systems , santa barbara , ca , usa ) , and the venous catheter was connected to a sage microinfusion pump ( orion research , inc .
, model m361 , boston , ma , usa ) set at 1 ml / hr saline infusion rate .
a bladder cannula was inserted to allow urine collection for determination of urine flow and concentrations of sodium and potassium ( flame photometry ; instrumentation laboratories , il 943 ) .
rbf was measured with a renal flow probe ( transonic , ithaca , ny , usa ) placed around the renal artery and connected to a transonic - t206 synchronized flow meter coupled to a polygraph system ( model mp100 , biopac system ) . in a subset ( n = 24 ) of anesthetized rats , the experiments were repeated with an additional catheter inserted into the right femoral vein to infuse inulin , para - amino hippuric acid , and albumin .
plasma and urine sodium and potassium concentrations were determined by flame photometry , and inulin concentrations were measured colorimetrically to determine glomerular filtration rate ( gfr ) .
rvr and fractional sodium excretion ( fena ) were calculated according to standard formulas . the renal excretion data from this subset of animals were not included in the final measures due to the different handling of these animals ( additional catheter , and albumin , pah , and inulin infusion ) .
however , the excretory data from these animals followed the same trends as the reported data .
plasma renin activity ( pra ) was measured with a commercially available assay kit ( gamma coat pra assay kit ) .
briefly , dala ( 80 mol / kg ; ip ) was infused into l - name- ( 50 mg / kg ; ip ) pretreated or untreated rats and pra was measured to determine if altered co levels had any effect on the renin - angiotensin system .
pra was determined by the radioimmunoassay generation of angiotensin i. given the noted experimental difficulties with measuring pra in whole animals , we did not perform clearance measurements or co measurements in these animals .
a subset of awake sprague - dawley rats ( n = 12 ) that did not receive any surgical treatments were infused with dala ( 80 mol / kg , iv ) to increase ho activity , both with and without chronic l - name pretreatment every 12 hours for 4 days .
animals were placed in an acrylic airtight chamber with the outflow leading to a heated mercuric oxide bed coupled with a gas chromatograph ( peak , mountain view , ca , usa ) for the determination of co concentration , detailed elsewhere [ 28 , 29 ] .
the chamber was continuously purged with purified air and the outflow sampled for co concentration at 2 min intervals .
after a 10 min equilibration period , the average of four measurements was used to calculate the co excretion rate for the whole animal .
in a subset ( n = 14 ) of similarly treated anesthetized animals , the experimental protocols were repeated to determine the ability of dala infusion to alter renal ho-1 levels .
kidneys from l - name - pretreated and untreated rats were removed and flash frozen in liquid nitrogen and suspended in 1x extraction reagent and protease inhibitor . once the kidney tissues were homogenized , the elisa sandwich immunoassay was preformed and the level of ho-1 protein present in the kidney was determined .
data were analyzed by analysis of variance ( anova ) followed by orthogonal contrast when appropriate ( systat ) .
bonferroni correction was employed in the final analysis of completed series ( = 0.05 ) .
acute administration of the heme precursor , dala ( 80 mol / kg , ip ) , to untreated animals produced a significant increase in expired co levels ( 63.9 1.6% , n
this effect was similar to a higher dose of dala ( 800 mol / kg , ip ) ( jackson et al , unpublished results ) .
this increase in expired co was not affected by l - name ( 50 mg / kg ; ip ) pretreatment ( 67.6 1.9% , n
acute administration of dala ( 80 mol / kg , iv ) in untreated and l - name - pretreated anesthetized rats produced a significant increase in renal ho-1 levels in untreated ( 50 0.56% , n = 7 ) ( figure 2 ) and l - name - treated ( 60 0.64% , n = 7 ) ( figure 2 ) rats .
l - name pretreatment produced a significant increase in renal ho-1 levels , as compared to untreated animals ( figure 2 ) ; however , dala increased renal ho-1 levels to a similar extent as in untreated animals .
there were no significant differences in hematocrit pre- and post - dala administration in both the l - name - pretreated and -untreated animals .
the subsequent values were obtained during the 30 min experimental period following administration of dala ( 80 mol / kg ; ip ) , biliverdin ( 20 mg / kg ) , bilirubin ( 30 mg / kg ) , or vehicle in l - name-(50 mg / kg ; ip ) treated and untreated animals . in animals without pretreatment , dala did not exert significant systemic or renal hemodynamic effects ( table 1 ) , but there were significant increases in urine flow and sodium and potassium excretion ( 108.8 0.28% , 172.1 18.4% , and 165.2 45.9% : n = 20 ) ( figure 3 ) .
biliverdin ( 20 mg / kg ) and bilirubin ( 30 mg / kg ) did not cause significant systemic or renal hemodynamic effects ( table 1 ) and any significant changes in urine flow or sodium , and potassium excretion ( table 3 ) . in rats
pretreated chronically with l - name , there was a significant increase in map ( 100 mmhg versus 150 mmhg ) but dala administration had no significant effects on map , hr , rbf , or rvr ( table 1 ) . however , dala significantly increased urine flow and sodium and potassium excretion ( 109.4 0.29% , 187.3 26.9% , and 197.2 45.7% : n = 20 ) ( figure 4 ) .
biliverdin ( 20 mg / kg ) and bilirubin ( 30 mg / kg ) did not exert significant effects on map , hr , rbf , or rvr ( table 1 ) and any significant effects on urinary volume , sodium and potassium excretion ( table 3 ) .
there were no significant differences between the urine flow and electrolyte excretion in the l - name - untreated and -treated animals .
dala had no effects on glomerular filtration in either l - name - treated or -untreated rats ( table 2 : n = 24 ) . in untreated rats given dala , no significant differences in plasma renin activity ( pra ) were evident ( figure 5 ; n = 25 ) .
similarly dala did not significantly alter pra in l - name - pretreated animals ( figure 5 ; n = 21 ) .
the present study investigated the role of increases in endogenous co on renal excretory function .
the heme precursor , dala , increased expired co levels in both l - name - treated and -untreated animals .
dala , which promotes the generation of endogenous co , increased volume and electrolyte excretion in both l - name - treated and -untreated animals .
acute increases in endogenous co formation were not accompanied by any significant differences in systemic or renal hemodynamic function in that a low dose of dala was specifically chosen to avoid alterations in renal or systemic hemodynamics .
there were also no significant changes in gfr with dala infusion in l - name - treated or -untreated animals .
increases in heme oxygenase activity , promote an equimolar elevation in carbon monoxide , iron , and biliverdin .
current literature would support an antioxidant role for both biliverdin and bilirubin [ 20 , 21 ] . to examine the potential role of these heme products to alter renal excretory function ,
however , no significant differences in renal or systemic hemodynamics were observed and , similarly , no significant differences in renal excretory function were observed , thus , suggesting that the observed increases in urine flow and sodium and potassium excretion were due to carbon monoxide .
the negative results observed with biliverdin and bilirubin suggest that they are not involved in the heme - oxygenase - mediated diuretic effects ; however , the current study can not rule out the importance of these metabolites in the kidney in that renal intracellular concentrations of biliverdin and bilirubin were not measured .
thus , dala , a substrate that drives heme formation and increases ho activity , can produce significant increases in endogenous co formation .
dala administration was observed to significantly increase ho-1 levels both in the presence and absence of an intact no system .
l - name administration increased baseline ho-1 levels , perhaps due to the observed elevation in map .
importantly , the ability of dala administration to increase ho-1 levels was not affected by l - name .
the current study used dala to drive co formation in that iron loading can lead to effects on the vasculature that are independent of the co system .
iron loading can occur , when one increases co formation via heme administration or co releasing molecules .
the current data support the hypothesis that co increases water and electrolyte excretion independent of changes in systemic or renal hemodynamics . the increases in urine flow and electrolyte excretion were still present during nos inhibition by l - name , indicating once again that the co effects on urine flow and electrolyte excretion are not simply due to alterations in the nitric oxide ( no ) system .
furthermore , dala administration did not significantly alter pra , thus co enhancement of renal excretion was not via suppression of the renin angiotensin system .
however , endogenous co effects on the juxtaglomerular cells could be maximal even at basal conditions ; therefore , increasing co formation by dala would not affect pra . in previous research ,
an increase in co concentration elicited through heme administration was shown to decrease rvr , increase rbf , and urine flow and sodium excretion .
pretreatment with the ho inhibitor , snmp , abolished the diuretic and natriuretic effects of heme but did not affect the increases in rbf .
the heme - induced changes in renal hemodynamic parameters could perhaps be attributed to differences in agents ( dala versus heme ) and/or concentrations .
regional differences in ho activity in the kidney have been reported , where medullary heme oxygenase contributes to pressure natriuresis and arterial blood pressure in the absence of any significant changes in cortical ho activity .
as previously stated , low concentrations of dala were employed to avoid hemodynamic changes in the present study .
therefore , dala - induced increases in urine flow and electrolyte excretion were not accompanied by any changes in renal hemodynamic function . however , medullary blood flow was not measured and we can not exclude the possibility of small increases in medullary bf to the diuretic and natriuretic responses . collectively these data suggest that co alters water and electrolyte excretion independent of changes in no and renal hemodynamic function and suggests that this response is due to a direct renal tubular effect .
previous studies have demonstrated co 's ability to promote vasoconstriction via inhibition of nos [ 19 , 34 ] .
however , in the present study , such an interaction between the two systems in acutely regulating water and electrolyte excretion was not observed .
thus , it is possible that in organ systems with a large capacity to autoregulate , such as the brain , heart , and kidney , co inhibition of no does not play a major role in establishing normal basal vascular tone .
co was able to promote water and electrolyte excretion without affecting renal hemodynamics , which suggests an alternate pathway for co regulation of renal excretory function .
thus , co could have direct effects on the tubules to alter water and electrolyte excretion . as a low dose of dala
was administered to avoid altering renal hemodynamics , the results suggest that the alterations in renal excretory function are most likely mediated via a direct tubular effect to inhibit sodium transport in that sodium and potassium excretion were enhanced during dala administration .
since heme administration was accompanied by a significant increase in blood pressure , it could not be established if the observed diuresis was due to a direct tubular action or simply due to an increase in perfusion pressure . in addition , it was not shown if the diuresis was due to co or one of the other ho metabolites . in the current study , we demonstrate a direct tubular action of ho induction in the absence of alterations in renal hemodynamic function .
furthermore , the negative results with biliverdin and bilirubin administration suggest a tubular role of co as a novel diuretic and therapeutic target to treat hypertension .
in summary , the present data indicate that an induction in ho-1 increases water and electrolyte excretion in the absence of alterations in renal hemodynamics , pra , gfr , or no production , thus , suggesting a direct tubular role for endogenous co in the control of sodium excretion . | purpose . studies were performed to examine hemodynamic and renal function before and after acute induction of the endogenous co system with delta - aminolevulinic acid ( dala ) , which drives ho activity .
methods . in vivo studies were conducted on inactin - anesthetized male sprague dawley rats ( 250300 g ) either with or without chronic pretreatment with l - name ( 50 mg / kg , q12 hours x4d ) .
results .
dala ( 80 mol / kg , iv bolus ) administration acutely increased endogenous co production and ho-1 protein . in untreated and l - name - pretreated rats , dala did not alter bp , gfr , or rbf but increased uf , unav , and ukv ( untreated : 108.8 0.28% , 172.1 18.4% , and 165.2 45.9% ; pretreated : 109.4 0.29% , 187.3 26.9% , and 197.2 45.7% ) .
acute administration of biliverdin ( 20 mg / kg , iv ) and bilirubin ( 30 mg / kg , iv ) to similarly treated animals did not alter uf , unav , and ukv . conclusion .
these results demonstrate that heme oxygenase induction increases urine and electrolyte excretion and suggest a direct tubular action of endogenous carbon monoxide . |
perfluorocarbon liquids ( pfcls ) are a mainstay of vitreoretinal surgery because of their high specific gravity , low viscosity , optical clarity and immiscibility in water , which permit surgical tissue manipulation .
pfcls are an adjunct in vitreoretinal surgery for complex retinal detachment repair as they displace subretinal fluid and blood anteriorly ( thus limiting the need for a posterior drainage retinotomy ) , unfold the retina in giant retinal tear cases and provide countertraction and retinal stabilization during membrane peeling in eyes with proliferative vitreoretinopathy .
multiple agents have been used and approved in different countries , including perfluoro - n - octane ( pfo ) , perfluoroperhydrophenanthrene ( vitreon ) and perfluorodecalin .
pfcls have a specific gravity of 1.9 ; therefore , they have a higher density than water .
this property allows them to sink into the retina and displace any subretinal fluid anteriorly . if there is no significant traction on the retina , the pfcls will push the retina flat onto the eye wall .
when compared with other available perfluorocarbons , pfo has the most visible interface , which aids complete intraoperative removal .
pfo also has the lowest viscosity of pfcls ( 0.69 centistokes at 25c for pfo and 8.03 centistokes for perfluoropherhydrophenanthrene ) , offering less resistance to injection and aspiration through microsurgical instruments and has the highest vapor pressure , allowing more complete evaporation of residual pfo from the retinal surface after fluid - air exchange . despite these characteristics ,
inadvertent post - operative retention of pfo occurs in approximately 1 - 3.5% of eyes .
an otherwise healthy 24-year - old male who was status post - lasik with a history of high myopia in both eyes presented to the emergency room at king khaled eye specialist hospital , saudi arabia on june 2002 with a history of a sudden drop of vision in the right eye with onset 3 weeks prior to presentation . on examination ,
his visual acuity was 20/40 and 20/20 for the right and left eyes , respectively .
intraocular pressure ( iop ) was within the normal ( 13 mmhg ) limits in both eyes .
fundus examination of the right eye indicated an inferior rhegmatogenous retinal detachment with multiple peripheral breaks and macula off .
patient was diagnosed with rhegmatogenous retinal detachment , macula off with multiple peripheral breaks in the right eye and localized retinal detachment with multiple peripheral breaks in the left eye .
a pars plana vitrectomy , air - fluid exchange with perfluoropropane ( c3f8 ) 15% flush and a scleral buckle were performed on the right eye .
the post - operative period was unremarkable and the patient was doing well with a flat retina in both eyes . on
a follow - up visit in early september 2002 , a new horseshoe tear had formed behind the buckle at the 12:00 meridian , which required laser treatment in the periphery of the tear . on the following two follow - up visits ( at 2 weeks and 1 month ) after the procedure , the retina was flat . in january 2003 , the patient presented to the emergency at king khalid eye specialist hospital with a visual complaint of a veil in front of the right eye with onset 3 days prior to presentation . on examination ,
iop was 12 mmhg in the right eye and 15 mmhg in the left eye .
anterior segment examination indicated a trace posterior subcapsular cataract ( psc ) in the right eye and the left eye was unremarkable .
on fundus examination of the right eye , there was subretinal fluid extending from 6:00 to 7:00 meridian with macula on , the remainder of the exam was normal .
pars plana vitrectomy , pfcl injection removal , air - fluid exchange , c3f8 10% flush and endolaser were performed in the right eye .
anterior segment examination of both eyes was only significant for pfo bubbles occupying approximately 15% of the anterior chamber ( ac ) [ figure 1 ] and a psc in the right eye .
patient continued follow - up with the vitreoretinal division at king khaled eye specialist hospital for 9 years at 6-month intervals and his last visit was on december 2012 ; the patient was doing well at all post - operative visits .
currently , his visual acuity is 20/60 with glasses in the right eye and 20/20 in the left eye .
( a - c ) slit lamp photos of the anterior segment of the right eye at different magnifications showing perfluoro - n - octane bubbles in the anterior chamber 9 years after vitreoretinal surgery ( may 2007 ) the patient refused any intervention for the cataract in the right eye as he is currently satisfied with his vision [ figure 2 ] .
the retained pfo in the ac remained stable for the entire follow - up over 9 years .
posterior segment examination , on all post - operative visits from 2003 to 2012 , revealed the retina was flat in both eyes [ figure 3 ] .
the endothelial cell count was 3500 cells / mm in 2007 and 3100 cells / mm in 2012 .
posterior subcapsular cataract in the right eye ( december 2012 ) fundus photo of the right eye showing a flat retina .
the mild hazy view is due to the cataract in this eye ( december 2012 )
in this case report of retained pfo over 9 years , we found no significant ocular effect .
the safety of pfo as a post - operative tamponade was investigated a decade ago by chang et al.1 intravitreal pfo retained for up to 48 h in the rabbit eye did not cause clinical , electrophysiologic or microscopic evidence of toxicity.1 however , minute amounts of pfo ( approximately 0.1 ml ) remained in the rabbit eye for longer periods led to the deposition of white precipitates ( appearing at 3 - 5 weeks).1 histopathology of the white precipitates indicated macrophages containing intracellular vacuoles.1 long - term ( up to 2 months ) placement of pfo revealed similar findings with the accumulation of cells at the interface of pfo and compressed cortical vitreous ( earliest appearance at 2 weeks).1 macrophages were present in all rabbit eyes containing these vacuoles on the inner retinal surface and evidence of progressive epiretinal membrane formation was noted.1 the safety of retained pfo has been previously studied . elsing
et al.2 reported five cases with retained ( pfo ) liquid after retinal reattachment surgery .
they2 concluded that if a significant volume of pfo is retained in an eye , pfo mechanically compresses residual vitreous , causing deposition of white proteinaceous deposits as early as the third post - operative week , with macrophage incursion.2 elsing et al.2 concluded that young eyes , eyes with considerable residual vitreous gel and eyes with 0.25 ml or greater of retained pfo are likely at higher risk for developing this inflammatory response .
eyes that develop persistent inflammation , secondary membrane formation or recurrent rd should undergo reoperation for removal of this material .
in our case , there was no inflammatory response , perhaps due to a low volume of retained pfo .
hence , we elected observation instead of surgical intervention . a multicenter study by scott et al.3 evaluated 555 patients ( 555 eyes ) , 15 months of age or older who had undergone pars plana vitrectomy for complex retinal detachment associated with proliferative vitreoretinopathy with intraoperative pfo .
they3 found 41 ( 7.4% ) eyes with retained pfo and concluded that it was not a significant predictor of either recurrent retinal detachment or visual outcome.3 these conclusions are consistent with our case where the patient has had an uneventful course and satisfied with his vision for almost a decade despite the retained pfo ( and cataract ) . in a comparison of ease of removal intraoperatively and safety and efficacy of pfo versus perfluoroperhydrophenanthrene ( vitreon ) ,
loewenstein et al.,4 reported that vitreon was retained in 8.4% eyes and pfo in 4% of the eyes .
there were no cases of macular epiretinal membranes , cystoid macular edema , or uveitis in patients with retained vitreon or pfo.4 the outcomes from both studies34 indicate observation may be the more prudent course in many cases of retained pfo .
however , there are cases where surgical intervention is warranted . for example , a 65-year - old male with secondary open angle glaucoma due to retained pfo after vitreoretinal surgery has been previously reported.5 in another case , pfcls and silicone oil were left in the eye at the end of the surgery.6 the authors concluded that ( pfcls ) are surgical tools and should be completely removed from the eye at the end of the surgery .
pfcls and silicone oil tend to emulsify together , forming an opaque fluid containing both silicone oil and dispersed pfcl bubbles.6 pradeep et al.7 reported a case of 55-year - old lady complaining of decreased vision in the left eye with pain and redness for 3 months with a history of cataract surgery with an unspecified pfcl to aid in the removal of a dropped nucleus intraoperatively .
they7 concluded that retained pfcl can cause late onset fibrinous inflammation after a quiescent period , but surgical intervention may lead to good visual outcome . in the current case ,
the eye has remained quiet for 9 years and late onset reaction may occur , yet we do not believe this potential scenario , warrants the risks associated with surgery at this time . in our case , this patient has retained pfo in the ac and has been extensively evaluated every 6 months over 9 years .
we performed visual acuity testing , slit lamp examination of the anterior segment looking for signs of inflammation , iop measurement and fundus examination .
every parameter to date has been normal without signs of ocular toxicity . to the best of our knowledge , this is the longest documented follow - up for a case with retained pfo in a human eye .
inadvertent retention of pfo in the ac may be well - tolerated , without side - effects for up to 9 years . however , some evidence of harmful effects from animal studies and isolated case reports has been reported .
hence , we recommend that in similar cases , the patient be followed regularly with extensive ophthalmic evaluation to rule out any signs of ocular toxicity . | perfluoro - n - octane ( pfo ) is commonly used in vitreoretinal surgery . in this case report
, we present a 35-year - old patient with retained pfo up to 9 years after par plana vitrectomy .
post - operatively , pfo bubbles occupied 15% of the anterior chamber ( ac ) .
follow - up over 9 years , consistently showed a quiet ac , normal intraocular pressure and endothelial cell counts remained stable . until date , the patient has been under observation and there have been no ocular symptoms or side - effects .
residual pfo that inadvertently remains in the ac can be well- tolerated , without side - effects for up to 9 years . |
excessive accumulation of fat in the liver , that is , intrahepatic triglyceride ( ihtg ) , is associated with increased prevalence rates of and risk for dyslipidemia , diabetes , and cardiovascular disease [ 13 ] .
data from epidemiological as well as metabolic studies indicate that increased ihtg content is accompanied by insulin resistance and dysregulation of lipid metabolism [ 46 ] .
exercise is known to improve metabolic function [ 7 , 8 ] ; however its effects on ihtg remain elusive [ 9 , 10 ] .
data from studies in humans are scarce and not entirely consistent . in this paper ,
the results from a number of animal studies are briefly reviewed in an attempt to highlight putative factors that may modulate the effect of exercise on ihtg content .
many studies have evaluated the effect of aerobic exercise training on ihtg content in rodents ; their design varies in terms of sex , strain , background diet , training duration , the prandial status , and the time of assessment after the last bout of exercise ( table 1 ) [ 1237 ] .
results are largely heterogeneous , but a crude analysis of the data suggests that endurance training decreases ihtg ( median : 16% , range : 92% to + 97% , n = 50 studies ; table 1 ) .
most frequently [ 14 , 16 , 18 , 20 , 26 , 31 , 35 ] but not always [ 15 , 17 , 34 , 37 ] , exercise has been shown to be more effective in reducing liver fat or attenuating its accretion in animals fed high - fat rather than standard , low - fat diets ( median decrease : 25% and 14% , resp .
this is consistent with data from human studies , in which exercise training appears to be more potent in reducing ihtg in subjects with increased baseline ihtg , for example , subjects with nafld , type ii diabetes , or the elderly .
the reasons why exercise is more effective in reducing ihtg on high - fat than low - fat diets are not entirely clear but are likely related to the hepatosteatotic effect of high - fat feeding .
fat is mainly stored as microvesicles ( < 1 m ) within hepatocytes , whereas the high - fat diet - induced hepatic steatosis occurs via accumulation of macrovesicles ( > 1 m ) [ 18 , 38 ] .
endurance training has been shown to completely prevent the high - fat diet - induced hepatic steatosis [ 18 , 38 ] , that is , the hepatocyte surface area occupied by the lipid vacuoles , solely by reducing the number of lipid vacuoles in all sizes between 1 and 10 m ( i.e. , macrovesicles ) , without affecting the number of vacuoles of surface area < 1 m ( i.e. , microvesicles ) .
hence exercise may have less of an effect when on low - fat diets , not only because of lower total ihtg content , but also because most of this fat ( 75% ) is stored in microvesicles , not macrovesicles .
a more pronounced ihtg - depleting effect of exercise has also been observed under other conditions that favor the development of fatty liver , such as overfeeding , ovariectomy , ethanol ingestion , or tumor - bearing .
apart from the fat content of the background diet , the type of dietary carbohydrate , protein , and fat ( i.e. , saturated or unsaturated fatty acids ) , as well as the feeding pattern ( ad libitum or paired ) do not appear to affect , at least not in a major way , the exercise - induced change in ihtg content .
the collective of available data in animals highlights a number of other putative factors that may modulate the effect of exercise on liver fat ; however , none of these factors has been formally tested using rigorous experimental designs .
concurrent weight loss or attenuated weight gain is not likely critical for the exercise - induced depletion of ihtg to manifest , albeit they may lead to greater reductions in liver fat when compared to no weight loss or similar weight gain ( median decrease : 27.5% and 14% , resp .
however , just like in humans , loss of visceral adipose tissue mass with exercise training is not necessarily coupled with a corresponding decrease in liver fat [ 16 , 18 , 28 , 37 ] .
likewise , human studies have shown that exercise - induced reductions in ihtg content can occur in the absence of changes in total body fat or even visceral adipose tissue .
exercise may be more effective in reducing ihtg content in males than in females ( median decrease : 25% and 14% , resp .
, figure 1(c ) ) , in fasted ( 6 h ) than in fed animals ( median decrease : 31% and 11% , resp .
, figure 1(d ) ) , and after longer ( 8 wk ) than shorter interventions ( median decrease : 24% and 14% , resp . ; figure 1(e ) ) . the time elapsed from the last bout of exercise ( 24 h or 36 h )
may also mediate the observed changes in ihtg ( median decrease : 24% and 13.5% , resp .
, figure 1(f ) ) , suggesting that even acute exercise could affect liver fat . however , relevant information is scarce and inconclusive .
a single bout of aerobic exercise ( 3060 min ) did not affect ihtg content , measured immediately after exercise , in female rats but caused a 30% decrease in male rats of the same strain , under both standard and high - fat feeding conditions .
this is in line with data from exercise training studies in animals raising the possibility that males may be more sensitive to the ihtg - reducing effect of exercise than females ( figure 1(c ) ) , as well as with recent observations in humans .
studies in which male rats were exercised until exhaustion provide conflicting results , some observed a mild or marked [ 46 , 47 ] increase in hepatic steatosis whereas others found a decrease of 3060% at the end of exercise .
if regular exercise reduces liver fat , cessation of exercise should lead to an increase in ihtg content .
only a few animal studies have evaluated the effect of detraining on liver fat accumulation , and all have demonstrated that cessation of regular exercise ( after 616 weeks of training ) for a short ( 2 - 3 days ) or a long ( 6 weeks ) period of time is not associated with any significant changes in ihtg content compared with the trained state ( i.e. , before discontinuation of exercise ) when animals are fed a standard low - fat diet [ 28 , 36 , 49 , 50 ] .
furthermore , detraining for 27 days does not alter the total number of hepatocyte lipid vacuoles and their size , even though it does activate precursors and processes in the liver known to initiate steatosis ( e.g. , decreased mitochondrial oxidative capacity , increased expression of de novo lipogenesis proteins , and increased malonyl coa levels ) .
it is possible that this lack of an effect of detraining relates to the lesser potency of exercise in reducing liver fat content in animals fed standard low - fat diets ( figure 1 ) , so that changes after detraining are similarly less pronounced . for instance , two [ 28 , 36 ] out of three studies that reported no effect of detraining on liver fat also failed to observe a training - induced decrease in ihtg content , suggesting that training and detraining have no effect on liver fat accumulation under low - fat feeding conditions .
whereas one study did observe a training - induced decrease in liver fat in rats fed a low - fat diet but found no changes after detraining , implying that the ihtg - depleting effect of regular exercise is long - lived and is not readily reversed by detraining .
still , compared with sedentary , never - exercised counterparts , detrained animals appear to be relatively protected from mild hepatic steatosis induced by 2 weeks of high - fat feeding , but not from the development of frank fatty liver 6 weeks after ovariectomy , even though cessation of exercise training in ovariectomized rats resulted in a nearly 40% increase in ihtg content compared with ovariectomized rats who did not stop exercising .
it is thus possible that the relevant molecular and biochemical adaptations to exercise are readily reversed when the exercise routine is interrupted ( < 1 week ) , however , changes in ihtg manifest later in time and only when strong triggering factors for liver fat accretion coexist , such as high - fat feeding or ovariectomy .
support for this notion is provided by an earlier study , where detraining resulted in a striking increase in ihtg content only when animals were subjected to starvation and refeeding .
the effect of exercise on ihtg content has recently attracted much scientific interest in light of the apparent detrimental metabolic effects of excessive liver fat accumulation .
although the results from a few studies in human subjects are promising , as exercise appears to reduce ihtg , the importance of the factors highlighted herein on the basis of studies in animals has never been evaluated in man .
future studies should at least control for in order to avoid confounding or directly investigate the role of these factors in affecting the exercise - induced changes in liver fat content . | an increase in intrahepatic triglyceride ( ihtg ) content is the hallmark of nonalcoholic fatty liver disease ( nafld ) and is strongly associated with insulin resistance and dyslipidemia . although regular aerobic exercise improves metabolic function , its role in regulating fat accumulation in the liver is incompletely understood , and human data are scarce .
results from exercise training studies in animals highlight a number of potential factors that could possibly mediate the effect of exercise on liver fat , but none of them has been formally tested in man .
the effect of exercise on ihtg content strongly depends on the background diet , so that exercise is more effective in reducing ihtg under conditions that favor liver fat accretion ( e.g. , when animals are fed high - fat diets ) .
concurrent loss of body weight or visceral fat does not appear to mediate the effect of exercise on ihtg , whereas sex ( males versus females ) , prandial status ( fasted versus fed ) , and duration of training , as well as the time elapsed from the last bout of exercise could all be affecting the observed exercise - induced changes in ihtg content .
the potential importance of these factors remains obscure , thus providing a wide array of opportunities for future research on the effects of exercise ( and diet ) on liver fat accumulation . |
recently , as the proportion of the elderly in the south korean population has increased , and as dietary life has been progressively westernized , the incidence of prostate cancer has increased . according to the annual report of the korean central cancer registry in 2009 ,
prostate cancer was the seventh most common cancer and the fifth most common among males .
it was approximated that 3 out of 100 men will be diagnosed with prostate cancer during their lifetime .
moreover , the incidence of prostate cancer in the population as a whole has been increasing by 14% each year .
serum prostate - specific antigen ( psa ) and digital rectal examination ( dre ) are usually recommended for prostate cancer screening , and any abnormal finding on these two diagnostic tools should prompt a clinician to recommend prostate biopsy to the patient .
currently , prostate needle biopsy is the only standardized method for diagnosis of prostate cancer .
however , the positive predictive value of prostate biopsy is very low , at about 24% .
in addition , because it can cause severe complications such as pain , infection , bleeding , and urinary symptoms after the procedure , some patients are reluctant to undergo this invasive procedure .
thus , when a physician recommends prostate biopsy , the patient 's decision may differ depending on his socioeconomic and individual health status .
furthermore , if the psa level continues to increase or if a new lesion on dre is palpated after a negative result of a previous prostate needle biopsy , the physician should recommend a repeat biopsy . at this point , both the physician and the patient may have difficulty in deciding to undergo a repeat biopsy not only because of the burden of an invasive prostate needle biopsy , but also because of economic factors and the somewhat low negative predictive value . according to rai et al .
, patient education about psa levels before screening tests affects compliance with additional study and initial treatment .
hu et al . insisted that the income level of patients affects the rejection of the prostate cancer screening procedure .
thus , to increase patients ' compliance with prostate biopsy and to clarify the decision - making process , in the present study we prospectively analyzed the socioeconomic and individual health status of patients who were candidates for prostate needle biopsy .
the study included 268 male patients who visited hallym sacred heart hospital from january 2011 to june 2011 .
all 266 patients were over 40 years old and had psa levels higher than 4.0 ng / ml or were recommended to undergo prostate biopsy under transrectal ultrasound ( trus ) following abnormalities during the initial dre or during trus for the first time .
the significance of increased psa levels and abnormal dre and trus findings was explained to the patient .
it was explained that prostate biopsies would be performed under trus on 6 to 12 routine locations on the rectal wall by needle biopsy and that any additional needle biopsies would be needed only when abnormalities were found in trus .
the survey was composed of 9 questions about demographic characteristics and 15 questions regarding the patient 's general understanding of prostate disease .
the nine demographic characteristics were selected on the basis of factors proven by previous reports to affect acceptance of prostate biopsy and prostate cancer screening , including patient 's age , marital status , income level , body mass index , education level , occupation status , past medical disease history , other cancer history , and operation history . the questions on general understanding covered areas such as prostate anatomy , function , prostate cancer screening , and symptoms of prostate cancer .
univariate analyses were performed by using fisher exact probability test to determine the factors affecting the acceptance of prostate biopsy ; p - values less than 0.05 were considered statistically significant .
the mean age of the patients in the study was 66.2 years ( range , 43 - 83 years ) , and 35 patients were unmarried , divorced , or widowed ( 13.1% ) .
patients who currently had a job numbered 135 ( 53.1% ) , and 125 patients ( 48.4% ) , and 133 patients ( 51.6% ) had a monthly income less than one million south korean won ( krw ) and more than one million krw , respectively .
a total of 173 patients had a high school education or higher ( 65.7% ) .
patients with previously diagnosed medical disease , including hypertension and diabetes , numbered 106 ( 40.2% ) , and 23 patients ( 8.6% ) had a history of other cancer ( i.e. , other than prostate cancer ) . patients who had previously experienced surgical treatment numbered 136 ( 51.7% ) .
these findings are presented in table 1 . among the 268 patients who were recommended to undergo prostate biopsy after increased psa levels and abnormal findings in dre , 190 patients ( 70.9% ) agreed to undergo the procedure , whereas 78 ( 29.1% ) refused . in the demographic characteristics category ,
patients with education levels lower than or equal to junior high school had an acceptance rate of 80.0% , compared with 65.9% for patients with at least a high school diploma , a difference that was statistically significant ( p=0.018 ) .
although patients with no previous medical history ( p=0.051 ) and patient groups younger than 65 years ( p=0.069 ) both showed higher acceptance rates , these findings were not statistically significant . in the general knowledge of prostate disease category , patients were divided into two groups , with one group having more than nine correct answers and the other group having nine or fewer .
the group with more than nine correct answers showed an acceptance rate of 65.3% compared with the other group , which had an acceptance rate of 75.2% ; however , the results were not statistically significant ( p=0.079 ) .
this study was a prospective study of the factors that affect the acceptance rate of prostate biopsy among patients with suspected prostate cancer .
although there are similar studies on the subject , this study is the first to target korean male patients .
prostate cancer is the most common form of cancer among males in north america and europe .
recently , the incidence of prostate cancer has been increasing in korea owing to factors such as a rapid increase in the elderly population , a progressively westernized diet , and expansion of prostate cancer screening . according to the national health insurance corporation
, 20,495 patients were treated for prostate cancer in korea in 2008 , which is 4.2 times higher than the 2002 level of 4,843 .
prostate cancer also had the fastest growing number of patients from 2001 to 2008 , making it the most prevalent cancer among male cancers worldwide .
the spread of psa screening , dre , and the number of prostate cancer diagnoses has resulted in an increase in prostate biopsies . however , the prostate cancer diagnosis rate for prostate biopsy is 24% , which is not exceptional .
the results of the present study showed that patients with an education level lower than junior high school had an acceptance rate of 80.0% , compared with 65.9% of patients with at least a high school diploma .
it may be that groups with lower education levels tend to be more dependent on professional counsel .
although previous studies have shown that older , more educated and knowledgeable patients display more cooperation with doctors , there are many cultural and geographical differences to consider when comparing these results .
although not statistically significant , groups with no prior medical history and groups younger than 65 years showed increased rates of acceptance of prostate biopsy .
this can be explained by the fact that older patients tend to have underlying conditions and also tend to be economically unstable , resulting in poor acceptance rates .
however , owing to the fact that prostate cancer has a higher prevalence among the elderly , and the elderly are the ones with an increased interest in cancer , the doctor 's counsel can have a profound effect on the patient 's decision .
the doctor must provide a thorough explanation of the disease , because the elderly are often insufficiently informed , before recommending prostate biopsy .
in males , spouses help to achieve a lower incidence of disease and extend life expectancy , and females affect their spouses ' decision making processes concerning health . according to meiser et al .
the present study showed that there was no correlation between marital status and the acceptance rate .
previous studies have stated that patients with lower income levels tend to rely on subjective information from acquaintances rather than objective data and education when it comes to health and disease .
patients with a lower income level may be more resistant to biopsy owing to costs ; however , they are more likely to be influenced into acceptance by the doctor 's recommendation . income levels , occupation status , and education levels are all interactive factors ; thus , further research in their correlation is desirable .
some previous studies have emphasized the relationship between prostate cancer screening and the patient 's general knowledge about the prostate , although the reason given was not clear .
. stated that the lesser the patient 's knowledge about the prostate , the lower the acceptance of prostate cancer screening .
watson et al . stated that the patient 's knowledge of psa levels affects screening acceptance .
in contrast , yasunaga et al . reported that acceptance of prostate cancer screening is correlated with income , age , and past admission history , whereas the level of knowledge about the disease is not relevant . in the present study ,
patients with lesser knowledge about the prostate showed higher biopsy acceptance , although this finding was not statistically significant . according to nijs
57% did not show urological symptoms , indicating that the presence of symptoms plays a crucial role in patient acceptance .
in addition , 25% of the patients who accepted prostate cancer screening cited urological symptoms as the main factor determining acceptance .
other reports from avery et al . stated that whereas urological symptoms and psa levels are weakly related to prostate cancer screening , they show a strong correlation with prostate biopsy .
it was explained that because patients tend to associate urological symptoms with cancer symptoms , the presence of such symptoms greatly increases the acceptance rate of prostate biopsy . for future studies , the precise effect of psa levels and urological symptoms on the patient acceptance rate
in addition , further analysis should be conducted concerning acceptance when , for example , significantly increased psa levels or severe pain possibly associated with metastatic prostate cancer are present . in such cases
, there may be issues with the doctor 's subjectivity and differences in characteristics during counsel on prostate biopsy .
the present survey lacked authentication beforehand , and more thorough analysis of the interaction between factors would be desirable .
the correlation between each factor affecting prostate biopsy should be analyzed and compared with key demographic factors and level of knowledge about the prostate to increase patient acceptance of prostate biopsy .
the results of this study showed that the lower the patient 's education level , the higher the acceptance level of prostate biopsy . because the demographic characteristics of the patient may affect the acceptance of prostate biopsy
, these characteristics must be explored when explaining the procedure to the patient , thereby increasing the acceptance rate of the procedure . | purposethis study aimed to improve prostate biopsy compliance by analyzing the factors that influence the acceptance of prostate biopsy by patients to whom transrectal ultrasound ( trus)-guided prostate biopsy is recommended for suspected prostate cancer.materials and methodsthe subjects of this study were 268 patients to whom trus - guided prostate biopsy was recommended from january to june 2011 and who completed a questionnaire .
patients who showed a prostate - specific antigen ( psa ) increase to more than 4.0 ng / ml or abnormal findings on a digital rectal examination and trus were recommended to undergo prostate biopsy .
the questionnaire consisted of 9 questions about the subjects ' demographic characteristics and 15 questions that assessed their knowledge of prostate disease .
fisher exact probability test was conducted to assess the influence of the demographic characteristics and levels of knowledge of prostate disease on acceptance of prostate biopsy.resultsthe mean age of the subjects was 66.2 years ( range , 43 - 83 years ) . of the cohort ,
188 patients ( 70.7% ) agreed to the prostate biopsy and 78 patients ( 29.3% ) refused . in terms of demographic characteristics ,
the patients ' acceptance of prostate biopsy was associated only with education level .
patients with relatively lower education levels had a higher acceptance rate for prostate biopsy ( 80.0% vs. 65.9% , p=0.018 ) .
other demographic factors , as well as the degree of knowledge of prostate disease , had no significant effect on the acceptance rate.conclusionsthe patients ' acceptance of prostate biopsy can be influenced by demographic characteristics , especially education level .
therefore , when prostate biopsy is recommended to patients , their demographic characteristics should be taken into consideration . |
in a review in this issue of critical care , bopp and colleagues summarize current knowledge on the receptor of advanced glycation endproducts ( rage ) and its potential as a new therapeutic target in sepsis .
rage is expressed in many cell types involved in the innate immune system and is able to recognize a wide range of endogenous molecules that are released during various conditions of inflammation and/or injury . collectively , these endogenous molecules , which warn the host of imminent danger , have been called alarmins or danger - associated molecular patterns . an important example of an alarmin and an established ligand for rage with relevance for sepsis is high - mobility group box 1 ( hmgb1 ) .
activation of rage results in sustained activation of nuclear factor - kappa b ( nf-b ) , thereby converting transient pro - inflammatory responses into lasting cellular dysfunction .
the evidence that inhibition of rage may be beneficial in sepsis is derived from what is , thus far , a limited number of studies . in a hallmark study published in 2004 , liliensiek and
colleagues reported that rage - deficient mice were strongly protected against lethality due to polymicrobial sepsis caused by cecal ligation and puncture ( clp ) .
the protection provided by the lack of rage was associated with a strongly reduced activation of nf-b in the peritoneum and lungs , which in wild - type mice was abundantly present , suggesting that the absence of excessive nf-b activation in rage - deficient mice might have contributed to their reduced mortality .
in addition , rage deficiency resulted in a diminished accumulation of inflammatory cells in the peritoneum , which is in line with an earlier investigation by the same group of authors identifying rage as a counter - receptor for the 2-integrin mac-1 ( cd11b / cd18 ) and thereby as a mediator of leukocyte recruitment and adhesion .
moreover , other authors have demonstrated that rage - deficient mice are partially protected against lethality due to endotoxin shock .
it is likely that the protective effect of rage inhibition in experimental sepsis is due , at least in part , to inhibition of one of its ligands , hmgb1 .
indeed , hmgb1 is released in the circulation during experimental and clinical sepsis and an anti - hmgb1 antibody protected against endotoxin- and clp - induced lethality .
importantly , hmgb1 can activate not only rage but also other receptors , most notably toll - like receptors 2 and 4 , and anti - hmgb1 treatment caused an additional survival benefit in rage - deficient mice injected with high - dose endotoxin , suggesting that hmgb1 acts only partially via rage during endotoxin shock . which questions remain to be answered to further establish a role for rage in sepsis and to obtain further support for the notion that rage may be a therapeutic target in this syndrome ? when addressing this question , one needs to consider that the historic concept of the pathogenesis of sepsis implicating mortality as the consequence of an uncontrolled hyperinflammatory response of the host has been modified .
the scientific community now agrees that this paradigm is oversimplified and only partially true . the extent and duration of hyperinflammation likely vary due to differences in the comorbidity , nutritional status , age , and genetic background of the patient , on the one hand , and the initial source of the infection , the virulence of the causing organism , and the size of the infectious inoculum on the other hand . in
most if not all patients who survive the acute phase of sepsis , a prolonged state of immune suppression evolves ; this condition is referred to as immunoparalysis .
moreover , experimental studies have indicated that a certain degree of inflammation is necessary to mount an effective innate immune response to invading pathogens . as such
therefore , more research is required to situate rage in a position that warrants clinical trials in patients with sepsis . in this respect
, one could think of studies on rage inhibition in pneumonia , considering that the lung not only is the most frequent cause of sepsis in humans but also represents an organ in which rage is abundantly expressed .
in addition , experiments in which anti - rage treatment is delayed until after bacterial infection ( peritonitis and pneumonia ) and combined with antibiotic therapy should be considered . moreover , more studies need to be conducted on the role of rage in critical organ derangements implicated in the pathogenesis of sepsis , including activation of the coagulation system and the complement system . until then
, rage remains a potential yet promising therapeutic target in sepsis which awaits further research .
clp = cecal ligation and puncture ; hmgb1 = high - mobility group box 1 ; nf-b = nuclear factor - kappa b ; rage = receptor of advanced glycation endproducts .
| the receptor of advanced glycation endproducts ( rage ) is a multiligand receptor that upon activation causes sustained activation of multiple inflammatory pathways .
recent evidence , summarized in a review by bopp and colleagues in this issue of critical care , has implicated rage as a potential therapeutic target in sepsis . here , we discuss several open issues that need to be addressed before anti - rage strategies can enter the sepsis clinical trial arena . |
the enzyme dehydroquinate synthase ( dhqs , ec 4.2.3.4 ) catalyses the transformation of the seven - carbon sugar 3-deoxy - d - arabino - heptulosonate 7-phosphate ( dah7p ) into the carbocycle dehydroquinate ( dhq ) .
this biosynthetic pathway is responsible for producing the precursors of aromatic amino acids ( phenylalanine , tyrosine , and tryptophan ) that are vital for the homeostasis of various plants , fungi , and prokaryotes .
the absence of the shikimate pathway in humans makes the enzymes of this pathway potential targets for new antibacterial and antifungal agents [ 2 , 3 ] .
dhqs is monofunctional in most bacteria ; however , in some organisms , it is part of a larger protein known as arom complex .
the arom complex is a pentafunctional polypeptide containing enzymes that catalyse steps two , three , four , and five of the shikimate pathway .
aspergillus nidulans and neurospora crassa dhqs enzymes exist in nature as part of the arom protein .
similarly , bacillus subtilis dhqs is part of a trifunctional enzyme complex that also contains chorismate synthase and nadph flavin reductase .
more recently , dhqs enzymes that form part of multifunctional complexes have been expressed and isolated as recombinant monofunctional proteins [ 6 , 8 ] .
dhqs has been an enzyme of much interest due to the complexity and variety of reactions that it catalyses despite its relatively small size [ 9 , 10 ] .
examples of dhqss that have been characterised include those from escherichia coli , corynebacterium glutamicum , thermus thermophilus , helicobacter pylori , bacillus subtilis , a. nidulans , n. crassa , phaseolus aureus ( mung bean ) , sorghum sp . , and pisum sativum [ 68 , 1216 ] . currently , there are five dhqs crystal structures available in the rcsb protein data bank ; these are from a. nidulans ( 1dqs ) , t. thermophilus ( 1ujn ) , h. pylori ( 3clh ) , staphylococcus aureus ( 1xag ) , and vibrio cholerae ( 3okf ) [ 10 , 12 , 13 , 17 ] .
preliminary diffraction data has also been recorded for the dhqs from xanthomonas oryzae pv . .
of the four dhqss for which crystal structures are available , those from a. nidulans and t. thermophilus assemble as homodimers , whereas s. aureus dhqs is monomeric [ 10 , 12 , 17 ] .
in contrast , the dhqs from h. pylori assembles as a hexamer composed of three dimers .
all dhqs enzymes require a divalent metal ion and nad for activity and convert dah7p to dhq by way of a five - step reaction process .
this reaction mechanism involves an oxidation , elimination of phosphate , reduction , ring opening , and an aldol reaction step [ 1922 ] .
comparisons of enzyme kinetic parameters for these enzymes are problematic since different methods have been used to measure activity .
the two most common are ( i ) the measurement of inorganic phosphate ( pi ) release and ( ii ) a coupled enzyme assay whereby dhq is converted to dehydroshikimate ( dhs ) and the latter measured spectrophotometrically [ 23 , 24 ] .
the measurement of pi release has been found to be relatively insensitive and results in the inaccurate determination of kinetic parameters .
for example , the e. coli dhqs km for dah7p determined by monitoring pi release was 18 m , and that determined by using the dhs - coupled assay was 4 m [ 25 , 26 ] .
furiosus is an anaerobic , hyperthermophilic archaeon originally isolated from geothermally heated marine sediments and has an optimal growth temperature of 100c . in this study
, we report the expression , purification , and characterisation of p. furiosus recombinant dhqs and a comparison of its properties with the enzyme from the mesophile e. coli .
this is the first report of the biochemical properties of an archaeal dhqs , and also the first characterisation of dhqs from a hyperthermophilic source , necessitating the development of a coupled assay that functions at elevated temperatures up to 80c .
standard pcr methodologies using p. furiosus dsm 3638 purified genomic dna as template , primers pfudhqsfwd ( 5-aggttctcatatggaagggataatttttggagat ) and pfudhqsrev ( 5-ccgggatccttaggcatttttagcttcct ) , and pfuturbo dna polymerase ( stratagene ) were employed to amplify the p. furiosus dhqs gene ( locus tag pf1691 ) and to introduce ndei and bamhi recognition sites ( underlined ) into the 1027 bp pcr product .
the pcr product was purified directly ( high pure pcr product purification kit , roche ) , digested with ndei and bamhi , ethanol precipitated , and ligated to pt7 - 7 previously restricted with the same endonucleases .
the ligation reaction was used to transform chemically competent e. coli xl1-blue cells .
plasmid miniprep dna was isolated from ampicillin - resistant colonies and digested with ndei and bamhi , followed by agarose gel electrophoresis , to identify recombinant plasmids .
one putative pt7-pfudhqs expression plasmid was sequenced on both strands to confirm the expected dna sequence and was then transformed into chemically competent e. coli rosetta ( de3 ) cells ( novagen ) .
transformants of this strain were routinely grown at 37c with vigourous shaking in luria bertani ( lb ) medium ( gibco ) supplemented with 100 g / ml ampicillin ( sigma ) and 34 g / ml chloramphenicol ( sigma ) .
standard pcr methodologies using p. furiosus dsm 3638 purified genomic dna as template , primers pfudhqasefwd ( 5-gaagctacatatgcctaaattggccggagtta ) and pfudhqaserev ( 5-tccggatccattattttgtctcacctagcaatt ) , and pfuturbo dna polymerase were employed to amplify the p. furiosus 3-dehydroquinase ( ec 4.2.1.10 ) gene ( locus tag pf1692 ) and to introduce ndei and bamhi recognition sites ( underlined ) into the 674 bp pcr product .
the pcr product was purified directly , digested with ndei and bamhi , ethanol precipitated , and ligated into pt7 - 7 previously restricted with the same endonucleases .
the ligation reaction was used to transform chemically competent e. coli xl1-blue cells .
plasmid miniprep dna was isolated from ampicillin - resistant colonies and digested with ndei and bamhi , followed by agarose gel electrophoresis , to identify recombinant plasmids .
one putative pt7-pfudhqase plasmid was sequenced on both strands to confirm the expected dna sequence and was then transformed into chemically competent e. coli rosetta ( de3 ) cells .
transformants of this strain were routinely grown at 37c with vigourous shaking in lb medium supplemented with 100 g / ml ampicillin and 34 g / ml chloramphenicol .
e. coli rb791 cells , transformed with the plasmid encoding the e. coli dhqs gene , obtained from professor john r. coggins ( university of glasgow ) , were grown overnight at 37c in lb medium supplemented with ampicillin ( 100 g / ml ) .
overexpressed ecodhqs was purified using a modification of the method published by frost and coworkers .
soluble protein from crude lysate was subjected to ammonium sulfate precipitation at 4c . fractions between 35 and 55% ammonium sulfate were pooled , desalted on a size exclusion column , concentrated and subjected to anion exchange chromatography using source q resin ( amersham biosciences ) ( buffer a : 10 mm -glycerophosphate ( sigma ) , ph 6.6 ; buffer b : 10 mm -glycerophosphate with 1 m nacl ( sigma ) , ph 6.6 ) .
fractions containing purified dhqs ( eluted at ~90 mm nacl ) were pooled and concentrated .
e. coli ab2848/pkd201 cells containing the e. coli dhqase gene were grown overnight at 37c in lb medium supplemented with ampicillin ( 100 g / ml ) .
overexpressed ecodhqase was purified by anion exchange chromatography using source q resin ( buffer a : 50 mm 1,3-bis ( tris(hydroxymethyl)methylamino)propane ( btp , sigma ) with 10 m edta , ph 7.5 ; buffer b : 50 mm btp , 10 m edta ( sigma ) with 1 m nacl , ph 7.5 ) .
fractions containing purified dhqase were pooled and concentrated . in order to purify pfudhqs efficiently ,
advantage was taken of the thermostability of pfudhqs to facilitate separation of the recombinant protein from e. coli host proteins .
e. coli rosetta ( de3 ) cells containing the expression plasmid pt7-pfudhqs were grown overnight at 37c in lb medium supplemented with ampicillin ( 100 g / ml ) and chloramphenicol ( 34 g / ml ) .
this culture was used to inoculate 500 ml of fresh medium in a 1000 ml flask , and growth continued with shaking at 37c .
isopropyl--d - thiogalactopyranoside ( iptg ) ( applichem ) was added at 1 mm to midlogarithmic phase cultures ( od600 ~0.6 ) to induce expression .
cells were harvested by centrifugation ( 4c , 4000 g , 20 minutes ) 16 hours after induction .
cell pellets were thawed and resuspended in 50 mm btp buffer containing 2 mm dithiothreitol ( dtt ) ( bdh ) , 0.5 mm nad ( sigma ) , and 200 mm kcl ( ajax chemicals ) , ph 6.8 and lysed by sonication at 30c .
the cell lysate was heat treated at 70c for 20 minutes , cooled to 5c , and centrifuged ( 4c , 10000 g , 20 minutes ) .
pfudhqs was further purified by anion exchange chromatography using a source q 15 column ( amersham biosciences ) . after filtering through a 0.45-micron filter ,
the supernatant from the heat treatment step was diluted with buffer a ( 50 mm btp with 10 m edta , ph 6.8 ) and loaded onto the anion exchange column .
pfudhqs was eluted at 90 mm nacl by applying a linear gradient of nacl at 2 ml / min using buffer b ( 50 mm btp , 10 m edta with 1 m nacl , ph 6.8 )
. fractions with dhqs activity were pooled and concentrated using a 10 kda mwco ( vivascience ) .
the concentrate was aliquoted ( 50 l ) , frozen in liquid nitrogen , and stored at 80c .
e. coli rosetta ( de3 ) cells , transformed with the expression plasmid pt7-pfudhqase , were grown at 37c in lb medium supplemented with ampicillin ( 100 g / ml ) and chloramphenicol ( 34 g / ml ) .
expression of pfudhqase was induced with iptg as described for pfudhqs and purified based on the method of schofield and coworkers . soluble protein from crude lysate
was subjected to heat treatment at 70c in lysis buffer ( 50 mm btp , 2 mm dtt , 200 mm kcl , 1 mm edta , ph 7.5 ) .
the resulting protein suspension was centrifuged to obtain supernatant which was then subjected to size exclusion chromatography on a superdex s200 hr 10/300 column ( amersham biosciences ) and eluted under isocratic conditions at 0.4 ml / min ( buffer : 10 mm btp , 10 m edta , 50 mm kcl , ph 6.8 ) .
dah7p was prepared enzymatically from d - erythrose-4-phosphate ( e4p , sigma ) and phosphoenolpyruvate ( pep , research chemicals ) using 3-deoxy - d - arabino - heptulosonate-7-phosphate synthase ( dah7ps , ec 2.5.1.54 ) as described by hasan and nester .
the reaction was monitored by tracking the disappearance of pep ( = 2.8 10 m cm at 232 nm , ph 6.8 at 25c ) .
the reaction mixture was filtered to remove the enzyme , the filtrate was loaded onto an anion exchange column , and the pooled fractions containing dah7p were lyophilised .
standards ( potassium dihydrogen phosphate ) and samples were reacted with lanzetta reagent , and the absorbance for each was read at 630 nm . to assess the activity of dhqs , in vitro experiments
this involved the dhqs - mediated conversion of dah7p into dhq followed by the 3-dehydroquinase - mediated conversion of dhq to dhs ( = 1.2 10 m cm at 234 nm ) .
when 3-dehydroquinase is present in excess ( at least 10 times the concentration of dhqs ) , this assay provides a quantitative measure of dhqs activity .
an extinction coefficient of 1.2 10 m cm was used in all calculations of activities at 25c for ecodhqs and 60c for pfudhqs . to determine the kinetics of pfudhqs for dah7p , a reaction mixture was prepared containing dah7p ( 1 to 70 m ) , zncl2 ( 100 m ) ( bdh ) , and nad ( 29 m ) in 50 mm btp buffer with 10 m edta , ph 6.8 at 60c .
the mixture was preincubated at 60c for 1 minute followed by addition of pfudhqase ( 826 nm ) .
km and kcat values were determined by fitting the data to the michaelis - menten equation using grafit 5 ( erithacus software limited , 2006 ) .
the extinction coefficient of dhs at various temperatures was determined by measuring the total conversion of dah7p to dhs .
the reaction mixture was prepared as above except that the concentration of dah7p used was 117 m and the ph at each of the required temperatures was adjusted to 6.8 .
a correction for the change in absorbance due to the addition of enzyme was determined using reaction mixtures without dah7p .
the stability of dah7p was determined by incubating several 5 l aliquots of dah7p at 60c . at appropriate time intervals ,
a 5 l aliquot of dah7p was added to a cuvette containing ecodhqase ( 1.46 m ) , zncl2 ( 100 m ) , and nad ( 29 m ) in 50 mm btp buffer with 10 m edta at ph 6.8 and allowed to incubate at 25c .
the amount of dah7p was determined by measuring the total conversion of dah7p to dhs ( = 1.2 10 m cm at 234 nm , ph 6.8 at 25c ) by the addition of ecodhqs ( 7 nm ) to the reaction mixture .
assays to determine the effect of temperature on enzymatic activity contained 50 mm btp buffer with 10 m edta adjusted to ph 6.8 at the temperature of use .
the reaction mixture was prepared as for the dhqs kinetics assay except that the concentration of dah7p used was 21 m .
specific activities at 40 , 60 , and 80c were inferred using the extinction coefficients for dhs determined at each temperature .
specific activities at 25 , 30 , 50 , and 70c were determined using calculated extinction coefficients .
assays to determine the effect of ph on enzymatic activity contained 50 mm btp buffer with 10 m edta adjusted to the required ph at 60c .
specific activities at ph 5.9 , 6.4 , 6.7 , 6.9 , 7.4 , 7.7 , 7.9 , 8.4 , and 9.4 were calculated using an extinction coefficient of 1.2 10 m cm .
reaction mixtures to determine the activity of pfudhqs in the absence of divalent metal ions contained dah7p ( 46 m ) and nad ( 29 m ) in 50 mm btp buffer with 10 m edta , ph 6.860c pretreated with chelex 100 resin ( bio - rad ) . reaction mixtures and pfudhqs samples
were pretreated for 10 minutes at 21c with edta ( 100 m and 1 mm , resp . ) with the exception of one pfudhqs sample that was not treated with edta .
all the reaction mixtures were preincubated at 60c for 5 minutes followed by addition of pfudhqase ( 330 nm ) .
the reactions were initiated by the addition of edta - treated pfudhqs ( 11 nm ) with the exception of one reaction mixture which was initiated by the addition of pfudhqs ( 11 nm ) that was not treated with edta .
divalent metal ion salts used in assays to restore activity to the edta - treated pfudhqs were dissolved in 50 mm btp buffer , ph 6.860c pretreated with chelex to give a final concentration of 0.1 mm in the reaction mixture .
the metal salts used were cocl26h2o ( sigma ) , bacl22h2o ( bdh ) , feso47h2o ( sigma ) , mgso4h2o ( may and baker ) , cacl2 ( prolabo ) , mnso4h2o ( sigma ) , crcl2 ( aldrich ) , hgcl2 ( aldrich ) , cdcl2 ( may and baker ) , nicl26h2o ( may and baker ) , cuso4h2o ( may and baker ) , and zncl2 . the molecular weight of pfudhqs was determined by electrospray ionisation mass spectrometry ( esi - ms ) on a micromass lct tof instrument , equipped with an esi probe .
protein samples ( 10 g / ml ) were prepared in 50% acetonitrile and water and directly injected at 20 l / ml . samples were analysed with a cone voltage of 25 v and a probe voltage of 3,200 v. this system was controlled by masslynx ( version 4.0 ) software . the native molecular weight was determined by size exclusion chromatography . filtered samples of partially purified protein at concentrations of 10 mg / ml were applied to a superdex s200 hr 10/300 column ( amersham biosciences ) in 10 mm btp buffer containing 10 m edta , 50 mm kcl at ph 6.8 .
a standard curve was generated using cytochrome c ( 12.4 kda , sigma ) , carbonic anhydrase ( 29 kda , sigma ) , bovine serum albumin ( 66 kda , sigma ) , alcohol dehydrogenase ( 150 kda , sigma ) , and -amylase ( 200 kda , sigma ) . the molecular weight was estimated from a curve prepared by plotting the log of the molecular weight of the standards versus the elution time .
circular dichroism ( cd ) spectroscopic data were generated using a jasco j-815 cd spectrophotometer .
spectra were collected at a concentration of 0.01 mg / ml of enzyme in water .
wavelength scans were collected at 20c using a 10 mm path - length cuvette , 1.0 nm bandwidth , 0.5 nm step size , and a 1-second averaging time .
temperature scans were monitored at 220 nm , and data were collected at 0.5c intervals between 20 to 90c with a 1-second averaging time .
a 25 l aliquot of solution containing 0.5 mg / ml of protein , 50 mm sodium phosphate buffer at ph 8.0 , and 2.5 l of 10xsypro orange dye ( invitrogen ) was added to the wells of a 96-well thin - wall pcr plate ( bio - rad ) .
the plates were sealed and heated in an icycleriq real - time pcr detection system ( bio - rad ) from 20 to 100c in increments of 0.5c , with 30-second dwell time .
fluorescence changes in the wells of the plate were monitored simultaneously with a charge - coupled device camera .
polyacrylamide gel electrophoresis ( page ) in the presence of sodium dodecyl sulfate ( sds ) was performed by the method of laemmli ( 1970 ) with a 4% ( w / v ) stacking gel and a 12% ( w / v ) resolving gel , using a mini - protean iii cell ( bio - rad ) .
samples were prepared in a loading buffer containing sds , boiled for 2 minutes , and loaded within 10 minutes .
low - range sds - page molecular weight standards ( bio - rad ) were used .
after electrophoresis , gels were stained for protein using coomassie brilliant blue r 250 ( park scientific ) .
protein concentrations were determined by the method of bradford , using bovine serum albumin as a standard .
the pcr product was purified by agarose gel electrophoresis , digested with ndei and bamhi , and ligated to similarly digested pt7 - 7 .
the resulting pt7-pfudhqs construct was sequenced to confirm the integrity of the pfudhqs gene and transformed into e. coli rosetta ( de3 ) cells .
after induction with iptg , cell lysis , and centrifugation , sds - page analysis indicated that the protein was largely insoluble ( figure 1(a ) ) .
however , adjusting the salt concentration in the lysis buffer to 200 mm kcl substantially increased the solubility of the enzyme ( figure 1(b ) ) .
kosmotropes such as kcl have been shown to influence protein aggregation and solubility .
following cell lysis at 30c and heat treatment to remove nonthermostable contaminants , dhqs was subjected to anion exchange chromatography ( figure 1(b ) ) .
although there was a substantial loss of protein during this step , the overall purity of pfudhqs compared to that in the crude lysate increased by 19-fold ( table 1 ) .
the relative molecular mass of the purified recombinant pfudhqs was 37,397 5 da for the monomer as determined by esi - ms .
this value is in close agreement with the value calculated from the sequence ( 37,394 da ) .
a single peak was observed by size exclusion chromatography corresponding to a mass of 72 kda .
a. nidulans and t. thermophilus dhqs enzymes are also reported to be homodimeric in their crystalline form [ 10 , 12 ] . a multiple sequence alignment ( figure 2 ) including
pfudhqs and other characterised enzymes indicates that of these proteins pfudhqs shares the greatest sequence identity with the dhqs from e. coli ( 37% ) .
slightly lower identity is observed between pfudhqs and the structurally characterised dhqs from the thermophilic bacterium t. thermophilus ( 32% ) .
the spectrophotometric coupled enzyme assay used to assess the activity of pfudhqs was optimised to function at 60c . at temperatures above 60c , gas bubbles developed in the cuvette interfering with the assay .
all cuvettes contained dah7p , a divalent metal , and nad in buffer at ph 6.860c and were preheated at 60c .
after 5 minute of preincubation , pfudhqase was added to the cuvette and the reaction mixture allowed to heat a further minute at 60c .
the reaction was initiated by the addition of pfudhqs , and the rate of dhs production was monitored at 234 nm .
it is important to note that the stability of dah7p at 60c was examined , and results showed that dah7p was stable for at least 30 minutes at 60c .
an extinction coefficient of 1.2 10 m cm was used in all calculations of activities at 60c .
the kinetic constants of pfudhqs were km 3.7 0.2 m and kcat 3.0 0.1 s , at 60c and ph 6.8 .
a comparison of the kinetic constants of pfudhqs with those of ecodhqs ( at 25c and ph 6.8 ) shows a higher kcat for ecodhqs than pfudhqs ( table 2 )
. some of the difference in kcat between ecodhqs and pfudhqs could be due to the assay for pfudhqs having been carried out at a suboptimal temperature for this enzyme . although the structure of dhqs from the moderate thermophile t. thermophilus has been determined , this is the first report of the biochemical characterisation of dhqs from any thermophile or hyperthermophile .
the effect of temperature on pfudhqs activity showed an initial rise in activity proportional to the rise in temperature .
however , the activity begins to taper off above 75c ( figure 3 ) . at 60c ,
the activity of pfudhqs is highest at ph 6.8 , but the range for optimum activity is broader at approximately 6.7 to 7.8 ( figure 4 ) .
it has been shown for dhqs enzymes from e. coli , b. subtilis , a. nidulans , n. crassa , p. sativum and sorghum sp . that a divalent metal ion is required for enzymatic activity [ 7 , 14 , 16 , 19 , 35 , 36 ] .
treatment of these enzymes with edta resulted in the rapid formation of inactive apoenzyme that could be reactivated by the addition of various divalent metal ions .
zinc , found in the active site of dhqs , has been suggested to be the naturally occurring metal ion for e. coli , a. nidulans , and n. crassa enzymes [ 14 , 19 , 35 ] .
the residual activity of pfudhqs in the absence of added metal ( no metal , table 3 ) decreased 10-fold when this sample was treated with 1 mm edta .
a range of divalent metal ions were tested for their ability to restore activity to edta - treated pfudhqs ( table 3 ) .
the edta - treated pfudhqs was activated 1000-fold by cadmium , and to a lesser extent by other metal ions .
the cadmium and cobalt forms of pfudhqs were both significantly more active than the zinc - activated enzyme .
a survey of the metal dependency of other dhqss reported in the literature showed that cobalt was the predominant activating metal in all screens [ 6 , 7 , 14 , 16 , 19 ] .
for example , cobalt restored the activity of a. nidulans dhqs to 125% of the level observed with zinc .
in addition , cobalt activated dhqs from phaseolus mungo and sorghum bicolour . furthermore , manganese and cobalt were the only divalent metals that activated dhqs from bacillus subtilis .
in contrast to a. nidulans dhqs , results for pfudhqs showed that cadmium was able to activate the enzyme to a greater extent than zinc .
similar to the observations made for a. nidulans dhqs , iron and nickel were poor activators of pfudhqs ( 2% and 3% , resp . ) although the activity seen with a. nidulans dhqs was greater ( 18% with iron , and 16% with nickel ) .
of the dhqss that have been characterised , cadmium has not been shown to activate other dhqs enzymes to the level seen with pfudhqs .
however , when comparing pfudhqs with p. furiosus dah7ps , a preference for cd can be seen .
schofield and coworkers showed that cd significantly activated p. furiosus dah7ps over mn and co ( 162% , 100% , and 68% , resp . ) .
these enzymes appear to be relatively tolerant to a range of divalent metal ions for the support of catalytic activity .
the preference for cadmium may be indicative of the increased bioavailability of this metal and the tolerance of organisms such as p. furiosus to cadmium [ 37 , 38 ] .
the thermal stability of pfudhqs and ecodhqs was examined using cd spectroscopy by monitoring the changes in the secondary structure at wavelengths in the far uv . as expected , pfudhqs was significantly more thermostable than ecodhqs .
loss of secondary structure was observed at 90 and 30c for pfudhqs and ecodhqs , respectively , ( data not shown ) .
differential scanning fluorimetry was used to determine the thermal stability of dhqs and to confirm the results seen with cd spectroscopy . using this technique ,
the tm for pfudhqs was found to be 90c , whereas the tm for ecodhqs was 45c ( figure 5 ) .
homology modelling of the enzyme indicates that the pfudhqs monomer has a truncated n - terminus and is likely to include shorter loops between secondary structure elements , most notably in the region around glu194 ( figure 6 ) .
recombinant pfudhqs overexpressed in e. coli rosetta ( de3 ) cells was purified in a soluble active form .
this success was largely due to the high - salt content in the lysis buffer that contributed to a higher yield of soluble protein .
characterisation of the enzyme revealed that recombinant pfudhqs assembles as a homodimer with a monomeric molecular weight of 37.4 kda .
the enzyme is structurally stable and active up to 90c and is activated by cd , co , zn , and mn .
high enzymatic activities in the presence of cd have not previously been observed for this enzyme from other sources . | dehydroquinate synthase ( dhqs ) catalyses the second step of the shikimate pathway to aromatic compounds .
dhqs from the archaeal hyperthermophile pyrococcus furiosus was insoluble when expressed in escherichia coli but was partially solubilised when kcl was included in the cell lysis buffer .
a purification procedure was developed , involving lysis by sonication at 30c followed by a heat treatment at 70c and anion exchange chromatography .
purified recombinant p. furiosus dhqs is a dimer with a subunit mr of 37,397 ( determined by electrospray ionisation mass spectrometry ) and is active over broad ph and temperature ranges .
the kinetic parameters are km ( 3-deoxy - d - arabino - heptulosonate 7-phosphate ) 3.7 m and kcat 3.0 sec1 at 60c and ph 6.8 .
edta inactivates the enzyme , and enzyme activity is restored by several divalent metal ions including ( in order of decreasing effectiveness ) cd2 + , co2 + , zn2 + , and mn2 + .
high activity of a dhqs in the presence of cd2 + has not been reported for enzymes from other sources , and may be related to the bioavailability of cd2 + for p. furiosus .
this study is the first biochemical characterisation of a dhqs from a thermophilic source .
furthermore , the characterisation of this hyperthermophilic enzyme was carried out at elevated temperatures using an enzyme - coupled assay . |
fatigue can be defined as difficulty in initiating or sustaining voluntary activities ; this decreases efficiency in performing daily tasks and is a risk factor of various diseases .
recently , naturally occurring nutrients and over - the - counter supplements such as vitamins , minerals , and taurine have been widely used with expectation of attenuating fatigue . at present
there is little scientific evidence for their efficacy and few established regimens for the treatment of fatigue , but there is evidence that specific nutrients such as carbohydrate contribute to energy production and vitamin c contributes to antioxidation .
this may be because no standardized fatigue - inducing tasks with relatively short duration and no appropriate methods of evaluating fatigue have been developed . to overcome these problems
, we recently developed physical and mental fatigue - inducing tasks and appropriate methods for their evaluation .
we have identified the anti - fatigue effects of oral substances such coenzyme q10 and chicken essence for physical fatigue using a recently developed physical fatigue - inducing task and evaluation methods . both coenzyme q10 and chicken essence improved physical performance and attenuated fatigue sensation due to fatigue - inducing workload trials .
however , we did not identify any anti - fatigue substances effective against mental fatigue .
chicken essence is used as a traditional remedy with various aims . especially in asian countries , it is widely taken for attenuation of fatigue , recovery from stress , and increasing mental efficiency .
chicken essence contains large amounts of imidazole dipeptides ( carnosine and anserine ) , which are natural antioxidants in meat extract .
the antioxidant effect of imidazole peptide inhibits tissue damage and suppresses the reduction in performance level induced by mental fatigue [ 1517 ] .
the aim of our study was to evaluate the efficacy of chicken essence , specifically on mental fatigue , by means of our established mental fatigue - inducing task and evaluation methods .
although the association between chicken essence and fatigue caused by mental workload has been indicated previously , that study design was totally different from ours in that it only compared chicken essence and placebo intake conditions administered for 7 days with an intra - subject design . to scientifically evaluate the anti - fatigue effect of chicken essence , we designed and conducted a placebo - controlled crossover study and evaluation sessions were performed just before and after the fatigue - inducing and rest sessions .
evaluation sessions included cognitive task trials to assess selective attention because our previous study showed that mental fatigue specifically caused a decrease in the ability to maintain selective attention .
twenty healthy male volunteers [ age , 34.70.83 years old ( mean sem ) ] were enrolled in this study .
we excluded current smokers , those with a history of medical illness , and those taking chronic , acute , and per - request medications .
good health was also ensured by physical examination by a medical doctor ( m.t . ) . in the present study
, we choose only healthy males because their physical condition is not affected by menstrual cycle .
the study protocol was approved by the ethics committee of osaka city university and was conducted in accordance with the declaration of helsinki .
after enrolment , the participants were randomly assigned to 2 groups in a placebo - controlled crossover manner to initially receive chicken essence or placebo drink ( figure 1a ) .
the participants receiving chicken extract were given 1 bottle of brand s essence of chicken ( bec ; cerebos pacific ltd . ,
bec is produced by a process of water extraction from chicken meat for several hours under high temperature .
the solid content consists mainly of proteins , amino acids , and peptides such as carnosine and anserine .
a bottle of bec ( 70 ml ) contains 83 mg protein and peptide , 3.1 mg free amino acids , 0.8 mg hexose , 0.4 mg fat , and 3 mg caramel .
it also contained -alanyl - l - histidine ( carnosine ) and -alanyl - l - methyl - l - histidine ( anserine ) as active di - peptides .
the dose of bec used in the present study was based on a previous human study .
those receiving placebo were given 1 bottle of sample twice a day ( after breakfast and dinner ) for 4 weeks .
a bottle of placebo ( 70 ml ) contains 83 mg milk casein and 3 mg caramel to produce protein content , caloric content , and color similar to those of bec .
casein is chosen as an ingredient in the placebo because it does not include peptides reported to have effects on fatigue and has similar amino - acid composition as bec .
the bec and placebo samples were provided by cerebos pacific ltd . via suntory holdings ltd .
experiments were conducted just before starting the sample ( t1 ) , 1 week later ( t2 ) , and 4 weeks after starting the sample ( t3 ) .
the time interval between each intake period was set at 4 weeks as a washout period . during each intake period , the participants refrained from strenuous mental and physical activities and followed normal dietary behavior , drinking patterns , and sleeping hours . they were asked to rate their levels of fatigue on a visual analogue scale ( vas ) from 0 ( no fatigue ) to 100 ( total exhaustion ) every day at home . on each experimental day , they performed fatigue - inducing and rest sessions , with evaluation sessions just before and after these sessions ( figure 1b ) . during the fatigue - inducing session
these involved remembering not the last item presented to them , but the one before that . during the rest session , they could choose to read books or magazines or listen to music for 60 minutes .
during the evaluation session , they performed cognitive task trials for 9 minutes and rated their subjective level of fatigue on the vas . for 1 day before each visit
, participants refrained from drinking caffeinated beverages and could ingest only water during each experimental day .
this study was conducted in a quiet , temperature- and humidity - controlled environment . as a fatigue - inducing mental task
one of 4 types of white letters was continually presented on a black background in the display of a laptop computer every 3 seconds .
the letter size was 3030 mm . during the trials , participants had to judge whether the target letter presented at the center of the screen was the same as the one that had appeared 2 presentations earlier . if it was , they were to press the right button with their right middle finger ; if it was not , they were to press the left button .
they were instructed to perform the task trials as quickly and as correctly as possible .
the result of each 2-back trial , that is , a correct response or error , was continually presented on the display of the laptop computer . the cognitive task presentation consisted of traffic lights ( a japanese character meaning blue or red was placed on either blue or red lights ) shown on the display of a personal computer screen .
participants performed task a for 3 minutes and task b for 6 minutes . in task
a , they were told to press the right button with their right middle finger if the blue traffic light was presented ( placed on a japanese character meaning blue ) . if the red traffic light was presented ( placed on a japanese character meaning red ) , they were told to press the left button with their right index finger . in task
a , they had to decide to press a button depending on whether the target japanese character presented at the center of a traffic light was blue or red .
if the japanese character meaning blue was presented , regardless of the color of the traffic light , they were to press the right button with their right middle finger ; otherwise , they were to press the left button with their right index finger . in these tasks , each trial was presented 100 msec after either of the buttons was pressed . during the task period ,
blue or red trials were given randomly and the probability of occurrence of each color and type of sign was equal . in task
b , mismatching the color of the traffic light with the japanese character ( i.e. , stroop trials ) , and matching the color of the traffic light with the japanese character ( i.e. , non - stroop trials ) occurred an equal number of times . this task is based on the stroop test , which is used as a classic experimental paradigm in research settings . in this test , the participants are asked to name the color of the letters as presented visually either in the congruent or incongruent condition .
the strong interference of word reading upon color naming is called the stroop interference effect , which occurs when the noun presented is a color name displayed visually using a different color .
this paradigm demonstrates the requirement for a limited - capacity attentional system in the selection of processing centers appropriate for job execution .
participants were instructed to perform the task trials as quickly and as correctly as possible .
the result of each cognitive task trial ( i.e. , a correct response or error ) was continuously presented on the display of the personal computer .
multiple comparisons during the time course of sample intake were performed using one - way repeated - measures analysis of variance .
when statistically significant or trend effects were found , intragroup differences were compared using the paired t - test with bonferroni correction .
statistical analyses were performed using the spss 17.0 software package ( spss , chicago , il ) .
twenty healthy male volunteers [ age , 34.70.83 years old ( mean sem ) ] were enrolled in this study .
we excluded current smokers , those with a history of medical illness , and those taking chronic , acute , and per - request medications .
good health was also ensured by physical examination by a medical doctor ( m.t . ) . in the present study
, we choose only healthy males because their physical condition is not affected by menstrual cycle .
the study protocol was approved by the ethics committee of osaka city university and was conducted in accordance with the declaration of helsinki .
after enrolment , the participants were randomly assigned to 2 groups in a placebo - controlled crossover manner to initially receive chicken essence or placebo drink ( figure 1a ) .
the participants receiving chicken extract were given 1 bottle of brand s essence of chicken ( bec ; cerebos pacific ltd . ,
bec is produced by a process of water extraction from chicken meat for several hours under high temperature .
the solid content consists mainly of proteins , amino acids , and peptides such as carnosine and anserine .
a bottle of bec ( 70 ml ) contains 83 mg protein and peptide , 3.1 mg free amino acids , 0.8 mg hexose , 0.4 mg fat , and 3 mg caramel .
it also contained -alanyl - l - histidine ( carnosine ) and -alanyl - l - methyl - l - histidine ( anserine ) as active di - peptides .
the dose of bec used in the present study was based on a previous human study .
those receiving placebo were given 1 bottle of sample twice a day ( after breakfast and dinner ) for 4 weeks .
a bottle of placebo ( 70 ml ) contains 83 mg milk casein and 3 mg caramel to produce protein content , caloric content , and color similar to those of bec .
casein is chosen as an ingredient in the placebo because it does not include peptides reported to have effects on fatigue and has similar amino - acid composition as bec .
the bec and placebo samples were provided by cerebos pacific ltd . via suntory holdings ltd .
experiments were conducted just before starting the sample ( t1 ) , 1 week later ( t2 ) , and 4 weeks after starting the sample ( t3 ) . the time interval between each intake period
, the participants refrained from strenuous mental and physical activities and followed normal dietary behavior , drinking patterns , and sleeping hours .
they were asked to rate their levels of fatigue on a visual analogue scale ( vas ) from 0 ( no fatigue ) to 100 ( total exhaustion ) every day at home .
on each experimental day , they performed fatigue - inducing and rest sessions , with evaluation sessions just before and after these sessions ( figure 1b ) . during the fatigue - inducing session
these involved remembering not the last item presented to them , but the one before that . during the rest session , they could choose to read books or magazines or listen to music for 60 minutes .
during the evaluation session , they performed cognitive task trials for 9 minutes and rated their subjective level of fatigue on the vas . for 1 day before each visit
, participants refrained from drinking caffeinated beverages and could ingest only water during each experimental day .
as a fatigue - inducing mental task , participants performed 2-back test trials for 40 minutes .
one of 4 types of white letters was continually presented on a black background in the display of a laptop computer every 3 seconds .
the letter size was 3030 mm . during the trials , participants had to judge whether the target letter presented at the center of the screen was the same as the one that had appeared 2 presentations earlier . if it was , they were to press the right button with their right middle finger ; if it was not , they were to press the left button .
they were instructed to perform the task trials as quickly and as correctly as possible .
the result of each 2-back trial , that is , a correct response or error , was continually presented on the display of the laptop computer .
the cognitive task presentation consisted of traffic lights ( a japanese character meaning blue or red was placed on either blue or red lights ) shown on the display of a personal computer screen .
participants performed task a for 3 minutes and task b for 6 minutes . in task
a , they were told to press the right button with their right middle finger if the blue traffic light was presented ( placed on a japanese character meaning blue ) . if the red traffic light was presented (
placed on a japanese character meaning red ) , they were told to press the left button with their right index finger . in task
a , they had to decide to press a button depending on whether the target japanese character presented at the center of a traffic light was blue or red .
if the japanese character meaning blue was presented , regardless of the color of the traffic light , they were to press the right button with their right middle finger ; otherwise , they were to press the left button with their right index finger . in these tasks ,
each trial was presented 100 msec after either of the buttons was pressed . during the task period ,
blue or red trials were given randomly and the probability of occurrence of each color and type of sign was equal . in task
b , mismatching the color of the traffic light with the japanese character ( i.e. , stroop trials ) , and matching the color of the traffic light with the japanese character ( i.e. , non - stroop trials ) occurred an equal number of times .
this task is based on the stroop test , which is used as a classic experimental paradigm in research settings . in this test , the participants are asked to name the color of the letters as presented visually either in the congruent or incongruent condition .
the strong interference of word reading upon color naming is called the stroop interference effect , which occurs when the noun presented is a color name displayed visually using a different color .
this paradigm demonstrates the requirement for a limited - capacity attentional system in the selection of processing centers appropriate for job execution .
participants were instructed to perform the task trials as quickly and as correctly as possible .
the result of each cognitive task trial ( i.e. , a correct response or error ) was continuously presented on the display of the personal computer .
multiple comparisons during the time course of sample intake were performed using one - way repeated - measures analysis of variance .
when statistically significant or trend effects were found , intragroup differences were compared using the paired t - test with bonferroni correction .
statistical analyses were performed using the spss 17.0 software package ( spss , chicago , il ) .
subjective levels of fatigue are shown in figures 2 and 3 . in figure 2 , the daily vas score for fatigue assessed at home is shown ; the scores of the bec condition were lower than those of the placebo condition throughout 4 weeks . the vas score for fatigue after the rest session during the experiment was significantly lower in the bec condition at t2 and t3 than at t1 , and in the placebo condition the fatigue score was significantly lower only at t3 ( figure 3 ) .
the vas score of the bec condition was significantly lower than that of the placebo condition at 1 week after the start of sample intake .
reaction times after the fatigue - inducing and rest sessions in tasks a and b are shown in table 1 .
reaction times in task a after the fatigue - inducing and rest sessions exhibited no change over the time course of the experimental day in either the bec or placebo condition ( figure 4 ) .
reaction times in task b of the stroop and non - stroop trials are shown in figure 5 . the reaction times in stroop trials
were longer than those in non - stroop trials across the experimental day in both the bec and placebo conditions .
the reaction time in task b of the stroop and non - stroop trials after the fatigue - inducing task session exhibited no change over the time course of the experimental day in either the bec or placebo condition ( figure 5a and 5b ) .
however , the reaction times in task b of the stroop and non - stroop trials after the rest session were significantly shorter at t2 and t3 than at t1 in the bec condition , but placebo intake did not exhibit these effects ( figure 5c and 5d ) .
subjective levels of fatigue are shown in figures 2 and 3 . in figure 2 , the daily vas score for fatigue assessed at home is shown ; the scores of the bec condition were lower than those of the placebo condition throughout 4 weeks . the vas score for fatigue after the rest session during the experiment was significantly lower in the bec condition at t2 and t3 than at t1 , and in the placebo condition the fatigue score was significantly lower only at t3 ( figure 3 ) .
the vas score of the bec condition was significantly lower than that of the placebo condition at 1 week after the start of sample intake .
reaction times after the fatigue - inducing and rest sessions in tasks a and b are shown in table 1 .
reaction times in task a after the fatigue - inducing and rest sessions exhibited no change over the time course of the experimental day in either the bec or placebo condition ( figure 4 ) .
reaction times in task b of the stroop and non - stroop trials are shown in figure 5 .
the reaction times in stroop trials were longer than those in non - stroop trials across the experimental day in both the bec and placebo conditions .
the reaction time in task b of the stroop and non - stroop trials after the fatigue - inducing task session exhibited no change over the time course of the experimental day in either the bec or placebo condition ( figure 5a and 5b ) .
however , the reaction times in task b of the stroop and non - stroop trials after the rest session were significantly shorter at t2 and t3 than at t1 in the bec condition , but placebo intake did not exhibit these effects ( figure 5c and 5d ) .
we found that oral administration of the bec drink improved the subjective level of fatigue as well as improving cognitive task performances in healthy males .
in particular , shorter reaction times in task b were observed in the bec - intake condition after 1 and 4 weeks compared to the corresponding values at baseline , although the placebo - intake condition did not show shorter reaction times .
consistent with our results , it has previously been reported that essence of chicken had an effect on the recovery from mental fatigue . however , that study used a simple placebo - controlled intra - subject design and simple evaluations of mental fatigue .
in addition , data were collected just before and after the recovery period from mental fatigue .
in contrast , we designed and conducted a placebo - controlled crossover study , and evaluation sessions were performed before and after the fatigue - inducing and rest sessions .
the results of our investigation provide scientific evidence of the fatigue - recovering effect of bec .
this evidence is significant in view of the fact that currently there are many nutrient supplements being marketed as attenuating fatigue , but which have little evidence of efficacy .
although the reaction time in task a , a simple selective attention task , was not altered by bec intake , bec intake caused a shorter reaction time after the recovery period in task b , which included stroop trials . because the stroop trial involves conflict ( i.e. , incongruency of color and word ) and therefore needs greater levels of selective attention
, our results suggest that bec is effective in inducing recovery from mental fatigue specifically manifested as the impairment of conflict - controlling selective attention rather than just simple selective attention .
the conflict - control of selective attention processes in stroop trials activates the prefrontal cortex ( pfc ) and the anterior cingulate cortex ( acc ) .
interestingly , the pfc and the acc have been reported to be the brain regions that have associations with fatigue [ 3234 ] .
thus , our results suggest that bec intake has favorable effects in these brain regions during the recovery period from mental fatigue . regarding physical fatigue , muscular exercise promotes the production of radicals and other reactive oxygen species in working muscles .
growing evidence indicates that reactive oxygen species are responsible for exercise - induced protein oxidation and contribute to physical fatigue . to protect against exercise - induced oxidative injury ,
furthermore , exogenous dietary antioxidants interact with endogenous antioxidants to form a cooperative network of cellular antioxidants . accordingly , exogenous antioxidants were candidates for anti - fatigue substances , at least in terms of physical fatigue .
since bec consists of many different substances , it is difficult to identify which ones have beneficial effects on mental fatigue . however , imidazole dipeptides such as anserine and carnosine contained in bec were reported to be powerful natural antioxidants .
in addition , imidazole dipeptides were found to accelerate the recovery from physical fatigue via their antioxidative effects . taken together , one possible explanation for the acceleration of recovery from mental fatigue by bec intake could be via its antioxidative effects in the same way as physical fatigue .
a human study showed that administration of vitamin c , an antioxidant , improved cognitive function as well as the sense of fatigue after mental fatigue loads , and oxidation was found to contribute to mental fatigue .
first , the mechanisms by which bec improved recovery from mental fatigue remain to be determined .
second , the results of the present study were obtained with a small sample size .
third , the participants were only healthy males in their thirties from single country or culture .
further large - scale investigations in other populations are needed , which may help draw clearer conclusions about the mental fatigue - recovery effects of bec .
we showed that daily oral administration of bec ( essence of chicken ) improved recovery from mental fatigue manifested as the impairment of cognitive function in healthy males .
this is the first study to show a favorable anti - fatigue outcome using bec . | backgroundfatigue is a common symptom in modern society .
there has been a recent resurgence of interest in traditional remedies for fatigue .
chicken essence , which is rich in anserine and carnosine , has been widely taken in asian countries as a traditional remedy with various aims , including attenuation of physical and mental fatigue .
however , the evidence for its efficacy specifically for mental fatigue remains unclear .
we examined the effect of essence of chicken on mental fatigue in humans , using our established fatigue - inducing task and evaluation methods.material/methodsin this placebo - controlled crossover study , 20 healthy male volunteers were randomized to receive daily oral administration of essence of chicken or placebo drink provided by cerebos pacific ltd . via suntory holdings ltd . for 4 weeks .
the participants performed 2-back test trials as a fatigue - inducing mental task and then had a rest session . just before and after each session
, they completed cognitive task trials focusing on selective attention to evaluate the level of mental fatigue.resultsafter essence of chicken intake for 1 and 4 weeks , the reaction times on the cognitive task trials after the rest session were significantly shorter than those at baseline , and significant changes were not observed with placebo intake .
the reaction times before and after the fatigue - inducing session were not altered by either essence of chicken or placebo intake.conclusionswe showed that daily intake of essence of chicken could be effective for the recovery from mental fatigue and is a promising candidate for use as an anti - fatigue food . |
Subsets and Splits